Production of transgenic goats expressing human coagulation factor IX in the mammary glands after nuclear transfer using transfected

fetal broblast cells

Abstract There are growing numbers of recombinant proteins that have been expressed in milk. Thus one can consider the placement of any gene of interest under the control of the regulatory elements of a milk protein gene in a dairy farm animal. Among the transgene introducing techniques, only nuclear transfer (NT) allows 100 % efciency and bypasses the mosaicism associated with counterpart techniques. In this study, in an attempt to produce a transgenic goat carrying the human coagulation factor IX (hFIX) Transgene, goat fetal broblasts were electroporated with a linearized marker-free construct in which the transgene was juxtaposed to bcasein promoter designed to secret the recombinant protein in goat milk. Two different lines of transfected cells were used as donors for NT to enucleated oocytes. Two transgenic goats were liveborn. DNA sequencing of the corresponding transgene locus conrmed authenticity of the cloning procedure and the complementary experiments on the whey demonstrated expression of human factor IX in the milk of transgenic goats. In conclusion, our study has provided the groundwork for a prosperous and promising approach for large-scale production and therapeutic application of hFIX expressed in transgenic goats. Keywords Human Coagulation Factor IX Goat Transgenic Somatic cell nuclear transfer Fibroblast

Introduction
For production of proteins with pharmaceutical importance, transgenic farm animals have become an attractive alternative to both microbial and cultured animal cell bioreactors. Transgenic rabbits, goats, sheep and cows have been developed as living bioreactors producing potentially high value biopharmaceuticals, commonly referred to as animal pharming. The mammary gland is well suited for the production and expression of human recombinant proteins (Maga and Murray 1995)suchas;alpha-1- antitrypsin (Wright et al. 1991),brinogen(Prunkard et al. 1996),FIX(Schniekeetal. 1997),and antithrombin III (Baguisi et al. 1999),antibodies (Pollock et al. 1999),humanIGF1(Zinovievaetal. 1998),humanNGF-b(Coulibalyetal. 1999),human growth hormone [hGH] (Devinoy et al. 1994),human lactoferrin (Platenburg et al. 1994),humanerythropoietin (Massoud et al. 1996),humanthrombopoietin (Sohn et al. 1999)andhumanparathyroidhormone (Prunkard et al. 1996).Interestingly,naturallycom- plex proteins have been secreted in milk in a fully functional form (Houdebine 2000). Obvious benets of using transgenic animals to provide human pharmaceuticals include: 1) high product yield, 2) low capital investment compared with cell culture techniques, 3) the ability to perform complex post-translational modications (e.g., glycosylation and gamma carboxylation) and 4) elimination of reliance on products derived from human blood, which may contain pathogens (e.g., human immunodeciency virus and hepatitis viruses) (Meade et al. 1998).The generation of transgenic large ruminants (cattle) is, however, very expensive because of the long gestation period, small litter size and high maintenance costs of this livestock species. In contrast, goats are ideal for the transgenic production of therapeutic recombinant proteins because of their high yield of puried product, relatively short generation interval and production of multiple offspring (Meade et al. 1998).For these reasons, the use of dairy goats as bioreactor animals is of particular interest. Until recently, the only reliable method available for producing transgenic farm animals has been pronuclear microinjection. The success rate of this technique has been low, with 0.53 % of microinjected embryos giving rise to transgenic offspring (Keefer et al. 2001).The emerging use of

transfected cultured somatic cells as karyoplast donors for nuclear transfer (NT) has several advantages over microinjection, and has facilitated the generation of transgenic animals (Baguisi et al. 1999;Campbell et al. 1996;Cibellietal. 1998;Onishietal. 2000; Polejaeva and Campbell 2000;Wilmutetal. 1997). NT using transfected somatic cells allows the prescreening of cells for desirable genotypic characteristics which can reduce the number of animals (donors and recipients) used during the production of transgenic animals. One criterion is that the cell line used can be propagated and maintained in culture for sufcient time to allow for transfection, selection and characterization while remaining diploid. Various types of cell have been used as donor cells for NT (Lagutina et al. 2005).Fetal broblasts are generally the cell of choice for generation of transgenic cell lines; however, other cells types, including granulosa cells and skin broblast cells obtained from adult animals have been used (Arat et al. 2001;Aratetal.2002;Cibellietal. 1998; Park et al. 2001;Schniekeetal. 1997). This study has used a transgene designed to express the human clotting factor IX [hFIX] protein in goat milk. The clotting factor IX belongs to the group of vitamin K-dependent proteins (Davie et al. 1991; Stubbs and Bode 1994;ReinerandDavie 1994). Factor IX plays an essential role in blood coagulation and its deciency results in hemophilia B (Brownlee 1987).ThisisanX-linked recessive condition which occurs at a frequency of about 1 in 30,000 males. Patients are currently treated by injection of the hFIX concentrate prepared from pooled plasma from normal blood donors. This treatment is complicated by the risk of infection by blood-borne viruses such as those responsible for hepatitis and AIDS. Cloning of the gene for the hFIX (Montesino and Toledo 2006;Rosen et al. 1996)has provided alternative means for production of this protein and the prospect of gene therapy for hemophilia B based on recombinant DNA techniques (Choo et al. 1987). Thus, the aim of this study was to examine the efciency of producing goats transgenic for human hFIX. This study resulted in the production of twin transgenic goats that contained hFIX gene; the rst birth of a transgenic goat in Iran.

Materials and methods

Unless otherwise indicated, all chemicals used in this study were obtained from SigmaAldrich Company (St. Louis, MO), the media from Gibco Invitrogen Corporation (Grand Island, NY), ICP bio (immune chemical products, Auckland, NZ). DNA isolation and purication kit from Roche (Mannheim, Germany), primers from MWG Company, factor IX decient plasma, and APTT from DIAGNOSTICA STAGO. Production of gene construct The cDNA encoding hFIX was constructed from liver cells by RT/PCR. The primers contained XhoI sites in the 50 end in order to synthesize hFIX cDNA and subcloning of pBC1 was designed. (Forward: 50-CT CGAGCCACCATGCAGCGCGTGAACATGATC-30 Reverse: 50CTCGAGTCATTAAGTGAGCTTTGTT TTTTCCTTA-30). PCR amplication consisted of 30 cycles with annealing at 58 C for 30 s and extension at 72 C for 45 s. The PCR product was cloned into the T vector (pTZ57R/T) followed by digestion and sequencing. Results of sequencing revealed that the cloned cDNA contained two mutations. As a result, a spliced overlap extension (SOE)-based PCR method was used to correct these mutations. After correctionof the coagulation factor IX gene, cloning into the T vector (pTZ57R/T) was repeated and conrmed by digestion and sequencing. Then, the corrected hFIX cDNA was exited from the T-vector by XhoI and subsequently cloned into pBC1 (Invitrogen) (Fig. 1). Finally in order to integration of gene construct into the goat f etal broblast genome,ampicillin resistance gene was removed from the recombinant vector entailing cDNA encoding human coagulation factor IX by SalI and NotI and the linear construct was made (15,752 bp).

Experiment 1 Preparation of adult goat broblast and cell culture This step was carried out based on a method described by Yu et al. (2003). The ear of a female goat, 1.5 years of age was shaved and disinfected with 70 % ethanol before a piece of skin was excised. The epidermis and hypodermis were removed with a scalpel blade and the dermis was cut into small pieces (2 9 2 mm). Pieces of skin were put in culture dishes containing DMEM supplemented with 15 % FBS and incubated at 38 C in a humid atmosphere containing 5 % CO2. The medium was refreshed every 23 days. When the cells reached conuency, after 10 days of culture, tissue pieces were removed and cells were washed with PBS, and detached from dishes by adding trypsin/EDTA for 2 min at 38 C. Cells were trypsinized and frozen with 10 % DMSO and stored in liquid nitrogen. Experiment 2 Isolation of transgenic goat fetal broblast cell line The goat fetal broblast cells used as karyoplast donors were prepared as previously described (Baguisi et al. 1999).Thelinesoffemalebroblastcellswere established from day 35 fetuses. The fetus head and the internal organs were removed, and the remaining tissues were cut into small pieces (1 2 mm). Cells were cultured in Dulbeccos modied eagle medium (DMEM; Invitrogen Corp.) containing 15 % fetal bovine serum (FBS; Hyclone, Logan, Utah), 2 mM L-glutamine and 1 mM sodium pyruvate, and were seeded into 25 cm2 tissue culture asks. After three subpassages, the cells were frozen with 10 % DMSO and stored in liquid nitrogen. Before transfection, the cells were analyzed for normal chromosome count by giemsa and were sexed by cytogenetic techniques (karyotype). Transfection of the goat fetal broblast cells At 90 % conuencey, about 107 cells were harvested and mixed with 1040 lg of the linearize gene- targeted cassette (107 cells in 425 ll DPBS with varying concentrations of the gene), transferred into a 0.4 cm cuvette (BioRad) and subjected to a pulse of 217218 volts delivered by a Gene Pulser (BioRad Mu nchen, Germany). After transfection the cell/DNA- mix was incubated in DMEM medium containing 10 % FBS for 15 min at room temperature, before being plated in 10 cm petridishes in DMEM without selection. After 24 h, the culture medium was refreshed. Identication of transfected cells by PCR Three days after transfection, a part of the cells were considered for PCR analysis for identication of transfected cells and the remaining cells were expanded by passaging until sufcient cells were obtained for cryopreservation. Genomic DNA was extracted by phenol/chloroform standard protocol and used as template for PCR using designed primer pairs (Table 1),in order to amplify two sub fragments of the hFIX cDNA. PCR analysis was also performed on the primary cultured broblasts and their corresponding supernatant. The supernatant was considered in the PCR analysis into rule out the possibilities of false positive results due to oating DNA in the supernatant. The transfected cells were thawed and diluted to a nal cell density of 1.3 9 104 cells per ml and from this, serial dilutions (1:10, v/v) were made until a nal cell density of 5 cells per mL was achieved. Finally, 100 lL aliquots were dispensed using a multi-channel pipettor into at bottom 96-well (TTP) and allowed to incubate at 37 C and 5 % CO2 in a humidied incubator and supplemented with fresh media after 4 days. Surviving cells were transferred into 24-well plates and allowed to culture with fresh media replacement every 72 h until the monolayer occupied approximately 90100 % of the wells surface area. Then, each well was divided into two parts: the rst part used for additional passages and cells from the second part were harvested for PCR analysis. Well positive cells (transgene) were isolated and used for NT. After 6 days of selection, each well was divided into two parts: the rst part used for additional

passages and cells from the second part were harvested for PCR analysis. Well positive cells (transgene) were isolated and used for NT. Fluorescent in situ hybridization Mini-prep extracted recombinant plasmid (pBC1- hFIX) was labeled base on a nick translation method using DNA Labeling kit (Vysis, Abbott Molecular) according to the manufacturers instructions and the probe was hybridized on PCR-positive metaphase preparations according to standard FISH procedure. Positive cells were isolated and used for NT. Donor cell preparation Previous experimental results demonstrated the capacity of different cell-culture conditions such as conuency, full conuency and serum starvation for synchronization of goat broblast cells in the G0/G1 phase of the cell cycle (Dalman et al. 2010).Those results showed that the use of full conuency is more suitable for cell cycle synchronization because it arrests cells at the G0/G1 phase and induces less apoptosis in comparison with the serum starvation group. Therefore, Cryopreserved transfected cells were thawed and seeded in a 25 cm2 ask (Greiner BioOne, Frickenhausen, Germany) at a concentration of 5 9 105 cells/ml and allowed to reach conuency and further cultured in 15 % FBS in DMEM for an additional 72 h.

Table 1 List of primers that used for amplication of hFIX cDNA Primer name Primer sequence PCR product For FIX-1 CTCGAGCCACCATGCAGCGCGTGAACATGATC 1,386 bp Rev FIX-1 CTCGAGTCATTAAGTGAGCTTTGTTTTTTCCTTA For FIX-3 GCAGAAAACCAGAAGTCCTGTG 537 bp Rev FIX-3 CGTGTATTCCTTGTCAGCAATG Oocyte collection and maturation Goat ovaries were collected from a local slaughter- house and kept at 2530 C during transportation. When ovaries arrived in the laboratory, they were washed with warmed PBS supplemented with 50 lg/ml gentamicin and then stored in a water bath at 2630 C before use. Cumulus oocyte complexes (COCs) were aspirated from follicles by a syringe attached to a 19G needle. COCs with more than three layers of cumulus cells were selected for in vitro maturation. Selected COCs were washed in in vitro maturation (TCM 199 medium supplemented with 10 % goat serum, 0.02 U/ml LH, 0.02 U/ml FSH, 1 lg/ml estradiol and 100 lM cysteamin, 0.2 mM sodium pyruvate) then cultured for 18 22 h in 5 % CO2 in air at 38.5 C. Following in vitro maturation, the cumulus cells were removed from the oocytes by vortexing the COCs for 12 min in TCM 199 supplemented with 500 lg/ml of hyaluronidase. Oocytes with a rst polar body and homogeneous cytoplasm were selected for enucleation. Nuclear transfer Oocytes were placed into manipulation drops (Em- Care supplemented with 1 % goat serum). Oocytes were held on a holding pipette and rotated as needed into a position suitable for enucleation. Utilizing an enucleation needle, the zona pellucida was punctured and the polar body and metaphase plate was removed by aspirating a minimal amount of surrounding cytoplasm. After each individual oocyte was enucle- ated, the donor cell was transferred into the perivitel- line space of the enucleated oocyte. Following reconstruction, karyoplast/oocyte couplets were trans- ferred to TCM 199/goat serum and incubated at least 30 min prior to fusion and activation.

Fusion and activation Fusion was performed at room temperature. Couplets were manually aligned equidistant between two stainless steel electrodes of a 0.5 mm gap fusion chamber (Genetronics Biomedical, San Diego, CA, USA) overlaid with fusion buffer (sorbitol, 0.25 M, calcium acetate 100 lM, magnesium acetate 0.5 mM BSA, 0.1 %) and fused by a single DC pulse (2.39 kV/cm for 25 ls) delivered by a BTX Electro- cell Manipulator 200 (Gentronics, San Diego, CA, USA). Couplets were evaluated for fusion after 1 h incubation period in TCM and then activated. Fused couplets were activated by a 5 min exposure to 5 lM ionomycin and then incubated for 5 h in 2 mM 6-dimethylaminopurine prepared in global medium (Vitrolife). Following activation, the recon- structed embryos were washed and cultured under oil in 50 ll droplets of global medium for 72 h (four- and eight-cell stages) prior to transfer to recipient females . Embryo transfer Four- and eight-cell stage embryos were surgically transferred to synchronized recipients on day two of their estrus cycle (day 0 = estrus). Immediately prior to transfer, embryos were placed in global medium supplemented with 10 % FBS. Utilizing a 3.5 Fr G Tom Cat Catheter attached to a 1 ml syringe, 46 embryos were transferred into the oviduct of each recipient. Pregnancy status Pregnancy was determined by ultrasonography (ultra- sound: PIE medical 200, Netherland; Probe: 2.57.5 MHZ linear (or rectal probe) for pregnancy diagnosis from day 25 till day 75, 13.5 MHZ sector (or abdominal probe) for pregnancy diagnosis from day 45 till parturition (day 150) starting on day 30 after the rst day of standing estrus. The observation of an amniotic sac was used to diagnose pregnancy. Transgene analysis of offspring PCR reactions were performed on the extracted genomic DNA of two goats with specic primers designed for amplication of the gene construct (Table 1).Subsequently, the PCR products were sequenced using the ABI 373A automated sequencer. Reproduction and lactation of the transgenic goat At about 10-month-old transgenic goat was naturally mate. Pregnancy was detected by trans-rectal ultra- sound at around 60 days after fertilization and maintained pregnancy up to birth. After their delivery, the milk samples from transgenic goat were collected and analyzed according to the following procedures. Expression of human Factor IX in the milk of transgenic goats Expression levels of recombinant human Factor IX in the milk of transgenic goats were determined as follows. Transgenic goats were milked by hand. To obtain whey, the milk was immediately diluted 1:1 with 200 mM EDTA, pH 7.0 to solubilize the caseins and then it was frozen in -70 C. The milk/EDTA mixture was centrifuged for 30 min at 16,000g at 4 C for twice to remove fat layer and casein. Activity and presence of rhFIX were examined using the activated partial thromboplastin time (APTT) assay and western blot analysis, respectively. SDSPAGE and western blotting Whey of the rst 5 days lactation mixtures were electrophoresed on 10 % SDS gels (St. Louis, MO, USA). Sample preparation included the addition of reducing sample buffer and boiling for 10 min. Negative control in this experiment was non-trans- genic goat whey from same species. Gel was stained with Coomassie Brillant Blue and destained. For western blotting, the gel electroblotted overnight onto PVDF membranes (Bio Rad) using transferring buffer. As antibodies against factor

IX, monoclonal mouse Ab from Sigma (St. Louis, MO, USA) was used. The secondary antibody was anti-mouse IgG conjugated with horseradish peroxidase. Enzyme-linked immunosorbent assay (ELISA) The amount of rhFIX in the whey was determined by ELISA, using rabbit anti-human factor IX antibody as the rst antibody and rabbit anti-factor IX antibody coupled with peroxidase as the second antibody. The used ELISA kit in the experiment was ASSERA- CHROM IX:Ag from STAGO. Factor IX activityAPTT assay Biological activity of the rhFIX was determined by APTT assay. Briey, 100 ll of PTT and factor IX decient plasma (STAGO), and each samples (The standard FIX was diluted with Owern-Koller solution from STAGO) were added to a plate and incubated at 37 C for 3 min. 100 ll of 20 mM CaCl2 (Sigma) was then added and the clotting time was measured. The data have shown in Table 3. Statistical analysis Statistical analyses were conrmed by ANOVA. Differences between experimental groups were evaluated with the T test. Data were expressed as mean SD and P\0.05 was considered signicant. Results Oocyte maturation, embryo reconstruction and embryo development Experiment 1 Seventy-one percent of the 1,488 recovered oocytes reached the MII stage (Table 2).Atotalof568 couplets from adult broblast cells were produced, which resulted in an overall reconstruction rate of 54.9 13.6 (568 couplets/1,074 mature oocytes) for this experiment. The overall fusion and cleavage rates were 77.5 14.9 and 68.5 15.0, respectively. A total of 21 recipient does received an average of 5 embryos. Three of the recipients maintained gestation until 2 months. The pregnancy rate at 30 days of gestation was 14.28 %. Experiment 2 Following a maturation interval of 1822 h, 71.6 12.0 of 1,231 recovered oocytes reached the MII stage (Table 2).Atotalof439coupletsfromfetal broblast cells were produced, resulting in an overall reconstruction rate of 54.5 19.1 (439 couplets/863 mature oocytes) for this experiment. The overall fusion and cleavage rates were 74.2 17.5 and 61.3 16.6, respectively. The development of 439 NT couplets reconstructed from donor cells were assessed (Table 2).The rate of fusion of NT embryos reconstructed was 74.2 17.5. Of the 344 fused embryos, 208 (61.3 16.6) cleaved and were subsequently 64 embryos transferred to 12 recipients (Fig. 2). Verication of transfected broblast cells A total of 120 cultured plates of transfected broblast cells were analyzed by PCR and subsequently by single-cell PCR reactions, among them three plates appeared as positive (Fig. 3). The positive samples were subjected for, FISH, by using whole gene construct, as a probe. As the results indicate the transgene was integrated in a single position in two out of three cells and at two sites in the third one (Fig. 4).The rst two lines of the fetal broblast cells were used for NT. Embryo transfer and cloned transfer offspring An average of ve embryos was transferred into 21 and 12 recipients in experiments 1 and 2, respectively. Two pregnancies were detected in group 2 and no pregnancies were detected in group

1 (Table 2).One recipient maintained concept uses throughout gestation. Twin transgenic kids were born at 147 days of gestation. Both offspring were healthy and vigorous at birth, and weighed 2 and 2.5 kg (Fig. 5).The pregnancy rate, based on the number of pregnant recipients per total number of recipients, was 16.6 %. Live born transgenicity conrmation DNA fragments of the expected sizes corresponding to specic subfragments of the hFIX coding region were amplied when PCR was carried out on the genomic DNA which was extracted from the blood samples of the newly born goats (Fig. 6).Comparison of the PCR products DNA sequences against the Gene Bank database was performed, using the BLAST program (Altschul et al. 1990),indicating the presence of the hFIX transgene in the two live born goats. Expression of human Factor IX in the milk of transgenic goats SDSPAGE and western blotting In the SDSPAGE one band migrated as a broad band with an apparent molecular weight of 55KD. This band is factor IX as shown in Fig. 7.Thebandswith molecular weight about 30 KD are caseins. These results were conrmed by the western blotting against factor IX. The results of western blotting are in Fig. 8. Fig. 2 Goat gene-targeted cloning embryos developed in vitro. a, b The goat 4-cell and 8-cell reconstructed embryos were cultured in vitro; c the goat 4-cell reconstructed embryos were cultured in vitro, and morphologically evaluated by nuclear staining with Hoechst 33,342, and uorescence was detected Table 2 Rate of oocyte maturation, embryo reconstruction and embryo development rates in goat transgenic adults and fetal broblast cells (mean SD) Donor cell Goat transfected fetal broblast cells Goat transfected adult broblast cells No. ovaries 690 649 No. oocytes recovered 1,231 1,488 No. (%) oocytes matured 863 (71.6 12.0) 1,074 (70.5 12.7) No. (%) couplets produced 439 (54.5 19.1) 568 (54.9 13.6) No. (%) couplets fused 344 (74.2 17.5) 435 (77.5 14.9) No. (%) embryos 208 (61.3 16.6) 285 (68.5 15.0) No. embryos transferred 64 150 No. recipients 12 21 No. (%) does pregnant, day 30 2 (16.6) 3 (14.28) No. healthy offspring 20 Enzyme-linked immunosorbent assay (ELISA) and Factor IX activityAPTT assay Recombinant human Factor IX and clotting activity were both expressed as a percentage of that in pooled normal human plasma. Amount of rhfIX is 0.67 lg ml -1 in whey using a standard value of5 lg ml -1 offactorIX in normal plasma. The amount of active human factor IX was calculated to be approx. 0.6 lg ml -1. This value correlates well with that of total human factor IX in whey. Fig. 3 Single cell PCR analysis,capillary electrophoresis. Row 1 negative control (without template); Row 2 negative control (normal goat DNA); Row 3 sample no. B1-12/3; Row 4 positive control (gene construct) As shown in Table 3,transgenic goat whey hasa specic activity of 31 U/mg which is compared to the normal plasma reference pool activity of 250 U/mg. Discussion FIX plays an essential role in blood coagulation cascade, and its deciency results in hemophilia B. This disease is currently treated with FIX derived mainly from human plasma (Brownlee 1987).Recombinant FIX produced in milk would provide an alternative source at lower cost and

free of the potential infectious risks associated with products derived from human blood. In the present study, a newly constructed hFIX expression vector was introduced to goat fetal broblast cells and live transgenic founder of a twin pregnancy was generated by NT, a major success obtained thus far in an attempt to generate transgenic goats with the ability to secrete hFIX in milk. The gene-targeted somatic cell lines for nuclear transfer must have high potency for population expansion and a high stability for cytogenetic Fig. 4 Fluorescent in situ hybridization (FISH) study shows integration of the transgene in a single position in two different lines (a, b) and in two positions in one line (c) Fig. 5 Cloned transgenic female goats produced from fetal broblast cell line Fig. 6 PCR products: a (1,386 bp) b (537 bp) amplied from the genomic DNA of the live born goats, using F-fIX-1/R fIX-1 and F-fIX-3/R fIX-3 primer pairs respectively. Lanes 1 1 Kb DNA ladder, Lanes 2 Goat no. 1 (Shangoole), Lanes 3 Goat no. 2 (Mangoole), Lanes 4 positive control (gene construct), Lanes 5, 6, 7 Negative control (normal goats), Lanes 8 negative control (without template), Lanes 9 express DNA ladder normalcy. In this work we used transfected goat adult and fetal broblast cells as nuclear donors. As suggested by previous studies, our results also con- rmed that fetal broblast cells were the optimal choice for nuclear donors because they proliferate rapidly in culture and have an inherently long G1 phase (Gadbois et al. 1992). Fetal broblasts have the potential for longer term culture as required in the transfection and selection processes (Keefer et al. 2001). In addition, the cytoplasm recipients sources were oocytes collected from a slaughter house because of their availability and costeffectiveness in comparison with hormone-stimulated oocytes. It is well documented that cells utilized as karyoplast donors synchronized in the G0/G1 stages of the cell cycle generate live offspring by somatic cell NT (Polejaeva and Campbell 2000; Rudolph 1999). Using full conuency, the majority of cells were in the G0/G1 stage which was similar to 72 h serum starvation conditions. Meanwhile 72 h serum starvation induces apoptosis in goat broblast cells. Full conuency is more suitable for cell cycle synchronization because it arrests cells at the G0/G1 phase and induces less apoptosis in comparison with the serum starvation group (Dalman et al. 2010). Synchronization between the recipients and the development stage of reconstructed embryos was an effort to compensate the slow development of reconstructed embryos. In our study four- to eight-cell embryos were transferred to the recipients who had undergone the estrus phase in the previous 48 60 h. We estimated that at the time of embryo transfer, the recipients had ovulated about 60 h prior to transfer. Additionally, 16.6 and 14.2 % of the recipients became pregnant from fetal and adult broblast cells, respectively and consequently, 8 % of fetal broblast cells resulted in birth. This pregnancy rate was based on the total number of pregnant recipients to the total number of recipients was more than the pregnancy rate achieved in the study of Baguisi et al. (1999). Here we report transgenic goats with hFIX cDNA stably integrated, and which secrete biological active hFIX in the lactating mammary glands without Fig. 7 Whey of lactation mixtures were electrophoresed on 10 % SDS gels. c Negative control (nontransgenic goat whey from same species); m transgenic goat whey Fig. 8 Western blotting. c Negative control (non-transgenic goat whey from same species); m transgenic goat whey Table 3 The Biological Activity of Recombinant Human Factor IX Sample Clotting time (s) Activity (U/mg) Standard FIX (100 %) 65 250 Standard FIX (50 %) 73 125 Standard FIX (25 %) 82 62.5 Standard FIX (12.5 %) 92 31.25 Standard FIX (6.25 %) 100 15.625 Transgenic goat whey 94 *31 Nontransgenic goat whey 223 *0 causing any harm to health. As far as we know, this is the rst model reported in the literature of transgenic goats producing functional hFIX using SCNT in the literature. Both of these new born goats were healthy and had normal weight at the time of birth. PCR reaction was done on the genomic DNA of the new born animals and conrmed the sequence of PCR products in genomic bank. After fertilization, the hFIX transgenic goat got pregnancy and

naturally delivered a healthy goat. To date, neither the trans- genic animals nor their offspring have shown any obvious adverse phenotype. This result suggested that the hFIX transgenic goat has normal reproduction and the hFIX transgenic has been expressed well in her milk. The transgenic strain-to-strain variability in expression which is attributed to a phenomenon called position effect is the main reason. In addition, biochemical and biophysical characteristics of the resultant hFIX including post-translational modications, protein functionality and activity remain to be identied. In according to the results of SDS-PAGE, western blotting and APPT-assay, presence of functional Factor IX was conrmed. APPT-assay shown the biological activity of transgenic goat whey is in equilibrium with standard factor IX in 12 %. This is suspected that the purication of recombinant protein can help to increase the purity and the biological activity of factor IX and so we will need to select the best method for purication of recombinant protein by the fact that some methods have a signicant impact on the biological activity and pharmacokinetics. The two goat kids are derived from the same cell clone and are genetically identical according our genetic identity test. However, the different coat color for the offsprings could be the result of an epigenetically imprinting trait. Further epigenetic studies in the future will be carried out in these transgenic animals. In conclusion, our study has provided the ground- work for a prosperous and promising approach for large-scale production and therapeutic application of hFIX expressed in transgenic goats.