What It Means To Be 98% Chimpanzee by Jonathan Marks

Download as pdf or txt
Download as pdf or txt
You are on page 1of 328

What It Means to Be 98% Chimpanzee

J O N AT H A N M A R K S

What It Means to Be
98% Chimpanzee
Apes, People, and Their Genes

university of california press


berkeley

los angeles

london

University of California Press


Berkeley and Los Angeles, California
University of California Press, Ltd.
London, England
2002 by the Regents of the University of California
Library of Congress Cataloging-in-Publication Data
ISBN 0-520-90062-6
Manufactured in the United States of America
10
10

09 08 07 06 05 04 03
9 8 7 6 5 4 3 2 1

02

The paper used in this publication is both acid-free and


totally chlorine-free (TCF). It meets the minimum requirements of ANSI/NISO Z39.481992 (R 1997) (Permanence of Paper).

For Peta and Abby

contents

List of Illustrations
xi

Acknowledgments
xiii

Introduction
1
one

molecular anthropology
7
two

the ape in you


32
three

how people differ from one another


51

four

the meaning of human variation


72
five

behavioral genetics
100
six

folk heredity
128
seven

human nature
159
eight

human rights . . . for apes?


180
nine

a human gene museum?


198
ten

identity and descent


219
eleven

is blood really so damn thick?


242
twelve

science, religion, and worldview


266

Notes and Sources


289

Index
303

illustrations

1. Tulps satyr, c. 1641.


2. Tysons orang-outang, or pygmie, c. 1699.
3. A fusion of two ape chromosomes led to the formation
of human chromosome 2.
4. Unlike humans, chimps and gorillas have darkly staining
regions at the tips of their chromosomes.
5. Paraphyly: humans are phylogenetically apes only in the
same sense that we are also phylogenetically sh.
6. Gorilla and man drawn by anatomist Adolph Schultz,
1933.
7. The ambiguity of presumptive genetic relations among
human races.

xi

16
18
38
39
46
71
201

acknowledgments

This book was begun in Berkeley and completed in Charlotte, and


the research was supported in part by a grant from the National
Science Foundation. It was a long time developing, and Id like to
thank the people who read and commented on it in various forms,
in part or as a whole: Deborah Weiss, Ken Korey, Amos Deinard,
Phyllis Dolhinow, Jonathan Beckwith, Alan Goodman, Jim Moore,
Vincent Sarich, Phillip Johnson, Rika Kaestle, Debra Harry, Sarah
Tishkoff, the participants in the 1999 Wenner-Gren symposium called
Anthropology in the Age of Genetics, and Regula Noetzli. Thanks
as well to my editors at the University of California Press, Howard
Boyer and Naomi Schneider.

xiii

introduction

C. P. snow, who was both a scientist and a novelist, observed in a


classic essay from the 1950s that the sciences and the humanities were
coming apart at their academic seams and forming two cultures.
He meant this in a specically anthropological sensetwo communities that speak different languages, see the world in different ways,
dont understand each other, and regard each other with suspicion.
Each thinks itself superior to the other.
This rift is probably irreparable. As the frontiers of knowledge have
expanded, it has become hard enough to keep up with the work in
ones own ridiculously narrow eld of expertise, never mind to read
novels, philosophy, or particle physics besides. Scientists lament the
lack of science education on the part of the public, but they have
ceded to science journalists the responsibility of educating the public.
Humanists lecture about the construction of knowledge, but scientists lecture that they are simply recording what is out there.
This book is about a hybrid eld that we can call molecular anthropology. To a large extent, it epitomizes the insecurities of modern science. On the one hand, technology permits us to study aspects
of the human condition in far greater detail than was previously
thought possiblethats the meaning here of molecular. On the

other hand, the scientists themselves have often employed that information to prop up dubious political assertions; or else they have
interpreted the information through cultural lenses of various tints,
and often with striking navetethats the anthropology.
Technical sophistication and intellectual navete have been the twin
hallmarks of human genetics since its origins as a science in the early
part of the twentieth century. The way genetics was practiced and
preached in the 1920s exploited the cachet of modern science to justify
blatant racism and xenophobia.
Times have changed, and technologies have certainly changed. But
many of our cultural ideas have remained strikingly unaltered across
the generations. We have a strong faith in the power of heredity to
shape destiny, in the ability of modern science to arrive at truths about
nature, in our identity as a deeply inscribed property, in the constitution of scientic facts to be neither good nor bad (but just authoritative), and in the ability of those scientic facts to speak for themselves.
Each of those propositions is true only to a very limited extent.
What is needed in human genetics is a mediation of its fundamentally
scientic and humanistic elements.
Anthropology has always been a eld of mediation. Classically (in
the 1920s), it involved juxtaposing the exotic and the mundane
showing that your way of seeing and interpreting the world is only
one of many possible and valid ways, but at the same time showing
that what New Guinea tribesmen do is only supercially different
from what you do.
In more recent decades, anthropology has assumed the political role
of mediator for aboriginal populations (usually the objects of anthropological study, of course) and colonial powers (usually the ones sending the anthropologist out). On the biological end, anthropology
emphasizes, on the one hand, the continuity of humans with other
primates, but, on the other, the uniqueness of humans among the
primates. And in a more general sense, anthropology mediates between professional scholarly knowledge about the world (science)
and popular or cultural wisdom about it (folk knowledge).

introduction

Molecular anthropology necessarily adopts the crucial role of mediator as well. Genetics advertises a classically modern scientic analysis of the human condition, and thus molecular anthropology examines both human populations with respect to one another and our
species with respect to other species. At the same time, however, we
are forced to ask what meaning to attach to such studies and what
value they have. Where human lives, welfare, and rights are concerned, genetics has historically provided excuses for those who wish
to make other peoples lives miserable, to justify their subjugation, or
to curry favor with the wealthy and powerful by scapegoating the
poor and voiceless. It is therefore now obliged to endure considerably
higher levels of scrutiny than other, more benign and less corruptible,
kinds of scientic pronouncements might.
Rather than simply avowing to study our hereditary constitution
objectively, dispassionately, and benignlyand being proved wrong
time and againthis book is about the way a genetic science of
humanity can confront issues. Some of these issues are political, such
as animal rights and colonialism; others lie in the domain of folk
wisdom, such as ethnocentrism and racism; and still others lie in
simply the way science represents itself to the public.
Molecular anthropology is a term paradoxically coined by a biochemist in 1962 to designate the study of human evolution by recourse to the differences in the structure of biomolecules. The paradox is that although it sounds like a kind of anthropology, a molecular
kind of anthropology, it was really the technology of biochemistry
merely being applied to classically anthropological questions. And
since technology drove this new eld, anybody could do molecular
anthropology, regardless of how much anthropology they really
knew.
While that may sound harmless enough, consider the opposite case.
What would constitute an anthropological biochemistry if you
didnt need to know any biochemistry to do it?
What I will show in this book is that when the cutting-edge technology of molecular genetics has been wed to a folk knowledge of
anthropology, the results have invariably been of exceedingly limited

introduction

value. This was true in the 1920s, when geneticists sought to rewrite
our understanding of social issues by blaming poverty on the genes
of the poor. The stock market crash and Depression had a sobering
effect on the geneticists.
It was also true in the 1960s, when genetics became molecular and
its practitioners began to make observations of seeming profundity,
such as from the standpoint of hemoglobin, man is just an abnormal
gorilla. It seems not to have occurred to the sanguine speaker that
the standpoint of hemoglobin might just be a poor one for the problem at hand: from the top of the Empire State Building, Chicago and
Los Angeles appear to be in the same place over the horizon. But not
from the Golden Gate Bridge.
Thats a classic anthropological questionwhose standpoint is superior? An anthropological approach would be to inquire what it is
that each standpoint allows you to see that the others conceal.
The standpoint of science is widely held to be superior to all rivals.
Especially by scientists. But once again, it is useful to acknowledge
that there may be more than one scientic standpoint, and that the
meaning of any particular scientic pronouncement may not be selfevident. And thus in the 1990s, we routinely heard that we are just 1
or 2% different from chimpanzees genetically, and therefore . . .
what?
Should we accord the chimpanzees human rights, as some activists
have suggested?
Should we acknowledge and accept as natural the promiscuity and
genocidal violence that lurks just underneath the veneer of humanity
and occasionally surfaces, as some biologists have implied?
Or should we perhaps all simply go naked and sleep in trees as the
chimpanzees do?
None of these suggestions, of course, necessarily follows from the
genetic similarity of humans to apes, although the rst two have been
proposed within the academic community and promoted in the popular media over the past few years. (Mercifully, the third has not.)
But all of them sound as though they might well proceed from that
genetic similarity.

introduction

An anthropological or cultural perspective allows us to examine


critically some of the assumptions that we often take for granted
about genetics itself.
The rst topic this book addresses is: What does the genetic similarity of humans to apes mean? What is it based on? Does it have
profound implications for understanding our nature?
Here we will see that the universe of genetic similarities is quite
different from our preconceptions of what similarities mean. For example, the very structure of DNA compels it to be no more than
75% different, no matter how diverse the species being compared are.
Yet the fact that our DNA is more than 25% similar to a dandelions
does not imply that we are over one-quarter dandelioneven if the
latter were a sensible statement. This will be a primary illustration of
the confrontation between scientic data and folk knowledge, and of
the exploitation of the latter by the former. The extent to which our
DNA resembles an apes predicts nothing about our general similarity
to apes, much less about any moral or political consequences arising
from it.
From there, I go on to examine the genetic differences within the
human species and how they have intersected with our attempts to
classify people into races. Geneticists have attempted to track the
evolutionary history of our species with varying degrees of success,
often nding what they expectidentifying races in one generation,
denying their existence in another. The perspective of molecular anthropologya social science of hereditywill shed light on both the
science itself and the uses of the science.
Perhaps the most contentious issue in modern biology, rekindled
by the furor over Richard Herrnstein and Charles Murrays 1994 book
The Bell Curve, is behavioral genetics. Here the pattern of human
behavioral diversity can be compared to the known patterns of genetic
variation, enabling us to look critically at the political claims ostensibly derived from the science.
Two modern social projects hoping to justify their existence by
recourse to genetics are the Great Ape Project, which argues for human rights for apes on the grounds of our genetic kinship with them,

introduction

and the Human Genome Diversity Project, which has advocated the
establishment of a genetic museum of the isolated and endangered
peoples of the world. Both of these proposals can be illuminated by
bringing together the scientic and humanistic elements that bear
upon them.
Finally, I explore more generally the ways in which technical and
cultural knowledge intersect in the classic conict between science
and religion. This broadens our scope from a humanistic study of
heredity to a culturally informed and socially relevant study of the
role of science.
Ultimately, that is what molecular anthropology is all about: the
intersection of chemical bodies, human bodies, and bodies of knowledge; and their mutual illumination. Molecular anthropology acts as
mediator between reductive genetics and holistic anthropology; between formal knowledge and ideology; between facts of nature and
facts produced by authorities; between what science can do and what
scientists ought to do; and most fundamentally, between human and
animal. All of these terms are, of course, laden with meanings, and
none of them can be taken at face value.
Thats the fun of it.

introduction

One
molecular anthropology

You know them. youve seen them, perhaps in the zoo, perhaps in
the movies or on television. Youve looked deep into their dark, soulful eyes, pondered their hairy faces, and recognized a mind behind
those eyes. A mind like a childs perhaps, but a mind akin to your
own. Youve seen their sinewy arms, their long ngers clasping somethinga twig to use as a tool? Or perhaps a Raggedy-Ann doll?
And you know about those resemblances. That chimpanzee, says
the narrator, is more than 98% genetically identical to us. That similarity, he says, blurs the line between us. We are chimpanzees, and
they are us.
But take another look. Those deep eyeswithout whites, which
those chimpanzee eyes really do lackthey look more like a dogs
dark eyes than like your own, dont they? And those sinewy arms are
rather hairy, arent they? They arent human arms at allthey are like
human arms. The chimpanzees themselves could not really be confused with people. Their heads are smaller. Their eyeteeth are bigger.
They have neither noses nor foreheads to speak of. Their legs are
short, their ears are huge, and they use their hands in walking. They
have thumbs on their feet. They have knees pointing ridiculously far
outward.

Listen to them. You hear no speech; rather, a series of grunts and


hoots. Sounds, meaningful sounds, but hardly human sounds.
They dont gossip, pray, sing, praise, or insult. They dont decorate
their bodies or cover them up. Their sexuality is stimulated by colorful swelling of the female genitalia. In fact, the chimpanzees do
hardly anything you might recognize as being human. When they
do, after all, its newsworthy.
And not only that, but sometimes the adults kill and eat the chimpanzee babies.
All of which is certainly not to deny that chimpanzees are closely
related to us. In the panoply of nature, chimpanzees are very similar
to us. Our species gives birth to live young and nurses them, like
chimpanzees and other mammals and unlike salamanders and pigeons. Among the mammals, our species has grasping hands, toenails,
and only one pair of nipplesa combination again like chimpanzees,
but unlike cows or dogs or dolphins. And among the primates, our
species has a very mobile shoulder and no tailonce again like chimpanzees, but unlike the awfully cute lorises and vervet monkeys of
Africa.
The great apes are indeed physically similar to us, and they are
indeed our closest living relatives. Particularly the African great apes:
the familiar common chimpanzee (Pan troglodytes), found across Central and West Africa; the bonobo (Pan paniscus), a very similar and
rare species with a distinctive black face and a head with long hair
parted in the center; and the larger gorilla (Gorilla gorilla), rare in the
Virunga mountains but more common in the lowlands of West Africa. None is plentiful in nature; all are restricted to patchy and often
discontinuous ranges of land in a quite restricted part of the world.
Their cousin, Homo sapiens, is by contrast exceedingly plentiful.
Too plentiful, many would argue.
We are slightly more distantly related to the red-haired orangutan
of Borneo and Sumatra. Like the chimpanzees and gorillas, the Asian
orangutan is also a great ape, in contrast to the small, long-armed,
and exceedingly graceful gibbons of southeast Asia, the lesser apes.
Were still similar enough to the orangutans, though, that the very
name orangutan means man of the woods in Malay. The indig-

molecular anthropology

enous peoples didnt need science to tell them of that creatures general similarities to them.
The general estimate, which there is no good reason to doubt at
present, is that about seven million years ago Homo, Pan, and Gorilla
all comprised a single species. That species lived in Africa (which is,
after all, where its descendants live), and probably resembled the
chimpanzee. One group evolved a larger body size and ultimately
became gorillas, and another group began to walk upright and ultimately became humans. And it is certainly possible that there were
several other branches of that family tree that ourished, say, three
million years ago, but whose remains have not yet been unearthed.
Obviously, a lot can happen in seven million yearsa creature
resembling a chimpanzee can evolve into a creature resembling a human being, for example. But it is also paradoxically little more than
a ash in biological time. It all depends upon ones perspective. The
average species of clam, for example, remains largely unchanged for
as much as ten million years.
Fifteen million years ago, there were many diverse species of apes,
thriving in the pristine and abundant woodlands of Africa, Asia, and
Europe. The Miocene epoch, which lasted from about twenty-ve to
ve million years ago, encompasses the orescence of the apes. They
ranged in size from the diminutive Micropithecus to the aptly named
Gigantopithecus, whose jaw dwarfs that of a modern gorilla. All looked
diagnosably different from one another and from modern apes, but
all would be recognizable as apes; none would be readily mistaken
for a raccoon or a billy goat.
Modern apes thus constitute in the present day but a minuscule
relic of the ecological space once occupied by their mighty group.
And this shift from diverse and prolic to nearly extinct, from masters
of the primate world to its tattered and pathetic remnants, has occurred within an evolutionary lament of the billions of years of life
on earth, the single thread that subsumes the emergence and development of the human line from that ape radiation.
Seven million years ago, toward the end of the Miocene, the ancestors of living humans, gorillas and chimps went their separate evolutionary ways. Possibly the proto-chimpanzees were spread widely

molecular anthropology

over Central Africa, the proto-gorillas occupied West Africa, where


we nd modern gorillas, and the proto-humans occupied East Africa,
where we nd the earliest humanlike fossils.
The human fossils are more copious than later ape fossils because,
like modern apes, the ancestral apes lived generally in forested areas
whose soil doesnt preserve fossils well. The human hallmark, bipedalism, took our ancestor to open savannas, where the complex geological processes of fossilization could more readily occur. The resulting abundance of proto-human fossils and near absence of later
ape (chimp/gorilla) fossils makes it unlikely that the fossil record will
tell us much about the actual historical divergence of humans and
living apes from one another.
But we do know that the historical divergence was quite recent. In
the mid-1960s, a collaboration between two scientists at Berkeley
a soft-spoken, slender, New-Zealand-born biochemist, Allan Wilson,
and a swarthy, genial, and argumentative six-and-a-half-foot anthropologist, Vincent Sarichdemonstrated it in a classic series of papers.
Although by then the genetic code had been worked out, DNA
could not yet be directly analyzed. Instead, one used a surrogate measure of genetic difference, the proteins. Proteins are a direct reection
of DNA, being the products of the DNA code, and consequently
they can be used as reasonable rst estimates of genetic similarity.
Morris Goodman, a biochemist at Wayne State University, had recently demonstrated that the proteins of humans, chimpanzees, and
gorillas were extraordinarily similar. Sarich and Wilson, however,
wanted to take the research to another level by asking just how similar
the proteins were, putting numbers on Goodmans crude observation.
Their technique involved injecting a rabbit with a human protein.
As would the blood of most vertebrates, the rabbits blood recognizes
the human protein as a foreign substance, like a virus, and produces
antibodies to attack it. The immune reaction is highly specic and
highly efcient, and once it has learned to attack the human substance, the rabbits blood will now also react against a similar protein
from a baboon. But since the baboon protein is only similar to, but
not identical with, the human protein, the rabbits blood reaction is
somewhat weaker.

10

molecular anthropology

How much weaker? By studying the extent of the reaction of rabbit


blood immunized against human proteins to the proteins of, say, an
orangutan, Sarich and Wilson could estimate the amount of difference between the human and orangutan proteins as simply the difference in the intensities of the chemical reactions in the rabbit blood.
On the other side of the country, an ambitious young British paleontologist at Yale named David Pilbeam was arguing that the jaw
fragments of a fourteen-million-year-old fossil called Ramapithecus
showed the dental hallmarks of humanity. If they indeed evinced
humanity and they were that old, it followed that humans had diverged from the apes at least fourteen million years ago.
But Sarich and Wilson had come up with an interesting result.
They found that rates of change in the protein varied very little from
species to species. Humans and orangutans are fairly close relatives,
from whom the baboon diverged much earlier. The ancestors of humans and orangutans were consequently the same species back when
they diverged from the baboon. And Sarich and Wilson found that
the intensity of reaction was generally the same if you studied the
human-baboon reaction or the orangutan-baboon reaction.
There just didnt seem to be much in the way of feverish activity
in the evolution of the proteins of humans, orangutans, or baboons.
Rates of protein evolution simply did not seem to vary extensively.
The amount of difference seemed sensitive only to the time since the
species had been separated from one another.
Knowing that the rates of protein evolution were roughly constant,
Sarich and Wilson calculated those rates and then applied them to
the human-chimpanzee divergence. Knowing how rapidly change occurs in a stretch of evolutionary time, and how much protein change
has accumulated since the divergence of human from chimpanzee, it
was a straightforward matter to calculate how long humans and chimpanzees had been independent evolutionary lineages.
Their answer: about four million years.
The problem was that based on the Ramapithecus jaw fragments,
Pilbeam was stridently proclaiming the independence of the human
lineage over fourteen million years ago, while Sarich and Wilson were
arguing just as forcefully that Ramapithecus couldnt be in the

molecular anthropology

11

human line, because there had been no human line that early; fourteen million years ago, humans and modern apes had necessarily
constituted the same evolutionary lineage. Even allowing for a bit
of sloppiness in their calibration, Sarich famously wrote in 1970,
one no longer has the option of considering a fossil specimen
older than about 8 million years as a hominid no matter what it
looks like.
Looks, as we all know, can be deceiving, and Ramapithecus has since
been shown not to have been a human ancestor. Details of its face
show it to have been more closely related to the orangutan.
But it would be wrong to read this as a victory of genetics over
anatomy. It was, rather, the a triumph of one carefully interpreted
corpus of data over another body of data, interpreted more freely. In
this case, the superior scholarship and science lay with the biochemists. Under slightly different circumstances, it could just as easily have
been the other way around.
And often it issurprisingly often, in fact. We routinely now hear,
however, of the reassessment of phylogenies based on molecular
datathat no matter what it looks like, cockeyed genetic evidence
shows that guinea pigs arent really rodents, that dogs were domesticated ten times earlier than had been thought, that humans diverged
from Neandertals ve times earlier than had been thought, that rabbits are more closely related to people than to mice, that frogs are
more closely related to sh than to lizards, and that the groups of
modern mammals diverged from one another far earlier than everyone thinks.
Even Vince Sarich, the doyen of iconoclastic molecular evolutionary studies, takes a jaundiced view today from retirement. Small miscalculations can have huge effects, he notes.
Then toss in a bit of molecular omnipotence, mix in a disdain for
the paleontologists, and youve got me some 25 years agoand
other researchers today. How did I escape? Well, mostly by reading,
listening, and thinking. Having been down the very seductive
molecules are everything; fossils are nothing road, and through
the lengthy and painful process of weaning myself off it, it hurts

12

molecular anthropology

me to see that the existence of the lesson is not even acknowledged,


never mind the lesson itself being learned.

Perhaps the most overexposed factoid in modern science is our


genetic similarity to those African apes, the chimpanzees and gorillas. It bears the precision of modern technology; it carries the air
of philosophical relevance. It reinforces what we already suspect,
that genetics reveals deep truths about the human condition; that
we are only half a step from the beast in our nature. Chimpanzees
can be brutal, humans can be brutal; its in our essence, its in our
genes.
But how do we know just how genetically similar we are to them?
What is that estimate based on? What real signicance does it have
for our conceptions of ourselves in the modern world, and the role
of genetic knowledge in shaping those conceptions? This is where
genetics and anthropology converge, the gray zone of molecular anthropology, which forces us not just to look at the genetic data but
to question both the cultural assumptions we bring to those data and
their relevance for thinking about the modern world and interpreting
our place within it.

s ci e n ce con f ron t s the chimp anzee

The fact that we are biologically similar to the apes was known long
before there were geneticists. For eighteenth-century scholars, apes
had roughly the same status as Bigfoot does today: they lived in
remote areas and were seen only by untrained observers. Consequently, reports about them differed widely in quality and reliability.
One famous and inuential story was that of a sixteenth-century
sailor named Andrew Battell, who survived a shipwreck and lived in
West Africa for several years before returning to Europe. His story
was related in a popular collection of travel narratives published by
Samuel Purchas in the early 1600s. Purchas wrote of two kinds of
Monsters, which are common in these Woods, and very dangerous,
known in the native tongue as the Pongo and the Engeco. Battell

molecular anthropology

13

had nothing to say about the Engeco, but the Pongos highth was
like a mans, but their bignesse twice as great.
Could he have been describing a gorilla?
This Pongo is in all proportion like a man, but that he is more
like a Giant in stature, then a man: for he is very tall, and hath a
mans face, hollow eyed, with long haire upon his browes. His
face and eares are without haire, and his hands also. His bodie is
full of haire, but not very thicke, and it is of a dunnish colour. He
differeth not from a man, but in his legs, for they have no calfe.
Hee goeth alwaies upon his legs, and carrieth his hands clasped on
the nape of his necke, when he goeth upon the ground. They
sleepe in the trees, and build shelters for the raine. They feed upon
Fruit that they nd in the Woods, and upon Nuts, for they eate
no kind of esh. They cannot speake, and have no understanding
more then a beast. The People of the Countrie, when they
travaile in the Woods, make res where they sleepe in the night;
and in the morning, when they are gone, the Pongoes will come
and sit about the re, til it goeth out: for they have no understanding
to lay the wood together. They goe many together, and kill many
Negroes that travaile in the Woods. Many times they fall upon
the Elephants, which come to feed where they be, and so beate
them with their clubbed sts, and pieces of wood, that they will
runne roaring away from them. Those Pongoes are never taken
alive, because they are so strong, that ten men cannot hold one of
them: but yet they take many of their young ones with poisoned
Arrowes. The young Pongo hangeth on his mothers bellie, with
his hands fast clasped about her: so that, when the Countrie people
kill any of the femals, they take the young one, which hangeth
fast upon his mother. When they die among themselves, they cover
the dead with great heapes of boughs and wood, which is commonly
found in the Forrests.

Perhaps that passage records a genuine encounter with gorillas. On


the other hand, this was an era of exploration, an era of great discoveries of lands, peoples, and animals. We now know that gorillas

14

molecular anthropology

sleep in trees, eat no meat, and do not speak. However, unless gorillas
have changed a lot in the past four hundred years, we also know that
they are not bipedal, and practice no funerary rites. Was this Pongo,
then, more like the well-known baboon or the well-known centaur?
The fact is, however, that the narrator identies the Pongo and the
Engeco as Monsters and distinguishes them from Baboones, Monkies, Apes, and Parrotsrendering the identication of the creature
even more ambiguous and attesting at very least to the unfamiliar
manner in which scholars of that era thought about the animal kingdom.
These monsters were situated on the boundary between personhood and animalhood. Consequently, they were immensely interesting. That boundary is the domain of powerful mythological motifs
in all cultures, for the distinction between person and animal allows
us to situate ourselves in the natural order, to make some sense of
our place in it. And the mythology is just as powerful in the scientic
culture, as the scientic literature will easily attest: these creatures are
both us and not-us, and we need to know what they really are.
When European sailors traveled to Africa and Asia, they often tried
to retrieve these creatures, but unfortunately the journey was long
and hard, and a baby chimpanzee could probably not be expected to
thrive on a seafaring diet of biscuits and salt pork. An ape of some
sort was described briey by a Dutch anatomist named Nicolaas Tulp
in 1641, but the terse description of the animal is so confusing that
it is hard to know whether Tulp had been brought a chimpanzee or
an orangutan. Tulps satyr (g. 1) looks more like an orangutan
than like anything else, and he tells us that it is called by the Indians
orang-outang, but he also says his specimen didnt come from the
Indies, but from Angola, and it had black hair.
The face, Tulp relates, counterfeits man: but the nostrils are at
and bent inwards, like a wrinkled and toothless old woman. But the
ears, breast, abdomen and limbs were so like ours that he considered
them as similar as two eggs in a basket. The satyr walked upright and
had prodigious strength; yet it drank with great delicacy and afterward wiped away the moisture on its lips not less suitably and less

molecular anthropology

15

Figure 1. Tulps satyr. From Nicolaas Tulp,


Observationum medicarum libri tres . . . (Amsterdam: Apud Ludovicum Elzevirium, 1641).

delicately than thou wouldst see it in the court of princes. It even


slept like a person.
Yet the satyr had a dark side. In Borneo,
they not only make attacks on armed men, but upon women and
girls. Meanwhile the desire for the latter burns so ardently that
not seldom they ravish them when captured. In fact they are so
greatly inclined to venery (even among themselves, as was common
with the licentious Satyrs of the ancients) that they are at all times

16

molecular anthropology

wanton and lustful: so that the Indian women therefore avoid


the woods and forests . . . where these shameless animals roam.

Clearly, Tulp is conating classic mythology, actual observations,


and the symbolic criteria popularly used to demarcate the human
condition (we are prim and sexually modest; they are immoral and
licentiousa recurrent theme when dealing with other species and
other races). And that is precisely the problemthe apes, by virtue
of straddling a symbolic boundary, are highly subject to the projections of the scientist from the very outset of modern science.
The rst successful description in the scientic literature of a great
ape appeared in 1699 by the leading anatomist in England, Edward
Tyson. Picked up in Angola and brought to London by ship, the
chimpanzee succumbed shortly thereafter to complications stemming
from a jaw infection it sustained from a fall on board. However, the
anatomist saw the animal alive, dissected it afterward, and described
and illustrated his work in such detail that it is impossible to mistake
his subject for anything but a chimpanzee (g. 2).
He called it a Pygmie, and was struck by the fact that when he
tallied up the resemblances of the Pygmie to a monkey, there were
thirty-four; but when he tallied up to the resemblances to a human,
he counted forty-eight. It was clearly like a human: It would lie in
a bed, place his head on the pillow, and pull the cloathes over him,
as a man would do; but was so careless and so very a brute, as to do
all Natures Occasions there.
But it was clearly not a human: Now when I observed it to go
upon all four, . . . it did not place the palms of the hand at to the
ground, but went upon its knuckles, . . . which seemed to me so unusual a way of walking, as I have not observed the like before in any
animal.
Tyson resolved the paradox by emphasizing the physical similarities
and the mental or spiritual discontinuities. The Pygmie partook of
both essences, the physical human and the mental nonhuman, and
thus formed a link between the material world of animals and the
spiritual world of people.
But the sterile analysis of the scientist-philosopher did not answer

molecular anthropology

17

Figure 2. Tysons orang-outang, or pygmie.


From Edward Tyson, Orang-outang, sive homo
sylvestris, or, The anatomy of a pygmie (London:
Thomas Bennett & Daniel Brown, 1699).

the question of what the creature was like when it was alivehow it
lived, how it moved, what it ate. For this, Europeans were still obliged
to rely on the accounts of sailors, travelers, or merchants. A contemporary of Tysons, Willem Bosman, wrote a popular Dutch account
of his travels in West Africa, translated into English in 1705. He relates
that there are so many various species of apes that he cant possibly
describe them all, but begins with apes he calls Smitten, which are

18

molecular anthropology

of a pale mouse color, and grow to a wonderful size. I have myself


seen one of ve foot long, and not much less than a man; they
are very mischievous and bold. It seems incredible what an English
merchant here afrmed to me for truth; that behind the English
fort at Wimba (where there is a terrible number of these apes; that
are so bold, that they will attack a man, as he related,) amongst
others they fell upon two of their Companys slaves, which the
apes had overpowered, and would have poked out their eyes, if
they had not been timely rescued by some Negroes; for they,
to complete their design, had gotten some sticks ready.
You, as well as myself, are at liberty what credit to give to this
story. But indeed, these are a terrible pernicious sort of brutes,
which seem to be made only for mischief.
Some of the Negroes believe, as an undoubted truth, that these
apes can speak, but will not, that they may not be set to work;
which they do not very well love: this is their opinion of them.

The Speaker, an English merchant ship, docked in London in 1738.


She had brought from Angola an animal of remarkably and terribly
hideous countenance . . . called by the name Chimpanzee. This had
the distinction of being the rst ape widely displayed in Europe, and
it impressed a number of leading scholars with its ability to ape the
human form and action. Again, the animal, a youngster, was made
the subject of a scientic report, which noted its habits of
walking with an erect body, with a few parts of the body being
covered with hair, the rest physically strong and muscular. It seeks
food from its own excrement; but it also loves the drink of tea,
which it drinks from a small container in the manner of humans.
Moreover it imitates the sleep of these humans and is not altogether
lacking in intelligence, even expressing a human chattiness in its
own voice. The males, when they have come to the age of adulthood,
seek out human females for illicit sexual intercourse, and provoke
men, even armed ones, to ghting.

Biological systematicshow we formally organize and partition


naturematured through the work of a Swedish botanist and phy-

molecular anthropology

19

sician, Carl Linnaeus. Biologists as far back as Aristotle had classied


animals; but Linnaeus succeeded in imposing regularity and rigor on
the process.
The father of scientic classication was an eighteenth-century
scholar of humble origins. Born in 1707, the son of a rural clergyman,
Linnaeus demonstrated a facility for botany that impressed the professors at Swedens most distinguished university, Uppsala. Arriving
at the university in poverty, he resoled his classmates cast-off shoes
to wear himself, but he soon managed to earn his keep as a tutor. He
obtained a medical degree in Holland in 1735; and that very year he
published the rst edition of his Systema naturae (System of Nature),
using the sexual anatomy of plants as a key to classifying them. In
the next three years, he published no fewer than eight books. He then
returned to Sweden to marry.
Linnaeus hung out his shingle in Stockholm to practice medicine,
but his reputation as a scholar was such that he was appointed to the
medical faculty of Uppsala in 1741. Within a year, he had contrived
to take charge of botany. An inspiring teacher and prodigious writer,
Linnaeus supervised over 180 doctoral theses during his academic
career and took an active role in writing them as well. His students
and colleagues sent him plant specimens from all over the world, and
Linnaeus tted them all into the system of nature. It was said that
God created, but Linnaeus arranged.
Nature, according to Linnaeus, in keeping with the new scientic
thought of the eighteenth century, could be expressed in simple formulas. What Newton had achieved mathematically with motion, Linnaeus could do anatomically with species. Prickly, insecure, obsessed
with his place in history, and unable to accept criticism, Linnaeus
had not quite as extreme a personality as the legendary Newton, but
he was known as someone you had to handle gingerly.
Linnaeuss Systema naturae, an authoritative guide to the arrangement of plants, animals, and minerals as ordained by God and discerned by the author, went through twelve editions, and it is from
the tenth (1758) that modern biological classication ofcially dates.
He was eventually ennobled, retroactively to 1757, under the name
Carl von Linne, and died in 1778.

20

molecular anthropology

And what sense did Linnaeus make of the relationship between


people and apes? The father of zoological classication was so confused that he simply divided reports about them into two sets, the
more anthropomorphic and less anthropomorphic. He designated the
former as a second species of humans, Homo troglodytes (which he
also called Homo nocturnusnocturnal, or cave-dwelling, man), and
put the latter in another primate genus, Simia satyrus. Not only were
the apes paradoxically very much like us and very much not like us
simultaneously, but they were now formally both human and nonhuman at the same time.
Subsequent generations of biologists quickly corrected Linnaeuss
error. As early as 1771, an English zoologist named Thomas Pennant
referred to Linnaeuss Homo nocturnus, an animal . . . unnecessarily
separated from his Simia satyrus. In 1775, the German biologist Johann Friedrich Blumenbach noted that Linnaeus had made a great
mistake in the Systema naturae, in that the attributes of apes are
there mixed up with those of men.
Biologists since the middle of the eighteenth century have sought
to highlight one or the other side of this paradox. Thus, we follow
Linnaeus today in classifying humans as just another species of
primate, specically just another species of apelike creature. The
ofcial version follows the paleontologist George Gaylord Simpsons
1945 monograph on classifying mammals, placing us in the superfamily Hominoidea, along with the lesser apes (gibbons) and great apes
(chimpanzees, gorillas, and orangutans). The special similarities of
structure that unite us with these creatures among other primates
generally are their teeth (since most of the vertebrate fossil record is
teeth, these are important diagnostic features), the lack of a tail, the
position and movement capabilities of the shoulder, and the structure
of the trunk.
We might alternatively choose to emphasize the otherness of humans by dividing the primate group fundamentally into Quadrumana and Bimana, or two-handed and four-handed, as was popular among Linnaeuss close intellectual descendants. Primates, being
generally arboreal creatures, are different from other mammals in the
structure of their hands and feet, which are grasping appendages and

molecular anthropology

21

lack the claws that other arboreal mammals use. Humans, of course,
retain this heritage in their hands, but not in their feet; we are not
gracefully four-handed but pitiably two-handed. This classication
would acknowledge the unique aspects of human feet, which are
specialized unlike those of any other primate and have lost the ability
to grasp, except in a very rudimentary manner. It wouldnt deny the
common ancestry of humans and apes, but would merely highlight
the divergence of humans from their ape ancestry.
We could even separate humans from other multicellular life altogether, placing humans in the subkingdom Psychozoamental
lifeas Julian Huxley proposed half a century ago. A species that
lives by its wits, that is to say, that relies entirely on the technological
products of its societies for individual survival, is quite different from
other life on earth. Perhaps indeed that might be worth acknowledging zoologically.
Humans are marked by a large number of physical, ecological,
mental, and social distinctions from other life. Not improvements,
of coursewe have no objective way to evaluate improvement in
the natural worldbut merely differences. Other primate species
spend time on two legs, and other vertebrate species are bipedal
(birds and kangaroos come readily to mind), but not in the same
manner as humans. Other species communicate, but not via the
absurdly arbitrary and symbolic media we call language. Other species modify natural objects and use them to aid in feeding (as
noted in Jane Goodalls classic observations of chimpanzees stripping twigs and using them to sh for termites), but none rely on
their technology to survive as humans do. And in no other species
does technology take on an evolutionary trajectory of its own, a
result of the social cycle of invention, adoption, spread, and modication. Other species appear to grieve, but none weep as humans
doand certainly not over imaginary events like those in Les Miserables or Love Story.
What does genetics have to say about all this?
Nothing.
Sameness/otherness is a philosophical paradox that is resolved by
argument, not by data. Genetic data tell us precisely what we already

22

molecular anthropology

knew, that humans are both very similar to and different from the
great apes.
But genetics is able to place a number on that similarity. It is not
uncommon to encounter the statement that we are something like
99.44% genetically identical to chimpanzees. (Actually that number
is the fabled degree of purity of Ivory Soap, but it serves the purpose.)
You can literally count the number of base differences among the
same regions of DNA in humans and chimpanzees and gorillas and
add them up. Or you can do the same thing to the products of the
DNA, protein structures. All such comparisons invariably yield the
result that humans and chimpanzees (and gorillas) are extraordinarily
similar. But that was known to Linnaeus without the aid of molecular
genetics.
So whats new?
Just the number.

g e n e t i ca l a n d a n a tom i cal contrasts

If you compare a human and a chimpanzee, it is easy to see that


structurally they are remarkably similar. Every bone of the chimpanzee body corresponds almost perfectly to a bone in a human body
but differs ever so slightly and diagnostically, in ways generally related
to the human habit of walking upright. And if not related to our
bipedal habit, any detectable difference is very likely related to either
of two other human physical specializations, our reduced front teeth
and our enlarged brains.
The problem is simply that its difcult to say just how similar a
particular chimpanzee body part and its human counterpart are, percentagewise. Where a human skull encases about 1400 cubic centimeters of brain, a chimp is lucky to have a third of that. Is that 67%
different? Where a chimps elbow has large bumps to accommodate
the muscles that bend it, a human has smaller bumps; where a humans thighbone has the lower part, corresponding to the knee, pointing in the same direction as the upper part, corresponding to the hip,
a chimps thighbone is twisted, so its knee points outward rather than
forward. Just how different is that?

molecular anthropology

23

A percentage, after all, is a scalar, one-dimensional measure, while


a body part is a three-dimensional entity. Indeed, four-dimensional,
if you consider the developmental aspects of growthas a person
matures, they change in form, they dont merely expand.
How similar is a large sphere to a small sphere? Is a large sphere
more similar to a small sphere or to a large cube?
Obviously, it depends on which criterion you decide is most importantsize or shape. Where there are two different and incomparable kinds of similarities being observed here, an evaluation along
a single scale is impossible; in fact, its absurd. If you were to compare
human and chimpanzee structure in the context of a three-way comparison to, say, a snail, it would be patently obvious that humans and
chimps are over 99% identical in practically every way you could
compare all three animals.
The human and chimp have bones, they lack a shell, they have
limbs, they dont leave a trail of slime as they move; every nerve, every
sinew, every organ is almost the same in a chimp and human and
very different, if present at all, in the snail.
Exactly how similar they are, of course, remains elusive. Even assuming it to be true, it would be rather old-fashioned and premodern
to say, Humans and chimpanzees are really, really, really similar,
even though it is true.
What genetics offers is the opportunity to place a hard number on
two-way comparisons, by virtue of the fact that the genetic instructions (and their primary products) are composed of long chains of
subunits, differences in which can be tabulated and numerically manipulated. Thus, I can look at a short region around one of the genes
for hemoglobin, as my colleagues and I did in 1986, and nd a DNA
sequence that reads GCTGGAGCCTCGGTGGCCAT in a baboon,
and GCTGGAGACTCGGTGGCCAT in an orangutan. One difference in twenty possibilities; the very linearity of DNA sequences
makes them easy to compare. And with a much longer DNA sequence, you would expect to get a more accurate estimate. In this
case, for example, we found a difference of about 5% in this small
region between a baboon and an orangutan, and a more general level
of difference of about 8%.

24

molecular anthropology

But the comparison can also be misleading in two important ways.


First, such comparisons of DNA sequence ignore qualitative
differences, those of kind rather than amount. To take the smallest case, consider a different sequence of twenty DNA bases from
the same region: CCTTGGGCCTCCCGCCAGGC in the baboon
and CCTTGGGCTCCCGCCAGGCC in the orangutan. If you
look at them in parallel rows you nd them to be different.
. . . CCTTGGGCCTCCCGCCAGGC . . .
. . . CCTTGGGCTCCCGCCAGGCC . . .

But if you look more carefully, you might observe that the general
gestalt of the sequences is roughly the same. If there is one C too
many in the middle of the top sequence, or one two few in the
bottom, the match becomes far more complete. (Since DNA sequences are immensely long, the presence of extra bases at the beginning or end of an arbitrary sequence is trivial. The ones in the middle
of sequences are interesting.) If we look at it again, inserting a small
gap for one base too many or too few, we see the similarity that was
previously hidden from view.
. . . CCTTGGGCCTCCCGCCAGGC . . .
. . . CCTTGGGC TCCCGCCAGGCC . . .

So we may infer an insertion in one lineage or a deletion in the


other, in order to make this sequence look maximally similar. But
how can we know for sure? This is a very different kind of inference
from the DNA base substitutions we were tabulating a few paragraphs
ago. This involved ignoring the actual census of differences in favor
of a gestalt similarity, and then retabulating the differencesa
highly subjective procedure, although probably right.
So weve overridden the observation of seven differences in twenty
with the inference of one difference, of a different sort, in twenty.
Again, this is not to say that its illegitimate (the example is actually
taken from a paper I co-authored), but the question is, what does it

molecular anthropology

25

do to our number, our precise estimate of the degree of genetic difference? First, it inserts an element of subjectivity masked by the
number itself; and second, it sums together DNA base substitutions
and DNA base deletions, as if they were biochemically identical and
quantitatively equivalent. In fact they are neither; this is a classic
apples and oranges case.
And that was an easy one.
In fact, the molecular apparatus has complex ways of generating
insertions and deletions in DNA, which we are only beginning to
understand. From a more poorly understood genetic region (the genes
for ribosomal RNA), here is a DNA sequence from human and orangutan, aligned three different ways:
Human
Orangutan

CCTCCGCCGCGCCG
CTCCGC GCCGCCGGGCA
CGGCC
CCGC
CC
GTCGCCTCCGCCACGCCGCGCCACCGGGCCGGGCCGGCCCGGCCCGCCCCGC

Human
Orangutan

CCTCCGCCGCGCCGCT
CCGCGCCGCCGGGCACGGCCCCGC
CCGTCGCCTCCGCCACGCCGCGCCACCGGGCCGGGCCGGCCCGGCCCGCCCCGC

Human
Orangutan

CCTCCGCCGCGCCG
CTCCGCGCCGCCGGG CAC GGCC
CCGC
CCGTCGCCTCCGCCACGCCGCGCCACCGGGCCGGGCCGGCCCGGCCCGCCCCGC

These are precisely the same sequences, reconstructed and presented three different ways. Tabulate the differences. The top one
invokes ve gaps and six base substitutions; the middle has only two
gaps but nine base substitutions. And the bottom one has ve gaps
and only three base substitutions. The three pairs of sequences differ
in the assumptions about which base in one species corresponds to
which base in the other. While we might, by Occams Razor, choose
the alignment that invokes the fewest inferred hypothetical evolutionary events, we still have to decide whether a gap equals a substitution. Does the bottom one win because it has a total of only
eight differences? Or might the middle one win because a gap should
be considered rare and thereby worth, say, ve base substitutions?
The problem is that we cannot know which is right, and the one
we choose will contain implicit information about what evolutionary
events have occurred, which will in turn affect the amount of similarity we tally. How similar is this stretch of DNA between human

26

molecular anthropology

and orangutan? There may be seven differences or eleven differences,


depending upon how we decide the bases correspond to each other
across the speciesand that is, of course, assuming that a one-base
gap is also equivalent to a ve-base gap and to a base substitution.
In a more general sense, however, the problem of taking quantitative estimates of difference between entities that differ in quality is
prevalent throughout the genetic comparison of human and ape. The
comparison of DNA sequences presupposes that there are corresponding, homologous sequences in both species, which of course
there must be if such a comparison is actually being undertaken. But
other measurements have shown that a chimpanzee cell has 10% more
DNA than a human cell. (This doesnt mean anything functionally,
since most DNA is functionless.) But how do you work that information into the comparison, or into the 99.44% similarity?
In the example just given, you may notice that our problem started
with the assumption that forty DNA bases of human sequences were
homologous to fty-four DNA bases of orangutan sequences. A simple estimate of similarity and difference must necessarily be confounded by variation in the size of the entities being compared.
If we compare the genes for alpha-hemoglobin (half of the molecule
that transports oxygen and carbon dioxide in our blood) on chromosome 16 between human and chimpanzee, we nd a near identity
of the base sequences. But we also nd that, with rare exceptions,
humans have two copies of the alpha-hemoglobin gene, aligned in
tandem, whereas chimpanzees have three. Or if we look at the genes
that code for the Rh blood group, again the nucleotides of the genes
match up almost perfectly between the two species, but humans have
two such genes, and chimpanzees have three. How can you make
simple numerical sense of that?
The second misleading area of DNA sequence comparisons entails a consideration of the other end of the scale. The structure of
DNA, the famous double helix, is built up of four simple subunits. Each of our cells has a length of DNA encompassing approximately 3.2 billion of these subunits, but there are still only
four of them: adenine, guanine, cytosine, and thymine, or A, G,
C, T. This creates a statistical oddity. Since genetic information is

molecular anthropology

27

composed of DNA sequences, and there are only four elements to


each DNA sequence, it follows that two DNA sequences can differ,
on the average, by no more than 75%. Certainly a very small
stretch of DNA might be 0% similar to another very small stretch
(AAAAT matches GGCCG nowhere, after all), but on the average
two random stretches of DNA will be statistically obliged to match
at one out of four places.
In other words, two stretches of DNA generated completely at
random, completely independently of one another, would not be 0%
similar but, rather, would be 25% similar.
But what would constitute a comparison of two DNA segments
that emerged completely independently of one another? When we
compare DNA sequences, of course, we are comparing corresponding
DNA sequences, such as the gene that codes for the electron-transport
protein cytochrome c. Such correspondence, or homology, in biology
is a reection of common descent. A human and a chimpanzee have
similar genes for cytochrome c because they are descended from a
common ancestor that had a gene for cytochrome c similar to those
of both.
In fact, so do humans and fruities. Their common ancestor is
more remote in time than that of human and chimpanzee, but the
y has the molecule cytochrome c, it does the same job as the human
and chimpanzee versions, and the genes can be compared precisely
because humans and ies share a common ancestry. Their DNA sequences did not emerge independently of one another but are products of the divergent histories of lineages that became separated some
hundreds of millions of years ago.
In fact, so do humans and daffodils. Their DNA sequences are not
independent of one another either. Any such independent DNA sequences would have to result from an independent origin of DNAbased life; and then we would still expect them to be 25% identical,
by virtue of the way in which DNA is constructed.
Thus, if you compare the DNA of a human and a daffodil, the
25% mark is actually the zero mark, and since humans and daffodils
do share a common ancestry, you would expect them to be generally
more similar than 25%. Say, about 35%.

28

molecular anthropology

In the context of a 35% similarity to a daffodil, the 99.44% similarity of the DNA of human to chimp doesnt seem so remarkable.
After all, humans are obviously a heck of a lot more similar to chimpanzees than to daffodils.
More than that, to say that humans are over one-third daffodil is
more ludicrous than profound. There are hardly any comparisons
you can make to a daffodil in which humans are 33% similar. DNA
comparisons thus overestimate similarity at the low end of the scale
(because 25% is actually the zero-mark of a DNA comparison) and
underestimate comparisons at the high end. At least snails, in the
earlier anatomical comparison, move around and eat; they cant photosynthesize. So from the standpoint of a daffodil, humans and chimpanzees arent even 99.44% identical, theyre 100% identical. The
only difference between them is that the chimpanzee would probably
be the one eating the daffodil.

nine ty- n i n e a n d f orty- f ou r one -hundredths


pe rce n t pure human

That particular Ivory Soap number is itself interesting. In a recent


book on the great apes, that specic similarity between human and
chimpanzee is invoked by several different authors. On p. 12 we learn
that our DNA differs from theirs by only just over 1 per cent; on
p. 39 we are within 1 per cent; on p. 95 that difference is put at
1.6 per cent; and on p. 220 we are told that they overlap more
than 98 per cent of their genes with us.
Whether the actual number is less than 1% or 2% is obviously trivial
in the great scheme of things. Our genes are very, very similar. But
somehow very, very similar doesnt sound quite scientic enough.
The invocation of a number with a decimal point, on the other hand,
certainly does sound scientic. It implies that there is some ofcially
calculated, scientically sanctioned degree of similarity between the
DNA of human and chimpanzee, when in fact there are simply a
variety of crudely measured, but generally concordant, studies.
The problem is that in being told about these data without a context in which to interpret them, we are left to our own cultural de-

molecular anthropology

29

vices. Here, we are generally expected to infer that genetic comparisons reect deep biological structure, and that 98% is an
overwhelming amount of similarity. Thus the DNA of a human is
98% identical to the DNA of a chimpanzee becomes casually interpreted as deep down inside, humans are overwhelmingly chimpanzee. Like 98% chimpanzee.
The important question that lurks behind this trivial disagreement
is, What constitutes a scientic statement about genetic similarity?
The estimates of genetic difference between human and chimpanzee
given in that book are precise, but not accurate. In other words, they
have a decimal point and are written out to a tenth of a percent, but
the numbers given are wrongyou dont have to be Aristotle to see
that it cant be both 1.6% and within 1% at the same time. The fact
that either or both are inaccurate doesnt seem to make them less
scientic.
The cachet of science resides here in both the DNA and the tenthsof-percentiles. DNA is now the stuff of bad direct-to-video movie
plots and a sweet-smelling cologne from Bijan of Beverly Hills, which
even comes in a helical bottle. (The fact that the helical bottle is
composed of three strands, rather than two, earned the company the
IgNobel prize for chemistry in 1996, presented at Harvard by the
Annals of Improbable Research. The spectacular, hilarious award ceremony has achieved cult status in the academic community.) And the
allure of tenths-of-percentiles is surely what Mark Twain had in mind
when he grouped statistics along with lies and damn lies.
Geneticists have occasionally fallen headlong into this trap of taking
precision in lieu of accuracy. For example, in the 1920s, it was not
known how many chromosomes a human being had in each cell.
Most counts were in the twenties (by American scientists), some were
as high as the forties (by European scientists), and some geneticists
reconciled the discrepancy by arguing that since the Americans were
studying the chromosomes of black people and the Europeans were
studying those of white people, perhaps whites had more chromosomes than blacks. In 1927, however, the leading cell biologist of the
era pronounced denitively on the human chromosome number,
forty-eight. The count of forty-eight entered the textbooks and re-

30

molecular anthropology

mained the ofcial human chromosome number for three decades;


indeed, the count was replicated several times. That is how these
scientists knew they were doing their experiments right; they identied all forty-eight human chromosomes.
In fact, these scientists were attempting essentially to count the
strands in a plate of linguini, which is daunting, at best. The truth,
the accurate inference, was always that humans had a large number
of chromosomes, probably in the high forties. But that wasnt what
they said. With the development of new techniques in cell biology,
it emerged in 1956 that humans really only have forty-six chromosomes.
Whoops!
The scientists were accepting a count that was precise over a count
that was true. Thus, the scientic statement of thirty years standing
was precise, authoritative, and wrong.
And all the geneticists were doing was counting.
And so it is with the 99.44% genetic identity to a chimpanzee. We
dont know precisely how similar the DNAs of chimps and humans
are, except that they are very similar, as are their bodies. Genetics
appropriates that discovery as a triumph because it can place a number on it, but the number is rather unreliable as such. And whatever
the number is, it shouldnt be any more impressive than the anatomical similarity; all we need to do is to put that old-fashioned comparison into a zoological context.
The paradox is not that we are so genetically similar to the chimpanzee; the paradox is why we now nd the genetic similarity to be
so much more striking than the anatomical similarity. Scholars of the
eighteenth century were overwhelmed by the similarities between humans and chimpanzees. Chimpanzees were as novel then as DNA is
now; and the apparent contrast between our bodies and our genes is
simply an artifact of having two centuries familiarity with chimpanzees and scarcely two decades familiarity with DNA sequences.

molecular anthropology

31

Two
the ape in you

Where does a number like 99.44%, ostensibly representing our


basic similarity to another species, come from? Three sorts of data
have produced these tabulations. The rst is a comparison of protein
structure from 1975, by Berkeley geneticists Mary-Claire King and
Allan Wilson. Proteins are long strands of elementary subunits, which
reect gene structure and can be compared. Examining the differences
between forty-four known proteins of human and chimpanzee, King
and Wilson found they were 99.3% identical. (Amazingly, only 0.14%
away from the legendary purity of Ivory Soap!)
We know that about only 1% of the total DNA of a cell is actually
expressed as proteins, and that protein-coding regions are the most
slowly changing parts of the DNA. The reason is that mutations or
changes to functional DNA are more likely to do systemic damage
to the organism than mutations to nonfunctional DNA. Consequently, they are most unlikely to be perpetuated in the species, because their bearers fail to thrive and reproduce as efciently as the
other creatures who lack the damaging mutation. Mutations to nonfunctional DNA occur at the same rate, but because they are not
expressed, they can do their bearers no harm. You would expect that
DNA to differ more widely across species. Consequently, the King-

32

Wilson estimate of 99.3% is an overestimate of the similarity of human and chimpanzee DNA, being derived from a skewed sample of
the DNA, reecting only protein-coding regions.
The second class of data was made available in the mid-1980s with
the development of direct DNA sequencing technology. DNA is a
long linear molecule, again composed of simple subunits that can be
compared. Bits and pieces of it have been compared between human
and chimpanzee, amounting to less than 100,000 DNA bases in
length. But there are 3.2 billion bases in the human genome, so obviously we have here a very minuscule proportion, and again there is
a bias toward regions that contain functional unitsgeneswhich
tend to be where geneticists look for DNA to sequence.
The most comprehensive comparison we have is actually innitesimal in scope, about 40,000 bases of the region of the hemoglobin
genes on chromosome 11. And we nd human and chimpanzee, base
for base, to be about 1.9% different. The difference between the 0.7%
estimate and the 1.9% estimate is a consequence of the fact that this
DNA comparison includes much more nongenic DNA than genic
DNA (which is the only class that would be translated into protein
differences). Indeed, the DNA sequences of genes included in that
region are virtually identical between the two species.
But again, that is a high estimate, because it focuses on a region
known to contain genes and hence is more conservative than the
overall DNA would be expected to be. Genes are rare in the genome.
Not only that, but we know that the evolution of human hemoglobin
has been sensitive to specic environmental problemssuch as malariaso it may have its own evolutionary idiosyncrasies.
Another piece of DNA that has been well studied is the mitochondrial DNA, or mtDNA. Where 3.2 billion nucleotides comprise the
twenty-three chromosomes of a human nuclear genome (the DNA
of a human gamete, half that of an ordinary cell), there is a tiny
fraction located outside the nucleus. The mitochondrion, a subcellular organelle universally known in biology textbooks as the powerhouse of the cell, generates metabolic energy for the physiological
processes of life. It also has 16,500 nucleotides of DNA, which code
for some of the molecules used by the mitochondrion. This mito-

the ape in you

33

chondrial DNA is much more famous for two reasonsit has suggested a primordial symbiotic relationship between free-living protomitochondria and free-living proto-cells at the dawn of life; and it is
also the source of revolutionary inferences about modern human origins in a mitochondrial Eve (see chapter 4).
Less spectacularly, this DNA has also been compared across the
great apes.
The mitochondrial DNA, however, is not 1% different among humans, chimpanzees, and gorillas. It is about 10% different. Why?
Because mtDNA mutates at a much higher rate than nuclear DNA.
The mutations have little or no effect on the life of the organism,
and so the differences simply accumulate. Two organisms will
therefore be far more similar in their nuclear DNA than in their
mtDNA. For example, the mitochondrial Eve work was based on
tabulating the differences detectable among human beings (0.2% difference), whose nuclear DNAs are so similar as to preclude that kind
of study generally.
The point is an important one: different bits of DNA evolve at
their own rates, and therefore in the six or seven million years of
evolutionary time separating humans, chimps, and gorillas, some bits
are 10% different, some are not comparable because they are different
in kind rather than amount, and most are less than 3% different.
Another technique in the 1980s permitted a much broader estimate
of DNA differencea technique called DNA hybridization. Here, a
pair of biologists from Yale adopted a technique that was recognized
a decade earlier to be effective, if crude. They began by analytically
dividing the DNA into two halves: repetitive DNA (redundant sequences of DNA, inferred to be meaningless) and unique-sequence
DNA. Presumably, the latter contained the genes, so they discarded
the former. Then, since DNA is a two-stranded molecule, the classic
double helix, they separated the strands of human DNA (by heating
it) and fooled the strands into rebonding with strands of chimpanzee
DNA. Human DNA is easy to foolif you simply give it a thousand
times more chimpanzee DNA, it wont be able to nd its perfect
human match and will bond instead to whatevers around. The bond-

34

the ape in you

ing to another species DNA must be imperfect, however, since mutations have accumulated to distinguish them genetically as species.
They then heated the hybrid DNA molecules. It takes less heat to
make these strands come apart, because they are imperfectly
bondedthere are fewer molecular bonds holding them together.
The difference between the temperature at which DNA strands from
the same species come apart and those at which hybrid DNA strands
come apart is thus a gross measure of how many mutations have
occurred during the divergent evolutionary histories of those species.
The Yale biologists made two major claims. The rst was that hybrid molecules of human and chimpanzee DNA dissociated from one
another at a temperature 1.8 degrees lower than did pure human
DNA. Assuming (conveniently) that 1 degree equals 1% genetic difference, they concluded that humans and chimpanzees are 1.8% genetically different. But there were two difculties with this claim.
First, others have calculated the conversion ratio at 1 degree equals
1.7% difference, which would make humans and chimps over 3%
different, rather than 1.8%. And, second, the experiment only examined half of the total DNA in the rst place. So it actually boils
down to a demonstration that half the DNA of humans is either
98.2% or 97% identical to that of chimpanzees.
The Yale biologists second claim was actually far more controversial. Not only were humans, chimpanzees, and gorillas genetically
very, very similar (as was already well known), they asserted with great
fanfare, but they could detect that humans and chimpanzees were
actually more genetically similar to each other than either was to a
gorilla. If true, this would be very signicant.
They said that they had done the experiments over and over again
and had always gotten values between 1.2 and 2.3 degrees for the
human-chimp comparison and 1.6 to 2.8 for the chimp-gorilla comparison. Thus the genomes of human and chimps were only about
1.8% different (plus or minus a little), while each of them differed
from the genome of a gorilla by about 2.3%. Unfortunately, however,
when other scientists got to examine just one-eighth of these data,
they found values for human-chimp ranging from -0.2 to 2.7 de-

the ape in you

35

greesfar beyond what the authors themselves had reported; and


neither calculated average of 1.8 nor 2.3 was reliableboth sets of
comparisons were simply about 2%. The numbers, alas, had been
subjected to a battery of what were euphemistically called correction
factors prior to publication, a fact conceded by the authors in a
subsequent paper. They even admitted that had it not been for their
unreported data alterations, they would have found humans, chimps,
and gorillas to be equidistantly related.
That, however, would have been a non-storyfailure to resolve the
three-way split among the species with high-tech genetics and to
establish the actual Ivory Soap value of the relationship. So the Yale
experimenters ended up converting it into a story, the resolution of
the genetic relationships of humans, chimpanzees, and gorillas, and
an exact 98.4% genetic identity of humans with chimpanzees. If it
had been true, it would indeed have been very interesting.
But it was simply another crude estimate of the genetic similarity
of humans to apesabout 98%unfortunately misrepresented as
being more precise than it really was.
Yet another kind of comparison involves examining the structure
of the chromosomes. Although the terms chromosome and gene
are commonly used as if they were synonymous, they arent. Genes
are elements of hereditary information; chromosomes are the boxes
they come in. There are estimated to be 35,000 human genes. And
if you gure in that genes constitute only an estimated 30 percent of
the genome (the rest is intergenic DNA of unknown, and possibly
no, function; and 95% of the DNA within a gene likewise has no
known function), then it follows that a lot of DNA has to be transmitted faithfully every time a cell divides. The DNA accomplishes
this by condensing into a manageable number of chromosomes. And
obviously there are a lot of genes on each chromosome.
Since the primary function of chromosomes is to get the DNA
through cell division smoothly, it doesnt really matter whether there
are ten, twenty, or fty of them. Any number in that range will do
well. Consequently, we nd that nearly all mammals have between
ten and fty, and in general, closely related species have similar numbers of chromosomes.

36

the ape in you

Chromosomes can be studied by examining cells (usually white


blood cells) and isolating those that are about to divide. They are the
ones whose chromosomes are visible. Ordinarily, only a very small
percentage of cells is undergoing division at any point in time; however, technological advances in cell biochemistry now permit routine
cultivation of blood cells in test tubes, one chemical stimulating them
to divide and another preventing them from completing cell division.
Thus the proportion of cells whose chromosomes can be studied is
much higher than would otherwise be the case.
When humans were thought to have forty-eight chromosomes, it
was of interest that chimpanzees had the same number. When humans were found actually to have only forty-six chromosomes, it
prompted a recount of chimpanzee chromosomes. But the number
remained forty-eight.
Until 1971, each chromosome could be studied only as a uniformly
stained silhouette under a microscope; consequently, it was quite difcult to tell one from another. In that year, however, another series
of biochemical advances permitted the observation of a characteristic
series of bands on each chromosome. Nowadays, a competent cytogeneticist can recognize any specic human chromosome immediately and can often identify any small part of a chromosome.
But if you want to have some fun with a cytogeneticist (as more
than one anthropologist has bragged), give him or her a sample of
ape blood, and forget to mention its not human. Cytogeneticists are
trained to identify the human chromosomes and to apply that knowledge in the identication of cancers, which are often associated with
broken and reorganized chromosomes. It requires a great deal of
thought and skill to recognize that the chromosomes of an ape are
those of another species.
Each of the twenty-three pairs of human chromosomes has a nearly
identical counterpart in the apes. Perhaps a half-dozen have undergone minor structural changes; but if you can recognize the standard
pattern of bands on human chromosomes (known as G-bands), you
can recognize chimpanzee chromosomes. It is not known precisely
what the bands are, but they can easily be generated in many ways,
the most common being to expose the chromosomes to a mild en-

the ape in you

37

Figure 3. Human chromosomes


are almost identical to those
of chimpanzees in their ne
structure, but there are
characteristic differences. The
large chromosome on the
left is a human chromosome
2, which has no single
counterpart in the chimpanzee;
rather, its pattern of light and
dark bands is matched by
two smaller chimpanzee chromosomes.

zyme treatment, which breaks down some of the protein complexes


in the chromosome packaging. This permits a stain to bind preferentially to certain areas, creating arrays of alternating stained and
unstained regionsbands. And those arrays are nearly identical in
humans, chimps, and gorillas.
The principal exception is human chromosome 2, the second largest (they are numbered according to their relative size). You can look
at the chromosomes of a chimpanzee forever, and you will never see
the large pair known as human chromosome 2. What you will see,
however, are two small pairs of chromosomes that when joined endto-end produce a dead ringer for human chromosome 2 (g. 3).
Apparently, a fusion occurred in the human lineage, creating chromosome 2 and reducing the count from twenty-four pairs to twentythree pairs. How do we know it wasnt a ssion of chromosome 2 in
the chimpanzee lineage? Because we nd those two chromosomes in
more distant relativesin fact, as distant as the baboon. That tells
us that the ancestral form of the chromosome was as two pairs and
the novelty was a fusion in the human line.
Is that what makes us human? Yes and no. Yes in a narrow,
diagnostic sensegiven the chromosomes from a cell of any species,

38

the ape in you

Figure 4. Unlike humans,


chimps and gorillas have darkly
staining regions at the tips of
their chromosomes.

if you nd chromosome 2 in it, its from a human. No in a functional sensethe fusion isnt what gives us language, or bipedalism,
or a big brain, or art, or sugarless bubble gum. Its just one of those
neutral changes, lacking outward expression and neither good nor
bad.
The human and chimpanzee chromosomes also differ in a subtle
but reliable way under a slightly more complex treatment known as
C-banding. C-banding doesnt tell you much, for only a few small
regions are stained under this procedure, so most chromosomes look
pretty much the same. C-banding seems to mark specically a few
chromosomal zones containing highly redundant junk DNA sequences, and in the human the characteristic zones are at the middle
or centromere of each chromosome; slightly below the centromere
on chromosomes 1, 9, and 16; and along most of the Y chromosome.
And we are the only species with such a pattern. If you look at the
chimpanzees cells using the identical procedure, you nd the centromeric bands readily enough, but the regions of chromosomes 1, 9,
16, and Y are simply not there. Not only that, but you will see something entirely unfamiliarbands at the tips of nearly every chromosome (g. 4). That is something youll see in the gorilla as well;

the ape in you

39

it has been seen in every chimpanzee and gorilla studied but in no


human or orangutan.
What is the cause of the bands on the tips? Something trivial, the
emergence of yet another functionless class of DNA, which somehow managed to colonize the ends of the chromosomes. This
class of DNA packs itself more densely into the chromosome than
the rest of the DNA does and absorbs more stain. Once the cytogeneticist suspected we had played a joke by handing in a chimpanzee blood sample, a C-band analysis would give it away immediately.
The story is recursive. We nd ourselves to be genetically very
similar to chimpanzees and yet diagnosably different. Not terribly
different from the conclusions we can draw from comparing anything
else between chimpanzees and humanshair, organs, skin, muscles,
bones. So the paradox of our great genetic resemblance and notable
physical dissimilarity seems less paradoxical.
There is a real paradox, however, that bears considering. We know,
on the one hand, that genetic changes are at the root of the visible
differences between humans and apes. Franz Kafkas short story Report to an Academy gives the reections of an ape who has become
human by virtue of living in Europe and ponders the life he now
leads and the one he has left behind. Kafka was using the ape-intohuman as a metaphor for the assimilated European Jews in a Christian
world, in between the Dreyfus Affair and the Holocaust. But no
manner of upbringing will convert an ape into a human; they are
immutably, constitutionally different, and programmed that way in
their DNA.
And yet when we compare their DNA, we are not comparing their
genes for bipedalism, or hairlessness, or braininess, or rapid body
growth during adolescence, or the deposition of body fat in the hips
and breasts of adult females, or beards in males, or prominent nasal
regions. Were comparing other genes, other DNA regions, which
have either cryptic biochemical functions or, often, no known function at all.
Its the old bait and switch. The genes we study are not really
the genes we are interested in. We have, sadly enough, exceedingly

40

the ape in you

little knowledge on how a body is put together from genetic instructions. We construct genetic maps principally of its breakdown productsdiseaseswhich are important, but which comprise a very different kind of genetic knowledge. We refer to the gene for cystic
brosis, the gene for Huntingtons chorea, the gene for Duchenne
muscular dystrophy, but those identications are misleading. There
are no genes whose function is to give us diseases, there only genes
that can be most easily identied by what happens to an unfortunate
person who lacks a fully functional copy. This becomes the target of
the search (and often the raison detre for the funding of the research
program), but leaves us little knowledge in two crucial areas: rst, the
genetics of normalcy; and, second, the physiology of anatomical
development and how it varies among species.
One hypothesis advanced in the 1970s is that there are two kinds
of genes, those that code for the biochemical minutiae we are able to
study genetically, and those that code for our bodies. The apparent
paradox of genetic near-identity, coupled with physical dissimilarity,
would seem to be resolved if we postulate that small changes in the
rst class of genes lead us to the Ivory Soap conclusion, while small
changes in the second class of genes lead to major physical changes,
the kind that enable you to tell Jane Goodall the person from Flo
the chimpanzee at fty paces.
Once we recognize, however, that both the genetic similarity and
the physical difference are somewhat overstated (consider how much
easier it is to tell Jane Goodall from Elsie the cow, Charlie the tuna,
and Rikki-Tikki-Tavi the mongoose!), there seems to be little reason
to imagine two kinds of genes in there. We learn that we are similar
to, but invariably distinguishable from, our closest relatives. It
couldnt really be any other way, given the fact of evolution.

the ce n t ra l f a l l a cy of m ol ecular anthrop ology

The argument I am criticizing here is the one that begins with our
unimpeachable genetic similarity to chimpanzees and concludes that
we are therefore nothing but chimpanzees genetically. In fact, the
data have been around for a surprisingly long time, and the fact that

the ape in you

41

it took decades to make this simple, direct deduction might alone


suggest that it is specious.
Blood tests used in the 1960s to study the similarity of human and
ape proteins were actually little modied from tests developed around
1900 by an English serologist named George Nuttall. By the 1920s,
the blood reactions of human and ape sera were well known. For
example, journalist and critic H. L. Mencken edited a popular periodical called the American Mercury, which featured essays and stories
by scientists and other literati. And shortly after the celebrated trial
of John T. Scopes (convicted of teaching evolution in Tennessee in
1925), the magazine ran an article called The Blood of the Primates.
And it was quite clear about the results: [T]he horse and donkey,
animals of so intimate a relationship that the one can, as everyone
knows, fecundate the other, show a greater difference than do man
and the apes. In other words, it is proved that the sanguinity of the
horse and donkey, which are capable of hybridization, is less close
than the kinship of Homo sapiens and the anthropoids. The article
failed, in spite of the data, to draw the conclusion that we are apes.
That inferencewhich I shall call The Central Fallacy of Molecular
Anthropologywould have to wait for the molecularization of biology in the 1960s.
Ultimately, the fallacy is not a genetic but a cultural oneour
reduction of the important things in life to genetics. Geneticists are
among the most frequent perpetrators of this fallacy, and of course it
is in their interests to perpetuate it. In the 1960s, when it became
possible to make direct comparisons between the proteins of different
species, biochemist Emile Zuckerkandl was impressed by the fact that
only one site in the 287 amino acids of hemoglobin could be found
to differ between a human and a gorilla. So impressed, in fact, that
he proclaimed that from the point of view of hemoglobin structure,
it appears that gorilla is just an abnormal human, or man an abnormal
gorilla, and the two species form actually one continuous population.
Well, of course, as the distinguished paleobiologist George Gaylord
Simpson was obliged to point out in quick response, a gorilla is not
an abnormal man; its a gorilla. A man is not an abnormal gorilla;

42

the ape in you

hes a man. And gorillas and humans do not form a single population,
any more than gorillas and daffodils do. And furthermore, if hemoglobin seems to be telling you anything else, its lying.
When I met Simpson, the patriarch of mammalian evolution studies, toward the end of his life in the early 1980s, he was still mystied
by the combination he saw of ignorance and arrogance on the part
of students of molecular evolution. He had led a fuller and more
prolic life than mosthe told me he had been in the army hospital
the day General Patton famously slapped the soldier; he had survived
a tree crushing his legs while on a fossil expedition in Brazil in 1956
and now continued to write books about evolution while in retirement in Tucson. His stature in the eld was such that, as a graduate
student, I developed a stutter whenever I spoke to him on the phone,
but in person, he was a reserved and humble old man. He still wore
the neatly trimmed beard he had always worn, now white with age.
Sipping the two martinis that constituted his lunch, he pronounced
with a shrug on deducing the sameness of humans and gorillas from
the sameness of their hemoglobin: Its just plain dumb!
And that from the man who had been preeminently responsible
for integrating modern genetics into evolutionary theory at midcentury.
Hemoglobin, of course, doesnt tell lies or truths. It indicates simply a set of data and interpretations. And in this case the interpretation was a facile one. Why on earth should hemoglobin be a microcosm for the relations of humans and gorillas? Surely we are not
strictly reducible to our blood, any more than we are reducible to
our arm, our toenails, or our phlegm. If we are similar but distinguishable from a gorilla ecologically, demographically, anatomically,
mentallyindeed, every way except geneticallydoes it follow that
all the other standards of comparison are irrelevant, and the genetic
comparison is transcendent? More likely, it should imply that the
genetic comparison is exceptional, and that it is interesting for that
very reason.
Suggesting that the relationships of our blood are the relations of
us, that we are our blood, is simply a metaphoric statement, technically
called metonymy, the substitution of a part for the thing itself. Per-

the ape in you

43

haps it is resonant with us because our brains evolved to make metaphoric connections, and because blood is such a symbolically powerful substance. Blood is, after all, a metaphor for heredity itself.
But this metaphor is not literally true; and science is supposed to
be about literal truths, not literary ones.
There is one sense in which we can acknowledge that we are apes
phylogenetically. We fall phylogenetically within the group constituted by the great apesthose large-bodied, tailless, exibleshouldered, slow-maturing primateswhich also includes chimpanzees, gorillas, and orangutans. And indeed, we are more closely related
to the chimpanzee and gorilla than they are to the orangutan. This
implies that that category of great ape is articial, for it comprises
species that are not one anothers closest relatives; or rather, it excludes
a member of the group of relativesnamely, us.
We are excluded by virtue of the fact that we have diverged relatively rapidly from the classic ape form and mode of life and have
evolved to ll a different niche, that of an ape that is bipedal and
culture-reliant. So although we fall within the great apes genetically
and are recently descended from them biohistorically, we are nevertheless different from them by virtue of having evolved a very large
number of readily observable specializations or novelties. We have left
them in our wake, so to speak, and the apes seem to resemble one
another more than they resemble us, because they didnt develop the
things we did.
But does this mean that we are apes, as Oxford professor and genetic enthusiast Richard Dawkins has argued?
Consider a different group of animals: say, sparrows, crocodiles, or
turtles. Two are crawling, green-scaled reptiles, and one is a bird. As
it happens (like humans and gorillas relative to orangutans), the
sparrow and crocodile are more closely related to each other than either is to the turtle. The two reptiles are more similar physically to
one another, but they are similar simply because the birds, which
originated from a group of reptiles, developed a set of specializations
and ew away, leaving the green scaly creatures behind. Since the
kind of reptile from which the birds originated was related to the
crocodile, it happens that the sparrow and crocodile, a few hundred

44

the ape in you

million years later, are more closely related than either is to the
turtle.
But does that mean that the sparrow is a reptile? No, it means it
is closely related to reptiles; its group is subsumed by the reptiles
but if the word bird is to have any meaning, it must be a different
meaning from the word reptile. Birds are birds; reptiles are a different kind of group, unied by not having evolved the specializations
of birds.
Closer to home, my family is distinct from me, although it subsumes me. In one sense, I am a part of my own family. But in a more
immediate sense, my love of my family does not necessarily imply a
narcissistic love of myself, for it refers to my family, excluding me.
Sometimes the exclusion is what makes a statement sensible.
We can go even further back in biohistory. Several hundred million
years ago, a group of sh developed specializations of their limbs that
enabled some of their descendants to venture out of the sea and on
to land. A living representative of that group of sh is the famous
living fossil, the coelacanth. Since all living land vertebrates (or
tetrapods) are descended from that particular group of sh, it follows
that if you compare a coelacanth, a human, and a tuna, the closest
relatives are the coelacanth and the human, not the two sh.
Lets return to the apes. The argument is that humans are apes,
because we belong to the group that produced chimpanzees and
orangutans; and because we are more closely related to some apes
than those apes are to other apes, we fall within that category. That
argument is structurally identical to the argument that humans are
sh, because we belong to the group that produced coelacanths and
tuna, and because we are more closely related to some sh (coelacanths) than those sh are to other sh (tuna). We fall (by virtue of
being tetrapods) within that category as well.
In other words, we are apes, but only in precisely the same way
that we are sh (g. 5).
Doesnt seem quite so profound now, does it?
Thats because this is not so much a revelation about our basic
natures as about how we name zoological groups. As constituted by
a group of related species that a subset has evolved away from, the

the ape in you

45

Orangutan

Human

Chimpanzee

Tuna

Tetrapods
(including humans)

Coelacanth

Figure 5. Humans fall within the phylogenetic category of apes, although we


have diverged physically from them (physical divergence is represented here by
broken lines); likewise, tetrapods fall within the phylogenetic category of sh,
although they have diverged physically from them. Thus humans are phylogenetically apes only in the same sense that we are phylogenetically sh.

species that remain unchanged will constitute a paraphyletic category. They may look similar, but they are dened on the basis of
lacking the specializations of the other grouptetrapods in the case
of paraphyletic sh, birds in the case of paraphyletic reptiles, and
humans in the case of paraphyletic great apes.
What appeared at rst to be a revelation about our animal nature
is instead a revelation about how we box up nature to make sense of
it. Making sense of the world through classication is a fundamentally
human act, and each human group does it in its own way, and thus
imposes structure upon the world for itself.
Modern science classies animals by two criteria, descent and divergence. This creates confusions such as the occasional paraphyletic
category, in which divergence takes precedence over proximity of descent. Some biologists prefer to classify by descent only and would
thus recognize only closest relatives, burying the categories great
apes, reptiles, and sh. Ultimately, this is a philosophical decision, is unresolvable by recourse to data, and displays the variation
of ideas about classifying among scientists. They are a human society,
and like other human societies, they make sense of their world by
organizing it into groups.
The ancient Hebrews classied for a different reason and used different criteria. Their goal was to distinguish symbolically clean from
unclean, and their criteria were where the animal lived, and how it
moved. For this reason, shellsh and pigs were prohibited but chick46

the ape in you

ens and locusts were not. Leviticus 11 and Deuteronomy 14 give us


the following categorization:
Living on the Ground
Animals with hooves
Split hoof and chews cud [EDIBLE]
ox, sheep, goat, hart, gazelle, roebuck, wild goat, pygarg
(ibex), antelope, mountain sheep
Whole hoof and chews cud [INEDIBLE]
camel, hare, rock-badger
Split hoof but does not chew cud [INEDIBLE]
pig
Animals with paws [INEDIBLE]
Animals that creep or swarm [INEDIBLE]
weasel, mouse, lizard, gecko, crocodile, chameleon
Animals that travel on belly [INEDIBLE]
Animals with many feet [INEDIBLE]
Living in the Water
Animals with ns and scales [EDIBLE]
Animals without ns and scales [INEDIBLE]
Living in the Air
Animals that y
Clean birds [EDIBLE]
Unclean birds [INEDIBLE]
eagle, vultures, osprey, glede, falcon, kite, raven, ostrich,
hawks, sea-mew, owls, cormorant, pelican, heron, hoopoe, bat
Animals that swarm, with wings and jointed legs [EDIBLE]
locust, grasshopper, cricket
Animals that swarm, with four feet [INEDIBLE]

One of the most widely studied classication systems crossculturally is that of kin. We give the same name, aunt, to four very
different relatives, for example: our mothers sister, our fathers sister,
our fathers brothers wife, and our mothers brothers wife. The latter
the ape in you

47

two are not even genetic relatives, and of those, at least the rst shares
our family name. There is no necessary reason to call them all aunt.
The fact that we call such different people the same thing is not
rooted in nature or genetics, but rather in an attempt by our ancestors
to make sense of the complex social relations they had to deal with,
by giving names to classes of people. As a result of the conventions
of categorization and language, we draw a distinction, for example,
between uncles and aunts, but in English we do not draw the
same distinction (by sex) for cousins. In fact, we dont even have a
word by which to designate our cousins spouse.

cl a s s i f i ca ti on a s a cultural act

There is a strong analogy to be made between classifying relatives


and classifying species. In both cases we are taking some aspect of
nature, either the state of kinship or the state of evolutionary populations, and imposing a cultural system of nomenclature upon it. In
the case of our relatives, we rarely question why our uncles spouse
should be a named relative but our cousins spouse should not be, or
why we should call people aunt who stand in such different relationships to us.
But surely the situation is different for classifying species, where
the order is directly derived from nature as a result of evolution.
Actually, though, it isnt. In the social world, there are blood relatives of different degrees, relationships derived from nature, which
our system of kinship amplies but does not perfectly reect. Likewise
with species, where the natural relationships often encode unnatural
information, most notably, as we have seen, paraphyly.
There are many arbitrary decisions that are imposed upon nature
in the act of classifying. At root is a classic problem that exists above
the species level: Are two animals that look somewhat different from
one another to be placed in different genera or in different families?
There is, in fact, no answer given to us by nature. The best answer
nature gives us is just at the species level, where parts of the same
species share in a common reproductive community and parts of
different species do not.

48

the ape in you

In the system of nature invented by Linnaeus, every species of


animal was given a double name (such as Homo sapiens) and a unique
place in a four-tiered, nested hierarchygenus, order, class, and kingdom. Many intervening categories have since been added since Linnaeuss time, and many changes have been made to his system. But
in the most basic ways, his work stands. For example, in the 1758
tenth edition of his Systema naturae, from which modern zoological
classication dates itself, Linnaeus decided that the natural place of
humans was within a class he called Mammalia.
Now, every biology student knows that humans are mammals. It
would seem like a simple fact of nature, quite the opposite of the
cultural situation described earlier. But recent scholarship has shown
that calling humans mammals is in fact a strongly cultural statement. Why did Linnaeus focus on our mammae? (Not, as a student
once told me, because he was a guy!) Why is milk so damn important in the great scheme of things that we should take our very
name on that basis? Couldnt we come up with the same group of
animals using a different criterion, and so why dont we?
For example, Aristotle over two thousand years ago called land
animals Quadrupedia (four-legged) and divided them into those that
lay eggs and those that give birth to live offspring. And four-legged
creatures that give birth to live offspring gives you basically the same
constellation of animals, with a few exceptions, like the duck-billed
platypus.
Mammals actually have a lot of features that distinguish them from
reptiles, amphibians, sh, and birds. Hair, for one thing. And some
scientists in the eighteenth century did call this group Pilosa, or
hairy things. But Linnaeus called us mammals, based on an anatomical feature thats only functional in half of our species, and then only
occasionally.
So why did he do that?
He had already made a reputation by classifying plants according
to their sexual anatomy. This might have been simply a way of bringing animals into that same paradigm. But there is no compelling
reason why animals and plants should necessarily be subject to the
same criteria.

the ape in you

49

It turns out actually to have been a political gesture. As historian


Londa Schiebinger points out in her book Natures Body, in the 1750s
there was a major controversy going on about wet-nursing. The European middle and upper classes at that time mostly sent their babies
off to be breast-fed by poor women in the countryside, rather than
nursing their own babies themselves. Linnaeus was active in the
movement that opposed this practice. In fact, he wrote a book on
the virtues of breast-feeding your own children, asserting that it was
natural for mothers to do so, and therefore wet-nursing was unnatural
and bad. Up to that time, he had been calling mammals simply
Quadrupedia, like Aristotle. Now he called mammals Mammalia,
using his scientic classication to make a point. He was saying that
women are designed to nurse their own children, that it is right, and
that it is what your family should do.
The point of all this is to show that what a biology student takes
for granted as a fact of naturethat we are essentially denable as a
lactating specieswas actually historically produced: it is an eighteenth-century political stand encrypted into biology. The fact is, of
course, that mammals are a natural unit, which can be dened by
nursing, but being natural doesnt make breast-feeding an objective
category, simply out there to be discovered and adopted as a scientic identier.
It is not obviously the case that breast-feeding is the key feature
that makes us mammals, any more than having a single bone in the
lower jaw (which all Mammalia have, and only Mammalia have) is
the key feature that would make us One-bone-in-jaw-malia. Theres
more here than nature.
To classify is to be human: mythical Adams rst task was to classify.
We rarely question the categories within which we work because they
seem so natural to us; we are accustomed to them. But they are
constructions of human minds, the products of social history. That
they seem natural or given or out there is a testimony to their
power over us and the difculty we have dropping them. While it
may seem arcane to worry about the existence of paraphyletic categories, this cultural drama is played out on a larger stage when we
attempt to come to grips with racial categories.

50

the ape in you

Three
how people differ from one another

The most prominent, or at least newsworthy, of our seemingly


natural categories is race. We tend to divide people into a few large
categories: white, yellow, black, red, or the more politically correct
Europeans, Asians, Africans, and Native Americans. And we tend to
perceive facial features that stereotypically follow this division: light
skin, almond eyes, kinky hair, beaked nose. In fact, these categories
do not reect any natural division of the human species and have
principally been the construction of social history.
Teaching that racial categories lack biological validity can be as
much of a challenge as teaching that the earth goes around the sun
must have been in the seventeenth centurywhen anyone can
plainly see the sun rise, traverse a path across the sky, and set beyond
the opposing horizon. How can something that seems so obvious be
denied? Of course, that is the way all great scientic breakthroughs
appear, by denying folk wisdom and replacing it with a more sophisticated and analytic interpretation of the same data.
It is hard to imagine that the order we perceive in nature may not
be natures order at all but our own order superimposed upon it.
Nevertheless, that is one of the great lessons of modern anthropology,

51

demonstrated specically in the history of the classication of peoples


and consistently reinforced by genetic data.

ra ce a s a s ci e n t i f i c organizing p ri ncip le

The ancients knew a rather limited world, but they were certainly
impressed by the ways in which people from different places looked
different from one another. Writing in the fth century b.c., for
example, Herodotus noted that the people of Colchis and Egypt had
dark skin and wooly hair, and that the people of Ethiopia were said
to be the tallest and handsomest in the world. To Herodotus each
land had its own characteristic peoples. But there was no hint of the
existence of any small fundamental number of natural human kinds.
The ensuing centuries saw little change in this unsystematic conception of human differences. Science itself perceived little unity in
the natural world until the seventeenth century, beginning with Galileo and ending with Newton, identied the unifying physical principles governing matter and motion.
This engendered a profound change in the approaches of scholars
to the natural world. Where once they had seen only individual phenomena and interpreted them as evidence of Gods bounty, they now
began to see general principles at work and interpreted them as evidence of Gods parsimony. Chaos would be replaced by order, disarray
by system. To understand the system was to know Gods plan.
Thus it was that a French physician and traveler named Francois
Bernier contributed something novel and original to the study of
human differencesthe idea that humans could be grouped systematically into a relatively small number of classes. Proclaimed Bernier,
there are four or ve species or races of men in particular whose
difference is so remarkable that it may be properly made use of as the
foundation for a new division of the earth.
Berniers rst group encompassed Europe, North Africa, the Near
East, and India. His second was sub-Saharan Africa, characterized by
people with thick lips and at noses, dark skin, scanty beards, and
noteworthy aspects of their hair (which is not properly hair, but
rather a species of wool, which comes near the hairs of some of our

52

how people differ from one another

dogs) and mouth (teeth whiter than the nest ivory . . . their
tongue and all the interior of their mouth and their lips as red as
coral). The third encompassed the Asians, who were truly white;
but they have broad shoulders, a small [at] nose, little pigs-eyes long
and deep-set, and a scanty beard as well. His fourth comprised the
Lapps of Norway, little stunted creatures with thick legs, large shoulders, short neck, and a face elongated immensely . . . , they are
wretched animals, and somewhat bearlike as well. As to the native
Americans, Bernier did not nd the difference sufciently great to
make of them a peculiar species different from ours. And nally,
the blacks of the Cape of Good Hope seem to be of a different
species to those from the rest of Africa. They are small, thin, dry,
ugly, quick in running, passionately fond of carrion which they eat
quite raw, and whose entrails they twine round their arms and neck
. . . ; drinking sea-water . . . , and speaking a language altogether
strange, and almost inimitable by Europeans.
Where formerly there had been diversity of form, Bernier now
found unity. No longer was local variation signicant, rather, there
were just a few basic formsspecies, or races.
Of course, the terms then did not have the same formal denitions
as they do now. Thus, when Bernier calls the Khoisan a different
species, he is not working with the biological denition we now
employ. He means merely a population that looks different (really
different).
Perhaps these differences reected different originsseparate creations, as a later school, known as polygenists, would come to argue.
Not surprisingly, this academic position reached its zenith during the
American Civil War. Or perhaps the races represented the different
offspring of the biblical patriarch Noah. The Bible sort of suggests
this in Genesis 10, giving a list of descendants of Noahs sons, which
are also the names of cities and peoples.
And by the rst century a.d., that had indeed become a widespread
interpretation. Noahs son Ham was the father of the Africans, Shem
was the father of the Asians, and Japheth the father of the Europeans.
The gloss was put on the story in an inuential popular work, Antiquities of the Jews, by Flavius Josephusa renegade from the Judean

how people differ from one another

53

army crushed by Rome in the year a.d. 71. Josephus was concerned
to explain away the Jewish War, in which Gods chosen people were
soundly thrashed, and to recount the ancient history and customs of
his people to their conquerors. Thus, he summarizes the Jewish Bible,
including not simply the literal stories but the general extracanonical
understandings of them as well.
In this account, after Noahs death, God tells his three sons to
send colonies abroad, for the thorough peopling of the earth. But
they disobey and hang together, under the suspicion that they were
therefore ordered to send out separate colonies, that, being divided
asunder, they might the more easily be oppressed. Two generations
later, Hams grandson Nimrod builds the Tower of Babel, which God
not only destroys, but also curses the builders by giving them different
languages. Now, says Josephus, they were dispersed abroad, on account of their languages, and went out by colonies everywhere; and
each colony took possession of that land which they light upon, and
unto which God led them; so that the whole continent was lled
with them, both the inland and the maritime countries.
The geographical details in Josephus are sometimes a bit obscure,
but it is not difcult to see how easy it was to equate Europeans with
Japheth, Asians with Shem, and Africans with Ham. Of course, Josephus and other ancient writers were not familiar with southern
Africa or east Asia, not to mention America or Australia.
But by the seventeenth century, European scholars were not only
aware of the diverse peoples of the most remote regions of the world,
they appreciated that humans everywhere could hybridize freely. (Sailors had proved that, not scientists.) Given, then, that we all constituted a single biological entity, what were that entitys basic components?
Europeans freely speculated on the divisions; thus a tract from 1721
nds
ve sorts of men: the white men, which are Europeans that have
beards; and a sort of white men in America (as I am told) that
only differ from us in having no beards; the third sort are the
Malatoes, which have their skins almost of a copper colour,

54

how people differ from one another

small eyes, and straight black hair; the fourth kind are the Blacks,
which have straight black hair; and the fth are the Blacks of
Guiney, whose hair is curled, like the wool of a sheep. . . .

It is always hard to know why certain things catch on and others


dontwhy we have VHS and not Beta; compact disks and not quadraphonic stereo; Honda Civics and not Ford Edsels; Christianity and
not Mithraism. In this case, it is not hard to see a self-serving harmony
between a neat and simple classication of people and the economic
and political systems emerging in Europe. Focusing ever more keenly
on the exploitation (from economic dependency to displacement,
enslavement, and even genocide) of large numbers of diverse peoples,
the spirit of the times could make this system seem very sensible.
If many different people were all basically the same, it would be
natural to treat them in a common fashion; and so the relations of
European and African could come to subsume those of the specic colonial nations or administrations and the specic indigenous
peoples they abused. The ease with which this classication tted
into the prevailing political and economic climate made it seem almost ordained by natural law.
And what is zoologically natural was codied by Linnaeus.
Writing only a few decades after Bernier, Linnaeus began the classication of animals in his Systema naturae with four kinds of Homo:
white Europeans, red Americans, yellow Asians, and black Africans.
He had not yet developed the formal binomial nomenclature that
would name species in two parts (Homo sapiens for humans, for example). Furthermore, his system does not precisely coincide with
Berniers. For example, the Lapps held a romantic fascination for
Linnaeus as innocent Scandinavian noble savagesbut certainly
not as a formally recognizable entity separated from other Europeans.
Nevertheless, he incorporated Berniers general innovation into the
scientic classication of humans and even color-coded them for your
convenience.
The tenth edition of Linnaeuss Systema naturae (1758) included
such signicant changes as substituting Mammalia for Quadru-

how people differ from one another

55

pedia and Primates for Anthropomorpha, as well as introducing


sapiens as the second half of our own species name. But he did not
deviate from the decision over twenty years earlier on the four geographical human tints.
Once again, though, we are reminded that these ideas are not quite
the same as our own when we see that Linnaeus also introduced a
fth subspecies, not of geographic origin, called Homo sapiens monstrosus. This was a geographical grab bag, including giant Patagonians,
cone-headed Chinese, at-headed Canadians, and one-testicled Hottentots.
Linnaeuss rst four color-coded subspecies, however, are the ones
that became the ofcial, scientically accepted subgroupings of man
(at least until Captain Cooks voyages to Oceania and Polynesia
later in that century). And it is worth examining the structure of
these subgroupings, for they reveal just how unlike the other species of animals Linnaeus treated this one. He is justly remembered
for the radical step of subsuming humans into the natural classication of organisms, but did he treat humans the same way he
treated anteaters?
Actually, Linnaeus rarely uses the concept of the subspecies. He
divides only two other groups of mammals (dogs and sheep) that way.
And his presentation of the human subspecies has a distinct structure
to it: three adjectives corresponding to color and temperament; a brief
description of the appearance; three adjectives describing the personality; a mention of their bodily covering, and a single word encapsulating their legal system (see table).
Linnaeuss training as a physician led him to interpret these differences among the four subspecies in a medical fashion. In particular,
his descriptions of the four temperaments (cholericus, sanguineus, melancholicus, and phlegmaticus; or irascible, vigorous, melancholy, and
sluggish) correspond to the four Hippocratic humors of which the
body was thought to be composed. These were yellow bile or chole,
blood (sanguis), black bile or melancholia, and phlegm.
In this view of health, the body was seen as normally being in a
state of balance among these four substances. Variation of behavior,
or attitude, or personality was interpreted as an overbalance of one

56

how people differ from one another

Linnaeuss Classication of the Species Homo Sapiens


in Systema Naturae (1758)
American

European

Asian

African

Color
Temperament

red
irascible,
impassive

white
vigorous,
muscular

black
sluggish, lazy

Face

thick,
straight,
black hair;
broad nose;
harsh appearance;
chin
beardless
stubborn,
happy, free

long
blond
hair, blue
eyes

yellow
melancholy,
stern
black hair,
dark eyes

Personality

Covered by
Ruled by

ne red
lines
custom

sensitive,
very
smart,
creative
tight
clothing
law

black kinky
hair, silky
skin, short
nose, thick
lips, females
with genital
ap, elongated breasts
sly, slow,
strict,
contemptu- careless
ous,
greedy
loose gargrease
ments
opinion
caprice

or more of the four humors. Each humor was in turn associated with
specic body organs: the gall bladder, heart, spleen, and pituitary.
And of course, with the continentsAmerica, Europe, Asia, and
Africa. What Linnaeus thus seems to have done here is to have encoded the peoples of the earth as the parts of a macrocosm of a
contemporary human body, each subspecies from each continent governed by one of the four humors and organs.
This simply shows that Linnaeus was interpreting human diversity
as well as he could scientically with the conceptual apparatus of his
training in the culture of eighteenth-century Europe. His subspecies
are idealizationsdenining Europeans zoologically as having long

how people differ from one another

57

blond hair and blue eyes, for instance, is an understandable absurdity


coming from a provincial Swedish biologist, but it is hardly realistic.
It reects a decidedly premodern, essentialized view of the world, in
which qualitative distinctions are assigned to each category on the
basis of symbolic distinctions, not real ones.
Essentialism is a mode of thought that we associate in biology with
the Greek philosopher Plato. Platos concern in many of his writings
was what the ideal world would be like, and his writings on nature
tend to eschew empirical reality for a deeper reection on deeper
realities. In his famous Cave Allegory, Plato wants us to look beyond
what we actually see (the shadows on the cave wall) to deduce what
we cannot see, but that which is the ultimate cause of the forms we
perceive. It takes reason, says Plato. While seductive in this form, the
allegory turns out to be a problem for science. It asks us to walk away
from our sensory experience, from data, from reality, and to think
instead about an imaginary hyperreality. The problem is that the core
of science lies in the connections between data and explanations;
explanations are cheap, but good explanations that permit themselves
to be judged on the basis of their t to the real worldthe shadows
we seeare precious.
In Linnaeus, we see the problem at its most glaring. When Linnaeus, for example, denes Europeans as having long blond hair and
blue eyes, he is obviously not describing themhe is idealizing them.
He is describing an imaginary man whose shadows he believes to
constitute the diverse faces and bodies of real Europeans. We shall
see the fallacy of essentialism crop up repeatedly in different biological
studies throughout the centuries, but always bearing the hallmark of
denying the importance of real variation and focusing instead on an
imaginary uniformity.
This would be merely a bit of historical esoterica were it not for
one important point. Linnaeus had indeed discovered a fundamental
truth about life on earth: it comes packaged in nested groups of
increasingly general similarity to one another. Thus, species cluster
into genera, like Linnaeuss Homo sapiens and Homo troglodytes (a
mistake on his part, as noted in chapter 1). Genera cluster into orders:
his Homo and Simia are both Primates. Orders cluster into classes, as

58

how people differ from one another

his Primates and Ferae (or what we would now call Carnivora) do
into Mammalia, and Mammalia and Aves do into the kingdom Animalia. What this represents is of course the patterns of evolutionary
descent, with lower-level categories sharing more recent ancestry with
one anotherat least to a rst approximation.
Linnaeus did not know the explanation for the pattern. All he knew
was that the pattern was there, and it became obvious to the rest of
the scientic community overnight, so that Linnaeuss classication
became the way to do biology. He supervised 186 doctoral theses, an
output so prodigious as to be difcult to believe nowadays (to put
this into context, Sherwood Washburn, arguably the leading American biological anthropologist of the latter half of the twentieth century, told me he supervised about 40 doctoral theses in the course of
a full and distinguished career at Columbia, Chicago, and Berkeley).
Linnaean biology, briey put, became biology. To study nature was
to study it his way, to classify it; to identify or infer the genera within
each family (the family as a classicatory level was introduced by his
successors), the species within each genus, and (at least in the case of
humans), the subspecies within each species.
A contrary view, however, was offered by the comte de Buffon, an
erudite French philosophe, in his widely read Natural History, General
and Specic, also published during the middle of the eighteenth century. Buffon famously rejected the entire Linnaean classicatory system, for an historically curious reason. According to Buffon, these
nested categories directly implied a common ancestry for the species
contained within them, and he knew that could not be true! As he
wrote with extraordinary insight, The naturalists who establish the
families of plants and animals so casually do not seem to have grasped
sufciently the full scope of these consequences, which would reduce
the immediate products of creation to as small a number of individuals as one might wish.
He was absolutely right; they did not fully grasp the consequences
of what they were doing, not until Darwin explained it a century
later. Buffon in any case deantly rejected Linnaeuss classicatory
system, and his work was inuential with the public (although less
so with the academics; Linnaeus was, after all, right).

how people differ from one another

59

In his survey of the varieties of the human species, Buffon consequently takes a very different approach from that of Linnaeus, not
carving the species into subspecies, but simply surveying the diversity
of form and behavior out there. His descriptions are often quaint
and ethnocentric, but they are quite different in structure from those
of Linneaus. Most importantly, however, Buffon recognized a pattern
of variation in the human species quite different from that promoted
by Linnaeus: namely, continuity, the absence of discrete boundaries
between any distinct formal categories of humans. On close examination of the peoples who compose the black races, says Buffon,
we will nd as many varieties as in the white races, and we will nd
all the shades from brown to black, as we have found in the white
races all the shades from brown to white.
The two naturalists hated each other. Although both were ennobled
late in life, Linnaeus had come from far humbler origins and had
known poverty. He was an academic and wrote in scholarly Latin;
Buffon was a wealthy landowner who wrote for the educated masses
in eminently readable French. Linnaeus found Buffons writing uffy
and disorganized; Buffon found Linnaeus philosophically unsophisticated and sterilewhat good was classifying without comprehending? The misunderstanding between these two able Naturalists is
most injurious to science, their English contemporary Thomas Pennant complained. The French Philosopher scarce mentions the
Suede, but to treat him with contempt; Linnaeus in return, never
deigns even to quote M. de Buffon, notwithstanding he must know
what ample lights he might have drawn from him. Linnaeus eventually acknowledged Buffon by naming a foul-smelling plant after
him.
A curiously relevant paradox arises in the general conict between
these two savants of the Enlightenment era. Linnaeus formalizes the
divisions among humans, but does not call them racesthey are,
for him, varieties or subspecies. Buffon, on the other hand, denies
the value of classication, denies there exist formal subspecies of humans, yet talks at length about racesin a very loose and colloquial
manner, akin to stocks. The next generation of scholars would take

60

how people differ from one another

Linnaeuss approach and apply Buffons termconverting the formal


subspecies of humans into races.
Whether you called them races or subspecies, the goal was the
same: to study humans scientically, you had to classify them. To
classify them was to transcend the shadows on the cave wall, and infer
the basic plan of nature, at least insofar as the diversity of the human
species was concerned. And thus it was that at the end of the eighteenth century, Johann Friedrich Blumenbach could write that one
variety of mankind does so sensibly pass into the other, that you
cannot mark out the limits between them, and then nevertheless
proceed to attempt just that. Donning the mantle of Linnaeus, Blumenbach jettisoned the nonbiological criteria Linnaeus had employed
and identied ve races: Mongolian, Ethiopian, Malay, American,
and, his most famous coinage, Caucasian.

phy s i ca l a n t h ropol og y a s linnaean scie nce

Physical anthropology became the scientic study of racial differencesassuming, of course, that there were indeed races, and that
they were formally different. To deny this was, however, to undermine
the raison detre of the eld, especially as it developed in American
academia in the early twentieth century under the inuence of the
organizational skills of a Bohemian physician-cum-anthropologist
named Ales Hrdlicka, and the pedagogical skills of a classicist-cumanthropologist from Wisconsin named Earnest Hooton. In laying
claim to the scientic study of race as their turf, Hrdlicka (at the
Smithsonian) and Hooton (at Harvard) became the authorities on
what was and wasnt really a race.
The two men could hardly have been more different. Hrdlicka, a
haughty Central European immigrant, had had a classical medical
training and studied with the French physical anthropologist Leonce
Manouvrier before settling at the Smithsonian and becoming the
expert on the origins of Native Americans. The good-natured Hooton, who came from old Anglo-Saxon stock, breezed into physical
anthropology while on a Rhodes Scholarship at Oxford. Appointed

how people differ from one another

61

to the Harvard faculty in 1913, he established himself as a glib lecturer


and witty writer, most especially on the nature of human differences.
With titles like Apes, Men, and Morons; Mans Poor Relations; and
Young Man, You Are Normal, his books were widely read, and his
opinions were regarded as authoritative. For nearly half a century,
virtually anyone who wished to study physical anthropology in the
United States came under his tutelage.
Hootons domain was race.
And what was race? Race was formally a vague physical background, usually more or less obscured or overlaid by single subjects
and realized best in a composite picture. Hardly the stuff of a precise
mature science. And yet Hooton would also write sarcastically of
those anthropologically illiterate ethnomaniacs who spoke casually
of a Jewish race, a Latin race, or an Irish race. The proper usage,
argued Hooton, should distinguish only each great division of mankind on the basis of their physical uniformities. But there was still
room for pure and isolated primary races and admixed secondary
races.
The ambiguity existed largely because there were still two different
senses of the word race concurrently in use. The rst, the colloquial
use of the word that Buffon had adopted, meant pretty much any
group of people with their own name. That, of course, couldnt be
scientic. The second was Linnaeuss formalized subspecies, the scientic sense of the word race, even if Linnaeus himself didnt use
it. Using both together produced the absurdity of those races within
races, some of which had more pronounced biological distinctions
and others of which did not. Neither was it clear whether individual
people constituted a race, or whether race was something that existed
within an individual. Racial identication, argued Hooton, was like
a physician diagnosing a disease; one needed to examine the symptoms before making a judgment, because a subject could look white
and really be black, or vice versathus, races were in people; people
werent in races.
The situation was so confused that, as the British polymath Lancelot Hogben would write: [G]eneticists believe that anthropologists
have decided what a race is. Ethnologists assume that their classica-

62

how people differ from one another

tions embody principles which genetic science has proven to be correct. Politicians believe that their prejudices have the sanction of genetic laws and the ndings of physical anthropology to sustain them.
Enter genetics.
The earliest genetic analysis of the human species was based on the
ABO blood group, discovered just after 1900 and surveyed during
World War I. Somehow it managed to divide the peoples of the world
into European, Intermediate, and Asio-African; or, essentially,
white and other. The curious fact is that if you look at any contemporary textbook today, you will discover that the ABO blood
group is now invoked as a demonstration of precisely the opposite
pointthat there are no discrete divisions of our species possible on
this basis.
How could the same genetic data have yielded a division of the human species into distinct genetic races at one point in time and demonstrate that there are no such distinct races at another point in time?
Obviously, the answer lies with what the geneticists expected to nd
at different times. When they expected to nd discrete divisions, their
data yielded them; and when they expected not to nd discrete divisions, their data did not yield them.
Race, it seems, is underdetermined by genetic data.
A more sophisticated analysis of the ABO blood group in 1926 divided the world into seven blood-group racial types on the basis of
their proportions of each of the ABO variants: European, Intermediate, Hunan, Indo-Manchurian, Africo-Malaysian, Pacic-American,
and Australian. The problem was that the classication was exceedingly unnatural. Since the Poles and the Chinese had the same frequencies of the blood-group genes, they were classied together as belonging to the Hunan type; but if there were anything at all to the
concept of race, the people of Poland and the people of China more
or less had to be in different ones. Likewise, the diverse peoples of
Senegal, Vietnam, and New Guinea ended up together as AfricoMalaysian.
Earnest Hooton at Harvard was dismayed. On the one hand, this
was authoritative genetic work. On the other hand, it produced
meaningless clusters of people, basically scientic gibberish. Once

how people differ from one another

63

again, the geneticists had impressive batteries of data but interpreted


the data within a fairly nave and narrow framework, bolstered by the
cachet of science.
For example, the blood-group work didnt end with just the classication of races. It also conjured up a biological history for those
races. Finding that all populations of the world have mostly type O
blood, and that Native Americans are almost exclusively type O, the
geneticists reasoned that the Native Americans must represent the
most primitive branch of humanity, diverging from the human stock
before any other populationin spite of the fact that they appeared
to resemble North Asians very strongly, suggesting a very recent common ancestry with them. And as for the rest of the world, the originally pure O race that settled in Europe must have been invaded by
the A race from the north, and the B race from the south, resulting in
the diverse populations that now exist.
The idea that the human species might be primordially polymorphic, and might have possessed all three variations from its very beginning, was hardly entertainedin spite of the fact that A, B, and O
were known to exist in the genes of the apes as well. In an era that valorized purity of race, the idea was incorporated whole-hog into geneticists scenarios with little critical thought.
Obviously, the geneticists were simply reading their expectations of
discrete divisions of the human species into their data. Quite possibly
the most bizarre of these studies was performed in the Soviet Union
by a hematologist named E. O. Manoilov. If he added a few simple
chemicals to a small sample of blood (a powerful metaphor, of course,
for heredity) under controlled conditions, Manoilov reported, the
blood changed color. Initially, he found that he could discriminate
male from female bloodand it even worked for plants, in spite of
the difculties imposed in extracting blood from them. Slightly later,
he could distinguish the bloods of different races, notably Poles, Koreans, Russians, and Jews. And as if that were not enough, the blood
test could even distinguish the blood of heterosexuals from that of homosexuals.
Certainly, no scientist would have welcomed a blood test for distinguishing race more than Hooton, but he appreciated that sociopolit-

64

how people differ from one another

ical categories such as Jew, Russian, and Pole were the constructions of human history and simply couldnt be distinguishable by the
properties of blood. He dismissed the Manoilov blood test in a single
sentence in his 1931 text Up from the Ape, and the test disappeared
from the anthropological literature.
It had a different fate in the genetics literature, however. Thomas
Hunt Morgan had a Russian visitor to his laboratory at Columbia
translate Manoilovs work and look into it. Charles Davenport, the
leading human geneticist in America, put some of his junior colleagues on the sex determination test, and they published preliminary results in major journals. Davenport also enlisted a biochemist
named K. George Falk to study the Manoilov blood test, and after
some encouraging preliminary results, Falk found to his surprise that
the blood test also worked on urine. He couldnt explain it, and they
abandoned the Manoilov blood test shortly thereafter.
To this day we dont know what the Manoilov blood test, which
mysteriously required no blood, was actually testing. But even as it
was disappearing from the anthropology literature, it was being uncritically cited in mainstream genetics textbooks. Said one major 1931
college textbook, According to Manoiloff, the oxidizing process in a
certain blood reaction occurs more quickly in Jewish blood than in
Russian blood; tests of race based on this difference proved correct in
91.7% of cases.
Technology, blood, and percentagesall sounding very much like
science is supposed to. And presented for the consumption of genetics
students without so much as a skeptical glance at the test itself. This
only goes to show, however, how easy it is to nd what youre looking
for. Where the researchers expected to nd essentialized differences
marked in the blood of different peoples, they easily found them.
All of which returns us to the question of whats really out there
when we examine the human species biologically.
And the answer was known two centuries ago to Buffon and Blumenbach.
Whether we examine peoples bodies or sample their genes, the pattern that we encounter is very concordant. People are similar to those
geographically nearby and different from those far away. Dividing hu-

how people differ from one another

65

man populations into a small number of discrete groups results in associations of populations and divisions between populations that are
arbitrary, not natural. Africa, for example, is home to tall, thin people
in Kenya (Nilotic), short people in central Africa (Pygmies), and
peoples in southern Africa who are sufciently different from our
physical stereotypes of Africans (i.e., West Africans) as to have caused
an earlier generation to speculate on whether they had some southeast
Asian ancestry. As far as we know, all are biologically different, all are
indigenously African, and establishing a single category (African/
black/Negroid) to encompass them all reects an arbitrary decision
about human diversity, one that is not at all dictated by nature.
Furthermore, grouping the peoples of Africa together as a single entity and dividing them from the peoples of Europe and the Near East
(European/white/Caucasoid) imposes an exceedingly unnatural distinction at the boundary between the two groups. In fact, the African peoples of Somalia are far more similar to the peoples of, say,
Saudi Arabia or Iranwhich are relatively closer to Somaliathan
they are to the Ghanaians on the western side of Africa. And the Iranis
and Saudis are themselves more similar to the Somalis than to Norwegians. Thus associating the Ghanaians and Somalis on the one
hand (as Negroids), and Saudis and Norwegians on the other (as
Caucasoids), generates an articial pattern that is contradicted by
empirical studies of human biology.
Immigrants to America have come mostly from ports where seafaring vessels in earlier centuries could pick them uphence our notion
of African is actually West African; and our notion of Asian is actually East Asian. When we realize that people originating from very different parts of the world are likely to look very different, and combine
that with the fact that most European immigrants came from northcentral Europe, it is not hard to see why we might perceive three types
of people. If there were a larger immigrant presence in America representing the rest of the worldwestern Asia, Oceania, eastern or
southern Africa, the Arcticwe would be more struck by our inability to classify them easily as representatives of three groups. Perhaps
the most obvious example would be South Asians from India and

66

how people differ from one another

Pakistan who are darkly complected like Africans, facially resemble


Europeans, and live on the continent of Asia!
One occasionally still hears the suggestion that West Africans represent the purest strains of blacks; East Asians the purest strains of yellows; and northern Europeans the purest strains of whites. The people
in between would then be hybrids of varying proportions of the original pure strains. But this is actually a pre-Darwinian gloss on the human species. What biohistorical model underlies this suggestion? The
answer is simple: its the familiar biblical story of Noah, the midnineteenth-century version of which had Ham emigrating to West Africa, Shem to East Asia, and Japheth to northern Europe, where their
descendants were fruitful, multiplied, and commingled at their
boundaries.
But this is contrary to both modern data and theory. In the rst
place, we know why human populations look different from one anotherthey have adapted to diverse climates and have been subjected
to vagaries of the history of their gene pools. And we also know why
they look similar to their neighborswherever populations coexist,
what Cole Porter called the urge to merge has invariably expressed
itself. Even Neandertals had trade networks; and where goods ow, so
do genes (one can imagine traveling salesmen jokes even in the Pleistocene). So the pattern of general geographic continuity we encounter
among human populations makes a good deal of sense.
And in the second place, there does not seem ever to have been a
time when people lived only in the most remote corners of the world,
say Nigeria, Norway, and Korea. People seem to have been living in
the in-between places for as long as there have been people.
What the pure race model does is to confuse the most extreme
peoples with the purest or most primordial. The people of Lagos,
Oslo, and Seoul look the most different from one another not because
they are the most untainted descendants of the original, physically
divergent founders of the species but because they live the farthest
away from one another and have consequently adapted to the most
different environments, while maintaining the least amount of genetic contact.

how people differ from one another

67

Which takes us away from the question of fundamental divisions


of the human species, and toward that of describing the diverse adaptations of human populations, as Buffon attempted to do in the
mid eighteenth century, while resisting the general classicatory innovations of Linnaeus. In anthropology, this conceptual revolution
occurred in the years directly following World War II, as the cultural
basis of classication generally became more broadly appreciated, and
as the destructive results of accepting such classications as naturally
based became more apparent.
Dividing and classifying are cultural acts and represent the imposition of arbitrary decisions upon natural patternsespecially in the
erection of boundaries within a species where none exists in nature.
This is most evident in the legalities of dening races, so that intermarriage between them could be prohibitedthe miscegenation laws.
Miscegenation is a term coined in a satirical pamphlet during the
Civil War to mean racial amalgamation, but intended to sound
worse. As late as the 1950s, nineteen U.S. states had laws forbidding
it on their books. All nineteen forbade black-white marriages, but
many of them specied other races as wellfor example, West Indian, Mongolian, Japanese, or Chinese in Georgia; Malay in
Maryland; and Indian in Virginia and South Carolina. From a
practical standpoint, in order to forbid a marriage, you had to dene
the criteria of inclusion in the excluded groups. Indiana thus prohibited marriages between a white and any person possessed of oneeighth or more of negro blood (Stat. 44-104).
Thus, a single black great-grandparent was sufcient to establish a
person as black, while seven white great grandparents were insufcient to establish one as white. Some states, such as Florida
(Const. Art. XVI, 24; Stat. 741.11), took it back another generation;
while Georgia (Code 53-106; ch. 53.3) demanded no trace of [nonwhite] blood in their veins.
Look carefully. Youll realize that race is being inherited according
to a symbolic or folk system of heredity, in contrast to biological
inheritance. Thus, racial heredity is qualitative, all-or-nothingany
amount is as good as any other; while biological heredity is quantitative and fractional.

68

how people differ from one another

This naturally leads to confusion. One can read an article about


the legal scholar Lani Guinier, for example, and learn in one place
that she is black and in another place that she is half-black. How
can somebody be both black and half-black at the same time? Algebraically that would seem to describe the equation x 12 x, to which
the only solution is x 0. Of course, the confusion stems from the
fact that, as the product of a mixed marriage, she is half-black
biologically, and black socially. Half of the biological contribution is
ignored in the construction of a social identity. The biological and
social realities contradict each other, and the social reality, based on
a folk model of heredity, dominates.
This distinction between ctive or folk ideas about heredity, and
scientic or biological patterns of heredity, is crucial. On the one
hand, we want to nd out what is really out there; and on the other
hand, we impose order upon what is out there by carving it up culturally and imagine that these divisions accurately describe it.
Race turns out to be an optical illusion. Its not the pattern of
human differences we encounter empirically. Humans vary principally locally, not continentally.

ch i m pa n z e e a s a raci al i nsult

Recognizing, however, that humans do not come naturally packaged


in continental groups, color-coded for your convenience, does not
preclude prejudice or discrimination. Historical prejudice in America
against Jews and the Irish, and contemporary biases against Latinos,
women, homosexuals, and many other classes of people in different
places and times, show this point clearly. Prejudice is independent of
biology or genetics.
The chimpanzee plays a classic and tragic role in the drama of
human hatreds, for it is a creature similar to us, yet an animal; a beast,
even if a clever one. Likening people to chimps is therefore a convenient symbolic means of denying their humanity. In the old metaphor of the great chain of being, chimpanzees are something less
than human. By likening the Africans or the Irish to chimps, as both
were sometimes caricatured (the Victorian novelist Charles Kingsley,

how people differ from one another

69

for example, wrote explicitly to his wife of the white chimpanzees


in Ireland), you deny their essential humanity, and thereby their
worth as humans.
More subtly, though, there are properties culturally assigned to the
apesoften themselves slandersthat also serve to degrade humans.
The most popular cultural stereotypes of the apes, for example, involve their stupidity and licentiousnessstereotypes that were, of
course, also applied readily to immigrant, impoverished, or otherwise
excluded groups of people.
Thus, Buffon in the mid eighteenth century emphasizes the unity
of the human species (in contrast to Linnaeuss subspecic classications), but remarks casually on the forced or voluntary matings of
Negresses and apes. The apes, after all, were thought to be lustful
for human females; and maybe the African women they snagged were
reciprocally lustful for ape males as well.
It doesnt necessarily have to be chimpanzees, of course, although
they are the most convenient, being the most nearly human of the
nonhumans. Consequently, when Frederick Goodwin, then the director of the Alcohol, Drug Abuse, and Mental Health Administration, observed in 1989 that high levels of lethal violence in urban
slums literally suggested life in the jungle to him, although he was
invoking rhesus monkeys as his dehumanizing species of choice,
everyone knew what he meant.
No one, however, quite knew what to make of a 1996 book on apes
and the origins of human violence that prominently featured a gorilla and a black man on the cover. Co-authored by a Harvard professor with ostensibly liberal political sensibilities, the book had simply
used a classic old illustration for its cover art. The picture in question
had been drawn by Adolph Schultz, a Swiss anatomist at Johns Hopkins, who was arguably the leading primate anatomist of his day.
Schultz was also a gifted artist and illustrated his scientic papers with
magnicent ink drawings. In 1933, Schultz published a gure illustrating the relative body proportions of a chimpanzee, a gorilla, an
orangutan, and a human being in the German journal Anthropologischer Anzeiger. The subjects are depicted with their bodies shaved,
and even with the skeletons partly showing through their skin (g. 6).

70

how people differ from one another

Figure 6. Drawing by the Swiss anatomist Adolph Schultz illustrating the relative
body proportions of a gorilla and a man. From A. H. Schultz, Die Korperproportionen der erwachsenen catarrhinen Primaten, mit spezieller Berucksichtigung
der Menschenaffen, Anthropologischer Anzeiger 10 (1933): 15485.

The illustration was widely reprinted, but there was one problem.
Schultzs human subject was an excellent representation of a corpse
he had dissected, which he identied as adult Negro. It was simply
a depiction of the human specimen he had most readily available,
but of course it fed into a number of archaic ideologies, within which
the highest ape would be contrasted with the lowest human. An
indignant article in the American Anthropologist in 1965 observed that
Schultzs drawings commonly compared blacks with apes, suggesting
(sometimes explicitly) that whites were less apelike, and called the
practice mischievous and incendiary. Thus, when reprinted by anthropologists, the illustration has often been altered to show the four
subjects merely in silhouette.
Consequently, it was a bit jarring to see the original gure not only
on the cover of a 1996 book but specically cropped to emphasize
the comparison between the gorilla and the black man.
The Origins of Human Violence, it said.
What could the publishers have been thinking?

how people differ from one another

71

Four
the meaning of human variation

Peoples of the world differ from one another, and to understand


the nature of those differences we are obliged to compare them. The
social issues involved in such comparisons, however, necessitate considerably more introspection than would be taken for granted by a
scientist accustomed to comparing spiders or earthworms.
Skin, hair, face, and body form all vary across the worlds populations. In humans, these biological differences are complemented and
exaggerated by differences in language, behavior, dress, and the other
components of the cumulative historical stream we call culture. The
skeletal differences among the worlds most different peoples are actually quite subtle, however, so that although trained forensic anthropologists can allocate modern remains into a small number of
categories given to them, it is much harder to sort prehistoric remains,
and almost impossible to sort skeletons accurately from places other
than West Africa, East Asia, and northern Europe. If you put human
bones from the Middle East, North Africa, and New Guinea together
in a pile, they would be almost impossible to sort accurately, and it
would actually be impossible to tell even how many geographic
regions were represented. Why? Because you would no longer be
distinguishing among discrete and familiar populations; rather, you

72

would now be obliged to distinguish among connected and unfamiliar populations.


The recognition that indigenous peoples of the world were not
naturally packaged into discrete groups was slow to come. It was
comparable to the replacement of the more intuitively obvious earthcentered solar system by the sun-centered system. It was a veritable
revolution in the way we interpret the world and the way we see
ourselves in relation to others.
In anthropology, this conceptual revolution was catalyzed during
the years directly after World War II by the anthropologist and author
Ashley Montagu, whose articulate liberal humanism struck a responsive chord with both professional and popular audiences; and by Sherwood Washburn, a former pupil of Earnest Hootons, who forswore
the static research program of the previous generations and articulated
a view of a new physical anthropologyone that would emphasize
adaptation and population, not race and classication.
In his mid-nineties, Ashley Montagu was still an imposing gure
(he died in late 1999), combining the physical grace of a former boxer
and the striking prole of an English aristocrat. But the gene pool of
the English aristocracy had nothing to do with it. Born in turn-of
the-century London, he adopted the name Montague Francis Ashley
Montagu to gain entree into circles that would not welcome a person
named Israel Ehrenberg. As a youth, he read voraciously and entered
anthropology during its heyday at the London School of Economics,
under the charismatic professor Bronislaw Malinowski. He augmented this training in cultural anthropology with an apprenticeship
to the leading anatomist in England, Sir Arthur Keith. After emigrating to New York in the 1920s, Montagu entered the circle of the
equally charismatic anthropologist Franz Boas at Columbia.
In 1941, Montagu launched the rst in what would become more
than a half-century of attacks upon the formal scientic classication
of humans in physical anthropology. This naturally brought him into
conict with the powerful Harvard professor Earnest Hooton, who
had established that very problem as the raison detre of the entire
eld. In the 1950s, Montagu left academia as a full-time livelihood
actually driven from it by right-wing zealots of the McCarthy years

the meaning of human variation

73

to devote himself to popular writing and lecturing, and became one


of the best-known public intellectuals in America, second only to
Margaret Mead as a publicly known anthropologist. He could be
seen, for example, debating the psychologist Richard Herrnstein on
The Phil Donahue Show on the subject of the genetic determination
of intelligence and behavior a full quarter-century before The Bell
Curve.
Other than their shared interests, Montagu had almost nothing in
common with Sherwood Washburn. The two were never particularly
close friends. Standing a foot and a half shorter than Montagu, Washburn led a classically academic life (he also died in 1999, at the age
of 88). He was from old New England stock, the son of a minister,
Harvard-educated. Aside from a few articles for Scientic American
over the span of a few decades, he disdained both popular writing
and book-length expositions; Washburns milieu was the research paper and the inskirts of academiapresidencies of learned societies,
editorships of academic journals, and a host of supervised doctoral
theses. He preferred the term biological anthropology to his mentor
Hootons physical anthropology, in order to emphasize the dynamic, evolutionary component of the eld. Washburns alienation
from Hootons ideas began in graduate school with his growing interest in the anatomical adaptations of primates, and he began to look
at humans through the same lens.
Washburns rst faculty post was at the Columbia University Medical School, where he taught anatomy. Columbia had been the academic center of Franz Boass anthropological school, and that of his
inheritors, Ruth Benedict and Margaret Mead. And it was in New
York that Washburn and Montagu independently befriended the brilliant population geneticist Theodosius Dobzhansky, a Russian emigre
whose 1937 book, Genetics and the Origin of Species, had revolutionized the eld. Washburn recalled that at his rst meeting with
Doby, the geneticist half-scowled at him, saying: So, you studied
under Hooton? I dont understand the way he divides people into
racial types. Explain it. To which the young assistant professor replied: I cant. I think theres only populations, not racial types. At

74

the meaning of human variation

which point the geneticist circled around to the front of his desk,
grabbed Washburns hand, and shook it vigorously.
Washburn and Dobzhansky organized a major convocation of geneticists and anthropologists in 1950 to discuss the integration of the
two elds. Of the eighteen anthropologists who spoke, eleven had
studied under Earnest Hooton at Harvard. Montagu was one of the
other seven. The meetings theme was the shift away from studying
nebulous abstract races and toward the analysis of real populations
and their adaptations and differences; and the goal was reiterated time
and again. Hooton himself was in attendance, and Washburn recalled
his old professor taking him aside during the conference and telling
him, Sherry, I hope I never hear the word population again!
The professional outputs of Washburn and Montagu suddenly
dovetailed in 1962, however. Postwar anthropology had not fully
come to grips with prewar anthropology, because Nazi racial anthropology was actually not that different from American racial anthropology. Hooton had consistently ridiculed the German anthropologists work, but many of the differences were actually subtle, and the
criticisms directed at the German scientists could hardly be evaded
by American scientists, including Hooton himself. Hooton, after all,
freely speculated that the technologically backward cultures of Africa
were what comes of inferior brains, and inferior brains were the natural products of inferior genes. Wasnt that pretty much what the
Germans thought too?
By the early 1960s, however, Nazi racial anthropology had been
appropriately demonized; American racial anthropology was nally
disintegrating; and the civil rights movement was crystallizing. But
the changes did not come without a struggle.

on th e ori g i n o f races

Carleton Stevens Coon was a New England Yankee and had been
one of Hootons rst students. A great bear of a man, he recounted
his exploits in the eld with bravado and could drink hard and cuss
with the most macho in any party. Coon taught at Harvard and Penn

the meaning of human variation

75

and was recognized for his research and publications by his election
as president of the American Association of Physical Anthropologists
in 1961. At the time, he was writing his magnum opus, tentatively
titled On the Origin of Races, to invoke Darwin.
The book was published the following year, having dropped the
rst word of the title. The Origin of Races was both engaging and
authoritative. It was also provocative, in a time and place struggling
to slough off the premodern science that had kept the nation divided
and much of it oppressed. Coon presented four major theses in the
book: (1) that the human species was divisible into ve races, or
subspeciesCaucasoids, Negroids, Mongoloids, Australoids, and
Capoids (southern Africans, from the Cape of Good Hope); (2) that
these ve races were recognizable in the Pleistocene fossil record and
had evolved largely independently of one another for the past halfmillion years; (3) that they had evolved into Homo sapiens in a specic
sequencenamely, Caucasoids, then Mongoloids, then Negroids,
and last, Capoids and Australoids; and (4) that the length of time a
subspecies has been in the sapiens state was the cause of the levels
of civilization attained by some of its populations.
In other words, Coon sought to explain civilization as a product of
nature, not as a product of human agency. And, more important, he
sought to explain political and economic dominance in the same way.
This of course revisited the most odious of archaic racist ideologies,
implying that slavery and oppression were good and necessary, because the enslaved and oppressed were constitutionally inferior to the
enslavers and oppressors.
By 1962, however, pretty much all anthropologists recognized that
levels of civilization were the results of social history, not of biological endowments. Anybody could have built the pyramids, but the
Egyptians did. And so did the Mayans. And so did other peoples.
But how could you hold the history of all the peoples who did not
build the pyramids against them? Peoples have their own histories,
and its nobodys fault that Indonesia didnt ght in the Punic Wars,
or that Eskimos didnt invent refrigerators. You cant really hold the
fact that they didnt have someone elses history against them. Coons
division of the human species was coupled with a scientic scenario

76

the meaning of human variation

for the biological origin of the species, which in turn formed the basis
of a theory that purported to explain the social, political, and economic subjugation of the dark-skinned indigenous peoples of the
earth by recourse to their biological natures.
And the message was not lost on political activists of the era, in
particular the opponents of civil rights and supporters of segregation.
As one segregationist propagandist, a sometime airline president and
historian named Carleton Putnam, would argue, based on the work
of his cousin, Professor Coon: How can you put black and white
children together, when the latest scientic research shows that blacks
are 200,000 years of evolution behind whites?
Coons book was reviewed everywhere, from the New York Times
to the Harvard Crimson (by an undergraduate pre-med anthropology
major and aspiring novelist who signed his review J. Michael Crichton). It was discussed on television and radio, in editorials and in
barber shops. It was physical anthropology, the science of human
classication, made relevant to the social issues of the day.
Ashley Montagu and Sherwood Washburn thus ended up on the
same side, working to purge anthropology once and for all of the
classicatory fallacy that had blinded it since the time of Linnaeus.
Montagu attacked the book in professional and public forums; Washburn used his bully pulpit as president of the American Anthropological Association to denounce the old, essentialized studies of human variation represented by The Origin of Races. And although
Washburn made only a single oblique reference to Coons book,
everyone knew what he was talking about (indeed, as a graduate
student at Harvard in the 1930s, he had once been assigned as a
teaching assistant to Coons course). Coon died in 1979, an embittered and largely forgotten gure, done in, he supposed, by the forces
of political correctness, and more darkly (he allowed in personal correspondence) by a conspiracy of communists and Jews as well.
In fact, Carleton Coon was a tragic anachronism, a throwback to
an era and literature whose claims to science and scholarship had long
been exposed as pretenses. There is always a purpose for comparing
peoplesif you nd their feet to be bigger, it explains why they run
faster or slower, depending upon whether you are intrigued by how

the meaning of human variation

77

fast or slow they run. If their heads differ, that explains why they are
smarter or dumber; if their eyes differ, that is why they see more or
less distinctly.
Can we contrast different populations of the world? Of course. But
thats not the important question. The important question is the one
that lurks underneath: Why do we want to contrast different populations? Science begins with the framing of an issue, a reason to collect
and examine data. Without that frame, without a reason to collect
data, data are meaningless and the endeavor begins and ends as futile
pseudoscience.
Populations differ in many ways. In fact, if you compare two groups
of people, any two groups of peoplepainters versus chemists, Yale
freshmen versus UCLA freshmen, the New York Yankees and the
Boston Red Soxyou are very likely to nd some differences between them. What makes this endeavor scholarly or scienticwhat
transforms it from information into knowledgeis the interpretation
you give to the results, how you impart meaning to the data. And
this is determined by the question you have in mind when you actually do the comparison.
Consider a classic comparison, brain size, across the classic three
racesblack, yellow, and whiteas was carried out in the mid nineteenth century by a premodern physical anthropologist, Samuel
George Morton. Assuming there are such discrete groups, and that
one can make do with samples from anywhere as representative of
those groups, Morton amassed an unparalleled collection of skulls
from around the world, stuffed them with mustard seed or lead shot,
and measured how much each skull could hold. On average, his ftytwo Caucasian skulls held 87 cubic inches of stufng, or about 1426
cubic centimeters; his ten Mongolian skulls, 83 cubic inches, or
1360 cc; and his twenty-nine Ethiopian skulls, 78 cubic inches, or
1278 cc.
What hypothesis guided Morton? Why did he bother to do this?
To see whetherto show thathis intuitive ranking of the intelligence of the races could be also read from their physical properties.
And indeed it couldwhites were bigger-headed (and smarter); and
blacks smaller-headed (and dumber). But what twenty-nine skulls

78

the meaning of human variation

could adequately have represented the diverse peoples of Africa,


whom he called Ethiopians? Were they actually from Ethiopia, or
were they American slaves? (Black Americans have hardly any ancestry
from Ethiopia, which is in East Africa.) Were the samples all taken
from people the same size? Smaller people tend to have smaller heads,
after all. Were the samples all taken from people of roughly the same
age? Were they taken from people of the same class? Better-nourished
people tend to have bigger bodies and heads.
The point is that the study was being undertaken for a reason.
Morton chose to measure a certain variable in a sample of people
clustered a certain way, and he used the results to demonstrate a
certain point. If the point had not been supported, nobody would
ever have heard about it. This is not necessarily to suggest any wrongdoing, as Stephen Jay Gould does strongly in his classic The Mismeasure of Man, but simply to observe that it is easy to collect data
that support your position. And once that position is supported, it is
easy not to look too hard for other explanations.
Some 150 years after Morton, Canadian psychologist J. Philippe
Rushton again compares crania sorted by race in order to show that
brain size is a predictor of intelligence. And what does he nd? In
an era in which Asians excel academically, their brains are now bigger
than European or African brains! Unsurprisingly, Rushtons interpretations are not the obvious onesthat brain size seems to track the
measurers expectations; or that peoples brains mysteriously seem to
expand in size as they attain higher educational levelsbut rather
simply, again, that blacks are inherently dumb.
So these comparisons are far from benign. Comparisons are made
to prove a point. And in a racially xated society, the purpose the
physical comparisons are used for is generally going to be unattering
to somebody.
Certainly, the apparent malleability in brain size over the past century, with Asians craniometrically leapfrogging over Europeans, directly implies that (1) Africans could leapfrog over both; and (2) these
physical measurements are too crude to be biologically, anthropologically, or socially meaningful. We will return to the brain in the next
chapter; for present purposes, we may simply note a survey by Colin

the meaning of human variation

79

Groves, an anthropologist at the Australian National University. Recognizing that human biological variation is local, not continental,
Groves looked at skulls that wayand he found exceedingly large
brains among some aboriginal populations of Hawaii, Mongolia,
France, South Africa, and Tierra del Fuego; middling brains among
some aboriginal inhabitants of Korea, Norway, Hawaii, and East Africa; and small brains among some populations of Sicily, Peru, India,
and West Africa. Indeed, skulls do vary, and they do so like everything
elselocally. The causes of such variation are complex, but there
seems no obvious justication for grouping them into a racial average. If this tells us anything at all about the relative brains of the
races, it must be information of an exceedingly occult nature, except
perhaps to someone with an invidious motive.
And that is the problem with comparative racial studies. It is easy
to get misinformation, or poor interpretation of data, into the record,
and hard to get it back out again. Racial comparisons are invariably
shot through with culturally loaded assumptions, and once populations become the level of analysis, the racial generalizations quickly
break down.
Consider another classic issue of racial comparisons: are blacks better athletes than whites? We will explore other aspects of this loaded
question later, but here is one way in which it has been approached
scientically. A group of Scandinavian marathon runners was compared to a group of Kenyan marathon runners and surveyed for enzyme concentrations and other biochemical minutiae.
Differences were found.
Of course differences were found. But are they racial differences?
Are they populational differences? Are the differences due to the divergent life histories of the Kenyans and the Swedes? And do these
differences have anything at all to do with black-white differences in
American athletics, given that American whites generally do not have
ancestry from Scandinavia and American blacks generally do not have
ancestry from East Africa? To give racial signicance to the result
involves rooting it in the symbolic representation of Swedish runners
as whites and Kenyan runners as blacks. It has little to do with
the empirical nature of the results.

80

the meaning of human variation

And the same situation obtains with genetic data.


One of Americas leading population geneticists is Richard Lewontin of Harvard, a former student of Dobzhanskys at Columbia.
In 1972, Lewontin took the genetic data that had by then been assembled on the diverse populations of the world and subjected
them to a new statistical analysis. What he wanted to know was:
Just how much of the detectable genetic variation in our species is
to be found in the categories of race? In other words, if you analyze
our species as (1) individuals versus individuals within a population;
(2) populations versus populations within a race; and (3) races
versus races; what proportion of our diversity is encompassed by
the third category?
Lewontins conclusion went against the popular ideology of race,
and for that reason was of the utmost signicance. And yet it makes
perfect sense. The very rst genetic system studied, the ABO blood
group, was thought to reveal races, because the scientists believed that
races were genetically signicant divisions, and this was genetic data.
But it reveals no such divisions. It reveals two things: rst, as we have
seen, people intergrade into their neighbors; and second, all populations have nearly all the variation. In other words, except for very
rare local mutants and their relatives, a person with a given genetic
variant might come from anywhere. Someone with type A blood
could be from Africa, Asia, or Europe. So could someone with type
B blood. Or someone with type O. Or type AB. The only thing that
varies is the probability: the B gene is more common in Asia, so
someone with type B or AB blood is slightly more likely to have some
Asian than African ancestry; but its nothing to bet the farm on.
The same is true of the Rh blood-group gene. People can be Rhpositive or Rh-negative. And you nd both kinds of people everywhere. This is a ubiquitous polymorphismgenetic variation that
exists all over the world. Somebody with Rh-negative blood is more
likely to be a Basque than to be a Cherokee (since the Basques have
famously high proportions of Rh-negative blood), but is most likely
to be neither. In other words, a global cataclysm that killed or sterilized every human being except the Uzbeks or the Dinka would still
leave the vast majority of the major genetic variants of the species

the meaning of human variation

81

represented in the gene pool. This is true for Rh, for ABO, and for
nearly all human genes.
And that was Lewontins discovery. The overwhelming bulk of detectable genetic variation in the human species is between individuals
in the same population. About 85% of it, in fact. Another 9% of the
detectable variation is between populations assigned to the same
race; while interracial differences constitute only about 6% of the
genetic variation in the human species.
The implication of the new genetic analysis is that so-called racial
variation is a tiny issue to someone interested in the study of general
human variation. Its components, its patterns, are almost negligible
racially. Race is thus a very small, and therefore trivial, corner of the
picture. The argument could of course be made that the 6% of genetic
variation that is racial is necessarily the most important 6%. But that
would be idle speculation or simple prejudice. Racial variation has
now been shown to be scientically, mathematically trivial.
It does need to be recalled here that population geneticists are nevertheless still practicing the old bait-and-switch, analyzing data on
variation in blood-group genes and enzymes and not analyzing data
on variation in genes for skin color, hair form, or nose shape. The
fact is that we do not have any data on those genes, nor any information on where they are, how many there are, what they actually
do physiologically, or how they differ. The assumption is that the
genes we can study follow the same pattern as the genes we are interested in.
And there is every reason to think they do. All populations have
people who are taller and shorter, fatter and thinner, braver and more
timid, introverted and extroverted, more decisive and more dithering.
There is no continent of uniformly brunet people to contrast with
one of uniformly blond people, or of uniformly tall people to contrast
with one of uniformly short people. The traits that differentiate
Swedes and Kenyans at the racial level are actually a very small
proportion of the differences detectable, which are distributed primarily among members of the same population and between populations on the same continent.

82

the meaning of human variation

A study that captured the publics imagination was the Mitochondrial Eve report published at the beginning of 1987 by Rebecca
Cann, Mark Stoneking, and Allan Wilson at Berkeley. Mitochondria
are, as noted earlier, the powerhouses of the cell, containing their
own 16,500 bases of DNA, distinct from the 3.2 billion bases of the
chromosomes. Moreover, at fertilization, a human egg retains the
maternal cellular mitochondria, and sloughs off the sperms mitochondria. This DNA is thus inherited directly through the mothers
lineage and is not subject to the vagaries of Mendelian assortment
and recombination. A child is a mitochondrial clone of its mother
and unrelated to its father.
For Canns doctoral thesis, she undertook the rst direct survey of
nucleotide variation in the human species. She sampled a restricted
range of bases of the mitochondrial genome (approximately 10% of
it) across nearly 150 people, drawn from diverse populations. She then
took the resulting diversity and asked her computer to produce a tree
linking the various individuals together by virtue of the similarity of
their mitochondrial genomes (or mtDNAsometimes rendered as
empty DNA by skeptics). The tree was constructed from the 140odd individuals studied, not from any a priori groupings. When the
geographic origin of the samples was imposed on the result, it was
found that Africa (represented by African Americans, on the assumption that any admixture was from white males and therefore not
passed on in mitochondria) constituted the most genetically diverse
continent. The origin of variation in mitochondrial DNA diversity
was thus located in Africa, and since mtDNA is passed on only
through the mothers lineage, the mtDNA of interest would necessarily have belonged to a female. This African progenitrix was given
the biblically inspired name Mitochondrial Eve.
Most aspects of the study and of the evolutionary model that accompanied it have been effectively criticized in the past decade, but
the basic ndings seem solid: that racial clusters are not inherent in
genetic comparisons of humans but must be imposed by the investigator; that Africans are more genetically diverse than Europeans and
Asians, and that they indeed subsume the genetic diversity found in

the meaning of human variation

83

the rest of the world. Why should this be the case? Presumably because modern humans evolved in Africa and some only subsequently
emigrated to the rest of the world.
This carries a number of implications for the study of the human
gene pool. It means, most signicantly, that Africans must be considered paraphyletic; that Africans are an ancestral diverse group and some
Africans are more closely related to some Europeans and Asians than
to other Africans. Africans, Europeans, and Asians therefore do not
constitute comparable groups, even though they may make their
homes on different continents. Rather, although Europeans and Asians
have, of course, evolved some of their own specializations over the millennia, they are genetically subsumed by the gene pool of Africans.
Comparing Europeans, Asians, and Africans is thus something like
comparing dogs, cows, and mammals. Such a comparison is meaningless, because the third category incorporates the rst two.
Comparable data were slow to arrive for the DNA of the nucleus,
because it evolves more slowly (and thus there arent many differences
among people to tabulate), and because nuclear DNA comes in two
different copies per person, as opposed to the uniformity of the
mtDNA sequence in a single individual. A few years later, however,
in 1996, another young female graduate researcher, Sarah Tishkoff,
devised a clever DNA comparison of her own at Yale.
Tishkoff (now at the University of Maryland) took advantage of
the major difference between mitochondrial and nuclear DNA, which
is usually perceived as a liability in studying nuclear DNAnamely,
that different variants of the same gene occasionally trade positions
with one another. In other words, if one chromosome 8 in your cells
has genes A and B, and the other chromosome 8 has genes a and b,
most of your reproductive cells will have AB and ab, as you do, but
a small percentage will have gene A and gene b together, and reciprocally the other chromosome will have aB. This is known as recombination, and it permitsindeed, mandateslinked combinations
of genes to be broken up and brought into new combinations.
At the level of populations, and over the span of evolutionary time,
all genetic variants ultimately recombine and thus can be found in

84

the meaning of human variation

all possible combinations. But this requires enough time for these
recombination events to occur. Recombinations are individually rare,
but summed over all reproductive cells for all people over many generations, they always happen. Thus, particular genetic variations that
are always found together simply havent had enough time to come
apart.
So Tishkoff chose to look at the linkage relationships of two genes
over the worlds populations. The rst gene came in two forms; well
call them A1 and A2. The second came in twelve different forms, B1
through B12. She found the fullest array of diversity in her ten subSaharan populations; A1 was found coupled with B1 through 12 in
someone or another, and A2 was found coupled with all the Bs except
B1 and B7, in varying frequencies. By contrast, in her European sample of seven populations, she found A1 joined to B2 and B7 frequently,
and to B3, B4, B6, B8, and B9 rarely; and A2 joined to B3 frequently,
and rarely to B2, B4, and B7. The rest of the combinations didnt
exist at all in Europeans.
Tishkoff s interpretation was properly the simplest. The populations of sub-Saharan Africa were the oldest; eons of recombination
had yielded many different combinations of these genes. But a small
group of emigrants out of Africa had carried a restricted set of these
genetic combinations. And they had not had sufcient time to regenerate the full scope of variation by recombination.
As if that were not enough, the three populations she examined
from the northern and eastern parts of Africa had patterns and levels
of diversity intermediate between the high sub-Saharan African and
low EurAsian levels. Thus the nuclear DNA survey parallels the ndings of mitochondrial DNA.
Another signicant conclusion of the genetic research study bears
noting as well. How genetically different are two random humans
from each other? Being good primates, we tend to put a lot of signicance on obvious, visible features of the face. But that, as Lewontins study suggests, might not reect much of the underlying genome; we could be facially different as a result of very few genetic
differences and genetically nearly identical otherwise.

the meaning of human variation

85

g e n e t i c v a ri a t i on i n ap es and p eop le

If we look to our closest relatives, the chimpanzees and gorillas, we


nd an odd pattern. Two chimpanzees or two gorillas are considerably
more different from each other than two humans are. In other words,
even though chimps, gorillas, and humans diverged from one another
about seven million years ago and are all consequently the same age,
humans appear to be depauperate in genetic variation compared to
our closest relatives.
Lanky, blue-eyed Amos Deinard was breaking hearts in Yales anthropology department from the rst day he arrived from Minnesota.
But he only had eyes for chimpanzees and yearned to combine a
denitive molecular anthropology survey with training in veterinary
care. He had ambitions to be expert in all the major aspects of chimpanzee biology, at both the organismal and population levels, starting
with their genes. When he nally nished his doctoral thesis, I said
to him, Goodbye, Mr. Chimps.
Allan Wilsons group at Berkeley, pioneering the analysis of mitochondrial DNA, had shown that the apes were considerably more
diverse than humans. But the strange rates and modes of mitochondrial DNA evolution left unclear whether that pattern would also
obtain for nuclear DNA, the real stuff. That is what Deinard wanted
to discover. The advantage of studying mitochondrial DNA was that
it was easy to work with, and each individual only had one sequence;
surveying nuclear DNAeven a minuscule sample of itwould be
far more painstaking.
He studied ve short DNA sequences on different chromosomes,
across forty-ve chimpanzees, eighteen bonobos, and fteen gorillas,
and compared them to a sample of nearly one hundred people drawn
from all over the world. And when the cells had been cultivated, the
DNA had been extracted, and the samples had been run, he found
a highly consistent pattern. Where the large global sample of humans
revealed one or a few DNA sequence variations, the corresponding
sequence from these endangered primates of equatorial Africa almost
invariably had more. For example, from a region of gene called Apo-

86

the meaning of human variation

lipoprotein B, located on chromosome 2, Deinard found four DNA


sequence variants in his survey of the human species.
By contrast, he found three DNA sequences from his mere eighteen
samples of the rare and endangered bonobo. Moreover, he found
seven different DNA sequences in his gorilla DNA, and no fewer
than seventeen different DNA sequences in his common chimpanzee
sample.
Not only did the apes have more sequence variations, but they had
more diverse variationsthe sequences they had were often more
different from each other than two different sequences in humans.
And this in spite of the fact that the human sample was much larger
than the ape sample and the apes all derived from relict populations
in a small part of the world.
Genetic evidence thus points to a recent origin for the genetic
diversity within our species. Genetic diversity in the human species
is surprisingly ephemeralonly on the scale of tens of thousands of
years. How, then, are humans able to make sense of their place in
the social world, to know what groups they belong to, and who else
does, if they dont have much biological diversity to guide them, as
other animals do?
The answer is that genetic variation between groups seems, in some
large measure, to have been replaced by cultural diversity.
Cultural diversity is the true evolutionary hallmark of humans, and
it serves the purpose (among many others) of telling us who we are,
of identifying ourselves in the social universe. Irish Catholics and Irish
Protestants are indistinguishable genetically, but they know who they
are, and who theyre not, by virtue of their cultural differences. Any
place on earth where there is civil unrest almost inevitably involves
people who are genetically and physically very similar and culturally
different. The fascinating thing about cultural differences is that they
are more important to us, for example, in creating life-and-death
situations than biological variation is. Where there are biological differences between hostile populations, they can easily be recruited to
mark the enemy. But group hostilities inevitably lie in the social,
political, and economic realms, not in the biological.

the meaning of human variation

87

Cultural variations are very stable (they persist for longer than individual lifespans) and very structuring (the knowledge they impart
seems so obvious that it is difcult to imagine ever calling it into
question). Yet this was precisely the contribution of anthropology in
the twentieth centuryto show that the way we often think the
world is may not be the way the world comes to us naturally at all.
It may be an artifact of the cultural glasses we wear. The fact that
populations seem so different from one anotherin the way they
dress, speak, act, think, eat, move, and livetempts us to think that
those differences must have some sort of basis in their natures, their
core beings, their genomes.
Which brings us to the next question.

a re con s i s t e n t l y d e te ctable di ffe rences


b e twe e n h um a n popu lati ons geneti c?

If I study 1000 Ibos from Nigeria and 1000 Danes from Denmark, I
can observe any number of differences between the two groups. One
group, for example, is darkly complected; the other is lightly complected. This difference would probably be the same whether I selected my sample in the year 1900, 2000, or 2100, and is presumably
genetic in etiology.
On the other hand, one group speaks Ibo and the other speaks
Danish. That difference would also be there if I selected my sample
in 1900, 2000, or 2100, but is presumably not genetic. At least, generations of immigrants attest to the unlikelihood of a genetic component to it.
How, then, can we know from the observation of a difference
whether it is biologically based or not?
European explorers were well aware that the people who looked
the most different from them also acted the most differently. Linnaeus
invoked broad suites of personality (impassive, lazy) and culture
traits (wears loose-tting clothes) in his diagnosis of four geographical subspecies of humans in 1758. The next generation of researchers
recognized that these traits were both overgeneralized (if not outright

88

the meaning of human variation

slanderous) and exceedingly malleable, and sought to establish their


formal divisions of the human species solely on biological criteria.
It was widely assumed by the middle of the nineteenth century that
regardless of the degree of malleability of mental or behavioral traits
of human groups, the features of the body were fundamentally immutable. Anthropology is, in its fundamentals, about getting inside
peoples heads. But lacking a way to look literally in peoples heads,
the next best thing was to look at peoples heads. And like the rest of
the body, heads varied in size and shape.
In 1847, a Swedish anatomist named Anders Retzius devised a way
of measuring and comparing heads. He measured the head at its
widest point and divided that by a measurement of the head at its
longest point, and then he multiplied by 100. People with wide heads
would thus come out with a low number, say around 75; and people
with long heads would come out with a high number, say around 85.
And a highfalutin vocabulary came to match the data: low numbers
were called brachycephalic, and high numbers were dolichocephalic.
Various other polysyllabic terms quickly entered the craniological lexicon.
This has been satirized in many places, for example, by Sir Arthur
Conan Doyle. The rst meeting of Sherlock Holmes and Lord Baskerville (owner of the eponymous hound) is marked by Baskervilles
exclamation on meeting the detective: I had hardly expected so dolichocephalic a skull or such well-marked supra-orbital development.
Then he adds pseudoerotically, Would you have any objection to
my running my nger along your parietal ssure? Somewhat later,
in the movie version of the musical On the Town (1949), Ann Miller
plays a tap-dancing anthropologist infatuated by a sailors sub-superdolichocephalic skullwhatever that means.
The important thing about skull shape was that it appeared to be
a fairly stable feature of people and of populations. It was also studiable in ancient skeletons, so comparisons could be made between
archaic and modern populations. And, of course, it measured the
head, which encased the brain, which determined the mind, which
was composed of diverse thoughts. It had to be important. Thus,

the meaning of human variation

89

traits like the shape of the head could be taken as an indicator of


transcendent biological afnitygroups with similarly shaped heads
were closely related, whereas those with differently shaped heads were
more distantly related.
The rst to challenge this assumption empirically was the pioneering American anthropologist Franz Boas, who measured skulls of
immigrants to Ellis Island, and compared them to those of relatives
already living in the United States. Boas was a German-Jewish immigrant who had come to anthropology via a circuitous intellectual
route, through physics and geography. With a guiding interest in
recording the lifeways of the indigenous peoples of the New World
as they were lost or irreversibly altered, Boas came to appreciate the
mammoth effects that cultural changes had on people in all spheres
social, mental, and physical. As a Jew in nineteenth-century Germany, he also had rsthand experience with the manner in which
socially marked groups can come to have their identities or differences
inscribed or etched into their makeup and their second-class status
assigned to nature.
Physical anthropologists already knew that the skull was somewhat
malleable. Various cultures of the Middle East and the U.S. Southwest used cradle-boards to carry their babies, which grew up with the
backs of their heads attened. The Incas molded their childrens skulls
to grow high; the Flathead Indians of Canada molded theirs to
grow low. Might more subtle, long-term inuences on the skull affect
its shape as well? If so, that would strongly undermine the assumption
that skull shape tells you much about race, or population relationships, much less about the inner mind of the person attached to the
skull.
European immigrants to America thus constituted a natural experiment for the theory that consistent bodily differences are innate.
Keeping the gene pool constant and altering the environment, Boas
found that the human body is indeed very sensitive to the conditions
of growth. The characteristically round-headed Jews coming to New
York from eastern Europe were considerably more round-headed than
their relatives already living in New York. And the children of immigrants, the generation born in the United States, were even less

90

the meaning of human variation

characteristically round-headed than their parents. By the same token,


the characteristically long-headed Sicilians became less long-headed
in America. There was a decided tendency of diverse immigrant
groups to become more physically homogeneous in Americain
spite of marrying within their own groupsthan they were when
they arrived.
In particular, the shape of the head turned out to be very plastic
and not at all a reliable indicator of genetics, or race. It wasnt that
people were turning into one another, but simply that the differing
conditions of life tended to exaggerate physical differences among
human populations. In similar surroundings, people became more
physically similar.
Subsequent studies of other immigrant groups, notably the study
of Japanese immigrants to Hawaii by Harry Shapiro and Frederick
Hulse in the 1930s, supported this discovery. Immigrants to Hawaii,
they found, differed from their relatives in Japan; and the Hawaiianborn generation differed even more markedly. Thus, the observation
of consistent difference between groups of peopleeven of the
bodyis not necessarily indicative of a genetic basis for that difference. This work effectively shifted the burden of proof from those
who question a genetic basis for the observation of difference to those
who assert it.
To establish a genetic basis for an observed difference between two
populations, therefore, requires more than just observing the difference to be consistent. It requires presumably genetic data. The inference of a genetic difference in the absence of genetic data thus represents not a scientic theory of heredity, but a folk theory of heredity.
To the extent that behavioral and mental traitssuch as test scores
and athletic performancesare even more developmentally plastic
than are strictly physical traits, the same injunction must hold even
more strongly for them. Genetic inferences require genetic data.

do diffe re n t pe opl e s h a v e d iffe rent p ote ntials?

One of the catchphrases of 1994s best-selling book The Bell Curve


(about how welfare should be abolished because the people on it are

the meaning of human variation

91

just plain stupid and theres nothing anyone can do about it) was
cognitive ability. Eluding a scientically rigorous denition, the
phrase is left to be explained by a commonsense or folk denition
cognitive ability presumably means the mental development possible for a person under optimal circumstances. But it would take an
extraordinarily nave or evil scientist to suggest seriously that such
circumstances are in fact broadly optimized across social groups in
our society. Consequently, not only can we not establish that abilities
are different, we have no reliable way even to measure such an innate
property in the rst place. What we have is performanceon tests
or just in lifewhich is measurable, but which is the result of many
things, only one of which is unmeasurable innate ability.
On the one hand, it is not at all unreasonable to suggest that different people have different individual giftswe all possess unique
genetic constellations, after all. On the other hand, those gifts are
not amenable to scientic study, for they are only detectable by virtue
of having been developed or cultivated. Thus no scientic statements
can be responsibly made about such genetic gifts in the absence of
the life history of the person to whom they belong.
In other words, ability is a concept that is generally easy to see only
in the past tense. I know I had the ability to be a college professor,
because I am one; but how can I know in any scientically valid sense
whether I could have been a major-league third baseman? I cant, so
it is simply vain for me to speculate on it. A life is lived but once,
and what it could have beenwhile fascinating to contemplateis
not a scientic issue.
There is also an important asymmetry about the concept of ability.
A good performance indicates a good ability; but a poor performance
need not indicate poor ability. As noted above, many factors go into
a performance, only one of which is ability. Thus, when we encounter
the question of whether poor performanceeven over the long
termis an indication of the lack of cognitive ability, the only defensible position from the standpoint of biology is agnosticism. We
do not know whether humans or human groups differ in their potentials in any signicant way. More than that, we cannot know, and
that is a crucial distinction. There is no experiment you can devise

92

the meaning of human variation

that will distinguish what one normal child at birth could optimally
accomplish as opposed to another normal child. Once again, it may
sound like genetics, but it isnt genetics.
Science is not about what is known, but about what is knowable.
That is why atoms are within the domain of science and angels are
not. It is also why individual potentials, like angels, lie outside the
domain of scientic discourse and within the domain of folk knowledge.
Folk knowledge is not necessarily bad. It is simply different from
scientic knowledge. It is also not necessarily wrong. Folk knowledge
is the commonsense comprehension of things and processes that science often challenges. But science makes a crucial distinction between
the knowable and unknowable, while folk knowledge does not. It
doesnt need to. The realm of the unknowable is often much more
interesting than the realm of the knowable. How many angels, after
all, really could dance on the head of a pin? Will people of the future
have brains the size of Volvos? Could Muhammad Ali really have
beaten Rocky Marciano? If they had really, really, really tried, could
Beethoven have played for the Chicago Bulls and Michael Jordan
have written the Ninth?
Think about it. Over a drink, perhaps.
The important thing to bear in mind, though, is that its not science, and its denitely not genetics. Its a folk gloss on issues about
natures and innate constitutions and potentialsbut these are
all ideas that long predate the science of genetics. They have an independent history. They actually have nothing to do with the science
of genetics.
Furthermore, this raises a darker question: What are we to make
of scientists who assert the existence of real constitutional differences
in ability? If we cannot gauge differences in ability in any reliable
manner, if ability is not a scientic concept, it is a corruption of
science to assert in its name that one group indeed has less ability
than another. From the mouth or pen of a politician, the assertion
might reect ignorance or demagoguery; from that of a scientist, it
reects incompetence or irresponsibility. Scientists are subject to the
cultural values of their time, place, and class, and historically have

the meaning of human variation

93

found it difcult to disentangle those values from their pronouncements as scientists. We now recognize the need to dene the boundaries of science in order to distinguish the authoritative voice of scientists speaking as scientists from the voice of scientists speaking as
citizens. This distinction is vital to keeping science from being tarnished by those few scientists who have chosen to invoke it as a
validation of odious social and political doctrines.
Racial classications represent a form of folk heredity, wherein subjects are compelled to identify with one of a small number of designated human groups. Where parents are members of different designated groups, offspring are generally expected to choose one, in
deance of their biological relationships.
Differing patterns of migration, and the intermixture that accompanies increasing urbanization, are ultimately proving the biological
uselessness of racial classications. Identication with a group is probably a fundamental feature of human existence. Such groups, however, are genetically uid, and to the extent that they may sometimes
reect biological populations, they are dened locally. Races do not
reect large fundamental biological divisions of the human species,
for the species does not, and probably never has, come packaged that
way.
Merely calling racial issues racial may serve to load the discussion
with reied patterns of biological variation, and to focus on biology
rather than on the social inequities at the heart of the problem. Racism is most fundamentally the assessment of individual worth on
the basis of real or imputed group characteristics. Its evil lies in the
denial of peoples right to be judged as individuals rather than as
group members, and in the truncation of opportunities or rights on
that basis. But this is true of other ismssexism, anti-Semitism,
and prejudices against other groupsand points toward the most
important conclusion about human biology: racial problems are not
racial. If biologically diverse peoples had no biological differences,
but were marked simply on the basis of language, religion, or behavior, the same problems would still exist. How do we know this? Because they do exist, for other groups. The problems of race are social
problems, not biological ones; and the focus on race (i.e., seemingly

94

the meaning of human variation

discontinuous biogeographic variation) is therefore a deection away


from the real issues.
A society in which individual talents can be cultivated without
regard to group afliations, social rank, or other a priori judgments
will be a successful oneacknowledging biological heterogeneity
while developing the diverse individual gifts of its citizenry.

n e a n d e rt a l m a n : a rca ne y e t relevant

It would seem as though what to call Neandertals is a question of


strikingly limited relevance to modern life. Neandertals were those
stout, football-headed, muscular people who inhabited Europe and
the Mediterranean for a couple of hundred thousand years during
the Ice Ages and died out about 32,000 years ago. They used to be
spelled with an h but arent any more.
In the paradox of sameness/otherness, the Neandertals have been
an enigma for over a century. They are diagnosably different from
anatomically modern humans, and yet you cannot get any closer to
us. They didnt develop art, but then neither did modern humans for
a hundred thousand years. We dont know whether or how well they
could speak, or conceptualize their world. They buried their dead in
stylized positions and borrowed technologies from their neighbors.
We know they were smart and successful, because they were around
for a long time, and survived under harsh conditions. An expert can
differentiate their shoulder blades or thighbones; a college freshman
can easily learn to differentiate a Neandertal jaw and skull from those
of modern peoples. But what does that mean? Were they another
species of people, or even closer than thatanother subspecies?
For about half a century, anthropologists have been content to call
them a different subspecies, Homo sapiens neanderthalensis. That implies that they were geographically and anatomically distinct, but
would not have been biologically incapable of breeding with modern
humans.
Of course, we cannot know for sure. There is no class of data we
could collect, short of nding a living Neandertal and tempting it
with a modern mate, which would tell us whether it could in fact

the meaning of human variation

95

have interbred with us. We just dont know how reproductive incompatibilities evolvesometimes genetically similar animals cant interbreed, and sometimes genetically different ones can. Often, of course,
there is some degree of correspondence between anatomical difference, genetical difference, and reproductive capacitiesbut it cannot
be taken for granted.
Calling the Neandertals a subspecies of Homo sapiens is a judgment
call about their level of sameness and otherness. But it has a salubrious
side effect. If Neandertals are a subspecies of Homo sapiens, in contrast
to all modern humans, then the question of the subspecies of living
humans is rendered moot. The question that had guided physical
anthropology since LinnaeusWhat are the divisions of modern
people?now has no possible answer, for the simple reason that subspecies are as low as you can go in the formal taxonomic hierarchy.
For us to recognize all living people as one subspecies and juxtapose
them at the subspecies level against extinct forms means that we
cannot formally name subgroups of living humans, because there is
simply nothing left to call them.
Thats good. If theres one thing we dont need, its a free taxonomic
niche that would permit the social differences that envelop us to be
formalized biologically once again. We have enough difculty equalizing opportunities among blacks and whites; we dont need new ways
for ideologues to divide us and make it look as though it is science
that is actually doing it.
But in the paleoanthropology community, a debate has resurfaced
in the past decade that has deep ramications of an unscientic nature: Should we give Neandertals their own species?
This would, of course, be a judgment call highlighting the otherness of Neandertals. They were, after all, different. Maybe they
were different enough to be called a species. Among the evidence
adduced in support of this was the sequencing in 1997 of a short
stretch of Neandertal mitochondrial DNA, amounting to 379 bases,
which differed somewhat from those of modern humans; where modern humans were found to vary from one another by up to twentyfour differences, the Neandertal sequence averaged twenty-seven differences, depending upon which human sequence you compared it

96

the meaning of human variation

to. The authors then calculated that the DNA sequences of Neandertals and modern people began to diverge about 600,000 years ago,
which suggested to them a different species.
Or maybe not, given that theres no rule of equivalence between
divergence of DNA and specieshood. Still a judgment call. Its not
exactly a scientic datum, its a parascientic one, which borders on
science but is actually in the realm of the unknowable. Could an
extinct form of near-human have interbred with us? Not only dont
we know, but we cannot know. Things we cannot know are outside
the domain of science. Of course, those are often the most interesting
issues to speculate about.
Heres the problem. If we elevate the Neandertals to the species
level, we create a vacuum at the subspecies level, one that our folk
ideologies about races and racial differences will all too readily ll.
Is it worth it? Is the judgment call on the taxonomic status of
Neandertals, an esoteric problem at best, worth the price of creating
a scientic loophole for overstating and naturalizing the social divisions in our world?
It is not as if we have positive knowledge about the species status
of Neandertals and would therefore be compromising our scientic
integrity in striving to be politically correct. It is, rather, that there
are drastic social consequences to this parascientic judgment call
about the reproductive capabilities of fossils, which need to be
weighed carefully. The status of Neandertals is not an isolated paleontological problem, nor is it a soluble scientic problem; it is a
subjective assessment that reverberates into our formal recognition of
modern people as well. And it would easily seem to harmonize with
archaic, folk ideologies about the living members of our own species,
making it easy for narrowly trained scientists to bring back the Caucasoids and Negroids as if they had validity beyond the colloquial
usages.
If you think that this scenario is far-fetched, consider the pronouncements by a couple of geneticists in a major journal, Molecular
Biology and Evolution, in 1993: [H]uman populations can be subdivided into ve major groups: (A) negroid . . . , (B) caucasoid . . . ,
(C) mongoloid . . . , (D) Amerindian . . . , and (E) australoid. . . .

the meaning of human variation

97

(There are intermediate populations, which are apparently products


of gene admixture of these major groups, but they are ignored here.)
How many fallacies can you nd? Not only are these geneticists
taking archaic folk ideologies as modern anthropology, but they believe in the Noahs Sons model of racial origins, with hybridization
occurring in the middle of the world. They are at the cutting edge
of molecular studies, and back in the nineteenth century anthropologically. They seem neither to have known nor to have cared what
the actual data on human variation, and contemporary understandings, wereand neither did the reviewers of their paper. The geneticists actually found ve subdivisions because they sampled people
from ve distinct parts of the world, and not other places: like many
studies before it, its conclusion was simply loaded into their assumptions. Its on account of science like this that its probably a good idea
to keep Neandertals safely at the subspecies level.
The history of racial science bears witness to the fact that no class
of data on human diversity is value-neutral. It all comes bundled with
cultural ideas. On the one hand, that is what makes this area so
interesting to study and to examine critically. On the other hand, it
exposes a simple liethat data and theories of human diversity and
human origins can exist outside a cultural context, external to a matrix
of values and judgments about others, without consequences and
attendant responsibilities.
The DNA evidence itself, curiously, did not last long. Although
the data were unimpeachable (and two more Neandertal DNA sequences now give concordant results), the interpretation wasnt. Certainly the Neandertal DNA lay outside the range of human variation,
as the Neandertal bodies do. But could it really be shown that the
gene pools of modern and Neandertal people diverged 600,000 years
ago? This was, it turned out, the same class of data (a particularly
rapidly evolving part of the mitochondrial DNA molecule known as
the control region) that had suggested to other researchers a few
months earlier that the dog had been domesticated 120,000 years
agoin spite of no evidence for it until 12,000 years ago. Could it
be that the problem wasnt Neandertal Mans genes at all, however

98

the meaning of human variation

many specimens are sequenced, but the way the dates were being
calibrated?
Yes, it could. A few weeks after the initial report, it was discovered
that mitochondrial DNA accumulates mutations up to twenty times
faster than had previously been thought. That means either that a lot
more change should accumulate in the same amount of time or that
the same amount of change should accumulate in a lot less time.
If the mutation rate used to calculate the divergence date was too
low, then the date of divergence obtained was too distantmore
changes were occurring in less time than the calculations allowed.
Just how far off the numbers were is unclear. But given the tabulated
amounts of difference in the 379 bases of Neandertal DNA, it now
appears that 600,000 years of divergence may well have been a considerably inated estimate. Along with the 120,000-year estimate for
the domestication of the dog. And as for the species status of Neandertals following from their DNA divergence, it is no greater than
the divergence of subspecies of chimpanzees from one another.
Anthropology may have got it right after all.

the meaning of human variation

99

Five
behavioral genetics

We know intuitively that nature and nurture somehow combine


to make us what we are; we dont need science to tell us that. But
science brings authority to the table. Many teachers unfortunately
skim over the material because it is emotional, or they attempt to
present both sidesusually uncritically, as if genetics and behavior
were simply a case of you say potay-to, I say potah-to. Actually,
though, an anthropological approach complements and illuminates
the genetic data quite well and shows how much we actually do know
about the nature-nurture debate.
Contemporary genetics relies on the ability to relate an observed
characteristic (a phenotype) to a hereditary state (a genotype) causally.
In other words, genetics is about the mechanism by which a series of
DNA instructions comes physiologically to produce an organism with
a particular suite of features.
Some connections are straightforward: if you have inherited the
genes for cystic brosis, you get cystic brosis. There is some considerable variation in the expression of the disease, but it is physiologically determined by the genes.
Other connections are more obscure. Light-skinned people tend to
have light-skinned children. Tall people tend to have tall children.

100

Rich people tend to have rich children. Syphilitics tend to have syphilitic children. How do we make genetic sense of this?
There is an easy answer. Do classical genetic experiments. Isolate
the individuals with the properties of interest. Mate them carefully
to specic partners. Make sure they have plenty of offspring. Study
the offspring carefully, mate them to specic partners, and study the
distribution of the traits of their children. Under the appropriately
controlled conditions, you will be able to distinguish which traits are
genetic and even how many genes are involved.
It worked with fruit ies.
Of course, fruit ies have a decided advantage over humans as
genetic subjects. In the rst place, you can mate them to each other
with godlike impunity. They dont seem to care much. And if they
did care, it wouldnt matter. Its your experiment. They dont whine,
and they have no rights.
In the second place, they breed like, well, ies. Having lots of
offspring is a very favorable trait for a genetic subject to have, since
genetic inferences are principally statistical. Mendel, after all, began
by counting up the hundreds of pea plants with the features he was
interested in. If his plants had had only three offspring apiece, he
wouldnt have gotten very far.
In the third place, fruit y generations are only a couple of weeks
long. You can study many generations during the term of a single
research grant.
And thats why fruit y genetics is so far ahead of human genetics.
One solution is to analogize directly from fruit y genetics to human genetics. After all, were both animals and share a basic biology.
But just how basic? A fruit y and a human male both have an XY
chromosome conguration; the females have XX. That would suggest
that sex determination is similar in both species. But it isnt, actually.
The similarity is supercial, for an XXY human is an abnormal male
(with a constellation of features comprising Kleinfelters Syndrome),
while an XXY fruit y is a less abnormal female. That suggests instead
that something very different is going on in the two species.
Studying behavior adds a further difculty, namely, identifying the
trait in question. Physical traits are there to be studied, measured,

behavioral genetics

101

analyzed. Behavioral traits must be elicited. And even then, it is easier


to analogize to human behavior supercially than to prove a meaningful biological connection.
In a classic midcentury study by A. J. Bateman, fruit ies were
carefully mated to a series of members of the opposite sex. The question was, does a succession of lovers increase your reproductive output? Having three partners enabled a male to increase the number of
eggs he fertilized dramatically, compared with fruit y males mated
to only two partners, or one partner. In females, however, the second
and third male mate made no difference; females who mated with
one partner laid the same number of eggs as those who mated with
two or three.
The result, however, was about people, not fruit ies. It was that
the male is eager for any female, without discrimination, whereas
the female chooses the male. In other words, the behavior of maleness and femaleness stereotypically transcended the evolutionary gulf
that divides ies from people.
Now, of course, one cant gauge eagerness in a y with any great
precision. But the results speak for themselves: a male ys reproductive success is aided by his ardor, while a females is not aided by hers.
The key question, however, is this: Have you discovered a fact
about males and females, or a fact about y males and females?
One way to nd out, of course, would be to ask whether ies have
physiological specializations that humans dont, which may facilitate
the result you observed in the ies. That might tell you youre looking
at the facts of specically y biology, not transcendent properties of
maleness and femaleness. And sure enough, they do have such specializations. Fruit y females have an organ known as a spermatheca,
which functions to store sperm, so that after one mating they can
fertilize as many eggs as they want. They dont need to mate again
to get more sperm.
Human females lack a spermatheca. That tells us something important. It tells us that the result you obtained harmonizes well with
fruit y biology. But since human biology is different, it follows that
the result should not be directly extendable to humans.

102

behavioral genetics

Unfortunately, that was not the lesson learned by the scientist. Nor
was it the lesson appreciated by several zealous students of sociobiology, which studies the biological roots of human behavior, whether
or not they exist.

of worm s a n d men

Molecular genetics seems to be revolutionizing all aspects of our lives,


at least to judge from the headlines. Consider the discovery that a
single gene mutation in the tiny nematode worm converts it from a
solitary eater to a gregarious eater, reported in the New York Times
on September 8, 1998, with the titillating heading Can Social Behavior of Man Be Glimpsed in a Lowly Worm? Oh, sure, reported
the Times, such a suggestion is unwelcomethe implication being
that its politically incorrect, rather than just bloody stupid and a
thoroughgoing disgrace to the good name of science.
A harsh judgment?
Once again, lets start with nematode worm biology. The animal is
technically known as Caenorhabditis elegans, or for the classically challenged, C. elegans. It has been a great boon to developmental biology,
for its growth and development from a fertilized egg is better understood than that of any other organism. The major reason is the biological simplicity of C. elegans. It has, for example, 302 nerve cells.
For its behavior to be directly translatable to human behavior, those
would have to be really, really good nerve cells, for that is several
billion fewer than will be found in you or me.
More than that, what really is the relationship between sociality
in worms and in humans? One can always compare animals and
people. The owl is wise, the fox is clever, the ant industriousAesop
popularized it in European literature, and cultures all over the world
make similar associations in their oral lore. This is anthropomorphism, great as song and story, dubious as science. The association
here between animal and person is analogical, metaphorical. Youre
not saying they share a common biology, but rather that they are
symbolically alike.

behavioral genetics

103

By the middle of the nineteenth century, anatomists had recognized


that there was another kind of comparison to be made among different species. It was more than a symbolic association; it seemed to
be something deeper, a fundamental correspondence of structure. The
basic similarity between the structure of a birds skeleton and a humans skeleton had been noted in the 1500s, but now it was given a
name: homology.
Homology is more than symbolic similarity; more than a common
name for two basically different features (like the wings of a sparrow
and a dragony). And it was Darwin who explained it: homology is
a correspondence of features due to common descent. Unlike analogous features, which are supercially similar (like the color and body
form of sharks and dolphins), homologous features are often supercially different but similar in deep structure (like the forelimbs of a
horse and a squirrel).
Which brings us back to sociality in worms and people. Is this
just a word game, in which case its a waste of time if your goal is to
throw light on human behavior? Or is it the same thing, a deep
biological correspondence?
Unfortunately, its not easy to tell in biology. There is no ofcial,
foolproof test to enable you to tell.
But we can make a reasonable guess. Look carefully at a 12centimeter-long nematode worm and at your mother. How many
similarities do you see? Is it reasonable to think that if legs arent
homologous (nematode worms dont even have them, after all), sociality would be?
Of course not; sociality in worms is like slavery in ants. Entomology can tell you no more about the enslavement of the Middle
Passage than it can tell you about the enslavement of iron lings by
a magnet. Helminthology can tell you no more about a family gathering at Thanksgiving than it can tell you about a family gathering
of protons in the nucleus of an atom.
It may sound like scienceits got experiments and genesbut its
a science of metaphorical, not of biological, connection. That makes
it nonscience.
And pretending that the nonscience is science is pseudoscience.

104

behavioral genetics

s tud yi n g h um a n behavi or

The rst question we need to deal with if we want to study the


genetics of variation in human behavior is: Who even has the behavior, the phenotype, we want to study? Suppose we are interested in
the genetics of aggression. Where do we begin to look? Boxers are
aggressive, but actually its just a job to them. After the nal bell, they
usually hug each other. The single act that killed tens of thousands
of people at Hiroshima was merely the ip of a switch. Not an especially aggressive act. Except in context.
The second question is the relationship between the range of what
is normal and what is abnormal. After all, aggression is a part of the
behavioral repertoire of genetically normal people. It is specically the
context of aggressive behavior that denes it as abnormal. Now, human genetics is driven by medical concerns and by biochemical techniques. As a result, we cluster virtually all of the genes we map into
two categories, with only a little overlap. First, we map genes that
have little effect on the body and that are responsible for the production of a specic molecule, characterized well only at the biochemical level. In this category are genes like those that make hemoglobin, those that make enzymes, those that code for the blood
groups. Here, very often, variation is detectable, but the variants are
generally equivalent. One can have type B blood or type O blood,
after all, and still be normal.
The other category comprises those genes that have a detectable
effect on the organism, the body at large. This class is composed
almost entirely of diseases. We map genes for the bodys breakdown:
the cystic brosis gene, the muscular dystrophy gene. This is actually
a complex shorthand. The fact is, there is no gene whose function is
to cause cystic brosis. Rather, what we know is that when the functioning of a certain gene (whose function and physiological role we
dont understand) is compromised, cystic brosis results.
The point is: We dont map the genes for noses.
That is very important: noses are genetic, noses are variable, and,
accidents aside, noses are all normal. Because of the way we identify
and name genes, we develop a map of the human genome that is very

behavioral genetics

105

morbid: a list of diseases, a genetic map of road hazards. But we dont


even have a way of conceptualizing the genes for the normal development of different bodies.
It is very easy to confuse pathology for normalcy, and vice versa.
You dont necessarily learn about the normal function of an object
from its breakdown. Observing the fumes that result from a broken
fuel injector in your cars engine will tell you neither what the fuel
injector actually does nor what exhaust fumes are normally supposed to be like. Likewise, observing pathological variation in different people doesnt necessarily tell you anything of value about
normalcy.
Consider height. We know that theres genetic and environmental
causes for variation in height. Tall parents tend to have tall children.
On the other hand, in developed countries, people are generally bigger than their parents, whose genes they have. If youve ever looked
at medieval armor, it may have struck you that bold and manly Sir
Lancelot would have been physically puny by modern standards. In
addition to genes, diet and lifestyle have also contributed to making
people tall.
But let us focus on the genes for height. No such genes have been
found or mapped, but it has been estimated that there are about eight
of them. And maybe there are. The crucial thing about them is that
they contribute to the range of normal heightthe differences within
the vast majority of the world that is between, say, four and a half
feet and seven and a half feet tall.
There are, of course, a few people with genetic variants that affect
their bones so that their body growth is abnormal, for example, the
condition known as achondroplasia, which causes very small stature. That gene is well characterized. It is a gene, and it affects height.
But it is not one of the eight genes postulated above. Why? Because
it does not contribute to the normal range of variation in height; the
variation it produces is pathological. Achondroplastics are abnormally
short. We learn nothing about the height genes from the study of
dwarsm, because the genes governing the range of normal height
are independent of the genes for rare dwarsm.

106

behavioral genetics

Likewise, Lesch-Nyhan syndrome is a rare condition in which a


biochemical pathway (purine metabolism) is disrupted by a mutation
in a gene that produces an enzyme called HPRT (or HGPRT, hypoxanthine-guanine phosphoribosyl transferase). Then physiology intervenes, and the phenotype that emerges is macabre compulsive selfmutilation; these unfortunate boys bite their ngertips and lips off
and must be forcibly restrained.
But what does this tell you about nail-biters (like me), or rituals of
scarication, or body piercing, or about any violent or mutilatory
behavior in normal people?
Nothing.
The pathological genetic condition is entirely independent of the
phenotypes of normal people. Yet to showcase the importance of
behavioral genetics in Scientic American, a practitioner brandishes
that very disease: [A] neurogeneticist at the National Institute of
Alcohol Abuse and Alcoholism . . . listed several factors he says are
incontrovertibly linked to violent behavior. The gene that causes
Lesch-Nyhan syndrome, which often involves self-mutilation, is
one.
Its fairly obvious that the geneticist is self-interested when he tries
to convince you that Lesch-Nyhan syndrome is caused by a behavior
gene. The syndrome is real, and affected children are tragic. But
effectively none of the violent behavior in the human species over the
span of world historyfrom the Battle of Vicksburg to Mike Tyson
biting Evander Holyelds ear, from the assassination of Julius Caesar
to Custers Last Stand to the My Lai massacrehas had anything
whatsoever to do with Lesch-Nyhan syndrome. These are violent acts
by genetically normal people and not the subject of the genetic data
being invoked here.
And in spite of the news division of the journal Science trumpeting
Possible Aggression Gene Found, the Dutch geneticists who studied a genetic syndrome called monoamine oxidase A (MAOA) deciency made no claim that their work had any bearing on the causes
of aggressive acts in modern society, which are overwhelmingly carried out by genetically normal people. In fact, Han Brunner, the

behavioral genetics

107

senior author of the MAOA study, made his thoughts very explicit
in print: Although genetic studies cannot explain why impulsive aggression occurs, they may help to improve our understanding of how
impulsive behavior happens.
Fair enough.
Lesch-Nyhan syndrome and monoamine oxidase deciency produce abnormal violent behavior. Violent behavior in normal people
in ordinary or extraordinary contexts (sports, crime, discipline, politics, etc.) is untouched by the genetic knowledge about those conditions. But its the normal violent behavior that were interested
in when we hear about genes for behavior. Why, then, was his work
reported as an aggression gene? Why does it get trotted out, for
example by sociobiologist E. O. Wilson, in his recent book Consilience, as an example of the inuence of genes on behaviorwhen
even the geneticist who did the work doesnt interpret it that way?
What on earth is going on here?
Welcome to behavioral genetics, where the social and natural sciences square off and we learn that nature really does beat nurture. At
least, if you believe behavioral geneticists. But then, of course theyd
say that; theyre behavioral geneticists, after all. And their work, however tentative or irrelevant, can then be uncritically invoked by people
who hold concordant social and political beliefs about the innateness
of social problems because it appears to support them scientically.
Its thus in the interests of both groups to get you thinking that
behavior is genetic. Just as it is in the interests of a Buick salesman
to convince you that Buicks are the best cars on the road. And maybe
theyre right. But on the other hand, would they tell you if they
werent?

b e twe e n n a t u re and nurture

Behavioral genetics is where science and politics converge. The Bell


Curve was a 1994 best-seller that argued that since differences in IQ
are innate, we should cut social programs, because they cannot advance people above their intellectual potentials. The authors of that

108

behavioral genetics

book certainly appreciated a signicant relationship between heredity


and politics.
If the heredity of behavior is politically loaded, then obviously it
needs to come under a special degree of scrutiny, or else work of
dubious quality may be used to inuence public policy and thereby
degrade peoples lives. And certainly if the history of anthropology
has shown us anything, it is that science can easily be invoked to
naturalize social inequalities, to make it seem as though they are natures fault (and not the fault of greedy and evil people), and thus
discourage any attempt to make the world better. And thats bad both
for people and for science.
We began by distinguishing normal from pathological behavior.
But its not always that easy. The vast majority of people in the world,
for example, are right-handed; fewer than 10% are left-handed. We
dont know why. But the fact that left-handedness is fairly rare doesnt
necessarily mean it is bad, or problematic, or even biologically abnormal. Culturally, however, this deviation from the majority is often
very signicant. There are many symbolic associations with lefthandedness, which take an infrequent biological condition and construct absolute dichotomies around it. Lefties are gauche, not adroit;
the left is politically unstable; the left is not the seat of honor. Lefties
are sinister, not dexterous. The left is widely associated with the west,
with sunset, with the dark, with cold, with death, with evilas anthropologists have been recognizing since shortly after the turn of the
century. Students in earlier generations were often forced to write
with their right hands, even if their natural inclination was to use the
left.
Somehow, the collective processes of the human mind have constructed a spiritual map of the opposed forces of the universe and
inscribed them upon the human body. We dont know why or how
this came to pass. What is clear is that an obscure and uncommon
biological datum has become a subtle and powerful worldwide symbol of abnormality, deviance, badnessalthough there is nothing
intrinsically bad about being left-handed. It is simply different from
most peoples inclinations.

behavioral genetics

109

One could search for the genes for left-handedness, and maybe
some exist. But they would not explain the meaning of lefthandedness, the signicance of the biological fact. More likely than
not, much left-handedness is developmental, not genetic at all, since
identical twins are commonly discordantin spite of its obvious innateness and the subtle differences in brain structure that accompany
left-handedness. Of course, handedness can be taught, and there are
degrees of it, in spite of the cultural dichotomy we impose.
Studying the genetics of left-handedness probably wouldnt tell
us much about its etiology, simply from what we already know;
it certainly wouldnt tell us anything about the signicance of the
phenomenon; nor would it tell us what to do about it, if anything.
Left-handedness is either something you accept culturally as aberrant, dangerous, and requiring corrective measures; or something
you live with. And after living with it for a while, you dont even
notice it.

th e g e n e t i cs of h omose xuality

One of the outstanding hallmarks of human evolution is the extent


to which our species has divorced sexuality from reproduction. Most
sexuality in other primates is directly associated with reproduction.
Lemurs are only sexually active for a few weeks in January. A male
chimpanzee is rarely sexually active except when stimulated by the
presence of a fertile female, who displays her swollen, purple genitalia.
Whether the actual cues are visual, olfactory, or behavioralmore
likely, some combination of all threeis not precisely known, but it
is clear that our closest relatives are not generally active sexually unless
there is a fertile female involved.
The principal exception seems to be the pygmy chimpanzee or
bonobo, also known as the rare and elusive pygmy chimpanzee or
bonobo. They appear to be far more sexually active than their closest
relatives, the common chimpanzees, and also appear to be sexual in
nonreproductive waysfamously, in females engaging in same-sex
genital stimulation. This tells us far more about chimpanzees and
bonobos than about humans. In any case, the bonobo appears to be

110

behavioral genetics

exceptionalvirtually all other primates are sexually active principally as a reproductive activity.
The human difference is the extent to which we have differentiated
sexuality from reproduction. When you consider the range of human
sexual experiencespostmenopausal, during menstruation, during
pregnancy, oral, masturbatory, et ceterait becomes clear that a surprisingly small proportion of human sexual activity is in fact the result
of the conjunction of a fertile mans penis and a fertile womans
vagina. In this light, homosexual activity seems hardly in need of
explanation. It may be viewed as simply another item in the long list
of nonreproductive human sexual experience. Presumably, it is inscribed in our genes to the extent that lots of nonreproductive sex
distinguishes us biologically from our close relatives.
It may be somewhat surprising to hear that it is only in the past
few centuries that homosexual began to be applied to people rather
than to sexual acts. In ancient Greece, as is well known, a relation of
apprenticeship often entailed sexual activity. In many cultures, homosexual acts take place willingly, and happily, between partners who
are not homosexuals, and who are expecting thereby neither to
reproduce nor to marry. They are relevant as examples of the multiple
meaning of sexual activity among humans, and as a demonstration
of the cultural construction of the homosexual.
Certainly human sexuality is far more complex than a division into
two wordshomo- and heterosexualwould suggest.
Of course, there is also a signicant cultural matrix into which the
genetic basis of human sexuality is cast. Germany in the 1930s strove
to deal with the problem of homosexuality by locating it to defects
in the constitutions of individuals and exterminating those with the
defect. This created strong pressure, in reaction, to consider homosexuality a learned behavior, for this understanding would render the
extermination program ineffectualone could kill homosexuals, but
homosexuality would continually arise. By the early 1960s, the conventional wisdom was that homosexuality was learned, which raised
the question of whether homosexuals should be allowed to teach, on
the presumption that they might be teaching buggery. This created
pressure to see the phenomenon the other waystraight parents

behavioral genetics

111

shouldnt worry about homosexuals teaching pupils homosexuality,


for it is innate.
Certainly, many people feel as though they have always known
they were gay, and that their lives could never have been lived any
other way, for it is innate, rooted in their essence. This is a classic
philosophical issue, essentialism, in which a whole person, a developmentally complex entity, is dened in terms of one innate quality
ascribed to him or her.
As an issue of molecular anthropology, however, we may start out
by asking whether there is an empirical scientic basis for the homosexual, as opposed to homosexual acts performed by ordinary
people. We may immediately observe that by isolating the homosexual as a being fundamentally different from, and opposed to, the
heterosexual, we are setting it up specically as a pathology to be
studied, like someone with cystic brosis or rickets. Is itis that
differencecaused by genes or environment?
Three sets of data have recently been advanced as showing that
homosexuality has a genetic basis. The rst, a study of brain structure;
the second, a study of the concordances of twins; and the third, a
study of the concordance of genetic markers in siblings. Let us say
for the sake of argument that they are valid. Bearing in mind that we
have a strong tendency to regard visible genetic traits as diseases,
because those are what we map, we create the possibility that homosexuality might be treated genetically as if it were a disease.
And in a recent review in the journal Science, thats exactly what
we see. In a chart listing behaviors ostensibly mapped to the genes,
the authors give: mental retardation, Alzheimers, violence, hyperactivity, paranoid schizophrenia, and nestled snugly in between alcoholism, drug abuse and reading disability is sexual orientation.
Regardless of ones own views on sexuality, it is not like cystic brosis;
and it is very far from a value-neutral reading of data to list it this
wayas a pathological phenotype.
Genes Are Tied to Homosexuality and Schizophrenia, a New York
Times callout says. Is homosexuality like schizophrenia? I dont know,
but associating them in this manner is very much a culturally loaded
statement.

112

behavioral genetics

At root is a very simple problem for behavioral genetics. Scientic


analyses sometimes involve unarticulated cultural assumptions, which
are imbued with the authority of science by virtue of being embedded
in scientic analyses. These have to be confronted and scrutinized,
for they are potentially harmful and stand thereby to taint science. If
you cant do science without harming, victimizing, or stigmatizing
people, you shouldnt be doing it. The burden of undertaking something controversial is to do it in such a way that you dont hurt
anybody.
Unfortunately, it is invariably the people most socially marginalized
who are the ones whose behaviors are different, and therefore interesting to study, and therefore easiest to stigmatize. To look at the
genetic basis of homosexuality through the eyes of a molecular anthropologist, we want to know two things: (1) Is this an objective
biological feature that we are studying genetically? (2) Whats the
genetic evidence?
We already have seen that there is a great deal of construction that
goes into the feature of homosexualitynot the least of which is
the imposition of a dichotomy upon the spectrum of human sexual
behaviors and attitudes. That tends to militate against the possibility
of any simple genetic models being applicable. But what about the
actual data? Are they convincing?
The rst line of evidence for a genetic basis of homosexuality came
out on August 30, 1991, when Science, the most prestigious scientic
journal in America, published a short paper by neurobiologist Simon
LeVay entitled A Difference in Hypothalamic Structure between
Homosexual and Heterosexual Men. Comparing the brains of dead
gay male AIDS victims to those of dead straight men and dead
straight women, LeVay found that a tiny region of the hypothalamus
(INAH 3) was larger in men than in women and larger in straight
men than in gay men. Although Le Vay discussed homosexuality as
biological, he did not at that point suggest that his work indicated
that it was genetic or innate. In fact, he said explicitly that the results
do not allow one to decide if the size of INAH 3 in an individual is
the cause or consequence of the individuals sexual orientation. But
to the New York Times, he made it clear that he thought it was the

behavioral genetics

113

cause, suggesting that the hypothalamic segment could be responsible for inspiring males to seek females.
A Newsweek cover story, Is This Child Gay? also featured LeVays
work and characterized him as a champion for the genetic side.
But wheres the genetics?
LeVay studied brains, and the key assumption promoted in the
public arena is that brain structure is a direct result of genetic instructions. But it isnt. The brain grows and develops interactively with
the experiences of the person; brains are not reliable surrogates for
studying genes.
Unfortunately, LeVay never followed up this study, and other brain
analyses have found his results to be very equivocal.
The most interesting aspect of the study is that, aside from the
technology, it is conceptually very unmodern. The logic is that the
brain is a surrogate for the genes, and that a consistent difference in
brain structure implies an innate basis for the thoughts associated
with the brain. Thats entirely wrong, virtually out of a different
century, and affords an excellent illustration of a simple rule of modern molecular anthropology: Genetic conclusions require genetic data.
The second line of evidence for the genetic basis of homosexuality
was a study of twins, showing a high concordance for sexual orientation between identical twins. Twin studies have a long and rather
sordid history as surrogates for genetic studies. The most notorious
were those of Sir Cyril Burt, who found identical twins raised apart
to be incredibly similar in IQ scoresso similar, in fact, that the
statistics describing their similarities didnt change even when his
sample of twins tripled. His power in the English psychology community was so great that nobody dared to challenge him, but upon
his death in the 1970s, it was found that he had invented collaborators, ghostwritten book reviews under their names, and generally
transgressed virtually every boundary separating the credible scientist
from the wacko mad scientist.
Twins are, of course, very powerful cultural gures, the subjects of
old mythologies and many hokey novels. In theory, they should be
good genetic guinea pigs for nature-nurture experiments, but they
arent in practice. For example, the homosexuality twin study found

114

behavioral genetics

52% of identical twins concordant for homosexuality, as opposed to


a control group of adopted siblings, only 11% of whom were both
gay.
Of course, that leaves 48% of identical twins with different sexual
orientations. And the 11% is a much higher estimate of homosexuality
among unrelated people than is generally taken as a reliable estimate
of homosexuality out there.
But more signicantly, this is a very crude comparison. The same
study showed that fraternal twins were concordant 22% of the time,
which seems to t the idea that it is genetic (the value is less than for
identical twins and more than for unrelated people); but ordinary
nontwin brothers were concordant for homosexuality only 9% of the
time. However, genetically, fraternal twins are simply siblings born at
the same time. How could the concordance rate for fraternal twins
be more than twice as high as the value for brothers generally, unless
the study is actually revealing a strong effect of twinship, rather than
of genetic identity?
Twins tend to be treated similarly, and tend to regard themselves
as more similar to each other than ordinary siblingsidentical twins
even more so. This study has not managed to isolate the genetic
similarity of twins and bracket it apart from the overall similarity
of twins. The fact that they are very concordant for a particular trait
consequently tells us nothing about genetics.
A second simple rule of molecular anthropology: Similarity among
relatives is not necessarily, and often isnt, genetic. See Rule #1.
The third study purporting to show that homosexuality is genetic
is the only one, oddly enough, actually to be based on genetic data.
Dean Hamer, a glib and charismatic researcher, led a team that found
an association between a tiny variant segment of the X chromosome
(called Xq28) and male homosexuality, published with considerable
fanfare in Science on July 16, 1993.
At least here we have some genetic data.
But what is the nature of these data and how convincing are they
for establishing a genetic basis for homosexuality?
As already noted, modern genetics relies on establishing a causeeffect relationship between a functional bit of DNA and an observable

behavioral genetics

115

trait. But this study didnt. It found that brothers who were gay
tended to match at this genetic region.
But what is a match? Crucially, the scientists isolated no gene there,
and no physiological product affecting sexual orientation is known
to be made there. The claim made by Hamer and his colleagues is
simply that they found this region to be grossly more similar (83%
matching of small genetic marker regions) in a specic sample of gay
brothers than at random (50% matching). The result hinged not on
a mechanistic analysis but on the statistical difference between the
frequency of gay brothers with similar genetic markers in a specic
chromosomal region and the random expectation.
The cultural meaning they imparted to the result they reported was
that chromosomal region implied functioning gene, which in
turn implied control of trait.
Assuming, of course, that the association was real to begin with.
The tricky design of the study makes it very sensitive to a few families
matching or not, because the key scientic question is not Do we
have a gene for homosexuality? but a surrogate question: Is our 83%
result sufciently different from 50% to be meaningful? A followup study by a different group found no such difference at all. Another
follow-up by the original researchers found the difference now to be
67%, rather than 83%, quite a bit closer to the 50% expected at
random.
Nevertheless, best-sellers were written; careers and fortunes were
made. Born Gay? Time asked on July 26, 1993. And the gay
genewhich has never subsequently been foundentered the popular mind as a fact of science.
For me, however, the most interesting aspect of the study was the
scope of the actual claim. How much homosexuality did these researchers believe they had actually explained with their study? From
the publicity, you might expect the gure to be 90%. Or perhaps a
more conservative 70%perhaps they had explained over two-thirds
of the homosexuality in our species, which would certainly merit
headlines.
In fact, however, when I posed that very question at a conference
in 1996, the answer was very different. It came in two parts. First,

116

behavioral genetics

the result, according to the researchers, was ostensibly only about male
homosexuality and had no relevance at all for female homosexuality;
and, second, they believed they had explained about 5% of male
homosexuality.
Five percent.
If we make a simplifying assumption that male and female homosexuality exist in the universe in equal proportions, then at best
assuming that homosexuality is a property of a person, not of an act,
and assuming all the statistical issues raised are invalid, and assuming
there is actually a gene therethey would have accounted for 2.5%
of homosexuality in our species.
The third rule of molecular anthropology: There is no science other
than behavioral genetics in which you can leave 97.5% of a phenomenon
unexplained and get headlines.
That is the most obvious indicator of the cultural power and meaning of this work, and why it needs to be considered very carefully
and regarded very skeptically. Virtually any claim, no matter how
ridiculously small, can grab headlines. The question is not, Do you
believe homosexuality is genetic? After all, the Constitution of the
United States guarantees you the right to believe anything you want.
The question is, What have we actually shown scientically about
it?
And the answer is, almost nothing.

the scope of b e h a v i ora l v ariati on in humans

The fact is, we already know a great deal about behavioral variation
in the human species. We know that virtually all the detectable behavioral variation between groups of people is the result of cultural
history. Why? Studies of immigrants, acculturation. The fact that
most of your ancestors three, four, or ve generations ago spoke different languages, ate different foods, had different aspirations, led
lives entirely different from yours today.
Odd as this may sound, Americans today are very behaviorally
homogeneous. In the kinds of foods we regard as edible, the sounds
and gestures we regard as meaningful, in terms of making some sense

behavioral genetics

117

of our lives, what we wear, the composition of our dietthe entire


fabric of our daily lives, no matter how diverse it seems, actually
encompasses a very narrow range of the possibilities of variation realized elsewhere in our species.
The point, then, is that the bulk of human behavioral variation is
between groups and is nongenetic. We know this. Imagine trying to
communicate with your own ancestors ve generations ago, much
less with the ancestors of your neighbors. Tremendous amounts of
behavioral change can occur within a few generations, either in the
same place (due to technology and social forces) or by the process of
immigration and internalizing a different set of normative ideas and
values. And all in the absence of genetic change: cultural variation is
the bulk of behavioral difference in our species, it comprises the differences between groups of people, and it is, as far as we know, entirely
nongenetic.
Within groups, there may well be genetic variation. Maybe there
were genetic differences at work constructing the brains of, say, Arsenio Hall and Al Gore. But the behavioral differences between them
are dwarfed by those between either of them and a Sherpa from Nepal.
Both American men wear pants, shirts, and underwear, eat with
knives and forks, have similar ideas about what is edible, what acceptable standards of behavior are for them in various roles as citizens,
sons, fathers, husbands, professionals; they speak the same language,
nd meaning in similar classes of gestures and sounds, and nd similar things funny, offensive, or revolting. None of these similarities
can be taken for granted when comparing people from different
places or times. In the spectrum of human behavior, the great bulk
of its differences are to be found in contrasting the myriad lifeways
of the peoples of the world (which are rapidly being reduced, of
course), which are the result, as far as we can tell, of differences of
nothing but history.
But this raises the question, exactly what are we looking for when
we talk about behavioral genetics? We are looking for a hypothetical
genetic component to account for a very narrow bandwidth of behavioral
diversity in the human species.

118

behavioral genetics

Is it there? That depends on what your standards of evidence are.


So let us think about modern science.
We now know that science is more than just the collection of facts.
Its a process by which some sort of factualness is established in a
specic atmosphere of cultural views, class biases, time and place, and
conicting interests. And human genetics is one area where that is
most obvious.
After all, when a genticist says, Social problems are genetic in
origin, that might be a true statement about the universe. But it
denitely is a grant proposal, a request for funding. If it happens to
be true, its good for business; but merely saying its true may be just
as good.
Now, scientists are citizens and are as much a product of their time
and class and culture as everyone else. Consequently, they are encumbered with similar ideas to everyone else about their place in the
world, about women, blacks, Jews, sexuality, the poor, and so on.
However, saying, Nine out of ten doctors smoke Lucky Strikes
carries more weight than Nine out of ten grocery store checkout
clerks smoke Lucky Strikes. Madison Avenue knew that generations
ago. Scientists are smart; they are scientic. Scientic statements are
authoritative. That places a burden on scientists to be careful in their
social pronouncements and raises a question about the implications
of their being wrong.

re s pon s i b i l i ty a n d th e p ronounceme nts


of h um a n g e neti cs

Madison Grant was a well-heeled, Yale-educated New York lawyer


with a broad moustache and an obsession with biology. Along with
his friend Theodore Roosevelt, he helped to found the New York
Zoological Society. And his 1916 book The Passing of the Great Race
is a classic of American popular social thought.
It argued that America was imperiled genetically by the short, swarthy poor people from southern and eastern Europe immigrating in
large numbers; and that the way to save America was to enact legis-

behavioral genetics

119

lation to sterilize them and restrict immigrationspecically on the


basis of the American gene pool. Grant proposed the elimination of
the weak or unt, beginning always with the criminal, the diseased
and the insane, and extending gradually to . . . worthless race types.
If this sounds un-American, or unmodern, of course it does. Thats
what makes it interesting. Madison Grant wasnt a Nazi, because in
1916 there were no Nazis. But by the mid-1920s, federal immigration
restriction laws were indeed on the books in the United States, and
state sterilization laws were upheld by the Supreme Courts 1927 ruling in Buck v. Bell. These were popular ideas in 1920s America.
I would like to be able to report that scientists rose with indignation
to bash this book. A few, like anthropologist Franz Boas, did. But
most didnt. For example, the book was reviewed by a geneticist from
MIT in Science, and he glowed about it. The book was good for
business if you were a geneticist, because it was fundamentally about
the importance of good heredity in American social life. And the fact
is, it didnt misrepresent contemporary genetics much, if at all. It was
an application of modern ideas about genetics toward the amelioration of social problems; which is why it was reviewed favorably, and
why Grant himself received fan mail from politicians as diverse as
Theodore Roosevelt and Adolf Hitler.
What Grant wrote, a manifesto of the eugenics movement in
America, is actually what most geneticists thought. Its basically what
they taught and what they wrote themselves. Thus, they were able to
promote it as the scientic view of social problems. If you opposed
it, you were branded as being against science, against progress, against
modernity.
It would be a mistake to underestimate these scholars, for there was
some very seductive scientic reasoning here. Madison Grants scientic inspiration was the work of his close friend Charles Davenport,
one of the two most prominent geneticists in America at the time,
who argued about social problems from a scientic, materialist genetic perspective. The genes or germ-plasm, argued Davenport in
his 1911 book Heredity in Relation to Eugenics, code for the brain. The
brain is the seat of the mind. The mind contains the thoughts that
lead to actions.

120

behavioral genetics

Bad thoughts and actions, therefore, are caused by bad genes.


In other words, immorality can in principle be controlled biologically by regulating the births and deaths of immoral people.
Its not stupid or illogical, but it is dead wrong.
In fact, you can pick up literally any textbook of genetics from
the 1920s and nd those ideas. Heres a particularly interesting excerpt from the rst edition of a very widely used textbook from
1925: [E]ven under the most favorable surroundings there would
still be a great many individuals who are always on the border line
of self-supporting existence and whose contribution to society is so
small that the elimination of their stock would be benecial. That
is another distinctly un-American thoughteliminating peoples
stock on the basis of their limited contribution to society! Of
course, its just the poor, but remember Madison Grantwe start
with the poor, and work our way out to worthless race types. The
thought should be unsettlingly reminiscent of authoritative scientic pronouncements we associate with the Germany of several
years later.
The problem is perennial and simple: When science justies violating civil and human rights, it doesnt much matter which people
or which rights. And its always going to be cheaper to kill people
than to operate on them, as we also know in tragic retrospect.
The history of that textbook is instructive: the entire chapter was
deleted from the second edition in 1932. Now, of course, between
1925 and 1932, the market crashed and most peoples stocks were eliminated, which demonstrated pretty clearly that wealth was not necessarily a good predictor of genetic value, something geneticists had
hardly realized before that.
The point of this history lesson is that the facts did not speak for
themselves.
Scientic answers to social issues implied political action. Scientists
such as Davenport knew this and strove for it. Its easy to see
their wrongness in hindsight. But that doesnt help the Americans
who were sterilized against their will or those who couldnt escape
the Nazi regime because of the newly restrictive U.S. immigration
laws.

behavioral genetics

121

Do todays geneticists bear a burden of responsibility for their predecessors wrongness? If so, what is it?
I think the answer is yes, and here is what I think it is: the responsibility to understand what the errors were, to ensure that they dont
happen again. In science, after all, you dont have the right to make
the same mistakes over and overyou only have the right to make
new and creative mistakes.
On the one hand, of course, nobody is seriously talking nowadays
about breeding a better form of citizen. But, on the other hand, we
also know that crime and poverty are not biomedical problems.
Crimes are dened by social convention, and poverty is the result of
social, not biological, forces. The act of taking a human life may be
justied if it is done in time of war, or in self-defense, or to appease
the gods, or in some other context. It is the context, not the mere
action, that denes it as a crime. The crime is specically taking a
human life in the wrong context. Thus, genetics is an inappropriate
arena for contemporary efforts to deal with crime.
That is what brings us back to behavioral genetics.
When the National Institutes of Health decided to sponsor a symposium exploring the genetic basis of crime in 1993, it encountered
an extraordinary backlash. Some trivialized this backlash as political
correctness, suggesting that it was mindless anti-modern, antiscience emotionalism, but others appreciated that critics of the eugenics movementunfortunately largely unheeded until it was too
latehad met with a similar reaction. The fact is, whether crime has
a genetic basis is not a soluble genetic problem, but the idea that it
does have such a basis can easily give rise to extraordinary claims,
which may enter the public consciousness and even shape public
policy.
So we had better be damn sure about them.

a b roa d e r pe r sp ecti ve

A perspective from molecular anthropology would dictate that while


there are empirical data to be collected, we are nevertheless not starting at ground zero. There is an abundance of databoth scientic

122

behavioral genetics

and humanisticon the problem of the genetics of crime. Since


crime isnt an objective entity (theft is contingent upon notions of
property rights; murder is contingent on notions of human rights),
it would be surprising to identify it in the genome!
We know that scholars over several generations believed that they
had found an organic basis for crime, only to have fundamental aws
revealed in their research. Before the days of DNA analysis, Harvards
Earnest Hooton measured the skulls, faces, and bodies of thousands
of prison inmates and compared them to model citizens to see
whether criminality was identiable in the constitution of the criminal, marked in his body. And Hooton concluded that the criminals
were indeed slightly different physically on average from volunteer
remen.
But it turned out that there were small differences in the composition of his criminal and control populations. For example, the criminals averaged four years younger and twelve pounds lighter than the
remen. These differences were, of course, minor, but four years can
make a difference in ones face and body. So the fact that he could
nd subtle physical differences between his criminal and control populations did not mean that they differed because of criminality, but
perhaps simply that they were not perfectly matched.
Hootons point was unconvincing and was thus valueless as scientic evidence. Science, after all, is supposed to be convincing knowledge. Harvard University Press published his ndings as volume 1 of
The American Criminal, but never released a second volume. Although it was useless for the scholarly community, Hooton packaged
the work for a popular audience under the title Crime and the Man.
The 1960s saw another vogue in criminal-genetic associations. The
Y chromosome has but one major trait associated with itmaleness.
Maleness is genetic, but is very difcult to distinguish from masculinity, the cultural construction of maleness. So the Y chromosome
is the focus of both genetic and cultural meanings, which may have
a considerable impact on the life of the 1 in 1000 boys born with an
extra one.
The geneticist Patricia Jacobs and her colleagues found in a 1965
study that 3.5% of the inmates in a mental/penal institution in Scot-

behavioral genetics

123

land had an extra Y chromosomefar more than the percentage of


XYYs at large. Although they carefully stated that they did not
know whether aggressive behavior was the cause of XYYs overrepresentation in the institution, they nevertheless made it clear that
they had undertaken the investigation on that assumption.
The logic, however, is cultural: the Y chromosome determines
maleness; men are more aggressive than women; so men with an extra
Y chromosome should be extra-aggressive. Nevertheless, by that reasoning, the XYY men should also spend more time watching football
on television, burp more frequently in public, and be especially good
at math. But those traits werent examined. The men were simply
found to be disproportionately institutionalized.
The culturally loaded interpretation of such ndings began to have
its effect. In 1968, a false newspaper story gave an extra Y chromosome
to the mass murderer Richard Speck. In 1971, Bentley Glass, a distinguished geneticist, called for a new and presumably benign eugenic
program to help rid us of sex deviants such as the XYY type. And
the third, 1992 installment of the Alien movie series takes place on a
remote penal colony in outer space, reserved for the most dangerous
criminals in the galaxythe XYYs.
But more detailed studies of XYYs were showing that they were
not hyperaggressive and supercriminalistic at all. The overrepresentation in mental-penal institutions was real enough, but
XXYs were also overrepresented, even though they had the opposite
of the extra violence chromosome! The people with abnormal chromosome congurations were apparently more prone to being caught
than to committing crimes.
A screening program was soon set up to detect newborns with XYY
syndrome and monitor them, but the projects design confronted
researchers with a catch-22: unless they deceived the parents of an
XYY son, they would be underwriting a self-fullling prophecy, because the parents would be raising the boy in the expectation that he
might have criminal tendencies. Under protest, the screening program was therefore aborted. But some years later, the geneticist who
had published the original study castigated environmentalists who
clearly felt threatened by the suggestion that there might be a genetic

124

behavioral genetics

component to behavioras if they were the ones who had introduced social politics into science.
The problem was that the original scientists were insufciently attuned to the social/political consequences of what they were doing.
On the scientic side, the male attributes provided by the additional
Y chromosome appear to be limited to height and acne. The greater
likelihood of incarceration for aggressive behavior may, moreover, be
a simple consequence of something well known in genetics, that adding extra chromosomal material generally reduces intelligence and
survival. The Y chromosome, being very small and having few genes,
permits a higher survival rate and compromises intelligence less than
other extra chromosomes do. Thus, most XYYs tend to be ordinary
people, unaware of their genotype and with no reason to suspect that
it might be anything other than normal.
Much later, oddly enough, both Hooton and the XYY work were
cited favorably in an overtly political 1985 book advancing the genetic
basis of crime by Richard Herrnstein, a decade before his book The
Bell Curve.
The problem seems to be that saying crime is genetic is newsworthy,
when proving it is what ought to be newsworthy. In human behavioral
genetics we nd an extraordinary pattern in which claims for genetic
associations to behaviors are made, along with a self-serving plea for
more funding and studies to corroborate this preliminary result,
and then a less widely reported failure to corroborate it. The examples
are legion: alcoholism, depression, novelty-seeking, schizophrenia,
homosexuality. . . . When Dean Hamers group reported nding a
genetic link to homosexuality in 1993, the news made page 1 of the
New York Times; but when another group a few years later looked for
that same genetic link using the same methods, and failed to nd it,
they only made page 17.
The question for behavioral genetics is: What do we know now
that makes this modern science? What have we gained from Davenport, or Hootons study of criminals, or the XYY syndrome, that
makes us believe that there is a biological basis of crime, and that we
can study it scientically? What do we know that they didnt? Can
we show that we are not just committing the same intellectual mis-

behavioral genetics

125

takes over and over againonly now aided by different and newerfangled technologies?
The tragedy is that usually we cant. Between the self-interested
pronouncements of behavioral genetics and the conservative social
and political interests who recognize that an innate basis for behavioral deviance complements their agendas, we really have little to
guide us in locating the ostensible scientic basis for understanding
human behavior.
One often hears the challenge to nd something wrong with the
studyto shoot it down. You have criticized it, youve raised questions, so the challenge goes, but you havent refuted it. The answer
is simple: I dont have to.
The burden of proof in science always falls on the claimant, not
on the critic. The challenge prove me wrong is the classic signature
of the quack and the charlatanthe one who wants you to believe
that Martians built the pyramids, or that they are communicating
with the dead, or that their body encases the reincarnated spirit of
the Queen of Atlantis. Scientic credence requires high standards of
evidence. Speculations are cheap, and youre entitled to believe whatever the hell you want, and even to make a buck off it, but if you lay
claim to the authority of science for your beliefs, you must expect to
be subjected to extraordinary demands.
And quit whining about it.
Sometimes we cant even identify the fallacy. Recall the Manoilov
blood test of the 1920s, which could distinguish the sex, race, and
sexual orientation of a person. You simply added a few chemicals,
shook the sample, waited, and watched. In itself, not that incredible,
although it was before the discovery of the human sex chromosomes
or any way to examine them reliably. Perhaps Manoilov had unknowingly developed a crude assay for hormone concentrations?
The interesting thing is that it engendered much interest and little
criticism in the scientic literature.
Hooton, the leading American student of race, would have welcomed such a test, but couldnt accept Manoilovs. It was not so much
that he knew Manoilovs results to be wrong; he knew them to be

126

behavioral genetics

impossible. They were so weird from the standpoint of critical anthropological thought that right and wrong didnt even seem to
apply.
Manoilovs blood test seemed to make a lot of cultural sense, however. After all, blood is a powerful metaphor for heredity. We quite
commonly talk about traits being in the blood. But being a Russian
or a Jew (tellingly, Manoilov assumed that you couldnt be both!) was
a fact of social history, not a literal question of blood. Being a Latvian
or a Pole was political history, not natural history. As Hooton summarized it in his 1931 text Up from the Ape: The results of the Manoiloff test do not inspire condence. . . . It is inconceivable that all
nationalities, which are principally linguistic and political groups,
should be racially and physiologically distinct.
Hooton, it should be noted, never identied a technical, methodological aw in the blood test. To this day we dont know what
that curious test was actually testing. Most likely it was simply verifying the investigators expectations.
Another anthropological generalization about science: its very easy
to come up with results you already believe.
Manoilovs work was still being cited in genetics textbooks into the
1940s, however. And why not? It was technological, it was statistical,
it was quantitative, and it was methodologically explicit. But it was
nonsense.
Its a fools errand to try and identify a methodological problem
with every study making a claim about biological differences among
people. What we can do, however, is integrate scientic and humanistic knowledge about our species to identify the major cultural fallacies associated with these studies, and help point usby counterexamplein more fruitful scientic directions.

behavioral genetics

127

Six
folk heredity

The history of genetics would be no different if Gregor Mendel


had never been born. The eld was not at all inuenced by his ideas,
and it wasnt until thirty-ve years after his work, in 1900, that other
scientists independently hit on the same results, only to nd that he
had scooped them by decades. In creating a new science, actually
given the name genetics by the English biologist William Bateson
in 1906, they adopted Mendel as a gurehead.
Mendels Two Laws, now universally memorized by college biology students, were not even formally codied as such until the
American geneticist Thomas Hunt Morgan did so in 1916. Prior to
that, geneticists simply wrote about Mendels Law and proceeded
to describe it vaguely, without the trappings of a lawlike proposition.
Today, we follow Morgan and pay homage to Mendel by recognizing two explicit scientic laws of heredity, which we usually express
in abstract alphabet-soup form. The rst governs the transmission of
a single gene. This Law of Segregation tells us that genes come in
pairs and can mask one anothers effect, but only one of each pair is
transmitted to offspring. The masking of one gene sequence by
another means that a phenotype (what you appear to be) is not a

128

reliable guide to a genotype (your genes). The same phenotype can


be the result of different genotypes.
The second law, the Law of Independent Assortment, governs the
transmission of different genesor at least, of genes on different
chromosomes. It tells us that because of the statistical behavior of
chromosomes during cell division in the reproductive organs, and the
random association of egg and sperm, Like doesnt necessarily beget
Like. Organisms can have offspring with visible features (phenotypes)
unlike their own. Two people with brown eyes and without cystic
brosis can have children with blue eyes and cystic brosis, or either
of the two traitsalthough theyre not both equally likely.
Such formalizations constitute the core of the modern science of
genetics. Subspecialties have their own laws, for example the Central
Dogma of Molecular Genetics: to wit, that in higher organisms,
DNA encodes RNA, which contains the code for proteins.
Genetics is recognizable. You know it when you see it, because of
the terms it uses: chromosome, gene, allele, heterozygous, phenotype.
You know it because of the ways it validates itself: blots, bands, gels,
sequences.
Genetics is the scientic study of heredity. While that may sound
redundant, it isnt. There are other, nonscientic approaches to
heredity. There is the old European idea, for example, that children
inherit the attributes their parents gained during the course of their
lives. While this is true of trust funds, it isnt true of physical, bodily
features. After all, throughout the course of the parents life, the features they will pass on are already sequestered away in the cells of
their reproductive organs. In premodern Europe, it was widely held
that an adulterous woman would nd her lovers traits in children
she bore many years later. The Tsonga of southern Africa hold that
the mother contributes nothing to the child she bears; the Trobriand
Islanders of Melanesia hold the opposite, that the mother contributes
all.
Often these ideas about heredity serve to justify other beliefs, such
as whether a child belongs to its mothers or fathers lineage; or to
whom the child is an heir. This is because there is no obvious reason

folk heredity

129

to distinguish formally between heredity (as in biological transmission) and inheritance (as in social transmission).
A scientic theory of heredity, of course, nds it necessary to make
precisely that distinction, and to make certain that the transmission
of sickle-cell anemia is differentiated conceptually from the transmission of Aunt Minnies silverwarealthough both may run in the
family. Failure to do so might suggest to someone born with one of
Aunt Minnies silver spoons in their mouth that their advantages in
life were simply natural, a part of their biological endowment. Or
conversely, that someone born without such advantages in life deserves no more.
This was the core of the nineteenth-century philosophy called social Darwinism. By confusing the biological fact that people arent
identical with the social observation that people arent equal, social
Darwinism developed a conservative political philosophy that justied existing social hierarchies as natural facts. The wealthy and powerful were in their rightful place by virtue of the survival of the
ttest, a phrase Darwin had not coined but had ultimately come to
accept as synonymous with his own natural selection. The political
implication was that the existing social hierarchy was natural, and
consequently that any attempt to alter it would represent a subversion
of nature. The people on top were there for a reasonthey were
simply better, and deserved their position; the cream had risen to the
top. Thus, ideas like welfare, labor laws, and other social programs
geared toward promoting social mobility were bad and should be
abandoned, because ultimately they would only y in the face of the
way things had evolved to be.
The power of this view, both as a genetic-sounding theory and as
scientic justication for a political movement, is evident in the popularity of 1994s The Bell Curve, which made headlines, magazine
covers, and talk shows because of its thesis that (as evidenced by
pencil-and-paper tests) the lower classes were innately intellectually
inferior to the upper classes, and that consequently nothing can be
done about it. And therefore nothing should be done about it.
New factoids and new ethnic groups are plugged into the holes,
but the theory is over a century old. And its fallacy is as simple today

130

folk heredity

as it was in 1900: it may sound like a theory of genetics, but it isnt


one.
It isnt a theory of the science of heredity. Its a theory of a different
order of ideas about heredity. Cultural ideas about heredity. Folk
heredity.
These ideas are tenacious. They sound as though they might be
true. They often make sense. They sound as though they might even
be scientic, because they can be dressed up in the vocabulary of
genetics. More than that, like their predecessors, they are generally
unthreatening to the dominant social classes, because they serve to
reinforce and justify that dominance. Sad to say, scientists (even geneticists) frequently believe these folk ideas about heredity, because
scientists are members of our culture and grow up internalizing its
values and folk ideologies. That is why the perspective of anthropology is particularly valuable in coming to grips with the science of
heredity.
The combination of anthropological knowledge and genetic data
allows us to identify four cultural ideas, which translate into scientic
fallacies, about human variation.

ta x on om i sm

We saw earlier how the idea that there is a small number of basic
kinds of people, equivalent to subspecies, accounts poorly for the
patterns of biological variation we actually nd in our species and is
actually a construction of social history. Humans differ from one
another, but the difference is patterned locally, not continentally.
Nevertheless, it is human nature to construct difference and impose
meaning on it (that is largely what we mean by culture), and since
the eighteenth century it has become the dominant cultural view that
the peoples of Africa are categorically equivalent to one another, the
peoples of Asia are categorically equivalent to one another, the peoples
of Europe are categorically equivalent to one another, and each is
categorically distinct from the other two. This isnt false simply because of the interbreeding that has occurred between members of the
different races, or simply because of the large migrations that have

folk heredity

131

taken place over the millennia. Its false because of the assignment of
meaning: it makes differences among Africans meaningless and differences between any African and any European meaningful. More
than that, it makes anyone with any known African ancestry meaningfully different from anyone with no known African ancestry.
And those are not biological patterns.
So we can call the anthropological fallacy of treating human biological variation as if it were actually partitioned into natural subspecies taxonomism. Taxonomism imposes qualitative distinctions between people where none exist in nature.
Geneticists have been particularly susceptible to taxonomism because the presumptive differences among groups being highlighted
are supposed to be genetic. Given (1) the knowledge that races must
be found in the human species and (2) the idea that they are supposed
to be genetically bounded entities, it is not surprising to nd that
geneticists have maintained some authority in race classication for
much of this century.
Perhaps the most illustrative example can be taken as the swan song
of this line of argument, a 1963 review article in the journal Science
by the distinguished biochemical geneticist William C. Boyd. Boyd
begins by telling the reader, Racial differentiation is the end result
of natural selection . . . in a population sufciently isolated genetically. But he crucially fails to distinguish here between populations
(which are local) and races (which are presumably larger). If a population is all that a race is, then there are many, many human races,
and the word loses its meaning. A race is supposed to be a megapopulation, of which there are few.
In fact, Boyd came to the conclusion that there were thirteen of
them. But an examination of his races shows them to be repositories
of cultural knowledge rather than objective tallyings of biological
patterns. For example, Boyd names ve races from Europe, but only
one from Africa. Thus, he formally differentiates the Basques of the
Pyrenees from Mediterraneans, and Northwest Europeans. But
the tall, thin Nilotics of East Africa, the pygmies of Central Africa,
and the small-jawed and at-faced Khoisan of southern Africa merit
no such distinction.

132

folk heredity

Apparently, they all looked alike to him.


And establishing the Basques as a unit of the human species equivalent to Africansas if they had green skin and square heads!is
a highly arbitrary judgment. It was based on their high proportions
of Rh-negative blood, which is very likely a genetical trivium here
being elevated to transcendent proportions.
The point is that no formal division is objectively discernible, and,
as noted earlier, we have no explanation for what it would represent
in evolutionary terms if it did exist.
The problem with taxonomism is not so much that it creates opportunities for prejudice, as any classication invariably may (although that problem lies with the prejudiced person, not necessarily
with the classier). Rather, the problem is that it creates an opportunity for some very badly designed research. Thus, under the regime
of taxonomism, if I wish to study some aspect of the biological diversity of the human species, I had better not confuse the Mediterranean people of Italy with Northwest Europeansbut essentially
any Africans can represent that continent.
If this sounds like a silly worry, consider that just such a study of
human variation was published in the prestigious Proceedings of the
National Academy of Sciences in 1991 and generalized about the gene
pool of Africans from a sample of Mbuti and Biaka pygmies! Africans are Africans, under this fallacy, and any is as good as any
other.
But the Basques! Now theyre supposed to be different! In point of
fact, of course, a Basque in a roomful of French and Spanish people
would be indistinguishable from them either genetically (Rh-negative
blood can be found in people of all origins) or any other way than
culturally. Basques pride themselves on their cultural distinctiveness
and have a history of political separatism. They emphasize their differences from the peoples who surround them.
And thats the problemthe conation of cultural and natural
patterns of variation.
Many genetic studies have uncritically sought to analyze the genetic distances between the three races, where genetic distance is
an abstract measure of differences between populations, and the three

folk heredity

133

races are black, white, and yellow, or Negroid, Caucasoid, and Mongoloid, or African, European, and Asian, depending upon your lexical
fancy.
Two papers published by distinguished geneticists in 1974 show the
taxonomic fallacy at is rawest. Stanford geneticist Luca Cavalli-Sforza
showed in the Scientic American that genetically Europeans and Africans were most closely related and had diverged from Asians about
35,00040,000 years ago. But using the same class of data and similar
taxonomical assumptions, but different statistical tests, Masatoshi
Nei of the University of Texas showed in the American Journal of
Human Genetics that genetically Caucasoids and Mongoloids were
most closely related and had diverged from Negroids about 115,000
120,000 years ago.
Obviously, the two sets of conclusions are incompatible. You dont
have to be Aristotle to see that. Both scholars were and are competent,
indeed brilliant, population geneticists. But actually, more likely than
not, both were wrong.
What they lacked was a grasp of the underlying anthropology. They
assumed that the familiar racial groupings had real, biological significance and used those groupings to structure their scientic questions.
As the saying goes, Garbage in, garbage out.
In fact, as noted earlier, the three categories are not even equivalent
to one another. Africans comprise a diverse paraphyletic group, subsuming the ancestral gene pools of Europeans and Asians. This makes
such a three-way comparison scientically meaningless.
But even more signicantly, Cavalli-Sforza and Nei were working
within a framework that assumed divergence as the principal microevolutionary process. In other words, they assumed that programming a computer to show a branching tree representing differences
among races would necessarily imply a literal branching divergence
of those races. But in fact the history of the world has been far more
complex, for the history of human populations is reticulated, like the
capillaries of the circulatory system, diverging and fusing. The computer program wasnt representing the process accurately and it was
too easy to misread the output. One of the papers even used black
Americans as stand-ins for Africansboth, after all, are Negroids.

134

folk heredity

In all, the cultural knowledge they brought to the scientic analysis


screwed it up. Race is a concept derived from cultural knowledge,
not from biological analysis. The problem is that our cultural knowledge seems so natural to us that its hard to recognize it for the artice
it is.
Thus, a correspondent of mine writes that he has solved the problem of race. It isnt a social construction, he saysit is real, like an
extended family. A race is just a very extended family, he says.
Now, as it happens, aside from race, another thing that anthropologists have studied quite a bit over the past century is the family.
One of the most distinguished recent students of that institution was
the late University of Chicago social anthropologist David Schneider.
And one of Schneiders most interesting observations was that Americans have some strange presumptions about the family. For example,
Americans take great pains to distinguish natural facts (whats objectively out there) from phenomena that are confabulations of the
human mind. And they believe that the family is based on the former,
rather than the latter.
But that doesnt stand up well to critical reection. My correspondent imagines himself at the center of a sort of familial spiderweb,
with his relatives radiating outward and the boundaries of his race
simply far away.
But that is just imagination, for families arent built that way. They
involve not only genetic ties but symbolic tiesparamount among
the latter, of course, being the symbolic tie of marriage.
Genetic ties, in fact, form a relatively small part of what composes
a family: all those aunts and unclessome blood relatives, some related by marriage; all those step-, foster, and in-law relations; all those
ex-spouses and ex-families; all those unacknowledged offspring. That
is as true for the tribe of Americans as it is for any other tribe, as
anthropologists have long acknowledged.
What my correspondent didnt realize is that a family is a social
construction. The dichotomy between natural facts and cultural facts
is actually a false one, for both sets of facts work together, and they
are often inseparable in imparting meaning to our world. In families,
there is certainly a relationship by blood, and there is considerable

folk heredity

135

signicance attached to it. But it neither encompasses nor is the key


and overriding component of the family. After all, I am blood kin to
my daughter, but not to my wife. And she is at the very heart of our
family.
We create families by conventions (marriage; adopting a fathers
surname) that embellish the natural genetic linkages with a host of
cultural associations, which are in turn no less familial for being cultural. Sometimes the genetic linkages are embellished; sometimes they
are obscured.
So the spiderweb metaphor fails to encapsulate the reality of the
family. It cant tell me the answers to questions that would be answerable if families were natural, genetically based, objective entities. Where does one family stop and another begin? How many
families are there, how can I tell them apart, and how do I know
which oneor how manyI belong to?
The answers arent found in biology or genetics. They arent out
there as natural facts simply to be discovered. They are there to be
considered and interpreted, as examples of the myriad ways in which
the worlds societies track and make sense of social relations by creating distinctions and imposing meaning on them.
And it is the same with race. Races arent there as natural facts,
they are there as cultural facts, which overwhelm and redene the
relatively minor biological component they have.
My correspondent is right. The race is like an extended family,
although for the opposite reason that he imagined!
Taxonomism, then, is the fallacy of taking races to be units of
nature. Races are real, as families are real. But they are units of cultural
meaning, not units of biology. There is biology thereI am genetically related to my parents and to my daughter, and the Swiss are
closer to the Italians than to the Rwandansbut they are not fundamentally natural entities like Drosophila persimilis, or Cetacea, or
lithium, or Betelgeuse.
As noted earlier, we can, of course, make comparisons between
groups of people and study their differences. The problem is invariably what meaning to assign to those differences. If we know that

136

folk heredity

there are gradients, not boundaries; that human variation is patterned


locally, not transcontinentally; that the extremes are not the purest
representatives of anything, but simply the most divergent; that populations are invariably mixed with their neighbors, and in the last
half-millennium with people from far away; and that clustering populations into larger units is a cultural act that values some differences
as important and submerges othersthen race evaporates as a natural
unit.
The term has no technical meaning, only a colloquial one. I use
the word because everyone knows what it means (sort of ); but Im
not talking about anything formal when I do. I use race the way I
use angels or psychic energy.
Human differences are just thatdifferences. The differences between a black person and a white person may be due to many things,
but if we begin by assigning them to races, then those differences
become racial differences. Likewise, the difference between a group
of Swedes and a group of Kenyans is only racial if you begin by
imagining them to be representatives of larger, mutually exclusive,
entities.
I was sitting in my ofce recently when a young female student
came in. She wasnt in any of my classes but knew of my interests
and that I had written widely on the subjects of genetics and race.
Her question was simple: Could I recommend a genetic test that
would tell her what she was?
How could she not know what race she was? She had fair skin,
hazel eyes, and straight, dark hair. Not exactly a racial poser for the
ages. Obviously, there was something here that the student wasnt
communicating to me. She said her ancestry was mixed, and I
explained that so is everybody elses.
But she was in emotional pain, and she had a sad story about
adoption and about not knowing her parentage. She wanted me to
suggest a genetic manner of telling what her ancestry was. I explained
that no such test exists. There are some genetic features that are more
common in some groups than others, but theyre just not racial markersyou dont have to be African to have the sickle-cell allele. Per-

folk heredity

137

haps if we used several different markers, and got lucky, we could


make a guess that she had some West African or Native American
ancestry. But she could be black or Amerindian and lack those features, or as white as the driven snow and have them. Thats just the
way heredity works.
But it was clear just from looking at her that if she had any recent
nonwhite ancestry at all, it wasnt much and was unlikely to be detectable genetically.
Finally, I asked the question that had been puzzling me. Exactly
what did she think she was, and what did she think she was mixed
with?
She obviously was greatly distressed by the fact that she did not
feel comfortable without a racial identity. And white was certainly
not adequate to her. I told her that she looked like anybody else from
northern or central Europe, and that that wasnt esoteric anthropological knowledge, just common sense. And of course, she could
have had a distant ancestor or two from pretty much anywhere, from
a Bafnland Eskimo to a Kenyan cattle herder, but in appearance
she seemed at least mostly of European descent. What was the problem?
No, there was more, she conded. She believed she might have
some Middle Eastern ancestry.
If there were ever a time that the peoples of the Middle East were
not in genetic contact with those of Europe, I explained, we dont
know of it. From the start of recorded history, we hear of dispersals
of peoples and migrations. They have probably been going on since
Europe and the Middle East were inhabited. And certainly for the
past few thousand years, the entire Mediterranean region has been in
quite extensive genetic contact.
A genetic test couldnt do it. Only a magic test could enable you
to distinguish European from Middle Eastern ancestry. She had
believed so strongly in the symbolic, folk heredity of racial differencesof labeling people taxonomicallythat she was grasping at
the straw of genetic testing to try and help her achieve an identity
she felt she lacked. An identity she felt she needed.
She left disappointed.

138

folk heredity

ra ci s m

Aside from the sadomasochistic lunatic fringes, you wont nd many


people in present-day America who will stand up and cheer for racism. We grow up learning that racism, whatever it is, is bad.
Unfortunately, it is a term that is so overused that it is in danger
of losing its power. The problem is that we learn that racism is bad
without learning exactly what racism is. Sometimes we hear, for example, that it is racist to say that crime is genetic. If thats true, its
true only very indirectly, only insofar as crime rates correlate in America with race. Its dumb to say that crime is genetic; its the fallacy of
hereditarianism (see below) to say that crime is genetic. But I dont
think its necessarily racist, because it doesnt specically say anything
about the presumptively natural groups of humans called races.
Likewise, we sometimes hear that racism is about the exercise of
social power, and that therefore poor people cannot be racists, because
they lack social power.
But that is also unsatisfactory, for the same reasonit eliminates
race from the concept of racism. If racism is really about power,
it seems to me that it should be called powerism. And furthermore,
there is something a bit unsettling about turning a blind eye to hateful
poor people. Cant they be just as racist as rich people? Although they
lack the institutional means to implement their hatreds, history shows
that angry mobs can be awfully destructive every now and then. Why
should they be absolved of responsibility for their hatreds simply on
account of their lower socioeconomic status?
Racism is, somehow, about race; but its different from the folkhereditary idea that all people can be naturally clustered into a few
big groups. Racism is a folk-hereditary fallacy that presupposes the
existence of such groups and judges individuals by recourse to the
properties of the groups to which they are assigned.
Its bad science because it is anti-empiricalyou dont need to learn
whether any specic black man is stupid, because you know ahead
of time that black people are stupid; you dont need to know whether
any specic Jew is cheap, because you know ahead of time that Jews
are cheap. And its politically abhorrent, because it is a fundamental

folk heredity

139

principle of our modern democracy that people should be judged as


individuals and not by properties attributed to their groups.
Hence the obvious analogy to sexism, where the categories are more
natural, but the fallacy is just the same.
Racism is a folk-hereditary fallacy because its central presumption
is that the attributes of the race have inscribed themselves on the
constitution of the member.
It is important to note that the fact that races dont exist as natural
entities has no bearing on racism. Racism exists as a real, social fact.
In other words, racism directed against Jews, Irish, and Puerto Ricans
is no less racism by reason of the fact that its victims are not members
of natural biological units.
That is less of a paradox than it may seem. Christianity exists as a
social fact, whether or not God exists as a natural fact; and of course
the workings of the Church in shaping the modern world have been
far more obvious than those of God. Social facts can be immensely
powerful forces regardless of whether there is a basis in nature for
them.
The major paradox of twentieth-century anthropology is that it
arrogated to itself the denition of what the real races are, particularly with the accession of the Nazis in Germany. Physical anthropologists in America were at great pains to denounce Nazi policies
and ideologies, focusing particularly on their racial isolation and
persecution of Jews and Gypsies. American physical anthropologists
criticized the Germans by denying that Jews and Gypsies were really
races; for only a true expert knew what a race really was.
Well-intentioned as the argument was, it was like medieval scholastics debating about angels. The issue wasnt race, it was racism.
People who hate Jews do so independently of the pronouncements
of scientists (although scientists can lend tragic credibility to their
bias), and independently of the facts of genetics (although natural
differences can appear to lend credibility as well). Racism exists with
or without science to back it up. Scientic racism is abhorrent to
those who wish science to be benign and liberating, or at least neutral. But to see genetics invoked for oppressive ends taints science
with the hue of demagoguery. So dewy-eyed geneticists sometimes

140

folk heredity

tell us that genetics will undermine racism by showing that races


dont exist.
Dream on.
The problem, as a molecular anthropological perspective can reveal,
is that group hatreds are not genetic but folk-hereditary issues. For
what biological property can indelibly inscribe itself upon the core of
every member of one group and upon no members of another? People
ght over many things, and frequently they vilify and demonize their
opposition in order to win. To the extent that the opposition consists
of groups of people, those people become objects of hatred because
they embody the nature of the dispute.
But the embodiment is symbolic, not biological.
So genetics wont go very far toward solving the problem of racism,
because racism hasnt much to do with the science of genetics. It
existed long before genetics.
Theres another aspect to the linkage of genetics and racism. Im
always astonished to nd it asserted in the sociobiological literature
that humans have a deep hereditary propensity for xenophobia, fear
or hatred of others, or more grandiosely, a genetic basis for genocide.
Now of course, one needs to tread a delicate line here. One does not
want to celebrate or glorify martyrdom and victimization, for that
serves to parochialize the experience and limit its meaning. Genocide
is an enormous tragedy and acknowledging its universality helps to
promote the empathy that may discourage future holocausts. But
what are the implications of saying that its genetically based? After
all, in acknowledging its universality, one does not want to trivialize
genocide either.
The argument presented in sociobiology, and often presented as
science, is how easy it is to hate and want to kill others unlike you.
So easy that its virtually universal. Xenophobia appears to be widespread in the human species. It knows no racial boundaries. So everyone has the taint of evil about them; no group is immune to it. But
exactly what constitutes the fear or hatred of others? How do you
actually know who the others are? How can you recognize them
when you encounter them? What really are those people unlike
you, and how have they come to be unlike you?

folk heredity

141

It is not, of course, reasonable at all to suppose that group antagonisms occur only between genetically or biologically different peoples. Were the Hatelds and the McCoys biologically distinct from
each other? Or the Viet Cong and the South Vietnamese? Or the
Bloods and the Crips? And thats precisely the central point: xenophobia, whatever it may beor more to the point, the perception of
otherness, of aliennessis not based on natural differences. Its
based on language, the deity worshipped, traditions, diet, activities,
beliefsthings that are learned, not things that are innate.
Alienness is thus a construction, not a fact of nature. Whom you
perceive as foreign, or who is to be suspected or hated or even worthy
of death, is generally based on cultural traits and on cultural histories.
The greatest genocidal hatreds are between peoples who are biologically very similar: Hutu and Tutsi, Bosnians and Serbs, Israelis and
Palestinians, Huron and Iroquois, Germans and Jews, English and
Irish.
That is why I think the argument for the potential universality,
and hence the genetic basis, of genocide is a biologically trivial one,
because it presupposes a natural difference between the two groups,
the oppressors and the victims, which often does not exist. How, then,
can it possibly be important in explaining or understanding the meaning of genocide?
Whom your group hates is dened culturally. Why your group
hates them is dened culturally. What youre expected to do about
it is dened culturally. There is no merit that I can see in talking
about any biological basis for genocide, because such a basis, if it even
existed in the rst place, accounts for nothing.
The lesson of the Holocaust, therefore, lies not so much in the
attempt on the part of one group to destroy another, which is indeed
a recurrent tragic theme of human global history, but rather in the
recognition that it was carried out by Europeans against themselves,
and that it took place in an age in which some form of enlightenment
was thought to have existed.
What we gain from presupposing genes for genocide is unclear. All
this serves to do is to absolve the guilty of responsibility, because It

142

folk heredity

wasnt our fault, it was just human nature, which is certainly a perverse use of genetics.
So to the extent that we can establish that racism is not biologically
signicant, the genetic basis for it is meaningless.
More to the point, it is folk heredity.
But the fallacy of racism does not only make itself felt in the form
of genocide. The central fallacy lies in dehumanizing a person because
you perceive them as a member of a group and not as an individual.
This cuts both ways.
I was recently asked to review a book about an issue the author
melodramatically regards as the subject of a conspiracy of silence, for
it is apparently taboothe genetic superiority of blacks in sports.
Now, everybody knows that blacks are prominent in major sports.
Look at basketball, look at defensive secondaries and running backs
in football, look at boxing. But how do you get from prominent
to racially superior? There are three major sets of variables at work
in making someone prominent in athletics: individual aptitudes
(whatever they might be), social and cultural setting (including expectations, opportunities, what is considered a respectable occupation, and the like), and any group endowments. With three causes
and one effect, you cant reasonably draw a conclusion about the
origin of black superiority in sports.
Thus, there are rather few possibilities for someone to conclude
that racial superiorities are at the heart of the observed prominence
of blacks in sports. Either the speaker is incapable of rigorously drawing conclusions from data or else the racist conclusion preceded, and
is independent of, the data.
The author indignantly denies being either illogical or a racist. He
insists he wasnt saying blacks are innately worse than whites, as for
example Herrnstein and Murray did for intelligence in The Bell Curve
(which he took pains to repudiate), but rather, that theyre innately
better.
But whether you think they are better or worse is a trivial difference, for the fallacy lies in attributing any innate property at all to
them in the absence of genetic evidence.

folk heredity

143

The issue is, what constitutes scientic evidence, and a rigorous


scientic argument, for innate group-level differences? You can point
to Afro-Caribbean sprinters, or Kenyan marathoners, or Michael Jordan and the NBA until the Second Coming, and it wont say anything
about the genetic propensities of black people in athletics, any more
than the brilliance of Jack Benny and the predominance of Jews in
comedy indicates the presence of comedy genes in Jews. The fallacy
of The Bell Curve is not that it focuses on the supposed racial basis
and innateness of an undesirable traitstupiditybut that it infers
the innateness of the trait simply from observation of predominance
(of the other races). In fact, the athletic argument is essentially identical to The Bell Curves: Look, theres such an obvious and consistent
pattern of this trait in those people; it must be innate; Q.E.D.
The fact that something is consistently observed does not imply that it
has a genetic cause. We know that. If you want to argue about science
and about genetics, you need controlled data and genetic data.
The author demands a refutation, calling me (and placing me in
some pretty ne company) an environmentalist, to make it sound
as if I were a tofu-eating tree-hugger. But as we noted earlier, it is a
basic tenet of science that the burden of proof always falls upon the
claimant. I dont have to refute the claim that blacks are racially
superior as athletes, any more than I have to refute the claim that
angels cause mutations, or that stepping on a sidewalk crack breaks
your mothers back. If you want to participate in a scientic discourse,
you have to abide by its rules, or youll end up shaking your st at
the sky and muttering, The fools! They called me mad! But Ill show
them. . . . Ill show them all!
What would it take to demonstrate that blacks are innately gifted
as athletes by reason of race? Above all, it would require delimiting
the problem in a far more precise manner and confronting the complications surrounding the answer. It would involve acknowledging
the complexities of life histories, the lack of rigorous data on the
subject, the ease with which cultural stereotypes can be made to look
like natural differences, and the difculty in generalizing about the
properties of populations from a comparison of the performances of
their most outstanding members. And thats just for starters. Other-

144

folk heredity

wise, you present a lot of interesting uff that doesnt prove anything
about anybodys innate abilities, much less about racial differences.
It would require acknowledging that black athletes are physically
quite diverse; certainly, a black interior lineman in football is physically very different from a black point guard in basketball. Thus, the
innate gifts they each possess that enable them to earn a living at
professional sports are probably not the same onesand are probably
more likely explicable as individual, not racial, gifts. The racial issue
is more likely why a black person is more apt to see the exceedingly
high-risk world of athletics as a reasonable venue for earning a livelihood than a white person is.
Darwins Athletes by John Hoberman eloquently presents the case
for disbelieving that black predomination in sports is caused by constitutional factors of the race. Its not that we can say specically why
one person becomes better at something than another personthats
fodder for astrologers, not scientistsbut rather that there are simply
a lot of forces at work besides imagined racial propensities.
Here the fallacy of racism has been inverted, but it is a fallacy nonetheless. Its not whether blacks are innately better than, or worse than,
whites at something. Rather, its that there is no reason at all to assume
that any observation of difference is due to a trait that is either innate
or racial. How easily, for example, Muhammad Ali and Michael Jordan can be made to slide from being extraordinary, well-trained black
men to being representative black men.
And thats precisely the problem. Athletes are elite performers and
arent representative of anyone but themselves, except symbolically.
So what can it mean about black people if the ten fastest known
sprinters are all black? In the rst place, it is a gross perversion of
statistical sensibilities to characterize a population by its ten most
extreme members. And in the second place, the fastest white and
yellow people are not too far behind anywaywere only talking
about the twinkling of an eye here, after all. And how do you know
you havent missed some really fast white guy somewhere?
Finally, those who laud the innate aptitudes of blacks for basketball
frequently need to be reminded of the push a decade ago to allow
American professionals to play in the Olympics. The rest of the world,

folk heredity

145

it seemed, had caught up to our gifted, predominantly black, amateurs.

h e re d i t a ri ani sm

The Bell Curve began with a premise that is not racist: that in general,
differences in IQ, or in performance of some surrogate pencil-andpaper test, are constitutional, or innate.
This does not presuppose the existence of races or of group-level
differences (although its authors assume those too). To the authors
of The Bell Curve, being a doctor or a lawyer or a professor means
that you are simply likely to be smarter than a carpenter, reman, or
television repairman. Its an assertion as much about innate intellectual differences within groups as between them.
Although the distinction between differences that may exist within
groups and those that may exist between groups may sound trivial, it
isnt. As already noted, most behavioral variation in the human species
is between groups, yet most genetic variation is within groups. That
makes it exceedingly unlikely that the latter can be a major cause of
the former.
Perhaps the weirdest weapon in the hereditarian arsenal is the concept of heritability, borrowed from animal and plant husbandry.
Technically dened as the ratio of genetic variation associated with a
particular feature to the total observable variation in that feature, and
varying from 0 to 1, heritability is hard to measure in people. Consequently, we rely on a number of shortcuts. The problem with heritability is that it sounds like a property of the feature itself, when in fact
it is merely a description of the population in which the trait appears.
The classic example is to envision two plots of soil, in each of which
a handful of seed is planted. The plot on the left receives ample water
and fertilizer; the plot on the right doesnt. Plants in the left plot
grow to be tall and vigorous; since they are not all identical, but their
environment is largely homogeneous, most of the variation in height
is due to the genetic differences among the seeds originally planted.
Thus the heritability of plant height here is quite high. Plants in the
right plot are small and stunted; but likewise the environment is

146

folk heredity

homogeneous, so differences in height are largely due to genetic differences, and heritability of height is high. But the large difference in
average height between the two populations is due entirely to the environmental difference imposed upon them.
Thus, heritability is a description of a population, not a property
of the trait. From our experiment in heritability above, we learn little
about height; rather, we learn something specic about each particular plot of plants.
When you hear someone say that the heritability of intelligence is
0.4, for example, the correct question to ask is, In whom? This is
a statement about a particular group of people, not about intelligence.
Moreover, however genetic it sounds, it is culturally loaded, and its
meanings and usages arent derived from the technical sense it has in
the science of genetics.
Hard as it may be to believe, we have actually learned something
about human heredity and human nonheredity in the past hundred
years. Most important, we have come to realize that when we ask, Is
a feature genetic? we are really asking, Is the detectable variation
[in the feature] due to genetic causes or to other causes?
We have learned that a consistent observation of difference between
two groups does not necessarily imply a genetic basis for that difference.
A glance through any of the major science journals will sufce to
show that contemporary genetics is characterized by a particular language, mode of argumentation, and evidentiary standard. The simple
belief that crude hereditary factors are important in human life certainly long antedates the science of genetics and is therefore independent of it, but it often piggybacks on the credibility of genetics. Such
beliefs are cultural, and therefore widely pervasive, even among geneticists, but they are different from scientic inferences about genetics; that is, hereditarian beliefs are distinct from science. The failure to make this distinction is retrospectively a crucial error of the
1920sgeneticists at that time widely felt that being a geneticist
implied a commitment to constitutional, hereditary explanations for
human social differences, even when they lacked valid evidence for
such explanations.

folk heredity

147

Scientists today regrettably sometimes fall into the same trap. We


used to think our fate was in the stars. Now we know, in large measure, our fate is in our genes, the molecular geneticist James Watson
told Time in 1989. One may question the existence of fate, its localization to our cellular nuclei, and whether genetics is indeed at root
merely high-tech astrology (though presumably more accurate). In
translation, of course, the statement is nothing but a grant proposal
the assertion about the centrality of genetics to everyday life was a
sales pitch for the Human Genome Project. This helps highlight,
however, the conict of interest still faced by geneticists in promoting
the importance of their eld, for their self-promotion expresses both
a funding request and a social philosophy. The crux of the matteras
the lessons of the 1920s show uslies in distinguishing the ideas of
modern genetics (i.e., contemporary science) from folk ideas about
heredity, even when those ideas are held or promoted by geneticists.
Sometimes we encounter modes of thought inherited almost directly from Charles Davenport and the genetics of the 1920s: genes
encode the development of the brain, which is the seat of the mind,
which is composed of thoughts, which lead to deeds. Therefore bad
thoughts and acts are caused by bad genes. From a bully pulpit as
editor of the journal Science, Daniel Koshland proclaimed the importance of the brain and falsely promoted the ability to infer organic
defects from the observation of bad deeds; a few years later, he decried
a German courts leniency toward Gunther Parche, assailant of the
tennis star Monica Seles, on the basis of its ignorance of brain disease.
Yet Parche was never diagnosed as having a brain diseasemuch less
any kind of constitutional cranial defectsome faulty wiring that
led him to the act. Would the criteria for an adequate knowledge of
modern science include not making a diagnosis without examining
the patient?
Unfortunately, scientic zeal comes with a responsibility borne of
the authority of science and of scientic statements. This is the legacy
of the genetics of the 1920s, and it is one that the current generation
must be better educated about and better prepared to assume. It
cannot be up to outsiders to monitor the pronouncements of geneticists; it must be up to geneticists themselves to distinguish between

148

folk heredity

their authoritative statements as scientists and their idiosyncratic or


culturally produced ideas as citizens.
Some of the most persuasive folk knowledge comes from anecdotes
about identical twins. In the world of twin studies the unscrupulous
and the credulous symbiotically plumb the depths of contemporary
pseudoscience.
In one recent popular book, called Twins: And What They Tell Us
About Who We Are, journalist Lawrence Wright introduces the reader
to a psychologist at the University of Minnesota, Professor Thomas
Bouchard. Bouchard, Wright tells us, had long been teaching the
controversial ideas of Arthur Jensen and Richard Herrnstein to the
effect that IQ differences are due to genetics, especially IQ differences
between races. Then Bouchard discovered the Jim twins.
Who are the Jim twins? Identical twins born in 1939 in Ohio, who
were reunited decades later and found to have: the same rst name,
rst wives named Linda, second wives named Ann, dogs named Toy,
and sons with the same name.*
The reunited twins story is a veritable chestnut in journalism,
Wright says, but no red ags go up for him.
Bouchard begins to study the Jim twins, particularly their performances on pencil-and-paper tests, and nds them to be amazingly concordant. Then, with grants from the Pioneer Fund, he begins to
study other twins as well. What is the Pioneer Fund? Wright obliges
us: a New York foundation that has roots in the eugenics movement of the thirties and that has a history of backing projects that
advocate racial separatism. The Pioneer Fund has given [Bouchards]
project over $1.3 million, more than any other project in the funds
history.
*We learn more about them in a picture book called Twins (Philadelphia: Running Press,
1998), containing essays by Ruth and Rachel Sandweiss and photographs by David Fields.
One was told he had a brother, but unaccountably did not try to nd him until middle age.
When they were young, living only forty-ve minutes apart, they both grew up with
adoptive brothers named Larry.
They smoked the same brand of cigarettes, drank the same brand of beer, . . . and
enjoyed math and disliked spelling in school. They used the same slang words. . . .
We found out that we even vacationed in the same spot on the Florida coast,
Jim Springer adds, at about the same time of year.

folk heredity

149

The curious reader might be led to inquire just what the Pioneer
Fund sees in it.
But still no red ags go up. There has simply been nothing on
the environmental side, the journalist observes, to counter the
power of twin and adoption studies.
But what power? Lets think about this. A committed ideologue
scientist, with funding from a radical organization (which would
achieve greater notoriety for their funding of much of the racist work
cited in The Bell Curve), builds a research program on patently idiotic
stories of reunited twins, which should be of greater interest to mythologists than to geneticists. And then he promotes it to the media
as evidence for Nature 1, Nurture 0and the journalist doesnt nd
a reason to be skeptical?
A bit of reection permits the realization that the Jim twins are
quite hard to explain scientically. There are in fact only a small
number of possibilities available to explain the story. What are they?
First, perhaps its just an odd coincidence, like the list of amazing,
dopey similarities between presidents Lincoln and Kennedyassassinated 100 years apart, one in Fords Theater, the other in a Lincoln
Ford, both succeeded by Johnsons, and so on. In which case, it isnt
worth mentioning. Coincidences are of no interest to science. On
the one hand, any two people at random looking for similarities
between themselves will inevitably nd them. On the other hand, it
does boggle the mind that two men married to two identically named
women, with identically named sons and dogs, and with the same
name themselvesan extraordinary set of occurrences in and of itselfwould then turn out to be identical twins separated at birth!
The mere fact that it is invoked in print implies it is not intended to
be regarded as a coincidence.
So lets move on to the second possibility. Maybe these amazing
similarities indeed attest to the genetic unity of identical twins. In
fact, I raised that question during a plenary talk I gave in 1996 to the
International Congress of Human Genetics. I said, You people are
an audience of human geneticists, and I would like to know, How
many of you think that the name you give your dog is under some
kindany kindof genetic inuence? I can happily report that not

150

folk heredity

a single hand went up. The blunt fact is, there isnt a competent
geneticist in the civilized world who will look you in the eye and tell
you that the name you give your dog is under any form, however
cryptic, of genetic inuence.
That, of course, doesnt prove that there is no genetic cause. But it
does show that the people who understand the most about genetic
evidence, and are the most critical thinkers about genetic issues in
the human species, do not agree with the weird psychologists who
present the Jim twins as presumptive evidence of genetic control. The
anecdote about the Jim twins actually demonstrates nothing whatsoever about the genetic unity of identical twins.
Third, then perhaps it demonstrates the psychic ESP bond of twins.
Even our wide-eyed reporter, Lawrence Wright, hesitates here: Clairvoyance is a part of twin lore; . . . [t]hese suggestive psychic connections between identical twins could explain some of the mysterious
synchronicities, but they have been rarely tested and never conrmed.
But this actually was a straightforward subheading in Newsweeks cover
story of November 23, 1987, on the amazing separated-twin research,
which included the Jim twins. (And why not? Most readers of Newsweek believe as strongly in ESP as in geneticstwin studies are a strong
site of convergence between folk knowledge and science.)
But wait a minutethese people are not being studied for psychic
powers; theyre being studied for genetics and personality. We are
being asked to judge this as scientically competent data. How on
earth did the dubious end of behavioral genetics come to be supported by the pseudoscience of parapsychology?
After all, if the twins are in psychic contact, then there is an immediately detectable aw in the majority of the data Bouchards study
collected, which are the results of pencil-and-paper tests, responses to
the same questions about personality and mental processes, which
were subsequently compared for concordances.
It is a fundamental assumption of any such situation that the people
writing down their answers are not in psychic contact with each other.
Those test concordances are now invalid because they are subject to
an uncontrolled variableif there is a real possibility that the twins
may be trading answers psychically.

folk heredity

151

Imagine the chaos that would ensue if it were known that identical
twins taking the SATs were cheating by using ESP!
But of course, there is no ESP. These twins dont have it, nor does
anyone else. ESP isnt science, and therefore doesnt constitute a reasonable scientic explanation for anything, because it lies outside the
domain of science. As an explanation for similarities of twins, it is
useless and inane. Worse, the more closely behavioral genetics is
linked to ESP, the less credible it necessarily becomes.
The process of elimination brings us to the fourth possible explanation.
There is just simply something screwy with these stories.
And this is explained by another simple conict of interest: identical twins without amazing coincidences and psychic bonds dont get
written up. (As one of my undergraduate students, who is an identical
twin and not in psychic contact with her sister, said to me: I guess
well never be on Oprah.) What we encounter here is generally a
strange brew of science and pseudoscience; of rigor and pop fantasy.
Unlike scientic data, such gee-whiz stories are often told, but
rarely rigorously analyzed, and never conrmed.
Here is an explanation for the similarities of identical twins. They
are similar because they are genetically identical. They are also similar
because they are usually raised to emphasize their similarities. When
raised apart, they are often placed in similar homesadoptive families, regretfully from the standpoint of experimental design, are very
homogeneous. And the most bizarre stories are just not true, exaggerating either their concordances, or their separateness, or both.
Opposing the amazing twin anecdotes, there is a community of
counteranecdotes developing. The journalist Lawrence Wright reports that the Jim twins had known of each other and had met each
other on many occasions prior to their reunion. (Oddly, he nds
that less credible than their amazing coincidences!)
Another amazing set of twins are Jack and Oskar, born in 1933 and
separated in the divorce of their parents; one grew up Jewish in Trinidad and the other in a Nazi home in Munich. They both, Constance
Holden writes in Science, think its funny to sneeze in a crowd of

152

folk heredity

strangers, ush the toilet before using it, store rubber bands on their
wrists, read magazines from back to front, dip buttered toast in their
coffee. But they each knew of the other and had met several times
as adults, and their families had kept up a correspondence. And the
counteranecdote is that the Jewish twin, who now lives in California,
appeared on talk shows on diverse topics with such frequency that he
joined the actors union, and that the twins were attempting to sell
their life stories to Hollywood.
Hardly the stuff of innocent birth-separation-reunion scenarios.
Much less of scientic inferences about genetics.

e s s e n ti a l i sm

The fourth major fallacy of folk heredity is that old philosophical


Platonic problem known as essentialism, which we encountered earlier in our discussion of race. As a scientic fallacy, it refers to imagining underlying uniformity in the face of apparent diversity.
Consider, for example, the question of human nature. Humans do,
and have done, an extraordinary number of things as individuals and
as collectivities. Presumably, these are all reections of human nature,
some genetic program distinct from cow nature or dog nature or
chimpanzee nature. It is human nature, we can safely assert, to walk
on two legs.
But is it human nature to have an extramarital affair?
Is it human nature to go to war?
Each of these is a folk-hereditary statement about our underlying
makeup, our basic constitutions. If they were statements from the
realm of genetics, wed say our genome. But they arent statements
from genetics, based on genetic data. Theyre statements from some
other intellectual domain, known these days as evolutionary psychology.
Evolutionary psychology dons the mantle of Darwin to tell us why
various components of our behavioral and mental repertoire evolved.
Unfortunately, it hasnt shown itself to be particularly good at (1)
identifying the fundamental components of our behavioral and men-

folk heredity

153

tal repertoire; (2) establishing their evolutionary histories; or (3) proving that their inferences reect an underlying human nature, rather
than being simply the projection of contemporary social values.
Take a well-publicized example: the waist-to-hips ratio of women.
If you draw silhouettes of womens gures and ask American college
students which ones they think are most attractive, they will invariably go for someone shaped like Marilyn Monroe. In fact, if you ask
the same question of many men around the world, they will generally
also go for Marilyn Monroe. Aha, say the evolutionary psychologists,
a clear indicator of a fundamental property of the human mind,
which has evolved over the eons.
But is it? Are American college students valid representatives of the
primordial human mind, or are their beliefs, thoughts and preferences
molded by both their humanness and their twentieth-century Americanness? Does the fact that other men around the world nd Marilyn
Monroes gure attractive mean that they are expressing a basic human propensity or merely that their sexual preferences have been
inuenced by the American entertainment media?
After all, American tastes and preferences have been globalized. The
worlds cultural diversity is constantly shrinking as a result of the
relentless economic and social pressure of the United States. Not that
its necessarily a bad thing; only that with increasing uniformity of
thought, it becomes ever more difcult to distinguish the properties
of the human mind from the consequences of human social history.
It is an old anthropological saw that what you do seems natural; how
much more natural it is to see the whole world do it! But what is
widespread is not necessarily innatethats the fallacy of essentialism.
There is a simple test one could perform to try to judge whether
the widespread attraction for men specically of Marilyn Monroes
shape is an evolved, innate propensity or an artifact of twentiethcentury American taste disseminated to the rest of the world. You
could test a remote group of people unfamiliar with Marilyn Monroe,
or American movie stars and pinups generally, and see what womens
gures they prefer. The problem is, of course, that there is hardly
anyone these days who falls into that categoryyou can see the latest
Julia Roberts movie in Nairobi.

154

folk heredity

But when biologist Douglas Yu and anthropologist Glenn Shepard


visited the Machiguenga in the South American jungle, they had
precisely that opportunityto test the idea that men naturally prefer
women shaped like modern movie stars. And what did they nd?
That the Machiguenga men preferred women shaped the way their
women were shaped and not the way American movie stars and models are shaped.
The discovery may evoke a schoolyard reaction of No shit, Sherlock! but it is an important one, because the possibility of performing
such studies is rapidly diminishing. That will make it ever more difcult to refute essentialized, folk-hereditary assertions about human
nature.
Consider another widely disseminated result. An evolutionary psychologist sends questionnaires out to people in thirty-seven different
countries asking what men and women are attracted to as properties
in mates. He nds that in general, women want a sugar daddy and
men want a babe. And that must be the way we evolved, argues David
Buss, author of The Evolution of Desire. Its natural, its evolved, its
genetic.
And that ostensibly scientic result enters the lore of evolutionary
psychology, repeated in popular scientic works with titles like The
Moral Animal and The Anatomy of Love and Consilience.
But wait. How different are people in those thirty-seven different
countries? The French and Swiss and Italians may be different, but
they share many common cultural values as a result of their history.
Add that complication of the American medias impact on the rest
of the world, and suddenly it becomes clear that those thirty-seven
data points are neither independent of one another nor an impressive
representation of the breadth of human thoughts, actions, and capacities.
Even more signicant, however, is the fact that patriarchal values
are widely pervasive in agricultural and industrial societies. Women
have variable, but generally lower, status than men. Even in America,
a woman typically earns only about three-quarters as much as a man
in an equivalent position. The only sure strategy to gain access to
nancial resources where men have preferential access to them is to

folk heredity

155

marry them. Is the fact that women worldwide express preferences


for sugar daddies, therefore, an expression of innate human nature
or just an obvious rational response to a social problem faced by
women worldwide?
Unless we can distinguish between those two possibilitiesand
these scientists dontthen the data are valueless, for they dont permit us to conclude that it is in fact human nature that we are seeing.
It could just as easily be a response to human social history. And the
fact is, as Cornell anthropologist Meredith Small points out, there
are enough exceptions out there to make generalizations about human
nature exceedingly tenuous. What about those exceptions? Are they
mutants? No, they constitute the crucial evidence against the idea
that there is a fundamental human nature reected in the crude generalizations detectable in human thoughts and deeds. That concept
of human nature is an essentialized fallacy.
Cultural globalization imposes a uniformity of thought on the
world that will make it ever more difcult to detect exceptions; but
it is precisely those exceptions that reveal the fallacy of essentialism,
of attributing to an underlying, invariant, and imaginary human nature the products of a specic, historically situated culture. And consequently, when Northwestern psychologist Alice Eagly controlled the
data on those thirty-seven different countries mate preferences for
economic inequality by sex, those patterns quickly vanished.
Studies of the genetics of homosexuals, as noted earlier in a different
context, frequently begin with an assumption of essentialismthat
homosexual is a noun describing a kind of person, rather than an
adjective describing a kind of act. How many homosexual acts does
it take to make someone a homosexual? That usage of the word is
in fact only a product of the past few centuries.
While there are many people today who have a sexual identity as
a homosexual, it is clear that the construction of identity is partly
a product of the available categories, the kinds of people available
to be. That is cultural knowledge, not biological data. From the perspective of anthropology, what is striking is the manner in which the
action has been essentialized into the constitution of the actor

156

folk heredity

through history; once it is acknowledged culturally as a state of being,


it is then adopted (or imposed) as an identity of individual people;
and once it is perceived as an identity (specically a deviant identity),
it is then sought in the genes. From the perspective of molecular
anthropology, the whole endeavor reects a folk-hereditary fallacy;
theres no reason to think it was ever in the genes in the rst place.

re s pon s i b i l i ty a n d f o lk he redi ty

It is the responsibility of a scientic community to distinguish for


everyone else the science from the pseudoscience: promote the former
and debunk the latter. The geneticists of the 1920s were either unwilling or unable to do that. The geneticists of the twenty-rst century have to learn from their predecessors mistakes. Behavioral genetics as a community has to meet the obligation of skepticismit
cannot be up to others to question the validity of the work; science
has to be rigorously evaluated from within.
Behavioral genetics has to be done in the context not merely of
scientic knowledge but of humanistic knowledge. We are not starting
at ground zero here. Without the benets of confronting the class
issues and history surrounding the genetics of criminality, or the race
and culture issues around the genetics of intelligence, it cannot be
good scholarship. And if it isnt good scholarship, it cannot be good
science. That is the burden imposed just by tackling tough and important questions.
What we need to know is whether specic behavioral genetic studies reect modern genetic sensibilities or merely hi-tech folk wisdom
about heredity. As I noted at the outset, contemporary genetics relies
on the ability to relate an observed characteristic (a phenotype) to a
hereditary state (a genotype) causally and mechanistically. Studying
phenotypes alone, or their distributions, or associations among them,
and then blithely inferring genes for them, is simply inadequate in
the context of modern genetic reasoning. To invent genes where none
are known is poor genetic practice, with a long and sordid history; it
confuses fantasy with modern science. While there may be short-term

folk heredity

157

benets to some scientists who pursue these lines of argument, they


are counteracted by the long-term harm both to the science of genetics and to the authority of science generally.
And it is the responsibility of behavioral geneticists to point this
out. If they dont, the rest of us cant be expected to.

e pi l og ue

The millennial issue of the Scientic American includes an ostensibly


balanced and objective article called The End of Nature versus Nurture by Frans de Waal, a primatologist. While sensibly eschewing
simple-minded genetic determinism, he also reports that the evidence for a connection between genes and behavior is mounting.
Studies of twins reared apart have reached the status of common
knowledge. . . .
That is, of course, the problem. They are nothing but common
knowledge. De Waals Scientic American article is actually illustrated
up front with a set of identical twins, and tells us, Twins reared apart
have been studied for clues about the relative contributions of genes
and environment to human behavior. These brothers, it goes on,
rediscovered each other later in life when both were mustachioed
reghters.
So genes determine who wears a moustache?
Or genes control being a reghter?
Otherwise, what is the point of calling this to our attention?

158

folk heredity

Seven
human nature

In a recent book called Demonic Males: Apes and the Origins of


Human Violence, primate sociobiologist Richard Wrangham and his
co-author Dale Peterson write that it is a natural inclination of the
human male to be aggressiveto be demonic. And this inclination,
they tell us, is written in the molecular chemistry of DNA.
Even for the moment overlooking the crude essentialism of the
thought, the question that jumped out at me when I was asked to
review the book for the journal Human Biology was: What exactly is
the evidence from the molecular chemistry of DNA?
In fact, this wasnt a book about molecular chemistry, nor was any
signicant chunk of the book devoted to the subject. There was no
evidence provided for a demonic gene on the short arm of chromosome 5, nor on any part of any chromosome. That bit about molecular chemistry of DNA was simply a purple way of expressing the
premodern thought that men are just innately nasty. They might just
as well innately be anything you like, of course, because if genetic evidence is unnecessary, you can make genetic assertions with impunity.
This particular argument for the innateness of male demonism is
based on the conjunction of two prior arguments: rst, that chimpanzee males are intrinsically demonic; and, second, that humans are

159

genetically almost identical to chimpanzees. Therefore, human males


must naturally be innately demonic as well.
The latter part of the argument has already been dealt with. In spite
of the genetic similarity, we are not chimpanzees and are easily distinguishable from them. Were the ones walking upright, speaking,
weeping, laughing, praising, insulting; were the ones with erotic
sexual foreplay and sex games, the ones who fall in love, who cook
our food, who decorate ourselves for public display. So different from
chimpanzees, and yet all the while genetically so similar to them.
Whether or not chimpanzees are demonic, there is plenty of genetic
leeway for humans to have become effectively angelic since we parted
gene pools with them.
And yet the behavior of chimpanzees is not entirely irrelevant to
understanding ourselves. We are derived from a recent common, if
nebulous, genetic substrate. If chimpanzees really are fundamentally
demonic, or angelic, or [insert your own adjective here], that might
have some relevance to our understanding of humans. It might represent the ancestral form of human thought and behavior, something
we have either retained or overlaid (like the urge to explore and touch,
color vision, and mobile shoulder of chimpanzees). On the other
hand, it might represent something we once had but have since altered or sloughed off. Like the large canine teeth, body hair, and
grasping feet of chimpanzees.
Unless, of course, it simply represents a unique evolutionary development specically of the chimpanzees themselveslike the
stripes of a zebra, the blue nose of a mandrill, the call of the howler
monkey, the moustache of the moustached tamarin, or the beard of
the bearded saki.

a pe s a n d peop le

There is consequently no guarantee, short of detailed physiological


and genetic data and analyses, that anything chimpanzees do is directly relevant to understanding anything that humans do. Since they
have been different species for several million years, anything that
chimpanzees do may be either (1) an element shared with human

160

human nature

nature; or (2) an ancient element of human nature now lost by humans; or (3) an evolved element of chimpanzee nature, never possessed by human ancestors.
The opposite idea, that what an ape does is illuminating for human
nature, has come to be known as the naturalistic fallacy. Let us say,
along with the nineteenth-century mutton-chopped English polymath Herbert Spencer, that the natural world is governed by unfettered competition. Does it not follow that competition, unrestrained
by governmental intervention in the form of poor laws, or welfare,
or social safety nets, is the most appropriate and natural form of
human society?
On the contrary, argued Spencers friend, the great biologist Thomas Huxley, who had actually published the rst book on human
evolution, Mans Place in Nature, in 1863. Thirty years later, Huxley
had come to realize the philosophical abuse that biology could wreak
on society. And in an essay called Evolution and Ethics, he challenged Spencers worldview: Let us understand, once and for all,
he avowed, that the ethical progress of society depends, not on imitating the cosmic process, still less in running away from it, but in
combating it. Humans do not live in a state of nature, they have
risen from it. What goes on out there among the birds and the beasts
may have no bearing at all on what is natural, much less on what is
appropriate, for humans.
Apes go around naked and sleep in the trees, and yet humans do
not. Which condition should be considered more natural for humanswhat apes do and humans do not (thats a perverse conception
of human nature!); or what humans do and apes do not (in which
case, why bring up the apes in the rst place?)?
What bearing, then, do any data from apes have on our understanding of humans? Obviously, we must look for commonalities
between apes and humans.

cu l tura l projections

In the 1960s, baboons were taken to be the most valuable models


available for understanding the evolution of human behavior. Why

human nature

161

baboons? Their closest relatives, the vervet monkeys, are all highly
arboreal, but baboons have descended to the ground for most of their
daily routine.
Rather like humans.
Moreover, the males vie with one another rather conspicuously.
They grunt, posture, bark, chase, and nipall with the obvious goal
of intimidating and displacing or overcoming all rivals. That seems
to be the core of their society.
Also rather like their human counterparts.
But in one key way, it was believed, they were not like humans.
They didnt hunt.
So hunting must have made all the difference in human evolution.
Here you had a species not terribly distantly related from us, with
similar hands, feet, teeth, and brains; recently descended from the
trees, like us; socially rather like us; and had they only, perhaps, developed the ability to huntwhat we might call the skill to kill
they might have been us.
And yet, since the 1960s, that interpretation of baboon society and
its relationship to human nature has fallen out of favor. First, baboons
do indeed hunt, it turns out. Theyve been observed to chase down
and eat several different kinds of animalssmall monkeys, bush pigs,
gazelles. Hunting doesnt contribute a major component of their diet,
but it has been observed regularly enough to now be accepted as a
facet of baboon life. So the big difference between us and them turns
out not to be as profound as the theory requires it to be. If they hunt,
after all, then they should be usbut they arent.
Moreover, the male interactionsso conspicuous, so dangerous
turn out to be largely ephemeral. Long-term studies of the course of
a baboons life have revealed that baboon females grow, mature, and
remain in their social group. Males, on the other hand, transfer into
a new group as they mature. As a result, the composition of a baboon
troop consists of related females who grew up together and know
one another and males who did not grow up together. It shouldnt
be a surprise, then, that the males ght and jockey conspicuously for
social position, while the female interactions are more subtle. But the

162

human nature

female bonds are also more pervasive and longer-lasting than the male
bonds.
What seemed at rst to be a reiteration of dominant themes of
American societymale competition and aggression, female passivitywere more the projections of the primatologists than expressions
of baboon nature. Whats more, it had been assumed that all that
conspicuous ghting that male baboons do could only be over one
thingfemale baboons. After all, what do men ght about, if not
women?
But again, eldwork in more recent years has shown that the connection between sex and aggressive competition in baboons is fairly
weak. Baboon females have many strategies for choosing mates, and
the biggest and strongest male isnt necessarily the one they pick.
Baboon males, for one thing, are smart enough to form coalitions to
ward off attacks fromand sometimes to deposethe single biggest
male. So the boys dont really seem to be ghting just to show off for
the girls, like American high school studentsonce again, a cultural
projection onto the animals.
Baboon nature, it seems, has precious little to tell us about human
nature; for what we derive from baboons turns out to be largely a
function of what we project onto them. Baboons are interesting because theyre baboons and fairly close relatives of ours. But their
utility as models for understanding human biology hardly outlasted
the Beatles.
Chimpanzees, however, are far more closely related to us than baboons. Their DNA is really, really similar to our own. Perhaps the
key to human nature lies in them. And thats what modern students
of chimpanzees say in their grant proposals: You should fund my research because it will reveal secrets of human nature.
But it wont, any more than baboon studies did.
The best evidence in support of that assertion comes from looking
at the oeuvre of the foremost student of chimpanzeesone of the
worlds best-known scientists, Jane Goodall.
Goodall began studying chimpanzees in the wild at the Gombe
Stream Reserve in Tanganyika (now Tanzania) in 1960, under the

human nature

163

aegis of the charismatic paleontologist Louis Leakey. After nearly four


decades of research, her National Geographic specials are xtures on
educational cable television, shes done a commercial for HBO, her
speaking engagements ll the largest auditoriums on college campuses, and she remains an inspiration to young women entering science.
When Jane Goodall enters a room, she lls it with an almost celestial presence, a delicate and beautiful woman with a steel backbone,
who has lived in difcult places as an alien human presence in the
name of science for many years. Her work remains the longest continuous eld study of chimpanzees, indeed of any primate species in
the wild, and her works on that species are authoritative.
And yet theyve evolved over the decades. They are more than mere
reportage about what chimpanzees do. Goodalls books on the
Gombe chimpanzees are not merely different from one another by
virtue of the inclusion of more and more of the same kinds of data
and observations. Rather, they incorporate new and different perspectives on the apes, perspectives that have changed with the decades.
Her rst and most famous book, In the Shadow of Man, is a chronicle of Goodalls rst decade at Gombe studying the chimpanzees.
She succeeds brilliantly in conveying a sense of the life history of
chimpanzeesbirth, death, adolescence, sexuality, danger, friendship, family. She also manages to show a facet of personality for
each of the Gombe chimpanzeesdominant Mike, popular Flo, irascible J. B., playful Gilka, clever Figan. These chimpanzees didnt have
to worry about the Vietnam War, or ination, or earning a living.
They lived at peace with nature, in a society of conicts and appeasements, of immediate gratication, and of sexual abandon.
In The Shadow of Man was published in 1971, and the chimpanzees
of Gombe could be seen as a hippie commune.
By the early 1980s, however, the chimpanzees were being seen rather
differently. They were now selsh strategists, manipulating others in
pursuit of their evolutionary goals. They now also had a dark side:
some were even occasionally infanticidal. Far from the integrated love
fest of the 1960s, the Gombe chimpanzees were now more like the

164

human nature

Carrington family of televisions Dynasty. They were now seen as


considerably more violent than the rst two decades of observation
had indicated.
The 1990s brought a new vision to chimpanzee research. Studies
at other sites, notably Ta in the Ivory Coast and Mahale in Tanzania,
afford behavioral contrasts to many of the observations at Gombe.
Multiculturalism thus became the order of the day in chimpanzee
studies.
From a hippie commune to vicious and self-interested exploiters to
multicultural pluralismchimpanzee studies since the 1960s have reected American changing social patterns. Obviously, this does not
mean they are without value and that we know nothing about chimpanzees. In fact, it means quite the opposite: we have learned much
about chimpanzees and much about studying and interpreting their
behaviorand that what chimpanzees do is only one component of
what goes into the study and interpretation of their behavior. The
study of chimpanzee behavior turns out to be as much about ourselves
as about chimpanzees, but not in the facile manner that relates chimpanzees directly to human nature.
Rather, it is about ourselves in the sense that we constantly contribute a cultural and symbolic framework to the interpretation of
chimpanzeesand it is all too easy to recover that framework and
mistake it for a contribution of the chimps, rather than for our own
input.
In the case of deriving human nature from chimpanzees, its clear
that the chimpanzees are not just chimpanzees. They are symbolic of
a past life and of a simpler existence. They are us, minus something.
They are supposed to be our pure biology, unfettered by the trappings
of civilization and its discontents. They are humans without humanity. They are nature without culture.

n a tura l m an

Imagining people without culture has been a pastime of Western


thinkers for millennia. Culture is clearly not innate; thus one is free
to imagine what a group of people who lacked religion, buildings,

human nature

165

re, haircuts, or rules governing sexual conduct might be like.


And the world is a big placesurely they must be out there somewhere.
Herodotus writes of cave dwellers in Africa who had no language
and squeaked like bats. Pliny the Elder, who was so fascinated by the
worlds marvels that he tarried a bit too long admiring the eruption
of Mount Vesuvius in 79 a.d., repeated Herodotuss brief discussion
of the cave dwellers.
In the fascinating, and frequently silly, Travels of Sir John Mandeville, dating from the mid-1300s, one reads of an island called Tracota, where the people are like animals lacking reason. They live in
caves, for they do not have the intelligence to build houses; and when
they see a stranger passing through the country, they run and hide in
their caves. They eat snakes, and do not speak, but hiss to one another
like adders.
But these people were, of course, imaginary. There was not much
to be said about them, but that they lived somewhere and were brutes.
That situation changed with the discovery of the New World. Although there were obviously great civilizations in the Americas, there
were also people living in an extraordinarily rude state (to the European mind) and speaking in utterly incomprehensible manners. As
stories of them ltered back to Europe, the Indians became valuable
to the newly emerging schools of political philosophy. The rst to
invoke them was Thomas Hobbes, in his monumental work Leviathan (1651).
Hobbes took a new and radical approach to political theory. He
tried to justify his English monarchial law by contrasting it with the
situation of natural man. What would people be like, asked
Hobbes, if stripped of the trappings of civility and law, relying only
on themselves and their own acts for survival? The answer, reasoned
Hobbes, would be a state of
Warre, where every man is Enemy to every man; the same is
consequent to the time, wherein men live without other security,
than what their own strength, and their own invention shall furnish
them withall. In such condition, there is no place for Industry;

166

human nature

because the fruit thereof is uncertain: and consequently no Culture


of the Earth; no Navigation, nor use of the commodities that
may be imported by Sea; no commodious Building; no instruments
of moving, and removing such things as require much force; no
Knowledge of the face of the Earth; no account of Time; no Arts;
no Letters; no Society; and which is worst of all, continuall
feare, and danger of violent death; And the life of man, solitary,
poore, nasty, brutish, and short.

And where might such a situation be found?


It may peradventure be thought, there was never such a time, nor
condition of warre as this; and I believe it was never generally
so, over all the world: but there are many places, where they live
so now. For the savage people in many places of America, except the
government of small Families, the concord whereof dependeth
on naturall lust, have no government at all; and live at this day in
that brutish manner. . . .

And thus Native Americans came to represent for European philosophers the idea of man in a state of pure naturethe beastly
other against whom the civilized state would form a contrast. Or
more to the point, a development, a risean evolution.
Hobbess argument was immensely inuential in European political
philosophy. The concept of the uncivilized, purely biological person
was also invoked by the generations that followed Hobbes. And their
favorite empirical grounding for this argument, the place where natural man could actually be found, and whose data could be invoked
for the purposes of polemic, was America.
John Locke, for example, challenged Hobbess most basic point
about human nature being a state of perpetual war, yet supported his
own ideas in the same manner as Hobbesby recourse to the lives
of savages living in a state of nature. He asks, for example, why money
would be necessary if the earth were bountiful and land were readily
available. Thus, wrote Locke in his Second Treatise on Civil Government (1690), in the beginning all the world was America, and

human nature

167

more so than that is now; for no such thing as money was any where
known.
But the question of human nature, and the Indian as a means of
revealing it, were nowhere more forcefully or clearly articulated than
in the work of Jean-Jacques Rousseau. He asks at the beginning of
his Discourse on the Origin of Inequality (1754):
And how shall man hope to see himself as nature has made him,
across all the changes which the succession of place and time must
have produced in his original constitution? How can he distinguish
what is fundamental in his nature from the changes and additions
which his circumstances and the advancements he has made
have introduced to modify his primitive condition?

The answer would become apparent: by proposing a model of the


natural man, with which to contrast modern man, and thus describe
the ascent to civilization and humanity. And that model, once again,
would be embedded in the indigenous inhabitants of the New World.
Rousseau explains, for example, that men in a state of nature are
conned to what is physical in love and thus are not subject to the
ts of passion and jealousy so consumptive in modern society. And
he identies the Caribbeans, who have as yet least of all deviated
from the state of nature, being in fact the most peaceable of people
in their amours.
In his essay on The Social Contract (1762), Rousseau describes the
origin of social and political relations. The rst societies, he tells
us, governed themselves aristocratically. The heads of families took
counsel together on public affairs. The young bowed without question to authority of experience. . . . The savages of North America
govern themselves in this way even now, and their government is
admirable.
Rousseau, of course, was romantically admiring the natural state,
just as Hobbes was demonizing it. What they shared were two premises: (1) that there was a kernel of nature to be revealed beneath the
layers of culture; and (2) the way to access it was through the most
cultureless societies known, supposedly those of the Amerindians.

168

human nature

And thus the study of human nature became the study of the
Indians. And through the nineteenth century, students of Indian
languages would imagine they were studying something primitive
and similar to the primordial or natural language of man; and
students of Indian society would imagine they were studying the
basic, and most rudimentary, manifestations of the social instinct
in humans. To some extent this reinforced the idea that Indians
should be assimilatedin other words, that layers of civilization
could be imparted to themand this affected federal policy toward
the Indians.
From the standpoint of social science, however, the nineteenthcentury Native American ethnology of Americans was invariably entangled with revelations of basic human nature.
That is, until the rst studies of Australians.
Inuenced by the renowned researches of Lewis Henry Morgan on
the Iroquois, and more generally on the evolution of society, Lorimer
Fison and A. L. Howitt published the rst ethnographic monograph
on the Kamileroi and Kurnai of Australia in 1880. Shortly thereafter,
Baldwin Spencer and F. J. Gillen published their rst monograph on
the Australian Arunta.
In short measure, the Australian aborigines came to replace the
Indians as the embodiment of natural manhuman life at its simplest. Thus the French anthropologist Emile Durkheim would write
his groundbreaking synthesis on The Elementary Forms of the Religious
Life (1912) based on the knowledge that the most elementary forms
of religion were those practiced by Australian aborigineshuman
religion at its most natural.
The years immediately after World War II saw an attempt by
UNESCO to universalize humanity in the wake of the overzealous
racialism of the Nazi era. Anthropologists had begun to conceptualize
human history in terms of revolutions in subsistencefrom hunting
and gathering, to agriculture, to industry. And the group that
emerged as the quintessential remaining hunter-gatherers were the
!Kung San of the Kalahari Desert in southern Africa. From 196374,
they were the subject of an intense interdisciplinary study organized
through Harvard University. With the emergence of sociobiology at

human nature

169

Harvard, the biophilosophical problem of natural man once again


came to the fore.
The !Kung San slipped neatly into the space formerly occupied by
the Indians and Australians. A major conference on Man the Hunter, organized in 1966, acknowledged the diversity of huntergatherers, but the organizers of the conference were also the organizers
of the !Kung San study, and in short order, the !Kung became anthropologys paradigmatic hunter-gatherers. And by that fact, they
became the representatives of natural manparticularly to the
newly emerging eld of human sociobiology.
The justication was that we had been hunter-gatherers for 99%
of our existence as a speciesfood production and its social consequences had only been around for a few thousand years, and industrialism for a much shorter time. The economic system of hunting
and gathering was what had shaped our gene pool.
On the other hand, we were sh for over half of our existence as
vertebrates, but there doesnt seem to be a great deal relevant in the
detailed study of sh biology if youre interested in humans. So the
fact that the !Kung San shared certain broad economic and organizational features with Mesolithic Europeans may be irrelevant to the
understanding of the behavior of Mesolithic Europeans, who had
their own environment to adapt to, and their own traditions.
More than that, the !Kung San might not be valuable as natural
people, either. Eric Wolf s Europe and the People without History
(1982) argued persuasively that the mere fact that we dont know the
histories of nonliterate, indigenous peoples doesnt mean that they
have always lived exactly as they do today. Archaeological studies have
found evidence of trade everywhere, which means that nobody was
really completely isolated, and ethnohistory has consistently found
that even hunters and gatherers often have long and complex relationships with their neighbors.
By the 1980s, the !Kung San were the subjects of a erce revisionist
ethnohistorical battle. Sociobiologists continued to represent them as
surrogates for early man, living the edenic life we all evolved for.
Ethnohistorians, on the other hand, found a far more interesting
history of the !Kung San than the biologists had expected. It was a

170

human nature

history of contact with pastoralists, European traders, colonialism,


and economic exploitation: far from being pristine and standing outside of world history, and representing human nature minimally affected by culture, the !Kung San were very much products of that
very world history. Their lifeways constituted revelations not about
people, but about them.
By 1992, Richard Lee, co-organizer of the !Kung San project, was
seeing the endeavor in a very different light.
In the preface to Man the Hunter, [Irven] DeVore and I wrote,
We cannot avoid the suspicion that many of [the contributors]
were led to live and work among the hunters because of a feeling
that the human condition was likely to be more clearly drawn
here than among other kinds of societies . . . I now believe this is
wrong. The human condition is about poverty, injustice, exploitation, war, suffering. To seek the human condition one must go . . .
to the barrios, shantytowns, and palatial mansions of Rio, Lima,
and Mexico City, where massive inequalities of wealth and power
have produced fabulous abundance for some and misery for most.
When anthropologists look at hunter-gatherers they are seeking
something else: a vision of human life and human possibilities
without the pomp and glory, but also without the misery and
inequity of state and class societies.

The !Kung San were no more primordial or natural than anybody


else. The questions Rousseau had asked two hundred years earlier
could not be answered by the hunter-gatherers of the Kalahari Desert.
In the shadow of the !Kung San fell the Yanomamo of Venezuela
and Brazil, subjects of continuous study since the 1960s, when they
became the subjects of a landmark genetic survey as a primitive
tribe. They became mainstays of sociobiological generalization for
their primordially aggressive ways and the discovery that the more
aggressive men among them fathered more children. In fact, the generalization remained even after both assertions had effectively been
refuted. To the extent that the Yanomamo really are aggressive, theres
nothing primordial to it; they ght over caches of goods distributed

human nature

171

by anthropologists and missionaries, not unlike the way people at the


local shopping mall would ght over $100 bills raining down upon
them. And the statistics simply dont bear out the assertion that aggressive men have more kids. In among a host of speculative accusations, Patrick Tierneys book Darkness in El Dorado (2000) effectively shows that the Yanomamo are anything but naturaltheyve
been pawns for scientists, politicians, and missionaries, and their social history is complex, and often tragicbut as with the !Kung San,
theres nothing primordial or natural about them. Theyre just exotic
and remote.
And exploited and in poor health.
Fueled by the unquestioned assumption that the question was at
least a valid one, the 1990s found a new surrogate for natural man.
Rousseaus goal had been to strip this being, thus constituted, of all
the supernatural gifts he may have received, and all the articial faculties he may have acquired only by a long process; [to] consider him,
in a word, just as he must have come from the hands of nature. . . .
I see him satisfying his hunger at the rst brook; nding his bed at
the foot of the tree which afforded him a repast; and with that, all
his wants supplied.
That surrogate natural man, supplanting the !Kung San and the
Yanomamo, would be the chimpanzee.
The chimpanzee had two things in its favor. First, misinterpretation of molecular data in the 1980s had crudely suggested that gorillas were not so closely related as humans and chimps were to one
another. Thus, chimpanzees could be claimed as our sole closest living relatives, and the complications ensuing from considering the
gorilla too, which is in many ways different from the chimpanzee,
could be ignored. And second, the dehumanizing discourse that
robbed the !Kung San and Yanomamo of their history and their
cultural complexity could be applied to the chimpanzees less offensively. Chimpanzees were, after all, not human, not historical, and
not cultural.
In Demonic Males (1996), primatologist Richard Wrangham takes
up Rousseaus task. To Wrangham, the key feature that makes chimpanzees primordial people is their violent nature. Curiously, this vi-

172

human nature

olence was sufciently subtle as to have been missed for the rst few
decades of chimpanzee research, in which conict was noted, but not
more than in other primate species. In the 1970s, at Gombe, however,
the males of the Kasakela community killed off the Kahama communityfor reasons unknown, but fundamentally and meaningfully
similar, according to Demonic Males, to human doings at Gaugamela,
Actium, Agincourt, Balaklava, Vicksburg, Ypres, Nagasaki, and
Sharpeville.
And were not merely a projection of human cultural values onto
another animal, like Aesops Fables or Dogs Playing Poker.
And although he neglects to mention Thomas Hobbes, who started
it all, Hobbes permeates this view of the chimpanzee as natural human: [M]odern chimpanzees are not merely fellow time-travelers
and evolutionary relatives, but surprisingly excellent models of our
direct ancestors. . . . [C]himpanzee-like violence preceded and paved
the way for human war, making modern humans the dazed survivors
of a continuous, 5-million-year habit of lethal aggression (p. 63).
And so we come full circle. Humans again live naturally in a state of
Warre, but 350 years after Hobbes, that state is proved by recourse
to evolutionary biology, and specically by recourse to the behavior
of the most natural man, the chimpanzee.
And yet, is there a biological evolutionary argument here? Even if
we were to concede the (inaccurate) point that chimpanzees are genetically our sole closest relatives; the (contestable) point that the
extinction of the Kahama community in the mid-1970s was a normal facet of chimpanzee behavior, although nothing like it had ever
before been noted; and the (equally contestable) point that this implies that chimpanzees are naturally violent, what might that imply
for humans biologically?
As is obvious from the foregoing discussion, exceedingly little. It
might indeed be a facet of human nature; or alternatively an element
of specically chimpanzee nature and never even present in a human
ancestor; it might have been present in a human-chimp ancestor and
lost in humans. You could study chimpanzee behavior until the Second Coming, and never be able to differentiate among these alternatives.

human nature

173

And that is a crucial point. The ability to distinguish between alternatives is testability, and it is a dening property of science. Without it, youre not talking science.
As a result, the discussion of human nature based on the properties
of the chimpanzee lies in the realm not of scientic discourse but of
metaphysics. Its equivalent to asking about Mozarts baseball talent
you cannot tell from the data available. A scientist might have an
opinion about it, just as a scientist might have an opinion about
whether Mike Tyson could have beaten Rocky Marciano, whether
there is intelligent life in outer space, or how many angels can sit on
the head of pin. But the basic inability to differentiate among the
possibilities with real-world evidence makes this a nonscientic issue.
Wars tend to be rooted in competition for status, Demonic Males
is reduced to arguing. We could well substitute for Sparta and Athens
the names of two male chimpanzees in the same community, one
rising in power, the other anxious to keep his higher status (p. 192).
I suppose we could. But that would have no biological meaning.
Who is competing for statusthe generals? The grunts? The politicians back home? The sociopolitical entities they represent? And what
is the biological connection between a chimpanzee and Greek citystate, anyway? A polis isnt a biological entity; it shares no common
ancestry with a chimpanzee; it is an artice of human social history.
The argument is simply an analogy. Maybe a chimpanzee is sort of
like a Greek city-state. Maybe an aphid is like Microsoft. Maybe a
kangaroo is like Gone with the Wind. Maybe a gopher is like a microwave oven. There may be arguments to be made in each case, but
they are literary, not biological.
The most interesting feature of the argument for using the chimpanzee as a surrogate for natural man is the way in which the same
animals are used to argue for very different qualities of human nature.
Sociobiologist Frans de Waal argues from the bonobo, or pygmy
chimpanzee, that humans are naturally good-natured. The fact
that bonobos and common chimpanzees are each others closest relatives should attest to the breadth of inferred natures possible in these
animals and the speciousness of taking any one of them as natural
for humans.

174

human nature

The answer is now framed in Darwinian terms, but the question


is still the one asked by the pre-evolutionist RousseauHow can we
come to know natural man, our essence prior to the development of
all these cultural complications? The quest for natural man has now
become the quest for our precultural ancestor, who is taken to be
Us, But Just Without Culture. And that is supposedly revealed by
the chimpanzee.

n a tura l s e x

The show was ABCs Nightline. Ted Koppel was off, and Forrest
Sawyer was substituting. It was August 3, 1992, and the subject was
the bonobo, in particular its extraordinary sex life. Extraordinary, that
is, for an ape: female bonobos rub their genitalia together, stimulating
one another, and they use sex in socially instrumental waysand,
more important, in nonreproductive ways. What might that tell us
about human nature?
Professor Frans de Waal, a distinguished primatologist from Emory
University, spoke quietly and candidly, in a mild Dutch accent, and
explained how the meaning of what was being discussed in bonobos
meant that things that we still have today, such as pedophilia and
homosexuality and a lot of other sexual orientations, that they are
sort of leftovers of that earlier period, in which sex was more widely
and publicly used in the society.
Now theres a thought that needs to be, as they say, unpacked.
Ignoring the gratuitous association of sexual preference and pedophilia, a sex crime, lets just focus on the last clause. The observations
in the bonobos are rst made relevant to humans by representing
them as equivalent to their human manifestations. This in itself may
be no more than a word game, for the equivalence of homosexuality
in humans and chimpanzees might be like that of slavery in humans
and ants, or ight in ducks, dragonies, and airplane pilotswhich
have, genetically, developmentally, and evolutionarily, nothing to do
with one another. Secondly, these bonobo and human attributes are
both equated with an attribute of human ancestors, by denition
unobservable. In this quite static evolutionary view, the attribute thus

human nature

175

becomes an unchanged survival from ancient times, a chunk of human nature made manifest.
That is simply pre-evolutionary philosophical thought clothed in
evolutionary terms.
We see this reasoning likewise in The Hunting Apes by sociobiologist Craig Stanford. [C]himpanzees, ancestral hominids, and modern foraging people such as the !Kung or Acheprovide a frame of
reference of our evolutionary history and therefore the roots of human
behavior, Stanford says. Thus we are presented with another species,
our own ancestors, and some modern humans as all being sufciently
equivalent as to be effectively interchangeable. To study one is to
study the others; to study chimps is to access human nature.

a d u ck wi t h lip s?

They used to teach a course in the biology department at Yale in


which the professor would raise the question of how to study human
nature without the confusing overlay of culture. He assured the class
that this was a modern scientic question, and not simply a rhetorical
device from political philosophy of the seventeenth and eighteenth
centuries.
We discussed it over lunch one day, and he patiently explained it
to me as well, that to study humans scientically, we had to examine
them as if they had no culture. Culture, he said, only confuses things.
He was an ornithologist.
I nally replied, Asking what humans would be like without culture is like asking what a duck would be like if it had lips instead of
a bill. It wouldnt be a duck; it would be something else.
I dont know if he ever got it. We never had lunch again.
On the other hand, that course is no longer offered.
Rousseau and Hobbes were wrong, as was the ornithologist. There
is no human nature outside of culture. A human is not like an artichoke, in which the prickly leaves of culture can be peeled away,
leaving only the exposed tender heart of natural man.
To dene human nature is to dene as well human un-nature. If
carnivory shaped our evolution, as one sociobiologist has written,
then being a vegetarian is unnatural. And yet people survive, and
176

human nature

thrive, and quite happily, as vegetarians. If polygyny is human nature,


then monogamous people are unnaturaland yet many are happy
that way.
Human nature is merely the range of things humans are capable
of. Some are noble, some are destructive, most are merely variants.
But if humans can be found to be both peaceful and aggressive, say,
then it makes little sense to speak of one or the other as being human
natureand its a ridiculously trivial observation to say that both are
human nature. That is because the question is framed archaically.
Nature and culture act as a synergy. If the human is like a cake,
culture is like the eggs, not like the icingit is an inseparable part,
not a supercial glaze. Whatever humans do, or look like, is a product
of both. Consider:
What is the shape of the human head? Is it globular or elongated? Youll
nd those extremes, and everything in between, atop the shoulders
of normal people. We know that head shape can be modied culturallythe Incas bound the heads of their children to give them high
skulls, and the Flathead Indians were renowned for skull modications in the opposite direction. The use of cradleboards affects the
shape of the back of the skull. But culture has far more subtle effects,
as Franz Boas showed early in the twentieth century. Merely growing
up in America, instead of in eastern Europe or Sicily, affects the form
of the skull. We dont know how, or what specically are the critical
variables. But as we noted earlier, this simply means that the human
body develops and grows responsively to the conditions of life. You
cannot develop a human skull outside of its environmental boundary
conditions. And in humans, those conditions are cultural.
Is it human nature to be polygynous? In primate species characterized
by a male mating with several females, the males are generally substantially larger than the females. Human males are on average 20
25% larger than females (but this can obviously be exaggerated in
cultures where boys are encouraged to be big and strong and girls are
encouraged to throw up lunch). Perhaps, then, this means we are
naturally somewhat polygynous, as sociobiologist Jared Diamond has
suggested in The Third Chimpanzee (1992)? On the other hand, males
human nature

177

in polygynous primate species have canine teeth substantially larger


than those of females; in monogamous primates (such as the gibbon),
males and females are not only the same size, but also have canine
teeth the same size. Whats the situation in humans? Surprise! Males
and females have canine teeth of the same size. (Diamond neglects
that counterevidence in presenting his case for human nature.) Whats
even more confusing is that humans have differences in body composition, with women averaging more fat and men more muscle; and
differences in facial and body hairpatterns of male-female differences without comparability in other species, for they are not seen in
our close primate relatives. So one bit of data suggests polygyny,
another suggests monogamy, and a third suggests that no comparative
inference about human nature, narrowly construed in a single noun
like polygyny or a single adjective like demonic, is possible.
Clearly, diverse sociosexual forms coexist in the human species; human nature appears to be everything and everywhere.
Is it natural to menstruate? In half our species, once a month a follicle
is released into the fallopian tubes, is not fertilized, and is discarded
with the endometrial lining of the uterus. What could be more natural? And yet, when we compare our culture to others, we nd that
women in modern industrialized society become fertile at an earlier
age, have fewer children in their lifetimes, space them more closely
together, dont take full advantage of the hormonal suppression of
ovulation that accompanies intensive breast-feeding, and reach menopause at a later age. When you do the math, you discover that
women in our modern society have ve to ten times as many menstrual cycles during their lives than women in rural, nonindustrialized
societies, and far more menstrual cycles than women at any other time,
in any other place, have ever had. In other words, cultural factors such
as economics, diet, and life expectations combine to determine the
number of menstrual cycles a woman will experience in her life.
What we get from all this is that the quest for human nature is itself
an illusion, the result of an antiquated way of thinking about humans
scienticallywith culture as a veneer overlying nature. Every hu-

178

human nature

man being that has ever lived has been born into a culture. Culture
preceded our speciesour ancestor Homo erectus certainly was a cultural species. In other words, culture is part of our nature; you cant
strip it away, scrape it off, pretend it doesnt exist, or look for it in
simpler forms. It is ubiquitous in human life; it is programmed into
human life.
You cant derive human nature from the Indians, the Australians,
the !Kung San, or the Yanomamo. Each is merely a variation on the
human themea theme as broad as the diversity of human societies,
languages, and activities over the span of the globe and the millennia
(and which, as it is reduced through the penetration of genocide,
colonialism, the media, and the market, reinforces the illusion of
uniformity). But none of them reveals human nature any more clearly
than a Harvard faculty meeting does. As Thomas Hobbes realized
when he invented this line of reasoning, its simply a series of political
inferences invoking the authority of science.
More than that, you cant get at human nature from chimpanzees.
Theyre not human.

human nature

179

Eight
human rights . . . for apes?

When we talk about whether antisocial behaviors are innate or


not, we are making anthropological pronouncements and invoking
what looks like genetics in support of a social and political philosophy.
In this case, the idea is that the poor and uneducated deserve what
little they have, for nature (rather than the avarice and malice of
others) has put them in the social position they are in. This can be
easily recognized as the central argument of The Bell Curve, for example. But much of Western social history has involved the development of views antithetical to that one, social ideologies that are
somewhat more empathetic.
We lack tests to gauge the individual potentials that people are born
with, and cannot make scientic statements about them. In the absence of a scientic approach to human potential, we are left with
two poles of social action: we can try to identify and cultivate diverse
talents as widely as possible (by investing our resources in education,
day care, and childrens enrichment programs); or we can condemn
large groups of people on the basis of their lack of performance,
denying the right of the subjects to be judged as individuals, and

180

denying as well the possibility of society at all beneting from the


talents with which they are endowed.
Neither alternative is particularly scientic; but the rst is at least
humanitarian.
There are other venues, however, by which social and political philosophies invoke molecular anthropological data in support of their
positions. As we saw in chapter 7, sociobiologists make plenty of hay
from the genetic similarity of humans and apes. One way in which
they extend this genetic similarity is to redene terms and concepts
generally applied to humans so that they can now apply to the apes
as well.

cul ture

In the previous chapter we saw how the 98% genetic similarity is used
to construct chimpanzees as the simplest humansa role no longer
lled by humans of any sort. Now the argument can be extended to
argue that the chimpanzees actually do possess in some rudimentary
state the quintessentially human attributeculture. If they have that,
which is supposed to be the thing that distinguishes humans from
other creatures, then they could really be considered simple people,
in a way.
Now, culture is a very tricky concept. It was invented by German
anthropologists in the nineteenth century and introduced independently to the American anthropological community by the Englishman Edward Burnett Tylor and the German American Franz Boas.
Tylor used the term in 1871 as synonymous with civilization and to
mean the things that arent inborn and of which all peoples partake
to a greater or lesser extent: the capabilities and habits acquired by
man as a member of society.
Boas, for his part, democratized culture and broadened it beyond
civilization, but never got around to trying to dene it until very
late in life. When he nally did, it came out a bit less felicitously than
Tylors denition: the totality of the mental and physical reactions
and activities that characterize the behavior of the individuals com-

human rights . . . for apes?

181

posing a social group . . . in relation to their natural environment, to


other groups, to members of the group itself, and of each individual
to himself. It also includes the product of these activities and their
role in the life of the groups.
Boas signicantly went on to say that [t]he mere enumeration of
these various aspects of life, however, does not constitute culture.
Culture was something more than just the sum of its parts. After all,
[t]he activities enumerated here are not by any means the sole property of man, for the life of animals is also regulated by their relations
to nature, to other animals, and by the interrelation of the individuals
composing the same species or social group.
In practice, what makes culture more than merely the enumeration
of the sum of its parts is language, the fundamentally symbolic activity
that permeates and suffuses all forms of human activity.
And thats the way anthropologists generally used the term in the
twentieth century.
That has been challenged recently in two ways: arguing that chimpanzees make and use tools, and have local traditions, and therefore
culture; and arguing that chimpanzees have language.
One thing chimpanzees do not have is speech; but speech isnt
language. Mynah birds speak, but they dont know what they are
saying. Speech can be an essentially mindless act of sound production;
but language is a mental faculty. Mute people are still human, but
mynah birds arent. Chimpanzees, for all their genetic similarity to
us, cannot even begin to approximate the range of sound that a person
can; indeed, that a mynah bird can.
Experiments with sign language and with computers, beginning in
the 1960s, were designed to see just what chimpanzees are mentally
capable of, along a linguistic path. Although they cant speak, perhaps
given a different medium than vocal, they might be shown actually
to approximate human faculties.
For all the interest generated by the sign-language experiments with
apes, three things are clear. First, they do have the capacity to manipulate a symbolic system given to them by humans, and to communicate with it. Second, unfortunately, they have nothing to say.
And third, they do not use any such system in the wild.

182

human rights . . . for apes?

This is not at all to disparage the value of that research. Given the
genetic and evolutionary proximity of the apes to us, it would be
somewhat surprising if they did not show any similarity to human
cognitive skills. But the studies were disappointing, for the apes never
said anything like, Would you like to know about our social system?
Well, the big guy, whom you call the alpha male, stomps around and
the offspring, who may or may not be his, get out of his way, unless
their mother is around.
Instead, they said, Come, tickle now. Gimme sweet.
Its also pretty clear that apes are very smart and can indeed make
and use toolscruddy tools to be sure, but tools by anyones denitionand that they can communicate coarsely in a human venue.
But thats not what anthropologists mean by culture.
Nor is the recognitionthe subject of an editorial in the New York
Times!that chimpanzees have local traditions, the ability to pass
on the results of observation and learning. No sane modern scholar
would deny that animals observe and learn. Culture is learned, but
it doesnt follow that everything learned is cultural. The fact that
humans have hair does not imply that all things with hair are human.
Thats from Philosophy of Logic 1A. But it comprises the core of this
odd argument: since culture is learned behavior, and chimps learn
behavior, it follows that chimps have culturein spite of what anthropologists have thought about it for decades.
And in spite of Boass own words decades ago.
What this revelation now shows, according to the Timess editorial,
is that chimps are more like us than we care to believe, and we are
more like them than we like to let on.
Well, of course, thats true whether or not they are cultural. But
whats the point of asserting that they are? Especially if it means
redening culture so as to make the demonstration that chimpanzees have it trivial?
Three separate questions must be answered to make sense of all
this:
What do humans have?
What do chimps have?
Whats their relationship?

human rights . . . for apes?

183

What humans have is a zoologically unique way of communicating,


which imparts arbitrary meaning to sounds, to combinations of
sounds, to the order of those combinations of sounds, and to the
associated social contexts of utterances. Our communication involves
phonologythe sounds, and especially decisions about them, such
as the rolled r and the trilled r, which are different in Spanish, shall
be variants of the same sound in English; semantics (words or parts
of words); syntax or grammar; and sociolinguistics (for example, the
knowledge that when Steve Martin said, Well, excuse me! in the
early days of Saturday Night Live, it was not intended to be a polite
apology, even though it appears to be one on paper).
This system, involving multiple levels of arbitrariness, is unique to
humans. It is so well developed in all human societiessymbolism
to the fourth power!that it is difcult even to imagine how it might
have evolved, although it obviously did.
Its power permits us to discuss things that didnt happen, that
might happen, that will happen; things to make us happy or sad; to
induce sexual arousal or exhortation to combat; to praise or berate
one another; to persuade, to lie. A narrowly utilitarian approach emphasizes the capabilities of transferring information from one person
to another, or to many people concurrently, but neglects the many
other kinds of things humans have to say to one anotherand probably have always had to say to one another.
And that chimpanzees dont, and havent.
Which is not to put chimps down. We in fact know rather little
about how they communicate with one another; weve given names
to their sounds, like grunt and pant-hoot, which occur in specic
contexts. But what they do have in the way of a communication
system is not well known; and what they have in the way of cognitive
apparatusthe ability to use a human system of communication
appears to be present, but about as useful to a chimpanzee as the
echolocation of bats would be. Language is just not a chimpanzee
thing. There is in fact very little overlap between chimpanzee and
human communication.
The news that they have culture depends crucially, then, on your
understanding of what is meant by the term. In this case, the scholars

184

human rights . . . for apes?

who published the paper in Nature that got the attention of the New
York Times meant something very specic. To them, culture is a set
of learned behaviors or traditions, which vary from group to group.
And they showed that chimps have that.
Not that it would have come as much of a surprise to Darwin or
Boas. Id venture to guess that populations of many animals have
learned behaviors that are different from those of other populations.
So why all the fuss?
Humanizing African apesjust like dehumanizing African people
has political weight. It might serve to make people aware of the abuses
chimpanzees sometimes suffer in captivity; it might arouse sympathies
for the animal rights movement; or it might just serve as yet another
rhetorical weapon against the fundamentalist Christians still trying
to subvert science education in America.

t h e g re a t a pe proj ect

A few years ago I was invited to Manchester, England, to participate


in a TV lm that would debate the merits of a movement to generate
interest in giving human rights to the great apes, The Great Ape
Project.
The Great Ape Project grew out of an apparent convergence of
interests between primate conservationists and animal-rights activists.
On the one hand, there is a worldwide problem that has not yet been
effectively addressed. Apes are threatened in the wild by the economic
development of the human societies around them. Part of this threat
is their exportation, legal and illegal. Apes are often objectied by
callous and cynical entrepreneurs, who neither regard them nor treat
them as the sentient, emotionally complex creatures they are. They
are generally disposed of when they lose their cuteness, usually less
than one-fth of the way through their lives. The lucky ones can live
out their lives in the care of an enlightened or sympathetic zoo or
primate research facility with sensitive caretakers and handlers. Most,
of course, are not lucky.
On the other hand, they strike the most self-reexive chord in us
when we look at them. They are our closest relatives; they sort of

human rights . . . for apes?

185

look and act like us, and they certainly have nervous systems, reactions, and behaviors like our own. So to the extent that animals are
persons deserving of rights, these are the animals most deserving of
all.
The Great Ape Project proposes that the great apes are entitled to
life, liberty, and not to be torturedin other words, to the rights of
humans, with whom they form a community of equals. Fair
enough; after all, who these days would stand up in favor of death,
enslavement, and torture? In the early 1990s, a book called The Great
Ape Project adduced no fewer than thirty essays in support of the idea
of human rights for the great apes. But in its way stand two simple
facts, which I tried to articulate for the British television audience.
First, the apes arent human.
And, second, we cant even guarantee human rights to humans.
Apes, being endangered, are no longer imported from the wild for
scientic research in America. We can readily acknowledge that they
deserve humane treatment in captivity. But human treatment? To
whom are they equal, anyway, and on what basis can we say so?
The fundamental basis, once again, was asserted to be their genetic
similarity to humans. This point was authoritatively asserted by the
biologists Jared Diamond and Richard Dawkins in their contributions and echoed by several others. It was also the very rst point
addressed in the lming of the television show. The molecular factoid
thus became the basis for a push for social legislation and moral
reform.
But we need to start out by remembering that we just do not accord
rights in modern society on the basis of genetic distance. The English
do not accord greater rights to Iraqis than to Japanese. The category
human is neither fuzzy nor dened by genetic closeness. In principle the category should be dened (as any animal species should
be) in terms of reproductive compatibility and ecological nichenot
in terms of how genetically similar or dissimilar two individuals may
be.
More to the point, the tenets of liberal democracy since the Enlightenment hold that citizens should be entitled to equal rights. Of
course, as philosopher Hannah Arendt noted, the Enlightenment had

186

human rights . . . for apes?

it backward in arguing that all people are created equal, which


entitled them to citizenship under the law. Actually, however, citizenship is neither an act of God, nor a fact of biology, but an endowment by the state. It is specically the conferral of citizenship
that makes people equal. The state decides who its citizens are and
makes them equal. And to the extent that since the end of World
War II we have sought to broaden the concept into one of universal
rights, that is predicated on the idea of universal citizenship.
To suggest that genetic distance should now dictate the allocation
of rights harks back to some of the more odious social philosophies
of this century. Certainly human rights agencies are not concerned
with how similar people are to one another; they are concerned with
the maltreatment of people. The entry of genetics would seem to be
a perverse change of moral direction.
Moral direction is notoriously ckle, though. My initial thoughts
about the push to give chimpanzees human rights harked back to the
1950 movie (and recent musical) Sunset Boulevard. The narrator, a
young screenwriter, played by William Holden, is visiting the home
of the reclusive screen legend Norma Desmond (Gloria Swanson).
His rst glimpse of her is as she cradles and mourns her lately expired
pet chimpanzee. Watching the last rites for that hairy old chimp,
performed with the utmost seriousness, as if she were laying to rest
an only child, the Holden character wonders: Was her life really as
empty as that?
Obviously, it was. We learn of her emotional isolation and her
inhumanity through the course of the movie. And foreshadowing the
dementia (All right, Mr. DeMille, Im ready for my close-up, she
coos famously as she is led out) is the fact that she has lost track of
her own kind; she doesnt know what she is. She treats animals like
humans and vice versa; she has no moral compass.
Fickle indeed are the moral winds. When Sunset Boulevard was
released in 1950, Norma Desmonds confusion of ape and person was
an obvious marker of her loss of her moral, and impending loss of
mental, bearings. Today, the same confusion is worn as a badge of
morality.
Fickle, indeed!

human rights . . . for apes?

187

Apes deserve protection, even rights, but not human rights. Confusing humans and nonhumans has never advanced anyones lot. And
certainly genetics is not going to clarify it much.
By the genetic criterion, the cutoff (at orangutans) is quite arbitrary
anyway. Indeed the ape-rights movement is aimed specically at the
great apes (chimpanzee, gorilla, orangutan), and leaves the graceful
and endangered lesser apes, the gibbons of southeast Asia, to their
own devices.
But this is where the alliance between the animal-rights activists
and the ape-conservation activists beaks down. The former group sees
the ape-rights movement as a Trojan horse, a foot in the door toward
the liberation of all animals; apes just happen to be among the cutest
and most resonant, and thereby the ones for which they can drum
up support most easily. Some of these supporters of the ape-rights
movement dont even seem to know much about apes; one essay in
their agship document actually begins, Chimpanzees make love
rather like humans do. . . .
Of course, it is not clear that chimpanzees make love at all. But
more important, the average copulatory bout in chimpanzees lasts
between ten and fteen seconds and involves a female whose genitalia
are swollen and purple (a prominent visual display of fertility, unique
among apes to the chimpanzees), and often a succession of males who
are otherwise generally not very interested in sex; and no tactile exploration or erogeny at all. In ten to fteen seconds, after all, you
cant expect much. Doesnt sound the least bit like love-making in
humans, at least the way most of us been fortunate enough to experience it, and it quite possibly says more about the author than it
does about chimpanzees.
But for the extreme animal-rights activists, genetic distance doesnt
much matter to begin with; it is simply a rhetorical device. If all
animals (or at least, mammals; or at least, cute mammals) are equivalent, then the apes hold no special place for them, and the evolutionary relationships between us and them are entirely irrelevant. The
conjunction of animal-rights activists and sincere primate conservationists is thus a marriage of convenience. If the justication for ape
rights is phylogenetic proximity, then the justication for animal

188

human rights . . . for apes?

rights is creationist, for it ignores evolutionary relationships and implies that all animals are equidistant from humans.
As the editors of The Great Ape Project write, the most important
contribution of the political push will be its symbolic value as a
concrete representation of the rst breach in the species barrier. This
sounds like an exploitation of the living apes and of their difcult
status as callous as any circus act is.

a re a pe s m e re l y d i s able d p eop le ?

One signicant argument advanced on behalf of human rights for


the apes involves their cognitive performance. Since their brains are
closely related to our brains, it should come as no surprise that the
apes can approach humans in their cognitive functions. To the extent
that those functions can be linearized for comparison, apes perform
mentally on a par with some mentally disabled children.
But that is a very misleading comparison, for two major reasons.
The fact that tests can be linearized does not mean that the relationship of apes to us is itself linear. Apes are not subhuman, they are
nonhuman. Thus, although the largest gorilla brain is similar in size
to the smallest nonpathological human brain, there is no evidence
that the gorilla brain ever produces anything other than normal gorilla
thoughts or that the human brain produces anything other than normal human thoughts.
But the comparison is even more invidious, for it often reinvents
the linear developmental hierarchy of Victorian science. A century
ago, evolution was commonly seen as a single-dimensional process,
with healthy adult European Christian men at a pinnacle, and nonEuropeans, non-Christians, non-men, non-adults, and non-healthy
people somewhere below them. In essence, the other categories of
people comprised humans who were not fully developed; to the extent
that they were at least biologically human, they were nevertheless
incomplete.
Over the course of the nineteenth and twentieth centuries, that
view was eroded by the elevation of all those other people. If healthy
adult European Christian men were at the pinnacle of something, it

human rights . . . for apes?

189

was a social hierarchy that placed them and kept them there by exploiting and subjugating other people. The problem was the agency
by which inequality came to be regarded as acceptable, and even
naturalnot the qualities of the incomplete people of the world.
This was not a natural hierarchy, expressing the superior qualities of
those people at the top; that view was a classic case of blaming the
victim.
Curiously, we see that hierarchy rediscovered in the Great Ape Project. A British zoologist was asked on our television show, as a supporter of human rights for apes, whether he would allow his daughter
to marry one. He replied, I dont think she would want to marry
one. . . . Would you let your daughter marry, say, a mentally retarded
individual?
Other members of the discussion gasped. Did he really think that
there was some kind of equivalence between a mentally handicapped
person and a chimpanzee? Is marrying outside your species really
equivalent to marrying outside your IQ cohort?
It was a chilling equivalence, made very casually.
Not only are apes not at all like mentally handicapped humans,
but more important, mentally handicapped humans are not like apes.
Nor are blacks, Jews, hunter-gatherers, or New York cabbies. All people are perfectly human, and all apes are not at all human. Thats the
simple biology.
And yet there is a seductive ring to the comparison. As a legal
advocate for the movement said on the television show:
We give human rights to children, to the aged and to the mentally
inrm, to the autistic, to the deaf and to the dumb. . . . [T]he
facts we recognize in common humanity compel us to recognize
the humanity in the great apes; . . . they can reason and communicate
at least as well as some of the children and disabled humans to
whom we accord human rights.

Humanity here seems to be something a bit unfamiliar, something other than merely the state of being human, which the apes
clearly are not and disabled people clearly are. It seems to be no longer

190

human rights . . . for apes?

a condition of birth, a simple fact of nature or genetics, but rather a


state one can aspire to, and may earn through industry and mental
vigor. If it can be earned, of course, it can also be lost; they are two
sides of the same coin. And so the key question is: What exactly is
the implied connection between the ability to reason and communicate on the one hand, and humanity and human rights on the
other? Why should the mentality of apes have any bearing on their
humanness (or lack thereof) or their rights (or lack thereof)? If you
lose the ability to reason and communicate, do you thereby forfeit
your humanity and rights?
This is a scary moral place for apes and people to be. Humans have
human rights by virtue of having been born human and to the extent
that being a human is a precondition of citizenship. Human rights
should neither be forfeitable nor accessible by nonhumans. That is
not to say that other beings should have no rights; it is merely to say
that the phrase human rights has no meaning if it does not apply
to all humans and only to humans. Singling out particular classes of
people in order to show how similar they are to apes is a troubling
scientic strategy, not least of all when the humans rhetorically invoked are the very ones whose rights are most conspicuously in jeopardy.
The closest example I can think of is the fateful decision made in
the nineteenth century by the great proponent of human evolution
Thomas Huxley. Knowing how intensely political the subject was,
Huxley let out all the stops in his public defense of evolution, particularly of human evolution. Unfortunately, Huxley was faced with
an embarrassing lack of data from the fossil record: just where one
would expect to see a transition from ape to human, there were no
such fossils.
Not to worry, argued Huxley. Evolution is well supported in spite
of the absence of fossil data: the transition from ape to human is
documented among living peoples. The nonwhite peoples of the
earth, argued Huxley, are the forms of life that connect the races of
Europe to the ape as surely as the duck-billed platypus connects mammals to the lower vertebrates. The argument was familiar to creationists, because it had been invoked in pre-evolutionary writings; asso-

human rights . . . for apes?

191

ciating non-European peoples with lower forms of life transcended


the argument of evolution versus creationism. But Huxley gave the
association a new scientic context.
And so the non-European peoples were sacriced on the altar of
evolution in order to make a rhetorical point against the creationists.
If we learn something from that episode, it must certainly be that
dehumanizing people is not an admirable rhetorical strategy for a
scientic debate.
The problem, as I see it, is that the great ape activists have tried to
make this a human rights issue, to which they assume all humans
would be empathetic. That, however, makes human the crucially
contested concept, which it shouldnt be. The concept should be
rights.
Apes should be conserved and treated with compassion, but to blur
the line between them and us is an unscientic rhetorical device. And
thereby to call the human status of the most marginalized people in
our society into question is morally problematic (in addition to being
zoologically ridiculous).
We also acknowledge that alongside the concept of rights comes
the attendant concept of responsibilities. You have a responsibility to
behave in a civil manner, and can forfeit certain rights by the commission of criminal acts, for example. Of course, a chimpanzee cannot
grasp the difference between civil and uncivil behavior, or between
legal and illegal activities. A human would be institutionalized in such
a state, but that is precisely what the ape-rights activists oppose for
apes. How, then, do you treat a chimpanzee who steals or murders?
Or do you just accord them human rights without attendant responsibilities, in essence giving them greater license than humans?
Here the ape-rights activists are in a bit of a bind, for they try to
represent chimpanzees as Jane Goodall did decades ago, as nice
(and Goodall is a prominent activist for chimpanzees). But the latest
work on chimpanzees shows them to be frequently mean and brutal,
occasionally carnivorous, and always dangerous. Not quite the stuff
of a sympathetic portrayal of human rights.
Perhaps the ugliest undertone in the discourse of human rights
for apes, however, is the combination of naive colonialism and cyn-

192

human rights . . . for apes?

ical misanthropy. Ape rights is not a political movement in Central


Africa or Indonesia, where human rights are sufciently precarious.
The ape rights movement is principally Euro-American.
When we hear talk of human rights for apes because they constitute a community of equals, we are hearing a plea for the consideration of the interests of apes and humans to be given some kind
of equal footing. Now dont get me wrong; nobody loves a cute baby
chimpanzee more than I do, but when we think about ape rights, we
have to remember that the ordinary New Yorkers or Londoners economic interests simply do not come into conict with those of a
chimpanzee. The average Tanzanians economic interests, on the
other hand, may well.
The basic problem is the presumption that comes with a couchpotato argument for rights to Tanzanian chimpanzees, Rwandan gorillas, or Indonesian orangutans. Could you really look a group of
Rwandans in the eye, with the horrors and brutalities on massive
scales that they have had to endure, and tell them that a gorilla has
got the same rights as them? Personally, I couldnt, but there are
people who seem to think they could.
Gorillas are sentient and emotionally complex, but of course, so
are humans. The people who would be most directly affected by such
a declaration are those whose ordinary lives have been far crueler than
those making the declaration. The welfare of gorillas is important,
but it is not a human rights issue and cannot be allowed to diffuse
the attention we pay to human rights violations.

th e b a n g kok si x

In Bangkok airport in 1989, a scheme to smuggle six baby orangutans


from Indonesia to (presumably) China was accidentally thwarted
when the cries of the apes, in wooden crates in transit, alerted ofcials,
after they had been abandoned for several days. One of the babies
died a few weeks later, one a few months later, and a third a few years
later. An appalling tragedy? You bet.
Could it be remedied by making the home country of orangutans,
Indonesia, recognize human rights for orangutans? Maybe, but think

human rights . . . for apes?

193

about it. Indonesia is one of the worst places in the world for enforcing human rights for humans. On the island of East Timor,
hundreds of thousands of people have been the victims of genocide
in recent years. Indonesian attitudes toward orangutans are also
tragic, but the simple fact is that state-mandated policies toward
the apes simply do not constitute the biggest problem of rights
there.
One occasionally encounters a curious response to this argument.
As a noted British zoologist once told me superciliously, Think percentages, not numbers. In other words, the Earth can spare a few
hundred thousand East Asian people, because there are lots of us, but
there are only a few orangutans, so each ape life is that much more
valuable.
It is an odious comparison, weighing the value of human life against
the value of orangutan life. But thats ultimately what this is about.
A British professor thinks there are too many Asians and not enough
orangutans.
Maybe, on the other hand, there are too many British professors.
This patently misanthropic ethic undermines any claim that aperights advocates might assert to the moral high ground. The value we
place on a human life cannot be a function of how many others there
are in that particular category. If you really believe there are too many
people and not enough orangutans, and you value their lives accordingly, you are obliged to decide which people are superuous.
Is your own life superuous? Or just the lives of little dark people
somewhere else whom you dont know?
Thats often the way it is, of course. It is easy to condemn the poor
of other nations, or even of our own, for being prolic, all the while
knowing smugly that the world will always be big enough for one
more Harvard man. That is in fact the fallacy promoted by Thomas
Malthus at the end of the eighteenth century. He projected too many
people and not enough resources and concluded we needed to take
a heartless approach to the poor because they were the problem. The
social forces that created the poor and kept them poor were invisible
to him. Nowadays we know that education, upward economic mobility, and economic modernization all work to drive reproductive

194

human rights . . . for apes?

rates down; giving women choices in their lives invariably has them
bear, on the average, fewer children.
It is far too easy to assert that theres too many of those other people;
they can tolerate some losses. Not only is that callous, it is the very
antithesis of morality in our civilization, and has been (at least normatively) for a very long time. Recall by way of mythic example the
Pharaoh in the rst chapter of Exodus, who decided there were too
many Hebrews, and acted accordingly. A concern for animal welfare
must come out of a concern for human welfare. It must emerge from
a concern for human rights, not supplant it. For once we begin to
devalue human lives, we lose a standard by which to value any other
kind of lives. And it just doesnt work the other way around.
It is importantvery importantto protect and defend the lives
of nonhuman primates. But our concern for them cant come at the
expense of our concern for human misery and make us numb to it.
Baby orangutans in boxes should make you sad, but human misery
should make you sadder. An abused chimpanzee may be genetically
98% human, but an abused person is 100% human.
The people who maintained overtly that most human life was cheap
were the ones who lost World War II.
They were also the ones who thought that genetic distances constituted a sound basis on which to accord human rights.

re a d i n g th e m i n ds of ap e s

The most resonant argument for human rights for apes is based on
their mental capacities, which are notoriously difcult to infer. Many
of the data, and especially the emotionally compelling data, are anecdotal or based on a combination of projection and dubious inferences.
Just look at them! Just be with themand you will experience the
empathy that links your mind to theirs!
And yet, where clever, controlled experimentation has been possible, it has tended strongly to show that in specic ways, ape minds
work quite differently from human minds. Which is, of course, what
we would expect, given that they are different species.

human rights . . . for apes?

195

Thus, argues Daniel Povinelli, you can watch chimps and imagine
you know what theyre thinking, but what you think theyre thinking
may not be a reliable guide at all to what theyre actually thinking.
Is a chimpanzee able to put itself in anothers place, as it casually
seems to human observers accustomed to imagining themselves in
someone elses place, or is a chimpanzees behavior guided by a less
complex, less human mental program? Povinelli nds that whenever
he can devise an experiment to distinguish between whether a chimpanzee is having a high-level thought or a low-level thought, the
chimps invariably are having the simple, unimpressive thoughtif
thought is even the right word.
The data invoked for ape rights on the basis of their minds and
behavior are invariably the ufest and least scientically compelling
data; where data are collected most rigorously, they point to the mental differences between us. Having three times as much brain does,
it seems, make a difference.
None of which is to say that chimpanzees dont merit protection
in captivity and preservation in the wildbut simply that it has
nothing to do with human rights.

t a ki n g i t t o t h e streets

In early 1999, the legislature of New Zealand debated the rst aperights bill. There are no apes indigenous to New Zealand, and no
research was being performed on apes in New Zealand. In fact, there
were at the time twenty-eight chimpanzees and six orangutans in the
entire country, and no one was suggesting that they were being in
any way mistreated, so the proposed legislation was almost entirely
symbolic. Appropriately, its major scientic proponent was a theoretical biologist.
Although largely ignored in the United States, the New Zealand
debate was watched carefully in England, particularly by the scientic
community. The weekly science magazine New Scientist weighed in
strongly in their issue of February 13, reminding the reader that folk
genetics lies just behind the legislation:

196

human rights . . . for apes?

Unfortunately, it has become fashionable to stress that chimpanzees


and humans must have staggeringly similar psychologies because
they share 98.4 per cent of their DNA. But this misses the point:
genomes are not cake recipes. . . . A creature that shares 98.4 per
cent of its DNA with humans is not 98.4 per cent human, any
more than a sh that shares, say, 40 per cent of its DNA with us is
40 per cent human.

And of the notion of human rights for the apes generally, New Scientist had only sarcasm:
[I]f animals have rights which protect them against humans, it is
only logical that they should have rights that protect them from
each other. If a chimp kills another chimp in the wild, or a human,
do we really want to hire a eet of lawyers? And if we extended
honorary personhood to all animals, would the gazelle be entitled
to rights against the lion?

The point, quite properly, is that such a movement invokes science


for an entirely unscientic end. The means are rhetorical; to the
extent that it sounds as if the end is supported by science, or by
genetics, it merely makes the scientists look foolish or thoughtless.
Nature ran a small article in its issue of June 17, 1999, titled NZ
Bid to Win Rights for Apes Fails in Parliament. The idea of human
rights for the apes died in committee. The chimpophiles had been
thwarted. This probably spells doom for their efforts to convince
the United Nations to make a Declaration of the Rights of Great
Apes, based on the genetic proximity of apes to humans.
Amen.

human rights . . . for apes?

197

Nine
a human gene museum?

If ape genetics is political, imagine how political human genetics


gets. The big lie all too frequently taught in university genetics classes
is that human genetics is, or at least ought to be, just like mouse or
y genetics.
It isnt.
It cant be. Mouse genetics doesnt have to deal with abortion,
genetic screening, racism, discrimination, the loss of health insurance,
and the rights of oppressed and indigenous mice.
Everyone knows about the Human Genome Project, a medical
genetics program begun in 1989 for sequencing all the DNA in a
typical human cell and identifying all its genes, and incidentally keeping every molecular geneticist in the world gainfully employed well
into the millennium.
When you think about it, however, the Human Genome Project
has a minor conceptual aw at its center. Medical geneticists often
conceive of genetic diseases in medical terms, in which people are
either normal or illwith a normal gene as the referent and its
pathological variants as contrasts. But thats not necessarily the right
way to see the human genome. After all (as noted in chapter 5), noses
are all genetically determined, all different, and, barring accidents, all

198

normal. Thus it is not appropriate to think of noses in the same way


we think of diseases: a single condition of normalcy and a spectrum
of deviations from it.
Similarly, the genes for blood groups, the longest-studied genetic
system, are arrayed quite differently from the gene that governs cystic
brosis. Rather than a normal gene and some rare disease-causing
variants, all populations of humans have all the blood group alleles
(A, B, and O) in differing (but high) proportions. This being the
case, there is no normal blood group gene; type O, type A, and
type B are all normal. And this seems to be the general pattern of
human genetic variation, not the disease model.
Since people are genetically diverse, and most are nevertheless normal, there can consequently be no the human genome to sequence.
Geneticist Bruce Walsh of the University of Arizona and I pointed
this out in a sarcastic letter to Nature in 1986. There are many human
genomes, all different from one another and all more or less normal.
Genetic diseases are the exception, not the rule, when it comes to
variation in our species. And if we are going to sequence one human
genome, by implication, the normal one, perhapsWalsh and I
argued tongue-in-cheekthe Human Genome Project should exhume Charles Darwin and sequence his DNA. At least that might
remind them of the awed premise guiding their work.
But sarcastic letters will only get you so far. At stake might be real
money, real prestige, and real jobs. Thus, population geneticists, hoping for a piece of the action, proposed a Human Genome Diversity
Project (HGDP) in 1991. Led by Stanfords Luca Cavalli-Sforza, they
proposed a major, centralized effort at establishing a genetic research
museum of the human species. By establishing cell lines derived from
the various peoples of the world, it would be possible to maintain a
resource in Palo Alto or New Haven covering genetic diversity in the
human species for study by geneticists anywhere, anytime.
Cavalli-Sforza, a charismatic and respected researcher in human
population genetics, had been interested for decades in the biogenetic
relationships among populations. For instance, given their genes, are
the English more closely related to the Irish or to the French? CavalliSforza had been developing algorithms by which to determine genetic

a human gene museum?

199

distances among populations of the world, and thence to ascertain


their biological history, or phylogeny. The HGDP t perfectly into
his overarching research program.
Pensive and downy-haired, looking very much the European aristocrat, Cavalli-Sforza is an imposing personal and intellectual gure.
The force of his personality and brilliance made the HGDP newsworthy. With Walter (now Sir Walter) Bodmer, Cavalli-Sforza had
literally written the book on human population genetics back in
the 1970s. The HGDP would be the culmination of that work.
It was dubious as anthropology, however, for the program was exceedingly nave in spite of its technological sophistication. After all,
the English are not genetically distinct from the French or Irish
they have absorbed elements of the gene pools of both, in spite of
their social differences. It is therefore unclear what the meaning of a
phylogenetic tree of the three populations relationshipsas if they
were Drosophila melanogaster, persimilis, and subobscurawould be.
It is rather like asking whether archaeology is more similar to art
history or to paleontology; well, its similar to both, and the answer
you get (and you can always get an answer from a computer) will
depend on the breadth of the data you analyze and the type of analysis
you make.
Cavalli-Sforza had shown in the 1960s that if you analyze the major races, you nd that EurAsians are juxtaposed against Africans in
the computer-generated phylogenetic tree derived from bodily measurements; while EurAfricans were juxtaposed against Asians in the
tree derived from the blood group genes. In other words, the basic
division in the human species appeared to be a North-South split
anatomically, but an East-West split genetically. His conclusion: the
anatomy was wrong; Europeans and Africans diverge from Asians in
the most fundamental division of our species. Genes dont lie.
Or do they? A different analysis of similar data by other population
geneticists actually obtained the presumptively anatomical tree
from the genetic data. Thus the basic structure of the tree appeared
to be very sensitive to the precise computer program used to cluster
the data. Perhaps, then, the conclusion was underdetermined by the
data.

200

a human gene museum?

Africans

Europeans

Asians

Asians

Europeans

Africans

Figure 7. Are the most closely related races Europeans and Asians or Europeans
and Africans? In fact, neither alternative is correct, for the African gene pool
subsumes those of Asians and Europeans and therefore cannot be contrasted with
them.

Even so, the model was predicated on two odd assumptions: that
the human species is naturally partitioned into three equivalent
unitsAfricans, Asians, and Europeansand that human history
can be interpreted sensibly as a series of bifurcations, as the populations come printed out of the computer. Neither assumption is valid.
Furthermore, the mitochondrial Eve research of the 1980s showed
a pattern different from that of Cavalli-Sforzas genetic work from
the 1960s. As we saw in chapter 4, African, European, and Asian are
not equivalent biological categories at all, it seems, because the rst
subsumes the other two genetically (g. 7).
That is a very important conclusion, because it means that asking
about the relationships among the three groups is a nonsense question. As noted in chapter 4, its like asking which two are most closely
related among cows, dogs, and mammals. Since the category mammals includes cows and dogs, it cannot be contrasted with them.
The answer you get will simply depend upon what you choose to
represent your group mammals.
Of course, those cultural categories of race are so powerful that the
point has proven elusive to many geneticists. And in fact by the late
1980s, it was still eluding these geneticists as they mobilized their
resources to push for the construction of a human genome diversity
project (or HGDP). When the same kinds of old models (bifurcating
relationships among historically constructed human groups) were
used, Africans now appeared to be more different genetically from
Europeans and Asians than originally thought. By 1988, Cavalli-

a human gene museum?

201

Sforza was prepared to acknowledge that his earlier conclusion had


been mistaken. A big project designed to collect and study the diversity of the human genes might be the perfect way to solve the
question once and for all.
Or, to a cynic, it might simply be a lot of money allocated to an
intellectually antiquated program.
th e h um a n g e n om e diversity p roj ect

The proposal was published in the journal Genome in 1991, signed by


geneticists Charles Cantor, Robert Cook-Deegan, Mary-Claire King,
and Allan Wilson, in addition to Cavalli-Sforza himself. Immediately,
the science media began to report on it, to help promote the project
as well.
I rst heard about the HGDP from Leslie Roberts, writing it up
for Science, the most prestigious science journal in America. Roberts
was interviewing people by phone for her story. In particular, she
wanted my opinion on a controversy at the very top, among the
organizers. Cavalli-Sforza was planning to sample the worlds populations by ethnic groupin other words, to nd and bleed some
Hopis, some Yanomamos, some Navajos, and so on. Allan Wilson
(who had supervised the mitochondrial Eve research a few years earlier) was arguing that that approach would bias the project so as to
produce misleading results.
Wilson was obviously right, I explained to the journalist. As any
anthropologist knows, ethnic groups are categories of human invention, not given by nature. Their boundaries are porous, their existence
historically ephemeral. There are the French, but no more Franks;
there are the English, but no Saxons; and Navajos, but no Anasazi.
Moreover, since we have very limited access to the Franks, the Saxons,
or the Anasazi (through classical physical comparisons or new methods of amplifying trace bits of DNA), we cannot really know the
nature of the actual relationship of the modern group to the ancient
one.
The worst mistake you can make in human biology is to confuse
constructed categories with natural ones. And to load a big project

202

a human gene museum?

with cultural categories as the overall sampling strategy would be a


serious problem. First, it would make those labels appear to be genetic
units; indeed, it would make them genetic units, which they had not
been previously. Second, it would emphasize the genetic distinctions
among these groups; it would force them to be genetically distinct by
being so labeled at the outset.
What was the alternative? Wilson had suggested sampling the world
by a less culturally loaded criterion: geography. Lay a grid over the
world, and simply take a few people from here and a few people from
there. Record the ethnic data if you like, but dont let that be the
guiding variable, or else your study of human genetic diversity will
be ridiculously biased toward differences between labeled categories.
And we already know that those differences are quite minor. All you
would do would be to magnify them articially.
The ephemerality of those cultural labels is well attested. Wherever
human populations have come into contact, they have exchanged
thingstechnologies, ideas, DNA. Human groupsno matter
where or whentrade, and where goods ow, so do genes. Those
stories about the traveling salesmen are not just urban myths.
As it happened, I ended up on the cutting-room oor of that Science
story. (I later learned that Kevin Costner had played the corpse in
The Big Chill and had suffered the same fate, so I didnt feel so bad.)
But when the story appeared, there was clearly more to it. In their
zeal to drum up support for the HGDP, its advocates were making
some weirdly old-fashioned assertions about human populations. For
example, highlighting the Bushmen of southern Africa, and the
Basques of the Pyrenees, Roberts wrote, What these populations
have in common is that each has been isolated and has rarelyif
everintermixed with its neighbors. Consequently, each offers a
window into the past, quoting one of the HGDPs enthusiastic
population geneticists. And the reporter wasnt making it up. The
original Genomics proposal told the scientic community:
The populations that can tell us the most about our evolutionary
past are those which have been isolated for some time, are likely to
be linguistically and culturally distinct, and are often surrounded

a human gene museum?

203

by geographical barriers. . . . Isolated human populations contain


much more informative genetic records than more recent, urban
ones. Such human populations are being rapidly merged with their
neighbors, however, destroying irrevocably the information needed
to reconstruct our evolutionary history.

But again, as any anthropology student knows, those populations


are certainly not isolated or pure. There are academic debates about
the ethnohistories of populations for whom we have few written records, but none of them at present involves an assertion of isolation
or genetic purity. And what kind of window into the past were they
expecting to nd? Did they think that the gene pool of the San
Bushmen of the Kalahari is ancestral to the gene pool of geneticists?
Just whose (our) evolutionary history or evolutionary past did they
expect to be illuminated by the genetics of the !Kung San or Hopi?
The fact is, human populations areand have probably always
beenporous constructs whose contemporary genetic information is
very unlikely to illuminate anything but their own evolutionary history, if that. Serious scholars of human variation hadnt made assertions like that for nearly a century.
And there was more. The pitch on behalf of the diversity project
asserted that time was shortbecause those peoples are becoming
extinct. The very title of the Science article was A Genetic Survey of
Vanishing Peoples. In the British journal Nature, biologist Jared Diamond stumped for the project with the impassioned plea that so
little time remains before it will be too late.
But wait a minute. If people are vanishing, what good does it do
them to save their genes?
These scientists were trying to approach indigenous peoples whose
lands had been stolen, lifeways eradicated, and people exterminated,
at the hands of the very civilization the scientists represented.
And now they wanted blood.
The cultural assumptions on the part of the geneticists were stunning: for people whose lifeways and whose very existence are jeopardized by insensitive exploitation, the preservation of their cells
bespoke a very cynical hereditarianism. The geneticists apparently

204

a human gene museum?

expected to look people in the eye and tell them that their DNA was
more valuable than their customs, their land, their traditions, and
their lives. Imagine the scientists surprise when those people failed
to share their priorities!
And why is the uidity of human populations (merg[ing] with
their neighbors) such a bad thing? Did they think it has only just
begun? In fact, many of the vanishing populations were only vanishing in a peculiarly narrow, genetical sense. Many were actually
bouncing back demographically and culturally, through a revival of
traditions, immigration, and the general ux of population histories.
Their genetics were changing, but why would geneticists demand
them to be frozen in time?
Worse still, when they were approached by geneticists interested in
studying the gene pool of African Americans and Latinos, the leaders
of the HGDP demurred. Those were admixed populations and thus
not interesting to them. The goal of the project was apparently to
reconstruct an imaginary human gene pool of the year 1500, not to
study the real human gene pool of the year 2000.
Objections to the project were slow to be voiced because the geneticists had succeeded in building up a favorable publicity machine
in the science media. Not only was this a big anthropology project
conceived and designed without input from anthropologists, but neither was there input from, or contact with, the people they hoped to
study. It thus appeared to be a classically colonialist undertaking.
Geneticists regarded the indigenous peoples as objects of analysis; the
scientists were talking about them, but not to them. From a standpoint of unequal power relations, they would coax them to provide
some of their blood (or perhaps get someone else to do the dirty
work), and then nd out who they were closely related to, back home
comfortably in Palo Alto.
It was a throwback to the anthropology of a much earlier generation.
With nancial assistance from major scientic organizations, the
geneticists began to hold formal meetings to discuss the scientic
issues. In July 1992, they convened at Stanford to debate the issues
of theoretical population genetics that would be central to the proj-

a human gene museum?

205

ects aims. Later that year, they convened again at Penn State to decide
which populations should be targeted, and came up with a list of
about 500, which ultimately became an ofcial list of 722 populations.
A third news feature in Science again reported the projects two articulated goals: how populations are related and to probe human
evolutionary history. Anthropologists were now being invited to
help, but it was clear that their participation was not for the projects
design, but simply to help operationalize it.

ob je cti on s t o t h e p roj e ct

Times, however, had changed. As anthropology had matured as a


discipline in the 1950s and 1960s, the scholars who were dependent
upon indigenous peoples for their academic livelihoods saw themselves increasingly as responsible to those people, acting as voices for
people who had little or no voice. Anthropology worked at getting
their stories told and helping develop their voices. Perhaps it was a
bit paternalistic, but that was better than colonialistic, and it was
certainly motivated by more noble goals. And now many of those
people had voices, and had some measure of political clout. It had
even begun to backre, as Native Americans became empowered by
the Native American Graves Protection and Repatriation Act (NAGPRA) of 1990, reclaiming skeletal materials and artifacts that had been
mainstays of anthropological studies for decades.
And these same isolated and vanishing peoples now began to
speak out about the Human Genome Diversity Project.
In early 1993, a watchdog organization concerned with the rights
of indigenous peoples, the Rural Advancement Foundation International (RAFI), alerted representatives of several populations about
the well-hyped project. They saw things a bit differently than the
scientists did. They recalled the free use of local knowledge of plants
by major First World corporations, which then developed hybrid
strains, patented them, and sold them back to the people who made
the prots possible in the rst place without sharing in them. They
recalled a long history of relations with powerful Euro-American
institutions, ranging from being exploited to being exterminated,

206

a human gene museum?

but usually ending in their being impoverished and socially marginalized.


By late 1993, e-mail had linked up the isolated populations and
their activist spokespeople into a strident anti-HGDP network. Open
letters to the HGDP bioethicist and lawyer Henry Greely from the
South-and-Meso American Indian Information Center (SAIIC), and
from the Onandaga Council of Chiefs to Jonathan Friedlaender of
the National Science Foundation, a supporter of the HGDP, were
widely circulated in the academic community. In December, a World
Council of Indigenous Peoples in Guatemala repudiated the HGDP.
As a reaction to the rst wave of anthropological criticisms, the
HGDP attempted to shift the major popularized goals of the project
away from human microphylogeny and toward biomedical benets
that might accrue from a study of genetic diversity, such as isolating
and thereby treating genetic dispositions to hypertension and diabetes. This was difcult to sustain, however, since the project had only
planned to collect blood, not biomedical histories, or even general
phenotypes. Without a knowledge of who actually had diabetes, it
would be virtually impossible to collect any useful medical genetic
information on it. For a genetic study of height, you have to know
how tall the subjects who donated the DNA being studied actually
were.
The projects goal was to record the ethnic group of each DNA
sample, since that was what its organizers needed to know, given their
research interests. Thus any researcher who wanted such a sample
would receive a Hopi, female or Efe pygmy, male. Unless diabetes
(i.e., medical history) or height were serendipitously recorded, that
information would simply not be available for a researcher interested
in such matters. There was no plan for the systematic recording of
medical history or outward characteristics (phenotypes); the HGDP
was being conceived simply for molecular population genetics, for
researchers with a biohistorical interest, like Cavalli-Sforzas, nothing
more.
It was already known that the biohistory of human populations is
difcult to extract from genetic differences. Different populations
might be similar to one another because they diverged from one

a human gene museum?

207

another recently, or because they came into genetic contact recently.


One could certainly generate a bifurcating tree from genetic data, but
it was difcult to know exactly what the tree might mean. That tree,
however, was the HGDPs raison detre, even though representatives
of indigenous peoples themselves had little interest in it.
The scientists were still meeting among themselves to try and spindoctor the situation. They began to appreciate that the concept of
informed consent, vital to modern bioethical protocols, might be
difcult to obtain when seeking to extract genetic materials from
people who did not share their conceptions of the body, the blood,
and hereditary continuity. As early as 1922, the anthropologist Carleton Coon (see chapter 4) had collected blood samples from the Rif
in Morocco for study in the United States. Coon is not remembered
as being among the most politically correct anthropologists of his
generation, but he knew it was no small matter to coax people to
surrender their bodily uids. Blood-letting for blood-group analysis
falls into the class of blood-letting in general, and evokes the whole
ideology of blood-brotherhood, the fear of injury by contagious
magic, and that of ritual condemnation based on the analogy of menstruation, he observed in his popular book The Story of Man (1954).
And that was when the distinction between consent and coercion
was blurry and it didnt really matter whether the participants in a
scientic project understood what you were doing to them. It did
now. The very rst article of the Nuremberg Code, the foundation
of modern (i.e., post-Nazi) bioethics, reads:
The voluntary consent of the human subject is absolutely essential.
This means that the person involved should have legal capacity
to give consent; should be so situated as to be able to exercise free
power of choice, without the intervention of any element of
force, fraud, deceit, duress, over-reaching, or other ulterior form of
constraint or coercion; and should have sufcient knowledge and
comprehension of the subject matter as to enable him to make
an understanding and enlightened decision. The latter element
requires that before the acceptance of an afrmative decision by the
experimental subject there should be made known to him nature,
duration, and purpose of the experiment; the method and means

208

a human gene museum?

by which it is to be conducted. . . . The duty and responsibility for


ascertaining the quality of the consent rests with each individual
who initiates, directs, or engages in the experiment.

That was, of course, intended to cover medical experimentation on


citizens of the First World. Drawing blood for genetic analysis
although medically rather benignwould certainly fall under it; and
it should be applicable to the rest of the worlds inhabitants as well.
In practice, however, it would obviously be very difcult to secure
such consent. To do so, someone would have to discuss cell biology
and molecular genetics with people to whom the scientic mind-set
involved was alien. And its hard enough to explain those concepts
to elite First World college students!
The population geneticists had gone to bed with a nice idea, the
amassing of a large repository of data on the populations of the world,
and had awakened on the cutting edge of contemporary anthropology
and bioethics. And they were entirely unprepared for it.
In terms that recalled Carleton Coons almost pathetic attempts to
deny responsibility for the social and political implications of his
racist anthropological publications in the 1960s, the HGDP indignantly castigated their opposition for politicizing their science. An
exasperated HGDP geneticist complained to Discover magazine in
November 1994, Were scientists, not politicians.
As if opening the veins of the indigenous peoples of the world
might not constitute a signicantly political act!
And this was over thirty years after Coons The Origin of Races.
Either these scientists were just too dumb to be entrusted with such
a sensitive project, or they were being disingenuous when they blamed
the other side for politicizing it. By now anthropologists were becoming vocal critics of the project as well.

ra ce a n d th e p roj e ct

The year 1995 began auspiciously for the HGDP. Cavalli-Sforza had
just published a magnum opus called The History and Geography of

a human gene museum?

209

Human Genes, and Time ran a feature on him, on the book, and, of
course, on the HGDP. Once again, though, things began to backre
on them. Taking another tackthat the HGDP would combat racism (and who could object to that?)Time represented the HGDP
as a counterblast to The Bell Curve.
But that was the equivalent of calling Gone With the Wind a refutation of Moby-Dick. The HGDP simply had nothing to do with
the thesis of The Bell Curve.
However, the leading proponents of the HGDP all had impeccably
liberal credentials dating from the 1970s, when the psychologist Arthur Jensen and the physicist William Shockley were reinventing the
inherent inferiority of the American lower classes. Luca Cavalli-Sforza
and his colleague Marcus Feldman had both been strident opponents
of the folk heredity of that era.
So this became a new selling-point for the HGDP. It was now going
to make the world a better place, because it was going to show that
there are no discrete races and thereby undermine racism. But, of
course, we already knew that there are no discrete races (Ashley Montagu had said that in the Journal of Heredity as early as 1941), and
there doesnt seem to be much sense in undertaking a big scientic
project to nd out something we already know.
Moreover, that goal assumes that the problem of racism lies in
animosities between distinct natural groups, so that denying the existence of such natural groups would implicitly deny racism a basis.
But, again, we already know that races are cultural constructions and
that racism exists independently of the naturalness of races. The people who hate one another the most are generally very similar biologically: think of the Irish and English, Hutu and Tutsi, Huron and
Iroquois.
Racism is thus independent of the existence of large natural groups
of people, or races. What could the Human Genome Diversity Project tell Bosnian Serbs and Muslims about each other that they dont
already know, or that they would care about?
Once again, the HGDP was talking through its hat. It had nothing
to contribute to contemporary discourse on racism. And nothing
revolutionary to tell us about the major features of human variation.

210

a human gene museum?

But things quickly worsened, for Time ran a color gure from The
History and Geography of Human Genes, in which each of the nonexistent human races actually came color-coded: Africans yellow,
Mongoloids blue, Caucasoids green, and Australians red.
Quite literally!
It was the old essentialist fallacy of Linnaeus, except now with
different colors and computerized.
And just for good measure, Time told its readers, All Europeans
are thought to be a hybrid population, with 65% Asian and 35%
African genes.
To say that statement was wrong would imply that we really know
the proportion to be, say, 80:20, rather than 65:35. To call it wrong
would be a massive understatement. It is less than wrong; it is not
even wrong.
There is no reason at all to think that there was ever a time when
there were only Africans and Asians who interbred to create Europeans. There is no reason to think that Africans and Asians are purer
or more homogeneous than Europeans, or even that all three of these
geographical categories are equivalent biologically (in fact, as we have
noted, Asians and Europeans appear to constitute genetic subsets of
Africans). So that statement reects a great deal of misconception
about human biology, diversity, and history. Was it a misquotation?
Did Time just make it up? Nothe HGDPs advocates had published a scientic paper in 1991 purporting to show it. [A]ncestral
Europeans are estimated to be an admixture of 65% ancestral Chinese
and 35% ancestral Africans, they wrote in the Proceedings of the National Academy of Sciences.
That kind of thinking has a venerable history in Western thought.
To an earlier generation, dividing humans into three continental types
harmonized well with a mythic history that saw humans as descended
from Noahs three sons. Although the far reaches of the continents
were unknown to them, by fanciful extrapolation from the Book of
Genesis it was argued that the ancient Hebrews had ascribed North
Africans to the lineage of Ham, central and southern Europeans to
the lineage of Japheth, and West Asians (including themselves) to the
lineage of Shem, after their families, after their tongues, in their

a human gene museum?

211

lands, in their nations (Gen. 10:20). And this origin myth ultimately
became the framework used by early nineteenth-century anthropologists to understand racial variation: the most divergent peoples became the purest, most primordial peoples, and they could be found
in West Africa, East Asia, and northern Europe. But serious scientists
had abandoned that kind of thinking decades earlier, until the new
genetic work reimposed it on their data.
In fact, the geneticists Asians were just a small sample of people
from China, now living in the San Francisco Bay Area, and their
Africans were two populations of Pygmies. This was some of the
most crude, culturally loaded, pseudoscientic prattle imaginable in
the contemporary genetics literature, and it was now exposed at the
very intellectual core of the HGDP.
Nevertheless, the HGDP had managed to get a seed grant of
$500,000 from the National Science Foundation, as well as sevengure grants from other private foundations. However bizarre the
research seemed to be, it was making an impression.
By years end, however, there was yet another scandal brewing.

t h e cu tti n g e d g e of bi oe thi cs

The Hagahai are a group of highland New Guineans who live, as


most human groups do, under constant exposure to certain pathogens. And they have, as most human groups also have, their own suite
of minor genetic distinctions. In this case, some of the Hagahai villagers posses a unique form of a human leukemia virus, which is
benign, unlike its closely related viral sequences in the rest of the
world.
Carol Jenkins, an anthropologist working with the Hagahai, had
retrieved their blood, had tried to explain cells, had tried to explain
the Western concept of patenting, and (trying to act in their interests)
had brokered a deal whereby the Hagahai would share in the prots,
if any, that a patent on the cell line containing the benign leukemia
virus might bring.
Jenkins had nothing to do with the HGDP, except that she was
doing on a small scale, as many scientists have been, what the HGDP

212

a human gene museum?

proposed to do on a centralized, grand scale. And in the spotlight


that the HGDP brought to this eld, Jenkins happened to be in the
proverbially wrong place at the wrong time.
On March 14, 1995, a patent was issued to the National Institutes
of Health (NIH) for the Hagahai cell line. This, of course, was nearly
precisely the scenario RAFI and other indigenous-rights groups had
predicted. And where the HGDP had maintained all along that there
were no nancial interests at stake in the collection of blood from
diverse peoples, clearly there were indeed.
Moreover, all the purple prose about ultimate signicance of DNA
in understanding human life, formerly used to promote the Human
Genome Project in the late 1980s, was now thrown back in the faces
of the Diversity Project. RAFI posted the story on the Internet. The
United States Government has issued itself a patent on a foreign
citizen, it proclaimed. [The Hagahai] now nd their genetic materialthe very core of their physical identitythe property of the
United States Government.
Where formerly geneticists had gushed that the genetic information
in ones cells contained The Book of Life or total knowledge of
the human organism, they now scrambled to reassure the public that
they were not patenting a person, or trying to gain ownership of a
human essence, but just a cell line.
As it happened, patents had also been led for cell lines derived
from a Guaymi woman from Panama and a Solomon Islander. So
this was not an isolated incident, but a serious issue, indeed, the
leading edge of bioethics. Do people have a nancial interest in the
prots derived from their own bodies? Does the act of donating a
blood sample constitute a blank check for all future biotechnological
research, however lucrative?
Once again, unfortunately, the Human Genome Diversity Project
was unprepared to discuss these issues. Its leaders indignantly denied
that they had anything to do with the patents in question, which was
true, but irrelevantfor the patenting issue certainly had major implications for the project. And they somewhat more sheepishly denied
that cells cultured in vitro were the equivalent of a persons life essence, which again was true, but difcult to reconcile with the popular

a human gene museum?

213

promotional spins the molecular biologists had been disseminating


on behalf of their craft for the past decade.
Indigenous peoples and their advocates had good reason to be worried. On July 9, 1990, the California Supreme Court had set a landmark precedent in the area of biotechnology when it ruled that the
patent on a cell line known as Mo-Cell, derived from the spleen of
a cancer patient named John Moore, belonged to the doctors who
had created it. Moore, who had refused to sign a consent form,
nevertheless still did not own any interest in the products derived
from his own body. And he was a middle-class white guy from Seattle.
Imagine how vulnerable the rest of the world was to rapacious
biomedical capitalism!
I heard a talk once by an expert in patenting, who explained to a
genetics conference in Milwaukee that American law favors the scientist patenting the cells, not the source of the cells, because the
scientist has put the labor into the cell line, isolating and characterizing the DNA. This being the case, and knowing of the HGDPs
interest specically in indigenous people and their presumptively exotic gene pools, I asked a question from the audience.
I was sitting at a table with some Native American friends interested
in the HGDP, as after all the HGDP was interested in them (or at
least, in their blood). So I asked the speaker, Given what youve told
us about patent law, I understand why a geneticist would want to
collect blood from Indiansthere is a chance, however small, that
they could make some big money. My question is, Why would an
Indian wish to give blood to a geneticist?
The speaker thought for a second, and gave an answer that inadvertently sent our table into paroxysms of laughter.
She said, Umm . . . , altruism?

th e h g d ps d e a t h throe s

At a symposium on the HGDP at the International Congress of


Bioethics in San Francisco in 1996, geneticist and bioethicist Benno
Muller-Hill addressed a question to the HGDPs leaders. Given that

214

a human gene museum?

we are going to nd some genes someday that affect some aspects of


intelligence, and that we are going to nd them to be unevenly distributed across populations, Muller-Hill asked, as custodians of the
human gene pool, how will the HGDP deal with that information?
They had no idea; apparently, it hadnt occurred to them. The
answer they gave was simply to deny that there might be genes for
intelligence. The bioethics audience was, in Dorothy Parkers famous
coinage, underwhelmed.
That was the beginning of the end. And the end came swiftly.
The nal blow came less than a year later, in October 1997, when
a blue-ribbon panel convened by the National Academy of Sciences
and the National Research Council released its ndings about the
Human Genome Diversity Project.
Of course, it said, the study of human genetic diversity is an important issue. But the HGDP wasnt going about it properly. In the
rst place, observed the panels report, the precise nature of the
proposed HGDP was elusive; different participants . . . had quite different perceptions of the intent of the project.
In other words, seven years and several million dollars into the
project, its spokespeople couldnt even tell the panel what it was for!
Their major concern was that HGDP geneticists had not paid sufcient concern to the bioethical issues they were raising. Probably
they were inuenced by the chillingly nave testimony of a geneticist
who said on the record that he saw no ethical problems in collecting
blood. Just go to an Indian reservation with some $5 bills, he proposed; there are so many desperate people there who will sell you
anything for ve bucks, youll have no problem getting samples.
To him, it was a simple market economy. You go up to some needy
people and offer them a mess of pottage for the rights to a commodity
you want and they have, and that you will be able to advance your
career from, and possibly even become rich from.
In spite of the biblical precedent, there is a major bioethical problem: The participant doesnt really have a choice. This is not a case
of voluntary informed consent; its a case of taking crass advantage
of a tragic situation.
Hardly the kind of thing that casts science in a favorable light.

a human gene museum?

215

Faced with a rebuff from the National Research Councils panel,


the HGDPs supporters tried to spin-doctor the report as best they
could. After four gung-ho write-ups in Science in the 1990s, its news
department came up with a story titled NRC OKs Long-Delayed
Survey of Human Genome Diversity, somehow managing to nd
the opposite message in the report. Sciences most bizarre article a year
later actually attempted to credit the HGDP geneticists with discovering that genetic diversity appears to be a continuum, with no clear
breaks delineating racial groupsas if anthropologists hadnt been
saying that for decades, and ignoring the color-coded racial maps the
HGDP geneticists had actually been publishing!

re qui e s ca t in p ace

The Human Genome Diversity Project raised many important issues


that had been previously hidden from view; things that geneticists
had been getting away with, for better or worse, on a small scale. The
public campaign for big money brought with it the glare of a far more
intense scrutiny than the geneticists had been accustomed to receiving. It suddenly brought out questions that had not been asked, questions about science and people.
Suppose, for example, you are interested in the possibility of genetic
causes of alcoholism. You know that rats can be bred with genes that
compel them to prefer to drink greater and greater quantities of alcohol. Maybe there are humans like that, too. You need a human
population in which there is rampant alcoholism, and a population
that permits you to take their blood for study.
You go to the Navajos, and explain how if your studies work out,
you might be able to diagnose people at risk for alcoholism and maybe
cure it someday with gene therapy.
But you also know that only a tiny component of alcoholism on
the Navajo reservationif that!is due to genetics. Navajo alcoholism is a terrible tragedy and an important social problem, but it
is due in the main to nongenetic causes.
So why is your work getting funded? Why isnt that money being
spent on the overwhelming side of the problem that is not genetic?

216

a human gene museum?

If the Navajos themselves had any input in determining the priorities for research, or access to the resources, they might well choose
to develop programs that would approach the problem differently
and get at its nongenetic root causes. In fact, if you bothered to
explain to them how small a component of alcoholism genes really
account for, its conceivable that the Navajos might not consider genetic research into the subject important enough for them to participate in.
Rather, they might insist that you take your syringes instead to
Boston on St. Patricks Day.
But that is the crux of the issue for geneticists at the millennium:
Who decides what genetic problems are important? Traditionally, it
has been the scientists dening the research questions, with indigenous peoples as passive pincushions. With the empowerment of
indigenous peoples over the past few decades, that is no longer tenable.
Indigenous peoples are increasingly weighing the merits of scientic
questions themselves and making scientists justify themselves to a
much greater extentand the less scientists acknowledge that, the
less science they will be permitted to do. This is a global political
reality in the twenty-rst century, and the fact that the HGDPs leaders did not recognize it is another testimony to their navete or insensitivity.
The issue is not the study of human genetic diversity per se but
the ancillary questions of bioethics, nance, discrimination, condentiality, essentialism, and choice. The ones the HGDP refused to
address.
Decentralized, unregulated collection of genetic materials from the
peoples of the world is still going on. There ought to be some kind
of centralized human population genetics project, a fusion of anthropological problems and genetic technologies. But it will have to use
the conceptual apparatus of modern anthropology. It will have to deal
with the fact that the scientic study of people is invariably political;
its just not like the scientic study of clams. It will have to address
a broader suite of questions than just microphylogenetic inferences
from trees based on genetic distance. And it will have to address

a human gene museum?

217

bioethical issues proactively and not merely deal with them as they
happen to come upby which time it will be too late.
I started out skeptical of the HGDP and evolved into an enemy.
The scientists in charge had no interest in acknowledging errors, in
revising their public positions, or in even learning about the relevant
cognate material. For them, it was a simple matter of getting lots of
money, getting blood, and nding out who was related to whom. It
was never clear they could do the third; they belatedly and grudgingly
acknowledged the limitations of the second; and, as a consequence,
they are being denied the rst.
If there is a special section of hell where scientists spend eternity
after ruining a good idea and leaving others to mop up the mess
theyve made, thats where youll nd the stalwarts of the Human
Genome Diversity Project. Perhaps theyll be plotting to study the
genetic diversity of the Damned.
Now that might be interesting.

218

a human gene museum?

Ten
identity and descent

There is a question that I am frequently asked, usually by wideeyed students who have already taken their science requirements, often in preparation for medical school, and who are now settling in
for a semester of biological anthropology, an elective that looks at
least relevant to their scientic interests. It comes up when I arrive
at the topic of molecular anthropology, and of the genetic similarities
between apes and humans.
Given the genetic similarities between chimp and human, begins
the student, could they interbreed? Could we make a human-chimp
hybrid?
Now, there are a lot of self-defeating ways to deal with that question. One of them is to take the attitude that there are things we are
not meant to know. But such arguments will carry little weight,
since the source of their moral authority is not clear. Who says we
arent meant to know? Who is the custodian of what we are and arent
meant to know? Werent we meant to know about the immune system, so that we could be spared smallpox and polio? Werent we
meant to know about the internal combustion engine, laser beams,
and radio waves?
How, then, can we say that we arent meant to know about chimps
and humans?

219

A second poor way to deal with that question is to look heavenward


and intone that we shouldnt play God by violating the natural
order. But havent we been playing God and violating the natural
order since we began growing our own food and domesticating animals? Those acts took plants and animals that had formerly been
wholly in the domain of nature and placed them under human control and created genetic entities that had never existed before. Gods
domain has never been particularly well demarcated in relation to
science, and it is certainly no great homage to the Deity to dene it
as simply what we cannot do or conceptualize as scientists at any
particular point in time.
A third, and rather more popular, fruitless way to deal with the
question of an ape-human hybrid is to wag ones nger and proclaim
that it would be immoral and unethical. The problem with this answer is that there is a follow-up question that goes, What would be
immoral and unethical about it? At this point, the average genetically
trained scientist sighs reectively and explains patiently to the inquisitive student that they simply couldnt get funding for such a
research project.
Hopefully true, but decidedly a non sequitur.
The chimp-human hybrid question is indeed a thorny one, but
it brings us back to the core of molecular anthropology, the fusion
of humanistic values and scientic technologies.
Could we make a human-chimp hybrid? I used to answer that
question facetiously: Its already been done; how else can you account for Pat Buchanan? Har-de-har-har.
But I take the question a lot more seriously now, because I think
it overlays a lot of important things that we take for granted in science
education these days, and which need to reconsidered.
The answer I give nowadays is this: Your guess is as good as mine,
probably better. But lets say you do the experiment. What are you
going to do with the baby? How are you going to raise him/her/it?
As an ape? As a human? You are talking about producing an organism
outside of any natural society. What do you think your responsibilities
are to that baby?

220

identity and descent

Are you going to raise him/her/it in isolation from the rest of the
world, which would be psychologically destructive to an ape or a
human; or announce it to the world, and allow People Magazine in
to lm the offsprings life? What kind of an identity will you help
him/her/it achieve? Bi-racial children have a hard enough time.
Assuming you have produced a sentient articulate being, how will
you answer the questions: What am I? Why dont I t in? Why is no
one else like me?
Budding geneticists learn to think technologically. The current generation are also being forced to think about their responsibilities and
obligations to their subjects and about accountability. That is the
heart of molecular anthropology.
Could it be done is not simply a biochemical question, it is a
social and ethical question. And let me make it clear that by ethical,
I dont mean to suggest that there are some things we shouldnt know,
because I think we should strive to know everything. By ethical I
mean its a question that involves acknowledging responsibilities on
the part of the researcher to the objects of analysis. Doing research
on humans may be technological, but doing it right is a social and
ethical matter.
In other words, the technical aspects of that experiment are the
easiest. What to do with the child once youve created it is a much
harder question.
That hybrid infant would be in a perpetual state of intermediacy,
only half-person.
What would it be? Its human part would certainly want to know,
because one of the most quintessentially human attributes is the desire
to situate ourselves in the social universe. We establish our identity
through systems of kinship; we decide who we are by learning what
we are.

wh o a n d what

Kinship is familiarity; kinship is orientation. That is why we build so


extensively on the metaphors of kinshipwe are family as a base-

identity and descent

221

ball teams slogan; fraternal lodges; Mother Teresa; Uncle Sam;


sorority houses.
A classic ethnocentrism is to suppose that our cultures kin terms
are rooted in nature or genetic relations, and that other cultures
kinship systems are not. But the diverse relations subsumed by the
term aunt (see chapter 2) easily give the lie to that. Moreover, our
kinship system does not represent genetic relationships among lineal
kin straightforwardly: I am a mitochondrial clone of my mothers
mother, but she bears the same relation and kin term as my fathers
mother, whose mtDNA is not closely related to mine. Likewise, my
Y chromosome is my fathers fathers; and my mothers father did not
give me a Y chromosome, although both are my grandfathers.
In other words, kinship is the imposition of order upon a complex
matrix of social relationships. There are many kinds of possible order,
but no kinship system actually represents genetic relationships accurately. In our culture, however, we look to science for authority. Its
reassuring to know that our diets are scientically approved, that our
medicines are scientically chosen. Its reassuring to know our social
prejudices are scientically validated (and not based on the whims of
selsh, greedy, evil ancestorsperish the thought!). We look to science for answers the way earlier generations looked to their magi
(which, of course, is translated as either wise men or magicians).
But what about when our ideas about our place in the natural order,
who and what we are, are impinged upon by science?
Science gives us authoritative new ideas about kinship, which force
us to reconceptualize our place in the order of things, which is by
that very fact disorienting. But it doesnt stick around to explain it
to us, to reintegrate us, to give new meaning to our existence. Thats
the problem with Darwinian theory, of course. It tells us our ancestors
were kin to apes, the products of eons of ordinary biological processes
of survival and reproduction, and not merely zapped into existence
in the Garden of Eden, but it doesnt tell us what that means or what
to do about it.
It just walks away from the wreckage.
And the question of who and what you are is not trivial. At a
symposium in 1996 on the Human Genome Diversity Project, I

222

identity and descent

found myself sitting next to Debra Harry, a Northern Paiute activist


against bio-colonialism who took a postgraduate fellowship to learn
genetics and quickly became a major thorn in the side of the genetic
bio-pirates represented by the HGDP. A spokesman for the project
came to the podium and explained patiently its rationaleWere
going to tell these people who they really are. What presumption!
As if they needed science to tell them! Debra took the oor next and
responded, I know who I really amshall I tell you who you really
are?

cl on i n g

Perhaps the best contemporary example of science impinging on kinship is in the cloning controversy. It surfaced briey in 1978, when a
writer named David Rorvick published a book entitled In His Image:
The Cloning of a Man, about a reclusive millionaire who buys himself
some geneticists and reproductive biologists and contrives to have
himself cloned. It was a novel, but Rorvick misrepresented the story
as nonction, setting off a ferocious controversy about whether or
not it could be true.
Much of contemporary thought about cloning was shaped by popular ction, notably Woody Allens movie Sleeper and Ira Levins
novel The Boys from Brazil (and the lm based on it), both of which
date from the mid-1970s. Each centers on a plot to clone an evil
dictator, linking cloning technology to its application.
But the debates over cloning died down with the discovery that
Rorvicks story was ction, as were all the other cloning scenarios.
Scientists vowed it couldnt happen, and so there was no need to
worry about it.
Then came Dolly, the cloned ewe, in 1998. Dolly suddenly ushered
in a new wave of millennial technophobia, calling forth scenarios in
which father and grandfather could be the same person, in which
fatherhood per se might not even exist, in which generations would
be blurred, in which the wealthy would clone themselves to perpetuate the exploitation of the poor, and tycoons would keep twins or
triplets of themselves on ice to use for spare parts.

identity and descent

223

Human cloning was immediately condemned by people who make


a living condemning things, but I confess I never saw much horror
in it. Hitler was a product of his ageabstracted from his time and
place, he would be a nobody. A hundred clones of him would be a
hundred nobodies. The fear of cloning Hitler is very much an artifact
of our cultural belief in the innateness of prominence. Does anyone
really think that a Hitler clone at Woodstock would have formed an
army of hippies to take over the U.S. government?
Nor am I trembling at the prospect of cloning as a tool of the
wealthy. It seems to me that a Brad Pitt raised by Jennifer Aniston
would have to come out somewhat differently than a Brad Pitt married to Jennifer Aniston.
And I see no reason to think that a world with six Bill Gateses, ve
Ted Turners, four David Geffens, and three Donald Trumps would
be manifestly inferior to a world with only one of each.
The problem with cloning is not the threat it might pose to the
world, but to the rights of the clone. The clone would be nothing
more than an identical twin, but it would be a different age from its
twin. That means it would have an idea of its genetic liabilities and
assets in advance of their development, which would inevitably place
constraints on its right to an open future, as some bioethicists have
noted. Imagine the burden of being a genetic replica of Michael Jordan, or Itzhak Perlman, or Neil Simon. What choices would you
really have about your own life trajectory? As a sentient and functional
member of our species, you would be entitled to such choices, but
as a clone of a prominent preexisting member, your choice would be
curtaileda clone of Neil Simon would inevitably be pushed toward
the theater, regardless of how he felt about it.
In other words, the problem of cloning is that it would create a
situation in which a person had an already partly formed identity, a
situation that of course never arises with the natural analog of
clones, identical twins. They explore and create their identities together. The most famous twins of all, Chang and Engthe eponymous Siamese Twinsdeveloped separate identities and personalities
while sharing all their DNA and many body parts, notes biologist
Paul Ehrlich.

224

identity and descent

Cloning thus technologically impinges on a crucial human right,


that of self-discovery. The right to an ancestry, to a lineage, and to
an independent identity in relation to your ancestors and relatives.
That cant be taken for granted.
Furthermore, this is a path that shouldnt be trodden. When science
begins to impinge on peoples ideas about who they are and what they
are, it encroaches on humanistic concerns and issues. The issue of
cloning has little to do with spare body parts in the closet, or an army
of Jeffrey Dahmers, and everything to do with having a feeling of
condence in where you came from, how you t in, and what you
can strive for in your life. Science can participate constructively, but
scientists have to realize that the hard part isnt the technical part; its
the social and cultural part.

k enn e wi ck m a n : th e f re n c h and indian war

Frederika Kaestle now teaches at Indiana University, having been an


outstanding undergraduate student of mine at Yale in the 1980s. Her
undergraduate thesis was on the genetics of the apes, and she went
on to do a doctoral thesis at the University of CaliforniaDavis, on
the biohistorical relationships of western Indians. Kaestle was in on
the ground oor of the development of a new series of techniques
for studying those relationshipsancient DNA. Since bones contain
cells, and cells dont vaporize immediately upon the death of the
organism containing them, sometimes bits of DNA can be extracted
from the bones of long-dead animals. The most extreme claims (DNA
hundreds of millions of years old) appear now to have been as ctitious as Jurassic Park, but it is not terribly uncommon for researchers
now to be able to extract a little genetic material reliably from bones
or carcasses thousands of years old. Theyve even gotten a tiny bit of
DNA from Neandertals and have learned that they were very similar
to, but a bit different from, modern people (as if we didnt already
know that).
But Rika Kaestle wasnt working on Neandertals. She was working
on Indians. As a tiny part of her thesis, Kaestle was asked to analyze
the DNA from a new specimen that had come to be known as Ken-

identity and descent

225

newick Man. Unfortunately, her study was interrupted, because the


specimen was conscated by the federal government. It wasnt as if
she was trying to clone Hitler, as in The Boys from Brazil, but somehow her work had quickly become as powerful and dangerous as any
genetic study could be, and it was shut down.
Why? How could the study of ancient bones be so threatening? To
get at the answer, which is at root a story of the abuse of scientic
authority, we must reconsider the history of anthropology. It is now
popularly perceived, albeit somewhat vacuously, as a politically correct eld, teaching cultural relativism, the respect for exotic and
diverse lifeways. And that is undeniably a part of it. But what is
entailed by such respect? Standards of respect themselves evolve, and
even the most open-minded of anthropologists a hundred years ago
would have difculty with contemporary standards.
How does one go about studying the history of peoples, and of
their civilizations and cultures? The obvious answer is, you dig it up
that is the heart of archaeology, itself a part of anthropology. And
what you dig up is often a cultural artifact, such as a scrap of pottery,
or a tool or weapon, or, commonly, a bone, perhaps of an animal
eaten, perhaps the remains of one of the people youre studying.
Macabre business, to be sure. But the study of human bones can in
some contexts be very rewardingit can assist police work by diagnosing the age and sex of a long-dead victim, for example. It can tell
you about the traumas that befell particular people, or even fossil
people, like Neandertals. It can tell you about their health, their
average lifespan, and even, perhaps, something about who they were
and where they came from.
Now, where did all this detailed knowledge come from? The simple
answer: from studying skeletonshow and under what circumstances they come to differ from one another.
But whose skeletons? Certainly youre not going to dig up your
own grandmother to study her; that would be disrespectful and sacrilegious, in addition to being grisly. If only there were other bones
around to study, bones that werent yours, your familys, or those of
anyone like you, or that anyone cared about . . .

226

identity and descent

And therein lies the paradoxical beginning of modern physical anthropology in the nineteenth century, with the collection and study
of the bones of dead Indians. Thousands of bones of Indians from
all ages, the results of controlled archaeological excavations and of
simple grave-robbing, have formed the basis of much of our knowledge of human skeletal variation, and they sit now in the dank recesses
of museums.
One of the major roles of cultural relativism is as a conscience of
the industrial world. Not merely pointing out the diversity of behavioral traditions for the sake of the titillation of exoticism, but compelling students, or just thoughtful citizens, to appreciate the precariousness of history in light of the privileges of power. You might pause
to think about how the course of your life would run if indigenous
Americans had conquered and colonized Europe, rather than vice
versa, and what you might then hope for in the way of toleration or
respect for your beliefs and behavioral traditions. (It could never
have happened that way is the classic response, based on the insecurities evoked by the thought of being unprivileged oneself, but we
know of no innate aw in the colonized peoples that would make
this scenario impossible.)
A product of the consciousnesses raised by a century of anthropology in America is the legislation known as NAGPRA, the Native
American Graves Protection and Repatriation Act (25 U.S.C. 3001
3013), introduced by Congressman Mo Udall (D-Ariz.) and ratied
in 1990. NAGPRA has two major injunctions: rst, Native American
cultural or biological materials stored in museums must be catalogued, appropriate tribal representatives must be contacted, and the
materials must be surrendered if the tribes want them; and second,
any artifacts or remains found on federal lands must now be treated
as if owned by the Indians, and you have to get their permission to
study them.
Its critics called NAGPRA anti-science, but it isnt science legislation, its human rights legislation. Its about setting limits on scientists, who can no longer do just anything they damn please. NAGPRA is as anti-science as the Nuremberg Code. Sure, it might be

identity and descent

227

interesting to know just what the tolerance of pain of the human


body is, or the precise amount of X-rays it takes to sterilize or kill a
person, or what syphilis would ultimately do to someone who was
left untreated, but those are scientic questions that cannot be directly
studied, by virtue of the excesses of previous generations of scientists.
Likewise, NAGPRA is an acknowledgment that those old bones are
somebodys; they are meaningful to people in nonscientic ways, and
those ways are important to acknowledge, and must be weighed
against the science.
NAGPRA takes science at its word: that it is for the enrichment of
peoples lives. In any case, its not to make them miserable and insecure.

ke n n e - h yp e

The Tri-City Herald in Washington State ran a small story in its


edition of July 29, 1996, to the effect that a couple of students watching a boat race from the shores of the Columbia River had found a
skull and a few other bone fragments. They turned the remains over
to local police in Kennewick, Washington. Nothing was known of
the age or origin of the skull, and it was being studied by a local
crime lab.
Late that afternoon, the county coroner called James Chatters, who
runs a local forensic anthropology business. Chatters recognized that
the skull wasnt from the victim of a recent crime; it was old. It was
possibly the skull of an early settler, although the back teeth were
exceedingly worn down, like those of Indians. Chatters applied for a
federal permit to look for more bones, and received it on July 31,
retroactive to July 28, the day the skull was rst discovered. They
found most of the skeleton, in bits and pieces ultimately numbering
about 350.
The skeleton seemed to be from a large adult man, a bit less than
six feet tall, with a constellation of facial characteristics not typically
Indian. On the other hand, he had a very archaic stone point, two
inches long, embedded in his hip. Chatters had a CAT-scan performed on the pelvis, to see the precise features of the spear tip, and

228

identity and descent

it was clearly a kind only in use thousands of years before any European (Lewis and Clark were the rst) had ever set foot in the region.
According to Chatters, We either had an ancient individual
with physical characteristics unlike later native peoples, or a trapper/
explorer whod had difculties with stone age peoples during his
travels. To resolve this ambiguity, therefore, he sent part of the bone
just below the left pinkie to a radiocarbon-dating laboratory on
August 5.
The preliminary result came in on August 23, saying the skeleton
was over 9,000 years old. The Army Corps of Engineers, custodians
of the site, followed NAGPRA by contacting the relevant tribes (in
this case, the Umatilla, Nez Perce, and Yakama; Chatters separately
notied the Colville) on August 27.
And then the anthropologists held a press conference.
On August 28, the Tri-City Herald reported that while initial indications were that the skeleton may ha[ve] been of European descent, it was obviously very old and indigenous. There was no indication of the bizarre racial furor the scientists would soon set off.
But the story ended by quoting Jerry Meninick of the Yakama tribe
compellingly about the sacred nature of the remains: If Christians
found a skeleton of someone who lived during the biblical book of
Genesis, those remains would be revered.
Another slant to the story was, however, beginning to emerge.
The following day, the Seattle Times ran a story with a very different theme. Ancient Bones, Old DisputesIs Kennewick Skeleton
Asian or European? it asked. This story contrasted the narrow,
European-shaped skull with the more rounded, Mongolian-type
of skull. It added rather anachronistically, Scientists determine race
by mathematically comparing measurements on several different
points of the skull. The model now involved two migrations of
different-headed peoples, an early one of people with more Caucasian featureswho today extend from Europe to Indiaand a
later one with rounder skulls typical of contemporary northern
Asians.
Chatters then contacted Rika Kaestle, then a graduate student at
UCDavis, and asked her to study Kennewick Mans DNA.

identity and descent

229

The last days of August were fateful for Kennewick Man. Seeing
that a potentially intellectually valuable specimen might be rendered
unavailable for study under NAGPRA, a leading anthropologist at
the Smithsonian Institution invited Chatters to bring the skeleton
east, away from the local Indians and the Army Corps of Engineers,
and offered Dr. Chatters airline accommodations in order to afford
. . . an opportunity to conduct an extensive evaluation of the skeleton, according to court documents.
On learning of these plans, the Army Corps recalled the bones from
the anthropologists, pending a decision about whose bones they were
and whether the bones should be given to one of the local tribes
under the federal law mandating a return of Indian bones to their
descendants. Chatters was instructed to lock the bones in the county
sheriff s evidence locker and go on with his life. When I heard this,
I panicked, he later recalled. I was the only one whod recorded
any information on it. There were all these things I should have done.
I didnt even have photographs of the post-cranial skeleton. I thought,
Am I going to be the last scientist to see these bones?
Chatterss panic over his failure to document the nd adequately
is what set off the chain of events that became the Kennewick Man
controversy. He had already consulted another physical anthropologist about the bones, and they had come to identical conclusions: the
skeleton was similar to that of a Caucasian male.
Of course, no Caucasiansthat is to say, people from Europe or
western Asiaare known to have been in the state of Washington
thousands of years ago. But regardless of how interesting the skeleton
might be, the anthropologists were about to lose it to a bunch of
people who didnt care about science and who just wanted to subject
it to some superstitious mumbo-jumbo and destroy it.
So the anthropologists devised a way to make Kennewick Man very
important. They cast him as the centerpiece in a literally earthshaking theorynamely, that there were Caucasians in the New
World thousands of years ago. And the carbon-14 date implied something even more earth-shaking: that Caucasians had been there rst.
And they clothed themselves in the mantle of science and began
to speak for it.

230

identity and descent

Thus, when the Umatillas led formally on September 9 for repatriation of the Kennewick Man skeleton, they were greeted with
an extraordinary challenge to the legality of their claim. Kennewick
Man, argued the scientists, did not fall under NAGPRA, because he
wasnt an Indian ancestor. He was a Caucasoid, and thus the Indian
tribes had no right to claim him under the law.
The most immediate requirement is satisfying the tribes desires
to honor their ancestors and see those remains re-interred, a spokesman for the Army Corps of Engineers said, but the anthropologist
responded that the bones have more European-like features, not
characteristics often associated with early American Indians.
According to one scientist, the Caucasian-like people represented
by the skeleton died out in a severe Western drought about 9,000
years ago and were replaced a few thousand years later by the ancestors
of todays Indians. According to another, the earlier group intermarried with later arrivals more similar in appearance to todays
northern Asians. Yet another speculated that the New World was
prehistorically colonized by populations hopping from England to
Iceland to Greenland to Canada, which might explain the Caucasian appearance of the early skeletons and . . . similarities between
European and American stone tools.
On September 22, the Seattle Times mentioned the existence of
non-Caucasoid features observed in Kennewick Mans remains, but
they quickly vanished from the discussion.
On Monday, September 30, the stakes were permanently raised
when the New York Times ran a story under the title Tribe Stops
Study of Bones That Challenge History and brought the developing
conict over Kennewick Man to national attention. But what conict
was there? Under the relevant federal law, the bones belonged to the
Indians, and that was that. Or it should have been.
The conict, such as it was, had been manufactured by the scientists. They wanted the skeleton but didnt have rights to it. Suddenly,
the skeleton became crucial, because it adds credence to theories that
some early inhabitants of North America came from European stock.
But what theories were those? Where had they come from? What had
they been based on?

identity and descent

231

The nding, according to the Times, does not necessarily suggest


that white people were in North America before Indians, [Chatters]
said. Rather, he said, it points to the possibility of mixed ancestry for
todays American Indians. Whatever that might mean. But the articles
headline made it clear what the issue was: A Law on Indian Culture
Sequesters Bones That Might be Caucasian.
The issue was race. The racial history of the world. Which race the
skeleton belonged to. And how that could be scientically determined.
And the Indians superstitions could not be allowed to stand in the
way.
Of the scientists superstitions.
Anti-NAGPRA scientists circled the wagons to defend Jim Chatters. On October 16, eight of themRobson Bonnichsen from
Oregon State, Loring Brace from Michigan, Dennis Stanford and
Douglas Owsley from the Smithsonian, Richard Jantz from Tennessee, George Gill from Wyoming, Vance Haynes from Arizona, and
Gentry Steele from Texas A&Mled a claim in federal court
against the Army Corps of Engineers plan to repatriate Kennewick
Man to the Indians. Their central issue was that Kennewick Man
didnt really belong to the people who are claiming him. NAGPRA
stipulates that the remains have to go to people who have a reasonable connection with the materialsin other words, a shared group
identity which can be reasonably traced historically or prehistorically.
Kennewick Man was going to the local Indians because he was a
native American and they were native Americans who lived in the
area and thus had a strong group identity based on their connection
to the land and its earlier inhabitants. That certainly seems to fulll
NAGPRAs requirement of a cultural afliation of the materials and
the people.
But cultural afliation and group identity are not scientically
ascertainable. They are the constructions of social history, not organic
or natural properties. The law is written to permit an association like
that between Yemeni Jews and French Jews, who may have nothing
special in common that is physically perceptible and little behaviorally, so that it is difcult to distinguish between their association and

232

identity and descent

the association between the Harrison Ford Fan Club in Omaha and
the one in Yokohama. The two fan clubs are afliated, and the identities of both are rooted in their admiration for Harrison Ford. Is
there an objective basis on which to decide that the bond between
two groups of Jews is valid and that between two groups of Harrison
Fords fans is not?
NAGPRA leaves the decision as to whether the bond claimed between Indians and specic remains is real or spurious to a committee.
Meanwhile the anti-NAGPRA anthropologists began to spin new
origin myths for Native Americans. Robson Bonnichsen of Oregon
State had already been quoted in the Seattle Times for his pet theory
that some of the rst Americans came by skin boat from Europe by
hopping from England to Iceland to Greenland to Canada, which,
the newspaper was quick to add, was entirely unsupported by any
anthropological evidence whatsoever. But it could explain both the
Caucasian appearance of the early skeletons and similarities between European and American stone tools.
Dennis Stanford, head of the Smithsonians anthropology division,
elaborated in March 1997. Based on supercial resemblances between
early stone tools in America (Clovis points) and older ones from
France (Solutrean laurel-leaf blades), Stanford suggested that the Indians came from France. Now this is really an off the wall kind of
idea right now, he added, but its one that I dont think we should
ignore.
And as much as it should have been, it couldnt be ignored after
Douglas Preston wrote it up in the New Yorker in June 1997. The
original inhabitants of the New World came from France with their
Solutrean tools across the Atlantic, and the Asian ancestors of the
Indians came thousands of years later. Their skulls and their tools
showed it.
The anthropology community was dumbfounded. Most students
of stone tools found little similarity between Solutrean and Clovis
points. For one thing, they were differently shaped; for another, they
were of different sizes. For a third, they were made quite differently.
The only similarity appeared to be that they both came to a point.
The French-Clovis tool connection had not been published in peer-

identity and descent

233

reviewed scientic forums, it had simply been put out in the New
Yorker.
In fact, inferring cultural contact on the basis of a supercial similarity of technologies has a long history in anthropology. In the nineteenth century, it served to deny the creative abilities of indigenous
peoples. There were pyramids in Mexico and pyramids in Egypt; the
Mexicans couldnt possibly have built them themselves; so they must
have gotten the idea from the Egyptians. Or perhaps from Atlantis.
(Later, space aliens would ll the role.)
But there is, in fact, no basis for thinking that the Central American
pyramids were conceived and erected by anyone but the indigenous
inhabitants of the region, and likewise for the Egyptian pyramids.
Similarly, there is no reason to think that Great Zimbabwe was built
by anyone other than indigenous Africans, although colonial Europeans struggled mightily to resist that conclusion.
An even more insidious undertone of the Smithsonian antiNAGPRA hypothesis is the linkage of biologies and technologies.
Not only were the anthropologists dubiously inferring European peoples, but they were also dubiously inferring European tools, and mapping them on to one another, thus denying aboriginal Americans both
a biological and a cultural identity!
Meanwhile, the Army Corps of Engineers had ordered all DNA
work to cease on Kennewick Man and placed a gag order on the
progress of the work to date. Kennewick Man did not appear to be
the property of science, and the people he appeared to belong to
didnt want scientists working on him.
But the scientists did have a cast of the skull and wished to make
it known that the Indians were impeding the march of science. One
widely repeated story in the newspapers and magazines involved trying to justify the racial propaganda for Kennewick Man by speculating on who he looked like, based on his skull. According to the New
Yorker, Jim Chatters was watching Star Trek: The Next Generation and
had an epiphany about Patrick Stewart, the actor who played Captain
Jean-Luc Picard: My God, there he is! Kennewick Man! Unsurprisingly, then, when Chatters collaborated with a local sculptor a

234

identity and descent

few months later to lay some esh on the old bones, the result was a
dead ringer for the English actor, as Chatters predicted months ago,
said the local newspaper on February 10, 1998.
This would serve to preempt debate over the race of the skull, by
presenting a Caucasoid face rather than race-less bones. But again,
there was exceedingly little science at work; an impressionistic description of Kennewick Man as resembling Captain Picard became a
self-fullling prophecy. Not only did the earliest American tools come
from France, but so did their users faces!
From the bones, however, there is no greater resemblance to Patrick
Stewart than there is to Patrick Ewing. In fact, the jaw, cheekbones,
and eye sockets probably resemble those of the basketball star at least
as much as they do those of the Star Trek actor. It wasnt widely
publicized, but one physical anthropologist consulted by Chatters
prior to the reclamation of the bones was reported as noting that the
shape of the skeletons upper eye sockets . . . resembled the shape
common to Negroid people.
The decision by a small group of anthropologists to challenge Kennewick Mans repatriation on the basis of its racial afliation was very
unfortunate. From a diverse assortment of characteristics, Kennewick
Man was assigned to a single racial category. This is the philosophical
problem of essentialism, in which you become dened by one or a
few key parts, ostensibly representing your essence, and the rest of
you, the motley reality, is ignored. The essentialism underlying both
racial categories and the assessment of racial afnity on the basis of
skull form belongs to an earlier era, which anthropologists recall regretfully. Today, the anthropology community en masse rejects as
pseudoscientic the notion of race as a natural category, and as equally
bogus the assignment of individuals to such transcendent categories
on the basis of their skulls. What exist are features and populations;
sometimes one can map them onto one another, and sometimes one
cannot.
As they tried to explain themselves to the anthropology community,
the anti-NAGPRA team ran in circles. [I]t was the very question of
racial identity that drove the work, Jim Chatters informed the aca-

identity and descent

235

demic community in the monthly Anthropology Newsletter, but a few


months later he asserted that the scientic issue in the Kennewick
Man debate is not race but human biological history.
Kennewick Man is a tragedy for several reasons. Most importantly,
science is by now supposed to have transcended the premise that it
must go on at any cost, no matter who is hurt or what anybody
thinks. A science without regard for peoples welfares and feelings is
a science that is difcult to justify. Since peoples identities are bound
up in history, and their histories and identities are very signicant to
them, science treads on thin ice when it tampers with peoples notions
of who and what they are. That, of course, is a problem the Darwinian
theory of evolution has always had in modern society. But at least
Darwinism is a European idea being imposed on European society
its even harder, and perceived more poorly, to impose a European
scientic idea on a non-European society.
The problem is compounded by the quality of the science supposedly overturning the quaint myths of the indigenous peoples. Darwins, after all, was a lot more solidly grounded than the science
behind Kennewick Man.
The idea of a European settlement of the New World is also not
new. The very rst person to teach a class in anthropology in the
United States was Daniel Garrison Brinton of the University of Pennsylvania. In his 1890 book Peoples and Races, Brinton explicitly rejected the popular notion that Indians had come to America from
Asia; he thought they had come from Europe. The modern version
differs in taking Europeans as the primordial Americans and seeing
the Indians as having only subsequently come from Asia, thus robbing
Native Americans of their claim to priority.
In fact, though, the transition of skull form through time has been
acknowledged by generations of anthropologists. Brinton himself derided the use of skull form as a racial characteristic before the eld
of anthropology even assumed its modern form. In the case of the
New World, Harvards Earnest Hooton analyzed the skulls excavated
from the site of Pecos Pueblo in 1930 and classied them into a diverse
framework of types. He identied, for example, pseudo-Negroids
and pseudo-Australoidsskulls that sort of resembled Africans or

236

identity and descent

Australians, but pseudo because he knew they were not African or


Australian, but Indian. Better yet, he remarked that a further type
was characterized by compressed or medium malars [cheekbones],
very long faces and deep mandibles, straight and often high-bridged
and narrow noses, high orbits, and orthognathism. I called this type
Long-faced Europeans because it seemed to me rather un-Indian, if
one may employ such an expression.
Indeed, one may, if only because it reveals the essentialist model
under which one labors. The oddity seems to be that Hooton could
openly acknowledge the plurality of physical types to be found among
prehistoric Native Americans without resorting to imaginary ancient
racial migrations as an explanation of it; whereas the anthropologists
studying Kennewick Man seventy years later could only resort to racial
migrations to explain him.
And Hootons collection of Pecos Pueblo skulls was itself repatriated in the summer of 1999.

g i v e u p ke n n e wi ck man

I see three reasons to give Kennewick Man to the Indians and for the
scientic community to forget about him.
First, he belongs to the Indians, not to science. That is the law. It
is up to them to decide whether they want scientists to study him.
Perhaps the law is a ass, but whining about it will probably not be
as efcacious as working to rebuild some condence between the
Indian and scientic communities.
Second, the scientists had their chance and muffed it badly. Not
only did they trample callously and cavalierly on Native American
beliefs and historythat is to say, not only were the scientists bad at
the humanistic end of thingsbut their pronouncements were exceedingly speculative and poorly conceived. The irresponsibility of
challenging the priority of Native Americans in America on such
imsy evidence harks back to the authoritarian nonsense espoused by
geneticists of the 1920s. It was never an issue of Indian beliefs versus
science, but of Indian beliefs versus pseudoscience. Perhaps the next

identity and descent

237

iteration of scientic thinking and writing about Kennewick Man


and the peopling of the Americas will be deeper and more conscientious, but like young children, scientists will have to earn their
second chance.
And third, Kennewick Man simply isnt that important. One specimen is never that important. If it is a unique and irreplaceable specimen, then it is scientically valueless, for that would make it a singularity of nature, in laymans terms, miraculous. And science doesnt
deal in miracles, it deals in regularities. There will be another Kennewick (as indeed there already are a handful of similar remains), and
if science repairs its community relations after the disgrace of Kennewick Man, then perhaps it will have a chance to study the next
skull in detail. The irreplaceable value of Kennewick Man lies in its
value for the careers of the scientists, not in its value for the progress
of science.
What binds this into the theme of molecular anthropology is the
conception of genetic descent being invoked all throughout the argument, particularly by the scientists. The scientists argued that the
Indians claiming him were not his descendants because they were of
different races. That claim is nonsensical; but it could be rendered
sensible by saying simply that Kennewick Man was physically different from living Indians. That statement might be true, but it
would be trivial, for there are several reasons why that might be the
caseand invoking major invasions of completely geographically distinct populations is only one of them.
But the fact is, at this level, all discussion of descent is metaphorical.
We do not, and cannot, know whether Kennewick Man had any
descendants literally. (Although the spear point in his pelvis would
certainly have made procreation painful!) The issue is the group he
belonged to, or that we assign him to, and its relationship to todays
groups. Scientic or genetic ideas of identity and descent are not the
heart of the matter, for descent is not being taken literally here. Thus,
any claim of ancestry for Kennewick Man is in the realm of folk
heredity, in the cultural ideas of relationship among constructed
groups. It isnt that Kennewick Man is excluded from Umatilla ancestry because he was Caucasoid; or because they probably have not

238

identity and descent

lived in the area continuously for 9,000 years; or because his people
died out and were replaced by other physically different groups of
indigenous Americans. Its that all claims of ancestry and descent from
Kennewick Man are nonliteral and nonscientic; they are metaphorical.
And we have no objective, scientic basis on which to judge one
metaphors validity as against anothers. The question of descent from
Kennewick Man thus falls outside the domain of science.
Kennewick Man has different signicance for the two groups that
want his remains, and his importance as a symbol to Native Americans, I would argue, outweighs his importance to the scientists as a
basis for thoughtless and irresponsible speculation. It has never been
good for science to trample callously on peoples views of themselves
and their place in the universe. All that does is make people angry,
resentful, and disoriented. And science was always supposed to improve peoples lives, not make them worse.
Kennewick Man lay at the crossroads of the sciences and the humanities. He represented a confrontation between the politics of
identity and human rights, on the one hand, and an archaic and
transgressive science, on the other.

cod a

In February and March of 1999, a blue-ribbon panel of scientic


experts was charged by a U.S. District Court to examine Kennewick
Man and to decide whether the remains actually fell under NAGPRA.
This was in itself a victory for the scientists, although the specic
charge was specically to perform nondestructive work, a concession
to Indian sensibilities.
The panels conclusions were predictable. It began by acknowledging that the geographic groupings or races seen among modern peoples are at best fuzzy and at worst non-existent when examining [ancient] populations world-wide. Kennewick Man looks different from
modern Indians, but isnt Caucasoid by any stretch. He has some
cranial features commonly found in Europeans, others commonly
found in east Asians, and still others indeed found in Native Amer-

identity and descent

239

icans. Most charitably, the panel determined that he had some


white features, which are actually also found quite broadly, it noted,
among other peoples, notably Polynesians. A statistical analysis found
him most closely resembling Polynesians and southern Asians.
The panel was too kind to identify the racialized science surrounding Kennewick Man for the bunkum it wasan appropriately measured tone for a blue-ribbon panel report. It did not say
that the Americas had been peopled by Polynesiansall the similarity means is that Polynesians have a more generalized cranial
form, and fewer specialized idiosyncracies of the skull, than other
comparative groups. But if Kennewick Man is not Caucasian,
theres no longer anything to preclude him from being an Indian
ancestorwhich means that he ought to fall under NAGPRA. After all, as the panel was told by the government, the term Native
American is clearly intended by NAGPRA to encompass all tribes,
peoples, and cultures that were residents of the lands comprising
the United States prior to historically documented European exploration of these lands.
About the same time as the Kennewick Man report came out, word
came from Brazil that anthropologists there had the skeleton of an
ancient woman they called Luzia after the 3-million-year-old australopithecine Lucy. Luzia was three million years younger than her
namesake and belonged to a different species, and her story was modeled not on that of Lucy but on Kennewick Mans.
Luzia, reported the London Times on August 22, 1999, is 12,000
years old and doesnt look at all Mongoloid. In fact, said the scientists working on the skull, Luzias features are similar to modernday [Australian] Aborigines and Africans and show no similarities at
all with Mongoloids from east Asia and modern-day Indians. And
they purported to nd links between the material culture of Australians and the inhabitants of Tierra del Fuego!
Thus the lead sentence from the London Times article: The rst
people to inhabit America were Australian Aboriginesnot American Indians.

240

identity and descent

The skulls change, but the story remains the same.


Frankly, I nd the use of science to undermine indigenous peoples
sense of identity crass and boorish. It represents the worst of what
science has to offera threatening, insensate, and destructive ideology.

identity and descent

241

Eleven
is blood really so damn thick?

While kennewick mans skeleton may seem to be a subject remote from the 98% genetic equivalence of humans and apes, it really isnt. Its all fundamentally about descent and relatednesshow
I identify my relatives and what their relationship to me means. In
many cultures, this is usually expressed through the medium of
blood.
Blood is one of the most powerful substances the human mind has
ever invented.
I dont mean that, of course, literally. People didnt invent blood.
It existed as a biological substance before people did.
But as such it has no meaning. People gave it meaning. It became
the emblem of a warriors prowess, the wondrous life force of a god,
the taboo monthly ow of a woman, and the link between the generations. It became the Eucharist of Jesus, the hallucination of Lady
Macbeth, and lunch for Dracula.
That is what we mean when we say that blood is a construction.
It has importance or signicance that is not a direct consequence of
its biological natureof the mixture of plasma, erythrocytes, basophils, neutrophils, lymphocytes, and the rest.
Blood, rather, is a highly sacred substance.

242

If that doesnt sound scientic, that is precisely the point. Blood


is culturally constructed as a sacred substance, and its signicance
stems from the meaning it contains in the human world of symbols
and semioticsnot in the material world of cells, molecules, and
biology.
We saw a similar situation with respect to race: the fact that the
natural patterns of biological or genetic variation do not permit us to
subdivide the human species into a small number of reasonably homogeneous groups has little to do with the importance of race in
modern society. Race affects your income, lifespan, and health and
suffuses every aspect of American lifeand yet it has no biological
reality. We cling to the paradox of blood (part natural, part construct)
as we do to the paradox of race (geographical variation is real, but
essentialized human subspecies arent) and the paradox of our place
in nature (part ape, part angel, in spite of the fact that apes exist and
angels dont). What makes them all paradoxes is that both parts are
important, regardless of their ontological status.
The most widespread meaning of blood is as a substitute for
hereditythe blood in of royal blood or blood relatives. The
word is also commonly used racially, as in Negro blood. In the
classic musical Show Boat, based on the Edna Ferber novel, the theatrical troupe nd their star couple accused of miscegenation. Learning of the accusation ahead of time, the husband cuts his wifes hand
with a penknife, and licks her bloody palm in full view of the troupe.
A few minutes later, when the sheriff makes the formal accusation of
miscegenation, the husband responds that although he looks white,
he has Negro blood in himand of course all the sympathetic witnesses swear to the literal truth of the statement.
The sheriff, of course, was using blood as a metaphor for heredity,
in the folk sense we discussed earlier. One drop of Negro blood
makes you a Negro in Mississippi, he intones. (But who didnt know
that?) And the couple are spared for the moment because they respond literally.
Relatives share blood, and racial relatives, although distant, share
traces of it, under this model. And this model is essentialist because
it holds that no matter how innitesimal the dilution, there will al-

is blood really so damn thick?

243

ways be a detectable elementan essencethat reveals the otherness in an individuals makeup.


The great contribution of the Mendelians, however, was to demonstrate that heredity is not essentialist but probabilistic. Every genetic element has a fty-fty chance of being passed onno more,
no less.
Lets say Mom and Dad have a baby girl, who for some reason later
either wants to, or has to, prove her racial identity. The ultimate
arbiter of heredity is science, the science of genetics. Mom and Dad
look racially appropriate, as does the girl, but for some reason thats
not enough. So the girl is subjected to a genetic test to look for a
specic genetic marker that her race has and that others dont.
If we take her family back two more generations, we know she has
four grandparents and eight great-grandparents. Did all eight have
that genetic marker?
Because if one didnt, there is a small but signicant chance that
the girl is also missing that crucial genetic marker; and it would
genetically identify her as racially wrong.
And thats precisely the problem. If one great-grandma was different, whether because she was from somewhere else or because the
generalization was incorrect to start with, and she inherited the genetic marker from one of her ancestors, then it has a fty-fty chance
of being passed on in each generation.
In other words, you could have a child who looks just like you and
your spouse, but fails a genetic test on account of one greatgrandparent (who may have been just as much of the same race as
the other seven). Thats why you cant do a genetic test for race,
because race and genetics dont map onto each other perfectly. Race
is an essentialized property, and genetics is probabilistic.
Thus, when the Vermont House of Representatives began to consider Bill 809, drafted by Republican Fred Maslack in late 1999, to
establish standards and procedures for DNA-HLA testing to determine the identity of an individual as a Native American, . . . [and to
provide] conclusive proof of the Native American ancestry of the
individual, it was greeted with astonishment by both Indians and
geneticists. First, because it removes from the Indian nations the right

244

is blood really so damn thick?

to dene their membership, and makes it a state of nature accessible


instead by the U.S. government; and, second, because it is scientically impossible.
There is not, and cannot be, a single genetic marker that, say, all
Africans have and no non-Africans have. Because of their biological
propensities for interbreeding, and their histories of having done so,
all human groups are culturally bounded. Even a term as naturalsounding as Africans unites physically and genetically diverse peoples and is usually taken to include people who themselves have never
been to Africa, but whose ancestors came from there, and to exclude
people whose families have lived there for hundreds of years. Thus,
one can hear surprisingly casual talk about white South Africans as
non-African, by people who would never consider white Americans
as non-American.
But that same confusion doesnt exist genetically between chimpanzee and human. All humans have a pair of large chromosomes
(#2) that no chimpanzee has. It is a correlate, not a cause, of humanness, but it permits an unambiguous diagnosis of the allocation and
ancestry of the cell in question.

e s s e n ti a l i z i n g blood

Essentialism is such an ingrained cultural value that it surfaces surprisingly and unfortunately often in population genetics, where it is
paradoxically most fundamentally undermined.
A widely publicized study in early 1997 tracked the Y chromosomes
of Jews to examine the hereditary priesthood that most people dont
even know Jews have. According to the Bible, Mosess brother Aaron
became the progenitor of a lineage, the Cohanim, entrusted with
special duties in the Temple in Jerusalem. With the destruction of
the Second Temple by the Romans in the rst century, the formal
functions of the priestly lineage came to an end, although some duties
and privileges remain in local synagogues for people with the surname
Cohen or its cognates.
A group of geneticistsIm not sure whether more pious than
credulous, or vice versaexamined the conguration of two genes

is blood really so damn thick?

245

on the Y chromosome, which is passed on from father to son, like


the priesthood. And they found that of Jews who answered yes to
the question of whether they are priestly, 54% had one particular
conguration; while of Jews who answered no, only 33% had this
conguration. In both groups, it was the most common conguration.
The obvious interpretation, from the standpoint of anthropology,
might be that the Cohanim simply represent a somewhat more inbred
group than the non-Cohanim, because many of them have the same
last name, which means they are more closely related to one another
than random Jews would be.
These scientists, however, took a different tack. They gured that,
taking the biblical story of the origin of the priestly lineage at face
value, all male descendants of Aaron would have Aarons Y chromosome. That Y chromosome would today be the most common
one in the Cohanim, implying that the 46% of Cohanim with a
different Y chromosome are nothing but pretenders. The studys rst
author said bluntly to the New York Times, The simplest, most
straightforward explanation is that these men have the Y chromosome
of Aaron.
I am reminded of a line of H. L. Menckens: To every complex
problem, there is a simple solution . . . and its wrong.
In this case, we certainly cant prove their interpretation to be
wrong. But of course, its not our burden in science to do that. Its
their burden to prove that they have done the adequate controls and
given the most reasonable interpretation. And in science, an extraordinary claim (like proving the Bible true!) requires extraordinary standards.
A reasonably sophisticated audience, on the other hand, appreciates
the Exodus narrative as an origin myth of the Jews, and this part
specically as a politically value-laden founding myth of the priestly
caste. Not only are the priests thereby justied back to the Exodus
by virtue of the narrative, but in accepting it, the geneticists are also
piously justifying their religious beliefs. Aaron is, after all, reputedly
the brother of Moseshe of the bulrushes, the burning bush, and
the stone tablets. Aarons Y chromosome is also that of the Lawgiver.

246

is blood really so damn thick?

In most scholarly contexts at the turn of the twenty-rst century,


one might be quite stunned to see a scientic study that begins by
assuming the literal truth of the Bible. I can imagine with some
trepidation an historical linguistic analysis assuming the Tower of
Babel (Gen. 11:9); a study of negative mass assuming the ascension
of Enoch (Gen. 5:24); a study of primate biogeography assuming
Noahs ark (Gen. 8:19); or a study of cellular hypoxia assuming the
resurrection of the body of Christ (Luke 24:15).
That people with similar surnames tend to be genetically more
closely related to one another than to people selected at random is a
well-known principle in biological anthropology. It is called isonymy and can even be used as a noninvasive surrogate measure of the
degree of inbreeding in a population. For example, a famous survey
of the Pennsylvania Amish in the 1950s, where a rare genetic disease
called Ellisvan Creveld Syndrome was surprisingly prevalent, found
that of 1100 ostensibly unrelated families, 23% were named Stoltzfus,
12% were named King, 12% were named Fisher, and so onsix surnames accounted for 72% of the families. The knowledge, therefore,
that the sample of Cohanim contains a few surnames considerably
overrepresented should suggest that this genetic result might be tracking isonymy, and therefore inbreeding, and not necessarily revealing
the constitution of the single mythic founder of the priestly lineage.
Consequently, the second study by the same geneticists, utilizing
twelve markers on the Y chromosome, and nding a most common
form shared by 51% of self-identied Cohanim and only 12% of other
Jews, tells us exactly the same thing. They have proven robustly that
that the Cohanim are somewhat distinct from, and somewhat more
inbred than, other Jews. That is, the Cohanim are more genetically
similar to one another than to other people.
In fact, the pattern detected among the Y chromosomes of the
Cohanim is precisely the pattern we would expect from a group of
people chosen largely on the basis of the overrepresentation of a few
surnames. It is the same pattern you would expect of a sample in
which half the people were named Horowitz or Bernstein. (In fact,
that is precisely the pattern detected in a recent study of people named
Sykes in three rural English counties.) In the absence of controls

is blood really so damn thick?

247

involving samples comparably overrepresenting Horowitzes or Bernsteins, we have no way to know just what the Cohanim pattern does
represent. And in the absence of comparative knowledge of the frequency of these arrays in non-Jews, the information is decontextualized and largely meaningless.
It is thus certainly gratuitous to assume, along with the reverent
geneticists, that the biblical narrative of the founding of the priesthood is literally true and has now been validated genetically. It is
conceivable alternatively that the Cohanim are of heterogeneous origin; that they comprise a population and not a single genetic form
with a lot of pretenders; that the genetic similarity within the group
may be a simple function of recent historical relatedness in the construction of the sample; and that there might be no single primordial
priestly conguration, even though this methodology combined with
essentialist assumptions will invariably identify one.
More important, the authors of the report nd themselves in the
middle of an identity controversy, as people want to know authoritatively if they are really Hebrew priests or not. Well, of course,
nobodys a Hebrew priest; there hasnt been a priesthood for centuries.
Nevertheless, in spite of how shaky the inference is, these genetic data
are culturally invested with religious authority.
The construction of identity is a political arena in which genetic
data should be regarded with considerable caution! Perhaps the most
bizarre aspect of this particular story is that the New York Times reported further on May 9, 1999, that the Cohanim Y chromosome
is also found among the Lemba, a South African group with an origin
myth associating them with the Jews.
And therefore, they are genetic crypto-Jews.
Perhaps so, but since the story and the data had not yet been
published, reviewed, submitted, or even written up for a scientic
audience, perhaps it would be wise to suspend judgment. Those who
are forced to trumpet their research in the press, rather than in a
scientic forum, usually have a good reason for doing so. (Such as,
they cant really prove their point because they havent done the appropriate controls or ancillary studies.) In this case, it would be nice
to know how prevalent the Cohanim Y chromosome is among

248

is blood really so damn thick?

Middle Eastern peoples generally, particularly among the descendants


of the ancient seafaring nations, which undoubtedly affected the gene
pools of their client states.
Among them probably the Lemba.
Indeed, when the work nally did appear in a scholarly forum (the
American Journal of Human Genetics), the authors were obliged to
concede that generalized gene ow from the Middle Eastnot necessarily from Jewswas what they had found.

wh a t i s a re l ative ?

Clearly, then, among the most mystied concepts in the modern


world is that of relatedness. I know my relatives, and I love them,
because they stand in a special relationship to me.
We share blood.
Of course we dont share blood literally. But we do share something,
dont we? What is it that relatives share that nonrelatives dont?
That is, in fact, a surprisingly subversive question. The social anthropologist David Schneider observed that Americans believe that
relatives share some manner of biogenetic substance with each
other, but left the exact nature of that substance unexplored. He
simply presented it as a cultural fact, that kinship balances the relations of biogenetic substance alongside relations of law, or marriage.
He referred to it as the axiom that Blood Is Thicker Than Water.
But it is a question that a molecular anthropology can address. Is
there a biogenetic substance in any literal, natural sense that I share
more of with my sister than with my cousin? Everyone knows that
blood is just a metaphor; its not as though relatives regularly get
transfusions from one another.
Perhaps the biogenetic substance is chromosomes? Actually, however, the basic genetics of crossing-over dictates that segments of chromosomes will be scrambled every generation. Of the twenty-three
chromosomes I pass along, any particular chromosome my daughter
has inherited from me is quite different from the one I inherited
myself; it is in fact a mixture of bits and pieces from the two chromosomes I inherited from my parents.

is blood really so damn thick?

249

And the biogenetic substance cannot be specic segments of


chromosomes, because there is no guarantee that any particular segment of my mothers chromosome is present in my daughter. The
particular chromosome segment of interest that my mother passed
on to me only has a fty-fty chance of being passed on to my
daughter.
That leaves us with the well-known sociobiological calculus of
shared proportions of genes50% with a sibling or parent or
child; 25% with a niece or nephew, and a subset of uncles and
aunts; and 1212% with a cousin. (Sociobiologists invoke this to explain altruism.) But the concept of shared proportions of genes is
metaphoric as wellthats rather less well knownbecause, of
course, we share 98% of our literal biogenetic substance with chimpanzees and gorillas.
This shared-proportions-of-genes business is derived from theoretical population genetics and didnt originally involve the sharing of a
percentage of substanceas it is too commonly articulated. Rather,
however, it represents the probability of two people inheriting the
same specic chunk of hereditythe same gene, or DNA segment
from the same common ancestor. In other words, it is a calculation
of the probability of identity by descentthat is the phrase from
population geneticsfor any particular gene. It would also represent
the average proportion of genes in two people that are identical by
descentbut that proportion would necessarily comprise a ridiculously small complement of the genes, the DNA, that they actually
do share, given the 98% shared with apes. Most DNA you have is,
of course, identical to anyone elses.
How this calculation managed to become enmeshed in a discourse
of overall proportion of shared biogenetic substance, and from there,
to become the bedrock of kin selection in sociobiology, is a good
question for a social historian of science. The point is, however, that
genetically we do not share a proportion of genes in any literal
sense with specic relatives; rather, there is a probability that we both
possess the identical gene, inherited independently from the same
ancestor.
What, then, do relatives hold in common?

250

is blood really so damn thick?

The only attributes that relatives sharethe literal nature of this


biogenetic substanceare revealed in precisely the manner in which
the great mathematical geneticist Sewall Wright originally formalized
the genetic issues. And that is, the biogenetic substance can only be
the common ancestors themselves.
That is what relatives literally share. Ancestors.
Ultimately, as with Santa Claus, there is no biogenetic substance.
The concept is a survival, a folk ideology of heredity. Theres DNA
and there are probabilities of sharing some, but no tangible genetic
stuff divisible among kin and distinguishing them or bounding them
from non-kin. There is no genetic test for kinship.
Kinship is not a genetic property.
As anthropologists have known all along, kinship is constructed,
for we make very arbitrary decisions about things as simple as where
to stop calculating. While we regard a sister as a relative, a second
cousin is a relative outside the bounds of incest, and its not clear that
a fteenth cousin is really a relative at all. All three of them might
share the same genetic marker, or they might not. What they share
are merely different probabilities of having that marker.
With or without the Cohanim Y chromosome, the South African
Lemba might or might not be related to the Jews.
So in a literal, natural sense, relatedness is a just a mathematical
abstraction. It has no real, bracketable biological properties. In a cultural, meaningful sense, kinship is a way of dening social networks,
establishing obligations, and organizing the transmission of property
across generations. But it is not based on the shared possession of
particular physical or genetic attributes.

a l a s t l ook a t ke n n e wi ck man

What, then, are we to make of the suggestion that Kennewick Mans


DNA should be studied in order to determine who he was and who
owns him?
In late 1999, a blue-ribbon panel reported back to the U.S. Department of the Interior that since Kennewick Man appeared to be
9,000 years old (based on a replication of the radiocarbon date), he

is blood really so damn thick?

251

had to be most reasonably regarded as Native American, and therefore


subject to NAGPRA. The last gasp of the scientists who wanted to
study him was to clamor for DNA teststhe kinds of studies that
Rika Kaestle had begun in good faith but had not been allowed to
complete.
But why? Why demand DNA tests at this point, against the wishes
of the Indians?
The rst question is whether you believe that nothing, like sacred
Indian beliefs, should stand in the way of science. But that question
has already been answeredthere are things that can legitimately
impede the progress of science, things like human rights. Just because
something might be interesting to learn (like just how much radiation
it takes to sterilize the ovaries of a Jew), doesnt mean that you can
simply carry out the experiment (as Josef Mengele did at Auschwitz,
to his lasting infamy).
The question then is to establish what the possible benets are for
scientic knowledge, and to weigh them against the possible harm.
The harm is the desecration of remains Amerindians regard as those
of an ancestor, the continuing irresponsible assault on their identities
as indigenous original inhabitants of North America, and the resulting alienation of Native communities vis-a`-vis the anthropological
community and federal agencies.
And the benet to science of grinding up bits of Kennewick Man
and doing a DNA test?
Well come back to that.
Whatever the questions that Kennewick Mans DNA could resolve,
lets say you decide that trying to solve them outweighs the possible
harm. So you desecrate the remains and grind up some of the bones.
What is the most likely outcome?
Quite simply, nothing. DNA can be extracted from old bones a
thousand years old with a reasonable degree of success (about 70%),
but Kennewick Man is nine thousand years old. The chances of actually recovering any DNA from him are rather small. So the most
likely outcome, even if you decide to override the concerns of the
Indians, is that you will have destroyed the material in vain.

252

is blood really so damn thick?

Now, lets say youre lucky and skillful enough to get some usable
DNA. It would have to be mitochondrial DNA, which exists in many
copies per cell and evolves rapidly. What can you do with it?
Well, there are only two questions you could conceivably ask with
Kennewick Mans DNA. First, is it Native American DNA? It turns
out that ve clusters of mutations in the mtDNA of Native Americans
tend to dene populations of the New World. I say tend to dene
because those ve clusters are neither exclusive to Native Americans
nor 100% characteristic of Native Americans. So nding that Kennewick Man has one of the ve mtDNA clusters doesnt actually tell
you hes Native American, and not nding it doesnt tell you he isnt
Native American. In any event, that question has already been decided, so this seems hardly worth the effort.
On the other hand, doing a DNA test, argue some of its proponents, might allow you to tell what tribe he belongs to and therefore
who should receive his remains.
On the other hand, if the tribes in question dont allow you to do
DNA tests on them, then you cant possibly say anything about Kennewick Mans afliation to them. More the point, though, is that the
tribes themselves are historically and politically constituted entities.
Their boundaries are porous and their durations ephemeral over the
scope of human history and prehistory. Consequently, closely related
tribes dont differ genetically from each other in any but the most
exceedingly subtle fashions. To try and allocate Kennewick Man to
one of them on the basis of his DNA would be a fools errand.
So why not just let him rest in peace?
But they wouldnt. Federal authorities decided in early 2000 to go
ahead with genetic tests on Kennewick Man in spite of the likelihood
of nding nothing interesting and desecrating a sacred relic to accomplish it. Rika Kaestle would get her chance to study Kennewick
Mans DNA after all; now the government was asking her to do it.
And when the smoke cleared in the autumn of 2000, they didnt
nd any DNA after all, and Secretary of the Interior Bruce Babbitt
nally recommended that Kennewick Man be given to the Indians.
Those scientists are still protesting.

is blood really so damn thick?

253

ki n s h i p a n d chimp shi p

Species, on the other hand, are not constructed entities: they are
natural lineages bounded in time and space by participation in a
common gene pool. Humans constitute one, chimpanzees another.
And they appear to have had separate biological histories for about
seven million years.
That recognition is the culmination of Darwins revolution, the
acknowledgment that species have histories, and their patterns of
resemblance indicate aspects of their relatedness to one another. That,
in turn, was the culmination of an earlier revolution, the acknowledgment that observation and experimentationthe empirical core
of scienceconstituted a powerful manner of understanding the universe. Such an understanding would comprise a more fundamental
reality than had ever been previously apprehended; and that apprehension was fundamentally good, because it would afford a means of
improving the quality of life for all, by the application of this knowledge of reality via technology. And moreover, it is therefore desirable
to promote science and scientic understandings as widely as possible.
This was the mandate promoted in the sixteenth and seventeenth
centuries by the likes of Francis Bacon in response to the defensive
position of the clergy and the conservative position of the common
folk. Science as a way to new knowledge was appropriately perceived
as threatening by the custodians of the old ways of knowledge
revelation and at.
But now we know that living and extinct species are genealogically
connected, and that our history is intimately bound up with that of
the apes.
Ive never quite understood what is so threatening about that, in
and of itself. Aside from the fact that it seems to go against biblical
narrativebut so do a lot of things. After all, we know that English
and Spanish werent spoken at the foot of the Tower of Babelthey
evolved in historical times from Germanic and Latin, respectively. We
know that Jesus didnt survive Herod the Greats order to massacre
the innocents (as St. Matthew says) if he was born in Bethlehem
during the census of Quirinius (as St. Luke says), because the census

254

is blood really so damn thick?

occurred in 6 a.d., when Herod the Great was already ten years in
his grave (as historical records say).
So whats threatening to religion about chimpanzees?
As with other forms of kinship, the common ancestry of humans
and apes constitutes an historical and social narrative, a story about
where you came from and ultimately about what and who you are.
Like other kinship narratives, it locates you within a social universe
of others, and identies a certain class as meaningfully similar to you
and the rest as meaningfully dissimilar from you.
Quite a responsibility for science to assume. And it is the core of
the paradox of the ongoing creation-evolution war: science doesnt
care about the risk of alienating people from the belief systems that
orient them in life. It cares simply to describe what isthe descent
of our species from an ape stock, and our intimate kinship to living
apes.
People, on the other hand, do care about their orientations. Learning, for example, that you were adopted, and that your parents arent
your biological parents, and that you dont have the nexus of kinship
to your relatives that you thought you had, would be highly disorienting. The scientic origin narrative is simply the opposite, from
which we learn that we indeed have parents and relatives, and do not
stand isolated from rest of the species on earth.
But it is no less disorienting.
Consequently, I think that creationists are entitled to a degree of
sympathy they dont often encounter in the scientic community.

unc on v e n t i on a l th oug h t s on cre ati onism

Biologists have a reason to get defensive about creationists, who do


seek to undermine science education in America. They successfully
prosecuted John T. Scopes in Tennessee in 1925 (it shall be unlawful
for any teacher in any of the Universities, Normals and all other
public schools of the State which are supported in whole or in part
by the public school funds of the State, to teach any theory that denies
the story of the Divine Creation of man as taught in the Bible, and
to teach instead that man has descended from a lower order of ani-

is blood really so damn thick?

255

mals), and although he successfully appealed and got off on a technicality in a higher court, they made their point. Evolution was a
distasteful philosophy that went counter to the teachings of the Bible
and needed to be fought.
And for the next thirty-ve years, their point was acknowledged in
high school biology textbooks, which generally ignored the subject
of evolution. It wasnt until the shock of the Soviet satellite Sputnik
stimulated a heavy investment in science education that evolution
made a big comeback in the curriculum.
By the mid-1970s, fundamentalist Christians had a series of loosely
afliated organizations in place, most notably the California-based
Institute for Creation Research, which actively sponsored undermining the teaching of the theory of evolution. Local university chapters
of fundamentalist student groups freely distributed literature and
were able to choose from a stable of speakers. Prominent among
these was the diminutive biochemist Duane Gish, author of a series
of polemics against evolution and a very competent orator, who
toured college campuses with a slide show, occasionally debating
(and usually trouncing) his opponents. Gish would show a picture of
a half-whale, half-cow and demand to know where this transitional
form could be found; hed talk about the fraudulent fossil Piltdown
Man, and about Nebraska Man, an obscure, transient misinterpretation of a peccary tooth for an early human tooth. And he would
invoke bizarre and seemingly random data to prove his pointfootprints of humans and dinosaurs in a Texas riverbed; the atomic
structure of the element polonium; the anti-predation defenses of
the bombardier beetle.
The grass-roots campaign to call evolution into question was so
successful that by the late 1970s, Arkansas passed a bill mandating
equal time for evolution and creationism. Creationist logic was
inconsistent heresometimes they should be given equal time because both were religious, and sometimes they should be given equal
time because both were scientic. Nevertheless, the law was overturned as unconstitutional in federal court in 1978, as Judge William
R. Overton concluded that evolution was science and creationism
was religion.

256

is blood really so damn thick?

The 98% genetic correspondence of humans and chimpanzees does


have a consequence with which hard-core creationists must wrestle
namely, that either humans and chimps do share a recent common
ancestry, or else they have been independently zapped into existence
by Someone lacking a great deal of imagination.
At the turn of the millennium, creationists are a diverse lot. Some
believe in a young earththey reject not only genetics, biology, and
anthropology, but geology and astrophysics as well. To them the universe is only a few thousand years old, as the chronology of Genesis
implies, a position even William Jennings Bryan stopped short of at
the Scopes trial. (He articulated the position freely and wasnt tricked
into it, as the play Inherit the Wind incorrectly suggests.) Others are,
like Bryan, old earth creationists and implicitly accept geology and
astrophysics, but reject biology. And still others accept the ancient
cosmos and much of biological evolution, but refuse to accept the
possibility of continuity between very different kinds of creatures
most especially humans.
One of the most prominent exponents of the last form of creationism is an affable law professor from Berkeley named Phillip Johnson.
Johnson has little argument with the possibility that a population
of birds happens to migrate to an isolated island as a result of which
a combination of inbreeding, mutation and natural selection may
cause this isolated population to develop different characteristics from
those possessed by the ancestral population on the mainland. To
Johnson, this is so mundane as to be uncontroversialbut for a
signicant reason: it has no important philosophical or theological
implications.
Johnson calls attention to the casualness with which evolutionary
science dispatches meaning from life and the superciality with which
scientists attempt to ll the intellectual vacuum they thereby create.
The central problem is a methodological assumption on the part of
science that he calls philosophical naturalismnamely, that the
natural world must be explained in terms of itself, and not in terms
of occult forces or supernatural beings.
Why is this assumption necessary? Because that is simply how science works. It tries to make sense of the natural world, and if the

is blood really so damn thick?

257

forces operating in it are supernatural or occult, they are by that very


fact unknowable and capricious. If such forces operate, they defeat
the purpose of science.
Which isnt to say they dont exist, only that we cant do science
with them, or on them. So we ignore them.
And science does seem to do well with that assumption. A large
class of diseases do seem to be caused by germs and not by evil spirits.
And they respond better to antibiotics than they do to prayer.
On the other hand, placebos also work a signicant percentage of
the time. And we dont know precisely why. We havent explained
everything.
Which brings us back to evolution.
William Jennings Bryan, grilled by Clarence Darrow at the Scopes
trial, is not represented well by the character called Matthew Harrison Brady in Inherit the Wind. For one thing, the exchanges were
often more interesting, at times resembling bits of an Abbott-andCostello routine, than they are as abbreviated or invented on the stage
and screen. For example: the real Darrow tries to show off Bryans
ignorance of other religions, and asks him about Buddhism. Bryan
responds:
bryan: Buddhism is an agnostic religion.
darrow: To what? What do you mean by agnostic?
bryan: I dont know.
darrow: You dont know what you mean?
bryan: That is what agnosticism isI dont know.

The crux of the matter, however, was Bryans rejection of scientic


expertise in his understanding of deep time. Darrow asked if he knew
of any civilizations older than 5,000 years. Quite poignantly, Bryan
responded.
Well, so far as I know, but when the scientists differ from twentyfour millions to three hundred millions in their opinions as to

258

is blood really so damn thick?

how long ago life came here, I want them to be nearer, to come
nearer together, before they demand of me to give up my belief in
the Bible.

In other words, if my Bible is more important to me than the age of


civilization is, why hassle me about it? And moreover, what is the
basis for asserting the authority of science over anything else when
science is itself internally inconsistent?
Bryans politics have been obscured by his anti-science legacy, but
they were surprisingly modern. He was a radical anti-imperialist in a
time of rife exploitation and empire-building and a staunch pacist
in an era of American machismo vis-a`-vis Mexico and the Philippines.
He ultimately resigned as secretary of state when it became clear that
the United States would be unable to stay out of World War I.
His consistent political stance was in fact concordant with his
stance on science. Very signicantly, Bryan lived in the heyday of the
scientic-political hodgepodge retrospectively labeled social Darwinism, when scholars commonly invoked biology and Darwin in support of war and imperialism, the two things Bryan opposed most
strongly.
If our descent from the apes meant that science justiedindeed
mandated!the bellicose colonialism he opposed, its no surprise he
would come to oppose evolution as well.
In a speech in 1900, Bryan argued:
There are degrees of prociency in the art of self-government, but
it is a reection upon the Creator to say that he denied to any
people the capacity for self-government. Once admit that some
people are capable of self-government and that others are not and
that the capable people have a right to seize upon and govern
the incapable, and you make forcebrute forcethe only
foundation of government and invite the reign of a despot. I am
not willing to believe that an all-wise and an all-loving God created
the Filipinos and then left them thousands of years helpless until
the islands attracted the attention of European nations.

is blood really so damn thick?

259

But consider the literature representing evolution to the public.


The rst generation of evolutionary anthropologists presented civilization as a stage beyond savagery and barbarism, where other
societies in other parts of the world still languished. Evolutionary
considerations dictated that since they had not risen to the point of
being able to govern themselves, they were most appropriate as colonies or corpses. A distinguished British paleontologist named William J. Sollas, in his 1911 book Ancient Hunters, interpreted human
prehistory as a series of invasions and conquests: The vanished Paleolithic hunters have succeeded one another over Europe in the order
of intelligence: each has yielded in turn to a more highly developed
and more highly gifted form of man. Remnants of these earlier peoples, he adds, are to be found as Australians, southern Africans, Eskimos, and native Americas. And in case the political import is still
unclear to his readers, he goes on:
Justice belongs to the strong, and has been meted out to each race
according to its strength; each has received as much justice as it
deserved. . . . It is not priority of occupation, but the power to
utilize, which establishes a claim to the land. Hence it is a duty
which every race owes to itself, and to the human family as well,
to cultivate by every possible means its own strength . . . [lest it
incur] a penalty which Natural Selection, the stern but benecent
tyrant of the organic world, will assuredly exact, and that
speedily, to the full.

Sollas was far from alone in his political interpretations of evolution.


A distinguished Canadian paleontologist, William Diller Matthew,
developed general principles of biogeography in which Europe and
western Asia were the cradle for more highly evolved types of organismsincluding peoplewhich then go out and colonize other areas. The Darwinian Karl Pearson argued that a capable and stalwart
race of white men should replace a dark-skinned tribe which can
neither utilize its land for the full benet of mankind, nor contribute
its quota to the common stock of human knowledge.

260

is blood really so damn thick?

Bryan was aware of this literature. When he read Darwins The


Descent of Man in 1905, he commented insightfully that the material
served to weaken the cause of democracy and strengthen class pride
and the power of wealth. For Bryan the last straw came in 1917,
when he read a book by Vernon Kellogg, an American biologist,
which warned specically of the manner in which the Germans were
invoking Darwinism in their war effort.
Phillip Johnsons modern antagonism to evolution is rooted in the
same very real problem. It is a question of the relationship between
science and scientists, between science and other modes of thought,
between science as a description/explanation of nature and as an odious or merely dumbly callous philosophy, between science as a way
of knowing and science as an intolerant truth, between the value of
scientists as technicians and as scholars.

a pe s a n d pe o p le

Ultimately, there is no self-evident meaning in the structural similarity of chimp and human DNA, any more than there is in the structural similarity of our phlegm or our little toes. We know that we are
similar to chimpanzees and yet distinguished from them.
Our place in nature is thus underdetermined by genetic data. To
make sense of the data requires a biological eye and an anthropological mind, for its meaninglike the meaning of evolution a hundred
years agois technologically constructed and ideologically situated.
Consequently, it should be no surprise that the collection of sophisticated genetic data today unfortunately all too frequently lends
itself to remarkably unsophisticated interpretations. The divergence
between the approaches of two of the founding fathers of molecular
anthropology in the 1960sVince Sarich and Morris Goodman
illustrates this glaringly.
Both have demonstrated the genetic similarity of humans to chimpanzees and gorillas. Both have inferred the close relationship among
these three creatures. But they differ on what that means.

is blood really so damn thick?

261

Goodman feels that the overarching result should be a change in


the formal classication of the apes, submerging all the living apes
and humans within the family Hominidae, the great apes and humans
within the subfamily Homininae, and chimps, gorillas, and humans
within a tribe, Hominini. A more idiosyncratic interpretation of the
molecular data further suggests to Goodman that chimpanzees and
humans, but not gorillas, be recognized as constituting a subtribe,
the Hominina.
The traditional anthropological view emphasizes how very different humans are from all other forms of life, Goodman says. In
contrast, the view from molecular studies emphasizes how very much
we hold in common . . . especially with chimpanzees, . . . with whom
we share more than 98.3% identity in typical nuclear noncoding
DNA sequences.
Of course it is a bit self-serving for someone studying molecules to
privilege the view from molecular studies, but that hardly gets to
the heart of the matter. Is our frame of reference simply so myopic
that all we get from the study of our genetic similarities to the apes
is a proliferation of pseudo-Latin names?
Is that where the 98% similarity begins and ends? With the Hominini and Hominina?
It seems like a lot of effort for a fairly minuscule end product.
Vince Sarich takes a different view of the problem: the classication is trivial. For him, the issue is the evolutionary process that
underlies the apparent pattern. Sarich quotes Thomas Huxley: It
would be not less wrong than absurd to deny the existence of this
chasm [separating human and chimpanzee]; but it is at least equally
wrong and absurd to exaggerate its magnitude, and, resting on the
admitted fact of its existence, to refuse to inquire whether it is wide
or narrow.
To which Sarich appends, the chasm is indeed narrow, but very
deep.
Sadly, genetics has only permitted us to glimpse the breadth of that
chasm. They say that when the only tool you have is a hammer,
everything tends to look like a nailso it is not surprising that some
geneticists would wish to ignore the chasms depth, which they cant

262

is blood really so damn thick?

measure, and exaggerate the signicance of its breadth, which they


can.
But that tells us about those geneticists, not about apes and humans.

oh , n o n ot a n ot he r p roj ect!

Thats why Im quite a bit skeptical of another project hoping to


ride the coattails of the Human Genome Projects success to science
nirvana. Given our 9899% genetic similarity to the apes, why not
sequence their genomes too and nd out ultimately What Makes Us
Human?
And thus, another group of molecular geneticists makes another
self-interested appeal for lots of public money to undertake a Human
Genome Evolution Project.
The problem here isnt so much ethical as it is conceptual.
Recall, as noted earlier: We dont map the genes for noses. By this, I
mean that in general the physical units of the body cannot be directly
and specically matched up with particular DNA segments. Just how
to get a four-dimensional organism from the linear one-dimensional
sequence of DNA, is entirely obscure.
Which is not to say that our big brains, penises, breasts, upright
posture, and the rest of our biological specializations arent ultimately
programmed somewhere in our genes. Just, rather, that laying the
human and chimpanzee DNA sequences side by side and examining
their differences wont tell you what you want to know.
If what you want to know is why humans are human and not
chimpanzees.
Sure, we will continue to nd the phylogenetic relations of the apes
to be quite ambiguous, with some DNA sequences, like mitochondrial DNA, appearing to link chimpanzees to humans; others, like
the genes for involucrin and DRD-4, appearing to link chimpanzees
to gorillas; and the DNA sequences of ancient retroviruses appearing
to reveal a thoroughly intractable phylogenetic problem.
Sure, we will continue to nd small differences between the genes
of a chimpanzee and a human, and small differences in the structure

is blood really so damn thick?

263

of their chromosomes. We will even continue to nd, as a group of


researchers reported in 1998, small biochemical differences in cell
structure. We will continue to nd small differences between them
wherever we look. Thats what Edward Tyson found in 1699, and
thats what weve been nding ever since.
But the suggestion that these particular DNA differences will be
easily translated directly into something obvious or something crucial
to the human condition ies in the face of what we know of genetics:
that the connection between genotype and phenotypebetween
DNA and bodyis very complex. Thus, as one advocate of the newest project gushes, What happens if scientists identify a human gene
that controls development of the larynxa gene that might give
chimpanzees the anatomy needed for speech?
The geneticist is apparently anticipating Boo-Boo the chimp sitting
up and saying, Look, Ma, Im talkin!
For one thing, the larynx alone wont do it; theres the tongue, the
musculature, and the neural networks that control them. And for
another, this view encapsulates a macromutational view of evolutiona view that is widely dismissed by evolutionary geneticists
to wit, that one or a few crucial changes to the DNA will have major
effects on specic parts of the body, creating a hopeful monster
a talking chimp? a soccer-playing gorilla? a religious orangutan?
which will then become the progenitor of a new evolutionary lineage.
The problem, as we noted earlier in a slightly different context, lies
with the assumption that highly pathological variation can be readily
used to understand the range of normal difference and change. Genes
with major effects on the body are invariably pathologies and also
affect many different physiological systems. Populations of shortstatured people like the central African pygmies are not simply groups
of people that all have the gene for achondroplasia. Rather, they have
normal genes for the low end of the range of human stature. If you
went looking in their genomes for one gene with a major effect, with
achondroplasia as your mind-set, youd never nd it. And we dont
know what the short stature genes actually do, or where to nd
them, or how to identify them if we do nd them.

264

is blood really so damn thick?

So where does this leave us with the Human Genome Evolution


Project? Its based on a problematic view of the evolutionary process,
and would be designed to document once again precisely how narrow
Huxleys chasm really is (the DNA sequence), and not how deep (the
causal relationship between the genes and the bodies that make us
and chimpanzees different). Its designed to give us more of what we
already know, and not to deal with what would actually be interesting:
the genetic physiology of humans and apes.
It is the genetic physiology of the apes that will ultimately allow us
to learn why the AIDS virus appears to be so much less virulent in
them than in us; a question that may have some impact on the treatment of the disease in people.

is blood really so damn thick?

265

Twelve
science, religion, and worldview

Science is a cognitive system, a way to think about things. There


are, of course, lots of ways to think about things.
Scientists are among the last great ethnocentrics in the modern
world. And why not? They have a system that works; it produces
technology. Why should they be humble? As Richard Dawkins, a
leading spokesman for science, puts it, The proof of the pudding is:
When you actually y to your international conference of cultural
anthropologists, do you go on a magic carpet or do you go on a
Boeing 747?
The great paradox of modern science is that scientists are not
trained to think about science; they are trained to do it, to carry it
out. They are trained to use the machines with the ashing multicolored lights, often in creative ways, to collect databut not to
think about where knowledge comes from, or the relationship between science and technology, or between scientic and nonscientic
modes of thought, or even about the growth and development of
their own eld of science. These all fall within the domain of the
humanities; generally a scientist is expected to pick them up osmotically, informally, passively. We all know about the ongoing explosions
in science and technology, but we rarely hear about the quieter rev-

266

olution that has been going on in the humanities about science.


Sometimes scientists are vaguely threatened by the knowledge that
someone is out there, studying them and thinking about themas
if they were the Yanomamo of the Amazon Basin or the !Kung San
of Botswana.
But there are big questions now being asked of science that emanate
from a paradox at the center of modern science. On the one hand,
science is widely held to advance by a mechanism of conjecture and
refutation, in the words of philosopher Karl Popper, or in the more
euphonious terms of immunologist Peter Medawar, proposal and
disposal. In other words, science advances by chucking out wrong
ideas and keeping the relative few that work. On the other hand,
science lays claim to being the domain of facts, of our positive knowledge of the natural world.
But how are we to reconcile science as disposal or refutation,
which implies a great deal of nonfactualness within the province of
science, to science-as-fact, which implies a claim to authority?
Clearly, there is more here than simply the discovery of facts
there is a process by which a small class of ideas become facts. This
process is partly based on ontologiesrealities of natureand also
strongly rooted in a social matrix of research, publication, power,
credibility, networking, strategizing, organizing, and propagandizing, which permit some facts to be recognized as such, and others
to go unrecognized.
Thus one of the hottest intellectual areas todaysome would say
scorchingis the anthropology of science, the ethnographic study of
how facts are made, through a negotiation between nature and the
sociocultural web of science.
And there is an important corollary to this research. If facts are
made rather than being simply discovered, then how do we know
what the facts are at any point in time? The facts are, of course, what
the men in white coats say they are.
But some of them are wrong. And we dont know which ones.
This makes the study of science very interesting, but it also is threatening, because it undermines sciences claim to authority by virtue of
facticity.

science, religion, and worldview

267

In their book Fashionable Nonsense: Postmodern Intellectuals Abuse


of Science (1998), physicists Alan Sokal and Jean Bricmont chide
Bruno Latour, an inuential French ethnographer of science, for failing to distinguish between a fact and the mere assertion of fact. The
former is presumably something out therethe reality that science
studiesand the latter is what scientists teach, what may or may not
be true about the universe. But Sokal and Bricmont fail to address
an important question: How do we tell them apart?
How can we distinguish in practice between whats really there
and what the experts tell us is therewhether its the number of
chromosomes in a human cell, the motion of the solar system, or the
nature of subatomic particles?

t h e e u g e n i cs move ment

Or to take a concrete exampleconsider genetics in America in the


1920s. Pick up any textbook on the subject written in that era and
youll nd a discussion of the merits of eugenics, the idea that
society could be improved through breeding better citizens. This not
only implied involuntary sterilization of the worse citizens, but restricting the inow of more bad citizens, which in effect meant the
poor. The movement was popularized by nonscientists such as the
inuential Madison Grant, who (as noted in chapter 5) advocated the
sterilization of social failures in his 1916 best-seller The Passing of
the Great Race. And who were those social discards he deemed
unworthy, unt, and in need of gonadal surgery for the common
good? Grant envisioned a process beginning always with the criminal, the diseased, and the insane, and extending gradually to types
which may be called weaklings rather than defectives, and perhaps
ultimately to worthless race types.
Yup. Worthless race types. Sure, you begin with the criminals,
and you make your way quickly to pretty much anyone you dont
like.
Grants book was perceived as modern and scientiche was
friends with Charles Davenport, the leading human geneticist in
Americaand praised by politicians as diverse as his friend Theodore

268

science, religion, and worldview

Roosevelt (with whom Grant had helped found the New York Zoological Society) and Grants admirer from afar, Adolf Hitler. (Hitler
read the German translation of 1925. Id like to think there were rather
few other things he and Teddy Roosevelt agreed on.)
More than that, the book was reviewed and praised in the leading
scientic journals. While popularized from outside the scientic community, eugenics was also very rmly rooted within it.
The eugenics movement spearheaded the drive to restrict immigration (enacted by Congress in 1924) and to sterilize the poor involuntarily (upheld by the Supreme Court in 1927, and likened to
vaccination with the famous injunction that three generations of
imbeciles is enough).
The government believed it was acting according to the best modern scientic principles. And it was. The problem was, few people
asked, Who the devil are these scientists to be appropriating to themselves the decisions about whose stock is benecialwho shall live,
who shall die, who shall procreate? To ask that question was to set
yourself up as being anti-science, anti-modern, indeed, as antievolutionfor eugenics donned the mantles of both Darwin and
Mendel.
Consequently, Clarence Darrow was perceived as a traitor when he
excoriated the scientic community for its eagerness to abrogate other
peoples rights. Amongst the schemes for remolding society this is
the most senseless and impudent that has ever been put forward by
irresponsible fanatics to plague a long-suffering race, he wrote the
year after defending John T. Scopes for teaching evolution.
Darrow had evolved from biologys champion to biologys basher
in less than a year. Why? He was mortied by scientists pronouncing
authoritatively on elds in which they had little training, little insight,
and lots of arrogance. All they did was to bring the voice of authority
to the aid of popular bigotry.
And they refused to acknowledge it, because they were speaking
the facts.
The eugenics movement died with the onset of the Depression.
After the Crash, geneticists belatedly came to appreciate that social
worth and genetic endowment might not be so closely connected.

science, religion, and worldview

269

But there was no great scientic discovery involvedsimply a growing appreciation for human rights, an appreciation that they saw eroding quickly in Germany. And American geneticists were actually quite
conicted about it.
One prominent geneticist believed that the Germans were beating
us at our own game. Others were less outspoken but still conicted.
In 1934, colleagues and students of the leading geneticist in Germany, Eugen Fischer, honored him with a special issue of the Zeitschrift fur Morphologie und Anthropologie. In their preface, the editors
glowed about the new government rmly in place: We stand upon
the threshold of a new era. For the rst time in the history of the
world, the fuhrer Adolf Hitler is putting into practice the insights
about the biological foundations of the development of peoples
race, heredity, selection. It is no coincidence that Germany is the
locus of this event: German science provides the tools for the politician.
In Fischers honor, the two leading human geneticists in America
contributed papers to that volumeRaymond Pearl of Johns Hopkins, and Charles Davenport. Neither lived to see the end of World
War II. Wouldnt it be interesting to know how they felt in retrospect,
about having their own words appear behind those just quoted?
To complete the storythe preface was written by Otmar Freiherr
von Verschuer, a student of the honoree Eugen Fischer, and quite
obscure except for the fact of having been the academic advisor of
Josef Mengele, the infamous Auschwitz camp doctor. And Fischer
himself applied for and received full Nazi party membership in 1940.

th e l e s son

What are we to make of the eugenics movement? One modern geneticist writes for his student readers: As is often the case in science,
geneticists have become much more humble about their understanding of their subject as they realise how little they really know. Eugenics
was based on ignorance and prejudice rather than on fact; a science
with these at its centre was bound to die.

270

science, religion, and worldview

Theres a lot to disagree with here.


For one thing, its one of rather few places you may ever see the
word geneticists modied by the word humble. (After all, in July
2000, when geneticist Francis Collins announced at the White House
that the Human Genome Project had completed 90% of its ambition
to sequence the human genome, he proclaimed, We have caught the
rst glimpses of our instruction book, previously known only to
God. So it was not surprising to hear President Clinton echo the
sentiment, Today we are learning the language in which God created
life. Those humble geneticists!)
And for another thing, it still doesnt indicate how to tell ignorance
and prejudice from fact, nor does it account for why the leading
scientists of the day were strikingly and pathetically unable to do so
themselves. The point is that geneticists did notuntil very late in
the gamesay, Hey, this is based on ignorance and prejudice, not
on fact! Its bound to die!
They couldnt tell the fact from the assertion of the fact.
And whether it was bound to die or not is beside the point; it
did die, but not before harming many people (while it would be an
overstatement to blame Nazi policies on geneticists, books by American scientists with titles like Sterilization for Human Betterment
widely extolled the virtues of social surgery and bragged about the
involuntary sterilization of nearly 10,000 poor people in California
alone).
The relationship between reality (the facts) and the views of the
experts (the assertion of fact) is dependent fully upon the wisdom
and goodwill of those experts. They control the means for telling the
facts from the nonfacts; if you are skeptical about what you hear about
subatomic particles, after all, you cant exactly go out and build your
own cyclotron. And it is, of course, in the interests of those experts
to assure the rest of us that there is nothing to worry about. Thus,
the real world of sciencethe conicts of interest, the power struggles, the politics, the stupidity, the arrogance, the lapses of integrity
are not to be studied or dwelt upon. They are simply dened out of
existence or rendered invisiblescience is the study of the facts of
nature.

science, religion, and worldview

271

But we need to do better than the geneticists of the 1920s. We need


to understand both nature and the relationship between nature and
representations of it. We need to know how things become facts, so
that we can tell the facts from the crap without having to wait fty
years to see what future scientists think about it.
But the ways in which facts are negotiated between nature and
culture, the way in which those facts achieve facticity, are not part of
the formal training of scientists; they are simply taught to believe they
are reading nature.
How sad!
It almost makes you wonder how science manages to progress, in
spite of the training of scientists.

re l a t i v i s m a n d scie nce

So lets return to Richard Dawkinss 747 and ying carpet. Does


anyone really think that you can travel to conferences on a ying
carpet? The 747 works; its real; it gets you where youre going.
But lets turn the question around. Does the fact that a 747 works
mean that the scientic view of the world is superior to others?
A 747 is not science, even in microcosm. It is technology, a product
of science. And as anthropologists since Franz Boas have noted, technology invariably constitutes a series of trade-offs. With the wonders
of the 747 come the wonders of lost luggage, cramped seats, no escape
from the obnoxious strangers around you, and the fear of bombs on
board. Sure, the Yanomamo dont write books on personal computers
with Pentium-based processors. But by the same token, they dont
worry about carpal-tunnel syndrome, system crashes, the Michelangelo virus, or any of a host of other anxieties that accompany the
technology. The disadvantages to our world of televisions and nuclear
weapons need hardly be tallied, although their utility is equally obvious.
Ultimately, technology is part of a cultural system, and as it
changes, so do other elements. And it is never clear whether the result
is improvement or decadence. Generations of social philosophers
have argued both ways, for example, Francis Bacon glamorizing the

272

science, religion, and worldview

technological society in the seventeenth century and Jean-Jacques


Rousseau deriding it in the eighteenth century. Ultimately, though,
whether technology is good or bad, we are stuck with it.
Which brings us back to the contrast between a 747 and a ying
carpet. The former is a piece of technology, the latter a piece of
mythology. We can compare technologies and argue for the superiority of one over the other (although it is unclear whether lives overall
are improved or degraded by it). We can compare mythologies, but
there is no scale on which to tell whether one is superior to another.
But to compare technology to mythology is ridiculous, even perverse.
The biologist apparently believed he was refuting cultural relativism, a principle that arose in the early twentieth century in the wake
of the exploitation, destruction, and genocide that accompanied colonialism. Often it was justied on the grounds that Euro-American
society had progressed further along a cultural or technological continuum and was therefore better than the cultures and peoples
Euro-Americans were wiping out.
It was a convenient rationalization, but it turned out to be difcult
to prove, as ethnographers documented the depth of local knowledge
of the environment, the complexities of diverse languages, and the
richness of non-Western lifeways. Cultural relativism became an intellectual principle governing the comparison of cultural systems
that they were different from one another, but could only be ranked
in very narrow fashions.
Cultural relativism is occasionally confused with Star Treks prime
directive of nonintervention, but isolationism was never part of the
doctrine of cultural relativism. Indeed, its most vocal exponents were
anti-Nazi activists. Cultural relativism is also occasionally confused
with a nihilistic philosophy of moral relativism in which anything
goes. But this is the very opposite of cultural relativism, which recognizes that we all live within a cultural system that distinguishes
right from wrongand although those distinctions may vary across
societies, one is obliged to live within the local set of norms or risk
the imposition of sanctions.
Science is a part of our cultural system. It is a way of seeing the
world and a way of nding out more about the world. To paraphrase

science, religion, and worldview

273

Peter Medawar again, science is a means by which we analyze the


many things that might be true about the universe and pare them
down to the relatively few that probably are true. In this way, we gain
positive knowledge, which we then apply to generate new technologies and mastery over nature.
The concept of mastery over nature is itself culturally loaded. It
is certainly tied into assumptions of social hierarchy, and as Mary
Midgley has shown, to images of sexual violencescience as male,
nature as female.
But why do we even believe we need to dominate nature? Why do
we need to know exactly how things work? We take these assumptions
for granted because we have inherited a cultural view that takes positive knowledge of nature as an ultimate goal, rationalism as a guide to
life, and technology as a mode of existence. That is certainly a valid
view. But is it the only acceptable one? Is it necessarily the best one?
Lets examine rationalism. Scientists perennially fret about the irrationality of the common person (a recent example is the late Carl
Sagans The Demon-Haunted World ). They deplore the fact that almost all newspapers carry horoscopes, the fact that books like Chariots
of the Gods and The Celestine Prophecy can be huge best-sellers, the
fact that Americans are so religious and so resistant to accepting the
theory of evolution. To a class of scientists, these nonscientic modes
of thought are threatening and to some extent foolish.
Contrasting what he calls transcendentalism with science, entomologist E. O. Wilson, the father of sociobiology, notes that the former is full and rich and also easier to followthus it continues
to win the heart even as science is winning the mind. And with
more than a bit of condescension, he observes:
Millions . . . feel otherwise adrift in a life without ultimate meaning.
. . . They enter established religions, succumb to cults, dabble in
New Age nostrums. They push The Celestine Prophecy [sic] and
other junk attempts at enlightenment onto the best-seller lists.
Perhaps, as I believe, it can all eventually be explained as brain
circuitry and deep, genetic history. But this is not a subject that
even the most hardened empiricist should presume to trivialize.

274

science, religion, and worldview

This contrast was made more sensitively and cleverly by Cole Porter
in a song he wrote for Silk Stockings, the musical version of the classic
Garbo movie Ninotchka. The lovely Soviet empiricist/sociobiologist
sings of love:
When the electromagnetic of the female
meets the electromagnetic of the he-male,
if right away
she should say
This is the male
Its a chemical reaction, thats all.

But her dashing counterpart doesnt buy it. Challenged to produce


his own theory, he responds, My theory is that there is no theory
and croons:
I love the looks of you,
The lure of you.
Id love to take a tour of you.
The eyes, the arms, the mouth of you;
The east, west, north, and the south of you.
Id love to gain complete control of you
And handle even the heart and soul of you.
So love at least a small percent of me, do,
For I love all of you.

Guess who wins.


Of course, love and mystico-religious experiences are electrochemical. But water is merely hydrogen and oxygen. Yet that knowledge
helps us neither to slake our thirst after a long mountain hike nor to
cope with another year of drought and the threat of the crops failing;
nor does it permit us to experience the mysteries of baptism or to
rebuild our lives after seeing our homes wrecked in a ood.
Just hydrogen and oxygen. But that knowledge is trivial; the extraordinary thing is why the reductive scientic attitude overvalues
itself and laments everyone elses shortsightedness.

science, religion, and worldview

275

Wilson believes that we evolved genetically to accept one truth


and discovered another, thus issuing a general absolution to science
for its overarching failure here. But his thought about the apparent
conict between science and religion fails to come to grips with what
anthropology has learned in the past century. It may be worth noting
that Wilson also blames the failure of his joyless reductionism to
penetrate the masses deeply on ignorance of the natural science by
design[, . . . ] a strategy fashioned by the founders [of modern social
science], most notably Emile Durkheim, Karl Marx, Franz Boas, and
Sigmund Freud. But thats a bum rap, for none of them was antiscience: Freud had a Viennese medical education, the envy of any in
contemporary America; Boas had a doctorate in physics; Marx read
and appreciated far more of Darwins work than Darwin did of his;
and Durkheim based his famous model of society (organic solidarity)
on a biological analogy.
They understood what the scientists of their day were saying about
the important things in human life, and they simply opposed it.
Anthropologists of the nineteenth century tended to see a progression of human thought from magic or superstition to religion to
science, with the rationality of the scientic modern age ultimately
coming to supersede and replace the stupidities of earlier times and
cultures. But we abandoned that way of thinking in the twentieth
century. Why? In the rst place, it is not at all clear that magical or
superstitious thought has been superseded by religion, much less religion by science. People today are no less superstitious than they
were hundreds of years ago; that kind of belief simply emerges in
particular contextssports and gambling, for example. By the same
token, Americans in the paramount technological society of the modern age are extremely religious.
Is it, as the writings of some scientists imply, because those people
are stupid?
There is a different explanation. Magic and religion are with us,
just as strong as ever. Even among scientists. It is the exaggerated
claims of scientists, and their often arrogant misunderstandings of
human behavior and society, and of the domain of science itself, that
are the problem.

276

science, religion, and worldview

a u th ori t y a n d accuracy

What kind of scientic rationalities should we make people follow?


Conceptions of what scientic rationalities should govern modern
lives are invariably strongly culture-bound. The American geneticist
Charles Davenport in 1911 envisioned a eugenically scientic society
in which people would fall in love intelligently. Not only were he
and his followers attempting to impose a cold rationalism upon a fundamentally inappropriate substrate, but their idea of scientically intelligent mating essentially excluded any partner who was not wealthy,
abstemious, and Nordic. Clarence Darrow condemned Davenports
elitist scientism as the product of an age of meddling, presumption,
and gross denial of all the individual feelings and emotion.
The idea of people leading all aspects of their lives by scientic
principles has been attractive to utopian writers, but most attempts
over the past two centuries to implement reforms in that direction
have failed extensively. For example, our numerically bizarre timekeeping system (the 24-hour day and 60-minute hour) is an inheritance from ancient Babylonian arithmetic systems, and our ridiculous
7-day week and 12-month year from their astrological cycles.
Wouldnt a rational, decimal time-keeping system be superior? Onehundred-minute hours, ten-hour days, ten-day weeks, and ten-month
years. Yet attempts to impose such reforms were unsuccessful following the French Revolutions attempt to establish a scientic society;
or following the Soviet Revolutions attempt to do the same. Britain
adopted a decimal currency only within the past generation, and its
scientists aside, the United States has steadfastly resisted the metric
system of weights and measures.
Many rational scientic systems for running peoples lives have, in
fact, been proposed, but what is considered in a given time and place
to be a rational scientic thing to compel people to do may not
necessarily even be good science, let alone display any respect for
human rights. To cite only the most agrant example, the Third
Reichs policy of Rassenhygiene offered what purported to be a rational, scientic solution to the problem of large numbers of inferior
and undesirable people.

science, religion, and worldview

277

This does not mean that the imposition of scientic rationality in


general life is wrong; only that one needs to consider its track record
before placing ones bets. Utopian scientic visions notwithstanding,
science ction plots (e.g., Star Trek) ridicule hyperrationalism as less
than human, if not fundamentally contrary to human nature. Fun,
of course, is nonscientic and irrational, but indelibly human.
It is not simply, as E. O. Wilson argues in Consilience, that we
evolved to be irrational, and then science discovered a rational approach to the universe that is destined to overlay it. Rather, both
together constitute human nature, and neither is more or less human
than the other. But one without the other constitutes an incomplete,
inhuman condition. Perhaps, indeed, the sciences can learn about
human nature from the humanities.
What the humanities tell us is that science in modern life is not
merely rational thought but bureaucratically organized rational
thought. In other words, science is both about the universe and about
scientists; it is both a rational and a social process. Consequently,
scientic statements encode two messages that are not strictly compatible: accuracy and authority. Scientic statements strive to be accurate, and often succeed, but are always authoritative. Why? Because
they are made by scientists. This creates a problem. If scientic statements are equally authoritative whether or not they are accurate, how
do we know when to believe them?
The authority of scientists has been exploited for generations by
Madison Avenue. Whether it was that smoking Brand X is actually
good for you or that eating one or another high-fat, low-ber, sugary
food is healthy, the ability to get 9 out of 10 doctors to say it has
always been recognized as a selling point. The authority that comes
with statements by scientists comes with responsibilitiesthe responsibility to get it right, to quickly censure those who get it wrong
in the name of science, and to acknowledge the consequences of
misleading the public.
Unfortunately, it is no easier to get the average scientist to accept
responsibilities than it is to get the average four-year-old to accept
responsibilities. Scientists wish to speak with authority, to be able to
say outrageous things, and to let outrageous statements by their col-

278

science, religion, and worldview

leagues stand unchallenged or minimally challenged and still have


their next utterance carry the authority of science too. That is not
sciencethat is scientism, an uncritical faith in science and scientists.
And that is what is being challenged here.
In addition to authoritative statements, science of course also makes
accurate statements. Science, after all, strives to comprehend the universe. As any scientist will tell you, it consists of formulating hypotheses, testing them against empirical data, falsifying those that are inaccurate, and linking them together as explanations or theories. In
this way, of course, science workswe understand things better now
than we did a hundred years ago, and expect to understand them
even better a hundred years from now.
But if, as generally formulated in the latter half of the twentieth
century, the principal mechanism of scientic advancement is the
falsication of hypotheses, it is difcult to equate scientic statements with accurate statements. After all, most hypotheses concerning a particular phenomenon will ultimately be falsied; this will
lead to greater accuracy in the long run, but it also means that most
ideas about it were wrong, although no less scientic for that reason.
Scientists are routinely taught, for example, about Mendels discoveries of the basic principles of heredity. Sometimes they are taught
that he reported his data selectively, or even fudged them a bit, but
of course one should hesitate to judge 1860s research by todays standards. What scientists arent taught is that Mendels scientic contemporaries certainly had their own ideas about heredity. They
werent dunces; their ideas were scientic, interesting, and nevertheless wrong.
Thus, science is generally not accurate, except in the long run.
Scientic statements are routinely falsied. In other words, most scientic statements turn out to be inaccurate, and rather few actually
turn out to be accurate. That is simply a consequence of the way
science operates. The 747 ies because of thousands of other aircraft
ideas that didnt.
So why should the 747 be entitled to bragging rights over ying
carpets, which have been the subject of far fewer failed ideas, designs,
and experiments?

science, religion, and worldview

279

s ci e n ce a n d my th

There is one more important difference between the ideas on which


scientically engineered aircraft are based and the idea of ying carpetsnamely, their purpose. Science is constituted as a series of explanatory stories about the universe. Explanatory stories are, like any
other stories, related through the medium of language, using metaphors to communicate meaningsthe selsh gene, the Big Bang, the
genetic code. These cannot be literally true: Genes are inanimate and
can no more be selsh than they can be loyal, ferocious, or pious;
there could not have been any bang at all without an atmosphere to
transmit sound, and in the absence of matter there could not have
been atmosphere; and the genetic code was a metaphor devised in
1944 by the physicist Erwin Schrodinger, before molecular genetics
was even invented.
So in the anthropological usage, stripped of the pejorative connotations of the common use of the term, science is constituted by
mythslinguistic stories purporting to explain things. Every culture
has its own. But those of science are a bit different. Scientic stories
have but a single goal, to relate as accurately as possible (given the
constraints of knowledge and language) the phenomenon in question.
If accuracy is the scale by which to compare myths, certainly sciences myths win. But that is an obviously rigged game, using sciences
criterion to evaluate its alternatives. The simple fact that science is
ignored or rejected by a signicant number of otherwise modern
people should suggest that they have other criteria that matter to
them, even if science doesnt.
Consider, for example, some of the many things that the scientic
myth of human evolution doesnt address. Afrmation of a sense of
individual worth or importance; living right, by codes of morality or
standards of conduct; the evocation of strong emotional bonds of
solidarity to a community; or simply how to get through the day and
feel good.
This is, of course, not to defend creationism, by which fundamentalist Christians seek to subvert science education in America. It is to
suggest, however, that the rejection of science by ordinary citizens is

280

science, religion, and worldview

a reection of the failings of scientists, not of the failings of those


ordinary citizens. Representing creationism as science is quite simply
a fraudulent claim. But it is crucial to note that science provides a
restricted set of answers to a very large set of questions that people
in all cultures have; and that science may easily be judged inadequate
if we look beyond the sole criterion of empirical validity. Evolution
provides the most empirically valid explanation that we have for the
present existence of life. Period.
But why should it really matter whether we are descended from
arboreal hairy primates or not? Either way, we are still human, and
engaged in the construction of a civil and just society. Either way,
you still have to earn a living, put food on the table, cope with
injustice and suffering, and nd meaning in your life.
The reason it matters to so many people is that scientists have made
it matter, and theyve done so in the worst possible way. Theyve
taken a proposition that does not matter much and has little effect
on the lives, cares, and worries of everyday peopleWe are descended from apesand stretched that into a series of additional
propositions, often both authoritative and odious.
Thirty years ago, in a widely read scientic-philosophical work
called Chance and Necessity, the French molecular biologist Jacques
Monod argued that evolution shows life to be meaningless. While
this might easily be dismissed as Sartre among the test-tubes, it
carried the authority of science, because a prominent scientist wrote
it. Is the proposition true? Perhaps, but there is no way to know.
There is no class of data to be collected that would indicate whether
life is meaningful or not. It is not a scientic proposition.
More than that, it is a distasteful proposition. Bluntly put, people
care more about whether their life has meaning than they do about
whether they came from apes. If you tell them that science shows life
has no meaning and that we came from apes, it is not surprising to
imagine that they would reject both scientic propositions. In fact,
it is pretty dumb to think otherwise.
The problem is that science is very good at answering questions
people dont care about. To the extent that physics aids the technology
that allows you to reheat frozen food in a few minutes, it is obviously

science, religion, and worldview

281

useful. But using technology derived from it, and caring about it, are
different things. The things that people care about tend to be the
things outside the domain of scienceWhat is death? Will I always
be able to take care of my children? Why do good things happen to
bad people? How can I be happy?
All humans care about these things. All cognitive systems provide
answers for them. In addition, they provide explanations for how
humans and the world they live in came to beas the scientic myth
does. And more than that, other myths explain not simply how we
came into existence, but why.
And science doesnt.
Science explains how we came to exist more accurately than does
any other myth. By its own criterion, it is therefore the best explanation. But it is an answer to a relatively small and trivial question.
Science tells us that we are descended from apes, a fact that affects
peoples lives and minds minimally, if at all. On the other hand,
science says nothing about whether the cosmos is ultimately benevolent or just. The perpetual crisis in science education is largely the
result of a consistent failure of scientists themselves to be educated
about what they do and its implications.
Richard Dawkins writes in River Out of Eden:
[I]f the universe were just electrons and selsh genes, meaningless
tragedies . . . are exactly what we should expect, along with
equally meaningless good fortune. Such a universe would be neither
evil nor good in its intention. It would manifest no intentions of
any kind. In a universe of blind physical forces and genetic
replication, some people are going to get hurt, other people are
going to get lucky, and you wont nd any rhyme or reason in it,
nor any justice. The universe we observe has precisely the properties
we should expect if there is, at bottom, no design, no purpose,
no evil and no good, nothing but blind, pitiless indifference.

And for good measure he adds, DNA neither knows nor cares.
DNA just is. And we dance to its music.

282

science, religion, and worldview

Well, maybe we do and maybe we dont. Since the author is not


an expert on molecular genetics, we may consequently take his musings about DNA with a grain of salt, falling within the domain of
folk heredity. But what about his dour view of the universe? Here
Dawkins presents a consistency argument, not a test of an hypothesis.
After all, the universe also has precisely the properties we would
expect to nd if it were benevolent and designed, and we simply didnt
understand it, lacking the key to its pattern. If the only language you
speak is Greek, other languages may sound like random noise, like
bar, bar, bar, which is why the Greeks called non-Greek speakers
barbarians. But thats a statement about the limitations of the
Greeks, not about the other peoples.
Random noise may be random noise or it may simply be stuff you
dont understand, which consequently looks or sounds like random
noise. The history of modern science, after all, is about the discovery
and imposition of order on what formerly looked like chaos. Perhaps
ultimately there is just chaos, but Dawkinss assertion about it is no
more than that, an assertion.
Dawkinss interpretation of the universe might be true, but again,
since there is no positive knowledge we can acquire, no controlled
set of data we can collect that would indicate whether it is in fact
likely to be true, we are obliged to identify the statement as nonscience.
The scientist is, of course, welcome to his opinion. It is not, however, the case that his opinion about this is more scientic than any
other. Indeed, since it reects an inability to tell science from nonscience, it might actually be regarded as less scientic than any other.
The important criticism, however, lies in the implications of teaching
such philosophy as if it constituted science, indeed as if it constituted
the theory of evolution.
The scientist says: Science has explained many things about the
universe. Your life has no meaning. Have a nice day. And then he
is surprised and appalled at the public rejection of that philosophy.
If the goal of science is to make people miserable, then Dawkins and
his gloomy philosophy would seem to be the ideal evangelical tool.

science, religion, and worldview

283

But for those of us who think that perhaps people do have the right
to be happy (or at least, as Thomas Jefferson believed, the right to
pursue happiness), it is an impoverished and unfullling worldview.
Small wonder it is so unpopular! Small wonder that people would
rather derive pleasure from the comforting inanities of The Celestine
Prophecy.

et h n oce n t ri s m a n d th e future of scie nce

Science attacks complex, integrated mythologies with a unidimensional substitute: one that is simply more accurate about mundane,
mechanistic things. Science thus sets for itself a single goalempirical
accuracyand relentlessly attempts to supplant other systems of belief on that basis, leaving an intellectual vacuum in its wake in many
other ways. In other words, science does chicken right but frequently
leaves diners bored and nutritionally imbalanced.
There is considerable ideological baggage associated with compelling nonscientists to think as scientists door at least as the most
cynical scientists do. It may be worth reecting upon the implications
of denying people the other qualities that nonscientic origin myths
provide. Science has only recently and marginally come to consider
its responsibilities, and in our culture, the responsibility attached to
telling people authoritatively that they are unimportant in the universe is great.
And it may be worth considering as a question of scientic ethics
whether, in an insecure world, science may actually be doing more
harm than good to people in actively undermining their images of
self-worth in a benevolent cosmos. Perhaps, rather than asserting the
authority of science aggressively in opposition to whatever else is popularly and ignorantly believed, a humanistic, anthropological approach to science, as a set of ideas about the universe arising from a
particular historical development and serving a particular function,
may be a more effective way of getting its central messages across.
Teaching how scientists think about science is fundamentally different
from compelling people to think the way scientists do (or the way
they are supposed to think).

284

science, religion, and worldview

Is it fair, then, for scientists to tell citizens of our nation, or of any


nation, You are wrong and we are right? This is an ideological
position widely held by powerful societies when confronted with the
beliefs of less powerful societies. It is the rawest form of ethnocentrism.
Is ethnocentrism wrong? It is certainly an ineffective way of getting
people to like you or to respect you. It is an effective way of getting
people to fear and resent you. If science adopts such a stance, it is
not terribly difcult to predict the probable reaction.
A reasonable alternative to the ethnocentric presentation of science
is to present science in an anthropological framework. In other words,
to present science not so much as the one true answer in opposition
to the many false ones (which has a familiarly evangelical ring to it)
but as an answer constructed within a particular cultural framework,
satisfying certain criteria well (notably empirical validity), but other
meaningful criteria poorly.
Humanistic ideas intersect with scientic ones at almost every turn
in the study of humans. We cannot escape them, and it is false to
suggest that they can successfully be ignored in the modern era, when
social and political problems constitute the bulk of unsolved problems
in contemporary life. We now acknowledge that the study of human
biology carries responsibilities that come with the authority of speaking as a scientist. Science has justied racism, but it should not.
Science has justied colonialism, but it should not. Science can make
peoples lives miserable, but it should not.
Decades ago, Jose Ortega y Gasset bluntly criticized the radical
specialization of modern scientists as comprising a new class of
learned ignoramus . . . ignorant, not in the fashion of the ignorant
man, but with all the petulance of one who is learned in his own
special line. Anti-intellectualism, after all, comes in many forms and
imperils not simply science but the entire scholarly community.
Consider, for example, the misrepresentation of creationism as science (from outside of science), and the misrepresentation of genetics
as a social panacea (from within science). Creationism is insidious,
because by misrepresenting itself as science it promotes ignorance.
But neohereditarianism, also misrepresenting itself as good science,

science, religion, and worldview

285

is insidious as well. Is either threat greater than the other? As far as I


am aware, no one has ever been killed or involuntarily sterilized in
the name of creationism. From the standpoint that ignorance is bliss,
and death probably is not, we might consequently do well to be at
least as skeptical of the judgments of scientists as of anti-scientists, at
least where peoples welfares and lives may be concerned. Indeed,
until such a time as modern social ethics becomes a required subject
for science students, we might do well to be even more skeptical of
the social judgments of scientists than of other citizens. As one commentator has noted, [W]ithout any reference to the interaction between science and society, [science education] will tend to produce
navete, xenophobia, and intellectual arrogance.
Because of the strides made by science, it is now possible for poor,
unethical, or pseudoscientic judgments to affect more peoples lives
more catastrophically than ever before. Science thus needs the humanities now more than ever.
If the twentieth century was the century of modern science, the
twenty-rst will be the century of modern scientic responsibility.
Science will have to be uncoupled from the colonialism and ethnocentrism of the modern era, which in turn implies a somewhat different approach to the training of scientists. The efciency with which
we can actually use science to help solve problems of health and
welfare in a global community may depend upon how effectively we
are able to accomplish this.
As a mediator of different and incompatible bodies of knowledge,
anthropology has an important role to play in the relation of science
to modern society. To the extent that genetics represents the molecular science of heredity, the molecular anthropology at the heart of
this book should be a central case for understanding the ambiguous
nature of sciences relationship to society. Science is seen as both
authority (epitomized in the benevolent Dr. Einstein) and sociopathy
(epitomized in the deranged Dr. Frankenstein). The reason for this
lies not simply in the failures of the masses (to which science ordinarily likes to attribute it) but also in the failures of scientists, whose
training generally does not include a curriculum on the humanistic
and social aspects of what they do.

286

science, religion, and worldview

Thus, Patrick Tierneys recent book Darkness in El Dorado: How


Scientists and Journalists Devastated the Amazon struck a nerve with
anthropologists by exposing the scientic, economic, and sexual exploitation of the Yanomamo of the Amazon basin by ambitious and
ruthless scientists. Unfortunately, Darkness in El Dorado fails to live
up to the standards demanded of an expose. It accuses geneticists of
starting a measles epidemic with their vaccination program, but it
would seem that the program was, in fact, initiated at least in part as
a humanitarian gesture and that measles preceded the scientists. And
with forty years of hindsight, it is a bit unfair to second-guess each
decision made in the eld at the time.
But the book does raise some important issues about the responsibilities of scholars to the communities they study, ethical issues that
anthropologists have been grappling with for decades. In the context
of an archaic anthropology, when much of the eld strove to be purely
objective and scientic (in the sense of what is sometimes called potted philosophy of science), giving something back to tribal peoples
would have been as scientically senseless as chemists giving something back to boron. But that isnt the case today.
Anthropologists have been debating ethics for as long as any scientists and speaking out on behalf of the powerless. The very rst
academic anthropologist, Edward Tylor of Oxford, called the eld
essentially a reformers science over a hundred years ago. And there
is hardly a more beloved target of political conservatives in academia
than Margaret Mead. Anthropology is very self-consciously a science
of the heart as well as of the head.
So, ultimately, one has to be slightly uncomfortable with the fact
that Yanomamo DNA sits in a refrigerator at Penn State, exclusively
for the benet of scientists in perpetuo, as Tierney notes, and is not
under the control of the Yanomamo themselves. That is a modern
problem, one that requires some thought in the context of balancing
human rights and welfare against the advancement of science (and
the advancement of scientists).
Scientism is the secular religion of the day, and what I have long
feared has come to pass: increase of knowledge unaccompanied by
increase of understanding, Ashley Montagu wrote presciently nearly

science, religion, and worldview

287

half a century ago to his friend Theodosius Dobzhansky, who understood the value of anthropology for genetics.
In sum, the place of the human species in the natural order is
predicated on the place of the chimpanzee, and is consequently a
contested site on the boundary of animalness and godliness, beast
and angel. When genetics provides information bearing on that question, it does so within the contexts of both the scientic study of
heredity and the study of human systems of meaning. It cannot be
divorced either from its intellectual contexts, social and philosophical
implications, or the responsibilities of scientists.
And more than that, it provides an entry for anthropology into
molecular studies to create a truly interdisciplinary research area.
Molecular anthropology shows in microscosm how we can integrate science into our contemporary culture and acknowledge science
as a signicant part of it, while at the same time valuing other cultural
subsystems and other kinds of knowledge. The other kinds of knowledge are as important for the proper interpretation of scientic data
as science is for modern life. Humanistic knowledge is thus at least
as crucial to the scientist as scientic knowledge is for the masses.
Ultimately, this hybrid eld permits us to bridge the two cultures
and give a broader and more effective base to understanding of the
molecular basis of human existence.

288

science, religion, and worldview

notes and sources

i n t rod ucti on
C. P. Snow, The Two Cultures and the Scientic Revolution (New York: Cambridge
University Press, 1959). First published in preliminary form in the New Statesman, October 6, 1956.
Richard J. Herrnstein and Charles Murray, The Bell Curve: Intelligence and Class
Structure in American Life (New York: Free Press, 1994).

ch a pte r 1
For an overview of primate evolution and systematics, see John G. Fleagle, Primate
Adaptation and Evolution (San Diego: Academic Press, 1988; 2d ed., 1999).
On the work of Sarich and Wilson, see V. M. Sarich, Appendix: Retrospective on
Hominoid Macromolecular Systematics, in New Interpretations of Ape and Human Ancestry, ed. R. L. Ciochon and R. S. Corruccini (New York: Plenum Press,
1983), 13750.
On weird phylogenies based on molecular data, see G. J. P. Naylor and W. M.
Brown, Structural Biology and Phylogenetic Estimation, Nature 388 (1997):
52728; J. P. Curole, and T. D. Kocher, Mitogenomics: Digging Deeper with
Complete Mitochondrial Genomes, Trends in Ecology and Evolution 14 (1999):
39498; W. W. de Jong, Molecules Remodel the Mammalian Tree, Trends in
Ecology and Evolution 13 (1998): 27075; D. Graur, L. Duret, and M. Gouy,
Phylogenetic Position of the Order Lagomorpha (Rabbits, Hares, and Allies),
Nature 379 (1996): 33335; D. Graur, W. A. Hide, and W.-H. Li, Is the Guineapig a Rodent? Nature 351 (1991): 64951.

289

For Sarichs view from retirement, see V. M. Sarich, Molecular Clocks: Then and
Now (paper presented at the Dual Congress of the International Association
for the Study of Human Paleontology and the International Association of Human Biologists, Sun City, South Africa, 1998).
On early studies of the apes, see R. M. Yerkes and A. W. Yerkes, The Great Apes:
A Study of Anthropoid Life (New Haven: Yale University Press, 1929).
For Andrew Battell, see Samuel Purchas, Hakluytus Postumus, or, Purchas His Pilgrimes, Contayning a History of the World in Sea Voyages and Lande Travells by
Englishmen and Others (1625; Glasgow: James MacLehose, 1905), 6: 39799.
Nicolaas Tulp, Observationum medicarum libri tres . . . (Amsterdam: Apud Ludovicum Elzevirium, 1641).
Edward Tyson, Orang-outang, sive homo sylvestris, or, The anatomy of a pygmie compared with that of a monkey, an ape, and a man to which is added, A philological
essay concerning the pygmies, the cynocephali, the satyrs, and sphinges of the ancients:
wherein it will appear that they are all either apes or monkeys, and not men, as
formerly pretended (London: Thomas Bennett & Daniel Brown, 1699). Facsimile
edition with an introduction by Ashley Montagu (London: Dawsons of Pall
Mall, 1966).
Willem Bosman, A New and Accurate Description of the Coast of Guinea, Divided
into the Gold, the Slave, and the Ivory Coasts (London: J. Knapton, 1705).
Speaker chimpanzee: Animalis rarioris, chimpanzee dicti, Nova Acta Eruditorum
8 (1739): 56465, an anonymous report attributed to Hubert Gravelot by G.
Barsanti, Les singes de Lamarck, in Ape, Man, Apeman: Changing Views since
1600: Evaluative Proceedings of the Symposium . . . Leiden, the Netherlands, 28
June1 July 1993, ed. Raymond Corbey and Bert Theunissen (Leiden: Dept. of
Prehistory, Leiden University, 1995).
Linnaeuss System of Nature: [Carl von Linne], Caroli Linni Systema naturae, sive,
Regna tria naturae systematice proposita per classes, ordines, genera, & species (Leiden: Apud Theodorum Haak, Ex typographia Joannis Wilhelmi de Groot, 1735);
10th rev. ed., Caroli Linni Systema natur per regna tria natur secundum classes,
ordines, genera, species, cum charateribus, differentiis, synonymis, locis (2 vols.,
Stockholm: Impensis L. Salvii, 175859). And see also Lisbet Koerner Linnaeus:
Nature and Nation (Cambridge, Mass.: Harvard University Press, 1999).
Thomas Pennant, Synopsis of Quadrupeds (Chester, Eng.: J. Monk, 1771).
Johann Friedrich Blumenbach: On the Natural Variety of Mankind, 3d ed. (1795),
in The Anthropological Treatises of Johann Friedrich Blumenbach, trans. and ed.
Thomas Bendyshe (London: Longman, Green, 1865).
George Gaylord Simpson, The Principles of Classication and a Classication of
Mammals. Bulletin of the American Museum of Natural History 85 (New York:
American Museum of Natural History, 1945).
Julian Huxley, Evolution, Cultural and Biological, Yearbook of Anthropology 0
(1955): 225. (This is formally listed as volume zero because the Yearbook of
Anthropology evolved into Current Anthropology shortly thereafter.)

290

notes and sources

On genes for ribosomal RNA, see I. L.Gonzalez, J. E. Sylvester, T. F. Smith, D.


Stambolian, and R. D. Schmickel, Ribosomal RNA Gene Sequences and Hominoid Phylogeny, Molecular Biology and Evolution 7 (1990): 20319.
In a single recent book on the great apes . . .: The Great Ape Project: Equality
beyond Humanity, ed. Paola Cavalieri and Peter Singer (1993; 1st U.S. ed., New
York: St. Martins Press, 1994).
On DNA cologne, see Jonathan Marks, Arrivaderci, Aroma: An Analysis of the
New DNA Cologne, in The Best of the Annals of Improbable Research, ed. Marc
Abraham (New York: W. H. Freeman 1998), 12122.
On the number of human chromosomes, see M. Kottler, From 48 to 46: Cytological Technique, Preconception, and the Counting of Human Chromosomes,
Bulletin of the History of Medicine 48 (1974): 465502.

ch a pt e r 2
On differences between human and chimpanzee proteins, see M.-C. King and A. C.
Wilson, Evolution at Two Levels in Humans and Chimpanzees, Science 188
(1975): 10716; W. J. Bailey, K. Hayasaka, C. G. Skinner, S. Kehoe, L. C. Sieu,
J. L. Slightom, and M. Goodman, Reexamination of the African Hominoid
Trichotomy with Additional Sequences from the Primate Beta-Globin Gene
Cluster, Molecular Phylogenetics and Evolution 1 (1992): 97135.
On differences in mitochondrial DNA among humans, chimpanzees, and gorillas,
see U. Arnason, X. Xu, and A. Gullberg, Comparison between the Complete
Mitochondrial DNA Sequences of Homo and the Common Chimpanzee Based
on Nonchimeric Sequences, Journal of Molecular Evolution 42 (1996): 14552.
On misrepresentation of the genetic similarity of humans to the apes by DNA
hybridization, see Jonathan Marks, Whats Old and New in Molecular Phylogenetics, American Journal of Physical Anthropology 85 (1991): 20719.
On the number of chimpanzee chromosomes, see W. J. Young, T. Merz, M. A.
Ferguson-Smith, and A. W. Johnston, Chromosome Number of the Chimpanzee, Pan troglodytes, Science 131 (1957): 167273.
On chromosome fusion in human lineage, see R. R. Stanyon, B. Chiarelli, and D.
Romagno, Origine del cromosoma n. 2 del cariotipo umano, Antropologia
contemporanea 6, 3 (1983): 22530.
On banded tips of chromosomes in chimpanzees and gorillas, see Jonathan Marks,
Hominoid Heterochromatin: Terminal C-bands as a Complex Genetic Character Linking Chimps and Gorillas, American Journal of Physical Anthropology
90 (1993): 23746.
On hypothesis of two kinds of genes, see A. C. Wilson, L. R. Maxson, and V. M.
Sarich, Two Types of Molecular Evolution: Evidence from Studies of Interspecic Hybridization, Proceedings of the National Academy of Sciences, USA 71
(1974): 284347.

notes and sources

291

Blood tests for studying the similarity of human and ape proteins are described in
G. H. F. Nuttall, Blood Immunity and Blood Relationship (Cambridge: Cambridge University Press, 1904). Nuttalls sister Zelia was an anthropologist who
did important archaeological work in Mexico and was inuential in the academic
professionalization of the eld. Small world, no?
L. M. Hussey, The Blood of the Primates, American Mercury 9 (1926): 31921.
On the similarity of hemoglobin in humans and gorillas, see Emile Zuckerkandl,
Perspectives in Molecular Anthropology, in Classication and Human Evolution, ed. S. L. Washburn (Chicago: Aldine, 1963), 24372.
George Gaylord Simpson comments on the difference between gorillas and humans
in Organisms and Molecules in Evolution, Science 146 (1964): 153538.
Richard Dawkins, Meet My Cousin, the Chimpanzee, New Scientist, June 5,
1993, 3638.
On proposed classication by descent only, see W. Hennig, Phylogenetic Systematics, Annual Review of Entomology 10 (1965): 97116; K. de Queiroz and
Jacques Gauthier, Phylogenetic Taxonomy, Annual Review of Ecology and Systematics 23 (1992): 44980.
On biblical dietary prohibitions, see Mary Douglas, Purity and Danger: An Analysis
of Concepts of Pollution and Taboo (New York: Praeger, 1966).
On Linnaeuss views on breast-feeding, see Londa L. Schiebinger, Natures Body:
Gender in the Making of Modern Science (Boston: Beacon Press, 1993).

ch a pte r 3
This chapter is based in part on Jonathan Marks, Science and Race, American
Behavioral Scientist 40 (1996): 12333, and a few other previously published essays.
On seventeenth-century perceptions of Gods plan in nature, see Ivan Hannaford,
Race: The History of an Idea in the West (Washington, D.C.: Woodrow Wilson
Center Press, 1996).
Francois Berniers essay was published anonymously in the Journal des Scavans,
April 24, 1684, and translated in Thomas Bendyshe, The History of Anthropology, Memoirs of the Anthropological Society of London 1 (1865): 335458; Flavius
Josephus, The Antiquities of the Jews, trans. William Whiston (n.p.), bk. 1, ch.
5.
The tension between the approaches of Buffon and Linnaeus to human variation
is discussed in Jonathan Marks, Human Biodiversity: Genes, Race, and History
(New York: Aldine de Gruyter, 1995).
Earnest Hootons views on race will be found in E. A. Hooton, Methods of Racial
Analysis, Science 63 (1926): 7581, and Plain Statements about Race, Science
83 (1936): 51113. And see also Hooton, Up from the Ape (New York: Macmillan,
1931).
Lancelot Hogben, Genetic Principles in Medicine and Social Science (New York:
Knopf, 1932).

292

notes and sources

On race based on ABO blood-type variants, see Jonathan Marks, The Legacy of
Serological Studies in American Physical Anthropology, History and Philosophy
of the Life Sciences 18 (1996): 34562.
For further discussion of the Manoilov blood test, see Jonathan Marks, Human
Biodiversity, and id., Blood Will Tell (Wont It?)? A Century of Molecular Discourse in Anthropological Systematics, American Journal of Physical Anthropology 94 (1994): 5979. Additional information is drawn from correspondence in
the archives of the American Philosophical Society.
Frederick Goodwin was quoted in all the newspapers in FebruaryMarch 1992.
The full statement, a very meaty text, is: If you look, for example, at male
monkeys, especially in the wild, roughly half of them survive to adulthood. The
other half die by violence. That is the natural way of it for males, to knock each
other off and, in fact, there are some interesting evolutionary implications of
that because the same hyperaggressive monkeys who kill each other are also
hypersexual, so they copulate more and therefore they reproduce more to offset
the fact that half of them are dying. Now, one could say that if some of the loss
of structure in this society, and particularly in the high impact inner city areas,
has removed some of the civilizing evolutionary things that we have built up
and that maybe it isnt just careless use of the word when people call certain
areas of certain cities jungles, that we may have gone back to what might be
more natural, without all of the social controls that we have imposed upon
ourselves as a civilization over thousands of years in our own evolution. See
P. R. Breggin, Campaigns against Racist Federal Programs by the Center for
the Study of Psychiatry and Psychology, Journal of African American Men 1
(199596): 322.
A 1996 book on apes and the origins of human violence : Richard Wrangham
and Dale Peterson, Demonic Males: Apes and the Origins of Human Violence
(Boston: Houghton Mifin, 1996). For comment, see L. Gould, Negro
Man, American Anthropologist 67 (1965): 128182. The paperback version of
Demonic Males toned down the illustration slightly by showing Adolph Schultzs
full rendering (human, gorilla, chimpanzee, orangutan) on the front, rather than
just the human and gorilla; a subsequent reprint of the paperback has a tasteful
abstract design instead.

ch a pt e r 4
This chapter incorporates some material from Jonathan Marks, The Limits of Our
Knowledge: Abilities, Responses, and Responsibilities, Anthropology Newsletter
36, 4 (1997): 72.
Carleton Coons correspondence is in the National Anthropological Archives at the
Smithsonian Institution. S. L. Washburn, The Study of Race, American Anthropologist 65 (1963): 52131; Ashley Montagu, What Is Remarkable about Varieties of Man Is Likenesses, Not Differences, Current Anthropology 4 (1963):
36164.

notes and sources

293

On Samuel Morton, see S. J. Gould, Mortons Ranking of Races by Cranial Capacity, Science 200 (1978): 5039; id., The Mismeasure of Man (New York: Norton, 1981); J. S. Michael, A New Look at Mortons Craniological Research,
Current Anthropology 29 (1988): 34854.
J. P. Rushton, Differences in Brain Size, Nature 358 (1992): 532; Colin Groves,
Genes, Genitals, and Genius: The Evolutionary Ecology of Race, in Human
Biology: An Integrative Science. Proceedings of the Fourth Conference of the Australasian Society for Human Biology, ed. P. OHiggins, 41932 (Perth: University of
Western Australia, Centre for Human Biology, 1990); L. Lieberman, How Caucasoids Got Such Big Crania and Why They Shrank: From Morton to Rushton, Current Anthropology 42 (2001): 6995.
R. C. Lewontin, The Apportionment of Human Diversity, Evolutionary Biology
6 (1972): 38198.
R. L. Cann, M. Stoneking, and A. C. Wilson, Mitochondrial DNA and Human
Evolution, Nature 325 (1987): 3136.
S. Tishkoff, E. Dietzsch, W. Speed, A. J. Pakstis, J. Kidd, K. Cheung, B. BonneTamir, A. Santachiara-Benerecetti, P. Moral, M. Krings et al., Global Patterns
of Linkage Disequilibrium at the CD4 Locus and Modern Human Origins,
Science 271 (1996): 138087.
Amos Deinard, The Evolutionary Genetics of the Chimpanzees (Ph.D. thesis,
Department of Anthropology, Yale University, 1997).
On studies of immigrant groups, see H. L. Shapiro, Migration and Environment
(New York: Oxford University Press, 1939); B. Kaplan, Environment and Human Plasticity, American Anthropologist 56 (1954): 78199.
On Neandertal mitochondrial DNA, see M. Krings, A. Stone, R. W. Schmitz, H.
Krainitzki, M. Stoneking, and S. Paabo, Neandertal DNA Sequences and the
Origin of Modern Humans, Cell 90 (1997): 1930; M. Krings, H. Geisert, R. W.
Schmitz, H. Krainitzki, and S. Paabo, DNA Sequence of the Mitochondrial
Hypervariable Region II from the Neandertal Type Specimen, Proceedings of
the National Academy of Sciences, USA 96 (1999): 558185; I. V. Ovchinnikov, A.
Gotherstrom, G. P. Romanova, V. M. Kharitonov, K. Liden, and W. Goodwin,
Molecular Analysis of Neanderthal DNA from the Northern Caucasus, Nature
404 (2000): 49093.
M. Nei and M. Roychoudhury, Evolutionary Relationships of Human Populations on a Global Scale, Molecular Biology and Evolution 10 (1993): 927
43.
On mutations in mitochondrial DNA, see C. Vila`, P. Savolainen, J. E. Maldonado,
I. R. Amorim, J. E. Rice, R. L. Honeycutt, K. A. Crandall, J. Lundeberg, and
R. K. Wayne, Multiple and Ancient Origins of the Domestic Dog, Science 276
(1996): 168789; T. J. Parsons, D. S. Muniec, K. Sullivan, N. Woodyatt, R.
Alliston-Greiner, M. Wilson, D. Berry, K. Holland, V. Weeden, P. Gill et al.,
A High Observed Substitution Rate in the Human Mitochondrial DNA Control Region, Nature Genetics 15 (1997): 36367.

294

notes and sources

On species status of Neandertals: J. H. Relethford, Ancient DNA and the Origin


of Modern Humans, Proceedings of the National Academy of Sciences, USA 98
(2001): 39091.

ch a pte r 5
This chapter is partly based on Jonathan Marks, Skepticism about Behavioral
Genetics, in Exploring Public Policy Issues in Genetics, ed. M. S. Frankel (Washington, D.C.: American Association for the Advancement of Science, 1997), 159
72.
Midcentury study of fruit ies: A. J. Bateman, Intra-sexual Selection in Drosophila, Heredity 2 (1948): 34968.
Can Social Behavior of Man be Glimpsed in a Lowly Worm? New York Times,
September 8, 1998; Jonathan Marks, Science Wars Revisited, Anthropology
Newsletter, November 1998, 5.
On Lesch-Nyhan syndrome: T. Beardsley, Crime and Punishment, Scientic
American, December 1995, 22.
On MAOA: H. G. Brunner, M. Nelen, X. O. Breakeeld, H. H. Ropers, and B. A.
van Oost, Abnormal Behavior Associated with a Point Mutation in the Structural Gene for Monoamine Oxidase A, Science 262 (1993): 57880; V. Morell,
Evidence Found for a Possible aggression gene, Science 260 (1993): 172223.
H. G. Brunner, MAOA Deciency and Abnormal Behaviour: Perspectives on
an Association, in Genetics of Criminal and Antisocial Behaviour, Ciba Foundation Symposium 194 (New York: Wiley, 1995), 15567.
E. O. Wilson, Consilience: The Unity of Knowledge (New York: Knopf, 1998).
Richard J. Herrnstein and Charles Murray, The Bell Curve: Intelligence and Class
Structure in American Life (New York: Free Press, 1994).
On left-handedness, see Robert Hertz, Death and the Right Hand, trans. Rodney
and Claudia Needham, with an introduction by E. E. Evans-Pritchard (Glencoe,
Ill.: Free Press, 1960).
In a chart listing behaviors . . .: R. Plomin, Michael J. Owen, and Peter McGufn, The Genetic Basis of Complex Behaviors, Science 264 (1994): 173339.
Genes Are Tied to Homosexuality and Schizophrenia: N. Angier, Gene Hunters
Pursue Elusive and Complex Traits of Mind, New York Times, October 31, 1995.
On homosexuality: S. Levay, A Difference in Hypothalamic Structure between
Heterosexual and Homosexual Men, Science 253 (1991): 103437; N. Angier,
Zone of Mens Brain Linked to Sexual Orientation, New York Times, August
30, 1991, A1; D. Gelman, D. Foote, T. Barrett, and M. Talbot, Born or Bred?
Newsweek, February 24, 1992, 4653; W. Byne and Bruce Parsons, Human
Sexual Orientation: The Biologic Theories Reappraised, Archives of General
Psychology 50 (March 1993): 22838; D. Hamer, S. Hu, V. L. Magnuson, N. Hu,
and A. M. L. Pattatucci, A Linkage between DNA Markers on the X Chromosome and Male Sexual Orientation, Science 261 (1993): 32127; N. Risch, E.

notes and sources

295

Squires-Wheeler, and B. Keats, Male Sexual Orientation and Genetic Evidence, Science 262 (1993): 206365.
On eugenics: Madison Grant, The Passing of the Great Race (New York: Scribners,
1916); F. A. Woods, review of id., Science 48, 1243 (1918): 41920; Stefan Kuhl,
The Nazi Connection: Eugenics, American Racism, and German National Socialism
(New York: Oxford University Press, 1994); C. B. Davenport, Heredity in Relation to Eugenics (New York: Holt, 1911); E. W. Sinnott, and L. C. Dunn, Principles of Genetics (New York: McGraw-Hill, 1925).
On crime: E. A. Hooton, The American Criminal: An Anthropological Study, vol. 1:
The Native White Criminal of Native Parentage (Cambridge, Mass.: Harvard
University Press, 1939); id., Crime and the Man (New York: Macmillan, 1940);
R. K. Merton and M. F. Ashley-Montagu, Crime and the Anthropologist,
American Anthropologist 42 (1940): 384408; P. A. Jacobs, M. Brunton, M. M.
Melville, R. P. Brittain, and W. F. McClemont, Aggressive Behaviour, Mental
Sub-normality, and the XYY Male, Nature 208 (1965): 135152; B. Glass, Science: Endless Horizons or Golden Age? Science 171 (1971): 2329; E. B. Hook,
Behavioral Implications of the Human XYY Genotype, Science 179 (1973): 139
50; H. A. Witkin, S. A. Mednick, F. Schulsinger, E. Bakkestrom, K. O. Christiansen, D. R. Goodenough, K. Hirschhorn, C. Lundsteen, D. R. Owen, J.
Philip, D. R. Rubin, and M. Stocking, Criminality in XYY and XXY Men,
Science 193 (1976): 54755; Patricia A. Jacobs, The William Allan Memorial
Award Address: Human Population CytogeneticsThe First Twenty-ve
Years, American Journal of Human Genetics 34 (1982): 68998; G. Allen, The
Biological Basis of Crime: An Historical and Methodological Study, Historical
Studies in the Physical and Biological Sciences 31 (2001): 183222.
J. Q. Wilson and R. J. Herrnstein, Crime and Human Nature (New York: Simon
& Schuster, 1985).
E. A. Hooton, Up from the Ape (New York: Macmillan, 1931), 491.

ch a pt e r 6
This chapter is partly based on Jonathan Marks, review of Taboo: Why Black Athletes
Dominate Sports and Why We Are Afraid to Talk About It, by Jon Entine (New
York: PublicAffairs, 2000), Human Biology 72 (2000): 107478, and Folk
Heredity, in Race and Intelligence: Separating Science from Myth, ed. J. Fish (New
York: Lawrence Erlbaum, 2001).
On taxonomism: W. C. Boyd, Genetics and the Human Race, Science 140 (1963):
105765; A. M. Bowcock, J. R. Kidd, J. L. Mountain, J. M. Hebert, L. Carotenuto, K. K. Kidd, and L. L. Cavalli-Sforza, Drift, Admixture, and Selection in
Human Evolution: A Study with DNA Polymorphisms, Proceedings of the National Academy of Sciences, USA 88 (1991): 83943; L. Cavalli-Sforza, The Genetics of Human Populations, Scientic American 231, 3 (1974): 8189; M. Nei
and A. Roychoudhury, Genic Variation within and between the Three Major

296

notes and sources

Races of Man, Caucasoids, Negroids, and Mongoloids, American Journal of


Human Genetics 26 (1974): 42143; D. M. Schneider, American Kinship, 2d ed.
(Chicago: University of Chicago Press, 1980).
On racism: Jared M. Diamond, The Third Chimpanzee: The Evolution and Future
of the Human Animal (New York: HarperCollins, 1992); Entine, Taboo; John M.
Hoberman, Darwins Athletes: How Sport Has Damaged Black America and Preserved the Myth of Race (Boston: Houghton Mifin, 1997).
On hereditarianism: James Watson is quoted in L. Jaroff, The Gene Hunt, Time,
March 20, 1989, 6267. More recently, Watson caused a row at a genetics lecture
in Berkeley on October 12, 2000, when he associated skin color and hair density
with sexual appetite and body build with personality. See Tom Abate, Nobel
Winners Theories Raise Uproar in Berkeley: Geneticists Views Strike Many as
Racist, Sexist, San Francisco Chronicle, November 13, 2000. Other references
for this section: D. E. Koshland, Jr., Frontiers in Neuroscience, Science 262
(1993): 635; Lawrence Wright, Twins: And What They Tell Us About Who We Are
(New York: Wiley, 1997); S. Begley, All about Twins, Newsweek, November
23, 1987, 5869; Constance Holden, Identical Twins Reared Apart, Science 207
(March 21, 1980): 132327.
On essentialism: D. Singh, Body Shape and Womens Attractiveness: The Critical
Role of Waist-to-Hip Ratio, Human Nature 4 (1993): 297321; D. W. Yu and
G. H. Shepard, Is Beauty in the Eye of the Beholder? Nature 326 (1998): 391
92; David Buss, The Evolution of Desire (New York: Basic Books, 1994); M.
Small, Are We Losers? Putting a Mating Theory to the Test, New York Times,
March 30, 1999.
H. E. Fisher, The Anatomy of Love (New York: Norton, 1992); Alice Eagly, The
Science and Politics of Comparing Men and Women, American Psychologist 50
(1995): 14558).
F. B. M. de Waal, The End of Nature versus Nurture, Scientic American 281, 6
(1999): 9499.

ch a pt e r 7
This chapter draws on Jonathan Marks, review of Demonic Males: Apes and the
Origins of Human Violence, by Richard Wrangham and Dale Peterson (Boston:
Houghton Mifin, 1996), Human Biology 70 (1998): 14346.
S. Sperling, Baboons with Briefcases: Feminism, Functionalism, and Sociobiology
in the Evolution of Primate Gender, Signs 17 (1991): 127.
Jane Goodall, In the Shadow of Man (Boston: Houghton Mifin, 1971); id., The
Chimpanzees of Gombe: Patterns of Behavior (Cambridge, Mass.: Harvard University Press, 1986); id., Through a Window: My Thirty Years with the Chimpanzees
of Gombe (Boston: Houghton Mifin, 1990); Dale Peterson and Jane Goodall,
Visions of Caliban: On Chimpanzees and People (Boston: Houghton Mifin,
1993).

notes and sources

297

Man the Hunter, ed. Richard B. Lee and Irven DeVore (Chicago: Aldine, 1969);
R. B. Lee, Art, Science, or Politics? The Crisis in Hunter-Gatherer Studies,
American Anthropologist 94 (1992): 3154.
Patrick Tierney, Darkness in El Dorado: How Scientists and Journalists Devastated
the Amazon (New York: Norton, 2000).
F. B. M. de Waal, Good Natured: The Origins of Right and Wrong in Humans and
Other Animals (Cambridge, Mass.: Harvard University Press, 1996).
Craig Stanford, The Hunting Apes: Meat Eating and the Origins of Human Behavior
(Princeton: Princeton University Press, 1999).

ch a pt e r 8
This chapter draws on Jonathan Marks, review of The Great Ape Project: Equality
beyond Humanity, ed. Paola Cavalieri and Peter Singer (1993; 1st U.S. ed., New
York: St. Martins Press, 1994), Human Biology 66 (1994): 111317, and on some
brief essays by the author in Anthropology Newsletter.
Franz Boas, The Mind of Primitive Man, rev. ed. (New York: Macmillan, 1938).
Joel Wallman, Aping Language (New York: Cambridge University Press, 1992).
A. Whiten, J. Goodall, W. C. McGrew, T. Nishida, V. Reynolds, Y. Sugiyama,
C. E. G. Tutin, R. W. Wrangham, and C. Boesch, Cultures in Chimpanzees,
Nature 399 (1999): 68285.
A. Whiten and C. Boesch, The Cultures of Chimpanzees, Scientic American,
January 2001, 6167.
Chimpanzees with Culture (editorial), New York Times, July 7, 1999.
B. Meggers, Mate Copying and Cultural Inheritance, Trends in Ecology and Evolution 13 (1998): 240.
R. Tuttle, On Culture and Traditional Chimpanzees, Current Anthropology 42
(2001): 4078.
The Great Ape Project: Equality beyond Humanity, ed. Paola Cavalieri and Peter
Singer (London: Fourth Estate, 1993).
Daniel Povinelli, Folk Physics for Apes: The Chimpanzees Theory of How the World
Works (New York: Oxford University Press, 2000).
Section 85 of the Animal Welfare Act passed by the New Zealand Parliament in
1999 places restrictions on [the] use of non-human hominids. Its target specically is scientic research (which comprises a minuscule proportion of the
problems affecting and threatening the apes). Although supporters of ape rights
hailed it as a victory (for example, in the New York Times, August 12, 2001), it
does not use the words rights or apes. In fact, the phrase non-human hominids would seem to allow a loophole to any researcher who cared to use the
traditional classication, which restricts hominids to humans, and calls the
apes pongids. At face value, the law might be seen simply as placing limits on
experimentation upon australopithecines.

298

notes and sources

ch a pt e r 9
J. Walsh and J. Marks, Sequencing the Human Genome, Nature 322 (1986): 590.
L. L. Cavalli-Sforza and A. W. F. Edwards, Analysis of Human Evolution, in
Genetics Today: Proceedings of the XI International Congress of Genetics, ed. S. J.
Geerts (Oxford: Pergamon, 1965), 92333; M. Nei and A. Roychoudhury, Genic
Variation within and between the Three Major Races of Man, Caucasoids, Negroids, and Mongoloids, American Journal of Human Genetics 26 (1974): 421
43.
Cavalli-Sforza was prepared to acknowledge . . . mistaken: L. L. Cavalli-Sforza,
A, Piazza, P. Menozzi, and J. Mountain, Reconstruction of Human Evolution:
Bringing Together Genetic, Archaeological, and Linguistic Data, Proceedings of
the National Academy of Sciences, USA 85 (1988): 60026.
The Human Genome Diversity Project: L. L. Cavalli-Sforza, A. C. Wilson, C. R.
Cantor, R. M. Cook-Deegan, and M.-C. King, Call for a Worldwide Survey
of Human Genetic Diversity: A Vanishing Opportunity for the Human Genome
Project, Genomics 11 (1991): 49091; L. Roberts, A Genetic Survey of Vanishing
Peoples, Science 252 (1991): 161417; J. M. Diamond, A Way to World Knowledge, Nature 352 (1991): 567; L. Roberts, Genetic Survey Gains Momentum,
Science 254 (1991): 517; id., Genome Diversity Project: Anthropologists Climb
(Gingerly) On Board, Science 258 (1992): 13001301.
Criticism of the HGDP: Jonathan Marks, The Human Genome Diversity Project:
Good For if Not Good As Anthropology? Anthropology Newsletter 36 (April
1995): 72; J. C. Gutin, End of the Rainbow, Discover, November 1994, 7075;
S. Subramanian, The Story in Our Genes, Time, January 16, 1995, 5455; A. M.
Bowcock, J. R. Kidd, J. L Mountain, J. M. Hebert, L. Carotenuto, K. K. Kidd,
and L. L. Cavalli-Sforza, Drift, Admixture, and Selection in Human Evolution:
A Study with DNA Polymorphisms, Proceedings of the National Academy of
Sciences, USA 88 (1991): 83943; G. Taubes, Scientists Attacked for patenting
Pacic Tribe, Science 270 (1995): 1112. And see also Carleton S. Coon, The Story
of Man (New York: Knopf, 1954); M. F. A. Montagu, The Concept of Race in
the Human Species in the Light of Genetics, Journal of Heredity 32 (1941): 243
47.
National Research Council, Evaluating Human Genetic Diversity (Washington,
D.C.: National Academy Press, 1997); E. Pennisi, NRC OKs Long-Delayed
Survey of Human Genome Diversity, Science 278 (1997): 568; V. Dominguez,
Misleading News Coverage Concerning HGDP, Anthropology Newsletter, January 1998, 18; E. Marshall, DNA Studies Challenge the Meaning of Race,
Science 282 (1998): 65455.
On going beyond microphylogenetic issues, see, e.g., L. G. Carvajal-Carmona,
I. D. Soto, N. Pineda, B. Ortiz, C. Daniel, C. Duque, J. Ospina-Duque, M.
McCarthy, P. Montoya, V. M. Alvarez, G. Bedoya et al., Strong Amerind/White
Sex Bias and a Possible Sephardic Contribution among the Founders of a Pop-

notes and sources

299

ulation in Northwest Colombia, American Journal of Human Genetics 67


(2000): 128795. This paper shows that a population with a known history from
Colombia has 94 percent European Y chromosomes, 90 percent Native American mitochondrial DNA, and 70 percent European blood-group markers.
Clearly any statements about the relationships among contemporary populations
with other histories will depend mightily upon what particular genes are being
compared!

ch a pte r 10
On the subjects discussed in this chapter, see also Jonathan Marks, Racism, Eugenics, and the Burdens of History, Yale Journal of Ethics 5 (1996): 1215, 40
42.
The experimental hybridization of human and ape has been seriously proposed in
the scientic literature, for example, by biologist Charles Remington, in Experimentation with Human Beings: The Authority of the Investigator, Subject, Professions, and State in the Human Experimentation Process, ed. Jay Katz (New York:
Russell Sage Foundation, 1972), 46164.
Paul R. Ehrlich, Human Natures: Genes, Cultures, and the Human Prospect (Washington, D.C.: Island Press for Shearwater Books, 2000).
D. W. Brock, Cloning Human Beings: An Assessment of the Ethical Issues Pro
and Con, in Clones and Clones: Facts and Fantasies about Human Cloning, ed.
M. C. Nussbaum and C. R. Sunstein (New York: Norton, 1998), 14164.
On the Native American Grave Protection and Repatriation Act and Kennewick
Man, see also David Hurst Thomas, Skull Wars: Kennewick Man, Archaeology,
and the Battle for Native American Identity (New York: Basic Books, 2000).
For James Chatterss side of the story, see J. C. Chatters, Encounter with an Ancestor, Anthropology Newsletter, January 1997, 910; id., Response from Chatters, ibid., May 1997, 6.
There is no primary scientic literature on the subject of the Kennewick Man.
Reports include T. Egan, Tribe Stops Study of Bones That Challenge History,
New York Times, September 30, 1996; Douglas Preston, The Lost Man, New
Yorker, June 16, 1997, 7078, 8081; C. W. Petit, Redisovering America, U.S.
News & World Report, October 12, 1998, 5664; N. Charles and J. Hannah,
Head Case: Archaeologist James Chatters Speaks for Science in a Fight over
the Fate of a 9,000 Year-Old Skeleton, People, November 30, 1998, 18182.
Both the Seattle Times and the Tri-City Herald have on-line archives. See esp.
John Stang, Skull Found on Shore of Columbia, Tri-City Herald, July 29,
1996; Mike Lee, Tri-Citians Sculpt Theoretical Look for Kennewick Man,
ibid., Feb 10, 1998, and Missing Ancient Bones Discovered, ibid, June 22,
2001.

300

notes and sources

ch a pte r 11
K. Skorecki, S. Selig, S. Blazer, R. Bradman, N. W. P. J. Bradman, M. Ismajlowiscz,
and M. Hammer, Y Chromosomes of Jewish Priests, Nature 385 (1997): 32; D.
Grady, Finding Genetic Traces of Jewish Priesthood, New York Times, January
7, 1997.
V. A. McKusick, R. Eldridge, R. A. Hostetler, and J. A. Egeland, Dwarsm in the
Amish, Transactions of the Association of American Physicians 77 (1964): 15168.
M. G. Thomas, K. Skorecki, H. Ben-Ami, T. Partt, N. Bradman, and D. Goldstein, Origins of Old Testament Priests, Nature 394 (1998): 13839.
The only other study associating surnames and Y-chromosomes looked at fortyeight men named Sykes in three English counties, without knowing how many,
if any, were known relatives. Half of them were found to have the same Ychromosome, which the researchers assumed derived from an original Sykes in
late medieval times. The other Sykeses in the group were attributed either to
false paternity or to adoption over the centuries. See B. Sykes and C. Irven,
Surnames and the Y Chromosome, American Journal of Human Genetics 66
(2000): 141719.
Methodological problems with the Cohanim study are detailed in A. ZoossmannDiskin, Are Todays Jewish Priests Descended from the Old Ones? Homo 51
(2000): 15662.
On Jewish genetic data invested with religious authority, see D. Grady, Who Is
Aarons Heir? Father Doesnt Always Know Best, New York Times, January 19,
1997; P. Herschberg, Decoding the Priesthood, Jerusalem Report, May 10, 1999,
3035.
D. M. Schneider, American Kinship: A Cultural Account, 2d ed. (Englewood Cliffs,
N.J.: Prentice-Hall, 1980). See also K. Finkler, The Kin in the Gene, Current
Anthropology 42 (2001): 23563.
M. G. Thomas, T. Partt, D. A. Weiss, K. Skorecki, J. Wilson, M. le Roux, N.
Bradman, and D. Goldstein, Y Chromosomes Traveling South: The Cohen
Modal Haplotype and the Origins of the Lembathe Black Jews of Southern
Africa, American Journal of Human Genetics 66 (2000): 67486.
On creationism, see Ronald L. Numbers, The Creationists (1992; Berkeley and Los
Angeles: University of California Press, 1993); Phillip E. Johnson, Darwin on
Trial (Washington, D.C.: Regnery Gateway, 1991). Quotations taken from Phillip E. Johnson, Objections Sustained: Subversive Essays on Evolution, Law, and
Culture (Downers Grove, Ill.: InterVarsity Press, 1998), 20. See also B. Appleyard, You Asked for It, New Scientist, April 22, 2000.
On social Darwinism, see Peter J. Bowler, Social Metaphors in Evolutionary Biology, 18701930: The Wider Dimension of Social Darwinism, in Biology as
Society, Society as Biology: Metaphors, ed. Sabine Maasen, Everett Mendelsohn,
and Peter Weingart (Boston: Kluwer Academic Publishers, 1995), 10726.
M. Goodman, Epilogue: A Personal Account of the Origins of a New Paradigm,
Molecular Phylogenetics and Evolution 5 (1996): 26985; V. M. Sarich, The Or-

notes and sources

301

igin of the Hominids: An Immunological Approach, in Perspectives on Human


Evolution, vol. 1, ed. S. L. Washburn and P. C. Jay (New York: Holt, Rinehart
& Winston, 1968), 94121.
On the Human Genome Evolution Project, see A. Gibbons, Which of Our Genes
Make Us Human? Science 281 (1998): 143244; E. McConkey and A. Varki, A
Primate Genome Project Deserves High Priority, ibid., 289 (2000): 1295.

ch a pte r 12
This chapter is partially based on Jonathan Marks, The Anthropology of Science,
Part I: Science as a Humanities and The Anthropology of Science, Part II:
Scientic Norms and Behaviors, Evolutionary Anthropology 5 (1996): 610, 75
80. Extensive references can be found there.
I. Parker, Richard Dawkinss Evolution: An Irascible Don Becomes a Surprising
Celebrity, New Yorker, September 9, 1996; Richard Dawkins, River Out of Eden:
A Darwinian View of Life (New York: Basic Books, 1995).
Alan Sokal and Jean Bricmont, Fashionable Nonsense: Postmodern Intellectuals Abuse
of Science (New York: Picador USA, 1998).
Clarence Darrow, The Eugenics Cult, American Mercury 8 (1926): 12937.
One molecular geneticist writes . . . : S. J. Jones in The Cambridge Encyclopedia
of Human Evolution (New York: Cambridge University Press, 1992), 442.
N. Wade, Genetic Code of Human Life Is Cracked by Scientists, New York Times,
June 27, 2000.
E. Gosney and P. Popenoe, Sterilization for Human Betterment (New York: Macmillan, 1929).
Mary Midgley, Science as Salvation (New York: Routledge, 1992).
E. O. Wilson, Consilience: The Unity of Knowledge (New York: Knopf, 1998).
Charles Davenport, Heredity in Relation to Eugenics (New York: Holt, 1911).
Erwin Schrodinger, What Is Life? (Cambridge: Cambridge University Press, 1944).
Richard Dawkins, River Out of Eden: A Darwinian View of Life (New York: Basic
Books, 1995), 13233.
Jose Ortega y Gasset, The Revolt of the Masses (New York: Norton, 1932).
As one commentator has noted: Bernard Dixon, What Is Science For? (London:
Penguin Books, 1973), 68.
Ashley Montagu to Theodosius Dobzhansky: quoted from Susan Sperlings obituary of Montagu in the American Anthropologist (2000).

302

notes and sources

index

Page numbers appearing in italics refer to illustrations.


anthropology, 2, 206
anthropomorphism, 103
anti-intellectualism, 285
Antiquities of the Jews ( Josephus), 53
54
apes: conservation of, 18889; DNA
across, 34; as endangered, 185, 186; evolution of, 9; genetic diversity among, 86
87; as models for human nature, 16061;
and primates hands/feet, 2122; species
of, 89; stereotypes of, 6971, 70, 293.
See also apes, human rights for; chimpanzees; humanape genetic similarity
apes, human rights for, 18097; apes as
disabled people, 18993; and the Bangkok Six, 19395; and culture, 18185;
The Great Ape Project, 56, 18589;
and human rights violations, 19294;
legislation on, 19697, 298; and mental
capacities of apes, 19596; and populations of humans vs. apes, 19495; and
responsibility, 192
Arendt, Hannah, 18687
Aristotle, 49

Aaron (Mosess brother), 245, 24647


abilities, 9195. See also potentials /abilities
achondroplasia, 106, 264
Aesop, 103
Africans: genetic diversity among, 8384,
245; as paraphyletic, 84, 134; as a race,
5253, 54, 6667, 13133
aggression, 105, 1078, 124; in males, 159
60, 16263, 17274. See also violence
AIDS, 265
alcoholism studies, 21617
alienness/otherness, 14142
Allen, Woody: Sleeper, 223
altruism, 250
American Mercury, 42
Americas, discovery of, 166
Amerindians. See Native Americans
Amish people (Pennsylvania), 247
anatomy vs. genetics, 2329, 31, 200
Ancient Hunters (Sollas), 260
animal rights movement, 185, 18889. See
also apes, human rights for
Annals of Improbable Research (Harvard),
30

303

Army Corps of Engineers, 229, 230, 232,


234
Arunta people (Australia), 169
Asians, 53, 54, 64, 6667, 13132
Australian aborigines, 169, 179, 240
Babbitt, Bruce, 253
baboons, 11, 2425, 16163
Bacon, Francis, 254, 27273
Bangkok Six, 19395
Basques, 133
Bateman, A. J., 102
Bateson, William, 128
Battell, Andrew, 1314
behavioral genetics, 5, 100127; characteristics (phenotypes) vs. hereditary states
(genotypes), 100101, 15758; on crime,
12226; cultural bases of, 11213, 119,
127 (see also folk heredity); and diseases,
gene mapping for, 1056; and fruit ies,
1012; and homology, 104; of homosexuality, 11017, 125, 15657; human behaviorial variation, scope of, 11719;
and maleness, 12324; molecular anthropological perspective on, 12227; on
morality, 12021; naturevs.nurture debate, 100, 10810, 158; responsibility/
pronouncements of human genetics, 119
22, 157; studying human behavior, 105
8; of worms vs. humans, 1034
The Bell Curve (Herrnstein and Murray):
and Cavalli-Sforzas History and Geography of Human Genes, 210; on cognitive
ability, 9192; genetic data lacking in,
14344; on IQ/social status as innate,
1089, 130, 146, 180; racist work cited
in, 150; reception of, 5, 130; on social
programs, 9192, 1089
Benedict, Ruth, 74
Bible, 24647, 25455
Bijan, 30
bioethics, 2089, 21214, 215
biological systematics, 1920
birds and reptiles, 4445
blacks, athletic superiority of, 80, 14346
blood, 24265; and apehuman genetic
similarity, signicance of, 26163; and

304

index

biogenetic substance, 24951; and creationism, 25561; essentializing of, 243


44, 24549; and genes, shared proportion of, 250; and genetic similarity
among people with similar surnames,
24548, 301; and genetic tests for race,
24445; as heredity, 24344, 251; and
humanchimpanzee kinship, as
threatening to religion, 25455, 257; and
the Human Genome Evolution Project,
26365; and Kennewick Man, 25153; as
a metaphor/symbol, 4344, 127, 24243,
249; and relatives/kinship, 243, 24951
blood tests for race, 6365, 81, 12627
Blumenbach, Friedrich, 21, 61, 65
Boas, Franz: anthropological school of, 73,
74; attitude toward science, 276; on
culture, 18182; on Grants Passing of the
Great Race, 120; on skull size/shape, 90
91, 177; on technology, 272
Bodmer, Sir Walter, 200
Bonnichsen, Robson, 232, 233
bonobos, 8, 11011, 174, 175
Bosman, Willem, 1718
Bouchard, Thomas, 14951
Boyd, William C., 13233
The Boys from Brazil (Levin), 223
Brace, Loring, 232
Bricmont, Jean, 268
Brinton, Daniel Garrison, 236
Brunner, Han, 1078
Bryan, William Jennings, 257, 25859, 261
Buck v. Bell, 120
Buffon, Georges-Louis Leclerc, comte de,
5961, 65, 68, 70
Burt, Sir Cyril, 114
Buss, David, 155
Cann, Rebecca, 83
Cantor, Charles, 202
Cavalieri, Paola: The Great Ape Project,
186, 189
Cavalli-Sforza, Luca, 13435, 199200, 201
2, 207; The History and Geography of
Human Genes, 20910, 211
Cave Allegory (Plato), 58
C-banding, 39, 39

cell lines, patents on, 21214


Chang and Eng (Siamese Twins), 224
Chatters, James, 22829, 230, 232, 23436
chimpanzee, as a racial insult, 6971, 71,
293
chimpanzee-human hybrids, 21921
chimpanzees: aggression in, 15960, 172
73; in captivity, 185; culture attributed
to, 181, 182, 18485; evolution of, 910;
Goodalls Gombe studies of, 16365;
humans evolutionary divergence from,
11; humans shared ancestry with, as
threatening to religion, 25455, 257; humans similarities to, 78, 245 (see also
humanape genetic similarity); language
attributed to, 18284; as model for evolution of human behavior, 16365; as
model for natural man, 17275, 176;
plenitude/range of, 8; sexuality in, 110,
188; Ta and Mahale studies of, 165;
tools used by, 22, 182
Christianity, 140
chromosomes: function and structure of,
3639, 3839; vs. genes, 36; number of,
in humans, 3031, 37
citizenship and equal rights, 18687
civilization, 7677, 181, 260
civil rights movement, 75
classication: Buffon on, 5961; cultural
bases of, 4850, 68 (see also folk
heredity); Hebrew, of animals, 4647;
by kinship, 4748; Linnaean, 1920, 46,
5961, 68 (see also Systema naturae); by
race (see race)
Clinton, Bill, 271
cloning, 22325
coelacanths, 45
cognitive ability, 9192
Cohanim, Y chromosomes of, 24546, 247
49, 251
coincidences, 150
Collins, Francis, 271
Columbia University Medical School, 74
Cook, Captain James, 56
Cook-Deegan, Robert, 202
Coon, Carleton Stevens, 75, 208, 209; The
Origin of Races, 7677

creationism, 19192, 25561, 28081, 285


86
crime, 12226, 139
cultural diversity, 8788
cultural relativism, 227, 27274
culture, 72; and apes rights, 18185; denition of, 18182; traits of, 8889
cytogenetics, 37
daffodils, 2829
Darkness in El Dorado (Tierney), 287
Darrow, Clarence, 25859, 269, 277
Darwin, Charles, 59, 104, 130, 269, 276;
The Descent of Man, 261
Darwinism, 222, 236, 254. See also evolution
Davenport, Charles, 65, 120, 121, 148, 268
69, 270, 277
Dawkins, Richard, 44, 186, 266, 28283
Deinard, Amos, 8687
demonism. See aggression
Depression, 269
descent and identity. See identity and descent; Kennewick Man
The Descent of Man (Darwin), 261
de Waal, Frans, 158, 174
Diamond, Jared, 177, 178, 186, 204
Discourse on the Origin of Inequality
(Rousseau), 168
diseases, gene mapping for, 41, 1056
DNA: across apes, 34; and C-banding, 39,
39; and chromosomal function/structure, 3639, 3839; and diseases, mapping for, 41, 1056; and genes, vs. chromosomes, 36; and genes coded for
biochemical minutiae vs. bodies, 41;
genic vs. nongenic, 33; hybridization of,
3435; as measure of genetic similarity,
10, 23, 2429, 3233; mitochondrial, 33
34, 83, 8586, 99; mutations to, 3233,
34, 99; Neandertal, 9697, 9899; nuclear, 8487; percentages of genetic similarity, interpreting, 2931, 3436; proteins in, 3233; recombination of, 8485;
and RNA, 129; XYY research, 12325
Dobzhansky, Theodosius, 75, 81, 28788;
Genetics and the Origin of Species, 74

index

305

Dolly (cloned sheep), 223


Doyle, Sir Arthur Conan, 89
Durkheim, Emile, 276; The Elementary
Forms of the Religious Life, 169
dwarsm, 106
Eagly, Alice, 156
Ehrlich, Paul, 224
The Elementary Forms of the Religious Life
(Durkheim), 169
Ellisvan Creveld Syndrome, 247
Enlightenment, 18687
ESP, 15152
essentialism, 58, 112, 15357, 24344, 245
49. See also human nature
eugenics, 120, 12425, 26871, 277
Europeans, as a race, 52, 53, 54, 55, 67, 131
32
evolution: vs. creationism, 19192, 25556;
Darwinian theory of, 222, 236, 254; descent, patterns of, 5859; macromutational view of, 264; and meaninglessness of life, 281; political interpretations
of (see social Darwinism); social concerns not addressed by, 280; Victorian
views of, 18990
evolutionary psychology, 15354
Exodus, 24647
Falk, K. George, 65
family, 13536. See also kinship
Feldman, Marcus, 210
Fischer, Eugen, 270
Fison, Lorimer, 169
folk heredity, 12831, 14658; essentialism,
15357; and genetics, 129, 13031;
hereditarianism, 14653; heredity vs. inheritance, 12930; Law of Independent
Assortment, 129; Law of Segregation,
12829; racism, 13946; and responsibility, 15758; social Darwinism, 13031,
25961; taxonomism, 13138
folk knowledge vs. science, 2, 5, 93
French Revolution, 277
Freud, Sigmund, 276
Friedlaender, Jonathan, 207
fruit ies, 28, 1012

306

index

Galileo, 52
genes vs. chromosomes, 36
genetics: vs. anatomy, 2329, 31, 200; credibility of, 147; human variation, as
based on, 8891; race, as based on, 81
82 (see also race); and racism/xenophobia, 2; as social panacea, 28586. See
also behavioral genetics; DNA; folk
heredity; humanape genetic similarity;
molecular anthropology
Genetics and the Origin of Species (Dobzhansky), 74
genocide, 14143
Genomics, 2034
genotypes vs. phenotypes, 100101, 157
58
gibbons, 8
Gill, George, 232
Gillen, F. J., 169
Gish, Duane, 256
Glass, Bentley, 124
Gods bounty vs. parsimony, 52
Goodall, Jane, 22, 16364, 192
Goodman, Morris, 10, 26162
Goodwin, Frederick, 70, 293
gorillas, 8, 910, 1415, 4243
Gould, Stephen Jay, 79
Grant, Madison: The Passing of the Great
Race, 11920, 26869
The Great Ape Project, 56, 18589
The Great Ape Project (Cavalieri and
Singer), 186, 189
great chain of being, 69
Great Genome Diversity Project, 56
Greely, Henry, 207
Groves, Colin, 7980
Guinier, Lani, 69
Gypsies, 140

Hagahai people (New Guinea), 21213


Hamer, Dean, 11517, 125
Harry, Debra, 22223
Haynes, Vance, 232
head size/shape, 7880, 8991, 177
Hebrew classication of animals, 4647
hereditarianism, 14653

heredity: blood as, 24344, 251; cultural


ideas about (see folk heredity); scientic
study of (see genetics)
heritability, 14647
Herodotus, 52, 166
Herrnstein, Richard, 74, 125, 149. See also
The Bell Curve
HGDP. See Human Genome Diversity
Project
The History and Geography of Human
Genes (Cavalli-Sforza), 20910, 211
Hitler, Adolf, 224, 26869, 270
Hobbes, Thomas: Leviathan, 16667, 173,
176, 179
Hoberman, John, 145
Hogben, Lancelot, 6263
Holden, Constance, 15253
Holocaust, 142
Homo erectus, 179
homology, 104
Homo sapiens monstrosus, 56
homosexuality, 11017, 125, 15657, 175
Hooton, Earnest: background of, 6162;
on blood test for race, 6365, 12627;
on criminals, 123; on primary vs. secondary races, 62; on skull form as determiner of race, 23637; and Washburn, 73, 7475
Howitt, A. L., 169
Hrdlicka, Ales, 61
Hulse, Frederick, 91
humanape genetic similarity, 1331; chromosomal, 3739, 3839, 245; and classication as a cultural act, 4850; genetics
vs. anatomy, 2329, 31; in hemoglobin,
33, 4244; historical/mythological accounts of, 1319, 16, 18; implications of,
4, 4142; Linnaeus on, 21; meaning of,
5, 26163; and molecular anthropology,
central fallacy of, 4148; and phylogenetic relatives, 4448, 46; vs. visible differences, 4041. See also DNA
human-chimpanzee hybrids, 21921
Human Genome Diversity Project
(HGDP), 199218; and alcoholism
studies, 21617; and bioethics, 2089,
21214, 215; biomedical benets of, 207;

and consent vs. coercion, 2089, 215;


death throes of, 21416; and ethnic
populations vs. genetic groupings, 202
4, 299300; funding for, 212; and mitochondrial Eve, 201; and normality, 198
99; objections to, 205, 2069, 21718;
proposal/support for, 199200, 2024,
2056; and race, 200202, 201, 209
12, 216; and research priorities, 216
17; and vanishing populations, 2045,
206
Human Genome Evolution Project, 263
65
Human Genome Project, 19899, 213, 263,
271
humanism, 284, 285, 286, 288
humanities vs. science, 1
human nature, 15979; apes vs. humans,
16061; and cultural projections, 16165;
and female passivity, 16263; head shape
as, 177; and homosexuality, 15657; and
male aggression/demonism, 15960, 162
63, 17274; menstruation as, 178; natural man, without culture, 16575, 176
77, 17879; and natural sex, 17576; polygyny vs. monogamy as, 17778; and
waist-to-hip ratio of women, 15455
human rights, 26970. See also apes, human rights for
humans: chimpanzees shared ancestry
with, as threatening to religion, 25455,
257; differences among, 5 (see also race);
evolutionary divergence from apes, 912;
fossils of, 10; mental distinctiveness of,
22; orangutans genetic similarity to, 26
28; plenitude/range of, 8; teeth of, 23.
See also humanape genetic similarity;
human variation, meaning of
human variation, meaning of, 7299; behaviorial, 11719 (see also behavioral genetics); in cognitive ability, 9192; genetic basis for, 8891; in head size/
shape, 8991; among immigrants, 90
91, 117; Neandertals vs. modern humans, 9599; and potentials/abilities, 91
95; skeletal, 7273. See also race
hunter-gatherers, 16970

index

307

hunting, 162
Huxley, Thomas, 161, 19192, 262
identity and descent, 21925, 23941; and
cloning, 22325; and humanchimpanzee hybrids, 21921; and kinship, 22122; who and what we are,
questions of, 22123. See also Kennewick Man
IgNobel prize (Harvard), 30
immigration, 9091, 117, 11920, 121, 269
inbreeding, measures of, 247
Indians,52
indigenous peoples, 206, 217. See also
Kennewick Man
Indonesia, 19394
Inherit the Wind, 257, 258
In His Image (Rorvick), 223
Institute for Creation Research, 256
intermarriage, laws against, 68
IQ, 146, 149. See also The Bell Curve
isolationism, 273
isonymy, 247
Jack and Oskar (twins), 15253
Jacobs, Patricia, 12324
Jantz, Richard, 232
Jefferson, Thomas, 284
Jenkins, Carol, 21213
Jensen, Arthur, 149, 210
Jews, 140, 24546, 24749, 251
Jim twins, 14951
Johnson, Phillip, 257, 261
Josephus, Flavius: Antiquities of the Jews,
5354
Kaestle, Frederika, 22526, 229, 252
Kafka, Franz: Report to an Academy, 40
Kamileroi people (Australia), 169
Keith, Sir Arthur, 73
Kellogg, Vernon, 261
Kennewick Man, 22540; DNA tests on,
25153; and human rights/respect issues,
22528, 252; hype about, 22837; and
race, 23336; reasons for returning him
to Native Americans, 23739
King, Mary-Claire, 3233, 202

308

index

Kingsley, Charles, 6970


kinship, 4748, 22122, 243, 24951
Koshland, Daniel, 148
!Kung San people (Kalahari Desert), 169
71, 172, 179, 204
Kurnai people (Australia), 169
language, 18284
Lapps, as a race, 53, 55
Latour, Bruno, 268
Law of Segregation, 12829
Leakey, Louis, 16364
Lee, Richard, 171
left-handedness, 10910
Lemba people (South Africa), 248, 251
LeschNyhan syndrome, 107, 108
LeVay, Simon, 11314
Leviathan (Hobbes), 16667, 173, 176,
179
Levin, Ira: The Boys from Brazil, 223
Lewontin, Richard, 8182
Linnaeus, Carl: and Buffon, 60; career/
reputation of, 20; on humanape genetic similarity, 21; inuence of, 59; life/
personality of, 20; on personality and
cultural traits, 8889; on race, 5561, 57
(table); scientic classication by, 19
20, 4950, 59, 68; Systema naturae, 20
21, 4950, 5556, 57 (table)
Locke, John: Second Treatise on Civil Government, 16768
Lucy, 240
Luzia, 240
maleness, 12324
Malinowski, Bronislaw, 73
Malthus, Thomas, 194
mammals, 4950
Mandeville, Sir John: Travels of Sir John
Mandeville, 166
Manoilov, E. O., 6465, 12627
Manouvrier, Leonce, 61
Man the Hunter (1966), 170
MAOA (monoamine oxidase A) deciency, 1078
Marx, Karl, 276
Maslack, Fred, 244

Matthew, William Diller, 260


Mead, Margaret, 74, 287
Medawar, Peter, 267, 27374
Mencken, H. L., 42, 246
Mendel, Gregor, 101, 12829, 269, 279
Mengele, Josef, 252, 270
Meninick, Jerry, 229
menstruation, 178
metric system, 277
Midgley, Mary, 274
miscegenation laws, 68
mitochondrial Eve, 34, 83, 201
mitochondrion, 3334
Mo-Cell, 214
molecular anthropology, 731; Central Fallacy of, 4148; denition of, 12, 3; and
DNA as a measure of genetic similarity,
10, 23, 2429; genetics vs. anatomy, 23
29, 31; and humanape evolutionary divergence, 912; and humanistic science,
28688; as mediator, 3, 6; and monsters,
stories of, 13 15; and otherness of humans, 2123; percentages of genetic
similarity, interpreting, 2931; and primates hands/feet, 2122; and proteins
as measure of genetic similarity, 1011,
23; and Ramapithecus, 1112; and scientic classication, 1920; value of, 34.
See also DNA; humanape genetic similarity
monoamine oxidase A. See MAOA deciency
Monod, Jacques, 281
monogamy, 17778
Monroe, Marilyn, 154
monsters, stories of, 13 15
Montagu, Ashley, 7374, 75, 77, 210, 287
88
Moore, John, 214
morality, 12021
moral relativism, 273
Morgan, Lewis Henry, 169
Morgan, Thomas Hunt, 65, 128
Morton, Samuel George, 7879
Muller-Hill, Benno, 21415
Murray, Charles. See The Bell Curve
myth, 27273, 28084

NAGPRA (Native American Graves Protection and Repatriation Act), 206, 227
28, 229, 230, 23233, 240
National Academy of Sciences, 215
National Institutes of Health (NIH), 122,
213
National Research Council, 215, 216
Native American Graves Protection and
Repatriation Act. See NAGPRA
Native Americans: artifacts/skeletal remains reclaimed by, 206; and genetic
tests for proof of ancestry, 24445; as
natural man, 16669, 179; origins of
(see Kennewick Man); as a race, 53, 64
naturalistic fallacy, 161
natural selection, 130
Nature, 197
nature-vs.-nurture debate, 100, 10810, 158
Navajo people, 21617
Nazis, 75, 140, 270, 271, 277
Neandertals, vs. modern people, 9599
Near East peoples, as a race, 52
Nebraska Man, 256
Nei, Masatoshi, 13435
New Scientist, 19697
Newton, Isaac, 20, 52
New World, discovery of, 166
New Yorker, 23334
New York Times, 23132
New York Zoological Society, 119, 26869
New Zealand, ape-rights legislation in, 196
97, 298
NIH (National Institutes of Health), 122,
213
Noahs Sons model of racial origins, 5354,
67, 9798, 21112
nonintervention, 273
Nuremberg Code, 2089
Nuttall, George, 42
Nuttall, Zelia, 292

Onandaga Council of Chiefs, 207


On the Town, 89
orangutans: baboons genetic similarity to,
2425; and the Bangkok Six, 19395;
humans evolutionary divergence from,

index

309

orangutans (continued )
11; humans genetic similarity to, 2628;
humans similarity to, 89
The Origin of Races (Coon), 7677
Ortega y Gasset, Jose, 285
Overton, William R., 256
Owsley, Douglas, 232
paraphyletic categories, 4546, 50
Parche, Gunther, 148
The Passing of the Great Race (Grant), 119
20, 26869
Pearl, Raymond, 270
Pearson, Karl, 260
Pecos Pueblo skulls, 23637
pedophilia, 175
Pennant, Thomas, 21, 60
percentages of genetic similarity, interpreting, 2931
personality traits, 8889
Peterson, Dale, 159, 173, 174
phenotypes vs. genotypes, 100101, 15758
physical anthropology, 6169, 7374, 140
Pilbeam, David, 1112
Piltdown Man, 256
Pioneer Fund, 14950
Plato, 58
Pliny (the Elder), 166
polygenists, 53
polygyny, 17778
Popper, Karl, 267
populations, 7475, 77, 8082, 13234
Porter, Cole, 275
potentials /abilities, 9195, 18081
poverty, 122
Povinelli, Daniel, 196
prejudice, 6971, 71, 9495, 293
Preston, Douglas, 23334
primates, hands/feet of, 2122
proteins, 1011, 23, 32
psychic connections, 151
Purchas, Samuel, 1314
Putnam, Carleton, 77
Pygmie, 1718, 18
pyramids, 234
Quadrupedia (four-legged), 49

310

index

race, 5171, 7588; athletic skills of blacks


vs. whites, 80; Bernier on, 5253, 55;
blood tests for determining, 6365, 81,
12627; Blumenbach on, 61, 65; Buffon
on, 6061, 65; chimpanzee as a racial
insult, 6971, 71, 293; and civilization,
7677; colloquial vs. scientic sense of,
62; Coon on, 7677; cultural bases of
classications of, 7880, 83, 9394, 97
98 (see also folk heredity); and cultural
diversity, 8788; and economics/politics
of Europe, 5455; and evolutionary descent, patterns of, 5859; and facial features, 51; genetic basis for, 8182; and
Gods bounty vs. parsimony, 52; and
head size/shape, 7880; Homo, kinds of,
55; and the Human Genome Diversity
Project, 200202, 201, 20912, 216;
identication with racial groups, 94;
and Kennewick Man, 23336; Linnaeus
on, 5561, 57 (table); and miscegenation
laws, 68; and the Mitochondrial Eve report, 83; Noahs Sons model of, 5354,
67, 9798, 21112; and physical anthropology as Linnaean science, 6169; and
populations, 7475, 77, 8082, 13234;
racial vs. biological heredity, 6869; as a
scientic organizing principle, 5261, 57
(table); and skull form, 23637; social
problems associated with, 9495; social
signicance of, 243; and taxonomism,
13638. See also human variation, meaning of
racial anthropology, Nazi vs. American,
75, 140
racism, 13946, 210
RAFI (Rural Advancement Foundation
International), 206, 213
Ramapithecus, 1112
Rassenhygiene, 277
rationalism, 27475, 276
relatives/kinship, 243, 24951
relativism, 227, 27274
religion: the Bible, 24647, 25455; Christianity, 140; Gods bounty vs. parsimony, 52; humanchimpanzee shared
ancestry as threatening to, 25455, 257;

and science, 6, 274, 276. See also creationism


Report to an Academy (Kafka), 40
reproduction vs. sexuality, 11011
reproductive rates, human vs. ape, 19495
reptiles and birds, 4445
Retzius, Anders, 89
rights. See apes, human rights for; human
rights
Roberts, Leslie, 202, 203
Roosevelt, Theodore, 119, 26869
Rorvick, David: In His Image, 223
Rousseau, Jean-Jacques, 172, 175, 176, 272
73; Discourse on the Origin of Inequality,
168; The Social Contract, 168
Rural Advancement Foundation International (RAFI), 206, 213
Rushton, J. Philippe, 79
Sagan, Carl, 274
SAIIC (South-and-Meso American Indian
Information Center), 207
Sarich, Vincent, 1013, 26162
satyr, 1517, 16
Sawyer, Forrest, 175
Schiebinger, Londa, 50
Schneider, David, 135, 249
Schrodinger, Erwin, 280
Schultz, Adolph, 7071, 71, 293
science, 26688; anthropological study of,
26667; and anthropology, 28688; authority vs. accuracy in, 27879; authority of /responsibility in, 11922, 14849,
15758, 221, 222, 27879, 28488;
burden of proof in, 126, 144, 245; as
concerned with the natural rather than
the supernatural, 25758; ethnocentrism
of, and the future of, 266, 28488; and
the eugenics movement, 26871, 277;
and facts, 26768, 27072; vs. folk
knowledge, 2, 5, 93; fundamentalist
Christian subversion of education in,
185, 25556, 280; and humanism, 284,
285, 286, 288; vs. humanities, 1; and human rights, 26970; and meaninglessness of life, 28183; and myth, 27273,
28084; and nature, mastery of, 274;

and new knowledge, 254; rationalism


of, 27475, 276; as rational and social,
27778; and relativism, 27274; vs. religion, 6, 274, 276; standpoints within, 4;
vs. superstition, 276; and technology vs.
mythology, 27273; testability in, 174;
vs. transcendentalism, 27475
Science, 113; on the Human Genome Diversity Project, 202, 203, 204, 206, 216
scientic classication. See classication
Scopes ( John T.) trial, 42, 255, 257, 258
59, 269
Seattle Times, 229, 231
Second Treatise on Civil Government
(Locke), 16768
segregation, 77
self-discovery, 22425
sexism, 140
sexuality, 11011, 17576, 188. See also homosexuality
Shapiro, Harry, 91
Shepard, Glenn, 155
Shockley, William, 210
Show Boat, 243
Silk Stockings, 275
Simpson, George Gaylord, 21, 4243
Singer, Peter: The Great Ape Project, 186,
189
skull size/shape, 7880, 8991, 177, 23637
slavery, 76
Sleeper (Allen), 223
Small, Meredith, 156
Smitten, 1718
Snow, C. P., 1
The Social Contract (Rousseau), 168
social Darwinism, 13031, 25961
sociobiology, 16970
Sokal, Alan, 268
Sollas, William J.: Ancient Hunters, 260
South-and-Meso American Indian Information Center (SAIIC), 207
Soviet Revolution, 277
Speck, Richard, 124
Spencer, Baldwin, 169
Spencer, Herbert, 161
Sputnik, 256
Stanford, Craig, 176

index

311

Stanford, Dennis, 232, 233


Steele, Gentry, 232
sterilization, involuntary, 11920, 121, 269,
271
Stewart, Patrick, 23435
Stoneking, Mark, 83
Sunset Boulevard, 187
superstition, 276
Sykeses, Y chromosomes of, 247, 301
Systema naturae (System of Nature; Linnaeus), 2021, 4950, 5556, 57 (table)

taxonomism, 13638
technology, 23334, 27273
Third Reich. See Nazis
Tierney, Patrick, 172; Darkness in El Dorado, 287
Time, 20910, 211
time-keeping systems, 277
Tishkoff, Sarah, 84, 85
transcendentalism, 27475
Travels of Sir John Mandeville (Mandeville), 166
Tri-City Herald, 228, 229
Trobriand Islanders (Melanesia), 129
Tsonga people (southern Africa), 129
Tulp, Nicolaas, 1517, 16
Twain, Mark, 30
twin studies, 11415, 14953, 158
Tylor, Edward Burnett, 181, 287
Tyson, Edward, 17, 18, 264

312

index

Udall, Mo, 227


Umatilla people (Washington State), 231,
23839
UNESCO, 169
Vershuer, Otmarr Freiherr von, 270
violence, 7071, 1078, 293. See also aggression
waist-to-hip ratio of women, 15455
Walsh, Bruce, 199
Washburn, Sherwood, 73, 7475, 77
Watson, James, 148, 297
wet-nursing, 50
Wilson, Allan, 1012, 3233, 83, 86; on the
Human Genome Diversity Project, 202,
203
Wilson, E. O., 108, 274, 276, 278
Wolf, Eric, 170
womens gures, 15455
World Council of Indigenous Peoples
(Guatemala), 207
Wrangham, Richard, 159, 17273, 174
Wright, Lawrence, 149, 151, 152
Wright, Sewall, 251
xenophobia, 14142
Yanomamo people (Venezuela), 17172,
179, 287
Yu, Douglas, 155
Zuckerkandl, Emile, 42

Indexer:
Compositor:
Text:
Display:
Printer and binder:

Carol Roberts
Binghamton Valley Composition, LLC
12/14.5 Adobe Garamond
Perpetua and Adobe Garamond
Maple-Vail Manufacturing Group

You might also like