2 Methods For Characterizing Microbial Communities in Caves and Karst: A Review
2 Methods For Characterizing Microbial Communities in Caves and Karst: A Review
2 Methods For Characterizing Microbial Communities in Caves and Karst: A Review
Jones
2.1 Introduction
Over the past several decades, we have begun to realize the immense diversity of microbial life on Earth [1]. Together, Bacteria and Archaea are the numerically dominant
organisms on our planet, and they are ubiquitous at the Earths surface, as well as
throughout the habitable regions of the subsurface. Caves are no exception. Microbial
life is a pervasive feature in caves, and can be found as sparse microbial populations in
oligotrophic caves [2, 3], as densely packed cave-wall biofilms in energy-rich sulfidic
systems [4], and everything in between [5]. Microorganisms are intimately involved
in many fundamental processes in cave ecosystems, including nutrient and element
cycling [6, 7], primary production [8], and processes related to the dissolution or precipitation of carbonates [9, 10] and other cave minerals [11, 12]. Furthermore, the subsurface contains immense microbial biomass and novel microbial diversity [1315],
yet it remains largely underexplored. Karst terrains cover approximately 15% of the
ice-free Earths surface [16], and constitute an important reservoir for microbial diversity that could contain new branches in the tree of life, novel microbial metabolisms,
and unique sources of genetic information for pharmaceutical or biotechnological applications [17].
To access the microbial diversity of caves and karst, we require methods to characterize environmental microbial communities and describe cave microorganisms. The
identification, description, and quantification of microbial populations and communities are requisite first steps to understand and define microbial roles in cave ecology
and biogeochemistry. However, environmental microbial communities have extraor-
dinarily high diversity and contain many organisms with unknown physiology [1, 18,
19]. Here, I present an overview of methods to characterize environmental microbial
communities, both for assessing community structure and composition, and for probing microbial metabolic and functional processes.
25
99% of microorganisms in the environment are not known in culture. This is commonly known as the great plate count anomaly, a phrase invoked by Staley and
Konopka [36] to describe the dramatic discrepancies between direct cell counts from
the environment versus enumeration of viable microbes in culture. Culture-based
analyses, therefore, present a biased view of microbial diversity in the natural environment [37]. Fortunately, culture-independent analyses developed over the past
three decades offer an alternative means to assess microbial diversity, abundance,
and environmentally relevant processes directly.
stances) and further DNA purification [39]. Because the DNA is extracted directly from
environmental materials, additional steps are often required for samples that contain
certain minerals or organic compounds that inhibit DNA extraction or subsequent
steps. For example, the presence of iron [40], humic acids [41], or excessive polysaccharides [42] often necessitates modified extraction procedures to achieve successful
DNA recovery, quality, and purity.
Cloning, or clone library construction, has been widely applied to analyze environmental rRNA genes over the past few decades. Simply stated, cloning is a technique by which environmental genes or genomic regions are inserted into Escherichia
coli cells (via transformation) and the E. coli are then grown in such a way as to separate the individual environmental genes for sequencing. Clone library construction
proceeds as follows ( Fig. 2.1): (i) DNA is extracted from an environmental sample; (ii)
rRNA genes are amplified via polymerase chain reaction (PCR) from the DNA extract,
prior to being (iii) ligated into a plasmid vector that is (iv) transformed into competent E. coli cells; commercially available plasmid vectors contain genes for antibiotic
resistance, so (v) E. coli are grown on an antibiotic-laced agar plate that selects only
for E. coli that contain a plasmid insert; (vi) individual E. coli colonies are then picked
(often using blue/white screening to indicate cells that contain an insert); and (vii)
environmental gene inserts are replicated to provide adequate copies for sequencing,
generally by capillary Sanger technology [43, 44]. Inserts are replicated in step (vii)
via either colony PCR, which is amplification of the insert directly by PCR of E. coli
colonies, or by growing the colonies in liquid medium and extracting plasmids from a
larger volume of E. coli biomass. Note that separation of the E. coli on the agar plate in
step (v) effectively isolates individual gene sequences from the mixed environmental
sample. The PCR product in step (ii) contains a mixture of 16S rRNA sequences from
microbes in the environmental community, but in steps (iii) and (iv), each successfully
ligated vector and successfully transformed E. coli only receive a single rRNA sequence
( Fig. 2.1). Therefore, picking individual E. coli colonies in step (vi) is akin to selecting
random 16S rRNA genes from the environment. For detailed information, readers are
referred to the molecular biology handbook by Sambrook and Russell [39].
Environmental 16S rRNA gene clones are analyzed by comparing newly acquired
rRNA genes from a sample to gene sequences previously retrieved from known isolates
or other environmental sequences. The number of 16S rRNA genes in public databases
has been increasing rapidly in recent years [1]. At the time of writing, one popular
and well-curated database (www.arb-silva.de [45]) contains over 500,000 nonredun Fig. 2.1. Three methods for culture-independent analysis of environmental microbial communities.
Both cloning and amplicon sequencing target a specific gene or genetic region of interest, such
as the 16S rRNA gene, while metagenomics generates a dataset of genomic DNA sequences from
the entire community. The resulting metagenome can contain the complete genetic complement of
multiple environmental organisms.
27
rRNA gene
clone library
rRNA gene
amplicon library
Metagenomics
Environmental
sample
Environmental
sample
Environmental
sample
Extract DNA
Extract DNA
Extract DNA
Sequence DNA
Transform E. coli
>Sequence1
TCGGATTGTAAACCTCTGTCACCGGGGAAGAAACGCTTCAAGTTAATAGCTTGAAGC
>Sequence2
CCTACGAGAGGCAGCAGTGGGGAATTTTGGACAATGGGGGAAACCCTGATCCAGC
>Sequence3
TCGGATTGTAAACTCCTTTTGTGAGGGACGATAATGACGGTACCTCGCGAATAAGCC
>Sequence4
TATGCGTCGTAAACTGCTTTTATACAGGAAGAAACGACTCTTGCGAGAGGCATTGAC
>Sequence5
CCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCC
>Sequence1
TCGGATTGTAAACCTCTGTCACCGGGGAAG
>Sequence2
CCTACGAGAGGCAGCAGTGGGGAATTTTG
>Sequence3
TCGGATTGTAAACTCCTTTTGTGAGGGACG
>Sequence4
TATGCGTCGTAAACTGCTTTTATACAGGAA
>Sequence5
CCTACGGGAGGCAGCAGTGGGGAATATTG
>Sequence1
CTGAGGAGAAACCGACTAAGGGTCCCAAG
>Sequence2
GCAACCAACCTCCCGGTTAAACACCATAAA
>Sequence3
GGAAACCAAACCAACAATCAAACCAACTA
>Sequence4
CTGTACTTTCGAACCTGGACAATCTACTTAT
>Sequence5
CCTCTTAATGATCTTACCATCACTAAACCTA
dant, nearly full-length 16S rRNA genes, and over four million partial rRNA sequences.
The taxonomic affiliation of environmental rRNA genes can be quickly determined
by a simple sequence comparison against these databases, or by more rigorous phylogenetic methods. The latter is required if no close relatives are present in public
databases. rRNA genes do not directly indicate microbial species [37, 46], but they
can serve as proxies. For example, 16S rRNA genes that share 97% sequence similarity
are often considered the same species, although a more appropriate designation is
operational taxonomic units (OTUs). OTUs can be considered analogous to species,
genera, or higher taxonomic divisions, with the important distinction that they are
operationally defined and should be interpreted within the constraints of the technique used.
A primary challenge when applying environmental rRNA sequencing is to avoid
introducing bias during library creation. Any process that systematically increases or
decreases a particular rRNA sequence with respect to its initial proportion in the sample may result in a dataset that inaccurately represents the true composition of the
environmental community. For example, microorganisms can have multiple copies of
the rrn operon [47]. An organism with two rrn operons will appear twice as abundant
in a 16S rRNA gene clone library as an organism with a single rrn operon. This rrn
copy bias is inherent in any 16S rRNA-based study. Different biases can also be introduced during clone library creation, such as from the PCR step if rRNA gene primers
are not truly universal (i.e. if a PCR primer contains a mismatch with particular sequences or a group of sequences, see Section 2.8, Case Study), or if the activity of the
polymerase enzyme is impeded or slowed by certain sequences [48, 49]. Additionally,
bias might occur at the transformation step, as some sequences inhibit E. coli growth,
or during the DNA extraction step if nucleic acid is more readily extracted from certain
organisms than others [50].
This list of potential biases may seem daunting, but it is a reality that environmental microbiologists must acknowledge. It is generally impossible to avoid introducing
any sort of bias with environmental techniques. As long as the potential sources for
bias are recognized, and the results are cautiously interpreted, then appropriate conclusions can be drawn. It is advantageous to compare multiple techniques for nucleic
acid extraction, PCR amplification, and cloning to compare different biases and to confirm results and identify potential artifacts (see Section 2.8). Specifically, steps may be
taken to limit bias, such as selecting appropriate PCR primers, minimizing PCR cycles,
or combining DNA extractions generated via different lysis procedures.
In recent years, 16S rRNA gene cloning has been widely applied in cave microbiology studies. One of the earliest applications of cloning to cave systems was performed by Angert et al. [51], in which cloning was used to describe a microbial community from a sulfidic stream in Parker Cave, Kentucky, USA. In other early applications, Vlasceanu et al. [52] and Hose et al. [4] used clone libraries to characterize
the communities of highly acidic cave snottites (see also Section 2.8). Other studies
applied cloning to explore the microbiology of ferromanganese corrosion residues in
29
Lechuguilla Cave, New Mexico [34], unusual microbial mantles in Nullarbor Caves,
Australia [53], and microbial mats from Cesspool Cave, Virginia, USA [32]. In each of
these studies, 16S rRNA gene cloning revealed novel microbial diversity.
31
ally, full-length rRNA gene sequences are required to link T-RFLP fragments to microbial taxa. However, because no sequencing is directly required, a much larger number
of samples can be analyzed by T-RFLP than is typically reasonable by cloning. Readers are referred to Liu et al. [66] and Osborn et al. [67] for additional information on
T-RFLP.
T-RFLP has been applied to studies of cave microbial communities, including
assessing microbial community response to different inputs of human- and animalderived carbon in Wind Cave, South Dakota [68], relating microbial community shifts
in a Floridan karst aquifer to seasonal changes in groundwater chemistry [69], and
comparing bacterial community changes in epiphreatic karst pools following microbial colonization events associated with periodic flooding [70]. In all three studies
listed above, T-RFLP was used in conjunction with cloning. rRNA gene cloning facilitated the identification of microbial taxa, and T-RFLP was used to quantify communities across a larger number of samples.
similar to each other than to microbial communities on adjacent speleothems [73], and
that fungal communities from show caves can be distinct from communities in caves
with restricted access [74]. In another application, DGGE of 23S rRNA sequences was
used to reveal the biogeography of Epsilonproteobacteria from different sulfidic caves
and springs [75].
T-RFLP, DGGE, and related methods are collectively known as community fingerprinting. All community fingerprinting techniques employ electrophoretic separation of genetic variants in a PCR product, and the resulting electrophoresis pattern (the fingerprint) represents a snapshot of the community structure. Other commonly used fingerprinting techniques include automated ribosomal intergenic spacer
analysis, amplified ribosomal DNA restriction analysis, temperature gradient gel electrophoresis, and others. For more information, readers are referred to reviews on community fingerprinting by Nocker et al. [76] and Marzorati et al. [77].
33
of cross-sections of the structures, the authors found that certain bacterial populations are restricted to the exterior of the structures, while other populations occur in
the interior. FISH has also been applied in other cave studies, such as to show that
certain groups of Epsilonproteobacteria dominate stream communities in Lower Kane
Cave, Wyoming, USA [82], to detect novel Acidobacteria in biofilms from the same
cave [83], and to quantify populations of different sulfur-oxidizing microorganisms
in sulfidic cave streams in the Frasassi and Acquasanta cave systems in Italy [8486].
In another study in the Frasassi cave system, a FISH probe was designed to label
attached Thiothrix epibionts that are symbiotically associated with a cave amphipod [87].
Many other methodological variations of FISH are possible. For example, catalyzed reporter deposition FISH (CARD-FISH) produces a more intense fluorescent
signal than traditional FISH [88] and can improve detection of cells with low ribosomal numbers. For example, CARD-FISH was applied for the enumeration of microorganisms in cold oligotrophic karst aquifers where traditional FISH did not produce
sufficient fluorescent signal to quantify bacterial populations [89]. Other variants
combine FISH with radiolabeling and microradiography (MAR-FISH [90]), incorporate gold labeling for identification via electron microscopy (GOLD-FISH [91]), and
even allow for the detection of nuclear genes [92]. In an application of one of these
FISH variants to karst microbial processes, Wilhartitz et al. [93] used MAR-FISH to
quantify the abundance of heterotrophic microorganisms and measure heterotrophic
production rates in an oligotrophic karst aquifer.
2.6 Metagenomics
All of the molecular techniques described above involve the direct amplification and
analysis of specific genomic regions of interest, such as rRNA gene sequences or genes
for particular enzymes. However, metagenomics is the analysis of genomic material
directly from a mixed microbial community, which circumvents some of the biases
and pitfalls of the other culture- and PCR-based methods. To construct a metagenomic
dataset, DNA is extracted from an environmental microbial community and directly
sequenced ( Fig. 2.1). The resulting metagenome contains genomic DNA sequences
from multiple organisms in the community and includes sequences of both phylogenetic marker genes (e.g. 16S rRNA genes) and functional genes (e.g. genes involved
in ammonia oxidation or nitrogen fixation). To effectively examine this mixed bag
of microbial genomic information, the taxonomic affiliation and function must be
determined for as many metagenomic sequences as possible. Generally, this is accomplished by first assembling short metagenomic sequences (reads) into longer
genome fragments, referred to as contiguous sequences. Assembly is followed by binning and annotation of the fragments. For a more in-depth introduction to metagenomics, consult recent reviews by Thomas et al. [102] and Teeling and Glckner [103].
At the time of writing, metagenomics applications to caves and karst communities are currently limited to just a few studies from recent years. Tetu et al. [7] identified genes for nitrogen cycling and partially reconstructed the genome of a novel
Thaumarchaeota from Weebubbie Cave, Australia. Ortiz et al. [3] studied community
metabolic pathways from stalactite surfaces in oligotrophic Kartchner Caverns. Jones
et al. [42, 104] determined microbial sulfur oxidation pathways from sulfidic cave
snottites, which is highlighted in Section 2.8, Case Study, below. As both computational and sequencing tools advance, metagenomics will likely become more and
more widely applied in cave studies.
| 35
G-plasma
Alphabet plasmas
Ferroplasma
Fig. 2.3. Phylogenetic analysis of archaeal 16S rRNA gene clones identified populations of Ferroplasma spp. and a G-plasma-like organism in Frasassi Cave snottites. The tree shown here was
constructed using neighbor-joining analysis and dots indicate nodes supported by > 95% bootstrap
support. rRNA gene cloning of Frasassi snottites is described in [42, 104, 108].
B
% of total cells
| 37
60
40
20
0
Ramo Sulfureo site RS2
ACM732
THIO1
DAPI
May, 2005
August, 2005
Fig. 2.4. FISH analyses of snottites from the Frasassi cave system. (a) A representative FISH photomicrograph of a snottite sample. Specificity of different FISH probes is given in the legend.
Based on other FISH analyses not shown here, the blue cells in (a) are archaeal populations and
the majority of green cells are Acidithiobacillus spp. (b) Cell counts based on FISH analyses were
used to quantify snottite microbial populations. FISH analyses of Frasassi snottites are reported
in [42, 104, 108].
FISH analyses [108] confirmed the cloning results, and were used to analyze
a larger number of snottite samples from multiple locations in the cave system
( Fig. 2.4). FISH analysis revealed that archaeal populations constituted a large
component of the snottite community, up to 40% in some cases, and that the Acidimicrobium-like organisms varied from 0% to 10% relative abundance. FISH analyses also
showed that Acidithiobacillus spp. were perennially dominant in snottites. Strains of
Acidithiobacillus spp. were isolated from snottites, and were shown to oxidize sulfur,
fix carbon dioxide, and form biofilm ( Fig. 2.5).
However, rRNA methods and cultivation could not answer all questions. Some,
but not all of the snottite Archaea hybridized with a FISH probe for the genus Ferroplasma [108]. Despite general agreement between FISH and cloning results [103],
the other Archaea could not be identified. Furthermore, snottite Archaea and the
Acidimicrobium-like bacteria were only distantly related to cultivated microorgan-
isms based on 16S rRNA gene sequence similarity. The low rRNA sequence similarity,
coupled with the fact that these groups defied all attempts at culturing, meant that
little could be inferred about their metabolism. Finally, despite the identification of
the snottite Acidithiobacillus spp. as sulfur-oxidizing autotrophs, other important
aspects of their metabolism remained unknown. Therefore, Jones et al. [42, 104] applied metagenomic sequencing and additional full-cycle rRNA analyses to explore the
metabolic potential of snottite microorganisms further.
Metagenomic analysis provided several important insights. First, the missing
snottite archaeal population was identified as G-plasma, an archaeon from the
Thermoplasmatales group with no close culture representatives ( Fig. 2.3) [42].
G-plasma was missed by earlier studies because of a mismatch between G-plasma
16S rRNA genes and widely used archaeal PCR primers. However, metagenomics
avoids PCR bias, and by using the new 16S rRNA gene sequence information recovered from metagenomics, primer sequences were modified and G-plasma sequences were successfully cloned [42]. Second, the energy metabolism of other
snottite populations was inferred from metagenomic data ( Fig. 2.6). A lack of any
known C-fixation pathways among the G-plasma, Ferroplasma, and Acidimicrobium-like populations suggested that those organisms were heterotrophic. With
deeper metagenome sequencing, snottite G-plasma, Acidimicrobium, and Ferroplasma were each found to have an sqr gene that encodes the sulfide-oxidizing enzyme
sulfide:quinoneoxidoreductase [104]. Third, metagenomics was used to characterize
the sulfur oxidation pathway of the snottite Acidithiobacillus, which includes the SQR
system, a partial SOX system, and four structurally distinct SQR enzymes [42, 104].
The combined use of cloning, FISH, culturing, and metagenomics has been essential to characterize the Frasassi snottite microorganisms. Cloning was used initially to
identify the microbial inhabitants of snottites, and FISH allowed for a quantitative accounting of different microbial populations across multiple samples. Metagenomics
identified an important primer bias against G-plasma, which led to a more complete community description. General agreement between FISH and metagenomics
confirmed the reliability of metagenomic-based community analysis. Metagenomics
also provided functional information beyond what could be predicted from rRNA sequence analysis alone, including the identification of metabolic sulfur oxidation pathways in snottite microorganisms and development of a conceptual model of snottite
biogeochemistry [42, 104]. Moreover, metagenomics generated hypotheses about the
mechanism of sulfur oxidation by Acidithiobacillus that will be tested with culturebased manipulations in the future.
2.9 Conclusions
Limestone (CaCO3)
cave walls
39
NO3-, P
trace metals?
Microcrystalline gypsum
(CaSO42H2O)
So
So
So
Rare organisms
(Fungi, protists, rare
bacteria and archaea)
Cave atmosphere
So
Acidimicrobiaceae sp.
S-oxidation
SQR
Corg oxidation
G-plasma
Corg
oxidation
Corg
Biofilm (EPS)
matrix (pH 0-1)
Acidithiobacillus sp.
S-oxidation
SQR, SOX system
EPS production
Acid production
CO2(g)
NH3(g)
C-fixation
Reductive pentose
phosphate pathway
H2S(g)
O2(g)
Cave stream
Fig. 2.6. Conceptual model of snottite biogeochemistry based in part on metagenomic analyses
described in [42, 104]. Modified from [42].
2.9 Conclusions
Numerous methods are available to environmental microbiologists seeking to study
microbial processes in caves and karst. The techniques reviewed here represent currently used approaches, as well as some that will become more widely employed in the
future. When considering different techniques, it is important to be aware not only of
the biases inherent to each, but also the extent to which each is capable of resolving
the true microbial diversity of the sample. Fig. 2.7 depicts a rank abundance curve
of a representative environmental community. Most environmental communities are
dominated by a relatively small number of abundant microbial populations and larger
Taxon abundance
FISH
16S rRNA gene community fingerprinting
16S rRNA gene cloning
Culture-dependent analyses
Rank
Fig. 2.7. A representative rank abundance curve of an environmental microbial community. Most
environmental communities are dominated by a small number of abundant taxa, but also include a
long tail of less abundant taxa that represent the rare biosphere. Different techniques describe
different portions of that total diversity (see the text for details). Figure based on [37].
numbers of low abundance taxa. The long tail of rare taxa in Fig. 2.7 is commonly
known as the rare biosphere [56, 61], and can be thought of as a seed bank of microbial diversity. Each different technique reviewed here is capable of describing a
slightly different component of this diversity, and Fig. 2.7 represents a useful context in which to summarize environmental methods.
Culture-based analyses represent a powerful tool for identifying microbial metabolic capabilities and fully characterizing isolates. However, they often represent a
biased view of microbial abundance and diversity in the environment because the
organisms that grow most readily in the lab might simply be weeds from the rare
biosphere ( Fig. 2.7). Culture-independent methods use direct amplification of rRNA
genes from environmental samples to produce a more accurate picture of the true microbial diversity. However, different techniques have different limitations. For example, rRNA amplicon sequencing produces large datasets that can begin to approach
the true microbial diversity ( Fig. 2.7), but each sequence has low taxonomic resolution and amplicons libraries can have high error rates. Cloning, in contrast, produces
full- or nearly full-length sequences but only relatively small libraries. Community
fingerprinting techniques are currently the most cost-effective rRNA-based tools, but
have neither the phylogenetic resolution of cloning nor the depth of amplicon libraries
( Fig. 2.7). Direct characterization of functional genes via PCR-based techniques or
metagenomics provides culture-independent information on metabolic potential, but
currently, those techniques are only effectively applied to the most abundant members
of the community. However, DNA sequencing technology is rapidly advancing, and as
costs decrease and throughput increases, metagenomics may even supplant certain
rRNA-based approaches [109]. Together, environmental DNA sequencing, novel cultivation techniques, -omics approaches, and other microbiological methods offer innovative ways to probe environmental microbial processes and represent an exciting
new toolbox for future cave and karst microbiology researchers.
References | 41
Acknowledgments
Thanks to all of those who have advised and assisted me in the lab and field, especially J. Macalady, I. Schaperdoth, E. Lyon, T. Jones, S. Dattagupta, K. Dawson, and
H. Albrecht. I extend sincere thanks to L. Hose, L. Rosales-Lagarde, A. Montanari, F.
Baldoni, S. Carnevali, S. Cerioni, S. Galdenzi, M. Mainiero, S. Mariani, and the Gruppo
Speleologico C. A. I. di Fabriano for wonderful guidance on caving and cave research.
I also extend special thanks to A. Engel for organizing and editing this volume.
References
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
Pace NR. Mapping the tree of life: progress and prospects. Microbiol Mol Biol Rev 2009, 73,
56576.
Barton HA, Taylor MR, Pace NR. Molecular phylogenetic analysis of a bacterial community in
an oligotrophic cave environment. Geomicrobiol J 2004, 21, 1120.
Ortiz M, Legatzki A, Neilson JW, et al. Making a living while starving in the dark: metagenomic
insights into the energy dynamics of a carbonate cave. ISME J 2014, 8, 47891.
Hose LD, Palmer AN, Palmer MV, Northup DE, Boston PJ, DuChene HR. Microbiology and geochemistry in a hydrogen-sulfide-rich karst environment. Chem Geol 2000, 169, 399423.
Engel AS. Microbial diversity of cave ecosystems. In: Barton LL, Mandl M, Loy A, eds. Geomicrobiology: Molecular and Environmental Perspective, Netherlands, Springer, 2010, 21938.
Chen Y, Wu L, Boden R, et al. Life without light: microbial diversity and evidence of sulfur-and
ammonium-based chemolithotrophy in Movile Cave. ISME J 2009, 3, 1093104.
Tetu SG, Breakwell K, Elbourne LD, Holmes AJ, Gillings MR, Paulsen IT. Life in the dark:
metagenomic evidence that a microbial slime community is driven by inorganic nitrogen
metabolism. ISME J 2013, 7, 122736.
Sarbu SM, Kane TC, Kinkle BK. A chemoautotrophically based cave ecosystem. Science 1996,
272, 19535.
Engel AS, Stern LA, Bennett PC. Microbial contributions to cave formation: New insights into
sulfuric acid speleogenesis. Geology 2004, 32, 36972.
Melim LA, Shinglman KM, Boston PJ, Northup DE, Spilde MN, Queen JM. Evidence for microbial involvement in pool finger precipitation, Hidden Cave, New Mexico. Geomicrobiol J 2001,
18, 31129.
Boston P, Spilde M, Northup D, et al. Cave biosignature suites: microbes, minerals, and Mars.
Astrobiology 2001, 1, 2555.
Carmichael MJ, Carmichael SK, Santelli CM, Strom A, Bruer SL. Mn (II)-oxidizing bacteria are
abundant and environmentally relevant members of ferromanganese deposits in caves of the
upper Tennessee River Basin. Geomicrobiol J 2013, 30, 779800.
Amend JP, Teske A. Expanding frontiers in deep subsurface microbiology. Palaeogeogr
Palaeoclimatol Palaeoecol 2005, 219, 13155.
Kallmeyer J, Pockalny R, Adhikari RR, Smith DC, DHondt S. Global distribution of microbial
abundance and biomass in subseafloor sediment. Proc Nat Acad Sci USA 2012, 109, 162136.
Lin L-H, Wang P-L, Rumble D, et al. Long-term sustainability of a high-energy, low-diversity
crustal biome. Science 2006, 314, 47982.
Palmer AN. Cave Geology. Dayton, OH, Cave Books, 2007.
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36]
[37]
[38]
Engel AS, Northup DE. Caves and karst as model systems for advancing the microbial sciences. In: Martin JB, White WB, eds. Frontiers of Karst Research. Leesburg, Virginia, Karst
Waters Institute, 2008, 9095.
Hugenholtz P, Goebel BM, Pace NR. Impact of culture-independent studies on the emerging
phylogenetic view of bacterial diversity. J Bacteriol 1998, 180, 476574.
Macalady JL, Hamilton TL, Grettenberger CL, Jones DS, Tsao LE, Burgos WD. Energy, ecology
and the distribution of microbial life. Phil Trans R Soc B 2013, 368, 20120383.
Madigan MT, Martinko JM, Stahl D, Clark DP. Brock Biology of Microorganisms (13th Edition).
Boston, MA, Benjamin Cummings, 2010.
Leadbetter JR. Cultivation of recalcitrant microbes: cells are alive, well and revealing their
secrets in the 21st century laboratory. Curr Opin Microbiol 2003, 6, 27481.
Keller M, Zengler K. Tapping into microbial diversity. Nature Reviews Microbiology 2004, 2,
14150.
Epstein S. The phenomenon of microbial uncultivability. Curr Opin Microbiol 2013, 16,
63642.
Caumartin V. Review of the microbiology of underground environments. Nat Speleol Soc Bull
1963, 25, 114.
Mikell Jr A, Smith C, Richardson J. Evaluation of media and techniques to enumerate heterotrophic microbes from karst and sand aquifer springs. Microb Ecol 1996, 31, 11524.
Vlasceanu L, Popa R, Kinkle BK. Characterization of Thiobacillus thioparus LV43 and its distribution in a chemoautotrophically based groundwater ecosystem. Appl Environ Microbiol
1997, 63, 31237.
Brigmon R, Martin H, Morris T, Bitton G, Zam S. Biogeochemical ecology of Thiothrix spp. in
underwater limestone caves. Geomicrobiol J 1994, 12, 14159.
Ikner LA, Toomey RS, Nolan G, Neilson JW, Pryor BM, Maier RM. Culturable microbial diversity
and the impact of tourism in Kartchner Caverns, Arizona. Microb Ecol 2007, 53, 3042.
Baskar S, Baskar R, Mauclaire L, McKenzie J. Microbially induced calcite precipitation in culture experiments: Possible origin for stalactites in Sahastradhara caves, Dehradun, India.
Curr Sci 2006, 90, 5864.
Caaveras J, Hoyos M, Sanchez-Moral S, et al. Microbial communities associated with hydromagnesite and needle-fiber aragonite deposits in a karstic cave (Altamira, Northern Spain).
Geomicrobiol J 1999, 16, 925.
Rusznyk A, Akob DM, Nietzsche S, et al. Calcite biomineralization by bacterial isolates from
the recently discovered pristine karstic Herrenberg cave. Appl Environ Microbiol 2012, 78,
115767.
Engel AS, Porter ML, Kinkle BK, Kane TC. Ecological assessment and geological significance
of microbial communities from Cesspool Cave, Virginia. Geomicrobiol J 2001, 18, 25974.
Northup DE, Barns SM, Yu LE, et al. Diverse microbial communities inhabiting ferromanganese deposits in Lechuguilla and Spider Caves. Environ Microbiol 2003, 5, 107186.
Northup DE, Dahm CN, Melim LA, et al. Evidence for geomicrobiological interactions in
Guadalupe caves. J Cave Karst Stud 2000, 62, 8090.
Popa R, Smith AR, Popa R, Boone J, Fisk M. Olivine-respiring bacteria isolated from the rockice interface in a lava-tube cave, a Mars analog environment. Astrobiology 2012, 12, 918.
Staley JT, Konopka A. Measurement of in situ activities of nonphotosynthetic microorganisms
in aquatic and terrestrial habitats. Annu Rev Microbiol 1985, 39, 32146.
Pedrs-Ali C. Marine microbial diversity: can it be determined? Trends Microbiol 2006, 14,
25763.
Woese CR, Fox GE. Phylogenetic structure of the prokaryotic domain: the primary kingdoms.
Proc Nat Acad Sci USA 1977, 74, 508890.
References | 43
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
Sambrook J, Russell DW, Russell DW. Molecular cloning: a laboratory manual, third edition.
Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press, 2001.
Senko JM, Wanjugi P, Lucas M, Bruns MA, Burgos WD. Characterization of Fe (II) oxidizing
bacterial activities and communities at two acidic Appalachian coalmine drainage-impacted
sites. ISME J 2008, 2, 113445.
Lakay F, Botha A, Prior B. Comparative analysis of environmental DNA extraction and purification methods from different humic acid-rich soils. J Appl Microbiol 2007, 102, 26573.
Jones D, Albrecht H, Dawson K, et al. Community genomic analysis of an extremely acidophilic sulfur-oxidizing biofilm. ISME J 2012, 6, 15870.
Dovichi NJ, Zhang J. How capillary electrophoresis sequenced the human genome. Angew
Chem Int Ed 2000, 39, 44638.
Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Nat
Acad Sci USA 1977, 74, 54637.
Pruesse E, Quast C, Knittel K, et al. SILVA: a comprehensive online resource for quality
checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res
2007, 35, 718896.
Konstantinidis KT, Ramette A, Tiedje JM. The bacterial species definition in the genomic era.
Phil Trans R Soc B 2006, 361, 192940.
Acinas SG, Marcelino LA, Klepac-Ceraj V, Polz MF. Divergence and redundancy of 16S rRNA
sequences in genomes with multiple rrn operons. J Bacteriol 2004, 186, 262935.
Kanagawa T. Bias and artifacts in multitemplate polymerase chain reactions (PCR). J Biosci
Bioeng 2003, 96, 31723.
Polz MF, Cavanaugh CM. Bias in template-to-product ratios in multitemplate PCR. Appl Environ Microbiol 1998, 64, 372430.
DeSantis TZ, Stone CE, Murray SR, Moberg JP, Andersen GL. Rapid quantification and taxonomic classification of environmental DNA from both prokaryotic and eukaryotic origins
using a microarray. FEMS Microbiol Lett 2005, 245, 2718.
Angert ER, Northup DE, Reysenbach A-L, Peek AS, Goebel BM, Pace NR. Molecular phylogenetic analysis of a bacterial community in Sulphur River, Parker Cave, Kentucky. Am Mineral
1998, 83, 158392.
Vlasceanu L, Sarbu SM, Engel AS, Kinkle BK. Acidic cave-wall biofilms located in the Frasassi
Gorge, Italy. Geomicrobiol J 2000, 17, 12539.
Holmes AJ, Tujula NA, Holley M, et al. Phylogenetic structure of unusual aquatic microbial
formations in Nullarbor caves, Australia. Environ Microbiol 2001, 3, 25664.
Margulies M, Egholm M, Altman WE, et al. Genome sequencing in microfabricated highdensity picolitre reactors. Nature 2005, 437, 37680.
Neefs J-M, Van de Peer Y, De Rijk P, Chapelle S, De Wachter R. Compilation of small ribosomal
subunit RNA structures. Nucleic Acids Res 1993, 21, 302549.
Sogin ML, Morrison HG, Huber JA, et al. Microbial diversity in the deep sea and the underexplored rare biosphere. Proc Nat Acad Sci USA 2006, 103, 1211520.
Sahl JW, Fairfield N, Harris JK, Wettergreen D, Stone WC, Spear JR. Novel microbial diversity
retrieved by autonomous robotic exploration of the worlds deepest vertical phreatic sinkhole. Astrobiology 2010, 10, 20113.
Sahl JW, Gary MO, Harris JK, Spear JR. A comparative molecular analysis of water-filled limestone sinkholes in north-eastern Mexico. Environ Microbiol 2011, 13, 22640.
Ortiz M, Neilson JW, Nelson WM, et al. Profiling bacterial diversity and taxonomic composition on speleothem surfaces in Kartchner Caverns, AZ. Microb Ecol 2013, 65, 37183.
Gray CJ, Engel AS. Microbial diversity and impact on carbonate geochemistry across a changing geochemical gradient in a karst aquifer. ISME J 2013, 7, 32537.
[61]
[62]
[63]
[64]
[65]
[66]
[67]
[68]
[69]
[70]
[71]
[72]
[73]
[74]
[75]
[76]
[77]
[78]
[79]
Kunin V, Engelbrektson A, Ochman H, Hugenholtz P. Wrinkles in the rare biosphere: pyrosequencing errors can lead to artificial inflation of diversity estimates. Environ Microbiol 2010,
12, 11823.
Bartram AK, Lynch MD, Stearns JC, Moreno-Hagelsieb G, Neufeld JD. Generation of
multimillion-sequence 16S rRNA gene libraries from complex microbial communities by assembling paired-end Illumina reads. Appl Environ Microbiol 2011, 77, 384652.
Faith JJ, Guruge JL, Charbonneau M, et al. The long-term stability of the human gut microbiota. Science 2013, 341, DOI:10.1126/science.1237439.
Lundberg DS, Yourstone S, Mieczkowski P, Jones CD, Dangl JL. Practical innovations for highthroughput amplicon sequencing. Nat Methods 2013, 10, 9991002.
Harrison BK, Orphan VJ. Method for assessing mineral composition-dependent patterns in
microbial diversity using magnetic and density separation. Geomicrobiol J 2012, 29, 43549.
Liu W-T, Marsh TL, Cheng H, Forney LJ. Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16S rRNA. Appl
Environ Microbiol 1997, 63, 451622.
Osborn AM, Moore ER, Timmis KN. An evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis for the study of microbial community structure and dynamics.
Environ Microbiol 2000, 2, 3950.
Chelius MK, Beresford G, Horton H, et al. Impacts of alterations of organic inputs on the bacterial community within the sediments of Wind Cave, South Dakota, USA. Int J Speleol 2012,
38, 110.
Moss JA, Nocker A, Snyder RA. Microbial characteristics of a submerged karst cave system in
Northern Florida. Geomicrobiol J 2011, 28, 71931.
Shabarova T, Widmer F, Pernthaler J. Mass effects meet species sorting: transformations of
microbial assemblages in epiphreatic subsurface karst water pools. Environ Microbiol 2013,
15, 247688.
Muyzer G, De Waal EC, Uitterlinden AG. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes
coding for 16S rRNA. Appl Environ Microbiol 1993, 59, 695700.
Portillo MC, Saiz-Jimenez C, Gonzalez JM. Molecular characterization of total and metabolically active bacterial communities of white colonizations in the Altamira Cave, Spain. Res
Microbiol 2009, 160, 417.
Legatzki A, Ortiz M, Neilson JW, et al. Bacterial and archaeal community structure of two adjacent calcite speleothems in Kartchner Caverns, Arizona, USA. Geomicrobiol J 2011, 28, 99
117.
Adetutu EM, Thorpe K, Bourne S, et al. Phylogenetic diversity of fungal communities in areas
accessible and not accessible to tourists in Naracoorte Caves. Mycologia 2011, 103, 95968.
Rossmassler K, Engel AS, Twing KI, Hanson TE, Campbell BJ. Drivers of epsilonproteobacterial
community composition in sulfidic caves and springs. FEMS Microbiol Ecol 2012, 79, 42132.
Nocker A, Burr M, Camper AK. Genotypic microbial community profiling: a critical technical
review. Microb Ecol 2007, 54, 27689.
Marzorati M, Wittebolle L, Boon N, Daffonchio D, Verstraete W. How to get more out of molecular fingerprints: practical tools for microbial ecology. Environ Microbiol 2008, 10, 157181.
Hugenholtz P, Tyson GW, Blackall LL. Design and evaluation of 16S rRNA-targeted oligonucleotide probes for fluorescence in situ hybridization. In: Aquino de Muro M, Rapley R, eds.
Methods in Molecular Biology, vol 179, Gene Probes: Principles and Protocols. Totowa, NJ,
USA, Humana, 2002, 2942.
Wagner M, Horn M, Daims H. Fluorescence in situ hybridisation for the identification and
characterisation of prokaryotes. Curr Opin Microbiol 2003, 6, 3029.
References | 45
[80]
[81]
[82]
[83]
[84]
[85]
[86]
[87]
[88]
[89]
[90]
[91]
[92]
[93]
[94]
[95]
[96]
[97]
Behrens S, Fuchs BM, Mueller F, Amann R. Is the in situ accessibility of the 16S rRNA of Escherichia coli for Cy3-labeled oligonucleotide probes predicted by a three-dimensional structure model of the 30S ribosomal subunit? Appl Environ Microbiol 2003, 69, 493541.
Kostanjek R, Pai L, Daims H, Sket B. Structure and community composition of sprout-like
bacterial aggregates in a Dinaric Karst subterranean stream. Microb Ecol 2013, 66, 518.
Engel AS, Lee N, Porter ML, Stern LA, Bennett PC, Wagner M. Filamentous Epsilonproteobacteria dominate microbial mats from sulfidic cave springs. Appl Environ Microbiol 2003, 69,
550311.
Meisinger DB, Zimmermann J, Ludwig W, et al. In situ detection of novel Acidobacteria in
microbial mats from a chemolithoautotrophically based cave ecosystem (Lower Kane Cave,
WY, USA). Environ Microbiol 2007, 9, 152334.
Jones D, Tobler D, Schaperdoth I, Mainiero M, Macalady J. Community structure of subsurface biofilms in the thermal sulfidic caves of Acquasanta Terme, Italy. Appl Environ Microbiol
2010, 76, 590210.
Macalady JL, Dattagupta S, Schaperdoth I, Jones DS, Druschel GK, Eastman D. Niche differentiation among sulfur-oxidizing bacterial populations in cave waters. ISME J 2008, 2, 590601.
Macalady JL, Lyon EH, Koffman B, et al. Dominant microbial populations in limestonecorroding stream biofilms, Frasassi cave system, Italy. Appl Environ Microbiol 2006, 72,
5596609.
Dattagupta S, Schaperdoth I, Montanari A, et al. A novel symbiosis between chemoautotrophic bacteria and a freshwater cave amphipod. ISME J 2009, 3, 93543.
Pernthaler A, Pernthaler J, Amann R. Fluorescence in situ hybridization and catalyzed reporter deposition for the identification of marine bacteria. Appl Environ Microbiol 2002, 68,
3094101.
Wilhartitz I, Mach RL, Teira E, Reinthaler T, Herndl GJ, Farnleitner AH. Prokaryotic community
analysis with CARD-FISH in comparison with FISH in ultra-oligotrophic groundand drinking
water. J Appl Microbiol 2007, 103, 87181.
Lee N, Nielsen PH, Andreasen KH, et al. Combination of fluorescent in situ hybridization and
microautoradiographya new tool for structure-function analyses in microbial ecology. Appl
Environ Microbiol 1999, 65, 128997.
Schmidt H, Eickhorst T, Mumann M. Gold-FISH: A new approach for the in situ detection of
single microbial cells combining fluorescence and scanning electron microscopy. Syst Appl
Microbiol 2012, 35, 51825.
Wagner M, Haider S. New trends in fluorescence in situ hybridization for identification and
functional analyses of microbes. Curr Opin Biotechnol 2012, 23, 96102.
Wilhartitz IC, Kirschner AK, Stadler H, et al. Heterotrophic prokaryotic production in ultraoligotrophic alpine karst aquifers and ecological implications. FEMS Microbiol Ecol 2009, 68,
28799.
Hutchens E, Radajewski S, Dumont MG, McDonald IR, Murrell JC. Analysis of methanotrophic
bacteria in Movile Cave by stable isotope probing. Environ Microbiol 2004, 6, 11120.
Marshall Hathaway JJ, Sinsabaugh RL, Dapkevicius MdLN, Northup DE. Diversity of ammonia
oxidation (amoA) and nitrogen fixation (nifH) genes in lava caves of Terceira, Azores, Portugal. Geomicrobiol J 2013, 31, 22135.
Desai MS, Assig K, Dattagupta S. Nitrogen fixation in distinct microbial niches within a
chemoautotrophy-driven cave ecosystem. ISME J 2013, 7, 241123.
Engel AS, Lichtenberg H, Prange A, Hormes J. Speciation of sulfur from filamentous microbial mats from sulfidic cave springs using X-ray absorption near-edge spectroscopy. FEMS
Microbiol Lett 2007, 269, 5462.
[98]
[99]
[100]
[101]
[102]
[103]
[104]
[105]
[106]
[107]
[108]
[109]
Porter ML, Engel AS, Kane TC, Kinkle BK. Productivity-diversity relationships from
chemolithoautotrophically based sulfidic karst systems. Int J Speleol 2009, 38, 2740.
Melim LA, Northup DE, Spilde MN, Jones B, Boston PJ, Bixby RJ. Reticulated filaments in cave
pool speleothems: microbe or mineral? J Cave Karst Stud 2008, 70, 13541.
Cunningham K, Northup D, Pollastro R, Wright W, LaRock E. Bacteria, fungi and biokarst in
Lechuguilla Cave, Carlsbad Caverns National Park, New Mexico. Environ Geol 1995, 25, 28.
Spilde MN, Northup DE, Boston PJ, et al. Geomicrobiology of cave ferromanganese deposits:
A field and laboratory investigation. Geomicrobiol J 2005, 22, 99116.
Thomas T, Gilbert J, Meyer F. Metagenomics a guide from sampling to data analysis. Microb
Inform Exp 2012, 2, 3. DOI:10.1186/204257832-3.
Teeling H, Glckner FO. Current opportunities and challenges in microbial metagenome
analysisa bioinformatic perspective. Brief Bioinform 2012, 13, 72842.
Jones DS, Schaperdoth I, Macalady JL. Metagenomic evidence for sulfide oxidation in extremely acidic cave biofilms. Geomicrobiol J 2014, 31, 194204.
Gonzalez JM, Portillo MC, Saiz-Jimenez C. Metabolically active Crenarchaeota in Altamira
cave. Naturwissenschaften 2006, 93, 425.
Bundy JG, Davey MP, Viant MR. Environmental metabolomics: a critical review and future
perspectives. Metabolomics 2009, 5, 321.
Ram RJ, VerBerkmoes NC, Thelen MP, et al. Community proteomics of a natural microbial
biofilm. Science 2005, 308, 191520.
Macalady JL, Jones DS, Lyon EH. Extremely acidic, pendulous microbial biofilms from the
Frasassi cave system, Italy. Environ Microbiol 2007, 9, 140214.
Logares R, Sunagawa S, Salazar G, et al. Metagenomic 16S rDNA Illumina tags are a powerful
alternative to amplicon sequencing to explore diversity and structure of microbial communities. Environ Microbiol 2014, 16, 265971.