International Journal of

Environmental Research
and Public Health

Article
Exploring the Impacts of Anthropogenic Disturbance
on Seawater and Sediment Microbial Communities in
Korean Coastal Waters Using Metagenomics Analysis
Nam-Il Won 1 , Ki-Hwan Kim 2 , Ji Hyoun Kang 3 , Sang Rul Park 4 and Hyuk Je Lee 5, *
1 K-Water Institute, Korea Water Resources Corporation, Daejeon 34350, Korea; [email protected]
2 Gencube, Seoul 10110, Korea; [email protected]
3 Korean Entomological Institute, Korea University, Seoul 02841, Korea; [email protected]
4 Estuarine and Coastal Ecology Laboratory, Department of Marine Life Sciences, Jeju National University,
Jeju 63243, Korea; [email protected]
5 Molecular Ecology and Evolution Laboratory, Department of Biological Science, Sangji University,
Wonju 26339, Korea
* Correspondence: [email protected]; Tel.: +82-33-730-0436; Fax: +82-33-730-0430

Academic Editor: Helena Solo-Gabriele

Received: 4 November 2016; Accepted: 10 January 2017; Published: 27 January 2017

Abstract: The coastal ecosystems are considered as one of the most dynamic and vulnerable
environments under various anthropogenic developments and the effects of climate change.
Variations in the composition and diversity of microbial communities may be a good indicator
for determining whether the marine ecosystems are affected by complex forcing stressors. DNA
sequence-based metagenomics has recently emerged as a promising tool for analyzing the structure
and diversity of microbial communities based on environmental DNA (eDNA). However, few studies
have so far been performed using this approach to assess the impacts of human activities on the
microbial communities in marine systems. In this study, using metagenomic DNA sequencing
(16S ribosomal RNA gene), we analyzed and compared seawater and sediment communities between
sand mining and control (natural) sites in southern coastal waters of Korea to assess whether
anthropogenic activities have significantly affected the microbial communities. The sand mining
sites harbored considerably lower levels of microbial diversities in the surface seawater community
during spring compared with control sites. Moreover, the sand mining areas had distinct microbial
taxonomic group compositions, particularly during spring season. The microbial groups detected
solely in the sediment load/dredging areas (e.g., Marinobacter, Alcanivorax, Novosphingobium) are
known to be involved in degradation of toxic chemicals such as hydrocarbon, oil, and aromatic
compounds, and they also contain potential pathogens. This study highlights the versatility of
metagenomics in monitoring and diagnosing the impacts of human disturbance on the environmental
health of marine ecosystems from eDNA.

Keywords: coastal ecosystem; environmental DNA; metagenomics; microbial community;

operational taxonomic unit (OTU); sand mining

1. Introduction
The marine ecosystem is the largest, most diverse, complex, and influential for all life on Earth,
including humans. It plays a fundamental role in the functioning of the global ecosystem and services
such as providing the balance of global water and geochemical cycles, the buffering of global climate
change, and the fisheries production for human society [1,2]. However, the global ocean health has
been under severe threat, particularly recently, predominantly due to anthropogenic pressure [3,4].
Various alarming signals such as decreasing fisheries production, oxygen depletion, and acidification

Int. J. Environ. Res. Public Health 2017, 14, 130; doi:10.3390/ijerph14020130 www.mdpi.com/journal/ijerph
Int. J. Environ. Res. Public Health 2017, 14, 130 2 of 17

have been identified in the global ocean [4]. The coastal ecosystem, in particular, might be the most
critical component of ocean health since it is affected by multifaceted stressors including various
anthropogenic activities (e.g., coastal developments) as well as natural variabilities. The ecosystem
resilience following (human) disturbance is one of the essential components in securing a sustainable
ecosystem and it has been evaluated by determining the function, structure, and biodiversity of the
target ecosystem [5].
Marine microbial communities are complex and highly diverse; on average, ocean water contains
one million microorganisms per milliliter, with thousands of unique microbial taxonomic groups [6].
They play a pivotal role in a number of ecological processes such as biogeochemical or nutrient cycling
and energy flow, serving as regulators of oxygen, carbon, and nutrient dynamics (i.e., ecosystem
functioning) [7]. In shallow coastal areas, microbial activities in bottom sediments and water column
are particularly crucial for understanding coastal ecological processes, e.g., coastal benthic-pelagic
coupling [8].
Evaluation of the structure and diversity of microorganisms or bacterial communities in coastal
ecosystems has recently been suggested to be critical to gauge their environmental status, particularly
for those that have been affected by human-driven stressors [9,10]. Microbial organisms can be
a reliable indicator for detecting or diagnosing changes in seawater ecosystems because they are
known to be sensitive to hydrologic and water quality changes exhibiting a rapid response to those
changes (e.g., [11]). They can also rapidly respond to seasonal fluctuations, including phytoplankton
abundance, grazing pressure, and nitrogen, phosphate and silica concentrations [12–14]. Moreover,
environmental parameters such as temperature, which is dependent on seasonal changes, have an
effect on the bacterial community [12,15]. Therefore, patterns of a detectable change in the structure
and diversity of microbial communities in the coastal ecosystems could reflect the “in situ” effects of
various environmental parameters (reviewed by [16]).
In Korean coastal waters, marine sand mining activities (e.g., bottom sediment load or dredging)
are routinely undertaken to supply sand materials for construction purposes, because of the recently
increasing coastal developments (Figure 1). These sand mining events continually introduce about 90-m
deep bottom sediments into deep, middle, and especially surface water layers, leading to spreading of
fine sediments up to approximately 10 km away, depending on the oceanographic conditions (N. Won,
unpublished data). Such a physical disturbance of underwater sediments causes turbidity in the
seawater, which might have a devastating effect, particularly on phototrophic organisms that require
sunlight for primary production [17]. The sand mining activity also entails the impact and risks on
the microbial community involved in toxicity, nutrient enrichment, and bioaccumulation by heavy
metals and organic pollutants [17]. Heavy metals and organic compounds contamination through
sand mining or dredging activities stems from polluted bottom sediments [18,19]. Continuous sand
mining events ultimately lead to a decrease in fisheries production [18,20], and therefore its public
concerns have been increased in local communities in Korea. However, the ecological impacts on the
marine ecosystem around the sand mining areas have not been assessed yet, primarily due to logistic
difficulties and remote locations of target areas, more than 100 km away from the main land. To our
knowledge, microbial communities have never been evaluated in terms of the possible impacts of
sand mining events on the target ecosystem in Korea, although there are a few studies that examined
the effects of sediment dredging on the marine bacterial community in different regions of the world
(e.g., the North Sea [18,19]).
 Int. J. Environ. Res. Public Health 2017, 14, 130 3 of 17

Furthermore, it has recently been suggested that “marine metagenomics” is a reliable and novel
method for assessing and monitoring environmental health status in the marine ecosystem [28].
Int. J. Environ. Res. Nevertheless,
Public Healthrelatively
2017, 14,few
130studies have so far been conducted using metagenomic DNA sequencing 3 of 17
(e.g., 16S rRNA) to directly assess the impacts of human activities on the structure and biodiversity
of microbial communities in the marine ecosystems [9,10,18,19].

Figure 1. Photo of sediment load and dredging, i.e., sand mining activity in southern coastal waters
Figure 1. PhotoofofKorea.
sediment load sand
The designated andmining
dredging, i.e.,
areas are sand mining
approximately activity
80 m deep and 100inkmsouthern coastal waters of
away from the
main land of Korea (Figure 2). Overflowing of pumped bottom sand or sediment is remarkable
Korea. The designated sand mining areas are approximately 80 m deep and 100 km away from the
around the ship and the spreading of overflowed sands is indicated as seen in the small photo.
main land of Korea (Figure 2). Overflowing of pumped bottom sand or sediment is remarkable around
the ship and theInspreading
the present study, we aimed tosands
of overflowed exploreisthe marine natural
indicated microbial
as seen in thecommunities
small photo.and the
impacts
Int. J. Environ. Res.ofPublic
sandHealth
mining activities
2017, 14, 130 on these environments in Korean waters using NGS-based DNA 4 of 17
sequencing of 16S rRNA gene. The specific objective of this study was to assess whether human-
driven coastal developments, i.e., sand mining activities, have significantly influenced seawater and
sediment microbial ecosystems. For this purpose, we analyzed and compared the structure and
diversity of microbial communities between coastal regions with continuous sand mining activities
vs. unaffected natural environments (i.e., control) during two different seasons (spring and autumn).
This study will help to better understand the mechanisms that shape bacterial diversity in this
particular ecosystem.

2. Materials and Methods

2.1. Sample Collection, Processing, and eDNA Isolation

Seawater and sediment samples were obtained from two different marine environments (“sand
mining” site (site 21, site SM) and “control” site (site 12)) in the open oceans of the South Sea in Korea
using the Van Dorn water sampler (KC Denmark, Silkeborg, Denmark) and the Van Veen grab
sampler (KC Denmark), respectively (Figure 2; Table 1). We chose site 12 as the control since loaded
and suspended fine sediments by sand mining events were observed to spread up to about 10 km
away by analyzing in-situ data measured by acoustic Doppler current profiler (ADCP, SonTek, San
Diego, CA, USA) during the present study (N. Won, unpublished data). Therefore, site 12 was
presumed to represent a “natural” environment. The collected seawater and sediment samples were
temporarily stored in sterile acid-washed Nalgene (Rochester, NY, USA) bottles and Falcon
(Pittsburgh, PA, USA) tubes, respectively. Nalgene plastic bottles were autoclaved and rinsed with
seawater prior to sampling. Sampling was performed during two different periods of April and
October 2015.

Figure 2. Maps showing the sampling sites of seawaters and sediments from southern coastal waters
Figure 2. Maps showing the sampling sites of seawaters and sediments from southern coastal waters of
of Korea. St. 21 (34°11.55′ N; 128°22.55′ E) and St. SM (34°11.17′ N; 128°24.50′ E) represent ‘sand
21 (34◦site,
Korea. St. mining’ 11.55 0
andN;St. 128
◦ 22.550 E) and St. SM (34◦ 11.170 N; 128◦ 24.500 E) represent ‘sand mining’
12 (34°15.05′ N; 128°23.68′ E) ‘control’ site. The red square area on the left map
site, and St. 12 (34◦the
represents 15.05 0 N; 128
authorized ◦ 23.680sand
on-going E) ‘control’
mining area site. The The
(St SM). redgrey
square area
area on the on
left the
mapleft map represents
represents
the marine sand research area for mining (St. 21). The dashed line indicates the Korean
the authorized on-going sand mining area (St SM). The grey area on the left map represents the marine coastal waters
up to 12 km from the main land.
sand research area for mining (St. 21). The dashed line indicates the Korean coastal waters up to 12 km
from the main
Table land.
1. Information of raw sequences of 16S ribosomal RNA (rRNA) gene from the sea water (surface,
middle and deep layers) and bottom sediment samples using Next Generation Sequencing (NGS)-MiSeq
platform. St 21 and St SM (sand mining) represent ”sand mining” sites and St 12 “control” site.
Metagenomics involves sequencing of the total DNA extracted from an environmental sample
Latitude; Sample Sampling Total Base Pair
(i.e., environmental
Site ID DNA; eDNA) containing
Longitude Type several different
Samples
Period organisms
Read Counts [21]. The metagenomics
Counts
approach has recently been proven
34°15.05′ N; to be a powerful
Surface tool to gauge “hidden”
876,484 ecosystem
263,821,684 biodiversity,
Site12 Control Middle 904,794 272,342,994
which was not possible in the past, and a number
128°23.68′ E
Deepof studies have been conducted
865,924 using this approach
260,643,124
to examine the marine microbial
34°11.55′ N; 128° communities
Sand [13,14,22–27].
Surface Next-generation
887,080 sequencing (NGS)
267,011,080
Site21 Middle April 2015 574,816 173,019,616
techniques for phylogenetically mining
22.55′ E informative markers such as the ribosomal RNA (rRNA) genes have
Deep (Spring) 511,724 154,028,924
enabled assessments 34°15.05′ N;
Site12 of the taxonomicControl diversity and structure of marine
Sediment microbial
845,526 communities [12–14].
254,503,326
128°23.68′ E
Furthermore, it has recently
34°11.55′ N;been
128° suggested
Sand that “marine metagenomics” is a reliable and novel
Site21 Sediment 741,150 223,086,150
22.55′ E mining
method for assessing and monitoring environmental health status in the marine ecosystem [28].
Surface 845,526 254,503,326
34°15.05′ N;
Nevertheless, relatively
Site12 few studies have
128°23.68′ E
Controlso far been conducted using
Middle metagenomic
1,260,066 DNA sequencing
379,279,866
Deep 1,039,742 312,962,342
Surface 1,135,076 341,657,876
Sand October 2015
Site SM Middle 1,052,748 316,877,148
mining (Autumn)
34°11.17′ N; 128° Deep 1,133,566 341,203,366
24.50′ E Sediment 1,090,470 328,231,470
Sand
Site SM Sediment 1,496,222 450,362,822
mining
Sediment 1,955,034 588,465,234
Int. J. Environ. Res. Public Health 2017, 14, 130 4 of 17

(e.g., 16S rRNA) to directly assess the impacts of human activities on the structure and biodiversity of
microbial communities in the marine ecosystems [9,10,18,19].
In the present study, we aimed to explore the marine natural microbial communities and the
impacts of sand mining activities on these environments in Korean waters using NGS-based DNA
sequencing of 16S rRNA gene. The specific objective of this study was to assess whether human-driven
coastal developments, i.e., sand mining activities, have significantly influenced seawater and sediment
microbial ecosystems. For this purpose, we analyzed and compared the structure and diversity of
microbial communities between coastal regions with continuous sand mining activities vs. unaffected
natural environments (i.e., control) during two different seasons (spring and autumn). This study will
help to better understand the mechanisms that shape bacterial diversity in this particular ecosystem.

2. Materials and Methods

2.1. Sample Collection, Processing, and eDNA Isolation

Seawater and sediment samples were obtained from two different marine environments
(“sand mining” site (site 21, site SM) and “control” site (site 12)) in the open oceans of the South
Sea in Korea using the Van Dorn water sampler (KC Denmark, Silkeborg, Denmark) and the Van Veen
grab sampler (KC Denmark), respectively (Figure 2; Table 1). We chose site 12 as the control since
loaded and suspended fine sediments by sand mining events were observed to spread up to about
10 km away by analyzing in-situ data measured by acoustic Doppler current profiler (ADCP, SonTek,
San Diego, CA, USA) during the present study (N. Won, unpublished data). Therefore, site 12
was presumed to represent a “natural” environment. The collected seawater and sediment samples
were temporarily stored in sterile acid-washed Nalgene (Rochester, NY, USA) bottles and Falcon
(Pittsburgh, PA, USA) tubes, respectively. Nalgene plastic bottles were autoclaved and rinsed with
seawater prior to sampling. Sampling was performed during two different periods of April and
October 2015.

Table 1. Information of raw sequences of 16S ribosomal RNA (rRNA) gene from the sea water
(surface, middle and deep layers) and bottom sediment samples using Next Generation Sequencing
(NGS)-MiSeq platform. St 21 and St SM (sand mining) represent “sand mining” sites and St 12
“control” site.

Latitude; Sample Sampling Read Total Base

Site ID Samples
Longitude Type Period Counts Pair Counts
Surface 876,484 263,821,684
34◦ 15.050 N; Middle 904,794 272,342,994
Site12 Control
128◦ 23.680 E Deep 865,924 260,643,124
April 2015
Surface 887,080 267,011,080
34◦ 11.550 N; Sand mining Middle
(Spring)
574,816 173,019,616
Site21
128◦ 22.550 E Deep 511,724 154,028,924
34◦ 15.050 N;
Site12 Control Sediment 845,526 254,503,326
128◦ 23.680 E
34◦ 11.550 N;
Site21 Sand mining Sediment 741,150 223,086,150
128◦ 22.550 E
Surface 845,526 254,503,326
34◦ 15.050 N; Middle 1,260,066 379,279,866
Site12 Control
128◦ 23.680 E Deep 1,039,742 312,962,342
Surface October 2015 1,135,076 341,657,876
Site SM Sand mining Middle (Autumn) 1,052,748 316,877,148
34◦ 11.170 N; Deep 1,133,566 341,203,366
128◦ 24.500 E Sediment 1,090,470 328,231,470
Site SM Sand mining Sediment 1,496,222 450,362,822
Sediment 1,955,034 588,465,234
Int. J. Environ. Res. Public Health 2017, 14, 130 5 of 17

Water samples (20 L) were collected twice (two technical replicates) at each of three different
depths—surface, middle (30 m in depth), and deep (60 m)—for each of the study sites to examine if
the structure of microbial communities changed with water depth. Seawater samples were stored at
4 ◦ C for less than 12 h unless being used immediately for filtration. The sediment samples were also
collected at identical sites as seawater samples, temporarily stored at 4 ◦ C, and then transported to the
laboratory at −80 ◦ C for DNA extraction. Unfortunately, however, we were not able to collect all the
samples (e.g., sediment samples were not obtained from the control site during October 2015).
To isolate eDNA from seawater samples, 20 L of seawater from each sample was filtered
through a 90-mm diameter, 2.5-µm GF/A filter (Whatman, Sigma-Aldrich, Darmstadt, Germany)
using Masterflex I/P tubing pump (Millipore, Darmstadt, Germany) in situ, immediately after
collection, to reduce eukaryotic cell abundances and maximize the proportion of prokaryotic
cells, as suggested by [23]. Then, the filtrate was applied directly to a 0.2-µm pore size of
cellulose membrane filter (Advantec, Dublin, CA, USA). Following filtration, each Advantec
membrane filter was stored at 4 ◦ C until DNA isolation. eDNA isolation from seawater samples
was performed on each of the filtered membranes using PowerWater® DNA Isolation Kit
(MOBIO, Qiagen, Carlsbad, CA, USA) and FastDNA® SPIN Kit (MPbio, Santa Ana, CA, USA)
following the manufacturer’s recommendations. eDNA from sediment samples was isolated
using FastDNA® SPIN Kit (MPbio). Approximately 50–100 ng of DNA was obtained from each
sample. DNA quality was assessed by a 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA) using
an Agilent RNA 6000 Pico Kit (Agilent, Santa Clara, CA, USA). All the samples from the reservoirs
were prepared using the 16S library preparation protocol and the Nextera XT DNA index kit
(Illumina, San Diego, CA, USA) to target the V3–V4 variable region of the 16S rRNA gene for
screening the bacterial biodiversity. A region of approximately 469 bp encompassing the V3–V4
hypervariable region was targeted for sequencing to maximize the effective length of the MiSeq’s
300-bp paired-end sequencing reads (see below). For the bacterial PCR amplification, the forward
primer (50 -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-CCTACGGGNGGCWGCAG-30 ;
‘TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG’ indicates the overhang adaptor sequences;
the underlined sequence indicates the target region primer) and the reverse primer (50 -GTCT
CGTGGGCTCGGAGATGTGTATAAGAGACAG-GACTACHVGGGTATCTAATCC-30 ; ‘GT CTCGT
GGGCTCGGAGATGTGTATAAGAGACAG’ indicates the overhang adaptor sequences; the underlined
sequence indicates the target region primer) were used [29]. Library quantification was performed by
real-time PCR using a CFX96 real-time system (BioRad, Hercules, CA, USA).

2.2. Sequencing and Prediction of 16S rRNA Data

The V3–V4 variable region of 16S rRNA was targeted and amplified. The amplicons were
sequenced into 300-bp paired-end reads according to the Illumina MiSeq (San Diego, CA, USA)
sequencing protocol. Raw data were trimmed using Trimmomatic v0.35 [30], and subsequently
the quality control of raw data was included to filter out reads of quality scores <30 using FastQC
v0.11.4 [31]. Each set of paired-end reads, which passed the quality check, was merged using FLASH
v1.2.11 [32] to employ longer sequences.

2.3. Metagenome Predictions from 16S rRNA Data

Merged sequence data were analyzed in Quantitative Insights into Microbial Ecology (QIIME)
1.9.1 [33], an open-source bioinformatics pipeline for metagenome analysis. To perform each
metagenome analysis for our experimental design, metadata and fasta files for each of the
experiments were produced for applying in further analyses, along with the QIIME labeling step
(add_qiime_labels.py). Next, operational taxonomic units (OTUs) were assigned with a similarity
of 97% against Greengenes 13_8 [34] using uclust [35] through open-reference OTU assignment step
including taxonomy assignment, sequence alignment, and tree building (pick_open_reference_otus.py).
Using a summary of OTU-assignment step into biom-format (biom summarize), alpha and beta
Int. J. Environ. Res. Public Health 2017, 14, 130 6 of 17

diversities that were calculated based on Unifrac distance matrix and principal coordinate analysis
(PCA) were generated using the core diversity test step (core_diversity_analyses.py).

2.4. 16S rRNA Sequence Assembly and Statistical Analysis

Processing of raw data was performed by removing the overhang adaptor sequences that can
be presented at the terminal of each read with Trimmomatic v0.33 using MiSeq NGS platform that
targeted variable regions from V3 to V4 of the 16S rRNA gene. Reads having a quality score of <30
were excluded using FastQC v0.11.3, and trimmed sequence data were obtained (Table 1). Paired-end
Int. J. Environ. Res. Public Health 2017, 14, 130 6 of 17
reads per sample were collapsed to a single read by combining each of the pair reads using FLASH
v1.2.11. Metagenome
2.4. 16S rRNA analysis using and
Sequence Assembly QIIME is an
Statistical open-source comprehensive program package that
Analysis
is used to analyze Processing of raw data was performed by removingonly
microorganism NGS data. Further, the read
the overhang that had
adaptor the quality
sequences that can be score higher
presented at the terminal of each read with Trimmomatic v0.33
than the specific standard was selected through quality filtering per merged sample, and analysisusing MiSeq NGS platform that
targeted variable regions from V3 to V4 of the 16S rRNA gene. Reads having a quality score of <30
was performed for the samples by grouping them into surface layer (water), middle layer, deep layer,
were excluded using FastQC v0.11.3, and trimmed sequence data were obtained (Table 1). Paired-
and sediment according
end reads per sampleto specific objectives
were collapsed of the
to a single readanalyses.
by combining However,
each of thethepairsamples
reads usingfrom surface
and middleFLASH
layersv1.2.11.
were combined
Metagenomebefore analysisthe formal
using QIIMEanalyses given thecomprehensive
is an open-source similar levels of diversity and
program
package that detected.
species composition is used to analyze
OTUs microorganism
corresponding NGS data. Further,
to each readonly
werethe read that hadusing
searched the quality
BLAST search
score higher than the specific − 7 standard was selected through quality filtering per merged sample, and
(>97% identical, E-value < 10 ) based on the Greengenes 16S rRNA database, and each OTU number
analysis was performed for the samples by grouping them into surface layer (water), middle layer,
was normalized
deep layer,andand provided
sediment through
according to clustering according
specific objectives to each However,
of the analyses. taxonomical standard
the samples from (Table 1).
surface and analyzed
We statistically middle layers thewere
number combined before using
of OTUs the formal analyses given the
a Mann-Whitney U similar
test tolevels
examineof whether
diversity and species composition detected. OTUs corresponding to each read were searched using
there was a significant difference in taxonomic−7 richness between seawater (n = 12) and sediment (n = 3)
BLAST search (>97% identical, E-value < 10 ) based on the Greengenes 16S rRNA database, and each
microbial communities.
OTU number wasAn independent
normalized t-testthrough
and provided was performed to test if
clustering according to there was a difference in
each taxonomical
the numberstandard
of OTUs (Tablebetween
1). the control (n = 6) and sand mining (n = 6) sites only for the seawater
community. Another We statistically analyzed t-test
independent the number
was of OTUs usingto
conducted a Mann-Whitney
determine whetherU test to examine
there waswhether
a difference in
there was a significant difference in taxonomic richness between seawater (n = 12) and sediment (n = 3)
the numbermicrobial
of OTUs between the spring (n = 6) and autumn (n = 6) samples.
communities. An independent t-test was performed to test if there was a difference in the
These analyses could not
be done fornumber
the sediment community,
of OTUs between owing
the control (n =to6) insufficient
and sand mining sample
(n = 6)sizes.
sites only for the seawater
community. Another independent t-test was conducted to determine whether there was a difference
3. Results in the number of OTUs between the spring (n = 6) and autumn (n = 6) samples. These analyses could
not be done for the sediment community, owing to insufficient sample sizes.
3.1. Differences in Taxonomic Richness between Sand Mining vs. Control Microbial Communities
3. Results
The OTU number and the diversity of microorganisms found in the sediment community from
3.1. Differences in Taxonomic Richness between Sand Mining vs. Control Microbial Communities
the sea floor were significantly higher than those of the microorganisms found in the seawater
The OTU number and the diversity of microorganisms found in the sediment community from
community, irrespective of the sampling date and water depth (Mann-Whitney U = 0.00, p = 0.004)
the sea floor were significantly higher than those of the microorganisms found in the seawater
(Figure 3). community,
The average number
irrespective ofsampling
of the OTUs date wasandapproximately four timesUgreater
water depth (Mann-Whitney = 0.00, p =for the sediment
0.004)
community (28,908) than for the seawater community (6828). Moreover, the number of OTUs in the
(Figure 3). The average number of OTUs was approximately four times greater for the sediment
community (28,908)
seawater community than for the seawater
was significantly highercommunity
for the(6828). Moreover,
spring samples the than
numberforof OTUs in the
the autumn samples
seawater community was significantly higher for the spring samples than for the autumn samples
(independent t-test, t = 3.955, df = 10, p = 0.003) (Figure
(independent t-test, t = 3.955, df = 10, p = 0.003) (Figure 3).
3).

35000
Number of OTUs (Operational Taxonomic Units)

(a)
30000
Control
25000 Sand mining

20000

15000

10000

5000

0
ater er er nt
ew wat wat ime
fac dle Dee
p sed
Sur Mid tom
Bot

Figure 3. Cont.
Figure 3. Cont.
Int. J. Environ. Res. Public Health 2017, 14, 130 7 of 17
Int. J. Environ. Res. Public Health 2017, 14, 130 7 of 17

Number of OTUs (Operational Taxonomic Units)

30000
(b)

25000
Control
Sand mining
20000

15000

10000

5000

0
er er ater nt
wat wat pw ime
face dle Dee sed
Sur Mid o t tom
B

Figure 3. Differences in taxonomic richness in the seawater (surface, middle, deep layers) and
Figure 3. Differences in taxonomic
sediment communities richnessbyinthe
(as calculated thenumber
seawater (surface, middle,
of Operational Taxonomic deep
Unitslayers) and sediment
or OTUs)
communities (as calculated
between sand mining by
and the number
control of Operational
sites during Taxonomic
each of the sampling Units
periods, April (a)or
andOTUs)
Octoberbetween
(b) sand
mining and2015.
control sites during each of the sampling periods, April (a) and October (b) 2015.
The number of OTUs in the control site, however, did not significantly differ from that in the
The number of OTUs
sand mining in the control
site (independent site,
t-test, t =however,
0.294, df = did
10, pnot significantly
> 0.05), differ from
despite noticeable that in the sand
differences
observed in the composition and diversity between the two sites (see below). In the case of surface
mining site (independent t-test, t = 0.294, df = 10, p > 0.05), despite noticeable differences observed in
layer water from site 21 representative of the “sand mining” area, the average number observed per
the composition
sample and diversity
was the lowest atbetween
4710 duringthe two2015,
April sites (seewas
which below). Indue
probably thetocase of surface
reduced microbiallayer water
from site 21diversity
representative
caused by theof anthropogenic
the “sand mining” area,
disturbance the
to the average
surface waternumber
ecosystemobserved per sample was
by the increasing
turbidity
the lowest at and toxicity
4710 during (see2015,
April below).
which was probably due to reduced microbial diversity caused by
the anthropogenic disturbance
3.2. Differences to the
in Composition surfaceofwater
and Diversity ecosystem
Microbial by the increasing
Seawater Community between Sand turbidity
Mining vs. and toxicity
(see below).Control Sites
For the April 2015 samples, our results of microbial community in the samples from the surface
3.2. Differences in Composition
seawater layer plus the and Diversity
middle of Microbial
layer revealed Seawater
that site 12 Community
(control) comprised between Sand
microorganisms Mining vs.
in the
Control Sitesorder of the phyla Proteobacteria (79%), Bacteroidetes (8%), Actinobacteria (3%), and Cyanobacteria
(3%), while a simple composition of Proteobacteria (99%) was detected in site 21 (sand mining)
For the(Figure
April4a).2015 samples, our results of microbial community in the samples from the surface
In addition, samples from deep seawater layer in the control site consisted of
seawater layer plus the middle
microorganisms layer
in the order revealed that
of Proteobacteria siteBacteroidetes
(86%), 12 (control) comprised
(5%), microorganisms
and Actinobacteria (3%), in the
order of thewhereas
phyla samples from the (79%),
Proteobacteria sand mining site consisted
Bacteroidetes (8%),ofActinobacteria
microorganisms (3%),in the and
orderCyanobacteria
of
(3%), whileProteobacteria (90%) and Bacteroidetes (4%) (Figure 4a).
a simple composition of Proteobacteria (99%) was detected in site 21 (sand mining)
The community composition of the upper seawater layer ecosystems between the sand mining
(Figure 4a).and control sites in spring turnedfrom
In addition, samples out to deep seawater
be apparently layeralthough
divergent, in thethe control site consisted of
microorganisms
microorganisms inbelonged
identified the order ofsame
to the Proteobacteria (86%), The
phylum Proteobacteria. Bacteroidetes
subphylum-level(5%), and Actinobacteria
microbial community (3%),
analysis for the samples from the surface seawater layer plus the middle layer
whereas samples from the sand mining site consisted of microorganisms in the order of Proteobacteriashowed that within
the order Oceanospirillales, Candidatus Portiera and others comprised 43%, followed by
(90%) and Bacteroidetes (4%) (Figure 4a).
Rhodobacteraceae at 10% in the control site, while samples from the sand mining site consisted of
The community
microorganisms in the orderof
composition ofthe upper seawater
Sphingomonadaceae layerSphingomonas;
(genus ecosystems67%), between the sand mining and
Oxalobacteraceae
(8%), Caulobacteraceae (8%), Bradyrhizobiaceae (3%), and Methylobacteriaceae
control sites in spring turned out to be apparently divergent, although the microorganisms (3%) (Figure 5). identified
belonged to the same phylum Proteobacteria. The subphylum-level microbial community analysis
for the samples from the surface seawater layer plus the middle layer showed that within the order
Oceanospirillales, Candidatus Portiera and others comprised 43%, followed by Rhodobacteraceae at
10% in the control site, while samples from the sand mining site consisted of microorganisms in the
order of Sphingomonadaceae (genus Sphingomonas; 67%), Oxalobacteraceae (8%), Caulobacteraceae
(8%), Bradyrhizobiaceae (3%), and Methylobacteriaceae (3%) (Figure 5).
Int. J. Environ. Res. Public Health 2017, 14, 130 8 of 17
Int. J. Environ. Res. Public Health 2017, 14, 130 8 of 17

100
(a) Control (surface + middle)
SM (surface + middle)
80 Control (deep)
SM (deep)

Proportion (%) 60

40

20

0
ria tes ria ria 06 ota bia
c te de c te cte R4 ae cro
ob
a
t e roi o ba oba SA arch o mi
ote c ti n an ry c
Pr Ba Ac Cy Eu rru
Ve
100
(b) Control (surface + middle)
SM (surface + middle)
Control (deep)
80
SM (deep)
Proportion (%)

60

40

20

0
ia ia tes 6 ia ia ta s xi
ter ter ide
40 ter icrob eo ycete rofle
b ac b ac r o S AR b ac m r c ha m l o
o
ote Cyan Bac
o te tin
o co rya ancto Ch
Pr Ac Verru Eu Pl

Figure 4. The
Figure 4. The phylum
phylum level
level taxonomic
taxonomic classification
classification and
and comparison
comparison of
of bacterial
bacterial reads
reads of
of 16S
16S rRNA
rRNA
from
from seawater samples (surface, middle, deep layers) between sand mining and control sites during
seawater samples (surface, middle, deep layers) between sand mining and control sites during
the
the sampling
sampling periods of April
periods of April (a)
(a) and
and October
October (b)
(b) 2015.
2015. SM:
SM: sand
sand mining.
mining.

These results suggest that either Sphingomonas as a result of physical stress within sand mining
These results suggest that either Sphingomonas as a result of physical stress within sand mining
areas was predominant as a response to degrading toxic compounds yielded by sand mining
areas was predominant as a response to degrading toxic compounds yielded by sand mining activities
activities or Oxalobacteraceae and Caulobacteraceae were present in large quantities probably due to
or Oxalobacteraceae and Caulobacteraceae were present in large quantities probably due to being
being engaged in nitrogen fixation ([17]; see below).
engaged in nitrogen fixation ([17]; see below).
The results of the deep (seawater) layer microbial communities in April also showed that
The results of the deep (seawater) layer microbial communities in April also showed that
microorganisms were present in the order of Pseudoalteromonas (42%), Candidatas Portiere (10%), and
microorganisms were present in the order of Pseudoalteromonas (42%), Candidatas Portiere (10%),
Pelagibacteraceae (9%) in the control site, while those in the sand mining site were found in the order
and Pelagibacteraceae (9%) in the control site, while those in the sand mining site were found in
of Pseudoalteromonas (39%), Vibrionaceae (10%), and Candidatas Portiere (9%) (Figure 5).
the order of Pseudoalteromonas (39%), Vibrionaceae (10%), and Candidatas Portiere (9%) (Figure 5).
Vibrionaceae, which never appeared in the control site, was also observed, but its population was not
Vibrionaceae, which never appeared in the control site, was also observed, but its population was not
as high as in the sample from the upper seawater community (e.g., surface layer plus middle layer),
as high as in the sample from the upper seawater community (e.g., surface layer plus middle layer),
probably due to the relatively negligible effects of sand mining on the deeper water community.
probably due to the relatively negligible effects of sand mining on the deeper water community.
Int. J. Environ. Res. Public Health 2017, 14, 130 9 of 17
Int. J. Environ. Res. Public Health 2017, 14, 130 9 of 17

80
Control (surface + middle)
70 SM (surface + middle)
Control (deep)
60 SM (deep)

Proportion (%) 50

40

30

20

10

0
Ps Ps ada ter

ba lia e
et b ra s

M ba rac e
Br hyl ria ae
yr ac ae

hi C bia m

ba m s

O atu ac e
ph n o e
ro pir ra
on ba e

Pe oa om ae

R Co tera as

an Vib era ae

ac s
ria
M xalo cte ona

gi o a

ob le
do el ea
lo te ea

n a
Al ea s P ea
om ulo ea
zo riu

ap os rtie
la lter on
c on
et cte e
ad ob ce

di rio ce
ud ud ce

ct ce

te
c

te illa
ho lw c
hy ac c

ng a c
hi te
O loba om
g
au n
C phi

d
S

c
C
Sp

Figure 5. The subphylum level (family; genus) taxonomic classification and comparison of bacterial
Figure 5. The subphylum level (family; genus) taxonomic classification and comparison of bacterial
reads of 16S rRNA from seawater samples (surface, middle, deep layers) between sand mining and
reads of 16S rRNA from seawater samples (surface, middle, deep layers) between sand mining and
control sites during the sampling period of April 2015. SM: sand mining.
control sites during the sampling period of April 2015. SM: sand mining.

The apparent differences in the structure of microbial communities between sand mining and
Theenvironments
control apparent differences
in April in the rather
were structure of microbial
uncertain communities
in October between
(Figure 4b). sand mining
Microbial community and
control environments in April were rather uncertain in October (Figure
analysis at the phylum level from the surface and middle layer samples collected in October showed 4b). Microbial community
analysis
that at the phylumwere
microorganisms levelpresent
from the insurface andof
the order middle layer samples
Proteobacteria (49%),collected in October
Bacteroidetes showed
(21%), and
that microorganisms were present in the order of Proteobacteria (49%),
Cyanobacteria (19%) in the control site, whereas the microbial taxa composition in the sand mining Bacteroidetes (21%), and
Cyanobacteria (19%) in the control site, whereas the microbial taxa composition
site was in the order of Proteobacteria (52%), Bacteroidetes (19%), and Cyanobacteria (19%) (Figure in the sand mining
site was
4b). in the
For the deeporder of Proteobacteria
seawater community, (52%), Bacteroideteswere
microorganisms (19%), and Cyanobacteria
present in the order of (19%) (Figure 4b).
Proteobacteria
(54%), Bacteroidetes (17%), and Cyanobacteria (10%) in the control site, while those in the(54%),
For the deep seawater community, microorganisms were present in the order of Proteobacteria sand
Bacteroidetes
mining site were(17%),
found andinCyanobacteria (10%) in the control
the order of Proteobacteria site, while those
(51%), Bacteroidetes in the
(17%), and sand mining site
Cyanobacteria
were found in the order of Proteobacteria (51%), Bacteroidetes (17%), and Cyanobacteria (17%).
(17%).
Again, there
Again, there were
wereno noobvious
obviousdifferences
differences in in
thethe compositions
compositions of microorganisms
of microorganisms between
between the
the samples
samples collected
collected in October
in October at at thethe subphylumlevel
subphylum level(family,
(family, genus)
genus) (Figure
(Figure S1,S1, Electronic
Electronic
Supplementary Material).
Supplementary Material). When Whencompared
compared with with the
the samples
samples collected
collected inin April,
April, the
the number
number of of
Proteobacteria was significantly reduced, suggesting that seasonal differences
Proteobacteria was significantly reduced, suggesting that seasonal differences existed (Figure S1). existed (Figure S1).
Furthermore, microorganism
Furthermore, microorganismcommunity community analysis
analysis at subphylum
at the the subphylum level level
for thefor the surface
surface plus
plus middle
middle layer samples collected in October showed that microorganisms
layer samples collected in October showed that microorganisms were found in the order of were found in the order
of Pelagibacteraceae
Pelagibacteraceae (16%),
(16%), Synechococcaceae
Synechococcaceae (16%),
(16%), Flavobacteriaceae
Flavobacteriaceae (9%),(9%), Alphaproteobacteria
Alphaproteobacteria (9%),
(9%), and Rhodobacteraceae (8%) in the control site, while those in the sand
and Rhodobacteraceae (8%) in the control site, while those in the sand mining site were found in the mining site were found
in the of
order order of Synechococcaceae
Synechococcaceae (17%),(17%), Pelagibacteraceae
Pelagibacteraceae (15%),(15%), and Flavobacteriaceae
and Flavobacteriaceae (9%). Deep
(9%). Deep layer
layer samples
samples collected
collected in October
in October contained
contained microorganisms
microorganisms in inthethe orderofofPelagibacteraceae
order Pelagibacteraceae (18%),(18%),
Synechococcaceae (9%),
Synechococcaceae (9%), Flavobacteriaceae
Flavobacteriaceae (7%), (7%), and
and Alphaproteobacteria
Alphaproteobacteria(7%) (7%) inin the
the control
control site,
site,
while microorganisms in the sand mining site were found in the order
while microorganisms in the sand mining site were found in the order of Pelagibacteraceae (17%), of Pelagibacteraceae (17%),
Synechococcaceae (15%),
Synechococcaceae (15%),Flavobacteriaceae
Flavobacteriaceae (8%), andand
(8%), Alphaproteobacteria
Alphaproteobacteria (8%), (8%),
indicating the abrupt
indicating the
increases of Synechococcaceae in comparison with those in the control
abrupt increases of Synechococcaceae in comparison with those in the control site (Figure S1). site (Figure S1).

3.3. Differences in Composition and Diversity of Microbial Sediment Community between Sand Mining vs.
Control Sites
For the microbial sediment community, phylum-level analysis of the April samples showed that
microorganisms were found in the order of Proteobacteria (50%), Planctomycetes (7%), Chloroflexi
Int. J. Environ. Res. Public Health 2017, 14, 130 10 of 17

3.3. Differences in Composition and Diversity of Microbial Sediment Community between Sand Mining vs.
Control Sites
For the microbial sediment community, phylum-level analysis of the April samples showed
Int. J. Environ. Res. Public Health 2017, 14, 130
that
10 of 17
microorganisms were found in the order of Proteobacteria (50%), Planctomycetes (7%), Chloroflexi (7%),
and Acidobacteria
(7%), (6%) in
and Acidobacteria thein
(6%) control site, while
the control microorganisms
site, while in the in
microorganisms sand
themining site were
sand mining sitefound
were
in the order
found in the of Proteobacteria
order (51%),(51%),
of Proteobacteria Planctomycetes (7%), Acidobacteria
Planctomycetes (6%), (6%),
(7%), Acidobacteria and Chloroflexi (5%),
and Chloroflexi
indicative of similar community composition between the sites (Figure 6). Accordingly,
(5%), indicative of similar community composition between the sites (Figure 6). Accordingly, composition of
the microbialofcommunity
composition the microbialat community
the subphylum level
at the from thelevel
subphylum sediment
from samples collected
the sediment in April
samples was
collected
also
in similar
April was between thebetween
also similar sites as seen in the
the sites as phylum-level communitycommunity
seen in the phylum-level analysis (Figure S2).(Figure S2).
analysis

60
Control
SM (Sand Mining)
50

40
Proportion (%)

30

20

10

0
G ia
im sp i
id yc a

co W a

ct i
C ide a

ac s

N ria
ch rix
c t ac t s

tin ad e

ic 3

ya h s

BR 9

P8
Sp al 4

1
at ro ex

ba ob
ob ete
Ba ob ete

hl te

C C ete
Ac om teri

ri
o i

Ac on ira

m S

C N0

1
C
b
er er

iro dith
te

e
KB

O
m Nit rofl

ro

no lor
a
c t ac

o
an b
Pl teo

rru
o
Pr

Ve
em
G

The phylum
Figure 6. The
Figure phylum level
level taxonomic
taxonomic classification
classification and
and comparison
comparison of
of bacterial
bacterial reads
reads of
of 16S
16S rRNA
rRNA
from bottom
from bottom sediment
sediment samples
samples between
between sand
sand mining
mining (SM)
(SM) and
and control
control sites
sites during
during the
the sampling
sampling
period of April 2015.

Besides, microorganismcomposition
Besides, microorganism compositionfrom fromthethesamples
samplescollected
collectedin in three
three replications
replications only
only fromfrom
the
the site SM (sand mining) in October was in the order of Proteobacteria (50.6%),
site SM (sand mining) in October was in the order of Proteobacteria (50.6%), Planctomycetes (9%), and Planctomycetes (9%),
and Acidobacteria
Acidobacteria (5.6%).(5.6%). Results
Results of genus-level
of genus-level microbial
microbial communitycommunity
analysisanalysis for the sediment
for the sediment samples
samples collected in October showed that microorganisms were found
collected in October showed that microorganisms were found in the order of Piscirickettsiaceae (6%), in the order of
Piscirickettsiaceae (6%), Desulfococcus (4.3%), and Alphaproteobacteria (3%),
Desulfococcus (4.3%), and Alphaproteobacteria (3%), showing no apparent differences in the dominant showing no apparent
differences in the dominant
taxonomic groups by season or taxonomic
site. These groups
resultsbycanseason or site. to
be attributed These results caneffects
less significant be attributed to
of seasonal
less significant effects of seasonal or sand mining on the sediment microbial
or sand mining on the sediment microbial community as compared with that in the seawater, but the community as compared
with
overallthat
OTU in numbers
the seawater, but the overall
were drastically reduced OTU numbers
in terms were drastically
of taxonomic diversity reduced
comparedinwithterms of
those
taxonomic diversity compared
collected in April (Figure 3). with those collected in April (Figure 3).
Furthermore,
Furthermore, uniqueunique microorganisms
microorganisms were were categorized
categorized by by the
the depth
depth of of seawater
seawater and
and sediment
sediment
occurring
occurring only
only in in the
the samples
samples fromfrom thethe sand
sand mining
mining sites
sites (Tables
(Tables 22 and
and 3).3). The
The large
large number
number of of
microbial taxonomic groups showed that the dominance of Micrococcus
microbial taxonomic groups showed that the dominance of Micrococcus is probably due to physical is probably due to physical
stress
stress within
within thethe sand
sand mining
mining sites,
sites, and
and that
that Sphingomonas
Sphingomonas might might bebe involved
involved in in toxic
toxic compound
compound
degradation
degradation (Figure
(Figure 5; 5; [36]),
[36]), and
and Oxalobacteraceae
Oxalobacteraceae and and Caulobacteraceae
Caulobacteraceae are are engaged
engaged in in nitrogen
nitrogen
fixation. Moreover, several groups of microorganisms are involved
fixation. Moreover, several groups of microorganisms are involved in hydrocarbon degradation in hydrocarbon degradation
(Marinobacter),
(Marinobacter), oil degradation (Alcanivorax),
oil degradation (Alcanivorax), aromatic compound degradation
aromatic compound degradation (Novosphingobium),
(Novosphingobium),
sulfate-methane zone existence (Desulfofaba), or potential pathogens (Parabacteroides,
sulfate-methane zone existence (Desulfofaba), or potential pathogens (Parabacteroides, Coxiella). Coxiella).
Int. J. Environ. Res. Public Health 2017, 14, 130 11 of 17

Table 2. Microbial taxonomic groups that were only detected in the seawater samples from the sand
mining sites.

Sample Class Family Genus

Cenarchaeales Cenarchaeaceae -
Flavobacteriales Flavobacteriaceae Mesonia
Ignavibacteriales Ignavibacteriaceae -
Kordiimonadales Kordiimonadaceae -
Burkholderiales Alcaligenaceae -
Surface water
Alteromonadales Alteromonadaceae Marinobacter
Alteromonadales Idiomarinaceae Pseudidiomarina
Oceanospirillales Alcanivoracaceae Alcanivorax
Oceanospirillales Halomonadaceae Cobetia
Marinicellales Marinicellaceae Marinicella
Bacteroidia Bacteroidaceae Bacteroides
Bacteroidia Porphyromonadaceae Parabacteroides
Flavobacteriia Flavobacteriaceae Cellulophaga
Flavobacteriia Weeksellaceae -
Clostridia Lachnospiraceae Lachnospira
Clostridia Veillonellaceae Succiniclasticum
Middle water
Clostridia Acidaminobacteraceae Fusibacter
Fusobacteriia Fusobacteriaceae Propionigenium
Alphaproteobacteria Erythrobacteraceae -
Alphaproteobacteria Sphingomonadaceae Novosphingobium
Deltaproteobacteria Desulfarculaceae -
Deltaproteobacteria Desulfobacteraceae Desulfofaba
Actinobacteria Micrococcaceae Micrococcus
Cytophagia Amoebophilaceae Ucs1325
Chlamydiia Simkaniaceae -
Ignavibacteria lheB3-7 -
Synechococcophycideae Synechococcaceae -
Bacilli Streptococcaceae Streptococcus
Alphaproteobacteria Kiloniellaceae Thalassospira
Alphaproteobacteria Rhodospirillaceae -
Deep water
Alphaproteobacteria Erythrobacteraceae Erythrobacter
Deltaproteobacteria Desulfarculaceae -
Deltaproteobacteria Desulfobacteraceae Desulfosarcina
Deltaproteobacteria Syntrophaceae Desulfobacca
Gammaproteobacteria Coxiellaceae Coxiella
Gammaproteobacteria Halomonadaceae Haererehalobacter
Gammaproteobacteria Oceanospirillaceae Oleibacter
PRR-12 KSB4 -
The genus in bold is known to be involved in toxic chemical degradation or pathogenic pollution (see Results
and Discussion).
Int. J. Environ. Res. Public Health 2017, 14, 130 12 of 17

Table 3. Microbial taxonomic groups that were only detected in the bottom sediment samples from the
sand mining sites.

Sample Class Family Genus

Actinobacteria Bifidobacteriaceae Bifidobacterium
Fimbriimonadia Fimbriimonadaceae -
Bacteroidia Bacteroidaceae Bacteroides
Flavobacteriia Cryomorphaceae -
Flavobacteriia Cryomorphaceae Cryomorpha
Flavobacteriia Cryomorphaceae Owenweeksia
Rhodothermi Balneolaceae Balneola
Synechococcophycideae Synechococcaceae Prochlorococcus
Bacilli Planococcaceae Sporosarcina
Bacilli Thermoactinomycetaceae -
Clostridia Clostridiaceae Alkaliphilus
Clostridia Clostridiaceae Geosporobacter
Clostridia Lachnospiraceae -
Clostridia Lachnospiraceae Coprococcus
Clostridia Lachnospiraceae Lachnospira
Clostridia Peptostreptococcaceae -
Clostridia Ruminococcaceae Faecalibacterium
Clostridia Ruminococcaceae Ruminococcus
Bottom sediments Clostridia Veillonellaceae Dialister
Clostridia Veillonellaceae Megamonas
Clostridia Acidaminobacteraceae -
Fusobacteriia Fusobacteriaceae u114
Alphaproteobacteria Methylocystaceae Pleomorphomonas
Alphaproteobacteria Rhodobiaceae Afifella
Alphaproteobacteria Rhodobacteraceae Marivita
Alphaproteobacteria Rhodobacteraceae Thalassobius
Alphaproteobacteria Rhodospirillaceae Novispirillum
Alphaproteobacteria Rhodospirillaceae Rhodospirillum
Alphaproteobacteria AEGEAN_112 -
Deltaproteobacteria S25_1238 -
Deltaproteobacteria SAR324 -
Gammaproteobacteria Psychromonadaceae -
Gammaproteobacteria Legionellaceae Legionella
Gammaproteobacteria Legionellaceae Tatlockia
Gammaproteobacteria Oceanospirillaceae Oleispira
AB16 A714017 SargSea-WGS
Mollicutes Mycoplasmataceae Candidatus Hepatoplasma
The genus in bold is known to be involved in toxic chemical degradation or pathogenic pollution (see Results
and Discussion).

4. Discussion
Microbial communities are an essential component of coastal ecosystems as they play an
indispensable role in ecosystem functioning and providing services such as biogeochemical cycles,
degradation of organic materials, energy production, food web dynamics, and climate change
regulation [6]. In particular, coastal ecosystems harbor large numbers of microorganisms, which may be
an order of magnitude higher with higher productivity and higher load of organic matter and nutrients,
compared with any other marine systems [6]. Coastal microbial communities are highly dynamic
over space and time in response to environmental heterogeneities such as day length, temperature,
water depth, oceanic currents, and inorganic nutrients [13,14]. During the last decade, a number of
studies on natural microbial communities in marine environments have been performed using an
NGS-based metagenomics approach to explore the diversity, community structure or composition,
and its seasonal variation from various oceanic regions worldwide (e.g., [13,23,24,28,37,38]), yet,
relatively little attention has been paid to the impacts of anthropogenic disturbances such as “sand
Int. J. Environ. Res. Public Health 2017, 14, 130 13 of 17

mining” activity on the marine ecosystem using genomic DNA analysis from a whole microbial
community [9,10,18,19]. A recent study with a metagenomics approach revealed that shifts in microbial
composition within Sydney Harbor, Australia, which is one of the most anthropogenically highly
impacted urban estuaries, were strongly linked to an enrichment of total microbial metabolic pathways
including phosphorus and nitrogen metabolism, sulfate reduction, virulence, and the degradation of
hydrocarbons [9]. Sand dredging is suggested to have a remarkable influence on the entire marine
community in the North Sea comprised of phyto- and zooplanktons, suspended, benthic filter feeders
and pelagic fish [18]. There are few studies that have examined the natural microbial communities in
the Korean marine ecosystems [14], although a few results have so far been documented by applying
metagenomics to screen or characterize functionally significant enzymes or biochemicals from the mud
flat ecosystem [39,40]. Our study is the first, to our knowledge, to explore the structure and diversity
of microbial communities in the Korean seawaters, with a focus on the impacts of anthropogenic
disturbance, i.e., sand mining activity, on the coastal ecosystem. Although the number of our study
sites analyzed is rather small (one each for the sand mining and control environments), our results
show that sand mining regions had an apparent loss in microbial taxonomic diversity and also differed
in bacterial composition, especially in surface water communities in spring season. Sand mining
activity is now being performed year-round on a daily basis under the legislative control by the Korean
government since 2004 depending on oceanographic conditions. Therefore, it would be conceivable
that the observed differences in the microbial diversity and composition between the sand mining
and control environments might be attributed to the overflowing of pumped bottom sediment driven
by dredging, resulting in increasing turbidity and toxicity [17]. However, future studies with more
extensive sampling (e.g., seawater sampling of moving water flow via the ocean currents rather than
that of a fixed spot) are certainly required to better understand the “in situ” effects of sand mining
disturbances on the target ecosystem [13]. The results of the analysis of the structure and diversity of
microbial communities in the seawater and sediment environments reported here will represent the
basis for future efforts on understanding the ecological or environmental factors that play a role in
shaping microbial communities in the Korean waters.
The bacterial taxonomic diversity as estimated by the number of OTUs is far greater in the
sediment community than in the seawater community, regardless of the sampling period and location
(Figure 3). A previous study on the composition of microbial assemblages in the Changjiang estuary
and coastal regions of the East China Sea found that bacterial diversity in the sediment samples was
much greater than that in the seawater samples and also Proteobacteria (72.9%) was the most dominant
phylum in the sediment [37]. Moreover, sediment from the Antarctic continental shelf consisted of
Proteobacteria as the most predominant bacterial lineage comprising >50% of the microbial biomass
analyzed [41]. Similarly, our results also indicate that Proteobacteria is the most abundant phylum
and comprises approximately 50% of the sediment bacterial assemblages in both the sand mining and
control sites. However, this trend was not observed in deep-sea offshore oceans; taxonomic richness
was found to be generally highest in the surface seawater and lowest in the seafloor sediment for
deep-sea environments [38].
The reduced microbial diversity and the changes in the composition of the bacterial assemblages
in the perturbed area can be attributed to the complicated impacts of the possible pollutants including
suspended particles, nutrients, organic pollutants and heavy metals, entailed by the sediment load
and dredging, i.e., sand mining activity (Figure 1) [17]. Previous studies suggest that heavy metals and
organic compounds contamination through sand mining or dredging activities originate from polluted
bottom sediments in the North Sea [18,19]. The data obtained from the sample of both the surface
and middle seawaters from the sand mining site collected in April strongly support such a trend.
There are prominent differences in the microbial diversity at the phylum and subphylum (family and
genus) levels. For example, surface and middle seawater microbial communities at the sand mining
site during April comprised exclusively Proteobacteria (99%), while those at the control site consisted
of only 79% of Proteobacteria (Figure 4a). Furthermore, the phyla Bacteroidetes (8%), Actinobacteria
Int. J. Environ. Res. Public Health 2017, 14, 130 14 of 17

(3%), Cyanobacteria (3%), Euryarchaeota (2%), and Verrucomicrobia (1%) were found in the surface
and middle seawater communities at the control site, but none were found in the sand mining site.
These results of predominance of Proteobacteria in the seawater regardless of location are consistent
with previous findings that this phylum comprised 63%–95% of the bacterial communities year-round
in Gosung Bay on the southern coast of Korea [14]. Plausible ecological impacts involved with
the sediment load/dredging include increasing turbidity, the resulting decrease in light penetration
and nutrient enrichment, and toxicity [17]. The nonappearance of phototrophic microorganisms,
Cyanobacteria, in the upper seawater communities in the sand mining sites suggests that suspended
particles by dredging certainly blocked light absorption into the upper water layer, which results
in the lack of phototrophic bacteria there. The differences in water reflectance observed between
the sand mining and control sites based on satellite data from Geostationary Ocean Color Imager
(GOCI) can support this hypothesis (N. Won, unpublished data). However, the microbial diversity and
composition in the samples collected in October did not greatly differ when compared with those in
April. These results might be due to seasonal changes in hydrography, such as movement of seawater
flow and other environmental factors including day length [13], water temperature [12], salinity, and
inorganic nutrients such as phosphate and nitrate concentrations [14]. The lack of differences in the
composition and diversity of microbial assemblages between the sand mining vs. control sites in
October is possibly due to the mixed overwhelming effects of typhoons with strong winds and storms
on the study ecosystem [16,42].
In the case of the sediment microbial community, the composition and diversity of dominant
taxonomic groups did not greatly change as those in the seawater community by season and location.
These findings might suggest that the sediment bacterial community from the sea floor is perhaps
more stable over space and time [38] or even more resilient following devastating disturbances such as
sand mining activities. However, this hypothesis needs to be validated in further studies.
Our study allows for identifying the microbial taxonomic groups exclusively occurring in
the sand mining sites (Tables 2 and 3). Interestingly, several groups of microorganisms solely
detected in the seawater communities from the disturbed areas are known to be involved in the
degradation of toxic chemicals including hydrocarbons (Marinobacter) [43], oil (Alcanivorax) [44],
aromatic compounds (Novosphingobium) [45], sulfate-methane reduction (Desulfofaba), or they possess
pathogenic characteristics (Parabacteroides, Coxiella). Similarly, some bacterial groups occurring
only at the bottom sediments from the sand mining site have chemoorganotrophic (Geosporobacter),
hydrocarbonoclastic (Oleispira), or pathogenic (Legionella) features. These results are consistent with a
previous report that sediment load and dredging can give rise to toxicity and biopollution in marine
environments [17].

5. Conclusions
In this study, using a metagenomic DNA sequencing (16S rRNA gene) approach, we showed
that the human disturbance and the sand mining activity, can result in a remarkable loss of diversity
and changes in the composition of microbial surface seawater assemblages in the South Sea of Korea.
We also found that the microbial taxonomic groups present only in the perturbed environments are
involved in pollutant-associated biological processes. The findings reported here can be directly
applied to the evaluation and monitoring of the impacts of human-mediated environmental pollution
on the distribution and diversity of microbial groups in the marine ecosystems in the future.

Supplementary Materials:
The following are available online at www.mdpi.com/1660-4601/14/2/130/s1, Figure S1: The subphylum
level (family; genus) taxonomic classification and comparison of bacterial reads of 16S rRNA from seawater
samples (surface, middle, deep layers) between sand mining and control sites during the sampling period of
October 2015, Figure S2: The subphylum level (family; genus) taxonomic classification and comparison of bacterial
reads of 16S rRNA from sediment samples between sand mining and control sites during the sampling period
of April 2015, Figure S3: Graphical representations of environmental parameters (temperature (◦ C), salinity
(practical salinity unit, PSU) and density (Sigma t, kg/m3)) obtained during sampling periods of spring and
Int. J. Environ. Res. Public Health 2017, 14, 130 15 of 17

autumn 2015 from the sand mining (SM) and control sites. Note that control site was not identical to the site (St. 12)
where seawater and sediment samples were collected. The environmental data are given as follows: station 1 (SM)
in spring (A), station 5 (control) in spring (B), station 1 (SM) in autumn (C) and station 6 (control) in autumn (D).
Acknowledgments: This study was supported by the Korea Water Resources Corporation (Project title: Study on
coastal marine ecosystem structures and suspended sediment in the EEZ sand mining zone of Korean coastal
waters) to Nam-Il Won and by the Ministry of Oceans and Fisheries, Korea (Project title: Long-term changes in
structure and function in the marine ecosystems of Korea) to Hyuk Je Lee and Sang Rul Park. We thank Ji Eun Jang
and Jae Hwan Kim for helping to collect and process seawater samples in the field.
Author Contributions: Nam-Il Won, Ki-Hwan Kim, Sang Rul Park and Hyuk Je Lee conceived and designed
the experiments; Nam-Il Won, Ki-Hwan Kim, Ji Hyoun Kang and Hyuk Je Lee performed the experiments;
Nam-Il Won, Ki-Hwan Kim and Hyuk Je Lee analyzed the data; Nam-Il Won, Ki-Hwan Kim and Hyuk Je Lee
wrote the paper.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Palumbi, S.R.; Sandifer, P.A.; Allan, J.D.; Beck, M.W.; Fautin, D.G.; Fogarty, M.J.; Halpern, B.S.; Incze, L.S.;
Leong, J.A.; Norse, E.; et al. Managing for ocean biodiversity to sustain marine ecosystem services.
Front. Ecol. Environ. 2009, 7, 204–211. [CrossRef]
2. UNEP-WCMC. Marine and Coastal Ecosystem Services: Valuation Methods and Their Application; UNEP-WCMC
Biodiversity: Cambridge, UK, 2011.
3. Halpern, B.S.; Longo, C.; Hardy, D.; McLeod, K.L.; Samhouri, J.F.; Katona, S.K.; Kleisner, K.; Lester, S.E.;
O’Leary, J.; Ranelletti, M.; et al. An index to assess the health and benefits of the global ocean. Nature 2012,
488, 615–620. [CrossRef] [PubMed]
4. Halpern, B.S.; Longo, C.; Stewart Lowndes, J.S.; Best, B.D.; Frazier, M.; Katona, S.K.; Kleisner, K.M.;
Rosenberg, A.A.; Scarborough, C.; Selig, E.R. Patterns and emerging trends in global ocean health. PLoS ONE
2015, 10, e0117863. [CrossRef] [PubMed]
5. Oliver, T.H.; Isaac, N.J.B.; August, T.A.; Woodcock, B.A.; Roy, D.B.; Bullock, J.M. Declining resilience of
ecosystem functions under biodiversity loss. Nat. Commun. 2015, 6, 10122. [CrossRef] [PubMed]
6. Glöckner, F.O.; Stal, L.J.; Sandaa, R.A.; Gasol, J.M.; O’Gara, F.; Hernandez, F.; Labrenz, M.; Stoica, E.;
Varela, M.M.; Bordalo, A.; et al. Marine Microbial Diversity and Its Role in Ecosystem Functioning and
Environmental Chang; Marine Board Position Paper 17; Calewaert, J.B., McDonough, N., Eds.; Marine
Board-ESF: Ostend, Belgium, 2012.
7. Cardinale, B.J.; Duffy, J.E.; Gonzalez, A.; Hooper, D.U.; Perrings, C.; Venail, P.; Narwani, A.; Mace, G.M.;
Tilman, D.; Wardle, D.A.; et al. Biodiversity loss and its impact on humanity. Nature 2012, 486, 59–67.
[CrossRef] [PubMed]
8. Marcus, N.H.; Boero, F. Minireview: The importance of benthic-pelagic coupling and the forgotten role of
life cycles in coastal aquatic systems. Limnol. Oceanogr. 1998, 43, 763–768. [CrossRef]
9. Jeffries, T.C.; Schmitz Fontes, M.L.; Harrison, D.P.; Van-Dongen-Vogels, V.; Eyre, B.D.; Ralph, P.J.; Seymour, J.R.
Bacterioplankton dynamics within a large anthropogenically impacted urban estuary. Front. Microbiol. 2016,
6, 1438. [CrossRef] [PubMed]
10. Meziti, A.; Tsementzi, D.; Kormas, K.A.; Karayanni, H.; Konstantinidis, K.T. Anthropogenic effects
on bacterial diversity and function along a river-to-estuary gradient in Northwest Greece revealed by
metagenomics. Environ. Microbiol. 2016, 18, 4640–4652. [CrossRef] [PubMed]
11. Lai, X.T.; Zeng, X.F.; Fang, S.; Huang, Y.L.; Cao, L.X.; Zhou, S.N. Denaturing gradient gel electrophoresis
(DGGE) analysis of bacterial community composition in deep-sea sediments of the South China Sea. World J.
Microb. Biot. 2006, 22, 1337–1345. [CrossRef]
12. Gilbert, J.A.; Field, D.; Swift, P.; Newbold, L.; Oliver, A.; Smyth, T.; Somerfield, P.J.; Huse, S.; Joint, I. The
seasonal structure of microbial communities in the Western English Channel. Environ. Microbiol. 2009, 11,
3132–3139. [CrossRef] [PubMed]
13. Gilbert, J.A.; Steele, J.A.; Caporaso, J.G.; Steinbrück, L.; Reeder, J.; Temperton, B.; Huse, S.; McHardy, A.C.;
Knight, R.; Joint, I.; et al. Defining seasonal marine microbial community dynamics. ISME J. 2012, 6, 298–308.
[CrossRef] [PubMed]
Int. J. Environ. Res. Public Health 2017, 14, 130 16 of 17

14. Suh, S.-S.; Park, M.; Hwang, J.; Kil, E.-J.; Jung, S.W.; Lee, S.; Lee, T.-K. Seasonal dynamics of marine microbial
community in the south sea of Korea. PLoS ONE 2015, 10, e0131633. [CrossRef] [PubMed]
15. Meziti, A.; Kormas, K.A.; Moustaka-Gouni, M.; Karayanni, H. Spatially uniform but temporally variable
bacterioplankton in a semi-enclosed coastal area. Syst. Appl. Microbiol. 2015, 38, 358–367. [CrossRef]
[PubMed]
16. Fuhrman, J.A.; Cram, J.A.; Needham, D.M. Marine microbial community dynamics and their ecological
interpretation. Nat. Rev. Microbiol. 2015, 13, 133–146. [CrossRef] [PubMed]
17. Nogales, B.; Lanfranconi, M.P.; Piña-Villalonga, J.M.; Bosch, R. Anthropogenic perturbations in marine
microbial communities. FEMS Microbiol. Rev. 2011, 358, 275–298. [CrossRef] [PubMed]
18. Phua, C.; Van den Akker, S.; Baretta, M.; Van Dalfsen, J. Ecological Effects of Sand Extraction in the North Sea.
Available online: http://www.vliz.be/imisdocs/publications/154975.pdf (accessed on 4 November 2016).
19. Edlund, A.; Jansson, J.K. Changes in active bacterial communities before and after dredging of highly
polluted Baltic Sea sediments. Appl. Environ. Microbiol. 2006, 72, 6800–6807. [CrossRef] [PubMed]
20. De Jong, M.F.; Baptist, M.J.; van Hal, R.; de Boois, I.J.; Lindeboom, H.J.; Hoekstra, P. Impact on demersal
fish of a large-scale and deep sand extraction site with ecosystem-based landscaped sandbars. Estuar. Coast.
Shelf Sci. 2014, 146, 83–94. [CrossRef]
21. Bohmann, K.; Evans, A.; Gilbert, M.T.P.; Carvalho, G.R.; Creer, S.; Knapp, M.; Yu, D.W.; de Bruyn, M.
Environmental DNA for wildlife biology and biodiversity monitoring. Trends Ecol. Evol. 2015, 29, 358–367.
[CrossRef] [PubMed]
22. DeLong, E.F.; Preston, C.M.; Mincer, T.; Rich, V.; Hallam, S.J.; Friggard, N.U.; Martinez, A.; Sullivan, M.B.;
Edwards, R.; Brito, B.R.; et al. Community genomics among stratified microbial assemblages in the ocean’s
interior. Science 2006, 5760, 496–503. [CrossRef] [PubMed]
23. Gilbert, J.A.; Field, D.; Huang, Y.; Edwards, R.; Li, W.; Gilna, P.; Joint, L. Detection of large numbers of novel
sequences in the metatranscriptomes of complex marine microbial communities. PLoS ONE 2008, 3, e3042.
[CrossRef] [PubMed]
24. Gilbert, J.A.; Dupont, C.L. Microbial metagenomics: beyond the genome. Annu. Rev. Mar. Sci. 2011, 3,
347–371. [CrossRef] [PubMed]
25. Zinger, L.; Amaral-Zettler, L.A.; Fuhrman, J.A.; Horner-Devine, M.C.; Huse, S.M.; Mark Welch, D.B.;
Martiny, J.B.H.; Sogin, M.; Boetius, A.; Ramette, A. Global patterns of bacterial beta-diversity in seafloor and
seawater ecosystems. PLoS ONE 2011, 6, e24570. [CrossRef] [PubMed]
26. Kisand, V.; Valente, A.; Lahm, A.; Tanet, G.; Lettieri, T. Phylogenetic and functional metagenomic profiling
for assessing microbial biodiversity in environmental monitoring. PLoS ONE 2012, 7, e43630. [CrossRef]
[PubMed]
27. Chan, X.Y.; Arumugam, R.; Choo, S.W.; Yin, W.F.; Chan, K.G. Metagenomic sequencing of prokaryotic
microbiota from tropical surface seawater. Genome Announc. 2013, 1, e00540-13. [CrossRef] [PubMed]
28. Boulat, S.J.; Borja, A.; Gilbert, J.; Taylor, M.I.; Davies, N.; Weisberg, S.B.; Griffith, J.F.; Lettieri, T.; Field, D.;
Benzie, J.; et al. Genomics in marine monitoring: New opportunities for assessing marine health status.
Mar. Poll. Bull. 2013, 74, 19–31. [CrossRef] [PubMed]
29. Klindworth, A.; Pruesse, E.; Schweer, T.; Peplies, J.; Quast, C.; Horn, M.; Glöckner, O. Evaluation of general
16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies.
Nucleic Acids Res. 2013, 41, e1. [CrossRef] [PubMed]
30. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data.
Bioinformatics 2014, 30, 2114–2120. [CrossRef] [PubMed]
31. Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online:
http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 04 March 2016 ).
32. Magoč, T.; Salzberg, S.L. FLASH: fast length adjustment of short reads to improve genome assemblies.
Bioinformatics 2011, 27, 2957–2963. [CrossRef] [PubMed]
33. Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.;
Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data.
Nat. Methods 2010, 7, 335–336. [CrossRef]
34. DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E.L.; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.;
Andersen, G.L. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with
ARB. Appl. Environ. Microbiol. 2006, 72, 5069–5072. [CrossRef] [PubMed]
Int. J. Environ. Res. Public Health 2017, 14, 130 17 of 17

35. Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461.
[CrossRef] [PubMed]
36. Nilgiriwala, K.S.; Alahari, A.; Rao, A.S.; Apte, S.K. Cloning and overexpression of alkaline phasphatase
phoK from Sphingomonas sp. stran BSAR-1 for bioprecipitation of uranium from alkaline solutions.
Appl. Environ. Microbiol. 2008, 74, 5516–5523. [CrossRef] [PubMed]
37. Feng, B.-W.; Li, X.-R.; Wang, J-H.; Hu, Z.-Y.; Meng, H.; Xiang, L.-Y.; Quan, Z.-X. Bacterial diversity of water
and sediment in the Changjiang estuary and coastal area of the East China Sea. FEMS Microbiol. Ecol. 2009,
70, 236–248. [CrossRef] [PubMed]
38. Walsh, E.A.; Kirkpatrick, J.B.; Rutherford, S.D.; Smith, D.C.; Sogin, M.; D’Hondt, S. Bacterial diversity and
community composition from sea surface to subseafloor. ISME J. 2016, 10, 979–989. [CrossRef] [PubMed]
39. Jeon, J.H.; Lee, H.S.; Kim, J.T.; Kim, S.-J.; Choi, S.H.; Kang, S.G.; Lee, J.-H. Identification of a new subfamily
of salt-tolerant esterases from a metagenomic library of tidal flat sediment. Appl. Microbiol. Biotech. 2012, 93,
623–631. [CrossRef]
40. Oh, K.H.; Nguyen, G.S.; Kim, E.Y.; Kourist, R.; Bornscheuer, U.; Oh, T.K.; Yoon, J.H. Characterization of a
novel esterase isolated from intertidal flat metagenome and its tertiary alcohols synthesis. J. Mol. Catal. B
2012, 80, 67–73. [CrossRef]
41. Bowman, J.P.; McCuaig, R.D. Biodiversity, community structural shifts, and biogeography of prokaryotes
within Antarctic continental shelf sediment. Appl. Environ. Microb. 2003, 69, 2463–2483. [CrossRef]
42. Jones, S.E.; Chiu, C.-Y.; Kratz, T.K.; Wu, J.-T.; Shade, A.; McMahon, K.D. Typhoons initiate predictable change
in aquatic bacterial communities. Limnol. Oceanogr. 2008, 53, 1319–1326. [CrossRef]
43. Brito, E.M.; Guyoneaud, R.; Goñi-Urriza, M.; Ranchou-Peyruse, A.; Verbaere, A.; Crapez, M.A.;
Wasserman, J.C.; Duran, R. Characterization of hydrocarbonoclastic bacterial communites from mangrove
sediments in Guanabara Bay. Res. Microbiol. 2006, 157, 752–762. [CrossRef] [PubMed]
44. Kasai, Y.; Kishira, H.; Sasaki, T.; Syutsubo, K.; Watanabe, K.; Harayama, S. Predominant growth of
Alcanivorax strains in oil-contaminated and nutrient-supplemented sea water. Environ. Microbiol. 2002, 4,
141–147. [CrossRef] [PubMed]
45. Liu, Z.P.; Wang, B.J.; Liu, Y.H.; Liu, S.J. Novosphingobium taihuense sp. nov., a novel aromatic-compund-
degrading bacterium isolated from Taihu Lake, China. Int. J. Syst. Evol. Microbiol. 2005, 55, 1229–1232.
[CrossRef] [PubMed]

© 2017 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).