Recombinant DNA technology (also known as genetic engineering) is the set of techniques

that enable the DNA from different sources to be identified, isolated and recombined so that new
characteristics can be introduced into an organism. One important aspect in recombinant DNA
technology is DNA cloning.

DNA cloning is the production of a large number of identical DNA molecules from a single
ancestral DNA. The essential characteristic of DNA cloning is that the desired DNA fragments
must be selectively amplified resulting in a large increase in copy number of selected DNA
sequences.

Essentially two different DNA cloning approaches are used: Cell-based DNA cloning and cell-
free DNA cloning.

Cell-based DNA cloning: This was the first form of DNA cloning to be developed, and is an in
vivo cloning method. The first step in this approach involves attaching foreign DNA fragments in
vitro to DNA sequences which are capable of independent replication. The recombinant DNA
fragments are then transferred into suitable host cells where they can be propagated selectively.

The essence of cell-based DNA cloning involves following steps:

Construction of recombinant DNA molecules

 Recombinants are hybrid DNA molecules consisting of autonomously replicating DNA
segment plus inserted elements.
 Such hybrid molecules are also called chimera.
 Recombinant DNA molecules are constructed by in vitro covalent attachment (ligation)
of the desired DNA fragments (target DNA) to a replicon (any sequence capable of
independent DNA replication).
 This step is facilitated by cutting the target DNA and replicon molecules with specific
restriction endonucleases before joining the different DNA fragments using the enzyme
DNA ligase.

Transformation

 The recombinant DNA molecules are transferred into host cells (often bacterial or yeast
cells) in which the chosen replicon can undergo DNA replication independently of the
host cell chromosome(s).

Selective propagation of cell clones

 Selective propagation of cell clones involves two stages. Initially the transformed cells
are plated out by spreading on an agar surface in order to encourage the growth of well-
separated cell colonies. These are cell clones (populations of identical cells all descended
from a single cell). Subsequently, individual colonies can be picked from the plate and
the cells can be further expanded in liquid culture.

Isolation of recombinant DNA clones

  Isolation of recombinant DNA clones by harvesting expanded cell cultures and
selectively isolating the recombinant DNA.

Figure: Problem of gene selection in

gene cloning

Figure: gene cloning

Cell-free DNA cloning

The polymerase chain reaction (PCR) is a newer form of DNA cloning which is enzyme
mediated and is conducted entirely in vitro. PCR (developed in 1983 by Kary Mullis) is a
revolutionary technique used for selective amplification of specific target sequence of nucleic
acid by using short primers. It is a rapid, inexpensive and simple method of copying specific
DNA sequence.
 Figure: we isolate a single gene of interest by PCR

Limitations of PCR

In order for the primers to anneal to the correct positions, either side of the gene of interest, the
sequences of these annealing sites must be known. It is easy to synthesize a primer with a
predetermined sequence, but if the sequences of the annealing sites are unknown then the
appropriate primers cannot be made. This means that PCR cannot be used to isolate genes that
have not been studied before that has to be done by cloning.
There is a limit to the length of DNA sequence that can be copied by PCR. Five kilobases (kb)
can be copied fairly easily, and segments up to forty kb can be dealt with by using specialized
techniques.

Vectors for Gene Cloning:

The term vector refers to the DNA molecules that act as transporting vehicle which carries
foreign DNA from the test tube to the host cell for the purpose of cloning and expression.
Cloning vectors are used to clone foreign DNA whereas expression vectors are engineered so
that any foreign DNA can be transcribed in RNA and translated into protein. A viral DNA or
plasmid is generally used as a vector.

 Ability to replicate in host cells.

 Have ori site.
 Have Unique restriction enzyme sites for insertional cloning
 Genetic marker to select for host cells containing the vector.
Either antibiotic resistance or enzyme producing gene
 Minimum amount of nonessential DNA
 It should be smaller in size

Cloning vector based on PLASMID:

Plasmids are naturally occurring circular, extra chromosomal double-stranded DNA present in
many prokaryotic and few eukaryotic organisms.
Plasmids range from about 1.0 kb for the smallest to over 250 kb for the largest plasmids.

Plasmids are often described as being either relaxed or stringent on the basis of copies of Plasmid
that are maintained within cell. Relaxed plasmids are maintained multiple copies while stringent
are present at a single copy or low number of copies per cell.

Plasmid classification:
Plasmids fall into two groups: conjugative and non-conjugative. Conjugative plasmids are
characterized by the ability to promote sexual conjugation between bacterial cells, a process that
can result in a conjugative plasmid spreading from one cell to all the other cells in a bacterial
culture.
Conjugation and plasmid transfer are controlled by a set of transfer or tra genes, which are
present on conjugative plasmids but absent from the non-conjugative type. However, a non-
conjugative plasmid may, under some circumstances, be cotransferred along with a conjugative
plasmid when both are present in the same cell.
Several different kinds of plasmid may be found in a single cell, including more than one
different conjugative plasmid at any one time.
E. coli have been known to contain up to seven different plasmids at once. To be able to coexist
in the same cell, different plasmids must be compatible. If two plasmids are incompatible then
one or the other will be rapidly lost from the cell.

The most useful classification of naturally occurring plasmids is based on the main characteristic
coded by the plasmid genes. The five major types of plasmid according to this classification are
as follows:
Fertility or F plasmids carry only tra genes and have no characteristic beyond the ability to
promote conjugal transfer of plasmids. A well-known example is the F plasmid of E. coli.
Resistance or R plasmids carry genes conferring on the host bacterium resistance to one or
more antibacterial agents, such as chloramphenicol, ampicillin, and mercury. R plasmids are very
important in clinical microbiology as their spread through natural populations can have profound
consequences in the treatment of bacterial infections. An example is RP4, which is commonly
found in Pseudomonas, but also occurs in many other bacteria.
Col plasmids code for colicins, proteins that kill other bacteria. An example is ColE1 of E. coli.
Degradative plasmids allow the host bacterium to metabolize unusual molecules such as
toluene and salicylic acid, an example being TOL of Pseudomonas putida.
Virulence plasmids confer pathogenicity on the host bacterium; these include the Ti plasmids
of Agrobacterium tumefaciens, which induce crown gall disease on dicotyledonous plants.

OTHER PLASMID VECTOR

Bacteriophages
Bacteriophages, or phages as they are commonly known, are viruses that specifically infect bacteria. Like all
viruses, phages are very simple in structure, consisting merely of a DNA (or occasionally ribonucleic acid (RNA))
molecule carrying a number of genes, including several for replication of the phage, surrounded by a protective coat
or capsid made up of protein molecules.

Figure. The two main types of phage structure: (a) head-andtail (e.g. λ); (b) filamentous (e.g.
M13).

The phage infection cycle

The general pattern of infection, which is the same for all types of phage, is a three-step process.

1. The phage particle attaches to the outside of

the bacterium and injects its DNA into the
cell.
2. The phage DNA molecule is replicated,
usually by specific phage enzymes coded by
genes in the phage DNA.
3. Other phage genes direct synthesis of the
protein components of the capsid, and new
phage particles are assembled and released
from the bacterium.
With some phage types the entire infection cycle is completed very quickly, possibly in less than 20
minutes. This type of rapid infection is called a lytic cycle, as release of the new phage particles is
associated with lysis of the bacterial cell. The characteristic feature of a lytic infection cycle is that
phage DNA replication is immediately followed by synthesis of capsid proteins, and the phage DNA
molecule is never maintained in a stable condition in the host cell.

Lysogenic cycle:
In contrast to a lytic cycle, lysogenic infection is characterized by retention of the phage DNA molecule in the host
bacterium, possibly for many thousands of cell divisions. With many lysogenic phages the phage DNA is inserted
into the bacterial genome.

The integrated form of the phage DNA (called the prophage) is inactive, and a bacterium (referred to as a lysogen)
that carries a prophage is usually physiologically indistinguishable from an uninfected cell.
However, the prophage is eventually released from the host genome and the phage reverts to the lytic mode and
lyses the cell.

Lamda (λ) bacteriophase: λ is a typical example of a head-and-tail phage. The λ DNA

molecule is 49 kb in size and has been intensively studied by the techniques of gene mapping
and DNA sequencing. As a result the positions and identities of all of the genes in the e DNA
molecule are known.

λ bacteriophase is importance for the construction of cloning vectors.

The molecule is linear, with two free ends. This linear molecule consists of two complementary
strands of DNA, base-paired. However, at either end of the molecule is a short 12-nucleotide
stretch in which the DNA is single-stranded.

The two single strands are complementary, and so can base pair with one another to form a
circular, completely double-stranded molecule.

Complementary single strands are often referred to as “sticky” ends or cohesive ends, because
base pairing between them can “stick” together the two ends of a DNA molecule.

The λ cohesive ends are called the cos sites and they play two distinct roles during the lamda
infection cycle.
First, they allow the linear DNA molecule that is injected into the cell to be circularized,
which is a necessary requirement for insertion into the bacterial genome.

The second role of the cos sites is rather different, and comes into play after the prophage has
excised from the host genome. At this stage a large number of new λ DNA molecules are
produced by the rolling circle mechanism of replication, in which a continuous DNA strand is
“rolled off” the template molecule.

The result is a catenane consisting of a series of linear λ genomes joined together at the cos sites.
The role of the cos sites is now to act as recognition sequences for an endonuclease that cleaves
the catenane at the cos sites, producing individual λ genomes.

M13: filamentous bacteriophase composed of circular single standard DNA (6407 nucleotide) and completely
different in structure from lamda. It is smaller than lamda genome. The smaller size of the M13 DNA molecule
means that it has room for fewer genes than the lamda genome.
It is circular and is unusual in that it consists entirely of single-stranded DNA.
Injection of an M13 DNA molecule into an E. coli cell occurs via the pilus, the structure that connects two cells
during sexual conjugation.
It is encapsulated 2700 copies of major coat protein P8, capped with minor coat protein (P7, P6, P9). The minor P3
attached with host through F pilus.
With these phages, cell lysis never occurs, and the infected bacterium can continue to grow and divide, albeit at a
slower rate than uninfected cells.
M13 follows a simpler infection cycle than e, and does not need genes for insertion into the host genome.
It is non lytic virus.

Life cycle and replication process:

Once inside the cell the single-stranded molecule acts as the template for synthesis of a complementary strand,
resulting in normal double-stranded DNA. This molecule is not inserted into the bacterial genome, but instead
replicates until over 100 copies are present in the cell.
When the bacterium divides, each daughter cell receives copies of the phage genome, which continues to replicate,
thereby maintaining its overall numbers per cell. New phage particles are continuously assembled and released,
about 1000 new phages being produced during each generation of an infected cell.

Although there are many different varieties of bacteriophage, only e and M13 have found a major role as cloning
vectors.

Several features of M13 make this phage attractive as a cloning vector. The genome is less than 10 kb in size, well
within the range desirable for a potential vector. In addition, the double-stranded replicative form (RF) of the M13
genome behaves very much like a plasmid, and can be treated as such for experimental purposes. It is easily
prepared from a culture of infected E. coli cells and can be reintroduced by transfection.
M13 vectors are also used in phage display, a technique for identifying pairs of genes whose protein products
interact with one another. Most living organisms are infected by viruses and it is not surprising that there has been
great interest in the possibility that viruses might be used as cloning vectors for higher organisms. This is especially
important when it is remembered that plasmids are not commonly found in organisms other than bacteria and
yeast. Several eukaryotic viruses have been employed as cloning vectors for specialized applications: for example,
human adenoviruses are used in gene therapy, baculoviruses are used to synthesize important pharmaceutical
proteins in insect cells, and caulimoviruses and geminiviruses have been used for cloning in plants.
DNA manipulative enzymes can be grouped into four broad classes, depending on the type of
reaction that they catalyze:
Nucleases are enzymes that cut, shorten, or degrade nucleic acid molecules.
Ligases join nucleic acid molecules together.
Polymerases make copies of molecules.
Modifying enzymes remove or add chemical groups.

NucleasesNucleases degrade DNA molecules by breaking the phosphodiester bonds that link
one nucleotide to the next in a DNA strand. There are two different kinds of nuclease (Figure.1):

Figure 1 (a) An exonuclease, removes nucleotides from the end of a DNA molecule.
(b) An endonuclease, which breaks internal phosphodiester bonds.

Exonucleases remove nucleotides one at a time from the end of a DNA molecule.
Endonucleases are able to break internal phosphodiester bonds within a DNA molecule.

The main distinction between different exonucleases lies in the number of strands that are
degraded when a double-stranded molecule is attacked. The enzyme called Bal31 (purified from
the bacterium Alteromonas espejiana) is an example of an exonuclease that removes nucleotides
from both strands of a double-stranded molecule (Figure 2a). The greater the length of time that
Bal31 is allowed to act on a group of DNA molecules, the shorter the resulting DNA fragments
will be. In contrast, enzymes such as E. coli exonuclease III degrade just one strand of a double-
stranded molecule, leaving single-stranded DNA as the product (Figure 2b).

Figure 2: action of exonuclease

The same criterion can be used to classify endonucleases. S1 endonuclease (from the fungus
Aspergillus oryzae) only cleaves RNA and single strand DNA (Figure 3a) including single-
stranded nicks in mainly double-stranded molecules.
Deoxyribonuclease I (DNase I): it cuts both single and double-stranded molecules (Figure 3b).
DNase I is non-specific in that it attacks DNA at any internal phosphodiester bond, so the end
result of prolonged DNase I action is a mixture of mononucleotides and very short
oligonucleotides. On the other hand, the special group of enzymes called restriction
endonucleases cleaves double stranded DNA only at a limited number of specific recognition
sites (Figure 3c).

Figure 3

Ligases

Ligases join DNA moliclue together by synthesizing phosphodiester bond between nucleotides at
end of two different molicules or at the two end of single molecule. DNA ligases commonly used
in cloning experiments are those obtained from E coli or from bacteriophase T4.

Polymerases: DNA polymerases are enzymes that synthesize a new strand of DNA
complementary to an existing DNA or RNA template. Four types of DNA polymerase are used
routinely in genetic engineering.
DNA polymerase I: Prepared from E. coli. This enzyme attaches to a short single-stranded
region (or nick) in a mainly double-stranded DNA molecule, and then synthesizes a completely
new strand, degrading the existing strand as it proceeds.

DNA polymerase I is therefore an example of an enzyme with a dual activity DNA

polymerization and DNA degradation.
The polymerase and nuclease activities of DNA polymerase I are controlled by different parts of
the enzyme molecule. The nuclease activity is contained in the first 323 amino acids of the
polypeptide, so removal of this segment leaves a modified enzyme that retains the polymerase
function but is unable to degrade DNA. This modified enzyme, called the Klenow fragment,
can still synthesize a complementary DNA strand on a single-stranded template, but as it has no
nuclease activity it cannot continue the synthesis once the nick is filled in. The major application
of these polymerases is in DNA sequencing.

The Taq DNA polymerase used in the polymerase chain reaction (PCR) is the DNA polymerase
I enzyme of the bacterium Thermus aquaticus. This organism lives in hot springs, and many of
its enzymes, including the Taq DNA polymerase, are thermostable, meaning that they are
resistant to denaturation by heat treatment. This is the special feature of Taq DNA polymerase
that makes it suitable for PCR, because if it was not thermostable it would be inactivated when
the temperature of the reaction is raised to 94°C to denature the DNA.

Reverse transcriptase: an enzyme involved in the replication of several kinds of virus. Reverse
transcriptase is unique in that it uses as a template not DNA but RNA. The ability of this enzyme
to synthesize a DNA strand complementary to an RNA template is central to the technique called
complementary DNA (cDNA) cloning.
DNA modifying enzymes There are numerous enzymes that modify DNA molecules by
addition or removal of specific chemical groups. The most important are as follows:

Alkaline phosphatase (from E. coli, calf intestinal tissue, or arctic shrimp), which removes the
phosphate group present at the 5’ terminus of a DNA molecule (Figure a).
Polynucleotide kinase (from E. coli infected with T4 phage), which has the reverse effect to
alkaline phosphatase, adding phosphate groups onto free 5 termininal (Figure b).
Terminal deoxynucleotidyl transferase (from calf thymus tissue), which adds one or more
deoxyribonucleotides onto the 3 terminus of a DNA molecule (Figure c).

Figure: The reactions catalyzed by DNA modifying enzymes. (a) Alkaline phosphatase, which removes 5-phosphate
groups. (b) Polynucleotide kinase, which attaches 5-phosphate groups. (c) Terminal deoxynucleotidyl transferase,
which attaches deoxyribonucleotides to the 3′ termini of polynucleotides in either (i) single-stranded or (ii) double-
stranded molecules.

Linker: short, blunt ended dsDNA of known sequence (8-14bp) and have a recognistion
site for 3 to 8 restriction enzymes. These linkers are simply ligated to blunt end DNA by ligase
(because of the high concentration of these molecules present in reaction). The cohesive ends are
generated by digesting the DNA with appropriate restriction enzyme. However, the problem of
linker is that the site for the enzyme used to generate cohesive ends may be present in the target
DNA fragment.
Adaptor: adaptors are linkers with cohesive ends. The idea to develop adaptor is to ligate the
blunt end of the adaptor to the blunt end of DNA fragment and produce a new molecule with
sticky end. But there is a problem. The sticky end of the individual adaptor molecule could base
pair with each other to form dimer, so that new stand DNA molecule is still blunt ended.
However this problem can be corrected by using the precise chemical structure of the end of
adaptor molecule.

The answer to the problem lies in the precise chemical structure of the ends of the adaptor
molecule. Normally the two ends of a polynucleotide strand are chemically distinct, a fact that is
clear from a careful examination of the polymeric structure of DNA.
One end, referred to as the 5′ terminus, carries a phosphate group (5′-P); the other, the 3′
terminus, has a hydroxyl group (3′-OH). In the double helix the two strands are antiparallel, so
each end of a double-stranded molecule consists of one 5′-P terminus and one 3′-OH terminus.
And we know that ligation takes place between the 5′-P and 3′-OH ends (Figure 4.24c).
Adaptor molecules are synthesized so that the blunt end is the same as “natural” DNA, but the
sticky end is different. The 3’-OH terminus of the sticky end is the same as usual, but the 5’-P
terminus is modified: it lacks the phosphate group, and is in fact a 5-OH terminal. So finally
DNA ligase is unable to form a phosphodiester bridge between 5-OH and 3-OH ends. After the
adaptors have been attached, the abnormal 5′-OH terminus is converted to the natural 5′-P form
by treatment with the enzyme polynucleotide kinase, producing a sticky-ended fragment that can
be inserted into an appropriate vector.

Figure: The use of adaptors: (a) the actual structure of an adaptor, showing the modified 5′-OH
terminus; (b) conversion of blunt ends to sticky ends through the attachment of adaptors.
Producing sticky ends by homopolymer tailing
The technique of homopolymer tailing offers a radically different approach to the production
of sticky ends on a blunt-ended DNA molecule. A homopolymer is simply a polymer in which
all the subunits are the same. A DNA strand made up entirely of, say, deoxyguanosine is an
example of a homopolymer, and is referred to as polydeoxyguanosine or poly(dG).
Tailing involves using the enzyme terminal deoxynucleotidyl transferase to add a series of
nucleotides onto the 3-OH termini of a double-stranded DNA molecule.
If this reaction is carried out in the presence of just one deoxyribonucleotide, a homopolymer
tail is produced. Of course, to be able to ligate together two tailed molecules, the homopolymers
must be complementary. Frequently polydeoxycytosine (poly(dC)) tails are attached to the vector
and poly(dG) to the DNA to be cloned.

Base pairing between the two occurs when the DNA molecules are mixed. In practice, the
poly(dG) and poly(dC) tails are not usually exactly the same length, and the base-paired
recombinant molecules that result have nicks as well as discontinuities. Repair is therefore a two-
step process, using Klenow polymerase to fill in the nicks followed by DNA ligase to
synthesize the final phosphodiester bonds.

This repair reaction does not always have to be performed in the test tube. If the complementary
homopolymer tails are longer than about 20 nucleotides, then quite stable base-paired
associations are formed. A recombinant DNA molecule, held together by base pairing although
not completely ligated, is often stable enough to be introduced into the host cell in the next stage
of the cloning experiment. Once inside the host, the cell’s own DNA polymerase and DNA
ligase repair the recombinant DNA molecule, completing the construction begun in the test tube.
Labeling with a

radioactive marker application

Definition
A DNA molecule is usually labeled by incorporating nucleotides that carry a radioactive isotope
of phosphorus, 32P

Several methods are available:

Nick translation. Most purified samples of DNA contain some nicked molecules, however
carefully the preparation has been carried out, which means that DNA polymerase I is able to
attach to the DNA and catalyze a strand replacement reaction. This reaction requires a supply of
nucleotides: if one of these is radioactively labeled, the DNA molecule will itself become
labeled. Nick translation can be used to label any DNA molecule but might under some
circumstances also cause DNA cleavage.

End filling is a gentler method than nick translation and rarely causes breakage of the DNA, but
unfortunately can only be used to label DNA molecules that have sticky ends. The enzyme used
is the Klenow fragment (p. 49), which “fills in” a sticky end by synthesizing the complementary
strand. As with nick translation, if the end filling reaction is carried out in the presence of labeled
nucleotides, the DNA becomes labeled.

Random priming: A method for DNA labeling that utilizes random DNA hexamers, which
anneal to single-stranded DNA and act as primers for complementary strand synthesis by a
suitable enzyme.

Random priming results in a probe with higher activity and therefore able to detect smaller
amounts of membrane-bound DNA. The denatured DNA is mixed with a set of hexameric
oligonucleotides (6 bases) of random sequence. By chance, these random hexamers will contain
a few molecules that will base pair with the probe and prime new DNA synthesis. The Klenow
fragment is used as this enzyme lacks the nuclease activity of DNA polymerase I and so only
fills in the gaps between adjacent primers. Labeled nucleotides are incorporated into the new
DNA that is synthesized.
After hybridization, the location of the bound probe is detected by autoradiography. A sheet of
X-ray-sensitive photographic film is placed over the membrane. The radioactive DNA exposes
the film, which is developed to reveal the positions of the colonies or plaques to which the probe
has hybridized.

Finally we defined Autoradiography as A method of detecting radioactively labeled molecules

through exposure of an X-ray-sensitive photographic film.

Non-radioactive labeling
Radioactive labeling methods are starting to fall out of favor, partly because of the hazard to the
researcher and partly because of the problems associated with disposal of radioactive waste.
As an alternative, the hybridization probe can be labeled in a non-radioactive manner.
A number of methods have been developed, two of which are illustrated in Figure which are
given below.

The first makes use of deoxyuridine triphosphate (dUTP) nucleotides modified by reaction
with biotin, an organic molecule that has a high affinity for a protein called avidin.

After hybridization the positions of the bound biotinylated (is process of covelentley attached
biotin to a protein with Nuclic acid) probe can be determined by washing with avidin coupled to
a fluorescent marker. This method is as sensitive as radioactive probing and is becoming
increasingly popular.

The same is true for a second procedure for non-radioactive hybridization probing, in which the
probe DNA is complexes with the enzyme horseradish peroxidase, and is detected through the
enzyme’s ability to degrade luminol with the emission of chemiluminescence. The signal can be
recorded on normal photographic film in a manner analogous to autoradiography.

Fluorescence in situ hybridization (FISH):

If new gene is discovered then a question in our mind this gene is present in which sp. Or we
also make sure their mutated form.
Or
In DNA and RNA sequence are very long and we don’t know our gene of interest is present or
not in particular cell or segment.
Then what we do?

Fluorescence in situ hybridization (FISH): A laboratory hybridization technique that uses

fluorochromes of different colors (5 or more) to enable two or more genes to be located within a
chromosome preparation in a single in situ experiment.

It is easiest tools for mark and tag a specific DNA or entire genome
It based on complementary nature of DNA

Basic steps:
 Making the probe:
 Denature DNA
 Attached probe to gene of interest

Making the probe:

For this we synthesized a small segment of ssDNA /RNA in laboratory (15-30bp). These small
segments are slightly modified either florescent dye or radiolabeling. Different types of probes
can be used for FISH.

Locus specific probes bind to a particular region of a chromosome. This type of probe is useful
when scientists have isolated a small portion of a gene and want to determine on which
chromosome the gene is located, or how many copies of a gene exist within a particular
genome.
Alphoid or centromeric repeat probes are generated from repetitive sequences found in the
middle of each chromosome. Researchers use these probes to determine whether an
individual has the correct number of chromosomes. These probes can also be used in
combination with "locus specific probes" to determine whether an individual is missing
genetic material from a particular chromosome.
Whole chromosome probes are actually collections of smaller probes, each of which binds to a
different sequence along the length of a given chromosome. Using multiple probes
labeled with a mixture of different fluorescent dyes, scientists are able to label each
chromosome in its own unique color. The resulting full-color map of the chromosome is
known as a spectral karyotype. Whole chromosome probes are particularly useful for
examining chromosomal abnormalities, for example, when a piece of one chromosome is
attached to the end of another chromosome.

Denaturant of DNA:
**Problem: complementary nature is present in both the stand. Hence we separate both stand of
nucleotides (DNA /RNA).

SS DNA or RNA mixed with probe: Probe attached only complementary segment (This study
performed in vivo or in vitro both)

Then FISH method comprises of three basic steps:

 fixation of a specimen on a microscope slide,
 hybridization of labeled probe to homologous fragments of genomic DNA,
 and enzymatic detection of the tagged target hybrids.

The mRNA segment also detected in same way (T /U)

If we can select a particular region of mRNA which coded a particular protein at a given time in
a cell and it compare it with different time gap to reveal the expression pattern of cell.

DNA
mRNA which coded different proteins doing different function

if body not need this protein this expression is off.

This on off mechanism occurs in cell varies time to time and requirement

If we look in embrayo (frezz). A certain gene is on or off

Or FISH is a laboratory technique for detecting and locating a RNA or DNA sequences in cells,
tissues, and tumors. The technique relies on exposing chromosome to a small DNA sequence
called probe that has a florescent molecule attached to it.

It provides a way to visualize and map the genetic material in an individual cell, including
specific gene or a portion of genes. This may be used for understanding a range of chromosomal
abnormalities and other genetic mutation.
Applications:

Including gene mapping, Diagnosis of chromosomal abnormalities, Studies of cellular structure

and function.

Chromosomes in three-dimensionally preserved nuclei can be "painted" using FISH.

In clinical research, FISH can be used for prenatal diagnosis of inherited chromosomal
aberrations, postnatal diagnosis of carriers of genetic disease, diagnosis of infectious disease,
viral and bacterial disease, tumor cytogenetic diagnosis, and detection of aberrant gene
expression.

In laboratory research, FISH can be used for mapping chromosomal genes, to study
the evolution of genomes (Zoo FISH), analyzing nuclear organization, visualization of
chromosomal territories and chromatin in interphase cells, to analyze dynamic nuclear processes,
somatic hybrid cells, replication, chromosome sorting, and to study tumor biology. It can also be
used in developmental biology to study the temporal expression of genes during differentiation
and development. Recently, high resolution FISH has become a popular method for ordering
genes or DNA markers within chromosomal regions of interest.

For many applications, FISH has largely been replaced by the use of microarrays. However,
FISH remains useful for some tests. FISH may also be used to study comparisons among the
chromosomal arrangements of genes across related species.
Preparation of bacteriophage DNA
The key difference between phage DNA purification and the preparation of either total cell DNA
or plasmid DNA is that for phages the starting material is not normally a cell extract. This is
because bacteriophage particles can be obtained in large numbers from the extracellular medium
of an infected bacterial culture.

When such a culture is centrifuged, the bacteria are pelleted, leaving the phage particles in
suspension (Figure).

The phage particles are then collected from the suspension and their DNA extracted by a single
deproteinization step to remove the phage capsid

This overall process is more straightforward than the procedure used to prepare total cell or
plasmid DNA.
Nevertheless, successful purification of significant quantities of phage DNA is subject to several
pitfalls. The main difficulty, especially with e, is growing an infected culture in such a way that
the extracellular phage titer (the number of phage particles per ml of culture) is sufficiently high.
In practical terms, the maximum titer that can reasonably be expected for lamda is 1010 per ml;
yet 1010 lamda particles will yield only 500 ng of DNA. Large culture volumes, in the range of
500–1000 ml, are therefore needed if substantial quantities of lamda DNA are to be obtained.

Growth of cultures to obtain a high * titer

The naturally occurring lamda phage is lysogenic , and an infected culture consists mainly of cells carrying the
prophage integrated into the bacterial DNA. The extracellular lamda titer is extremely low under these
circumstances.

To get a high yield of extracellular lamda, the culture must be induced, so that all the bacteria enter the lytic phase of
the infection cycle, resulting in cell death and release of e particles into the medium.

Most laboratory strains of lamd carry a temperature-sensitive (ts) mutation in the cI gene. This is one of the genes
that are responsible for maintaining the phage in the integrated state.
If inactivated by a mutation, the cI gene no longer functions correctly and the switch to lysis occurs. In the cIts
mutation, the cI gene is functional at 30°C, at which temperature normal lysogeny can occur. But at 42°C, the cIts
gene product does not work properly, and lysogeny cannot be maintained. A culture of E. coli infected with a lmda
phages carrying the cIts mutation can therefore be induced to produce extracellular phages by transferring from
30°C to 42°C (Figure).
 Figure: induction of lamd phages.

Preparation of non-lysogenic * phages

Most lamda strains are lysogenic in nature.
Many cloning vectors derived from lamda are modified, by deletions of the cI and other genes, so that lysogeny
never occurs. These phages cannot integrate into the bacterial genome and can infect cells only by a lytic cycle.

With these phages the key to obtaining a high titer lies in the way in which the culture is grown, in particular the
stage at which the cells are infected by adding phage particles.

The ideal situation is when the age of the culture, and the size of the phage inoculum, are balanced such that the
culture continues to grow, but eventually all the cells are infectedand lysed.
Collection of phages from an infected culture
The problem now is to reduce the size of the suspension to 5 ml or less, a manageable size for DNA extraction.
Phage particles are so small that they are pelleted only by very high speed centrifugation. Collection of phages is
therefore usually achieved by precipitation with polyethylene glycol (PEG). This is a long-chain polymeric
compound which, in the presence of salt, absorbs water, thereby causing macromolecular assemblies such as phage
particles to precipitate. The precipitate can then be collected by centrifugation, and redissolved in a suitably small
volume (Figure).

Deproteinization of the redissolved PEG precipitate is sometimes sufficient to extract pure phage DNA, but
usually lamda phages are subjected to an intermediate purification step. This step is necessary because the PEG
precipitate also contains a certain amount of bacterial debris, possibly including unwanted cellular DNA. These
contaminants can be separated from the lamda particles by CsCl density gradient centrifugation.

Preparation of plasmid DNA

Purification of plasmids from a culture of bacteria involves the same general strategy as
preparation of total cell DNA. A culture of cells, containing plasmids, is grown in liquid
medium, harvested, and a cell extract prepared. The protein and RNA are removed, and the DNA
probably concentrated by ethanol precipitation. However, there is an important distinction
between plasmid purification and preparation of total cell DNA.

Separating the two types of DNA can be very difficult, but is nonetheless essential if the
plasmids are to be used as cloning vectors.
The presence of the smallest amount of contaminating bacterial DNA in a gene cloning
experiment can easily lead to undesirable results.

The separation methods are based on the several physical differences between plasmid DNA
and bacterial DNA, the most obvious of which is size.
The largest plasmids are only 8% of the size of the E. coli chromosome, and most are much
smaller than this. Techniques that can separate small DNA molecules from large ones should
therefore effectively purify plasmid DNA.

In addition to size, plasmids and bacterial DNA differ in conformation.

Plasmids and the bacterial chromosome are circular, but during preparation of the cell extract the
chromosome is always broken to give linear fragments. A method for separating circular from
linear molecules will therefore result in pure plasmids.
Separation on the basis of size

If the cells are lysed under very carefully controlled conditions, only a minimal amount of
chromosomal DNA breakage occurs.
This process is aided by the fact that the bacterial chromosome is physically attached to the cell
envelope, so fragments of the chromosome sediment with the cell debris if these attachments are
not broken.

Cell disruption must therefore be carried out very gently to prevent wholesale breakage of the
bacterial DNA. For E. coli and related species, controlled lysis is performed as shown in Figure.
Treatment with EDTA and lysozyme is carried out in the presence of sucrose, which prevents the
cells from bursting immediately.
Instead sphaeroplasts are formed, cells with partially degraded cell walls that retain an intact
cytoplasmic membrane. Cell lysis is now induced by adding a non-ionic detergent such as Triton
X-100 (ionic detergents, such as SDS, cause chromosomal breakage). This method causes very
little breakage of the bacterial DNA, so centrifugation leaves a cleared lysate, consisting almost
entirely of plasmid DNA.

Separation on the basis of conformation

Before considering the ways in which conformational differences between plasmids and
bacterial DNA can be used to separate the two types of DNA, we must look more closely at the
overall structure of plasmid DNA.
Most plasmids exist in the cell as supercoiled Molecules
The supercoiled conformation can be maintained only if both polynucleotide strands are intact,
hence the more technical name of covalently closedcircular (ccc) DNA. If one of the
polynucleotide strands is broken the double helix reverts to its normal relaxed state, and the
plasmid takes on the alternative conformation, called open-circular (oc). Supercoiling is
important in plasmid preparation because supercoiled molecules can be fairly easily separated
from non-supercoiled DNA.

Figure Two conformations of circular double-stranded DNA: (a) supercoiled—both strands are intact; (b) open-circular —one or
both strands are nicked.

Alkaline denaturation

The basis of this technique is that there is a narrow pH range at which non-supercoiled DNA is
denatured, whereas supercoiled plasmids are not. If sodium hydroxide is added to a cell extract
or cleared lysate, so that the pH is adjusted to 12.0–12.5, then the hydrogen bonding in non-
supercoiled DNA molecules is broken, causing the double
helix to unwind and the two polynucleotide chains to separate.
If acid is now added, these denatured bacterial DNA strands reaggregate into a tangled mass. The
insoluble network can be pelleted by centrifugation, leaving plasmid DNA in the supernatant.

An additional advantage of this procedure is that, under some circumstances (specifically cell
lysis by SDS and neutralization with sodium acetate), most of the protein and RNA also becomes
insoluble and can be removed by the centrifugation step. Further purification by organic
extraction or column chromatography may therefore not be needed if the alkaline denaturation
method is used.

Figure
alkaline
denaturation
method
Ethidium bromide–caesium chloride density gradient centrifugation

This is a specialized version of the more general technique of equilibrium or density gradient centrifugation. A
density gradient is produced by centrifuging a solution ofcaesium chloride (CsCl) at a very high speed.
Exactly where a particular molecule bands depends on its buoyant density: DNA has a buoyant density of about
1.70 g/cm3, and therefore migrates to the point in the gradient where the CsCl density is also 1.70 g/cm3.
In contrast, protein molecules have much lower buoyant densities, and so float at the top of the tube, whereas RNA
forms a pellet at the bottom (Figure).

More importantly, density gradient centrifugation in the presence of ethidium bromide (EtBr) can be used to
separate supercoiled DNA from non-supercoiled molecules.
Ethidium bromide binds to DNA molecules by intercalating between adjacent base pairs, causing partial unwinding
of the double helix (Figure).
This unwinding result in a decrease in the buoyant density, by as much as 0.125 g/cm3 for linear
DNA. However, supercoiled DNA, with no free ends, has very little freedom to unwind, and can
only bind a limited amount of EtBr. As a consequence, supercoiled molecules form a band in an
EtBr–CsCl gradient at a different position to linear and open-circular DNA (Figure).

Ethidium bromide–caesium chloride density gradient centrifugation is a very efficient method

for obtaining pure plasmid DNA. When a cleared lysate is subjected to this procedure, plasmids
band at a distinct point, separated from the linear bacterial DNA, with the protein floating on the
top of the gradient and RNA pelleted at the bottom.

The position of the DNA bands can be seen by shining ultraviolet radiation on the tube, which
causes the bound EtBr to fluoresce. The pure plasmid DNA is removed by puncturing the side of
the tube and withdrawing a sample with a syringe (Figure).

The EtBr bound to the plasmid DNA is extracted with n-butanol and the CsCl removed by
dialysis. The resulting plasmid preparation is virtually 100% pure and ready for use as a cloning
vector.
Purification of Total RNA

RNA is thermodynamically less stable than DNA because of the 2’ hydroxyl group on the ribose
ring that promotes hydrophilic attack on the 5’-3’ phosphodiester bond to form a 2’-3’ cyclic
phosphate. Therefore, even if all RNases are eliminated or inhibited during RNA purification,
RNA spontaneously degrades while in solution. To avoid this biological decay of RNA, purified
samples are stored at –20°C as ethanol precipitates.

Total RNA: It is all the RNA molecules found inside a cell. This includes: mRNA, microRNA
(miRNA)

Isolating total RNA

The purification of mRNA involves two basic steps:
1. Biochemical separation of total cellular RNA from DNA and protein using a strong protein
denaturant to inhibit cellular RNases, and
2. Isolation of poly A tail mRNA using an oligo dT affinity matrix.

Figure: Isolation and purification of mRNA from tissue culture cells using guanidinium
thiocyanate.

Guanidinium thiocyanate-phenol-chloroform (also called Trizol) extraction is commonly used

for RNA isolation. Guanidinium thiocyanate, a chaotropic agent, is added to the organic phase to
aid in the denaturation of proteins. The nucleic acids (RNA and/or DNA) partition into the
aqueous phase, while protein partitions into the organic phase.

TRIzol is a powerful protein denaturant that breaks down protein cell components and
inactivates all enzymes, including RNases. TRIzol extraction typically uses acidic phenol-
chloroform to confine total RNA in a clear aqueous phase while proteins and cell debris end up
in the pink organic layer. RNA can be recovered by precipitation with ethanol, washed and then
redissolved in water.
The pH of the mixture determines which nucleic acids get purified.

 Under acidic conditions (pH 4-6), DNA partitions into the organic phase while RNA
remains in the aqueous phase.
 Under neutral conditions (pH 7-8), both DNA and RNA partition into the aqueous phase.

Phenol: Phenol is naturally somewhat water-soluble, and gives a fuzzy interface, which is
sharpened by the presence of chloroform, and the isoamyl alcohol reduces foaming. Most
solutions also have an antioxidant, as oxidized phenol damages the nucleic acids. For RNA
purification, the pH is kept at around 4, which retains RNA in the aqueous phase
preferentially. For DNA purification, the pH is usually near 7, at which point all nucleic acids are
found in the aqueous phase.

Chloroform: Chloroform is stabilized with small quantities of amylene or ethanol, because

exposure of pure chloroform to oxygen and ultraviolet light produces phosgene gas. Some
chloroform solutions come as pre-made a 96% chloroform, 4% isoamyl alcohol mixture that can
be mixed with an equal volume of phenol to obtain the 25:24:1 solution.

Isoamyl alcohol: Isoamyl alcohol may reduce foaming and ensure deactivation of RNases.

Requirement:
Guanidinium thiocynate
Sodium citrate
2-mercaptoethanol
Glacial acitic acid
Phenol
Chloroform
Isoamyle alcohol
Isopropanol
Ethanol
SDS
Glycerol

Composition Trizol for 1L.

38% phenol; 0.8M Guanidinium thiocynate (118.6 gm); 0.1M sodium actate, 0.4 M ammonium
thiosuphate (79.12gm/Mol), glycerol 5%

500 gm phenol crystal, melt it in water bath and calculate the rest. Accordingly with 500 g
phenol as 38%.
The density of phenol is 1.07 g/cm3, so if 500 gm is 38%, this will be 500/1.07=467.3 ml, and
therefore total vol will be 767.3*(100/38)=1.23 L.

Prepare the working solution jusat add 0.36ml 2-mercaptoethanol.

Basic steps
Cell lysis

If isolating RNA from tissues, you will need to homogenize the sample first in 1 ml of TRIZOL
reagent per 50 to 100 mg of tissue using a homogenizer. The sample volume should not exceed
10% of the TRIzol volume.

Phenol-Chloroform separation

Add 0.2 volume of chloroform per 1 volume of TRIZOL Reagent, cap the tubes securely and
vortex samples vigorously for 15 seconds.

Incubate samples at room temperature for 5 minutes.

Centrifuge the samples at no more than 12,000 x g for 15 minutes at 4C. The mixture will
separate into lower organic, interphase, and upper aqueous phases that contains RNA. Carefully
transfer the upper aqueous phase without disturbing the interphase into fresh tube. The volume of
the aqueous phase is usually about 60% of the TRIzol volume used in step 1.

RNA precipitation

Use 0.5 ml of ethanol /1 ml of TRIZOL to precipitate the RNA from the aqueous phase.

Incubate samples at room temperature for 10 minutes and centrifuge at not more than 12,000 x g
for 10 minutes at 40C. The RNA precipitate will form a pellet on the side or bottom of the tube,
which could be hard to see by eye.

RNA wash and resuspension

Remove the supernatant and wash the RNA pellet once with 75% ethanol.

Mix the samples by vortexing and centrifuge at no more than 8000 x g for 5 minutes at Repeat
above washing procedure and remove all leftover ethanol.

Air-dry or vacuum dry RNA pellet for 5-10 minutes but don’t heat or centrifuge under vacuum.
Don’t overdry RNA or it will be hard to redissolve the pelelt.

Dissolve RNA in DEPC-treated water by passing solution a few times through a pipette tip.

Once you have your sample redissolved, determine sample concentration and purity by taking
OD measurements at 260 nm and 280 nm. The A260/A280 ratio should be above 1.6.
Cloning Vectors

Vectors are gene carrying vehicle in molecular biology. If we chose a segment or gene of interest and cut it. Then
what to do, it is not inserted directly to the host because it is easily degraded by nuclease activity in the medium.
Then we need a system that carries this sequence in such a way the host cell can survive and increases their number.

Characteristics of vector:
o Having origin of replication (Ori): is particular sequence at which replication origins. Bacterial usually one
Ori. Plasmid have capability to self replication is due to Ori. If plasmid don’t contain Ori it should be not
be considered as vector for cloning.
o ROP: This protein which bind to ori site for replication. And DNA poly recognized it.
o MCS: Multiple cloning sites: site at which we insert gene of interest. It increases the freedom to use
different kind of RE enzyme. And if a vector has MCS then it considered as versatile and easy to handle.
How we identified after ligation which one is our interest or which one is not.

VECTOR CAN SELF JOIN

SOME CARRIOR MOLICULE FORMED (RD)

TARGET SEQUENCE MAY JOINS

Then how we determine?

o Selectable markers: Antibiotic resistant gene another is enzyme producing gene (lac gene: synthesize beta
galactocidase): help to identified desired gene.
o It should be small in size (easy to handle).

Basically vector is of two types

Cloning vector (used for cloning only) and expression vector (used for expression): It has all the stuff of
cloning vector. It has promoter region, start and stop sequences: for transcription and translation, taq
sequence.

There are many vectors used in molecular biology. Some of them are following below

 YAC Yeast artificial chromosomes

Size
 BAC Bacterial artificial chromosomes
increasing
 Bacteriophages (Phase)

 E. coli—plasmids
Specific vector:

pBR322: first artificial cloning plasmid. An example of a widely used cloning vector is pBR322,
which replicates in E coli. Created in 1977 in the laboratory of Herbert Boyer at the University of
California, San Francisco, it was named after the postdoctoral researchers who constructed it.
Structure

 Ori site one

 It has two markers.
 It have 8 RE sites. Which we cut by using these endonucleases.
 No any RE site is repeated in this vector. Hence if you use one site to cut you get
only one.

In totality, pBR322, is p stands for "plasmid BR for "Bolivar" and "Rodriguez. 322 distinguish
this plasmid from others developed in the same laboratory. It is small (4361 bp) and maintain in
the host in relatively high copy number (20-30/cell). It has genes conferring
ampicillin resistance and tetracycline resistance on its host and has single cleavage site for
EcoR1, HindIII, BamI, PstI, and ClaI.
pUC 19: the valuable feature of pBR322 have been inhanced by construction of a series of
plasmids termed pUC (product at the university of California). The plasmid vector pUC19 (2686
bp long) contained a polylinker with unique cloning sites for multiple restriction endonuclease
and an ampicilline resistance gene to permit identification of transformed cell. This vector can be
easily distinguished from non-recombinants based on color (blue for non-recombinant and white
for recombinant) differentiation on growth media.

Bacteriophases: 3 types used (lamda phase, m13 phase, retroviruses: having RNA GM).

Neither plasmid nor lambda phage vectors are suitable for cloning DNAs larger than about 20 to
25 kb in length. Several vectors have been developed that allow investigators to clone much
larger pieces of DNA. Some recombinant plasmids incorporate multiple replication origins and
other elements that allow them to be used in more than one species (for example, yeast or E.
coli).

Shuttle vectors (Yep13): A vector that can be propagated in cells of two or more different host
species are called shuttle vector.

It has two Ori,

Bacterial artificial chromosome (BAC): it acts as a vehicle to artificially carry and store DNA
into bacterial cell. BACs were developed in 1992 during human gene project. Because, human
genome is too long and scientist can’t be manage properly. Hence, all agree to split up into
manageable chunk (large piece /or mass). These chunks (typically 100,000 to 300,000 bp) can be
place into bacterium, E coli, and then stored for long time.

It is based on F plasmid. It is very useful because it is very stable with host DNA and
information is not loss during several cycle of host.

Hence we define simply BAC is a cloning vector based on the F plasmid, used for cloning
relatively large fragments of DNA in E. coli.
They generally include selectable
markers such as resistance to the
antibiotic chloramphenicol (CmR),
as well as a very stable origin of
replication (ori) that maintains the
plasmid at one or two copies per
cell. DNA fragments of several
hundred thousand base pairs are
cloned into the BAC vector. The
large circular DNAs are then
introduced into host bacteria by
electroporation.
Yeast Artificial Chromosomes (YACs)

E. coli cells are by no means the only hosts for genetic engineering. Yeasts are particularly
convenient eukaryotic organisms for this work. As with E. coli, yeast genetics is a well-
developed discipline. The genome of the most commonly used yeast, Saccharomyces cerevisiae,
contains only 14x 106bp (a simple genome by eukaryotic standards, less than four times the size
of the E. coli chromosome), and its entire sequence is known.

Yeast is also very easy to maintain and grow on a large scale in the laboratory. Plasmid vectors
have been constructed for yeast, employing the same principles that govern the use of E. coli
vectors described above.

YAC: it can accept segments of foreign DNA as large as 1000 kb (one million base pairs). Used
during human genome project.

As the name implies, YACs are artificial versions of a normal yeast chromosome. They contain
all of the elements of a yeast chromosome that are necessary for the structure to be replicated
during S phase and segregated to daughter cells during mitosis, including one or more origins of
replication, telomeres at the ends of the chromosomes, and a centromere to which the spindle
fibers can attach during chromosome separation.
In addition to these elements, YACs are constructed to contain (1) a gene whose encoded product
allows those cells containing the YAC to be selected from those that lack the element and (2) the
DNA fragment to be cloned. Like other cells, yeast cells can take up DNA from their medium,
which provides the means by which YACs are introduced into the cells. Over the past few years,
laboratories involved in sequencing genomes have relied heavily on an alternate cloning vector,
called a bacterial artificial chromosome (BAC), which is also able to accept large foreign
DNA fragments (up to about 500 kb).

Note: BACs have the advantage over YACs in high-speed sequencing projects because they can
be cloned in E. coli, which readily picks up exogenous DNA, has an extremely short generation
time, can be grown at high density in simple media, and does not “corrupt” the cloned DNA
through recombination.

DNA fragments cloned in YACs and BACs are typically greater than 100 kb in length.
Fragments of such large size are usually produced by treatment of DNAs with restriction
enzymes that recognize particularly long nucleotide sequences (7–8 nucleotides) containing CG
dinucleotides.
CG dinucleotides have special functions in the mammalian genome, and presumably because of
this they do not appear nearly as often as would be predicted by chance. The restriction enzyme
Not1, for example, which recognizes the 8- nucleotide sequence GCGGCCGC, typically cleaves
mammalian DNA into fragments several hundred thousand base pairs long. These fragments can
then be incorporated into YACs or BACs and cloned within host yeast or bacterial cells.
Phasemids: combining GM of bacteriphase with plasmid.

Ti Plasmid: Isolated from Agrobacterium tumilasia (tumor inducing plasmid): included tumor
induce in plants.

Special properties: it goes to bind host DNA; it induces cell division

Limitation: host cell only in plants cell.

High capacity vector:

P2 phase vector:

Cosmid vector: this is constructed using or combining cos site with plasmid. That means

Phagemid:

Phasemid:

Animal and plant virus based on cloning vector:

Expression vector:

Insertion of foreign DNA into host cell:

Transformation:
PCR and its type
The polymerase chain reaction is very different from gene cloning. This process acts as “copy machine” for DNA. It
is used to amplify a specific segment of DNA. Rather than a series of manipulations involving living cells, PCR is
carried out in a single test tube simply by mixing DNA with a set of reagents (primers+ PCR buffer, dNTPs, taq
poly) and placing the tube in a thermal cycler, a piece of equipment that enables the mixture to be incubated at a
series of temperatures that are varied in a preprogrammed manner.

Basic steps:
1. Denaturation: Separation of host dsDNA stand.
The sample mixture is heated to 90-94°C for few sec, at which temperature only hydrogen bonds that hold together
the two strands of the double-stranded DNA molecule are broken, causing the molecule to denature and separated.

2. Annealing: need hybridization that means primer +ssDNA.

The mixture is cooled down to approx 55°C. The two strands of each molecule could join back together at this
temperature, but most do not because the mixture contains a large excess of short DNA molecules, called
oligonucleotides or primers (attached on 3’ of parent DNA), which anneal (RNA primer 5’ to 3’)to the DNA
molecules at specific positions.

3. Synthesis or extension: DNA poly enzyme come and synthesis of new DNA stand at 72 °C with the help of
thermo stable DNA.
The temperature is raised to 74°C. This is a good working temperature for the Taq DNA polymerase that is present
in the reaction mixture. Taq DNA polymerase attaches to one end of each primer and synthesizes new strands of
DNA, complementary to the template DNA molecules, during this step of the PCR.

Now we have four stands of DNA instead of the two that there were to start with.

Further, the temperature is increased back to 94°C. The double-stranded DNA molecules, each of which consists of
one strand of the original molecule and one new strand of DNA, denature into single strands. This begins a second
cycle of denaturation–annealing–synthesis, at the end of which there are eight DNA strands.

By repeating the cycle 30 times the double-stranded molecule that we began with is converted into over 130 million
new double-stranded molecules, each one a copy of the region of the starting molecule delineated by the annealing
sites of the two primers.

A PCR experiment can be completed in a few hours, whereas it takes weeks or months to obtain a gene by cloning.

Note: Why then is gene cloning still used? This is because PCR has two limitations:
 If the sequences of the annealing sites are unknown then the appropriate primers cannot be made. This
means that PCR cannot be used to isolate genes that have not been studied before—that has to be done by
cloning.
 There is a limit to the length of DNA sequence that can be copied by PCR.

Primer designing:
The primers are the key to the success or failure of a PCR experiment. If the primers are designed correctly the
experiment results in amplification of a single DNA fragment, corresponding to the target region of the
template molecule. If the primers are incorrectly designed the experiment will fail, possibly because no
amplification occurs, or possibly because the wrong fragment, or more than one fragment, is amplified.

1. Primer length: The first important issue to address is the length of the primers. If the primers are too short
they might hybridize to non-target sites and give undesired amplification products.

To illustrate this point,

Imagine “8-mers” primers are used for human DNA.
The frequency of this 8-mers is 48 =65,536 bp, giving approximately 49,000 possible sites in the 3,200,000 kb of
nucleotide sequence that makes up the human genome. This means that it would be very unlikely that a pair
of 8-mer primers would give a single, specific amplification product with human DNA.

What if the 17-mer primers are used?

The expected frequency of a 17-mer sequence is once every 417 17,179,869,184 bp. This figure is over five times
greater than the length of the human genome, so a 17-mer primer would be expected to have just one
hybridization site in total human DNA. A pair of 17-mer primers should therefore give a single, specific
amplification product.

Why not simply make the primers as long as possible?

The length of the primer influences the rate at which it hybridizes to the template DNA, long primers hybridizing at
a slower rate.
Hence, primer length should between 18-30bp.

2. Melting temperature: The annealing temperature for a PCR experiment is determined by calculating the Tm
value for each primer. In PCR experiment a set of primer is used. One is forward (+) and another is reverse
(-). Normally these primers have different melting temperature. For example if the one primer having high
GC value compared to another one then their Tm value is comparatively higher.
Note that this means the two primers should be designed in such a manner that they have identical Tm value.

3. Primer dimmer: due to complementary nature these nucleotide have tendency to self dimmerized. Hence,
we design the primer in such a way then self dimmerized capacity should be minimized.
For example if we not design self repeated sequence then tendency of self dimmerization is reduced. If we reduce
the repeated sequence then secondary structure will also not formed.

4. Prevented repeated sequence: one nucleotide should not be repeats continuous fashion.

ACGGGGATGCTCCCTAGTTT then

Secondary structure of DNA primers is formed if you have repeated same nucleotides

GCTAGTACTCGC then

Secondary structure not formed

5. GC content: the GC contends in a primer is should be greater than 60%. If not then your primer is weak.

For example which one is better for primer?

(a) ATGACGATATCATACTATAG: it is weaker because it has AT content. And AT is comparatively weak

bonding (double bond)
(b) GACGCAGCAGCTAGCGACG: then we select this primer because it contains more GC content (join by
triple bond).

6. Distance between primers:

If distance between two primers is too long: miss binding
If the distance between two primers is very less then it have tendency to bind it and formed primer dimmer. Then
distance between two primers should be 150 bp to 10 kb.
Types of PCR:

Colony PCR: Extraction of plasmid DNA or ligated DNA directly from bacterial or yeast
colony.
Pick the colony put in 50 µL TE buffer. Heat and mixed properly and incubated at 90 to 100 °C
for two minute (material come out from the cell). Centrifuge it 10000 rpm (pull out the cell
debris). Take 1 or 2µL supernatant as a template in PCR reaction mixture. In this PCR technique
transformed culture can be used directly for PCR and reducing the time and efforts.

Hot start PCR:

It is also a modified version of PCR. In conventional PCR, Taq DNA polymerase is working on
normal temperature. In this PCR, some antibodies and binding inhibitors are used to bind the
activated center of taq polymerase enzyme. These special enzymes are inhibited the polymerase
activity at ambient temperature and they are dissociated only at high temperature (>71 0C). It
reduces their work below 72 0C and performed greater specificity.
It reduces non specific amplification during initial step of PCR.
Multiplex PCR: In this PCR multiple set of primers are
used in a single PCR reaction.
Precision: DNA sequences that are amplified in this PCR
must be not very much similar.

Applications: It has wide range of application in forensic

science, mutation genetics and pathogen identification.

Nested PCR: Sequence similarities

between the target DNA and related DNA
are very frequently seen. As a result of
this, the primer may bind to both the DNA
and therefore even undesirable fragment
also get amplified in PCR. To avoid this
problem nested PCR is used.
In this PCR two set of primers are used.
First target all types of amplification that is
desirable or undesirable. Second primer
targeted the inner segment of desired
DNA.
More convincing results seen in
amplification process.
It removes unwanted amplification of
undesired segment of DNA.

Touchdown PCR:
Basics: annealing is a very important process in which primer get bind on template DNA stands.
Annealing of primers depends on two things: first melting temperature (Tm: at which primer
dissociate) and second annealing temperature (at which primer get attached to template).
Low annealing temperature favors annealing that means if we chose less temperature for
annealing we support unwanted annealing on template DNA. This is not good for our final
outcome.
Hence, to overcome this situation annealing temperature of PCR should be just near (below) to
Tm value.
If we provide annealing temperature just below the Tm value it bind only those segment or
region which it have high affinity and specificity.

Tm value calculated according to standard formula

Tm = [4 (G+C)] + [2 (A+T)]
For example
We have a primer of following sequence
GACAGCAGCGACACATA
G= 4; C=5; A=7; T=1
Then, Tm= (4x9) + (2x8)= (36) + (16) = 52 0C

Finally, this PCR is used to reduce the amplification of non targeted DNA sequence by
gradually lowering the annealing temperature in step wise fashion as cycle progressed. This
PCR performed only high temperature that means just below the Tm value which allow
only perfectly matched primer template DNA hybridization and give good quality of
amplified sequences.

If you correct this in very

first cycle (0.5 0C) then
after some amplification
annealing temperature is
down because only specific
segments are amplified.
Hence energy used for
dissociation is reduced.
Reverse transcriptase PCR (RT-PCR) is a PCR technique in which the starting material is
RNA. The first step in the procedure is conversion of the RNA to
cDNA with reverse transcriptase. That means it a PCR technique
commonly used for RNA expression.

Requirement
1. Primers:
oligo dT (usually TTT nucleotide because most of the mRNA have
poly AAAA tail. But: limitation all RNA have not poly A tail.)
Random primers: Their sequences are random and it attached on
template is random (mostly used primers).
Gene specific primer: if you know your gene of interest then you
easily design a primer who is complementary to their target gene.
That type of primer is known as site specific primer. It is very useful
for mutation studies and forensic science.

2. Reverse transcriptase enzymes (it synthesized RNA to single standard

complementary DNA):
M-MLV: (moloney leukemia virus): RNA dependent DNA polymerase that can be
used in cDNA synthesis from mRNA. But, their annealing activity is best up to 37 0C. If you have a primer with
high GC content then annealing temperature automatically rises.
Annealing temperature is rises then secondary structures are formed easily because lower temperature favors self
binding.
Hence, if you have high secondary structure and high temperature for annealing then M-MLV can’t work properly.
Then another enzyme is work that is super striptease III (SSIII). It survive up to 50 0C.

Note: Reverse transcriptase PCR (RT PCR) and Real time PCR (qPCR)both are separate
technique. RT PCR is used for qualitative detection of gene expression by the creation of cDNA
which are obtained from RNA and qPCR is used fir quantitative measurement of DNA during
the time course of amplification by the help of florescent dyes.
Real time PCR: Normal PCR is an end point PCR. But in this PCR technique amplification are
monitored in real time by help of some florescent dyes.

Figure: florescent depends on concentration of amplification of DNA.

Real time PCR can perform detection, analysis, and quantification of the sample in real time.
Detection: find the presence of targeted gene sequence which is assured by the presence of the
amplification curve.
Quantification: this is done by using cycle number needed to obtain the threshold value of
detector and PCR efficiency.
Analysis: analysis of the variant can be done by studing the melting curve or comparing the
melting temperature with the sequence of database.

There are many different markers used in real time. Hear we discussed two major types

SYBR green (Non specific): DNA binding dye and give very strong signal. These probes
attached to template in PCR tube and emit photons which are captured by detectors.
It has high affinity to bind the minor grove of dsDNA. If this dye bind ssDNA binding are low
and give very less florescent.
1. High stability
2. Lesser inhibitor to taq
3. Less hazards and mutagenicity
Limitation: it bind non specific PCR product and also give fluorescent to primer dimmer

Taqman probe (specific):

This is a hydrolysis probe. It consist of a reporter dye (fluorescent

portion) at 5’ end and a quencher (refer to a molecule that reduce
the florescence) (tetramethylrhodamine, acronym: TAMRA) at 3’
end.

The quencher part quenches the fluorescence emitted by fluropore

by the mechanism of FRET (florescence resonance energy transfer).
FRET: depends on is a mechanism in which two light sensitive molecule exchange their energy.
One is act as donor and another act as receptor. But this mechanism work only when these two
are very close. If it is not too close fluorescent part is glowing without any quenching.

See the figure below: When the molecule intact: the light of receptor molecule is quenched by
other part. Probe gets hybridized to template DNA at 5’ end.
DNA polymerase starts working and constructed a new stand. This activity cut down the
fluorescent portion from another one and fluorescent signals are generated. As this process
continue more and more signal are generated which is positively related to the amplification of
DNA. That means signal is directly proportional to amplified product in a sample mixture.

Advantage
High flurogenic
Easy PCR set up
Sequence specific detection, multiplexing
Disadvantage
Expensive
Probe design and poisoning challenging
Similar condition for primer and probe
Probe degrade: no end point analysis

In situ PCR: in situ (ISH) is a PCR that actually take place inside the cell on a slide. In situ PCR
amplification can be performed on fixed tissue or cells.
Applies the methodology of hybridization of the nuclic acid.
Allow the identification of cellular markers
Use
 Detection and diagnostics of virus and other infectious agents in specific type of cells
 Detection and characterization of tumor cell within tissue
 Detection of genetic mutation in inherited disease
 Detection of gene and gene expression in a tissue.
 And no need to radioactive material.
Cloning of PCR Product
Some applications require that after a PCR the resulting products are ligated into a vector and examined
by any of the standard methods used for studying cloned DNA. This may sound easy, but there are
complications.

Figure Gel electrophoresis of the PCR product can provide information on the template DNA molecule.
Lanes 1 and 2 shows, respectively, an unrestricted PCR product and a product restricted with the enzyme
that cuts at site R. Lane 3 shows the result obtained when the template DNA contains an insertion in the
amplified region.
Introduction of DNA into plant cell

Transfection technique

Construction of cDNA and genomic library

cDNA and genomic cloning