Journal of Insect Science

RESEARCH

Identification and Characterization of Bacillus cereus SW7-1 in Bombyx mori

(Lepidoptera: Bombycidae)
Guan-Nan Li,1,2 Xue-Juan Xia,3 Huan-Huan Zhao,1,2 Parfait Sendegeya,1,2 and Yong Zhu1,2,4
1
College of Biotechnology, Southwest University, Chongqing 400716, China
2
State Key Laboratory of Silkworm Genome Biology, Chongqing 400716, China
3
College of Food Science, Southwest University, Chongqing 400716, China
4
Corresponding author, e-mail: [email protected]

Subject Editor: Seth Barribeau

J. Insect Sci. (2015) 15(1): 136; DOI: 10.1093/jisesa/iev121

ABSTRACT. The bacterial diseases of silkworms cause significant reductions in sericulture and result in huge economic loss. This study
aimed to identify and characterize a pathogen from diseased silkworm. SW7-1, a pathogenic bacterial strain, was isolated from the dis-
eased silkworm. The strain was identified on the basis of its bacteriological properties and 16S rRNA gene sequence. The colony was
round, slightly convex, opaque, dry, and milky on a nutrient agar medium, the colony also exhibited jagged edges. SW7-1 was Gram-
positive, without parasporal crystal, and 0.8–1.2 by 2.6–3.4 mm in length, resembling long rods with rounded ends. The strain was posi-
tive to most of the physiological biochemical tests used in this study. The strain could utilize glucose, sucrose, and maltose. The results
of its 16S rRNA gene sequence analysis revealed that SW7-1 shared the highest sequence identity (>99%) with Bacillus cereus strain
14. The bacterial strain was highly susceptible to gentamycin, streptomycin, erythromycin, norfloxacin, and ofloxacin and moderately
susceptible to tetracycline and rifampicin. It exhibited resistance to other antibiotics. SW7-1 had hemolytic activity and could produce
extracellular casease, lipase, and amylase. SW7-1 could reproduce septicemia-like symptoms with high mortality rate when re-fed to
healthy silkworm. .The median lethal concentration (LC50) was 5.45  104 cfu/ml. Thus, SW7-1 was identified as B. cereus, which is a
pathogen for silkworm and human infections are possible.

Key Words: silkworm (Bombyx mori), identification, characterization, Bacillus cereus, pathogen

The silkworm, Bombyx mori L. (Lepidoptera: Bombycidae), is an im- Materials and Methods
portant economic insect that not only can produce silk but has high nu- Experimental Silkworm. Diseased silkworm specimens were col-
tritive value. Over 30 million silkworm farmers are presently involved lected from the Laboratory of Genetics and Breeding of Silkworm,
in the sericultural production in China across 10 provinces (Li et al. College of Biotechnology of Southwest University (Chongqing,
2011, Liang et al. 2014). The silkworm is susceptible to silkworm dis- China), and they were used as a source of inocula to isolate the patho-
eases, but massive outbreaks are generally rare. Studies have investi- genic microorganisms. Healthy newly molted fifth-instar larvae were
gated the pathogenicity of Nosema bombycis (Li et al. 2015b) and used for bioassays. Silkworm variety 734 was used for the test.
Beauveria bassiana (Xu et al. 2015). However, a few studies have eval- Isolation and Culture. SW7-1 was isolated according to the method
uated the bacterial diseases of silkworms. Bacteria can attack physio- described by Zhang et al. (2013) with slight modifications. SW7-1 was
logically weak silkworms; as a result, great losses in sericulture occur grown on nutrient agar medium at 37 C for 48 h. The medium com-
(Tao et al. 2011). Hence, unknown pathogenic bacteria should be iden- prised the following (per liter): tryptone, 10 g; NaCl, 5 g; beef extract,
tified and effectively controlled. 3 g; and agar, 20 g and neutral pH. The medium was autoclaved at
Bacterial disease commonly affect silkworm, but the etiology is not 121 C for 15 min. To prepare the suspension culture, we cultivated
fully understood because multiple bacterial types are involved in bacte- strain SW7-1 at 37 C and 200 rpm (THZ-22 oscillator; Bing Lab
rial infections (Choudhury et al. 2002, Kaito et al. 2002). Many silk- Equipment Co., Ltd., Suzhou, China) for 24 h in nutrient broth medium
worm pathogenic bacteria, including Bacillus, Enterobacter, Serratia, (nutrient agar medium without agar) and stored at 4 C. Media for phys-
Aeromonas, Streptococcus, Pseudomonas, and Staphylococcus, have iological and biochemical identification tests were prepared as
been identified (Tao et al. 2011). Although previous studies have char- described in relevant references (Barrow and Feltham 2004, Li et al.
acterized the pathogenicity of Bacillus bombysepticus and Bacillus 2014a). The culture has been deposited to China General
thuringiensis to silkworm (Cheng et al. 2014, Li et al. 2014b), few stud- Microbiological Culture Collection Center (CGMCC), and its pathoge-
ies have identified or characterized other pathogenic bacteria in the nicity was established using Koch’s laws (Liu et al. 1995).
Bacillus genus. Morphologic and Biochemical Characterization of SW7-1. Colony
In our study, a pathogenic bacterial strain, named SW7-1, was iso- characteristics of SW7-1 were observed after growing on a nutrient
lated from the diseased silkworm and then cultured on nutrient agar me- agar plate at 37 C for 48 h, and cellular morphology was determined
dium. The isolated strain proved to be pathogenic to healthy silkworm, using light microscopy and Gram staining (Feng et al. 2011). Cell
and its LC50 was investigated. Simultaneously, SW7-1 was examined morphology was also observed under a JCM-5000 (Nikon, Japan)
in detail to confirm its taxonomic status, and its hemolytic activity, anti- scanning electron microscope under 5,400 magnification.
biotic susceptibility, and extracellular enzyme activity were recorded. Physiological and biochemical analyses were performed by
This study aimed to identify and characterize a pathogen of silkworm, referring to Bergey’s Manual (Holt 1994) and the Manual for the
as well as provide a basis for its pathogenesis and control. Microbiology Experiment (Shen et al. 1999).

C The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.
V
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits
non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected]
2 JOURNAL OF INSECT SCIENCE VOLUME 15

DNA Extraction and Polymerase Chain Reaction Amplification of large, convex, opaque, dry, crude colonies of SW7-1 developed. The
16S rRNA Sequence. The genomic DNA of SW7-1 was extracted using colonies had jagged edges, and a waxy substance appeared around the
a TIANamp Bacteria DNA Kit (Tiangen Biotech Co., Ltd., Beijing, colony. Moreover, SW7-1 was Gram-positive and could produce
China), quantified with a NanoDrop 2000 Spectrophotometer (Thermo, spores. No crystals were found in the sporulated cultures of the SW7-1
USA), and stored at 20 C until used. Polymerase chain reaction strains examined through light and electron microscopies. Electron
(PCR) amplification of SW7-1 was performed with a universal set of microscopy revealed that the cells were rods shaped with rounded ends,
primers for the bacterial 16S rRNA gene. The forward primer was 27F: and the sizes of the cells were 0.8–1.2 mm in width by 2.6–3.4 mm in
AGAGTTTGATCATGGCTCAG, and the reverse primer was 1492R: length (Fig. 1).
ACGGTTACCTTGTTACGACTT (Lane et al. 1985). PCR amplifica- Physiological and Biochemical Characteristics of SW7-1. SW7-1
tion was performed in a total volume of 50 ll containing 5 ll of DNA was aerobic and motile. It was positive for urease, catalase, oxidase,
extract, 1 ll of each primer (10 mmol/liter), 4 ll of deoxyribonucleotide deoxidization of nitrate, and VogesProskauer reaction. However, it
triphosphate mixture (each 2.5 mM), 5 ll of 10 PCR buffer (Mg2þ was negative for methyl red, indole, H2S production, and phenylalanine
plus), and 0.3 ll of Taq DNA polymerase (TaKaRa, Japan). PCR was deaminase reaction tests. SW7-1 produced oxidase and catalase. It
performed in a thermocycler (ABI, USA) with initial denaturation at could utilize sodium citrate, glucose, fructose, and sucrose, except lac-
94 C for 4 min, followed by 35 cycles of denaturation for 40 s at 94 C, tose (Table 1).
annealing at 55.0 C for 40 s, extension for 1 min at 72 C, and a final On the basis of these observations, we propose that SW7-1 may be a
extension at 72 C for 10 min. The amplified products (1,500 bp) were strain of Bacillus sp.
subjected to 1.2% agarose gel electrophoresis, cloned into pMD19-T 16S rRNA Gene Sequence and Phylogenetic Analysis. The 16S
Vector (TaKaRa, Japan), and sequenced directly in Sangon Biotech rRNA gene sequence of strain SW7-1 was about 1,500 bp in length
Co., Ltd (Shanghai, China). The sequence was deposited in GenBank, (GenBank accession no. KP698984). The sequence was analyzed using
and an accession number was obtained for it. the RDP online software, and the taxonomic status of SW7-1 was deter-
The sequence was analyzed online (http://rdp.come.msu.edu). mined directly as follows: Bacteria (domain), Firmicutes (phylum),
Homology comparison of the almost complete 16S rRNA gene sequence Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus
of SW7-1 was performed by running it through the BLAST database on (genus).
NCBI (http://www.ncbi.nlm.nih.gov/Blast.cgi). Sequence alignment was The 16S rRNA gene sequence was also compared using
carried out using CLUSTAL X software. The phylogenetic tree was per- BLASTN, and SW7-1 showed high similarity to Bacillus spp.
formed using the MEGA 5.05 software package (Hall 2005, Li et al. (>99%). A total of 29 sequences of different strains were selected
2015a) and was constructed using the neighbor-joining method. and aligned, and a phylogenetic tree was constructed (Fig. 2). The
Hemolysis Test and Antibiotic Susceptibility Assay. The hemolysis phylogenetic tree revealed that Bacillus cereus strain 14 had high
test of SW7-1 was performed by placing the strain on a Columbia agar homology with SW7-1. Hence, SW7-1 could be a B. cereus
base (Cr-microbio Trade Co., Ltd., Jiangmen, China) at 37 C for 48 h, (CGMCC No. 10652).
and hemolytic activity was observed. The antibiotic susceptibility test Hemolytic Activity and Antibiotic Susceptibility. The hemolysis
of SW7-1 employed the K-B disc diffusion method using 14 kinds of test indicated that SW7-1 exhibited hemolytic activity and produced
paper discs (Hangzhou Microbial Reagent Co., Ltd., Hangzhou, hemolysin. SW7-1 was highly susceptible to gentamycin, streptomy-
China). The zone of inhibition was measured (mm), and antibiotic sen- cin, erythromycin, norfloxacin, and ofloxacin (zone of inhibition of
sitivity was recorded as different grades based on their activity >6 mm) and moderately susceptible to tetracycline and rifampicin. It
(Thankappan et al. 2014). was resistant to other antibiotics (Table 2).
Extracellular Enzyme Test. Casease medium, lipase medium, and Extracellular Enzyme Activity. SW7-1 exhibited strong amylase
soluble starch medium were prepared according to Li et al. (2015a) to activity as observed by the clear inhibition zone (4–5 mm) around the
survey casease, lipase, and amylase-producing activity of SW7-1. The colony. However, SW7-1 possessed only moderate casease activity
bacterial isolate, SW7-1, grown overnight was inoculated on three (2–4 mm) and lipase activity.
selective media for the determination of extracellular enzyme activity. Pathogenicity Analysis of Strain SW7-1. The SW7-1 suspension
Plates were incubated at 37 C for 48 h, and the halos or clear zone was fed to the fifth-instar larvae, and SW7-1 exerted an obvious lethal
around colonies were recorded. effect on the silkworms after 48 h. The peak mortality of silkworms
Pathogenicity Test. A bacterial suspension of SW7-1 was prepared occurred between 48 and 72 h. Simultaneously, the control groups all
with 10.0 ml of sterile PBS (2 mol/liter, pH 7.4) and centrifuged at survived. The silkworms fed with SW7-1 exhibited symptoms similar
2,314g (Allegra X-22R; BACKMAN, USA) for 3 min. The sediment
was again suspended in 10.0 ml PBS. Its concentration was determined
according to the method described by Tao et al. (2011). The feedstuff of
silkworm was purchased from Shandong Academy of Agricultural
Sciences (Yantai, China). The feedstuff was mixed well with ddH2O,
autoclaved at 105 C for 1 h, and stored at room temperature. Forty
healthy newly molted fifth-instar larvae were included in each experi-
mental group, and each treatment was performed in triplicate.
Simultaneously, the control group was set with PBS only. The feedstuff
of silkworm inoculated with an appropriate number of bacteria was fed
to the larvae three times daily. The larvae were reared under hygienic
conditions at 28.0 6 1.0 C. The symptoms of the silkworms were
observed and the mortality of the silkworms was recorded. Data were
analyzed using SPSS 20, and the median lethal concentration (LC50)
was obtained (Mohanta et al. 2014).

Results
Description of SW7-1 Colonies and Microscopic Morphology.
Bacteria were isolated after plating onto agar solidified nutrient Fig. 1. Morphological features of SW7-1 under scanning electron
medium. After routine culture on nutrient agar at 37 C for 48 h, milky, microscope.
2015 LI ET AL.: IDENTIFICATION OF A PATHOGEN OF SILKWORM 3

Table 1. Physiological and biochemical characteristics of SW7-1

Tested items SW7-1 Tested items SW7-1 Tested items SW7-1
Gram strain þ Parasporal crystal – H2S production –
Spore þ Deoxidization of nitrate þ Glucose fermentation þ
Motility þ Utilization of sodium citrate þ Lactose fermentation –
Catalase þ Gelatin liquefaction test þ Sucrose utilization þ
Oxidase þ Phenylalanine deaminase – Maltose utilization þ
Urease test þ M.R. reaction –
V–P test þ Indole test –
þ, Positive; –, negative.

Bacillus globisporus (X68415.1)

95
100 Bacillus pasteurii (X60631.1)
18 Bacillus insolitus (AM980508.1)

28 Bacillus lentus (JN393850.1)

Bacillus azotoformans (AB363732.1)
Bacillus circulans (KF475811.1)
43 33
35 Bacillus firmus (KF535122.1)
Bacillus fastidiosus (X60615.1)
38 Bacillus megaterium (GU191918.1)
Bacillus alcalophilus (EU231621.1)
Bacillus pumilus (GU191909.1)
37
Bacillus licheniformis (AB039328.1)
94
Paenibacillus popilliae (X60633.1)
97
Paenibacillus lentimorbus (X60622.1)
86
Bacillus amyloliquefaciens (FJ705346.1)
78
59 Bacillus tequilensis (KM015443.1)
Geobacillus stearothermophilus (AY608930.1)
27
Virgibacillus pantothenticus (AB039331.1)
Bacillus coagulans (AB557590.1)
22
Bacillus mycoides (AB738786.1)
20 Bacillus anthracis (HQ200405.1)
Bacillus thuringiensis (KC758847.1)
100
Bacillus thuringiensis (HM217124.1)
99 Bacillus cereus (KR063181.1)
Bacillus cereus (FJ501984.1)
64
85 Bacillus thuringiensis (JX283457.1)
Bacillus cereus (KJ572277.1)
Bacillus cereus (EU794727.1)
Bacillus cereus strain 14 (JN700160.1)
88
SW7-1

0.005

Fig. 2. Phylogenetic tree of the 16S rRNA sequences of the SW7-1 strain. The tree was constructed by the neighbor-joining method. Numbers
in parentheses represent the sequences accession numbers in GenBank. The neighbor-joining consensus tree used 1,000 bootstrap replicates.
The number at each branch point represents the percentage of bootstrap values.

to diseased silkworms. The mortality rate of the larvae increased with cfu/ml (Table 3). The silkworm infected with SW7-1 exhibited symp-
increasing bacterial concentration. Pathogenicity could be depicted as a toms such as loss of appetite, vomiting, diarrhea, softening of larvae,
linear regression of the logarithm (y) of SW7-1 concentration against crimping of cadavers, and rotting, which were similar to those of bacte-
probability (x) (y ¼ 1.85 þ 0.6651x). LC50 was found to be 5.45  104 rial septicemia (Fig. 3).
4 JOURNAL OF INSECT SCIENCE VOLUME 15

Discussion homology is higher than 99% (Fry et al. 1991, Laurentiu et al. 2014).
The silkworm is an insect with high economic value. It occupies an Most microbiologists believe that B. thuringiensis and B. cereus can
important position in human economic life and cultural history. In generally be classified on the basis of parasporal crystals, despite the
China, sericulture is an important part of agriculture that has been in difficulty in distinguishing these strains in terms of bacteriological
existence for more than 5,000 years. However, bacterial diseases often properties (Gillis and Mahillon 2014). The presence of crystals can be
cause severe economic losses in sericulture. Although several bacterial determined through light or scanning electron microscopy (Priest et al.
diseases have been researched and described, the pathogenic mecha- 2004). Thus, our experiments support the SW7-1 is a strain of B. cereus.
nism of many bacteria remains unknown. Therefore, the identification B. cereus is a highly threatening hemolytic bacterium that causes diar-
and characterization of new pathogenic bacteria for silkworm is very rhea to the host organism (Thankappan et al. 2014). This study con-
important. We found masses of dead silkworms with the same symptom firmed that SW7-1 was pathogenic and hemolytic against the silkworm
when we worked on the genetics and breeding of silkworm. Therefore, and red blood cell, respectively, which verified its pathogenicity for ser-
we collected diseased silkworm specimens, which we used as source of iculture and other livestock production purposes. Using an antibiotic
inocula to isolate pathogenic microorganisms. susceptibility assay, we found that SW7-1 was highly susceptible to
In this study, the isolated bacterium was characterized by various gentamycin, streptomycin, erythromycin, norfloxacin, and ofloxacin.
morphological, biochemical, and molecular biological techniques and However, SW7-1 is highly resistant to b-lactam antibiotics (Yim et al.
named as SW7-1. Based on morphological, physiological, and bio- 2015), such as penicillin, ampicillin, carbenicillin, amoxicillin, oxacil-
chemical characteristics, SW7-1 was preliminarily identified as lin, cefazolin, and ceftriaxone. This resistance may be associated with
Bacillus sp. The phylogenetic tree and 16S rRNA gene sequence analy- b-lactamase production (Park et al. 2009). The result of antibiotic sus-
sis showed that SW7-1 had high sequence homology with B. cereus ceptibility assay indicated that the SW7-1 bacterium was a multidrug-
strain 14 (>99%). Bacterial taxonomists believe that bacteria can be resistant pathogen that might lead to sudden infectious disease
identified as the same species when their 16S rRNA gene sequence outbreaks.
Studies have shown that the extracellular enzymes of B. cereus
might be related to pathogenicity (Orhan et al. 2005). The result of the
extracellular enzyme test showed that SW7-1 could produce extracellu-
Table 2. Antimicrobial susceptibility and resistance pattern lar casease, lipase, and amylase, and these enzymes might contribute to
of SW7-1 pathogenicity. B. cereus is a pathogenic strain that does not only infect
Antibiotics SW7-1 Antibiotics SW7-1 Antibiotics SW7-1 insects but also causes human diseases, such as septicaemia (Lysenko
(mg) (mg) (mg) 1972, Casella and Monzani 1984, Fagerlund et al. 2007). Thus, SW7-1
was a pathogen for silkworm, and human infections are possible. The
Penicillin-G (10) R Gentamycin (10) S Amoxicillin (10) R
Oxacillin (1) R Streptomycin (10) S Rifampicin (5) M LC50 of SW7-1 was 5.45  104 cfu/ml. Previous studies have reported
Ampicillin (10) R Tetracycline (10) M Ofloxacin (5) S the LC50 values of several pathogens of silkworm: Pseudmonas auran-
Cefazolin (30) R Erythromycin (15) S Carbenicillin (100) R tiaca, LC50 of 2.12  104 cfu/ml; Serratia marcescens, 4.32  104 cfu/
Ceftriaxone (30) R Norfloxacin (10) S ml; Bacillus thuringensis, 2.80  104 cfu/ml; Providencia rettgeri,
S, zone of inhibition above 6 mm; M, zone of inhibition between 4 and 1.44  107 cfu/ml; and Klebsiella granulomatis, 2.54  107 cfu/ml
6 mm; R, resistant. (Tao et al. 2011, Zhang et al. 2013, Mohanta et al. 2014).

Table 3. Pathogenicity of B. cereus SW7-1 against silkworm

Concentration of bacteria (cfu/ml) Corrected mortality (%) Linear regression equation LC50 95% confidence limits Pearson correlation
3 4
1.91  10 23.84 y ¼ 1.85 þ 0.661x 5.45  10 28433.59-104432.18 0.961
1.91  104 36.47
1.91  105 52.16
1.91  106 78.42
1.91  107 97.53

Fig. 3. Symptoms of silkworm infected by SW7-1. Blue arrow: healthy silkworm; red arrow, silkworm infect with SW7-1; a: after 48 h
infection; b: after 24 h infection.
2015 LI ET AL.: IDENTIFICATION OF A PATHOGEN OF SILKWORM 5

In conclusion, the silkworm pathogen SW7-1 was identified and bacteria in laboratory rodents: a practical approach in laboratory animal bac-
characterized. It was hemolytic and highly pathogenic to silkworm teriology diagnostics. Lab. Anim. 48: 305–312.
(LC50 ¼ 5.45  104 cfu/ml), and this pathogen could produce extracel- Li, G. H., Q. Tang, H. Q. Chen, Q. Yao, D. G. Ning, and K. P. Chen. 2011.
Display of Bombyx mori nucleopolyhedrovirus GP64 on the Bacillus subtilis
lular enzyme and resistance to b-lactam antibiotics. Detailed studies are spore coat. Curr. Microbiol. 62: 1368–1373.
needed to confirm the pathogenic mechanism of the silkworm disease Li, G. N., X. J. Xia, H. H. Zhao, Y. H. Long, J. R. Li, and Y. Zhu. 2014a.
caused by this bacterium. These results contribute to prevent and Effects of fluoride on the community and diversity of the retained enzyme-
control of disease caused by this bacterium. Hence, investigations on producing bacteria in the intestine of silkworm (Bombyx mori). Acta.
this bacterium have important implications in sericulture. Entomol. Sin. 57: 187–193.
Li, N., J. Wang, H. Y. Han, L. Huang, F. Shao, and X. P. Li. 2014b. Intravital
Acknowledgments imaging of Bacillus thuringiensis Cry1A toxin bingding sites in the midgut
of silkworm. Anal. Biochem. 447: 90–97.
This study was supported by The National Agricultural Science Li, G. N., X. J. Xia, P. Sendegeya, S. B. He, D. D. Guo, and Y. Zhu. 2015a.
and Technology Achievements Transformation Foundation Screening and identification of silkworm probitic Bacillus SWL-19 and its ef-
(2012GB2F100376) and The Special Research Foundation of fect on intestinal microflora diversity. Sci. Agric. Sin. 48: 1845–1853.
Southwest University (XDJK2014D039). We are grateful to all who Li, Z. H., H. J. Hao, L. L. Wang, H. Xiang, and Z. Y. Zhou. 2015b. Genome-
wide identification and comprehensive analyses of the kinomes in four patho-
provided the means for us to access free software, which we used cited genic microsporidia species. PLoS One 9: 1–27.
in this article. We thank all partners and laboratory members for their Liang, X., Y. M. Fu, L. Tong, and H. Liu. 2014. Microbial shifts of the silk-
kind help. worm larval gut in response to lettuce leaf feeding. Appl. Microbiol.
Biotechnol. 98: 3769–3776.
References Cited Liu, S. G., W. Zhu, Z. R. Yang, S. R. Ge, X. Y. He, X. Yuan, and L. Z.
Zhang. 1995. Isolation and identification of a pathogen of grasshoppers.
Barrow, G. I., and R.K.A. Feltham. 2004. Cowan and Steel’s manual for the
Acta Microbiol. Sin. 35: 86–89.
identification of medical bacteria. Cambridge University Press, Cambridge,
Lysenko, O. 1972. Pathogenicity of Bacillus cereus for insects. Folia.
UK.
Microbiol. 17: 221–227.
Casella, P., and N. Monzani. 1984. A case of septicaemia caused by Bacillus
Mohanta, M. K., A. K. Saha, D. K. M. A. Saleh, M. S. Islam, K. S. B.
cereus. Eur. J. Appl. Physiol. 3: 35–36.
Mannan, and M. Fakruddin. 2014. Characterization of Klebsiella granulo-
Cheng, T. C., P. Lin, S. K. Jin, Y. Q. Wu, B. F. Fu, R. W. Long, D. L. Liu, Y.
matis pathogentic to silkworm, Bombyx mori L. 3 Biotech. 5: 577–583.
B. Guo, L. Peng, and Q. Y. Xia. 2014. Complete genome sequence of
Orhan, E., D. Omay, and Y. Guvenilir. 2005. Partial purification and charac-
Bacillus bombysepticus, a pathogen leading to Bombyx mori black chest sep-
terization of protease enzyme from Bacillus subtilis and Bacillus cereus.
ticemia. Genome Announc. 2: e00312-14.
Appl. Biochem. Biotechnol. 121: 183–194.
Choudhury, A., A. Guba, A. Yadav, B. G. Unni, and M. K. Roy. 2002.
Park, Y., J. B. Kim, S. B. Shin, J. C. Kim, S. H. Cho, B. K. Lee, J. Ahn, J.
Causal organism of flacherie in the silkworm Antheraea assama Ww: isola-
M. Kim, and D. H. Oh. 2009. Prevalence, genetic diversity, and antibiotic
tion, characterization and its inhibition by garlic extract. Phytother. Res. 16:
susceptibility of Bacillus cereus strains isolated from rice and cereals col-
89–90.
lected in Korea. J. Food. Prot. 72: 612–617.
Fagerlund, A., J. Brillard, R. Fürst, M. H. Guinebretière, and P. E.
Priest, F. G., M. Barker, L. W. J. Baillie, E. C. Holmes, and M. C. J.
Granum. 2007. Toxin production in a rare and genetically remote cluster of
Maiden. 2004. Population structure and evolution of the Bacillus cereus
strains of the Bacillus cereus group. BMC. Microbiol. 7: 43–45.
group. J. Bacteriol. 186: 7959–7970.
Feng, W., X. Q. Wang, W. Zhou, G. Y. Liu, and Y. J. Wan. 2011. Isolation
Shen, P., S. R. Fan, and G. W. Li. 1999. Microbiology experiment, 3rd Ed.
and characterization of lipase-producing bacteria in the intestine of the silk-
High Education Press, Beijing, China.
worm, Bombyx mori, reared on different forage. J. Insect. Sci. 11: 1–10.
Tao, H. P., Z. Y. Shen, F. Zhu, X. F. Xu, X. D. Tang, and L. Xu. 2011.
Fry, N. K., S. Warwick, N. A. Saunders, and T. M. Embley. 1991. The use of
Isolation and identification of a pathogen of silkworm Bombyx mori. Curr.
16S ribosomal RNA analyses to investigate the phylogeny of the family
Microbiol. 62: 876–883.
Legionellaceae. J. Gen. Appl. Microbiol. 137: 1215–1222.
Thankappan, B., D. Ramesh, S. Ramkumar, K. Natarajaseenivasan, and
Gillis, A., and J. Mahillon. 2014. Phages preying on Bacillus anthraces,
K. Anbarasu. 2014. Characterization of Bacillus spp. from the gastrointesti-
Bacillus cereus, and Bacillus thuringiensis: past, present and future. Viruses
nal tract of Labeo rohita—towards to identify novel probiotics against fish
6: 2623–2672.
pathogens. Appl. Biochem. Biotechnol. 175: 340–353.
Hall, B. G. 2005. Comparison of the accuracies of several phylogenetic meth-
Xu, Y. J., F. F. Luo, Q. Gao, Y. F. Shang., and C. S. Wang. 2015.
ods using protein and NDA sequence. Mol. Biol. Evol. 22: 792–802.
Metabolomics reveals insect metabolic responses associated with fungal in-
Holt, J. G. 1994. Bergey’s manual of determinative bacteriology, 9th ed.
fection. Anal. Bioanal. Chem. 407: 4815–821.
Williams and Wilkins, Baltimore, MA.
Yim, J. H., K. Y. Kim, J. W. Chon, D. H. Kim, H. S. Kim, D. S. Choi, I. S.
Kaito, C., N. Akimitsu, H. Watanabe, and K. Sekimizu. 2002. Silkworm lar-
Choi, and K. H. Seo. 2015. Incidence, antibiotic susceptibility, and toxin
vae as an animal model of bacterial infection pathogenic to humans. Microb.
profiles of Bacillus cereus sensu lato isolated from Korean fermented soy-
Pathog. 32: 183–190.
bean products. J. Food. Sci. 80: 1266–1270.
Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, M. L. Soqin, and N. R. Pace.
Zhang, J., Z. Y. Shen, X. D. Tang, L. Xu, and F. Zhu. 2013. Isolation and
1985. Rapid determination of 16S ribosomal RNA sequence for phylogenetic
identification of a pathogen, Providencia rettgeri, in Bombyx mori. J.
analysis. Proc. Natl. Acad. Sci. USA. 82: 6955–6959.
Bacteriol. Res. 1: 49–55.
Laurentiu, B., W.P.M. Benten, E. Engelhardt, K. Köhrer, C. Gougoula, and
M. Sager. 2014. 16S ribosomal DNA sequence-based identification of Received 5 June 2015; accepted 6 September 2015.