Detection of viruses in used ventilation

filters from two large public buildings

Sagar M. Goyal, DVM, PhD,a Senthilvelan Anantharaman, DVM, PhD,a M. A. Ramakrishnan, DVM, PhD,a
Suchitra Sajja, PhD,a Seung Won Kim, PhD,b Nicholas J. Stanley, MS,c James E. Farnsworth, MS,c Thomas H. Kuehn, PhD,c
and Peter C. Raynor, PhDb
St. Paul and Minneapolis, Minnesota

Background: Viral and bacterial pathogens may be present in the air after being released from infected individuals and animals.
Filters are installed in the heating, ventilation, and air-conditioning (HVAC) systems of buildings to protect ventilation equipment
and maintain healthy indoor air quality. These filters process enormous volumes of air. This study was undertaken to determine
the utility of sampling used ventilation filters to assess the types and concentrations of virus aerosols present in buildings.
Methods: The HVAC filters from 2 large public buildings in Minneapolis and Seattle were sampled to determine the presence of
human respiratory viruses and viruses with bioterrorism potential. Four air-handling units were selected from each building,
and a total of 64 prefilters and final filters were tested for the presence of influenza A, influenza B, respiratory syncytial, corona,
parainfluenza 1-3, adeno, orthopox, entero, Ebola, Marburg, Lassa fever, Machupo, eastern equine encephalitis, western equine
encephalitis, and Venezuelan equine encephalitis viruses. Representative pieces of each filter were cut and eluted with a buffer
solution.
Results: Attempts were made to detect viruses by inoculation of these eluates in cell cultures (Vero, MDCK, and RK-13) and specific
pathogen-free embryonated chicken eggs. Two passages of eluates in cell cultures or these eggs did not reveal the presence of any
live virus. The eluates were also examined by polymerase chain reaction or reverse-transcription polymerase chain reaction to
detect the presence of viral DNA or RNA, respectively. Nine of the 64 filters tested were positive for influenza A virus, 2 filters
were positive for influenza B virus, and 1 filter was positive for parainfluenza virus 1.
Conclusion: These findings indicate that existing building HVAC filters may be used as a method of detection for airborne viruses.
As integrated long-term bioaerosol sampling devices, they may yield valuable information on the epidemiology and aerobiology of
viruses in air that can inform the development of methods to prevent airborne transmission of viruses and possible deterrents
against the spread of bioterrorism agents.
Key Words: Aerosols; bioterrorism; long-term sampling; polymerase chain reaction; virus isolation; viral nucleic acid detection.
Copyright ª 2011 by the Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights
reserved. (Am J Infect Control 2011;39:e30-8.)

Human and animal health is influenced by the pres- distances.5-8 The viability of bioaerosols is influenced
ence of gaseous pollutants, dust, and bioaerosols in the by temperature, humidity, UV radiation, the nature of
ambient air. The air may contain viable or nonviable the pathogen, and the presence of particulates/organic
pathogens, including bacteria, fungi, and viruses.1-4 In- matter.9,10 Most previous studies of bioaerosols in in-
fectious bioaerosols have been implicated in many res- door environments, such as schools, child care centers
piratory diseases and are capable of transporting an and other large buildings, are related to contamination
infection hazard from one area to another over long with bacteria and fungi,11-13 whereas reports on the
presence of viral aerosols in indoor air are scarce.
From the Department of Veterinary Population Medicine, College of Many types of air samplers, eg, Andersen sampler,
Veterinary Medicine, University of Minnesota, Saint Paul, MN,a Division Burkhard sampler (Burkhard Scientific, Uxbridge, UK),
of Environmental Health Sciences, School of Public Health,b and Depart-
ment of Mechanical Engineering, College of Science and Engineering, RCS Plus (Biotest Microbiology Corporation, Rockaway,
University of Minnesota, Minneapolis, MN.c NJ), SAS Super 90 (Bioscience International, Rockville,
Address correspondence to Sagar M. Goyal, DVM, PhD, Department of MD), and Ace all-glass impinger 30 (Ace Glass, Inc., Vine-
Veterinary Population Medicine, College of Veterinary Medicine, Uni- land, NJ), are commercially available and have been used
versity of Minnesota, St Paul, MN 55108. E-mail: [email protected]. to detect airborne bacteria and fungi.14-17 However, there
This study was supported in part by a contract from the Technical Sup- are conflicting data on the ability and efficiency of these
port Working Group (TSWG Task DC-2012A), with funding from the samplers for the detection of viral aerosols. For example,
US Department of Homeland Security (W91CRB-04-C-0035).
Hogan et al18 determined that the Ace Glass all-glass
Conflict of interest: None to report.
impinger 30, SKC BioSampler (SKC Inc., Eighty Four,
0196-6553/$36.00 PA), and frit bubbler were not adequate for collecting vi-
Copyright ª 2011 by the Association for Professionals in Infection rus particles from the air. However, using a high-volume
Control and Epidemiology, Inc. Published by Elsevier Inc. All rights air sampler, McGarrity and Dion19 were able to detect pol-
reserved.
yoma virus in the air of an animal laboratory housing
doi:10.1016/j.ajic.2010.10.036
mice infected with the virus. Donaldson et al20 used a

e30
www.ajicjournal.org Goyal et al. e31
Vol. 39 No. 7

large-volume sampler and a cyclone sampler to detect from only 0.7% to 20%. Our results indicate that the
airborne foot-and-mouth disease virus, and Myatt airborne concentration of hardy spore-forming bacte-
et al21 detected airborne rhinovirus in an office environ- ria might be determined by analyzing the material col-
ment using 37-mm Teflon (DuPont, Wilmington, DE) fil- lected on HVAC filter media. That earlier study
ters and sampling air at 4 L/min. Similarly, exotic suggested that culture-based analytical techniques
Newcastle disease virus was detected in commercial may be impractical for live virus recovery, but
poultry flocks using wetted-wall, cyclone-style air molecular-based identification techniques, such as
samplers.2 PCR and reverse-transcription PCR (RT-PCR), might be
Filters are used in the heating, ventilation, and air- useful for virus detection.
conditioning (HVAC) systems of large buildings to re-
move particulate pollutants from both outdoor and MATERIALS AND METHODS
indoor air, protecting ventilation system components
Overview
and maintaining acceptable indoor air quality.8,22 Al-
though these filters are not designed specifically to cap- This pilot study was conducted to detect human
ture virus-sized particles and have not been evaluated as pathogenic viruses in HVAC filters removed from 2
such, they can be expected to trap viral aerosols because large public buildings. The viruses investigated in-
they filter large volumes of air continuously, and aggre- cluded those that cause respiratory diseases (eg, influ-
gates of viruses and particles laden with one or more vi- enza A, influenza B, respiratory syncytial, corona,
ruses are likely to be deposited on their surfaces. The parainfluenza types 1-3, and adenovirus) and those
role of ventilation filters in the epidemiology of that could possibly be used as bioterrorism agents
adenovirus-related respiratory disease was docu- (eg, orthopox, entero, Ebola, Marburg, Lassa fever,
mented by Echavarria et al,23 who conducted a study Machupo, eastern equine encephalitis, western equine
in buildings occupied by unvaccinated US Army encephalitis, and Venezuelan equine encephalitis vi-
trainees for adenovirus-related infections. The percent- ruses). After eluting collected materials from the
age of filters that were positive for adenovirus type 4 by HVAC filters, we attempted to detect these viruses by vi-
polymerase chain reaction (PCR) analysis was directly rus isolation in cell cultures and specific pathogen-free
proportional to the number of hospitalizations of the (SPF) embryonated chicken eggs and by the detection
trainees housed in those buildings, indicating that these of viral RNA by RT-PCR or DNA by PCR.
filters could trap the aerosolized infectious pathogens.
Another study found that a commercial air filtration sys- Filters
tem prevented the transmission of porcine reproductive
and respiratory syndrome virus aerosols from infected Two large public buildings located in Minneapolis
to noninfected pigs, indicating that the virus was re- (M) and Seattle (S) were used in this study. The 2 build-
moved by the intervening filters.24 These studies dem- ings were of similar size, had the same occupancy den-
onstrate that HVAC filters can be used as a sampling sity, and were used for the same purpose. The 2 cities
medium to collect virus aerosols for further study. were chosen to observe any differences due to climate.
Bioterrorism poses a major potential threat to hu- The buildings were equipped with numerous air-
man health and global peace. In addition to the possi- handling units (AHUs) to maintain indoor temperature
bility of intentional release, individuals self-infected and humidity levels and maintain indoor air quality in
with bioterrorism agents could invade and infect tar- accordance with American Society of Heating, Refrig-
gets.25 Because HVAC filters trap aerosols along with erating and Air-Conditioning Engineers standards.27
other pollutants, testing these filters during a bioterror- Each AHU was fitted with a set of prefilters and final fil-
ism event may yield valuable data on the agent. ters, the number of which depended on the volume of
In a previous study, we analyzed the effectiveness of air being processed. Both filters were designed to be
ventilation filters as sampling devices for airborne bac- dust filters (tested against American Society of Heating,
teria and viruses in an HVAC test apparatus.26 We Refrigerating and Air-Conditioning Engineers standard
loaded HVAC filters with aerosolized bacteria and vi- 52.1: dust-spot efficiency test). Both the prefilters
ruses and used SKC BioSamplers as reference samplers and final filters were constructed from fiberglass or
upstream and downstream of the test filter. Filter sam- synthetic material, designed to not support microbial
ples were cut from the test filter and eluted with 3% growth. The pleated prefilters (60 cm 3 60 cm 3
beef extract-0.05 M glycine (BE solution; pH 8.5). An 3 cm) were designed to capture large particles from
extraction efficiency of 105% 6 19% was calculated the air (with ;30% efficiency). The final filters were
for culturable Bacillus atrophaeus, whereas the extrac- bag-type filters (60 cm2 3 60 cm2) consisting of 8-10
tion efficiencies of live transmissible gastroenteritis vi- bags per filter, designed to capture smaller particles
rus, avian pneumovirus, and fowlpox virus ranged that escape the prefilters.
e32 Goyal et al. American Journal of Infection Control
September 2011

Table 1. Characteristics of filters tested*

Building AHU Air origin Prefilters, n Final filters, n Age of prefilters, days Age of final filters, days

M A-01 Mixed indoor and outdoor 7 5 25-83 30-122

A-04 Mixed indoor and outdoor 7 5 4-48 30-94
F-04 Mixed indoor and outdoor 2 2 30-60 30-60
B-01 Mixed indoor and outdoor 5 3 44-85 92-159
S-18 100% outdoor 2 2 25-30 25-30
S-23 100% outdoor 5 3 6-48 92-154
S HAC-01 Mixed indoor and outdoor 2 2 83-90 91-166
HCC201 Mixed indoor and outdoor 2 2 91-168 91-116
HMT210 Mixed indoor and outdoor 2 2 70-91 91-261
HCT202 Mixed indoor and outdoor 2 2 91-139 91-138
*Filters were in use from 4 to 261 days. Due to strict administrative procedures in these buildings, filters were not obtained at uniform time intervals.

Four AHUs each from buildings M and S were selected In phase II, larger pieces (;60 cm 3 15 cm) were cut
for sampling (Table 1). Initially, AHUs A-01, A-04, F-04, from each prefilter using sterile scissors. These pieces
and S-18 were sampled from building M. Later, however, were then cut into still-smaller pieces and placed in a
F-04 and S-18 were replaced by B-01 and S-23 due to dif- large autoclavable polypropylene bag containing 3 L
ficulties encountered in collecting environmental data. of BE solution. The bag was then placed in a plastic
The building S AHUs sampled were HAC-01, HCC-01, tray and subjected to 15 minutes of shaking on a
HMT-10, and HCT-02. AHUs S-18 and S-23 from building table-top shaker. A bottom corner of the bag was cut
M processed 100% outdoor air, whereas the remaining open with sterile scissors, and the filter eluate was care-
AHUs in the 2 buildings processed a mixture of indoor fully drained into a 4-L beaker. For the final filters, a
and outdoor air. Prefilters and final filters were obtained 26 cm2 piece was cut from each of the 8-10 bags,
from both buildings at different times over an 18-month pooled, and eluted in 1 L of BE solution. Each filter el-
period from August 2004 to December 2005. The period uate was divided into 2 portions (portions A and B). To
from August 2004 to July 2005 was considered phase I, reduce eluate volume, portion A was concentrated by
and that from August 2005 to December 2005 was des- an organic flocculation method,28-30 and portion B
ignated phase II. In phase I, 8 prefilters and 8 final filters was concentrated by a polyethylene glycol (PEG) pre-
were obtained and tested from building M only. Phase II cipitation method,31 as described below.
included building S, and a total of 48 prefilters and final
filters from both buildings were obtained and tested Organic flocculation
(Table 1). Organic flocculation was performed using previ-
ously described methods with modifications.28-30 In
Virus elution brief, bovine serum albumin was added to portion A
In phase I, 4 pieces (;15 cm2 each) were cut from of each eluate at a concentration of 0.02%, followed
randomly selected areas of each prefilter and final filter by adjustment of pH to 3.5 with 1 N HCl. The eluate
for live virus tests. These 4 pieces were pooled as a sin- was stirred for 30 minutes with a magnetic stirrer, fol-
gle sample for virus elution, yielding a total of 16 pools lowed by centrifugation at 6400 3 g for 15 minutes.
from 8 prefilters and 8 final filters. Each pool of filter The supernatant was discarded, and the precipitate
pieces was placed in a 50-mL plastic centrifuge tube was dissolved in 0.15 M Na2HPO4 buffer at pH 9.0 (5
containing 5 mL of 3% beef extract-0.05 M glycine mL per 100 mL of original volume).
(BE solution; pH 8.5). The tube was vortexed for PEG precipitation
1 minute, followed by centrifugation at 3000 3 g for
5 minutes. The supernatant was filtered through a PEG precipitation was performed using the method
serum-coated 0.22-mm pore size filter (Millipore, Bed- of Killington et al31 with modifications. In brief, portion
ford, MA), and the filtrate was inoculated in cell cul- B of the eluate was transferred to a sterile beaker. So-
tures and embryonated chicken eggs for virus dium chloride was added slowly to a final concentra-
isolation. For detection of viral nucleic acids by PCR tion of 2.3% with gentle magnetic stirring. This was
and RT-PCR, another 4 pieces (;15 cm2) from each pre- followed by slow addition of PEG-8000 to a final con-
filter and final filter were cut and eluted in 5 mL of centration of 7%. Stirring was continued for 1 hour,
phosphate-buffered saline (PBS). The PBS eluates and the eluate was kept at 48C overnight. The eluate
from 2 pieces of the same prefilter or final filter were was then centrifuged at 16,000 3 g for 15 minutes, af-
pooled, yielding a total of 32 pools (2 for each filter). ter which the supernatant was discarded. The pellet
www.ajicjournal.org Goyal et al. e33
Vol. 39 No. 7

was suspended in 15 mL of Tris-EDTA-sodium chloride PCR and RT-PCR

buffer (0.01 M Tris-HCl [pH 7.2], 0.002 M EDTA, and
0.15 M NaCl) for each prefilter or in 5 mL for each final Nucleic acid extracts were screened for the viruses
filter. After vortexing for 1 minute, PEG from these sus- listed in Tables 2 and 3. Primers targeting the conserved
pensions was removed by centrifugation at 14,000 3 g region of the genome of the respective virus were se-
for 5 minutes, and the supernatant was used for viral lected from the literature (Tables 2 and 3), using the
analysis. same reaction conditions and primers as in the original
studies. The One-Step RT-PCR Kit (Qiagen) was used for
Virus isolation in cell cultures RT-PCR. The reaction mix consisted of 5 mL of RNA ex-
tract from filter eluate, 1 mL (10 pmol) each of forward
Virus isolation was attempted in 3 different cell and reverse primers, 10 mL of 5 3 RT-PCR buffer, 2 mL
types: Vero, MDCK, and RK-13 cells. The cells were of dNTP mix (containing 10 mM of each dNTP), 2 mL of
grown in 25-cm2 flasks in Eagle’s minimum essential RT-PCR enzyme mix, 1 mL (40 units) of RNase inhibitor
medium (Cellgro; Mediatech, Kansas City, MO) with (Invitrogen, Carlsbad, CA), and water to a volume of 50
Earle’s salts, containing 8% fetal bovine serum and an- mL. PCR analyses with nested or seminested primers
tibiotics (penicillin 150 IU/mL, streptomycin 150 mg/ were carried out using 2 mL of previous RT-PCR reac-
mL, neomycin 50 mg/mL, ciprofloxacin 10 mg/mL, and tion mix as a template. For PCR of DNA viruses, the re-
fungizone 1.5 mg/mL). All samples were inoculated sep- action mixture comprised 25 mL of master mix (HotStar
arately in all 3 cell types (1 mL of sample per flask). The Taq Master Mix Kit; Qiagen), 1 mL (10 pmol) of respec-
inoculated cells were incubated at 378C in a 5% CO2 at- tive forward and reverse primers, 5 mL of DNA extract
mosphere and examined daily under a light micro- from the filter eluate, and water. The final reaction vol-
scope for the appearance of cytopathic effects. After ume was 50 mL in all cases. All amplicons were visual-
5 days of incubation, the cells were freeze-thawed ized in ethidium bromide‒stained 2% agarose gel after
and blind-passaged once. Cell culture fluids after the electrophoresis in 13 Tris-acetate-EDTA buffer. PCR
second passage were centrifuged at 3000 3 g for mix preparation, PCR reactions, and post-PCR analysis
10 minutes. The supernatants were tested for the pres- (agarose gel electrophoresis and documentation) were
ence of viruses by negative contrast electron micro- performed in separate rooms to avoid false-positive re-
copy (NCEM)32 and by hemagglutination (HA)33 using actions and cross-contamination.34
0.5% turkey erythrocytes. Positive controls included influenza A, influenza
Virus isolation in embryonated chicken eggs B, parainfluenza virus 3, rhinovirus, poliovirus type
1 (LSc strain), and porcine adenovirus with their respec-
Samples (0.1 mL per egg) were inoculated into three tive primers and PCR conditions. Bands of appropriate
9- to 11-day-old SPF embryonated chicken eggs sizes were obtained with the viruses tested. To avoid
through the allantoic route. Inoculated eggs were incu- cross-contamination issues, the template was added
bated at 378C and candled every 24 hours. Embryos first for samples, and then for positive controls. Nucleic
that died within 24 hours of inoculation were dis- acid extraction, preparation of PCR reaction mix, and
carded. The remaining embryos were chilled after addition of template were done in different areas of
5 days of incubation; allantoic fluids were harvested the laboratory.
and then blind-passaged once in SPF eggs. After the
second passage, the embryos were examined for the Nucleic acid sequencing
presence of any visible lesions. The harvested allantoic
fluids were centrifuged at 3000 3 g for 10 minutes and All PCR products were purified using the Qiagen
then screened for the presence of viruses by NCEM and MiniElute PCR Purification Kit and submitted for auto-
HA as described above. mated sequencing at the Advanced Genetic Analysis
Center, University of Minnesota. All products were se-
Nucleic acid extraction quenced in both directions using the same set of
primers as used in amplification. Obtained sequences
Viral RNA and DNA were extracted from all eluates were compared with the current GenBank database us-
using the QIAamp Viral RNA Mini Kit and QIAamp ing BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) to
DNA Mini Kit (Qiagen, Valencia, CA), respectively. confirm the presence of the virus.
Known isolates of influenza A virus, influenza B virus,
parainfluenza viruses 1-3, porcine adenovirus 3, cow- RESULTS
pox virus, poliovirus, and transmissible gastroenteritis
virus were used as positive controls. Filter eluates A total of 64 filters were tested for the presence of 18
from unused new filters and nuclease-free water served different viruses by virus isolation in cell cultures and
as negative controls. embryonated chicken eggs and by RT-PCR and PCR.
 e34
Table 2. Primers used for the detection of RNA viruses by RT-PCR assay

Goyal et al.
Primer sequence
Virus Primer name (59 / 39) Target region Amplicon size, bp Reference

Influenza A virus Inf As AAAGCGAATTTCAGTGTGAT NS gene 104 Templeton et al44

Inf Aas GAAGGCAAGGTGAGATTT
Influenza B virus Inf Bs GTCCATCAAGCTCCAGTTTT NP gene 145 Templeton et al44
Inf Bas TCTTCTTACAGCTTGCTTGC
Respiratory syncytial virus RSVs TTTCCACAATATYTAAGTGTCAA Polymerase L gene 155 Templeton et al44
RSVas TCATCWCCATACTTTTCTGTTA
Parainfluenza virus 1 PIV 1s ACCTACAAGGCAACAACATC HN gene 129 Templeton et al44
PIV 1as CTTCCTGCTGGTGTGTTAAT
Parainfluenza virus 2 PIV 2s CCATTTACCTAAGTGATGGAA HN gene 116 Templeton et al44
PIV 2as CGTGGCATAATCTTCTTTTT
Parainfluenza virus 3 PIV 3.1 CTCGAGGTTGTCAGGATATAG HN gene 189 Karron et al45
PIV 3.2 CTTTGGGAGTTGAACACAGTT
Rhinovirus* RV f CCCCTGAATG(CT)GGCTAACCT 5’ NCR 106 Steininger et al46
RV r CGGACACCCAAAGTAGT(CT)GGTC
RV nf GAATG(CT)GGCTAACCTTAA(AC)CCa 93
RV nr CAAAGTAGT(CT)GGTCCC(AG)TCC
Enterovirus UG 52 CAAGCACTTCTGTTTCCCCGG 5’ UTR 435 Siafakas et al47
UG 53 TTGTCACCATAACCAGCCA
Corona virus CORO-1 TGATGGGTTGGGACTATCCTAAATGTGA Pol 1b gene 220 Adachi et al.48
CORO-2 GTAGTTGCATCACCGGAAGTTGTGCACC
Filovirusesy Filo A ATCGGAATTTTTCTTTCTCATT L gene 419 Sanchez et al49
Filo B ATGTGGTGGGTTATAATAATCACTGACATG
Lassa fever virus 36 E2 ACCGGGGATCCTAGGCATTT GPC gene 334 Drosten et al50
80 F2 ATATAATGATGACTGTTGTTCTTTGTGCA
Machupo virusz J1 CGCACAGTGGATCCTAGGC S RNA 185 Lozano et al51
J2 GGCATCCTTCAGAACAT 215
J3 CAACCACTTTTGTACAGGTT
Eastern equine encephalitis* EEE24 CTAGTTGAGCACAAACACCGCA E2 gene 464 Linssen et al52
cEEE-7 CACTTGCAAGGTGTCGTCTGCCCTC 262
EEE25 AAGTGATGCAAATCCAACTCGAC
cEEE-6 GGAGCCACACGGATGTGACACAA

American Journal of Infection Control

Western equine encephalitisz WEE-1 GTTCTGCCCGTATTGCAGACACTCA E2 gene 354 Linssen et al52
cWEE-3 GTCTTTCGACCACGACCATG 195
WEE-2 CCTCCTGATCTTTTTCTCCACG
Venezuelan equine encephalitisz VEE-2 ACCACCTGGGAGTCCTTGGA 6K and E1 342 Linssen et al52
cVEE-4 TTGGCTCGGCA CGTGTTCGCG 192
cVEE-3 TGGCTGGTGAATCCATTCCT

September 2011
*Nested PCR was done to detect these viruses.
y
Marburg and Ebola viruses.
z
Seminested PCR was done to detect these viruses.
www.ajicjournal.org Goyal et al. e35
Vol. 39 No. 7

Table 3. Primers used for the detection of DNA viruses by PCR assay
Virus Primer name Primer sequence (59 / 39) Target region Amplicon length, bp Reference

Adenovirus Ad 1 TTCCCCATGGCICAYAACAC Hexon gene 482 Xu et al53

Ad 2 CCCTGGTAKCCRATRTTGTA
Orthopox virus A13 L1 GACTTTAGTAAGTCTACCAGTCCCACTC 13L gene 664 Pulford et al54
A13 L2 AAGATTATTGTTGCCTCCTTT

None of the filter eluates demonstrated cytopathic ef- tested in this study were in use for between 4 and
fects in Vero, MDCK, or RK-13 cells after 2 blind pas- 261 days in the filter banks, allowing plenty of time
sages. Similarly, none of the chicken embryos died or for inactivation of viruses after collection.
exhibited any visible lesions. None of the cell culture It is possible that the conditions used for virus isola-
supernatant or egg fluid was positive for any virus by tion might not have been optimal for all viruses, al-
HA or NCEM. though we used 2 blind passages in 3 different cell
None of the filter eluates was positive for DNA viruses lines and SPF chicken eggs. This is in agreement with
when examined by PCR. On RT-PCR, 11 eluates showed the findings of Echavarria et al,23 who could not isolate
amplification with primers for influenza A virus, with adenovirus from the implicated ventilation filters dur-
bands of ;104 bp in all 11 cases (Table 4). Nine of the ing an outbreak of adenovirus infection but could detect
11 amplicons were true positives when tested by DNA viral nucleic acids in many of the filters. The authors
sequencing. These 9 sequences had the highest homol- sampled filter surfaces by wiping them with swabs pre-
ogy with the NS genes of Influenza A/New York/491/ moistened with cell culture medium. In the present
2003 (H1N2; GenBank no. CY006191) and Influenza A/ study, we opted for elution of viruses from filters, based
New York/360/2004 (H1N2; GenBank no. CY008192). on previous laboratory studies indicating that the eluent
Of the 9 positive samples, 7 were from building M and will remove not only the viruses present on filter sur-
2 were from building S. Because quantitative RT-PCR faces, but also those embedded within the filter media.26
was not performed, we cannot speculate on the number In phase I, we eluted small pieces (;15 cm2) of
of viral copies present on these filters. This should be filtersin PBS and found 4 samples (total n 5 16) that
taken into account in future studies. were positive for influenza A, influenza B, and PIV-1
As shown in Table 4, 1 prefilter from building M and (Table 4). In phase II, we increased the filter test size to
1 final filter from building S were also positive for influ- 900 cm2 and eluted the filter in BE buffer (pH 8.5)
enza B virus, with an expected DNA band size of 145 because separate preliminary trials had judged this
bp. Sequence analysis confirmed these to be true pos- buffer better than PBS for virus elution. To decrease
itives. The nucleic acid detected in the prefilter of the volume of eluates to a manageable amount, we com-
building M matched wild-type influenza B/Ann Arbor/ pared 2 commonly used methods, organic flocculation
1/66/ (GenBank no. M20174), whereas the nucleic and PEG precipitation.29 We used the 2 concentration
acid detected in the final filter of building S matched methods in an attempt to increase the chance of identi-
cold-adapted influenza B/Ann Arbor/1/66/ (GenBank fying all listed viral pathogens, as well as to find a suit-
no. M20173). One prefilter from building M was found able method to concentrate filter eluates of this kind.
to be positive for human parainfluenza virus type Products obtained in the RT-PCR tests were further
1 (PIV-1) by RT-PCR. The PCR product was purified analyzed by sequencing. Evaluating these results
and sequenced. Blast analysis of the sequences showed that both concentration methods gave specific
matched that of the HA gene of human PIV-1 (GenBank positive amplifications for influenza A virus from only
no. U70492). 2 filters. In the remaining cases, filters found to be pos-
itive by one method were not positive by the other
DISCUSSION method. This could be due to low copy number of path-
ogens with uneven distribution over the filter surfaces.
In this study, we evaluated the use of ventilation fil- Our results demonstrate no significant advantage of
ters to detect virus aerosols from 2 large public build- one method over the other. Thus, it is recommended
ings. We detected no live virus in any of the samples that both methods of concentration be used to screen
tested. It is possible that any filter-captured virus might HVAC filters for the detection of viral pathogens.
have been inactivated during airborne transport before The presence of influenza A, influenza B, and PIV-1 nu-
capture or over time after capture due to exposure to cleic acids in ventilation filters is not surprising. These vi-
light or UV radiation or to inhospitable temperature ruses are a major cause of respiratory infections in
or relative humidity in the ambient air.3,35 The filters humans and are known to spread via the aerosol route.36
e36 Goyal et al. American Journal of Infection Control
September 2011

FF
Sequence analysis of all identified influenza A viruses re-

HMT210

1
–
–
2
vealed their close relation to H1N2. These subtypes are
prevalent in the United States37 and are a product of reas-

PF

–
–
–
2
sortment between subtypes H1N1 and H3N2.38 This sub-
type is not a component of the influenza vaccine used in
the United States.39 Thus, these viruses might have been
FF

1
–
–
2
HCT202

aerosolized by infected individuals and then removed

from the air by the ventilation filters. The influenza B de-

M, building located in Minneapolis; S, building located in Seattle; PF, prefilter; FF, final filter; IAV, influenza A virus; IBV, influenza B virus; V, nonspecific amplification obtained for influenza A primers.
PF
Building S

–
–
–
2
tected in this study is related to influenza B/Ann Arbor/1/
66/, a component of cold-adapted, live attenuated vac-
cine currently in use.40 Because there are no vaccines
FF

–
1
–
2
HCC201

*AHUs B-01 and S-23 were selected in the phase II due to difficulties encountered in retrieving environmental data (associated with another part of this project) from F-04 and S-18.
available for PIV-1, the identified PIV-1 was likely re-
leased by an infected individual.
PF

–
–
–
2

All identified viruses are etiologic agents of common

respiratory diseases in humans and might have existed
as live bioaerosols at some point in time. More filters
FF

–
–
2

–
HAC -01

were positive for influenza A than the other 2 patho-

gens. No pathogen of exotic nature or bioterrorist po-
PF

tential was identified. In this study, small areas of

–
–
2

filters were examined for virus isolation and detection.

More pathogens may have been detected if a larger
213
FF

area from each filter had been examined. Moreover,

–
–
–
S-18/S-23y

the distribution of virus aerosols in these filters might

not be uniform so the results may depend on which
215

110

area was chosen for study. Low copy numbers of

PF

–
–

the target genome may not have been detected by the

PCR used. Low quantity of target DNA is one of the
Table 4. Filters found positive for the presence of viral nucleic acids by RT-PCR

common problems encountered in environmental

213
FF

Numbers in bold type indicate that these filters were tested in phase I and the others were tested in phase II.

samples for PCR analysis.41 The AHUs are designed to

–
–
–
F-04/B-01

include a variable amount of outdoor air during the

process of filtration. One prefilter and 1 final filter
V13
215

110

that processed 100% outdoor air also were positive

PF

–
Building M

for influenza B and influenza A, respectively (Tables

1 and 4). Thus, the viral nucleic acids found in ventila-
tion filters could be from either an indoor source or an
213
FF

–
–
–

outdoor source.
A-04

Nonspecific amplifications obtained in RT-PCR of in-

fluenza A virus from 2 prefilters (1 each from A-04 and
215
PF

F-04 of building M) is not surprising. This could be due

V
–
–

to mispriming with other contaminating nucleic acid

sequences present in the filter eluates, which is an-
other drawback in testing environmental samples.16
213
111
FF

–
–

Thus, additional tests, such as hybridization with spe-

A-01

cific oligonucleotide probes or sequencing of ampli-

cons, is advocated to confirm PCR amplicons from
215
111
PF

environmental samples.42,43
–
–

AHUs processed 100% outdoor air.

Many studies have shown that the presence of con-

taminants in environmental samples may interfere
Number of filters testedz

with PCR. However, the positive amplifications in this

study indicate that the filter eluates did not contain
AHU* Filter type

any inhibitory factors that could interfere with our de-

tection process. The possibilities of interference by
contaminants in the filter eluates during PCR also
were ruled out by different spiking experiments con-
PIV-1
IAV
IBV

ducted in our laboratory (data not shown).

y
z
www.ajicjournal.org Goyal et al. e37
Vol. 39 No. 7

This appears to be the first report of detection of in- 10. Goyal SM. Preservation of environmental samples. In: Gerba CP, Goyal
fluenza A, influenza B, and PIV-1 nucleic acids from SM, eds. Methods in environmental virology. New York: Marcel Dek-
ker; 1982. p. 49-57.
used HVAC filters in buildings by RT-PCR. These results 11. Gorny RL, Dutkiewicz J. Bacterial and fungal aerosols in indoor envi-
indicate that significant levels of viral aerosol exist ronment in central and European countries. Ann Agric Environ Med
within buildings, and that ventilation filter banks can 2002;9:17-23.
be used as passive sampling systems to detect them. 12. Tsai FC, Macher JM. Concentrations of airborne culturable bacteria in
Analysis of ventilation filters certainly could play a 100 large US office buldings from the BASE study. Indoor Air 2005;
15(Suppl 9):71-81.
role in the epidemiology of infectious diseases as 13. Wu P, Li YY, Chiang CM, Huang CY, Lee CC, Li FC, et al. Changing
well as cater to the needs of investigators of bioterror- microbial concentrations are associated with ventilation performance
ism pathogens released into the environment in the fu- in Taiwan’s air-conditioned office buildings. Indoor Air 2005;15:19-26.
ture. However, test validation should be carried out to 14. Zimmerman NJ, Reist PC, Turner AG. Comparison of two biological
suit the respective study situations. aerosol sampling methods. Appl Environ Microbiol 1987;53:99-104.
15. Jensen P, Todd WF, Davis GN, Scarpino PV. Evaluation of eight bioaer-
Once aerosolized, virus aerosols may travel signifi- sol samplers challenged with aerosols of free bacteria. Am Ind Hyg As-
cant distances through buildings before being captured soc J 1992;53:660-7.
and retained by HVAC filters. They also may pass 16. Alvarez AJ, Buttner MP, Stetzenbach LD. PCR for bioaerosol monitor-
through, because most HVAC filters are not 100% effi- ing: sensitivity and environmental interference. Appl Environ Microbiol
cient in capturing particles. The rapidity with which 1995;61:3639-44.
17. Mehta SA, Bell-Robinson DL, Groves TO, Stetzenbach LD, Pierson DL.
airborne viruses are inactivated during transport or af- Evaluation of portable air samplers for monitoring airborne culturable
ter filter capture is uncertain and merits further study. bacteria. Am Ind Hyg Assn J 2000;61:850-4.
This could be an important factor when evaluating 18. Hogan CJ Jr, Kettleson EM, Lee MH, Ramaswami B, Angenent LT,
whether droplet or airborne infection control precau- Biswas P. Sampling methodologies and dosage assessment tech-
tions are necessary in health care facilities when pa- niques for submicrometer and ultrafine virus aerosol particles. J
Appl Microbiol 2005;99:1422-34.
tients are infected with viral agents. 19. McGarrity GJ, Dion AS. Detection of airborne polyoma virus. J Hyg
In conclusion, we have used 2 buildings’ ventilation (Lond) 1978;81:9-13.
systems as a long-term sampling device to determine 20. Donaldson AI, Ferris NP, Gloster J. Air sampling of pigs infected with
the presence of a variety of airborne viruses. This foot-and-mouth disease virus: comparison of Lipton and cyclone sam-
methodology can be useful in the fields of aerobiology, plers. Res Vet Sci 1982;33:384-5.
21. Myatt TA, Johnston SL, Zuo Z, Wand M, Kebadze T, Rudnick S, et al.
exposure control, and epidemiology of viral pathogens. Detection of airborne rhinovirus and its relation to outdoor air supply
Whether this method can be used as a possible deter- in office environments. Am J Respir Crit Care Med 2004;169:1187-90.
rent to the spread of biowarfare agents remains to be 22. Myatt MR, Bender TR, Margolis HS, Noble GR, Kendal AP, Ritter DG.
seen, but the potential for this exists. An outbreak of influenza aboard a commercial airliner. Am J Epidemiol
1979;110:1-6.
23. Echavarria M, Kolavic SA, Cersovsky S, Mitchell F, Sanchez JL, Polyak C,
References et al. Detection of adenoviruses (AdV) in culture-negative environmen-
1. Arricau-Bouvery N, Rodolakis A. Is Q fever an emerging or re- tal samples by PCR during an AdV-associated respiratory disease out-
emerging zoonosis? Vet Res 2005;36:327-49. break. J Clin Microbiol 2000;38:2982-4.
2. Hietala SK, Hullinger PJ, Crossley BM, Kinde H, Ardans AA. Environ- 24. Dee SA, Batista L, Deen J, Pijoan C. Evaluation of an air filtration sys-
mental air sampling to detect exotic Newcastle disease virus in two Cal- tem for preventing aerosol transmission of porcine reproductive and
ifornia commercial poultry flocks. J Vet Diagn Invest 2005;17:198-200. respiratory syndrome virus. Can J Vet Res 2005;69:293-8.
3. Li Y, Huang X, Yu IT, Wong TW, Qian H. Indoor air: role of air distri- 25. Relman DA. Bioterrorism: preparing to fight the next war. N Engl J
bution in SARS transmission during the largest nosocomial outbreak in Med 2006;354:113-5.
Hong Kong. Indoor Air 2005;15:83-95. 26. Farnsworth JE, Goyal SM, Kim SW, Kuehn TH, Raynor PC, Ramak-
4. Spendlove JC, Fannin KF. Methods for characterization of virus aero- rishnan MA, et al. Development of a method for bacteria and virus re-
sols. In: Gerba CP, Goyal SM, eds. Methods in environmental virology. covery from heating, ventilation, and air-conditioning (HVAC) filters. J
New York: Marcel Dekker; 1982. p. 261-330. Environ Monit 2006;8:1006-13.
5. Dick EC, Jennings LC, Mink KA, Wartgow CD, Inhorn SL. Aerosol 27. American Society of Heating, Refrigeration, and Air-Conditioning En-
transmission of rhinovirus colds. J Infect Dis 1987;156:442-8. gineers. ANSI/ASHRAE standard 62.1-2004: ventilation for acceptable
6. Brundage JF, Scott RM, Lednar WM, Smith DW, Miller RN. Building as- indoor air quality. Atlanta (GA): American Society of Heating, Refrig-
sociated risk of febrile acute respiratory diseases in army trainees. eration, and Air-Conditioning Engineers; 2004.
JAMA 1988;259:2108-12. 28. Katzenelson E, Fattal B, Hostovesky T. Organic flocculation: an effi-
7. Pirtle EC, Beran GW. Virus survival in the environment. Rev Sci Tech cient second-step concentration method for the detection of viruses
1991;10:733-48. in tap water. Appl Environ Microbiol 1976;32:638-9.
8. Hoge CW, Reichler MR, Dominguez EA, Bremer JC, Mastro TD, 29. Goyal SM, Gerba CP. Concentration of viruses from water by mem-
Hendricks KA, et al. An epidemic of pneumococcal disease in an brane filters. In: Gerba CP, Goyal SM, eds. Methods in environmental
overcrowded inadequately ventilated jail. New Engl J Med 1994; virology. New York: Marcel Dekker; 1982. p. 59-116.
331:643-8. 30. Lakhe SB, Paunikar WN. Elution and reconcentration of poliovi-
9. Miller WS, Artenstein MS. Aerosol stability of three acute respiratory ruses adsorbed on coal from water samples. Water Res 2002;36:
disease viruses. Proc Soc Exp Biol Med 1967;125:222-7. 3919-24.
e38 Goyal et al. American Journal of Infection Control
September 2011

31. Killington RA, Stokes A, Hierholzer JC. Virus purification. In: Mahy 44. Templeton KE, Scheltinga SA, Beersma MFC, Kroes ACM, Claas ECG.
BW, Kangro HO, eds. Virology methods manual. San Diego (CA): Rapid and sensitive method using multiplex real-time PCR for diagno-
Academic Press; 1996. p. 73-4. sis of infections by influenza A and influenza B viruses, respiratory syn-
32. Goyal SM, Rademacher RA, Pomeroy KA. Comparison of electron mi- cytial virus, and parainfluenza viruses 1, 2, 3, and 4. J Clin Microbiol
croscopy with three commercial tests for the detection of rotavirus in 2004;42:1564-9.
animal feces. Diag Microbiol Infect Dis 1987;6:249-54. 45. Karron RA, Froehlich JL, Bobo L, Belshe RB, Yolken RH. Rapid detec-
33. Swayne DE, Senne DA, Beard CW. Avian influenza. In: Swayne DE, tion of parainfluenza virus 3 RNA in respiratory specimens: use of
Glisson JR, Jackwood MW, Pearson JE, Reed WM, eds. A laboratory reverse-transcription PCR enzyme immunoassay. J Clin Microbiol
manual for the isolation and identification of avian pathogens. 1994;32:484-8.
4th ed. Kennett Square (PA): American Association of Avian Patholo- 46. Steininger C, Aberle SW, Popow-Kraupp T. Early detection of acute
gists; 1998. p. 150-5. rhinovirus infections by a rapid reverse-transcription PCR assay. J
34. Kwok S, Higuchi R. Avoiding false-positives with PCR. Nature 1989; Clin Microbiol 2001;39:129-33.
339:237-8. 47. Siafakas N, Markoulatos P, Levidiotou-Stefanou S. Molecular identifica-
35. Cox CS. Stability of airborne microbes and allergens. In: Cox CS, tion of enteroviruses responsible for an outbreak of aseptic meningi-
Wathes CM, eds. Bioaerosol handbook. New York: Lewis; 1995. p. tis: implications in clinical practice and epidemiology. Mol Cell Probes
77-9. 2004;18:389-98.
36. Barker J, Stevens D, Bloomfield SF. Spread and prevention of some 48. Adachi D, Johnson G, Draker R, Ayers M, Mazzulli T, Talbot PJ, et al.
common viral infections in community facilities and domestic homes. Comprehensive detection and identification of human coronaviruses,
J Appl Microbiol 2001;91:7-21. including the SARS-associated coronavirus, with a single RT-PCR assay.
37. Centers for Disease Control and Prevention. Update: influenza J Virol Methods 2004;122:29-36.
activity—United States, 2001‒02 season. MMWR Morb Mortal 49. Sanchez A, Ksiazek TG, Rollin PE, Miranda ME, Trappier SG, Khan AS,
Wkly Rep 2002;51:276-9. et al. Detection and molecular characterization of Ebola viruses caus-
38. Xu X, Indstrom SE, Shaw MW, Smith CB, Hall HE, Mungall BA, et al. ing disease in human and nonhuman primates. J Infect Dis 1999;
Reassortment and evolution of current influenza A and B viruses. Vi- 179(Suppl 1):S164-9.
rus Res 2004;103:55-60. 50. Drosten C, Gottig S, Schilling S, Asper M, Panning M, Schmitz H, et al.
39. Centers for Disease Control and Prevention. Prevention and control Rapid detection and quantification of RNA of Ebola and Marburg vi-
of influenza. MMWR Morb Mortal Wkly Rep 2005;54:1-40. ruses, Lassa virus, Crimean-Congo haemorrhagic fever virus, Rift Val-
40. Chen Z, Aspellund A, Kemble G, Jin H. Genetic mapping of the cold- ley fever virus, dengue virus, and yellow fever virus by real-time
adapted phenotype of B/Ann Arbor/1/66, the master donor virus reverse-transcription PCR. J Clin Microbiol 2002;40:2323-30.
for live attenuated influenza vaccines (FluMist). Virology 2006;345: 51. Lozano ME, Enria D, Maiztegui JI, Grau O, Romanowski V. Rapid diag-
416-23. nosis of Argentine haemorrhagic fever by reverse-transcriptase PCR‒
41. Cohen ND, Martin LJ, Simpson RB, Wallis DE, Neibergs HL. Compar- based assay. J Clin Microbiol 1995;33:1327-32.
ison of polymerase chain reaction and microbiological culture for de- 52. Linssen B, Kinney RM, Aguilar P, Russel KL, Watts DM, Kaaden OR,
tection of salmonellae in equine feces and environmental samples. Am et al. Development of reverse-transcription PCR assays specific for
J Vet Res 1996;57:780-6. detection of equine encephalitis viruses. J Clin Microbiol 2000;38:
42. Cho HB, Lee SH, Cho JC, Kim SJ. Detection of adenoviruses and en- 1527-35.
teroviruses in tap water and river water by reverse-transcription mul- 53. Xu W, McDonough MC, Erdman DD. Species-specific identification of
tiplex PCR. Can J Microbiol 2000;46:417-24. human adenoviruses by a multiplex PCR assay. J Clin Microbiol 2000;
43. Feder I, Nietfeld JC, Galland J, Yeary T, Sargeant JM, Oberst R, et al. 38:4114-20.
Comparison of cultivation and PCR hybridization for detection of Sal- 54. Pulford D, Meyer H, Brightwell G, Damon I, Kline R, Ulaeto D. Ampli-
monella in porcine fecal and water samples. J Clin Microbiol 2001;39: fication refractory mutation system PCR assays for the detection of
2477-84. variola and Orthopoxvirus. J Virol Methods 2004;117:81-90.