Scribd Logo
Upload

Welcome to Scribd!

  • 100 views

    General Biology 2

    Uploaded by

    Christianne Joseph Monzon
    This document provides an overview of the molecular structures of DNA, RNA, and proteins. It defines key terms like nucleotides, nucleic acids, and nitrogenous bases. It describes the double-helix structure of DNA, composed of deoxyribose, phosphate groups, and complementary nucleotide base pairing. RNA is single-stranded with ribose and uracil replacing thymine. The central dogma of molecular biology explains that DNA codes for RNA, which codes for proteins. There are four levels of protein structure from primary to quaternary. Activities provide practice with DNA/RNA base pairing, transcription, and translation.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd

    General Biology 2

    Uploaded by

    Christianne Joseph Monzon
    100 views4 pages
    This document provides an overview of the molecular structures of DNA, RNA, and proteins. It defines key terms like nucleotides, nucleic acids, and nitrogenous bases. It describes the double-helix structure of DNA, composed of deoxyribose, phosphate groups, and complementary nucleotide base pairing. RNA is single-stranded with ribose and uracil replacing thymine. The central dogma of molecular biology explains that DNA codes for RNA, which codes for proteins. There are four levels of protein structure from primary to quaternary. Activities provide practice with DNA/RNA base pairing, transcription, and translation.

    Original Description:

    Original Title

    GenBio2scribd04

    Copyright

    © © All Rights Reserved

    Available Formats

    DOCX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    This document provides an overview of the molecular structures of DNA, RNA, and proteins. It defines key terms like nucleotides, nucleic acids, and nitrogenous bases. It describes the double-helix structure of DNA, composed of deoxyribose, phosphate groups, and complementary nucleotide base pairing. RNA is single-stranded with ribose and uracil replacing thymine. The central dogma of molecular biology explains that DNA codes for RNA, which codes for proteins. There are four levels of protein structure from primary to quaternary. Activities provide practice with DNA/RNA base pairing, transcription, and translation.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    100 views4 pages

    General Biology 2

    Uploaded by

    Christianne Joseph Monzon
    This document provides an overview of the molecular structures of DNA, RNA, and proteins. It defines key terms like nucleotides, nucleic acids, and nitrogenous bases. It describes the double-helix structure of DNA, composed of deoxyribose, phosphate groups, and complementary nucleotide base pairing. RNA is single-stranded with ribose and uracil replacing thymine. The central dogma of molecular biology explains that DNA codes for RNA, which codes for proteins. There are four levels of protein structure from primary to quaternary. Activities provide practice with DNA/RNA base pairing, transcription, and translation.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    of 4

    General Biology 2

    Lesson 4: Molecular Structure of DNA, RNA, and Proteins


    Learning Objectives:
    At the end of the lesson, the learners will be able to:
    • describe the building blocks of DNA, RNA and proteins;
    • identify the structural and functional differences between DNA and RNA and
    • explain the different levels of protein structure
    Terms-to-know
    • Nucleotides - any member of a class of organic compounds in which the molecular structure
    comprises a nitrogen-containing unit (N-base) linked to a five-carbon sugar and a phosphate
    group (with negative charges). The nucleotides are of great importance to living organisms, as
    they are the building blocks of nucleic acids, the substances that control all hereditary
    characteristics.

    • Nucleic acid - are the biopolymers, or large biomolecules, essential to all known forms of life.
    The term nucleic acid is the overall name for DNA and RNA.
    • Nitrogenous bases - are either purines or pyrimidines.
    • Purine bases have double-ringed structure. e.g. Adenine (A) and Guanine (G).
    • Pyrimidines have single-ringed structure. e.g. Cytosine (C), Thymine (T, in DNA only) and
    Uracil (U, found only in RNA)
    • The 5' and 3' mean "five prime" and "three prime", which indicate the carbon numbers in the
    DNA's sugar backbone. The 5' carbon has a phosphate group attached to it and the 3' carbon a
    hydroxyl (-OH) group. This asymmetry gives a DNA strand a "direction".
    The Central Dogma of Molecular Biology
    - is the basic underlying principle in the field of genetics. This explains that DNA codes for RNA, which
    codes for proteins.

    DNA or Deoxyribonucleic Acid


    -genetic material passed on from parents to offspring. It contains the instructions necessary for survival
    of every organism.
    -DNA model is a double helix structure that twists spirally, similar to a twisted ladder or a spiral staircase.
    - The two helices may coil either clockwise or counter-clockwise.
    - Its backbone or building block is nucleotide which is composed of a phosphate group, a pentose sugar
    and a nitrogenous base.
    - The sugar group is called deoxyribose. The prefix deoxy means that it is a ribose that has lost one
    oxygen atom.
    - the nucleotides present are Adenine, Thymine, Guanine and Cytosine
    - The rule in a complementary nitrogenous base pairing is that a purine should always be paired with a
    pyrimidine. So, in the case of DNA guanine will always be paired with cytosine while adenine will always
    be paired with thymine. In the case of RNA thymine is replaced by uracil.
    - When nucleotides are incorporated into DNA, adjacent nucleotides are linked by a phosphodiester
    bond: a covalent bond is formed between the 5’ phosphate group of one nucleotide and the 3’-OH group
    of another (see below). In this manner, each strand of DNA has a “backbone” of phosphate-sugar-
    phosphate-sugar-phosphate.

    RNA or Ribonucleic acid


    - information in the form of base sequence is transformed (transcribed) into mRNA, tRNA and rRNA. DNA
    is the template copied into RNA by base pairing.
    - is a single stranded molecule that is also composed of nucleotides with a few modifications
    - The sugar backbone of RNA is ribose
    - the nucleotides present are Adenine, Uracil, Guanine and Cytosine
    - the complementary base pairing is G with C; A with U.

    Transcription
    -DNA Transcription in nature is the process of converting a template strand of DNA into RNA. Specifically,
    RNA is complementary to the DNA strand. That is Guanines (G’s) are replaced with Cytosines (C’s),
    Thymines (T’s) are replaced with Adenines (A’s), and importantly Adenines (A’s) are replaced with Uracil.
    - Example:
    DNA 5' - ACATAGGCCTAC - 3'
    RNA 5' - GUAGGCCUAUGU - 3'
    You’ll notice that reading top from bottom, left to right this doesn’t make any sense. It’s a common
    mistake. The two complementary strands need to be read from the 5’ to the 3’ end for the DNA strand
    and from the 3’ to the 5’ end for the RNA strand. This is very important to remember when using real
    datasets. The 5’ to 3’ DNA strand is called the template strand. The 3’ to 5’ complementary DNA strand is
    called the non-template strand. In this case our non-template DNA strand would be 3’ – TGTATCCGGATG
    – 5’.
    Proteins
    - amino acids are building blocks of protein
    - are the final products in the central dogma of molecular biology. Executes cellular functions.
    - they are called the building blocks of life because they have diverse functions in the body
    - also aids in transporting molecules around your body, acts as enzymes, and acts as a passage way of
    molecules and substances into and out of the cell.

    - Amino acids are building blocks of protein. Scientists have identified 20 amino acids so far. These amino
    acids can potentially be configured to unique information carrying structures. The property of proteins is
    determined by the order of amino acids in the polypeptide.
    - The codon alphabet is used to translate the mRNA sequence

    - The four structural levels of proteins are:


    • Primary- sequence of amino acids in the polypeptide chain;
    • Secondary- when the polypeptide chains form a helix or a pleated sheet structure;
    • Tertiary- coiling of the polypeptide, combining helices and sheet forms;
    • Quaternary- the association of two or more polypeptides in space
    Summarized table

    The process of central dogma


    - DNA codes for proteins through the process of transcription and translation.
    - DNA transcription is the first process wherein the important information in the DNA is copied into the
    mRNA.
    - The next step is DNA translation wherein information sent by the mRNA is analyzed with the help of
    ribosomes. The ribosome translate the mRNA code into the proper protein format
    Sample Problem:
    Given the following coding sequence for DNA, provide the sequence of the complementary (template)
    sequence.
    Coding sequence:
    5’ ATGCATAGATTAGGATATCCCAGATAG 3’
    (Answer)
    Complementary sequence:
    3’ TACGTATCTAATCCTATAGGGTCTATC 5’
    Activity 7
    Provide the complementary base for each item
    DNA RNA
    1. A 5. U
    2. G 6. G
    3. C 7. C
    4. T 8. A
    Provide the complementary base for each item (DNA)
    • CGC GAA TTA ATA TCC GCG
    • GGC TCT AAT AGC GAT CAG
    • ATA AGG CGA TTT AAC CCG
    Activity 8
    • Convert the given coding sequence into an mRNA transcript:
    Complementary Non-coding/ Template sequence:
    3’ TACGTATCTAATCCTATAGGGTCTATC 5’

    • Translate the given mRNA transcript into a polypeptide sequence(use the codon alphabet):

    Coding sequence ~ mRNA transcript :


    5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
    -END-

    You might also like