Heliyon 5 (2019) e02220

Contents lists available at ScienceDirect

Heliyon
journal homepage: www.heliyon.com

Phenotypic and molecular detection of Aeromonads infection in farmed Nile

tilapia in Southern highland and Northern Tanzania
Alexanda Mzula a, b, *, Philemon N. Wambura b, c, Robinson H. Mdegela a, Gabriel M. Shirima a
a
Department of Global Health and Biomedical Sciences, School of Life Science and Bioengineering, Nelson Mandela African Institution of Science and Technology, Arusha,
Tanzania
b
College of Veterinary Medicine and Biomedical Sciences, Sokoine University of Agriculture, Morogoro, Tanzania
c
National Ranching Company (NARCO), Ministry of Livestock and Fisheries Development, Tanzania

A R T I C L E I N F O A B S T R A C T

Keyword: Aeromonads disease outbreaks are now becoming a common phenomenon in freshwater farmed fish worldwide.
Molecular biology In Tanzania, the aquaculture field is increasingly growing save to sustain food protein demand and strengthen
household income. To avoid losses that tilapia fish farmers might account, information on magnitude of infection
and characteristics of the aetiological agent is vital. This study aimed to establish the prevalence of aeromonads
infection in farmed tilapia and assess pond and fish health management practices. A cross sectional study was
carried out between February 2017 and October 2018 and a total of 816 whole fish samples were aseptically
collected from 32 ponds in Ruvuma, Mbeya, Iringa and Kilimanjaro regions. During sampling, water quality
parameters were taken and questionnaires to assess the knowledge of farmers were also provided. Isolation and
identification of bacteria was conducted using conventional biotyping and molecular techniques. A total of 201
(80.4%) of 250 isolates that were conventionally identified were confirmed to be aeromonads by amplification of
820 bp rpoD gene, making the overall prevalence of 24.6% (201, n ¼ 816). Sequencing of rpoD gene and
phylogenetic analysis revealed two aeromonads species, Aeromonas hydrophila and Aeromonas veronii. To the best
of our knowledge this is the first report to establish the prevalence of aeromonads in apparently healthy farmed
tilapia in Southern highlands and Northern zone of Tanzania. In addition it was observed that farmers were
lacking proper knowledge and awareness on pond management practices and fish health management. In
conclusion, the infection rate of aeromonads in apparently health tilapia coupled with lack of proper knowledge
and awareness on pond and fish health management by fish farmers in the study area poses risk of diseases
outbreaks in their farms in future. Therefore, it is recommended that the farmers should be trained on basic pond
and fish health management and control strategies.

1. Introduction (Baumgartner et al., 2017).

According to recent taxonomy, the genus Aeromonas is currently
Aeromonads as disease causing agents are now becoming common consisting of more than 30 genospecies (Erdem et al., 2011). The
culprit causing outbreaks in farmed fish worldwide (Bebak et al., 2015; phenotypic identification of these species is difficult because of its
Harikrishnan and Balasundaram, 2005). Aeromonads are gram negative, complexity in using growth and biochemical characteristics as it brings
rod shaped facultative bacterium which cause various diseases in fish confusions especially to closely related species and strains (Beaz-Hidalgo
named as haemorrhagic septicaemia, dropsy, epizootic ulcerative syn- et al., 2010; Chandran et al., 2002; Puthucheary et al., 2012).
drome, haemorrhagic enteritis, and red body disease (Abdelhamed et al., Twenty four years back, before the use of molecular tools the only
2017; Igbinosa et al., 2012). These bacterial species are ubiquitous in the Aeromonas species recognised using a profile of sugars, API systems and
aquatic environment but now have become a challenging pathogen of Matrix-assisted laser desorption/ionization time of flight mass spec-
cultured fish (Chaix et al., 2017; De Jagoda et al., 2014; Janda and trometry (MALDI-TOF) were A. hydrophila, A. sobria, A. caviae, A. veronii
Abbott, 2010; Joseph et al., 2013). Nile tilapia (Oreochromis niloticus) is and A. salmonicida. Consensus is yet to be reached on assigning the
one among wide range of fish species infected by aeromonads Aeromonas strains to the recognised species using conventional

* Corresponding author.
E-mail address: [email protected] (A. Mzula).

https://doi.org/10.1016/j.heliyon.2019.e02220
Received 13 April 2019; Received in revised form 6 June 2019; Accepted 31 July 2019
2405-8440/© 2019 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
A. Mzula et al. Heliyon 5 (2019) e02220

biochemical characteristics. The use of housekeeping genes in identifi- and transported to the microbiology laboratory at Sokoine University of
cation of Aeromonas species has recently gained attention to most sci- Agriculture (SUA) for microbiological analysis within 7 days and later at
entists. These housekeeping genes have high discriminatory and Nelson Mandela African Institution of Science and Technology (MN-A-
resolving power and upon precise identification of eromonads at genus IST) for Molecular analysis.
level, a phylogenetic analysis of either one of them could be used to
reveal genospecies. Some of these housekeeping genes employed in 2.2. Ethics statement
inferring the taxonomy of the genus aeromonas include but not limited to
gyrB, rpoD, recA, dnaJ, gyrA, dnaX and atpD (Zhou et al., 2019). Sampling of fish and all dissections has been carried out in accordance
Despite the known contributions of other species of the genus Aero- with the U.K. Animals (Scientific Procedures) Act, 1986 and associated
monas in causing diseases in fish, A. hydrophila is the main cause of dis- guidelines, the European and the National Institutes of Health – Office of
ease outbreaks in fresh water farmed fish contributing to food insecurity Laboratory Animal Welfare policies and laws and the Tanzania Animal
and economic loss worldwide (Aboyadak et al., 2015; Baumgartner et al., Welfare Act of 2008 was complied. This study also complied with the
2017). Aeromonads diseases in fish farms are accelerated by several ARRIVE guidelines. Implementation of ethical issues was under the su-
factors including variations in physical-chemical parameters of pond pervision of the Kibong'oto Infectious Diseases Hospital (KIDH), the
water. The important physical-chemical parameters are the increased Nelson Mandela African Institution of Science and Technology (NM-
turbidity, temperature, salinity, pH, water conductivity and low dis- AIST) and Centre for Educational Development in Health Arusha
solved oxygen (FAO, 2018; Jacobs and Chenia, 2007; Najiah and Laith, (CEDHA), Health Research Ethics Committee (KNCHREC).
2014). These environmental factors induce stresses that predispose fish
to infections and diseases (Camus et al., 1998). It has been well 2.3. Assessment of knowledge and practices on fish health and pond
acknowledged that semi-intensive and intensive fish farming coupled management
with poor management can result into aeromonads disease outbreaks
(Najiah and Laith, 2014). Alongside with fish samples collection, semi structured question-
In Tanzania, the aquaculture field is increasingly growing and it has naires was administered to each pond owner to gather information
become an attractive venture to most of people to sustain food protein related to fish bacterial diseases, farming systems and general
demand and strengthen household income. It is largely driven by the management.
availability of water and land and therefore fresh water fish farming
industry is well established in Southern highlands, Northern zone and 2.4. Culture, isolation and identification
Lake Zone due to existence of lakes and rivers (MLFD, 2013). Despite
these opportunities, the subsector is challenged by feed resources, sour- Internal organs (liver, heart and kidneys and gills) collected were
ces of fingerlings, knowledge and awareness, water quality and diseases. cultured in MacConkey, Blood agar, Aeromonas isolation agar medium
The recent outbreak of A. hydrophila in Tanzania occurred in 2009 at (M88)) and Tryptic soy agar supplemented with 5% defibrinated sheep
Mtera hydroelectric power dam and caused substantial loss of wild tilapia blood. (All culture media manufactured by HiMedia Laboratories Pvt.
(Oreochromis niloticus) (Shayo et al., 2012). The same aetiological agent Ltd. of Mumbai, India). The inoculated plates were incubated at 28  C for
was isolated in the same area in 2012 (Shayo et al., 2012). Despite the 24–48 hours. The classical identification of bacterial colonies and bio-
reported outbreaks and few sporadic cases of unknown aetiology with typing was performed as described by Abbott et al. (2003) and Deen et al.
clinical signs similar to haemorrhagic septicaemia in tilapia farms in (2014) with modification. Briefly, the isolates were tested for 21
Southern highlands of Tanzania, systematic surveillance of aeromonads phenotypic characteristics in conventional bases. The biochemical tests
infections in farmed fish has not been explored. To avoid losses that used to study the phenotypic characteristics included; Raffinose, Lactose,
tilapia fish farmers might encounter, information on magnitude of Maltose, Mannose, D-Mannitol, Melibiose, Sucrose, Citrate, Urea, Indole,
infection and characteristics of the aetiological agent is vital. The Catalase, Motility, Ampicillin Resistance, m-Inositol, oxidase, Nitrate,
objective of this study was to establish the prevalence of aeromonads Trehalose, Dulcitol, Cellobiose, and Xylose. All isolates suggestive to
infection in farmed tilapia and to assess pond and fish health manage- aeromonads were stored in cryovials containing 20% glycerol Tryptic soy
ment practices in Southern highlands and Northern zones of Tanzania, so broth at -20  C for further molecular typing.
as to establish information and knowledge that will assist in providing
proper mitigation towards establishment of sustainable aquaculture 2.5. Molecular genotyping and identification
production in the country.
The genomic DNA was isolated using the thermal extraction method
2. Material and methods as described by Carriero et al. (2016). Briefly, 1.0 mL of the Tryptic broth
culture was pelleted, washed and resuspended by vortexing in Nuclease
2.1. Study site and sampling procedure Free water (Sourced from Inqaba biotech, Hatfield, South Africa), placed
in a water bath at 95  C for 5 min and immediately transferred to ice for 5
A cross sectional study was carried out between February 2017 and min. This procedure was then repeated once more and the suspension
October 2018. A total of 816 whole fish samples were aseptically centrifuged at 10 000 g for 10 min. The total genomic DNA was spec-
collected from 32 randomly selected ponds in Ruvuma, Mbeya, Iringa trophotometrically quantified using NanoDropTM Lite Spectrophotom-
and Kilimanjaro regions (8 in each region). The sample size of fish eter (Thermo Scientific, Waltham, U.S.A) and stored at -20  C until
specimens was derived and determined from the method developed by further use.
Ossiander (1973). HI9829 portable meter (HANNA Instruments, Woon- PCR amplification and sequencing of RNA polymerase sigma factor
socket, and U.S.A) was used to collect pond water quality data; water gene (rpoD) (820 bp) was done according to Carriero et al. (2016) with
turbidity, temperature, water salinity, conductivity, dissolved oxygen some modifications as follows; The amplification used the following set
and pH were recorded from each sampled pond. From each pond, fish of primer rpoD70F ACGACTGACCCGGTACGCATGTA (Yamamoto et al.,
were sampled by scooping using small sized fish net. Morphometric pa- 2000) and rpoD11R ATGCTCATGCGRCGGTTGAT (Martinez-Murcia
rameters (weight and length were recorded before dissection using dig- et al., 2011). The reaction mix included 3.0 μL of 10–50 ng of genomic
ital balance and simple ruler, respectively). Fish were aseptically DNA, 12.5 μL of 2X OneTaq Quick Load Standard Buffer (New England
dissected on the spot and the selected organs such as; liver, kidney, BioLab, U.K, sourced from Inqaba biotech, Hatfield,South Africa), 0.5 μL
spleen and gills were collected and stored in bijou bottles containing of each primer (0.2 μM) and 8.5 μL Nuclease free water to give a final
Cary-Blair transport medium, placed in a cool box containing ice packs volume of 25 μL. The reaction mixture was subjected to a PCR regimen of

2
A. Mzula et al. Heliyon 5 (2019) e02220

35 cycles of denaturation at 95  C for 30 s, annealing at 55  C for 30 s and 3.2. Knowledge and practices
extension at 72  C for 1 minute preceded by an initial denaturation step
at 95  C for 3 min and followed by terminal extension at 72  C for 3 min. Thirty two (32) fish farmers were interviewed using the semi-
The amplified product was gel electrophoresed on 1.5% agarose TBE gel structured questionnaire and 87.5% (28/32) were male. Their age
and viewed in a gel documentation system (E-box CX5.TS ranged from 27 to 65 years with an average of 39.7  1.5 years. Majority
Epi-illumination, Collegien, France). of these fish farmers (75%, 24/32) had primary and secondary (31.3%,
The nucleotide sequences of PCR product was determined by Sanger 10/32) education. The remaining quarter had attended training up to
method using ABI 3500 Genetic analyzer (Applied Biosystem ™, Foster college level.
City, California, U.S.A) according to manufacturer's instructions and These fish farmers had an experience in fish farming industry ranging
protocol. from 1 to 11 years with an average of 4.6  0.4 years. They own
Sequence assembly was performed using BioEdit v7.0.5 software. The earthen ponds ranging from 90 to 864 m2 in size with an average pond
sequence comparison was performed by BLASTING the sequences in size of 454 m2, with stocking density ranging from 150 to 10,000 fish
www.ncbi.nlm.nih.gov/ BLAST. Isolates were identified at the species per pond. Monoculture is the most practiced fish culture system by
level through alignment of the rpoD gene sequences from this study and farmers (68.8%, 22/32), whereas 9.4% (3/32) fish farmers practice
type strains reference sequences from the gene bank using Clustal W polyculture and 21.9% (7/32) of them practice both monoculture and
followed by phylogenetic construction in MEGA X software (Kumar et al., polyculture.
2018).
3.3. Pond management practices at the study areas

2.6. Determination of prevalence Majority of the farmers (81.2%) reported to fertilize their ponds by
using cow dung (69.2%) and poultry manure (11.5%). These farmers
The prevalence was derived based on infection status. Fish were apply the fertilizing material either directly from the source (50%) or dry
regarded to have been infected when aeromonads were isolated from the them first before use (50%). Out of those who fertilize their pond 50%
Kidney, Spleen or Liver. Fish were grouped in terms of weight (g) into spread the fertilizing material on the surface of the pond water. Sixty
three categories based on FAO classification as 1–10 g (Fingerlings), eight percent have reported to change water and clean their ponds
11–15 g (Sub-adults) and >26 g (Adults). The prevalence based on these different circumstances. It was observed that most of farmers stoked their
groups was established. ponds above the recommended stocking rate (Table 2).

3.4. Awareness and knowledge about pond management practices and fish
2.7. Data analysis health

Descriptive statistical analysis was conducted using Graph pad Prism Few farmers (28.1%, 9/32) mentioned to have previously acquired
5 software. A chi-square of independent variables was carried out to diseases in their farms between May and August (66.7%). Other time
determine the association between fish size groups developed based on interval responded by these farmers were September to December
fish weight and infection status using a Social Science Statistics program (22.2%) and January and April (11. 1%). Out of 32 farmers, 18 (56.3%)
(https://www.socscistatistics.com/tests/chisquare2/Default2.aspx). experienced fish death in their farms prior to commencement of this
The sequence comparison was performed by BLASTING the sequences study and Ruvuma was the leading region (Fig. 1). Haemorrhages, slow
in www.ncbi.nlm.nih.gov/ BLAST. swimming, pope-eye, and reddening were the leading clinical signs
mentioned and identified by farmers in all study areas (Fig. 2). According
3. Results to the respondents, 47% could not manage to state the reasons for

3.1. Pond water quality parameters of the surveyed ponds Table 2

Pond management practices performed by fish farmers in the study areas.
Assessment of water quality parameters in fish ponds showed slightly Practice Category Frequency %
variation in the four geographical regions. However, significant variation
Stocking rate Above recommended 24 (n ¼ 32) 75
in temperature and turbidity water parameters were observed between (2fish/m2)
the four regions (p < 0.05) (Table 1). Recommended (2fish/ 8 (n ¼ 32) 25
m2)
Pond fertilization Yes 26 (n ¼ 32) 81.2
Table 1 No 6 (n ¼ 32) 18.8
Mean physical-chemical parameters in fish ponds of four study regions. Cow dung 18 (n ¼ 26) 69.2
REGION Temperature DO pH Turbidity Conductivity Urea and DAP 1 (n ¼ 26) 3.9
( C) (mg/ (NTU) (μS/cm) Poultry manure 3 (n ¼ 26) 11.5
L) cow dung and poultry 4 (n ¼ 26) 15.4
manure
Ruvuma 24.9  0.5a 6.5  6.9  10.7  1.1b 182.3  49.8a Fertilizer application Reduce pond water and 13 (n ¼ 26) 50.0
0.5a 0.1a apply
c b a
Mbeya 26.2  0.4 7.7  7.0  18.7  0.2 139.6  32.7 Spread over the surface 13 (n ¼ 26) 50.0
0.5a 0.3a Direct from the source 4 (n ¼ 26) 50.0
b a a
Iringa 25.1  0.4 7.4  6.7  33.0  2.3 143.4  32.7 Dry 4 (n ¼ 26) 50.0
0.5a 0.3a Change water and cleaning Yes 22 (n ¼ 32) 68.8
Kilimanjaro 25.7  0.2b 6.8  6.6  16.1  1.0b 174.6  39.3a ponds
0.5a 0.1a No 10 (n ¼ 32) 31.2
Preferred 20 to 30 5 to 8 6 to 9 30 to 80 150 to 500 Circumstances of changing and Long stay 7 (n ¼ 26) 26.9
range cleaning
Stressful <12, >35 <5, <4, <12,>80 - Smelling 9 (n ¼ 26) 34.6
range >8 >11 Too greenish (dark green) 9 (n ¼ 26) 34.6
Experience oxygen 8 (n ¼ 26) 30.8
Note: The same letter in superscript within the column indicate no significant
deficiency
difference (P  0.05).

3
A. Mzula et al. Heliyon 5 (2019) e02220

Fig. 1. Proportion of respondents who experienced mortality in their fish farms in the four regions.

Fig. 2. Proportion of fish farmers who reported to have seen the clinical signs in their farms.

mortality whereas, 18.8% mentioned low oxygen concentration, 12.5% control methods. However, small proportion uses other methods
bird injury, 6% due to transportation and 9.4% reported due to inade- including antibiotics (9.4 %), herbs (6.3%) and separate infected fish
quate water and feeds supply. (6.3%).
Despite the fact farmers reported infections and mortalities in fish,
majority (84.4%, 27/32) of respondents confessed ill-informed about 3.5. Morphometric parameters of fish

Weight and length parameters of fish sampled displayed variability

Table 3 with weight ranged from 10-220g and length ranged from 2-15cm. Fish
Fish groups based on weight and length. were grouped in categories of “fingerlings”, “sub-adults” and “adults” as
Weight(g) Category (size) No of fish Percentage (%) adopted from FAO (Table 3).
1–10 Fingerlings 379 46.5
10–25 Sub adults 231 28.3 3.6. Culturing, isolation and conventional identification
>25 Adults 206 25.2
Total 816 100
The bacterial colonies assumed to be aeromonads had medium,

4
A. Mzula et al. Heliyon 5 (2019) e02220

Fig. 3. Colonial morphologies of aeromonads in different media. A and B are Blood Agar with B showing β-hemolytic characteristics, C is Tryptic Soy Agar (TSA)and D
is Aeromonas Isolation Agar (M884).

greyish in colour with β-haemolytic colonies in Blood agar; relatively 3.7. Prevalence of aeromonads infection in freshwater farmed tilapia
small and pale colonies (non-lactose fermenter) on MacConkey agar;
smooth, shining, creamy colonies on Tryptic soy agar (TSA) and dark Bacteriological testing of 816 apparently healthy tilapia fish were
green, opaque with dark Centre colonies on Aeromonas isolation medium done from 32 fresh water ponds in Songea Municipality (Ruvuma re-
(M884) (Fig. 3). Upon staining, bacteria ware seen to be gram negative, gion), Mbarali District (Mbeya Region), Mafinga Township (Iringa Re-
rod shaped, in singles and few in pairs. gion) and Rombo District (Kilimanjaro Region). Out of the 816 fish
All suspected aeromonads colonies when subjected to different samples, 250 (30.6%) were identified to have been naturally infected
biochemical tests gave reactions which are characteristic to the genus. with aeromonas.
The bacteria produced positive reaction to catalase, Oxidase, D-glucose, A conventional PCR for identification of aeromonads was done
Citrate, Arabinose and Mannose (Table 4). by amplifying the RNA polymerase gene sigma 70 domain (rpoD gene).
A total of 201 (80.4%) out of 250 isolates that were conventionally
identified using biochemical sugars confirmed to be aeromonads
Table 4 by amplification of 820 bp rpoD gene (Fig. 4), making the overall mo-
Biochemical sugar profile of the Aeromonas species. lecular prevalence of 24.6% (201, n ¼ 816), higher in Iringa and
Mbeya and least in Ruvuma (Fig. 5A). aeromonas spp ware highly iso-
Biochemical test/ Bacteria Aeromonas spp
lated in gills (40%, 135/339) and less isolated in Kidney (17%, 57/339)
Catalase þ
(Fig. 5B).
Oxidase þ
m-Inositol -
Raffinose -
Lactose -
Xylose -
Cellobiose þ/-
Maltose þ
Mannose þ
D-Mannitol þ
Melibiose -
Sucrose þ
Citrate þ
Urea -
Indole þ
Motility þ/-
AmpicillinR þ
Nitrate, þ
D-sorbitol - Fig. 4. PCR amplification of rpoD gene (820 bp) from aeromonads isolates in
Trehalose þ this study. Lane 1–7 are representative bacterial isolates from fish collected at
Dulcitol -
Ruvuma, Mbeya Iringa, and Kilimanjaro, lane 8 is the positive control, Lane 9 is
Salicin þ/-
a negative control and Lane M, is DNA size marker (100 bp DNA ladder).

5
A. Mzula et al. Heliyon 5 (2019) e02220

Fig. 5. Prevalence of aeromonas spp based on geographical regions (A), fish internal organs (B) and fish groups (C).

When the relationship between fish groups (fingerlings, sub adults Lio-Po et al. (2001) that disease occurrence in fish farms is a function of
and adults) and infection of Aeromonas spp was tested using χ2 test, it was the pathogen, host and the environment, the absence of stressful envi-
observed that being infected or not infected is dependent on fish groups. ronment could be the reason for the absence of the disease at the time,
There was a significant association between infection status with and fish when this study was carried out. The two Aeromonas species identified
size group (p < 0.05). The prevalence based on fish size groups was high from farmed tilapia in this study (A. hydrophila and A. veronii) are the
in fingerlings and low in adults (Fig. 5C). known important etiological agents of diseases outbreaks in the fresh-
water tilapia farms and detection of these bacterial species in the kidney,
3.8. Phylogenetic analysis the liver and spleen of apparently healthy fish are not startling because
they are ubiquitous of the aquatic environment. The high proportion of
The rpoD gene from the isolates displayed sequence homologue of infection in gills in comparison to other organs is due to the exposed
97–99 % with several rpoD sequences of aeromonas spp from the Gene nature of the organ to microbiota (Mwega et al., 2017). Identification of
Bank. The phylogeny grouped the isolates from this study into the clus- members of the family Aeromonadaceae in apparently healthy fish col-
ters of A. hydrophila and A. veronii in relation to reference sequences from laborates with a previous report by Omeje and Chukwu (2014), they
the gene bank (Fig. 6). found these bacteria in both apparently healthy and diseased fish. Even
though they have been detected in apparently healthy fish, they remain
4. Discussion to be a potential risk to disease outbreaks when ponds management
practices are totally poor.
Aeromonads disease outbreak has become an important limiting It is well-known that aeromonads affects all age and size of fish
factor to sustainable fish farming worldwide (Ibrahem et al., 2008). (Camus et al., 1998), however, our findings revealed that fingerlings are
These diseases are accelerated by poor physical-chemical pond water highly infected in agreement with what has been explained by Camus
parameters as well as poor pond management practices. In this study, et al. (1998). The outbreaks of aeromonads diseases are seasonal based
there were no significant variations of most of the assessed and highly experienced in summer (Ibrahem et al., 2008), similar find-
physical-chemical water parameters in fishponds between all four re- ings have been observed in this study where fish farmers reported pre-
gions, and that all the parameters were within the desirable range. vious outbreaks to have been occurred between May and August. The
However, the study reports the occurrence and identification of aero- findings from interviewed fish farmers on knowledge of pond manage-
monads for the first time in farmed tilapia in Southern highland and ment practices and fish health management revealed that farmers have
Northern Tanzania to an overall prevalence of 24.6% with no disease inadequacy knowledge and are not aware to some pond management
outbreak reported in all farms at the point in time. The prevalence is close practices (Chenyambuga et al., 2014). High stocking rate and poor ways
to that reported by Deen et al. (2014) in Egypt. As it was explained by of fertilizing pond are some of them. Assessment of knowledge and

6
A. Mzula et al. Heliyon 5 (2019) e02220

Fig. 6. Phylogenetic tree of representative eromonads isolates from this study (black circle) and closely related taxa from the gene bank. The tree was generated using
Neighbor-Joining method (p-distance model), bootstrap values expressed as percentages of 1,000 replication. Fowlpox virus (FPV-VR250) saved as an out-group.

awareness on fish health management identified that the majority of regarding efficacy and economic feasibility especially in Low and Middle-
farmers lack knowledge on disease diagnosis based on clinical signs; Income Countries (LMIC).
however, farmers from Ruvuma region showed to be familiar with the
most common clinical signs. This is because it is this region where Declarations
farmers reported to have experienced fish mortalities in their farms. One
of the most common methods for managing diseases on fish farms is the Author contribution statement
application of antibiotics (Chitmanat et al., 2016). It was observed from
this study that the majority of fish farmers didn't know any method of Alexanda Mzula: Conceived and designed the experiments; Per-
managing, and controlling fish diseases while few of them mentioning formed the experiments; Analyzed and interpreted the data; Wrote the
antibiotics as one of the methods. Biosecurity measures, good pond paper.
management practices coupled with other fish disease control methods Philemon N. Wambura, Robinson H. Mdegela: Conceived and
such as disease treatment and vaccination are of paramount importance designed the experiments.
towards sustainable aquaculture. While these are greatly implemented in Gabriel M. Shirima: Conceived and designed the experiments;
developed countries, in developing countries like Tanzania efforts must Contributed reagents, materials, analysis tools or data.
be made to train farmers who majority of them are sole peasant farmers
with primary education on biosecurity measures and pond management
practices and on potential risks of bacterial diseases if the same are not Funding statement
employed.
This work was supported by the African Development Bank (AfDB),
capacity building initiatives through Nelson Mandela African Institution
4.1. Conclusion
of Science and Technology, grant no.2100155032816.
The infection rate of aeromonads in apparently healthy tilapia
coupled with limited knowledge and awareness on proper pond man- Competing interest statement
agement practices and fish health management by fish farmers in the
study area poses the risk of disease outbreaks in their farms. Therefore, it The authors declare no conflict of interest.
is recommended that the farmers should be trained on basic pond and
fish health management and control strategies while striving for best
control method to complement such as the use of simple, autogenous Additional information
vaccines based on accurate typing and evidence-based definition of the
epidemiological unit because it is the most viable approach both No additional information is available for this paper.

7
A. Mzula et al. Heliyon 5 (2019) e02220

Acknowledgements _
Erdem, B., KarIptaş, _ E., Işik, K., 2011. Biochemical identifi cation and numerical
E., ÇIl,
taxonomy of Aeromonas spp . isolated from food samples in Turkey. Turkish J. Biol.
35, 463–472.
We acknowledge the technical support provided by Mr. Jeremiah FAO, 2018. Manual on Polyculture and Integrated Fish Farming in Bangladesh. Retrieved
Mugusi at Sokoine University of Agriculture, College of Veterinary November 10, 2018, from Hazard Management website: http://www.fao.org/do
Medicine and Biomedical Sciences at the department of Veterinary crep/field/003/ac375e/AC375E05.htm.
Harikrishnan, R., Balasundaram, C., 2005. Modern trends in Aeromonas hydrophila
Microbiology Parasitology and Biotechnology. We also extend our disease management with fish. Rev. Fish. Sci. 13 (4), 281–320.
acknowledgement to all fish farmers who contributed in one way or Ibrahem, M.D., Mostafa, M.M., Arab, R.M.H., Rezk, M., 2008. Prevalence of Aeromonas
another in this study. hydrophila infection in wild and cultured Tilapia Nilotica (O. Niloticus). In: 8th
International Symposium on Tilapia in Aquaculture, pp. 1257–1271.
Igbinosa, I.H., Igumbor, E.U., Aghdasi, F., Tom, M., Okoh, A.I., 2012. Emerging
References Aeromonas species infections and their significance in public health. Sci. World J.
2012, 1–13.
Abbott, S.L., Cheung, W.K.W., Janda, J.M., 2003. The genus Aeromonas: biochemical Jacobs, L., Chenia, H.Y., 2007. Characterization of integrons and tetracycline resistance
characteristics, atypical reactions, and phenotypic identification schemes. J. Clin. determinants in Aeromonas spp. isolated from South African aquaculture systems.
Microbiol. 41 (6), 2348–2357. Int. J. Food Microbiol. 114 (3), 295–306.
Abdelhamed, H., Ibrahim, I., Baumgartner, W., Lawrence, M.L., Karsi, A., 2017. Janda, J.M., Abbott, S.L., 2010. The genus Aeromonas: taxonomy, pathogenicity, and
Characterization of histopathological and ultrastructural changes in channel catfish infection. Clin. Microbiol. Rev. 23 (1), 35–73.
experimentally infected with virulent Aeromonas hydrophila. Front. Microbiol. 8 Joseph, A.V., Sasidharan, R.S., Nair, H.P., Bhat, S.G., 2013. Occurrence of potential
(AUG), 1–15. pathogenic Aeromonas species in tropical seafood, Aquafarms and mangroves off
Aboyadak, I.M., Ali, N.G.M., Goda, A.M.A.S., Aboelgalagel, W.H. , Salam, A., 2015. Cochin coast in South India. Vet. World 6 (6), 300–306.
Molecular detection of Aeromonas hydrophila as the main cause of outbreak in Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: molecular
Tilapia farms in Egypt. J. Aquacult. Mar. Biol. 2 (6), 2–5. Evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35 (6),
Baumgartner, W.A., Ford, L., Hanson, L., 2017. Lesions caused by virulent Aeromonas 1547–1549.
hydrophila in farmed catfish (Ictalurus punctatus and I. punctatus  I. furcatus) in Lio-Po, G.D., Lavilla, C.R., Cruz-lacierda, E.R., 2001. Health management in aquaculture.
Mississippi. J. Vet. Diagn. Investig. 29 (5), 747–751. In: C.-L., E.R., Lio-Po, Gilda D., Lavilla, Celia R. (Eds.), Tigbauan, Iloilo, Philippines:
Beaz-Hidalgo, R., Alperi, A., Buj
an, N., Romalde, J.L., Figueras, M.J., 2010. Comparison of Aquaculture Department, Southeast Asian Fisheries Development Center. TIGBAUAN,
phenotypical and genetic identification of Aeromonas strains isolated from diseased ILOILO. Aquaculture Department Southeast Asian Fisheries Development Center
fish. Syst. Appl. Microbiol. 33 (3), 149–153. Tigbauan, Iloilo, Philippines ALL.
Bebak, J., Wagner, B., Burnes, B., Hanson, T., 2015. Farm size, seining practices, and salt Martinez-Murcia, A.J., Monera, A., Saavedra, M.J., Oncina, R., Lopez-Alvarez, M.,
use: risk factors for Aeromonas hydrophila outbreaks in farm-raised catfish, Alabama, Lara, E., Figueras, M.J., 2011. Multilocus phylogenetic analysis of the genus
USA. Prev. Vet. Med. 118 (1), 161–168. Aeromonas. Syst. Appl. Microbiol. 34 (3), 189–199.
Camus, A.C., Durborow, R.M., Hemstreet, W.G., Thune, R.L., Hawke, J.P., 1998. MLFD, 2013. Fisheries Sector Development Programme: Fisheries Sector Development
Aeromonas bacterial infections - motile Aeromonad septicemia. South. Reg. Programme. In: Fisheries Sector Development Programme.
Aquacult. Cent. 478 (1), 1–4. Mwega, E., Tuntufye, H., Colquhoun, D., Mutoloki, S., Mdegela, R., Evensen, Ø.,
Carriero, M.M., Mendes Maia, A.A., Moro Sousa, R.L., Henrique-Silva, F., 2016. Wasteson, Y., 2017. Isolation and Characterization of Flavobacteriaceae from Nile
Characterization of a new strain of Aeromonas dhakensis isolated from diseased pacu Tilapia in Tanzania. Retrieved July 27, 2018, from World Aquaculture Society
fish (Piaractus mesopotamicus) in Brazil. J. Fish Dis. 39 (11), 1285–1295. Meetings website. https://www.was.org/meetings/ShowAbstract.aspx?Id¼47279.
Chaix, G., Roger, F., Berthe, T., Lamy, B., Jumas-Bilak, E., Lafite, R., Petit, F., 2017. Najiah, M., Laith, A.R., 2014. Aeromonas hydrophila: antimicrobial susceptibility and
Distinct Aeromonas populations in water column and associated with copepods from histopathology of isolates from diseased catfish, Clarias gariepinus (Burchell).
estuarine environment (Seine, France). Front. Microbiol. 8 (JUL), 1–13. J. Aquac. Res. Dev. 05 (02), 1–7.
Chandran, M.R., Aruna, B.V., Logambal, S.M., Michael, R.D., 2002. Immunisation of Omeje, V.O., Chukwu, C., 2014. Prevalence of Aeromonas hydrophila isolates in cultured
Indian major carps against Aeromonas hydrophila by intraperitoneal injection. Fish and feral Clarias gariepinus of the Kainji lake area, Nigeria. Niger. Vet. J. 35 (1),
Shellfish Immunol. 13, 1–9. 948–955.
Chenyambuga, S.W., Mwandya, A.Lamtane, HA., Madalla, N., 2014. Productivity and Ossiander, F.J., Wedemeyer, G., 1973. Computer program for sample sizes required to
marketing of Nile tilapia (Oreochromis niloticus) cultured in ponds of small-scale determine disease incidence in fish populations. J. Fish, Res. Board Can. 30,
farmers in Mvomero and Mbarali districts, Tanzania. Livest. Res. Rural Dev. 26 (3). 1383–1384.
Retrieved from. http://www.lrrd.org/lrrd26/3/chen26043.htm. Puthucheary, S.D., Puah, S.M., Chua, K.H., 2012. Molecular characterization of clinical
Chitmanat, C., Lebel, P., Whangchai, N., Lebel, L., 2016. Tilapia diseases and isolates of Aeromonas species from Malaysia. PLoS One 7 (2), 1–7.
management in river-based cage aquaculture in northern Thailand. J. Appl. Aquac. Shayo, S.D., Mwita, C.J., Hosea, K., 2012. Ulcerative Aeromonas infections in Tilapia
28 (1), 9–16. (Cichlidae: Tilapiini) from Mtera hydropower dam, Tanzania Shayo. Open Access Sci.
De Jagoda, S.S.S., Wijewardana, T.G., Arulkanthan, A., Igarashi, Y., Tan, E., Kinoshita, S., Rep. 1 (2), 1–7.
et al., 2014. Characterization and antimicrobial susceptibility of motile aeromonads Yamamoto, S., Kasai, H., Arnold, D.L., Jackson, R.W., Vivian, A., Harayama, S., 2000.
isolated from freshwater ornamental fish showing signs of septicaemia. Dis. Aquat. Phylogeny of the genus Pseudomonas: intrageneric structure reconstructed from the
Org. 109 (2), 127–137. nucleotide sequences of gyrB and rpoD genes. Microbiology 146 (10), 2385–2394.
Deen, A. E. N. El, Dorgham, M., Hassan, A.H.M., Hakim, A.S., 2014. Studies on Zhou, Y., Yu, L., Nan, Z., Zhang, P., Kan, B., Yan, D., Su, J., 2019. Taxonomy, virulence
Aeromonas hydrophila in cultured Oreochromis niloticus at kafr El sheikh genes and antimicrobial resistance of Aeromonas isolated from extra-intestinal and
governorate , Egypt with reference to histopathological alterations in some vital intestinal infections. BMC Infect. Dis. 19 (1), 1–9.
organs. World J. Fish Mar. Sci. 6 (3), 233–240.