38

AMPLIFICATION AND DIRECT

SEQUENCING OF FUNGAL
RIBOSOMAL RNA GENES
FOR PHYLOGENETICS
T. J. White, T. Bruns, S. Lee, and J. Taylor

Comparative studies of the nucleotide sequences of ribosomal R N A

(rRNA) genes provide a means for analyzing phylogenetic relation­
ships over a wide range of taxonomic levels (Woese and Olsen 1986;
Zimmer et al 1988; Medlin et al 1988; Jorgensen and Cluster 1989).
T h e nuclear small-subunit rDNA sequences (16S-like) evolve rela­
tively slowly and are useful for studying distantly related organisms,
whereas the mitochondrial rRNA genes evolve more rapidly and can
be useful at the ordinal or family level. T h e internal transcribed
spacer region and intergenic spacer of the nuclear rRNA repeat units
evolve fastest and may vary among species within a genus or among
populations.
Numerous sequences of rRNA genes have been obtained primarily
by isolating and sequencing individual cloned genes (Medlin et al
1988). Direct rRNA sequencing (Lane et al 1985) has also been used
to rapidly obtain sequence data. However, this method requires rela­
tively large amounts of RNA and is prone to errors since only one
strand is sequenced.
T h e polymerase chain reaction (PCR) and direct sequencing offer
several advantages over cloning and direct rRNA sequencing: (1) the
method utilizes relatively crude preparations of total D N A such as

PCR Protocols: A Guide to Methods and Applications

Copyright © 1990 by Academic Press, Inc. All rights of reproduction in any form reserved. 315
316 Part Three. Genetics and Evolution

those from minipreps (see Chapter 34); (2) only small amounts of
D N A are required, about 0.1 to 10 ng per amplification; (3) both
strands of the gene can be sequenced, which reduces errors; and (4)
the method is compatible with automated D N A sequencing instru­
ments that utilize fluorescently labeled sequencing primers or di-
deoxynucleotide triphosphates.
Figure 1 shows the location of the primers, and Table 1 describes
the sequences of primers that we have designed for amplifying vari­
ous segments of the nuclear and mitochondrial rDNA genes of fungi.
The specificity of the primers for amplification of the target genes is
excellent using the cycling parameters indicated (Fig. 2). T h e range
of organisms that can be studied (as described below) can be ex­
tended or restricted to some extent by altering the annealing tem­
perature.
Primers NS1 through N S 8 were based on conserved nucleotide se­
quences from the 18S rRNA genes from Saccharomyces cerevisiae,
Dictyostelium discoideum, and Stylonicha pustulata (Dams et ah
1988). Primers NS1 and N S 2 have amplified rDNA from a wide vari­
ety of fungi, protists, and red and green algae. NS3 through N S 6 have
amplified all fungal DNAs tested. NS7 and N S 8 also amplify some
plant and vertebrate rDNAs.
The primers NS1 through NS8 will generally allow the sequenc-

NS1 NS3 NS5 NS7 ITS5 ITS1 ITS3

% Nuclear Small rDNA ITS

5 .S8ITS
rONAJ Nuclear Large rDNA

NS2 NS4 NS6 NS8 ITS2 ITS4

MS1

1
s Mitochondrial Small rDNA % 500 bp

MS2

ML1 ML3 ML5 ML7

Mitochondrial Large rDNA

ML2 ML4 ML6 ML8

Figure 1 Locations o n n u c l e a r a n d m i t o c h o n d r i a l r D N A s o f PCR p r i m e r s g i v e n i n
T a b l e 1 . T h e a r r o w h e a d s r e p r e s e n t t h e 3' e n d o f e a c h p r i m e r . T h e n u c l e a r l a r g e r D N A
is t r u n c a t e d i n t h i s f i g u r e .
 38. Amplification and Direct Sequencing 317

Table 1
Primers for Amplification of Fungal Ribosomal R N A Genes

Product b TmC
rRNA GenePrimer^ Size (bp) (°C)

Nuclear, small
NS1 GTAGTCATATGCTTGTCTC 555 56
NS2 GGCTGCTGGCACCAGACTTGC 68
NS3 GCAAGTCTGGTGCCAGCAGCC 597 68
NS4 CTTCCGTCAATTCCTTTAAG 56
NS5 AACTTAAAGGAATTGACGGAAG 310 57
NS6 GCATCACAGACCTGTTATTGCCTC 65
NS7 GAGGCAATAACAGGTCTGTGATGC 377 65
NS8 TCCGCAGGTTCACCTACGGA 65
Nuclear, ITS
ITS1 TCCGTAGGTGAACCTGCGG 290 65
ITS5 GGAAGTAAAAGTCGTAACAAGG 315 63
ITS2 GCTGCGTTCTTCATCGATGC 290 62
ITS3 G C A T C G A T G A A G A A C G C A G C 330 62
ITS4 T C C T C C G C T T A T T G A T A T G C 58
Mitochondrial, small
MSI CAGCAGTCAAGAATATTAGTCAATG 716 65
MS2 GCGGATTATCGAATTAAATAAC 63
Mitochondrial, large
ML1 G T A C T T T T G C A T A A T G G G T C A G C 253 68
ML2 T A T G T T T C G T A G A A A A C C A G C 63
ML3 GCTGGTTTTCTACGAAACATATTTAAG 934 67
ML4 GAGGATAATTTGCCGAGTTCC 68
ML5 CTCGGCAAATTATCCTCATAAG 359 66
ML6 CAGTAGAAGCTGCATAGGGTC 65
ML7 GACCCTATGCAGCTTCTACTG 735 63
ML8 TTATCCCTAGCGTAACTTTTATC 57
a
A\l odd-numbered primers are 5' primers; even numbers indicate 3 ' primers. Se­
b
quences are written 5'-3'.
P r o d u c t sizes are approximate based on the rRNA genes of S. cerevisiae-, the size
of the region amplified is the product size minus the primers. Primers NS3 and NS4
amplify mitochondrial and bacterial r D N A from some organisms; expected product
c are approximately 3 6 5 bp and 4 2 5 bp, respectively (see Fig. 2, lane 5).
sizes
T ' s were calculated by the method of Meinkoth and Wahl, 1984.
m
318 Part Three. Genetics and Evolution

Figure 2 PCR a m p l i f i c a t i o n o f a d j a c e n t s e g m e n t s o f t h e n u c l e a r s m a l l - s u b u n i t r R N A
g e n e f r o m a s c o m y c e t e s : (lanes 1 - 4 , NS1 a n d N S 2 ; lanes 5 - 8 , NS3 a n d N S 4 ; lanes
9 - 1 2 , N S 5 a n d N S 6 ; l a n e s 1 3 - 1 5 , N S 7 a n d N S 8 ) f r o m Talaromyces flavus (lanes 1 , 5 , 9 ,
1 3 ) , T. leycettanus ( l a n e s 2 , 6, 1 0 , 1 4 ) , a n d Byssochlamys nivea ( l a n e s 3 , 7, 1 1 , 1 5 ) .
N e g a t i v e c o n t r o l s ( n o D N A ) i n l a n e s 4 , 8 , 1 2 . M o l e c u l a r w e i g h t s t a n d a r d s : <£X174RF
H a e l l l d i g e s t i n lane 16.

ing of m o s t of t h e n u c l e a r s m a l l r R N A gene e x c l u d i n g t h e a r e a s of
t h e p r i m e r s e q u e n c e s . N S 2 and N S 3 , N S 4 and N S 5 , and N S 6 and
N S 7 a r e c o m p l e m e n t a r y , and a b e t t e r design w o u l d h a v e offset t h e m
t o p e r m i t s e q u e n c i n g of t h e p r i m e r regions. N S 1 and N S 8 w i l l a m ­
plify n e a r l y t h e e n t i r e 1 8 S gene in all fungi t e s t e d , b u t w e h a v e n o t
y e t devised o p t i m a l c o n d i t i o n s for o b t a i n i n g a good yield of single-
strand t e m p l a t e f r o m a n amplified p r o d u c t of t h i s size.
T h e regions used for t h e m i t o c h o n d r i a l p r i m e r s w e r e s e l e c t e d b y
c o m p a r i s o n of s e q u e n c e s f r o m t h e a s c o m y c e t e s S. cerevisiae and
 38. Amplification and Direct Sequencing 319

Aspergillus nidulans with the unpublished sequence of the basidio-

mycete Suillus sinuspaulianus (T. Bruns, personal communication).
Potential primer sequences were then compared to nuclear 28S and
18S sequences to ensure that they were specific for mitochondrial
genes. Where the three mitochondrial sequences differ within the
primer regions, the S. sinuspaulianus sequences were chosen. Thus
some of the primers are better matched to Suillus and related basi-
diomycetes than to ascomycetes. However, the primers were de­
signed such that mismatches are few and central to the regions of
homology. All primers have been tested with the ascomycete Neu­
rospora crassa and found to amplify the correct fragment. Primers
ML1, ML2, ML4, M S I , and M S 2 will also amplify specific frag­
ments from the oomycete Phytophthora cinnamomi. T h e region

A B C D E F M G H I J K

Figure 3 Length differences in t h e m i t o c h o n d r i a l LrRNA gene (A-F) and nuclear

ITS r e g i o n ( G - L ) . A p o r t i o n o f t h e m i t o c h o n d r i a l L r R N A g e n e w a s a m p l i f i e d f r o m
six s p e c i e s o f Suillus using t h e M L 7 p r i m e r a n d o n e that is 3' t o M L 8 (MLID,
C G G A G G A T A G G A T A A G T C G ) a n d s p e c i f i c t o t h e Boletaceae a n d related basidio-
m y c e t e s . F o u r o f t h e s p e c i e s y i e l d e d a f r a g m e n t o f a p p r o x i m a t e l y 610 b p , b u t t w o
(D,E), w h i c h are k n o w n f r o m p r e v i o u s m a p p i n g studies (Bruns a n d Palmer, in press)
t o c o n t a i n a n i n t r o n i n t h e r e g i o n , y i e l d e d f r a g m e n t s o f a p p r o x i m a t e l y 2000 a n d 1700
b p . T h e ITS1 a n d ITS4 p r i m e r s w e r e u s e d t o a m p l i f y t h e ITS r e g i o n f r o m f o u r s p e c i e s
o f Suillus a n d t w o s p e c i e s f r o m t h e c l o s e l y r e l a t e d g e n u s Rhizopogon. Sizes o f t h e
r e g i o n w e r e f o u n d t o b e a p p r o x i m a t e l y 710 b p i n t h e f o u r Suillus species ( G - l , L), b u t
740 a n d 850 b p i n t h e t w o Rhizopogon s p e c i e s (J, K ) . T h e s i z e m a r k e r s ( M , m i d d l e ) a r e
P h a g e X H / ' n d l l l a n d <DX H a e l l l f r a g m e n t s o f 2 3 2 2 , 2 0 2 7 , 1 3 6 0 , 1 0 7 8 , 8 7 8 , 6 0 6 , a n d 3 1 0 b p .
320 Part Three. Genetics and Evolution

amplified by M L 6 and ML5 contains an intron in some species of

basidiomycetes (Fig. 3, Bruns and Palmer 1989), and in species in
which this intron is large, the fragment is not amplified efficiently.
Length mutations are c o m m o n in these mitochondrial genes, and
the length of the regions amplified may vary considerably from those
listed in Table 1.
The ITS primers make use of conserved regions of the 18S, 5.8S,
and 28S rRNA genes to amplify the noncoding regions between them.
ITS1 is the complement of N S 8 and was designed as described above.
Comparisons among 5.8S rRNA sequences of N. crassa, Schizo-
saccharomyces pombe, S. cerevisiae, Broad bean [Vicia faba), and
mouse (Mus musculus) were used to select ITS2 and ITS3. T h e 28S
sequences of S. pombe, S. cerevisiae, and rice (Oryza sativa) were
compared to select ITS4. T h e conserved region chosen overlaps the
28A primer of Zimmer et al. (1988), which has been previously used
for direct sequencing of the 28S rRNA. ITS5 is identical in sequence
to the N. crassa sequence in the 18S rDNA region (Kelly and Cox
1982) that is 25 base pairs 5 ' to ITS 1.

Protocol

Reagents
1 0 x amplification buffer
15 m M M g C I 2
500 mM KCI
100 mM Tris HCI (pH 8.3) at 23°C
0.1% gelatin
10xdNTP stock mixture
2 m/Vf each of dATP, dGTP, dTTP, and dCTP

Procedure
1. Using positive displacement pipets for steps 1 - 4 , prepare a
working reaction mixture sufficient for 10 amplifications, which
consists of:
275 /xl sterile-distilled water
100 /xl 1 0 x amplification buffer
 38. Amplification and Direct Sequencing 321

100 /xl dNTP stock mixture (2 m M each dNTP)

10 /xl excess primer (50 /xM stock)
10 /xl limiting primer (1 /xM stock)
5 /xl Taq polymerase (5 units//xl)
2. Add 50 /xl of the w o r k i n g mixture to each tube.
3. Dilute the DNA samples in water o r TE (10 m M Tris-HCI [ p H
8.0], 0.1 m M EDTA) t o 0.1 t o 10 ng per 50 /xl.
4. Add 50 /xl of the diluted sample DNA t o each tube followed by
t w o drops of mineral o i l .
5. Spin briefly in a microcentrifuge.
6. Cycling parameters
Initial denaturation 2 t o 3 minutes at 95°C
Annealing 30 seconds at 50° to 60°C
Extension 0.5 t o 2 minutes (depending o n product
size) at 72°C
Denaturation 30 seconds at 95°C
Final extension 10 minutes at 72°C
7. Number of cycles
25 f o r double-stranded product, using 50 pmol of each primer.
35 for single-stranded product, using a primer ratio of 50 : 1 or
50 : 2.5 pmoles.
8. W h e n the amplification is completed, briefly centrifuge the
tubes and take 5-/xl samples for analysis by minigels. Before
sequencing the single-stranded PCR product, remove the oil by
extraction in c h l o r o f o r m and remove the unincorporated n u ­
cleotides while concentrating the DNA by Centricon-30 cen­
trifugal filtration (W. R. Grace, Danvers, Massachusetts).
9. W e routinely use 7 /xl of the Centricon-30 retentate f o r se­
quencing reactions. If this D N A proves too dilute, concentrate
the retentate in a Speed Vac. Use 1 pmole of the limiting
primer (or an internal primer) as the sequencing primer. D o not
denature the double-stranded product prior t o primer anneal­
ing, i.e., anneal at 65°C instead of 90 to 95°C.
10. Primers NS1 through NS8 and ITS1 through ITS4 have also
been used with lower dNTP concentrations (32 /xM each dNTP,
instead of 200 /xM, in the reaction).
11. These conditions have not been optimized for enzyme and
magnesium ion concentrations.
322 Part Three. Genetics and Evolution

Literature Cited

Bruns, T. D., and J. D. Palmer. 1989. Evolution of mushroom mitochondrial D N A :

Suillus and related genera. /. Mol. Evol. 2 8 : 3 4 9 - 3 6 2 .
Dams, E., L. Hendriks, Y. Van de Peer, J.-M. Neefs, G. Smits, I. Vandenbempt, and
R. De Wachter. 1988. Compilation of small ribosomal subunit R N A sequences.
Nucleic Acids Res. 16 (Sup.):r87-rl73.
Hamby, R. K., and E. A. Zimmer. 1989. Direct ribosomal R N A sequencing: optimiza­
tion of extraction and sequencing methods for work with higher plants. Plant
Mol. Biol. Rep. 6 : 1 7 5 - 1 9 2 .
Jorgensen, R. A., and P. D. Cluster. 1989. Modes and tempos in the evolution of nu­
clear ribosomal D N A : new characters for evolutionary studies and new markers
for genetic and population studies. Ann. Mo. Bot. Gard. 7 5 : 1 2 3 8 - 1 2 4 7 .
Kelly, ]. M., and R. A. Cox. 1982. The nucleotide sequence at the 3'-end of Neurospora
crassa 18S-rRNA and studies on the interaction with 5S-rRNA. Nucleic Acids
Res. 1 0 : 6 7 3 3 - 6 7 4 5 .
Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, M. L. Sogin, and N. R. Pace. 1 9 8 5 . Rapid
determination of 16S ribosomal R N A sequences for phylogenetic analyses. Proc.
Natl Acad. Sci. USA 8 2 : 6 9 5 5 - 6 9 5 9 .
Medlin, L., H. J. Elwood, S. Stickel, andM. L. Sogin. 1988. The characterization of enzy­
matically amplified eukaryotic 16S-likerRNA-codingregions. GenelX:491-499.
Meinkoth,J., and G. Wahl. 1984. Hybridization of nucleic acids immobilized on solid
supports. Anal. Biochem. 1 3 8 : 2 6 7 - 2 8 4 .
Woese, C. R., and G. J. Olsen. 1986. Archaebacterial phylogeny: perspectives on the
urkingdoms. Syst. Appl. Microbiol. 7 : 1 6 1 - 1 7 7 .