Ignou Physical Anthropology-1

[Type the document title]
ANTHROGURU
ANTHROPOLOGY
IGNOU-MA (ANTHROPOLOGY)
PHYSICAL
ANTHROPOLOGY
{ PART-1 }
TOPICS ARE ARRANGED ACCORDING TO THE NEEDS OF

CIVILS SYLLABUS
TOPICS COVERED;
PAPER-1
1.1, 1.5, 1.7,9.1,9.2,9.3,9.4,9.6
CONTACT:
[email protected]
telegram: anthroguru
1.3 Main branches of Anthropology, their scope and relevance:
(b) Biological Anthropology.
1.5 Characteristics of Primates; Evolutionary Trend and Primate Taxonomy; Primate

Adaptations; (Arboreal and Terrestrial) Primate Taxonomy; Primate Behaviour; Tertiary
and Quaternary fossil primates; Living Major Primates; Comparative Anatomy of Man
and Apes; Skeletal changes due to erect posture and its implications.
1.7 The biological basis of life: The Cell, DNA structure and replication, Protein Synthesis,
Gene, Mutation, Chromosomes, and Cell Division.
9.1 Human Genetics : Methods and Application: Methods for study of genetic principles in
man-family study (pedigree analysis, twin study, foster child, co-twin method, cytogenetic
method, chromosomal and karyo-type analysis), biochemical methods, immunological
methods, D.N.A. technology and recombinant technologies.
9.2 Mendelian genetics in man-family study, single factor, multifactor, lethal, sublethal and
polygenic inheritance in man.
9.3 Concept of genetic polymorphism and selection, Mendelian population, Hardy

Weinberg law; causes and changes which bring down frequency – mutation, isolation,
migration, selection, inbreeding and genetic drift.
Consanguineous and non-consanguineous mating, genetic load, genetic effect of

consanguineous and cousin marriages.
9.4 Chromosomes and chromosomal aberrations in man, methodology.
(a) Numerical and structural aberrations (disorders).
(b) Sex chromosomal aberrations – Klinefelter (XXY), Turner (XO), Super female (XXX),
intersex and other syndromic disorders.
(c) Autosomal aberrations – Down syndrome, Patau, Edward and Cri-du-chat syndromes.
(d) Genetic imprints in human disease, genetic screening, genetic counseling, human DNA
profiling, gene mapping and genome study.
9.6 Age, sex and population variation as genetic marker- ABO, Rh blood groups, HLA Hp,
transferring, Gm, blood enzymes. Physiological characteristics-Hb level, body fat, pulse
rate, respiratory functions and sensory perceptions in different cultural and socio-
economic groups.
MANI-002
PHYSICAL
Indira Gandhi
ANTHROPOLOGY
National Open University
School of Social Sciences
Block
1
HISTORY AND DEVELOPMENT OF PHYSICAL
ANTHROPOLOGY
UNIT 1
Definition and Scope 5
UNIT 2
Relationship with Other Disciplines 17
UNIT 3
Applied Dimensions-I 25
UNIT 4
Applied Dimentions-II 33
Expert Committee
Professor I. J. S. Bansal Professor S.Channa
Retired, Department of Human Biology Department of Anthropology
Punjabi University University of Delhi, Delhi
Patiala
Professor P. Vijay Prakash
Professor K. K. Misra Department of Anthropology
Director Andhra University
Indira Gandhi Rashtriya Manav Visakhapatnam
Sangrahalaya, Bhopal
Dr. Nita Mathur
Professor Ranjana Ray Associate Professor
Retired, Department of Anthropology, Faculty of Sociology
Calcutta University School of Social Sciences
Kolkata Indira Gandhi National Open University
Maidan Garhi, New Delhi
Professor P. Chengal Reddy
Retired, Department of Anthropology Dr. S. M. Patnaik
S V University, Tirupati Associate Professor
Department of Anthropology
Professor R. K. Pathak
University of Delhi, Delhi
Panjab University Dr. Manoj Kumar Singh
Chandigarh Assistant Professor
Professor A. K. Kapoor
University of Delhi, Delhi Faculty of Anthropology
SOSS, IGNOU
Professor V.K.Srivastava
Principal, Hindu College Dr. Rashmi Sinha, Reader
University of Delhi, Delhi Dr. Mitoo Das, Assistant Professor
Professor Sudhakar Rao Dr. Rukshana Zaman, Assistant Professor
Department of Anthropology Dr. P Venkatramana, Assistant Professor
University of Hyderabad, Hyderabad Dr. K. Anil Kumar, Assistant Professor
Programme Coordinator: Dr. Rashmi Sinha, SOSS, IGNOU, New Delhi
Course Coordinator: Dr. Rashmi Sinha, SOSS, IGNOU, New Delhi
Content Editor Language Editor
Professor P. K. Seth Mrs. Narinder Jit Kaur
Retired, Department of Anthropology Retired, Associate Professor in English
University of Delhi, Delhi Government Mohindra College, Patiala
Blocks Preparation Team
Unit Writers
Dr Rashmi Sinha (Units 1,2 & 3) Dr. P. Venkatramana (Unit 4)
Reader, Faculty of Anthropology Assistant Professor, Faculty of Anthropology
SOSS, IGNOU, New Delhi SOSS, IGNOU, New Delhi
Authors are responsible for the academic content of this course as far as the copy right issues are concerned.
Print Production Cover Design

Mr. Manjit Singh Dr. Mitoo Das
Section Officer (Pub.), SOSS, IGNOU, New Delhi Asstt. Professor, Anthropology, SOSS, IGNOU
August, 2011
 Indira Gandhi National Open University, 2011
ISBN-978-81-266-5545-8
All rights reserved. No part of this work may be reproduced in any form, by mimeograph or any other
means, without permission in writing from the Indira Gandhi National Open University.
Further information on Indira Gandhi National Open University courses may be obtained from the
University's office at Maidan Garhi. New Delhi-110 068.
Printed and published on behalf of the Indira Gandhi National Open University, New Delhi by the
Director, School of Social Sciences.
Laser Typeset by : Tessa Media & Computers, C-206, A.F.E.-II, Okhla, New Delhi
Printed at :
BLOCK 1 HISTORY AND DEVELOPMENT
OF PHYSICAL ANTHROPOLOGY
Introduction
We are so inquisitive to know about ourselves right from what we were earlier to
why we are like today. The scientific family and individual have been enamored
by the subject for many years. All the answers lead us to the in-depth knowledge
in the discipline of Anthropology. Anthropology is holistic in approach as it
deals with human beings all around the world and throughout time by examining
the historical and present geographical distribution and considering all aspects
of human, both biological as well as social. The strength of physical anthropology
lies in its wide horizon to understand man as a physical being in his prehistoric
setting and cultural context ruled by a multifaceted system of customs, attitudes
and behaviour. Amongst the branches in Anthropology, Physical Anthropology
holds a very coveted position.
Physical anthropology is about humans’ place in nature. It is a very sought-after

arena of anthropology. The mechanisms of biological evolution [i.e., how man
evolved to present form], genetic inheritance (refers to passing of traits from one
generation to the next), human adaptability and variation, primatology, and the
fossil record of human evolution set up Physical Anthropology.
What is Physical anthropology, its definition at various times past and present is
dealt in Unit 1. Its historical journey to the days when physical anthropology
meant human variation and measurement, to the current status when our
knowledge has advanced through technical progression, the aim and scope of
this subject and an overview of the several sub disciplines of physical
anthropology exploring human yet maintaining its own identity will all be dealt
in this introductory unit.
Anthropology is not an isolated but is a broad field of study. It involves all branches
of learning that concerns human and hence is involved with several other
disciplines. Unit 2 concerns with the interdisciplinary and trandisciplinary
approaches in relation to physical anthropology. There are some strong
connections between physical anthropology and other disciplines like forensic
science, life sciences, medical sciences, earth sciences, human biology,
environmental sciences, social sciences, human engineering and technology, and
physical sciences.
Anthropology has spread its tentacles to more than just being an academic
discipline. The recent years reflect an ever increasing recognition; what
anthropology has discovered and can discover about human is invaluable. Applied
and academic anthropology are not mutually restricted approaches, infact, applied
anthropology banks on research and theory of academic anthropology and
simultaneously has much to contribute to theory and technique. But then the
applied aspect of physical anthropology is far from the knowledge bank of the
subject. Applied anthropology is dedicated in making theoretical anthropological
knowledge useful. The applied aspect in physical anthropology is not a recent
discipline which needs an introduction. The knowledge gained by physical
anthropology has been used for getting practical benefits in various fields will
History and Development of be dealt in unit 3 and 4. The application of physical anthropology in field of
Physical Anthropology
designing, forensic anthropology, diseases, aging, sports, public health and
nutritional anthropology would be covered in Unit 3 and Unit 4 deals with
paternity diagnosis, genetic counseling, eugenics and DNA technology and its
use in disease and medicine.
4
Definition and Scope
UNIT 1 DEFINITION AND SCOPE
Contents
1.1 Introduction
1.2 Definition
1.3 Aim
1.4 Scope
1.5 History
1.6 Branches and its Development
1.7 Summary
Suggested Reading
Sample Questions
Learning Objectives &

After reading this unit, you would know the:
Ø definition of physical anthropology and its historical background;
Ø scope of physical anthropology; and
Ø different branches of physical anthropology.
1.1 INTRODUCTION
Physical anthropology is an important field of anthropology. Aren’t we inquisitive
to know about ourselves? How we were in the past to why we are like today? In
this course on Physical Anthropology, let us first define what physical
anthropology is and what does one achieve knowing this discipline. The historical
background will take you back to the days when physical anthropology meant
human variation and measurement to the current status, when we have advanced
our knowledge through technical progression. The progress in this discipline
has paved the way for several branches in physical anthropology.
1.2 DEFINITION
It very much interests us to know more about our past, present and future. What
were the stages that took us to our present day form? All the answers lead us to
the in-depth knowledge of Anthropology. The word Anthropology consists of
Greek word “Anthropos” which means man and “logos” stands for study. It is a
very vast subject comprising man as a physical being, man in his prehistoric
setting and man in his cultural context who is ruled by a multifaceted system of
customs, attitudes and behaviour. Anthropology is holistic in approach as it is
concerned with all human beings, at all times, around the world through the
examination of historical and present geographical distribution of human both
biological as well as social. In a broader perspective, it is comparative science of
man, his variation and their causes.
5
History and Development of Amongst the various branches in Anthropology, Physical Anthropology holds a
very coveted position. What is Physical Anthropology? It is not a simple task to
provide a specific definition of physical anthropology for the simple reason that
it involves interdisciplinary approach. Paul Broca, father of Physical Anthropology
defines it as natural history of the genus Homo and more concretely as the science
whose objective is to study humanity as a whole and in relationship to rest of the
nature. Herskovits identifies that physical anthropologists study such matters as
the nature of racial differences; the inheritance of bodily traits; the growth,
development and decay of human organism; the influence of natural environment
on man. According to Juan Comas, it is defined as science which studies variation,
comparative study of the human body and its inseparable functions, exposition
of the causes and courses of human evolution, transmission and classification,
effects and tendencies in the functional and organic differences, etc.
Broadly speaking, Physical Anthropology comprises of biological evolution,

genetic inheritance, human adaptability and variation, primatology, and the fossil
record of human evolution. Physical Anthropology thus reflects an important
scenario in today’s increasingly specialised world of science.
The discipline thereby facilitates us in investigating the sources of variation which

are the result of genetic differences and environmental modifications and
directions of change which originated in the past. These differences perhaps
arose over long spans of time through evolution both among individuals and
groups. This very understanding of human organism is the strength of physical
anthropology and in today’s increasingly specialised world of science, it
constitutes an important perspective. The domain of physical anthropology is
widespread leading into physicians’ seminars, schoolroom classes or even in
casual conversation, endorsing its broad spectrum.
The branch of anthropology that concerns the human and nonhuman primate
evolution, the biological basis of human behaviour, and human biological
variability and its significance (giving it a proximity to biological science) is
referred to as biological anthropology while physical anthropology is largely an
American and British concept. In most European and many other countries,
physical anthropologists are the only ones who are considered as anthropologists,
while others are referred to as archaeologists, ethnologists, linguists, or
prehistorians depending upon their field of specialisation.
1.3 AIM
The broad based understanding of human organism is the strength of physical
anthropology. Not only this, physical anthropology integrates bio-cultural studies
of human diversity, the ancestors of human species, comparative anatomy,
ecology, behaviour and history of primates. Physical anthropologists are interested
in studying human genetics, growth and development and evolutionary history.
They attempt to accurately describe human physical structure both past and present
and also investigate how function and behaviour are integrated into the
environment in which human beings live.
Human biology has many times been erroneously used as a synonym for physical
anthropology although, there is clear cut area for both the fields. Human biology
comprises structure and function of contemporary man, whereas physical
6
anthropology refers to all that is chronological, racial, social and even pathological Definition and Scope
groupings of human. They are very close knit, yet they maintain individual identity
in working methods, techniques and objectives.
1.4 SCOPE
With so much information getting unveiled, do you think physical anthropology
is merely an academic subject? On the contrary, the recent years reflect an ever
increasing recognition of what anthropology has discovered and can discover
about humans.
The essence of physical anthropology right from its inception remains focused
on man’s physical characters, their origin, how they evolved and their development
to present state that is, whatever we are today is the result of past and present
conditions. Physical anthropology is widely accepted as the comparative science
of man as a physical organism in context to his total surrounding be it social or
cultural or physical; because development of his physical and cultural factors is
reliant on the environment prevailing at that time.
What makes physical anthropology so indispensable? The answer lies in the

very fact that the understanding and assessment of the degree of human variability
along with the accounting of factors responsible for our current distribution have
been of vital concern. Major answer lies in the fields of genetics and anthropometry
which has been used in approximating the causes of diversification and human
variation. Human variation is a specialised branch of physical anthropology.
The stages of evolution particularly the ‘prehuman’ history of man to his present
form is the basis of Primatology. It also includes the study of human biology
including anatomy, physiology and ethology. Undeniable is the contribution of
Primate Palaeontology on extinct primates. This entire phenomenon tracing the
origin of man and his evolution comes under Palaeoanthropology. Appropriate
evaluation of the remains of fossil men in evolutionary outlook requires the
contribution of comparative anatomy as well as embryology or developmental
anatomy and physiology of growth.
Human diversity, another important component of physical anthropology takes

into account human taxonomy, which in anthropological perspective refers to
study of races. It was decided to replace the term ‘race’ with ‘ethnic group’ due
to the misuse of the term, but then again the term is being revived.
The inclusion of human genetics as an essential component of physical

anthropology has witnessed tremendous growth even occupying place in health
magazine about a disease cell or gene therapy to treat diseases. Whatever it may
be, there would undoubtedly be some information related to the field of genetics.
Patterns of inheritance of trait in humans have generated tremendous interest.
The assessment of the distribution and the gene frequency of the traits form an
important basis for evaluating the continuous process of human differentiation.
The information on recurrence of a particular trait interests us a lot, like, what
would be the stature of a child born to parents of average stature. The study of
human genetics has facilitated for treatment and genetic counseling to prevent
recurrence of Down’s and other syndromes. Human population genetics using
mating pattern as a method contributes in the evaluation of inflow and outflow
7
History and Development of of genes which are responsible for evolution. Eugenics forms a fundamental
part of physical anthropology responsible towards the improvement of
populations.
Growth and development in physical anthropology has its own importance, be it

studying secular trends (e.g., increase or decrease of weight in the next generation),
stages of growth, growth pattern of a population, factors affecting nutritional
status and reproductive biology, population variation, all come under the flagship
of physical anthropology.
Recent years have witnessed physical anthropology playing undeniable services

in the field of dentistry, medicine and industrial research. This clearly is reflection
of the basic fact that whenever human body in part or whole needs any explanation
be it the form, functional or age changes, physical anthropology plays a vital
role. The scope of physical anthropology in the field of forensic science is
noteworthy. The various branches of physical anthropology which facilitates
forensic scientist in arriving at conclusion are dermatoglyphics, osteology,
osteometry, and serology; somatic and genetic characteristics contributing towards
the determination of age and sex. Somatological knowledge plays an important
role in interpreting the body types for different sports or even in relation to specific
disease.
1.5 HISTORY
Early physical anthropologists pondered about the nature and geneses of human
races. Variation in human phenotypes mesmerized them. Way back in the
seventeenth century, it was widely accepted by the western scholars that humans
belonged to a single species, all descendants of Noah and his family. When they
came across so many different looking human beings, it struck upon them the
diversity among mankind. This was obviously something they had not imagined.
With the advent of 18th century, physical anthropology answered this curiosity
with its emergence as the scientific study of race, a response to the presence of
so many human types.
The founder of physical anthropology was the German physician Johann Friedrich
Blumenbach (1752–1840) of Göttingen; he was also regarded as the inventor of
craniology, build up enormous collection of human skulls, and thus had right to
be an empirical power on the question of human diversity. According to him,
mankind could be divided into five races: American, Caucasian, Ethiopian,
Malayan and Mongolian.
The very first impression everyone had, was that all contemporary human races
were monogenic, which meant that man’s origin was from a single gene. James
Cowles Prichard (1786-1848), was of the opinion that, as the descendants of
Adam became lighter-skinned they attained higher intellects and civilization.
With passage of time, all races would become similar to Western Europeans, the
race that in his view had progressed farther or more rapidly. It was in late
eighteenth and early nineteenth centuries, the proposal that races were polygenic,
that is more than one gene, picked up momentum in the scientific circles of
Europe especially France and America. The advocates of polygenism were of
the view that the extent of human diversity found could not be attributed to the
opponents of polygenism as the variation between the races was too much to be
8
just a resultant of environmental differences and too great for humanity to be Definition and Scope
attributed to a single species. Therefore, there must have been many species
right from the beginning. This human variation which came into limelight was
studied using anthropometric measurements (anthropometry) by a Philadelphia
physician and advocate of polygenism, Samuel George Morton (1799-1844), in
later nineteenth century.
Anthropological Society of Paris, first in the field of Anthropology, was founded

in 1859 by a French surgeon, Paul Broca (1824-1880). He set up an
anthropological laboratory the previous year, which subsequently became the
Centre for a training program for anthropologists. Broca followed the tradition
of Samuel Morton. Most of the activities of these early physical anthropologists
could be categorized as racial craniology. Anthropometry took lead and spread
from Broca’s laboratory to other institutions. It became clearer why polygenism
was preferred over monogenism. The polygenists were in a position to make
their point more acceptable. Broca emphasised that it was incorrect to attribute
the huge diversity in races due to degeneration and also argued that it would be
degrading to believe the diversity of racial variation as degeneration from a single
superior species.
Paul Broca along with other French physical anthropologists intensified their
work on cranial anatomy and other small variations. While the German tradition,
led by Rudolf Virchow (1821–1902) stressed on the fact that the variation
observed in the human form is a result of environment and disease upon the
human body, and the lack of fit among race, nation, and culture. The American
tradition focused upon the “pacified” aboriginal (Indian) inhabitants of the North
American continent, unearthing and gathering skeletons as scientific objects along
with artifacts, languages, and culture.
It was Edward Tyson (1650-1708), a London physician and member of the Royal
Society, who started the European primate studies and differentiated between
the animal, humans, and monkeys by dissecting a chimpanzee. In fact lot of
curiosity was generated among people in primate behaviour despite it most of
the early scientific investigations were basically anatomical. Thomas Henry
Huxley’s in Man’s Place in Nature (1863) endeavored to apply Darwinism to
appreciate the origins of human. Thus Primatology focused on anatomy and look
for primate evolution from paleontological record. It was Ernst Haeckel (1834-
1919) in Germany who published an encyclopedia of primate anatomy and came
up with first scientific phylogenetic trees. It was because of these efforts that
made us understand what we are today, with anatomy remaining the focal point
until after 1900.
Subsequently, with the advent of nineteenth century, it was anthropometry which

came more in limelight by becoming more sophisticated under the patronage of
Karl Pearson (1857-1936), co-founder and editor of the journal, Biometrika. It
goes to the credit of Karl Pearson who treated the measurements of bones and
bodies to statistical tests which made the exercise more scientific including
computations for variation and correlation, and tests of significance for comparing
samples. Physical anthropology was devoted to the study of racial determinism–
a philosophy that assumed the superiority of Caucasoids in the last half of the
nineteenth century.
9
History and Development of It was prevalent in the United States after the Civil War (1861–65) that physical
anthropology was a mystique medical speciality. But it was Franz Boas (1858–
1942) in 1897, an architect of today’s face of physical anthropology who used
his expertise in measuring schoolchildren, and collecting Inuit skeletons. Boas
also propagated changeability of the human form and minimize race in favor of
studying culture.
Ales Hrdlicka (1869–1943), a physician, studied physical anthropology in France,

whereas Hooton, a Classics Ph.D from the University of Wisconsin, then entered
anthropology as an Oxford Rhodes Scholar, under R. R. Marett, and the anatomist
Arthur Keith. In the following decades, Hooton trained most American physical
anthropologists under his umbrella: like Harry L. Shapiro and Carleton S. Coon
whose input to the discipline is unmatched. As the leading US student of race in
the 1930s, Earnest Hooton, a protagonist of race in 1930’s, tried to differentiate
“good” American physical anthropology from “bad” German physical
anthropology. Unaware of the conflict of scientific interpretation, the priceless
input towards the field of anthropology continued between Germans and
Americans, by Eugen Fischer, Fritz Lenz and Erwin Baur.
Right in the middle of twentieth century in 1951, a Hooton alumnus, Sherwood

Washburn rediscovered the field with newer focus in physical anthropology;
racial typology studies took a backseat and centre was shifted to the study of
human microevolution distancing from classification, emphasising evolutionary
process and history. Washburn’s anthropology ventured to paleoanthropology
and primatology. As a result, current anthropology boasts of diverse methodology
to get a more vivid picture of animal behaviour, human genetics and medical
anatomy. It has taken several roads of development in recognising physical
anthropology and giving it a very enviable position in scientific fraternity.
1.6 BRANCHES AND ITS DEVELOPMENT

The growth of physical anthropology has been unparallel. In its nascent stages,
physical anthropology was synonym to taking measurements, compute indices
and other statistics. Irrespective of the objectives of study, the methods of
observation, measurement and comparison remained same. As a result, the
approach at that time was stagnant with thrust on taxonomy. This was because
the development of theory was not known at that time and so was genetics.
Consequently for number of years, classical Physical Anthropology was
considered nothing but anthropometry with assumption that with accurate metric
values all the solutions would be there. Precisely for this, an agreement on the
techniques of measurement became necessary and thus was attempted.
The significance of measurements and indices was certainly well understood in

understanding the extent of variability and development in certain traits.
Nevertheless, it does not reveal if all could be put in a single biological category
on the basis of some traits. To get clarity on evolution, race and constitution,
information on number of factors like cranial forms, pigmentation, somatic
structures and growth process is essential, thereby requiring the reorientation of
the methodology becoming vital. This necessitated the beginning of the analytical
phase, thereby initiating a new outlook in Physical anthropology. The new physical
anthropology aims to enhance the knowledge of past by the study of present.
10
Physical anthropology, often called biological anthropology, as has been Definition and Scope
mentioned earlier specialises in the physical development of the human body
and the human species. Its area of function is large as it involves man. Physical
Anthropology can be divided into several branches. Conventionally, physical
anthropology meant races and anthropometry. But now with passage of time,
many sub-branches have arisen due to vast work done in the quest to know
about ourselves. This is a continuous process and new branches are evolving
depending upon the nature of field area. Some of these include:
Human Growth and Development: This branch of physical anthropology

concerns the process of growing to maturity. In biological terms, it involves
growth from a one-cell zygote to an adult human being. Human growth and
development specialises in understanding the different stages of growth, patterns
of growth and the effect of nutrition, environment and genetic factors influencing
growth. The growth studies of different populations not only reflect variation
amongst them but also indicate the growth rate of the nation. There has been
tremendous progress in the field of human growth and development since the
1940s. The studies have enabled to establish the norms of bone development,
sexual maturation so that congenital, nutritional, and other environmental effects
can be detected and utilised clinically in children and adolescents. Another
contribution of the field is that global nutritional surveys recognised small adult
size to be correlated with dietary insufficiency. It is the endeavor of physical
anthropologist to apply anthropometric techniques to the study of aging to have
an insight into longevity of certain people.
Human Genetics: Human genetics involves the study of inheritance of genes-

unit of hereditary, in human beings. It is the common factor of most human
traits. It provides information to questions about human nature, understand the
diseases and their effective treatment, and also understand genetics of human
life. The information on what are the chances of acquiring a trait like blue eyes
or cardiac ailment all can be gathered from human genetics. It incorporates a
variety of overlapping fields including: classical genetics, cytogenetics, molecular
genetics, biochemical genetics, genomics, population genetics, developmental
genetics, clinical genetics, and genetic counseling. In fact the rechristening of
physical anthropology to biological anthropology is primarily because of inclusion
of human genetics so as to understand Human better.
Primatology: It is basically concerned with the study of primates. Anthropologists

hope to gain more insight into human nature by studying primates like apes and
monkeys.This branch of physical anthropology encompasses the study of the
hominids, (general term used for humans and any member of the species of
animal we are most closely evolved from), which include all ape-like ancestors
of man and the other great apes. Modern primatology boasts of newer and an
extremely diverse science, ranging from anatomical studies of primate ancestors
and field studies of primates in their natural habitat, to get intrinsic information,
to experiments in animal psychology and ape language. This parameter has
generated tremendous information on basic human behaviours and their ancestry.
Human Evolution: This branch, as the name suggests, revolves around the origin
and evolution of Homo sapiens as a distinct species. The word “human” in the
framework of human evolution speak of the genus Homo. But then how did
humans evolve. In order to understand human evolution we study hominids also
11
History and Development of as the study of hominids holds importance. It is important to know other
disciplines like primatology, archaeology, linguistics and genetics so as to have
a better understanding of human evolution.
Palaeoanthropology: Palaeoanthropology is the study of fossil hominid

evidences petrified bones and footprints, encompassing the discipline of
paleontology. It also involves human osteology which provides historical support
by studying the remains of the human evolutionary lineage. It is amongst the
forerunners of the fundamental branches of physical anthropology.
Paleoanthropology incorporates many disciplines to enrich our knowledge on
human evolution as supported by fossils, artifacts, and their geological and burial
sites. They accomplish the task by reconstructing from the fossils found in the
excavation, the organism or the individual to whom they could probably have
belonged. They must be in know how of human and other primate anatomy and
the principles of taxonomy, so as to explain their discovery.
Human Osteology: The study of human bones is termed as Human Osteology.

Evidences concerning osteology are frequently applied in forensic science. It
holds important information in arenas like health, disease, physique, genetics of
early populations, identification of unknown remains, criminal investigations,
war crimes, etc.
Human Ecology: Ecology is a biological discipline that deals with the interactions
between organisms and their environment. This environment is a sum total of
the physical environment including temperature, water availability, wind, soil
acidity and biological environment which holds influences on an organism.
Human adaptation (physiologic, developmental, and genetic) to environmental
stresses and variation is part of human ecology. Human being is the most versatile
species on earth which can adapt in any environment, be it extreme climate,
deserts, polar region, high altitude or even a marooned island. Human species
are distributed world wide well adapted in diverse environment. The human
group is an ever-increasing population which in return would involve more
consumption of resources; therefore better adoption of the Earth’s primary
production is need of the hour. However, many other human ecological
developments are probable in future. The growth of human population and how
this growth is accommodated, the way they utilise these resources yet preserve
the biodiversity is yet to be comprehended.
Nutritional Anthropology: This branch of physical anthropology enjoys wide

horizons describing how particular social and cultural factor place people at risk
for nutritional disorder or identifying health problems related to nutrition.
Nutritional Anthropology is gaining importance mainly due to concern and
consciousness of people towards health. Anthropologists have contributed to
the specialised fields of nutrition at a more holistic perspective, based on the
historical, direct observation, and documentary accounts. The significance of
this field lies in assessing health status of any population.
Molecular Anthropology: Molecular anthropology is a comparatively newer

branch of physical anthropology which deals with the molecular analysis. It makes
easier to understand the evolutionary links between ancient and modern human
populations, as well as between contemporary species. This enables to determine
the closeness or distance in relationship between populations or within
12
populations. The findings of DNA study of primate phylogeny questions the Definition and Scope
views of the traditional anthropologist that humans are very different from all
other animals. Certain similarities in genetic makeup let molecular anthropologists
determine whether or not different groups of people share a common geographical
origin. This paves way for anthropologists to trace patterns of migration and
settlement, which gives an insight as to how contemporary populations have
formed and progressed over time. Molecular anthropology plays a very important
role in establishing the evolutionary tree of humans and other primates, including
closely related species like chimpanzees and gorillas. This is of vital importance
as it aids in searching for common ancestors and thus in understanding of human
evolution. The coming up of molecular biology that tracked the cracking of the
genetic code fascinated physical anthropologists, interested in knowing the
proximity between the humans and the apes, and the relationships of other
primates to one another and to other creatures. In fact it is claimed that “molecular
clocks” have been unearthed to indicate when species diverged from one another.
Forensic Anthropology: This has been one of the most sought after branches of
physical anthropology. The term “forensic” refers to the application of this subfield
of science to a court of law. Forensic anthropology is the application of the science
of physical anthropology and human osteology in a legal scenario; when in a
criminal case, victim’s remains are unidentifiable or in the advanced stages of
decomposition, forensic anthropology helps in identification of the individual.
The techniques of Forensic anthropology helps to assist in the reconstruction of
remains, assessment of age, sex, stature, ancestry, and analyse trauma and disease.
Forensic anthropology is witnessing rapid growth and recognition, laurels of
which goes to anthropologists whose expertise in criminal evidence (fingerprints,
blood types, and skeletal remains) are sought. Forensic anthropologists utilise
the proficiency of forensic pathologists, odontologists, and homicide investigators
to identify a decedent, discover evidence of trauma, and determine the postmortem
interval. Though their opinions are taken into consideration by the medical
examiner, yet they do not enjoy the legal authority to declare the official cause of
death.
Anthropological Genetics: Genetic methods are used to learn about human in

the course of its deviation from apes, the magnitude and how hominid population
in geographic area originated and the initial migrations of anatomically modern
humans. The field of anthropological genetics encompasses patterns of genetic
similarity among different human populations to deduce demographic history,
including mating structure, the account of people moving from one place to
another and mixing with surrounding groups, and population size fluctuations.
Genetic Anthropology: This is a very new branch of scientific study which

deals with combining DNA data with available physical evidence and past
histories of civilizations. This facilitates scientists to assemble through existing
genetic information in elucidating how the modern day Homo sapiens evolved
through the millennia.
Physiological Anthropology: The word physiology is from Greek: “physis”

which means nature, origin and “logy” means, study. Human physiology is a
scientific study of the mechanical, physical and biochemical functions of humans
in good health, their organs, and the cells which constitute them. Physiological
basis is at the level of organs and systems within systems. It is strongly connected
13
History and Development of to anatomy since anatomy is the study of form, while physiology is the study of
function of that form.
Dental Anthropology: This branch engages the scientific study of people

including their living and extinct primate relatives, using the evidence of teeth.
Practicing dentists, anatomists, radiologists, forensic scientists, biochemists and
geneticists, archaeologists, paleontologists and zoologists apart from
anthropologists are actively working in the field of Dental anthropology.
Anthropometry: Anthropometry as the name suggests consists of Greek word

“anthropos” which means man, and “metry” meaning measure. This branch
focuses on the understanding of human physical variation as in literal sense
anthropometry refers to measurement of humans, and in physical anthropology,
it means measuring of the human individual. Anthropometry plays an extensive
role in industrial design, clothing design, defence equipments, ergonomics and
architecture. To attain perfection in this endeavor statistical data on the variation
in body dimensions in population are taken into consideration. These variations
in body size can be attributed to changes in life styles, nutrition and ethnic
composition of populations and therefore warranting regular updating of
anthropometric data collection.
Ergonomics: Ergonomics is derived from two Greek words, “ergon” meaning

work, and “nomoi” meaning natural laws, which means the science of work and
a person’s relationship to that work. Ergonomics is fundamentally the study of
designing equipment and devices that fit the human body, its movements, and
how to carry about the work. Proper ergonomic design is necessary to avoid
recurrent strain injuries, which can be hazardous later in life. Ergonomics takes
into account designing the furniture and technological knowledge such that it
appears to be perfect amalgam of the two. In accomplishing so, it takes into
account the user’s competence and restrictions in seeking to make certain that
tasks, equipment, information and the environment are appropriate to yield
efficient results. Ergonomics comprises number of disciplines like anthropometry,
biomechanics, mechanical engineering, industrial engineering, industrial
designing, physiology and psychology.
Demography: Demography is the scientific study of uniqueness and movement

relevant to the human population illustrated by size, growth rate, density, vital
statistics, and distribution of a specified population. Demography gains its
significance as it is this field that necessitates the study of precise information
that may be collected from a population census or vital statistic records. People
who study and record this information are referred to as demographers.
Demographers must know both how to scientifically obtain information and
then interpret it relatively. Demography is the basic statistics of human population
which can be applied to any kind of human population which does not remain
static, that is, one that changes over time or space in response to birth, migration,
aging and death.
Human Diversity: It is concerned with study of human evolution and human

biological variation. Human evolution involves the extensive work on the
discovery, analysis, and description of fossilized human remains. This mainly
aids to identify the differences between humans and their nonhuman ancestors
and how did present man emerge. To achieve this, it involves the comparative
14
analysis of genetic codes. Studies on human variation among contemporary Definition and Scope
humans are not only dependent on the concept of race, but on principles of genetics
also.
Palaeoprimatology: It is well understood that man is a primate evolved from

non-human primates. The nonhuman primates are link to human physical history
and status as mammals. They also show the continuity in the similarities to the
behaviour and mental abilities of human ancestors as gauged by physical
anthropologist. The palaeoprimatologists take the assistance of fossil specimens
by collecting, describing and interpreting them phylogenetically and functionally.
Population Genetics: Population genetics concerns the genetic structure of

populations, the frequencies of alleles (alternate form of a gene) and its genotypes
(genetic constitution). An important branch of physical anthropology, it is related
to the process of evolution witnessing natural selection, genetic drift, gene flow
and mutation. It is the study of allele frequency distribution and change under
the influence of the above mentioned evolutionary processes. Population genetics
specialises in the genetic constitution and changes overtime in any population.
It also encompasses the study of the forces like mutation, migration and
intermixture between the groups which have the capability of altering the genetic
composition of any population. This enables us to understand the steps towards
biological evolution. It concerns the information of the frequencies of genes,
genotypes and phenotypes, and the mating systems.
Human Variation: The term human variation is gaining popularity over its
historical predecessor “race” in anthropology because of the exploitation of the
term. It is suggested to use gene frequencies and biological traits of human
populations by their geographic area. This genotypic and phenotypic detail would
be understood in terms of historical and closest selective forces in each
environment. Its main thrust is focused in an endeavor to interpret given so much
of human diversity, a consequence of evolution through a long passage of time
and all around the globe.
1.7 SUMMARY
After going through this unit, you must have understood that various definitions
of physical anthropology have been given depending upon the focus at that time.
It is rather difficult to give precise definition to physical anthropology as it
embraces interdisciplinary approach. The mechanisms of biological evolution,
genetic inheritance, human adaptability and variation, primatology and the fossil
record of human evolution constitute Physical Anthropology reflecting an
important scenario in today’s increasingly specialised world of science. It aims
for the physical anthropologists to explore human genetics, growth and
development and evolutionary history in an attempt to accurately describe human
physical structure both in the present and in the past and also investigate how
function and behaviour are integrated into the environment in which human beings
live. The scope of this discipline is manifold making it indispensable. We realised
that the understanding and assessment of the degree of human variability along
with the accounting of factors responsible for our current distribution has been
of vital concern. Genetics and anthropometry have been used in estimating the
detailed cause of individual variation and diversification of the varieties of man.
Human variation, a specialised branch of physical anthropology, currently carries
15
History and Development of out studies to facilitate in the understanding of reliable history of the origin and
evolution of mankind and its varieties; and attempts to evaluate the reasons of
human variation. There are different branches of physical anthropology, each
maintaining its thrust area and identity.
It is believed that by now you must have realised how fascinating is the field of
physical anthropology. It has witnessed a long painstaking journey in its quest to
never-ending desire to know about human. Continuously, physical anthropologists
are meticulously working to unearth the mysteries of human beings. It is not that
they are working in isolation but amazingly involves varied fields resulting in
newer concepts and better understanding which you will encounter in the next
unit.
Suggested Reading
Boaz, N.T and Almquist, A.J. 1999. Essentials of Biological Anthropology, New
Jersey, Prentice Hall.
Harrison, G.A., Weiner, J.S., Tanner, J.M. and Barnicot, N.A.1964. Human
Biology.Oxford University Press
Harrison, G.A, Weiner, J.S., Tanner, J.M., Barnicot, N.A. and Reynolds,V. 1977.
Human Biology, An Introduction to Human Evolution, Variation, Growth and
Ecology. Oxford University Press.
Reddy, R. 1992. Physical Anthropology, Evolution and Human Genetics. Tirupati,

V. Indira.
Sarkar, R.M. 2000. Fundamentals of Physical Anthropology. Calcutta, Vidyodaya

Library Private Limited.
Shukla, B. R.K. and Rastogi, S. 1999. Physical Anthropology and Human

Genetics- An Introduction. Delhi, Palka Prakashan.
Stein, P. L. and Rowe, B.M. 1974. Physical Anthropology. New York, McGraw-
Hill.
Sample Questions
1) What is physical anthropology and what are its aims and scope?
2) Briefly give the history of physical anthropology.
3) What are the different branches in physical anthropology? Give a brief outline
of each branch.
16
UNIT 2 RELATIONSHIP WITH OTHER
DISCIPLINES
Contents
2.1 Introduction
2.2 Interdisciplinary and Trandisciplinary Approaches
2.2.1 Forensic Science
2.2.2 Life Sciences
2.2.3 Medical Sciences
2.2.4 Earth Sciences
2.2.5 Human Biology
2.2.6 Environmental Sciences
2.2.7 Social Sciences
2.2.8 Human Engineering and Technology
2.2.9 Physical Sciences
2.3 Summary
Suggested Reading
Sample Questions

Once you have studied this unit, you will be able to understand the:
Ø meaning of interdisciplinary and trandisciplinary approaches;
Ø its relevance in physical anthropology; and
Ø relationship with other disciplines.
2.1 INTRODUCTION
In this unit, it will be our endeavour to know what does interdisciplinary and
trandisciplinary approaches mean with reference to physical anthropology. As
mentioned in the earlier unit that physical anthropology involves other disciplines
too, we will also explore in this unit the relationship of anthropology with forensic
science, life sciences, medical sciences, earth sciences, human biology,
environmental sciences, social sciences, human engineering and technology, and
physical sciences.
2.2 INTERDISCIPLINARY AND

TRANDISCIPLINARY APPROACHES
Anthropology is a vast field of study, and hence can be seen in association with
numerous other fields. Often divided broadly into two branches, anthropology is
either the science that deals with the cultural development, characteristics, social
customs or beliefs of humankind referred to as cultural anthropology, or the
study of human similarity to or divergence from other animals, their growth,
evolution, development etc. named as physical anthropology. Physical
anthropology is unarguably not an isolated field but incorporates all the branches
17
History and Development of of learning that concerns human. Physical anthropologist often comes in close
contact with archaeologists in the cross disciplinary area of Palaeoanthropology
which is the study of human evolution through fossils and artifacts. Archaeologists
may find a fossilized human skull, but the job of describing and studying the
specimen falls in the domain of the physical anthropologist. Or physical
anthropologist may find it essential to put together their knowledge of skeletal
biology with that of cultural and living contexts that the archaeologists had
discovered in order to get a holistic picture of the adaptation of past human
populations. Physical anthropologist also studies the behaviour of non-human
primates and thereby has close intellectual ties with psychologists. Consequently,
it is undisputable that there are some strong connections between physical
anthropology and other subdisciplines.
2.2.1 Forensic Science

Let me explain how physical anthropology holds coveted position in forensic
science. Physical anthropology has always been an acknowledged area of forensic
proficiency at least since 1850. Forensic anthropology is the application of the
science of physical anthropology associated to the identification of skeletal
material (badly decomposed or otherwise unidentified human remains). Main
objective of forensic science is to detect the criminal(s) through the evidence
obtained from the crime site by means of the study of various bodily remains. It
is in this sphere that physical anthropology plays a pivotal role through its various
methodologies by identifying the deceased from insignificant remains. The study
of blood types, palm and sole prints provides clues in forensic science. Thus, an
association with physical anthropology enables in the detection of crime.
Forensic anthropologists often work in combination with forensic pathologists,

odontologists and homicide investigators to identify a deceased, ascertain
evidence of foul play, and/or the postmortem interval. In addition to supporting
in locating and recovering doubtful remains, forensic anthropologists work to
agree on the age, sex, ancestry, stature and unique features of a deceased from
the skeleton. Forensic anthropologists are often described as “bone detectives”
who assist police unravel intricate cases involving unidentified human remains
by validating the identity of the victims of accidents, fires, plane crashes, war or
crimes such as murder.
What is the role of physical anthropologist in arriving at a conclusion? What is

the role expected of a forensic anthropologist in it? It is well known that forensic
anthropology utilise the standard methodical procedures established in physical
anthropology to identify human remains, thus assist in the unraveling the mystery
of crime. A forensic anthropologist can determine if the person was a male or
female by reviewing the pelvis, base of the skull, the forehead and the jaw. To
elucidate to you further, males usually have a more noticeable brow ridge, eye
sockets, and jaw, whereas women have a broader pelvis. Anthropologists’ are
able to approximate the age of the person by examining the suture closures in the
skull, joints, bones and teeth. Likewise, a child’s skull has more separation
between the bone plates. If the skull is found to be smoother, the indications are
that it belongs to older person. Forensic scientists use formulas to establish height
based on the length of leg and arm bones. The longest bone in human, the femur,
is best for this, but inference can also be made from the metacarpals of the hand.
The consideration of wrist development for children under thirteen is another
18
reliable method of determining age. By and large, the estimation of age works Relationship with Other
Disciplines
best if the victim is under 30 years when the bones are taken into consideration.
Anthropologists are able to calculate approximately the person’s weight by the

wear on the bones at certain points. Racial identification is possible by probing
the dimensions of the nose-width and height. Facial or head hair, when found
with the skeleton, can also assist determine race. To give an example, it is known
that Caucasian nasal openings are triangular, Negroid’s square and those of
Mongoloid’s diamond-shaped. Negroid femur bones are also straighter than other
racial groups. On examination, Anthropologists can also reflect on the occupation
of the person. For example, if the person played an instrument such as a flute or
clarinet, the teeth and bones around the mouth will be influenced. A carpenter’s
or a roofer’s teeth might be clipped in front where he seized nails in his
mouth. Also the ridge where muscle was attached to the bone reflects the persons’
physique.
Physical anthropologist can make out whether the person was right or left-handed.
Observe carefully, there would be more muscle attachment on the bones on the
dominant side. A physical anthropologist can also be adjudging the injury suffered
by the deceased that is if ever the deceased injured or fractured a bone during his
lifetime and whether his death was aggressive. All these warning signs can be
determined by looking for signs of trauma which could possibly be stab marks,
marks on the skull, broken bones, and bullets or pellets in or near the body. A
physical anthropologist plays a decisive role in determining the time when the
individual died. This is evidenced by the amount of soft tissue that is still present
which actually is key to determining the time of death. It is established that the
females lose one pound of tissue a day during decomposition; while males loose
three pounds a day. Acidic soil hastens decomposition whereas the alkaline soil
hinders it. A good number of these such as age, sex, race, and height are class
characteristics, but some are individual characteristics such as trauma. Court
substantiates other evidences or supplements the authentication of other experts
along with forensic anthropological identification, to arrive at their verdict.
Police utilise the expertise of physical anthropologists for facial reconstruction,

recreating a face by taking clues from the skeleton to help them identify the
deceased. When a physical anthropologist is asked to create a reconstruction, he
first deduces as much information from the skeleton, including the most basic
and vital information such as age, race and sex.
2.2.2 Life Sciences

There are so many branches of science like biology, medicine, anthropology, or
ecology, which are invariably related with living organisms and their organisation
such as life processes, and relationships to each other along with their
environment. All this can be categorized under one roof that is Life Sciences. It
is concerned with all fields of science that engage the scientific study of living
organisms, like plants, animals, and human beings. But then, when the study of
behaviour of organisms, such as that practiced in ethology and psychology is
concerned in these disciplines, it is only included when it involves a clearly
biological aspect. There is a very strong relationship between biology and
medicine which is the main attraction of the life sciences, at the same time its
divergence towards technological progress in molecular biology and
19
History and Development of biotechnology has led to rapidly increasing of specialisations and often new
interdisciplinary fields.
How human beings originated have caused lot of curiosity and has been an
attraction for millennia. This aspect forms a core part of physical anthropology.
It occupies a significant issue in many systems of mythological and religious
belief; however the systematic scientific study of human origins is rather recent.
The seventeenth and eighteenth centuries witnessed the advancement in studies
in anatomy. While the scientists began concentrating in organising species into
genera and speculating on evolution; the others focused their attention to man’s
relationship with other animals, especially the primates. This led to the explanation
to many questions which have been endorsed to the progress that life sciences
have made.
Even though anthropology supplies life sciences with their basic fodders, the
stepping stones are laying down the fundamentals of evolution, growth,
development, and behaviour which are part of life sciences and strengthens it
further.
2.2.3 Medical Sciences

Physical anthropology and medical sciences have close proximity and enjoy a
close inter- and trans disciplinary relationship. It is understood that physical
anthropology is incomplete and programmatic with its specific branches being
in close relationship with medical sciences. Physical anthropology significantly
contributes in investigating the nature and extent of various diseases, like whether
a concerned disease is hereditary that is running as a family trait or non-hereditary.
Not only this but also the growth studies relating to their pattern, growth trends,
abnormalities and environmental effects are also assessed by physical
anthropologists in the backdrop of medical sciences. Study of anatomy forms an
integral part of medical sciences and hence can be said to be the scientific study
of the morphology of the human body. Medical science in addition includes
subjects like physiology which is the study of function and biochemistry - the
study of the chemistry of living structures which are complementary basic medical
sciences when applied to the human body. Basically it means that each of the
fairly recognised principles from the fields of anatomy, morphology, growth,
health, biochemistry and physiology are significant specialties in anthropology.
Physical anthropology is concerned with the evaluation of the anatomy of various
races of humans. Under its purview also comes the morphological distinction
with the help of anthropometric dimensions and genomic diversity which are
judged through genetic parameters of anthropology. Medical Sciences with such
wide spread field facilitates a framework in anatomical, biochemistry and
physiological knowledge which helps anthropology intensively and vice versa.
In the following units you will realise that anthropology can be credited to its
own strong theoretical and scientific foundations some of which are by far oriented
in medicine. The aim of anthropology is to demonstrate rationally what being
specifically human is in the most fundamental physiological functions, with
medical science defining the standards. This has led to the origin of a new
discipline-Medical Anthropology which incorporates both physical anthropology
and medical science.
20
2.2.4 Earth Sciences Relationship with Other
Disciplines
Earth science embraces the study of nature of structural pattern of the earth that
throws light on its various land forms, its waters, the air that engulfs it, how the
rocks are formed, the different strata of the earth and their formation and also
includes the geologic, hydrologic, and atmospheric sciences. The perspective of
Earth sciences is to recognise the present features and past evolution of the Earth
and to exploit this knowledge, wherever found appropriate, for the benefit of
humankind, the basic premise on which physical anthropology is based. It gives
us great deal of information about the series of events which occurred in the
distant past and through these evidences the oldest forms of life can be known
that prospered umpteenth number of years ago on earth. This achievement is
possible through the systematic study and analysis of the earth’s crusts and
different strata of earth bearing fossils as evidence, by employing geological
methodology. Not only has it held an invaluable contribution towards the
understanding of human evolution, but as well of various cultural stages of man
especially when the information on time sequence is crucial.
The physical surroundings which are inhabited by humans include the immediate
surface of the solid Earth along with the land beneath it and the water and air
above it. The facts of life were of concern to the early man rather than with
theories, and thus his survival depended on his ability to get metals from the
ground which enabled him in producing alloys, for example, bronze from copper
and tin, for tools and armor. He was also concerned to find adequate water supplies
for creating dwelling sites, and to predict the weather, which had an immense
bearing on human life in earlier times than it has today. These situations
correspond to the fundamentals of the three principal disciplines of the modern
earth sciences. While physical Anthropologists focuses on the evolution of early
man, the earth scientist concentrates on the raw material available to this early
man which either helped or slowed down their evolutionary process. Only when
one is aware of the marvelous complexity of the Earth, it would be easier to
appreciate how the world today is growing with environment around and how
humans are adapting to this changing earth. Each in its own premise, both physical
anthropology and earth science is a comfortable field and together they emphasise
on two important features, yet basic questions as to how did life on Earth begin,
and from what did man evolve remains a mystery.
Earth Sciences area of specialisation involves with the geologic history of the
earth, study of fossils and the fossil record (paleontology), the growing of
sedimentary strata accumulated typically over millions of years (stratigraphy),
and the isotopic chemistry and age dating of rocks (geochronology). These provide
vital input to anthropology.
Similar to physical Anthropology, the applied aspect of earth sciences deals with
practical applications beneficial to society. They engage in the study of fossil
fuels (oil, natural gas and coal); oil reservoirs; mineral deposits; geothermal energy
for electricity and heating; the structure and composition of bedrock for the setting
of bridges, nuclear reactors, roads, dams and skyscrapers and other buildings;
risk involving rock and mud avalanches, volcanic eruptions, earthquakes, and
the collapse of tunnels; and coastal, cliff, and soil erosion. Most of these would
have a direct impact on human beings hence come under global anthropology’s
focus.
21
History and Development of 2.2.5 Human Biology
Physical anthropology as you have rightly understood is the study of the biological
perspectives of man. Undoubtedly its proximity to biological sciences is natural.
Let us see how it works, when we are trying to build up sequence of human
evolution, physical anthropologists’ basic instinct is to compare the biological
features of man and with other animals. Now-a-days human genetics forms the
integral part of physical anthropology. The focus of physical anthropology on
human heredity, factors relating to growth and development has boosted the
field of human biology.
2.2.6 Environmental Sciences

Nature holds no significance without the participation of human, similarly the
science of nature is incomplete if it is studied without human involvement.
Therefore, it becomes imperative for both disciplines namely ecology and
anthropology to take part in the discourse on sustainability of working
environment that has human involvement. Environmental science is predisposed
to focus on the nature front and to realise the human condition while the
anthropological sciences tend to focus on their respective specialties and on
“nature” as concept, and then consider ecological reality into account.
Environmental science and anthropology as disciplines take into account both
the nature and human. They go beyond the dualism of nature-culture to a further
holistic outlook on ecological and cultural realities in their inbuilt connectedness
with humans. Ecoanthropology is dedicated to a large extent by contributing to
the analysis and actions towards such a conversion, by taking both the nature
comprising the local environmental management and culture defined as ways of
living and of making a living to sustain, which are identifiable with environmental
sciences. In view of the fact that it is a discipline that has been exploring both the
sides, eco-anthropology has the merit to widen its horizon towards “futures”.
Anthropology has its applications for future by exploring the conditions adjoining
a civilization’s endurance or disintegration with respect to its environments by
being appreciative of adaptations, weather, biological, behavioural or cultural in
reaction to environment. Environmental sciences point towards the adverse
conditions an environment can pose to its inhabitants and while anthropology, in
all its genuine concern points out the diversity of outstanding characteristics of
life supported by different cultures in different environments. The conservation
and understanding of its significance to human life and its endurance and hence
continued existence are other issues dealt by both disciplines.
2.2.7 Social Sciences

“Social science” is universally used as a flagship embracing number of fields
not in the sphere of the natural sciences whereas Anthropology is the holistic
“science of man,” - a science of the sum of human existence. Anthropology
incorporates different aspects of the social sciences and physical anthropology.
Time and again it has been observed that anthropological social sciences give
meaning even to minutest difference in rather than deriving the general laws as
found in natural sciences. Not only this, it boasts of explaining individual cases
through more general principles, like in many fields of psychology. It is rather
difficult for anthropology just as in history to easily fit into one of these categories;
22
but then different branches of anthropology draw on one or more of these fields Relationship with Other
Disciplines
which concerns human. Essentially, the main objective of anthropology is to
grant a holistic account of humans and human nature which corroborates that
although anthropologists usually specialise in only one sub-field the biological,
linguistic, historic and cultural aspects of any problem are always kept into
consideration.
The quest for holism interested most anthropologists to study people in explicitly,
exploiting the biogenetic, archaeological and societal data. This would also take
into account direct observation of present-day customs which in turn correlates
the close relationship it shares with the social sciences. It is not unjustifiable to
believe that all human cultures as part of one large, developing global culture,
which is a basic contention of social scientists. These dynamic relationships,
between what can be observed on the ground, in contrast to what can be observed
by assembling many local observations still remains essential in anthropology,
be it cultural, biological, linguistic or archaeological.
2.2.8 Human Engineering and Technology

Human engineering and technology applies techniques to living cells to result in
a particular product of superior quality. It is basically taking advantage of the
resources for the benefit of mankind. The techniques of anthropometry are
intensively utilised in the field of “Human engineering” – a term used by the
experimental psychologists and applied engineers working on biomechanical
problems. In anthropological sense, human engineering indicates the efforts to
design and build modern machines which would suit the person working with
these. Human engineering is applied in the jet engines – an important implication.
The jet flies at a very high altitude and at such height, human body has a tendency
to swell up due to reduced atmospheric pressure. Dr. J.P. Henry, a medical
physiologist, invented a one piece ‘jacket’ which had perfect fitting, non-stretch
garment with air tubes connected to it. This facilitated the situation when the air
pressure dropped, air would be introduced in the spaces within the clothing that
assisted in the prevention of muscles from expanding. The unit served the function
but there was major size drawback. The necessity was that each suit fit like skin
from neck to wrists and ankles, but then there was paucity of anthropological
data. Anthropological data came in handy and it was found that stature and weight
were best correlated with other bodily dimensions and could become the model
for complex fitting garments.
2.2.9 Physical Sciences

The life concerns both the organic and inorganic world; Physical science is the
systematic study of the inorganic world. It is different from the study of the
organic world which is the sphere of biological science. Physical science by and
large comprises of four broad areas: astronomy, physics, chemistry and the earth
sciences. Each of these is distinguished and is further in turn divided into fields
and subfields. On the other hand, Physical anthropology is a biological science
that concerns with the adaptations, variability, and evolution of human beings
and their living and fossil relatives that is past and present. Unanimously it has
been agreed upon by both physical and biological scientists that technological
breakthroughs like DNA splicing, spacecraft docking in outer space, and the
development of very small computer chips could not have taken place without
an enormous amount of basic research to unearth the laws of nature in physical
23
History and Development of and biological worlds. Applied and practicing anthropology is explicit in its
concern with making anthropological knowledge useful.
2.3 SUMMARY
What an amazing concept interdisciplinary and transdisciplinary approach is
especially when physical anthropology is concerned. You just read how the
different disciplines join hands and work together for the benefit of mankind
and yet maintain their own identity. Is it not incredible the way anthropology
projects itself. The unit describes the interdisciplinary relation which involves
two or more academic disciplines that are usually considered distinct and also
trans–disciplinary; i.e., the research approach that crosses many disciplinary
boundaries to construct a holistic approach. The following chapter would
enlighten how we apply the knowledge of anthropology in practice.
Suggested Reading
Harrison, G.A., Weiner, J.S., Tanner, J.M. and Barnicot, N.A.1964. Human
Biology, Oxford University Press

V. Indira.
Sarkar, R.M. 2000. Fundamentals of Physical Anthropology, Calcutta, Vidyodaya

Shukla B. R.K. and Rastogi, S. 1999. Physical Anthropology and Human

Genetics- An Introduction Delhi, Palka Prakashan.
Stein, P. L. and Rowe, B.M. 1974. Physical Anthropology, New York, McGraw-
Hill.
Sample Questions
1) What do you understand by interdisciplinary and transdisciplinary approach?
2) Give examples of interdisciplinary and transdisciplinary approaches in
physical anthropology?
3) Explain the relationship of physical anthropology with special reference to
forensic science and medical science?
24
Relationship with Other
UNIT 3 APPLIED DIMENSIONS-I Disciplines
Contents
3.1 Introduction
3.2 Meaning of Applied Physical Anthropology
3.3 Applied Physical Anthropology
3.3.1 Designing Equipment
3.3.2 Forensic Anthropology
3.3.3 Epidemiology
3.3.4 Aging
3.3.5 Sports
3.3.6 Public Health
3.3.7 Nutritional Anthropology
3.4 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
Once you have studied this unit, you will know:
Ø the meaning of applied physical anthropology;
Ø how academic knowledge is applied as applications; and
Ø the application of physical anthropology in designing equipment, forensic
anthropology, epidemiology, aging, sports, public health and nutritional
anthropology.
3.1 INTRODUCTION
In this unit, we will first discuss the meaning of applied physical anthropology
and how it was initiated. Following this, we will read through the anthropological
applications in the fields of designing equipment, forensic anthropology,
epidemiology, aging, sports, public health and nutritional anthropology.
3.2 MEANING OF APPLIED PHYSICAL

ANTHROPOLOGY
Anthropology has achieved the status of being more than just an academic
discipline. The recent years reflect an ever increasing awareness of what
anthropology has discovered and can discover. The basic of applied anthropology
basis lies in making theoretical anthropological knowledge useful. An applied
anthropologist can be qualified in any or all the branches of anthropology. Physical
Anthropologist exploits their expertise to design clothes and equipments to fit
human body and also enjoy significant role in providing forensic support in court.
As the perception of evolutionary biology incorporates both the natural and social
sciences, it has also influenced such applied areas as medicine, psychotherapy,
education and conservation.
25
History and Development of The basic objective of all sciences is to apply the results of scientific knowledge
in betterment of mankind. The applied physical anthropology is not something
new that needs an introduction. The knowledge gained by physical anthropology
has been used for getting practical benefits in diverse fields. But then the
application of physical anthropological knowledge is far behind the mammoth
contributions made by so many people in this field.
Applied anthropology in the United States came into picture when the
anthropologists’ worked on disadvantaged people in other cultures and realised
the need for their improvement. In fact, today anthropologists are involved in
understanding and finding solution to the problems in their own society in an
endeavor to improve people’s lives. Currently, there is demand for applied
anthropologists to progressively increase their participation in earlier stages of
planning process and in helping in ventures by solving wide range of issues.
With the passage of time, our knowledge in the subject has seen phenomenal
increase, and this knowledge has culminated in designing many products for
applying it for the benefit and welfare of human use such as airplanes and
automobiles.
Physical anthropologists have been active in practical applications of their research

for several years. Rudolf Virchow, one of the most prominent 19th century German
anthropologists regarded as pioneer of social medicine, founded the public health
service in Berlin. French anthropologist, Paul Broca’s input to medical treatment
of brain disorders is unparallel. Then with the advent of twentieth century, endless
applications of physical anthropological research can be boasted of which vary
from designing the dimensions of fighter plane cockpits to assisting apprehending
criminals to urban planning. Applied physical anthropology is holistic in approach
involving evolutionary, cross-cultural, and comparative and population
dimensions.
As you all know, anthropology is a population based biological science and is

not restricted to an individual. Whatever results are derived, they are based on
statistics and its statements are probabilistic as it involves population which is
just too diverse. This aspect of anthropological research is of immense importance
for physicians or other health professionals to remember while dealing with
anthropological data.
Physical anthropology also concerns evolutionary perspectives and the applied

aspect of it can facilitate people to bring their living environment into closer
similarity with their biological adaptation as human beings. This has foundation
in natural selection proceeding through millions of years of evolution; an ideal
fit between human adaptive capabilities and the environment as these have also
co-evolved. In the following block, we will learn that natural selection plays
significant role in the process of evolution. This evolutionary perspective signifies
that human beings are the product of a long process of change that has perfected
a certain way of solving problems and getting work done.
The demand for applied physical anthropologists is enormously increasing in

government agencies, international development agencies, private consulting
firms, business, public health organisations, medical schools, law offices, crime
investigations, sports, nutrition and designing equipments.
26
Applied Dimensions-I
3.3 APPLIED PHYSICAL ANTHROPOLOGY
The thrust of applied physical anthropology aims to construct an explanatory
framework for the many physical and behavioural traits of human species within
evolutionary and environmental contexts and to seek ways to maximize their
function. Here are some examples illustrating the aforementioned.
3.3.1 Designing Equipment

It is not very easy to design any product or equipment especially when magnitude
to the extent of diverse human variation is involved. This warrants the
participation of the users, anthropologists and the manufacturers in unison with
anthropologists playing very crucial role. This all the more gains importance,
particularly when the efficiency of equipment is dependent on human variability.
Designs that do not take into account human variations result in poor job
performance and waste of time. Earlier equipment was designed without taking
into account the physical characteristic of the users. Anthropometry concerned
with the measurement of human body plays an enviable role in designing
equipment as they provide information on the range and variation in body shapes.
This holds significance because it affects the utility of equipment, clothing or
work space, significantly in designing automobile seating or aeroplane cockpit
where reach or field vision is a critical factor.
One of the most momentous applications of anthropometry is designing of defense

equipment which dates back to World War II with the contribution of physical
anthropologists as the experts of human anatomy. There has been no looking
back after that as anthropometric research has played pertinent role in engineering
designing of many technologies right from Jet-fighter ejection seats to analysing
human posture in zero gravity on Skylab experiences. Anthropometric data with
due credit to its accuracy and reliability has been intelligently applied by
anthropologists for Air Force by improving the flying efficiency of the pilots
thus saving much money on procurement of large number of pilots.
Anthropometric techniques have witnessed its wide usage in defence for better
results. For example, a gun turret is designed using scientific principle that any
extrusion from an aircraft adds air resistance in such a manner that the gunner
has all the free movement of his body needed. This not only reduces their
discomfort of long occupancy in a cramped enclosure but also increased efficiency
of crewmen, and ensured effective means of escape from an aircraft in emergency.
A landmark contribution is reflected in improvising the cock-pit size in different
types of air craft and designing of various seat configurations for both fighters
and bombers which assisted in reducing cockpit fatigue and discomfort by proper
body support.
Another noteworthy application is in flight clothing. Anthropologists have

contributed in providing sculptor-carved wooden head forms in four statistically
derived sizes: extra-large, large, medium and small to the helmet manufacturers
as standards to provide correct size-control. Great deal of physical anthropologist’s
concern also lies in designing of oxygen masks using set of seven statistical
sizes and shapes of sculptured face forms for correct fit. These are not restricted
to males but body sizes of females are also taken to procure flight clothing and
other garments for service women. The ejection seat and car passenger safety
modifications have helped crew accommodation in the space capsules as well as
27
History and Development of cockpits and seats of advance fighter aircrafts and automobiles thereby reducing
the severity of damage during accidents. Talking of jet engines at high altitudes
where the jet flies human body, has the tendency to swell up due to reduced
atmospheric pressure. Now in such a scenario, clothing for high altitudes has to
be designed in a manner that would prevent muscles from expanding. Using the
anthropological technique, it was construed that stature and weight generally
yield the highest correlations with other body dimensions and were projected to
be diagnostic dimensions for complex fitting garments.
In fact after 1942, anthropometric applications were exploited by other fields of

human activities to improve work efficiency by reducing discomfort of people.
The design requirements include work space design, clothing and personal
equipment design. Workplace design includes designing of any space for human
occupancy during work, recreation, rest, education, travel, treatment, etc. The
intention behind such designing aims to ensure that there is enough operational
work space and proper location of controls, displays and devices for the
convenience and efficiency of the operator. Designing of automobile interiors,
aircraft cockpit, seating apparatus, doors, tunnels, furniture and kitchen are some
of the examples where workplace designing is needed for better results. The
measurements required in designing workplace include reach limits, body
clearance, eye location, etc. The body measurements that are considered for
designing clothing and personal equipment are the circumferences, body contours,
limb movements etc. Clothing and personal equipment design includes designing
of garments, sportswear, press suits, helmets and gloves, knobs, handles, switches,
etc., basically to ensure proper fitting and comfortable movement.
3.3.2 Forensic Anthropology

Forensic anthropology is a specialised branch of physical anthropology that is
devoted in solving crimes, attracting increasing attention by the public and an
increasing number of practitioners. The term Forensic is a Latin word ‘Forensis’
which means court of law. The term Forensic Anthropology entails the application
of anthropological and medical knowledge to queries of law. This science is
used in detection of crime. Forensic anthropology is the largest and very popular
applied sub discipline of physical anthropology.
The scope of forensic anthropology as an applied discipline in physical

anthropology was recognised by C C Show in 1972. By virtue of the fact that
Physical anthropologists study osteology, they would be able to contribute
considerably in the field of crime. There are two aspects of Forensic Anthropology
which hold importance; they are the identification of decomposed or mutilated
bodies and the analysis of skeletal and fragmentary remains. Any evidence left at
the site even in an unimportant proportion, finger prints, skeletal remains, teeth,
saliva, blood or scratches of skin tissues significantly helps the forensic
anthropologists to identify the persons involved. Genetics plays a very vital role
for Forensic anthropologists in identifying the victim as well as the culprit.
Anthropologists are well versed in racial variations, estimation of stature from
broken bones and assessment of understanding postmortem skeletal alterations.
These features facilitate the crime investigators in positive identification. The
accomplishment by forensic anthropologist can be attributed to new developments
in its methodological techniques. Due to this, there is an increasing trend of
associating anthropologists in evidence discovery and recovery.
28
3.3.3 Epidemiology Applied Dimensions-I
We all know that health and longevity of every individual to a great deal depends
on heredity and environment. Diseases reveal the array of triggering factors right
from inheritance of genes to the environment of surroundings they live in, which
means that disease can occur due to trait running in the family or the environment
a person lives in. The last two decades have seen momentum in the contributions
that anthropology may be useful to epidemiological study of health and disease.
This can be attributed to rise in chronic, non-infectious diseases as important
causes of morbidity and mortality during the 20th century. Chronic (long lasting),
non-infectious diseases (disease that may be caused by the environment) are
influenced by a number of lifestyle variables. These variables are by themselves
strongly influenced by social and cultural factors. The past decade witnessed
anthropologists and epidemiologists moving together beyond the “harmless
neglect” that characterised their prior relationship. Some of the most important
collaborations between epidemiology and anthropology concerns impact of
culture change and stress, social stratification and spread of various health risks
which have increased immensely. Anthropologists have disapproved and have
expanded epidemiological notions of risk and vulnerability. Now involving
multidisciplinary approaches, anthropologists and epidemiologists have invented
measures to increase the validity and reliability of their results. The working
together of anthropologists and epidemiologists due to their specialised field
area, ensures more nuanced and accurate descriptions of human behaviour and
more appropriate and effective interventions. The involvement of epidemiological
techniques is exploited for anthropological ends, because disease often spreads
along the framework of social structure.
3.3.4 Aging
The field of gerontology is amazingly diverse, warranting massive number of
investigations of physical anthropological issues in aging research. It has been
experienced that a good number of gerontology topics of actual and/or potential
interest are significantly important to physical anthropologists. It has been
observed that the physiological changes of aging include a varied mixture of
physical decline as would be expected from an evolutionary model. It has been
seen that the studies of the prehistoric aging accounts for the estimation of lifespan,
which in no way reflects rate of aging. Recent years have witnessed substantial
work relating to body composition and aging. These results give an evidence
towards the loss of lean tissue with age and relatively constant, though
redistribution of fat mass. Though osteoporosis is one of the major concerns in
females due to aging, tooth loss in both sexes is also witnessed. Biological age is
found to be associated with lifestyle, economic and nutritional status. These
factors can be of significance in divulging cause for variation in rates of aging
which in turn would be of vital importance. To answer these and many more
potential queries physical anthropologists is the best bet.
3.3.5 Sports
Sports, as history shows, has developed to be part of human culture as recreational
activity. We cannot deny the role of cultural aspect in sports, but the biological
aspect of human is considerably responsible for the performance in any sporting
event. The factors like body size, body proportions, physique and nutrition
influence the performance in any sporting event. Most of these traits are acquired
29
History and Development of through heredity but they are also influenced by environment to a substantial
extent. Human psychological factors like motivation, training and nature also
play a vital role in moulding the sportive personality to a large extent. It becomes
quite obvious that human biological, cultural and psychological aspects are must
to understand the environment of sports, thus laying the foundation for
anthropological role in the field of sports.
The study of sports is a specialised sub-discipline in physical anthropology

christened as Kinanthropometry. This specialisation of physical anthropology
assesses the physical structure of individual in relation to gross motor functions
or functioning capacity, taking into account maturation, nutrition and body
composition. The term Kinanthropometry was coined by Bill Ross in 1972. It
was first considered in Olympic Scientific Congress at Quebec in 1976 prior to
Montreal Olympic Games in 1978. UNESCO has been instrumental behind most
initiatives for development of Kinanthropometry when it founded an International
Working Group on Kinanthropometry at Brasilla, working under the International
Council of Sports Science and Physical Education.
There are number of factors that are responsible for the performance of an
individual in sports. These factors in turn are dependent on both genetic
constitution and environment. However, it is undisputable that genetics has a
greater role to play in the formation of a phenotype (observable characters arising
out of interaction between gene and environment in an individual). Phenotypic
variations in size, physique, body composition, metabolic powers, strength, speed
and skill, cardio-vascular adaptations are prevailing forces responsible behind a
sportsman’s feat. Environment to some extent can shape a genotype by way of
training and motivation. The goal of Kinanthropometry focuses on selecting the
fit genotypes which help individuals attain their fullest potentialities, that means
selecting those individuals who possess genetic constitution which is ideal for a
particular sport. It is not just muscular strength that is required for coordinating
body movements. But the responsibility of physical anthropologist lies in selecting
the players who have better potentialities in a particular sport than others; for
training and other external influence can change one’s morphological status only
within the narrow limits set by genotype. Physical anthropologist can also curtail
the financial implications by minimizing the expenditure on individuals who
because of their unfavorable anthropometric standards are less fit for a particular
sport. Physical anthropologist would exercise his discretion to choose an
individual ideal for sporting event. It is rather impossible to alter the capacity of
the genotype in order to maintain desirable levels of different bio-chemical
determinants. Thus, it is imperative to lay more emphasis on the genetically
determined morpho-physiological status of the individual to yield good results.
We realise that the techniques of Kinanthropometry enabled the anthropologists
to classify humans into different somatotype and suggest the right sport for them.
The composition of body plays important morphological characteristics essential
for sports. Body composition inclusive of muscular, skeletal, fatty tissues are
dependent on the environmental influence, sex, socio-economic conditions,
occupations, genetic make-up, nutrition and exercise.
Studies on body composition of sportsman hold significance. It has been deduced

that athletes with less fat but heavy muscles perform better in certain competitive
sports, while those with substantial amount of fat tissues require increased energy
due to inert weight, result in endurance in activities like jumping, running, etc.
30
Moderate quantity of fat aids performance by providing extra buoyancy and Applied Dimensions-I
reduction of heat loss in water sports. Apart from physique and body composition,
somatotype also plays decisive factor for different sports. This in turn is dependent
on flexibility of training, motivation factors and psyche. Physical anthropologist
plays a constructive role in designing sports equipment using anthropometric
techniques suitable for a particular somatotype.
3.3.6 Public Health

Public health refers to the population or community rather than an individual as
its focus. This is a rapidly growing field of research and practice within
anthropology. Physical anthropology has followed systematic approach to public
health by applying the scientific knowledge at a community level in such a way
to be an effective practice. Ecology which involves an interaction of population
and environment has also an important role to play since it forms bond between
biomedicine with biological and cultural anthropology. This provides a significant
path of perception to health and disease as dynamic, adaptive, population-based
processes. Public health practice unambiguously seeks to contribute to the creation
of global health systems that serve the people. The application of anthropological
methods to public health problems has been major area of contribution for health
and disease amelioration. The wide range of variation in populations can be
used to improve the development and measurement of epidemiologic variables.
3.3.7 Nutritional Anthropology

This field is continuously contributing to the field of nutritional sciences especially
in defining the nutritional status of persons by making use of the techniques of
anthropometry. This area of defining the nutritional status is quite satisfactory as
earlier the methods were highly technical and were looking for an internal
agreement for their practical use. The application of anthropology and the
underlying conjecture for use of anthropometry in nutritional assessment of
population is unquestionable. Undeniably it forms the basis to the fact that
although heredity contributes to growth, the genotype is competent enough of its
different growth potential in different environment. Thus the induction by
introducing the specialised sub-discipline within applied physical anthropology
called Nutritional Anthropology. Nutritional anthropometry employs three basic
measurements age, weight and height. These three basic values hold importance
for physical anthropologists since they compute the indices and compare these
indices with reference to population or persons. There are basic indices which
exhibit geographical variation, to assess the nutritional status. Nutritional
anthropologists have provided indicators in terms of cut-off points to assess
nutritional status along with the range for different categories. In recent years,
international consensus has been achieved to a large extent for defining the
nutritional status of an individual with the help of anthropometry. The contribution
of heredity in the growth and development cannot be overlooked, yet it is
undisputable that the same genotype is responsible for different growth
potentialities in different environments. This is the foundation for using
anthropometry in nutritional assessment of populations. The health status of any
population all over the world can be evaluated and appropriate health plans can
then be enforced.
31
History and Development of
Physical Anthropology 3.4 SUMMARY
This unit must have made an impression that academic knowledge can be best
utilised if we are able to use it practically. The different applied aspects of physical
anthropology, right from measurements to suit the equipment and furniture
designing, clothes, choice in sports, health status and in the health field, reflect
its wide spectrum. It is astoundingly fascinating to bring into practice the
knowledge of physical anthropology with other disciplines. This corroboration
has done wonders for the benefit of mankind. The unit to follow would take you
through the journey of physical anthropology along with genetics and am sure
you will realise the wonders of applied physical anthropology in understanding
mankind.
Suggested Reading
Harrison, G.A., Weiner, J.S, Tanner J.M. and Barnicot, N.A.1964. Human Biology,
1964, Oxford University Press

V. Indira.
Sarkar, R.M. 2000. Fundamentals of Physical Anthropology, Calcutta, Vidyodaya

Shukla B. R.K. and Rastogi, S. 1999. Physical Anthropology and Human

Genetics- An Introduction Delhi, Palka Prakashan.
Stein, P. L., and Rowe, B.M. 1974. Physical Anthropology, New York, McGraw-
Hill.
Sample Questions
1) What do you understand by the concept of applied physical/biological
anthropology?
2) Illustrate the application of physical anthropology in designing equipment,
sports and forensic anthropology.
3) Epidemiology, nutrition, aging and public health have applied component
of physical anthropology. How?
32
Applied Dimensions-I
UNIT 4 APPLIED DIMENSIONS-II
Contents
4.1 Introduction
4.2 Paternity Diagnosis
4.3 Genetic Counseling
4.4 Eugenics
4.5 DNA Technology and Its Use in Disease and Medicine
4.6 Summary
References
Suggested Reading
Sample Questions
Learning Objectives
&
It is expected that after reading, you would be able to understand the following
applications of Human Genetics:
Ø paternity diagnosis;
Ø genetic counseling and eugenics; and
Ø DNA technology and its use in disease and medicine
4.1 INTRODUCTION
Genetics is the name given to the study of heredity, the process by which
characteristics are passed from parents to offspring, so that all organisms including
human beings resemble their ancestors. The central concept of genetics is that
heredity is controlled by a vast number of factors called genes, which are discrete
physical particles present in all living organisms.
Branches of genetics are microbial genetics, mycogenetics, plant genetics,

animal genetics, human genetics, population genetics, cytogenetics,
biochemical genetics, molecular genetics, clinical genetics etc.
Since the present unit is on human genetics, the definition of human genetics is
presented here. Human genetics is concerned with genetically determined
resemblances and differences among human beings. In normal human being,
the nucleus of each cell contains 46 chromosomes, which comprises 23 pairs. Of
each of these chromosome pair, one chromosome is from father and one
chromosome is from mother i.e., only one member of each pair is handed on
through the reproductive cell (egg or sperm) to each child. Thus, each egg or
sperm has 23 chromosomes (McGraw-Hill Science & Technology Encyclopedia,
2005). Twenty two of the 23 chromosome pairs, i.e., the autosomes, are alike in
both the sexes, the other pair comprises of the sex chromosomes. A female has a
pair of XX and a male has XY chromosomes. Further, Human Genetics has
several applications, like Paternity diagnosis, genetic counseling and eugenics,
DNA technology and its use in disease and medicine are discussed below.
33
History and Development of
Physical Anthropology 4.2 PATERNITY DIAGNOSIS
Paternity Diagnosis helps to establish genetic proof whether a man is the biological
father of an individual or not. This paternity test is carried out by using DNA
analysis. The DNA analysis through DNA fingerprinting offers a more reliable
way to determine the genetic parent. Before DNA fingerprinting came into
existence, blood group polymorphisms like ABO, MN and Rh systems were
most widely used. But using these blood group polymorphisms, a particular
person can be excluded as the parent of a child. The exclusion of parentage can
be determined with certainty.
But to determine parentage, DNA analysis is the most advanced and accurate
technology. This paternity test compares a child’s DNA pattern with that of the
alleged father to check for evidence of this inheritance. The DNA fingerprinting
technique assures the probability of parents to more than 99.9% if the alleged
father is biologically related and the probability is 0% when the alleged father is
not biologically related to the child.
Now let us briefly familiarise ourselves with the structure of DNA.

DNA: DNA (Deoxyribonucleic acid) is a chemical structure that forms
chromosomes. A piece of a chromosome that dictates a particular trait is called a
gene. The structure of the DNA molecule was proposed by James Watson and
Francis Crick in 1953. DNA is a polymer (a large molecule containing repeated
units) composed of a sugar, phosphoric acid and four nitrogen bases. Two of
these nitrogen bases are purines, the other two are pyramidines. The purines
bases are adenine (A) and guanine (G) and the pyramidine bases are thymine (T)
and cytosine (C). The two strands of DNA are connected at each base. Each base
will only bond with one other base, as follows: Adenine (A) will only bond with
thymine (T), and guanine (G) will only bond with cytosine (C). The structure of
DNA is presented below in Fig.4.1.
Fig.4.1: DNA Structure
Source: www.protist.biology.washington.edu
34
DNA Finger Printing: This is also known as DNA typing or Genetic Applied Dimentions-II
Fingerprinting.
After knowing the DNA structure, we now briefly familiarise ourselves with the
procedure adopted in DNA finger printing:
DNA samples can be extracted from blood, semen, hair roots, bone or saliva.
The extracted DNA is then treated with restriction enzymes, which cuts the DNA
into smaller fragments by cutting at specific sites. This DNA is then amplified
by the technique of Polymerase chain reaction (PCR). By using alkaline chemicals
this double stranded DNA splits into single stranded DNA. The DNA fragments
are then subjected to agarose gel electrophoresis. The DNA bands so formed are
transferred to nylon membrane. This is treated with a radioactively-labelled DNA
probe which binds to complemental DNA sequences on the membrane. The excess
DNA probe is then washed off. The radioactive DNA pattern is transferred to
X-ray film by direct exposure. When developed, the resultant pattern is the DNA
finger print.
4.3 GENETIC COUNSELING

Genetic Counseling, as defined by Harper (1984), is “the process by which patients
or relatives at risk of a disorder (that may be hereditary) are advised of the
consequences of the disorder, the probability of developing and or transmitting
it, and the ways in which this may be prevented or ameliorated”. However, the
American Society of Human genetics (1975) formulated the definition as “Genetic
counseling is a communication process which deals with the human problems
associated with the risk of occurrence of a genetic disorder in a family”. This
process involves an attempt by one or more appropriately trained persons to help
the individual or family to: (i) comprehend the medical facts including the
diagnosis, probable course of the disorder, and the available management; (ii)
appreciate the way hereditary contributes to the disorder and the risk of recurrence
in specified relatives; (iii) understand the alternatives for dealing with the risk of
recurrence; (iv) choose a course of action which seems to them appropriate in
their view of their risk, their family goals, and their ethical and religious standards
and act in accordance with that decision; and (v) to make the best possible
adjustment to the disorder in an affected family member and/or to the risk of
recurrence of that disorder (Fraser, 1974).
Now let us see how Genetic Counseling is done:

Firstly, it is necessary to identify people suffering from a genetic disease; and
this is relatively easy for a trained clinician. But, it is difficult to identify a carrier
for genetic disease and in most cases, it is not possible. However, information on
the likelihood of an individual being a carrier for a genetic disease can be obtained
by the analysis of family pedigree. Thereafter, the prospective parents (either
suffering from or suspected to be heterozygous for some genetic disease) are
advised about the risk of their would-be children suffering from the same disease.
By creating a suitable social environment, such parent may be encouraged to
voluntarily abstain from producing children.
Genetic screening
Genetic counseling is essentially a communications process that informs
prospective parents about the nature of genetic disorders, about the risk of their
35
History and Development of having a genetically defective child, and about the options available to them in
dealing with that risk. Or else they can opt to cope with the care of an existing
genetically handicapped child. Genetic screening, in contrast, is a routine
diagnostic procedure devised to detect those who are carriers of, or who are
themselves affected by a hereditary disease. Genetic screening applies to
populations rather than to individuals.
The most-widespread application of genetic screening in the United States is for

phenylketonuria (PKU). All hospitals in the United States screen newborn babies
for PKU by a blood test called Guthrie test.
After genetic screening, if both the parents are heterozygous for a genetic disease
and the genotypes of both the prospective parents become known, then it is
easier to work out the probability of their child (if they decide to have one)
inheriting the disease. This can be done through amniocentesis about two months
after conception; i.e., in amniocentesis; the cultured fetal cells are used for
determining their karyotype, levels of the critical enzymes and the restriction
patterns of DNA. Such an antenatal diagnosis is now available for several genetic
diseases and for a variety of chromosomal defects. Such a diagnosis can help
the parents to opt for premature termination of abnormal fetus, if they so decide.
Genetic counseling and antenatal diagnosis provides definite relief to the possible
parents ‘at risk’ and thereby reduce the frequency of genetically defective
individuals in the population. However, it is unlikely that these measures would
eliminate the deleterious alleles from a population. This is so because most genetic
defects are recessive and heterozygotes for such alleles. Thus, even after a total
ban on reproduction by the homozygotes for such recessive alleles, they would
remain in the population through the heterozygotes, therefore, even such an
extreme selection would lead to only a slow decline in their frequency. Further,
it is not likely that all the couples in any society will willingly submit themselves,
at least in the foreseeable future, to these procedures. But genetic counseling has
become a routine aspect of medical practice in most developed countries.
It has been advocated that defective genes may be corrected through sophisticated
genetic techniques either during the early stages of embryo development (embryo
therapy) or in specific tissues of the adult patient (patient therapy); such an
approach is referred to as genetic surgery. Embryo therapy involves
• In vitro fertilization of egg
• Production of several copies of the normal allele of the defective gene
• Introduction of this DNA into the zygote or in the cells of the developing
embryo and
• Integration of DNA, preferably in place of the defective allele, so that it may
function normally.
The aim of patient therapy is to introduce the normal gene into the critical tissue
of the patient that is affected by a genetic disease, i.e., the tissue where the
concerned gene is required to express itself the most, e.g., pancreas in the case of
diabetes. The steps involved in patient therapy are similar to those in embryo
therapy. But in this case, cells from the concerned tissues have to be treated in
vitro to correct their genetic defects and then reintroduced into the tissue where
they may function normally. Techniques for isolation, identification and
36
multiplication of many human genes are now available, and for many others Applied Dimentions-II
they are likely to be developed soon. The techniques for gene transfer in eukaryotes
are being refined and it may not be a great problem in the near future.
A suggestion has also been made to use highly specific chemical mutagens that
will correct the defect in the concerned gene. Such a directed mutagenesis,
however, is a dream that may be more difficult to fulfill for the patient and embryo
therapies through DNA mediated genetic modifications. Genetic screening and
counseling may also lead to certain problems. The cases of mistaken paternity,
the problem of confidentiality, delayed counseling are important among them.
4.4 EUGENICS
The term Eugenics was introduced by Francis Galton in 1883. It refers to the
improvement of a population by selection of only its ‘best’ specimens for breeding.
This has been practiced both by plant and animal breeders since ancient times.
The idea of eugenics was to improve society by screening out and sterilizing
people diagnosed as genetically unfit. Those with desirable genes would be given
incentives to reproduce. Regardless of the reasons in support of sterilization,
restricting an individual’s ability to reproduce is viewed as a violation of their
constitutional rights. The science of eugenics can also be defined as a science of
the well born, improving the inborn qualities of race and obtaining the better
heritage of judicious breeding.
Eugenics is of two types, positive and negative:

Positive Eugenics: By encouraging desirable individuals to bear more children
and also to produce genetically enhanced children i.e., give them genetic
characteristics (genotypes) they ordinarily would not be born with
(www.bioethicsanddisability.org). The positive eugenics can be increased by
adopting the following measures:
a) Encouraging early marriages: It is a general observation that highly placed

persons of the society and those who have high ambitions of the future life
devote best part of their youth to achieve ambitious goals. Hence, they get
married at a late age. Both, biological and psychological investigations
have revealed that the aged persons often lack expressive warmth for the
sexual behaviour and their germplasm also lose its strength. Hence, the
young persons having the best hereditary traits should be encouraged for
early marriages. For this, a few laws should be formulated to avoid the
delayed marriages.
b) To fund the fit: Most of the well gifted persons in a society would like to
lead a well planned and relaxed life. In order to lead a comfortable life and
to avoid unnecessary difficulties in nurturing the children, they wish to have
small number of children. Thus, the selected young men and women who
have best eugenic value should be encouraged to have more children.
H.J.Muller (1890–1967) has suggested that the persons who have best
eugenic value should increase their family size. The persons who have best
eugenic value besides increasing their family size can otherwise act as father
to many more children, and this is possible through artificial insemination.
The sperms and eggs of stupendous people should be stored for potential
use. 37
History and Development of c) Fitness and Education: In a society, the people should be educated about the
basic ideology of wellbeing, ecology, human genetics, eugenics and sex.
Hence, the children should be properly instructed about basic laws of health
and they should be confident to develop a healthy, physically and mentally
sound body. The children ignorant about the details of sex may do further
harm to the society than others. Therefore, there is a need to have sex
education to avoid unwanted behaviour which is not desirable for our country.
d) Wastage of germplasm: By following measures, one can avoid the wastage

of best type of germplasm:
i) We should select the marriage partners wisely,
ii) The nuns and priests, because of religious commitment do not marry.
This should be avoided. By allowing these persons to marry, the wastage
of the best part of germplasm can be prevented.
e) Genetic counselling: Human being is benefited a lot through genetic
counselling. The nature of mutant condition must be informed to the
concerned persons. This is the duty of the genetic counselor to enlighten the
affected persons. After knowing the problem, the probability of producing
affected offspring can be calculated provided it is inherited in a Mendelian
fashion. The ultimate judgment of taking a risk is exclusively the
accountability of the person concerned.
f) Ecological surroundings and their improvement: To improve eugenically

better persons, heredity and environment have played the most important
role. Therefore, every individual in society should get better food, good
existing circumstances, proper education and health assistance etc., so that
his or her genetic behaviour may have the best improvement. This will help
in producing fertile offspring.
g) Encouraging of genetic research: The existing knowledge on genetic diseases

is not enough as we still have minute information on different human
diseases. Hence, further research in the field of cytogenetics should be
increased so that we can learn more and more about the man. Therefore,
genetic research must be encouraged.
Negative Eugenics: Faulty germplasm from the people can be eliminated with
the help of following measures:
i) Sexual disconnection: Colour blindness, night blindness, hemophilia, etc.
are some of the sex-linked diseases possessed by the defective persons and
these may be regulated by dominant or recessive genes. The defective traits
in the population can be checked by sexual disconnection and keeping them
away and separated from the public.
ii) Sterilization of the defective: Persons who have defective traits may be
advised to go for sterilization. Through sterilization, without disturbing any
of his usual functions, we can withdraw a person from his power of
reproduction.
iii) Immigration and its control: The unwanted or faulty genes of different races
and nationalities may intermingle with the normal germplasm of the people
38
during immigration. The persons with unwanted hereditary traits must not
be permitted to migrate from one place to another. Some laws should be Applied Dimentions-II
formulated to control the immigration of those persons who have defective
genetic traits.
iv) Marriage regulation: The affluent or well placed persons (who, still, may
have numerous faulty genetic characters), are more favored for marriages
than those who have eugenically sound hereditary traits but have no money.
Because of not having money the eugenically sound persons agree for
marriage with the genetically defective people. These people fail to reach
the uppermost status in the society due to lack of opportunities.
4.5 DNA TECHNOLOGY AND ITS USE IN

DISEASE AND MEDICINE
Recombinant DNA (rDNA) technology, also known as genetic engineering,
involves artificial modification of the genetic constitution of a living cell by
introduction of foreign DNA through experimental technique. The DNA
technology has made a significant contribution in the prevention, diagnosis and
treatment of diseases. A few of the applications of recombinant DNA are discussed
below:
i) DNA Probes: DNA probes are short segments of DNA that distinguish
corresponding sequences in DNA and hence permit recognition of specific
DNA sequences. This technique is mainly helpful in diagnosis. DNA probes
can hybridize with specific DNA sequences and permit the recognition of
specific parasites. Probes resultant by recombinant DNA methods are
extensively used in prenatal detection of disease: for example, in detecting
genetic disorders like cystic fibrosis, Huntington disease, sickle-cell anemia
etc. In a few cases, probes resultant from the gene itself is used and, in extra
cases, restriction fragment length polymorphisms genetically associated to
the disease gene are engaged. If the disease gene itself, or a region close to
it in the chromosome, differs from the normal chromosome in the positions
of one or more cleavage sites for restriction enzymes, then these differences
can be detected with southern blot i.e. with the use of cloned DNA from the
region as the probe. The genotype of the fetus can, therefore, be determined
since the restriction fragments present in its DNA. These techniques are
very responsive and can be carried out as soon as tissue from the fetus-or
still from the placenta – can be obtained. DNA probes have been developed
for Leishmania, Trypnosoma, plasmodium, Schistosoma, Wuchereria and
some additional human parasites. DNA probes can also be used to recognise
viruses which were previously hard to culture.
ii) Gene Therapy: The hereditary disease in particular can be treated with Gene
therapy. Gene Therapy is the insertion of genes into an individual’s cells to
treat a disease. Gene therapy normally aims to supplement a faulty mutant
allele with a functional one. In the majority gene therapy studies, a normal
gene is inserted into the genome to supplement an abnormal disease causing
gene. A carrier, called a vector, must be used to deliver the therapeutic gene
to the patient’s target cells. Presently, the most widespread vector is a virus
that has been genetically changed to carry normal human DNA. The vector
unloads its genetic material containing the therapeutic human gene into the
39
History and Development of target cell. The creation of an efficient protein product from the therapeutic
gene restores the target cell to a normal state.
iii) Production of hormones and Proteins: Using DNA technique, the genes
responsible for the production of hormones and proteins can be introduced
into bacteria by vectors. These genetically changed bacteria produce greater
amounts of these substances. The hormones like insulin, human growth
hormones, somatostatin, erythropoietin etc. are being produced using this
DNA technique. The most important application of genetic engineering is
the production of large quantities of particular proteins that are otherwise
hard to acquire. Urokinase, are industrially produced today using this DNA
technique.
iv) Production of vaccines: The conventional vaccines are inactivated germs or

their antigens. There is always a danger of contamination to use such kind
of vaccines. However the synthetic vaccines are produced by separation of
pure antigens using mono-clonal antibodies. These are specific antibodies
produced by Lymphocytes when they hybridize with the concerned cell.
The resulting hybridoma (of Lymphocyte and the cell) can produce antibodies
constantly. In diagnosis, therapy and also in prevention such antibodies can
be used. Synthetic vaccines can also be produced by transferring genes for
certain antigens into bacteria. Bacteria produce antibodies in large quantities
which can be used as vaccines. The vaccine for Hepatitis virus is
manufactured in this manner.
v) Diagnosis of Infectious Diseases: Several diseases are diagnosed by

conducting definite tests. The diseases like TB and cancer are being
diagnosed using Recombinant DNA technology. The other diseases like
measles, small pox and hepatitis can also be diagnosed through these tests.
In the diagnosis process, certain pathogens are isolated and identified, and
then diagnostic kits are produced (when the genome of the specific pathogen
is known to kill it or block its pathogenic activity).
This DNA technique is also used in the diagnosis of AIDS diagnosis, prenatal
diagnosis, understanding the molecular basis of diseases like sickle cell anaemia,
thalassemia, familial hypercholesterolemia and cystic fibrosis.
4.6 SUMMARY
Genetics is primarily concerned with the understanding of biological properties
that are transmitted from parents to offspring. Human genetics is the study of the
inherited characters of human beings. The applications of human genetics are
many; for instance, paternity diagnosis, genetic counseling, eugenics, DNA
technology in disease and medicine. DNA profiling popularly known as DNA
fingerprinting is used to establish paternity and distant relationship by tracing
their ancestors. Genetic counseling is a process that seeks to assist affected
individuals and other individuals at risk of getting an inherited condition; it also
helps to understand the nature of the genetic disorder, its transmission and the
options available for their management and family planning. Eugenics deals with
the application of the laws of genetics for the improvement of human race. The
recombinant DNA technology has revolutionized modern biology. It is used in
the efficient production of useful proteins, derivation of DNA probes for diagnosis
40
and in the production of vaccines. Gene therapy is another important application Applied Dimentions-II
of human genetics, which is useful in introduction of functional genes in
individuals suffering from non-functioning of some of their genes. Some
infectious diseases, AIDS diagnosis, prenatal diagnosis, molecular basis of
diseases, like sickle cell anaemia, thalassemia, familial hypercholesterolemia
and cystic fibrosis are also diagnosed through this DNA technique.
References
Fraser, F.C. 1974. Excerpts from “Genetic Counseling”. The American Journal
of Human Genetics 636-659.
McGraw-Hill Science & Technology Encyclopedia Hman Genetics. 2005.

Accessed on April 26, 2011.
www.bioethicsanddisability.org accessed on April 18, 2011.
Suggested Reading
Cederbaum, S.D. 1984. Recombinant DNA in Medicine. West J Med. 141:210-
222
Griffiths, A.J.F., Miller, J.H., Suzuki, D.T., Lewontin, R.C. and Gelbart, W.M.
1993. An Introduction to Genetic Analysis. USA W.H. Freeman and Company.
Gupta, V., Singh, J., Bala, R. and Magazine, R. 2003. Recombinat DNA Therapy
in Medicine. JK practitioner. 10:315-318.
Hartl, D.L. Basic Genetics. 1991. Boston, USA Jones and Bartlett Publishers.
Mueller, R.F, Young, I.D. Emery’s.1995. Elements of Medical Genetics. New

York and London. Churchill Livingstone.
Thompson, J.S. and Thompson, M.W. 2005. Genetics in Medicine. Philadelphia

and London. WB Saunders Company.
Verma, P.S. and Agarwal, V.K. 1999. Cell Biology, Genetics, Molecular Biology,
Evolution and Ecology. New Delhi. S. Chand company Ltd.
Uhlmann, W.R, Schuette, J.L and Yashar, B.M. 2009. A Guide to Genetic
Counseling. New Jersey. Wiley-Blackwell.
Sample Questions
1) Define Human Genetics and briefly discuss the applications of Human
genetics
2) What is DNA Finger Printing? Explain its application in Paternity Diagnosis.
3) What is genetic counseling? Explain its process
4) Write a note on DNA technology in disease and medicine
5) Write short notes on the following
a) Eugenics
b) DNA Finger printing
c) Genetic counseling
41
MANI-002
PHYSICAL
Indira Gandhi
ANTHROPOLOGY
Block
3
PRIMATE STUDY
UNIT 1
Living Primates 5
UNIT 2
Primate Behaviour 24
UNIT 3
Phylogeny of Living Primates and Primate Anatomy 42
Expert Committee
Professor I. J. S. Bansal Professor S.Channa
Retired, Department of Human Biology Department of Anthropology
Punjabi University University of Delhi, Delhi
Patiala
Professor P. Vijay Prakash
Professor K. K. Misra Department of Anthropology
Director Andhra University
Indira Gandhi Rashtriya Manav Visakhapatnam
Sangrahalaya, Bhopal
Dr. Nita Mathur
Professor Ranjana Ray Associate Professor
Retired, Department of Anthropology, Faculty of Sociology
Calcutta University School of Social Sciences
Kolkata Indira Gandhi National Open University
Maidan Garhi, New Delhi
Professor P. Chengal Reddy
Retired, Department of Anthropology Dr. S. M. Patnaik
S V University, Tirupati Associate Professor
Professor R. K. Pathak
Panjab University Dr. Manoj Kumar Singh
Chandigarh Assistant Professor
Professor A. K. Kapoor
University of Delhi, Delhi Faculty of Anthropology
SOSS, IGNOU
Professor V.K.Srivastava
Principal, Hindu College Dr. Rashmi Sinha, Reader
University of Delhi, Delhi Dr. Mitoo Das, Assistant Professor
Professor Sudhakar Rao Dr. Rukshana Zaman, Assistant Professor
Department of Anthropology Dr. P Venkatramana, Assistant Professor
University of Hyderabad, Hyderabad Dr. K. Anil Kumar, Assistant Professor
Course Coordinator: Dr. Rashmi Sinha, SOSS, IGNOU, New Delhi
Content Editor Language Editor
Professor V. Rami Reddy Mrs. Narinder Jit Kaur
Retired, Department of Anthropology Retired, Associate Professor in English
S V University, Tirupati Government Mohindra College, Patiala
Blocks Preparation Team
Unit Writers
Professor P. K. Seth (Unit 1 & 2) Professor R. P. Srivastava (Unit 3 )
Retired, Deptt. of Anthropology, Retired, Deptt. of Anthropology
University of Delhi, Delhi University of Lucknow, Lucknow.
Authors are responsible for the academic content of this course as far as the copy right issues are concerned.
Print Production Cover Design

Mr. Manjit Singh Dr. Mitoo Das
Section Officer (Pub.), SOSS, IGNOU, New Delhi Asstt. Professor, Anthropology, SOSS, IGNOU
August, 2011
ISBN-978-81-266-5547-2
Printed at :
BLOCK 3 PRIMATE STUDY
Introduction
Man is primate of the primates with a unique place in the animal kingdom due to
most distinguishable primate characteristics. He and the non-human primates of
apes and monkeys descended from a common ancestor. The non-human primates
particularly the apes are our close relatives. Primates as multi-cellular animals
are mammals with a rather generalised anatomy. Two categories can be
distinguished among the primates: prosimians or lower monkeys (tree-shrews,
lemurs, lorises and tarsiers), anthoropoids or higher primates (New World or
platyrrhine monkeys, Old World or Catarrhine monkeys and man). There are
many characteristics which are common to both the groups of primates. Humans
are closely related to great apes as shown by anatomical- molecular-behavioural
evidences inspite of many typical characteristics in which they differ from each
other. The ancestral or basal primate stock separated from the common eutherian
stock, emerged as an independent order and evolved as prosimians during
Palaeocene of 70-60 myr BP, as cuboids and pongids of Oligocene of 40-20 myr
BP, and as protohominids during Pliocene of 12-4 myr BP. Squirrel-like, simple
prosimian primates made their first appearance, followed by their adaptive
radiation till the Oligocene time when the New World monkey and the anthropoid
apes came to the scene. The predominance of the latter continued during the
Miocene epoch. During the Miocene and Pliocene epochs the Pliopithicus-
Proconsul-Dryopithecus-Ramapithicus groups made remarkable progress in the
Old World. Of all the classifications of primates, the one by G G Simpson seems
to be most convincing.
The human behaviour including that of the extinct hominids can be best
understood and interpreted from the studies of non-human primates in their natural
setting. This has to be gauged from the findings of field investigations among
the non-human primates on their activity pattern, social organisation, mating
patterns, reproduction, parental care, territoriality, communication, life span,
dominance and aggression, communication, social behaviour, sexual behaviour,
and so on. These behavioural aspects have been examined among such non-
human primates as rhesus monkeys, baboons, presbytis, and great apes. The
rhesus monkey helped in the discovery of Rh factor, which has been found to be
hereditary in Homo sapiens. The great apes have been found to be similar to
humans in anatomical, physiological and behavioural traits.
In the construction of primate phylogenies including those of hominids, the

biological sciences of palaeontology, comparative anatomy and morphology
played a significant role. These methods have been found to be inadequate in the
matter of convincing interpretation of the phylogenies. Recent advances in modern
genetics revealed the development of important techniques and approaches of
signal importance in understanding the relationships between the great apes and
man. Among these can be mentioned the immunological technique, molecular
approaches, DNA hybridisation, mobile DNA elements approach, and human-
chimpanzee-gorilla tricnotomy. Morris Goodman’s 1960s analysis revealed
greater similarity between African apes and man than between Asian apes and
humans. Sarich and Wilson through their molecular approach in 1971 found that
man; gorilla and chimpanzee shared a common ancestor about five million years
Primate Study ago. Yunish and Prakash, Mai and kluge all in 1983 and Schwar in 1984 found
biomolecular similarities between man and African apes. DNA hybridisation,
mobile DNA elements approach and man-gorilla-chimpanzee trichotomy also
support the above findings. The process of hominisation is supported by details
of comparative anatomy of man and apes in the context of skull, spine, pectoral
girdle, pelvic girdle, and lower limbs. The block on Primate Study will facilitate
in understanding Man better.
4
Living Primates
UNIT 1 LIVING PRIMATES
Contents
1.1 Introduction
1.2 Definition
1.3 Characteristics
1.4 Evolutionary Trends
1.5 Classification
1.6 Distribution
1.7 Adaptation
1.8 Summary
1.9 Glossary
References
Suggested Reading
Sample Questions

We consider ourselves as the highest among all beings. But we hardly know
about ourselves. Once you have studied, this unit you will be able to understand
the
Ø distribution of MAN including non-human primates (our closest relatives);
Ø characteristics of MAN including non-human primates;
Ø classification of MAN including non-human primates; and
Ø evolution of MAN including non-human primates.
1.1 INTRODUCTION
That modern MAN, Homo sapiens sapiens, is a primate and a close cousin of
monkeys and apes cannot be denied. Yet, few people understand the relationship
between them. Neither man nor the non-human primates can be defined on the
basis of one or two features. They can be best defined on the basis of the general
pattern displayed by them or by the complexes of their characteristics. So, what
do we mean by the term primate (as this term also includes human beings)?
Unless we know this, it would be difficult for us to proceed with our discussion
on living primates, “our close relatives”.
Carl von Linnaeus, a Swedish botanist, chose the term ‘primate’(meaning first
or the highest amongst all), for the specific order Primates of Animal Kingdom,
Class Mammalia, including humans and the nonhuman primates, i.e., lemurs,
tree-shrews, lorises, aye-ayes, pottos, bush babies, tarsiers, monkeys and apes.
From a little shrew like ancestor, these animals are dominating this kingdom.
The evolutionary story of the primates – beginning from the prosimians at
one end of the spectrum to the highly complex man at the other end – is
now revealed in an ever new and fascinating manner.
5
Primate Study Within the Class Mammalia, there is tremendous diversity — from tiny shrews
to gigantic whales, from flying bats to burrowing badgers, from pronghorns to
sloths, from opossums to artists and engineers and mammalogists.
1.2 DEFINITION
Primates are multicellular animals (metazoans), possess an internal skeleton
(chordata), segmented vertebral column (vertebrates), maintain constant body
temperatures within a few degrees like other mammals and birds (homeotherms),
are mammals for they possess a complex of traits such as mammary glands,
suckling of young ones, hairy body, give birth to young ones, warm blooded,
heterodontism, have a single dental arch which articulates with the squamosal
bone of the skull, have the thorax separated from the abdomen by a muscular
diaphragm and are diphyodont. The primates have retained rather a primitive
and generalised anatomy, which lacks many specialisations; they are not radically
changed from earliest mammals, especially those ancestral to primates.
Primates represent the 7th largest order (including both living and extinct) with
51 genera and 168 species. Of these, 16 genera and 50 species are in the New
World. This order is often considered to be the most important of the mammals.
No one denies that modern man is a primate yet few people understand why man
is classified with animals such as the tree shrew, loris and aye-aye. Most nonhuman
primates occur in tropical areas. Because of his (Man’s) cultural and biological
plasticity, man adapts to most biomes.
None of these traits characterise all members of the order Primate. There are
always exceptions to singular traits. Even today the classic definition of the order
Primate propounded by Mivart in 1873 holds good. Primates cannot be easily
defined as they are characterised by a combination of primitive features and
progressive trends; for instance, primates can be defined as under:
“Unguiculate, claviculate, placental mammals; with orbits encircled by bony

rim; three kinds of teeth; at least at one time of life; brain always with a posterior
lobe and a calcarine fissure; the innermost digits of at least one pair of extremities
opposable; hallux with a flat nail or none; a well-developed caecum; penis
pendulous; testes scrotal; always two pectoral mammae (Mivart, 1873)”.
1.3 CHARACTERISTICS
There are no distinguishing features which characterise them all – except a
negative one, i.e. their lack of specialisation. Primates are distinguished from
other mammals by one or more of the following traits: unspecialised structure,
specialised behaviour, a short muzzle, comparatively poor sense of smell,
prehensile five-digit hands and feet possessing flat nails instead of claws, acute
vision with depth perception due to forward-facing eyes, a large brain, and
prolonged pre- and post-natal development. Most species bear a single young
and live in troops headed by a male. They include the prosimians or lower monkeys
lemurs, lorises and tarsiers and the anthropoids or higher primates (New World
monkeys, Old World monkeys, and apes and man). Primates range in size from
the Mouse Lemur, which weighs only 30 grams (1.1 oz) to the Mountain Gorilla
weighing 200 kilograms (440 lb). Monkeys range in size from the Pygmy
Marmoset measuring 140 to 160 millimeters (5½–6½) long (including tail) and
6
weighing 120 to 140 grams (4–5 oz), to the male Mandrill of about one metre Living Primates
(3.3 ft) length and having a weight of 35 kilograms (77 lb). Some are arboreal
(living on trees) while others live in the savanna. Their diet differs amongst
various species. It may contain any of the following: fruits, leaves, seeds, nuts,
flowers, eggs and small animals (including insects and spiders).
In the past, tarsiers (commonly called as owl monkey) have been grouped together
with the strepsirhines as prosimians, because they retain many primitive features
which are absent in higher primates. Tarsiers are crepuscular and have very large
eyes unlike in any other primate. They have adapted to a specialised lifestyle as
vertical clingers and leapers. However, tarsiers share a number of distinctive
specialisations with anthropoids that suggest that they are more closely related
to each other than to the strepsirhines. Hence, tarsiers and anthropoids (higher
primates) are classified together as haplorhines.
The following are the main characteristics of the primates:
v The anatomy of Primates enables them to maintain semi-erect and erect
postures and locomotor patterns.
v They have pentadactyl hands and feet (a very primitive trait).
v They have flattened nails on each of their digits excepting tree shrews.
v They possess a relatively low density of body hairs (hair instead of fur).
v They have fewer tactile hairs.
v The olfactory area of their brain is reduced. They thus have an increased
dominance of vision over smell, and reduction in the length of the (nose)
snout
v The visual area of their brain is expanded.
v Their eye sockets are completely encircled by a bony ridge. Their eyes are
more forwardly directed on the skull (for binocular vision) suggesting
development of a stereoscopic vision.
v They show an increased reliance on stereoscopic vision at the expense of
smell (the dominant sensory system in majority of the mammals).
v Some primates have developed a three color vision.
v They have pseudo-and true-opposability of the thumb and the great toe (i.e.,
the two function, to a varying degree, independently of the other digits.
They are widely separated from them); usually they have both these digits,
on hands and feet, opposable for grasping purposes.
v Some have prehensile tails.
v They possess relatively larger and complex brains.
v Most female primates have a simple unicornuate uterus.
v They are placental mammals with longer gestation period and generally
give birth to only one or two infants at a time.
v They have year round fertility.
v Their infants have prolonged physical and emotional dependence upon their
mothers, i.e. they have a longer period of infant dependency and parenting.
v They have prolonged growth and maturation periods and long life spans.
7
Primate Study v They display a reduction in the number of teeth, i.e. they have an incisor
and premolar less in each half of the upper and lower jaws unlike those in
the primitive placental mammals.
v They have retained a primitive clavicle.
v They possess a separate radius and an ulna in the forearm and a separate
tibia and a fibula in the lower leg (excepting tarsier).
v They show reduction in the length of their external tail.
v They possess a shortened vertebral column.
Prosimians, the simplest and the lowliest of the primates, have comb-like incisors
and canines (lower front teeth forming a toothcomb; also known as procumbent
lower incisors and canines); and a specialised claw on their back feet for grooming
whereas monkeys use their hands.
Platyrrhines display a variety of quadrupedal locomotor types ranging from
squirrel like scrambling to leaping and forelimb suspension. Atelines and capuchin
monkeys are distinctive among primates in having a specialised prehensile tail
that can grasp around branches for extra support. Their dental formula (DF) is
2.1.3.3. Though this DF is similar to that of prosimians yet the typical prosimian
tooth comb is absent in them.
Strepsirhines have elongated and forwardly projecting lower front teeth that form
a toothcomb. These teeth are used for grooming the fur and for obtaining resins
and gums from trees as source of food. The digits of the hands and feet bear
flattened nails, rather than claws, excepting the second toe, which has a sharp
toilet claw for grooming. They also have a moist, naked rhinarium and cleft
upper lip (similar to the wet noses of dogs). Most strepsirhines are nocturnal and
have large eyes. Their brain size is relatively small and the snout tends to be
longer than the haplorhines.
The Old World monkeys include some terrestrial species such as the baboons
and man, whereas the New World monkeys are exclusively arboreal. Some New
World monkeys have a prehensile tail for grasping. Cercopithecids or the Old
World monkeys, and the hominoids or apes and humans are distinguished from
Ceboidea in the development of a tube like (rather than ring like) tympanic bone
to support the eardrum (refer table below):
Ceboidea Cercopithecoidea Hominoidea
Platyrrhines Catarrhines Apes (Pongidae)
New World Monkeys Old World Monkeys Man
(NWM) (OWM) ( Hominidae)
Flat nosed Sharp nosed Sharp nosed
Broad nasal septum Narrow nasal septum Narrow nasal septum
D.F. 2.1.3.3; an D.F. 2.1.2.3 D.F. 2.1.2.3
extra premolar
Bilophodont Dryopithecus pattern of
lower molar
Incisors broad and Incisors broad and
spatulate spatulate
Prehensile tail Tail never prehensile Tail altogether absent
8
Living Primates
(Broad nasal septum) (Narrow nasal septum)

Platyrrhines (Ceboidea or NWM) Catarrhines (Cercopithecoidea or Hominoidea; OWM)
Source: Seth, P.K and Seth, S. 1986. The Primates, New Delhi, Northern Book Centre
Diagrammatic representation of the nasal septum in the NWM and OWM

Catarrhines (OWM; DF 2.1.2.3) are a highly successful group comprising more
than 80 species. They are distinguished from other anthropoids in having
bilophodont molar teeth which bear a pair of transverse crests. They also have
naked, roughened sitting pads on their rumps called ischial callosities - a feature
they share with hylobatids.
Hominoidea is the superfamily to which both apes and humans belong. MAN
shares numerous structural similarities with the apes but the most significant
feature is the absence of tail, large body size and shortened trunk. Hominoids are
distinguished from cercopithecoids by the occurrence of primitive nonbilophodont
molars, larger brains, longer arms than legs (except in humans), a broader chest,
a shorter and less flexible lower back, and absence of tail. Many of these
specialisations are related to a more upright posture in apes associated with a
greater emphasis on vertical climbing and forelimb suspension.
Hominoids contain two families: pongidae and hominidae. Pongidae includes
the hylobates (gibbons and siamangs), and the great apes (orangutan, chimpanzee
and gorilla). The Hominidae includes the humans (Homo sapiens) only. The
gibbons and siamang (Hylobates) are the smallest of the hominoids (4–11 kg or
9–24 lb), and due to which they are sometimes referred to as the lesser apes. The
nine or so species are common throughout the tropical forests of Asia.
The great apes are remarkable in having the longest arms in any primates, which
are 30–50% longer than their legs. The gibbon and the closely related siamang
of the superfamily Hylobatinae are characterised by their highly specialised mode
of locomotion, called brachiation, by which they swing below the tree branches
using only their forelimbs. They are small tailless, arboreal apes having ischial
callosities and exceptionally long arms including prehensile hands.
The Gibbons are fruit eaters, whereas the larger siamang consumes a higher
proportion of leaves in its diet. Hylobatids live in monogamous family groups in
which males and females are similar in size.
The Great apes are included together in their own subfamily of Ponginae to
distinguish them from humans, who are placed in the family Hominidae. However,
recent anatomical, molecular, and behavioural evidence has confirmed that
humans are closely related to the great apes, especially the African apes. For this
reason, most scientists now classify them together in a single family, the Hominidae. 9
Primate Study Let us now find out the typical characteristics in which MAN differs from Apes
MAN APES
Orthograde locomotion Pronograde locomotion
Great toe largest Great toe not the largest
Forward positioning of foramen Foramen magnum backwardly directed
magnum
Strong development of mastoid Mastoid processes not well developed
processes
Vertebral column has moved Vertebral column dorsally placed
anteriorly into thorax
Dorsal shift of shoulder joints Shoulder joints and scapula laterally
and scapula placed
Largest brain Small brain
Marked reduction in the size of Large face and lower jaw
face and lower jaw
Everted chin Receding chin
Forward positioning of eyes Obliquely laterally directed eyes
Post-canine length less More post canine length
Canine size same as other teeth Canine protrudes out of the tooth rows
1.4 EVOLUTIONARY TRENDS

The oldest known fossil remains of primates appeared about 60 mya. Man, even
today, is regarded as the most evolved among the primates. These earliest primates
were small, forest dwelling, and insectivorous mammals not larger than a rat.
The Primate adaptive radiation began sixty-five to seventy million years ago in
the Palaeocene epoch. Though the living primates could be arranged in order of
increasing their anatomical and behavioural complexity, they are the end products
of their own evolutionary lines.
Early Tertiary Period

The climate of the early Tertiary period — about 66.4 million years ago - was
warm with wide tropical and subtropical zones extending from the equator up to
the higher latitudes in both the Old and the New World. During this period, the
most primitive of the primates were in existence. During the Palaeocene epoch,
which lasted for about 8.6 million years (c.66.4 million-c.57.8 million years
ago), there were many primates in existence. Three of these families had long
chisel-shaped teeth that resembled those of the rodents with which they competed
for a similar ecological niche, or habitat.
During the Palaeocene and Eocene epochs (from about 66.4 million to about
36.6 million years ago) early in the Tertiary period, more advanced primates
appeared. During these epochs, an explosive primate radiation took place which
dwindled in the Oligocene (Oligo = small). Lemuroids, Tarsioids and Platyrrhines
have been recognised in the Palaeocene and Eocene epochs of America, Europe,
Egypt and Burma. The Adapidae family represented by the Lemuriformes, was
10
the most widespread one as per the fossil record. The Tarsiiformes are known Living Primates
from one family, the Omomyidae. The characteristic tarsioid (tarsier-like)
specialisation of the skull and hind limbs were already well advanced in the
known fossil forms, but some of the European genera have some structures
indicating relationships with the early monkeys.
The New World witnessed the appearance of three-fourth of the primates. Their
development and human origins probably took place in the Old World.
Amphipithecus, implying both ways an ape, a platyrrhini, found in the Eocene
of Burma is considered to be ancestral to the Parapithecus (Para = near) of
Egypt. Generally speaking, there is hardly any fossil evidence of the Eocene
ancestors of the Old World monkeys and apes. Thus, the Eocene epoch terminated
after about 30 million years of primate evolution with lemur-like and tarsier-like
forms.
Later, during the Oligocene epoch (36.6 to 23.7 million years ago) which followed,
there came into existence primitive monkeys and exceedingly primitive
anthropoid apes. The Fayum deposits of the Oligocene epoch in Egypt yielded
fossil remains of Propliopithecus (Pro = before, Plio = more), the earliest
anthropoid ape on record (they had small brains, long snouts, skulls resembling
those of monkeys or lemurs and their teeth like those of modern apes; they lived
in trees and had tails) and Parapithecus (known from some lower jaws 30 mya),
a very small sized (squirrel-like) and earliest Old World Monkey on record having
a generalised Tarsioid appearance. Gregory regarded Propliopithecus as a
primitive gibbon and Parapithecus as a primitive monkey. These fossils are
distinguished by traits normally necessary for adaptation to arboreal life: grasping
extremities, nails instead of claws, pentadactyly, an opposable thumb and a big
toe, forearm consisting of ulna and radius, reduced snout, forwardly directed
eyes and orbits closed from behind, and enlarged visual centers.
Apidium, which is also included in the family of Parapithecidae, could be the

forerunner of African monkeys. The Egyptian Oligocene epoch also contributed
to several primitive fossil apes including Aeolopithecus, which may be an ancestral
gibbon, and Aegyptopithecus, which may be ancestral to the modern great apes.
One other fossil ape from the Fayum that deserves special mention is
Propliopithecus, formerly believed to be an ancestral gibbon. It has been
suggested, primarily on the basis of its generalised dentition, that Propliopithecus
is possibly ancestral to the hominids.
The Miocene Epoch

About 23.7 million years ago the Miocene epoch began and lasted about 18.4
million years. It was a incredible phase in primate evolution which witnessed an
increase in the number of larger primates that were widely spread throughout the
Old World, including Europe, Asia, and Africa. The large Miocene hominoids
appear to belong to three groups, the Sivapithecus, the Dryopithecus, and the
Proconsul groups.
The Miocene fossil forms of Asian and African apes suggest that the Asian apes
formed a distinct category which diversified in Asia and Southeast Europe by
fourteen million years ago (e.g., Sivapithecus, Ramapithecus, etc). There were
other significant fossils reported from the Miocene of Europe, Egypt and Africa.
The lower Miocene epoch is often referred to as the ‘Age of Apes’. Skeletal
11
Primate Study remains from Africa were classified into three major groups: Proconsul (a non-
specialised ape), Sivapithecus (a transitional form between the anthropoids and
man), and Limnopithecus (an early type of gibbon).
From Europe, the fossil material of Pliopithecus was recovered. The name means
that the individual is thought out as ancestral to the modern gibbons. A small-
sized primitive gibbon (Prohylobate) frequented Egypt during the Miocene. This
ape was slightly bigger in size than the Propliopithecus. This epoch, thus, saw
the rise of the generalised apes of large size which are regarded as the offshoots
of Propliopithecus of Oligocene.
Dryopithecids (a very heterogeneous group) and Oreopithecus were inhabiting

in India and Europe during the Pliocene. Pliocene signals the decline, both in
numbers and diversification, of these closely related Miocene forms and the
commencement of the primitive hominids. The Dryopithecus group comprises
the first specimen of the Dryopithecus fontani found in 1856 in Saint-Gaudens
in France. Its molars possess five cusps and the Y-5 pattern -its fissure pattern is
typical of dryopithecines.
The Proconsul groups are known from the early Miocene period of Africa. It
includes three species— Proconsul africanus, Proconsul nyanzae, and Proconsul
major—as well as Rangwapithecus gordoni and several other smaller-bodied
apes. The second group of Middle Miocene apes (all from East Africa) is
represented by the Oreopithecidae, which includes Nyanzapithecus, the large
Afropithecus, and two species of Kenyapithecus.
Dryopithecinae
These fossil remains represent the most interesting and the controversial part of
the primate evolution. The entire subfamily Dryopithecinae has been named after
a mandible (Dryopithecus fontani) by Lartet. Similar finds have been reported
from China, northern India, Africa and parts of Europe, viz., France, Germany,
and Spain. The dryopithecines are a very heterogeneous group representing a
stage of primate evolution rather than a single phylum and its branches. Numerous
species of Dryopithecus have been described. They show considerable variation
in their dental anatomy, some suggesting closeness to the chimpanzee, some to
the orangutans and yet others to the gorilla.
This ape complex is represented by teeth, jaw fragments, cranial and long bones
(humerus shaft, ulna and a femur). The humerus bone, with its both ends missing,
was reported from France and uncertainly labeled as that belonging to
Dryopithecus fontani. A complete femur found in Germany has been assigned to
Paidopithex (Boule and Vallois, 1957). These long bones are gibbon-sized.
Dryopithecinae fossils range in size from animals as big as gibbons to as large or
larger than the modern gorillas. They are distinguished from the Hominidae on
the basis of their dentition alone.
The incisors are small and more vertical compared to those of the Ponginae.
Canines are larger than those in the Hominidae. The lower premolar is sectorial
in shape. The molars usually increase in size within the series M1<M2<M3.
Their characteristic ‘Y-5’ cusp pattern is not commonly found in modern man.
This suggests that the pattern is of fossil origin. The primordial crown pattern of
human lower molars is comprised of set of three grooves in the form of ‘Y’ lying
12
on its side with its tail pointing forwards and its two arms pointing to the rear. In Living Primates
each obtuse angle are stationed two cusps, and in the acute angle, a fifth cusp is
located forming the Y-5 pattern (Coon, 1963). In the teeth of modern human
beings, the molar crown patterns have been simplified in two ways: the groove
pattern has changed from ‘Y’ to a simple ‘+’ and the number of cusps has reduced
from five to four or even less (three or two).
Pliocene of Siwalik Hills in North India is a highly productive radiation center

of fossil pongids during the second half or late Miocene and lower Pliocene.
Dryopithecus
Dryopithecus, a genus of extinct apelike animals, is representative of a group of
small, generalised apes that contains the ancestors of both the modern apes and
humans. Although Dryopithecus has been known by a variety of names based
upon fragmentary material found over a widespread area including Europe, Africa,
and Asia, it appears that only a single genus is represented. Dryopithecus is
found as fossils in Miocene and Pliocene deposits (23.7 to 1.6 million years old)
and apparently originated in Africa.
Ramapithecus
The first Ramapithecus fossils (fragments of an upper jaw and some teeth) were
discovered in 1932 in fossil deposits of the Siwalik Hills of Northwestern India.
No significance was attached to these fossils until 1960, when Elwyn Simons of
Yale University began to study them and ‘fit’ the jaw fragments together (refer
Figure below). Based on his observations of the shape of the jaw and dentition
¯ which were transitional between those of apes and humans, Simons advanced
the theory that Ramapithecus represented the first step in the evolutionary
divergence of humans from the common hominoid stock that produced modern
apes and humans.
Ramapithecus (from the Middle and Late Miocene epochs) represents the earliest
known hominid and its existence establishes from that of the African apes fifteen
million years ago. This basic tenet is now regarded as questionable, even if an
alternative ‘correct’ answer cannot be provided. Lewis (1933) first described the
fossil remains of a fragment of an upper jaw from Haritalyangar in the Siwalik
Hills (India) and christened it Ramapithecus brevirostris. This fragment has a
wide curving jaw with an arched palate (man-like feature) and was so named as
it resembled the Indian God ‘Lord Rama’. It has a short snout, a feature
characteristic of the apes.
Ramapithecus punjabicus (upper and lower jaws fit very well)

13
Primate Study According to Simons, the two jaws fit i.e., this lower jaw fits with the widely
curving upper jaw fragment denoting that the two might have belonged to same/
similar individuals. The facial features (sloped and slightly concave facial profile)
and the anterior dentition (forward jutting of canines) suggest similarities with
orangutans.
From amongst the various ramapithecinae finds, the ‘Brahmapithecus’ lower

wide jaw fits well with the upper jaw fragment of Ramapithecus brevirostris
(Simon, 1961). This clearly shows that the two are the same.
Gigantopithecus
Gigantopithecus mandible
Gigantopithecus remains from the Siwaliks of India have been dated as ca. 6.3
mya. Hominid features of Gigantopithecus bilaspurensis from the Indian Siwaliks
(for instance, marked reduction of the front teeth, relatively small canine and
tooth wear) suggest that hominid-like tendencies were already underway some 5
to 10 mya in the Pliocene period. Being considerably older than the Chinese
Gigantopithecus, these remains provide newer insights into the initial stages of
differentiation of hominoids and man-like primates. These Siwalik finds were
found associated with antelopes and primitive elephants further indicating that
they inhabited open woodland areas. It can also be argued that the hominoids
were displaced from India and after the emergence of MAN, they made a re-
entry? The Siwalik hominoids probably used ad-hoc tools to compensate for the
reduction of the anterior dentition, exposure to forest ecology accompanied by
dietary change and emergence of incipient bipedality (Simons and Pilbeam, 1965).
Lower jaw of Gigantopithecus blacki and right lower molar of Gigantopithecus
14
Living Primates
1.5 CLASSIFICATION
There are numerous classifications of primates suggested by various scientists.
However, the classification of Simpson (1945), based on their morphology, is
widely accepted, and is given below:
Taxonomic Groups including Members
category primates
Kingdom Animalia Multicellular (have sexual reproduction,
nervous system, differentiated tissues)*
Phylum Chordata Animals with vertebral column
Nonchordata Animals without vertebral column
Class Aves Animals with feathers, wings formed by
forelimbs
Pisces Animals having gills throughout life,
usually have fins
Amphibia Animals with 4 pentadactyl limbs; pelvic
girdle unlike fish, have eggs without
protective shell, fertilised without coition
Reptilia Animals having no direct articulation of
dentary bone with the skull, homodont,
polyphyodont
Mammalia Warm blooded furry animals, heterodont
animals, diphyodont, single dentary arch
which articulates with squamosal bone
of skull, thorax separated by a diaphragm
from abdomen, and all other animals that
suckle their young
Subclass Prototheria Egg laying mammals
Metatheria Pouched mammals
Eutheria Placental mammals
Order Insectivora Ordinarily insect eaters, small and
nocturnal, simple brain
Chiroptera Ulna reduced to a vestige, have wings to
fly
Dermoptera Larger than chiroptera
Edentata Usually without teeth, slow in
locomotion
Pholidota Really toothless, scales on their body
Primates Prosimii (the lower primates: tarsiers,
lorises, lemurs, etc.)* and Anthropoidea
(monkeys, baboons, apes and man)*
Suborder Prosimii Lemuriformes, Lorisiformes,
Tarsiiformes (the most primitive of the
primates)*
15
Primate Study
Anthropoidea Ceboidea (Platyrrhines/New World
Monkeys)*, Cercopithecoidea
(Catarrhines/Old World Monkeys)* and
Hominoidea
Superfamily Ceboidea Cebidae and Callitrichidae (monkeys:
owl, saki, howler, capuchin, spider and
goeldi’s, marmosets)*
Cercopithecoidea Cercopithecidae (monkeys: rhesus, drill,
baboon, colobus, nasalis, langur etc)*
Hominoidea Pongidae and Hominidae
Family Pongidae Hylobatinae (gibbon, siamang)* and
Ponginae (orangutan, chimpanzee,
gorilla)*
Hominidae Man (Homo)*, ape-man
(Australopithecus)*, and early ape-man
(Ramapithecus)*
Genus Homo Early man (Homo erectus)* and modern
man (Homo sapiens sapiens)*
Species sapiens Modern humans including early
subspecies and all living races
*Text within brackets as suggested by other taxonomists

Yet another classification of the primates has been is proposed by (Hill, 1957-
63):
Order Primates
Suborder Strepsirhini (Prosimians) (or curly-nosed primates, to include non-
tarsier prosimians)
Infraorder Lorisiformes
Superfamily Lorisoidea
Family: Lorisidae (lorises)
Galagidae (bush babies)
Infraorder Lemuriformes
Superfamily Lemuroidea
Family: Cheirogaleidae (dwarf lemurs)
Lepilemuridae (sportive lemur )
Lemuridae (true lemurs)
Indriidae (sifakas, indri, woolly lemur)
Daubentoniidae (aye-aye)
Suborder Haplorrhini (or dry-nosed primates)
Hyporder Tarsiiformes
Superfamily Tarsioidea
Family Tarsiidae (tarsiers)
Hyporder Anthropoidea
Infraorder Platyrrhini (“flat nosed”) or New World monkeys of South and Central
16 America
Living Primates
Superfamily Ceboidea (New World Monkeys)
Family: Callitrichidae (marmosets, tamarins)
Cebidae (capuchins, squirrel monkeys, douroucoulis, titis)
Atelidae (sakis, uakaris, howler monkeys, spider monkeys, woolly monkeys)
Infraorder Catarrhini (narrow nosed)(of Africa and south eastern Asia)
Superfamily Cercopithecoidea
Family Cercopithecidae (Old World monkeys)
Superfamily Hominoidea
Family: Hylobatidae (gibbons, siamang)
Hominidae (orangutans , gorillas, chimpanzees, humans)
1.6 DISTRIBUTION
The prosimians are subdivided into three major groups: the lemuroids, which
are restricted to Madagascar (more than 30 species are represented, belonging to
five different families); the lorisoids, which are found throughout tropical Africa
and Asia; and the tarsioids (tiny primates) (weighing only about 120 g), which
inhabit the islands of Southeast Asia (all belong to a single genus, Tarsius).
The platyrrhines from South and Central America are a diverse group of primates
comprising more than 50 species and 16 genera. All members of the suborder
Ceboidea (NWM/platyrrhines) are arboreal. They are widely distributed
throughout tropical forests extending from Mexico to northern Argentina. The
catarrhines include all anthropoid primates from Africa, Asia, and Europe. The
Old World monkeys are widely distributed throughout sub-Saharan Africa and
tropical Asia. They also occur in the extreme southwestern tip of the Arabian
Peninsula, northwest Africa, Gibraltar (their only European record), and East
Asia.
Apes
The gibbons and siamang (Hylobates) are the smallest of the pongids (4–11 kg
or 9–24 lb), and for this reason they are sometimes referred to as the lesser apes.
The nine or so species are common throughout the tropical rain forests, and the
semi deciduous mountain forests of Southeast Asia. They are known for their
remarkably longer arms than in any other primates, which are 30–50% longer
than their legs. This is related to their highly specialised mode of locomotion
called brachiation by which they swing below the tree branches using only their
forelimbs. Gibbons are fruit eaters, while the diet of larger siamangs incorporates
a higher proportion of leaves.
The great apes include the orangutans (Pongo) from Asia and Gorillas (Gorilla)
and chimpanzees (Pan) from Africa. The orangutan is restricted to the tropical
rainforests of Borneo and northern Sumatra. They are large, arboreal primates
and climb cautiously through the trees using all four limbs for support. Orangutans
subsist mainly on fruits (www.accessscience.com).
The Gorillas are the largest of the hominoids found in tropical Africa. Because
of their huge size, gorillas are almost completely terrestrial, although females
and young individuals frequently climb trees. They often build nests on the ground.
Gorillas move quadrupedally. Like the chimpanzees, their hands are specialised
for knuckle-walking when the weight of the animal is borne on the upper surface 17
Primate Study of the middle joints of the fingers. They are of two types: mountain Gorillas and
lowland Gorillas. Mountain Gorillas eat a variety of leaves, stems, and roots,
while the lowland gorillas eats a larger proportion of fruits. They live in groups
which consists of a dominant male, several adult females, sub adults, and infants.
There are two species of Chimpanzees, the common Chimpanzee (Pan

troglodytes) and the bonobo or pygmy chimpanzee (Pan panicus). The common
chimpanzee is far and wide distributed in the forests and woodlands stretching
across equatorial Africa. The pygmy chimpanzee is limited to the tropical
rainforests of the Congo. Both species make nests and feed in trees, but they by
and large travel on the ground. Common chimpanzees have eclectic diets,
including meat, which they get hold of by hunting small to medium-sized
mammals. Tool-using behaviours are common among them and more than a
dozen simple tool types have been recognised. Chimpanzees are gregarious and
sociable animals. They live in communities where there are many males that
divide into smaller subgroups for foraging.
1.7 ADAPTATIONS
Primates have diversified in arboreal and terrestrial habitats (trees, bushes and
land) and retain many characteristics facilitating adaptations to these
environments:
v Retention of the collar bone in the pectoral girdle.
v Shoulder joints with a high degree of movement in all directions.
v Possession of five digits on the fore and hind limbs with opposable thumbs
and big toes facilitating them in grasping objects and climbing trees.
v Presence of nails on the fingers and toes in most species.
v Presence of sensitive tactile pads on the ends of the digits.
v Orbits encircled in a bony rim facilitating rotation of eyeballs in the socket.
v Trend towards a reduced snout and flattened face supposedly leading to the
development of vision at the expense of olfaction.
v Complex visual system with stereoscopic vision, high visual acuity and color
vision – all contributing to quicker movements on the trees.
v Large brain in comparison to body size especially in simians.
v Differentiation of the enlarged cerebral cortex.
v Reduction in the number of teeth compared to primitive mammals.
v Three kinds of teeth.
v Longer gestation and developmental period; and
v Trend towards holding the torso upright leading to bipedalism.
Primates exhibit a wide range of characteristics. Some primates, inclusive of
some great apes and baboons, do not live primarily in trees. But all species possess
adaptations for climbing trees. Their locomotion techniques include leaping from
tree to tree, walking on twos or fours limbs, knuckle-walking, and swinging
between branches of trees (known as brachiation). The three-color vision has
developed in some primates.
18
Living Primates
1.8 SUMMARY
We consider ourselves as the highest among all beings. But we hardly know
about ourselves. Modern MAN, Homo sapiens sapiens, belongs to the group of
mammals known as Primates and is a close cousin of monkeys and apes. Yet,
few people understand the relationship between them.
Here in this unit, we find that neither man nor the non-human primates can be
defined on the basis of one or two features. They can be best defined on the basis
of the general pattern displayed by them or by the complexes of their
characteristics. So, what do we mean by the term primate (as this term also
includes human beings)? The term ‘primate’ means first or the highest amongst
all. Primates belong to the Animal Kingdom, Class Mammalia and include humans
and the nonhuman primates, i.e., lemurs, tree-shrews, lorises, aye-ayes, pottos,
bush babies, tarsiers, the monkeys of the New World and Old World, and also
the apes.
As primates, we all share many characteristics; for instance,

v overlapping fields of vision due to the forwardly directed eyes (this allows
for greater 3D vision),
v fine ability to grasp and handle objects in our hands and
v enlarged brain relative to body size.
In this Unit, we also discuss the distribution, classification, evolutionary trends,
typical physical characteristics, and similarities and dissimilarities within primates
including man.
The distinctive features of all the primates (include prosimians, monkeys, apes,
and humans) are that they have:
v hair instead of fur;
v nails instead of claws;
v opposable thumb and big toe (thumb/big toe can touch all other digits) –
The exception is humans in which the big toe is modified for bipedal walking;
v prehensility – ability to grasp with fingers and/or toes;
v pentadactyly – five digits on each hand;
v padded digits with fingerprints;
v reduced olfactory sense and dependent on vision more than smell;
v stereoscopic vision – forward rotation of eye with protective bony structure;
v binocular vision– both eyes focus on one object (depth perception); and
v large brain compared to the body size – high level of intelligence.
We find that primates have a two-fold division: prosimians (lowliest of primates)
and Anthropoidea. The Anthropoidea further includes new world monkeys
(platyrrhines – flat nosed) and the old world monkeys (catarrhines - sharp nosed).
We find that chimpanzee is closest to MAN genetically. Humans and chimpanzees
have very similar DNA (about 98% of human and chimpanzee DNA is identical).
Genetic studies show that chimpanzees and humans share a common ancestor. 19
Primate Study Gorilla is the largest primate on earth and the most powerful of all the primates,
a group which includes everything from small arboreal creatures such as the tree
shrew, bush babies, several types of monkeys to humans.
1.9 GLOSSARY
Apes : Gibbons, Siamangs, Chimpanzees, Gorillas and
Orangutans.
Arboreal : tree dwelling.
Bipedalism : walking on two limbs.
Brachiation : swinging from branch to branch using forearms.
Caecum : end part of intestines.
Claviculate : have a clavicle (collar bone).
Dental formula (D.F.) : number/type of teeth in each half of the lower and
upper jaws; for instance, human D.F. is 2.1.2.3; each
half of jaw has 2 incisors, 1 canine, 2 premolars, 3
molars; total number of teeth = 32.
Extremities : limbs, i.e. arms and or legs.
Great apes : Orangutans, Chimpanzees and Gorillas.
Hallux : great toe.
Ischial callosities : hardening of skin in the region of buttocks which
comes in contact with the surface while sitting.
Knuckle walking : walking using bent fingers.
Lesser apes : Gibbons and Siamangs.
Opposable : oppositely directed.
Orbits : eye sockets.
Pectoral mammae : mammary glands on chest region.
Penis pendulous : male genital organ hanging outside body.
Pentadactyl : having five digits (fingers or toes).
Placental mammals : mammals with umbilical cord.
Pollex : thumb.
Quadrupedalism : walking on all four limbs.
Terrestrial : ground dwelling.
Testes scrotal : testes in the scrotum.
Three types of : (trichromacy or trichromaticism) is the condition of
colour vision possessing three independent channels for conveying
colour information; derived from three different cone
types. Organisms with trichromacy are called
trichromats. Their retina contains three types of
colour receptors (called cone cells) with different
absorption spectra. Trichromatic colour vision is the
ability of humans and some other animals to see
20
different colour, mediated by interactions among Living Primates
three types of colour -sensing cone cells.
Unguiculate : have nails on fingers and toes.
References
Boule, M. and H.V. Vallois 1957 Fossil Men: A Textbook of Human
Palaeontology. London, Thames and Hudson.
Osman Hill, W. C. 1953-1957 Primates. Edinburg, Edinburgh University Press.
Seth, P. K. and S. Seth 1986 The Primates. New Delhi, Northern Book Centre.
Simons E.L. and S.R.K. Chopra 1969a A preliminary announcement of a new
Gigantopithecus species from India. In Recent Advances in Primatology. Ed.
H.O. Hofer. Basel and New York: S. Karger. 2: 135¯142.
Simons, E.L. and S.R.K. Chopra 1969b Gigantopithecus (Pongidae,
Hominoidea): A New Species from North India. Postilla (Yale University Peabody
Museum of Natural History) 138:1¯18.
van Valen, L. and Sloan, R.E. 1965 The Earliest Primates. Science 150:743–
745.
www.accessscience.com/content/Primates.
Suggested Reading
Chopra, S.R.K. 1979a. Early Man in North West India. New Delhi: Allied
Publishers Private Limited.
Chopra, S.R.K. 1979b. Palaeontological evidence bearing on the problem of

human origins in North-West India. In “Early Man in North West India. (edited
by S.R.K. Chopra). New Delhi: Allied Publishers Private Limited. pp 1– 19.
Chopra, S.R.K. and S. Kaul 1979. A New Species of Pliopithecus from the Indian
Sivaliks. Journal of Human Evolution 8: 475– 477.
Clark, W.E. Le Gros 1934. Early Forerunners of Man. London, Bailliere Tindall
&Cox.
Clark, W.E. Le Gros 1965. History of the Primates. London, British Museum of
Natural History. .
Wood, J.F. 1948. Hallmarks of Mankind. London, Bailliere Tindall and Cox.
Hooton, E.A. 1954. Up From the Ape. New York, The Macmillan Company.
Lewis, G.E. 1933. Preliminary Notice of a New Genus of Lemuroid from the
Siwaliks. American Journal of Science 26: 134– 138.
Lewis, G.E. 1936. A New Species of Sugrivapithecus. American Journal of Science

31: 450– 452.
Lewis, G.E. 1937. Taxonomic Syllabus of Siwalik Fossil Anthropoids. American

Journal of Science 34:137– 147.
21
Primate Study Lewis. G.E. 1934. Preliminary Notice of New Man-like Apes from India: Scientific
Research of the Yale India Expedition. American Journal of Science 27:161–
181.
Lydekker, R. 1878. Notices of Siwalik Mammals. Records of Geological Survey

of India, Calcutta 11:64– 104.
Lydekker, R. 1879. Notices of Siwalik Mammals. Records of Geological Survey

of India 12: 33– 52.
Lydekker, R. 1886. Siwalik Mammalia. Supplement one. Memoirs of the

Geological Survey of India 10: 1– 18.
Seth, P.K. and S. Seth 1986. A review of evolutionary and genetic differentiation
in primates. In Primate Evolution. Eds. Else and Lee Cambridge: Cambridge
University Press. Procs. 10th Congress of the International Primatological Society.
Vol. 1, pp 291¯306.
Rami Reddy, V 1992. Physical Anthropology, Evolution and Genetics of Man.

Tirupati: V Indira.
Simons, E.L. 1960b. Apidium and Oreopithecus. Nature 186:824¯826.
Simons, E.L. 1961. The Phyletic Position of Ramapithecus. Postilla 57:1¯9.
Simons, E.L. 1964. The Early Relatives of Man. Scientific American 211:50-62.
Simons, E.L. 1969. The Origin and Radiation of the Primates. Annals of New
York Academy of Sciences 167:319¯331.
Simons, E.L. 1972. Primate Evolution. –An Introduction to Man’s Place in Nature.
New York: Macmillan.
Simons, E.L. 1974. On the Discovery of Gigantopithecus in north India. In

Perspectives in Palaeoanthropology. Ed.A.K. Ghosh. Calcutta: Firma K.L.
Mukhopadhyay. pp 1¯7.
Simons, E.L. 1977. Ramapithecus. Scientific American 236(5):28¯35.
Simons, E.L. and D. Pilbeam 1965. Preliminary Revision of the Dryopithecinae

(Pongidae, Anthropoidea). Folia Primatologia 3:81¯152.
Simons, E.L. and D.R. Pilbeam 1972. Hominid Palaeoprimatology. In: The
Functional and Evolutionary Biology of Primates. Ed .R.H. Tuttle. Chicago:
Aldine. pp: 36¯62.
Simons, E.L. and D.R. Pilbeam 1978. Ramapithecus. In: Evolution of African
Mammals. Ed: V.J. Maglio and H.B.S. Cooke. Massachusetts: Harvard University
Press. pp 147¯153.
Simpson, G.G. 1945. The Principles of Classification and a Classification of

Mammals. Bulletein of American Museum of Natural History, New York. Vol.
85
Simpson, G.G. 1949b. The Meaning of Evolution. New Haven: Yale University
22
Press.
Sample Questions Living Primates
1) Who is Man?
2) Who are his immediate relations and why?
3) What are Man’s distinguishing physical characteristics?
4) How does MAN differ from his nearest relatives?
5) What do you know about the evolution of MAN?
23
Primate Study
UNIT 2 PRIMATE BEHAVIOUR
Contents
2.1 Introduction
2.2 Activity Pattern
2.3 Social Organisation
2.4 So What Sort of Behaviours do We See in Primates?
2.5 Rhesus Monkey (Common Monkey)
2.6 Papio (Commonly Known as Baboons)
2.7 Presbytis (Hanuman Langur)
2.8 Lesser Apes (Siamangs and Gibbons)
2.9 Great Apes: Orangutan
2.10 Chimpanzee
2.11 Gorilla
2.12 MAN and Other Primates
2.13 Summary
2.14 Glossary
References
Suggested Reading
Sample Questions

MAN is a primate. However, it is difficult to understand why he behaves
differently under different situations. At the same time, it is not possible to study
man in the laboratory. In order to understand his changing behaviour, emotions,
etc., under different conditions, it is important to study the behaviour and social
structure/organisation of non-human primates and then extrapolate that to MAN.
Once you have studied this unit you will be able to understand
Ø primate behaviour under different ecological conditions; and
Ø insight into the behavioural variables as seen in MAN.
2.1 INTRODUCTION
The very fact that non human primates have been so frequently used in biomedical
researches shows that structurally, physiologically and behaviourally, they display
greater similarities to the Homo sapiens.
It is only on man’s closest relatives, the non-human primates, that behavioural

studies can be conducted and extrapolated to MAN. The social behaviour of the
non-human primates may be viewed as a simplified model of human behaviour.
So the question arises as to how we can study primate behaviour? Study of their
behaviour in captivity is not their natural behaviour but conditioned behaviour.
24
Thus, we need to understand how they adjust into their environment, i.e., to Primate Behaviour
understand the life style/behaviour of our non-human primate relatives in their
natural habitats. This depends on a number of variables, including different types
of trees on which they move, sleep and collect food (amount and types of food
needed as also food distribution across the habitat occupied) during different
seasons. As such, non human primates occupying different environments must
meet different demands. Many of the behavioural differences prevalent among
them reflect adaptations to this diversity. For instance, different primate groups
live within a single forest but move and feed on different levels and or on different
types of trees (e.g. bamboos, palms, vines, etc.). Most primates eat a variety of
foods resulting in differential development of teeth. For example, insectivores
have pointed cusps on their teeth, plant gum eaters have typically sturdy incisors
and sometimes canines that protrude forward for scraping off gum, frugivores
have wide incisors and low rounded molar cusps for scraping out the fruit from
the rinds, and folivores have sharp ridged molars for shearing leaves into tiny
bits.
The ultimate needs of human and non-human primates are not as divergent as
they appear since the survival of both depends upon the conservation of the
natural habitats. Rapid urbanisation and industrialisation is not only forcing the
non-human primates to move into smaller home ranges but it is also disturbing
their ranging patterns (due to destruction of trees, undergrowth and arboreal
pathways), group structure, dominance, etc. Such demographic changes and
ecological disturbances transform their behaviour as well as movement patterns,
temporarily if not permanently.
Researchers on the above lines reveal that urban primates depict higher
competition and aggressive instinct than their forest counterparts. On the contrary,
the role of leadership and dominance is much more defined amongst the forest
primates in tune with the exigencies of the environment. Aggression is quite
common among the urban primates whereas communication is well developed
amongst the forest monkeys. Seasonal changes in the ecosystems and the annual
variations in the weather year after year influence their daily activity pattern.
2.2 ACTIVITY PATTERN

Primates normally begin their day early in the morning and retire to their sleeping
areas (usually trees, abandoned buildings, etc.) in the evening. Their major
activities that occupy them most of the day are eating, travelling and resting;
they have well defined areas through which they move in groups in search of
food and places to rest or sleep. Grooming, playing, fighting and mating activities
occupy a small fraction of their time budget. Of course, the amount of time they
spend in each of these activities varies according to the season, availability of
food, and the habitat occupied by them.
All primates have a home range or territoriality which they defend from other
groups. The neighboring groups actively defend the boundaries of their home
ranges. Ranges of non-territorial primates may overlap. At times, when different
groups occupying the same territory come face to face, an encounter occurs leading
to fight with the lesser dominant group yielding to the higher-ranking group.
25
Primate Study
2.3 SOCIAL ORGANISATION
Living in social groups is one of the significant characteristics of primates. They
solve their major adaptive problems within this social context. Social groups
among non-human primates probably formed due to two main selection pressures:
predation (gaining protection by living in groups) and group life (increasing the
efficiency in acquiring food sources in the forest). The richness of the environment
determines the composition of the population, a poor habitat supporting fewer
non-human primates than the richer one.
Many different patterns of social organisations exist among the primates. Usually,
the primate social group includes members of all ages and both sexes. This
composition does not vary significantly during the annual cycle.
The following are the main social groups that can be encountered among the
living primates:
v Solitary individuals, e.g. a mother and her dependent offspring, adult males
and adult females.
v Family, or monogamous pairs (a mated pair and their young ones).
v Multi-male groups (several adult males, several adult females, and their
young ones).
v Offspring and (perhaps) several non-sexually active females.
v Uni-male groups.
v Single male (or harem) groups (a single adult male, several adult females,
and their offspring).
v All female groups (several adult females and their offspring).
v All adult male groups.
These categories reflect the sizes of the social groups. But medium sized groups
of about a dozen individuals can have either one or several males. In any case,
groups of a given size need not have the same internal structure. This applies to
dominance hierarchies. For instance, in multimale groups of macaques and
baboons, there is a clear rank order among the adult males, whereas it is absent
in the multimale groups of spider monkeys and chimpanzees. Besides these,
there are other social groups such as foraging and hunting groups.
Group life is likely to increase competition for resources and any benefits of
groups must outweigh the costs of such competition. The nocturnal primates
live in monogamous family groups. They are not gregarious animals. The diurnal
species usually live in relatively large and stable groups. Most of the diurnal
species form sizeable groups.
For all primate species, the primary social link is the mother-infant bond. In
group living primates, relationships between females and successive generations
of their female off springs usually form the core of the group. Primate social
groups are stable only in a relative sense, as individuals migrate between them
when they become sexually mature. In most of the groups, males leave the group
whereas females remain behind.
26
Mating and Paternal Care Primate Behaviour
Mating and paternal care are the keys to successful reproduction. From amongst
the primates, females must make a substantial commitment of time and energy
to pregnancy and lactation once they have conceived. This naturally leads females
to emphasise parental care.
Females in Groups
The females generally protect themselves by living in groups. As a consequence,
the males usually compete for control over such groups of females. A single
dominant male might be able to keep other competitors away when groups are
small (e.g. less than 10 females) and thereby monopolise matings with the females
within the group. Primates living in more open country like the baboons and
macaques are exposed to much greater risks of predation and thus tend to live in
larger groups. As groups become large, a male cannot prevent other males from
joining his group. This also leads to competition for access to females for mating.
In large multimale groups like baboons and macaques, males are usually organised
in a dominance hierarchy. Most of the matings are generally performed by one or
two ‘top’ ranking males.
Home Range/Territory
This is an area in which the non-human primates normally confine themselves
for their day-to-day activity. This may or may not change during the individual’s
lifetime. The changes vary according to both the species and their sex. Home
range is often described as an area, which provides the animal or group of animals
with food.
Individuals or groups of most of the non-human primates actively defend part or

all of their home range against other members of their own species with displays,
vocalisations and interactions. On the other extreme, baboons have an extensive
overlapping area between their home ranges, within which groups usually avoid
each other. The degree of territoriality depends on the costs and benefits of
defending resources as in the case of scarce water resources, food resources, and
so on.
2.4 SO WHAT SORT OF BEHAVIOURS DO WE SEE

IN PRIMATES?
Social Grooming
Social grooming is a regular primate activity. Allogrooming (others) is an
important affiliative mechanism. It can be used to fortify links: subordinate
animals tend to groom more dominant ones; males groom females for sexual
access.
Social grooming is an important and a unique primate entity since it facilitates
social cementing of the organisation of the group. This activity eases the
interaction between the individuals where there is a possibility of friction and/or
aggression thus resulting in the establishment and/or strengthening of friendly
social relations among the animals within the group. It plays an important role in
the life of most of the non-human primate. It also helps in keeping the body
clean since it removes parasites and debris from the fur and the skin. 27
Primate Study Parental Care
An infant usually depends upon its mother for 2-6 months after birth for food,
etc., depending upon one’s size, etc. Most infants are usually carried by their
mothers for a further period of 6 to 12 months. The infants also depend upon
their mothers for support during fight or for protection against danger for another
3 to 4 years. Some females as among baboons and rhesus monkeys have longer
inter-birth intervals enabling the mothers to invest more time and energy in the
care of each infant.
Reproduction
In all primates, except for humans (and perhaps Chimpanzees), the females are
seasonally or cyclically receptive. This is usually associated with visual changes
such as genital swelling clearly indicating that the females are experiencing heat.
Pair bonding of any sort is rare among primates though Gibbons seem to be life-
long monogamists. Also some New World monkey groups such as marmosets
have only one reproductively active pair in any group. Chimpanzees have been
seen to have consortships of several weeks where copulation is frequent.
Mother-Infant Relationship
It has been observed that this mother infant bonding is required to allow the
infant to be able to interact properly as an adult. This attachment between the
mother and her infant which begins at birth itself is the most fundamental social
unit within the primate social relations and begins at birth itself. Infants are
mostly cared for by their mother. Primates learn what to eat, where to find food,
how to eat different foods, mating rituals, social structure, and females learn
maternal behaviour.
Dominance
Primates are mostly group-living animals and tend to form “dominance
hierarchies”. These hierarchies are also referred to as status rank. A dominant
individual always gets priority and even in a confrontation his is usually the last
word.
Animals higher in the hierarchy tend to displace lower ranked individuals from
resources like mates, space and food. The hierarchy is not a fixed one and depends
on a number of changing factors such as age, sex, body physique, aggression and
even intelligence perhaps.
Dominance serves to organise social interactions. Since the primates are born
within the group and grown therein, they learn the processes and norms of
behaviour by sheer observation. This helps in avoiding chaotic and unpleasant
situations within the group.
Males are generally dominant over females in most of the non-human primate
societies. Higher ranking males are also responsible for protecting the group,
particularly the females in estrus or with off springs, from predators or from
attack by other groups.
Aggression
Aggression is either intra- or inter-specific and is generally associated with one
or more of the following: competition for food, defense of an infant by its parents,
28
struggle for dominance or change in social status, failure to comply with signals,
the consort formation at oestrus, and changes in the internal biological state of Primate Behaviour
the animal. Aggression builds up spontaneously and must be released. It has
been shown that hierarchies are considered to reduce the amount of aggression
but when hierarchies are most rigid, aggression is most common.
Communication
The communication system of the non-human primates which includes scents,
body postures, gestures, and vocalisations as monkeys and apes is rather an
expanding field. From the human perspective, we often find it easier to associate
sounds with specific meaning, whereas among the non-human primates, gestures
and actions are often used. Presentation and mounting behaviour is often used to
diffuse potentially aggressive situations. Yawns exposing teeth are often threats,
like direct eye contact. Facial expression is important too. It’s very obvious in
chimpanzees: their expression often appears all too human-like, but other primates
also use stereotyped eyelid flashes or lip slaps.
‘Display’ communicates to other members one’s emotion such as greeting, fear,

threat, happiness, danger, pain, hunger, courtship etc., through a wide variety of
body movements, facial expressions, vocalisations and olfactory signals. A display
primarily communicates information that is useful to an individual of the group,
to the social group to which he belongs and to other species.
We have now familiarised ourselves with basic behavioural characteristics of

non human primates. Let us now examine the behavioural aspects of some
common non human primates such as Rhesus monkeys, baboons, presbytis and
great apes (Orangutan, Chimpanzee and Gorillas).
2.5 RHESUS MONKEY (COMMON MONKEY)

Hindus regard the rhesus monkey as God Hanuman and as such it is considered
as sacred in India. These monkeys are omnivorous feeders and often raid cultivated
fields and gardens.
Social Behaviour
They live in large multimale-multifemale groups. Macaques (rhesus monkey)
live in troops of varying sizes in which both males and females have well-defined
rank. Ranking females benefit from easier access to food and water, space, and
grooming partners. Their group sizes range from 5 to 80; at times groups as large
as 125 individuals are also encountered. Macaques have a variable social structure.
Matrilineal hierarchies are very strong. As in many Old World monkeys, females
get genital swellings when they are in oestrus (sexually receptive). This occurs
often in multimale groups. In this way, all the males become aware that the
female is for copulation. For this purpose, they compete with one another and
ultimately the stronger male will copulate with her.
After a conflict, they have a ritual reconciliation behaviour in which the

subordinate presents its hindquarters to the dominant, which clasps the presenter
by the rump. The dominant animal may present to a low-ranking individual to
reassure or pacify it. This eases the tension between individuals. Grin, teeth
chattering, and lip-smacking are other signs of submission. Grooming is a form
of social interaction that promotes appeasement and group cohesion. The teeth- 29
Primate Study chattering face is a greeting or appeasement signal. When attacked by a high-
ranking animal, a stump tail macaque may redirect its aggression by attacking a
nearby subordinate.
Sexual Behaviour
Male rhesus monkeys make intense sexual friends. Males, especially younger
ones, use a number of ritualised erotic “greeting” gestures with one another,
including embracing, face-licking or kissing, fondling or grabbing of the erect
penis, mounting and rump fingering.
Reproduction
Dominant males copulate with high-ranking females throughout their oestrus
cycles. When low-ranking males mate, they are often interrupted by the dominant
male; to avoid interruption, they mate while he is mating with another female
(www.cellar.org).
Vocalisations
The most common vocalisation of rhesus monkeys is a ‘coo’ used when
approaching other group members to avoid aggression and initiate grooming or
other friendly interactions.
2.6 PAPIO (COMMONLY KNOWN AS BABOONS)

Baboons have complex social systems. The average size for a baboon troop is
closer to 40-80 individuals (at times as large as 200 individuals). All live in a
multimale - multi-female social group. Males fiercely defend the group. Baboons
normally sleep in large troops, no matter what their foraging patterns are, in
some high place where they are protected from predators. Mutual grooming
functions as a strong social bond.
Dominance
All baboons have strong dominance hierarchies where ranks are inherited from
the females. Females outnumber male group members, though males tend to be
dominant, herding females around and determining their foraging direction. The
highest ranking male of the group is dominant over all other males and females.
There is a ranking system between the females that is established at birth. A
daughter assumes the rank just below her mother. The ranking of the females is
stable, where as that of the males frequently changes. The dominant male is
challenged by other males who want to be in the highest ranking position.
Males will often, though not always, live elsewhere. Male olive baboons use
infants as “social buffers” in dominance struggles. Males may change troops
more than once in the course of their lives.
Reproduction and Lifespan

Baboons attain sexual maturity from 3.5 to 6 years (approx) whereas the males
become mature when they are of 60 months. Oestrus cycles run roughly for 30-
35 days. Gestation time varies from 170-190 days with most falling around 180
days. Infants are born throughout the year. Baboons live around 35-45 years.
30
Communication Primate Behaviour
Baboons communicate through a variety of facial, gestural, postural, olfactory

and vocal means. Lip smacking is associated with affiliative behaviour.
2.7 PRESBYTIS (HANUMAN LANGUR)

Activity Pattern
The word “langur” means “long tail” in Hindi language. They are generally shy
creatures, spending most of their time in the trees, although some langurs spend
a major part of their time on the ground. Langurs are most active in the early
morning and late afternoon. They sleep in a shady grove during the hot midday
hours. Feeding occurs at dawn and again during the evening. The Hanuman
langur often feeds in troops, which contain males and/or females of various ages.
A troop of langurs returns to the same resting place every night. They sleep on
the extremities of branches, a precaution against large beasts of prey. Groups
may forage over several kilometers in the course of a day.
Their home range varies between .05-13 km for groups containing both males
and females, and 7-22 km for all-male groups. A portion of the home range is a
core area in which most of the time is spent.
Social Behaviour
Langur groups range between 13-37 individuals. But this can swell up to 125
when several groups gather at rich food areas. Groups usually consist of 8 - 125
individuals. Males without females form bachelor groups of 2-32. Langurs have
variable social structure: one male-multifemale, multimale-mutifemale, all
females with infants and adolescent males and females and all male groups.
Bisexual groups usually contain between 10 and 30 members – one adult male
besides adult females, young individuals of both sexes and infants. All male
troops are more variable in number, and comprise solely of adult and subadult
males. Larger groups may break into subgroups in some seasons. In the groups
with several males, the high-ranking males can mate with any female, while the
other males can only mate when they can sneak by the high-ranking males.
Females stay in the same home-range for their whole lives in association with
their mothers, grand-mothers, sisters, daughters and aunts. These home ranges
slightly overlap.
Reproduction
The young ones are weaned in 10-12 months. Female langurs become sexually
mature at 3-4 years, and the males at 4-5 years. They however do not mate until
they attain 6-7 years of age. Gestation lasts for about 190-210 days. Mothers
usually bear one infant at a time. The oestrus cycle is about 24 days long. But if
the infant is lost, cycles can resume within 8 days. The normal interval between
births is 15-24 months.
Infanticide
When a male takes over a troop, he will kill the infants to gain a reproductive
advantage. Normally, a female takes around nine months to wean her young one
and another year or so to be sexually receptive again. Infanticide serves to shorten
31
Primate Study this waiting period as females whose infants have been killed will be in oestrus
shortly. As such the new male will establish himself as the leader.
Locomotion
They move through the forest and on the ground quadrupedally. Langurs also
use a leaping gait on trees through the forest. Their tails can be up to three feet
long and are used as balancing rods (like a bamboo pole) for swinging in the
trees. Langurs can be entirely terrestrial or entirely arboreal depending on the
ecological situation. In areas where trees are scarce, the langurs adapts well to
life on the ground. When on the ground, langurs walk or run on all four feet. In
the trees, they are remarkably agile. Langurs can jump horizontally from 3-5 m.
The grasping capacity of their hands and feet allows them to move on the trees at
great speeds.
Communication
Presenting behaviour is performed by the female to elicit copulation from the
male. From this condition the male understands that the female is ready for
copulation. Head-shaking precedes the display of the female presenting behaviour.
In the morning, the resident male in a group of females gives long-distance shouts,
viz., whoop, whoop! They produce a variety of sounds, e.g., a joyous “whoop”,
a guttural alarm, and a booming whoop.
Lifespan
Langurs can live up to 20 years in the wild and about 25 years in captivity.
2.8 LESSER APES (SIAMANGS AND GIBBONS)

The lesser apes are monogamous and live in small stable family groups consisting
of an adult male and an adult female (for life) and their immature off springs.
Unlike great apes, these lesser apes do not make sleeping nests. They simply
sleep (in sitting posture) between the forking branches of the trees.
They have a throat pouch (also known as gular sac) which enables them to make
louder calls. This hooting can be heard up to longer distances (approx 2-3 kms)
through the dense rain forests. These apes in the morning make loud territorial
hooting calls and menacing gestures signaling their presence in the area. Such
calls warn others to stay away from their territory particularly from the local
fruit trees. These diurnal apes are otherwise quite social animals. They are
territorial and emigrate from their natal groups around adolescence.
2.9 GREAT APES: ORANGUTANS

Orangutans are the largest and rarest of the great apes. They are found in the
tropical rain forests of Borneo and Sumatra in the southeastern islands of Asia.
Males often grow to over 150 pounds with a high degree of sexual dimorphism.
They are arboreal and good climbers having much longer arms than legs. But on
the ground, they have an obliquely quadrupedal mode of locomotion, generally
knuckle walking.
32
Orangutans are intelligent, peaceful and predominantly frugivores. Adult males Primate Behaviour
and females forage independently in their habitat.
Social Behaviour
Orangutans have little social organisation, their maximum group size being the
mother with her infant. A couple may have brief associations when the female is
in oestrus. A few orangutans may congregate at a good fruit tree. Orangutan
adult males mostly lead a solitary life, except when they copulate with females.
This is probably because their food is scattered thinly throughout the rain forest.
Further they need lots of food owing to their being large creatures.
Their population densities range from 0.2 to 5.0 individuals per sq km. Local
variation has been reported in the social structure of the orangutans. Adult males
occupy larger home ranges than adult females and are hostile to one another.
Males’ home ranges are often 2 - 6 sq. km. in size, and overlap the ranges of
several females.
To avoid violent disputes, males make distinctive ‘long call’ unique to orangutans
which produces a booming sound that can be heard up to 1km away. In this way,
males avoid each other.
Orangutans are active during the day and are almost exclusively arboreal. They
forage in the early morning, resting during the midday heat and resume their
activity in the afternoon. They live alone in large territories probably due to their
eating habits.
Orangutans also construct a sleeping nest high up in the trees to rest at night. But
only the lighter female and juveniles do this. The heavier males usually sleep on
the ground. Each night, they construct nests out of leaves and branches. The
nests are of a platform style ranging from 40 to 60 feet high in a tree.
Reproduction
Orangutans have a very low reproductive rate. They mature and become capable
of reproducing when they are 7 to 10 years old by which time they attain their
adult size. The males however continue to grow until they are 10 years old and
do not have successful mating until they are about 14 years of age.
A female usually has her first infant at the age of 12-15 years. It gives birth to
one offspring at a time. They give birth once in every 3-8 years. Their gestation
period is 227 to 275 days (8 to 9 months). The young ones are not weaned from
their mothers until they are 3 ½ years old. The female orangutans have an estrous
cycle of about 30 days in length.
The male and female adults come together only for a brief period of courtship.
For purposes of mating, males prefer fully adult females. The choice of sexual
partners is very much a prerogative of females. When she is ready to mate, the
female listens to the loud calls of males following which she reaches out to one
of them for mating.
Mother - infant
Like human children, orangutan babies have to be taught everything that they
need to know to survive. Since males have nothing to do with the female after
mating, the mother takes the responsibility of teaching the infant. The mother
even feeds her baby pre-chewed food until it can eat on its own.
33
Primate Study A newborn orangutan weighs 2 kg and remains totally dependent on the mother
for the first 18 months. A female adult usually establishes a territory near her
mother often overlapping with hers. A male travels far away to establish a separate
territory.
Life Span
Orangutans live about 50 to 60 years in captivity while their life span in the wild
is only 40 to 50 years.
Locomotion
Orangutans have longer and more powerful arms than other great apes. Their
arms measure 2.2 m across in their outspread position. They are longer than their
height. In contrast, their legs are short and weak. Too heavy to brachiate, the
adult orangutans swing slowly, not letting go of a branch until they reach the
next branch. They usually move slowly and deliberately using all the four limbs.
Orangutans usually move in the forests by swinging from one branch to another
called brachiating. On the ground, they usually walk on all fours. Though they
have really mobile joints, they do not really swing like the gibbons. It is more
like climbing with four hands. Adult males get so big that they sometimes have
to get down and walk from one tree to the next!
As one of man’s closest relatives, the orangutan (Asiatic great ape) or commonly
referred to as ‘man of the forest’, is a severely endangered species.
Communication and Vocalisation

Orangutans are quieter but make very long, loud calls that can be heard through
forests for up to 1 km for territorial and courting purposes. Males have a large
throat sac that lets them make these loud calls. They scream when scared, and
males sometimes roar.
Tool Use
Orangutans show a remarkable ability to arrive at certain trees just when their
fruit is ripening. Like other great apes, they have been observed to use tools but
less extensively than has been observed in chimpanzees.
They use sticks for digging and winkling out edible seeds from a spiny fruit
case, or use a stick even to hit a snake. They may also use sticks to fight each
other or scratch themselves.
2.10 CHIMPANZEE
Chimpanzees are diurnal, semi terrestrial and generally frugivorous. During the
dry season seeds, nuts, flowers, leaves, resin, eggs , etc., form the important food
resources.
Social Behaviour
Chimpanzees are social animals and are active during the day (diurnal). Their
social structure can be categorised as fusion-fission. They live in small, stable
groups (called communities or unit groups) of about 40-60 individuals who would
defend a common territory. Smaller subgroups of 6-7 chimpanzees stay together
34
for a while, with the membership changing over time. A 38 year long study in the
Gombe Stream Reserve revealed that the number of individuals in the main Primate Behaviour
study community ranged between 40 and 60.
Chimpanzees live in relatively large and complex social groups based on

permanent relationships among males. All chimpanzees are highly sociable.
Common chimpanzees live in loose, extended groups that may include more
than 100 animals. Social-bonding among them is not as strict or structured as in
gorillas and relations within a group are complex. It is hard to identify groups
because their members travel around individually, in pairs and other combinations.
But they usually forage alone.
Grooming one another (cleaning the hair of another chimpanzee) is an important

activity by which they maintain positive relationships. This kind of behaviour is
a major occupation among chimpanzees. Males do social grooming with a wider
range of individuals than females do. Grooming plays a vital role in establishing
and reinforcing bonds. Chimpanzees are particular about their territoriality.
Like other apes, they build bowl shaped sleeping nest in trees with leaves and
other plant material usually at a height of 6-25 m from the ground for safety
from predators. Every evening, chimpanzees construct a new “sleeping nest” in
the trees where they curl up and sleep. They use the same nest for several nights
if the troop is not on the move. They keep their nests clean. Each adult makes its
own nest, only young chimpanzees share their mother’s nest, until the next baby
is born.
Dominance
Within the community, there is a linear hierarchy with one of the males emerging
as number one (or alpha). All adult males dominate all females. The males of a
community regularly patrol their boundaries. Adolescent females may migrate
into a new community permanently. When they become pregnant, they move
back to their own natal group.
Hierarchy is based on age and size as well as on alliances and friendships. A

male chimpanzee gains rank or dominance on the basis of his mother’s higher
rank. In such fluid communities, aggressive behaviour is common which seldom
results in outright violence.
Male chimpanzees proclaim their dominance with spectacular charging

displays during which they may hurl themselves along the ground, or stand
upright, slap their hands, stamp their feet, drag branches, or even hurl rocks
(www.janegoodallug.org).
Sexual Behaviour
Mothers engage in sexual activity fairly often with their infants. Young females
typically experience a one-to-three year period of long adolescent sterility
following their first menstruation. During this period, they mate heterosexually
without conceiving. Incestuous matings between adults are not common
(www.forum.philosophynow.org).
Reproduction
There is no distinct breeding season among chimpanzees. They mate whenever
a female ‘comes in season’ whereupon she develops massive pink swellings on
35
Primate Study her hind region lasting two to three weeks or more and occurring every four to
six weeks. This condition is an invitation for males for copulation. Chimpanzees
attain full growth and are able to reproduce by the age of 12-13 years. Female
chimpanzee’s pregnancy period lasts 8.5-9 months. They usually have a single
baby at a time; twins are rare. The female gives birth once every 4 to 5 years. The
gestation period ranges from 230 to 250 days (8 to 9 months). The females are
good mothers and raise their young ones alone.
Infanticide
Infanticide is common among them. This generally happens when there is a
change in the leadership as it immediately leads to the weaning females coming
in estrus; thereby the new leader can have sexual relationship with the adult
females to raise his own offspring.
Tool Use
Chimpanzees have opposable thumbs (although much shorter than the human
thumb) and opposable big toes capable of a precision grip, which enables them
to use tools especially in extracting ant and termites out of a mound and or a
ground as also to crack open nuts with a stone using a hard platform. Chimpanzees
have been observed to use sticks to obtain ants and termites to eat and to scare
away intruders. They also use chewed up leaves as a sponge to sop-up water to
drink.
Life Span
Chimpanzees live about 50 to 60 years in captivity while their life span in the
wild ranges from 35-40 years. Like most animals, they survive for longer period
in captivity.
Locomotion
Chimpanzees’ arms are longer than their legs which enable them to reach out to
fruits growing on thin branches that would not support their weight. This also
helps them climb trees and brachiate (swing from branch to branch by their
arms). Chimpanzees can also walk upright (on the two legs in the bipedal
position), when carrying something in their hands or when looking over tall
grass.
Chimpanzees are known as “knuckle walkers” because they place their soles
and the back of the finger joints on the ground. They are terrestrial creatures.
While most primates walk on the flats of their hands, chimpanzees walk on their
knuckles with their hands turned over. This type of walking is typical of not only
chimpanzees but also of gorillas. Chimpanzees usually walk using all fours (on
the soles of feet and the knuckles of their hands).

Chimpanzees have complex communication methods involving facial
expressions, gestures and calls. Their crying calls warn other chimpanzees of the
likely danger in the area. Such danger calls can be heard through the forest for
about 2 miles (3 km). When they spot food in abundance, chimpanzees bark
loudly to call others in their group to a feast.
36
The intra-group communication is mostly achieved through posture, gesture or Primate Behaviour
facial expression, and submissive signals of crouching, presenting the rump and
holding the hand out accompanied by pant-grunts or squeaks.
2.11 GORILLA
These are the largest of the primates in the world weighing up to 400 pounds.
Their build is much heavier than that of chimpanzees. Further, they have big
canine teeth and much larger stature. They are diurnal, terrestrial apes. Some of
them prefer arboreal climbing. Gorillas possess widely set and deeply sunken
eyes and flaring nostrils. They inhabit lowland and montane forests with a
discontinuous distribution in equatorial Africa.
Ecology
Gorillas are mostly folivorous. They eat fruit, leaves, bark, ants, and bamboo
shoots. They never eat all the leaves from a single plant. Instead, they leave
plenty of leaves so that the plant can replace the leaves quickly.
Activity Pattern
The activity pattern of the gorillas depends upon the food availability, social
conditions and their reproductive status. Gorillas are shy, social animals and are
most active in the morning.
Gorillas are active during the daytime. They wake up just after sunrise (troop
rises between 6 A.M. and 8 A.M.) and search for food such as leaves, buds,
stalks, berries, bark and ferns, which they consume and rest and relax. During
midday, adults usually nap while the young play games. Gorillas do not appear
to drink water but derive the same from their juicy diet. They feed again in the
afternoon, finally retiring for the night in nests made of twigs and leaves. Unlike
the chimpanzees, they construct nests of leaves on the ground for sleeping at
night.
Home Range
Gorilla groups wander about within a home range of 10 to 40 sq km (4 to 15 1/
2 sq mile), which is not defended or marked at the boundaries. Some conflicts
may arise with neighboring groups, but encounters are generally avoided by
communications such as drumming on the ground from a distance.
Social Behaviour
Gorillas live in structured family groups with a polygynous mating pattern. The
gorilla’s social system is usually composed of a single adult male with multiple
females. They live in small groups (bands or harems) consisting of close family
members and other relatives (6–7 individuals) that may number up to 30
individuals. The adult females maintain hierarchy within the group which they
pass on to their offspring.
A typical harem is a closely-knit group including a dominant male, one or two
subdominant males, and several mature and young females. Some groups may
contain only the dominant male, two or three females and the young. males are
normally driven out of a harem once they reach an age of 11-13 years. Males
may form all male groups or travel lonely until the opportunity to start their own
harem arises. 37
Primate Study Dominance
The gorilla is essentially a peace-loving creature that would rather retreat than
fight except in circumstances when its life is threatened and retreat is impossible.
However, once provoked, an adult male will attempt to intimidate his aggressor
by standing on his legs and slapping its chest with cupped hands, simultaneously
roaring and screaming. Adult males perform elaborate displays, including chest
beating, running sideways and tearing up vegetation to frighten an intruding
male or similar other threat. Males also use these displays as a show of dominance
within the group. Adult females can become aggressive while defending their
infants, or while helping each other to drive out rowdy, young adult males. The
dominant male leads the family group and decides where the members should
feed and sleep. Females are strongly bonded to the male.
Grooming
Grooming one another (cleaning the hair of another gorilla) is a major occupation
among gorillas in a band. Female gorillas not only groom their offspring but also
one another and the dominant male. Unlike most other primates, each gorilla
takes care of its own toilet routine. Mutual grooming is quite rare among the
gorillas.
Reproduction
Females reach sexual maturity during 6-9 years of age. Males become sexually
mature in the wild between 8 and 9 ½ years of their age and in captivity as early
as 6 ½ years. Males are not considered fully mature until they become about 15
years old. The oestrus cycle lasts 26-30 days. Gorillas do not have a distinct
breeding season. Gestation lasts from 250 to 285 days. In the wild, female gorillas
usually deliver their first offspring at their age of 10½ years old and subsequently
at four-year intervals.
Locomotion
Gorillas walk in an obliquely quadrupedal mode of locomotion by actually using
their knuckles to support part of their weight. However, they do stand erect on
occasions. Gorillas perform knuckle-walking by using both their legs and long
arms. They can climb trees but do not do so very often because of their heavy
weight.
Gorillas generally communicate with each other using many complicated sounds
and gestures. Some of their gestures range from chest-beating, high-pitched barks,
lunging, throwing objects to staring, lip-tucking, sticking out the tongue, sideways
running, slapping, rising to a two-legged stance, etc.(www.animalcorner.co.uk).
2.12 MAN AND OTHER PRIMATES

Macaques are the favorite animals for laboratory tests. Tests on the rhesus macaque
resulted in the discovery of the Rh (rhesus) factor in 1940. This is a hereditary
blood antigen. When Rh and non-Rh blood samples are mixed during blood
transfusions, fatal reactions can occur. The crab-eating macaque was the clinical
test animal for the development of the polio vaccine.
Orangutans have senses very similar to ours, including hearing, sight, smell,
taste and touch.
38
Chimpanzees on occasions exhibit such behaviours as group hunting, food sharing Primate Behaviour
and tool making which were once considered as the exclusive trait of humans.
These behavioural traits suggest close anatomical and behavioural kinship
between Homo sapiens and chimpanzees. They have senses very similar to ours,
including hearing, sight, smell, taste and touch. Chimpanzees are very intelligent
and can learn even extremely complex tasks. Chimpanzees are the most violent
primates besides humans!
It is hardly impossible to emphasise the importance of friendly physical contact
in maintaining good relationships among chimpanzees. Social grooming is one
remarkable trait which is probably the most important social behaviour (in humans
as well), serving to maintain or to improve friendships within the community as
also to calm nervous or tense individuals.
2.13 SUMMARY
Non human primates are referred to as Man’s closest relatives. Therefore, in
order to understand Man’s changing behaviour and emotions, etc., under different
conditions, it is important to study the behaviour and social structure/organisation
of non-human primates, man’s closest relatives, and then extrapolate that to MAN.
In this Unit, we briefly discuss the behaviour of our closest relatives, i.e. the
non-human primates.
Major activities that occupy these primates most of the day are eating, traveling
and resting, grooming, playing, fighting and mating activities.
For all primate species, the primary social link is the mother-infant bond. In
group living primates, relationships between females and successive generations
of their female off springs usually form the core of the group.
We find in this unit that the frequently observed primate activity is social
grooming. It helps to strengthen links. The mother-infant relationship is the most
fundamental social unit within the primate social relations and begins at birth
itself.
Primates are mostly group-living animals and tend to form “dominance
hierarchies”. These hierarchies are also referred to as status rank. Dominance
serves to organise social interactions. Since the primates are born within the
group and grown therein, they learn the processes and norms of behaviour by
sheer observation. Aggression is either intra- or inter-specific.
In this Unit, it is observed that the primates have a very interesting system of
communication amongst themselves. For example, ‘display’ primarily
communicates information that is useful to an individual of the group, to the
social group to which he belongs and to other species. This mode of
communication conveys to other members of the group, one’s emotion such as
greeting, fear, threat, happiness, danger, pain, hunger, courtship, , etc., through a
wide variety of body movements, facial expressions, vocalisations, and olfactory
signals.
Macaques are the favorite animals for laboratory tests. Tests on the rhesus macaque
resulted in the discovery of the Rh (rhesus) factor in 1940.
Baboons have complex social systems. They live in a multimale - multi-female
social group. Baboons normally sleep in large troops, no matter what their foraging
patterns are, in some high place where they are protected from predators. Mutual
grooming functions as a strong social bond. 39
Primate Study The word “langur” means “long tail” in Hindi language. They are most active in
the early morning and late afternoon. Feeding occurs at dawn and again during
the evening. Langur groups may forage over several kilometers in the course of
a day. A troop of langurs returns to the same resting place every night.
The lesser apes (siamang and gibbon) are monogamous and live in small stable
family groups consisting of an adult male and an adult female (for life) and their
immature offsprings. Unlike great apes, these lesser apes do not make sleeping
nests. They simply sleep (in sitting posture) between the forking branches of the
trees (www.miamimetrozoo.com).
Orangutans, the largest and rarest of the great apes, have senses very similar to
humans, including hearing, sight, smell, taste and touch; are usually frugivores.
Chimpanzees are diurnal, semi terrestrial and generally frugivorous. During the
dry season seeds, nuts, flowers, leaves, resin, eggs etc. form the important food
resources. Chimpanzees on occasions exhibit such behaviours as group hunting,
food sharing and tool making which were once considered as the exclusive trait
of humans. Gorillas are the largest of the primates in the world weighing up to
400 pounds. They are diurnal, terrestrial apes. Some of them prefer arboreal
climbing. Gorillas possess widely set and deeply sunken eyes and flaring nostrils.
These behavioural traits speak of the close anatomical and behavioural kinship
between man and chimpanzees. These non-human primates have senses very
similar to ours, including hearing, sight, smell, taste and touch. Chimpanzees
are very intelligent and can learn even extremely complex tasks but are the most
violent primates besides humans!
2.14 GLOSSARY
Alpha male/female : highest ranking individual within a dominance
hierarchy.
Arboreal : tree dwelling.
Affiliative behaviour : behaviours which promote group cohesion (friendly/
positive gestures), e.g. grooming, touching, and
hugging
Brachiation : locomotion by arm swinging.
Crepuscular : active during twilight hours.
Diurnal : active during day time.
Dominance : ability to intimidate others.
Estrus : period in which an adult female is sexually receptive.
Frugivorous : fruit eating.
Gestation : conception and development of young one in uterus.
Grooming : cleaning of body surface by licking, nibbling, picking
with fingers or kind of manipulation.
Home range : area of land used.
Infanticide : killing of infants.
Mating : having sex.
Matrilocal : residence with mating female.
40
New World : American mainland. Primate Behaviour
Nocturnal : active during night.

Old World : Europe, Africa and Asia.
Patrilocal : living with male.
Perineal : area in between anus and the pubic arch.
Quadrupedal : walking on four limbs.
Rank : position or status in hierarchy.
Reproductive success : number of surviving offspring of an individual.
Sexual dimorphism : difference in the body size and form of the males and
females.
Terrestrial : living on ground.
Territory : area which is exclusive and defended.
Weaning : gradually stop breast feeding.
References
www.animalcorner.co.uk accessed on 21-03-2011
www.cellar.org accessed on 30-05-2011
www.forum.philosophynow.org accessed on 11-02-2011
www.janegoodallug.org accessed on 16-02-2011
www.miamimetrozoo.com accessed on 02-05-2011.
Suggested Reading
Bramblett, C.A. 1976. Patterns of Primate Behaviour. California, Mayfield
Publishing Company.
Kummer, H. 1971. Primate Societies. Chicago, Aldine Publishing Company.
Nelson, H. and R. Jurmain 1988. Introduction to Physical Anthropology. New
York, West Publishing Company.
Seth, P.K. and S. Seth 1993. Structure, function and diversity of Indian rhesus
monkey. In New Perspective in Anthropology Ed. P.K. Seth and S. Seth. New
Delhi, M.D. Publications Pvt Ltd. pp 47 – 82.
Sample Questions
1) How does home range influence behaviour of primates?
2) What is the role of a female in estrus within the social structure of the group?
3) How do sleeping sites, food, and water resources affect the social structure
of primates?
4) Compare and contrast the social behaviour of rhesus monkey and apes.
5) Write short notes on
a) Territoriality
b) Dominance and aggression
c) Prosimians and insectivores.
41
Primate Study
UNIT 3 PHYLOGENY OF LIVING PRIMATES
AND PRIMATE ANATOMY
Contents
3.1 Introduction
3.2 Biogenetic Basis of Phylogeny of Living Primates
3.2.1 Immunological Techniques
3.2.2 Molecular Approach
3.2.3 DNA Hybridisation
3.2.4 Mobile DNA Elements Approach
3.3 Comparative Anatomy of Man and Apes
3.3.1 Skull
3.3.2 Spine
3.3.3 Pectoral Girdle
3.3.4 Pelvic Girdle
3.3.5 Lower Limbs
3.4 Hominization
3.4.1 Skeletal Changes Due to Erect Posture and its Implications
3.5 Summary
3.6 Glossary
References
Suggested Reading
Sample Questions
Learning Objectives
&
Comparative anatomy and fossil records for constructing phylogenies are very
important for paleontologists. The development of sophisticated techniques in
the field of modern genetics has facilitated in the endeavor. After you have read
this unit you will follow the
Ø biogenetic basis of phylogeny of living primates; and
Ø comparative anatomy of Man and Apes.
3.1 INTRODUCTION
Before the development of sophisticated techniques in the field of modern
genetics, paleontologists had to depend on comparative anatomy and fossil records
for constructing phylogenies. Sometimes the interpretation of the fossils varied
so much that instead of one phylogeny there could be two or more.
But now majority of the paleontologists and biological anthropologists

agree that genetic data of the living primates offer useful information for
constructing their phylogeny.
Anatomy refers to observation and description of the structures of animals. Hence,

the comparison between man and apes will be based on all the structures of their
42 body.
Phylogeny of Living
3.2 BIOGENETIC BASIS OF PHYLOGENY OF Primates and Primate
Anatomy
LIVING PRIMATES
New researches in molecular genetics have influenced many disciplines. Its
application in Physical Anthropology has led to a better understanding of human
evolution. And as such the pre-molecular evidence (based on physical
characteristics) has been replaced by post-molecular evidence. The following
discussion is related to the latter.
3.2.1 Immunological Techniques

During the early 1960s it was Morris Goodman who developed immunological
tests to establish the close genetic relationships among humans, chimpanzees,
and gorillas. The technique involved production of antisera by injecting an animal
with protein (albumin) from another species. The antisera produced in this way
contained antibodies of the foreign protein which was injected. The cross reaction
is done between the antiserum and the immunological protein, i.e., homologous
antigen. Similarly cross reaction is also done between the antiserum and the
protein of other species, i.e., heterologous antigens. It was observed that greater
the similarities in the immunological properties of the two species, the greater
the reactions are. That is how Goodman showed that immunogically there is
greater similarity between African apes and man than between Asian apes and
humans.
3.2.2 Molecular Approach

During 1966 and 1967 Sarich and Wilson carried out more elaborate
immunological experiments. The results they got supported Goodman’s findings
and also enabled them to construct a molecular clock. They injected human
albumin into rabbits which produced antihuman albumin. When this antihuman
albumin was brought in contact with human albumin the reaction was very strong
and same was the case with chimpanzee albumin, while with monkey albumin
the reaction was weaker. This shows that the degree of cross reaction depends
upon the number of amino acid differences between the homologous albumin
(the albumin injected) and the heterologous test albumin. Sarich and Wilson
thus established that closer the genetic relatedness of two species, the antigens
of one will cross react with the antibody of the other antiserum.
Sarich and Wilson (1971) concluded that man, gorilla and chimpanzee last shared
a common ancestor five million years ago. In their further research of 1995, they
suggested that chimpanzee and man might have shared a period of common
ancestry after the split of gorilla line.
Yunish and Prakash (1983) in their comparative analysis of high- resolution
chromosome suggested that the taxonomic scheme of man and apes should be
revised. The taxonomists’ classification of two families-Hominidae for man and
Pongidae for apes be changed to two subfamilies-Hominae for man and large
apes and Ponginae for Orangutan. This kind of classification instead of solving
the problem generated controversy. The protein-enzyme nucleic acid analysis
based biomolecular evidence, showing similarities between man and African
apes of Chimpanzee and Gorilla, has been found to be of primitive retentions of
earlier inheritance from the common hominid stock as shown by works of Mai
(1983), Kluge (1983), Schwartz (1984) and a host of others on the chromosome
number and karyotyping variability. 43
Primate Study But to suggest the revision of the taxonomic scheme of man and apes on the
basis of comparative analysis of chromosome alone is a far fetched idea. It is
well established fact that the family Hominidae contains single genus Homo and
single species Homo sapiens. There are many characters supporting the influences
of the family in the Primate order. Needless to say that “Man the tool maker” is
the only culture-creating, culture-retaining, culture-transmitting creature with a
complex brain and articulate speech in the animal kingdom.
3.2.3 DNA Hybridisation

Besides the above approaches there is DNA comparison based on hybridization
technique. In this technique single stranded DNA of one species is allowed to
seek out its complement in the single stranded DNA of another species. DNA
strands can be separated and combined in the laboratory. When the DNA
sequences of two species are similar, the bonds that develop will be stronger but
when the sequences are different the bands will be weak. If the bonded pair is
strong the temperature is also high. Examination of the hybrid strand shows that
a double strand composed of one human and the chimpanzee strand is 97.5% fit
and 2.5% amino acid sequences are different. It indicates that they have descended
from a common ancestor and the minor difference in their DNA might have
been due to changes since the time of their separation.
3.2.4 Mobile DNA Elements Approach

Mobile DNA elements are distinct DNA sequences that have remarkable ability
to transport or duplicate the other regions of the genome.
It has been observed that nearly 50% of the primates genome is made up of
mobile repetitive DNA sequences such as Alu and LINE elements. The causes
and evolutionary consequences of these mobile elements have been studied during
the last decade.
Due to their distinctive mutational mechanism, these elements are exceedingly

useful in constructing phylogeny particularly human-chimpanzee-gorilla
trichotomy as well as that of New World Primates.
Without going into the details of the two different types of mobile DNA elements
(DNA Transposons and DNA Retrotransposons), let us examine the role of
Alu elements which are primate specific. Alu elements have been extensively
used in primate phylogenetic studies.
Human-Chimpanzee-Gorilla Trichotomy
According to Paterson et al. (2006), the relationship among humans, chimpanzees,
and gorillas have been a difficult and long standing problem. Several studies
have tried to resolve this problem. Though the mtDNA studies by Horai et al.
(1965) support chimpanzee as nearest living relative of humans, Satta et al. (2000)
who analysed the sequences from 45 nuclear loci found that 60% of the loci
support human-chimpanzee relationship. Salem et al. (2000) analysed 117 Alu
Ye subfamily and 16 loci from Alu Y subfamily. They found a single most
parsimonious tree with high levels of support. The resulting tree clearly clusters
human and chimpanzee as a sister clad with gorilla as outgroups.
44
Phylogeny of Living
3.3 COMPARATIVE ANATOMY OF MAN AND Primates and Primate
Anatomy
APES
Comparative anatomy is one among many branches of Comparative Biological
Sciences such as comparative physiology, comparative embryology, comparative
biochemistry, and so forth. Comparative method is widely used by scientists in
their fields of specialization.
3.3.1 Skull
It consists of two parts – Cranium and Face.
Cranium is a more or less dome shaped case which contains the brain.
Face consists of the upper and lower jaws, the cheek and the nasal bones. Between
the face and cranium are the orbits.
The great size of the cranium and reduction of the face are the characteristics of
man. In apes the face is very large and heavy whereas cranium is proportionately
very small. In man the face is not only small but it does not project beyond the
cranium. Hence the skull is orthognathous (orthos- straight, gnathous – jaw).
On the other hand, the large face and jaws project in front of the cranium and
form a snout. It means that cranium is placed behind the face instead of over it
and as such the skull becomes prognathous.
Supra orbital torus Sagittal Crest

Cranium
Face
Orthognathous
Prognathous
Ape
Man
Fig.3.1: Lateral view of human and ape skulls
In man, the cranial capacity is larger because of the larger dimensions in length,
breadth and height than that of the apes. The average cranial capacity in man
varies from 1000 cc to 1400 cc. The average cranial capacity of adult gorilla
varies from 540 cc to 600 cc; in chimpanzee it is between 420 cc to 500 cc and in
orangutan it ranges from 450 cc to 550 cc. The smallest cranial capacity of 100
cc is found in the gibbon.
45
Primate Study The roof and the sides of cranium constitute the vault. The vault of the human
skull is smooth and convex in the frontal, occipital and parietal regions which
overlie the corresponding regions of the brain associated with intelligence, vision
and sense of touch and control of muscles. The vault of the ape skull lacks these
convexities also known as eminences or bumps.
The bones in the vault of human and ape skulls are firmly joined together. The
frontal bone of the forehead makes contact with the occipital bone of the back.
There are two parietals between these two, one on each side of the midline on
the top of the skull. There are two more bones namely the temporal and the
sphenoid which complete the side of the vault. The junction along the edges of
these bones is marked by line known as sutures. There are many sutures such as
coronal suture between frontal and parietals, lambdoid between occipital and
parietals, squamous between temporal and parietal where the former overlaps
the latter, sagittal between the two parietals in the midline at the top of the skull,
and spheno-temporal between temporal and sphenoid. These sutures are clearly
seen in man but tend to cynostose (fuse) in old age and become completely
obliterated. In apes the sutures are not easy to see.
Sagittal suture
Coronal suture
Sphenoid frontal PARIETAL

suture FRONTAL
Spheno-parietal suture
Squamous suture
Orbit
SPHENOID
TEMPORAL
Lambdoid suture
Sogebi0tenoirak sytyre
Nasal
bone
ZYGOMATIC
OCCIPITAL
MAXILLA
Occipito-mastooid
Ramus
MANDIBLE
Chin Body
Fig. 3.2 : Lateral view of human Skull
46
Phylogeny of Living
Primates and Primate
Anatomy
FRONTAL
PARIETAL Orbit
TEMPORAL
ZYGOMATIC BONE
Nasal bone
MAXILLA
MANDIBLE
Fig. 3.3: Frontal view of human skull
The differences between man and ape skulls are prominently marked in the
development of ridges and the areas for the attachment of neck and masticatory
muscles. In man the side of the vault has extensive flattened area known as
temporal fossa for the attachment of temporal masticatory muscles. These muscles
extend from the side of the cranium to the lower jaw. They help the jaw in moving
up and down and sideways during mastication. The temporal fossa in apes is
much larger than in man. Because of the large size of jaw and teeth, the temporal
fossa in apes has to provide greater surface for the attachment of the masticatory
muscle. The line of its attachment known as temporal line rises right up to the
top of the skull where it meets the midline and forms a vertical crest called the
sagittal crest. This crest joins a transverse crest called occipital crest in the
posterior region of the skull.
The frontal bone in man has two eminences, one on each side and the forehead is
vertical, whereas in apes there are no eminences and the forehead is flat and
retreating. There are two conical cavities which accommodate the eyeballs. These
orbital cavities are connected with the temporal region in man by two narrow
spaces, one between the zygomatic (malar) and sphenoid bones and the other
between the zygomatic and maxillary. The orbital cavities are large and almost
completely shut off from the temporal fossa by the extension inwards of the
zygomatic bone.
The frontal bone forms the upper border of the orbits and in between them it
makes sutural contact with the nasal bones. The upper border is curved and
thickened known as supraorbital ridge. In man, the two supraorbital ridges may
not be prominent. They are separated from the midline by a depressed area. The
supraorbital margins are very strongly developed in apes but in gorilla they are
massive and form a continuous supraorbital torus. In orangutan this torus is
conspicuous but not massive.
The occipital region in the back of the skull forms the vault and also enters into
the part formation of the base. The vault portion in man is smooth and bulging
and the basal portion is less bulging. The occipital bone in the apes is less convex
and less uniform in outline and the rough muscular portion is flattened and looks
backwards and downwards. The external occipital curve line is raised into a
prominent occipital crest which is joined by the sagittal crest. As compared to
47
Primate Study man, the ape’s skull is large and projecting and is ill balanced on the vertebral
column. The muscular area has to be extensive in the occipital bone. At the base
of the skull, there is a large opening through which the spinal cord passes into
the vertebral column. Because of the bulge of occipital bone, there is a
considerable extension of the base of the skull behind the foramen magnum in
man and as such its position is relatively forward. Since there is reduction in the
occipital bulge in apes, the base becomes small and so the foramen is placed far
back and faces downwards.
Fig. 3.4: Basal view of Human and ape skulls
The face consists of upper jaw formed by two symmetrical bones joined together
in the lower part to form the palate. It has several processes. Its frontonasal
process connects the maxilla to the frontal bone and also supports the nasal
bones. In apes, it is stronger and shorter than in man and acts as a buttress. The
lower curved margin of the maxilla is the alveolar process which bears the teeth.
It is stronger and larger in apes than in man because of the larger teeth.
The zygomatic or the malar bone supports upper and outer part of the cheek on
each side and joins (connects) the maxilla to the cranium on the outer side of the
orbit. It acts as a buttress or support and conveys pressure forces up to the base
of the skull. It is very stout in apes as it has to support the strains (pressure)
produced during mastication by the heavy jaws. The palatal processes of the
maxillae form the hard palate which separates the mouth from the nose and
forms the roof of the mouth and the floor of the nasal cavity. The only difference
between man and apes is that the premaxillary part of the palate is fused with
maxilla in the former whereas it is separate in the latter. The upper surface of the
maxilla extends as the orbital process under the eye. The alveolar process shows
a number of vertical ridges raised by the roots of the teeth and one of these near
the margin of the nasal aperture is prominent. This is the canine ridge. The ridges
are more prominent in apes than in man because of the larger roots of the teeth.
The zygomatic bone connects the upper jaw to the base, and medially and below
it is continuous with zygomatic process of the maxilla. The inner process of the
zygomatic bone meets the angular projection of the frontal bone while the outer
process extends to meet a similar process of the temporal bone across the temporal
48
fossa. This is how the zygomatic arch is formed. In apes we find the same Phylogeny of Living
processes as in man but they are shorter and stronger. The zygomatic arch is also Anatomy
shorter.
The paired nasal bones are raised above the level of the face and meet in the
midline. They are in contact with the maxilla on each side and meet the frontal in
the upper end. The lower ends widen out to form the nasal aperture. In apes the
nasal bones are not raised above the level of the face as they are flat and thus
there is no nasal bridge, a prominent feature of nasal bones in man.
The lower jaw or the mandible has two symmetrical halves which become fused
early in infancy. The junction of the two halves in the midline is known as
symphysis menti or mental symphysis (joint of the chin). The bodies of the
mandible (i.e., the two halves) diverge backwards from the symphysis. The
mandibular body accommodates the teeth of the lower jaw. The ramus of the
mandible is a broad flat plate of bone which turns up from the posterior of the
body. The upper part of the ramus is separated into two processes by a depression
known as sigmoid notch. The anterior coronoid process gives attachment to the
temporal muscles where as the posterior process or condyle fits into a fossa on
the undersurface of the squamous portion of the temporal bone to form the
temporo-mandibular joint. The backward divergence of the bodies of the mandible
and the chin are characteristic features of man. The general description of the
mandible of apes is same as that of man but there are differences between them.
In apes, the body of the mandible is heavier and the two halves are parallel.
There is no mental eminence. The two halves of the body at the symphysis are
buttressed behind by a bony bar called simian shelf. The ramus is also wider
than in man and the sigmoid notch is shallower.
Fig.3.5: Dental Arch in Man and Apes
There are three parts of a tooth. The crown is above the gum, the root fits into the
socket of the alveolar hard enamel material. The neck is the slightly constricted
region between the crown and the root.
According to the shape, special functions (cutting, grinding) and location in the
jaws, the teeth are classified as incisors, canines, premolars, and molars. The
total number of teeth both in man and apes is 32 represented by the dental formula
of 2123/2123. There are two incisors, one canine, two premolars and three molars
found in each half of the upper and lower jaws (8 x 4 =32). The teeth in apes are
much larger than in man.
49
Primate Study Incisors are sharp cutting or nibbling teeth in front. They are larger and clumsier
than in man. Canines are the tearing teeth. They are large and long with blunted
crown in man. In apes they are large and out of proportion of the adjacent teeth.
On account of great length, they are accommodated into the spaces of the upper
and lower jaws at the time of oscillation or closure of the jaws. The space is
known as diastema characteristic of simian dentition. Diastema between the
upper canines and the lateral incisors is present. The canines project forward and
are interlocked.
Premolars are also known as bicuspsids because they have two conical crowns.
They are also grinding teeth. In man, the upper premolars have two roots and the
lower ones possess only one root, whereas in apes the upper ones have three
roots and the lower ones have two roots. Molars are grinding teeth. In man they
have four dome shaped cusps on the upper and five on the lower molars. The last
molar is the smallest in the series. The molars of the apes have large well developed
cusps. The third molar is the largest in the series.
3.3.2 Spine
The spine is made up by a number of superimposed blocks of bone called
vertebrae. They form a vertical column supporting the head and the ribs. That is
why it has been named as vertebral column. The vertebral column protects the
spinal cord which is a downward prolongation of the central nervous system. It
represents a series of curvatures. These are cervical, thoracic, lumbar, sacral and
caudal or coccygeal. In man, the thoracic and lumbar curves are called primary
curves because they are the parts of the embryo. The cervical curve develops
only after birth when the head is lifted and the lumbar curve appears when the
trunk is raised as the child begins to walk. The curvatures in the cervical and
lumbar region are convex forwards, whereas in the thoracic and pelvic region
they are concave forwards. The cervical vertebrae are seven in number. They are
small and their spines are short and bifid. The first vertebra called atlas supports
the head and is modified to twist horizontally around the second or axis. The
rotation of the head takes place on the atlas and axis. The apes also have seven
cervical vertebrae which are proportionately larger than those of man. Their spines
are long and stout. The graceful hollow of the neck in man is filled up in the
apes.
The thoracic vertebrae are normally twelve but may be thirteen in number. The
thoracic vertebrae resemble those of man. The lumbar vertebrae also known as
lion vertebrae and are five in number in man but may be reduced to four or
increased to six. They are broad from side to side and rough. The lumbar vertebrae
in apes are very flat and broad.
The sacral vertebrae in the pelvic region are fused together to form a wedge
shaped bone. It lies in the posterior part of the pelvis where it is firmly attached.
The curvature or concavity of the sacrum is well developed. In apes this curvature
is less marked and the sacrum is narrower as compared to that of man.
The coccygeal vertebrae of the tail region are reduced to small plates of bone
hardly recognizable as vertebrae both in man and apes.
50
Phylogeny of Living
Anatomy
Fig. 3.6: Vertebral Column Curvatures
3.3.3 Pectoral Girdle

The bones of the pectoral girdle are the clavicle (collar-bone) and the scapula
(shoulder-blade). The clavicle is a long sigma-shaped bone. It is joined to the top
of the sternum by a movable joint and its other end meets the scapula. One can
feel it with the hand. In apes, the clavicle occupies the same position and
connections as in man. In gibbons, the clavicle is long and slender due to their
arm swinging mode of locomotion.
The scapula is flat and triangular in shape. It lies on the back of the shoulder
region. It is attached to the outer end of the clavicle and accommodates the head
of humerus in its glenoid cavity. The ape scapula has the same attachments and
shape as in man. It is narrower than in man.
3.3.4 Pelvic Girdle

The pelvic girdle is formed by two ossainnominata (hip bones). They have five
bones which are fused. The outer side of each hip bone has a cup-shaped cavity
called acetabulum which receives the head of the femur (thigh bone). The two
hip bones form a basin-shaped cavity closed by sacrum in the posterior region.
In man, this basin is wider specially in females as compared to males. The iliac
element of the hip bone is expanded. In apes, the pelvis as a whole is longer
because of the elongation of the ilium. The basin is also narrower than in man.
Fig.3.7: Pelvic Girdle of Man and Ape

Source: WKO-187-PF:Female Chimpanzee Pelvis and Femur (Museum Quality bone clones TM
Replica) 51
Primate Study 3.3.5 Lower Limbs
The lower limb of the body has the longest bone called femur (thigh bone). It has
a spherical head connected to the shaft through the neck. The femoral head fits
into the acetebulum of the os innominatum and the lower end with its two condyles
(knuckles) which are expanded into a broad base and enter into the knee joint.
This arrangement forms an efficient support for the body. In apes, the head of the
femur is not so extensive. The neck is shorter and at a less obtuse angle with the
shaft. The shaft is short and stout, and its lower end is less expanded.
In man, the tibia transmits the weight from the femur to the foot. The upper end
of the tibia is horizontally expanded to support the triangular shaft, whereas the
lower end is slightly expanded which rests on the talus, one of the tarsal bones of
the foot. The tibia does not enter into the knee-joint but articulates with outer
surface of talus. It acts like a spring-bone as it takes up the strain of the outward
bends of the foot at the ankle-joint.
The bones of the tarsus have adapted for bearing weight of the body. The
metatarsals form a somewhat conical arch. Thus the long heel bone, calcaneous,
slops backward from below to reach the ground at the posterior end. In apes, the
plane of the tibio-talus joint is oblique in such a way as to twist the foot a little
inwards. The arching of the inner side of the sole is not so marked.
In man, the metatarsal of the big toe is firmly bound together with the other four
in marked contrast with that of the thumb. In apes, the metatarsal is relatively
and separately movable. Thus the big toe can be opposed to the other toes and
functions as a grasping organ like the human hand.
Big toe
(opposable)
Fig. 3.8: Foot of Man and Ape
We have considered the comparative anatomy of man and apes and have seen
the differences between them. However it must be noted that there are many
shared features which are ancestral traits, that is, traits inherited from the shared
common ancestor. These are human trunk similar to that of an ape, length of
arm, breadth of trunk, and shortness of the lumbar region (back bone), length of
clavicle, and many details of bone joints and muscles.
3.4 HOMINIZATION
The earliest evidence of hominids that was found, included teeth and cranial
pieces which were not enough to distinguish modern man from our closest
relatives the apes. Then, how can we identify hominids from other types of
animals, especially when these occur only as fragments of fossil remains?
The Olduvai Gorge in Tanzania is the most important site that yielded the fossil
52
evidence in abundance about the skeleton and behaviour of hominids. The layers
through which the Gorge cuts are divided into four numbered from the bottom Phylogeny of Living
as Bed I, Bed II, Bed III and Bed IV, the uppermost. Anatomy
In 1960 Leaky’s son found pieces of jaws, partial cranial vault and hand bones
from Bed 1 dated to 1.8 million years ago. The bony remains were encircled by
loosely piled stones. Leaky thought that it was a dwelling of a hominid which
belonged to genus Homo. He named it Homo habilis (handy man) believing it
to be a tool maker. The piled stones, according to Leakey were windbreak
constructed by Homo habilis. The cranial capacity after reconstruction was found
to be 680 cc which to Leakey was further proof for separating Homo habilis
from the Australopithecus africanus.
The debate among the palaeanthropologists over which of the traits-tool making,
large brain, and bipedalism-was critical in defining mankind. Yattersall has very
rightly pointed out that the spin off of this mindset was the idea of hominization,
that is, becoming human in some way was definable and separate process which
could be studied. It must be noted that all these traits did not develop
simultaneously as can be seen in hominid evolution over the last seven million
years. The process of hominization may be examined in the biocultural nature of
hominid evolution.
3.4.1 Skeletal Changes Due to the Erect Posture and its

Implications
The Miocene and Pliocene apes were arboreal but they could also move on the
ground. Our ancestors came down from the trees probably more than 4 million
years ago. Due to paucity of fossil record, we do not know the successive stages
through which hominids passed before they walked upright. The anatomical
changes associated with erect posture and bipedal gait are found throughout the
body- toes, legs, vertebral column, pelvis, skull, and various muscles. The changes
are seen in the shape, position and function.
Fig 3.9: Bipedal Locomotion in Man 53

Primate Study Foot
The big toe or hallux is enlarged and projects beyond the other toes, but it is in
line with other toes. The bones of the foot are arranged in such a way that a
marked longitudinal arch is formed along the inner side of the foot. There is a
less marked longitudinal arch along the outer side, and a third arch, the transverse
arch across the heads of five metatarsals. The arches perform several functions
in standing and walking. They ensure that the weight of the body is evenly
distributed over the sole. They absorb shock and work as spring in the stride.
The usefulness of these arches in bipedalism is also associated with certain
disadvantages. The arches may become flattened due to several reasons. The flat
feet not only reduce functional efficiency but also affect the skeleton adversely.
The strains felt in maintaining the arch under the increasing weight may stretch
tendons and ligaments until the arches collapse. The flat footed hominids cannot
stand for longer period and cannot also run fast.
Knee Joint
The large human knee joint is particularly well adapted for weight bearing and
locomotion. The lower limbs are elongated. The femur is angled inward so that
the legs are directly under the body.
Pelvis
Adaptation of upright posture led to many alterations in the pelvis. The ilium
bones become shorter and broader for balancing the weight of the body and for
transmitting it from the vertebral column to the limbs. The pelvis is shaped like
a basin to accommodate the internal organs.
Vertebral Column
The Vertebral column of man is adapted to his upright posture. It has two distinct
curves, a backward thoracic one (convex) and a forward lumbar one. These two
curvatures keep the trunk and weight centered above the pelvis.
Upper Limb
Man’s upper limb shows some anatomical specializations including the freedom
and mobility of the shoulder joint. Also the human hand can be brought into
almost any position.
Skull
The cranium becomes globular and voluminous. The foramen magnum at the
base of the skull is placed further forward and as such the head is balanced on
the vertebral column.
Implications
There are numerous models that suggest the evolution of upright posture.
According to one view the evolution of erect posture may be associated with the
disappearance of thick forests and their replacement with small woods separated
by tracts of open tall grasses which indicate that such countryside might have
existed in Kenya during the Miocene epoch, once the upright posture was attained
by the hominids, bipedalism became the mode of locomotion as an adaptive
response to life in the tall grasses of savanna. They could thus spot ground
predators and potential prey.
54
Another model accounts for better dispersion of body when the head is raised Phylogeny of Living
and less surface is exposed to the sun during the hottest time of the day. This Anatomy
might have played an important role in the thermoregulation of the brain in early
hominids for the development of brain.
The importance of allowing the hands to be free while the legs are moving has
been stressed by paleoanthropologists. Selection may have favoured critical
activity if it were necessary to carry food from one location to other. Hence,
bipedal locomotion offered an adaptive advantage.
Tool use and tool making favoured bipedalism. It was an appropriate adaptation
for hominids to scavenge food. There is however no direct evidence in support
of any of these models on hominization.
3.5 SUMMARY
We read in biogenetic basis of phylogeny of living primates that various
sophisticated techniques have been developed by scientists for establishing the
phylogenetic relationship between humans and apes. The results of immunological
tests and the molecular clock constructed by Sarich and Wilson suggest the
divergence of man and apes from a common ancestor around 5 million years ago
(mya). The chimpanzees are closer to man than the gorilla. The human-
chimpanzees-gorillas trichotomy is accepted by the majority of the scientists.
The unit also provides a comprehensive background on comparative anatomy of

man and large apes, supported by suitable diagrams, followed by the process of
hominization. The changes that took place due to erect posture and their
implications are discussed. Models have been advanced to explain the
development of erect posture and bipedalism, but none of them is fool-proof in
the matter.
3.6 GLOSSARY
Adaptation : successful interaction between populations and
environment.
Antibody : a protein produced in response to foreign antigen.
Antigen : a substance (also a protein) that causes the
production of antibody.
Brachiation : a mode of movement through the trees by swinging
alternate arms to reach from branch to branch.
Among the apes Gibbon is the extreme brachiater.
Cranial capacity : the measurement of interior volume of the brain case
expressed in cubic centimeter (c.c.)
Dental Formula : shorthand notation for the number of teeth on each
side of the upper and lower jaws.
DNA : a long stranded molecule in the gene. It directs the
(Deoxyribonucleic acid) making of an organism according to the instructions
in its genetic code.
55
Primate Study Gait : manner of walking, such as bipedal or quadrupedal
gait.
Genome : the total DNA sequences of an organism.
Foramen Magnum : the large opening on the base of the skull where the
spinal cord enters.
Pelvic outlet or basin : the brim of the pelvic cavity. It is wider in human
female.
Posture : the disposition or arrangement of the body parts.
Phylogeny : the evolutionary history or genealogy of the species
or groups of species
Savanna or Savannah : open grasslands in which the food resources are
spread.
Zygomatic arch : the cheek bone formed by the zygomatic and
temporal bone on the side of the skull.
References
Aibley, C.G. and Ahlquist, J.E. 1984. The Phylogeny of Hominoid Primates as
Indicated by DNA-DNA Hybridisation. J.Mol. Evol. 20: 2-15.
Horais, S. Hyansaka, K. Kondo, R. Tasugane, K. and Takahata,N. 1965. Recent
African Origin of Modern Humans Revealed by Complete Sequences of Hominoid
Mitochondrial DHAs. Proc.Natl. Acad. Sci. 92:532-636.
Kluge, A.G. 1983. Cladistics and the classification of the great apes. In: R L
Ciochon and R S Corrtcinni (Eds), New Interpretations of Ape and Human
Ancestory. New York:Plenum press. pp 151-177
Mai, L. L. 1983. A model of chromosome evolution and its bearing cladogenesis
in the hominoidea. In : R L Ciochon and R S Corrtcinni (Eds), New Interpretations
of Ape and Human Ancestory, New York:Plenum press. pp 87-114.
Patterson, N.D., Richter, J., Genorre, S., Lander, E.S. and Reich, D. 2006. Genetic
Evidence for Complex Speciationof Humans and Champanzees. Nature. 441:
1103-1108.
Salem, A.H., Ray, D.A., Xing, T., Callinan, P.A., Mayers, T.S., Hedger, D.J.,
Garberg,R.K., Witherspoon, D.J., Jordeh,B. and Batzer,M.A. 2000c. Alu
Elementsasnd Hominid Phylogenetics. Proc. Natl.Acad. Sci. 100: 12787-12791
Sarich,V.M. and Wilson, A.C. !971. Hominid origin revisted. In Climbing Man’s
Family Tree. Eds.Mc Cowm,T.M. Kennedy,A.R.K. New Jersy, Prentice-hall Inc.
(This article contains details about molecular clock.)
Satta,Y., Klein, J. and Takahata, N. 2000. DNA Archives and Our Nearest Relative:
The Trichotomy Problem Revisited. Mol.Phylogenetic.Evol. 14: 259-275.
Schwartz, J H. 1984. Phylogeny of Humans and Orangutans. American Journal
of Physical Anthropology 63: 217-220.
Yunish, J. and Prakash, G. 1985. The Origin of Man: A Chromosomal Pictorial
Legacy. Science. 215: 1825-1529.
56
Suggested Reading Phylogeny of Living
Napier, J.R. and Napier, P.H. 1967. A Handbook of Living Primates. New York. Anatomy
Academic Press
Piorier, F.E. 2007. Understanding Human Evolution. New Jersey, Prentice-Hall

Inc.
Roberts, J., Kilgore, L. and Trevathan,W. 2006. Introduction to Physical

Anthropology. Tenth edition. Toronto,Canada, Thomson Wadswort.
Roger, E.1984. Human Evoution: An Illutrated Introduction. New Jersey,

H.Freeman Company.
Srivastava, R.P. 2009. Morphology of the Ptimates and Human Evolution. New
Delhi, PHI Learning Pvt. Ltd.
Sample Questions
1) How has genetic research clarified biological relationship between humans
and large apes?
2) Write notes on:
a) Man-chimpanzees -gorilla trichotomy
b) Comment on the existing taxonomic status of man and apes.
3) Compare the morphological features of human skull with those of large
apes.
4) Describe the changes associated with evolution of erect posture in human
body.
5) Discuss the models that have been proposed by different authors to explain
the emergence of erect posture and bipedalism.
57
MANE-001
Human Genetics
Indira Gandhi
Block
1
INTRODUCTION TO HUMAN GENETICS
UNIT 1
Definition and Scope 5
UNIT 2
Biological Basis of Human Heredity 27
UNIT 3
Formal Genetics 42
Expert Committee
Prof. P. Dash Sharma (Retd.) Faculty of Anthropology
Dept. of Anthropology SOSS, IGNOU
Ranchi University, Ranchi
Dr. Rashmi Sinha, Reader
Prof. P. Veerraju (Retd.) Discipline of Anthropology
Dept. of Human Genetics IGNOU, New Delhi
Andhra University
Visakhapatnam Dr. P. Venkatramana
Assistant Professor
Prof. S.M.S. Chahal Discipline of Anthropology
Dept. of Human Biology IGNOU, New Delhi
Punjabi University, Patiala
Dr. Rukshana Zaman
Prof. A. Papa Rao Assistant Professor
Dept. of Anthropology Discipline of Anthropology
Sri Venkateswara University IGNOU, New Delhi
Tirupati
Dr. Mitoo Das
Dr. Roli Mathur Assistant Professor
Scientist ‘C’ Discipline of Anthropology
Division of Basic Medical Sciences IGNOU, New Delhi
Indian Council of Medical Research
New Delhi Dr. K. Anil Kumar
Assistant Professor
Dr. Seema Kalra Discipline of Anthropology
Assistant Professor IGNOU, New Delhi
Dept. of Biochemistry
IGNOU, New Delhi

Course Coordinator: Dr. P. Venkatramana, SOSS, IGNOU, New Delhi
Content Editor
Prof. S.M.S. Chahal
Department of Human Biology
Pubjabi University, Patiala
Block Preparation Team

Unit Writers
Prof. T. Padma (Retd.) (Unit 1) Cover Design
Department of Genetics Dr. Mitoo Das
Osmania University, Hyderabad Asstt. Professor
Prof. M. Sethuraman (Retd.) (Unit 2) Discipline of Anthropology
Department of Anthropology SOSS, IGNOU
Tamil University, Tanjore New Delhi
Prof. P. Veerraju (Retd.) (Unit 3)
Department of Human Genetics
Andhra University, Visakhapatnam
Authore are responsible for the academic content of this course as far as the copyright issues are concerned.
Print Production
Mr. Manjit Singh
Section Officer (Pub.), SOSS, IGNOU, New Delhi
September, 2012
ISBN-978-81-266-
Printed at :
BLOCK 1 INTRODUCTION
The prevailing concept of heredity in Gregor Mendel’s time was that the traits of
the parents become blended in the progeny, as though the hereditary material
consisted of fluids that become permanently mixed when combined. However,
Mendel’s observation that one of the parental characteristics was absent in F1
generation and reappeared in unchanged form in the F2 generation was inconsistent
with the idea of blending. Mendel’s experiments were simple and direct and
revealed the most significant principles that determine how characteristics (traits)
are passed from parents to offspring. Due to his careful analysis of inheritance of
traits in garden peas carried out from 1856 to 1963 and published in 1866, heredity
came to be recognized as a biological process separate from development. The
Mendelian principles are the basis of ‘transmission genetics’ also referred to as
‘formal genetics’ because the subject can be understood and the rules clearly
seen without any reference to the biochemical nature of genes or gene products.
Mendel’s story is one of the great legends in the history of science.
Although Mendel’s work demonstrated that the units of heredity are stable and
particulate but at that time the biological basis of the transmission of genes from
parents to offspring was quite mysterious; neither the role of the nucleus in
reproduction nor the details of cell division were known. The early geneticists
began to wonder about the biochemical nature of the gene and raised questions
like what kind of molecule is a gene. How can hereditary information be contained
in a molecule? How can this information be transmitted from parents to offspring?
In what way is the information different in a mutant? At that time, there was no
logical starting point for such an investigation. In 1869, Friedrich Miescher
discovered a new type of mild acid, abundant in the nuclei of white blood cells
that turned out to be chemical substance of which genes are made and is called
deoxyribonucleic acid (DNA). However, the connection between DNA and
heredity was not demonstrated.
In the 1870s, the importance of the nucleus in inheritance was made clear by the
observation that the nuclei of the male and female reproductive cells fuse in the
process of fertilization. The next major advance was the discovery of the thread
like structures, the chromosomes, inside the nucleus that become visible in the
light microscope when stained with certain dyes. Chromosomes have a
characteristic ‘splitting’ behaviour in cell division, in which each daughter cell
formed by cell division receives an identical complement of chromosomes.
Furthermore, the number of chromosomes differs among species but is constant
within each species. These features of chromosomes, well understood by about
1900 made it likely that chromosomes were the carriers of the genes.
Beginning in the early 1920s, and especially in the 1940s, a few critical
observations were made that implicated DNA in heredity. The three-dimensional
structure of DNA proposed in 1953 by Watson and Crick gave many clues about
the manner in which DNA functions as the genetic material. Within a decade,
there came an understanding of the chemical nature of genes and how genetic
information is stored, released to the cell, and transmitted from one generation
to the next. By 1970s, the basic tools required for manipulation of DNA such as
DNA ligases and restriction enzymes, respectively the molecular glues and
scissors, were found. A novel technique of in vitro DNA amplification, polymerase
chain reaction (PCR), was developed by Kary Banks Mullis in 1983 which found
instant application in genomics and clinical genetics.
Introduction to Human Though there was some awareness of the genetic basis of a number of diseases;
Genetics
it was not until 1956 that we finally knew how many chromosomes man had,
thanks to the pioneer work of Tjio and Levan who using tissue culture and
hypotonic shock discovered that our species has only 46 chromosomes. Among
the great scientific movements initiating the study of human heredity, history
will no doubt pick out after Mendelism and gene chemistry, chromosome analysis.
Cytogenetic techniques permit detection of numerical anomalies and major
structural anomalies.
Mendel worked with artificial populations of plants, but the principles of
Mendelian genetics are equally applicable to natural populations. Population
Genetics is the application of Mendel’s laws and other principles of genetics to
population of organisms. One of the goals of this branch of genetics is to determine
the nature and extent of genetic variation in natural populations and in this analysis
allele frequencies are often more useful than genotype frequencies because alleles,
not genotypes, form the bridge between generations. Alleles rarely undergo
mutation in a single generation and so they are relatively stable in their
transmission from one generation to the next. On the other hand, genotypes are
not permanent; they are totally broken up in the process of segregation and
recombination that take place in each reproductive cycle.
While Mendelian genetics began with the rediscovery of Mendel’s work at the
beginning of the 20th century; modern human genetics as applied to anthropology
only dates from the Second World War, though ABO blood groups were
discovered in 1900 and some early beginnings were made by Hirszfelds pioneer
studies on ABO blood groups of soldiers of different nationalities at the end of
First World War. Certainly as late as the early 1940s we knew only four blood
group systems, PTC tasting ability and red/green colourblindness as simply
inherited normal genetic traits of anthropological interest.
The great advance in human genetics since the Second World War has been truly
impressive. There was the great blossoming of serology, giving the discovery of
dozen odd more public blood group systems. Of technical advances, in the
biochemical sphere the coming of electrophoresis and isoelectric focusing
techniques brought to light the enormous variation in serum proteins and red
cell enzymes and undreamed-of richness of genetic variability in DNA was
revealed by the molecular techniques of southern blotting and PCR; improved
microscopy allowed us to visualize the chromosomes, and indeed their ultra-
structure, as also differential staining of the human chromosomes showing
characteristic banding patterns; development of tissue culture methods brought
the possibility of establishing gene location by somatic cell hybridization, and
by combining the cytogenetic process of producing metaphase on slides and
recombinant DNA technology, the resultant technique of molecular cytogenetic
or in situ hybridization (ISH) with increased resolution enabled detection of
chromosomal aberrations not detected by the light microscope. The general theory
of population genetics was steadily advancing, and the computer revolution
provided power to apply this theory to man, applying models of genetic structure
and evolution to populations of great complexity. The development of clinical
genetics provided further proof of enormous genetic heterogeneity, filling in the
gaps that the study of normal genetic variants had left.
With the above background, the present Block on Human Genetics comprising
three Units viz., Definition and Scope, Biological Basis of Human Heredity and
Formal Genetics provides a comprehensive account of the subject in a lucid manner.
4
UNIT 1 DEFINITION AND SCOPE
Contents
1.1 Introduction and Background
1.1.1 Modes of Inheritance
1.2 Definition, Scope and Emerging Trends
1.3 Branches of Human Genetics
1.3.1 Cytogenetics
1.3.2 Biochemical Genetics
1.3.3 Immunogenetics
1.3.4 Pharmacogenetics
1.3.5 Molecular Genetics
1.3.6 Somatic Cell Genetics
1.3.7 Population Genetics
1.3.8 Genomics
1.3.9 Clinical Genetics
1.3.9.1 Genetic Diagnosis
1.3.9.2 Mangement of Genetic Conditions
1.4 Summary
Suggested Readings
Glossary
Sample Questions
Learning Objectives
&
After reading this unit, you will be able to:
Ø understand about the subject of human genetics, its origin, growth and
emergence of its branches;
Ø expalin how the characters/traits are inherited from parents to offspring;
Ø discuss about the normal and abnormal composition of the chromosomes
leading to syndromes/ disorders;
Ø elucidate the concept of “one-gene-one-enzyme hypothesis” which explains
development of genetic diseases/disorders caused by defective genes
controlling the functions of enzymes in metabolic pathways;
Ø discuss about ABO and RHD blood groups, blood group incompatibility
and the development of the branch of immunogenetics;
Ø know about the genetic defects caused by nucleotide variations in the DNA
sequence of a gene, providing understanding of molecular basis of genetic
diseases;
Ø explain the importance of somatic cell genetics, pharmacogenetics and
population genetics; and
Ø discuss the importance of clinical diagnosis, genetic counselling and
management of genetic diseases in maintaining human health.
5
Introduction to Human
Genetics 1.1 INTRODUCTION AND BACKGROUND
Man’s insatiable thirst to know more and more about himself and his surroundings
has led to the discovery of many secrets of life. Bestowed with the power of
thinking, imagination and judgment, man has been applying the knowledge he
acquired to his day to day needs and his own betterment. In this attempt he
pursued the search for explanations and scientific proofs for the origin and
existence of other forms of life including plants and animals, their organization,
life processes and their use to the mankind.
Initially it was a puzzle how the individual species maintain their identity with
characteristic features and reproduce individuals similar to them. It was observed
that a mouse reproduces mouse, an elephant another elephant and tamarind seeds
grow only as tamarind trees. In other words, it was understood that “like begets
like”. Still differences or variations were found to occur between the members
of the same species i.e. no two individuals appear to resemble exactly. What
contributes to these differences between the individuals is studied at various
levels using advanced technologies. Such studies provided explanation for
understanding the mechanisms related to the following.
a) The inheritance of characters from parents to offspring that may be simple
or complex.
b) The resemblance between the members of the same species or members of
the same family.
c) The reasons for individual differences.
d) Process of reproduction.
e) Maintenance of species identity and many more.
Such knowledge led to the development of several branches of science and of
them the “science of inheritance” attracted the attention of several scientists over
centuries which could explain the facts of life.
Inheritance of characters (traits) through generations in man was noticed from
time immemorial and in 1644 Sur Kenelm Digby cited a five generation family
with inheritance of polydactyly (extra fingers/toes) (Fig. 1.1).
Fig. 1.1: Polydactly showing extra fingers on hands and extra toes on the feet (source:
6 handfacts.wordpress.com
After a century, the French scientist Maupertuis through family studies described Definition and Scope
segregation of polydactyly and albinism (lack of pigmentation) in family
members and suggested that these two characters are inherited following different
patterns of inheritance. Further, based on animal breeding experiments he
stated that both the parents contribute equally to the inheritance of traits to their
offspring.
Later in 18th and early 19th centuries the inheritance of haemophilia, a bleeding
disorder in which the affected individuals have continuous bleeding as their blood
fails to clot when there is cut or injury and colour blindness, in which the affected
individuals can not differentiate either red or green colours, was discovered.
These two conditions showed high frequency of occurrence in males compared
to females, a typical feature of X-linked inheritance. These initial observations
of inherited characters in man prompted the concept of structural basis of heredity
which was similar to the ideas suggested later by George Mendel through his
laws of inheritance (Box 1.1).
Box 1.1
Mendel’s laws
The two laws of heredity formulated by Gregor Mendel, based on his

experiments with the garden pea plants are as follows:
1) Law of segregation (The “First Law”): It states that the members of a

pair of homologous chromosomes segregate during meiosis and are
distributed to different gametes.
2) Law of independent assortment (The “Second Law”): It states that each

member of a pair of homologous chromosomes segregates during
meiosis, independently of the members of other pairs, so that alleles
carried on different chromosomes are distributed randomly to the gamets.
Understanding the principles of biology was possible in the later part of 19th
century when the nature and functions of the building blocks of life “the cells”
and the stages of cell division and formation of daughter cells were discovered.
Sutton and Boveri in 1903 proposed independently the “chromosomal theory of
inheritance”. They drew one to one correlation between various stages of cell
division leading to the formation of daughter cells and the segregation of
characters from the parents to their offspring. They suggested that the hereditary
factors (genes) are located on the chromosomes and are transmitted along with
the chromosomes to the daughter cells.
1.1.1 Modes of Inheritance

Autosomal dominant inheritance
Characteristic features
Every affected individual has an affected parent; trait does not skips generation
(vertical inheritance), both males and females are equally affected.
7
Genetics
Examples: Huntington’s chorea, Brachydactyly, Brown enamel, Hypercholesterolemia,

Congenital cataract.
Autosomal recessive inheritance
Parents of probands have normal phenotype but carry the mutant allele; both the
sexes are equally affected; multiple sibs affected; increased incidence of parental
consanguinity especially for rare case; pleiotropism observed; pseudodominance
present when segregating in isolate groups.
Examples: All metabolic disorders, cystic fibrosis, some forms of congenital

hearing impairment, retinitis pigmentosum (night blindness), corneal dystrophy,
8 among others.
X-linked inheritance Definition and Scope
All the daughters of an affected male are affected; all sons and daughters of an
affected woman will be affected.
Examples: Xg blood groups; Vitamin D resistant rickets; Rett’s syndrome; Fragile
X syndrome.
Characteristic features of X-linked recessive inheritance
Absence of male to male transmission; gene in affected male is transmitted to
his grandson through his daughter; criss-cross inheritance seen; 50% of sons of
carrier woman are affected while 50% of daughters are carriers; when a male is
affected the disease may be present in male relatives of his mother.
Examples: Colour blindness; haemophilia A and B; Duchenne and Becker’s
muscular dystrophies; G6PD deficiency; X-linked ichthyosis.
X-linked dominant X-linked recessive
Y-linked inheritance
Characteristic features of Y-linked Inheritance
Y-linked genes are located on Y chromosome and are always transmitted from
father to sons and not to daughters.
Examples: Male infertility (due to deletions in Y chromosome); Non-syndromic
hearing impairment.
1 2
3 4 5 6 7 8 9
10 11 12 13 14 15
Source: Desktopclass.com
Mitochondrial Inheritance
The defect is transmitted to sons and daughters only through affected mothers;
affected males do not transmit the disorder to his offspring. 9
Introduction to Human Examples: Ptosis, neurological disorders, deafness and diabetes (DAD), Leber’s
Genetics
hereditary optic neuropathy (LHON,Leigh syndrome, Myoclonic Epilepsy with
Ragged Red Fibers.
The breakthrough in understanding the principles of biology was witnessed in

the later part of 19th century when the nature and functions of the building blocks
of life “the cells” and the stages of cell division and formation of daughter cells
were discovered. At the same time plant and animal breeders tried to explain
how the traits were passed on from the parents to their offspring. These studies
and rediscovery of the propositions of laws of inheritance (Box 1.1) by George
Mendel in 1900 motivated Sutton and Boveri in 1903 to propose independently
the “Chromosomal Theory of Inheritance”. They tried to draw one to one
correlation between the stages of cell division leading to the formation of daughter
cells and the segregations of characters from the parents to their offspring. They
suggested that the hereditary factors or “genes” are located on the chromosomes
and are transmitted along with the chromosomes to the daughter cells. This
hypothesis helped in finding explanations to several other observations made in
the following years.
The progress in the field of human genetics was rather slow because of 1) longer
generation time (~30 yr) and 2) because unlike other animals, human matings
cannot be performed at will. Therefore, human geneticists had to rely on the data
collected from the already existing (retrospective) information on human
pedigrees rather than plannnig prospective studies and following generations for
the study of inheritance of the characters.
1.2 DEFINITION, SCOPE AND EMERGING

TRENDS
Human genetics can be defined as a field of science that deals with the inheritance
of traits that can be traced through generations. But the mechanisms governing
the inheritance patterns are not simple always as they may sometimes involve
interaction of genes with non-genetic and environmental factors as in the case of
complex traits.
The growth of the field of human genetics witnessed several breakthroughs
described under different branches of human genetics in the following.
Development of advanced laboratory and analytical methods such as biostatistics
and bioinformatics tools has helped in gaining more insights into the subject.
The progress made in human genetics over the past fifty years has revolutionarised
10
the understanding of several concepts linked to health science, treatment of disease Definition and Scope
conditions, understanding the basic principles of biology, reasons for ethnic
variations, evolution of living forms, including man, among others. Now it is
being realized that almost every human disease has genetic basis and treating or
managing any genetic condition is becoming more specific based on the genetic
constitution of an individual. Thus the concepts of “personalised medicine” or
“tailor made medicine” have been advanced.
1.3 BRANCHES OF HUMAN GENETICS

Like any other field, the subject of human genetics as it progressed led to the
division into sub-specialties like cytogenetics, biochemical genetics,
immunogenetics, pharmacogenetics, molecular genetics, somatic cell genetics,
population genetics, genetic epidemiology, genomics and clinical genetics.
1.3.1 Cytogenetics
Cytogenetics can be defined as the study of chromosomes, the hereditary units.
It has been an active field of research contributing to the understanding of
organization of chromosomes and human genome. It is a discipline that matches
phenotypes to detectable chromosomal abnormalities. In other words, you can
correlate the abnormal changes occurring in the number (numerical aberrations
like, monosomy, trisomy, nullisomy, triploidy) or structure (structural aberrations
like chromosomal deletions, duplications, translocations and inversions) of
chromosomes in an individual with the clinical features and symptoms (Table 1.1).
Table 1.1: Common chromosomal aberrations in man and their clinical features
Chromosomal Chromosome Clinical features

aberration complement
Down’s syndrome 47, trisomy 21 & Mental retardation, moon face, simian
t(21;13), t (21;14), crease, epicanthic fold.
t(21;15), t(21;22)
Turner’s syndrome 45, XO Female with short stature, webbed neck,
infertility, swelling in the ankles and
wrist.
Klinefelter’s 47, XXY Male with tall stature, infertility,
syndrome gynaecomastia (breast development).
Edward’s syndrome 47, trisomy 18 Small face with micrognathia and a small
chest. The ears are low set, overlapping
fingers (clenched fist); digits 2 and 5
overlap 3 and 4.
Patau’s syndrome 47, trisomy 13 Cleft lip, flexed fingers with polydactyly,
ocular hypotelorism, bulbous nose, low-
set and malformed ears, small abnormal
skull, cerebral and cardiac malformation,
microphthalmia, hypoplastic or absent
ribs, visceral and genital anomalies.
Cri-du chat 46, deletion of 5p Cry resembling that of a cat, flat face,
(Cat cry syndrome) receding chin, simian crease.
Philadelphia 46, deletion 21q Myeloid leukaemia.
chromosome (Ph’) & t (9;22)
11
Introduction to Human The foundation for cytogenetic studies was laid by the work of Arnold (1879)
Genetics
and Fleming (1882) who for the first time identified thread like structures called
“chromosomes” during mitotic cell division by staining the preparations with
certain dyes. In humans, the field of cytogenetics had its origin in the year 1956
when Tjio and Levan established the diploid chromosome number as 46. The
preparation of human karyotype (Box 1.2) for the first time in 1959 led to the
identification of numerical aberrations (changes in the number of chromosomes)
in the following years associated with conditions like Down’s syndrome (trisomy
21), Klinefelter’s syndrome (XXY) and monosomy like Turner’s syndrome (XO)
which implied the need for routine screening for chromosomal anomalies in
certain clinical conditions.
Box 1.2
Human body is composed of trillions of cells forming 200 different types of
cells e.g. liver cells, brain cells, mucosal cells etc. Cells found in body parts
are called somatic cells and cells found only in the gonads are referred to as
germ cells. Each somatic cell comprises constant number of thread like
structures called chromosomes that number 46, arranged in 23 pairs of which
22 pairs are autosomes and the remaining pair sex chromosomes. The
autosomes and the sex chromosomes differ in their length, centromeric
position and DNA content, among others. The homologous chromosomes
of the sex chromosome pair are of the same type in females called X
chromosomes while in males the pair of sex chromosomes comprises two
different types of chromosomes referred as X and Y chromosomes. Thus, in
the humans the normal chromosomal complement or karyotype in females
is represented as 22, XX and in males as 22, XY.
Normal human karyotype with 22 pairs of autosomes and two X

chromosomes in females and one X and Y chromosomes in males
12
In 1960 Moorehead and his colleagues published the chromosome preparations Definition and Scope
using short term lymphocyte cultures. Later Patau et al. and Edwards et al. reported
trisomy 13 (Patau’s syndrome) and trisomy 18 (Edward’s syndrome), respectively,
the affected infants showing congenital malformations. Nowell and Hungerford
in the same year found deletion of chromosome 21, later referred to as Philadelphia
chromosome (Ph’), consistently in patients of chronic myelogenous leukaemia.
This opened up new approach of screening for chromosmal variations such as
deletions, duplications and translocations in patients with different types of
tumors. Lejeune et al. (1963) reported a deletion syndrome called Cri-du-chat
(cat cry syndrome). In the following years, Schroeder et al. (1964) and
German et al. (1965) described chromosomal instability in conditions called
Fanconi’s anaemia and Bloom’s syndrome, respectively. At the same time Jacobs
and colleagues associated XYY chromosomal complement with criminal
tendency.
The next significant breakthrough in human cytogenetics was the development

of chromosomal banding techniques by Caspersson et al. (1968) who used
quinacrine mustard to stain the chromosomes. This is referred to as quinacrine
(Q) banding technique which yields fluorescent banding patterns that are specific
for each chromosome. Thus, the technique permitted unequivocal identification
of homologous human chromosomes of all autosomal pairs and sex chromosomes.
Later other banding techniques such as giemsa (G) banding, reverse (R) banding,
constitutive heterochromatin (C) banding and telomeric (T) banding were
developed, of which G banding is most often used in clinical cytogenetic
laboratories for diagnostic purposes. Further, studies of prometaphase
chromosomes facilitated better identification of chromosomal variations with high
resolution.
Later with the adoption of molecular biology techniques, especially the

hybridisation technique, the field of cytogenetics transformed itself into the field
of molecular cytogenetics. The discovery of DNA probes and their tagging with
fluorescent dyes led to the development of a new technique called fluorescent in
situ hybridisation (FISH) in early 1980s. This technique is used to detect and localize
the presence or absence of specific DNA sequences on chromosomes to identify
gain or loss of interstitial chromosomal regions such as microdeletions, duplications
and several chromosomal structural changes that cannot be traced by the application
of classical cytogenetic techniques. FISH can also be used to study interphase
nuclei, cultured specimens and cells from specimens embedded in paraffin.
More recently the novel approach followed in molecular cytogenetics is the

determination of overall genomic changes occurring in a given tissue by two
types of comparative genomic hybridisation (CGH) techniques, referred to as
metaphase CGH and array based CGH. These approaches enable the identification
of copy number variations (CNV) in the genome with cells showing abnormal
number of copies of DNA regions i.e. either deletions or duplications. These
CNVs may show association with certain clinical conditions and help in diagnosis
and risk prediction.
1.3.2 Biochemical Genetics

By definition, the field of bochemical genetics deals with the inheritance of genes
that control the activity of an enzyme that catalyze the specific biochemical
reaction in a metabolic pathway. When a gene becomes defective (due to 13
Introduction to Human mutation), then a block is created in the biochemical pathways catalyzed by the
Genetics
particular enzyme. This leads to the accumulation of the product prior to the
block and other reactions in the pathway will not proceed further. Sir Archibald
Garrod, the father of biochemical genetics was the first to point out in 1902 that
defects in the biochemical pathways can lead to inherited disorders like
alkaptonuria, a rare condition in which urine of the patient turns black when
exposed to atmospheric air; the black color being due to the accumulation of
homogentisic acid caused by a block in the metabolic pathway of phenylalanine
(Fig. 1.2). It is a harmless condition except that it causes arthritis in later life due
to the accumulation of homogentisic acid in the joints. Garrod reported four
families with eleven members affected and three of them were born to parents
who were first cousins. It was later interpreted as an autosomal recessive condition
and being rare is expected to show high incidence among offspring born to parents
who are blood relatives (like cousins, uncle-niece and aunt-nephew). Parents
who are cousins have greater chance of carrying the defective gene transmitted
from their forefathers and both of them pass on the gene to their offspring who
after receiving the defective gene in double dose (homozygous form) expresses
the recessive disease.
The concept of genetic blocks in the metabolic pathways later received support
by the proposition of “one-gene-one-enzyme hypothesis by three scientists namely,
Avery, MacLeod and McCarty in 1944. Garrod also reported other genetic
conditions called albinism, pentosuria and cystinuria arising due to defects in
the respective metabolic pathways. The concept of gene controlling the activity
of an enzyme involved in a biochemical pathway led to the detection of several
inherited biochemical defects covering phenylalanine, amino acid,
mucopolysaccharide, metal, carbohydrate, lipids, and purine and pyrimidine
metabolisms. Each of these pathways may harbor several metabolic blocks leading
to overlapping or distinct clinical conditions. For example, defects in
phenylalanine metabolism may cause phenylketonuria, albinism, tyrosinosis and
alkaptonuria (Fig. 1.2). In general, human metabolic disorders follow autosomal
recessive pattern of inheritance, barring Hurler’s syndrome and Lesch-Nyhan
syndrome which follow sex linked recessive pattern.
THYROXINE
DIET PHENYLALANINE TYROSINE DOPA MELANINE

PIGMENT
1 2
PHENYLPYRUVIC HOMOGENITISIC
ACID ACID
(Excreted in urine in (Excreted in urine in
phenylketonuria) alkaptonuria)
3
ACETOACETIC
ACID
CO2 + H2O
Fig. 1.2: Diagram showing the sites of biochemical blocks in the pathway of phenylalanine
metabolism. Metabolic blocks are indicated in red: 1- Phenylketonuria, 2- Albinism,
3- Alkaptonuria, 4- Congenital Thyroxine Deficiency (Cretinism)
14
Another significant event in the history of human genetics was the discovery of Definition and Scope
sickle cell anaemia in which red blood cells in an affected individual become
sickle shaped under reduced oxygen tension (Figs. 1.3 a, b). This disorder is
inherited as a codominant condition along with normal haemoglobin. Pauling
(1949) demonstrated change in elelectrophoretic pattern of sickle cell
haemoglobin (HB S) implying chemical difference between normal (HB A) and
mutant sickle haemoglobin . The cause of HB S was identified in 1957 by Ingram
by protein fingerprinting as the substitution of glutamic acid by valine which are
coded by the codon GAG and GTG, respectively.
Fig. 1.3a: Normal and sickle shaped red blood cells (indicated by arrow) (source: proargi.us).
Fig. 1.3b: Replacement of glutamic acid in the haemoglobin of normal individual (HB AA)
by valine in the haemoglobin of sickle cell individual (HB SS).
This was the beginning of identification of molecular basis for inherited diseases.
Further, development of chromatography technique to check for the accumulated
metabolites in urine and serum and gel electrophoresis for detecting polymorphic
proteins and automated protein sequencing to identify abnormalities in the
structure of serum and cellular proteins and enzymes enhanced the identification
of several biochemical diseases with Mendelian inheritance.
15
Introduction to Human 1.3.3 Immunogenetics
Genetics
Immunogenetics can be defined as the study that is concerned with the molecular
and genetic basis of the immune response. The field of Immunogenetics has
contributed a great deal in understanding certain disorders in recent times. You
may say that the discovery of the ABO blood groups in 1900 by Landsteiner and
the proof provided by von Dungern and Hirschfeld in 1911 that these blood
groups are inherited formed the basis for the development of a separate field of
immunogenetics in the following years.
The immune system consists of antigens and antibodies that distinguish self
from nonself antigens. The immune reactions are highly specific and the antigens
react only when they come in contact with specific antibodies and this specificity
works like lock and key. ABO blood groups play an important role in blood
transfusions because blood can be given from one person to other only when
there is antigenic compatibility between the donor and recipient (Tables 2a,b).
Table 1.2a: Determination of ABO blood groups, based on reaction to added
antibodies
Table 1.2b: ABO blood groups that can be donated by the donors to the recipients
Donor blood group Recipient blood group Possibility for transfusion
A A and AB Yes
A B and O No
B B and AB Yes
B A and O No
AB AB Yes
AB* A, B and O No
O** A, B, AB and O Yes
16 * Universal recipient, ** Universal donor
Another blood group system important in transfusions is the Rh D blood groups Definition and Scope
which was discovered by the combined effort of Wiener, Levine and Landsteiner
during the second world war. Blood of some wounded soldiers got agglutinated
(clumped) when the antibodies raised in guinea pigs against the blood of rhesus
monkeys was used. This means that the antigens reacting specifically with these
antibodies are similar in man and the rhesus monkeys. The RH blood groups are
important because they may cause haemolytic disease in the RH D+ babies born
to RH D- mothers. This maternal fetal incompatibility leads to haemolytic anemia,
jaundice resulting in premature birth and even death of the newborn. The affected
offspring can be saved by giving exchange transfusion i.e. by slowly removing
the blood from the infant on one side and replacing it with fresh RH D+ blood
(Fig. 1.4, Table 1.3). In 1960 Clarke suggested a prophylactic (preventive)
treatment which is being practiced now by administering anti-RH D antibodies
just before delivery to RH D- mothers who are at risk.
a) RH D - mother with RhH D + fetus (source: mifrah.com)
b) Exchange transfusion of blood given to a new born baby with haemolytic anaemia
(source: pathologystudent.com)
Fig. 1.4: Haemolytic anaemia of the new born
17
Introduction to Human Table 1.3: Maternal-fetal incompatibility for RH D blood group system
Genetics
Father’s Mother’s Fetus Condition of
blood group blood group blood group the baby
RH D+ RH D+ RH D+ Normal
RH D- RH D+ RH D+ Normal
RH D- RH D- RH D- Normal
RH D+ RH D- RH D+ Haemolytic anaemia
Similar to red cell antigens, leucocyte (white blood cell) antigens play an important
role in kidney and other organ transplantations. The histocompatibility antigens
(HLA) comprising HLA A, B, C, D and D loci with several hundred alleles at
each locus have only two of these alleles (one derived from the father and another
from the mother) present in an individual. Therefore, it is difficult to identify a
donor with compatible genotypes for the HLA alleles that match with that of the
recipient requiring organ transplantation.
Now many abnormalities of the immune mechanisms involving

immunoglobulins, cellular immunity, complement and polymorphonuclear
function are identified which form group of autoimmune disorders. Research
conducted at varied levels using techniques like immuno precipitation,
immunoelectrophoresis and hybridoma, among others, are expected to solve some
of the problems of immune system disorders.
1.3.4 Pharmacogenetics
Pharmacogenetics is a growing field and is defined as the discipline that deals
with inheritance of drug sensitivity in humans. The classical example that can be
quoted is the sensitivity in humans to taste the chemical phenylthiocarbamide
(PTC) or the related compound phenylthio- urea (PTU) which is inherited as an
autosomal dominant trait. Individuals who can taste such compounds at micro
levels are called tasters (about 70% of the population) and those who can not
taste are called non-tasters (about 30% of the population). Thus the ability to
taste PTC is considered to be dominant over the non-tasting of it. The non-
tasters are found to be at higher risk for developing the condition called gout.
Another classical example that fits into pharmacogenetics is the sensitivity of

G6PD (glucose-6-phosphate dehydrogenase) enzyme deficient individuals to anti-
malarial and several other drugs including those with naphthalene component.
WHO has listed the chemicals or drugs to which the G6PD deficient individuals
are sensitive. G6PD deficiency is an X-linked recessive condition and leads to
haemolytic anaemia and death when deficient individuals are exposed to anti-
malarial and other drugs. Several other situations that can be considered under
pharmacogenetics are now known and correlating them with genome sequence
(nucleotide sequence) in an individual may provide more information about the
reasons for sensitivity and variations caused among individuals.
1.3.5 Molecular Genetics

Molecular Genetics can be defined as the field that deals with any genetic
condition that occurs due to changes in the nucleotide sequence of DNA
representing a gene. Such conditions are identified by applying molecular biology
18
tools. Study of genetic diseases at molecular or DNA level has been accelerated Definition and Scope
in mid 1970s after the development of recombinant DNA technolgy in which a
normal or desired gene sequence is introduced into the genome of a vector (virus,
liposomes etc., that act as carriers of introduced DNA sequence/gene) and the
recombinant molecule with the vector and introduced gene sequence is multiplied
inside a host, mostly a bacterium or artifial chromosomes of yeast (YACs), bacteria
(BACs) or of mammals (MACs).
The first human gene to be cloned and completely seuqenced was the beta globin
gene of haemoglobin. Now hundreds of genes are cloned that help in the treatment
of diseases (e.g. human insulin used to treat diabetes mellitus). Further rapid
growth of sensitive techniques enabled manipulation of DNA, RNA and proteins
which touched every aspect of human genetics, especially clinical diagnosis and
treatment aspects.
The development of several thousands of polymorphic markers (Box 1.3), has

helped a great deal to identify the risk causing genes and their use in preclinical/
presymptomatic diagnosis. If the extent of risk is known, one can try to prevent
or delay the onset of fatal compliactions associated with the disease condition
like in diabetes or hypetension that are associated with heart attack, kidney failure
and retinal damage, among others.
Box 1.3
Genetic Polymorphisms
The proteins and enzymes are encoded by genes with stretches of DNA having
hundreds/thousands of nucleotide base pairs. Alteration/mutation of even a
single nucleotide in the stretch can affect structure and function of the encoded
protein/enzyme. The mutations occurring in the same gene sequence represent
the alleles. When such alleles exist more frequently in a given normal/patient
population, they are referred as polymorphic alleles.. Polymorphism is defind
as the occurrence of two or more alleles of a gene in a population such that
frequency of the rarest of the alleles is =1.0%. In a given individual only two
of the alleles can be present, one inherited from the father and other from the
mother). Thus differences or variations between individuals in a population
are found based on the combination of alleles they possess. If a gene has four
alleles, individuals with ten different allelic combinations are expected. Red
cell antigen polymorphisms (like ABO, RH D blood groups), leucocyte antigen
polymorphisms (HLA system), serum protein polymorphisms (like HP, TF),,
red cell enzyme polymorphisms (like PGM, AK) and DNA polymorphisms
(like, restriction fragment length polymorphisms (RFLPs), variable number
of tandem repeats (VNTRs), di and tri nucleotide polymorphisms and single
nucleotide polymorphisms (SNPs)) represent polymorphic genetic systems
in man.
Molecular biology techniques are being used extensively to map genes to specific
chromosomal regions; understand the clustering of SNPs on a homologue as a
group (i.e. haplotypes); linkage disequilibrium (i.e. non random association of
genes/markers present on same or different chromosomes), epistatic or non allelic
interaction between genetic loci influencing severity of diseases, exploring
population diversity in terms of genic/allelic distribution; to predict risk of a disease
in association with genetic marker/ environmental/ epidemiological factors. 19
Introduction to Human Since molecular analysis generates huge data, improved analytical biometric and
Genetics
bioinformatics tools were developed to draw reliable inferences. Generation of
super computers is expected to simpilfy the study of differences between
individuals for several thousands of SNPs that helps to understand mainly the
population diveristy, origin of races and communities and also evaluation of
drug effects on disease and drug designing, among others.
1.3.6 Somatic Cell Genetics

Somatic cell genetics can be defined as the branch of genetics that deals with
fusion of somatic cells of different species to conduct genetic studies by testing
the hybrid cells. The introduction of somatic cell genetics in 1960s was a major
breakthrough as the technology bypasses the need to wait for next generation
(~20-25 yr of generation time) to trace the inheritance of traits from parents to
the offspring. The technology in few weeks can help identifying mutations,
detecting inheritance patterns, mapping genes to specific chromosomal regions
using panel of hybrid cells and molecular markers.
Barski et al. (1960) were the first to demonstrate spontaneous fusion of two
different but related tumor cells. Ephrussi et al. (1961) showed that large genetic
differences did not affect the cell fusions. Littlefield (1964) used HAT Medium
with hypoxanthine, aminopterine and thymidine- which selects the hybrid cells
from other cells in culture. The two mutant genes located at two different loci
complement with each other in hybrid cells which grow in the minimal medium.
Later Ephrussi and Weiss in 1965 fused mouse and rat cells for the first time
indicating that interspecific barrier does not affect cell fusions. In the same year
Okada, Harris and Watkin enhanced the frequency of cell fusions by adding
inactivated Sendai virus to the cell cultures. Later several chemicals were also
tried and of them polyethylene glycol (PEG) gave good results. Use of Sendai
virus, PEG and HAT medium together yields greater success in somatic cell
fusions.
1.3.7 Population Genetics

A population can be defined as a group of interbreeding individuals and their
offspring. Population genetics deals with frequencies of different alleles in
different groups of populations and exploration of mechanisms causing genetic
diversity between them. The primary generalization of population genetics was
first focused by Penrose in 1904 which was clearly formulated by Hardy, a British
mathematician, and Weinberg, a German medical doctor, in 1908. They
independently set out the fundamental theorem of population genetics popularly
known as Hardy-Weinberg Law (equilibrium) which states that the gene and
genotypic frequencies remain constant through generations in a large random
mating population in the absence of natural selection, genetic drift, mutation
and migration. The data pertaining to any study on polymorphism is tested for
deviations from the equilibrium and when significant deviations are observed
proper explanations are sought for. Weinberg also studied Mendelian inheritance
in small pedigrees and by analysis of twins reared,apart, suggested methods for
resolving bias ascertainment of recessive inheritance. Haldane too developed
statistical tests to deal with biased human data. He in 1919 formulated the relation
between recombination frequency and linkage map distance and coined the term
centimorgan. In 1925, Bernstein through family studies identified multiple allelic
inheritance for ABO blood groups. Around 1930-32 Haldane, Fisher and Wright
20
established the principles of population genetics. In 1935 Haldane determined Definition and Scope
the spontaneous mutation rates of a human gene. After two decades, in 1955
Morton developed lod score method to determine linkage between two loci using
likelihood ratio method. Today genetic analysis of any condition is carried out at
population level to understand the distribution and dynamics of the genes studied
in those populations.
With the realization of the importance of population studies in genetics, another

field i.e. genetic epidemiology emerged that uses advanced analytical tools.
Genetic epidemiology deals with knowledge on prevalence of a condition/disease,
modes of inheritance, heterogeneity and mutation rates of hereditary diseases. In
1940s and 1950s, T. Kemp’s institute from Copenhagen, J.V. Neel’s institute
from Michigan, A.C. Stevenson’s from North Ireland contributed a great deal to
the understanding of genetic epidemiology. In recent years, complex analysis of
common diseases like diabetes, hypertension, coronary artery disease and
neurological and affective disorders is being carried out to predict risk for a
condition based on its association with epidemiological parameters and genes
implicated in its etiology.
1.3.8 Genomics
Genomics can be defined as the structural and functional studies of genome that
represents the total content of DNA within an organism or cell, including nuclear
and mitochondrial DNA. The human genome comprises of 3.2 billion nucleotides
and about 20,000 genes along with spaces between them. Under Human Genome
Project (HGP) entire DNA in human genome was sequenced in April 2003. The
sequence derived is being annotated to obtain complete map of human genome.
The organization of the human genome that has coding and non-coding sequences,
unique and repeated sequences, etc., is shown in the flow diagram (Fig. 1.5).
Fig. 1.5: Organisation of Human Genome

21
Introduction to Human 1.3.9 Clinical Genetics
Genetics
Clinical genetics can be defined as the branch of genetics that deals with evaluation
of genetic involvement in a disease/disorder and its treatment and management.
Three cardinal principles viz. genetic heterogeneity, pleiotropism and variability
should be essentially observed in the practice of clinical genetics. In simple terms,
genetic heterogeneity can be defined as occurrence of one and the same or nearly
the same phenotype having different modes of inheritance. This naturally has
different implication in genetic counseling.
Pleiotropism is defined as multiple end effects of the same gene and in some
conditions may result in a syndrome. A syndrome is defined as a collection of
symptoms arising due to a single gene defect. Pleiotropism is important to clinical
medicine because certain of the multiple effects of a given gene may provide
valuable clues in the diagnosis of serious internal diseases. Variability in the
expression of any disease is another important factor in clinical medicine. If the
expression of the condition is mild, the presence of the mutant gene can not be
recognized by the phenotypic appearance. In such cases the gene is said to be
non penetrant and such an individual, when present in a family the pedigree,
shows irregular dominant pattern of inheritance. Dominant genes are often
associated with penetrance while recessive genes are often associated with varied
expression of the condition.
1.3.9.1 Genetic Diagnosis

Genetic diagnosis can be defined as the determination of genetic cause underlying
a disease/disorder. Genetic diagnosis is carried out at chromosomal and gene
level including pedigree analysis, screening for known mutations using
biochemical, immunological and molecular markers. Other diagnostic tools
include ultrasound, X-rays, magnetic resonance imaging (MRI), echocardiograms,
angiograms etc. Simple investigations using blood biochemistry may become
useful in confirming the diagnosis like estimation of blood sugar levels in diabetes.
For certain conditions like birth defects and malformations (spina bifida,
anencephaly, cleft lip, skeletal abnormalities and some syndromes) prenatal
diagnosis even before the birth of the offspring can be performed through
ultrasound, fetoscopy and measurement of serum alpha protein levels etc.
Screening for metabolic defects like phenylketonuria and galactosaemia etc. and
mutations in genes causing congenital defects like in certain cases of blindness
and deaf mutism can also be performed using amniotic fluid and fetal cells. By
culturing foetal cells and chorionic villi it is possible to diagnose the chromosomal
disorders at early stage of pregnancy (4-16 weeks) and terminate the same, if
needed.
Genetic diagnosis can also be performed in the adult population using molecular
and other diagnostic tests as in prospective cases of Huntigton’s disease, myotonic
dystrophy and lipedemias etc. which are expressed in later years of life. Screening
of populations for carriers of the genetic cases is recommended to identify persons
at risk so that steps for proper management can be adopted.
1.3.9.2 Management of Genetic Conditions

Once the genetic diagnosis is available, one can look for the prognosis for
improving quality of patient’s life by using proper treatment. There are various
22
methods of treating genetic disorders right from using planned diet, Definition and Scope
supplementation of missing gene products, use of vaccinations, antibiotics and
drugs and surgical interventions etc. If this is not possible then extent of risks for
complication in the patient and recurrence of the condition in relatives can be
estimated. This preventive strategy is important to reduce the occurrence of the
condition in the population and burden to the society at large.
Advanced technologies like gene therapy that involves replacement of defective

gene with normal gene sequence, use of embryonic and adult stem cells to
regenerate the damaged tissues or organs (such as damaged heart muscles), use
of nano particles to deliver efficiently the normal genes or drugs to the target
sites are the most recent approaches that have revolutionarised the practice of
clinical genetics
1.4 SUMMARY
Human genetics is a branch of science that deals with the inheritance of characters
(traits) and diseases/disorders through generations from parents to offspring.
Genetic diseases may be caused by numerical or structural chromosomal
abnormalities (like trisomies, monosomies, translocations, deletions, duplications
and inversions) due to mutations or variations in DNA. These may follow
autosomal dominant, autosomal recessive, X-linked dominant, X-linked recessive
or mitochondrial (maternal) pattern of inheritance. Genes sometimes interact
with demographic and environmental factors and thus cause difficulty in
interpreting the mode of inheritance.
The dedicated work of scientists in the past led to the steady growth of the subject
of human genetics. Biochemical defects, mutations in DNA sequence, differences
in immune responses and abnormal chromosome complements were identified
as reasons for several diseases/ disorders. This led to the subdivision of the subject
of human genetics into branches like cytogenetics, biochemical genetics,
immunogenetics, pharmacogenetics, molecular genetics, somatic cell genetics,
population genetics, genomics, clinical genetics, genetic diagnosis and counseling.
Rapid progress in the subject, especially during the past five decades, has opened
several avenues for improving quality of human health and thereby longevity.
Today, differences between the individuals can be identified at single nucleotide
level and based on this information specific drugs can be used for treatment to
suit the genetic makeup of the individual.
Suggested Readings
Emery, A. E. H. 1986. Methodology in Medical Genetics, 2nd edition.
Edinburgh:Churchill Livingstone.
Emery, A. E. H. 1984. An Introduction to Recombinant DNA. Chichester: John

Wiley.
McConkey, E. H. 1993. Human Genetics the Molecular Revolution. Jones &

Bartlett: Boston.
Pasternak, J. J. 2005. An Introduction to Human Molecular Genetics: Mechanisms

of Inherited Diseases, 2nd Edition. New York: Wiley-LISS.
23
Introduction to Human Lewis, R. 2003. Human Genetics : Concepts and Applications. New
Genetics
York:McGraw-Hill.
Strachan, T. and Read, A. P.2004. Human Molecular Genetics, 3rd edition. New
York: Garland Science.
Vogel, F. and Motulsky, A.G. 1996. Human Genetics: Problems and Approaches.
3rd edition. New York: Springer.
Glossary
Allele : Alternative form of a gene at a locus, each of which
is a viable DNA sequence occupying a given
position, or locus on a chromosome.
Autosome : A chromosome not involved in sex determination.
Chromosomal theory : The chromosomal theory of inheritance is the idea
of inheritance that genes, the units of heredity, are physical in
nature and are found in the chromosomes.
Consanguinity : Consanguineous individuals have at least one
common ancestor in the preceding few generations.
Deoxyribose nucleic : DNA is a double-stranded molecule that encodes
acid (DNA) genetic information.
Domianant gene : Alleles that determine the phenotype displayed in a
heterozygote with another (recessive) allele.
Empiric risk : The chance that a disease will occur in a family
based upon experience (past history, medical
records, etc.) rather than theory.
Epistasis : A circumstance where the expression of one gene
is affected by the expression of one or more
independently inherited genes.
Expresivity : A term used in genetics to refer to variations in a
phenotype among individuals carrying a particular
genotype.
Gene : The fundamental physical and functional unit of
heredity. A gene is an ordered sequence of
nucleotides located in a particular position on a
particular chromosome that encodes a specific
functional product (i.e., a protein or RNA molecule).
Genetic counseling : The educational process that helps individuals,
couples, or families to understand genetic
information and issues that may have an impact on
them.
Genome : All the genetic material in the chromosomes of a
particular organism; its size is generally given as its
total number of base pairs.
Genomics : Refers to the study of the entire genome of an
organism.
24
Genotype : Genetic constitution of an individual Definition and Scope
Heterozygote : An individual having two different alleles at a locus

in a pair of homologous chromosomes.
Heterozygote detection : Identification of genetic carriers for a given trait.
Homozygote : An individual having two identical alleles at a locus
in a pair of homologous chromosomes.
Hardy–Weinberg : HWE states that both allele and genotype
equilibrium (HWE) frequencies in a population remain constant, that
is, they are in equilibrium from generation to
generation unless specific disturbing influences such
as drift, mutation, selection, among others, are
introduced.
Idiogram : A diagrammatic representation of a karyotype
showing the number, relative sizes, and morphologic
characteristics of the chromosomes of a species,
individual, or cell.
Inbreeding coefficient : The probability that the two genes present at a locus
in an individual are identical by descent.
Incomplete dominance : A form of intermediate inheritance in which one
allele for a specific trait is not completely dominant
over the other allele. This results in a combined
phenotype.
Karyotype : Arrangement of chromosomes according to their
size (from largest to smallest), position of centromere
and banding patterns (to identify homologous pairs).
Locus : Site for the location of genes on a chromosome.
Multifactorial condition: A characteristic influenced in its expression by many
factors, both genetic and environmental.
Mutation : Process by which genes undergo a structural change
or any heritable change in DNA sequence.
Nucleotide : A subunit of DNA or RNA consisting of a nitrogenous
base (adenine, guanine, thymine, or cytosine in DNA;
adenine, guanine, uracil, or cytosine in RNA), a
phosphate molecule, and a pentose sugar molecule
(deoxyribose in DNA and ribose in RNA).
Pedigree : A genetic representation of a family tree that
diagrams the inheritance of a trait or disease though
several generations.
Penetrance : The proportion of individuals carrying a particular
variant of a gene (allele or genotype) that also
express an associated trait (phenotype).
Phenotype : Observable characteristics of an organism produced
by the organism’s genotype interacting with the
environment. 25
Introduction to Human Pleiotropism : A single gene affects a number of phenotypic traits
Genetics
in the same organism.
Polymorphism : Genetic variations in DNA sequence occurring in
=1% of a population.
Prenatal diagnosis : Testing performed during pregnancy to determine
if a fetus is affected with a particular disorder.
Recessive gene : A gene that is phenotypically manifest in the
homozygous state but is masked in the presence of
a dominant allele.
RNA : One of the two types of nucleic acids and a single
stranded molecule found in all cells which transmits
genetic information from DNA to proteins produced
by the cell.
Sex chromosomes : The X and Y chromosomes in human beings that
determine the sex of an individual. Females have
two X chromosomes in diploid cells; males have
an X and a Y chromosome.
Stem cells : A stem cell is a cell with the potential to form many
of the different cell types found in the body.
Ultrasound : The visualization of deep structures of the body by
recording the reflections of echoes of pulses of
ultrasonic waves directed into the tissues.
X-linked dominant : Describes a dominant trait or disorder caused by a
mutation in a gene on the X chromosome.
X-linked recessive gene: A mutation in a gene on the X chromosome that
causes the phenotype to be expressed in males who
are hemizygous for the gene mutation (i.e., they have
only one X chromosome) and in females who are
homozygous for the gene mutation (i.e., they have
a copy of the gene mutation on each of their two X
chromosomes).
Sample Questions
1) Define human genetics? Briefly discuss the different branches of human
genetics.
2) Define the following terms
a) Human genetics, b) Genomics, c) Polymorphism and d) Pharmacogenetics.
3) What do you understand by somatic cell genetics? Mention its applications.
4) What is meant by Hardy-Weinberg equilibrium? Define.
5) What are cardinal features to be observed while practicing clinical genetics
and why?
6) Briefly describe the terms a) Gene therapy and b) Genetic counseling.
7) Describe briefly the organization of human genome.
8) What do you understand by polymorphism? Explain.
26
UNIT 2 BIOLOGICAL BASIS OF HUMAN
HEREDITY
Contents
2.1 Introduction
2.2 Organization of Various Cellular Components
2.3 Cell Division
2.3.1 Mitosis
2.3.2 Meiosis
2.4 Major differences between Mitosis and Meiosis
2.5 Biochemical Basis of Cell Division
2.6 Genetic Basis of Human Variation
2.7 Summary
Glossary
Suggested Readings
Sample Questions
Learning Objectives
&
Ø understand cell, its structure and other cellular components;
Ø discuss mitotic and meiotic cellular divisions and the differences between
them; and
Ø explain the genetic basis of human variation.
2.1 INTRODUCTION
Earlier biologists and geneticists viewed heredity and inheritance in a different
way, some of which are presented here to widen your understanding in this unit.
Galton’s theory of blending inheritance states that the hereditary characteristics
of the parents are irreversibly mixed in the progeny. Weismann (1892) put forth
his theory of germplasm inheritance according to which germplasm was
considered immortal and formed the bridge of life passing from generation to
generation. The blood theory of inheritance states that blood acts as a vehicle for
the transmission of characters from parents to offspring. All these views have
been rendered void after Mendel’s discovery of laws of inheritance. Currently,
the principle of chromosomal theory of inheritance is the valid concept to
understand heredity.
Hereditary mechanisms keep populations similar and stable from generation

to generation. But we know populations do change over time. Such changes
may be understood by studying the factors that alter the hereditary
mechanisms of populations.
William C. Boyd
27
Genetics 2.2 ORGANIZATION OF VARIOUS CELLULAR
COMPONENTS
Historical Background
Robert Hook (1665) observed the cell for the first time with the help of his
primitive microscope. The material that he observed was a piece of cork. This
structure of cell is now known as the unit of life. There is really no ‘typical’ cell
in which we can see all the features of the cell. Living things are composed of
material structural units called cells. A cell is the fundamental unit of structure
and function in an organism. It is that unit of organism which is delimited by
plasma membrane and is capable of self-reproduction (Loewy and Siekevitz,
1963). Sir Frederick Gowland Hopkins called cells as theaters of life. All cells
carry out the same biological function. They perform metabolic and reproductive
functions and maintain cellular integrity for our life. Cells combine to form
colonies (Functional Association) and form tissues (Facultative Association).
Cell Theory
The cell theory is a concept proposed by Schwann and Schleiden (1838-39) and
Rudolf Virchow (1858). This theory states that:
All organisms are made up of cells.
Cells are organisms.
Cells arise from pre-existing cells.
The activities of organisms are the outcome of individual cells.
Cell Types
Living organisms on earth provide us high degree of cellular diversity in reference
to cell types. There are two principle cell types’ namely unicellular simple
prokaryotes and multi cellular complex eukaryotes. The former shows the absence
of well-organized nucleus and nuclear membrane and the latter shows the presence
of them. The examples of prokaryotes (e.g. bacterial cell) and of eukaryotes (e.g.
human) are listed below:
Reproductive cells e.g. sperm, egg.
Somatic cells e.g. nerve cells.
Intestinal cells e.g. mucosa.
Columnar epithelial cells e.g. gut.
Goblet cells e.g. lumen of gut.
Connective tissue cells e.g. collagen fibre.
Muscle cells e.g. smooth muscle cell.
Unicellular organisms e.g. amoeba.
Prokaryotic cell e.g. bacterium.
Eukaryotic plant cell e.g. onion peel cell.
Eukaryotic cell e.g. human cheek epithetical.
28
Cell Structure Biological Basis of Human
Heredity
The cell consists of three principle components. They are: 1) Plasma membrane
2) Cytoplasm and 3) Nucleus, and all of them are combinely known as protoplasm.
The nucleus controls all the activities of the cell (Fig. 2.1). Besides this, the
cytoplasm possesses many organelles and inclusions. For example, endoplasmic
reticulum and mitochondrion are organelles while vacuoles and vesicles are
inclusions. The cell has two types of membranes: 1) cytoplasmic membrane
which regulates internal environment and 2) internal membrane which encloses
organelles and perform metabolic functions such as mitochondrial ATP synthesis.
There are many organelles present inside the cell. The nucleus and chromosomes
take active part in the hereditary transmission of characters so we will examine
them in greater detail in the following.
animal cell plant cell
microvilli
ribosome
pinocytic
vesicles
thylacoids
nuclear
pore
cristae chloroplast
cell wall
oxysome chromatin
desomosome
nucleus
oxysome
endoplasmic
mitochon- reticulum
drion (smooth)
tubuli
golgi body centrosome endoplasmic reticulum (rough)
Fig 2.1: Diagrammatic representation of cell structure showing differences in animal and
plant cells (Source: Gupta (1974).
The Nucleus
Nucleus is the most vital part of the cell. It controls all the activities of cell and
can be called as manager of the cellular factory. It was first discovered by Robert
Brown in 1831. It is defined as any formation surrounded by cytoplasm from
which chromosomes arise during cell division. Nucleus is present in all cells.
However, it is absent in human red blood corpuscles (RBC) and in some lens
cells.
The nucleus is bounded by a double layer of membranes called nuclear membrane.

A thread like material can be seen within nucleus called chromatin which consists
of DNA and proteins. The nucleus is filled with a transparent substance called
nuclear sap in which nucleolus and chromatin threads remain enclosed.
29
Introduction to Human The nucleus consists of nucleolus proteins and nucleic acids. The nucleic acids
Genetics
are of two types - DNA (deoxyribonucleic acid and RNA (ribonucleic acid).
DNA is present in chromatin network and RNA is present in nucleolus.
The most significant role of the nucleus is to store and transmit hereditary
information from generation to generation of cells.
The Chromosomes
Chromosomes are self-reproducing thread like structures located inside the
nucleus. The word chromosome (chromo = colour, soma = body) means coloured
bodies. They can be easily stained with dyes. Hofmeister in 1848 discovered
chromosomes. They are the vehicles of heredity and serve as our horoscope. The
chromosome number varies from species to species. But it remains constant
between the members of the same species.
Humans have 46 chromosomes in 23 pairs: 22 pairs are called autosomes and

one pair is the sex chromosomes X and Y. These chromosomes are divided into
7 (A-G) groups as per Denver- London System of classification. From cytogenetic
point of view, males are characterized by (22 autosomes + XY) and females are
characterized by 22 autosomes + XX. The presence of barr body is characteristic
of females and sex determination in humans. Males with 22 autosomes + XY are
heterogametic producing two types of gametes, while females with 22 autosomes
+ XX are homogametic producing one type of gamete (Fig. 2.2).
Fig. 2.2: Sex determination (Source: Sabanayagam, 1990).
The principle of chromosomal basis of hereditary transmission clearly states

that genes we have with their unique features form an integral part of the
chromosome of each cell. Sexual reproduction mediates the transmission of
chromosomes (genes) from generation to generation. The chromosomal
30
constitution of an individual, a species or race is called karyotype which is an Biological Basis of Human
Heredity
arrangement of chromosomes according to their size and position of centromere.
There are 4 types of chromosomes (Fig.2.3): metacentric, sub-metacentric,

acrocentric (with satellites), acrocentric (without satellites) and telocentric (absent
in man). However, acentric chromosomes without centromere can also be found.
Fig 2.3: Human chromosomes, one member of each homologous pair, shown in groups A
to G , and in numerical order of Denver London classification. Banding pattern
indicated. The sex chromosomes X and Y are shown in groups C and G, respectively
(Source: Bhatnagar et al., 1977).
The Cell Cycle
Living organisms are characterized by two important features, growth and

reproduction. Each cell grows to a definite size and then it undergoes self-
reproduction to give daughter cells.
There are two phases/periods in the life of a cell. They are N (inter phase or
period of non-division) and M (phase or period of division). The longest phase
in cell cycle is the inter phase (89 hours). The cycle shows 4 distinct phases.
31
Introduction to Human G1 Phase S – Phase
Genetics
M-Phase
G2 Phase
G1 - Gap (1st Growth)
S = Synthesis
G2 = 2nd Growth
M = Mitosis
The M phase consists of the following two sub phases.
Karyokinesis – division of nucleus into two daughter nuclei.
Cytokinesis – division of cytoplasm into two daughter cells.
2.3 CELL DIVISION

Organisms show two types of cell division viz., mitosis and meiosis. Following
is the brief account of cell divisions with their genetic significance.
2.3.1 Mitosis
Mitosis is essentially somatic cell division and was first discovered by Fleming
in 1879. It is defined as that cell division which gives rise to two identical daughter
cells, each with nucleus containing the same amount of DNA and same genes as
the parent cell. Mitosis is necessary for growth and reproduction of all living
organisms.
Following are the types of mitosis.
Intra nuclear mitosis: It occurs within the nucleus (cell division).
Extra nuclear mitosis: It occurs outside nucleus but in cytoplasm.
Endomitosis: Chromosomes multiply without cell division e.g. polytene chromosome.
Mechanism of Mitosis
The mitotic division takes place in following two stages.
Karyokinesis – the division of nucleus into two daughter nuclei
Cytokinesis – division of cytoplasm into two daughter cells.
The former cell division takes place in four stages. They are prophase, metaphase,
anaphase and telophase (Figs. 2.4, 2.5). We will examine in brief these changes
in each phase.
1) Prophase – It is the first phase of mitosis in which chromosomes become

short and thick; each chromosome is formed of two chromatids and are
connected by centromere.
32
2) Metaphase – Chromosomes are arranged in the equatorial plane and Biological Basis of Human
Heredity
chromosomal fibers are formed.
3) Anaphase – The chromatids of each chromosome are separated to form two

daughter chromosomes which move to opposite poles of the cell.
4) Telophase – It is the last stage in cell division in which chromosomes uncoil

and lengthen, nucleolus appears, spindle fibers are dissolved into cytoplasm
and two daughter nuclei are formed.
Fig. 2.4: Some early stages of mitosis (after King, 1965) (Source: Verma and Agarwal,
1982). 33
Genetics
Fig. 2.5: Late stages of mitosis (after King, 1965) (Source: Verma and Agarwal, 1982).
Genetic significance of Mitosis

The mitotic cell division ensures equitable distribution of nucleus and cytoplasm
between the daughter cells. The number of chromosomes in the parent cell is the
same in daughter cells. Therefore, the structural, functional and hereditary
potentialities of both daughter cells are same as that of the parent.
2.3.2 Meiosis
Meiosis cell division was discovered by Farmer in 1905. It is also called as
reduction division or reproductive division because the diploid (2n) chromosomes
are reduced to haploid (n). It occurs only in reproductive (germ) cells. The cell in
which meiosis takes place is called meiocytes. It is more complex than mitosis.
Meiosis has two stages as follows.
1) Heterotypic division (First Meiotic Division): The diploid cell is divided

into 2 haploid cells.
2) Homotypic division (Second Meiotic division): During this, the two haploid
cells of Ist division divide into 4 haploid cells. The daughter cells are similar
to parent cell in chromosome number.
34
The important point to note here that during the first meiotic division, the Biological Basis of Human
Heredity
centromere does not divide causing the reduction in the number of chromosomes.
During second meiotic division, the centromeres divide and not the chromatids.
Meiosis – First stage (Prophase) is represented in the Fig. 2.6 and is comprised
of 5 different stages as follows.
1) First Prophase
i) Leptotene – The diploid chromosome appear in the nucleus.
ii) Zygotene – The identical chromosomes come close to each other and
undergo pairing whole length. This is called synopsis. The paired
chromosomes become Bivalent condition.
iii) Pachytene – The bivalent chromosomes coil around one another and
get shortened, chromosomes are haploid.
iv) Diplotene: The longitudinal split of chromosome give rise to 2 chromatids.
v) Diakinesis: Chromosomes coil and become further short. They remain
distributed in the Nucleus.
centriole
chromosome
Fig. 2.6: The mechanism of distribution of chromosomes during meiosis first (after King,
1965) (Source: Verma and Agarwal, 1982).
35
Introduction to Human Further stage of Meiotic division is known as Meiosis II and is represented in
Genetics
Figure 2.7. In addition to First Prophase, Meiosis consists of the following stages.
1) First Metaphase: Nuclear membrane disappears, nucleolus vanishes, nuclear
spindle develops and bivalent chromosomes move towards equatorial plane.
Each chromosome has 2 centromeres and attached to spindle fibers.
2) First Anaphase: The two pairs now get separated and move to opposite poles.
3) First Telophase: Two daughter nuclei each with a pair of chromatids formed
at the poles. The nuclei are haploid.
4) Second Metaphase: The paired chromatids are widely separated and point
of attachment is at centromere.
5) Second Anaphase: The chromatids separate in opposite poles.
6) Second Telophase: 4 daughter nuclei are formed each with haploid (N)
number of chromosomes.
centromere chromatids
Fig. 2.7: The different stages of meiosis (after King, 1965) (Source: Verma and Agarwal,
1982).
Genetic significance of Meiosis
1) Gametes are produced by meiosis and are essential units of sexual
reproduction.
2) Meiosis reduces diploid (2n) chromosomes characteristic of somatic cells to
36 the haploid number (n) characteristic of gametes.
3) Meiosis prevents in the duplication of chromosomes in the zygote which Biological Basis of Human
Heredity
otherwise would be abnormal.
4) The constant number of chromosomes is maintained by meiosis in a given species.
5) Meiosis provides new combination of genetic material due to crossing over.
The hereditary factors (genes) from males and females get mixed causing
genetic variations among species. Variations are the principle source for
evolution.
6) Meiotic drive refers to disturbance in 1:1sex ratio.
2.4 MAJOR DIFFERENCES BETWEEN MITOSIS

AND MEIOSIS
The following are some of the major differences between mitosis and meiosis.
Mitosis Meiosis
1. It is a simple cell division. 1. It is a complex cell division.
2. It takes place in somatic (body) 2. It takes place in reproductive
cells. (germ) cells.
3. It helps for the growth of 3. It is concerned with
organism. reproduction.
4. It is a single step cell division. 4. It is a multiple step cell division.
5. It produces two cells. 5. It produces four cells.
6. Similarity between daughter cells 6. No similarity between daughter
and parent cells is observed. cells and parent cells is observed.
7. Chromosome number of 7. Chromosome number of
daughter cells is same as parents daughter cells is reduced to half
i.e. if parents are 2N each, the i.e. if parents are 2N each, the
daughter cells are also 2N. daughter cells are N each.
8. Daughter cells further divide and 8. Daughter cells do not divide
grow. further.
9. Prophase is short and simple. 9. Prophase is long and complex.
10. No pairing of homologous 10. Pairing of homologous
chromosomes occurs. chromosomes Occurs.
11. No chiasmata and crossing over 11. Chaismata is formed due to
occurs. crossing over of chromosomes.
12. Absence of crossing over and 12. Crossing over and of exchange
absence of exchange of genes. of genes occur.
13. Centromere position is towards 13. Opposite situation is observed in
equator and arms towards poles. meiosis.
14. The size of chromosomes is thin 14. The size of chromosomes is short
and large. and thick.
15. Telophase occurs. 15. Telophase may be absent.
16. Karyokinesis (nuclear division) 16. Cytokinesis may be absent.
is followed by cytokinesis.
37
Genetics 2.5 BIOCHEMICAL BASIS OF CELL DIVISION
The biochemical basis of cell division is not very simple and straight as we
believe. It involves various highly sensitive cellular interactions and based on
enzymes. Cell biologists are currently involved in unraveling the mystery of cell
divisions through intensive current research. Recent advances in cell biology
genetics and molecular biology have shown new insights into cell division. All
higher organisms possess B1 type of cyclins. Mitotic cyclins play a vital role in
cell division. They are accumulated; activated and destroyed during cell division.
When cellular proteins are phosphorylated to high degree the cell enters Mitosis.
When they are dephosphorylated the cell leaves Mitosis.
2.6 GENETIC BASIS OF HUMAN VARIATION

Genetic variability is a universal feature of all breeding populations. It forms a
pre-requisite condition for evolution.
Human body with all its physical attributes is the product of heredity and
environment. Variation is due to heredity and environment says Galton. Variation
forms the principal source for evolution. When variation within a population is
converted into variation between population evolutions occurs (Lewontin, 1967).
The Mendelian school and Darwinian school differ in their very outlook of
variations. The former look at variations upward from the genes, while later
looks at variation downward from the phenotype. Variations refer to dynamic
study of gene differences in the population to understand evolutionary changes.
The greater genetic diversity in man is due to combination of alleles. Besides
this, mutations play a vital role in the maintenance of genetic variability.
How Variations originate in the Biological System
We have good constancy in the operation of various biological systems. For

example
1) Precise transcription of DNA
2) Precise pattern of chromosome movement
3) Strong sugar–phosphate backbone of DNA that maintains correct
transmission of hereditary information.
4) Mitosis ensures identical genetic content in daughter cells
With all the above mechanisms of constancy, biological systems generate new
information or combination of new information. At the backdrop of above
constancy, all biological systems have to play following two games of chance to
play.
1) Errors in the replication of DNA (mutations).
2) Random assortment of chromosomes pair (meiosis).
38
Types of Variations Biological Basis of Human
Heredity
A) Phenotypic variation
Phenotypic variation
Continuous variation Discontinuous variation Quasi Semi Continuous

(Quantitative variation) (Qualitative variation) Variation
e.g. height, weight e.g. blood groups, hair colour, e.g. ridges on fingers,
skin colour number of teeth
B) Genotypic variation (VG)
It is that portion of phenotypic variation which is entirely due to genes. This is

called H (heritability). If H is 100% then all variations are genetic. In other words,
it means absence of environmental variation. As environmental variation
increases, heritability decreases. The remarkable genetic diversity which sets
each person apart is a unique phenomenon in nature. There is a definite genetic
basis of this variation. Even among MZ (monozygotic) identical twins variations
are bound to occur due to intra – uterine environment. It is often said that there
are as many genotypes as many individuals in the world.
Genes (hereditary factors) play a very important role in causing variation. At

cellular level, DNA has a definite role to play in genetics as shown in the following
diagram.
DNA Replication DNA DNA
rRNA mRNA tRNA
Translation
V
Proteins
Genes are located in linear fashion on the chromosomes which are made up of
DNA and proteins. Thus DNA segments are genes. It is the germ cells which
carry genes from one generation to another. Life itself is an eternal journey from
cell to cell.
The gene is made up of 4 functional units namely Codon, Recon, Muton and
Cistron. Gene is a segment of DNA molecule that codes polypeptide.
2.7 SUMMARY
This unit provides a comprehensive picture on various aspects, heredity,
inheritance, biological and genetic basis of transmission of hereditary characters
in man. Besides this, this unit is endowed with good coverage of all basic points
in reference to cell, cell structure, cell types, structural components of cell, mitosis
and meiosis their major differences and genetic basis of human variation. 39
Introduction to Human Glossary
Genetics
Phenotype : Observable hereditary characteristic of an individual.
Genotype : Characteristic present in an individual.
Karyokinesis : Division of nucleus.
Cytokinesis : Division of cytoplasm.
Diploid : The double state of all chromosomes in somatic cells
(2N).
Somatic cells : Cells of the body.
Reproductive cells : Germ cells e.g. egg, sperm.
Homogametic : Produce one type of gametes (females).
Heterogametic : Two types of gametes are produced (males).
Gene : A segment of DNA that codes for one polypeptide.
Prokaryotes : Unicellular primitive organisms.
Eukaryotes : Multicellular organisms.
Karyotype : The chromosome set of a somatic cell. It is also called
idiograph.
Locus : The site of location of the gene on chromosome.
Centromere : The constricted portion of the chromosome.
Chromatid : One of the two identical longitudinal half of
chromosome.
Crossing over : Exchange of genetic material between two homologous
chromosomes during meiosis.
Codon : A triplet of 3 successive bases in a DNA or RNA
molecule that code for single amino acid.
Cistron : The smallest structural and functional unit of the gene
which specifies the coding of a particular polypeptide.
Muton : Smallest sub unit of cistron that brings mutation in the
genetic material, as small as one nucleotide pair.
Recon : The smallest unit of sub unit of cistron that is capable
of recombination equals one nucleotide pair.
Allele : An alternate form of a gene occurring at a locus.
Meiotic drive : Refers to disturbance in 1:1 sex ratio.
Acentric : Chromosomes without centromere.
chromosome
40
Suggested Readings Biological Basis of Human
Heredity
Gupta, P.K. 1974. A Text Book of Cytology, Genetics and Evolution. Meerut:
Rastogi Publications.
Verma, P.S. and Agarwal, P.K. 1982. Genetics. New Delhi: S. Chand Publishers.
Bhatnagar, S.M. Kothari, M.L. and Mehta L. A.,1977. Essentials of Human

Genetics. Bombay: Kothari Medical Publishers.
Gopalkrishnan, T.S, Sambasivaiah, I. and Kamalakara Rao, A.P. 1972. Elements

of Cytology. Madras: Pearl Publications.
Arumugam, N. 1992. Cell Biology, Genetics and Molecular Biology.

Kanyakumari: Saras Publications.
Phondke, B. 1992. Life from Cell to Cell. New Delhi : CSIR PID Publications.
Das, B.M. 1998. Outlines of Physical Anthropology. New Delhi: Kitab Mahal.
Sample Questions
1) What is the difference between prokaryotes and eukaryotes in their cell
structure?
2) What is cell theory? Who proposed it? Explain the theory.
3) What is the composition of a gene? How many functional units are present
in it?
4) Explain transcription, translation and replication with reference to DNA.
5) Define mitosis. Briefly comment on various stages of cell division.
6) Define meiosis and list various stages involved in this cell division.
7) What are the major differences between mitosis and meiosis. What is genetic
significance of cell division.
8) What is karyotype?
9) What are the three principle components of a cell? Elaborate.
10) Explain in brief various earlier theories of heredity and inheritance.
41
Genetics UNIT 3 FORMAL GENETICS
Contents
3.1 Introduction
3.2 Mendel’s Laws of Inheritance
3.2.1 Law of Uniformity
3.2.2 Law of Segregation
3.2.3 Law of Independent Assortment
3.2.4 Back Cross and Test Cross
3.3 Inheritance Patterns in Man
3.3.1 Monogenic Inheritance
3.3.2 Autosomal Dominant Inheritance
3.3.3 Autosomal Recessive Inheritance
3.3.4 Sex Linked Inheritance
3.3.4.1 X-Linked Dominant Inheritance
3.3.4.2 X-Linked Recessive Inheritance
3.3.4.3 Y-Linked Inheritance
3.3.5 Extranuclear Inheritance
3.4 Sex Limited Characters
3.5 Sex Influenced Characters
3.6 Multiple Alleles
3.7 Polygenic or Multi-factorial Inheritance
3.8 Summary
Suggested Readings
Sample Questions
Learning Objectives
&
After having studied the contents of this unit, you should be in a position to:
Ø understand the classical concepts of inheritance in man;
Ø explain the different types of simple factor human inheritance; and
Ø discuss the different types of complex types of human inheritance.
3.1 INTRODUCTION
Formal genetics deals with the study of Mendel’s laws of inheritance, suggesting
the transmission of single gene characters in the families, along with more
complex types of inheritance such as multi-factorial or polygenic inheritance.
This unit also deals with multiple allelic inheritance, which is an extension of
single genic inheritance. Further, other exceptions like epistasis are also dealt
with here. Under single genic inheritance, autosomal dominant and autosomal
recessive inheritance and sex-linked inheritance (X-linked inheritance and Y-
linked inheritance) are covered. Inheritance of sex-limited and sex influenced
characters is also described.
42
Formal Genetics
3.2 MENDEL’S LAWS OF INHERITANCE
Gregor Johann Mendel was born on July 22, 1822 to peasant parents in a small
agrarian town in Czechoslovakia. He is considered as the father of genetics.
Through his hybridization experiments on garden pea plant (Pisum sativum), in
the year 1865 he presented some basic ideas on inheritance in a research paper.
This remarkable piece of work unfortunately remained unrecognized for 34 long
years. In the year 1900, Mendel’s work was rediscovered by three botanists namely
Hugo de Vries, Carl Correns and Erich Von Tschermak. Interestingly, it was not
Mendel but Correns, one of the discoverers of Mendel’s work, who proposed this
work as Mendelian laws of Inheritance. These laws of heredity are listed below.
1) Law of uniformity.
2) Law of segregation or Law of purity of gametes.
3) Law of independent assortment or Law of free recombination.
From the monohybrid crosses, in which crosses were made between parents,
each of which exhibited one of two contrasting forms of the characters, Mendel
suggested as follows.
Genetic characters are controlled by unit factors (later called genes) that occur in
pairs on homologous chromosomes in individual organism.
When two unlike unit factors responsible for a single character are present in a
single individual, one unit factor may be dominant over the other, which is referred
to as recessive.
3.2.1 Law of Uniformity

Mendel’s first law states that when plants with two contrasting characters are
crossed (mated), the characters do not blend. If any character does not express in
the first generation, it may reappear without any change in subsequent generations.
3.2.2 Law of Segregation

The second law states that in a heterozygote the dominant and recessive factors
(genes or alleles) remain together throughout life without contaminating or mixing
with each other and finally separate or segregate from one another so that each
gamete receives only one factor either dominant or recessive. For explanation,
see the following figures.
Monohybrid cross in garden pea plants

Pure bred tall Pure bred short
tt
TT
Cross Pollination
Tt Tt
Tt
Tt
F1 generation All Hybrid Tall Self-pollination
(First Filial Generation) (Tt)
Fig. 3.1: All the plants of F1 generation are genetically Tt. 43

Genetics To determine the types and frequencies of various offspring expected we normally
use squares called Punnett Squares in genetics.
Gametes of pure bred tall plant
T T
Gametes of pure bred short plant t Tt Tt
t Tt Tt
Fig. 3.2: The Punnett’s square showing genetic constitution of offspring resulted due to the
mating between pure short and pure tall plants.
Monohybrid cross in humans
Normal Skin Colour Albinism

(with Melanin) (without melanin skin pigment)
AA aa
F1 Generation Aa (all hybrid individuals are genetically normal)
A = Normal dominant
a = Abnormal recessive
Fig. 3.3: Monohybrid cross (mating) for skin colour in Man.
A A a (Gametes)
a
Aa Aa Aa Aa
Fig. 3.4: All the individuals of F1 generation are genetically hybrid.
Gametes of pure bred

normal individuals
A A
Gametes of pure bred albinos a Aa Aa
a Aa Aa
Fig. 3.5: The punnett squares showing the genetic contribution of the offspring resulted
from mating between pure normal and pure albino individuals.
3.2.3 Law of Independent Assortment

The law of independent assortment or recombination states that the members of
different pairs of factors (genes) assort independently of each other when the
gametes are formed. Because of that new combinations (or all possible
combinations) of characters are produced in the offspring.
44
For explanation see the following figures. Formal Genetics
Di hybrid cross in pea plants having yellow, round, green and wrinkled seeds.
YR X yr Corss
Pure bred Prue bred Pollination
yellow round green wrinkled
F1
F2
Checker Board
Genotype YyRr YR YR
Phenotype Yellow Yr YyRr YyRr

Round
Yr YyRr YyRr
Fig. 3.6a: Di hybrid cross F1 generation.
YR Yr yR yr
YR YRYR YRYr YRyR YRyr
Yr YrYR YrYr YryR Yryr
yR yRYR yRYr yRyR yRyr
yr yrYR yrYr yryR Yryr
Fig. 3.6b: Di hybrid cross F2 generation.
Genotypes: 9 different combinations.
Phenotypes: 9 Yellow Round : 3 Yellow Wrinkled : 3 Green Round : 1 Green

Wrinkled.
In case of di hybrid cross, when mating takes place in humans showing different
contrasting pairs of characters, it will be observed that assortment of genes of
one pair will be independent of the other pair.
From the above figure it is revealed that each pair of contrasting characters behaves
independently and bears no association with a particular character.
45
Introduction to Human In the ABO blood group system of human beings, ABO*A and ABO*B are
Genetics
codominant and both are dominant over ABO*O which is recessive, while in the
Rhesus blood group system, RH*D is dominant over RH*d. If an individual
with A blood group (ABO*A ABO*A) and RHD+ factor (RH*D RH*D ) marries
a person possessing O blood group (ABO*O ABO*O) and RHD- factor (RH*d
RH*d), then due to the independent assortment of the two blood group systems
9:3:3:1 dihybrid ratio is observed in the offspring.
ABO*A ABO*A RH*D RH*D ABO*O ABO*O RH*d RH*d
A blood group O blood group

X
RH*D+ RH*D-
Gametes ABO*A RH*D ABO*O RH*d
F1 : ABO*A ABO*O RH*D RH*d i.e. A blood group, RH*D+
Fig. 3.7: Dihybrid cross F1 generation.
Punnett’s checker board

F1 generation
Ova ABO*A RH*D ABO*A RH*D
Genotype Sperm
ABO*A ABO*O RH*D RH*d ABO*O ABO*A ABO*O ABO*A ABO*O
RH*D RH*D RH*d RH*D RH*d
Phenotype
All A-blood group RH*D+ ABO*O ABO*A ABO*O ABO*A ABO*O
RH*D RH*D RH*d RH*D RH*d
F2 generation
Gametes ABO*A RH*D, ABO*O RH*D, ABO*A RH*d, ABO*O RH*d
ABO*A RH*D ABO*A RH*d ABO*O RH*D ABO*O RH*d
ABO*A RH*D ABO*A ABO*A ABO*A ABO*A ABO*A ABO*O ABO*A ABO*O
RH*DRH*D RH*D RH*d RH*DRH*D RH*D RH*d
ABO*A RH*d ABO*A RH*d ABO*A RH*d ABO*A RH*d ABO*A RH*d
ABO*O RH*D ABO*O RH*D ABO*O RH*D ABO*O ABO*O ABO*O RH*D
ABO*A RH*D ABO*A RH*d RH*DRH*D ABO*O RH*d
ABO*O RH*d ABO*O RH*d ABO*O RH*d ABO*O RH*d ABO*O RH*d
Genotype 9-different combinations.
Phenotype
Dyhybrid cross: F2 generation
9 A Blood group RH*D+
3 A Blood group RH*D-
3 O Blood group RH*D+
1 O Blood group RH*D-
46
3.2.4 Back Cross and Test Cross Formal Genetics
When F1 individuals are crossed with one of the parents from which they are
obtained, such cross is called back cross. In such back crosses, when F1 is back
crossed to the parent with dominant phenotype, no recessive individuals are
derived in the offspring. But when F1 progeny is back crossed with its recessive
parent, both phenotypes (i.e. dominant and recessive) appear in the progeny.
While both of these crosses are back crossed, only the cross with the recessive
parent is called Test Cross.
Examples
I) Monohybrid Test Cross
In a monohybrid cross of homozygous tall (DD) and homozygous dwarf (dd)
plant is crossed either with its dominant parent to perform a back cross or with
its recessive parent to perform a test cross the following results are obtained
P1
Homozygous tall X Homozygous dwarf

(DD) (dd)
Heterozygous Tall
Dd
A) Back Cross
F1 Tall X P1 Tall
Dd DD
½ DD ½ Dd
Back Cross Homozygous Tall Heterozygous Tall

Progeny (All Tall)
B) Test Cross
F1 Tall X P1 Dwarf
Dd dd
½ Dd ½ dd
Test Cross Progeny Homozygous Tall Homozygous Dwarf
Or Test Cross ratio = 1:1
II) Di hybrid Test Cross
The test cross of heterozygous yellow round (YyRr) seeded pea plant with a
double parent recessive parent (green wrinkled yyrr) yields a test cross genotypic
ratio of 1 : 1 : 1 : 1 as follows.
47
Introduction to Human P1
Genetics
Yellow, Round X Green, Wrinkled
(Heterozygous) (Homozygous)
YyRr X yyrr
F1
1YyRr : 1Yyrr : 1 yyRr : 1 yyrr
(Or)
¼ Yellow round : ¼ yellow wrinkled : ¼ green round : ¼ green wrinkled
3.3 INHERITANCE PATTERNS IN MAN

It is necessary to know the patterns of inheritance in man, before understanding
the features of any genetic disease for the following reasons.
• For the precise diagnosis of genetic disorders.
• To estimate the risk of genetic disease (recurring risk) appearing in the
offspring.
• To identify the means to prevent the genetic disease.
The inheritance of common traits will broadly fall in the following categories.
• Monogenic (single gene) or Mendelian Inheritance.
• Polygenic or multi-factorial inheritance.
3.3.1 Monogenic Inheritance

In monogenic (also referred to as single gene or Mendelian) inheritance, the trait
or character is determined by single gene and it follows Mendel’s laws of
inheritance. This single gene inheritance is further classified as follows.
Autosomal inheritance
Sex-linked inheritance
Autosomal inheritance is due to the gene present on autosome while sex-linked

inheritance is determined by gene present on sex chromosome (X or Y). The
autosomal inheritance is further classified into autosomal dominant and autosomal
recessive. In case of autosomal dominant inheritance, the gene manifests itself
even in single dose (heterozygous state) while an autosomal recessive inheritance
the trait is expressed only when the gene is present in double dose (homozygous
state). Sex-linked inheritance is determined by a gene present on the sex
chromosome (X or Y) i.e. it could be X-linked or Y-linked.
Pedigree Chart
A pedigree diagram is used to follow the transmission of the character in the
families, over different generations using certain symbols as listed below.
• Squares represent males and circles represent females.
• Affected persons (proband / propositus / index case) for male and female are
shown by solid squares or solid circles, respectively.
48
• The position of affected person(s) in the family tree is indicated by arrow. Formal Genetics
• Mating is represented by horizontal line.

• The order of birth of children is shown from left to right.
• The successive generations are shown by roman numerals. e. g. I, II, III and
IV etc.
3.3.2 Autosomal Dominant Inheritance

The genes responsible for autosomal dominant characters are present on
autosomes and can express the trait even in single dose (heterozygous state).
Following are some of the examples.
Trait Characteristic features
Achondroplasia Dwarfism with short limbs, normal size head and
trunk.
Hypercholesterolemia Very high serum cholesterol levels, heart disease.
Polydactyly Extra fingers and/or toes.
Huntington disease Progressive uncontrollable movements and
personality changes, beginning in middle age.
Characteristic features of autosomal dominant inheritance are listed below:

1) A trait can appear in either sex because an autosome carries the gene.
2) The trait does not skip generations.
3) An affected person will always have an affected parent.
4) Normal children do not transmit the trait to the next generation as they do
not have the abnormal gene.
Affected heterozygous parent (Aa)
Gametes 1:1
A: Mutant gene a: Normal gene
Aa = 50% (Heterozygous affected) aa = 50% (Homozygous normal)
Affected Heterozygous Parent

(Aa)
Gametes1:1 A a
When affected heterozygous parent (Aa) marries unaffected parent (aa)

Aa X aa
Aa (50% Heterozygous affected)
Gamete A a
aa (50% Homozygous normal/ a Aa aa
unaffected)
a Aa aa
Fig. 3.8: Autosomal dominant Inheritance 49

Introduction to Human Some of the exceptions like pleiotrophy, variable expressivity of gene, incomplete
Genetics
penetrance, co-dominance and intermediate inheritance are discussed here in
detail in the following.
Pleiotrophy
Usually an autosomal dominant gene has one effect and thus involves only one
organ or part of the body. However, when single gene disorder produces multiple
phenotypic effects then it is called pleiotrophy. For example, in case of
osteogenesis imperfecta the mutant gene is responsible for defect in the synthesis
of collagen. However, the formation of defective collagen leads to many other
defects like osteosclerosis, blue sclera and brittle bone etc.
Variable expressivity of gene

The phenotypic expression of an autosomal dominant gene can vary from person
to person. In clinical terms the expression of gene may be in mild, moderate or
severe form of the trait. One common example is polydactyly (extra finger). In
some individuals this extra finger may be fully formed while in other individuals
it may be very small.
Incomplete penetrance
It is the extreme end of variable expressivity. In this condition a person who is
heterozygous for a dominant disorder fails to manifest a disorder clinically. Thus
it may appear as if the disorder has skipped the generation. The penetrance of a
gene in any generation is expressed in terms of percentage (%) which is calculated
from the number of offspring showing the trait as compared to the expected.
The cause of reduced penetrance or the variation in the expression of gene may
be due to influence of genes at other loci. It may be also due to the difference in
environmental factors.
Codominance
When both the traits are expressed fully in heterozygous state they are called
codominant. For example, a person with blood group AB shows both A and B
antigens on his red blood cells. The allelic genes ABO*A and ABO*B, which are
present near the tip of long arm of chromosome 9, are therefore codominant.
Intermediate Inheritance
In the heterozygous condition of a recessive trait, abnormal (mutant) allele is
unable to express itself. However, when in heterozygous condition if it shows
intermediate expression between abnormal heterozygous and normal
heterozygous then this is known as intermediate inheritance.
3.3.3 Autosomal Recessive Inheritance

For the manifestation of this trait, the gene should be in homozygous state (double
dose). Following are some examples.
Phenylketonuria Mental retardation, fair skin
Cystic fibrosis Lung infection and congestion, poor fat digestion, male
infertility, poor weight gain, salty sweat
50
Following are the characteristic features of autosomal recessive inheritance Formal Genetics
1) The trait can also appear in either sex.

2) Affected individuals have homozygous recessive genotype, while the
heterozygotes, called carriers, are quite healthy.
3) The trait can skip generations.
4) Parents of the affected individual are either heterozygous carriers or have
the trait.
5) Consanguinity among parents can increase the recurrence risk of the disease.
Aa X Aa
Mating between carrier parents
Normal but carrier parent (Aa)
A a
Normal but carrier parent (Aa) A AA Aa
a Aa Aa
A= mutant gene, a =Nomal gene
AA = 25% normal Aa = 50% normal but carrier aa = 25% affected
Genotypic ratio 1:2:1

Phenotypic ratio 3:1
Fig. 3.9: Autosomal recessive inheritance.
3.3.4 Sex Linked Inheritance

This type of inheritance depends on the genes present on X or Y chromosome;
chiefly it is one of the following two kinds.
1) X-linked inheritance
2) Y-linked inheritance
X-linked Inheritance may be dominant or recessive.
3.3.4.1 X-Linked Dominant Inheritance
This disorder is due to the presence of mutant gene on X chromosome. As the
gene is dominant, it expresses in heterozygous females as well as in males. This
type of inheritance resembles that of an autosomal dominant inheritance but can
be distinguished owing to the fact that an affected male passes on this trait to all
his daughters but to none of his sons. Therefore, to distinguish this character
from autosomal inheritance one has to observe the offspring of affected males.
Further, gene expression of X-linked dominant allele is different in two sexes. A

female who inherits dominant X –linked allele has the associated trait or illness,
but a male who inherits the allele is more severely affected because he is
hemizygous for X chromosome and therefore has no other allele to offset the
effect of the dominant allele.
51
Introduction to Human The children of a normal male and female with a dominant disease causing gene
Genetics
on the X chromosome bear the risk as shown in the following figure.
Oocytes
XRX XrXr
Affected
(affected daughter) (unaffected daughter)
Heterozygous
female (XRX) XRY Xr Y
(unaffected son) (unaffected son)
Unaffected Male
(XrY)
Xr Y
Sperms
Fig. 3.10: X-Linked Dominant Inheritance
A woman who is a carrier of X-linked dominant trait transmits it to sons with a

probability of 1 in 2 and to a carrier daughter with same chance.
Following are some examples of X-linked dominant traits in man.

Hypophosphatemia Vitamin-D resistant rickets.
Incontinentia pigmenti Swirls of skin color, hair loss, seizures, abnormal
teeth.
Xg blood groups Normal character.
3.3.4.2 X-Linked Recessive Inheritance

An X-linked recessive trait is expressed in females if genes for it are present in
two copies i.e. homozygous state (since in females there are two X-chromosomes).
Because X-linked recessive genes are rare, possibility of an X-linked recessive
trait in females is rarer.
A common situation is for an X-linked trait to pass from a heterozygous mother

to an unaffected son. Since male is having only one X-chromosome, he can
express the trait even in heterozygous state referred to as hemizygous state in
this context. The affected male will transmit this gene to all his daughters who
will become carriers and will transmit the triat to 50% of his grandsons.
52
Following are some of the examples of X-linked recessive traits in man. Formal Genetics

Haemophilia Absence of clotting due to factor VIII.
Red green colour blindness Abnormal red cone pigments in retina.
Muscular dystrophy Progressive muscle weakness.
Characteristic features of X-linked recessive traits are as follows:

1) Predominantly males are affected.
2) The trait is transmitted through unaffected carrier females (and also affected
homozygous females) to their sons.
3) Affected female has an affected father and a mother who is affected or a
carrier.
4) The affected males cannot transmit the disorder to their sons as the gene is
not present on Y chromosome.
5) Affected males usually have normal parents as the mutant gene on X
chromosome is received through normal carrier mother.
Carrier female (mother)
Normal male Gamete XH Xh

(father)
XH XHXH XHXh
Y XHY XhY
XH = Normal gene, Xh = Abnormal gene
25%XHXH Normal daughter

25%XHXh Carrier daughter
25%XHY Normal son
25%XhY Son with haemophilia
Fig. 3.11: A mating between normal male (XHY) and carrier female (XHXh) for haemophilia.
3.3.4.3 Y-Linked Inheritance

The only one gene known as SRY (sex determining region-Y) is identified on Y-
chromosome. The SRY gene encodes a type of protein called transcription factor
which controls other genes involved in male development. An affected male
transmits Y-linked trait to all his sons but to none of his daughters (as an affected
male transmits X chromosome to the daughters).
Characteristic features of Y-linked inheritance are listed below:
1) Only males are affected.
2) All sons of affected males are affected.
3) Females never get the trait or transmit it.

53
Introduction to Human 3.3.5 Extranuclear Inheritance
Genetics
Extranuclear inheritance, also referred to as mitochondrial or maternal inheritance,
is defined as non-mendelian inheritance, usually involing DNA in self-replicating
cytoplasmic oraganell mitochondrion. Mitichondria contain DNA that is
autonomous outside the nuclear genome. Mitochondria in human cells contain
several copies of a ‘mini chromosome’ that carries just 37 genes. Sometimes it is
called the twenty fifth chromosome. The inheritance of these genes is variously
referred to as extranuclear, mitochondrial, maternal or cytoplasmic inheritance.
The basis of the Mendel’s law of segregation is that both parents contribute
equally to progeny. This is not the case for genes present in mitochondria.
The hereditary patterns and mutation rates for the mitochondrial genes differ
from those for genes in the nucleus. Mitochondrial genes are maternally inherited.
They are passed only from an individual’s mother because sperms almost never
contribute to mitochondria when they fertilize an oocyte. Pedigrees that follow
mitochondrial genes show a woman transmitting the trait to all her children,
while a male cannot pass this trait to any of his children.
Unlike DNA in the nucleus, mitochondrial DNA (mt DNA) mutates faster because
it lacks DNA repair enzyme and mitochondria is the site of energy reactions that
produce oxygen free radicals that damage DNA. Also unlike nuclear DNA,
mitochondrial DNA is not wrapped in histone proteins and nor are genes
interrupted by DNA sequences that do not encode proteins called introns.
Inheritance of mitochondrial genes differs from inheritance of nuclear genes
simply because a cell has one nucleus but many mitochondria and each
mitochondrium harbours several copies of its chromosome. Mitochondria with
different alleles for the same gene can reside in the same cell.
Some examples of mitochondrial disorders in humans are given below.
Mitochondrial myopathies Weak and placid muscles and intolerance

to exercise.
Leber’s hereditary optic Impairs vision.

neuropathy (LHON)
3.4 SEX LIMITED CHARACTERS

Here the expression of character is limited to one sex. In humans, beard growth
in males and breast development in females are sex limited traits. A woman does
not grow a beard because she does not produce the hormones required for facial
hair growth. She, can, however pass to her sons the genes specifying heavy beard
growth. Such a gene may be sex-linked or autosomal.
Due to anatomical differences between males and females, intrauterine or

testicular defects constitute other examples of sex limited characters. Another
inherited condition known as preeclampsia that arises during pregnancy is also a
good example of sex limited trait. Since males do not get pregnancy, preeclampsia
in females leads to a sudden increase in blood pressure that occurs in pregnant
woman as the birth approaches.
54
Formal Genetics
3.5 SEX INFLUENCED CHARACTERS
A trait is said to be sex influenced when it expresses differently in males and
females because an allele is dominant in one sex but recessive in the other. Again
such a gene may be X-linked or autosomal. The difference in expression can be
caused by hormonal differences between the sexes. For example, the expression
of common baldness is different in males and females. It is an autosomal dominant
trait in males and hence very common. While it is autosomal recessive in females
hence they are rarely seen bald. Female heterozygote can transmit the trait to
their offspring but do not manifest it. Females display the trait only when they
inherit two copies of the gene, i.e. when they are homozygous recessive. Even
then, they are more likely to display marked thinning of the hair, rather than
complete baldness whereas an affected male may be completely hairless on the
top of the head.
3.6 MULTIPLE ALLELES

The concept of multiple alleles is simply an extension of single gene inheritance.
Mendel’s short and tall pea plants seem much simpler. New mutations at a single
locus would complicate the correlation between phenotype and genotypes. An
individual possesses two alleles for any autosomal gene (one allele for each
homologous chromosome) but a gene can exist in more than two allelic forms in
a population on account of new mutations producing variations in phenotype.
For instance, the ABO blood groups are determined by the presence of three
alleles (alternative form of the gene) at a single locus and hence are examples of
multiple alleles. These alleles are designated as ABO*A, ABO*B and ABO*O;
the former two are dominant over the latter. A person can have any two of these
alleles present on the homologous chromosomes.
Genotype Phenotype
(Blood group)
ABO*A ABO*A/ABO*A ABO*O A
ABO*B ABO*B/ABO*B ABO*O B
ABO*A ABO*B AB
ABO*O ABO*O O
The ABO*A and ABO*B alleles are dominant over ABO*O allele, which is
recessive. When ABO*A and ABO*B are present together, both are expressed
and this phenomenon is called co-dominance.
3.7 POLYGENIC OR MULTI-FACTORIAL

INHERITANCE
There are many common characters and disorders which do not follow simple
Mendelian (single gene) inheritance. Common traits like intelligence, blood
pressure, height, weight, hair colour, eye color and facial appearance have more
55
Introduction to Human complex genetic basis. If height were to be determined by a pair of genes (as is
Genetics
the case of Mendelian inheritance) then this would result in only two types of
persons i.e. tall and short. (If we represent tallness as ‘T’ and shortness ‘t’ then
tall individual will be ‘TT‘ or ‘Tt’ and short ones will be ‘tt’). However, in each
family we get individuals whose height shows quantitative variation from one
extreme to other. All the aforementioned traits cannot be distinctly classified
into two groups but are measured quantitatively and therefore are called as
continuous or quantitative traits.
Similarly, the following disorders do not follow Mendelian (single gene)

inheritance. However these disorders cannot be measured as height or blood
pressure. These disorders are either present or absent. These are called threshold
traits. Threshold traits are present or absent e.g. a person is diabetic or non-
diabetic. Following are examples of threshold traits in man.
Congenital malformation Adult onset disease

Neural tube defects Diabetes mellitus
Pyloric stenosis Epilepsy
Cleft lip Hypertension
Cleft palate Ischemic heart disease
Heart defects Schizophrenia
Glaucoma
The above mentioned threshold traits are considered to be determined by actions

of many genes which are situated at different loci on chromosomes, each of
which exerts an equal additive effect. This kind of inheritance is called polygenic
inheritance. Thus in polygenic inheritance the genes do not behave as dominant
or recessive but have an additive or cumulative effect on the trait.
It is also believed that these common physical traits, disorders or congenital

malformations are not entirely determined by the action of many genes but are to
be resulted from interaction of environmental and genetic factors. Many
environmental factors like diet (in case of weight), sunlight (in case of skin colour),
disease, chemicals and radiation, among others, may influence the action of genes.
Thus polygenic inheritance is also called as multi-factorial inheritance.
3.8 SUMMARY
A bird’s eye view of the contents mentioned in the above unit will give you an
overall picture of the classical concepts of formal genetics in man, the different
modes of the simple and complex inheritances along with illustrations, with a
focus on related topics dealing with certain situations of exceptions, which we
come across while studying the inheritance patterns in man.
Suggested Readings
Lewis, R. 2003. Human Genetics, 5th Edition. New York: McGraw-Hill
Publications.
Verma, P.S and Agarwal, V.K. 2009. Genetics. New Delhi: S. Chand & Company
56 Ltd.
Jorde L.B, Carey J.C, Bamshad M.J, and White R.L 2000. Medical Genetics, Formal Genetics
2nd Edition. St. Louis: Mosby.
Barua, S. 2002. Human Genetics. An Anthropological Perspective. Kolkata:
Classsique Books.
Sample Questions
1) Describe the Mendel’s laws of inheritance. Illustrate your answers with
suitable examples.
2) Distinguish between multiple alleles and polygenic inheritance. Illustrate
your answer with appropriate examples.
3) Differentiate between the autosomal dominant and X-linked dominant modes
of inheritance giving examples.
4) Give an account of mitochondrial inheritance as differentiated from nuclear
inheritance.
5) How can you distinguish mitochondrial inheritance from nuclear inheritance?
6) Write short notes on the following.
a) Pleiotropism
b) Sex limited traits
c) Sex influenced traits
d) Variable expressivity of gene
e) Y-linked inheritance
f) Red green colour blindness
g) Albinism
h) Test cross
57
Introduction to Molecular
UNIT 1 INTRODUCTION TO MOLECULAR Genetics
GENETICS
Contents
1.1 Introduction
1.2 Scope of Molecular Genetics
1.3 Deoxyribonucleic Acid (DNA)
1.3.1 Structure of DNA
1.3.2 Features of Double Helix
1.3.3 How DNA Decides the Hereditary Features
1.4 Genome
1.4.1 Organisation of Nuclear Genome
1.4.2 Organisation of Mitochondrial Genome
1.5 Genetic Code
1.5.1 Properties of Genetic Code
1.6 Gene Expression
1.6.1 Transcription
1.6.1.1 Ribonucleic Acid (RNA) and its Types
1.6.1.2 Messenger RNA (mRNA)
1.6.1.3 Transfer RNA (tRNA)
1.6.1.4 Ribosomal RNA (rRNA)
1.6.2 Post Transcriptional Modifications
1.6.3 Translation
1.6.3.1 Proteins
1.7 Regulation of Gene Expression
1.8 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
After reading this unit, you would be able to:
Ø discuss what is molecular genetics and how is it useful to mankind;
Ø describe structure and function of nucleic acids;
Ø imagine how the genome is organised in humans; and
Ø explain how genes are expressed and the ways in which gene expression is
regulated.
1.1 INTRODUCTION
DNA is the master molecule which carries the genetic information from one
generation to the other. Study of Molecular Genetics accelerated since April 25th,
1953 when James Watson and Francis Crick proposed the structure of DNA
which was published in Journal called ‘Nature’. Molecular Genetics deals with
the flow of genetic information and its regulation. In simple terms it can be
defined as the field of biology which studies the structure and function of genes
at molecular level. 5
Human Molecular Genetics
1.2 SCOPE OF MOLECULAR GENETICS
Development of techniques like nucleic acid hybridisation, cloning, sequencing
etc. brought a revolutionary change in Molecular Genetics. It is of major interest
to the students of biology and medicine. Though it has a lot of significance in
many fields, we’ll confine ourselves to the applications of molecular genetics to
the mankind. They are as follows:
i) Diagnosis of infectious diseases: Normally microorganisms are detected in
the laboratory using biochemical methods. In case of molecular techniques,
microorganisms are detected by using probes (short DNA or RNA sequence)
which are complementary to a part of genome of the microbe. The advantage
of using molecular methods is:
• Identification of pathogen is done within a short time;
• No need to cultivate the microbes;
• Latent infections can also be identified when no antibody is formed; and
• The technique can be used even when the microorganism cannot be
cultured.
ii) Diagnosis of genetic diseases : Before the advent of the above techniques,
counselors used to give risk estimate like one fourth risk of getting the
disease, if the parents are heterozygous for an autosomal trait. But now by
directly testing for the mutation, they are able to confirm the presence or
absence of mutation in the fetus. It is of immense help in prenatal diagnosis.
iii) Individuals can be identified and relationship can be determined by DNA
fingerprinting.
iv) Mouse models for genetic diseases have been developed by creating
transgenic mice.
v) Production of vaccines, antibodies and therapeutic proteins using
recombinant DNA technology. Eg; Insulin, Human Growth Hormone.
vi) It has great potential for treating disease. Gene therapy is a process where
the cells of a patient are genetically modified to alleviate disease.
vii) With the development of recombinant DNA technology, identification of
disease genes became much easier. Once the disease gene is identified, a
molecular test can be designed for diagnosis of genetic disease.
DNA Fingerprinting
Just like no two individuals have identical finger prints, no two individuals
have identical genetic information, except monozygotic twins. Unlike finger
prints which are present only on the tips of the fingers, the genetic
information which is unique to the individual is present in each and every
cell. Alec Jeffrey discovered repetitive sequences called minisatellites to
be unique to every individual. DNA fingerprinting is a technique which
makes use of these sequences to evaluate genetic information. It’s a quick
way to compare the DNA sequences of any two living organisms. It is used
for personal identification, identification of the parents, when babies are
switched in hospital, identification of criminals etc.
6
1.3 DEOXYRIBONUCLEIC ACID (DNA) Genetics
DNA is the thread of life. It is the hereditary material in all organisms except in
certain RNA viruses. All the information that is needed for the development,
behavior, well being etc. of an individual is encoded in its structure. The genetic
information that’s stored in DNA flows through RNA to proteins. This flow of
genetic information is referred to as central dogma of molecular biology. Though
the information is present in the DNA, it is the activity of proteins that is
responsible for the inherited traits. The function of DNA is to direct its own
replication and to direct transcription.
The number of DNA molecules present in a cell is equal to the number of

chromosomes per cell. When compared to the length of the chromosome, the
length of the DNA is very very long. It’s a matter of interest, how this long DNA
fits into the cell whose diameter is in microns (like a long snake fitting into a
small basket). This is possible because of the winding of the DNA around histone
proteins into structures called nucleosomes. Nucleosomes are further coiled and
coiled to form chromosome. So each chromosome is nothing but a single DNA
molecule along with proteins.
Fig.1.1: Packing of DNA into chromosomes (Source:http://www.prism.gatech.edu/~gh19/

b1510/dnarep.htm)
1.3.1 Structure of DNA

The structure of DNA was proposed by Watson and Crick in the year 1953 for
which they won Nobel Prize in 1962. The structure of DNA molecule resembles
a gently twisted ladder. Two long polynucleotide chains represent the rails of the
ladder. They’re coiled around a central axis to form right handed double helix.
The rungs are made up of nitrogen bases which are held together by Hydrogen
bonds. The basic unit of DNA is nucleotide. It’s composed of three subunits-
nitrogen base, sugar and phosphate.
7
Nitrogenous
base
Phosphate
Deoxyribose
sugar
Fig. 2.2: Nucleotide
There are two kinds of bases- purines (double ringed) and pyrimidines (single
ringed). A purine (Adenine and Guanine) always pairs with a pyrimidine (Thymine
and Cytosine). Therefore, the amount of purines present in a DNA molecule is
equal to the amount of pyrimidines. Adenine always pairs with Thymine with
two Hydrogen bonds whereas Guanine always pairs with Cytosine with three
Hydrogen bonds. The two strands of the DNA can be separated easily during
replication because of the weak Hydrogen bonds.
Fig. 1.3: Pentose sugar ; Purines and pyrimidines (Source : Berg JM et al, 2002 Biochemistry
WH Freeman & Co.)
The sugar is a pentose sugar which is deoxyribose in DNA because it lacks
Oxygen at second Carbon position. To distinguish between the Carbon atoms
present in the base and sugar, the Carbon atoms in the sugar are given a prime
(‘). The bases attach to the sugar (at 1’C) by glycosidic bond.
The phosphate group links the 3’C atom of one sugar with the 5’C atom of
adjacent sugar by a phospodiester bond. Because of the negative charges present
on the phosphate groups, DNA is a polyanion. In vivo, these charges are neutralised
by the positively charged histone proteins.
1.3.2 Features of Double Helix

The two strands of the double helix are antiparallel ie., the 5’ end of one strand
aligns with 3’ end of other strand.
8
Because of the specific base pairing, the two strands are complementary to each Introduction to Molecular
Genetics
other which means that if we know the sequence of one strand we can infer the
sequence of the other.
The bases are stacked on one another 3.4Ao apart and are perpendicular to the
axis of the double helix. The diameter of the helix is about 20Ao and each complete
turn of helix measures 34Ao, thus accommodating 10 base pairs in each turn.
Fig. 1.4: Structure of DNA (Source:http://www.transtutors.com/chemistry-homework-

help/biomolecules/dna-structure.aspx)
Stacking of base pairs (bp) results in major and minor grooves in DNA. Major
groove is rich in chemical information and is recognised by sequence specific
DNA binding proteins.
1.3.3 How DNA Decides the Hereditary Features

The structure of DNA is the same in all organisms with same four nitrogenous
bases-A,T,G and C. Then what makes the difference between plants and animals
or how does a zygote know to develop into a monkey or a human? It’s the order
of the base sequence that makes all the difference. It’s not the same in all. The
bases are present in different amounts in different species.
1.4 GENOME
A genome is the total genetic information present in a cell. Basing on the
complexity of humans, if you assume that among all species, the human beings
have the largest amount of DNA, you’re mistaken. This is because many plant
species have much more DNA per cell compared to humans. Even among
vertebrates, it’s the amphibians which have the greatest amount of DNA per cell.
The organisation of human genome is very complex. It comprises of two genomes
(Nuclear and Mitochondrial).
9
Human Molecular Genetics 1.4.1 Organisation of Nuclear Genome
The nuclear genome constitutes more than 99% of the total genome. The haploid
genome contains 3 billion bp. The haploid genome is distributed in 23 different
types of chromosomes (22 autosomes and 1 allosome). Each chromosome contains
many genes. The genes are not uniformly distributed on the chromosomes. A certain
area of the chromosome may be rich in genes while areas like centromere and
telomeres are largely devoid of genes. Some chromosomes are rich in genes (22nd
chromosome) some are gene poor (4th chromosome). The genes which are part
of same metabolic pathway may be on different chromosomes and genes which
are no way connected to metabolic pathway may be side by side on the
chromosome.
There is tremendous variation in the size of the gene, size of the exon as well as
intron. On an average an exon may contain < 200bp. Size of the intron may vary
from 100bp to >100,000bp. About 1.5% of the total genome is coding (Exon is
the coding region and Intron is non coding).
A number of protein coding genes in the human genome form gene families. A
set of genes which code for similar protein sequences or which have nucleotide
sequence similarity form a gene family (just like related individuals make a
family). They arose by duplication of the ancestral gene and accumulation of
independent mutations over a period of time. Eg: members of beta globin gene
family. An individual won’t have same beta globin throughout his development.
Apart from beta globin (â) there are different genes like ä, Gã, Aã and å which
code for slightly different polypeptides. They express during different stages of
development of an individual and forms a gene family. Members of a gene family
generally appear as a cluster or they may be dispersed.
å Gγ Aγ ψβ δ β
Fig. 1.5: Human beta globin gene cluster
More than half of the genome contains repetitive sequences. Basing on the number
of copies per genome, the DNA sequences are classified into-unique sequences
(1-10 copies), moderately repetitive sequences (10-105copies) and highly
repetitive sequences (>105copies). Unique sequences include most of the genes
which code for proteins. Example for moderately repetitive sequences is the
genes which code for ribosomal RNA and histone proteins. Highly repetitive
sequences are tandemly arranged and are transcriptionally inactive. They are
once again classified into mega satellite, satellite, mini satellite and micro satellite
according to the decreasing size of the repeat. Mega satellites are very few in
number. Satellite DNA is present in the centromeric region of the chromosomes.
The length of the mini satellite DNA is quite variable among individuals and is
the basis for DNA fingerprinting. Microsatellites constitute single base runs, di,
tri and tetra nucleotide repeats.
Transposons, the DNA sequences which are capable of moving from one part of
the genome to other constitute about 45% of the total human genome. Most of
them are nonfunctional. Transposition is RNA mediated ie., DNA is first
transcribed into RNA and then reverse transcribed into cDNA which is the double
10
stranded form is inserted elsewhere in the genome.
There are pseudogenes in the genome which are nonfunctional copies of a Introduction to Molecular
Genetics
functional gene eg. pseudo beta(øâ) in beta globin gene family. They also arose
by duplication of the ancestral gene but in course of time accumulated mutations
which rendered them non functional. Few overlapping genes (in class III region
of HLA complex present on 6th chromosome.) and genes within genes (presence
of two genes within the intron of clotting factor VIII gene) also exist in the
genome.
1.4.2 Organisation of Mitochondrial Genome

The total amount of mitochondrial genome is <1%. It varies per cell basing on
the number of mitochondrial DNA(mt DNA) molecules per mitochondrion and
the number of mitochondria per cell.
The size of the human mtDNA is 16,569 bp. It is circular and double stranded. It
lies naked in the organelle. mtDNA isn’t associated with histone proteins. It
contains a light chain and a heavy chain. Heavy strand is rich in guanines and
light strand is rich in cytosines. DNA is triple stranded at a region, due to
duplication of a section of heavy strand and is called D loop. D loop has no
coding sequences. mtDNA has altogether 37 genes out of which 13 code for
polypeptides, 22 for tRNAs and 2 for rRNAs. In contrast to nuclear genome,
about 93% of the mtDNA is coding. The genome is compact with no introns and
presence of overlapping genes. Mitochondria have their own ribosomes on which
polypeptides are synthesized. It has a slightly different genetic code when
compared to that followed by the nuclear genome.
Fig.1.6: Mitochondrial genome (Source : http://www.nature.com/scitable/content/the-role-

of-the-mitochondrial-genome-in-61848)
The mitochondria synthesize only some of the proteins needed by it, others being
synthesized by the nuclear genes. The proteins produced by the nuclear genome
are imported into mitochondria. mtDNA shows maternal inheritance because all
the mitochondria received by the zygote are from the ovum. Mutations in mtDNA
are responsible for certain diseases in humans.
11
1.5 GENETIC CODE
We now know that DNA contains the information that is necessary for the
production of proteins. The question is how the information stored in DNA can
be decoded into a protein? One of the two DNA strands is transcribed into RNA.
This RNA which contains the coded information, acts as a messenger molecule
which is further translated into polypeptide. It’s essential to understand the nature
of genetic code to understand how the coded information in RNA is decoded to
protein. Genetic code is a dictionary for the translation of mRNA into protein.
DNA is made up of only 4 different nucleotides (A,T,G and C) and proteins are
synthesized from 20 different amino acids. The question is how 4 nucleotides
could specify 20 amino acids ? A singlet code (each nucleotide codes for one
amino acid) specifies only 4 amino acids, a doublet code (2 bases code for one
amino acid) specifies only 16 amino acids (42). So the minimum number of
nucleotides needed to code for 20 different amino acids is 3. This group of 3
nucleotides or nucleotide triplet is called a codon. A triplet code will contain 64
codons (43) which are in excess of the number of amino acids. The code was
deciphered in 1960s by the important contributions made by Nirenberg, Matthaei,
Gobind Khorana and Ochoa.
You may have a doubt whether the same genetic code is followed by plants,
animals and bacteria as all of them have same 4 bases in their genetic material.
Yes, genetic code is universal, except slightly different code is used in
mitochondria and by few prokaryotes. Because of this property, we are able to
translate mRNA from one species, in a cell of another species (recombinant
DNA technology).
1.5.1 Properties of Genetic Code

The genetic code is triplet : The code is read in 3 letter words. A group of three
nucleotides code for one amino acid.
The code is degenerate : There are 64 codons but amino acids are 20 only which
means some amino acids are specified by more than one codon. Eg: GUU,GUC,GUA
and GUG code for valine. All these 4 codons are said to be degenerate.
First base Second base Third base
5’ end U C A G 3’ end
UUU Phe UCU UAU Tyr UGU Cys U

U UUC UCC UAC UGC C
UUA Leu UCA Ser UAA Stop UGA Stop A
UUG UCG UAG UGG Trp G
CUU CCU CAU His CGU U

C CUC Leu CCC CAC CGC Arg C
CUA CCA Pro CAA Gln CGA A
CUG CCG CAG CGG G
AUU ACU AAU Asn AGU Ser U

A AUC Ile ACC Thr AAC AGC C
AUA ACA AAA Lys AGA Arg A
AUG Start ACG AAG AGG G
Met
GUU GCU GAU Asp GGU U
G GUC Val GCC GAC GGC C
GUA GCA Ala GAA Glu GGA Gly A
GUG GCG GAG GGG G
12 Fig.1.7: The genetic code

The code has polarity: Codons may specify different amino acids when they are Introduction to Molecular
Genetics
read in opposite directions.
Eg.: 5’ CCU 3’ → proline
3’ UCC 5’ → serine
As translation occurs in 5’→ 3’ direction, it’s apt to read the codons in 5’→3’
direction only.
The code is non overlapping: Each codon consists of three consecutive nucleotides.
That is none of the nucleotide is part of 2 codons. Eg. 5’ GCUACCUGC 3’
Non overlapping code will specify only three amino acids. NH2-ala-thr-cys-COOH.
Overlapping code will specify seven amino acids. NH2-ala-leu-tyr-thr-pro-leu-
cys-COOH.
The code is comma less: There is no gap or punctuation between 2 codons. After
one amino acid is coded, the second one will be coded automatically. If there is
any gap between two codons, deletion or addition of one base should not change
the reading frame. But a change in reading frame was observed which means
that code is comma less.
Reading Frame
The possible way in which a nucleotide sequence is read during translation

is called the reading frame. Basing on the starting point, a single strand of
DNA molecule can be read in three possible ways.
Eg: 5’AGCGCAAGGCGA…..3’
The above sequence has three possible reading frames –one starting with
the first base, other two frames starting with second and third bases.
5’AGC GCA AGG CGA….3’
5’GCG CAA GGC GA….3’
5’CGC AAG GCG A…..3’
The code is unambiguous: Though there are few exceptions, a particular codon
will always specify the same amino acid. Eg. GCU always codes for alanine.
The code contains “start” and “stop” signals: There is only one start codon (AUG)
whereas termination codons (UAA, UAG and UGA) are three in number.
Wobble Hypothesis: Leaving the three termination codons which are recognised
by proteins, the remaining 61 codons are recognised by tRNAs. There are only
about 30 types of cytoplasmic tRNAs. Then how’s it possible to interpret 61
codons? This is possible because of the relaxation of normal base pairing rules
when it comes to codon-anticodon recognition. According to Wobble hypothesis
of Crick, normal A-U and G-C rules are followed for the first two base positions
only but wobbling occurs at third position (G can pair with C or U and U can
pair with A or G).
13
1.6 GENE EXPRESSION
Before going to gene expression, let us first understand the meaning of gene, the
number of genes in humans, their location and their structure. In simple terms,
gene is a stretch of DNA that carries the information necessary for the synthesis
of a polypeptide. Actually the definition of gene is much more complex. Today
we know that a single gene can give rise to many polypeptides. There are about
25,000 genes in humans according to Human Genome Project. The number of
proteins about two lakhs is far greater than the number of genes because of
alternative splicing. Genes are located on chromosomes. Each chromosome
contains many number of genes arranged in a linear order. Eukaryotic genes are
split genes, which means that their coding sequence is not contiguous but it is
interrupted by noncoding or intervening sequences called introns. The coding
sequences or the expressed sequences are called as exons. In addition to the
coding and noncoding sequences, there are flanking regions which are important
in regulation and have ‘start’ and ‘stop’ signals. These include promoter which is
located at the 5’ end of the gene and a sequence that is present at the 3’ end which
provides the signal for the addition of poly A tail to the 3’ end of mature mRNA.
Fig. 1.8: Structure of a gene
Gene expression is a process in which a protein is synthesized from a gene. It

occurs in two major steps. The first step is transcription, in which the linear
DNA is transcribed into linear mRNA. The second step is translation during _
which mRNA associates with the ribosomes present in the cytoplasm and directs
the synthesis of proteins.
DNA
1↓ 1. Transcription
Primary transcript
2↓ 2. Post transcriptional
m RNA modification
3. Transport of mRNA from

nucleus to Cytoplasm
3 4. Translation
m RNA
4↓ 5. Post translational
protein modification and folding
5↓
active protein
Fig.1.9: Gene expression
14
Here you should note the point that only a small proportion of the total DNA Introduction to Molecular
Genetics
(1.5%) is coding. Moreover, all the genes that are transcribed are not translated
that is the end product of some genes is RNA itself eg: tRNA, rRNA etc.
1.6.1 Transcription
It’s a process in which single stranded RNA is generated from one of the strands
of the DNA. It occurs in nucleus in 5’→ 3’ direction. It needs RNA polymerase,
ribonucleotides and several proteins for initiation. Only one of the two strands
of the DNA acts as a template. RNA that is synthesized is complementary to the
template but similar in sequence and orientation to that of nontemplate strand
(except U is present in place of T). Therefore nontemplate strand is called sense
strand and template strand is called antisense strand. Whenever we want to give
a gene sequence, it’s customary to give the sequence of sense strand in 5’ to 3’
direction.
Nontemplate (sense strand) 5’___________________________3’

ACATGCCTATACCGACCAGCTATT DNA
Template (antisense strand) 3’TGTACGGATATGGCTGGTCGATAA 5’
Transcription
5’____________________________3’ RNA
ACAUGCCUAUACCGACCAGCUAUU
Fig. 1.10: Process of transcription showing the similarity between RNA and sense strand
The first base that’s transcribed is denoted +1 and the bases that are proceeding
in the right side (5’→ 3’) are indicated by positive numbers and the direction is
called downstream. Conversely the bases towards the left side of +1 are indicated
by negative numbers and the direction is called upstream. The promoter which
is present in the upstream region of the sense strand contains a group of short
sequence elements called TATA box, GC box, CAAT box etc. These elements
will be recognised by proteins called transcription factors (TFs). Only when TFs
bind to the promoter, followed by binding of RNA polymerase, then transcription
occurs. There are three kinds of RNA polymerases in humans. RNA polymerases
I and III transcribe the genes which code for tRNA, rRNA and various small
RNAs. Structural genes (genes which code for proteins) are transcribed by RNA
polymerase II. Termination occurs in them by endonucleolytic cleavage
(downstream to a sequence AAUAAA) followed by addition of poly(A) tail.
1.6.1.1 Ribonucleic Acid (RNA) and its Types
RNA molecule is also a polynucleotide chain. The sequence of RNA is determined

by the DNA sequence. The difference between DNA and RNA is, it’s single
stranded, contains ribose sugar (2’OH) in place of deoxyribose sugar (2’-H) and
thymine is replaced by Uracil. Occasionally it may fold on itself to give stem
loop structures.
Transcription leads to the synthesis of several different types of RNA. Messenger

RNA, ribosomal RNA and transfer RNA are the major classes of RNA involved
in protein synthesis.
15
Human Molecular Genetics 1.6.1.2 Messenger RNA (mRNA)
It’s this RNA, which carries the message present in the gene to the cytoplasm
where synthesis of protein occurs. Only the central part of the mRNA is translated.
The region of the first exon and the last exon which are not translated are denoted
as 5’UTR and 3’UTR. Each group of three mRNA bases constitutes a codon
which specifies an amino acid. The length of different mRNAs vary considerably
basing on the length of the gene.
5’UTR coding region 3’UTR

AUG UAA AAAAAA
Cap start stops poly A tail
Fig.11: Structure of mRNA showing coding and untranslated regions
1.6.1.3 Transfer RNA (tRNA)

Transfer RNA molecules interpret the mRNAs with the aid of ribosomal RNAs.
They are smallest RNAs (about 80 nucleotides long) which carry the amino
acids to the site of protein synthesis. Their one end binds to a codon in the mRNA
and the opposite end carries a specific amino acid. Thus it acts like an adaptor.
Because of the formation of Hydrogen bonds between some of the complementary
bases it forms a clover leafed structure (secondary structure). Its three dimensional
structure is however L shaped.
1.6.1.4 Ribosomal RNA (rRNA)
About 80% of the total RNA is rRNA. Generally the largest of the RNAs, along
with ribosomal proteins it forms the ribosome. A ribosome is made up of two
subunits, both of which join at the time of protein synthesis.
Larger subunit: 3 kinds of rRNAs (28S, 5.8S and 5S) + about 50 ribosomal
proteins. Smaller subunit: single rRNA (18S) + more than 30 ribosomal proteins
1.6.2 Post Transcriptional Modifications

All the above three types of RNAs undergo post transcriptional modifications
that is; certain bases present in the RNAs are removed. The RNA that is obtained
after transcription is termed primary transcript. In case of mRNA, the introns are
removed and the exons are spliced together to form the mature mRNA. Splicing
occurs with the help of certain conserved sequences present in the introns. In
addition to splicing , in case of mRNA, a cap and a poly A tail are added to the 5’
and 3’ ends of the mRNA respectively. These two structures help in the migration
of the mRNA from the nucleus to the cytoplasm and also in the regulation of
gene expression.
We’ve already discussed about alternative splicing due to which we are getting
about 2,00,000 proteins from the 25,000 genes we have. In simple terms,
alternative splicing means getting more number of mRNAs from a single gene.
This is possible by differential splicing in different tissues. For eg. a sequence
which acts as an intron in one tissue may act as a coding sequence in another
tissue thereby changing the sequence of the polypeptide in different tissues.
16
Genetics
Fig. 1.12: Alternative splicing where liver is using only two exons whereas all the three are
used in the muscle
1.6.3 Translation
It’s a process in which the information present in an mRNA is decoded into the
amino acid sequence of a protein. It requires mRNA, tRNA, ribosomes, ATP and
various protein factors. It occurs on ribosomes in the cytoplasm. It also occurs in
5’→3’ direction. The 5’ end of mRNA corresponds to the amino terminus of the
protein. Translation starts from the initiation codon and ends with the termination
codon. That’s the reason why most of the polypeptides start with methionine.
Initiation of translation requires several factors which include a cap binding
protein, initiation factors, smaller subunit of the ribosome, initiator methionyl
tRNA, all of which bind to the 5’ cap region of the mRNA. The initiation complex
formed scans the mRNA for the initiation codon. In the elongation step, larger
subunit attaches to the initiation complex. The codon next to the AUG is then
Gene
recognised by another tRNA which brings the mRNA
second amino acidpolypeptide
of the
polypeptide chain. A peptide bond is formed between the two amino acids and
5’ successive amino acids 3’ are incorporated
liver into the growing polypeptide chain.
3’ This process continues5’till the termination codon is reached
AAAA which is recognised
1 by a protein
2 but 3not tRNA. Finally the caplast1 tRNA
3 will be released from the
ribosome,
exons the two subunits of the
muscle ribosome separate and the new polypeptide
will be released. AAAA
Cap 1 2 3
Fig.1.13: Translation of mRNA into polypeptide (Source:http://www2.le.ac.uk/departments/

genetics/vgec/diagrams/47-translation.gif)
17
Human Molecular Genetics 1.6.3.1 Proteins
A protein is a polymer made up of amino acids. It’s the end product of most of
the genes. Proteins perform all the metabolic reactions that are carried out in a
cell. Though the term protein and polypeptide are loosely used, there is a difference
between the two. Polypeptide is the molecule that’s formed after translation.
After its release, the nascent polypeptide folds up and achieves a three dimensional
conformation to become functional protein. Many proteins depend on other
proteins called chaperones for folding. In addition to proper folding, polypeptides
also undergo post translational modifications (hydroxylation, glycosylation,
phosphorylation etc.) to achieve functional status. So a polypeptide is a precursor
of protein. Some proteins may have more than one polypeptide, which may be of
same kind or of different kinds.
1.7 REGULATION OF GENE EXPRESSION

There are 200 different types of cells in human beings. All of them have the
same DNA content or to be precise all the genes. Yet all of them are
morphologically different and have different function. This depends on the type
of genes that are expressed in these cells or in other words differential gene
expression is responsible for the diverse properties of different cells. All the
genes are not expressed in all the cells or all the times. By this we mean that
some genes are expressed only in some cells (tissue specific expression). Similarly
some genes are expressed only during a particular time of development. However
there are certain genes which are expressed in all cell types (house keeping genes)
eg: genes for rRNA, tRNA, DNA polymerases etc. The question is how does a
cell know which genes to express, when to express and to what extent. That’s
what is explained in this topic.
It’s a waste of energy for the cell to produce the proteins which are not needed by
it. Cells have their own methods, by which they can regulate the expression of
genes. Interestingly it’s the proteins which are largely responsible for regulation
of gene expression. Regulation occurs at three levels.
1) Transcription is the predominant stage at which regulation occurs.

Transcription occurs at basal level with the help of TFs. Up regulation and
down regulation of gene expression is possible with the help of proteins
called activators and repressors respectively. Activators bind to sequences
called enhancers whereas repressors bind to silencers. These sequences may
be located near the promoter region or far away in the upstream or
downstream region of the gene. These regulatory proteins are controlled by
signals which determine whether these proteins bind DNA. They determine
the amount of the protein to be synthesized. Tissue specific expression is
possible by limiting the availability of TFs needed by a gene only to a
particular tissue. In some cases, the promoter sequence is methylated in all
other tissues except the tissue where it’s expressed. Histone proteins also
have a role in regulation. Methylation of certain amino acids in histone
proteins turns off the expression of a gene.
2) Regulation also occurs at post transcriptional level. Alternative splicing

produces different isoforms in different tissues. Isoforms also result due to
alternative polyadenylation (same gene uses different polyadenylation signals
18
in different tissues) and RNA editing (same gene produces different isoforms Introduction to Molecular
Genetics
due to single base substitution, deletion or insertion at the RNA level) .
5’ 3’ gene
3’ 1 2 3 ↑ 4 ↑ 5’
exons poly A1 poly A2
Liver muscle
m RNA
AAAA AAAA
cap 1 2 3 cap 1 2 3 4
polypeptide
Fig. 1.14: Alternative polyadenylation where liver uses polyA1 signal and muscle
usespolyA2 signal
Kidney Heart
mRNA 5’ CAA UAG AAA… 3’ 5’ CAA UAG AAA.. 3’

78 175 78 175
RNA editing
5’ UAA UAG AAA…3’

Translation 78 175
Translation
protein
Fig. 1.15:174
RNA amino acids
editing showing substitution of a single base in 7877
th amino acids
codon, thereby converting
it into a stop codon in heart. Thus, a single gene expresses as 174 amino acid
F protein in kidney and 77 amino acid protein in heart.
3) Regulation at translation level includes longevity of mRNA which depends

on length of poly A tail (mRNAs without poly A tail are short lived), structure
of 3’UTR (many repeats of AUUUA in the 3’UTR makes the RNA short
lived) etc. Translation of some mRNAs is regulated by specific RNA binding
proteins. Degradation of mRNA is another control point. Rapid degradation
of mRNA prevents undesired protein synthesis.
19
1.8 SUMMARY
Molecular Genetics deals with the study of gene expression and its regulation.
Revolutionary changes occurred in the field of molecular genetics due to the
invention of molecular techniques. It has several applications like diagnosis of
genetic as well as infectious diseases, treatment of the disease, personal
identification etc.
DNA is the information macromolecule. Each chromosome contains a single

DNA molecule. The structure of DNA was deciphered by Watson and Crick.
DNA is a right handed double helix with two ribbon like strands constituting the
sugar phosphate backbones. The horizontal rungs are made up of nitrogenous
bases. The two strands are complementary and antiparallel to each other. They
are held together by Hydrogen bonds formed between the opposite bases. The
order of the bases in the DNA determines the hereditary features.
The human genome is comprised of two genomes : nuclear genome which is

complex and comprises the bulk of the genome and mitochondrial genome. The
size of the haploid genome is about three billion bp and it is distributed in 23
chromosomes. The organisation of the genome is complex. Neither the
distribution of the genes nor the base composition is uniform throughout. There
is high degree of variation not only in the size of the gene but also in the size of
exons and introns. In addition, the existence of repetitive sequences, transposons,
pseudogenes, overlapping genes and genes within genes make the genome more
complex.
The size of the mitochondrial genome is 16,569 bps. It is a circular, double

stranded molecule. It shows maternal inheritance. It contains 37 genes. Most of
the genes needed for its function are coded by nuclear genome. Mutations do
occur in mitochondria which leads to disease.
Genetic code is the relationship between the nucleotide sequence of mRNA and
amino acid sequence of protein. The genetic code is triplet, degenerate,
nonoverlapping, commaless and universal.
Gene expression is a two step process. First the information present in DNA is
transcribed to RNA. Later the information in the mRNA form is decoded to
amino acid sequence of the polypeptide by translation. The polypeptide that is
formed during translation, undergoes folding and post translational modifications
to form a functional protein.
Gene expression is highly regulated. Each cell contains all the genes present in
the total DNA. However to save energy, cells express only the proteins needed
by it, in required amounts and at needed time. This kind of control over gene
expression is achieved largely by proteins. Gene expression is regulated at
different levels like transcription, post transcription, translation. Major control
occurs at the transcriptional level. Same gene can produce different forms of
proteins in different tissues by mechanisms like alternative splicing, alternative
polyadenylation and RNA editing.
20
Suggested Reading Introduction to Molecular
Genetics
Strachan, T and Read, A.P. 2004. Human Molecular Genetics. Wiley-Liss.
Lewin, B. 2004. Genes VIII. Prentice Hall.
Watson, J.D, Baker, T.A, Bell, S.P, Gann, A, Levine, M and Losick, R. 2004.
Molecular Biology of the Gene. Pearson Education.
McConkey, E. H. 1993. Human Genetics. The Molecular Revolution. Jones and
Barlett Publishers.
Sample Questions
1) Describe the salient features of DNA double helix.
2) “The organisation of human nuclear genome is complex”. Justify the

statement.
3) Define genetic code and write about its properties.
4) Explain how the nucleotide sequence present in a gene is used to synthesize

a protein.
5) Describe how gene expression is regulated at different levels.
Short Notes
i) MtDNA
ii) Genome
iii) RNA and its Types
21
Human Genetics
UNIT 2 METHODS OF HUMAN GENETIC
STUDY
Contents
2.1 Introduction
2.2 Pedigree
2.3 Chromosome Analysis
2.4 Karyotype Analysis
2.5 Cytogenetic Methods
2.6 DNA and Recombinant Technology
2.7 Biochemical Methods
2.8 Paternity Testing
2.9 Twin Studies
2.10 Immunological Methods
2.11 Summary
References
Suggested Reading
Sample Questions

Once you have read the unit, you will understand that, there are:
Ø various classical and modern techniques developed for human genetics study;
Ø techniques aimed to put light on various processes that help to understand
and identify some specific diseases and disorders;
Ø classical genetic methods like pedigree studies and twin studies are very
important to understand the role of heredity and the environment in the
manifestation of some physical traits in man, and some physiological and
pathological conditions, and diseases like tuberculosis, cancer, etc.; and
Ø twin study methods help us to understand how much the variability observed
between different individuals, or individuals of the same familial group, is
due to hereditary differences and how much differences due to environmental
factors.
2.1 INTRODUCTION
At first sight, man appears to be an unfavourable object for genetic study. Plant
and animal geneticists use breeding methods to raise successive generations under
similar environmental conditions.
In man, however, the genetic diversity of individuals is great and
uncontrolled, and biological and social environment vary greatly. In man,
as we cannot do experimental crossing, so the studies on inheritance pattern
are based on a series of generations.
23
Human Genetics For human genetical study, the observer, that is the geneticist, and the object of
his observation, a family, or pedigree, of say three to four generations, is restricted,
as the duration of a generation is alike in the observer and in the object of
observation. Many factors affecting transmission of hereditary traits obey
statistical laws and are best studied when large numbers of offspring are available.
In man, these numbers are always small, even large human families fall far short
of the size desirable for statistical deductions.
Genetic differences between two individuals may consist of differences between

the alleles at a single pair of loci or between those at more than one pair of loci.
An example of a ‘single factor inheritance’ showing simple dominant inheritance
was found in an extensive pedigree of a rare type of unusually wooly hair in
Norwegian kindred, reported in the year 1932. It has been propagated for at least
five generations. So we find pedigree studies help us to understand the nature of
inheritance of a specific familial trait.
Through the statistical analysis of covariance and discriminant analysis of

morphological and anatomical traits the study of human diversity has been greatly
advanced.
Methods of human genetic studies may be taken up at the family / pedigree level
by simple or clinical observation, while at the cellular level through chromosomal
studies of particular cases in families. At the population level for understanding
human variation of different morphological anthropometric traits,
deramtoglyphics and other anatomical traits, population sero-genetical markers
like blood groups, PTC, ABH secretion etc., and biochemical traits like G6PD,
haptolobin and tranferrin, and other red cell enzyme polymorphisms through
electrophoretic methods are being conducted. Lately DNA fingerprinting
techniques are being used to assess migration and population affinities of different
ethnic groups and their biochemical relationship at different levels. These are
highly specialised methods of study of human population groups at the genic
level.
We will discuss briefly about all these methods of human genetic studies at the
family and population level, so as to make you aware about the different methods
of human genetic studies now normally being used by human geneticists.
2.2 PEDIGREE
A pedigree is a diagram of family relationships in which symbols are used to
represent people, and lines are used to represent genetic relationships. These
diagrams make it easier to visualize the relationships within the families,
particularly large extended families. Pedigrees are also often used to determine
the mode of inheritance of genetic diseases (Strachan and Read. 1999).
24
Various symbols used in pedigree analysis: Methods of Human Genetic
Study
(Adapted from: www.uic.edu)

We can use pedigree to study different modes of inheritance:
Autosomal Dominant inheritance
(p= proband)
(Adapted from www.bios.niu.edu/johns/genetics)
The major characteristics are following:
• It manifests in the heterozygous state i.e. in a person possessing both an
abnormal and normal allele,
• Gene is located on autosome,
• Both males and females are equally affected, and
• Vertical family history may be seen and male to male transmission is possible.
Example: Marfan syndrome, Huntington’s disease.
25
Human Genetics Autosomal recessive inheritance

The major characteristics are the following:
• The gene is located on autosome,
• Two copies of the mutant gene is necessary for phenotypic manifestations,
• Males and females are equally affected,
• Pedigree may show several sibs and cousins affected in the same generation
indicating a horizontal transmission, and
• Consanguinity is often present.
Example: Phenylketonuria, Homocystinuria, Cystic fibrosis
X-linked recessive inheritance

• The mutant gene is on the X-chromosome,
• One copy of mutant gene in males and two copies of mutant gene in females
are needed for phenotypic effect,
• Usually males are affected and transmission is through heterozygous (carrier)
females,
• No male to male transmission, and
• All daughters of affected males will be carriers.
Example: Duchenne’s muscular dystrophy (DMD), hemophilia, color blindness
26
X-linked dominant inheritance Methods of Human Genetic
Study

• Affected males have no normal daughters and no affected sons,
• The pattern of inheritance resembles autosomal dominant,
• No male to male transmission, and
• Affected heterozygous females transmit the condition to half of their children
of either sex and affected homozygous females transmit to all their children.
Example: Vitamin D resistant rickets, orofacial digital syndrome.
Y-linked inheritance

• Only males are affected, and
• Affected males must transmit the disorder to their sons.
Example: Male infertility.
27
Human Genetics Mitochondrial inheritance

• Trait is transmitted through affected females, and
• Affected males give rise to unaffected offspring.
Example: Inherited blindness (Leber’s hereditary optic neuropathy) and a type
of deafness (Muller and Young. 2001).
2.3 CHROMOSOME ANALYSIS

Genes form the physical hereditary link between generations. A typical human
body cell contains about 40,000 genes. The genes do not exist as a separate unit,
but are arranged in a linear order on thread like bodies known as chromosomes,
within the nucleus of a cell. Chromosomes become shortened and thickened
during cell division and can be seen clearly under the microscope.
Chromosomes are microscopic filamentous structures that contain an individual’s

genetic material. This genetic material serves as the “instruction manual” for the
body, containing the “directions” the body needs in order to form and function
properly. Human cells have a total of 46 chromosomes, which are arranged into
23 pairs. We inherit one member of each pair from our biological mother, and
the other member of each pair from our biological father. The first 22 pairs of
chromosomes are called “autosomes” and the last pair is called the “sex
chromosomes”. Females typically have two “X” sex chromosomes, while males
typically have one “X” and one “Y” sex chromosome (Tseng. 1995).
Let us know what is a chromosome analysis?
Chromosome analysis is a study of the number and general structure of all 46

chromosomes, it is also known as a karyotype. In a standard karyotype,
chromosomes from cells in the body are counted to ensure that the cells have the
correct number of chromosomes, and their structure is analysed to ensure that
there are no large pieces of material that are missing (deleted), extra (duplicated),
or rearranged in any way. It is important to realise that standard chromosome
analysis may not be able to detect tiny deletions or duplications of genetic material
and will not be able to detect single gene conditions, such as sickle cell disease.
Hundreds of different types of chromosome abnormalities causing well described
syndromes have been reported in humans. They fall into two categories:
28
ü Numerical Chromosome Abnormality means that a person has a total number Methods of Human Genetic
Study
of chromosomes different from 46; usually 47 or sometimes 45
chromosomes, in each cell of their body, respectively. An example of a
numerical chromosome abnormality is Down syndrome, which is caused
by having an entire extra chromosome 21, for a total of three copies of
chromosome 21 instead of two (www.genetics.emory.edu).
ü Structural Chromosome Abnormality means that a portion of the genetic

material has been rearranged in some way; for example, a piece of one
chromosome may be attached to another chromosome (translocation), or a
piece of a chromosome may be turned upside down (inversion). A
rearrangement may or may not result in obvious health problems. This
depends on whether the structural problem ultimately results in a net gain
or loss of chromosome material. If the chromosome material is simply in a
rearranged fashion, but all of the genetic information is present, the person
may have no symptoms and this is known as a balanced rearrangement
(www.genetics.emory.edu).
Fig. 2.1: Deletion and Duplication (Adapted from www.ghr.nlm.nih.gov)
Fig.2.2: Translocation between chromosome 20 and 4 (Adapted from www.ghr.nlm.nih.gov)

29
Human Genetics Requirement for chromosome analysis:
Chromosome analysis is recommended as a routine diagnostic procedure for a
number of indications, including the following:
• Problems noted during early growth/development,
• Stillbirths and neonatal deaths,
• Fertility problems,
• Pregnancy in women 35 years or older at the time of delivery, and
• Family History (Rowley. 2001).
2.4 KARYOTYPE ANALYSIS

Karyotype is the number and appearance of chromosomes in the nucleus of a
eukaryotic cell. The term is also used for the complete set of chromosomes in a
species, or an individual. Karyotype analysis involves visualization of
chromosomes under a microscope. Cells are collected from an individual, induced
to divide, and then arrested at metaphase. The chromosomes are stained with
certain dyes that show a pattern of light and dark bands (called the banding
pattern). The banding pattern for each chromosome is specific and consistent
allowing identification of each of the 24 chromosomes (Comai, 2005).
Karyotype analysis can be performed on virtually any population of rapidly

dividing cells either grown in tissue culture or extracted from tumors.
Chromosomes derived from peripheral blood lymphocytes are ideal because they
can be analysed three days after they are cultured. Lymphocytes can be induced
to proliferate using a mitogen (a drug that induces mitosis) like
phytohemagglutinin. The cultured cells are treated with colcemid, a drug that
disrupts the mitotic spindle apparatus to prevent the completion of mitosis and
arrests the cells in metaphase. The harvested cells are treated briefly with a
hypotonic solution. This causes the nuclei to swell making it easier for technicians
to identify each chromosome. The cells are fixed, dropped on a microscope slide,
dried, and stained. The most common stain used is the Giemsa dye. Other dyes,
such as fluorescent dyes, can also be used to produce banding patterns
(www.bookrags.com).
Chromosome spreads can be photographed, cut out, and assigned into the
appropriate chromosome number or they can be digitally imaged using a computer.
The chromosomes can be divided into seven groups (A-G) based on descending
order of size and position of the centeromere. The standard nomenclature for
describing a karyotype is based on the International System for Human
Cytogenetic Nomenclature (ISCN) (www.science.jrank.org).
Genetic counselors rely on karyotypes to diagnose abnormal pregnancies.

Amniocentesis is a routine procedure used in prenatal screening that involves
removing amniotic fluid for karyotype analysis. It also can be helpful in certain
cases to obtain karyotypes from parents to determine carrier status, which can be
relevant to recurrence risks in future pregnancies. Karyotype also may help
determine the cause of infertility in patients having reproductive difficulties
(www.bookrags.com).
30
Karyotype analysis is important for some abnormalities: Methods of Human Genetic
Study
Fig.2.3: Trisomy 21 (Down syndrome)
(Adapted from Human Genome Project)
Trisomy 21 is the presence of 3 chromosome 21 and causes the condition

commonly known as Down syndrome
Klinefelter syndrome
A male with the genotype 47, XXY with extra X chromosome leads which to
features of the condition commonly known as Klinefelter syndrome.
31
Human Genetics
Fig.2.4: Klinefelter's Synoromo
(Adapted from www.trueknowledge.com)
Turner’s syndrome: A female with genotype (45, X), with one X chromosome
missing
Fig.2.5: Turner's Syndrom

(Adapted from www.powerofthegene.com)
32
Methods of Human Genetic
2.5 CYTOGENETIC METHODS Study
Cytogenetics is a branch of genetics that is concerned with the structural and

functional studies of the cell, especially the chromosomes. It includes routine
analysis of G-banded chromosomes, other cytogenetic banding techniques, as
well as molecular cytogenetics such as fluorescent in situ hybridization (FISH)
and comparative genomic hybridization (CGH).
(www.doctorsmedicalopinion.com).
Chromosome banding
Different staining methods can be utilised to identify individual chromosomes:
G (Giemsa) banding: This is the most commonly used method. The chromosomes
are treated with trypsin to denature their protein content and then stained with a
DNA binding dye known as Giemsa which gives each chromosome a
characteristic and reproducible pattern of light and dark bands (www.scribd.com).
Q (Quinacrine) banding: This gives a banding pattern similar to that obtained
with Giemsa and requires examination of the chromosome with an ultraviolet
fluorescent microscope (www.bogari.net).
R (Reverse) banding: In this technique, the chromosomes are heat denatured
before staining with Giemsa, yielding light and dark bands patterns which are
reverse of those obtained using conventional G banding (www.bogari.net).
C (Centromeric heterochromatin) banding: In C banding the chromosomes are
pretreated with acid prior to G banding, the centromeres and other heterochromatic
regions containing highly repetitive DNA are preferentially stained (Muller and
young. 2001).
2.6 DNA AND RECOMBINANT TECHNOLOGY

The recombinant DNA technology also called as genetic engineering, involves
artificial modification of genetic constitution of a living cell by introduction of
foreign DNA through experimental techniques. The tools which are required in
recombinant DNA include vectors, restriction enzymes, ligases and host organism.
Applications
• For the production of recombinant human peptide hormones:-These include
highly publicized family of products of recombinant DNA technology. These
include Insulin, Human growth hormone (HGH), Follicle stimulating
hormone (FSH), Luteinizing hormone(LH), epidermal growth factors,
gastrin, relaxin, neuropeptides (calcitonin) and secretin
– Insulin: Insulin is secreted by the â cells of the pancreas. It is required
for the cellular uptake of glucose for use in energy metabolism. When
produced in insufficient amount it causes diabetes mellitus. It is made of
51 amino acids, consisting of two interconnecting chains: chain A and
chain B. Chain A is made of 31 amino acids and chain B of 20 amino
acids. In the formation of recombinant insulin, the two chains are
synthesized in separate bacteria. In one vector the gene for chain A in
inserted and in other vector the gene for chain B is inserted and then
these two chains are joined in vitro with the help of disulphide bonds.
Humulin (human insulin) was the first recombinant DNA product to be
approved by food and drug administration insulin in 1986 (Gupta. 2003).
33
Human Genetics – Human growth hormone (HGH): This hormone stimulates growth and
cell reproduction. It is secreted by the somatotroph cells of anterior
pituitary gland. When present in insufficient amount it causes retarded
growth, body fat at the waist and dwarfism. It is made of 191 amino
acids. For the formation of recombinant human growth hormone the
gene for HGH is inserted into plasmid and then introduced to a host for
large production. It also consists of the 26 amino acid signal peptides
which are removed from the HGH molecule with the help of EcoRI
restriction enzyme.
• In production of recombinant vaccines: The recombinant technology is

responsible for the production of vaccines for various diseases such as
Hepatitis B, AIDS, Influenza, cholera and leishmaniasis.
– AIDS vaccine: In this vaccine, genes of the two glycoproteins gp120

and gp41 are introduced into a suitable vector. When vector containing
glycoproteins is injected into the patient, they stimulate antibody
production, that neutralise the gp120 and gp41 binding sites and thus
prevents its binding to the host T-lymphocytes.
– DNA vaccine: It consists of plasmids containing a protein encoding

gene, promoter site, cloning site for the gene, origin of replication,
selectable marker and a poly A tail termination sequence. These vaccines
are not infectious or replicative, so are safer for use. They elicit high
immune response and are used to protect against influenza, HIV
infection, several cancers (colon, renal, T cell lymphoma) and herpes
simplex virus (Yang et al.2002).
• In anti sense therapy

Antisense therapy, it is possible to synthesize a strand of nucleic acid
(DNA,RNA or a chemical analogue) that will bind to the messenger RNA
(mRNA) produced by that gene and inactivate it and effectively turning that
gene “off”. This synthesized nucleic acid is termed an “anti sense”
oligonucleotide because its base sequence is complementary to the gene’s
messenger RNA (mRNA), which is called the “sense” sequence. Antisense
drugs are being researched to treat cancers, diabetes and diseases such as
asthma and arthritis with an inflammatory component. One antisense drug,
fomivirsen (marketed as Vitravene), has been approved by the US Food and
Drug Administration (FDA) as a treatment for cytomegalovirus retinitis
(Biroccio et al. 2003).
2.7 BIOCHEMICAL METHODS

Protein purification: Protein purification is a series of processes used to isolate a
specific type of protein from a complex mixture. Protein purification is important
for the characterization of the function, structure and interactions of the protein
of interest. The various steps in the purification process may include the isolation
of the protein from a matrix, separate the protein and non-protein parts of the
mixture, and finally separate the desired protein from all other proteins. Separation
of the proteins depends on protein size, physio-chemical properties, binding
affinity and biological activity (Burgess. 2008).
34
Chromatographic methods Methods of Human Genetic
Study
• Ion-exchange chromatography separates proteins based on charge. Columns
can either be prepared for anion exchange or cation exchange. Elution of
the target proteins is done by changing the pH in the column, which results
in a change or neutralisation of the charged functional groups of each protein
(www.biotech.about.com).
• Size-exclusion chromatography (gel filtration) separates larger proteins from

small ones, since the larger molecules travel faster through the cross-linked
polymer in the chromatography column. The large proteins do not fit into
the pores of the polymer whereas smaller proteins do, and take longer to
travel through the chromatography column, via their less direct route.
• Affinity chromatography is a very useful technique for completing the protein

purification process. Beads in the chromatography column are cross-linked
to ligands that bind specifically to the target protein. The protein is then
removed from the column by rinsing with a solution containing free ligands.
This method generally gives the purest results and highest specific activity
compared to other techniques (Wilson and Walker. 2006).
Blotting: is a method of transferring proteins, DNA or RNA, onto a carrier (for
example, a nitrocellulose, polyvinylidine fluoride (PVDF) or nylon membrane.
Electrophoresis
Electrophoresis is the main biochemical technique for molecular separation.
Electrophoresis can be one dimensional or two dimensional. One dimensional
electrophoresis is used for most routine protein and nucleic acid separations.
Two dimensional separation of proteins is used for finger printing , and when
properly constructed can be extremely accurate in resolving all of the proteins
present within a cell (greater than 1,500).When the detergent SDS (sodium
dodecyl sulfate) is used with proteins, C all of the proteins become negatively
charged by their attachment to the SDS anions. When separated on a
polyacrylamide gel, the procedure is known as SDS—PAGE (Sodium Dodecyl
Sulfate- PolyAcrylamide Gel Electrophoresis). The technique has become a
standard means for molecular weight determination (Lodish et al. 2004).
2.8 PATERNITY TESTING

Blood Types and DNA
Occasionally, situations arise in which people require concrete, scientific evidence
of parentage, whether it be their own or that of someone else. In most instances,
maternity is easy to determine. The woman who gave birth to a child is obviously
that child’s gestational, genetic, and legal mother if she is not the surrogate mother
(www.nature.com).
Unfortunately, questions of paternity aren’t so easy to answer. In order to make a

determination of fatherhood, scientists work backwards from the child to the
potential parent to ascertain the actual nature of the relationship. In the past, this
involved identifying specific phenotypes (in particular, specific blood types) in
the child and using this information to either “rule in” or “rule out” possible
fathers. However, this system presented a number of problems, one of which
35
Human Genetics was that it often yielded inconclusive results. Thus, since 1990s, the more common
approach has been to consider the presence of particular genotypic markers when
attempting to establish fatherhood (and, in a handful of cases, motherhood)
(www.docstoc.com).
a) By using blood-typing: The best-known blood-typing system is ABO typing,

which involves the presence of antigens on red blood cells that are encoded
by the ABO locus on human chromosome 9. In the ABO system, the A
allele and the B allele are co-dominant, and the O allele is recessive. Thus,
if a person’s ABO blood type is O, he or she has two O alleles. If, however,
a person’s blood type is A, he or she has either two A alleles or one A allele
and one O allele. Similarly, if a person has type B blood, this indicates the
presence of either two B alleles or one B allele and one O allele. Finally,
some people have type AB blood, which means they inherited both an A
allele and a B allele (www.nature.com).
In cases when paternity is questioned, ABO blood-typing can be used to

exclude a man from being a child’s father. For example, a man who has type
AB blood could not father a child with type O blood, because he would pass
on either the A or the B allele to all of his offspring (www.docstoc.com).
b) DNA Markers and Electrophoresis: In the 1970s and 1980s, electrophoresis

of various biochemical markers became available. With this process, proteins
from a person’s blood or other tissue were placed onto a gel, such as potato
starch, agarose, or polyacrylamide. An electric current was then run through
the gel, and different forms or isozymes of the proteins were separated by
their electrical charge and/or size. Differences in isozymes relate to
differences in the alleles that code for these proteins. Thus, the presence of
certain identical isozymes in samples from both a child and his or her
potential father could be used to reveal the existence of a genetic relationship
between the two individuals. Interestingly, improvements in paternity testing
over the past several decades have not only led to an increase in the accuracy
of test results, but also to expanded application of various testing methods.
For example, as DNA technology has gotten more precise, it has become
possible to determine paternity using DNA from grandparents, cousins, or
even saliva left on a discarded coffee cup. Such DNA testing is clearly an
important part of criminal investigations, including forensic analysis, but it
is also useful in civil courts when the paternity of a child is in question
(Adams. 2008).
2.9 TWIN STUDIES

Establishing twin registers have an enormous potential for research on the genetics
of complex traits. Some of them have existed for decades and have carefully
collected longitudinal data on behavioural traits, diseases and environmental
risk factors in large samples of twins and their families. By making comparisons
between monozygotic (MZ) and dizygotic (DZ) twins, twin registers represent
some of the best resources for evaluating the importance of genetic variation in
susceptibility to disease. They are an excellent source for studying the significance
of the genotype-environment interaction and of the contribution of specific
36
polymorphisms to the total genetic variance. Recent advances in statistical Methods of Human Genetic
Study
modeling allow simultaneous analysis of many variables in relatives such as MZ
and DZ twins.
Classical twin studies.: The classical twin study compares phenotypic

resemblances of MZ and DZ twins. MZ twins derive from a single fertilized egg
and therefore inherit identical genetic material. Comparing the resemblance of
phenotypic characters of MZ twins for a trait or disease with DZ twins offers the
first estimate of the extent to which genetic variation determines phenotypic
variation of that trait. If MZ twins resemble each other more than DZ twins, then
the heritability (h2) of the phenotype can be estimated from twice the difference
between MZ and DZ correlations.
Types of twin study and their applications

v Classical MZ–DZ comparison: These studies estimate the contributions of
genetic and environmental effects to phenotypic variance, and test, for
example, for age, cohort and sex differences in gene expression.
v Multivariate analyses: simultaneous analysis of correlated trait

This type of analysis involves:
• direction of phenotypic casuality;
• causes of co-morbidity of two or more traits: multivariate modelling of
environmental and genetic correlations between traits;
• multivariate modeling to obtain genotypic (or environmental) values
for individuals;
• analysis of longitudinal data to study causes of phenotypic stability and
tracking over time; and
• testing of Genotype × Environment using measured environmental
indices.
v Co-twin control study: Case–control studies of MZ twins who are perfectly
matched for genes and family background; such studies can also be used to
study gene expression in discordant twins
Extended Twin Study: Studies of Twins and Their Families
• Parents of twins can be included to study cultural transmission and G ×
E covariance,
• Parents of twins can be studied in a quasi-longitudinal design to
determine genetic and environmental stability,
• Assortative mating can be studied if spouses of twins are included;
social interactions and special twin effects, such as prenatal hormone
transition, the ‘private language’ of twins and shared prenatal
environment, can be studied if siblings of twins are included, and
• Maternal effects, Genotype × Environment correlation and imprinting
can be studied if offspring of MZ twins are included.
Twin studies are very helpful to understand the role of genes and environment
for multifactorial traits (such as body height and weight, neuroticism and blood
lipid levels) and complex diseases (such as obesity, depression and cardiovascular
37
Human Genetics disease). Lifestyle risk factors such as smoking, exercise, diet etc. are important
for the development of complex diseases are often considered to be
‘environmental’, they might themselves be influenced by genes (Blickstein et al,
2005).
2.10 IMMUNOLOGICAL METHODS

Immunological techniques are important to detect emerging infectious agents
like dengue fever, West Nile fever, and Rift Valley fever and biological weapons
like Bacillus anthracis (anthrax) and variola major virus (smallpox), botulinum
neurotoxins, Yersinia pestis, and Francisella tularensis which are great threat to
public health. Following are the immunological methods are based mainly upon
antigen antibody reactions.
1) Agglutination Tests
2) Coomb’s Test (Antiglobulin Test)
3) Precipitation tests
4) Immunoelectrophoresis
2.11 SUMMARY
Modern techniques like Cytogenetic methods identify the underlying genetic
causes of various diseases/disorders. Immunological methods help to identify
the various infectious agents that aid in the manifestation of the diseases and
thus help in the cure. Methods like DNA fingerprinting are very important to
solve the paternity disputes and also help in forensics to identify the right culprit.
DNA recombinant technology brings hope and opportunity to cure the genetic
disorders that are otherwise incurable. Thus understanding and application of
the genetic methods is very important for better disease control and good public
health.
References
Adams, J. 2008. Paternity Testing: Blood Types and DNA. Nature education 1(1).
Biroccio, A., Leonetti, C. and Zupi, G. 2003. The Future of Antisense Therapy:
Combination with Anticancer Treatments. Oncogene 22:6579–6588.
Boomsa, D., Busjahn, A. and Peltonen, L.2002 Classical Twin Studies and
Beyond. Nature publishing group 3.
Burgess, R.R. 2008. Protein Purification. In: H. G. Nothwang and S. E. Pfeiffer
(Eds.), Proteomics of the Nervous System, Chapter 1, pp. 1-18. Weinheim;
WILEY-VCH Verlag GmbH & Co.
Comai, L. 2005 The Advantages and Disadvantages of Being Polyploid. Nature
Reviews, Genetics. 6:836-46.
Fenech, M. 2002. Micronutrients and Genomic Stability: A New Paradigm for
Recommended Dietary Allowances (RDAs). Food Chem Toxicol 40: 1113–1117.
Graff J.C. 2006. Community Nursing: Medical Care for Children and Adults
with Developmental Disabilities. 2nd edition.
38
Gupta, V. 2005. Recombinant DNA Therapy in Medicine. Keio J Med 54 (2): 85–94. Methods of Human Genetic
Study
Mayer, G. 2006. Immunology - Chapter Seven Immunoglobulins- Antigen-
Antibody reactions and selected tests.: 67-74.
Muller, R.F. and Young I.D. 2001. Emery’s Elements of Medical Genetics (11th
edition). Edinburgh; Churchill. Livingstone. Rooney DE .
Peruski, A., and Peruski, F. 2003 Immunological Methods for Detection and
Identification of Infectious Disease and Biological Warfare Agents. Clinical and
Diagnostic Laboratory Immunology. 10: 506–513.
Rowley, J. 2001. Chromosome Translocations. Nature Reviews Cancer 1: 246.
Strachan, T. and Read, A,P. 1999. Human Molecular Genetics (2nd edition).
New York; Wiley-Liss.
Tseng, C.C. 1995. Human Chromosome Analysis. Proceedings of the 16th
Workshop of the Association for Biology Laboratory Education 16: 33-36.
www.biotech.about.com accessed on November 18, 2010
www.bogari.net accessed on January 17, 2011
www.bookrags.com accessed on November 18, 2010
www.docstoc.com accessed on November 18, 2010
www.doctorsmedicalopinion.com accessed on April 29, 2011
www.dramarabiochem.blogspot.com accessed on March 10, 2010
www.genetics.emory.edu accessed on March 10, 2011
www.genetics.emory.edu accessed on March 11, 2011
www.nature.com. accessed on March 10, 2011
www.pathmicro.med.sc.edu accessed on April 10, 2011
www.science.jrank.org accessed on March 10, 2011
www.scientific-web.com accessed on March 10, 2011
www.scribd.com accessed on April 29, 2011
Yang, L., Li, S., Hatch, H., Ahrens, K., Cornelius, J.G., Petersen, B.E. and Peck,
A. 2002. In vitro Trans-Differentiation of Adult Hepatic Stem cells into Pancreatic
Endocrine Hormone Producing Cells. Proc Natl 99: 8078–8083.
Suggested Reading
Gardner, E. J., Simmons, M.J. and Snustad, D.P. 1991. Principles of Genetics.
New York, John Willey & Sons.
Lewis, R. 2003. Human Genetics: Concepts and Applications 5th edition. Boston,
WCB McGraw Hill.
Mange, E. J. and Mange, A. P. 1994. Basic Human Genetics. Sunderland; MA.

Sinauer Associates.
Stern, C. 1960. Principles of Human Genetics. San Francisco and London;

Freeman and Company.
Strickberger, M. W. 2003. Genetics 3rd edition. New Delhi, Prentice Hall.
39
Human Genetics Whittinghill, M. 1965. Human Genetics and Its Foundations. Calcutta, New
Delhi, Oxford and IBH Publishing Company.
Sample Questions
1) Identify the mode of inheritance in the given below pedigree?
2) What do you mean by chromosome analysis and what is the difference

between the numerical and structural abnormality?
3) To how many groups the chromosomes can be divided according to ISCN?
How can be chromosome analysis be used in prenatal diagnosis?
4) What are the main steps involved in karyotype analysis and why peripheral
blood lymphocytes are considered to be ideal for karyotype analysis?
5) What are the different staining methods utilised to identify chromosomes?
How SKY is different from FISH technique?
40
Methods of Human Genetic
UNIT 3 POPULATION GENETICS Study
Contents
3.1 Introduction
3.2 Mendelian Population
3.3 Genetic Polymorphism
3.4 Hardy-Weinberg Law
3.5 Deviations from Hardy-Weinberg Law or Factors Affecting Gene Frequencies
3.6 Consanguineous and Non-consanguineous Mating
3.7 Genetic Load
3.8 Summary
References
Suggested Readings
Sample Questions

Once you have studied this unit, you should be able to:
Ø know the importance of population genetics;
Ø understand what Mendelian population is and clearly differentiate breeding
population and effective population;
Ø understand the concepts of genetic polymorphism;
Ø understand the significance of Hardy-Weinberg Law;
Ø explain how mutation, migration, selection, inbreeding, genetic drift,
consanguineous and non-consanguineous mating disturb the genetic
equilibrium and also clearly understand the process of evolution of
populations; and
Ø know what genetic load is, and understand the effect of consanguineous
marriages.
3.1 INTRODUCTION
Genetics, a discipline of biology, is the study of fundamental units of inheritance
called genes, heredity, and variation in living organisms. This hereditary material
(gene), whether as a unit of segregation, recombination, mutation, or function, is
the unifying idea basic to the field of genetics. In 1866, Gregor Mendel put
forward the mechanisms for heredity and variation. The Mendelian laws: the
independent segregation and recombination of dominant and recessive characters
constitute the cornerstone of the modern science of genetics. Mendel’s
monumental work (1866) on the principles of inheritance, that is, Mendel’s Laws
of inheritance, remained long ignored, and only received attention in 1900, sixteen
years after his death (1884). It was not until 1900, when three botanists, de Vries,
Correns, and Von Tschermak independently rediscovered the Mendelian
Principles. Later Mendel’s experiments were extended to many species of plants
and animals including man.
41
Human Genetics Human genetics is a subject of special interest to us as students of anthropology.
Human genetics itself is further subdivided into the areas of medical genetics,
biochemical genetics, cytogenetics, somatic cell genetics, immunogenetics, formal
or mathematical genetics, population genetics, and anthropological genetics.
These subdivisions of human genetics are closely interrelated and interdependent.
For example, the study of the distribution and evolution of the abnormal
haemoglobins in human populations witnessed the union of medical genetics,
biochemical genetics, formal genetics, and population genetics.
Population Genetics
Study of a whole population is, in fact, often superior to the collection of large
pedigree, because pedigree has unusual characteristics and is of specific interest,
and thus is not representative of a population. Within many populations an
equilibrium of genotypes prevails. This was first pointed out in 1908
independently by the mathematician G. H. Hardy and the physician W. Weinberg
whose several contributions laid the foundations of the genetic study of natural
populations of man and wild animals. The foundations by Sewall Wright, R. A.
Fisher and J. B. S. Haldane helped the formation of modern population genetics.
The mathematical theory of population genetics was developed in the early
twentieth century due largely to the work of Sewall Wright, Ronald Fisher, and
J. B. S. Haldane. So the population genetics deals with the consequences of
Mendelian laws on the composition of the population with special reference to
the effects of mutation, selection, migration, and chance fluctuation of gene
frequencies.
The population considered under Hardy-Weinberg law is a unique population. It

does not change genetically and cannot and does not evolve. It is an ideal
population, because it necessarily fulfilled certain “ideal” conditions and is a
mathematical abstraction, because no real population fulfills the ideal conditions
such as large size of the population with equal sexes, random mating and equal
fertility among all couples and another stipulation that the population must be
free from evolutionary forces.
3.2 MENDELIAN POPULATION

A population isolate is that group of persons within which individuals choose
their partners. Such an isolate is also called a Mendelian population. Ideally the
population isolate inhabits an island, a mountain valley, a peninsular region, a
forested area, or even a large area covering several villages, where the marriage
alliance is restricted within that endogamous group.
The general and simple definition of population is the number of people in an

area at a given time. It may be used in reference to the number of people possessing
a particular character or group of characteristics in an area at a given time. It is
difficult to define a particular population strictly, for the actual boundaries around
a specific human population are not always easy to find. A human population is
usually found in a particular place, and it is a coherent entity largely because of
geographical boundaries. Regardless of how they are circumscribed, the
significance that populations have for evolutionary genetics lies in the web of
genetic relationships within and between them—allele frequencies, consanguinity,
42
mating patterns, gene flow, natural selection, etc. The genetic approach uses the Population Genetics
concept of the Mendelian population, which Dobzhonsky has defined as “a
reproductive community of sexual and cross fertilizing individuals which share
in a common gene pool”. If the isolate or the Mendelian population is not changed
by natural selection, nor by mutation, nor by migration, and if the population
size is large and if individuals are not mating assortatively (that is, random choice
of partners), then the isolate is said to be in equilibrium. These assumptions are
fundamental to population analysis and for maintaining an equilibrium of
genotypes from generations to generations.
Although, all human gene pools are open to varying degree, it is evident that
panmixis does not take place within the total species. The more important
mechanisms maintaining genetic isolation of populations today are cultural rather
than geographical.
Breeding Population
In addition to the problem introduced by the biological openness of human-
population systems, accurate definition of a human Mendelian population is
complicated by the fact that man clusters in social groupings which may or may
not serve as biological breeding units. So the first problem of the population
geneticist, therefore, is to identify and describe, as accurately as possible, the
biological population before he can undertake an analysis of the gene pool and
forces acting on it. Because direct analysis of a population’s gene pool is
impossible, all conclusions regarding its composition are necessarily inferential,
and must be made on the basis of direct examination of the phenotypes of the
reproducing individuals. To infer the composition of a gene pool at a single
point in time the population geneticist must first enumerate and describe the
actual progenitors, that is, the parents in a population. These progenitors constitute
the breeding population.
3.3 GENETIC POLYMORPHISM

Genetic polymorphism is defined as the occurrence together in the same habitat
at the same time of two or more distinct forms of a species in such proportions
that the rarest of them cannot be maintained merely by recurrent mutation (Ford,
1940). Genetic polymorphism can also be defined as the occurrence in the same
population of two or more alleles at one locus, each with appreciable frequency
(Cavalli-Sforza and Bodmer, 1971). A formal definition, such as the above, based
on the frequency of genes that are found in a population is likely to be the most
satisfactory. At one time, polymorphism was defined in terms of the selective
mechanisms responsible for maintaining relatively high gene frequencies of two
or more alleles at a locus. Because it is difficult to determine these mechanisms
or the nature of these forces and therefore can hardly be useful in a definition.
This is the reason why it is difficult to accept unequivocally Ford’s definition.
However, it is likely that Ford’s definition applies to many, if not most, instances
of polymorphism (Ford, 1964).
Some knowledge of the theory of polymorphism is essential for a clear

understanding of the blood groups and the kindred phenomena. It should be
noted that the definition of polymorphism excludes the following forms of
variation.
43
Human Genetics v Geographical races, White, Mongoloid and Negroid types of man. These
are normally maintained by isolation from one another. It should be stressed
here, that the occurrence of polymorphism in one district and its absence or
different nature in another, may be an important attribute of distinct
communities.
v ‘Continuous variation’ under multifactorial (or environmental) control, such
as height, is brought about by cumulative effect of segregation taking place
at many loci. This cannot be considered as polymorphic condition, as it is
not maintained in the population by selection.
v The segregation of rare recessive, albinism for example or rare heterozygous
conditions, such as Huntington’s chorea, are eliminated by selection and
maintained only by mutation. Hence they cannot give rise to polymorphism.
It must be noted that polymorphism cannot normally be maintained
environmentally.
Genetic polymorphisms are very common phenomena in all human populations.
Most of the polymorphisms encountered in human populations so far fall into
two main categories: blood-cell antigens (blood groups) and blood proteins (serum
proteins). The first category of polymorphisms, the kind detected by
immunological techniques, is that of blood groups or blood cell antigens, of
which the ABO blood groups are an outstanding example. The second category
of polymorphisms, most of them detected by electrophoretic techniques, for which
complications due to incompatibility are not known or are not likely to occur,
comprises proteins found in the blood either in the free, liquid portion (serum or
plasma) or in its cells (red or white). The modern techniques of biochemistry
revealed how widely individual men and populations differ in the various enzymes
and proteins systems of the body.
Polymorphism in Man
The human polymorphism may conveniently be introduced by two examples
which reveal their essential qualities. Let us discuss about sickle-cell anaemia,
which is genetically controlled by a gene which produces the disease when
homozygous and is responsible merely for the sickling trait when heterozygous.
This gene affects the formation of haemoglobin, but not for all, it only affects the
structure of erythrocytes that assumes a sickle-like shape, that leads to haemolysis
severe enough to cause an extreme and often fatal anaemia. Those who merely
manifest the sickling trait appear on the other hand, to be perfectly healthy. Though
their blood also contains the exceptional haemoglobin, but in smaller proportion,
so the shape of the erythrocytes is normal when in circulation. It must be noted
that the anaemia is recessive while the formation of the abnormal haemoglobin
is not. In spite of the fact that the homozygotes suffer from this heavily lethal
disease which usually eliminates them, the heterozygotes are quite common in
certain regions of European population, as in some parts of Greece and Italy, and
in African tribes. Evidently the heterozygotes must have an advantage which
strongly counter-balances the destruction of the homozygotes in these areas.
Allison (1954) discovered that the sickle-cell trait confers marked immunity
against malaria especially, due to Plasmodium falciparum. The polymorphism
is established only in those places where malaria is common.
Allison (1954) further observed polymorphism involving another genetically
controlled disease, thalassaemia. Many homozygotes, and perhaps a few of the
44 heterozygotes, die, yet the gene is present in 10 per cent of the population in
some of the districts of Greece and Italy where malaria is endemic. In India, Population Genetics
particularly in parts of central India, such polymorphism exists where sickle-cell
anaemia has been found to be prevalent in malaria endemic regions.
One of the oldest known such polymorphism is the ability to taste phenyl-thio-
carbamide (PTC), or phenyl-thio-urea (PTU). For some people PTC has only a
faint taste or no taste at all; for others it has a very bitter taste. More specifically
there is a single dominant gene T (with incomplete penetrance) that determines a
high sensitivity for the taste of PTC. Non-tasters are homozygous for the recessive
allele t. When both parents are non-tasters, all their children are non-tasters.
When one parent is taster and the other is not, either all or half of their children
will be tasters, depending on whether or not the parent of the dominant (tasting)
type is homozygote or heterozygote.
Genetic polymorphisms may be ‘transient’ or ‘balanced’. Genetic polymorphisms

are called balanced, if selection favors the heterozygotes. When selection favors
the heterozygotes, a stable equilibrium may be achieved and substantial frequencies
of both alleles may be maintained in one environment. The balanced or stable
polymorphism is the result of natural selection operating as a stabilizing agent.
It is difficult to establish whether a polymorphism is stable or transient. However,

direct evidence for at least one balanced polymorphism is available; the
polymorphism for the group of haemoglobins, including haemoglobin S, in the
presence of malaria.
3.4 HARDY-WEINBERG LAW

Definition
Mathematician Godfrey Hardy and physician Wilhelm Weinberg independently
showed in 1908 that population gene frequencies remain constant from generation
to generation under a system of random union of gametes in fertilization when
the frequencies of the heterozygotes are equal to twice the product of the square
roots of the two homozygotes: p2 AA + 2pq Aa +- q2 aa = 1, where p and q are the
frequencies of genes A and a (p + q = l) in the population, which is ideally large,
with non overlapping generations, sexes equally distributed and all parents are
equally fertile, and where there are no changes in gene frequency due to mutation,
gene flow, selection or genetic drift, or where mutation and selection rates are
balanced so that there is no net change in gene frequencies.
This theory is considered as the cornerstone of population genetics because it

mathematically describes the behaviour of genetic traits through time within a
specific unit — the population. Actually, the population assumed under Hardy-
Weinberg Law is a unique population. It does not change genetically, i.e., it cannot
and does not evolve. It is a so-called ideal population, i.e., a hypothetical one,
which means that within it certain ‘ideal’ conditions must necessarily be fulfilled.
The ideal population is a mathematical abstraction, because no real population
ever fulfills all of the necessary conditions, that is, the population must be large,
the sexes must be equally distributed, mating must be random (panmictic1), all
parents must be equally fertile, and must be free from the four forces of evolution;
that is, mutation, natural selection, genetic drift, and gene flow.
1
A population undergoing random mating is often referred to as a panmictic population, or it is
said to be in a state of panmixia. 45
Human Genetics The Hardy-Weinberg Law deals with the simplest genetic case, that of a single
locus carrying only two alleles, p and q. The manner in which genetic stability is
maintained under a two-allele system is best understood if the gene pool is
visualized as divided into two component sexual units: one unit containing all
the male gametes (spermatozoa), carrying the alleles p and q, the other unit
containing all the female gametes (ova) in equal numbers. The relative proportions
of p and q are identical between the two sex units. If all the male and female
gametes mate randomly, the offspring will be distributed as shown in the box.
Whether or not the gene pool is initially in equilibrium, after one generation of
random mating, genetic equilibrium at a single locus is established and then
perpetuated at the same gene frequencies through subsequent generations.
Male gametes → P q
↓ Female gametes
P P2 pq
Q pq q2
Genotype frequencies: p2+2pq+q2
Let us examine what would be expected under random mating in a simple and
general case of an autosomal locus with two alleles A and a with frequencies, p
and q and the corresponding genotypes AA, Aa and aa with the corresponding
frequencies, p2:2pq:q2. The various mating types and the expected progeny are
given in the following table.
Mating Frequency Expected Frequency

Type of Mating AA Aa aa
AA x AA P4 P4
AA x Aa 2p3q p3q p3q
AA x aa p2q2 p2q2
Aa x AA 2p3q p3q p3q
Aa x Aa 4p2q2 p2q2 2p2q2 p2q2
Aa x aa 2pq3 pq3 pq3
aa x AA p2q2 p2q2
aa x Aa 2pq3 pq3 pq3
aa x aa q4 q4
Total * P4+2p3q+ p2q2 2p3q+4p2q2+2pq3 p2q2+2pq3+ q4
= = =
p (p +2pq+q ) 2pq(p +2pq+q ) q (p +2pq+q2)
2 2 2 2 2 2 2
*p4+4p3q+6p2q2+4pq3+q4 = p2(p2+2pq+q2)+ 2pq(p2+2pq+q2)+ q2(p2+2pq+q2) =

p2+2pq+q2
The above table presents a formal demonstration or derivation that p2+2pq+q2 is

an equilibrium.
46
Applications of Hardy-Weinberg Law Population Genetics
More precisely, Hardy-Weinberg equilibrium postulates a set of conditions where

no evolution occurs. If all the conditions are satisfied, allele frequencies will not
change (that is, no evolution will take place) and a permanent equilibrium will
be maintained as long as these conditions prevail. However, it is obvious that the
Hardy-Weinberg ideal population can never be found in the real sense in human
populations. First, the formula provides a standard against which genetic change
in a population may be measured and predicted. The formula serves as a basic
theorem which can be expanded and elaborated by other mathematical models
that deal with changes in populations (Jurmain et al 1998).
Secondly, the Hardy-Weinberg formula may be applied to large populations to
provide an estimate of gene frequencies at a single point in time.
Population genetics is the study of allele frequencies in groups of

organisms of the same species in the same geographic area.
The genes in a population comprise its gene pool.
Microevolution reflects changes in allele frequencies in populations.
It is not occurring if allele frequencies stay constant over generations
(Hardy-Weinberg equilibrium).
Five factors can change genotype frequencies - nonrandom mating,
gene flow, genetic drift, mutation, and natural selection.
3.5 DEVIATIONS FROM HARDY-WEINBERG

LAW OR FACTORS AFFECTING GENE
FREQUENCIES
The discussion above relates to an ‘ideal’ population. By definition such a
population is large and shows random mating with no new mutations, and no
selection for or against any particular genotype. For some human characteristics,
such as neutral genes for blood groups or enzyme variants, these criteria can be
fulfilled. However, in genetic disorders, several factors can disturb the Hardy-
Weinberg equilibrium by influencing either the distribution of genes in the
population or by altering the gene frequencies. These factors include:
• Non-random mating
• Mutation
• Selection
• Small population size
• Gene flow (migration).
• Non-random mating
Random mating, or panmixis, refers to the selection of a partner regardless of
that partner’s genotype. Non-random mating can lead to an increase in the
frequency of affected homozygotes by two mechanisms, either assortative mating
or consanguinity.
Assortative mating
Assortative mating is the tendency for human beings to choose partners who
share characteristics such as height, intelligence and racial origin for marriage. 47
Human Genetics Consanguinity
Consanguinity is the term used to describe marriages between blood relatives
who have at least one common ancestor no more remote than a great-great
grandparent. Widespread consanguinity in a community will lead to a relative
increase in the frequency of affected homozygotes with a relative decrease in the
frequency of heterozygotes.
• Mutation
The validity of the Hardy-Weinberg principle is based on the assumption that no
new mutations occur. If a particular locus shows a high mutation rate then there
will be a steady increase in the proportion of mutant alleles in a population. In
that case the law will not be applicable.
• Selection
In the ‘ideal’ population there is no selection for or against any particular genotype.
In reality for deleterious characteristics there is likely to be negative selection with
affected individuals having reduced reproductive fitness in genetical sense, as the
genes would not be transmitted in the next generation. In the absence of new
mutations this reduction in fitness will lead to a gradual reduction in the frequency
of the mutant gene and will cause disturbance of Hardy-Weinberg equilibrium.
Selection can act in the opposite direction by increasing fitness. For some
autosomal recessive disorders there is evidence that heterozygotes show a slight
increase in biological fitness as compared with unaffected homozygotes. This is
referred to as heterozygote advantage. The best understood example is sickle-
cell disease in which affected homozygotes have severe anemia and often show
persistent ill-health. However, heterozygotes are relatively immune to infection
with Plasmodium falciparum malaria because if their red blood cells are invaded
by the parasite they undergo sickling and are rapidly destroyed. In areas in which
this form of malaria is endemic, carriers of sickle-cell anemia, who are described
as having sickle-cell trait, are at a biological advantage as compared with
unaffected homozygotes. Therefore, in these communities, there will be a tendency
for the proportion of heterozygotes to increase relative to the proportions of
normal and affected homozygotes. Once again this will result in a disturbance of
Hardy-Weinberg equilibrium.
We have earlier discussed about selection favouring heterozygotes as in sickle-
cell anaemia, and thalassaemia. There is also the opposite situation, that is
selection against heterozygotes, as we find in maternal-foetal incompatibility
(Erythroblastosis fetalis) as is observed for the allele R (Rh blood group), and
also for other blood group genes (Rh-ABO incompatibility).
Mutation alters genotype frequencies by introducing new alleles.
Heterozygotes and new mutations maintain the frequencies of deleterious
alleles in populations.
Different alleles are more likely to confer a survival advantage in different
environments. Cycles of infectious disease prevalence and virulence often
reflect natural selection.
In balanced polymorphism, a disease-causing allele persists because
heterozygotes resist a certain infectious illness or environmental condition.
Gene flow alters genotype frequencies by adding and removing alleles from
populations.
48
Population Genetics
Clines are gradual changes in allele frequencies between neighboring
populations.
Geographical barriers and language differences often create great differences
in allele frequencies.
Genetic drift occurs when a subset of a population has different allele
frequencies than the larger population.
The founder effect occurs when a few individuals leave a community to
start a new settlement. The resulting population may, by chance, either lack
some alleles from the original population or have high frequencies of others.
•` Genetic drift
In a large population the numbers of children produced by individuals with
different genotypes, assuming no alteration in fitness for any particular genotype
will tend to balance out, so that gene frequencies will remain stable. However, in
a small population it is possible that by random statistical fluctuation one allele
could be transmitted to a high proportion of offspring by chance, resulting in
marked changes in allele frequency from one generation to the next, so that
Hardy-Weinberg equilibrium is disturbed. This phenomenon is referred to as
random genetic drift. If one allele is lost altogether then it is said to be extinguished
and the other allele is described as having become fixed (www. faculty.ksu.edu).
• Gene flow (migration)
If new alleles are introduced into a population as a consequence of migration
with subsequent intermarriage, this will lead to a change in the relevant allele
frequencies. This slow diffusion of alleles across a racial or geographical boundary
is known as gene flow. The most widely quoted example is the gradient shown
by the incidence of the B blood group allele throughout the world. This allele is
thought to have originated in Asia and spread slowly westward as a result of
admixture through invasion.
3.6 CONSANGUINEOUS AND NON-

CONSANGUINEOUS MATINGS
There are two general patterns of mating in human populations: random and
non-random mating. Deviations from random mating can occur in two general
directions. People who are related can either marry more frequently or less
frequently than they would by chance. In the former case the mating system is
one of inbreeding and in the latter one of outbreeding. Assortative mating is
another important mating type which deviates from random mating. The
assortative mating is either positive or negative. Inbreeding is defined as mating
between close relatives. When the frequency of marriages between close relatives
who have one or more common ancestors exceed the expected frequency under
random mating in a population then it is called inbreeding and when it decreases
the expected proportion then it is called outbreeding. Marriage between close
relatives who have one or more common ancestors is called consanguineous
marriage. Non-consanguineous marriages are between individuals of opposite
sex who do not have a known common ancestor. Consanguinity refers to marriage
type and inbreeding refers to the mating pattern of the population. Consanguinity
is the term referred to describe the marriages between blood relatives who have
one or more common ancestors and consanguinity is the name given to close 49
Human Genetics relationships (as distinct from relationships by marriage). In positive assortative
mating, individuals tend to choose mates who resemble themselves (e.g., in native
language, intelligence, stature, skin colour, musical talent, or athletic ability)
more frequently than would be expected by chance. In negative assortative mating,
the mating pairs are dissimilar in phenotype than would be expected by chance.
All societies have rules which forbid marriage between close blood relatives
such as parent offspring and sibs (brother and sisters) called incest taboo. Though
incest taboo is a universal feature of human society, it is complemented by a
preference for marriage between certain other relatives. The most common form
of consanguinity in the human population is cousin marriage. Marriage between
children of siblings of the same sex (parallel cousins) is prohibited except in
some Islamic societies of the Middle East where marriage between a man and
his father’s brother’s daughter is common. There are in certain areas (South
India, Japan, etc.) where marriages are commonly observed between the children
of the siblings of opposite sexes (cross cousins). First cousin marriages make up
almost 10 per cent. In southern part of India, especially in the state of Andhra
Pradesh, among certain castes, uncle-niece unions also make up about 10 per
cent of marriages. Less frequent marriage types also occur in this part of India
such as the marriages between first cousins once removed, second cousins, double
first cousins and aunt-nephew.
The possible types of mating between different relationships are shown in the
following figure.
50
Fig. 4.1: The possible types of matings between different relationships
Population Genetics
People choose partners for marriage, and they do not contribute the same
numbers of children to the next generation. The marriage practices change
allele frequencies in populations.
Traits lacking obvious phenotypes may be in Hardy-Weinberg equilibrium.
Consanguinity and endogamy increase the proportion of homozygotes in
a population.
Effect of Consanguineous Marriages
The main genetic consequence of inbreeding is an increase in the proportion of
homozygotes. Through inbreeding recessive genes are more easily brought to
the fore.
Inbreeding Depression
Usually, inbreeding causes deterioration and outbreeding causes improvement
of most of the characters. Animal breeders noticed that inbreeding particularly
always lead to a deterioration in many important qualities; fertility for instance,
tends to decrease and many an inbred stock, has lost because the fertility level
became too low for the maintenance of the line in generations. In addition, some
traits such as overall general size also decrease. This phenomenon of deterioration
on inbreeding is known as inbreeding depression.
Heterosis
In contrast to inbreeding depression, if two independent pure lines are crossed,
the hybrids between them (at least in the first generation) mostly show a
considerable increase in size, fertility and many other desirable traits. This has
been called hybrid vigor or heterosis, and clearly has a great potential for
application in agriculture and animal husbandry. The first practical application
of hybrid vigor as a technique for crop improvement was applied to corn and it
led to a very significant increase in production. This practice is now being
extended to other plants and animals. These inbreeding and outbreeding
consequences are also seen in man. The genetic effects of inbreeding are similar
to positive assortative mating. Both increase the frequency of homozygous
genotypes at the expense of heterozygotes, relative to Hardy-Weinberg
proportions. So it is clear that the inbreeding affects genotype frequencies and
inbreeding along with selection modifies gene frequencies in a population.
It should be emphasised that the increasing homozygosity i.e., the general effect
of inbreeding does not predict whether inbreeding is good or bad. It depends on
the nature of the homozygotes. Many instances can be cited of talented persons
whose parents were first cousins or otherwise closely related. Presumably
consanguinity made it easier for ‘good’ genes to come together in these cases
(example: Charles Darwin).
On the other hand, there is considerable evidence that homozygous recessives,
albinism, alkaptonuria, etc., and the lethals are encountered with greater frequency
in consanguineous marriages than in marriages of unrelated persons. Studies in
Japan, where inbreeding is greater have shown increased rates of infant mortality
and congenital abnormalities. Studies in France, Sweden, United States, and
Japan have shown increased frequencies of certain physical diseases, and mental
disorders among children of first cousin mating.
51
Human Genetics
3.7 GENETIC LOAD
Among source of variability affecting Darwinian fitness (adaptive value) may
lead to a genetic load. Crow (1970) proposed three definitions of genetic load of
which mostly used one is that the (expressed) genetic load is the fraction by
which the average population fitness is decreased in comparison with the genotype
showing the highest fitness.
It appears that some polymorphisms exist because recurrent mutations replace

genes lost to selection, whereas others exist because the heterozygote is adaptively
superior and causes several alleles to persist even though many are lost due to
selection against both homozygotes. The loss of individuals — often unseen
individuals — under either situation because they carry certain genes, has been
termed as genetic load of a species or population. So it is obvious that every
human population carries a burden of deleterious mutations which impairs the
fitness of the group. So the genetic load refers to the proportion by which fitness
is reduced in the population due to the operations of a factor such as mutation.
So the genetic load of a species is a measure of the number of deleterious traits

maintained in a population or of the damage to the population by the factors
under study. It may be measured as decreased average fitness, or somewhat more
specifically, as mortality, sterility, or morbidity due to specified causes, usually
deleterious alleles. The genetic load of a species may be partially hidden and
partially manifested. The genetic load depends on several variables — the
occurrence of mutations, the number of detrimental mutations, the number of
mutant recessive alleles, and the number of partially lethal mutant dominant
alleles.
Genetic Radiation Hazard

In every generation numerous mutations, of every possible degree of harmfulness,
will arise in human species; and in every generation, the carriers of some of
these mutants — persons afflicted with hereditary diseases, malformations, or
constitutional weaknesses — will die before they have children, or will remain
unmarried, or will produce fewer children than they would have produced if
they did not carry the mutant genes in question. The burden of genetic ill-health
and abnormality in human populations is very great. And this is more so because
of the genetic hazards of radiation. High-energy radiations cause two kinds of
damage to living matter — physiological and genetic. Physiological damage
consists of radiation burns, radiation sickness, and death, which occur soon after
the irradiation (as had happened when an Atom Bomb was dropped on the twin
cities of Japan by the Americans in 1945), and of various delayed effects, such
as malignant growths. Genetic damage includes the mutations induced in the
reproductive tissues and transmitted to the progeny. The genetic damage may
inflict harm on the descendents of the exposed persons, and that too for many
generations after the exposure.
3.8 SUMMARY
A population is a group of interbreeding members of the same species in a
particular area. Their genes constitute the gene pool. Population genetics considers
allele, genotype, and phenotype frequencies to reveal microevolution. Phenotypic
52
frequencies can be determined empirically. Genotype frequencies change if Population Genetics
migration, nonrandom mating, genetic drift, mutations, or natural selection
operate. In Hardy-Weinberg equilibrium, frequencies are not changing. Hardy
and Weinberg proposed an algebraic equation to explain the consistency of allele
frequencies. The Hardy-Weinberg equation is a binomial expansion used to
represent genotypes in a population. According to Hardy-Weinberg equilibrium
all individuals mate with the same frequency and choose mates without any
consideration to phenotype. This seldom happens. We choose mates based on
certain characteristics, and some people have many more children than others.
Consanguinity increases the proportion of homozygotes in a population, which
may lead to increased incidence of recessive illnesses or traits.
Clines are changes in allele frequencies from one area to another. Clines may
reflect geographical barriers or linguistic differences and may be either abrupt or
gradual. Genetic drift occurs when a small population separates from a larger
one, or its members breed only among themselves, perpetuating allele frequencies
not characteristic of the larger population due to chance sampling. A founder
effect occurs when a few individuals found a settlement and their alleles form a
new gene pool, amplifying their alleles and eliminating others. Mutation
continually introduces new alleles into populations. Mutation does not have as
great an influence on disrupting Hardy-Weinberg equilibrium as the other factors.
The genetic load is the collection of deleterious alleles in a population.
Environmental conditions influence allele frequencies via natural selection.
Alleles that do not enable an individual to reproduce in a particular environment
are selected against and diminish in the population, unless conditions change.
Beneficial alleles are retained. In balanced polymorphism, the frequencies of
some deleterious alleles are maintained when heterozygotes have a reproductive
advantage under certain conditions.
Reference
Jurmain, R., Kilgore, L. and Trevathan, W. 1998. Essentials of Physical
Anthropology. Belmont California; Wadsworth.
www. faculty.ksu.edu accessed on February 19, 2011
Suggested Reading
Cavalli-Sforza, L. L. and Bodmer, W. L. 1971. The Genetics of Human
Populations. San Francisco; W. H. Freeman and Company.
Ford, E. B. 1967. Genetics for Medical Students. Sixth edition. London; Methuen
& Co. Ltd.
Hartl, D. L. and Clark, A. G. 2006. Principles of Population Genetics. 4th Ed.
Sunderland; MA. Sinauer Associates.
Mange, E. J. and Mange, A. P. 1994. Basic Human Genetics. Sunderland; MA.
Sinauer Associates.
Mueller, R. F. and Young, I. D. 1998. Emery’s Elements of Medical Genetics.
New York; Churchill Livingstone.
Stern, C. 1960. Principles of Human Genetics. San Francisco and London;
Freeman and Company.
53
Human Genetics Sample Questions
1) What is a population? List three populations.
2) Explain the differences among an allele frequency, a phenotypic frequency,
and a genotypic frequency.
3) What does Hardy-Weinberg equilibrium mean?
4) What are the conditions under which Hardy-Weinberg equilibrium cannot
be met?
5) Why is knowing the incidence of a homozygous recessive condition in a
population important in deriving allele frequencies?
54
Meaning and Scope
UNIT 1 MEANING AND SCOPE
Contents
1.1 Introduction
1.1.1 Inheritance-Historical Development
1.2 Unit of Study
1.2.1 Gene Pool
1.2.2 Breeding Isolation
1.3 Mating Patterns
1.3.1 Random Mating
1.3.2 Assortative Mating
1.4 Inbreeding
1.4.1 Consanguineous Marriages
1.4.2 Types of Inbreeding/Consanguineous Marriages
1.4.3 Consequences of Inbreeding
1.4.4 Measures of Inbreeding
1.4.5 Inbreeding Coefficient
1.4.5.1 Inbreeding in Families (Pedigree)
1.4.5.2 Inbreeding in Populations (Fp)
1.4.6 Extent of Consanguineous Marriages in India
1.5 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
Ø define biological inheritance and describe its historical development;
Ø discuss breeding isolation and its implications in human population genetics;
Ø define and outline various mating patterns;
Ø explain inbreeding and types of consanguineous marriages; and
Ø measure inbreeding in families and in populations, its consequences of
inbreeding/consanguineous marriage.
1.1 INTRODUCTION
Population Genetics can be defined as the study of genetic transmission in
populations of interbreeding organisms. It is the study of the nature and source
of the inherited differences and involves predicting the changes that may take
place in relative frequencies of different genes that may be found in a population,
and determining a condition under which equilibrium between forces affecting
their frequencies may be obtained.
The science of population genetics deals with Mendel’s laws and other genetic
principles as they affect entire populations of organisms. The organisms may be 5
Human Population Genetics human beings, animals, plants or microbes. The populations may be natural,
agricultural or experimental. The environment may be city, farm, field or forest.
The habitat may be soil, water or air. Because of its wide ranging purview,
population genetics cuts across many fields of modern biology. A working
knowledge has become essential in genetics, evolutionary biology, systematic,
plant breeding, animal breeding, ecology, natural history, forestry, horticulture,
conservation and wildlife management. A basic understanding of population
genetics is also useful in medicine, law, biotechnology, molecular biology, cell
biology, sociology and anthropology.
Population genetics also includes the study of the various forces that result in
evolutionary changes in species through time. By defining the framework within
which evolution takes place, the principles of population genetics are basic to
broad evolutionary perspectives on biology. Many oddities in biology become
comprehensible in the light of evolution: they result from shared ancestry among
organisms, and they attest to the unity of life on earth. One of the purposes of
population genetics is to study the mechanism of origin and maintenance of
genetic variability. The genetic variability is studied in terms of polymorphism
of various genetic markers, as polymorphism usually refers to alternative
hereditary forms that can easily be distinguished from each other and whose
inheritance is clearly understood. Human populations are polymorphic for a large
number of genetic loci. These polymorphic loci are useful for constructing linkage
maps, genetic counselling, paternity testing and studying the evolutionary
relationships of human populations. The association between gene frequencies
and environmental factors has been made for number of polymorphic loci. It
seems that this type of association study is an effective way to make an inference
about selective mechanisms, which could be done by having the data on the
distribution of gene frequencies among various populations, provided that the
population is endogamous. If there are gene frequencies for a number of loci in
a population, the heterozygosity for individual locus can be calculated and average
heterozygosity per locus of a population is obtained. The average heterozygosity
indicates the magnitude of genetic variation that exists within a population.
1.1.1 Inheritance – Historical Development

Probably no area of biology arouses more interest or creates more controversy
than evolution, which deals with the origin of living organisms, the genetic
diversity of populations, the mechanisms of speciation, and the biological history
of our planet. Evolution is the branch of biology that attempts to explain how to
tens or hundreds of millions of different species of plants, animals and micro
organisms arouse in the course of several billion years of earth’s history.
Evolutionary science analyzes the various forces that cause species to adapt, to
change and to eventually become extinct.
Evolution and genetics are inextricably connected because the biological changes
that occur in organisms through time are due to changes in their hereditary
information changes in their genes. To a geneticist, evolution refers to changes
in gene and genotype frequencies that arise and accumulate through time in
populations and organisms (it is populations, not individual organisms, which
evolve). These cumulative changes in gene and genotype frequencies are subject
to natural selection, a process originally proposed by Charles Darwin. Charles
Darwin, in his landmark work ‘On the Origin of Species by Means of Natural
6
Selection’ altered the course of intellectual history in the Western World. Like Meaning and Scope
Newton, Copernicus, Galileo and others, Darwin proposed a mechanistic
explanation for natural phenomena. Darwin argued that the diversity of life on
earth could be accounted for by the operation of simple and observable processes
that are part of our everyday experience. Darwin made the assumptions that
phenotypic variation is partly determined by hereditary differences between
individuals. It is remarkable that the mechanisms of heredity transmission were
not then known because as Darwin himself realised, the theory of evolution by
natural selection depended critically on the way in which hereditary information
is passed from generation to generation in interbreeding populations, which he
himself was unable to account for. Darwin realised that for his theory of natural
selection to be plausible and for the adaptive modifications, observed as
phenotypes, to be passed on from one generation to the next, a mechanism of
hereditary transmission was required otherwise the offspring will not resemble
their parents and fitness-enhancing traits will not spread through the population
but he was not able to shed light on this. The fact that he could not explain the
mechanism of inheritance was the main objection to his theory of evolution. He
accepted a weak form of Lamarck’s use and disuse theory to explain origin of
variation and attempted to work out a way for explaining mechanism of
inheritance by assuming that in response to environmental stimuli, somatic cells
of body would release entities called ‘gemmules’. According to him, these
‘gemmules’ carried information on the traits of the organism and would
accumulate in germ cells and get passed on to the next generation. But he could
not prove this. He knew that for selection to operate in a population and gradually
alter it, continuous supply of variation was required. There were scholars who
believed in importance of selection for creating new adaptive changes. Others
doubted that selection acting on continuous variations was sufficient to transform
one species into another. Still others advocated Lamarckism. It took the discovery
of genes and mutations in the 20th century to render natural selection feasible and
unavoidable as an explanation for evolution.
Historically the first and still the most conclusive evidence for the existence of
genes come from the phenomenon of segregation of traits observed in the offspring
of hybrids between individuals or strains that differ in some recognizable aspect.
The principle behind the transmission was for the first time demonstrated by
Austrian monk Gregor J. Mendel (July 20, 1822 – January 6, 1884). His
publications on the results obtained from the very carefully selected breeding
experiments on ‘hybridisation’ conducted on Pisum sativum in monastery gardens
of Austria for eight years (1856-1863) indicated that the transmission of these
(seven) characters (height, size and shape of seed, colour of flowers etc. among
pea plants) are particulate in nature. The hereditary transmission of the above
traits follows specific pattern what has termed as law of independent assortment
and law of segregation. According to Mendel’s laws, given the parental phenotype/
genotype combination, it is possible to predict the likelihood genotype/phenotypes
of the offspring. Another important aspect of the discovery of Mendel’s laws is
that the transmission of hereditary traits from parents to offspring follows simple
binomial expectation with stochastic perturbation, which is more likely to be
true in a large sample size.
The Mendelian’s concept of hereditary unit is contradictory to the erstwhile

popular Greek school of thought ‘blending theory of inheritance’ that involves
mixing nature of inheritance of characters from parents to offspring. In this regard,
7
Human Population Genetics it is important to mention that Darwin has proposed ‘pangenesis’ to explain the
mechanism of inheritance and in doing so; he postulated ‘gemmules’ particle
nature of inheritance. According to Darwin, The ‘gemmules’ is produced by the
cells and could diffuse to other parts of the organism and produce new cells etc.
However, this did not stand the scrutiny of the developments of empirical
experiments of hereditary by others like Francis Galton etc. As against these
backdrops, independently and at the same time (1860s), the Mendel’s hereditary
experiments have demonstrated the existence of particular nature of hereditary
units, and rightly, he located its existence in germ cells.
The principle of segregation and dominance and principle of independent

assortment was formulated by Gregor Mendel in 1866 under such peculiar
circumstances that the scientific world failed to recognize or appreciate it until
after a lapse of 34 years. Mendel was not primarily a biologist but a monk in the
Augustinian Monastery at Brunn, Austria (now Brno, Czechoslovakia). After
seven years of experimental work in the monastery gardens, he presented the
results of his experiments, together with the generalizations we now know as
‘Mendel’s Law’, at two meetings of the Natural History Society of Brunn in
1865. The results and the theory were printed in the annual proceedings of the
society, which appeared and distributed to libraries in Europe and America in
1866.
Possibly, people expected that the results obtained by Mendel is more related to
hybridisation and are of importance to breeding animals and the implications
that Mendel’s discovery of hereditary units, the secret behind the heredity and its
implications to overall biology, was possibly realised by a few, until after three
decades later by the rediscovery of his laws in 1900 simultaneously by Hugo De
Vries in Holland, Carl Correns in Germany and Erich Von Tschermak in Austria,
who found Mendel’s forgotten paper and proclaimed its importance. Immediately
his conclusions began to be confirmed and extended by experiments carried on
in various parts of the world on many kinds of plants and animals.
It was from the Mendel’s rediscovery of laws of hereditary that describes how
the characters that he selected – e.g., height, seed colour – among plants follows
simple principles of transmission, it became clear that the cause for the hereditary
transmission of a particular (Mendelian) character is governed by what Mendel
hypothesised as ‘hereditary unit’. This hereditary unit was later described as
‘gene’ by William Bateson and the subject that deals with the heredity and its
transmission rules and regulations is the discipline of ‘Genetics’. The hereditary
transmission of traits, its variation or extent of diversity among regional
populations, how its changes over time, what are the factors and causes that
influence these changes all are important for us and the study that deals with it in
brief is the ‘human population genetics’. It also deals with theoretical and
empirical studies to understand the how different traits change over time and
factors governed its mechanism at the population level, at amino acid, enzyme,
molecular level etc.
1.2 UNIT OF STUDY

One of the major intellectual challenges of early twentieth century genetics was
the integration of Mendelian genetics and the theory of evolution by natural
selection. The resulting synthesis combined the postulates of evolution by natural
8
selection presented. Darwin with the statistical rules of genetic transmission in Meaning and Scope
the population to construct mathematical theory of evolution. This synthetic theory
of evolution, based on population genetics, is sufficient to account for the
evolution of the great variety of life forms on earth. Thus, Population Genetics,
as we know it today, arose from the need to reconcile Mendel with Darwin.
It may not be less worth mentioning here that genotype frequencies are determined
in part by pattern of mating. To deduce the genotype frequencies from the
estimated allele frequencies, British mathematician, G.H.Hardy and German
Physician, W.Weinberg independently formulated a model in 1908 describing
the relationship between the gene and genotype frequencies, and this relationship
is now popularly known as Hardy-Weinberg principle or Hardy-Weinberg
equilibrium (H.W.E), which eventually laid down the foundation of genetic
analysis of population.
Population genetics deals with the changes in gene frequency over generations
in a population. In the context of evolution, according to Darwin, it is the species
living in a given eco-niche evolves over time and this is brought by what he
called as ‘natural selection’, the driving force for the evolutionary change among
species. The unit of study in the biological realm of Darwinian evolution is the
species. Apart from the phenotypic characters that is/are characteristic (identity)
of given species — what we can understand from the common English usage
that is quite opt to the topic, for example, “birds of the same feather flock
together”, — interbreeding within a species is prime distinguishing character
that defines a species, the study unit. This is in a way identified by characteristic
species specific phenotypic traits. In general, in nature, mating is restricted to
within the species; as such the phenotypic and genetic characters are transmitted
through generations and become restricted to a given species. Therefore, mating
within a species is compatible and matings between species are unlikely and are
supposed to be incompatible. However, Man was successful in bringing out
interspecies matings between related species e.g. Lion and Tiger, Horse and
Donkey, etc. in artificial circumstances (cross-breeding) creating some unusual
types such as ‘tigon’ and ‘mule’ (was supposed to be infertile). The mating within
a species or a group restricts the transmission of characters through generations
within the group or a species. This is similar to water pond or pool/lake where
the water is contained and restricted to its geographical space.
In general, in Man, human populations live in groups over a neighbourhood area

in a wide geographical or eco-regions. In general, the marriages are expected to
be within a particular community, group or clan or caste etc. Marriages within a
community or group or clan, is said to be endogamous. Similar to water tight
compartments, the endogamy within a community restricts transmission of genetic
characters within its community, over generations. In population genetics, the
endogamous populations, where marriages are restricted within a community
are construed as ‘gene pools’ where genes/alleles or consisting of a variety of
traits with different frequencies confined to the population or the gene pool.
1.2.1 Gene Pool

Gene pool refers to the endogamous population where the marriages are restricted
within the group, restricting the genes within its group or community. This is
also called as Mendelian population (A reproductive community of individuals
9
Human Population Genetics which share in a common gene pool). How do we investigate whether a population
is endogamous? or how do we investigate the extent of a Mendelian population
or a gene pool among human populations?
The boundaries of a gene pool in human populations can be investigated by the

extent of endogamy that is practiced in a local/regional population and by studying
the marital alliances or the pattern of mating. It is not always easy to estimate the
extent of endogamy, except in small isolated populations with known or defined
barriers that restricts marriages within the population. These barriers could be
geographical and/or cultural. Examples where geographical factors play major
barriers to marriages within in the community include island populations or a
few tribal populations who live in hunting and gathering sustainable livelihood
in interior jungles or high mountain ranges of difficult terrain or inhospitable
environmental conditions. Even when the population is large, they might
subdivide to form several endogamous populations. In this case, the cultural
factors that regulate marriages lead to endogamy within in the community.
Identification of these cultural isolates helps us to investigate or define the ‘gene
pool. At empirical level one gets information about marriages within the
community and estimates “endogamy index”. It is defined as per cent occurrence
of number of marriages within the community to the total number of marriages.
The index ranges from 0 to 100 and a value of above 95% can serve as indication
to suggest the population is an endogamous and can be considered as a gene
pool. The index can be investigated for each generation to get an idea to track
changes in endogamy levels in the recent past. In case one would like to investigate
the status of endogamy beyond 5 or 6 generations, one can choose other
informative data. One such data is marriages among surnames or clans. This can
help us to get to know the relative levels of endogamy in the recent past beyond
several generations.
1.2.2 Breeding Isolation

In human populations, breeding isolation can give an estimate the spatial
distribution of gene pool. The breeding isolation can be investigated by marital
distance between the birth places of the spouses in a population. In general there
is a tendency to marry within the communities over a neighbourhood region.
The distance between the birth places of the spouses gives an extent of spatial
distribution of gene pool. In general, in traditional rural, tribal societies and in
among some urban societies a positively skewed marital distribution is expected.
A low mean marital distance (MMD) is supposed to be characteristic of traditional
societies. In urban and metropolitan societies is expected to show higher mean
and higher variance of MMD. In a study conducted among the regional
populations of Yanadi (a tribal population from Andhra Pradesh) who differ in
their subsistence pattern in islands, coastal and plateau and hill forest areas shows
the typical positively skewed MMD. The mean also varies from hunting gathering
to agricultural societies, lower among hunting gathering and higher the mean
among agricultural societies of the same tribe. It also shows the spatial distribution
of extent of gene pool among the Yanadi regional populations (Figure. 1.1).
The urban population tend to have large and higher values of MMD and their
gene pool extend over a large spatial distance. Among these populations they are
characteristic of lower endogamy rates, which become difficult to define them
as breeding isolates or gene pools. Another difficulty is in urban communities
10
are tend to show higher interbreeding with other communities, which poses Meaning and Scope
problems for considering them as breeding isolates or gene pools for population
genetic studies. Though there are very few studies about the interbreeding or
admixture in various populations, but in general such rates are about 1-2 per
cent among the rural endogamous groups and among urban communities it can
vary as high as 10%. Due to socio-economic reasons such admixture or
interbreeding is increasing among urban societies.
CY - Challa Yanadi
IY - Insular Yanadi
P1 - Upper Plateau Yanadi
P2 - Lower Plateau Yanadi
HF - Hill Forest Yanadi
Fig. 1. Distribution of matrimonial distance in regional breeding populations of

the Yanadi tribe
Fig.1.1: Distribution of matrimonial distance in regional breeding populations of the Yanadi

tribe
11
Human Population Genetics
1.3 MATING PATTERNS
Hereditary transmission of characters from generation to generation depends on
type and selection of males and females that they participate in sexual selection
leading to reproduction. Both in animals and human populations mating behaviour
is very complex and it is non-random. The selection of male and female is
characterised by a variety of patterns and certain pattern is characteristic of some
groups. Charles Darwin while elucidating his hypothesis of origin of species by
natural selection, considered sexual selection is an important criterion that plays
a role in the successive reproduction that might lead to proliferation of desired
qualities in the offspring. Those who are not so successful in selecting a mate
will have least possibility of successful reproduction of their abilities being
transmitted in the next generation. These abilities or characters stands eliminated
in successive generations. In human populations, there is a wide variety of mating
patterns and marriage norms, rules and regulations. These vary in different
societies and communities.
Human populations are organized conglomerate entities. It generally consists of

demographic, cultural, linguistic, political sub structuring; each with its own
defined functional domain. Of these several entities, culture is one important
component of human populations, which can have a profound biological
significance. For example, populations have varying rules and regulations in
choosing a mate or marriage partner. Charles Darwin in 1871 in his book ‘Descent
of Man and selection in relation to sex’, recognized sexual or mate selection as
important causative factor as that of natural selection in Evolution.
The non-random nature of choice of mate or mate selection can lead to significant
genetic changes. There are different types of mating. The genetic significance of
each type of mating can be investigated theoretical and its theoretical expectation
of the possible genetic changes over generations can be worked out or marriages
in diverse societies. These are described below.
1.3.1 Random Mating

Random mating is also referred as ‘panmixia’. Panmixia or Random mating
refers to the situation in a population where there is equal opportunity for both
the sexes to mate and reproduce irrespective of any choice or selection. Random
mating refers to a situation where absence of cultural rules and regulations that
involve preferences or avoidances of choice or selection of marriage partners. If
an individual mate or marry without any criteria of selection or choice what so
ever, it is random mating. Random mating can also refer to those mating with
respect to individual genotype or phenotype, though they may be marrying
individuals within the community. Therefore, the random mating also refers to
the characters which are not involved, either directly or indirectly, in the choice
or selection by the respective mates or marriage partners.
Random mating is one important criterion in Hardy-Weinberg equilibrium which

ensues, in a large population, stability of gene frequency over generations.
Otherwise deviations from random mating, a common phenomenon among
human populations, is an important factor which changes the gene frequency.
12
1.3.2 Assortative Mating Meaning and Scope
In all human populations, from simple societies of tribes and to complex societies
of urban in metropolis, people usually like to select their marriage partners, mates
or spouse, i.e., non-randomly, with desirable characters of their liking. This is
referred as ‘assortative mating’, an important factor of non-random selection of
mates that exists in all human societies. Assortative mating is one of the deviations
from random mating assumption of Hardy-Weinberg equilibrium. According to
H W Law the gene frequency in a population is expected change as a result of
non-random mating due to assortative mating.
Choice of mate selection is more concerned directly with respect to some specific
phenotypic characters (rarely genotypes are involved) and it might involve,
indirectly, other characters which are associated or related to selected traits or
characters among spouses or mates. For example, choice of marriage partner
could be based on such desired or preferred traits e.g., skin colour, age preferences,
intelligence, social status etc. In case one selects intelligence as the criterion it
might be associated with high social status, which may not be desired trait.
In general, the institution of marriage, in human populations, prescribes rules
and regulations that allow members of the community choice to select his/her
spouse or marriage partner. Assortative mating refers to the preferential marriages
(or mating) between individuals that involve either similar traits such as
intelligence or phenotypic characters such as height, skin colour etc. or it might
involve different traits of phenotypic characters. Assortative mating is one type
of non-random mating that commonly occurs among human populations.
Assortative mating could be of two types: positive and negative mating. In positive
assortative mating (homogamy) type both the spouses choose or select their mates
on the basis of common phenotype or of similar characteristics. Conversely, the
negative assortative (heterogamy) mating types are those where the partners select
their mates based on different or dissimilar phenotypic traits.
For example, if tall and fair people choose to marry those with similar traits of
equally tall and fare peoples, then it is assortative mating involving phenotypic
characters of tall and fair skin colour. Similarly the opposite can also happen
where people choose their mates unlike themselves or with dissimilar or opposite
traits. In general, in some societies, in mate selection, there is preference (or
selective advantage value) for fair skin colour people to get married. Conversely,
people with dark skin colour are avoided or least preferred as ones’ spouse. In a
patrilineal society, it is observed that males with dark skin colour prefer to marry
fair skin brides. In these communities, there is negative assortative mating
involving selection of dissimilar characters (dark and fair skin colour) between
the males and females. In simple positive assortative mating people marry their
spouse who are similar to them and in negative assortative mating spouse avoid
similar characters or marry their spouse with dissimilar or diverse phenotypic
traits.
1.4 INBREEDING
In many societies marriages takes place between relatives. In general, breeding
among close individuals within a group is referred as ‘inbreeding’, and it is 13
Human Population Genetics applicable in case of plants and animals. The extent of inbreeding depends on
the amount of common ancestry shared by the parents of the ‘inbred’ child (the
progeny of a consanguineous marriage or inbreeding) or in genetic terms it is the
proportion of genes that the parents have in common. It is opposite to outbreeding
referring to breeding with the individuals from outside the group or unrelated
individuals.
In human societies the marriages contracted among relatives and are referred as
‘consanguineous marriages’ or ‘inbreeding’. Consanguineous is more with
reference to cultural context and inbreeding is more with reference to general
breeding that include Man and other organisms.
1.4.1 Consanguineous Marriages

In general relatives are referred as blood relatives (see introduction above for
details) as per the belief that blood is responsible for hereditary transmission. In
Greek the word ‘Consanguin’ refers to blood and relatives are referred as
‘consanguines’. The other word for relatives is kin. Hence, marriages contracted
between relatives (consanguines) or among kin are referred as consanguineous
marriages.
In several human societies there is a preference and practice of marriages among

close relatives. Possibly owing reasons due to social, cultural and economic
reasons, several societies practice consanguineous marriages.
1.4.2 Types of Inbreeding/Consanguineous Marriages

There are different types of inbreeding and/or consanguineous marriages that
are practiced that differ among communities or societies. Self fertilization is one
of the closest form of inbreeding, which is observed among some flowering-
plants, some hermaphroditic animals. The types of close inbreeding that are
disapproved in most of the human societies but rarely observed in Man include
sib-mating, parent-offspring. In early history of mankind, e.g., in ancient Egypt,
the royal families had followed brother-sister marriages for some generations.
This was based on the belief that royal blood is pure and to maintain the purity of
blood they followed sib-sib mating. The Egyptian queen Cleopatra is one such
example of generations of sib-sib mating in the royal family.
The cousin mating or marriages among near-relatives are practiced in several

human populations. These different types of close marriages can be investigated
by drawing a pedigree with all the information of relationship between husband
and wife in a family that can extend to several generations. Aunt-nephew and
Uncle-niece marriages are the marriages that occur across two different
generations. In Indian populations Uncle-niece marriages are more common to
Aunt-nephew marriages. Depending on the type of consanguineous relationship
between husband and wife, they are categorized as first degree, second degree
(and etc.) consanguineous marriages. The first cousin marriages are categorized
as first degree consanguinity. This involves individuals who belong to same
generation but come from different families whose parents share a common
ancestor (grand parental level). These are referred as first cousin marriages,
marriage among cousins who share a common grand parent. An individual if he
14
or she marries his/her paternal or maternal daughter or son (uncle’s daughter or Meaning and Scope
son respectively) the cousin marriages is the first cousin marriage. Similarly in
case of second cousin marriages, the second cousins share a common ancestor at
great grand parent level. In between there could be marriages between individuals
that belong to two generations e.g., one-and-half cousin marriages etc.
The cousin marriages could be of different types: for example, parallel, cross
and double cousin marriages etc. The marriage between the cousins who were
descendents of two brothers or sisters (or whose (either) parents are either brothers
or sisters) is referred as parallel cousin marriages. An individual marries his or
her paternal uncle’s daughter or son is referred as parallel cousin marriage. The
word ‘parallel’ refers to same sex (either brothers or sisters) at the parental level.
In case of cross cousin marriages, it is the marriage between the offspring (cousins)
who’s (either) parents are brother and sisters. In cross cousin marriage an
individual marries his or her maternal uncle’s daughter or son is the cross cousin
marriage type. Apart from the above two there could be one more type of cousin
marriages, it is called as double cross cousin marriages. In double cross cousin
marriage, the marriages between a brother and a sister of a family marry their
cousins a sister and a brother of their uncle or aunts respectively. In cross cousin
marriage either a boy or a girl marries his or her uncle’s daughter or son (cousin)
respectively. In double cross cousin marriage type both a boy and a girl marry
their uncle’s or aunts’ girl or son (cousins) respectively.
The prevalence of consanguineous marriages varies across different populations

across regions and through time (generations). At least in the early history of
Man such close inbreeding should have been very common as a result of
population structure that is conducive of small population size, isolation and
subsistence pattern of hunting and gathering and early agricultural life. It should
have been a common practice in the history of mankind till 19-20th century or
two centuries ago before the era of breeding and principles of inheritance and its
consequences were investigated. Charles Darwin, who married her cousin Emma
Wedgewood, had of the opinion: it is likely that we are all descendents of cousin
marriages.
1.4.3 Consequences of Inbreeding

One of the important aspects of inbreeding is that it increases the chance of some
of the recessive alleles with deleterious effects to get expressed in the inbred (the
offspring of consanguineous marriages) which get transmitted from one or more
common ancestors carrying (harbour) the rare recessive alleles.
Theoretically, inbreeding in a population, in general, increases the number of

homozygotes at any autosomal locus. In case of recessive Mendelian diseases
this can lead to increased risk of genetic diseases among the inbred children. In
the same logic, in case the alleles are not deleterious in nature, but are
advantageous, increase of such genes through inbreeding in a population is
expected to be beneficial. The consequence of inbreeding whether it is deleterious
or advantageous depends on the status of the allele that is involved in the
expression among the inbred and transmission from the common ancestors.
15
Human Population Genetics Such cases pose health and survival problems of deleterious or debilitating
diseases. This is health and socio-economic burden to the society and to the
country. Increase of deleterious characters as a result of inbreeding is referred as
‘inbreeding load’.
Inbreeding in a small population lead to decrease in the genetic diversity, and it

may lead to decreased Darwinian fitness of an organism. In case if these results
to less capability to survive in changing environment, or eco-niche, with
inbreeding such characters will eventually allow the species to extinction. Such
characters are supposed to have less Darwanian fitness. Such decline in
reproductive performance and fitness with inbreeding in a population is referred
as ‘inbreeding depression’.
In case the population is large enough, some of the undesirable characters which
are deleterious, over long inbreeding in a population, suppose to get eliminated
by selection and thus attributes to better fitness and increased survival advantage
to the population.
The above theoretical expectations differ from the empirical studies conducted
on the consequences of inbreeding and its effects in human populations. These
results are not uniform across populations and there has been a debate on the
deleterious or harmful effects of inbreeding in human populations. This could
be partly due to problems of study design, the methodology used and the history
of inbreeding in the population. Some studies show significant differences with
respect to some characters considered among the inbreeding and non-inbred
population, while others have not found such differences in other populations
studied. These studies on inbreeding effects are concerned with characters such
as fertility, offspring mortality, morbidity, diseases, and rare genetic disorders,
etc.
1.4.4 Measures of Inbreeding

The consanguineous marriages or mating in a population increases the chance of
inheriting two identical copies of a homologous gene in the offspring from one
or more common ancestors. The possibility that an inbred-individual gets two
identical copies (homozygote) of such homologous genes due to inbreeding is
described as ‘identical by descent’ (or ‘ibd’). And the two alleles are called
‘autozygous’. Apart from the case of close kin marriages that can lead to increased
likelihood of both the identical copies to get expressed in the offspring by descent,
it can also happen by chance alone. In cases of chance occurrence of homozygosity
of two identical copies being expressed in an individual independent of inheritance
from a common ancestry or absence of inbreeding, then such homozygous alleles
are said to be described as ‘identical by state’ (or ‘ibs’) and the two alleles are
called as ‘allozygous’. The extent of autozygosity depends on the type of
consanguinity followed in a family or in a population. The degree or extent of
consanguinity or inbreeding in a family or in a population can be quantified by
suitable measures.
There are at least two types of inbreeding measures. These measures can be
calculated or estimated at different levels or type of data: pedigree data, population
data and based on variety of traits: phenotypic, genetic and genomic information.
The two measures are:
16
1) A genetic similarity measure to find out how or to what extent two related Meaning and Scope
individuals are genetically similar; and
2) The effect of inbreeding on the fitness of inbred offspring, described as
‘inbreeding depression’
a) Inbreeding depression: Inbreeding is expected to reduce the fitness of an

individual when compared to non-inbred population. With inbreeding within
variation will reduce and between variations is expected to increase. The
extent of Inbreeding depression can be estimated in a pedigree among the
inbred and outbred individuals and in a population. This can be investigated
in case of single trait or multiple loci and phenotypic characters. The measures
to estimate the extent of inbreeding depression include deviation from the
mean of phenotypic characters, or deviation or differences between
frequencies of a trait between the outbred and inbred individuals in a
population and taking care of the variance of the trait concerned.
1.4.5 Inbreeding Coefficient ‘F’

It is the measure of extent of genetic similarity among inbred individuals as a
result of inbreeding. Sewall Wright (1922,1923) defined inbreeding coefficient
as the ‘correlation between uniting gametes’ however such correlation can also
occur because of other types of mating e.g., assortative mating.
Malecot (1948) defined inbreeding coefficient ‘F’ based on the probability that
the homologous genes of uniting gametes are ‘identical by descent (ibd)’.
Therefore, F is the probability of autozygosity
Inbreeding coefficient == coefficient of consanguinity
== coefficient of ancestry
An inbred individual has genes that are likely to be same with the ancestor.
The inbreeding coefficient can be calculated (estimated) by different methods
for pedigrees and populations and for a variety of data as well.
1.4.5.1 Inbreeding in Families (Pedigree)

In case of individual inbreeding coefficient (Fx) from a detailed pedigree where
individual x is an inbred offspring as a result of consanguineous marriage of the
parents and/or grand parents etc. The inbreeding coefficient of the individuals
can be calculated as follows:
The inbreeding coefficient of an individual, according to Sewall Wright (1922)
is
FX = Σ [(1/2) n1 + n2 + 1 (1 + FA)]
Where x is the inbred individual
n1 is the number of generations from the inbred (x) to the male common
ancestor
n2 are the number of generations from the inbred (x) to the females
common ancestor
FA is the inbreeding coefficient of the ancestor
17
Human Population Genetics The inbreeding coefficient (F) can also be calculated from path analysis:
FX = Σ [(1/2) np — 1 (1 + FA)] and
FX = Σ [(1/2) na (1 + FA)]
Where, np is the number of paths that connects x to the common ancestor, and na
is the number of ancestors from the inbred to the ancestor in the earliest generation.
FA is the inbreeding coefficient of the common ancestor. If the common ancestor
is non-inbred, then FA is zero (in both the methods).
The value of F ranges from 0 to 1. If F is zero then there is no inbreeding in the

population and higher the value higher the inbreeding coefficient. This states
proportion of common genome shared by the inbred as a result of inbreeding.
The offspring of first cousin marriage is 0.0625 or 6.25% of the genome is
supposed to be same with that of the common ancestor.
First cousin marriage

A: cross cousin
X X X
B: parallel cousin
A B First cross cousin marriage
In the above diagram first cross cousin and parallel cousin marriages are shown.
X is the inbred ( ), his or her parents are cousins and an example of
consanguineous marriage ( = ).
The right hand side of the diagram is short form of representing the inbreeding
in the pedigrees. Here the ancestors are not themselves are inbred, so that the
term (1 + FA) is zero for the above pedigree.
The inbreeding coefficient of the x in the above can be calculated as per the
above formulae: The pedigree shows two loops. Here FA is zero as the ancestors
are unrelated and not inbred.
There are 5 ancestors (a) in the first loop starting from x.
Another 5 ancestor (a) in the other loop starting from x.
18
If one wants to count number of paths, then there are six paths (lines) (p) that Meaning and Scope
connect x through one common ancestor and another six paths (lines) (p) through
the other common ancestor.
By using any one of the formulae it is easy to calculate FX for example:
FX = Σ [(1/2) na (1 + FA)] = (1/2)5 + (1/2)5 (1) = (1/16)
FX = Σ [(1/2) np —1 (1 + FA)] = (1/2)6-1 + (1/2)6-1(1) = (1/16)
The inbreeding coefficient of a first cross/parallel cousin marriage offspring is

0.0625. Similarly it is possible to calculate the inbreeding coefficient of different
type of related marriages practiced in the population through pedigree method.
The same can be extended to complex pedigree structures with multiple loops
extending to several generations as well.
The above inbreeding coefficient refers to autosomal loci. But the same can be
extended to estimate the inbreeding coefficient for sex-linked chromosomes (Fs)
as well. In that case there is no inbreeding coefficient for a male offspring and
the path if there are two consecutive males Fs will be zero.
Inbreeding coefficient for different type of consanguineous marriages in human

populations is shown below. More close the relationship the higher the inbreeding
coefficient. In general the above is very simple example of individual cases of
consanguineous or related marriages to illustrate the inbreeding by pedigree
method. The different inbreeding coefficients of known related marriages are
shown in Table 1.1. However, in empirical study, the pedigree information is a
tedious exercise to draw large family data and from them to identify the complex
inbreeding that might run several generations.
Table 1.1: Type of consanguineous marriage and inbreeding coefficient
Type of consanguineous or related marriage Inbreeding coefficient
Uncle – Niece or Aunt – Nephew (UN/AN) 1/8 0.025
First cousin marriage (cross, parallel) IC 1/16 0.0625
First cousin once removed IC1 1/32 0.03125
Second cousin 2C 1/64 0.015625
Double cross first cousin marriage D1C 1/16 0.0625
Double cross second cousin marriage D2C 1/32 0.03125
Here for example, we have a one such complex inbreeding drawn from field
work studies among tribal villages which shows one such large complex
inbreeding network involving several families (see box 1). Indeed to calculate
the inbreeding coefficient for such complex pedigree will be difficult. But now a
days there are several methods of drawing the related marriages and luckily there
are softwares on the internet services they can provide quick way of drawing the
pedigree of complex nature and to calculate the inbreeding coefficient as well.
19
Box 1
In some populations the inbreeding
marriages may run in several
generations. Here is one such short
pedigree of 5 generations showing only
those individuals leading to
inbreeding. This is drawn from large
pedigree involving 20 families from a
tribal village. The pedigree shows four
inbred individuals with varied
inbreeding coefficient. I expect you
will be interesting to calculate the
inbreeding coefficient of the four
individuals
1.4.5.2 Inbreeding in Populations (Fp)

By knowing different types of inbreeding coefficient in a population it is possible
to calculate the inbreeding coefficient for a particular population where inbreeding
is preferred by tradition. This will be the average inbreeding coefficient practiced
in the population.
Suppose in a survey one has observed different types of consanguineous types of

marriages with each occurring at some frequency or proportion.
If ‘ci’ is the proportion of ‘ith’ types of marriages (‘ith’ e.g., = Uncle-Niece

marriages, First Cross Cousin, Second Cross Cousin once removed, Double cross
cousin etc. marriages observed in a population)
The inbreeding coefficient in the population is:
Fp == Σ (ci .Fi)
Where, ci is the proportion of type (ith) of consanguineous marriage and Fi is the

inbreeding coefficient of ith type of consanguineous marriage.
1.4.6 Extent of Consanguineous Marriages in India

In India several communities practice consanguineous marriages and the extent
of consanguineous marriages vary. For example a review work indicates that the
extent of average inbreeding coefficient among Muslim population in different
states of the country vary from 0.007 in West Bengal to 0.26 in Madhya Pradesh
(Table 1.2). In case of castes and tribes, such marriages in different regions show
an average of 0.0325. The extent of consanguineous marriages and average
inbreeding levels practiced in the country is shown in Fig. 1.2. (Malhotra and
Vasulu, 1999).
20
Table 1.2: Extent of consanguineous marriages and inbreeding among muslims in Meaning and Scope
different states of India
State/ No. of Type of Marriage Inbreeding
Region Marriages UN I.C Total Coefficient
Andhra Pradesh 356 3.37 32.87 36.2 0.025
Tamil Nadu 6116 0.88 16.29 19.5 0.012
Kerala 215 — 16.74 22.3 0.012
Maharashtra 2014 — 14.00 20.71 0.010
Madhya Pradesh 351 7.41 19.09 59.3 0.026
Rajasthan 412 — 31.55 41.3 0.022
Uttar Pradesh and 1000 — 27.7 49.4 0.020
Delhi 1483 — 11.4 27.6 0.010
West Bengal 835 — 20.36 22.2 0.013
471 — 8.28 19.3 0.007
Fig.1.2: Extent of consanguineous marriages and inbreeding levels in India
1.5 SUMMARY
1) An understanding of the human population genetics starts with an idea of
the concept of heredity, historical development of the concept and to the
present knowledge of the concept of Mandelian hereditary unit and genetics
and its developments.
21
Human Population Genetics 2) In human populations the study of population genetics is the gene pool, the
study unit. To identify and investigate the extent of gene pool requires
understanding of the breeding isolation, especially who marries whom and
where. This demographic information helps us to understand the extent of
endogamy.
3) Sexual selection is one of the important mechanism that can significantly
influence the pattern of gene transmission in a population. In case of random
mating, where everybody can marry anybody as per HW equilibrium the
genetic pattern is expected to be influenced by selection, drift and mutational
pressures.
4) In human populations mating is non-random. Each population follows a
variety of rules and regulations in selecting their marriage or mating partners.
There are preferences or criterion of mate selection, one such criterion is
based on e.g., morphological characters, intelligence, socio-economic status
and is referred as assortative mating. One can choose to marry a partner
with desirable similar characters as ones mate, where it is called as positive
assortative mating or dissimilar or opposite characters where it is called as
negative assortative mating.
5) Several human populations prefer to marry their own relatives. Such related
mating or marriages are called inbreeding. Consagnuineous marriages in
Man are one of the common type of marriage. There are a variety of types of
related marriages and all result in inbreeding. Inbreeding leads to a greater
chance of inheriting two copies of the homologous genes from one or more
common ancestors. This is referred as identity by descent (ibd). In case of
inbreeding there is decrease in variability of a trait. There is decrease in
heterozygosity of several characters. This decrease in survival and fertility
due to inbreeding is called inbreeding depression.
6) Theoretically it is possible to investigate the extent of genetic similarity
between related individuals. One such measure is the inbreeding coefficient.
By knowing types of consanguineous type or inbreeding practiced, one can
calculate the inbreeding coefficient for different types of related marriages.
One can also calculate the inbreeding coefficient in a population and examine
the trends of levels of inbreeding practiced over time and region among
diverse populations.
Overall this unit gives an idea of developments of the concept of inheritance

how it is developed from the earlier time to the current understanding of genetics.
This gives an idea of what is the unit of study in human population genetics, and
how we investigate the breeding isolation in Man. It gives an idea of what is
random mating, non-random mating, deviations from random mating in Man.
Inbreeding and consanguineous marriages and how to measure them, the pattern
and levels of inbreeding in Indian populations.
Suggested Reading
Charles Darwin 1859. Origin of Species by Natural Selection.
Charles Darwin 1871. Descent of Man and Selection in Relation to Sex.
Cavalli-Sforza, L.L. and W.F. Bodmer. 1971. The Genetics of Human Populations.
22 San Francisco: W.H. Freeman.
Crawford M.H and P.L Workman, 1973. Methods and Theories of Anthropological Meaning and Scope
Genetics. Albuquerque: University of New Mexico Press.
Harrison, G.A and A.J Boyce. 1972. The Structure of Human Populations. Oxford:
Clarendon Press.
Malhotra, K.C and T.S Vasulu. 1993. Structure of Human Populations in India.
In. “Human Population Genetics: A centennial tribute to J.B.S.Haldane”.(ed.).
P.P. Majumder.207-233. New York: Plenum Press.
Curt Stern. 1973. The Principles of Human Genetics. (3rd.). San Francisco: W.H.
Freeman.
Sample Questions
1) What is gene pool? How do we investigate the extent of gene pool in human
populations.
2) What is Assortative mating and how it is different from random mating and
inbreeding.
3) What are different measures of inbreeding?
23
UNIT 2 HARDY-WEINBERG EQUILIBRIUM
Contents
2.1 Introduction
2.2 Hardy Weinberg Equilibrium (HWE)
2.2.1 Importance and Implications of Hardy Weinberg Equilibrium
2.3 Applications in Human Population Genetics
2.4 Departure from HWE
2.4.1 Factors Affecting Change in Gene Frequency
2.4.1.1 Mutation
2.4.1.2 Genetic Drift
2.4.1.3 Natural Selection
2.4.1.4 Gene Flow
2.4.1.5 Genetic Equilibrium
2.5 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
Ø define what is Hardy-Weinberg Equilibrium or Law;
Ø depict the importance of HW Equilibrium and the field of population
genetics;
Ø explain the method how to estimate the genotype and phenotype frequencies
from HW theorem and to calculate in empirical situation; and
Ø evaluate the theory behind the deviations from H-WE, especially the gene
frequency changes with respect to Mutation, Genetic drift, Selection, Gene
flow and how to investigate them in empirical situations in human
populations.
2.1 INTRODUCTION
Living organisms are endowed with unique abilities, traits that allow them to
survive in a given environment. These traits or abilities may show or exhibit
enormous variations within species and across species. Some of these traits are
unique to that species; some traits are common within and across species with
little variation, these are adaptive characters and gives survival advantage.
These traits are the ‘phenotypic’ forms that can be observed as a quantitative
trait (or measurable) or classified as types or categories. These traits are hereditary
and transmitted across generations: either in the same form or in slight variable
form. At times some new traits or variations of the trait appear among the
offspring. Some of these traits are governed by ‘genes’ or located in the ‘genome’
of an organism. The nature of heredity of some of these traits could be complex
24 and/or it could follow some simple principles of transmission.
Human population genetics deals with how these traits or variation change in a Hardy-Weinberg
Equilibrium
population over space and time (generations)? What are the factors that influence
the variation of these traits in the population? To what extent these traits are
hereditary and are influenced by environment? Can we understand them by simple
theoretical models? Can we study how different forces operate differentially in
different populations to give a characteristics distribution of gene and genotype
frequencies?
Population genetics is the study of gene and genotype frequencies in populations

of interbreeding organisms (small or large, natural or artificial) and predicting
the way these frequencies are maintained or changed under the combined influence
of various factors. It is concerned with applying models of gene frequency change
involving different factors in the context of Mendelian genetics to examine
evolution in a quantitative manner. In order to understand the pattern of allele
frequencies we need to have a defined population, in this case a ‘Mendelian
population’. Dobzhansky (1951) defined it as the reproductive community of
individuals which share a common gene pool. Evolutionary studies involve
reconstructing past demographic events that have led to the present day diversity
patterns. Use of various models allows one to examine interplay of various factors
and make inferences about the past based on present day data. But one has to be
careful about interpreting results obtained from any model considering that all
models have some assumptions inherent to them.
2.2 HARDY-WEINBERG EQUILIBRIUM

During the early 1900s people were interested to validate the Mendelian laws of
genetics to other organisms, including Man. Are there Mendelian traits in Man?
Mendelian Genetics in Man
BOX 2.1
Brachydactyly in a population: All the mating types are:
The mating types include individuals Normal and Brachydactyly (a Dominant
Mendelian trait)
N – Normal and B –Brachydactyly a NN – NN = All the offspring N
a. Both parents are normal — All the offspring are N b NB – NN = ½ : ½ = N : B
c BB – NN = all are B
b. One parent is N and the other B (heterozygous)
d NB – NB = 1 N : 1 B: 2 B
c. One parent is N the other B
e BB – BB = All the offspring B
d. Both parents are brachydactyly B (heterozygous)
e. Both parents are brachydactyly B (homozygous)
Of the 5 possible combinations of parental mating types 4 types of matings results
brachydactyly offspring.
Therefore, B are more frequent than N in a population as per Mendelian expectation.
However Normal individuals are more frequent than Brachydactyly in a population.
# there is apparent contradiction between what is observed and what is expected
(Mendelian)!
At Cambridge one research scholar was studying ‘brachydactyly’ – a trait

characteristic of small or short digital length (‘brachy’ and ‘dactyl’ in Greek 25
Human Population Genetics means ‘short’ and ‘digit’ respectively) than the normal type. The trait runs in
some families. Does ‘brachydactyly’ follow Mendelian principles? The results
of the study showed that ‘brachydactyly’ is dominant Mendelian trait and the
pedigrees showed 3:1 ratio of brachydactyly to normal offspring. This has invoked
an important and interesting question? If it is a dominant trait, there will be more
and more brachydactyly individuals in the population, but normal individuals
are more frequent than brachydactyly individuals (See Box 2.1)
GH Hardy has solved the puzzle theoretically and published the theorem in
Science (Hardy, 1908). GH Hardy’s proof illustrates that the gene (or allele)
frequency, — here in this case, frequency of brachydactyly individuals in a
population, — will not increase over generations, but remain the same, under
equilibrium conditions or in the absence of confounding variables. In 1908,
Dr. W. Weinberg independently also published similar results (Weinberg, 1908)
and is called as HWEqulibirium. (See Box 2.2)
BOX 2.2: Historical anecdotes: HWEqulibrium/Law

In 1908, a German physicist Dr. Weinberg published similar results on
Mendelian genetics in a German journal. It was discovered by Dr. Curt Stern
(publication in Science 1943), and the Hardy theorem was rightfully referred
as HW Law or HWEquilibrium. However, in 1903, at least five years earlier,
two scientists have considered similar such possibility of change in gene
frequency. They are: WE Castle 1903 in America and Karl Pearson 1903 in
England. These two papers considers the question of equilibrium state of
gene frequency and change in gene frequency partially with respect to some
factors.
a) What is H-W EQUILIBRIUM/LAW?

HWE states that in a randomly mating population of sufficiently large size,
and in the absence of the influencing factors such as; mutation, migration,
selection, genetic drift and inbreeding, the gene and genotype frequencies
will remain constant from generation to generation.
The mathematical proof of invariance of gene frequency under given
assumptions, require:
a) simple knowledge of school algebra and
b) basic concepts of Mendelian genetics (See Box 2.3).
The proof in case of autosomal ‘biallelic’ trait is given in Box 2.4. (for
further reading see references)
BOX 2.3: Basic concepts

Phenotype : A trait or a character that is observed as types or measurable
and is transmitted from parents to offspring. Some phenotypes
are complex with unknown genotypes, and some are directly
governed by hereditary units (genes).
Gene : The causative factor of hereditary transmission of traits

(phenotypes) and are located in the chromosomes (the
hereditary materials in cell nucleus and in mitochondria).
26
Hardy-Weinberg
Allele : Genes, the causative factor of hereditary transmission Equilibrium
can exist or express in different forms and are referred as
‘alleles’.
Codominant: Where both the alleles are equally expressive in the offspring.
Recessive : The alleles whose expression is suppressed at phenotypic

level. The heterozygote offspring of a recessive allele will
express the phenotype of the dominant allele.
Haploid : Organisms which carry one set of chromosomes.
Haplotype : It is short form of ‘Haploid genotype’. Refers to genetic

markers located on one chromosome. A haplotype can be
identified by SNP (single nucleotide polymorphism).
Diploid : Organisms which carry two sets of chromosomes, each set

derived from either of the parent. Man is diploid and carries
two sets of chromosome (2N).
A diploid individual can carry two copies (alleles) of the gene in each of the
chromosome that he or she gets from his or her parents. The two copies
could be of the same type (form/status) or of different type (form/status).
Homozygous: The two alleles that an individual carries are of the same or
identical types.
Heterozygous: The two alleles that an individual carries are of different type.
Genotype : Is the combination of alleles that a diploid individual can

carry in each of the chromosomes.
For example, in case of a ‘biallelic’ gene say A, B two forms (alleles) of the
gene that occur in each of the two sets of the chromosomes. There could be
three different genotypes: AA, AB, BB.
AA and BB : two different homozygotes (genotype).
AB = BA : heterozygote (genotype).
The box shows the “Punnet’s square” – method Punnet’s square

of scoring different combination of genotypes
based on the male and female gametes or mating Male Gamete
Female gamete
A B
types. This can be extended to multiple alleles.
A AA BA
Polymorphism: If a gene exists in more than one
form or morph (alleles) and that occurs in stable B AB BB
frequency in a population. Genotype
27
Human Population Genetics BOX 2.4: Hardy-Weinberg theorem or principle: Proof
In case of genetic trait that has positive family history in a population, let us
assume that the gene is biallelic and therefore the two alleles are: B1 and B2
and let
‘p’ is the frequency of ‘B1 allele’ and
‘q’ is the frequency of B2 allele,
N is the total individuals and
So that (p + q = 1) or p = (1 – q) or q = (1 – p)
An individual in the population can have three types of genotypes: B1B1,
B1B2, and B2B2. And let the frequency of the above three genotypes in the
parental population are: P, H and Q respectively.
...................................................................................
Gene (alleles) Genotypes
..................................... ...................................
B1 B2 B1B1 B1B2 B2B2
...............................................................................................................
Frequencies p q P H Q
...............................................................................................................
If there are total N individuals in the sample, there will be
P individuals with genotype B1B1 type,
H individuals with genotype B1B2 type and
Q individuals with genotype B2B2 type
So that sum of (P +H + Q) = N,
Assuming all the individuals of the three genotypes are equally fertile, then
given the genotypes, one can calculate the frequencies ‘p’ and ‘q’ in the
population, by gene counting method:
The gene (allele) frequency ‘p’ = [P + ½ (H)]1/N = (B1B1)/N + ½ (B1B2/N), and
The gene (allele) frequency ‘q’= [Q + ½ (H)]1/N = (B2B2)/N + ½ (B1B2/N)
This is the gene (allele) frequencies of ‘p’ and ‘q’, which are also the gametes
produced in the population.
Only some of the gametes form zygotes that will eventually become individuals
in the next generation. The allele (gene) frequency in the zygote is unchanged
provided there is no reproductive advantage of either of the allele and the
zygotes formed represent a large sample of the parental gametes.
Random mating between individuals is equivalent to random union among
their gametes. Therefore, in the next generation, the genotype frequencies
among the zygotes (fertilized eggs) are the result of random union of two
types of gametes. The genotype frequencies among the progeny are therefore
can be worked out by Punnet’s square. Or it is the multiplication of the
frequencies of the gametic types produced by the parents. Viz.,
------ ----------------------- -- Allele B1 B2
Genotype
Genotype B1B1 2B1B2 B2B2
B1B1 B1B2 B2B2
Frequency p2 2pq q2
--------------------------------
Absolute freq. P H Q
Frequency p2 2pq q2
28 -------------------------------
Hardy-Weinberg
BOX 2.4 (Contd.) Equilibrium
Hardy-Weinberg theorem or principle: Proof
In a population there will be three different types of genotypes among males and
females, who will mate randomly and they will give rise to their offspring who
will represent the same genotypes in the next generation. We will have to work
out the frequencies of offspring genotypes given the three genotypes among the
male and female parents. This is worked out easily by Punnet’s square: the
frequencies of different mating types among the male and female genotypes in
the population and different possible genotypes among the offspring are.
Frequency of different mating types and the offspring genotypes
- ----------------------- ------------------
Male Parent — Genotype
Female Parent B1B1 B1B2 B2B2
2
Freq. p 2pq q2
------------------------------------------
B1B1 p2 p4 2p3q p2q2
B1B2 2pq 2p3q 2p2q2 2pq3
2 2 2 3
B2B2 q pq 2pq q4
------------------------------------------
Once we know the possible offspring genotypes as a result of random mating
among the three parental genotypes we can calculate the expected frequencies
among the offspring genotypes for different combination of mating types in the
population. Given the three genotypes six possible mating types are possible in
the population and each mating type will give rise to offspring of different possible
combination of genotypes. These are worked out in the following table and this
gives the allele frequencies in the offspring population in the next generation:
Frequency of different mating types and the offspring genotypes
- ----------------------- --------------------------------
Parent Offspring — Genotype
Female X Male B1B1 B1B2 B2B2
(Genotype) Freq.
----------------------------------------------------------
B1B1 X B1B1 p2 p4 — —
3 3 3
B1B1 X B1B2 4p q 2p q 2p q —
B1B2 X B1B1 }
B1B1 X B2B2 2p2q2 2p2q2
B2B2 X B1B1
} — —
B1B2 X B1B2 4p2q2 p2q2 2p2q2 p2q2

3 3
B1B2 X B2B2 4pq — 2pq 2pq3
B2B2 X B1B2
}
B2B2 X B2B2 q4 — — q4
---------------------------------------------------------
1 p2 (p2 + 2pq + q2) 2pq (p2 + 2pq + q2) q2 (p2 + 2pq + q2)
p2 2pq q2
---------------------------------------------------------
Thus the genotypic frequencies in the offspring remain the same in two successive
generations, assuming that allele frequencies are not influenced by selection,
mutation and mating is random and there is no differential fertility and mortality
and the population is large.
The above is true for autosomal loci and can be extended for multiple loci. It is
also true for sex-linked trait. Here the gene frequencies will oscillate (by ½)
between two sexes in successive generation and will soon reach to equilibrium.
29
Human Population Genetics 2.2.1 Importance and Implications of HWE
What are the implications and why it is so important? In brief, it is the fundamental
theorem of population genetics.
• Methodology: Tells us how to calculate (or estimate) the allele frequency

or genotype frequency from observed phenotypes in an empirical situation.
It can help us to investigate how many alleles are governed by a phenotypic
trait.
• Evolution: It is quantitative way of understanding the mechanism of

evolutionary factors and its influences. Evolution is a dynamic and complex
phenomenon and it is hardly possible to study evolution in the laboratory
conditions. It gives insights into the inter-relationship between the forces
and how to study the effects of each of these forces and the gene frequency.
(See the box 2.5 for the relationship between gene frequencies and genotype
frequencies).
• It is the benchmark criterion to test whether a new trait is in equilibrium or

if not how to test the reasons for the deviations.
• It helps us in genetic counselling to expect the likelihood of a child being

homozygous for a recessive deleterious trait given the parental genotype. It
helps in forensic science in cases like identification of suspects, parent-
offspring disputes etc.
• Quantitative Genetics: HWE helps us to investigate complex genetic traits,

to estimate the role of environment and genetic components, spatial
distribution of gene frequency etc.
Further implications of this principle are as under:
• In case in a population a particular trait or character is in HWE, (the converse)

it does not mean that the assumptions are satisfied. (The theoretical proof is
complicated and it is available).
• The allele frequencies remain constant from generation to generation. This

means that hereditary mechanism itself does not change allele frequencies.
It is possible for one or more assumptions of the equilibrium to be violated
and still not produce deviations from the expected frequencies that are large
enough to be detected by the goodness of fit test.
• When an allele is rare, there are many more heterozygotes than homozygotes
for it. Thus, rare alleles will be impossible to eliminate even if there is
selection against homozygosity for them.
• For populations in HWE, the proportion of heterozygotes is maximal when

allele frequencies are equal (p = q = 0.50), and when this happens the
heterozygote frequency will be 0.50 (2x0.50x0.50). Unless HWE is violated
(as in selective loss of homozygotes), heterozygosity can never be more
than 0.50 at any biallelic locus. The relationship between gene frequency
and genotype frequency is illustrated in Box 2.5.
30
Hardy-Weinberg
BOX 2.5 Equilibrium
The relationship between gene frequency and genotype frequency
It is interesting to know the relation between the gene and genotype frequency
for a biallelic loci which is under H-W equilibrium. The graph shows the
changes in the three genotype frequencies as against the change in allele
frequencies A1 and A2 from 0 to 1 in Cartesian coordinates (drawn on x and
y axis).
A1A1/A2A2 – homozygotes, A1A2 – heterozygotes
Relationship between genotype frequency and gene frequency
- biallelic GENE
G 1.0
E
n A1A1
o
A2A2
t
y
p
e
0.5
f
r A1A2
e
q
u
e
n 0.1
c
y
0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0
Gene frequency A2
Fig: Left top curve – A1A1, Right top curve – A2A2, Lower curve – A1A2
The graph shows two interesting properties of the HWE:
ü The frequency of the heterozygotes can reach to a maximum of 50%
ü And this can occur when the gene frequency of ‘p’ = ‘q’ = 50%
ü When one of the gene frequencies of an allele is low, the rare allele
predominantly occurs as heterozygotes and there will be few heterozygotes.
• An application of HWE is that when the frequency of an autosomal recessive

disease (e.g., sickle cell disease, hereditary hemochromatosis, congenital
adrenal hyperplasia) is known in a population and unless there is reason to
believe HWE does not hold in that population, the gene frequency of the
disease gene can be calculated. Likewise, the carrier rate may be calculated
for autosomal recessive disorders if the disease gene frequency is known.
For example, phenylketonuria (PKU) occurs in 1/11,000 (q2), which gives a
heterozygote carrier frequency of approximately 1/50 [ 2xq(1-q) ]. If the
diseased individuals (q2) are deducted from the whole population, the carrier
rate in normal individuals approximates to [ 2q/1+q ].
31
Human Population Genetics • It has to be remembered that when HWE is tested, mathematical thinking is
necessary. When the population is found in equilibrium, it does not
necessarily mean that all assumptions are valid since there may be
counterbalancing forces. Similarly, a significant deviance may be due to
sampling errors (including Wahlund effect), misclassification of genotypes,
measuring two or more systems as a single system, population substructure,
failure to detect rare alleles and the inclusion of non-existent alleles. The
Hardy-Weinberg laws rarely holds true in nature (otherwise evolution would
not occur). Organisms are subject to mutations, selective forces and they
move about, or the allele frequencies may be different in males and females.
The gene frequencies are constantly changing in a population, but the effects
of these processes can be assessed by using the Hardy-Weinberg law as the
starting point.
• The direction of departure of observed from expected frequency cannot be
used to infer the type of selection acting on the locus even if it is known that
selection is acting. If selection is operating, the frequency of each genotype
in the next generation will be determined by its relative fitness (W). Relative
fitness is a measure of the relative contribution that a genotype makes to the
next generation. It can be measured in terms of the intensity of selection (s),
where W = 1 - s [0 < s < 1]. The frequencies of each genotype after selection
will be p2 WAA, 2pq WAa, and q2 Waa. The highest fitness is always 1 and the
others are estimated proportional to this. For example, in the case of
heterozygote advantage (or overdominance), the fitness of the heterozygous
genotype (Aa) is 1, and the fitnesses of the homozygous genotypes negatively
selected are WAA = 1 - sAA and Waa = 1 - saa. It can be shown mathematically
that only in this case a stable polymorphism is possible. Other selection
forms, underdominance and directional selection, result in unstable
polymorphisms. The weighted average of the fitnesses of all genotypes is
the mean fitness. It is important that genetic fitness is determined by both
fertility and viability. This means that diseases that are fatal to the bearer
but do not reduce the number of progeny are not genetic lethal and do not
have reduced fitness (like the adult onset genetic diseases: Huntington’s
chorea, hereditary hemochromatosis). The detection of selection is not easy
because the impact on changes in allele frequency occurs very slowly and
selective forces are not static (may even vary in one generation as in
antagonistic pleiotropy).
• All discussions presented so far concerns a simple biallelic locus. In real
life, however, there are many loci which are multiallelic, and interacting
with each other as well as with the environmental factors. The Hardy-
Weinberg principle is equally applicable to multiallelic loci but the
mathematics is slightly more complicated. For multigenic and multifactorial
traits, which are mathematically continuous as opposed to discrete, more
complex techniques of quantitative genetics are required.
2.3 APPLICATION IN HUMAN POPULATION

GENETICS
The behaviour of HW principle under different assumptions is the discipline of
‘population genetics’, which describes, primarily, the changes in gene frequency
that are influenced by demographic factors, population structure variables,
32
historical, random events, sampling fluctuations and evolutionary factors of Hardy-Weinberg
Equilibrium
selection and mutation. In simple the four main factors that influence the gene
frequency in a population are: mutation and genetic drift (non-systematic factors),
migration and selection (systematic factors). The genetic drift is effective, more
specifically, in populations whose size is small or limited e.g., an isolate or an
island population or a small endogamous population. These are described in
detail below:
• For example, HWE has helped us to find out to investigate the number of
alleles of ABO locus and how to calculate the gene frequency of ABO locus
(e.g., Bernstein has given the method of correction ) (see Box 2.6)
• We were able to understand how HbS despite its deleterious effect it
maintains its equilibrium in the population.
• HWE helps to understand the some of the health problems in some isolated
populations, whose propagation is the result of genetic drift, and selection
or inbreeding etc.
• HWE has forensic applications in solving problems related to disputed
paternity, to provide evidence in case of crime to detect the culprit, property
or biological inheritance cases.
• It helps in understanding the complex genetic disorders, to be able to estimate
the contribution of genetic versus environmental effects.
• HWE helps to understand to investigate the human origins, the role of
selection versus demographic effects on the genetic diversity in a population.
BOX 2.6
HWE – Gene frequency estimation: Gene counting method
Given the information about the genotypes, HWE helps us to estimate the
allele frequency by ‘gene counting method’ (how many alleles a genotype
contains). For example,
Ø As each homozygote carries two alleles and each
Ø Heterozygote carries one allele, therefore, estimate of an allele frequency
in a population of size N individuals (or 2N alleles) will be
= (2 homozygotes + heterozygote) *(1/2N)
Ø In a population there will be three genotypes and their absolute frequency
will be say N1, N2 and N3 (where N1 + N2 + N3 = N). If there are two
alleles say ‘A’ and ‘a’ with a frequency ‘p’ and ‘q’ respectively (where p
+ q = 1).
Ø By gene counting method assuming HW law the gene (allele) frequencies
of p = (1/2N) * (2N1 + N2), q = (1/2N) * (2N3 + N2) and p = (1 – q)
2.4 DEPARTURE FROM HWE

In general, the factors that are assumed to be non-operative under HWE are
hardly realised in the living systems. The living system (populations or organisms)
are structured (non-random entities) and are influenced by multiple and interactive
factors that operate through space and time. With the help of HW equilibrium it
is possible to investigate and estimate the effect of these individual forces that
change gene frequency in human populations. 33
Human Population Genetics 2.4.1 Factors Affecting Change in Gene Frequency
The four aspects of the H-W assumptions are:
i) Demographic:
a) Size, mating, fertility and mortality, and migration
ii) Evolutionary:
a) Mutation, selection, gene flow
iii) Population structure:
a) Social and Cultural factors
i) Matings and Marriage specifications that regulate the marriage or
mating type in a population.
ii) Non-random mating – Sexual selection of mates
iv) Ecological:
a) Population bottle-neck events:
i) Pandemic: disease, earthquake etc.
ii) Historical: wars etc.,
Of the above factors, for the present academic purpose, we will be dealing a few
factors and examine how these factors change or influence the gene frequency in
a population and how to estimate them in empirical situation.
2.4.1.1 Mutation
Mutation is a random change in phenotypic or genotypic forms that occur once a
while in a population. The probability or likelihood of occurrence, in a population,
in general, is of the order of one over several lakhs or tens of thousand of individuals.
For example, several of the Mendelian syndromes and disorders that have been
discovered in human populations are the result of mutation. In general, it is
observed to be a single mutation or point mutation. At molecular level, mutation
primarily refers to changes in the DNA sequences (or SNPs — Single Nucleotide
Polymorphism) in the genome of an individual (population) with phenotypic
manifestations resulting to non-normal cases, some of them are clinically or
medically identified as diseases or a syndrome. If one can search web resources,
there is a data base created by Hopkins institute and or by NIH (America) on a
list of Mendelian syndromes, which can be found by a search criterion OMIM
(Online Mendelian Inheritance in Man). One can also find such data bases from
a variety of sources.
Some examples will help us to get an idea of mutation and its effects. Sickle cell
anaemia (or HbS condition), is a disease related to Haemoglobinopathies. Its
inability to synthesize Oxygen (O2) to its full capacity by an individual who is
suffering from the disease or the trait, which results a risk to survival liability.
This is identified as due to a point mutation or single mutation at the 6th position
of the â-globlin chain of the haemoglobin gene. The single aminoacid substitution
(â6 Glu to Val) changes the haemoglobin structure, which is phenotypically
identified as sickle cell shaped form (or half moon shaped form) of the RBC.
Mutation is an important factor or ingredient leading to the appearance of new
characters in the population. The fate of the mutation as a new character in a
34 population depends on its advantage or disadvantage that it can impinge to the
survival fitness of the population. For example, mutation is a significant Hardy-Weinberg
Equilibrium
evolutionary force which can change allele frequency variation in a population
under a favourable environment. How we can know the relation between the
mutation and allele frequency change from HWE.
a) Change in gene frequency due to mutation (µ):

Random changes that happen at the DNA sequence, especially at the coding
region of the gene can create an allele which can alter the gene frequency in
the population in successive generations. This can be investigated
theoretically given the mutation rate per generation in the population. This
has been shown in Box 2.7 for bi allelic loci.
The theoretical results suggest that the change in gene frequency of a mutant
allele, after‘t’ generations, depends on the initial allele (gene) frequency
before mutation and the mutation rate of the allele per generation in the
population.
This is an important result and can help to calculate change in gene frequency
after‘t’ generations given the mutation rate (µ) per generation and the initial
gene frequency in the population.
b) Rate of mutation (µ):
Though the mutation is random, but the rate of mutation varies. It is site
specific – there are ‘hot-spots’ where mutation rate is more frequent than in
other parts of the genome. In general, the coding part of the gene does not
support mutation to occur, as a result of proof reading process and functional
importance of the codons. However, mutations occur at higher rate in the
intronic region, and in the repeat sequences than in exons or codons. Also
the mitochondrial non-coding parts, viz., hyper variable regions HV1, HV2
in the D-loop has higher rate of mutation than in nuclear genome.
BOX 2.7
Change in gene frequency due to mutation (µ)
If there are two alleles ‘A’ and ‘a’ with its frequencies ‘p0’ and ‘q0’ at the initial stage
(say at time ‘t0’) in a population and ‘µ’ is the mutation rate that changes allele ‘A’ to
‘a’ per generation, then gene frequency (g.f.) of ‘A’ will decrease by an amount ‘µ p0’
in the first generation. Therefore the g.f. of ‘A’ allele in the first generation after
mutation will be:
P1 = p0 - µ p0 = (1 - µ) P0
In the (next) second generation the gene frequency is expected to be:
P2 = P1- µ P1 = (1 - µ) P0 - µ(1 - µ) P0
= (1 - µ) P0 [(1 - µ)]
= (1 - µ)2 P0
After‘t’ generations the g.f. of ‘A’ is expected to be
Pt = (1- µ) Pt-1 = (1- µ)2Pt-2 .. = (1-µ)t P0
When µ is very small (1-µ)t can be approximately equated to = e-ut, (where e is
natural logarithm to base e), therefore, gene frequency after ‘t’ generations will be
Pt ˜ P0 e-ut
Therefore, the mutations that occur at HV1 and HV2 regions of mitochondrial
genome help us to investigate the short-term evolution or micro-evolutionary
35
Human Population Genetics trends in sub-populations. This has helped us to address some of the questions of
human origins or to verify the Darwin’s hypothesis that the Africa is the origin
of Man. This also helps to enquire the antiquity and past genetic history of diverse
populations and their diversity and relationship with other human populations.
2.4.1.2 Genetic Drift

Genetic drift is an important non-systematic evolutionary force. To understand
the concept of genetic drift, let us know what the word ‘drift’ conveys, in general.
One of the descriptions for the word ‘drift’ in the English Dictionary is: “move
aimlessly from one place or activity to another’ – this is more with reference to
things or events that we experience with practical world e.g., drifting by air,
wind and water or ocean. Similar phenomena can also happen with respect to
gene frequency in a small population. In small populations, as a result of
population-events such as pandemic diseases, earthquakes etc., the population
size is drastically reduced which can have significant effect on the genetic diversity
and gene frequency: for example, the gene frequency can drift from one generation
to generation randomly leading to either loss or fixation of alleles over generations
(in the absence of other interfering factors). In small populations or due to
demographic and ecological effects the population size drastically reduced to a
fraction (or a random sample) of the original population with allelic representation
different from the original population. In these cases, there will be random changes
in gene frequency, which appear to drift at varying frequencies in successive
generations in an erratic manner. For example, the studies on the origins of Man,
suggest that decreasing heterozygosity and linkage disequilibrium levels away
from Africa are supportive of the role of genetic drift among human populations.
To understand how the genetic drift can happen or possible, one can investigate
and/or understand by attempting some simple examples or simulation exercises.
These are available on the online resources. One such example is illustrated in
Box 2.8.
a) Bottle-neck effect
Genetic Drift can happen in a variety of ways due to different events that
populations experiences in empirical situation. These have been referred as
part of ecological factors that disturb the population size (see 2.4.1).
Historically the world has experienced several pandemic diseases in the
past: e.g. Syphilis, Plague, leprosy, malaria, HIV infection, etc. which has
killed or wiped out bulk of the population. The natural geographical events
like earthquakes, tsunami etc. had killed vast majority of the populations.
Even the political and man interfering events like explosion of atomic bombs,
world wars etc. have affected the demographic size of the populations. Each
such event is followed by a drastic reduction in population sizes. In genetic
terms it means reduction in genetic diversity (at the time of the event), and
those survived will have different allelic profile or gene frequency and the
stability of a particular allele over generations depends on the demographic
structure of the population.
‘Breeding individuals’ part of the demographic structure of a population is

of particular genetic importance. They are capable of mating and producing
children. They will be a fraction (of the total population) who contribute to
the next generation or gene pool and is referred as ‘effective size’ (‘Ne’).
36
Hardy-Weinberg
BOX 2.8 Equilibrium
Simple exercises to understand the genetic drift
There are different ways to replicate to illustrate the random drift phenomena.
One such simple example could be the following:
Ø Start with a jar that contain with N number of blue, red, yellow balls.
Ø At the first step blindly or randomly take out (sat e.g., by hand) some
balls and put them in the second bottle.
Ø Then from the second bottle, take some balls (e.g., by hand) and put in
the third bottle.
If you have started with large sample (N) of mixed coloured balls you can
repeat the same. Otherwise, at the third/fourth bottle you can count how many
or red, blue and yellow balls. Compare the outcome with the original number
of red, blue and yellow balls at the start. They will differ from the original
number at the start. You may also find the absence of a particular colour at
the fourth (or nth) bottle.
In case of Genetic Drift, similar such random sampling of gene frequency
changes happen over successive generations in a small population. One can
search several such simple examples on the online resources on genetic drift
– bottleneck effect, founder effect etc.
Genetic drift can alter the ‘effective size’ of a population and change the
genetic diversity. After successive generations, the gene frequency in the
population will be significantly different from the gene frequency before
genetic drift. This is similar to the bottle neck, where the narrow neck of the
bottle restricts the flow and this event is referred as ‘bottle neck-effect’ in
population genetics. Such bottle neck effect resulting to sudden population
size reduction had been experienced by several human populations in the
past historical times affecting the genetic structure: genetic diversity, gene
frequency changes.
b) Founder effect
The word ‘founders’ refers to the ancestors or the earliest settlers who
colonised or founded the new population in alien territories. It could be an
historical adventure of ware fare, or exploration to a new island or new area
or it could also be due to chance factors like surviving from a sudden
calamities like ship wreck, etc. or it could be serial migration of people at
different timing to other places: in all the cases, a few founders start living
and establishing a new subpopulation.
In genetic scenario, the few founders represent a random sample of the genes
from the original population or gene pool from which they got separated. It
is possible that, some of the rare alleles that are in the large population, by
chance, may not be present in the founder individuals. It could be that,
among the founders, especially if the founders are related, by chance, some
of alleles may be of a higher frequency than the original population.
Therefore, in the new colony after generations the gene pool will have either
absence of the allele or higher frequency of the rare allele than when
compared to the original population.
37
Human Population Genetics c) Serial founder effect
It is possible that people or organisms migrate repeatedly over time or waves
of migration from a region to found new colonies. Such repeated waves of
migration at different time periods produce successive subpopulations or
gene pools whose genetic profile will be different. There appears to be waves
of out of Africa migration to other continents that had happened at different
time periods in the past, whose genetic signature can now be traced among
the extant populations in South Asia, Europe, and America etc. The
mitochondrial, X and Y chromosomal haplogroup distribution of continental
populations can be explained as a result of founder effect of out of Africa
hypothesis of human origins.
d) Empirical studies of founder effect in Man

The importance of ‘Founder effect’ as significant evolutionary factor has
been outlined by German evolutionary biologist Ernst Mayr (1942). Founder
effect is the “The establishment of a new population by a few original
founders (in an extreme case, by a single fertilized female) which carry
only a small fraction of the total genetic variation of the parental
population.» This is sampling effect especially the genetic composition and
evolution of the successive generations entirely depends upon the few
founders. A few examples illustrating the role of genetic drift in the gene
frequency changes are shown in Box 2.9
BOX 2.9
Studies on Genetic Drift
Ø Tristan da Cunha is an island; the few hundred individuals (<300)

living on the island are mostly the (15) descendants (8 males and 7
females) who had founded the island in 1816-1908. Three of the founders
were Asthma sufferers and there is high incidence of Asthma in the
population. In a study of the 9 Y-chromosome haplotypes of the island,
seven of them are traced to its 7 male founders.
Ø Amish population, USA: All most all the Amish population (~249K)
descended from about 200 founders from German during 18th century.
The population is endogamous, they show high frequency of genetic
disorders as a result of founder effect that include dwarfism, metabolic
disorders, unusual distribution of blood types, metabolic disorders etc.
Ø ‘Blue Fugates’ of Appalachian, Kentucky, USA: In 1800, Martin

Fugate and his wife settled in trouble some creek in Kentucky. They
carried recessive gene methemoglobinemia (met-H). Due to deficiency
of an enzyme diaphorase (NADH methemoglobin reductase) met-H
levels rise and this gives rise to reduced oxygen-carrying capacity. This
gives a tinge of blue skin of the homozygous condition. Isolation and
inbreeding has caused to increase of blue people which are traced to the
founders Fugates.
Ø India: In the northeast populations, some of them live in geographical

isolation, practice endogamy show unusual frequency of a few genetic
38
Hardy-Weinberg
traits which are expected to be due to genetic drift and founder effect. Equilibrium
Some of them include:
– Complete lack of A2, cde, K, pc, and AK2 genes, lack of isozyme
ALDH-1 (Roychoudhury and Nei 1997), a high prevalence (about
50%) of lactase malabsorption (Flatz 1987).
– Low frequency of AIBG*2 allele ( Juneja et al. 1989), high frequency

of G6PD deficiency in Naga (Seth and Seth 1971), absence of ‘Gd_’
variant in Adi and Hmar and high frequency of this variant in Bodos
(Saha et al. 1990).
– Continuing from classical genetic observations, unique and rare allele

frequency of microsatellite loci among the Adi subpopultions
(Krithika et al. 2005). High frequency of susceptibility of tuberculosis
in some clans of tribes, stomach cancer, high incidence of cardio
deaths etc.
– Absence of attached ear lobe among the Nandiwalas in Maharashtra.
– Population size reduction and allele frequency changes among

Ahmedias of Kashmir population.
2.4.1.3 Natural Selection

Charles Darwin (and Wallace) has described natural selection as one of the
important factor (key mechanism) of evolution. Natural selection happens where
there is differential rate of reproductive success among different genotypes
(underlying the phenotype, or trait or observed character). How selection operates
at the molecular (genome) level for example, especially change in gene frequency
considered, theoretically, in population genetics.
Due to differential reproductive success involving these variant of the trait, there
will be more offspring with the variant than those individuals with other variant
of the trait. In Darwinian sense ‘fitness’ (‘Darwinian Fitness’) refers to ability to
contribute successfully to the next generation. This is also referred as ‘adaptive
value’ or ‘selective value’. Therefore, if the differences of fitness are in a way
associated with the presence or absence of a particular allele (or gene) in the
individual’s genotype then selection operates at the genetic level.
When a gene is subjected to selection (or under selective pressure), its frequency
in the offspring is not the same as in the parents (or in the previous generation)
as parents with different genotypes pass on their genes unequally to the next
generation. This leads to change in gene frequency and consequently also of
genotype frequency, as a result of selection (of a particular gene). The theoretical
investigation of change in gene frequency of an allele under selection pressure is
more complex, than factors like mutation, migration. There could be different
situations under which selection can operate in a population and different
situations need to be incorporated in theoretical models. Here we will consider a
few of those situations (types of selection) in a more descriptive way, rather than
theoretically, which is beyond the scope of the present purpose.
39
Human Population Genetics Theoretically, selection is measured by ‘fitness’ (‘W’) or by selection coefficient
(‘s’). Fitness refers to ‘relative rate of survival’. The selection coefficient (‘s’) is
defined as ( 1-W ) and the value varies between 0 and 1. Once the fitness is
quantified and defined the different types of dominance can be taken as degrees
of dominance with respect to fitness (this is different from the dominance effect
of the gene). In general, most mutant genes are completely recessive compared
to the wild type as can be observed from phenotypic form of the trait. This does
not imply that the heterozygotes are equally fit when compared to homozygote.
Before we get to know the effect of selection on gene frequency, it is required to

know different types of selection and its fitness values. Some of the known
selection types are: no dominance, partial dominance, complete dominance, over
dominance. The fitness values for the four types are shown below (See Box
2.10). The change in gene frequency with respect the four types of selection
(with fitness values) are given in Box 2.11.
BOX 2.10
Types of dominance or degree of dominance and fitness
A2A2 A1A2 A1A1
a. No dominance: I———————I————————I
1–s 1 – 1/2s 1
A2A2 A1A2 A1A1
b. Partial dominance: I————————I———————I
1–s 1 – hs 1
A2A2 A1A2,A1A1
c. Complete dominance: I————————--———————I
1–s 1
A2A2 A1A1 A1A2
d. Over dominance: I————!——--——-——————I
1 – s2 1 – s1 1
a) Types of selection
Selection is a systematic force and operates in different ways. Selection takes
place when there is differential fitness of a heritable trait. Based on the effect on
the allele frequencies, the selection can be seen operating into three types.
Directional selection: occurs one extreme value or allele is selected. In case if
one of the allele of a variety of the trait has greater fitness and producing more
offspring of that allele or a variety, then the selection is said to be directional.
The effect of directional selection is fixation of allele with greater fitness and the
loss of the allele with least fitness. For example: well known cases come from
the parasitic world, especially resistance to antibiotics in case of some of the
vector-borne diseases. Initially as a result of antibiotic the parasite growth comes
down to zero, but the parasites develops some mutant or new variant which gets
resistance against the antibiotics or better fitness in the presence of antibiotics,
in due course, the less fit variant is replaced by new variant which can survive
against antibiotics. This can be illustrated as a shift in the mean of the character
40 of a distribution (See box 2.12).
Hardy-Weinberg
BOX 2.11: Change in gene frequency under selection Equilibrium
First we will consider the basic formulae for the change in gene frequency that is
achieved in one generation of selection. Under the similar notation that has been
used above for other factors (p = gene freq. of A1 and q = gene freq. of A2), the
below table shows the genotype frequencies under HWE before selection to the
allele for the three genotypes (first line).
........................................................................................................................
Genotypes
A1A1 A1A2 A2A2 Total
........................................................................................................................
Initial frequency p2 2pq q2 1
Coefficient of selection 0 0 s
Fitness 1 1 1–s
2 2
Genetic contribution p 2pq q (1—s) (1 – sq2)
........................................................................................................................
Here we consider selection acting on the recessive genotype A2A2 with a selection
coefficient: ‘s’ acting against it. This will have a differential fitness to the genotypes
that will be as given in the second line. By multiplying the initial frequency by the
fitness values gives the frequency of each genotype after selection. This is the third
line – the genetic contribution to allow to selection to operate over life cycle.
Therefore, after selection, there will be a loss of fitness that is proportional to an
amount (1 – sq2). From this we can calculate the frequency of A2 gametes produced
(frequency of A2 genes in the progeny). The new g.f. is (where p = (1 – q)
q1 = [q2 (1 – s ) + pq] / (1 – sq2)
= [q – sq2] / (1 – sq2)
The change in gene frequency ∆q, resulting from one generation of selection is
∆q = q1 – q = sq2 (1 — q) / (1 – sq2)
This tells us that the effect of selection on gene frequency depends not only on the
intensity of selection s, but also on the initial gene frequency (of the recessive allele).
Different type of selection
What we have considered above is in general selection with respect to recessive
allele q under selective pressure. But there are variety (or types) of selection that
can act on the allele frequency. Depending upon the type of selection the change in
gene frequency will consequently change. These are shown in the following table.
Initial freq. & fitness New gene frequency Change in gene frequency
of Genotypes due to selection at q
A1A1 A1A2 A2A2 q1 ∆q = q1 – q

p2 2pq q2
1. 1 1– ½ s 1– s (q – ½ sq – ½ sq2) / (1 – sq) – ½ sq (1—q) / ( 1– sq)
2. 1 1 – hs 1– s (q – hspq – sq2) / (1–2hspq–sq2) –spq[q + h(p-q)]/ (1–2hspq–sq2)
3. 1 1 1 – s (q – sq2) / (1 – sq2) – [sq2 (1—sq)]/ (1 – sq2)
4. 1–s 1–s 1(1–sq + sq2) / (1– s(1-q2) + [sq2 (1 - sq)]/ [1 – s(1 – q2)]
5. 1–s1 1 1– s2 (q – s2q2) / (1 – s1p2 – s2q2) + [pq(s1p – s2q)] / (1–s1p2 – s2q2)
Above the different types of dominance are:
1. No dominance, selection against A2 2. Partial dominance of A1: selection against A2
3. Complete dominance of A1: selection against A2
4. Complete dominance of A1: selection against A1
5. Over dominance: Selection against A1A1 and A2A2 (Applicable to any degree of dominance
with fitnesses expressed relative to A1A2) 41
Human Population Genetics Stabilizing selection: The extremes are selected in favour of the middle. In case
of stabilizing selection, the two extreme values of a trait or alleles will have
lower fitness than the intermediate value or the heterozygote alleles of a trait.
One of the well known examples includes birth weight. The average birth weight
of offspring ranges between 2500g (5.5pounds) to 4500g (10 pounds). Offspring
with weight less than 2500g are low birth weight and greater than 4500g are the
heavy babies and both have less chance of survival. As a result the selection
favours the offspring with the average birth weight. Stabilizing selection is also
the reason in case of height distribution in a population. This can be illustrated
as a change in mean values of the distribution (See Box 2.12)
BOX 2.12
Different types of selection. Change in gene frequency in
case of Stabilizing, Directional and disruptive (balancing)
selection
42
Balanced Selection: In case of balanced selection, the heterozygotes have higher Hardy-Weinberg
Equilibrium
fitness than either of the homozygotes. This is also called heterozygous advantage
or over-dominance. The best example is the sickle cell anaemia. In non-malarial
environment the homozygote state of the sickle cell anaemia will have low fitness
and as a result the allele gets lost in the population in due course of time. However,
in malarial environment, Homozygote sickle cell anaemic individuals have the
better fitness as equal to the normal homozygote individuals; as such both the
alleles will be maintained in the population. (See Box 2.12).
Disruptive selection: both the extreme value (alleles) of a trait gets selected. It is
one form of balanced selection. In case of disruptive selection, the extreme values
or the alleles (low and high) of a trait will have a higher fitness when compared
to the average value. As a result of disruptive selection the extreme values will
increase as against the average values of the trait. This can be explained as leading
to bimodal distribution (See Box 2.12).
b) Opportunity for natural selection

In general, to investigate natural selection in human populations is complex.
Since natural selection operates on fertility and mortality, it can help us to get an
overall idea of operation of natural selection. Indeed, Crow (1958) has formulated
an index (Crow’s Index) to examine the maximum intensity of (natural) selection
that is more applicable for human populations; the index is based on the
demographic components of fertility and mortality rates. According to Crow,
“there can be selection only if, through differential survival and fertility,
individuals of one generation are differentially represented by progeny in
succeeding generations.The extent to which this occurs is a measure of ‘total
selection intensity’. It sets an upper limit on the amount of genetically effective
selection.”
The total selection intensity (as defined by Crow) has two components: A fertility
component (If) and mortality (Im). The fertility and mortality patterns depend on
several factors that vary across populations such as age at marriage, menarche,
and survival to reach to fertility age, variation in fertility and age of death etc.
Likelihood of these occurring needs to be calculated based on age-sex structure.
The fertility and mortality also include embryonic development and birth; these
have been incorporated to make it more rigorous and efficient estimate by
Johnston and Kensinger (1971). More details of the Crow Index and the
relationship are given in Box 2.13.
The estimates of ‘total intensity of selection’ have been studied in wide diverse
populations. In Indian scenario, tribal populations show larger ‘Index of mortality
than fertility components. There is also an overall declines in Im and It among
urban communities as a result of socio-economic and public health facilities.
More details of the trends of the Crow’s Index in Indian populations are described
by Gautam (2009).
43
BOX 2.13
Index of opportunity for selection
Crow (1958) and Johnston & Kensinger (1971)
The total selection intensity (It), is computed based on
Im = index of opportunity for natural selection due to pre-reproductive
mortality (mortality from birth to reproductive age, i.e. below 15 years).
If = index of opportunity for natural selection due to fertility.
X = average number of live births per women who have completed their
reproductive life span (aged 45 years and above).
Vf = variance (average deviation from mean) of number of live births.
Pd = proportion of pre-reproductive deaths.
Ps = proportion of survivors from birth to reproductive ages.
The proportion of pre-reproductive deaths (Pd) is calculated from children
ever-born to mothers aged 45 years and above (who have completed their
fertility) and pre-reproductive deaths.
The proportions of survivors were calculated by subtracting Pd from 1:
It = Im + If/Ps
Im = Pd/Ps & Ps = 1/Pd
If = Vf /X2
The crow’s Index of opportunity for selection was modified by Johnston and
Kensinger (1971) to account for the survival and mortality component during
conception, before the birth of an infant.
This include Ime = the selection due to prenatal mortality, Ped = the probability
to die before birth,
Pb = the probability to survive till birth, Imc the index of total selection
due to postnatal mortality,
Pd = the probability to die before reaching reproductive age,
Ps = the likelihood to survive til reproductive age, If = selection due to
fertility,
V = varience due to fertility among women who had completed their
fertility,
X is the mean number of births, Pd and Ps are proportion of deaths and
survivors.
The modified total intensity index It is:
It = Ime + (Imc/Pb) + (If/Pb) Ps
Ime = Ped/Pb, Pb = 1 – Ped
Imc = Pd/Ps
Ps = (1 – Pd)
If = V/X2
44
2.4.1.4 Gene Flow Hardy-Weinberg
Equilibrium
a) Migration
Migration or gene flow is an important factor that can change the gene frequency.
Emigration or immigration of individuals between populations can alter or change
in the gene frequency. In genetic terms it is either loss of genetic diversity due to
emigration or increase of genetic diversity due to immigration of individuals.
There is loss of gene flow from a gene pool or gain of gene flow into a
subpopulation from other gene pool. The quantitative estimate of the effect of
migration in case of an allele at a single locus has been estimated by Bernstein
and it has been shown (Box 2.14).
BOX 2.14
Change in gene frequency due to migration (m) / gene flow or
genetic admixture
Suppose if migration is unidirectional from mainland to a nearby island and
is random, then suppose
‘m’ is the rate of migration per generation from mainland to island
a) Pi be the frequency of gene A in immigrating individuals
‘p0’ is the frequency of gene A in the island
b) The gene freq of A in the island after migration is
pam = mpi + ( 1 – m ) p0
‘m’
The change in gene freq in one generation is
A
pam – p0 = [ mpi + (1-m) p0] – p0 pi
A
= m (pi – p0) + p0 – p0 mpi
m = (pam –p0) / (pi – p0) Island pop

A=po
NB: This is based on Bernstein’s formula for an allele at a single locus
The effect of migration rate (m) on allele frequency in a population is the

proportion of differences of allele frequency in the island population (pi) before
and after migration (pam) to the difference between allele frequency in the migrant
population (p0) and the island population (pi). The above formula can be extended
for a multiple loci by using least square or maximum likelihood estimate
procedures. It can also be worked out based on gene identity method.
b) Genetic admixture
Gene flow can happen between two subpopulations through random mating or
admixture or marriages. The American Blacks, Anglo Indians, are examples of
genetic admixed populations. The Latin American countries are populated by
admixed populations contributed by native tribes, African, European and other
settlers. The estimates of admixture proportion can be estimated for a gene located
at a specific locus of interest or for a set of genetic markers located at different
loci. The above formula (Box 2.14) can be used to estimate the ‘m’ the admixture
45
Human Population Genetics in a hybrid population. It is also possible to estimate the admixture proportions
based on genetic distances and from principal component analysis (for multilocus
allele frequencies).
c) Barriers to gene flow

Human populations live over wide geographical regions forming local
subpopulations; these subpopulations are formed as a result of endogamy which
is promoted by geographical, cultural, linguistic, political and other factors. The
same factors form barriers for gene flow and restrict the admixture, intermarriages
etc. between the local populations. In India caste, geographical isolation, cultural,
linguistic, political factors play a major role in restricting the gene flow or
admixture or intermarriages between groups.
d) Theoretical Models of gene flow

These factors are important to consider estimating or modelling the gene flow
between populations. In population genetic point of view, there is a decrease in
genetic diversity with the increasing distance or geographical location of the
populations. This gives spatial pattern of gene frequency clines, which help us to
understand the geographic variation of genetic markers across populations and
regions.
Since gene flow can occur in different scenarios, there are a variety of theoretical
models to account for different situations of spatial gene exchange or flow. For
example, Sewall Wright has proposed ‘island’, ‘neighbourhood’ and ‘isolation
by distance’ models and ‘steppingstone’ model by Kimura and Weiss.
Island model: It is the simple situation similar to island population. Suppose

the population is distributed among a few close (equi distance) islands, each of
population size N. The people tend to marry within each of the islands and gene
flow is restricted, in the sense that there is equal immigration between islands,
hence ‘island model’. Suppose the mating takes place at random in each of such
island or insular populations. The gene frequency in each of the island will differ
with respect to total population (of all the islands). The theoretical results show
that the deviation in such island model is exactly the variance in allele frequency
among the islands. The number of homozygotes in the total population is always
larger than expected from HW proportions in that population. The result is known
as ‘Wahlund principle’. For a two-allele polymorphism, the genotypic proportions
in the total population are:
AA : p20 + V, Aa : 2p0q0 – 2V and aa: q20 + V.
These proportions are similar to those population practicing inbreeding with

inbreeding coefficient ‘F’ (F = V/p0q0). Where P0 is the gene frequency of allele
A and V is the variance of the gene frequency among the islands. “The change in
heterozygote frequency is twice the covariance among populations in the
frequency of the allele in the heterozygote, and this may be positive or negative.”
(Christiasen and Feldman, 1986). One other model proposed by Sewall Wright
is Neighbourhood model.
Steppingstone model: The island model is too realistic to realise, therefore other
models have been proposed which is more close to geographically structured
populations. Kimura and Weiss (1964) proposed the ‘stepping stone model’. In
46
‘one-step-linear (one dimensional) stepping stone model, the populations are Hardy-Weinberg
Equilibrium
arranged, rather in a linear fashion, on a long chain. The migration occurs between
the neighbouring populations. This situation allows the distant populations with
least migration between them are expected to behave differently than the
neighbouring populations that are expected to change the gene frequency of the
extreme populations as against the neighbouring populations. Kimura and Weiss
(1964) have shown that the correlation in gene frequencies ( r ) between demes
decreases approximately exponentially as a function of the number of steps ( x )
between deems.
This is expected to lead to clines in the gene frequency or geographical clines of

the allele frequency.
Isolation by distance model: This was proposed by Sewall Wright, which is in a

similar to the stepping stone model in a continuously distributed population.
2.4.1.5 Genetic Equilibrium

The evolutionary forces of mutation, selection, and drift may oppose each other
to create a dynamic equilibrium in which allele frequencies no longer change.
In a randomly mating population without selection or drift to change allele

frequencies, and without migration or mutation to introduce new alleles, the
Hardy-Weinberg genotype frequencies persist indefinitely. Such an idealized
population is in a state of genetic equilibrium. In reality, the situation is much
more complicated; selection and drift, migration and mutation are almost at work
changing the population’s genetic composition. However, these evolutionary
forces may act in contrary ways to create a dynamic equilibrium in which there
is no net change in allele frequencies. This type of equilibrium differs
fundamentally from the equilibrium of the ideal Hardy-Weinberg population. In
a dynamic equilibrium, the population simultaneously tends to change in opposite
directions, but these opposing tendencies cancel each other and bring the population
to a point of balance. In the ideal Hardy-Weinberg equilibrium, the population
does not change because there are no evolutionary forces at work. However,
opposing evolutionary forces can create a dynamic equilibrium within a population.
Box 2.15
Calculating Equilibrium Allele Frequencies with Balancing Selection
Genotypes: AA Aa aa
Relative fitnesses: 1–s 1 1–t
Frequencies: P2 2pq q2
Average-relative fitness: w̄ = P2 x (1–s) + 2pq x 1 + q2 x (1–t)
Frequency of A in the next
generation after selection: P1 = [P2 (1 – s) + (1/2) 2pq] / w̄ = p(1–sp) / w̄
Change in frequency
of A due to selection: ∆ p = P1 - p = pq(tq-sp) / w̄
At equilibrium, p∆ = 0 P = t / (s + t) and q = s / (s + t)
47
Human Population Genetics Balancing Selection
One type of dynamic equilibrium arises when selection favors the heterozygotes
at the expense of each type of homozygote in the population. In this situation,
called balancing selection or heterozygote advantage, one can assign the relative
fitness of the heterozygotes to be 1 and the relative fitness of the two types of
homozygotes to be less than 1:
Genotype: AA Aa Aa
Relative fitness 1– s 1 1– t
In this formulation, the terms 1 – s and 1-t contain selection coefficients that are
assumed to lie between 0 and 1. Thus, each of the homozygotes has a lower
fitness than the heterozygotes. The superiority of the heterozygotes is sometimes
referred to as ‘overdominance’.
In cases of heterozygote advantage, selection tends to eliminate both the A and

‘a’ alleles through its effects on the homozygotes, but it also preserves these
alleles through its effects on the heterozygotes. At some point these opposing
tendencies balance each other, and a dynamic equilibrium is established. To
determine the frequencies of the two alleles at the point of equilibrium, one must
derive an equation that describes the process of selection, and then solve this
equation for the allele frequencies when the opposing selective forces are in
balance that is, when the allele frequencies are no longer changing (Box 2.15).
At the balance point, the frequency of A is p = t/(s + t),

and the frequency of a is q = s/(s + t)
As an example, let’s suppose that the AA homozygotes are lethal (s = 1) and that
the aa homozygotes are 50 percent as fit as the heterozygotes (t = 0.5). Under
these assumptions, the population will establish a dynamic equilibrium when p
= 0.5/(0.5 + 1) = 1/3 and q = 1/(0.5 + 1) = 2/3.
Both alleles will be maintained at appreciable frequencies by selection in favour

of the heterozygotes – a condition known as a balanced polymorphism.
In humans, the disease sickle-cell anaemia is associated with a balanced

polymorphism. Individuals with this disease are homozygous for a mutant allele
of the â-globin gene, denoted Hbs, and they suffer from a severe form of anaemia
in which the haemoglobin molecules crystallize in the blood. This crystallization
causes the red blood cells to assume a characteristic sickle shape. Because sickle-
cell anaemia is usually fatal without medical treatment, the fitness of Hbs Hbs
homozygotes has historically been 0. However, in some parts of the world,
particularly in tropical Africa, the frequency of the Hbs allele is as high as 0.2.
With such harmful effects, why does the Hbs allele remain in the population at
all?
The answer is that there is moderate selection against homozygotes that carry
the wild-type allele HbA . These homozygotes that carry the wild-type allele HbA..
These homozygotes are less fit than the Hbs HbA heterozygotes because they are
more susceptible to infection by the parasites that cause malaria, a fitness-reducing
disease that is widespread in regions where the frequency of the HbS allele is
high.
48
We can schematize this situation by assigning relative fitness to each of the Hardy-Weinberg
Equilibrium
genotype of the â-globin gene:
Genotype: HbS HbS HbS HbA HbA HbA

Relative fitness: 1 – s 1 1–t
If one assumes that the equilibrium frequency of HbS is p = 0.1 – a typical value
in West Africa – and if one notes that s = 1 because the HbS HbS homozygotes
die, one can estimate the intensity of selection against the HbA HbA homozygotes
because of their greater susceptibility to malaria:
P = t/ (s + t)
0.1 = t/ (1+t)
t = (0.1)/(0.9) = 0.11
This result tells us that the HbA HbA homozygotes are about 11 percent less fit
than the HbS HbA heterozygotes. Thus, the selective inferiority of the HbS HbS
and HbA HbA homozygotes compared to the heterozygotes creates a balanced
polymorphism in which both alleles of the â-globin gene are maintained in the
population.
Various other mutant Hb alleles are found at appreciable frequencies in tropical

and subtropical regions of the world in which falciparum malaria is – or was –
endemic. It is plausible that these alleles have also been maintained in human
populations by balancing selection.
Mutation-Selection Balance
Another type of dynamic equilibrium is created when selection eliminates
deleterious alleles that are produced by recurrent mutation. For example, let’s
consider the case of a deleterious recessive allele a that is produced by mutation
of the wild-type allele A at rate u. A typical value for u is 3 X 10-6 mutations per
generation. Even though this rate is very low, over time, the mutant allele will
accumulate in the population, and, because it is recessive, it can be carried in
heterozygous condition without having any harmful effects. At some point,
however, the mutant allele will become frequent enough for aa homozygotes to
appear in the population, and these will be subject to the force of selection in
proportion to their frequency and the value of the selection coefficient s. Selection
against these homozygotes will counteract the force of mutation, which introduces
the mutant allele into the population.
If one assumes that the population mates randomly, and if one denotes the
frequency of A as p and that of a as q, then one can summarize the situation as
follows:
Mutation: Selection:
Produces a eliminates a
A→ a Genotype: AA Aa aa
rate = u Relative fitness: 1 1 1-s
Frequency: P2 2pq q2
49
Human Population Genetics Mutation introduces mutant alleles into the population at rate u, and selection
eliminates them at rate sq2
Harmful recessive allele

u Introduced by mutation
Population
sq2 Elimination by
Selection
Mutation-selection balance for a deleterious recessive allele with frequency q.

Genetic equilibrium is reached when the introduction of the allele into the
population by mutation at rate u is balanced by the elimination of the allele by
selection with intensity s against the recessive homozygotes.
When these two processes are in balance, a dynamic equilibrium will be

established. We can calculate the frequency of the mutant allele at the equilibrium
created by mutation – selection balance by equating the rate of mutation to the
rate of elimination by selection:
u = sq2
Thus, after solving for q, we obtain q= u/s
For a mutant allele that is lethal in homozygous condition, s = 1, and the

equilibrium frequency of the mutant allele is simply the square root of the mutation
rate. If one uses the value for u that was given above, then for a recessive lethal
allele the equilibrium frequency is q = 0.0017. If the mutant allele is not completely
lethal in homozygous condition, then the equilibrium frequency will be higher
than 0.0017 by a factor that depends on 1/ s . For example, if s is 0.1, then at
equilibrium the frequency of this slightly deleterious allele will be q=0.0055, or
3.2 times greater than the equilibrium frequency of a recessive lethal allele.
Studies with natural population of Drosopbila have indicated that lethal alleles
are less frequent that the preceding calculations predict. The discrepancy between
the observed and predicted frequencies has been attributed to partial dominance
of the mutant alleles-that is, these alleles are not completely recessive. Natural
selection appears to act against deleterious alleles in heterozygous condition as
well as in homozygous condition. Thus, the equilibrium frequencies of these
alleles are lower than one would otherwise predict. Selection that acts against
mutant alleles in homozygous or heterozygous condition are sometimes called
purifying selection.
Mutation-Drift Balance
The random genetic drift eliminates variability from a population. Without any
50 counteracting force, this process would eventually make all populations
completely homogeneous. However, mutation replenishes the variability that is Hardy-Weinberg
Equilibrium
lost by drift. At some point, the opposing forces of mutation and genetic drift
come into balance and a dynamic equilibrium is established. The genetic
variability can be quantified by calculating the frequency of heterozygotes in a
population- a statistic called the heterozygosity, which is symbolized by the letter
H. The frequency of homozygotes in a population- often called the homozygosity-
is equal to 1-H. Over time, genetic drift decreases H and increases 1-H, and
mutation does just the opposite as shown in the figure below (Box 2.16).
Let’s assume that each new mutation is selectively neutral. In a randomly mating
population of size N, the rate at which drift decreases H is ( )H. The rate at
which mutation increases H is proportional to the frequency of the homozygotes
in the population (1-H) and the probability that one of the two alleles in a particular
homozygote mutates to a different allele, thereby converting that homozygote
into a heterozygote. This probability is simply the mutation rate µ for each of the
two alleles in the homozygote; thus, the total probability of mutation converting
a particular homozygote into a heterozygote is 2µ. The rate at which mutation
increases H in a population is therefore equal to 2µ(1 - H).
Box2.16
Box 2.16
Mutation pressure
Introduces variation @ rate u)
Heterozygotes Homozygotes
Genetic Drift H
(eliminates variation)
When the opposing forces of mutation and drift come into balance, the population
will achieve an equilibrium level of variability denoted by H. This equilibrium
value of H can be estimated, by equating the rate at which mutation increases H
to the rate at which drift decreases it:
2µ(1 - H) = H
By solving for H, the equilibrium heterozygosity at the point of mutation-drift

balance is obtained as :
^
H = 4 Nµ / (4Nµ +1)
51
Human Population Genetics Thus, the equilibrium level of variability(as measured by the heterozygosity) is a
function of the population size and the mutation rate.
–6 ^
If one assumes that the mutation rate is µ = 1×10 , one can plot H for different
values of N. For N < 10,000, the equilibrium frequency of heterozygotes in the
population will be quite low; thus, drift dominates over mutation in small
populations. For N equal to 1/µ, the reciprocal of the mutation rate, the equilibrium
frequency of heterozygotes would be 0.8, and for even greater values of N, the
frequency of heterozygotes increases asymptotically towards 1. Thus, in large
populations, mutations dominate over drift; every mutational event creates a
new allele, and each new allele contributes to the heterozygosity because the
large size of the population protects the allele from being lost by random genetic
drift.
Values of H^ in natural populations vary among species. In the African cheetah,

for example, H^ is 1 percent or less among a sample of loci, suggesting that over
evolutionary time, population size in this species has been small. In humans, H ^
is estimated to be about 12 percent, suggesting that evolutionary time population
size has averaged about 30,000to 40,000 individuals. Estimates of population
size that are derived from heterozygosity data are typically much smaller than
estimates obtained from census data. The reason for this discrepancy is that the
estimates based on heterozygosity data are genetically effective population sizes-
sizes that take into account restrictions on mating and reproduction, as well as
temporal fluctuations in the number of mating individuals. The genetically
effective size of a population is almost less than the census size of a population.
(Source: Principles of Genetics (2006) by D. Peter Snustad and Michael J.

Simmons. John Wiley & Sons (Asia Edition) PP. 750-754.
2.5 SUMMARY
1) Understanding of Population genetics principles, requires the basic concepts
of Mendelian genetics: the result of segregation, the concept ‘gene’,
‘phenotype’, ‘genotype’, ‘dominant’ , ‘recessive’ traits, ‘allele’ etc. Parental
mating types and expected distribution of genotypes among the offspring.
2) Hardy-Weinberg equilibrium is the solution to an intriguing question: what

happens to gene frequency of a dominant character over generations in a
population. With three times more frequent than normal does this will
increase over generations?
3) HWE law states that under the absence of intervening factors, especially in
a large population, given random mating, no selection of any sort, no mutation
and absence of demographic factors like migration, differential fertility and
mortality etc., the allele frequency remain constant over generations. This
can be proved theoretically, easily, for a ‘biallelic locus and it can be extended
to multilocus as well.
4) The importance of HWE: it gives a methodology to estimate the allele

frequency in a population based on phenotypic/genotypic information of
the parental mating types. It helps us to investigate the relationship between
change in gene frequency with respect to mutation, migration, selection,
52
genetic drift etc. The entire investigation is the kernel of a branch of Hardy-Weinberg
Equilibrium
biomathematics or the new field: ‘population genetics’ and ‘quantitative
genetics’.
7) HWE is the bench mark of qualitative test to check whether a trait, an allele,
SNP, is in equilibrium. It tells how to distinguish between the effects of
evolutionary forces from the demographic factors.
8) Mutation is a non-systematic and random, but rate of mutation is site specific.

Mutations are more frequent at hot-spots and are rare at the ‘conserved
region’. The mitochondrial non-coding genome has a higher frequency of
mutations than the nuclear genome.
9) Genetic drift is a non-systematic force which can lead to significant changes

in gene frequency in a small population. If an allele is rare in a small
population, it can get lost or get fixed in the population over generations.
10) Founder effect is one form of genetic drift. The founders are a sample
(represent a fraction of the genetic diversity) of original populations. The
descendents of a few founders have the gene frequency that is dependent on
the genetic composition and genetic structure of the founders. It can also
happen as bottleneck effect, especially as a result of sudden population size
reduction in a population, due to reasons such as natural causes or man-
made causes or socio-cultural regulations. There could be serial founder
effect as a result of waves of migration at different times. The mitochondrial
investigation of human origins suggests that the human origins and migration
to other continents appears as a result of serial founder effect from Africa.
11) Natural selection is one of the complex systematic forces that can influence
significant changes in gene frequency. Selection can operate in multitude
ways and it is a slow process than to the effect of migration or admixture
etc.
12) Selection basically operates at differential fertility and mortality levels. It is

measured as ‘fitness’ the ability to leave offspring and refers to ‘relative
rate of survival’. It is measured by ‘selection coefficient’ (‘s’) which is a
function of fitness (W). The fitness or selection coefficient differs with
respect to the type of dominance: complete, partial, over etc.
13) The effect of ‘directional selection’ to shift the mean allele frequency towards
its extremes. Or it could be stabilizing selection that shifts the allele frequency
of extreme alleles as a result the heterozygote frequency will increase. Or it
could be disruptive selection where the extreme allele frequency increases
as against the heterozygote frequency.
14) Selection can also be measured based on demographic factors of fertility

and mortality trends. Crow’s Index of opportunity for selection measures
total selection intensity that a population can experience which depend on
two components, fertility and mortality.
15) Gene flow (migration/admixture) is a systematic factor which can bring

rapid changes in gene frequency within a short period. In general, human
populations follow a variety of restrictions or regulations that restrict gene
53
Human Population Genetics flow between and within populations. The barriers for gene flow could be because
of culture or due to geographical, political, religious and linguistic etc.
16) There are theoretical models to investigate the effect of spatial gene flow or
population structure between populations. Island model, stepping stone
model, neighbourhood model help us to investigate the spatial gene flow in
different situations of population structure.
Suggested Reading
Crow, J.F. and Kimura M. 1970. An Introduction to Population Genetics Theory.
New Jersey: Blackburn Press.
Li, C.C. 1976. First Course in Population Genetics. USA: Boxwood Press.
Cavalli Sforza L.L. and Bodmer W.F. 1971. The Genetics of Human Populations.
Sanfrancisco. USA: W.H. Freeman,
Falconer, D.S, 1980. Introduction to Quantitative Genetics. Second edition.
London and New York: Longman.
Christiansen, B, Freddy, and Feldman W Marcus. 1986. Population Genetics.
Victoria: Blackwell Scientific Publications (Australia) Pvt. Ltd.
Gautam, R.K (2009). Opportunity for natural selection among the Indian
population: secular trend, covariates and implications. J. Biosoc. Sci. 41:705-
745.
Kimura, M. and G.H, Weiss 1964. The steppingstone model of population
structure and the correlation with distance. Genetics. 49:561-576.
Majumder, PP. 1993. Human Population Genetics. A centennial tribute to JBS
Haldane. Ed. PP Majumder. New York: Plenum Press.
Malhotra, K.C. 1988. Statistical Methods in Human Population Genetics. Ed.
KC Malhotra. Calcutta: Eka Press.
Dobzhansky, T. 1951. Genetics and the Origin of Species. New York: Columbia
University Press.
Sample Questions
1) A total of 120 individuals were tested for M, N blood group and the observed
genotype frequencies of MM, MN and NN are 34, 62 and 24 respectively.
Calculate the gene (allele) frequencies?
2) If ‘ì’ is the mutation rate (‘ì’ = 10 – 5) per generation for a gene frequency of
A then how many generations are required to reduce the gene frequency by
a factor of ½.
3) What is Hardy-Weinberg equilibrium? Explain why HWE is important in
genetic of populations?
4) In case in a population the observed gene frequencies of a particular bi-
allelic locus are in HW equilibrium for the locus, does this imply the
population satisfies the assumptions of the HW equilibrium? Explain?
5) What is genetic drift and how it operates in populations? Explain with
54 Examples.
Hardy-Weinberg
UNIT 3 GENETIC POLYMORPHISM Equilibrium
Contents
3.1 Introduction
3.2 Balanced Polymorphism
3.3 Transient and Balanced Polymorphisms
3.4 Serological Markers
3.5 Biochemical Polymorphisms
3.6 Molecular Markers
3.6.1 Repetitive DNA Sequence Variants
3.6.2 Non- Repetitive DNA Sequence Variants
3.6.3 Lineage Markers
3.7 Tools for Studying Polymorphisms
3.8 Genetic Markers and Disease
3.9 Genetic Mapping of Disease Gene on Human Chromosome Using
Polymorphic Markers
3.10 Use of Polymorphic Markers in Forensic Testing
3.11 Use of Polymorphic Markers in Population Studies
3.12 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
Ø define the concept of genetic polymorphism;
Ø explain genetic polymorphism with respect to serological, biochemical and
molecular markers;
Ø explain the genetic markers in disease association; and
Ø discuss the use of polymorphic markers in population and forensic studies.
3.1 INTRODUCTION
Genetic polymorphism can be defined as the occurrence together in the same
population two or more than two alleles such that the frequency of rare allele is
always >1%, and is maintained in the population not merely by the recurrent
mutation. Polymorphism can be in a coding region (coding region means the
portion of DNA which code for a gene, it may be synonymous or non-
synonymous) or more commonly, in the noncoding regions (which does not code
for functional region), often vary by ethnicity. Basic information about the types,
frequencies and distribution of common polymorphisms are essential not only
for the understanding of pathological entities, but also to know our evolutionary
past and provide guidance about our biological future. The most common
polymorphism in our genome are single base pair sequence variation i.e. SNP
55
Human Population Genetics but other types like copy number changes, insertions, deletions, duplications
and rearrangements also occur. The methods to asses this diversity is variable.
Few examples of polymorphic markers are listed in table 3.1.
Table 3.1: Example of Genetic polymorphisms

Type of marker Year No. of loci Properties
Blood groups 1910-1960 ~20 May need fresh blood, rare antisera.
Genotype cannot always be inferred
from phenotype because of dominance.
No easy physical localization.
E l e c t r o p h o r e t i c 1960-1975 ~30 May need fresh serum, specialized

mobility variants of assays, no easy physical localization
serum proteins often limited polymorphisms
Human Leucocyte 1970 1 (multi locus One linked set highly informative. Can
Antigens (HLA) haplotype) only test for linkage to 6p21.3
DNA RFLPs 1975 >105 Two allele markers, maximum

(potentially) heterozygosity 0.5,initially required
Southern blotting, now PCR. Easy
physical localization
DNA VNTRs 1985- >104 Many alleles, highly informative can be

(minisatellites) (potentially) typed by southern blotting easy physical
localization. Tend to cluster near ends
of chromosomes.
DNA VNTRs 1989- 105 (potentially) Many alleles, highly informative

(microsatellites) Can be typed by automated multiplex
(di-,tri-, and PCR, easy physical localization.
tetranucleotide Distributed throughout genome
repeats)
DNA SNPs 1998- 106 (potentially) Less informative than microsatellites.

Can be typed on a very large scale by
automated equipment, without gel
electrophoresis, etc.
3.2 BALANCED POLYMORPHISM

When natural selection favors heterozygotes over both homozygotes, the result
is balanced polymorphism. It accounts for the persistence of an allele even though
it is deleterious when homozygous. Some of the examples are given below:
Sickle Cell Disease

It is an autosomal recessive disorder that causes anemia, joint pain, a swollen
spleen, and frequent, severe infections. It illustrates balanced polymorphism
because carriers are resistant to malaria, an infection by the parasite Plasmodium
falciparum that causes cycles of chills and fever. The parasite spends the first
stage of its life cycle in the salivary glands of the mosquito Anopheles gambiae.
When an infected mosquito bites a human, the malaria parasite enters the red
56
blood cells, which transport it to the liver. The red blood cells burst, releasing Genetic Polymorphism
the parasite throughout the body.
It is known since long that malaria is a quite common in the tropical regions of
Africa. Sickle shape red blood cells provide selective advantage as malarial
parasite cannot grow in these cells. Therefore, along with malaria the sickle cell
anemia also increased in these parts of Africa. The sickle cell disease is less
common in Caucasians due to the less frequency of malaria. This shows the
heterozygous advantage of sickle cell as it provides protective effect.
The rise of sickle cell disease goes hand in hand with the cultural development
with the advent of cultivation of crops gave a breeding ground to Anopheles
mosquitoes as the malaria rose the selective pressures gave rise to the change in
the shape of the RBCs from elliptical to sickle shaped and when it occurred in
homozygous condition the disease was caused otherwise it had selective
advantage. The spread of sickle cell disease is associated to the migratory events.
Africa by people migrating from Southern Arabia and India, or it may have arisen
by mutation directly in East Africa.
Settlements with large numbers of sickle cell carriers escaped devastating malaria.
They were therefore strong enough to clear even more land to grow food-and
support the disease-bearing mosquitoes. Even today, sickle cell disease is more
prevalent in agricultural societies than among people who hunt and gather their
food.
G6PD Deficiency
It is a sex-linked enzyme deficiency. It affects 400 million people throughout the
world. It results into hemolytic anemia which is life-threatening. It is under the
influence of certain environmental conditions like eating fava beans, inhaling
certain types of pollen, taking certain drugs, or catching certain infections. It has
been seen in Africa that hemizygous males and heterozygous males for this
enzyme deficiency are at less risk for malaria again revealing a selective advantage
for heterozygotes. Therefore, natural selection acts in two directions hence it
could be one of the example of balanced polymorphism.
3.3 TRANSIENT AND BALANCED

POLYMORPHISMS
Polymorphism occurs when two or more clearly different phenotypes exist in
the same population of a species-in other words, the occurrence of more than
one form or morph.
A transient polymorphism is one that is changing in frequency over time. In

transient polymorphism, one form is gradually being replaced by another. As the
name implies, it represents a temporary situation as a by-product of directional
natural selection.
The phenomenon of industrial melanism occurs in a number of moth species in

Europe and the United States. The British ecological geneticist, E. B.Ford, first
called attention to this phenomenon as a way of demonstrating the effect of
natural selection in nature (as opposed to artificial selection experiments which
have long enjoyed success in the lab). Ford noted that a light colored moth species, 57
Human Population Genetics Biston betularia, occasionally undergoes mutation at a single locus to produce a
dark or melanic individual. Since the mutant allele is dominant, any gamete
containing this mutant will produce a melanic individual upon syngamy. The
first melanic specimen in this species was found in a collection from Manchester,
England dated 1848, but by 1895 about 95% of all collected specimens were
dark morphs, referred to as the form carbonaria. In a series of 12 observations
and mark-recapture experiments during the 1950s, H. B. D. Kettlewell
demonstrated that the two forms (light and dark) were differentially preyed upon
by birds. He found that the birds selectively caught and ate more individuals of
the form that did not match its background as compared to the one that was
masked. In industrialized areas of England where the substrate (walls and tree
trunks) upon which the moths rested were darkened by pollutants in the smoke
poured out by factories, the carbonaria form possessed a selective advantage.
Rural areas, unaffected by pollutants, afforded the light form an adaptive
advantage. The environmental change brought on by the industrial revolution
did not produce the carbonaria form (which presumably appeared from time to
time due to recurrent mutation); it only protected the dark moths from bird
predation (the agent of natural selection). The fact that the light form still exists
in rare numbers in industrialized areas testifies to the amount of time selection
requires to eliminate a recessive allele.
Mendilian Population
A population is a group of individuals who share a common gene pool where the
characters are transmitted in a Mendelian fashion from one generation to the
next generation. A group of individuals within which marriages are performed is
called a Mendelian population. In a given Mendelian population, which is under
Hardy-Weinberg equilibrium, the resultant genotype and phenotype frequencies
are more or less permanently established.
3.4 SEROLOGICAL MARKERS

Blood groups are the best cited examples of serological markers. Both ABO and
Rh are quite important serological markers as they can be used to study population
diversity. These blood groups cause newborn hemolytic diseases. They also have
a role in blood transfusion and also solid organ transplantation. They follow
mendalian inheritance. ABO blood groups were discovered by Landsteiner in
1900 and are cited as a best example of triallelic inheritance. Blood groups can
be tested by using antisera and red blood cells using simple agglutination
techniques. Presently more advanced molecular techniques are also used.
The ranges of phenotypes in humans are a direct result of genetic variations

which act together with environmental and behavioral factors to produce diversity.
The identification of gene polymorphisms, which control the blood group antigen
expression, contributes to the understanding of the biological significance of
blood group systems. In addition to assisting in the characterization of allelic
variations, the identification of gene polymorphisms allows us to estimate the
processes involved in the formation of different populations (the founder effect,
genetic drift, migration, etc.). Thus, blood group gene polymorphisms are valuable
predictors of genomic ethnic ancestry.
58
Genetic Polymorphism
3.5 BIOCHEMICAL POLYMORPHISMS
There is marked difference between individuals on the basis of biochemical
markers like G6PD, human enzymes and proteins etc. This has been explained
in the above section. However, here we would like to throw some light on the
molecular basis of G6PD variants.
Molecular Basis of G6PD Variants

The G6PD gene, located on chromosome Xq28 region, is 18 Kb long consisting
of 13 exons transcribed to a 2.269 Kb messenger RNA with 1.545 Kb of coding
regions. The commonest variant in South China, G6PD Canton, has been
sequenced and was found to be due to a mutation at nucleotide (nt) position
1376 of cDNA, G to T, resulting in a missense mutation in amino acid position
459, Arg to Leu. With improved DNA technology, the whole cDNA sequence
can be amplified and screened for mutation directly. PCR technique and restriction
analysis has been used.
World Incidence and Distribution of G6PD Deficiency

G6PD deficiency in male subjects can be detected easily by a number of screening
tests. The simplest one is the fluorescent spot test developed by Beutler and
Mitchell which relied on the fluorescence of NADPH, generated by an adequate
amount of G6PD enzyme. This test can also be done on blood sample dried on
filter paper similar to the Guthrie cards. In Hong Kong, the routine screening of
newborns have included test for G6PD deficiency.
3.6 MOLECULAR MARKERS

Although ∼99% DNA is known to be similar between individuals but still
sequence differences exist between individuals in non-coding regions of the
genome and such polymorphic regions are useful for various kinds of analyses
in population genetic studies. A genetic marker can be a nucleotide sequence of
variable length, varying from a single base pair to several hundred base pairs.
Selection of markers for any study is dictated by the nature and purpose of the
study. The more commonly used markers in population genetics studies can
broadly be grouped as follows:
3.6.1 Repetitive DNA Sequence Variants

Tandem Repeats
Besides the interspersed repeats (SINEs and LINES), Tandem repeats are the
other kind of repeated elements found in the genome. These are highly variable
tandemly repeated arrays of 2 or more base pair core units in the non-coding
regions of the genome and are located adjacent to each other. On the basis of size
of the core unit, they are categorised into minisatellites (10-60 bp1 ), Short Tandem
Repeats (STRs) or microsatellites (<10 bp). When the number of nucleotides in
the core unit is not known or is variable then it is called Variable Number Tandem
Repeats (VNTRs).
Insertion/ Deletion Polymorphisms

An InDel or Insertion-Deletion polymorphism refers to insertion or deletion of a
DNA sequence of variable length in the genome. The concerned DNA sequence 59
Human Population Genetics may vary in length from a single nucleotide to several hundred nucleotides. They
are widely spread across the genome and constitute around 1.5 million of more
than 10 million polymorphisms known in humans.
Alu InDels – Alu Insertion/ Deletion polymorphisms (Alu InDels) involve Alu
sequences that are characterized by the cleavage action of AluI restriction
endonuclease.
Properties of Alu sequences such as their known ancestral state, identity by
descent, wide occurrence and stability make them ideal markers for human
evolutionary and diversity studies.
3.6.2 Non- Repetitive DNA Sequence Variants

Single Nucleotide Polymorphisms (SNPs or Snips)
SNP or Single Nucleotide Polymorphism is a single nucleotide (base pair) change
in a DNA sequence. As with all polymorphisms, for an alteration to be considered
a snip it must be present in ≥ 1% of the population being considered. They make
up about 90% of all the human gene sequence variation. SNPs may be present in
coding regions (exons) or non-coding regions (introns) or intergenic regions.
Restriction Fragment Length Polymorphisms (RFLPs) are the characteristic
pattern of fragments of DNA produced when a DNA sequence is cleaved by
specific enzymes belonging to endonuclease class of enzymes. The property of
these enzymes that enables them to cleave DNA segment only at specific locations
known as restriction sites have led to their use in detecting genetic differences
on the basis of absence or presence of restriction sites.
3.6.3 Lineage Markers

Mitochondrial Markers
Maternally inherited mitochondrial genome consists of multiple copies of circular
mitochondrial DNA or mtDNA. Markers present on this haploid genome are
primarily used for tracing maternal ancestral lineage(s) in populations because
of their uniparental inheritance.
Y-chromosomal Markers
Like mtDNA, Y- chromosome has a uniparental inheritance but in the male line
and can thus be used for tracing paternal ancestral lineages. In absence of
recombination, Y-chromosome is more or less transmitted unchanged from one
generation to next and the few changes that may occur usually do not have any
effect as around 98% of the DNA is in non-coding region.
Hardy-Weinberg equilibrium
The Hardy-Weinberg equilibrium predicts that in the absence of evolutionary
forces, both allelic and genotypic frequencies remain constant in a population
and that if the equilibrium is disturbed a new equilibrium will be reached within
one generation based on the allelic frequencies of the remaining population. The
conditions that must be met for the predictions of the Hardy-Weinberg equilibrium
to be valid are described below:
1) Random mating: Mating patterns must randomly reflect the entire breeding
population, with no dependence on genotype or closeness of relationship
60 (either positive or negative).
2) No sex bias in allelic frequencies: The distribution of alleles must be the Genetic Polymorphism
same in both sexes.
3) All genotypes equally viable and fertile: There must not be any selective
advantages or disadvantages. This is seldom true in a real population, and
often must be taken into account in terms of evolutionary pressures.
4) Mutation rate too low to alter ratios: The basic assumption is that alleles are
stable through many generations and are not altered or degraded significantly
by mutation. In practice this is generally not a serious problem.
5) Closed population (no in or out migration): The “population” that is being

considered must be a constant one. Introduction of new genes into the
breeding pool or loss of genes from the breeding pool by migration between
“populations” can distort trends.
6) Population must be large: The population must be large enough so that there
are no confounding effects due to genetic drift (random events altering allelic
frequencies by pure chance) or due to “founder” effects, where a recessive
gene becomes fixed in a population because too many of its members are
descendants of a single individual.
The Hardy-Weinberg law can also be applied to multiple alleles and X-linked
alleles. The genotypic frequencies expected under Hardy-Weinberg equilibrium
will differ according to the situation.
3.7 TOOLS FOR STUDYING POLYMORPHISMS

Both conventional and advanced techniques are used to study polymorphisms.
Conventional techniques are blood groups by carrying out simple agglutination
techniques or protein electrophoresis for studying the protein polymorphisms
etc. Under advanced techniques are the tools for studying molecular markers,
and the foremost requirement for carrying out molecular analysis of any kind is
the availability of the genetic material. As mentioned earlier, DNA is the focal
point of human diversity and disease-association studies by virtue of the fact
that it is the blueprint of our existence. There are several techniques for isolating
DNA such as manual methods (like Phenol Chloroform, Salting-out) and kits.
The technique of DNA isolation or extraction varies depending on the starting
material, but, it is the technique of PCR which is the most useful for DNA analysis.
Polymerase Chain Reaction (PCR): It involves cycling of DNA sample through

a series of heating and cooling cycles with the required raw materials and enzymes
to achieve its exponential amplification. The technique has come a long way
since its invention. Instead of having to manually maintain the heating and cooling
cycles, automated thermal cyclers are now available; and instead of having to
add fresh polymerase (earlier derived from E. coli) after every cycle because of
its denaturation due to heating, thermally stable DNA polymerases such as Taq
DNA Polymerase are now made use of.
Amplification of DNA by PCR has found applications in a variety of fields ranging

from forensics to archaeology; study of variation and evolution to mutation
detection; gene mapping and cloning and DNA sequencing to epidemiology
among several others. 61
Human Population Genetics Restriction Digestion: It is the method of cutting DNA sequences into fragments
using restriction endonucleases or enzymes that cut at specific recognition sites.
This generates DNA fragments of varying lengths producing a variation pattern
known as Restriction Fragment Length Polymorphisms (RFLPs). The variation
may be produced in response to absence or presence of particular SNP(s) or an
insertion or deletion event in that region and is recognised in the form of banding
pattern. Resulting fragments are separated according to molecular size using gel
electrophoresis. There are several classes of endonucleases- Type I, Type II, Type
III and Type IV but the most commonly used restriction enzymes are of type II
and they cleave DNA fragment at specific sites within or close to the recognition
sequence. Most of these enzymes cut palindromic sequences.
The technique is useful in detection of mutations/ SNPs. It is also used to detect

VNTRs. The technique has been widely used for constructing physical maps of
the genome, genetic linkage maps; in forensic testing; and in epidemiological
and evolutionary studies.
Electrophoresis: It is one of the few techniques that has been in use since the
beginning of study of classical genetic markers and is still in use for molecular
markers. It is the method of separating macromolecules (both proteins and nucleic
acids) on the basis of size, electric charge or other physical properties under the
influence of electric field.
Sequencing: DNA sequencing refers to establishing the exact sequential

arrangement of bases in a stretch of DNA. Knowledge of exact sequence of
bases in a gene is crucial especially in ascertaining the function of genes. This is
also important as the disease-causing alterations in the genes can then be identified.
The selection of technique and markers depends upon the purpose of study. In
the following section we have discussed the uses of polymorphic markers.
Uses of polymorphisms: All the markers listed in table 3.1 can be used for
population diversity studies. Now a days most extensively studied markers are
Single nucleotide polymorphisms. Genomics and specially SNP research can be
used to improve health care through gene therapy, to yield new targets for drug
discovery, to renew the process of drug development and to discover new
diagnostics.
3.8 GENETIC MARKERS AND DISEASE

Understanding the genetic basis of complex human diseases (like hypertension,
cardiovascular disease, diabetes etc.) has been increasingly emphasized as a means
of achieving insight into disease pathogenesis, with the ultimate goal of improving
preventive strategies, diagnostic tools, and therapies. Genetic approaches to
complex disorders thus offer great potential to improve our understanding of
their pathophysiology, but they also offer significant challenges. These can be
studied either using linkage analysis. In linkage analysis we use families and try
to find out which polymorphic marker is near to the disease gene and then try to
map the gene on the human genome. The other approach is where we study
populations of both types of individuals. One would be those suffering with a
disease and the other would be who are not suffering with the disease. We take
different polymorphic markers and study in these two sets of samples. Then we
62
compare both the groups and if both the groups differ significantly at these markers Genetic Polymorphism
we propose that these markers may be associated with the disease.
Association studies can be a very powerful approach for finding genetic

determinants of a complex disorder. It has been suggested that if hundreds of
thousands of single nucleotide polymorphisms (SNPs) were identified across
the genome, then it would be possible to perform genome-wide association studies
to identify the regions of linkage disequilibrium around disease susceptibility
genes. In addition, they noted that much smaller sample sizes would be required
to detect association than to detect linkage. The SNP Consortium is rapidly
identifying single nucleotide polymorphisms, and within next several years,
genome-wide association studies may become a reality.
These association studies can result into positive association or negative

association. Some time they result into false positive or false negative results.
The following general guidelines, summarized in Table 3.2, may be useful for
genetic association studies. First, are the candidate gene(s) under study should
be biologically reasonable. Several factors can determine the appropriateness of
a candidate gene. If human genetic linkage studies have identified a chromosomal
region linked to a disease, or if an animal model for a disease is influenced by a
particular gene or syntenic chromosomal region, positional candidate genes in
such genomic regions warrant strong consideration. In addition, the biologic
plausibility of a candidate gene for involvement in disease pathogenesis is
important. However, obvious limitations of this candidate approach are the large
number of potential candidate genes for complex diseases and the reality that
only known genes can be investigated. Although candidate genes can be selected
for study on this basis, they should not be ruled out on the basis of our current
understanding of disease pathophysiology- important new insights may be missed
if potential candidate genes must fit into current pathophysiologic models.
Table 3.2: Evaluation of candidate gene case-control association studies
Issue Key Questions Possible Solutions
Selection Is candidate gene Demonstration of biologically

of candidate biologically reasonable? functional effect
Gene polymor- Is the candidate gene a Within linked region in man or

phism positional candidate? systemic from animal model
Population Are cases and controls Matching on ethnicity

stratification matched? Family-based association designs
Negative results with multiple
unlinked markers
Hardy-Weinberg Is control group in H-W Calculation of H-W equilibrium

(H-W) equilibrium equilibrium? with goodness-of-fit test (2 alleles)
or simulation (multiple alleles)
Multiple How many alleles were Bonferroni correction

comparisons tested?
How many genetic loci Estimation of empirical P values

were tested?
63
Human Population Genetics A second criterion in evaluation of case-control association studies is the careful
selection of cases and control subjects. Do the case subjects meet appropriate
criteria for disease affection? Are control subjects free from symptoms of disease,
associated intermediate phenotypes, and potential confounders? Have control
subjects been exposed to relevant environmental influences involved in disease
pathogenesis while remaining clearly unaffected? Were the cases and controls
matched on demographic and environmental factors? Was consideration of
population stratification included, either by attempting to match ethnicity or by
typing unlinked markers.
A third criterion in the evaluation of case-control studies is assessment of Hardy-

Weinberg equilibrium in the markers studied within the control group. Hardy-
Weinberg equilibrium indicates that the genotype frequencies can be determined
directly from the allele frequencies; failure to demonstrate Hardy-Weinberg
equilibrium could result from genotyping errors, inbreeding, genetic drift,
mutation, or population substructure. Hardy-Weinberg equilibrium can be readily
assessed with a goodness-of-fit chi square test for biallelic markers; for markers
with multiple alleles (such as short-tandem repeat markers), more accurate
determination of Hardy-Weinberg equilibrium can be obtained with Markov
Chain Monte Carlo methods. Significant deviations from the expected proportions
of homozygote and heterozygote classes in a population of case subjects may be
caused by association with the disease allele. Lack of consistency with Hardy-
Weinberg equilibrium among control subjects should prompt investigation for
potential complications, including genotyping errors and population stratification.
A final criterion for evaluation of a case-control study is correction for multiple
comparisons. This remains a problematic topic requiring additional statistical
genetic research. However, an effort to correct for spurious associations, which
can result from testing a large number of alleles, is warranted. The multiple
comparison issue is especially problematic with markers that have multiple alleles
like short-tandem repeat polymorphisms; the conservative Bonferroni approach
to use a corrected significance value calculated by multiplication of the observed
P value by the number of alleles tested. Bonferroni corrections for the total number
of alleles at all loci are probably too conservative because the alleles at one locus
are not independent of each other and closely linked loci are probably not
independent either. A less conservative but more computationally intensive
approach is to estimate empirical significance values using simulation approaches.
Genome Wide Studies

Unlike the direct approach of case-control association with candidate genes,
genome scanning (screening) is an indirect strategy that does not rely on
conjecture. Basically, either affected individuals, usually siblings, from a number
of families or families with two or more affected individuals are genotyped with
polymorphic DNA markers that cover the entire chromosome complement. A
set of about 400 short tandem repeat polymorphic markers that are spaced at
about every 10cM is used for most genome scans. This level of resolution has
been enhanced with the assembly of about 3000 simple sequence repeat
polymorphic markers that are about 1.5cM apart. Single –nucleotide polymorphic
sites (SNPs) are preferred for genome scans because they are uniformly distributed
about every 300 bases throughout the genome and easily identified with automated
equipment. Eventually, sets of SNPs will supersedes short tandem repeat
polymorphic sequence marker systems.
64
Furthermore, major landmark attempts that have also been made to study various Genetic Polymorphism
aspects of human genome, and few are listed below.
Human Genome Project (HGP): A National Institute of Health (NIH, US)

initiative started in 1990, HGP was a multinational collaborative project aimed
at identifying all the genes in the human DNA and determining the sequence of
about 3 billion nucleotide pairs that constitute the human DNA to understand
the species’ genetic makeup.
First draft was released in 2001 followed by the complete draft in 2003. Some of
the main findings from the draft sequence are as follows:
• Total number of genes was estimated at 30, 000.
• The average gene was found to consist of 3000 bp but sizes vary greatly.
• Repeated sequences that do not code for proteins (“junk DNA”) make up at
least 50% of the human genome.
• About 1.4 million locations with SNPs were identified.
Findings from HGP are already having profound impact on diverse areas of
research including molecular medicine (improved diagnosis of disease, earlier
detection of genetic predispositions to disease, rational drug design etc.),
bioarchaeology, anthropology, evolution and human migration, DNA forensics
(identification), agriculture, livestock breeding etc.
Human Genome Diversity Project (HGDP): HGDP was formally organised in

1993 under Stanford University’s Morrison Institute, and was aimed at
understanding the diversity patterns worldwide, the contributing factors and the
implications of the observed diversity patterns. Findings from the project could
also shed light on the origins and migration patterns of the entire human species.
HGDP could also aid in understanding the role played by environmental factors
in complex human diseases.
HapMap Project: The International HapMap Consortium is an international

collaborative venture between Japan, the United Kingdom, Canada, China,
Nigeria, and the United States aimed at developing haplotype map of the human
genome in a bid to identify genetic determinants of complex diseases. The
information made available through the HapMap project is helping researchers
find genes that affect health, disease, and individual responses to medications
and environmental factors.
Indian Genome Variation (IGV): IGV was the first large scale effort to document
and understand the genomic structure of enormously varied Indian populations.
The study found high degree of genetic differentiation among the different ethnic
groups.
Genetic Testing and Counseling

Frequently the question may arise as to whether the patient has a certain disease
for which there is a genetic basis. Often among the 10,000 conditions for which
a genetic basis has been identified, the diagnosis can be made from evaluation of
personal and family history, physical examination, and conventional laboratory
tests. A useful database for identifying these conditions is available on Online
Mendelian Inheritance in Man (OMIM) (www.ncbi.nlm.nih.gov/omim). This
65
Human Population Genetics catalog is updated regularly and can be searched using multiple terms. The entries
provide information about the clinical signs as well as the genetic basis for the
condition, if known, including mutations that have been found to cause the
condition. To determine whether genetic testing is available for a given condition
and to find a laboratory, a useful link is GeneTests, a free online service
(www.genetests.org). The entries in this catalog indicate the test menus and contact
information for the laboratories, as well as whether the testing is provided on a
routine or research basis. A very useful adjunct in the GeneTests Website is
GeneReviews, which provides succinct summaries about many genetic conditions
and the ways the genetic testing can be used for diagnosing these conditions,
including prediction of natural history.
The clinician is likely to encounter many situations in which a genetic test may
be useful. Sometimes genetic testing is required from diagnosis when it cannot
be made by clinical criteria alone. The fragile X syndrome is the most common
genetic form of mental retardation. Although the diagnosis may be suggested by
the presence of the characteristic signs—large ears, protruding chin, and large
testes—the only way to diagnose fragile X is by genetic testing. For the various
forms of spinocerebellar ataxia, there is considerable overlap. Yet, these can be
readily distinguished by their specific mutations. Patients with atypical forms of
certain diseases may have a negative gold standard test, but positive genetic test.
For most patients with cystic fibrosis, the diagnosis can usually be made by a
sweat chloride test. However, a number of individuals have been described with
pulmonary disease suggestive of this condition for whom the sweat chloride test
is normal. For these patients, the diagnosis has been based on observation of
mutations in both copies of their CFTR genes.
For some conditions, the signs of disease may not yet have developed, yet on the
basis of one’s family history, one may want to know about the risk of developing
disease. This is true for the person whose parent(s) may have died from
Huntington’s disease, a progressive neurodegenerative disease or for the person
whose mother and sister may have died from breast or ovarian cancer, suggesting
a heritable risk. For these individuals, a positive genetic test result will indicate
an increased, although not necessarily absolute, risk for developing the disease.
Genetic testing is used for assessing reproductive risks—by testing the parents
for carrier status and by testing the fetus. Individuals with a positive family history
of genetic disease (usually autosomal recessive or X-linked) or who come from
ethnic groups with an increased prevalence of autosomal recessive or X-linked
diseases are candidates for carrier screening. Currently, carrier screening for cystic
fibrosis, fragile X syndrome, and spinal muscular atrophy is recommended in
the United States. For people of Mediterranean, African, or South Asian ancestry,
hemoglobinopathy screening is recommended. For individuals of Ashkenazi
Jewish ancestry, screening for Tay-Sachs disease, Canavan disease, cystic fibrosis,
Gaucher disease, Bloom syndrome, Fanconi anemia, Niemann-Pick disease,
familial dysau-tonomia, maple syrup urine disease, glycogen storage disease,
and familial hyperinsulinism is available. An individual who is a carrier for a
certain condition may choose not to marry another individual who is a carrier for
the same condition. Alternatively, if a carrier couple is identified, they may choose
to have prenatal diagnosis to determine whether their fetus is affected with this
condition. This can be performed either at 10-11 weeks using the procedure of
chorionic villus sampling where a bit of placenta is obtained under ultrasound
66
guidance. As another option, an amniocentesis can be performed at 15-18 weeks Genetic Polymorphism
of pregnancy to obtain cells from the amniotic fluid. These couples might also
choose to have preimplantation genetic diagnosis with selection implantation
of only those embryos that are deemed unaffected.
Not all genetic testing involves looking for heritable mutations. Sometimes it is
used to look for genetic alterations that are confined to a specific population of
cells. These alterations may cause certain cells to become cancerous, or if
cancerous, to progress to a more aggressive stage. Genetic testing can be used to
identify chromosomal translocations between two non-homologous chromosomal
segments and in the process diagnose a specific form of leukemia. For example,
the translocation between chromosomes 1 and 19 in leukemic cells is diagnostic
of the acute promyelocytic form of this disease and the translocation between
chromosomes 9 and 22 is diagnostic of the chronic myelogenous form. The
expression patterns of RNA transcribed from many genes can be assessed to
predict the natural history of the disease. This approach has been used to predict
breast cancer outcome and whether more or less aggressive therapies should be
used to treat patients.
Individuals might also have genetic tests of identity. These might be voluntary
and selected to test specific questions, such as whether they are members of a
known patrilineal lineage, such a people with a specific surname. These tests
analyze a series of polymorphic genetic markers on the Y chromosome. On the
basis of the general pattern of markers, or “haplogroup,” they may be told of the
geographic region where their Y chromosome originated. According to the number
of markers that match with people who are suspected to be of the same lineage,
individuals may be advised about the common ancestors or other people in that
lineage. Such testing is also possible for matrilineal lineages by testing
mitochondrial DNA markers.
3.9 GENETIC MAPPING OF DISEASE GENE ON

HUMAN CHROMOSOME USING
POLYMORPHIC MARKERS
In genetic mapping the diseased gene polymorphic markers play a very important
role. These markers could be short tandem repeats, variable number of tandem
repeats, blood groups, restriction fragment length polymorphism etc. Mapping
can be done in a step wise manner.
Collect all the pedigrees where the disease is found. Analyse all the members
against various polymorphisms and perform linkage analysis.
Linkage study entails collecting blood cells from members of several two – and
three – generation families or from individuals of a large multiple generation
family with a specific genetic disorder. The blood can be cultured and cell lines
can be maintained large number of polymorphic markers (probes), representing
sites from all parts of all autosomes, are used. A two –point (two – locus) LOD
score is calculated for each polymorphic locus and the site of the genetic disease
from all informative parent offspring combinations and finally the linkage is
established. However, genotyping errors can give –ve or +ve LOD score. Hence
perfect genotyping is must to get the correct results.
67
3.10 USE OF POLYMORPHIC MARKERS IN
FORENSIC TESTING
Polymorphic markers have great utility in personal identification. As mentioned
above no two individuals are alike. These differences are at both phenotypic and
genotypic levels. The genetic differences can be identified by testing these
markers. This testing is provided by commercial firms that market directly to
consumers. Identity genetic analysis may also be involuntary and used for paternity
testing of children or fetuses or for identification of forensic samples in murder,
assault or rape cases, in which the perpetrator of the crime left a tissue sample of
blood, semen, hair, or other tissue type from which DNA can be extracted and
the test can be performed. However, it must be kept in mind that there are ethnic
differences in the distribution of these markers. Hence every population should
have its own genetic profile.
3.11 USE OF POLYMORPHIC MARKERS IN

POPULATION STUDIES
Population Diversity Studies
Human genome varies from individual to individual and therefore no two
individuals look alike. This was noted long back. Historically, individual variation
was studied on the basis of conventional somatoscopic markers. However, with
the advancement of technology various genetic markers were discovered and
the gene frequency data for studying the evolution of human races was analyzed
using these markers. Initially, the classical serological and biochemical markers
have played important roles in various types of human population genetic studies.
One of the problems that limited their practical utility results from the limited
number of possible genotypes at each of such loci. The discovery of hyper variable
DNA loci offers the opportunity to ameliorate this problem. It was later realized
that comparison of gene frequencies for one or two loci are not reliable since
each locus has a different geographical distribution, hence the differences observed
may be because of chance factor. Only when a large number of loci are used, the
genetic relationship among populations could be drawn successfully. Recent
analysis based upon polymorphic markers reveal that inter and intragroup genetic
variation may be of a lesser magnitude and may not be of significance if proper
markers are not selected and more so if statistical tools used are not highly
powerful. However, it is important to record population variation because it is
helpful to know the various mechanisms involved in causing variation and it
further enhances our knowledge about the molecular basis of disease
susceptibility.
3.12 SUMMARY
It is difficult to attribute any functional significance to genetic polymorphisms.
However, the non-coding sequences of the genes which are located far away
from the functional region of the gene may affect the function of the gene.
However, these sequences are otherwise useful in studying population diversity,
disease gene mapping, forensic investigations etc. Recently after the advent of
microarray genes for many complex disorders have been found by using genome
68 wide association studies.
Suggested Reading Genetic Polymorphism
Gardner, E.D, Simmons, M.J and Snustad, D.P. 2003. Principles of Genetics, 8th
Edition, New York: John Wiley and Sons.
Simmons, S and Simmons, M.J. 2003. Principles of Genetics, 3rd Edition, New
York: John Wiley and Sons.
Sample Question
1) Define polymorphism with few examples.
2) What are the evolutionary forces that affect gene frequency of polymorphic
markers?
3) Give some uses of polymorphic markers.
4) What is law of Hardy Weinberg?
5) What is genetic testing?
6) Describe the utility of studying molecular markers in anthropological
genetics.
69
UNIT 2 DNA POLYMORPHISMS
Contents
2.1 Introduction
2.2 Different Forms of DNA Polymorphisms
2.3 Human Evolution with Special Reference to Mitochondrial DNA and
Y-Chromosome Polymorphisms
2.3.1 mt DNA Polymorphism-Human Evolution
2.3.2 Y Chromosome Polymorphism-Human Evolution
2.4 DNA Polymorphisms and Disease Association
2.4.1 Monogenetic Disease
2.4.2 Multifactorial Disease
2.5 Techniques in Molecular Genetics
2.5.1 Polymerase Chain Reaction
2.5.2 Restriction Fragment Length Polymorphism
2.5.3 DNA Sequencing Methods
2.5.4 Microarray
2.6 Summary
References
Suggested Reading
Sample Questions
Learning Objectives
&
After having studied this unit, you will be able to:
Ø understand Human DNA polymorphisms;
Ø explain types of DNA polymorphisms;
Ø discuss DNA polymorphisms role in disease manifestation; and
Ø describe Single Nucleotide Polymorphism’s role in reconstructing Human
evolution and modern Human migrations.
2.1 INTRODUCTION
Human genome (entire genetic material present in a cell) consists of 3 billion
bases. There are about 10 million Single Nucleotide Polymorphisms. The DNA
sequence will carry code of information for carrying genetic information from
parent to child (generation to generation). A person or plant or animal
phenotypically looking different, means that there are variations in the genetic
material of the organism. Any change in the DNA sequence will bring change in
the genetic information, inturn brings change in phenotypic expression and
biological function. The change in the DNA sequence is called Mutation. If the
mutation frequency is more than 2 per cent in a population, it is called as
polymorphism. Hence, we can define DNA polymorphism as DNA having more
than one form, with a frequency of above 2 percent in a population.
22
DNA Polymorphisms
2.2 DIFFERENT FORMS OF DNA
POLYMORPHISMS
DNA polymorphisms can be studied in the form of Single Nucleotide
Polymorphisms (SNPs), Restriction site Polymorphisms (RSPs) or Restricted
Fragment Length Polymorphisms (RFLP) and Variable Number of Tandem
Repeats (VNTRs).
Single Nucleotide Polymorphisms (SNPs): A single nucleotide is substituted
by a different nucleotide.
Fig.2.1: SNP in double strand DNA
There are two types of nucleotide substitutions resulting SNPs. 1) Transition: A

substitution occurs between Purines (A,G) or between Pyrimidines (C,T). This
type of substitution constitutes two thirds of all SNPs. 2) Transvertion: A
substitution occurs between a Purine and a Pyrimidine.
Insertions: A new nucleotide will be inserted in the sequence.
Deletions: An existing nucleotide will be deleted in the sequence.
Restriction site Polymorphisms (RSPs) or Restricted Fragment Length
Polymorphisms (RFLP): A sub set of SNPs cause a loss or gain of a restriction
site (restriction site is the location where a particular enzyme cuts the DNA sequence
at particular sequence location into pieces of DNA). Due to change in nucleotide
at particular site location, enables the enzyme to cut DNA into pieces. This leads to
create different length of DNA piece in an individual and another length of DNA
piece in another individual. This is called Restriction site polymorphism. RSPs are
described as restricted fragment length polymorphisms (RFLP).
III.Variable Number of Tandem Repeats (VNTRs): It is divided into two
types:
Microsatellite polymorphism
Minisatellite polymorphism.
Micro-satellite polymorphism is also called as Short Tandem Repeats (STRs). A
small array of tandem repeats of a simple sequence (usually less than 10 base
23
Human Molecular Genetics pairs). Ex; GATAA GATAA GATAA GATAA GATAA GATAA in this sample 5
bases repeated 6 times.
a) GA GA GA GA GA – it is dinuleotide repeat
b) TAT TAT TAT TAT- it is trinuleotide repeat
Mini-satellite polymorphism: A collection of moderately sized arrays of
tandemly repeated DNA sequence which are dispersed over considerable portions
of the nuclear genome.
c) TTAGGGTACCGG TTAGGGTACCGG TTAGGGTACCGG –this
array of 12 nucleotides repeats from 3-20 Kbp(thousand base pairs).
2.3 HUMAN EVOLUTION WITH SPECIAL

REFERENCE TO MITOCHONDRIAL DNA
AND Y-CHROMOSOME POLYMORPHISMS
DNA polymorphisms particularly SNPs became a powerful tool in reconstructing
human origins, evolution and prehistoric migrations. Earlier we used to depend
on archaeological and paleontological evidences to reconstruct human evolution.
In the absence of these traditional evidences DNA analysis became an alternative
tool to reconstruct human evolution.
The hominid fossil record in Africa begins about 4 MYs ago in Early Pliocene
with representatives of the genus Australopithecus from Ethiopia and Tanzania.
Homo erectus arose more than a million years ago in the Pleistocene, giving rise to
our own genus, Homo. Anatomically modern humans began to appear 120000-
100000 years ago and co-existed with Neanderthals until the latter became extinct
about 30,000years ago. Based on these evidences, two theories have been proposed
for the evolution of modern humans: 1.Multiregional evolution: It proposes that
present day worldwide populations are the descendants’ of in situ evolution after
an initial dispersal of Homo erectus from Africa during the Lower
Pleistocene(~650kybp), 2. Uni regional hypothesis (also called as Recent African
Origin model or Out-of-Africa):- All present day populations have descended
from a recent common ancestor that lived in East Africa ~150,000 years ago.
At this juncture, mitochondrial DNA and Non-recombining region of Y-
chromosome (NRY) analysis provided an alternative approach to reconstruct
Modern Human evolution. mtDNA and NRY Y-chromosome analysis enable us
to trace maternal and paternal lineages of modern humans. Along with these
DNA markers autosomal and X-linked markers have also been studied.
DNA can also be extracted from bone material of ancient specimens. The ancient
mtDNA analysis from Neanderthal specimens reveals that Neanderthals are not
immediate ancestors to modern humans. Modern humans diverged from
Neanderthals about 400,000 years ago. Neanderthals went extinct without
contributing any mtDNA to modern humans.
2.3.1 mtDNA Polymorphism-Human Evolution

DNA polymorphisms suggested a recent origin of modern humans from African
populations. Initial evidence came from mtDNA, which is transmited maternally.
Each human cell cytoplasm contains 10-100 mitochondria. Each mitochondrion
will have a circular double strand DNA molecule about 16569 base pair length.
24 The most ancient mtDNA haplotypes (having the same genotype) are L0, L1, L2
and L3. Haplotypes L1 and L2 are specific to the sub-Saharan Africa. L3 is DNA Polymorphisms
present in North East Africa and Middle East. L3, M & N are parallel branches.
M branch is called as Asian branch and N is called as European branch. All
branches of M arose in Asia. M branches didn’t present in Europe. M1, a branch
of M present in East Africa is originated in Middle East and back migrated into
Africa. In Asia N branch is also present. M is the oldest branch than N branch.
An ancestral branch of Asian might have arisen in North East Africa and
subsequently left to colonise Asia (50-70 thousand years ago) and Europe (45-
50 thousand years ago).The mtDNA analysis of world populations reveals that
modern humans can be traced back to a single mother, ‘mitochondrial eve’. The
analysis also shows that this individual existed about 100,000-130,000 years
ago in east Africa. Of course, the mitochondrial eve was not the only person
living on the planet at that time: there are perhaps about 10,000 individuals
living at that time but unlike Eve, there mtDNA sequences didn’t get transmitted
to the present human populations.
SNPs normally exhibit two forms of variation at a nucleotide position or have

two alleles. For example Africans (L0, L1 & L2 haplogroups) have Thymine at
nucleotide position 3594 where as all Non-Africans will have Cytocine at np3594.
Likewise all Asians have four mutations (M lineage) in their mtDNA sequence.
N haplogroup
M haplogroup
L3 haplogroup
L2 haplogroup
L1 haplogroup
L0 haplogroup
Fig.2.2: mtDNA phylogenetic tree constructed based on Polymorphisms present in mtDNA

of world populations (adopted after Ingman, 2000) 25
Human Molecular Genetics Indian scenario
The initial dispersal of modern humans from East Africa en-route North and East
of Africa has now been documented, following the African mtDNA haplogroups
into Saudi Arabia and then Western India. Indian specific mtDNA branches, M
and N encompass all the populations in India irrespective of their social rank, caste
or tribe. In India the frequency of M haplogroup ranges from 54 to 97 percent.
Indian specific M sub haplogroups are M2,-M6, M18, M25, and M30-M62. M1is
present in North East Africa, M31 & M32 are specific for Andaman Islands. M7,
M8, M9, M10, M11 & M12 are specific for China and Japan. Most numerous sub
haplogroups of European N haplogroup are Indian specific. Ex: N5, R5, R6, R7,
R8 T30, R31, U2. Genetic links of Indians with East Eurasians, West Eurasians
and Australians are established by mtDNA polymorphisms.
2.3.2 Y Chromosome Polymorphism-Human Evolution

The Y chromosome is a suitable tool for investigating the recent human evolution,
for medical genetics, DNA forensics and genealogical reconstructions, due to its
uniqueness among the other human chromosomes. The Y chromosome has a
sex-determining role, it is male specific and constitutively haploid (Single). It is
inherited paternally and is transmitted from father to son, and unlike other
chromosomes, the Y chromosome escapes meiotic recombination in its NRY
(Non Recombining Y chromosome) region. The non-recombining portion of the
Y chromosome descends as a single locus. As they change only by accumulating
mutations in time, they preserve by far more simple record of their history
compared to autosomes.
Y chromosome variation consists of large amount of different types of
polymorphisms, which are widely used in evolutionary studies. They may roughly
be divided into two large groups: bi-allelic markers and polymorphisms of tandem
repeats or multi-allelic markers. Bi-allelic markers include SNPs (Single
Nucleotide Polymorphisms) and insertions and deletions (indels). SNPs are the
most common type of polymorphisms, constituting more than 90% of total
polymorphisms of DNA. Only these bi-allelic mutations that have occurred, only
once in history of humans and have a detectable frequency in human populations
are used in phylogenetic studies.
Y chromosome DNA polymorphisms are useful to trace paternal lineages. The
Y chromosome consortium is formed to document the binary polymorphisms in
NRY (non recombining region of Y chromosome). There are about 599
polymorphisms made Y chromosomes in to 311 groups. This information was
constructed into a tree and named the main branches starting from alphabets A to
T. Major branches are called as Clades and sub branches are called as a haplogroups.
Polymorphisms at P91, M168, M294 distinguishes A, B clades from the rest of
clades. Clade A & B are exclusively present among African populations. The
majority of branches of the Y chromosome tree outside Africa are composed of
a tripartite assemblage of the following haplogroups: a) C; b) D and E, and c) an
overarching haplogroup F that defines the internal node of all remaining
haplogroups from G to T.
Because the mutation defining haplogroup C (M130=RPS4Y) has not been
observed in any African populations, this haplogroup is likely to have arisen
somewhere in Asia after an early departure of modern humans from Africa, prior
26 to the arrival of them to Sahul in Southeast Asia. The most western region where
haplogroup C* has been detected is India. This lineage consists of several sub- DNA Polymorphisms
lineages with irregular phylogeographic patterning, ranging from Central and
North Asia to America and in the direction of Southeast Asia up to Australia and
Oceania. Differently from hg C, haplogroups E and D share three phylo-
genetically equivalent markers.
Calde D* is found in Andaman Islands whereas D1 & D2 are found in Tibetans
and Japanese. E is the most frequent and divergent in Africa.The third major
sub-clade of M168 lineages is super haplogroup F. It is characterized by mutation
M89 at its root from which all other haplogroups deploy. F has been suggested to
have evolved early in the diversification and migration of modern humans. Later
on, the ancestral trunk of F diversified into many branches by subsequent
acquisition of mutations, giving rise to many region-specific haplogroups, such
as J and G in Near and Middle East, I in Europe, H in Southern Asia, etc. An
expansion of F lineages gave rise also to a population that acquired the M9
mutation (haplogroup K), which defines another major bifurcation in the
phylogeny . The branches of this clade probably migrated in different directions
(North and East) and gave start to many separate and region-specific haplogroups
in Eurasian continent and beyond. Out of descendants of M9 lineage, haplogroup
L (M20) has greatest frequency in Southwest Asia and distinctive K lineages and
M (M4, M5) haplogroup are restricted to Oceania and New Guinea, whereas
haplogroup O with its numerous sub-clades predominates in southern and
southeastern Asia, reaching North China, Manchuria and some Siberian
populations. The population carrying M9 expanded also in direction of north
towards Central Asia characterized by subsequent mutations defining haplogroup
P, which encompasses distinctive eastward expanding haplogroup Q (M242)
characteristic to Siberian populations and Amerindians and Eurasian haplogroup
R lineages that have expanded westward. Thus, one may speculate that multiple
independent formations and fragmentations of populations carrying F-related
lineages throughout most of Eurasia may have displaced the earlier haplogroup
C and D lineages towards the margin in many areas. Among Indians H, O, R1,
R2 are the major clades. H haplogroup is nearly restricted to India, Srilanka and
Pakistan. Among Austro-Asiatic language speaking groups of India O haplogroup
is predominant followed by H group. Indo-European language speakers have 50
percent of O haplogroup followed by H & R.
Fig.2.3: Schematic reconstruction of super haplogroup F (defined by M89) origin,

subsequent diversification of M9 lineages and their possible migration routes
across the world. Adapted from Underhill (2003). 27
Human Molecular Genetics Table 2.1:Number of mutations associated with 20 major Y chromosome
clades (Karafet,2008)
Clade Mutations haplogroups

A 47 12
BT 5
B 32 17
CT 3
C 30 19
DE 8
D 23 15
E 101 56
C,FT 1
FT 25
F 6 5
G 13 10
H 12 10
IJ 7
I 35 16
J 42 34
KT 4
K 5 5
L 13 7
M 20 12
NO 6
N 11 10
O 48 31
P 20 1
Q 18 14
R 50 28
S 8 6
T 6 3
TOTAL 599 311
Based on the above table the tree has been constructed which is as follows.
28
DNA Polymorphisms
Fig.2.4: Y-Chromosome tree. Mutation names are indicated on the branches. A to T are
branch names. Sub trees are not shown in this figure (Karafet, 2008)
Apart from bi-allelic polymorphisms, insertions and deletions (indels) persist

over generations and are sufficiently common to be considered as polymorphisms.
One such example is a 2kb deletion in 12f2 marker, used for defining haplogroup
J. Some indels have arisen independently more than once in human history. For
example, the deletion or duplication of the 50f2/C region in background of
different haplogroups is thought to be arisen at least 7–8 times. Another example
is the deletion of DAZ3/DAZ4 region that has been indicated to occur in
haplogroup N individuals, widely spread in northern Eurasia.
29
Human Molecular Genetics Another frequent type of polymorphism, present also in Y chromosome, is tandem
repeats, mostly in non-coding DNA regions. According to their length, these
repeats are classified as satellite-DNAs (repeat lengths of one to several thousand
base pairs), mini-satellites or variable number of tandem repeats (VNTRs),
ranging from 10 to 100 bp, and microsatellites or short tandem repeats (STRs),
with motifs less than 10 bp, mostly 2 to 6 bp long. In Y-chromosomal studies
microsatellites are widely used, than mini-satellites. Microsatellites are multi-
allelic markers with different allele numbers ranging from 3 to 49 in locus. Their
mutation rate is much higher than that for biallelic markers and, therefore, they
are widely used in phylogenetic studies to investigate details of demographic
events that have occurred in a more recent time scale. In evolutionary studies
STRs are valuable in combination with binary haplogroup data, as they enable
us to study diversity within a haplogroup. STRs are particularly widely explored
in forensic work. So far the number of widely used Y chromosomal STRs has
been quite low (about 30) but in a recent study 166 new and potentially useful
STRs were described.
Based on the Phylogenetic analysis it was concluded that, all humans have
originated from an African ancestor. About 70,000 thousand years ago modern
man came out of Africa and peopled all the continents.
Thus the combination of molecular age and geographical structure makes mtDNA
and the NRY a sensitive genetic index capable of tracing the micro evolutionary
patterns of noval modren human diversity. Mitochondrial DNA and Y
chromosome studies in Indian populations reveals affiliation with Europeans,
East Asians, Austro-Melanesians and in situ development of deep rooted ancestry
whose relative clustering and coalescence ages suggest shaping of Indian gene
pool during late pleistocene.
2.4 DNA POLYMORPHISMS AND DISEASE

ASSOCIATION
Disease is a disordered or incorrectly functioning of organ, part, structure, or
system of the body resulting from the effect of genetic or developmental errors,
infection, poisons, nutritional deficiency or imbalance, toxicity, or unfavourable
environmental factors.
A genetic disease is any disease that is caused by an abnormality in an individual’s

genome. The abnormality can range from minuscule to major from a discrete
mutation in a single base in the DNA of a single gene to a gross chromosome
abnormality involving the addition or subtraction of an entire chromosome or
set of chromosomes. Some genetic disorders are inherited from the parents, while
other genetic diseases are caused by acquired changes or mutations in a pre-
existing gene or group of genes. Mutations occur either randomly or due to some
environmental exposure. There are about 30,000 genes in humans. Some of the
mutations in these genes cause a disease, predispose us to the common diseases
in combination with other variants and with the environment. Knowledge of
these polymorphisms offers tremendous advantage in the study of disease and
variable response to treatment.
30
2.4.1 Monogenetic Disease DNA Polymorphisms
It is caused by changes or mutations that occur in the DNA sequence of a single

gene, also called Mendelian disorder. There are more than 6,000 known single-
gene disorders, which occur in about 1 out of every 200 births. Some examples
of monogenetic disorders include: Cystic Fibrosis, Sickle Cell Anaemia, Marfan
syndrome, Huntington’s disease, and Hemochromatosis. Single-gene disorders
are inherited in recognisable patterns: autosomal dominant, autosomal recessive,
and X-linked.
Example: Sickle cell anaemia is a disease passed down through families in which
red blood cells form an abnormal crescent shape (Red blood cells are normally
shaped like a disc.) Sickle cell anaemia is caused by an abnormal type of
haemoglobin called haemoglobin S. Haemoglobin is a protein inside red blood
cells that carries oxygen. Haemoglobin S changes the shape of red blood cells,
especially when the cells are exposed to low oxygen levels. Then the red blood
cells become crescent shaped or sickles. The sickling occurs because of a mutation
in the haemoglobin gene. The haemoglobin beta(HBB) gene is found in region
15.5 on the short (p) arm of human chromosome 11. In sickle cell haemoglobin
(HbS) the glutamic acid in position 6 is mutated to valine in a beta chain. This
change allows the deoxygenated form of the haemoglobin to stick to itself and
become crescent shape.
Fig.2.5: Normal and sickle red blood cells.
31
Human Molecular Genetics The fragile, sickle shaped cells deliver less oxygen to the body’s tissues. They
can also get stuck more easily in small blood vessels, and break into pieces that
interrupt healthy blood flow.
Sickle cell anaemia is inherited from both parents. If you inherit the haemoglobin
S gene from one parent and normal haemoglobin (A) from your other parent,
you will have sickle cell trait. People with sickle cell trait do not have the
symptoms of sickle cell anaemia. The children of both sickle cell parents will
get sickle cell anaemia.
Sickle cell disease is much more common in people of African and Mediterranean
descent. It is also seen in people from South and Central America, the Caribbean,
and the Middle East.
2.4.2 Multifactorial Disease

It is called complex or polygenic disease. Complex diseases are caused by a
interaction of environmental factors and mutations in multiple genes. Some
common chronic diseases are multifactorial in nature. Examples of complex
diseases include: Cardio Vascular diseases, high blood pressure, Alzheimer’s
disease, arthritis, diabetes, cancer, and obesity. For example, different genes that
influence breast cancer susceptibility have been found on chromosomes 6, 11,
13, 14, 15, 17, and 22.
Mutations in BRCA1 gene (BRCA1 Gene is located on chromosome17q21.31)

contribute significantly to the development of familial/hereditary breast and
ovarian cancer. Founder mutations such as the BRCA1-185delAG and 5382insC
are found among Ashkenazi Jews.
Polymorphism in BRCA1 Chr17 at np 37043496 is shown in the figure.
CCGCCCCTACCCCCCGTCAAAGAATACCCAT(normal form)
CCGCCCCTACCCCCCCTCAAAGAATACCCAT (mutated form)
Large rearrangements, mostly deletions in regions of Y-specific genes (AZFa,

AZFb, AZFc), have been known as causes for many diseases leading to male
infertility, causing spermatogenic failure, azoospermia, severe oligo spermia or
otherwise severely impair male reproductive fitness.
2.5 TECHNIQUES IN MOLECULAR GENETICS

To study DNA polymorphisms initial step is extraction of DNA from cells. We
can extract up to 1500 nano grams of DNA from 5ml of blood by Phenol
chloroform method.
DNA Extraction- Principle

The process of DNA extraction can be divided into three stages: (i) disruption of
the cellular membranes, resulting in cell lysis, (ii) protein denaturation, and finally
(iii) the separation of DNA from the denatured protein and other cellular
components.
32
About 5 ml of blood is transferred to a sterile 15ml conical bottom polypropylene DNA Polymorphisms
tube and equal amount of RBC lysis buffer is added. Shake the tube gently for 3
to 5 minutes. The contents of the tube transforms into transparent red colour
upon the lysis of RBC. We have to ensure that RBC is completely lysed before
proceeding to further step. Once RBC is lysed, transfer the tubes into the
centrifuge. Run the centrifuge at 1500 rpm for 15 mts at 20oC. Upon the
completion of the run carefully, remove the tubes from the centrifuge and decant
the supernatant without disturbing the pellet at the bottom. Now add 4 ml of
RBC buffer to the tube and break the pellet using hand or vortex. Repeat the
centrifugation step as earlier with same settings. Decant the supernatant, if pellet
is still red repeat the RBC lysis. If pellets are light pink or white proceed for
further step.
Add 1 ml of digestion buffer and 10 ul of Proteinase K to the tube and carefully

dislodge the pellet from the bottom of the tube. Adjust the hot water bath at
55oC, now transfer the tubes into the hot water bath. Gently dislodge the tubes
for every 30 minutes to enhance the digestion process. The content of the tubes
turns clear and transparent upon the digestion.
Now add 250ul of 5M sodium per chlorate to the tube and gently mix the contents
by partially inverting the tube. Now add 500ul of tris saturated phenol, 500ul of
24:1 chloroform isoamyl alcohol, mix the contents thoroughly and adjust the
centrifuge at 4ºC, 4000 rpm and 15 minutes. Take a fresh tube, carefully transfer
the supernatant using the 1ml pipette and cut tips into the fresh tube. Now add
500ul of 24:1 chloroform and isoamyl alcohol, and repeat the centrifugation
step with same settings. Carefully transfer the supernatant using a cut tip into a
fresh tube. Add double the volume of chilled alcohol; gently invert the tube for
a minute. A milky white fibrous DNA is visible. Now transfer the DNA into a
1.5ml tube, add 1 ml of 70 % alcohol, spin at 12,000 rpm for 10 minutes, and
repeat the step for one more time to eliminate the remaining protein contamination.
Dry the pellets and add 200ul of TE buffer and mix the contents thoroughly and
transfer into the hot water bath/dry bath for digesting the DNA. This process
usually takes 2 hours. Transfer tubes for -80ºC for long term storage.
Details of the buffers and reagents used for DNA extraction are given below.
1) RBC Lysis Buffer contains Sucrose, 1M Magnesium Chloride 1M Tris-Hcl

and Triton X.
2) Digestion Buffer constitutes 1M Tris-Hcl (pH 8.0), 1M Sodium Chloride,

0.5M EDTA (Na salt)
2) Tris-EDTA Buffer made up of 1M Tris-HCl (pH 8.0), 0.5M EDTA
After DNA was completely dissolved in the TE buffer, its quantity and quality
was checked by both spectrophotometry and gel electrophoresis.
Determination of DNA concentration by Spectrophotometry

Prior to any analysis, DNA should be quantified and checked for purity and
integrity. Based on its structure, DNA absorbs light in the ultraviolet range,
33
Human Molecular Genetics specifically at a wavelength of 260nm. A value of 1 at OD260 is equal to 50ng/µl
double stranded DNA. Therefore to calculate the concentration of DNA, the
following formula can be used:
Concentration of DNA = 260nmabs x 50ng/µl
Procedure
2µl DNA sample was diluted to 200 µl with Double Distilled water (Dilution
1:100). Spectrophotometer was set to auto zero with the Double Distilled water.
Optical Density (OD) of the diluted DNA aliquot was measured at 260 nm and
280nm using quartz crystal cuvette.
Quality Assessment
A ratio of OD values at 260nm and 280nm indicates the purity of the extracted
DNA sample. If the ratio is within range of 1.6 to 2.0, then DNA sample is
considered as clear and free from contaminants like residual protein and mRNA.
An OD ratio less than 1.6 indicate the residual proteins or phenol contamination,
whereas ratio of more than 2.0 indicates residual RNA contamination.
Quantity Assessment
DNA quantity was estimated as the OD value at 260nm of extracted sample is

1.00 then the concentration of the DNA is 50ug/ml.
Therefore, DNA concentration = OD at 260nm x 50 x Dilution factor.
DNA quantification and electrophoresis
Electrophoretic analysis of DNA using agarose gels can confirm DNA integrity.
Typically intact genomic DNA will be up to 40KB in size, depending upon the
species. Prepare 1% agarose gel has to be by adding required quantity of agarose
to 1X Tris-Acetate-EDTA (TAE) buffer and mix well. Heat the mixture in
microwave oven until it became clear and take care to avoid over boiling and
evaporation. Cool the mixture to ~500 C and add ethidium bromide to make a
final concentration of 0.001ug/ml. Pour the entire mixture into a tray in which
combs are fixed to make wells in the gel. After gel formation, place the tray in
buffer tank containing 1X TAE buffer for submerged gel electrophoresis and
remove the combs with care to avoid rupture of wells. Mix 1µl of each DNA
sample with 1µl of loading dye and load the mixture into the wells. Subject the
Gel to electrophoresis at 90V for 30 minutes and visualise using gel documentation
system where it is exposed to Ultraviolet rays. Under Ultraviolet rays exposure,
DNA will give luminance which indicate the presence of DNA in the sample as
shown in the below figure.
34
DNA Polymorphisms
Fig. 2.6: Electrophoresis gel picture showing DNA bands
2.5.1 Polymerase Chain Reaction

PCR (Polymerase Chain Reaction) is a revolutionary method developed by Kary
Mullis in 1980s. It is an essential and ubiquitous tool in genetics and molecular
biology. With the use of this technique we can clone DNA invitro.
PCR is based on using the ability of DNA polymerase to synthesize new strand
of DNA complementary to the offered template strand. Because DNA polymerase
can add a nucleotide only onto a pre existing 3'-OH group, it needs a primer to
which it can add the first nucleotide. This requirement makes it possible to
delineate a specific region of template sequence that the researcher wants to
amplify. At the end of the PCR reaction, the specific sequence will be accumulated
in billions of copies (amplicons). DNA sequencing by dye termination technique
requires multiple copies of DNA, hence PCR is performed to generate numerous
copies of DNA fragments of interest which were further used for sequencing.
The genomic DNA of each subject can be amplified on thermal cycler with an
initial denaturation at 960C for 3 minutes and later on for 35 cycles at 950C for
60 seconds, at estimated annealing temperature of the primer for 45 seconds,
extension at 720 C for 2.30 minutes and a final extension at the end of 35th cycle
at 720C for 7 minutes in a final volume of 10 µl containing 50mM KCl, 10mm
Tris (pH 8.3), 1.5mM MgCl2, 75 ng of each primer, 100 µM deoxy-NTP, and 1
U Taq polymerase.
Primer designing
The main limitation of PCR technique is to provide short pieces of single-stranded
DNA (primers) that are complementary to a part of target sequence. With the use
of human genome sequence available we can now design primers to any region
of interest in the human genome. The most critical step in PCR experiment is
designing oligo-nucleotide primers. As poor primers could result in little or even
no PCR product, alternatively they could amplify unwanted DNA fragments.
Either will affect the downstream analysis. Many of the factors which affect the
primers specificity and sensitivity like product size, primer size, tm, GC content,
GC clamps and dimer formation can be adjusted as per the user requirement.
Primers which fit the specified criteria can be checked for their specificity using
NCBI BLAST.
35
Fig.2.7: Schematic diagram of Polymerase chain reaction
36
2.5.2 Restriction Fragment Length Polymorphism DNA Polymorphisms
Restriction-Fragment Length Polymorphism (RFLP) was proposed by American

geneticist David Botstein, biochemist Ronald W. Davis, population geneticist
Mark Skolnick, and biologist Ray White. Restriction fragment length
polymorphisms (RFLPs) can be used to produce a linkage map of the human
genome and to map the genes that cause disease in humans.
Restriction Fragment Length Polymorphism (RFLP) analysis measures fragments

of DNA containing short sequences that vary from person to person, called
VNTRs. After extracting DNA from a sample and amplifying it with the technique
known as Polymerase Chain Reaction, we can add restriction enzymes that cut
the DNA at specific points. The resulting fragments can be sorted by length with
gel electrophoresis technology to determine how many times a given VNTR is
repeated.
If two different samples show VNTRs of different lengths, the samples could
not have come from the same person. On the other hand, two samples showing
VNTRs of the same length could have come from the same person, or from two
people who happen to have VNTRs of the same length at that location. By
comparing enough VNTRs from two individuals, however, the likelihood of a
coincidental match can be reduced to nearly zero. RFLP testing requires hundreds
of steps and weeks to complete, and it has been largely replaced by newer, faster
techniques.
Fig. 2.8: Restricted enzyme EcoR-I identifies its specific GAATTC sequence and Cuts
between G and A of the DNA strand. a) Showing the cutting positions. b) Showing
resulted four strand fragments after enzyme digestion
Short Tandem Repeats in DNA Analysis
STRs can be amplified and sequenced using PCR and Sequencing techniques.
Analysis is based on the number of repeats present in the sample.
37
Fig.2.9: a) One DNA strand showing 7 repeats (STRs) of AATG. b) Another DNA strand
showing 8 repeats of AATG.
2.5.3 DNA Sequencing Methods

In the 1960s and 1970s, British scientists Frederick Sanger and Alan Coulson,
Alan Maxam and Walter Gilbert in the United States, developed DNA sequencing
techniques. Automated equipment makes DNA sequencing a speedy, routine
laboratory procedure. Sanger and Gilbert won the 1980 Nobel Prize in Chemistry
for their work.
Sanger method of DNA Sequencing
In Sanger method, specific terminators of DNA chain elongation 2’, 3’-
dideoxynucleoside triphosphates are synthesized. These molecules can be
incorporated normally into a growing DNA chain through their 5’- triphosphates
groups. However, they cannot form phosphodiester bonds with the next incoming
deoxynucleotide triphosphates (dNTPs). When a small amount of a specific
dideoxy NTP is included along with the four deoxyNTPs normally required in
the reaction mixture for DNA synthesis by DNA polymerase, the products are a
series of chains that are specifically terminated at dideoxy residue. This forms
the basis for Sanger’s method.
Procedure
Initially single strand DNA is prepared through denaturation process. Then single
strand DNA is mixed with a short end labeled piece of DNA (Primer) that is
complementary to the end of single strand DNA. Labeling of primer is carried
out using enzymes like Alkaline Phosphatase and Polynucleotide Kinase. After
primer is annealed to DNA, sample is divided into four portions in four tubes.
In each tube, along with DNA, Primer, DNA polymerase, a carefully controlled
ratio of one particular dideoxynucleotide with its normal deoxynucleotide, and
the other three dNTPs are added.
In each tube, DNA polymerase polymerizes normally from primer by utilizing
nucleotides. When ddNTP is incorporated, the growth of that chain will stop. If
the correct ratio of ddNTP: dNTP is chosen, a series of labeled strands will
result, the lengths of which are dependent on the location of a particular base
relative to the end of the DNA.
After suitable time period, the resultant labeled fragments in each tube are
separated by size on an acrylamide gel. The separated fragments are detected by
38 exposure of the gel to x-ray film through the process of autoradiography. From
the band developed in each lane of the autoradiograph and knowledge of which DNA Polymorphisms
lane contain which base, the sequence of the complementary sequence can be
obtained. From the complementary sequence, the sequence of the original strand
can be easily determined with the help of Watson and Crick base pairing rule.
Thus Sanger method is used for DNA sequencing.
Fig.2.10: Schematic diagram of Sanger’s enzymatic sequencing
Automated DNA Sequencing

There are various methods available for DNA sequencing like chemical
degradation, chain termination method, sequencing by ligation and micro fluidic
Sanger sequencing etc. Advances in automation have opened gates to new fast
and reliable automated DNA sequencing technologies. Owing to its greater
expediency and speed, dye-terminator sequencing is now the mainstay in automated
sequencing. Dye-terminator sequencing is a slight modification of the Sanger’s
chain termination method it utilizes labelling of the chain terminator ddNTPs,
which permits sequencing in a single reaction. In dye-terminator sequencing, each
of the four dideoxynucleotide chain terminators is labelled with fluorescent dyes,
with different wavelengths of fluorescence and emission. The dye labelled DNA
fragments will be capillary electrophoresed and a detection system will identify
the labelled bases when they pass through a laser that activates the dye.
Cycle sequencing
To read the sequence of the amplified DNA termination with florescent dye
labelled ddNTPs, each base PCR amplicon should be subjected to cycle reaction
with one primer using BigDye terminator cycle sequencing ready reaction kits
following the manufacturer’s guidelines. 39
Human Molecular Genetics Sequencing run
The PCR product should be added 10µl of Hi-Di formamide before feeding it to
the sequencer machine.
Sequence Alignment
The generated sequences can aligned to their respective reference sequences with
the use of software called DNA baser. It performs sequence comparisons for
variant identifications, SNP discovery and validation. It allows analysis of the
re-sequenced data, comparing the consensus sequences to a known reference
sequence. The reference sequences for the gene studied are obtained from NCBI
Gen bank data base.
Sequence Editing and Mutation Scoring

We can score the mutations from the aligned sequences by checking
electropherograms of the DNA sequences. Genotypes can be exported from the
software for further analysis.
Single Nucleotide Polymorphisms or SNPs (pronounced snips”) are variations

in a DNA sequence that occur when a single nucleotide in the sequence is different
from the normal in at least one percent of the population. When SNPs occur
inside a gene, they create different variants or alleles, of that gene.
Unlike repeated portions of DNA like STRs and VNTRs, in the case of SNPs it
is the sequence itself, not its length that is useful to forensic scientists. SNPs are
commonly occurring every 100 to 300 bases along the entire length of the human
genome. Mutations in SNPs are very rare, so the sequences tend to be passed
unchanged across generations. But because any given SNP is relatively common
in the population, an analyst must examine dozens of SNPs to derive a true DNA
fingerprint. For this reason, SNP analysis is rarely used in forensic cases.
Figure: Sequence showing Homozygous mutation
Fig.2.11: DNA Sequence Electropherograms showing mutations
40
DNA Polymorphisms
Fig.2.12: Sequence showing Heterozygous mutation
Fig.2.13: Sequence showing 39 basepair deletion
2.5.4 Microarray
A DNA microarray (also commonly known as gene chip, DNA chip, or biochip)
is a collection of microscopic DNA spots attached to a solid surface. Scientists
use DNA microarrays to measure the expression levels of large numbers of genes
simultaneously or to genotype multiple regions of a genome. Each DNA spot
contains picomoles (10-12 moles) of a specific DNA sequence, known
41
Human Molecular Genetics as probes (or reporters). These can be a short section of a gene or other DNA
element that are used to hybridize a cDNA or cRNA sample (called target) under
high-stringency conditions. Probe-target hybridisation is usually detected and
quantified by detection of fluorophore, silver, or chemiluminescence-labelled
targets to determine relative abundance of nucleic acid sequences in the target
DNA microarrays can be used to measure changes in expression levels, to

detect single nucleotide polymorphisms (SNPs), or to genotype or resequence
mutant genomes (see uses and types section).
Principle
Hybridisation of the target to the probe

The core principle behind microarrays is hybridisation between two DNA strands,
the property of complementary nucleic acid sequences to specifically pair with
each other by forming hydrogen bonds between complementary nucleotide base
pairs. A high number of complementary base pairs in a nucleotide sequence
means tighter non-covalent bonding between the two strands. After washing off
of non-specific bonding sequences, only strongly paired strands will remain
hybridized. So fluorescently labelled target sequences that bind to a probe
sequence generate a signal that depends on the strength of the hybridisation
determined by the number of paired bases, the hybridisation conditions (such as
temperature), and washing after hybridisation. Total strength of the signal, from
a spot (feature), depends upon the amount of target sample binding to the probes
present on that spot. Microarrays use relative quantisation in which the intensity
of a feature is compared to the intensity of the same feature under a different
condition, and the identity of the feature is known by its position.
Many types of arrays exist and the broadest distinction is whether they are spatially
arranged on a surface or on coded beads: (i) The traditional solid-phase array is
a collection of orderly microscopic “spots”, called features, each with a specific
probe attached to a solid surface, such as glass, plastic or silicon biochip
(commonly known as a genome chip, DNA chip or gene array). Thousands of
them can be placed in known locations on a single DNA microarray. (ii)The
alternative bead array is a collection of microscopic polystyrene beads, each
with a specific probe and a ratio of two or more dyes, which do not interfere with
the fluorescent dyes used on the target sequence.
DNA microarrays can be used to detect DNA (as in comparative genomic

hybridisation), or detect RNA (most commonly as cDNA after reverse
transcription) that may or may not be translated into proteins. The process of
measuring gene expression via cDNA is called expression analysis or expression
profiling.
42
DNA Polymorphisms
2.6 SUMMARY
DNA, or deoxyribonucleic acid, contains genetic information in the form of
genetic code that is responsible for physical appearance of the organism, biological
development and maintenance of life processes. Any change in the DNA leads
to different form of DNA in the population. Occurrence of more than one form
of DNA in the population is called as DNA polymorphism. This Polymorphism
may be due to variation at single nucleotide base, an array of nucleotide bases or
at chromosomal level. DNA polymorphisms are playing an important role in
understanding human evolution and in unravelling the genetic basis of diseases.
References
Rao V.R. and A.R.Sankyan, 2007. Human origins, genome and people of India.
Anthropological Survey of India. Allied publications Pvt Ltd, New Delhi .
Ingman M, Kaessmann H, Pääbo S, Gyllensten U (2000) Mitochondrial genome

variation and the origin of modern humans. Nature 408: 708–713.
Chandrasekar A, Satish Kumar, J. Sreenath, B. N. Sarkar, B.P. Urade, S. Mallick,

S. S.Bandopadhyay, Pinuma Barua, S. S. Barik,Debasish Basu, U.Kiran, P.
Gangopadhyay, Ramesh Sahani, B. V.Ravi Prasad, S.Gangopadhyay, G. R.
Lakshmi, R. R. Reddy , K. Padmaja, P. N. Venugopal, M. B. Sharma, and V.R.Rao.
Updating Phylogeny of Mitochondrial DNA Macrohaplogroup M in India:
Dispersal of Modern Human in South Asian Corridor. PLoS ONE 4(10): e7447.
doi:10.1371/ journal.pone.0007447(2009).
Barik, S.S. R. Sahani, B.V.R. Prasad, P. Endicott, M. Metspalu, B.N. Sarkar, S.

Bhattacharya, P.C.H. Annapoorna, J. Sreenath, D. Sun, J.J. Sanchez, S.Y.W. Ho,
A. Chandrasekar, V.R. Rao. Detailed mtDNA genotypes permit a reassessment
of the settlement and population structure of the Andaman Islands. American
Journal of Physical Anthropology. 136(1):19-27 (2008).
Chandrasekar, A et al. YAP insertion signature in South Asia. Ann Hum Biol.
34(5):582-586 (2007).
Palanichamy MG, Sun C, Agrawal S, Bandelt H-J, Kong Q-P, et al. 2004.
Phylogeny of mitochondrial DNA macrohaplogroup N in India, based on complete
sequencing: implications for the peopling of South Asia. Am J Hum Genet 75:
966–978.
Web resources:
http://ycc.biosci.arizona.edu/
http://yhrd.org
http://mitomap.org
http://phylotree.org
http://projects.tcag.ca/variation/decipher
http://ncbi.nlm.nih.gov/projects/SNP/
43
Human Molecular Genetics Suggested Reading
Tom Strachan and Andrew P. Read. 2004. Human Molecular Genetics. Garland
publishing, Taylor and Francis Group, London and New York.
Sambrook, J. and Russell, D. 2001. Molecular cloning: A laboratory manual,

3rd Edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Human Genome Nature Issue (15 February 2001) Nature 409, 813-958. http://
www.nature.com/genomics/human/
Human Genome Science Issue (16 February 2001) Science 291, 1177-1351. http:/
/www.sciencemag.org/content/vol291/issue5507/index.shtml
U.S. National Human Genome Research Institute: www.ncbi.nlm.nih.gov/
About human genome project: http://www.genome.gov/10001772
Human genome Browsers and Integrated Databases: www.ensembl.org/
Sample Questions
1) Define what in DNA polymorphism and its forms?
2) Explain how mtDNA polymorphism helped in understanding modern
humans in Indian subcontinent?
3) Discuss the Y-chromosome tree?
Short Notes
1) Polymerase Chain Reaction?
Sanger method of DNA sequencing?
RFLP and its uses?
Microarray and its usage?
44
Population Genetics
UNIT 4 CHROMOSOMAL ABERRATIONS
IN MAN
Contents
4.1 Introduction
4.2 Changes in Chromosome Number
4.3 Specific Autosomal Abnormalities
4.4 Sex Chromosomal Abnormalities
4.5 Mosaicism
4.6 Structural Abnormalities or Chromosome Rearrangements
4.7 Summary
Suggested Reading
Sample Questions

Ø define chromosome and chromosome abnormalities or syndromes;
Ø describe and distinguish different chromosomal aberrations in man with
examples;
Ø understand the causes for chromosomal anomalies; and
Ø understand the consequences of chromosomal aberrations.
4.1 INTRODUCTION
Chromosomes and genes
A chromosome is an organised thread-like microscopic structure found in the
cell nucleus of living organisms including man. Until 1956, it was thought that
the number of chromosomes in man was 48, when it was established that it is 46.
Each human cell, except for the gametes, i.e. ovum (egg) and the sperm cells,
contains 23 pairs of chromosomes (22 pairs of autosomes and one pair of sex
chromosome). Women possess two identical chromosomes called the X
chromosomes while men possess one X chromosome and one Y chromosome.
The ovum and sperm cells each contain 23 chromosomes (22 autosomes and
one X or Y chromosome). The behaviour of chromosomes at somatic cell division
in mitosis provides a mechanism that ensures the daughter cells to retain its own
complete genetic component. Similarly their behaviour in the reproductive cells
during gametes formation in meiosis enables each mature ovum and sperm to
contain a unique single set of parental genes.
In earlier lectures we have discussed about gene mutations, where a change occurs
from one allelic form to another, and such changes led to new inherited properties.
However, there are other type of changes, namely, changes in the quantity of the
chromosomal material and changes in its arrangement. The cellular and
developmental functioning of an organism depends not only on the presence of
the necessary alleles, but also on their harmonious interaction with each other.
Generally, the chromosomes remain unchanged but under certain natural or
artificial adverse circumstances certain structural changes may occur in the
55
Human Genetics chromosomes which alter the positions of gene or loss of some genes or changes
in chromosomal number. Any alteration in the number of chromosomes or changes
in gross structure of chromosome that disrupts this genetic balance generally
produces developmental abnormalities with profound phenotypic effects in the
form of physical effects and sometimes accompanied by mental imbalances. These
structural and numerical alterations which affect the phenotype of the organisms
in various degrees are collectively called chromosomal aberrations or anomalies
or abnormalities. These accumulated sets of abnormalities so produced are called
syndrome. If several specific abnormal traits present in the same individual are
transmitted to his offspring as a unit, as they often are, it can usually be assumed
that they depend jointly on a single gene. In medicine such group of characters is
called a syndrome. A well-known example of a syndrome is Marfan’s syndrome,
or Arachnodactyly (spider-fingeredness), so called because of the excessive length
of the bones of fingers and toes. Though abnormal chromosomes account for at
least 50 per cent of spontaneous abortions, only 0.65 per cent of newborns have
abnormal chromosomes as most embryos and fetuses with abnormal
chromosomes stop developing before birth.
Chromosomal Changes
Normally, every somatic cell contains a pair of each type of autosome, each pair
of autosomes has numerous pairs of homologous loci, and at each of these loci is
one of a pair of alleles. The harmonious genic action depends on the twofold
presence of each locus. Occasionally, however, abnormalities in the division or
the distribution of the chromosomes or of chromosomal sections may result in
some loci existing in triplicate or singly instead of as a pair. The abnormal
chromosomal types in many plants and animals have shown that development
does not proceed normally. Such imbalance in the genetic content of the zygotes
– two alleles of most loci but three, or one, of the loci of certain chromosome –
may result in early death of the zygote. Sometime, however, full development of
the zygote may occur but the individual will not be normal. One of the most
remarkable and abnormal syndromes in man is that called Down’s syndrome or
Mongolism, first described as a clinical syndrome in 1866 by Langdon-Down of
England. Affected individuals are characterised by physical abnormalities of the
face, eyelids, tongue, and other parts of the body and are greatly retarded both
physically and mentally. The incidence at birth is about 1/700 among Europeans.
This is caused due to the presence of a very small 47th chromosome, and the
small chromosome is present in triplicate, instead of duplicate, on chromosome
number 21, suggesting the synonym Trisomy 21.
56 Source: www.science.com
By 1959 a variety of chromosomal aberrations was demonstrated in man. Different Chromosomal Aberrations
in Man
types of abnormalities which can occur are divided into numerical, structural
and a third category consisting of different chromosome constitutions in two or
more cell lines. A chromosome anomaly or abnormality or aberration reflects an
atypical number of chromosomes or a structural abnormality in one or more
chromosomes. A karyotype is a full set of chromosomes arranged in an order of
their size from an individual which can be compared to a “normal” karyotype for
the species via genetic testing. Any anomaly in the chromosome may be detected
or confirmed in this manner. Chromosome anomalies usually occur when there
is a fault in cell division following meiosis or mitosis. These chromosome
anomalies can be organised and summarized into two basic groups, numerical
and structural anomalies (Table 4.1).
Table 4.1: Chromosomal abnormalities
Numerical
Aneuploidy – Monosomy
– Trisomy
– Tetrasomy
Polyploidy – Triploidy
– Tetraploidy
Structural
Translocation – Reciprocal
– Robertsonian
Deletions
Insertions
Inversions – Paracentric
– Pericentric
Rings
Isochromosomes
Different cell lines (Mixoploidy)
– Mosaicism
– Chimaerism
4.2 CHANGES IN CHROMOSOME NUMBER

The most obvious way of disrupting the balance of genes is by the variation in
number of chromosomes. There are two distinct types of abnormalities in
chromosome number. The first one involves the presence of extra entire sets of
chromosomes and the second type involves individual chromosomes instead of
entire sets of chromosomes. Human gametes are haploid (n) i.e. the gametes
carry 23 chromosomes. The gametes carry one complete set of chromosomes
consisting of 22 autosomes and 1 sex chromosome and whereas the somatic
cells in contrast are diploid (2n) and carry two haploid sets of chromosomes – 46
altogether. Abnormally higher multiple of the basic haploid (n) set is known as
polyploid (3n, 4n, and so forth). Polyploidy (euploidy, which means a good set)
in man is extremely rare. A triploid cell (3n) would contain 69 chromosomes
and tetraploid (4n) 92. Such genetic imbalance is intolerable in man and animals,
but quite common in plants. Triploidy in man is relatively rarely found in
57
Human Genetics spontaneous miscarriages and rarely survive beyond mid-pregnancy. Only eight
live-borns have been recorded and all have died soon after birth. Polyploidy can
arise from fertilization involving unreduced gametes (essentially complete non-
disjunction) containing 46 instead of 23 chromosomes, through fertilization of
an ovum with two sperms called dispermy, or by the failure of duplicated
chromosomes to separate into two daughter cells during mitosis – the observed
live-born mosaics. A few full triploids have been born prematurely, but none
survived more than several hours.
Chromosomal abnormalities in the form of aneuploidy (extra or missing
chromosomes) are very regular among humans. Roughly 8 per cent of all
conceptions are aneuploidy, and it is projected that up to half of all miscarriages
are due to some form of chromosome disorders. Sex chromosome disorders are
the most commonly observed type of aneuploidy in humans. Four common
categories of aneuploidy crop up in humans:
(i) Nullisomy – occurs when a chromosome is missing altogether (www.dummies.
com). Generally, embryos that are nullisomic don’t survive to birth; (ii) Monosomy
– Occurs when one chromosome lacks its homolog; (iii) Trisomy – Occurs when
one extra copy of a chromosome is present and (iv) Tetrasomy – Occurs when
four total copies of a chromosome are present and tetrasomy are extremely rare.
In humans, it is unusual to find individuals surviving with more than one extra
or one missing chromosome. If there is one extra chromosome present, which
means a particular chromosome is represented three times instead of the usual
paired diploid arrangement and the condition is known as trisomy for that
chromosome and is symbolized as 2n + 1 = 47. When one chromosome is missing
from the diploid complement, only one representative of a particular pair is
present, producing a condition known as monosomy symbolized as 2n -1 = 45.
24 different trisomies and 24 different monosomies are expected to occur in man
as there would be one trisomic and one monosomic for each of the 22 autosomes
and an X and a Y of each type. Of the 48 theoretical possibilities, only eight
aneuploids were observed in live-born children of whom six were trisomics and
three were monosomics. The types of aneuploids generally observed in man are
shown in table 4.2.
Table 4.2: Types of Aneupoids in live-born Children
Abnormal Name of the Year of
Chromosomal Syndrome Discovery Occurrence
Constitution
Trisomies
13, 13, 13 (47, + 13) Patau’s 1960 1 in 5,000 births
18, 18, 18 (47, + 18) Edward’s 1960 1 in 6,500 births
21, 21, 21 (47, + 21) Down’s 1959 1 in 800 births
X, X, X (47, XXX) Trisomy X 1961 1 in 950 female births
X, X, Y (47, XXY) Klinefelter’s 1959 1 in 1,000 male births
X, Y, Y (47, XYY) Jacob’s (Double 1961 I in 950 male births
Y Syndrome)
Monosomies
21, 0 (45, - 21) Al-Aish’s 1967 Very rare (about 3 known)
X, 0 (45, X) Turner’s 1959 1 in 5,000 female births
58
The meiotic error that causes aneuploidy is called non-disjunction. Non- Chromosomal Aberrations
in Man
disjunction is the failure of two members of homologous chromosome pair to
separate during cell division so that both pass to the same daughter cell. It is not
clear how non-disjunction is caused. But the factors implicated for the cause of
nondisjunction are aging, radiation and delayed fertilization after ovulation. The
principal cause of aneuploidy is an accident in meiosis that leads to an unequal
distribution of chromosome pair (www.scribd.com).
In meiotic cell division there are two instances in which non-disjunction can
occur – during first meiotic division or second meiotic division (see figure 4.1).
In either case, the result is the production of one or more gametes that carry an
extra chromosome and one or more gametes that lack a chromosome.
Fig.4.1: The effect of meiotic non-disjunction on gametic chromosome number
Source: Nagle, J.J. 1974 Heredity and Human Affairs. Saint Louis, The C.U. Mosby Company p. 256
4.3 SPECIFIC AUTOSOMAL ABNORMALITIES

Patau’s Syndrome or 13-Trisomy: This syndrome occurs in about 1 in 5000 live
births. Patau’s syndrome also has a slightly increased incidence with maternal
age. Generally they do not survive beyond three or four months after birth. The
patients having a trisomy of the 13th chromosome, are characterised by multiple
and severe body malformations, as well as profound mental deficiency.
Edward’s Syndrome or 18-Trisomy: This syndrome is about eight times less

frequent than the Down’s syndrome and affects about 1 in 6500 live births. The
children with Edward’s syndrome have multiple congenital abnormalities,
including severe mental and physical retardation. The head of such a patient is
laterally flattened. The hands are short and show little development of the second
phalanx. These children usually die before one year of age.
Down’s syndrome (21-Trisomy): One of the most familiar human aneuploidy is

trisomy 21. Originally studied by Langdon Down in 1866, it had been termed
mongoloid idiocy or mongolism because of suggested resemblance to that ethnic
feature. The condition is now referred to as Down’s syndrome. The persons having
59
Human Genetics this syndrome are mentally retarded and have markedly defective development
of the central nervous system. The face of such a patient has a moon-like
appearence, with a skin fold (epicanthus) at the inner part of the eyes. The nose
is flattened the ears are malformed; the mouth is constantly open; and the tongue
protrudes. The heart, hands and feet too remain defective.
Al-Aish’s Syndrome or 21-Monosomy: When one chromosome of the pair of

chromosome 21 becomes completely deleted 21-monosomy occurs and it remains
lethal to the patient. In 21-monosomics, the nose remains prominent, the distance
between eyes is shorter than normal, the ears are large and the muscles are
contracted. Its incidence is very rare.
4.4 SEX CHROMOSOMAL ABNORMALITIES

Different kinds of sex chromosomal numerical aberrations have been detected
in man. Most of them are caused either by meiotic non-disjunctions or mitotic
non-disjunctions. They are expressed phenotypically in the following different
kinds of syndromes:
Trisomy X or Triplo-X: Women with this syndrome have 47 chromosomes,

including three X chromosomes. XXX females are physically normal but many
are mentally retarded. Some are reported to have menstrual irregularities.
All kinds of syndromes are caused by meiotic non-disjunctions of sex

chromosomes and all of them are expressed phenotypically in dwarfisms, mental
retardation and various other physical abnormalities. Some of the triplo-X females
menstruate.
Klinefelter’s syndrome: This XXY condition (44 autosomes + XXY) occurs in

about 1 in 1000 newborn males. The patients of this syndrome have some degree
of mental retardation; growth and physical development are quite normal, but
the affected males are tending to be tall for their age. Puberty does not occur
normally and they remain sterile.
Turner’s syndrome: The persons with the karyotype of 45 chromosomes (44

autosomes and one X chromosome) have the symptoms of disease called female
gonadal dysgenesis. Such persons have female phenotype, but with rudimentary
gonads and without menstruation cycle during puberty, Further, a patient of
Turner’s syndrome is characterised by short stature, and a pronounced webbing
of the neck, and short fourth metacarpal (www.microbiologyprocedure.com).
4.5 MOSAICISM
Mosaicism
All forms of aneuploidy are not clear as discussed earlier as mixtures of aneuploidy
and normal cell lines are possible to exist within the same person. These are
called chromosomal mosaicism. Mosaicism is defined as the presence of two or
more cell lines in an individual or in a tissue which differ in their genetic
constitution and are derived from the same zygote (Fig.4.2). The degree of
abnormality may range from severe to negligible. Mosaicism may occur in two
ways. The most common one is the mitotic non-disjunction — that occurs at an
60
early stage of embryonic development and in this case one daughter cell will be Chromosomal Aberrations
in Man
trisomic for the chromosome in question and the other daughter cell will be
monosomic. Thus the individual is a chromosomal mosaic – an individual with
two or more chromosomally distinct cell lines.
Fig. 4.2: Chromosomal mosaicism as a result of mitotic non-disjunction

Source: Nagle, J.J. 1974 Heredity and Human Affairs. Saint Louis, The C.U. Mosby
Company p. 263
A – Zygotic non-disjunction, producing trisomic and monosomic cell lines and

B – Postzygotic non-disjcunction, producing three different cell lines.
The second manner in which chromosomal mosaicism may be developed is by
the loss of one chromosome as it moves towards the pole during mitosis. This is
known as anaphase lag and results in one cell line with normal chromosome
constitution and one with monosomy for the lost chromosome.
Chimaerism
It can be defined as the presence of two or more genetically distinct cell lines in
an individual derived from more than one zygote. The word chimaera is derived
from the mythological Greek monster which had the head of a lion, the body of
a goat and the tail of a dragon. In humans these are of two kinds, dispermic and
blood chimaeras (www.uqu.edu.sa). Chimeras are gynandromorphs like
individuals which are mosaics for different cells having various abnormalities
of sex chromosomal number. The occurrence of male and female cells in the
animal body in a mosaic like pattern is called gynandromorphism. However, the
different kinds of cells arise from different zygotes. The most common chimerism
in man occurs with the passage of fetal cells into the maternal circulation, in
which the immunization of ABO and Rh blood group takes place. This kind of
chimerism is called post-zygotic chimerism. Chimerism can also be produced
by double fertilization (zygotic chimerism) or by artificial means such as grafting
and organ transplantation.
61
Human Genetics
Polyploids have extra sets of chromosomes and do not survive for
long.
Aneuploids have extra or missing chromosomes.
Nondisjunction during meiosis causes aneuploidy.
Trisomies are less severe than monosomies, and sex chromosome
aneuploidy is less severe than autosomal aneuploidy.
Mitotic nondisjunction produces chromosomal mosaics.
Down syndrome (trisomy 21) is the most common autosomal
aneuploid, followed by trisomies 18 and 13.
Sex chromosome aneuploid conditions include XO, triplo-X, XXY,
XXYY, and XYY syndromes
4.6 STRUCTURAL ABNORMALITIES OR

CHROMOSOME REARRANGEMENTS
Chromosomes are prone to accidents that break and alter their individual structure.
Structural abnormalities are referred to the chromosomes having an abnormal
structure with a missing portion or a portion represented twice. They range in
size from those that are so small as to be almost undetected with the light
microscope to those that are so large as to be striking and obvious. Large scale
chromosome changes are called chromosomal rearrangements. A chromosome
rearrangement is a structural change in a chromosome such as a deletion,
translocation, inversion, or gene amplification. Chromosome rearrangements can
contribute to the transformation of a normal cell into a cancerous cell and are
therefore found in many cancer cells. The chromosomal aberrations may remain
confined to a single chromosome or may extend to both of the member of the
homologous pair. In considering chromosome rearrangements, it is important to
note whether the rearranged chromosomes still carry all of the genes they should
have in their proper dosage, although of course, in an incorrect arrangement, or
whether the rearranged chromosomes have lost or gained genes. A chromosome
rearrangement that retains all the genes in proper dosage is said to be a balanced
rearrangement. One that has lost or gained genes is said to be an unbalanced.
Four kinds of structural abnormalities of chromosomes are of great importance
in human genetics.
• Deletions or deficiencies (large parts of the chromosome are lost),
• Duplications (large parts of the chromosome are copied more than once,
making the chromosome substantially large),
• Inversions (a section of the chromosome gets turned around, reversing the
sequence of genes) and
• Translocations (parts are exchanged between non-homologous
chromosomes) (Fig.4.3).
62
Chromosomal Aberrations
in Man
Fig.4.3: The Four Types of Chromosomal Abnormalites or Rearrangements

Source: Hartl, D.L, 1985. Our uncertain heritage: Genetics and Human Diversity.
New York, Harper and Row Publishers
Deletions (Deficiencies)
In deletion or deficiency type aberration, a chromosome lacks either in an interstitial
or terminal chromosomal segment which may include only a single gene or part of
a gene. If break occurs near the end of a chromosome a small piece of the terminal
end is lost and thus, terminal deficiency occurs. Sometimes two breaks may occur
at any two points, releasing an intercalary segment which may remain rod-shaped
or may become ring-shaped, if its broken ends join and fuse, a ring-shaped
chromosome called deletion ring is formed (www.microbiologyprocedure.com).
The broken ends of original chromosome are fused and have intercalary or
interstitial deficiency. A deletion is the loss of a portion of a chromosome and, in
effect, represents partial monosomy. Breakage may occur by any of a number of
agents such as irradiation, chemicals, drugs, and viral infections. Deletions occur
in one of two ways:
ü the chromosome breaks during interphase of the cell cycle and the broken
piece is lost when the cell divides, and
ü parts of chromosomes are lost due to unequal crossing-over during mitosis.
The syndromes caused by the deletion of either short arm or long arm are associated
with mental and physical retardation. The physical abnormalities tend to be variable
from patient to patient. However, children with partial deletion of the short arm of
chromosome 18 sometimes have malformations in their ear and jaws and those
with partial deletion of the long arm of 18 have severe eye and ear defects.
Duplications
Duplications are the chromosomes having an extra part and gene sequences.
Traditionally, only large duplications could be visualized in karyotypes and, in
general, the more genes involved, the more severe the associated syndrome. Small
duplications tend to be less severe than deletions of small sizes. Small duplications
involving only a few genes, called repeats can be tolerated. In fact, such
duplications are thought to be an important evolutionary mechanism for the origin
of “new genes”. Duplications of large unwanted copies of portions of the
chromosome most often arise from unequal crossing-over. Most disorders arising
from duplications are considered partial trisomies because large portions of one
chromosome are usually present in triplicate. 63
Human Genetics Inversions
An inversion (see Fig. 4.4) involves breaks (a) in one chromosome, followed by
repair in the form of reversal of the broken segment (b), and restitution of the
broken ends (c), resulting in an inverted chromosome (d). The normal order of
genes of this chromosome is ABCD, but in the inverted chromosome the order
of the genes is ACBD. Depending on whether or not the centromere is included
within the inverted section, two kinds of inversions can be distinguished:
v paracentric inversion when the centromere is outside the inverted segment and
v pericentric invesion when the centromere is included in the inverted segment
of the chromosome.
Fig. 4.4: Inversion in a chromosome

Source: Hartl, D.L, 1985. Our uncertain heritage: Genetics and Human Diversity.
New York, Harper and Row Publishers, p- 185
The above example of inversion is called paracentric inversion. It is so called

because the inverted segment does not include the centromere. The pericentric
inversion is illustrated in Figure 4.5. When the breakpoints of a pericentric
inversion are at appropriate distances from the centromere, the inversion can
alter the physical appearance of the chromosome. In the illustrated figure a
metacentric chromosome (a) after its inversion it is converted to a submetcentric
one (b). Because of this kind of change the pericentric inversions can be
microscopically detected as the relative position of the centromere changes.
Inversions interfere with normal pairing during meiosis and may cause
nondisjunction of the improperly paired chromosomes. They also suppress the
effect of crossing over within the inverted section and retain groups of genes
intact, producing what have been called supergenes that can evolve (be selected
64 for or against) as units.
in Man
Fig. 4.5: Pericentric Inversion

Source: Hartl, D.L, 1985. Our uncertain heritage: Genetics andHuman Diversity.
New York, Harper and Row Publishers, p. 187
Heterozygous inversions can cause problem during meiosis. When synapsis occurs
during prophase 1, all regions of the inverted chromosome try to pair gene for
gene with the corresponding regions of the normal chromosome. To accomplish
this, the inverted region in one of the chromosomes must form a loop (see Fig.
4.6); this loop will permit gene-for-gene pairing with homologue. Thus, except
for a relatively small region around the breakpoints themselves, the normal and
the inverted chromosomes can synapse all along lengths. The result is the
formation of four gametes from the Anaphase I cell (see Fig.4.6), one will carry
the normal chromosomes, one will carry the inverted chromosome, and two will
have major abnormalities as a result of the crossover. In addition, among the
phenotypically normal offspring (whether the inversion is large or small, and
whether a crossover occurs or not), half will inherit the inverted chromosome
and the other half will inherit its noninverted homologue.
Fig. 4.6: (a) Synapsis in an individual who is hetetozygous for a paracentric inversion
showing a crossover within the inversion loop. (b) Anaphase I configuration
resulting from the crossover in (a). One of the chromatids involved in the
crossover is dicentric (solid arrows); the other is an acentric (open arrows)
New York, Harper and Row Publishers, p. 186 65
Human Genetics Similar to paracentric inversions, synapsis in meiosis produces an inversion loop
and crossing-over within this loop resulting in abnormal chromatids in pericentric
inversions also (Fig.4.7). The chromatids involved in a crossover within the
inversion loop of a heterozygous pericentric inversion will carry duplications
and deficiencies and will lead to offspring who have major chromosomal
abnormalities. Among the phenotypically normal offspring of an individual who
is heterozygous for a pericentric inversion, half will receive the inverted
chromosome and the other half will receive its noninverted homologue.
Fig. 4.7: (a) Synapsis in an individual who is hetetozygous for a paracentric inversion
showing a crossover within the inversion loop. (b) Anaphase I configuration
resulting from the crossover in (a). One of the chromatids involved in the
crossover has a duplication of A and a deficiency of D (solid arrows); the other
chromatid has a deficiency of A and a duplication of D (open arrows)
New York, Harper and Row Publishers, p.185
The larger the segments in the duplication and deletion in the recombinant
chromosome, the greater the degree of imbalance and the more likely miscarriage
will result. Also the smaller the size of the inversion, the greater will be the
degree of imbalance which will result in miscarriage of recombinant conceptions.
Translocations
Translocation is another class of structural abnormalities commonly found in
man which involves the detachment of a segment of one chromosome and
reattachment to another, usually nonhomologous, chromosome. The genetic
significance of this structural rearrangement is that genes from one chromosome
are transferred to another. These are of two types: (1) Reciprocal translocation
and (2) Nonreciprocal translocation. The reciprocal translocation is referred to
the structural rearrangement when segments of two nonhomologous chromosomes
are interchanged without any net loss of genetic material (Fig. 4.8). A special
type of nonreciprocal translocation is a Robertsonian translocation, in which
the centromeric regions of two nonhomologous acrocentric chromosomes become
fused to form a single centromere (Fig.4.9) (www.udl.es/usuaris).
In the reciprocal translocation as illustrated in Figure 4.8 no chromosomal material
is gained or lost and also each chromosome is monocentric. An individual who
carries the parts of reciprocal translocation (see (c) of Figure 4.8) would also
carry the normal homologue of both chromosome (i.e., ABCDE and YZ). Such
an individual is said to carry a balanced translocation because the individual
carries all the normal genes in their proper dosage; only the order of genes has
been changed. Individuals who carry only part of reciprocal translocation and
thus have duplications and/or deficiencies are said to carry unbalanced
66
translocations. When the interchanged parts of the reciprocal translocation are
large, the individuals with unbalanced translocations will have large duplications Chromosomal Aberrations
or deficiencies and would be expected to undergo spontaneous abortion. in Man
Fig. 4.8: Origin of a reciprocal translocation (c) from breaks ubtwo nonhomologous chromosomes
(a) followed by repositioning of broken ends and restitution of the breaks (b)
Source: Hartl, D.L, 1985. Our uncertain heritage: Genetics andHuman Diversity
New York, Harper and Row Publishers, p.189
Robertsonian translocation as illustrated in Figure 4.9 involves the interchange

of the long arm of one acrocentric chromosome with the short arm of a
nonhomologous acrocentric chromosome (see (a) and (b) of Figure 4.9) leading
to a tiny metacentric chromosome consisting of both short arms along with a
large metacentric chromosome consisting of both long arms (see (c) of Figure
4.9). The tiny metacentric chromosome frequently undergoes mitotic or meiotic
nondisjunction and is lost, but its loss has no detectable phenotypic effect owing
to the small amount of chromosomal material in tiny metacentric chromosome.
Robertsonian translocation is sometimes referred to as a chromosomal fusion or
centric fusion as there is a fusion of the long arms of two acrocentrics.
Fig. 4.9: Origin of Robertsonian translocation(c) from nonhomologous acrocentrics broken

as shown in (a) with restitution as in (b). In most cases the tiny metacentric
chromosome is lost
New York, Harper and Row Publishers, p.192 67
Human Genetics Chromosomes can also be fused end-to-end to shape a structure with two
centromeres. If one of these is inactivated, the chromosome fusion will be stable.
Such a fusion clearly occurred in the evolution of our own species. Human
chromosome 2, which is a metacentric, has arms that correspond to two different
acrocentric chromosomes in the genomes of the great apes. Detailed cytological
analysis has revealed that the ends of the short arms of these two chromosomes
apparently fused to create human chromosome 2.
Isochromosomes
An isochromosome is a chromosome in which both arms are identical.
Isochromosome is formed by the mirror image copy of a chromosome segment
including the centromere. It is thought to arise when a centromere splits
transversely in the wrong plane instead of along the normal longitudinal plane,
yielding two daughter chromosomes (Fig. 4.10), each of which carries the
information of one arm only but present twice. So these chromosomes show loss
of one arm and duplication of the other. They are perfectly metacentric
chromosomes. The isochromosomes are formed during mitosis and meiosis.
Fig. 4.10: Diagrammatic interpretation of the formation of isochromosomes. A) Normal

longitudinal spliting of the centromere (dotted line). B) Abormal transverse
splitting of the centromere (dotted line) forming isochromosomes
Source: Nagle, J.J. 1974 Heredity and Human Affairs. Saint Louis, The C.U. Mosby Com-
pany, p.271
Isochromosomes have been observed for the X chromosome with some regularity,
but they are virtually unknown in autosomes, except possibly for chromosome
21 in a few cases of Down’s syndrome.
Ring Chromosomes
A portion of a chromosome gets broken off and forms a circle or ring. A ring
chromosome is formed when a break occurs on each chromosome leaving two
sticky ends on the central portion which reunites as a ring. This can happen with
or without loss of genetic material. Ring chromosomes can be a centric or acentric
event.
Chromosome rearrangements can cause deletions and duplications.
In a Robertsonian translocation, the long arms of two different acrocentric
chromosomes join.
In a reciprocal translocation, chromosomes exchange parts.
68
If a translocation leads to a deletion or duplication, or disrupts a gene, in Man
symptoms may result.
Gene duplications and deletions can occur in isochromosomes and ring
chromosomes, and when crossovers involve inversions.
An isochromosome has two identical arms, introducing duplications and
deletions.
Ring chromosomes form when telomeres are missing.
4.7 SUMMARY
A Chromosome is a thread-like structure located in the cell nucleus of living
organisms. Generally, the chromosomes remain unchanged but due to certain
natural or adverse conditions the chromosomal number changes or certain
structural alterations may occur in the chromosomes which modifies the positions
of gene or loss of some genes. Abnormal Chromosome Number: A euploid
somatic human cell has 22 pairs of autosomes and one pair of sex chromosomes.
Polyploid cells have extra chromosome sets. Aneuploids have extra or missing
chromosomes. Trisomies (an extra chromosome) are less harmful than
monosomies (lack of a chromosome), and sex chromosome aneuploidy is less
severe than autosomal aneuploidy. Nondisjunction is uneven distribution of
chromosomes in meiosis. It causes aneuploidy. Most autosomal aneuploids cease
developing as embryos.
There are two different types of abnormalities in chromosome number, (1) the
presence of extra entire sets of chromosomes, and (2) involves individual
chromosomes instead of entire sets of chromosomes. Monosomic and trisomic
zygotes are usually the consequence of non-disjunction during meiotic cell
division. Non-disjunction is the inability of two members of homologous
chromosome pair to separate during cell division so that both pass to the same
daughter cell and the result is the production of one or more gametes that carry
an extra chromosome and one or more gametes lack a chromosome. There are
three types of trisomies and one monosomy of sex chromosomes observed in
man. Turner’s syndrome is a monosomy (XO, 45,X) and Klinefelter’s syndrome
(XXY, 47,XXY), Trisomy X syndrome (XXX, 47,XXX), and Jacob’s (Double
Y) syndrome (XYY, 47,XYY) are the trisomics. Among the autosomes, only
one monosomy is observed which is very rare. It is called Al-Aish’s syndrome
(21, 0 or 45, -21). There are three autosomal trisomics in man and they are Patau’s
syndrome (13, 13, 13 or 47, +13), Edward’s syndrome (18, 18, 18 or 47, +18)
and Down’s syndrome (21, 21, 21 or 47, +21).
A mixture of aneuploidy and normal cell lines are possible to exist within the
same person. These are called chromosomal mosaicism. The presence of two or
more genetically distinct cell lines in an individual derived from more than one
zygote is called chimerism. Chromosomes are prone to accidents that break and
alter their individual structure. Deletions and/or duplications result from crossing
over after pairing errors in synapsis. Crossing over in an inversion heterozygote
can also generate deletions and duplications. A chromosome with a deletion
(deficiency) has certain genes missing. Small duplications involving only a few
genes, are thought to be an important evolutionary mechanism for the origin of
“new genes”. In a Robertsonian translocation, the short arms of two acrocentric
69
Human Genetics chromosomes break, leaving sticky ends on the long arms that join to form an
unusual, large chromosome. In a reciprocal translocation, two nonhomologous
chromosomes substitute parts. A translocation carrier may have an associated
phenotype and generate some unbalanced gametes. Isochromosomes repeat one
chromosome arm but delete the other. This happens when the centromere divides
in the wrong plane during meiosis. Ring chromosomes form when telomeres are
removed, leaving sticky ends that hold on.
Reference
www.dummies.com
www.microbiologyprocedure.com
www.udl.es
www.scribd.com
www.uqu.edu.sa
Suggested Reading
Borgaonkar, D. S. 1977. Chromosomal Variation in Man. New York, Alan R.
Liss.
Gardner, R. J. M. and Sutherland, G. R. 2004. Chromosome Abnormalities and
Genetic Counseling. London,Oxford University Press.
Stern, C.1960. Principles of Human Genetics. San Francisco and London, W.
H. Freeman and Company.
Therman, E. S. 1993. Human Chromosomes: Structure, Be haviour and Effects.
New York. Springer-Verlag.
Whittinghill, M. 1965. Human Genetics and Its Foundations. Calcutta, New
Delhi, Oxford and IBH Publishing Company.
Sample Questions
1) Distinguish among a euploid, aneuploid, and polyploid. State which of the
following involve in aneuploid number of chromosomes: diploidy,
duplication, haploidy, triplication, Trisomy 21, Turner’s syndrome, XXYY.
2) Discuss classification of some structural mutants, and illustrate them
diagrammatically.
3) How many chromosomes would a person have who has Klinefelter syndrome
and also trisomy 21?
4) Describe an individual with each of the following chromosome constitutions.
Mention the person’s sex and possible phenotype.
a) 47, XXX; b). 45, X; c) (47, + 21) trisomy 21
5) List three types of chromosomal aberrations that can cause duplications and/
or deletions, and explain how they do so. List three causes of Turner
syndrome.
70
Human Chromosome
UNIT 1 HUMAN CHROMOSOME
Contents
1.1 Introduction
1.1.1 Definition of Genetics
1.1.2 What are Genes?
1.2 What is Cytogenetics?
1.2.1 The Human Genome
1.2.2 Cell Theory
1.2.3 The Cell and its Types
1.2.4 Cell Cycle
1.2.5 Types of Cell Divisions
1.3 Human Chromosome Complement
1.3.1 Morphology of Human Chromosome
1.3.2 Classification of Chromosomes
1.3.3 The Groups of Chromosomes
1.4 Methods Used in Chromosome Analysis
1.4.1 Chromosome Preparation
1.4.2 Chromosome Banding Techniques
1.4.3 High Resolution Banding
1.5 Karyotype Analysis
1.5.1 Counting the Number
1.5.2 Analysis of the Banding Pattern
1.5.3 Idiogram
1.6 Summary
Further Reading
Sample Questions
Learning Objectives
&
Ø discuss the basics of Cytogenetics;
Ø understand difference in cell division;
Ø explain the basis of classification of human chromosomes;
Ø understand how the chromosome preparations are made;
Ø discuss different techniques available to stain the chromosome; and
Ø understand the methods used in chromosomal analysis and its importance.
1.1 INTRODUCTION
In this block you will learn about an important branch of human genetics known
as Human cytogenetics. But before that let me begin with the important elements
that will enable you to understand this block’s theme.
5
Human Cytogenetics 1.1.1 Definition of Genetics
Essentially, Genetics is the science of heredity and the study of genes. You might
be aware from the newspapers and other media about the rapid expansion of the
knowledge in the recent past in the field of genetics. You as an Anthropologist
need to understand that genetics will play a central role not only in the new
model of medical practice; but also in understanding the variations both normal
and abnormal among the diverse ethnic populations spread across World.
1.1.2 What are Genes?

While heredity is understood as the biological similarity of offspring and parents,
it is the gene that bears this heredity. Gene is the fundamental, physical and
functional unit of the heredity, which carries information from one generation to
the next.
The next question is, “Where are these genes?” They are in you. Yes! They are in
each of your cell trying to maintain you in all ways, be it your growth, development
or disease resistance. They reside tightly packed in what is called as chromosome.
So, chromosomes are thread like structures where a linear end to end arrangement
of these genes exists.
1.2 WHAT IS CYTOGENETICS?

Now having examined some elementary terms, let us understand what
cytogenetics is. This is the branch of genetics concerned principally with the
study of chromosomes. It is the cytological approach to genetics, mainly consisting
of microscopic studies of chromosomes. To put in another way the study of
chromosomes and cell divisions, is also referred to as cytogenetics.
Fig. 1.1: German cytologist Walther Flemming

(Source: www.nndb.com)
Flemming developed a new staining technique in 1879, using synthesized aniline

dyes to identify chromosomes, the structures of the cell nucleus. This allowed
observation of mitosis, a term first used by Flemming for cell division, in far
greater detail than ever before. He also coined the term chromatin, from the
Greek word for color, after noting that his red dye was thoroughly absorbed by
structures in the nucleus. He is usually credited as the father of cytogenetics
(analysis of human chromosomes for the detection of inheritable diseases).
6
1.2.1 The Human Genome Human Chromosome
The entire complement of genetic material in a chromosome set of a species is

known as genome. A unifying theory (known as chromosome theory of
inheritance) states that inheritance patterns may be generally explained by
assuming that the genes are located in specific sites of chromosomes.
Fig. 1.2 : Electron micrograph of the human genome

Source: http://www.ocf.berkeley.edu/~edy/genome/
1.2.2 Cell Theory

With the invention of compound microscope around 1600, a whole new world
of science to marvel opened up for us. It was between 1655 and 1879 when
researchers described the many kinds of cells seen in very thin slices of plant and
animal tissues. The darkly staining long threads (chromosomes) were present in
every cell. They had a remarkable dance like behaviour during the cell division.
It is during this time, that the cell theory was put forth. Cell theory states that the
cell is the underlying unit of structure in all the living organisms. They also
proposed that new cells come only from pre-existing cells. With this idea, now
just imagine a continuous unbroken series of cell divisions, from the point called
“you’ backward and backward, continuously to your ancestors, their forefathers
and so on. So you would now agree with me, but you are here because of this
marvellous unbroken chain of cell divisions running to the remote past. Yes in
4000 million years of earth history, you are lucky enough to be alive because of
this continuum!
1.2.3 The Cell and its Types

The dark staining threads as I mentioned, in each cell are called as chromosomes
(Greek chroma, “colour”, soma “body”) located in a nucleus. The nucleus is
separated from the remaining cell contents, known as cytoplasm by a double
membrane wall. Organism with this kind of cell structure is called eukaryotes.
7
Human Cytogenetics
Chromosome
Chromatid Chromatid
Nucleus
Telomere
Centromere
Telomere
Cell
Histones
Base pairs
DNA
Fig.1.3: Diagramatic representation of a cell and the location of the chromosome
Single celled prokaryotes (bacteria and archaebacteria) lack nuclei and have
simpler chromosome. The hereditary material that is faithfully passed on from
your ancestor to you resides in the chromosome.
Your body contains about 10 trillion cells. All of them came from just one cell,
the fertilised egg. Yet the 10 trillion cells you are made up of are now no longer
identical to each other. The skin, bones, muscles, brain, internal organs all are
made up of different somatic cells. Yet they are a product of two germ cells that
are also called as reproductive cells- the egg in your mother and the sperm in
your father that united sexually to produce the new individual called you. Around
200 different types of somatic cells exist; each specialised to perform one or
more unique functions.
Inspite of differences in the structure and function of the different cell types
there are certain basic structure and functions common to virtually all cells.
(Fig.1.3). But remember, that cells have complex organisations and multiple
roles. How they develop and carry on their work is taken care by the information
packed in their nuclei. The nucleus forms the large central compartment. As I
told you earlier the nuclear envelope consists of two membranes that contain
many pores, through which materials are exchanged with the surrounding
cytoplasm; within the nucleus, are at least one dark staining nucleolus and many
finely dispersed chromosomes.
1.2.4 Cell Cycle

Many cell divisions occur before a fertilized egg transforms itself into an
individual with trillion cells. Events occurring during cell cycle (Fig 1. 4) indicates
whether a cell is dividing or not. The rate of cell cycle differs with the tissue
8
type. For e.g. cells lining the small intestine divide through out the life while Human Chromosome
nerve cells may not divide at all during the life time. You may define the “Cell
Cycle” as a continuous process with two major stages: 1) Interphase (stage with
no division of cell), 2) Mitosis (stage with cell division).
Interphase is the time in the cell cycle with great activity like carrying out several
biochemical functions concerned with life processes, DNA replication and
subcellular structures that are distributed to daughter cells after cell division.
Interphase is divided into two gap phase called G1 phase and G2 phase. A cell
exists from G1 phase to enter G0 phase also called as “quiscent phase”. A cell in
G0 phase maintains its characteristicks and DNA replication or division does not
occur at this stage. from here the cell may proceed for division or may lead to
“apoptosis” or cell death. In G1 phase, synthesis of proteins, carbohydrates and
lipids occur which are required for the daughter cells. The time duration of G1
phase varies from cell to cell.
Apoptosis
Check Point
DNA Damage
Check Point
Spindle
Assembly
Check point
Fig. 1.4: The Cell Cycle
9
Human Cytogenetics During the next phase called S phase, cell replicates its entire genome, each
chromosome replicates longitudinally held together by the centromere. This phase
lasts for 8-10 hours and synthesises protein required for the formation of spindle-
the structre that pull the chromosomes to the poles of the cells during anaphase
stage of cell division.
G2 phase occurs after the replication of DNA and before the cell enters the mitotic
divsion. In this phase cell synthesises more of protein, membranes are formed
from the proteins produced in G1 phase and stored in small vesicles that will
enclose the daughter cells at later stage.
There are certain check points (group of interacting proteins) that ensure that the
events happen in proper sequence. These points are a) DNA damage check point-
that acts during S phase. It inhibits cell cycle from proceeding further till the
damage is rectified, b) Apoptosis Check Point- which acts as the mitosis begins.
In apoptosis check point, proteins called “survivins” override the signals causing
cell death. Thus cells are kept at mitosis., c) Spindle assembly check points- take
care of spindle formation to which chromosomes are attached helping their
movement towards the poles during cell division.
1.2.5 Types of Cell Divisions

Before going further, let us recollect from our previous biology lessons that cell
divisions are of two types. They are Mitosis and Meiosis.
Mitosis
Mitosis is the normal form of cell division. As a person develops from an embryo
through fetus and infant to an adult, cell divisions are needed to generate the
large number of cells required. Remember that many cells have a limited life
span, so there is a continuous requirement to generate new cells in the adult. All
these cell divisions occur by Mitosis. Mitosis is the normal process or cell division,
from cleavage of the zygote to death of the person. It is estimated that in the life
time of a human, there may be something like 1017 mitotic divisions.
Fig. 1.5: Mitosis (M) phase: The division of genetic material and cellular contents
Source:sparkcharts.sparknotes.com
10
Meiosis Human Chromosome
Meiosis is a specialized form of cell division giving rise to the sperm and egg
cells. Primordial germ cells migrate into the embryonic gonad and engage in
repeated rounds of mitosis to form oogonia in females and spermatogonia in
males. Further growth and differentiation produces primary oocytes in the ovary
and produces primary spermatocytes in the testis. These specialized diploid cells
can undergo meiosis.
An important point to remember is, that meiosis involves two successive cell divisions
first, reduction stage during which chromosome number is halved (i.e it becomes
haploid or n) and second, the multiplication stage (also known as equational stage)
with mitotic division maintaning the haploid number of chromosomes. Only one
round of DNA replication occurs so the products are haploid.
Fig. 1. 6: The different phases of meiosis (Source: diffen.com)
1.3 HUMAN CHROMOSOME COMPLEMENT

Prior to the 1950s, it was believed that each human cell contained 48 chromosomes
and that human sex was determined by the number of X chromosomes present at
conception. With the help of realise methods for chromosome preparation it was
realized that the correct chromosome number in humans is 46 and that maleness
is determined by the presence of a Y chromosomes irrespective of the number of
X chromosome present in each cell. Further it was also realized that abnormalities
of chromosome number and structure could seriously disrupt normal growth
and development.
1.3.1 Morphology of Human Chromosome

At the sub-microscopic level chromosomes consist of an extremely elaborate
complex, made of supercoils of DNA (Fig. 1.7). So each chromosome contains
one molecule of DNA. The DNA molecule is incredibily long and has to fold
itself in compact way so as to fit inside a cell which is only one millionth of an
inch. Various proteins help in the compression of DNA molecule with out
damaging it. A frame work of scaffold proteins guide the DNA molecule to
11
Human Cytogenetics compress. The DNA coils around the proteins known as “Histones” which give
beaded appearance. The beaded structures are called “Nucleosomes” which get
packed tightly during cell division so that the chromosomes become condensed
and are visible as the cell division progresses specially at metaphase and telophase.
A chromosome consists about 1/3 of DNA, 1/3 of histone protein, 1/3 of other
DNA binding proteins and a small amount of RNA. The chromosome material
is referred as “Chromatin” since it takes the color of the dye used while staining.
2 nm –10 nm –30 nm
Histome Portion of an
octamer interphase
chromosome
–200 bp
of DNA
Each loop contains

–100,000 bp of DNA
Double Solenoid Interphase
helix Nucleosome fiber
Nucleus
(beads-on-a-string)
Fig. 1.7: Chromatin packaging in human chromosome
In a diploid nucleus, the two members of a chromosome pair are called homologous
chromosomes or just homologs. Thus in diploids, each gene is present as a gene
pair. Although the nucleus in a human cell contains pairs of chromosomes, they
are not physically paired, in the sense of being next to each other.
Most of our knowledge of chromosome structure has been gained using microscope.
Fig. 1. 8: Electron micrograph of human chromosome showing the centromere and well
defined chromatids (Source: glaucoma-eye-info.com)
Special stains selectively taken up by the DNA have enabled each individual
chromosome to be identified. These are best seen during cell division when the
chromosomes are maximally contracted. During this contracted phase the
constituent genes can no longer be transcribed. At this point of time, you can see
that each chromosome consists of two identical strands known as chromatids, or
12 sister chromatids, which are the result of DNA replication having taken place
during the S (synthesis) phase of the cell cycle. The point or the primary Human Chromosome
constriction at which the two sister chromatids are joined is called as the
centromere. This is the spot that is responsible for the movement of chromosomes
at cell division. Each centromere divides the chromosome into short or petite
arm (designated as p) and long arm (designated as q). The tip of each chromosome
arm is known as the telomere. Telomeres seal the chromosome tips and their
DNA caps have a unique chemical structure that keeps chromosomes from
shortening during replication.
Fig. 1.10: Telomeres are similar to

Fig. 1.9: The telomeres are the ends of the chromosome shoe lace tips
(source:wikispaces.psu.edu) (source: lucasbrouwers.nl)
But with aging and with certain types of cancer there is a gradual accumulation
of changes (mutations) in telomeres. Please remember that for unknown reasons
the regions next to telomeres contain a high concentration of genes. Telomeres
are known to be highly conserved throughout evolution and in humans they
contain many tandem repeats of a sequence TTAGGG Sequence.
Morphologically chromosomes are classified according to the position of the
centromere.
If this is located centrally, the chromosome is metacentric, if terminal it is
acrocentric, and in case the centromere is located in an intermediate position, the
chromosome is sub-metacentic.
Fig. 1.11: Morphologically chromosomes are described as metacentric, submetacentric or

acrocentric depending on the position of the centromere
(source: http://learn.genetics.utah.edu/content/begin/traits/scientists/).
13
Human Cytogenetics Besides centromeres, some chromosomes have additional pinched-in sites called
secondary constrictions. Acrocentric chromosomes sometimes have stalk like
appendages called satellites that form the nucleolus of the resting interface cell
and contain multiple repeat copies of genes for ribosomal RNA.
1.3.2 Classification of Chromosomes

Another parameter that varies among the chromosomes is their overall length.
So three parameters form the basis for classification, length, position of the
centromere and the presence or absence of satellites.The early researchers in
cytogenetics recognized the 23 chromosomes and divided them into groups.
1.3.3 The Groups of Chromosomes

The groups span from A to G (seven classes) in the alphabetical order based on
the overall morphology. In many standard text books you will see that the human
mitotic chromosomes* of humans are generally grouped according to the
following cytological criteria:
Group A (chromosomes 1-3) Large chromosomes with approximately median
centromeres.
Group B (chromosomes 4-5) Large chromosomes with sub median centromeres.
Group C (chromosomes 6-12 and the X chromosome) Medium sized
chromosomes with sub median centromeres.
Group D (chromosomes 13-15) Medium sized acrocentric chromosomes.
Chromosome 13 has a prominent satellite on the short arm.
Chromosome 14 has a small satellite on the short arm.
Group E (chromosomes 16-18) Rather short chromosomes with approximately
median (in chromosome 16) or sub median centromeres.
Group F (chromosomes 19 and 20) Short chromosomes with approximately
median centromeres.
Group G (chromosomes 21, 22 and the Y chromosome) Very short acrocentric
chromosomes.
* J.H.Tjio and A . Levan in 1956 demonstrated that the diploid chromosome
number for humans is 46.
* M.L.O’Riordin and three colleagues in 1971, reported that all 22 pairs of

human autosomes can be identified visually after staining with quinacrine
hydrochloride. They demonstrated that the Philadelphia chromosome is an
aberrant chromosome 22.
(Philadelphia chromosome was first observed by researchers at the university of

Pennsylvania and named after the city where the discovery was made. The
chromosome is often found in myeloid leukemia, a disease in which several
bone marrow derived cell lineages proliferate uncontrollably. Philadelphia
chromosome (Ph1) is generally a reciprocal translocation between human
chromosomes 9 and 22 involving break points at 9q34 and 22q11. The
translocation generates a fusion gene made up of elements from a gene on
chromosome 22 and the majority of a proto-oncogene from chromosome 9).
14
The regions in the chromosomes where genes are actively expressed stains lightly Human Chromosome
and these are called as euchromatin regions. On the contrary heterochromatin
regions stain darkly and is made up of largely inactive, unexpressed, repetitive
DNA.
Sex chromosomes have a critical role in the determination of one’s gender. In

humans both males and females have two sex chromosomes. XX in females and
XY in males. The most important gene on the Y chromosome is the testis
determining factor known as SRY. Other genes on the Y chromosome are
important in spermatogenesis. Each of the ovum in the female carries one copy
of X chromosome while in male each sperm carries either an X or a Y chromosome.
1.4 METHODS USED IN CHROMOSOME

ANALYSIS
Tijo and Levin were the first group of scientists who in 1956 demonstrated that
each human cell contains 46 chromosomes and broke then prevailing belief that
it is 48chromosomes.
1.4.1 Chromosome Preparation

Having recollected the features of the two types of cell divisions, let us move to
the methods of chromosome analysis. These methods are commonly employed
in cytogenetics laboratories to analyze the chromosome constitution of an
individual, which is known as karyotype. The word karyotype is also used to
describe photomicrograph of an individual’s chromosome arranged in a standard
manner.
The entire chromosome complement of an individual organism or cell as seen

during mitotic metaphase is used to arrange the karyotype.
Any tissue with living cells having a nucleus that can undergo cell division is
suitable for studying human chromosomes. The commonest method is to use
circulating lymphocytes from peripheral blood.
Some steps in the chromosome preparation are given below:
1) The venous blood sample is added to a small volume of nutrient medium
containing phytohemagglutinin, which stimulates T lymphocytes to divide.
2) The cells are cultured under sterile conditions in an incubator at 370C for
about for 72 hours, at the end of which the culture is terminated.
3) At 70 hours i.e. 2 hours prior to the termination of the culture, colchicine is
added to each culture which now stops the cell division at metaphase.
Colchicine is a chemical that has a special property of preventing formation
of the spindle. Once the spindle is not formed, the cell division gets arrested
at metaphase. Metaphase is the time when the chromosomes are condensed
to a maximum extent and because of this condensation are very clearly
visible.
4) Hypotonic saline is then added to the cultures, which causes the cells to
swell which helps in the lysing or breaking of the cells with ease.
15
Human Cytogenetics 5) Then the cell suspensions are dropped on the pre chilled glass slides by
holding the pipettes at a distance so that good metaphase spreads are obtained.
6) The cells are then fixed and mounted on a slide.
7) The slides are further processed for staining.
Fig. 1.12: Preparation of a karyotype

(source:From Mueller and Young, 2001.medical- dictionary.thefreedictionary.com).
1.4.2 Chromosome Banding Techniques

Now there is an important step which is called as the staining step. Many different
stains and methods are used to identify individual chromosomes, using:
i) G (Giemsa) banding is the most common method used. The chromosomes
are treated with Trypsin. Trypsin denatures their protein content; following
this, the cells are stained with a DNA-binding dye known as Geimsa. On
staining with Geimsa each chromosome takes up a characteristic pattern of
light and dark bands. These light and dark bands can be reproduced in the
same pattern for each chromosome. In other words the banding pattern is
repeatable.
ii) Q (quinacrine) banding: This gives a banding pattern which is similar to the
bands, obtained in Giemsa staining. However a ultraviolet fluorescent
microscope is required to view these chromosomes.
iii) R (reverse) banding: In this method the chromosomes are denatured by
heating and then stained with Giemsa. This gives light and dark bands which
16 are the reverse of those obtained using conventional G banding.
Meaning- there will be a dark band in the region where the Giemsa stain Human Chromosome
shows up as a light band. Similarly it will be a light band in the corresponding
region where the G staining gives a dark band.
Fig. 1.13 : Chromosome banding
iv) C (centromeric heterochromatin) banding: Here the chromosomes are

pretreated with acid followed by alkali before G banding; the Centromeres
and other heterochromatin regions containing highly repetitive DNA
sequences are stained preferentially.
1.4.3 High Resolution Banding

G banding gives approximately 400 to 500 bands per haploid set, enabling us to
do a high- quality chromosome analysis. Each band approximately corresponds
on an average to 6000 to 8000 kilobases (kb) or 6 – 8 megabases (mb) of DNA
(deoxy ribo nuclei acid, which is the ultimate molecule of life - the polymer of
which genes are composed). One thousand base pairs in a DNA sequence is
equal to one kilobase.
If you want a more detailed banding pattern, which is known as high resolution
banding, say with 800 bands can also be obtained. The only condition is that it is
technically more skill based and laborious.
Here the cells have to be arrested precisely at even an earlier stage of mitosis
called as prophase or prometaphase that results in greater sensitivity to give upto
800 bands per haploid set. The agent used to inhibit cell division is methotrexate
or thymidine.
Folic acid or deoxycytidine is added to the culture medium, releasing the cells
into mitosis. Colchicine is then added for a specific time interval, leading to a
high proportion of cells to remain in prometaphase. They will also be in fully
contracted state, giving a more detailed banding pattern.
1.5 KARYOTYPE ANALYSIS

1.5.1 Counting the Number
The most important step in chromosome analysis involves first counting the
number of chromosomes present in a particular number of cells. The cells that
are counted to know the chromosome number in them are called as the metaphase
spreads. One has to first count each metaphase spread and find out how many
chromosomes are there in each of the spread.
17
Human Cytogenetics Generally the total chromosome count is determined in 10 to 15 cells.
But if there is a state of mosaicism (a condition in which the same individual has
two or more types of cells with different number of chromosome in one metaphase
spread, and another chromosome number in the second spread) then 30 or more
metaphase spreads are counted.
Once counting the number of chromosomes in each spread is completed, a little

more detailed analysis is done.
Fig. 1.14: Metaphase spread of unbanded chromosomes from a normal male (XY)
(source: physics.uwo.ca)
1.5.2 Analysis of the Banding Pattern

This is followed by a careful analysis of the banding pattern of each individual
chromosome in selected cells. This will be observed on both members of each
pair of homologs say the “ 1st chromosome pair”, “ 2nd chromosome pair” and so
on. Three to five metaphase spreads, which show high-quality banding, are chosen
for this purpose of detailed banding analysis.
1.5.3 Idiogram
The banding pattern of each chromosome is specific and can be shown in a
particular style known as idiogram. The chromosome pairs are conventionally
presented in a karyotype also called as karyogram with each pair of chromosomes
arranged in descending order of their size.
18
Human Chromosome
Fig. 1.15 : Idiogram of G banded chromosome (source: pathology.washington.edu)
So, having introduced the important steps to you, I will now sum up that, karyotype
is the chromosomal complement of a cell, individual, or species. It describes the
light microscopic morphology of the component chromosomes, so that their
relative lengths, centromere positions and secondary constrictions can be
identified. Attention should be paid to heteromorphic sex chromosomes
(homologous chromosomes that differ morphologically).
The karyotype is often illustrated with a figure showing the chromosomes placed
in order from largest to smallest as I mentioned earlier. This illustration is called
as idiogram, which can be constructed by aligning photomicrographs of individual
chromosomes, or it may be an inked drawing, summarizing the data from a series
of analyses of metaphase chromosome spreads.
Importance of chromosome analysis

Chromosome analysis is important to detect the structural and numerical
abnormalities. An extra chromosome can result in a trisomy of that particular
chromosome. Sometimes the whole haploid complement can be present resulting
in polyploidy instead of the usual diploid complement. Advanced chromosomal
techniques like molecular cytogenetics helps to quickly detect the structural
abnormalities like deletion of the segment of the chromosome, insertion of an 19
Human Cytogenetics extra bit of chromosome or an inversion of a segment of the chromosome.
Sometimes a ring chromosome is found when a break occurs on each arm of a
chromosome leaving two ‘sticky’ ends on the central portion that reunite to form
a ring.
1.6 SUMMARY
The normal human karyotype is made up of 46 chromosomes consisting of 22
pairs of autosomes and a pair of sex chromosomes XX in the female and XY in
the male. Specific banding patterns help to identify the different chromosomes
after using special procedures to culture the cells. Mitosis and meiosis are the
two types of cell divisions. Mitosis takes place in the somatic cells while meiosis
occurs during the final stage of gametogenisis. Homologous chromosomes at
this stage exchange segments and then segregate independently to the matured
daughter cells. DNA, the genetic material consists of two nucleiotide chains
wound in a helix. In the backbone of each chain the sugar deoxyribose alternates
with phosphate groups. Attached to the sugars of both strands are the paired
basis: A opposite T and G opposite C. Chromosomes are best seen during cell
division especially at metaphase when they are tightly coiled. Each replicated
chromosome at first consists of two identical chromatids joined by an undivided
centromere. Each chromosome can be identified in metaphase are late prophase
by its size, shape and banding pattern. Chromosome analysis is important to
detect the structural and numerical abnormalities, which lead to the development
of clinical conditions or syndromes.
Further Reading
Peter, D. Turnpenny and Sian Ellard. 2007. Emery’s Elements of Medical
Genetics, 13th Edition, Philadelphia : Elsevier Publications.
Robert, C. King and William, D. StansField. 2002. A Dictionary of Genetics. 6th
Edition, New Delhi: Oxford University Press.
Elaine Johansen Mange and Arthur, P.Mange. 1999. Basic Human Genetics, 2nd
Edition. Sunderland Publishers.
Thomas, D. Gelehrter and Francis S.Collins. 1993. Principles of Medical
Genetics, 3rd Edition. Williams and Wilkins.
Sample Questions
1) Write in brief about the human chromosome complement.
2) What is the basis for the classification of the chromosomes?
3) Highlight the seven classes of human chromosomes described in a karyotype.
4) What is a telomere?
5) What is the importance of chromosome analysis?
6) Define Idiogram.
7) Write on the various chromosome banding techniques available.
8) Differentiate between mitosis and meiosis.
9) Write briefly on the morphology of human chromosomes.
10) What is cell theory?
20
Human Chromosome
UNIT 2 CHROMOSOMAL ABERRATIONS
Contents
2.1 Introduction
2.2 Types of Chromosomal Aberrations
2.2.1 Numerical Aberrations
2.2.2 Structural Aberrations
2.3 Aneuploidy Changes in Humans
2.3.1 Autosomal Trisomies
2.3.2 Autosomal Monosomies
2.3.3 Allosomal Aberrations
2.3.4 Mosaicism and Chimerism
2.4 Structural Chromosomal Aberrations
2.4.1 Deletions
2.4.2 Duplications
2.4.3 Robertsonian Translocation
2.4.4 Reciprocal Translocation
2.4.5 Inversions
2.4.6 Isochromosomes and Ring Chromosomes
2.5 Causes of Chromosomal Aberrations
2.5.1 Non-disjunction
2.5.4 Inversions
2.6 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
Ø explain different types of chromosomal aberrations;
Ø discuss the role of chromosomal aberrations in human disorders; and
Ø evaluate the causes and consequences of chromosomal aberrations.
2.1 INTRODUCTION
In this unit we shall discuss genetic changes at the level of the chromosomes and
their effects in humans. Almost all individuals of a species contain the same
number of chromosomes specific for that species. For example, you and I contain,
within each of our cells, a total of 46 chromosomes which is specific for Homo
sapiens. However, there are individuals who show variations from this normal
complement. These variations could be changes in number of chromosomes or
structural changes within and among chromosomes – together such changes are
called chromosomal aberrations.
The genetic component of an organism regulates its development and interaction
with the environment. Thus, any change in this genetic component leads to 21
Human Cytogenetics variation in phenotypic characters. Depending on the extent of the aberration,
these effects can range from being lethal to being harmless variations. We shall
discuss the different types of aberrations, their phenotypic effects, the causes of
such aberrations, and their roles in human disorders.
2.2 TYPES OF CHROMOSOMAL ABERRATIONS

Chromosomal aberrations are broadly classified as numerical or structural
aberrations. They are further classified as shown in Figure 2.1
Numerical Structural
Euploidy Aneuploidy Deletion Duplication Inversion Translocation

• Triploid • Monosomy • Terminal • Terminal • Pericentric • Reciprocal
• Tetraplod • Trisomy • Intercalary • Intercalary • Paracentric • Non-reciprocal
• Polyploid • Tetrasomy • Robertsonian
Fig. 2.1: Classification of chromosomal aberrations
2.2.1 Numerical Aberrations

Numerical aberrations are those that cause a change (addition or deletion) in the
number of chromosomes. They are further classified as euploidy changes or
aneuploidy changes.
• Euploidy is the condition when an organism gains or losses one or more
complete set of chromosomes, thus causing change in the ploidy number.
For example, triploid (3n), tetraploid (4n) etc. (Table 2.1).
• Aneuploidy is the condition when an organism gains or losses one or more
chromosomes and not the entire set. For example, trisomy (2n + 1),
monosomy (2n – 1) (Table 2.1).
In humans, euploidy conditions do not exist because the extent of abnormality is
too large to sustain life. Aneuploidy conditions, however, are more common and
are manifested in disorders such as Down syndrome, Klinefelter syndrome and
Turner syndrome. We shall discuss these changes in detail later in the unit.
Table 2.1: Different types of numerical changes
Type of Representation Explanation
aberration
Aneuploid 2n ± x Gain or loss of one or more chromosomes
Monosomy 2n – 1 Deletion of one copy of any one chromosome
Nullisomy 2n – 2 Deletion of both copies of any one chromosome
Trisomy 2n + 1 Addition of one extra copy of any one chromosome
Tetrasomy 2n + 2 Addition of two copies of any one chromosome
Euploid Gain or loss of entire sets of chromosomes
Triploid 3n Addition of one entire set to 2n
Tetraploid 4n Addition two entire sets to 2n
Polyploid 5n, 6n,7n,….. Addition of more than two entire sets to 2n
22
2.2.2 Structural Aberrations Chromosomal Aberrations
Structural aberrations are those that involve a change in the chromosome structure.
These include deletions, duplications and rearrangements (inversions and
translocations). Structural changes occur when chromosomes break and later
rejoin in combinations that are different from the original. When there is a net
loss or gain or chromosomal segments, the change is called an unbalanced
structural change. When there is no net loss or gain of chromosomal segments,
instead there is only a rearrangement; it is called a balanced structural change
(Figure 2.2). Thus, balanced changes usually do not show any abnormal
phenotypes, which unbalanced changes do. You should keep in mind that these
changes are not mutations in genes; they only cause the number and order of
genes to be changed.
As with aneuploidy changes, structural changes are also seen in humans, and
manifest in disorders such as Cri-du-chat syndrome, Wolf-Hirschhorn syndrome,
Prader-Willi syndrome and Angelman syndrome. We shall discuss each of these
changes and their effects later in the unit.
Fig. 2.2: Balanced and unbalanced structural changes in chromosomes
23
Human Cytogenetics
2.3 ANEUPLOIDY CHANGES IN HUMANS
As was discussed previously, aneuploidy conditions are non-lethal and result in
abnormal phenotypes described as syndromes. The effects of aneuploidy changes
differ significantly depending on the type of chromosome involved. For example,
changes in chromosomes involved in sex determination (allosomes) results in
changes in the primary and secondary sexual characters of that individual, whereas
changes in other chromosomes (autosomes) do not. As you can see, there are
various factors that affect the phenotypic manifestations of chromosomal
disorders. We shall now look at the different aneuploidy conditions in humans
and their clinical manifestations.
2.3.1 Autosomal Trisomies

Trisomy is the condition where there is an additional copy of one chromosome.
It is represented as 2n+1. Individuals, who are trisomics, thus show three copies
of the chromosome rather than the normal two. It is usually observed that
trisomies of the smaller chromosomes are more tolerated than trisomies of the
larger chromosomes. This is expected, because additional copies of larger
chromosomes contribute to larger genetic imbalance than additional small
chromosomes. You will find it no surprise that the most common trisomy is of
the shortest chromosome in human – chromosome 21. The other trisomies that
have been reported include trisomy 13 (Patau syndrome) and trisomy 18 (Edward
syndrome).
Down Syndrome
Down syndrome was one of the first reported chromosomal abnormalities in
humans. It was described as Mongolian Idiocy by John Langdon Down in 1866.
It wasn’t until 1959 that it was shown to be caused by the presence of an extra
chromosome 21, resulting in an increase of number of chromosomes to 47
(karyotype 47, XX / XY, +21). Thus, this disorder is also known as trisomy 21 or
Down syndrome. Figure 2.3 shows the karyotype of an individual with 3 copies
of chromosome 21, or trisomy 21. With an incidence of 1 in 800 live births, this
is one of the common trisomies seen in humans. This incidence increases to 1 in
350 when the woman conceives beyond 35 years of age and to 1 in 25 when she
conceives beyond 45 years. Down syndrome is caused by trisomy 21 in almost
90% of the cases. 6% of the cases are also shown to be caused by a translocation
rather than a numerical change (see Section 2.5.2) and the other 4 % are known
to be caused by mosaicism (see Section 2.3.4).
There are many phenotypic manifestations that are typical in patients of this
syndrome. However, as in other syndromes, not all affected individuals show all
the symptoms. Any single individual usually expresses only a subset of the
manifestations. Some of the most common are:
• Flat face, round head, and typical epicanthic fold of the eyes
• Short, broad hands
• Mental retardation
• Hypotonia – poor muscle tone
• Short stature
24
• Protruding furrowed tongue Chromosomal Aberrations
• Mild to moderate developmental disabilities

• Typical dermatoglyphic patterns (palm and fingerprint patterns)
Fig. 2.3: Karyotyping of the Down syndrome and the image of an affected baby (http://
www.hhmi.org/news/media/981432.gif)
The most common cause of this trisomy is the non-disjunction (see Section 2.5.1)
or the failure of separation of the chromosomes during meiotic division. Due to
this one of the gametes undergoing fertilization contains two copies of
chromosome 21 instead of the normal one copy (gametes are haploid containing
one copy of each chromosome). This non-disjunction can occur at either meiosis
I or II. Chromosomal analysis has shown that 75% of the cases are due to non-
disjunction occurring at meiosis I. When such a gamete is fertilized by a normal
gamete, it results in trisomy 21.
2.3.2 Autosomal Monosomies

Autosomal monosomies have not been reported beyond birth in humans. Even
the loss of the smallest chromosome is not compatible with life. Most known
cases, therefore, are stillbirths and spontaneously aborted fetuses. It seems that
loss of whole chromosomes cause too much genetic imbalance, which cannot
support life. However, partial monosomies have been reported and well-
documented. Partial monosomy refers to the loss of a part of a chromosome
while the rest of the chromosome is retained. Since such a partial monosomy is
a chromosomal deletion, strictly speaking, we shall discuss it under Section 2.4.1.
2.3.3 Allosomal Aberrations

Changes in number of allosomes (X and Y chromosomes in humans) are termed
allosomal aberrations. The gain or loss of these chromosomes alters the phenotype
leading to syndromes. For example, the loss of one X chromosome in females
leads to turner syndrome (XO) and the excess of one X chromosome in males
leads to Klinefelter syndrome (XXY). As mentioned earlier changes in allosomes
cause changes in the primary and secondary sexual characters along with other
manifestations. We shall look at the consequences of two such changes and the
contrasting variation they produce.
25
Human Cytogenetics Turner Syndrome
This syndrome is characterized by the partial or complete absence of one of the
X chromosomes in females (Fig. 2.4). This results in a reduction of the total
number of chromosomes to 45 (karyotype – 45, X). Thus, this syndrome is also
called Monosomy X. Its first description as a syndrome was by Henry Turner in
1938. Later, in 1954, the absence of barr body (inactivated X-chromosome seen
in buccal cells) and presence of only one X chromosome was noted. As we saw
in Down syndrome, monosomy of X is not the only cause of this syndrome.
Mosaicism, deletions and isochromosome (see Sections 2.3.4 and 2.4.6) have
also been shown to cause this condition.
A
Fig. 2.4: Turner syndrome. A:Karyotype showing the absence of one sex (X) chromosome
(http://www.geneticsofpregnancy.com/images/Turner_Syndrome.jpg); B:Classical
Features (http://img.tfd.com/mk/T/X2604-T-53.png).
It is well known that, of the two X chromosomes in females, one is inactivated

throughout her lifetime. If normal females have only one active X chromosome,
then why should the loss of one X chromosome cause abnormal phenotype? The
answer lies in the fact that although we speak of inactivated X chromosome, not
all genes on that chromosome are being inactivated. There is a small subset of
genes on the X chromosomes that are required to be expressed by both
chromosomes for normal female development. Thus, individuals who lack one
X chromosome fail to develop normal female character.
Some of the commonly seen manifestations of Turner syndrome are:
• Primary hypogonadism – poor ovary development
• Short stature
• Minimal breast development
• Broad shield-like chest with widely spaced nipples
26 • Absence of menstrual periods
• Absence of secondary sexual characteristics Chromosomal Aberrations
• Horseshoe-shaped kidney
• Inability to produce gametes - sterility
Klinefelter Syndrome
The presence of an additional X chromosome in males causes abnormal sexual
development and is described as Klinefelter syndrome. This set of characteristics
was first described by Harry Klinefelter in 1942. In 1959 it was shown to be due
to the presence of an additional X chromosome in males by the presence of barr
bodies in these males (normal males do not show barr body). The additional X
chromosome results in an increase in the total number of chromosomes to 47
(karyotype 47, XXY). It has an overall incidence of 1 in 1000 live male births.
While most patients show the XXY condition, individuals showing variations
like XXXY or XXYY have also been reported (Fig. 2.5).
A B
Fig. 2.5A: Karyotype of individual with Klinefelter Syndrome. Note the presence of two X
chromosomes along with a Y chromosome (arrow) (source: http://www.geneticsof
pregnancy.com/images/Klinefelter_Syndrome.jpg); B: Symptoms of Klinefelter
Syndrome (Source: http://img.tfd.com/mk/K/X2604-K-07.png)
The additional X chromosome arises due to non-disjunction (see Section 2.5.1)

during meiosis. Due to this, the gamete contains two X chromosomes rather
than one. When such an egg containing XX is fertilized by sperm containing Y,
an XXY zygote is formed that develops into a Klinefelter male. The extra X
chromosome may be either of maternal or paternal origin, but it is more often to
be of maternal origin.
Individuals with this syndrome show hypogonadism and reduced fertility. These
males do no develop masculine secondary sexual characteristics and show female-
type characteristics. Some of the clinical manifestations include:
27
Human Cytogenetics • Primary male hypogonadism
• Reduced facial, body and pubic hair
• Small and soft testes
• Slight learning difficulties
• Increased breast tissue – gynacomastia
• Long limb bones and lanky body
• Azoospermia – absence of sperm production leading to infertility
2.3.4 Mosaicism and Chimerism

So far we have seen how changes in chromosome number can affect an individual.
We also saw that the extent of these effects vary between individuals. Some
individuals show very mild conditions. These individuals provided examples of
a phenomenon known as mosaicism. This is defined as the presence of more
than one cell line in an individual derived from a single zygote. These cell lines
can differ in their chromosome constitution, with a percentage of the individual’s
cells showing numerical changes. Karyotype analysis from these individuals show
that some cells have the normal number of chromosome while other have either
losses or gains.
A classic example of this mosaicism is Down syndrome. These individuals show

milder symptoms of the syndrome because only a portion of their body cells
have the associated abnormality. Other numerical abnormalities also include
mosaic individuals such as for Turner syndrome and Klinefelter syndrome. The
severity of symptoms in these individuals is dependent on two things: what
percentage of their cells shows the abnormality and which of their cells show the
abnormality. For example, because the ovaries are the most affected organs, a
Turner syndrome female whose ovary cells are from the normal cell line would
show much milder symptoms than a Turner syndrome female whose ovary cells
have the monosomy.
Like aneuploidy, mosaicism too can result from non-disjunction of chromosomes.

But here the non-disjunction occurs in one of the early mitotic divisions of the
zygote. This gives rise to three cell lines – normal, trisomic and monosomic (fig
2.6). The monosomic line usually does not survive; the normal and trisomic
lines do. Thus, the embryo is formed of normal and abnormal cells.
Chimerism is similar to mosaicism in that the individual possesses cell lines of

more than one type. The difference is that, while in mosaicism the cell lines are
derived from the same zygote, in chimerism the cell lines are derived from
different zygotes. A temporary chimeric condition is developed when a person
undergoes blood transfusion. For a few days after the transfusion, the individual
will have his own cells and the donor’s cells circulating in his body. Since the
donor cells in his body are not of his own origin he is said to be chimeric.
A more permanent form of chimerism can develop if cells from a different zygote
get incorporated into the developing embryo. There is an increased risk of this
during in-vitro fertilization methods. Chimeric individuals often do not show
any abnormal phenotypes, but their fertility and type of offspring would depend
on which cell line gave rise to the reproductive organs. Especially, ambiguous
28 genitalia (genitalia that look neither completely like male nor female),
hermaphroditism, and intersexuality can result if one cell line is genetically female Chromosomal Aberrations
(XX) and the other is genetically male (XY).
Fig. 2.6: Formation of multiple cell lines in mosaic individual due to non-disjunction during
mitosis
2.4 STRUCTURAL CHROMOSOMAL

ABERRATIONS
So far, we have described the types and effects of numerical chromosomal
changes. We also saw that these syndromes can also be caused by certain types
of structural changes. In this section you will learn the different structural changes
and their consequences.
2.4.1 Deletions
A deletion refers to the loss of a segment of a chromosome. This leads to the loss
of the genes present in the missing region. A single break in the chromosome
leads to the loss of the terminal segment and is called terminal deletion (see
Figure 2.2). Intercalary deletion, however, involves two breaks in the
chromosome, loss of the segment, and rejoining of the two chromosomal parts.
Very large deletions are usually lethal because the monosomic condition of the
large number of genes of the missing fragment reaches the level of genetic
imbalance that cannot sustain life. Usually any deletion resulting in loss of more
than 2% of the genome has a lethal outcome. Microdeletions, however, are
reported and documented for specific disorders.
Cri-du-chat Syndrome
This syndrome results from a deletion on the short arm of chromosome 5. It is
also known by other names such as 5p deletion syndrome and Lejeune’s syndrome.
The disorder gets its name from the characteristic cat-like cry of affected infants.
29
Human Cytogenetics Described first by Jérôme Lejeune in 1963, this disorder has an incidence of 1 in
25,000 live births. This disorder, being autosomal, should affect males and females
in equal frequencies; but incidence is seen to be more in females by a ratio of 4:3
of females: males affected.
The deletion occurring on the short (p arm) arm of chromosome 5 varies in

different affected individuals. The phenotypic effects are also shown to vary
between individuals. Most cases show deletion of 30 to 60% of the terminal
region of the short arm. Studies show that larger deletions tend to result in more
severe intellectual disability and developmental delay than smaller deletions.
Figure 2.7 shows the chromosome 5 pair from a karyotype of an individual with
this syndrome. You can see that one of the chromosomes (left) has the normal
length of the short arm while the other (right) has significantly reduced short
arm. More specifically, a dark band is prominently seen in the normal
chromosome, which is missing in the deletion chromosome.
Fig. 2.7: Chromosome 5 pair from karyotype of individual with Cri-du-chat syndrome.
Note the deletion (arrow)
Affected individuals characteristically show a distinctive, high-pitched, catlike

cry in infancy with growth failure, microcephaly, facial abnormalities, and mental
retardation throughout life. Some common clinical manifestations are:
• Cry that is high-pitched and sounds like a cat
• Downward slant to the eyes
• Low birth weight and slow growth
• Low-set or abnormally shaped ears
• Mental retardation (intellectual disability)
• Partial webbing or fusing of fingers or toes
• Slow or incomplete development of motor skills
• Small head (microcephaly)
• Small jaw (micrognathia)
• Wide-set eyes
2.4.2 Duplications
Duplications, like deletions, can cause abnormal phenotypic effects. They usually
arise by errors in homologous recombination (unequal crossing-over).
Duplications have their importance not only in medical genetics, but also in
evolutionary genetics. The presence of an extra copy of the gene virtually makes
it free of selection pressure. Thus, it contributes to diversification of protein
functions resulting in families of proteins. Proteins of such families have related
functions differing in the task they are specialized for. A classic example is that
of the globin genes. Different globin proteins express during different times of
30 development, each of which is specialized to transport oxygen under those
conditions. These differences arose by gene duplications. Without digressing Chromosomal Aberrations
too much we shall now look at the clinical significance of duplications exemplified
by Charcot–Marie–Tooth disorder.
Charcot–Marie–Tooth (CMT) Disorder

This disorder results from duplication in the short arm of chromosome 17 in the
region 17p12. It is a hereditary motor and sensory neuropathy that affects the
nerve cells of the individual. Affected individuals typically show loss of touch
sensation and muscle tissue. The chromosomal basis of this disorder is varied,
with 17p12 duplication being one of the causes. The severity and symptoms
shown differ depending on the region affected, and the presence of other
chromosomal abnormalities associated with the duplication. In CMT type 1A,
the duplication causes more of the protein to be produced from the genes in that
region. This causes the structure and function of the myelin sheath around nerve
fibres to be abnormal, causing various clinical manifestations such as:
• Weak feet and lower leg muscles
• Foot deformities (eg: high arch)
• Difficulty with fine motor skills due to muscle atrophy
• Mild to severe pain as age progresses
• May lead to respiratory muscle weakness

Translocations generally do not result in loss of genetic material. Robertsonian
translocations, however, result in the loss of small parts of the chromosomes
involved. The fusion of two acrocentric chromosomes with the subsequent loss
of the two short arms is termed Robertsonian translocation or centric fusion
(Figure 2.8). Although this translocation causes loss of the short arms, it is
maintained as a balanced translocation. This is explained by the fact that the
genes on the short arms are most rRNA genes that are present in many copies on
other chromosomes; thus deletion of these copies doesn’t have much phenotypic
manifestation as you might expect.
Fig. 2.8: Robertsonian translocation between two acrocentric chromosomes–14 and 21
One of the commonly seen such translocation is between chromosome 14 and

21, that gives rise to individuals showing characteristics of Down syndrome.
Since this translocation is functionally a balanced translocation, individuals with
31
Human Cytogenetics this aberration usually do not show any abnormal phenotype. Their effects are
only seen in the next generation due to production of abnormal gametes. Balanced
changes cause disturbances during the meiotic segregation. Due to this, the
resulting gametes end up with loss of chromosome, or gain chromosome. How
they cause such aberrations will be discussed in Section 2.5.2.

Reciprocal translocation involves breaks in two chromosomes and the subsequent
exchange of segments between the two chromosomes (Figure 2.9). Reciprocal
translocation do not change the number of chromosomes. However, they may
change the size and type of chromosome if the segments being exchanges are
differing in size (Figure 2.9-b). For reasons not yet clear, reciprocal translocations
involving chromosomes 11 and 22 are fairly common in the population.
Fig. 2.9: Reciprocal translocation between two chromosomes
Fig. 2.10: Fluorescence photomicrograph of translocation between chromosomes 5 and 14.

A segment from the short arm of chromosome 5 (yellow) has been mutually
exchanged with a segment from the long arm of chromosome 14 (red). Courtesy:
Science Photo Library
32
Reciprocal translocations can give rise to deletion-duplication conditions and Chromosomal Aberrations
can cause disorders associated with such conditions. However, as in the case of
Robertsonian translocation, an individual possessing the translocation himself
would not show any abnormal phenotype. Due to disturbances during meiotic
segregation of these translocated products, individual of the next generation have
a possibility of showing abnormal phenotype. This is discussed in Section 2.5.3.
2.4.5 Inversions
An inversion is a condition wherein a segment of a chromosome is inverted.
This is caused by two breaks in the chromosome and the subsequent rejoining in
a reverse manner. This changes the order of genes on that chromosome and does
not cause any changes in the chromosome number (Figure 2.11). Depending on
the involvement of the centromere, inversion are of two types – pericentric and
paracentric.
• Pericentric inversions occur when the inverted segment that includes the
centromere. The product after inversion can differ significantly in the arm
length and thus change the type of chromosome (eg: sub-metacentric to
metacentric as shown in Figure 2.11-a).
• Paracentric inversions occur when the inverted segment does not include
the centromere. The product after inversion remains the same type as the
original except for a change in the order of genes (Figure 2.11-b)
Fig. 2.11: Pericentric and paracentric inversions
Pericentric and paracentric inversion are both balanced rearrangements because

they do not cause any net loss or gain of genes. Except in the very rare cases that
the break points in the chromosome is within a gene (which gets disrupted),
individuals with inversions do not show any abnormal phenotype. As you may
expect, their effects are seen as deletion-duplication only in the next generation.
Hence we shall discuss it under the causes of aberrations in Section 2.5.4.
2.4.6 Isochromosomes and Ring chromosomes

Isochromosomes
An isochromosome is an abnormal chromosome with two identical arms – either
having two short (p) arms or two long (q) arms. An isochromosome, thus, has an
entire arm deleted along with the duplication of the other arm. This type of
aberration is caused due to the transverse separation of the centromere during
cell division instead of the normal lateral separation (Figure 2.12).
33
Human Cytogenetics
Fig. 2.12: Origin of isochromosome by transverse separation of centromere
Isochromosomes, due to their deletion-duplication nature, cause abnormal

phenotypes in individuals possessing them. The most common isochromosome
is that of the X chromosome. This condition leads to the individual showing
phenotypic charactertictics of Turner syndrome. The missing genes on the missing
arm contributes to the development of Turner syndrome in these females. Such
X-isochromosomes account for as much as 15% of Turner syndrome cases.
Ring chromosomes
Ring chromosomes are formed when a chromosome losses its telomere regions
and joins back on itself end-to-end. Breaks at the terminal regions cause the
chromosome to have “sticky ends” because of loss of telomere region. These
end, thus, join with each other causing the chromosome to become circular or
‘ring-like’ (Figure 2.13). Since the two terminal fragments are lost, loss of genes
in those regions can have an effect on the phenotype. If these regions have
important genes, their consequences can be serious abnormality in the phenotype.
Fig. 2.13: Formation of a ring chromosome
34
Fig. 2.14: Fluorescence photomicrograph showing normal chromosome 2 and ring

chromosome 2. Note the presence of telomere (green) in the normal chromosome
and its absence in the ring chromosome. Courtesy: Journal of Medical Genetics
Disorders caused by ring chromosomes are not due to the ring formation itself,
but due to the deletion of the genes in terminal regions. Also, ring chromosome
are unstable during mitosis, hence the daughter cells may have lost the
chromosome altogether. This results essentially in a monosomy. As much as 5%
of Turner syndrome cases are shown to be due to ring chromosome-X. Some of
the other disorders include ring chromosome 20 syndrome where a ring formed
by one copy of chromosome 20 is associated with epilepsy; ring chromosome 14
and ring chromosome 13 syndromes are associated with mental retardation and
dysmorphic (malformation) facial features; ring chromosome 15 is associated
with mental retardation, dwarfism and microcephaly (small head).
2.5 CAUSES OF CHROMOSOMAL

ABERRATIONS
In the preceding sections we looked at the different types of numerical and
structural aberrations, and their effects on phenotypes. We briefed through the
causes and origins of these aberrations. In this section we will discuss them in
detail.
Table 2.2 gives an overview of the types of aberrations and the origin of their
causes. It is evident that the abnormality can occur not only during gamete
formation, but also in the previous generation as well as after fertilization. Since
the time of occurrence would lead to different consequences, it is important to
analyze existing aberrations and offer effective methods for those who are at
risk. Some of these methods are explained in the following unit. If an abnormal
child is born into a family, it is strongly advised that the family should undergo
genetic counseling. Finding the cause of the abnormality and taking steps to
reduce future abnormalities is just as important as learning to deal with an affected
child.
35
Human Cytogenetics Table 2.2: Causes of different chromosomal aberrations
Type of aberration Possible causes Time of occurrence

Numerical (aneuploidy) Non-disjunction Parental meiosis, early zygote
mitosis
Large deletion/duplication Robertsonian Parental generation, subsequent
(whole chromosome arms) translocation segregation at meiosis
Isochromosome Parental meiosis
Small deletion/duplication Reciprocal Parental generation, subsequent
(part of chromosome arms) translocation segregation at meiosis
Pericentric Parental generation, crossover
inversion within inversion during meiosis
Micro deletion/duplication Unequal crossing Parental meiosis
(one to 5 genes involved) over
Break without Parental germline cells, early
joining zygotic cells
(terminal deletion)
Ring chromosome Terminal breaks Parental germline
producing sticky
ends
2.5.1 Non-disjunction
Non-disjunction is the failure of separation of the chromosomes during mitosis
or meiosis. Normal division involves the separation of the two arms (mitosis
and meiosis-II) of the chromosomes or separation of the two chromosomes
(meiosis-I) during the anaphase stage. This ensure that one copy of each is moved
to each pole and consequently each daughter cell receives one copy. When this
separation fails, both copies will move to one pole. Hence, one of the daughter
cells will now have two copies while the other has no copies of that chromosome.
Simply put, this is the basis of aneuploidy changes where there is one extra copy
present or one copy missing in the cells. Figure 2.15 shows the normal meiotic
and mitotic division and the consequences of non-disjunction at meiosis-I,
meiosis-II and mitosis anaphase stages.
The occurrence of non-disjunction is itself dependent on many factors. Some of

these factors are:
• Advanced maternal age has been well correlated with an increase in the
chances of non-disjunction. This is well illustrated in the fact that incidence
of Down syndrome increases drastically as the maternal age increases. Figure
2.16 shows a graph correlating maternal age and incidence of Down
syndrome (here Down syndrome is indicative of non-disjunction). This
increase is attributed to the aging of the primary oocyte as age progresses
and a reduction of the maternal competence to identify and abort abnormal
fetuses.
36
Fig. 2.15: (A) Normal segregation during meiosis-I and II. (B) Non-disjunction occurring
at meiosis-I producing gametes that can cause trisomy. (C) Non-disjunction at
meiosis-II producing gametes that can cause monosomy and trisomy. (D) Normal
mitotic division and Non-disjunction during early zygotic mitosis that can give
rise to different cell lines leading to mosaicism.
Fig. 2.16: Incidence of Down syndrome in relation to maternal age

37
Human Cytogenetics • Increase in the time between ovulation and fertilization is well documented
in animals to increase the rate of non-disjunction. As the frequency of
copulations reduces there is an increased chance that there is a delay between
ovulation and fertilization.
• Exposure to mutagens in general increases the chances of non-disjunction.
Especially those who are constantly exposed to radiations have a high risk
of non-disjunction.
• Genetic control of non-disjunction has been shown in a few species of
Drosophila (fruit fly). These findings accounts for those few families that
have shown to be prone to recurrent non-disjunction.

As discussed before, Robertsonian translocation or centric fusion, causes a
balanced rearrangement in the individual without any phenotypic abnormalities;
however, due to improper meiotic segregation they give rise to trisomy-like and
monosomy-like conditions in the offspring of such individuals.
A normal chromosomal complement in humans consists of two copies each of

the 22 chromosomes and XY (for males) or XX (for females) – total of 46. Let
us consider an individual who has a Robertsonian translocation between
chromosomes 14 and 22. This person has a total of only 45 chromosomes. He
has two copies of all the other chromosomes except 14 and 21. For this pair of
chromosomes he has one chromosome 14, one chromosome 21 and one
translocation 14/21 chromosome (Figure 2.17).
Fig. 2.17: Chromosome complement of 14 and 21 in a balanced translocation carrier
In a normal individual, during meiosis, one copy of each of these chromosome

moves to each pole. This results in daughter cells each containing one copy of 14
and one of 21. In a translocation individual, however, because there are three
chromosomes instead of four two of them move to one pole and one moves to
another pole. This causes abnormal chromosomal constituents in the daughter
cells (gametes). There are different possible ways of these three chromosomes
segregating as shown in Figure 2.18. It is clear that only a small portion of gametes
produced by individuals with such balanced translocations can produce normal
offspring. Thus, a Robertsonian translocation can give rise to monosomies and
trisomies of different chromosomes and their associated syndromes.
38
Fig. 2.18: Segregation products of a balanced translocation carrier. The last three
possibilities (monosomy 21, trisomy 14, and monosomy 14) are lethal conditions.
Only trisomy 21 is compatible with survival.
You should note that although these abnormalities do not cause true trisomies or
monosomies, they give rise to conditions that are akin to true trisomies and
monosomies. This is because, as stated before, the long arms of these
chromosomes contain the bulk of the genes for that chromosome; presence of
extra copies of the long arm has the same effect as having an extra copy of the
entire chromosome.

Translocations not only cause trisomy-like and monosomy-like conditions, they
also produce deletion-duplication conditions. A deletion-duplicaion is a condition
where one segment of the chromosome is missing (deletion) and another is present
in an extra copy (duplication). Figure 2.19 shows an example of a deletion-
duplication condition.
Fig. 2.19: Deletion of genes FGHI present in only one copy) and duplication of genes QR
(present in three copies). All other genes are present in two copies which is the
normal complement.
39
Human Cytogenetics Reciprocal translocations, wherein there is a mutual exchange of segments
between two chromosomes, cause abnormal meiotic segregation. This
abnormality is due to the formation of a quadrivalent of the four chromosomes
during pairing (Figure 2.20). This structure is formed because the chromosomal
segments always pair with their homologous regions. When such a complex
structure is formed, separation of the chromosomes can happen in different ways
depending on their orientation in the spindle. Figure 2.20 shows the different
possibilities of segregation of a quadrivalent formed from reciprocally translocated
chromosomes.
Fig. 2.20: Reciprocal translocation between two chromosomes (red and blue), subsequent
quadrivalent formation, and meiotic segregation
By analyzing the segregation products you should be able to predict the condition
of the offspring from such a gamete. The first two segregation patterns produced
phenotypically normal offspring. The next two segregation patterns may produce
surviving offspring, but they will show abnormal phenotype due to the deletion-
duplication condition. Depending on the size of the del-dup segment the severity
may vary. The last two segregation patterns are usually lethal. This is due to the
del-dup segments being very large in these cases. If you recall, deletions of over
2% of the genome is incompatible with survival.
Hence, translocations by themselves do not cause deletions or duplications; it is

only in the next generation that their effects are seen. It cannot be emphasized
enough that a balanced translocation carrier will most probably have normal
phenotype, unless the breakpoint disrupts some gene. As with all balanced
rearrangements, we shall see that inversions, too, cause deletions and duplications
because of abnormalities in meiotic division.
40
2.5.4 Inversions Chromosomal Aberrations
Inversions are balanced genetic rearrangements that invert segments within the
chromosome. Depending on the involvement of the centromere they are either
paracentric or pericentric (see Section 2.4.5). It is important to distinguish between
these two types because the crossover products after meiosis is different for
each.
In Section 2.5.3 you saw how a reciprocal translocation gives rise to an abnormal
complex during meiotic pairing. By the same logic, inversions too cause the
formation of “inversion loops” during meiotic pairing. Because one of the two
homologous chromosomes contains the inversion, it folds back into a loop to
allow for maximum homologous pairing (Figures 2.21 and 2.22). Crossing over
is a unique event in meiosis that causes recombination between the homologous
pair of chromosomes. When crossing over occurs in a region within an inversion
loop, it gives rise to recombinant products that contain deletion and duplication.
Look at Figures 2.21 and 2.22. You can see that the formation of the inversion
loop produces maximum homologous regions to be paired up. In pericentric
inversions the inversion loop contains the centromere and in paracentric inversion
the centromere is outside the inversion loop. Crossing over outside the inversion
loop will give rise to normal chromosomes and inversion chromosomes. A cross-
over within the inversion loop, however, produces two non-recombinants (one
normal and one inverted) and two recombinants (that contain deletion and
duplication). These recombinants will contain duplication of certain genes along
with deletion of other genes.
Fig. 2.21: Pericentric inversion and its products due to crossing over within the inversion
loop. NCO-Non cross-over; SCO-Single cross-over.
41
Human Cytogenetics
Fig. 2.22: Paracentric inversion and its products due to crossing over within the inversion
loop. NCO-Non cross-over; SCO-Single cross-over.
In pericentric inversions the deleted and duplicated segments do not involve the
centromere; hence four types of gametes will be produced. Two of these will
contain the aberrations; depending on the extent of the aberration it may or may
not be compatible with survival. In paracentric inversions the deleted and
duplicated segments involve the centromere, hence we get one dicentric
(containing two centromeres) and one acentric (containing no centromere)
chromosome as recombinants. The dicentric chromosome forms a dicentric bridge
during anaphase and thus arrests cell division (does not produce a gamete). The
acentric chromosome is lost during division and thus doesn’t produce any viable
gamete. Hence, only two types of gametes are produced from such individuals –
one normal and one containing the inversion. These offspring will have normal
phenotype because the inversion itself is a balanced rearrangement. Hence, the
inversion itself will tend to persist in the population.
2.6 SUMMARY
Chromosomal aberrations are, broadly speaking, any kind of changes in the
number and structure of chromosomes. Changes in number are classified as
numerical changes; and changes in structure and size are classified as structural
changes. Changes in ploidy level (euploidy changes) are seen only in plants and
lower organisms. Aneuploidy changes are, however, seen commonly in animals
including humans. Trisomy disorders in humans are a commonly occurring
chromosomal aberration. They cause conditions such as Down syndrome (trisomy
21), Edward syndrome (trisomy 18), and Patau syndrome (trisomy 13). Changes
in the sex chromosome constitution causes conditions such as Turner syndrome
42 (monosomy X – XO) and Klinefelter syndrome (XXY).
Numerical aberrations needn’t necessarily be present in all of the affected Chromosomal Aberrations
individuals. Cases of milder symptoms have been shown to be due to mosaicism
whereby only a subset of the individual’s cells contains the aberration. The
presence of normal cells in the individuals lessens the severity of the symptoms.
The variability of the symptoms also depends on which organ’s cells contain the
aberration. If the aberrant chromosomal genes are not normally expressed in the
organ containing cells with the aberration, no symptoms will develop. Chimerism
is similar to mosaicism differing only in the origin of the different cell lines
being from different zygotes.
Structural aberrations include deletions, duplications, translocations and

inversions. They also include isochromosome and ring chromosome that are the
cause for a small percentage of syndromes like Turner syndrome. Among the
structural aberrations, it is only the deletions and duplications (unbalanced
changes) that majorly cause abnormal phenotypes such as Cri-du-chat syndrome
and Charcot-Marie-Tooth disorder. Balanced rearrangements (translocations and
inversions) by themselves do not cause abnormal phenotype because there is no
actual loss or gain of genes – only their rearrangement. They, however, cause
deletions and duplications in the next generation.
Numerical aberrations usually arise due to non-disjunction (failure of chromosome

separation during division). Non-disjunction can occur during meiosis-I, meiosis-
II or mitosis. The products of non-disjunction usually causes either monosomy
or trisomy. Monosomy of any chromosome is usually a lethal condition, except
for X chromosome (Turner syndrome). Trisomy for the larger chromosomes is
usually lethal. Trisomy of small acrocentric chromosomes is most commonly
seen (chromosomes 21, 13, and 18). Trisomy-like conditions can also be produced
by abnormal segregation of centric fusions (Robertsonian translocations) as is
seen in a percentage of cases of Down syndrome.
Coupled deletions and duplications (Del-Dup) can arise from reciprocal

translocations and inversions. These aberrations are balanced and do not cause
any abnormal phenotype themselves (except if the breakpoint disrupts a gene).
However, these rearrangements cause abnormal pairing up and segregation during
meiosis giving rise to the deletions and duplications.
Chromosomal aberrations not only have their significance in medical genetics,

but also in evolutionary biology. Certain aberrations, such as inversions, occur
naturally and become stable in populations. They alter the structure of the genome
and contribute to the evolutionary course for that species. Other aberrations,
such as deletions, cause genome instability to the extent that they are lethal. Still
others, such as centric fusion, play a role in speciation. For example, centric
fusion of two ape chromosomes (acrocentric) gave rise to the human chromosome
2 (metacentric). The study of chromosomal aberrations thus has its importance
in multiple fields of life sciences.
Suggested Reading
Peter, J. Russel. 2006. Genetics – A Molecular Approach. 2nd Edition, Chapter
17. Delhi: Pearson Education Inc.
Daniel, L. Hartl and Elizabeth W. Jones. 2005. Genetics – Analysis of Genes and
Genomes. 6th Edition, Chapter 8. New Delhi: Jones and Bartlett Publishers Inc.
43
Human Cytogenetics Benjamin A. Pierce. 2008. Genetics – A Conceptual Approach. 3rd Edition,
Chapter 9. New York: W. H. Freeman and Company.
Epstein C. J. 1988. Mechanisms of the Effects of Aneuploidy in Mammals. Annual
Review of Genetics. 22:51
Stewart, G. D, T. J. Hassold, and D. M. Kurnit. 1988. Trisomy 21: Molecular
and Cytogenetic Studies of Non-disjunction. Advances in Human Genetics. 17:99
Sample Questions
1) What are the structural chromosomal aberrations, give a note with examples?
2) Give an account of common genetic syndromes caused by aneuploidy.
3) Describe the phenomenon of Genetic Imprinting.
4) Write short notes on Non-disjunction and translocations?
44
UNIT 3 RECENT TRENDS IN HUMAN
CYTOGENETICS
Contents
3.1 Introduction
3.2 Cell Culture Medium: Peripheral Blood Lymphocytes for Chromosome
Studies in Humans
3.3 Chromosome Banding and the Human Karyotype
3.4 Cytogenetic Approaches to Map Genes
3.5 Fluorescence in Situ Hybridization (FISH)
3.6 Advances in Molecular Cytogenetic Analysis
3.6.1 Whole Chromosome Painting and M-FISH
3.6.2 Spectral Karyotyping (SKY)
3.6.3 Comparative Genomic Hybridization (CGH)
3.6.4 Array CGH (aCGH)
3.7 Flow Karyotyping
3.8 Summary
Further Reading and References
Sample Questions
Learning Objectives
&
Ø define the role of cytogenetics and understand the Human Karyotype;
Ø explain the efficacy and drawbacks in conventional karyotyping;
Ø elucidate the role played by molecular biology in the evolution of Molecular
Cytogenetics;
Ø discuss in detail the principle and process of Fluorescent In Situ
Hybridization; and
Ø describe the newer methods of FISH based cytogenetic analysis and their
applications and drawbacks.
3.1 INTRODUCTION
The branch of genetics which deals with the study of the structure and function
of the cell, especially the chromosomes is known as Cytogenetics. Cytogenetic
analysis can be carried out virtually for any cell in the body. However analysis of
certain cells such as lymphocytes yield the best quality of chromosomes for study.
Generally to undertand the complete chromosomal complement, Karyotyping is
done. A Karyotype is defined as the identification of chromosomes based on
their size, centromere location and banding pattern. When the chromosomal image
is organized based on the same criteria then we get an Ideogram. The normal
45
Human Cytogenetics human karyotype is written as 46, XX for females and 46, XY for Males. The
nomenclature and correct method of denoting the karyotype, normal chromosomes
and aberrations (which have been described in Unit 2) are done in accordance to
the International Society for Chromosome Nomenclature (ISCN) guidelines.
3.2 CELL CULTURE MEDIUM: PERIPHERAL

BLOOD LYMPHOCYTES FOR
CHROMOSOME STUDIES IN HUMANS
As the culture is essentially set up outside a living system in a laboratory and
under artificial conditions, it is critical that the cells be made to ‘feel at home’.
Hence macro-environmental conditions such as pH, Temperature, O2/ CO2
concentrations, humidity and sterility have to be carefully maintained while setting
up the cell cultures. In addition to this, other micro environmental conditions
like nutrients, growth factors, signal molecules etc., should also be carefully
regulated.
Peripheral blood forms an ideal source for studying Human Chromosomes. This
is because it contains lymphocytes and is easily collected without much discomfort
to the subject. These types of cultures are of the primary type as whole blood is
used, the culture is finite i.e the cells are only viable for a maximum period of 72
hours after it is initiated. These cells have large nuclei and yield high quality
Metaphases for analysis. Also genetic damages if present can be easily observed
on analysis. However the drawback of using these cells is that they are mature
cells. In in vitro cultures often a mitogen be used. The function of mitogen is to
stimulate division of the lymphocytes that are under culture. One commonly and
sucessfully used mitogen is Phytohemaglutinin (PHA) an extract from the plant
Phaseolus vulgaris. During culture in order to arrest the cells at metaphase
certain mitotic spindle inhibitors like Colchicine or Methotrexate are added at
two to four hours before the termination of the culture.
RPMI 1640 has traditionally been used for the serum-free expansion of human
lymphoid cells. (RPMI- Roswell Park Memorial Institute). It has traditionally
been used for growth of Human lymphoid cells. This medium contains a great
deal of phosphate and is formulated for use in a 5% carbon dioxide atmosphere.
Generally a bicarbonate buffer is required. However several modifications are
available. pH indicator is Phenol Red.
3.3 CHROMOSOME BANDING AND THE HUMAN

KARYOTYPE
Maximo Drets and Margery Shaw established methods to stain metaphase
chromosomes using a dye called Giemsa, which produces a signature banding
pattern, called G-bands, for each of the 24 different human chromosomes. G-
banding patterns can be used to detect chromosomal translocations, deletions,
and insertions, and localising the genes to specific regions of the chromosomes.
Chromosomal Banding Patterns: Chromosomes are composed of chromatin.

Chromatin is nothing but the DNA Polynucleotide encased within several different
proteins including Histones. Chromatin itself is of different types; the more active
46
regions are known as Euchromatin where as the less functional and more structural Recent Trends in Human
Cytogenetics
regions are known as heterochromatin. On staining ‘Banding’ pattern that is
specific to each chromosome is observed that helps in identifying the chromosmes
and arranging them in the form of karyotypes. The differential pattern of staining
of chromosomes occurs with the additional treatment of the cultures with
proteolytic enzymes such a Trypsin, Alkali or even Heat.
Banding techniques are often referred to by a single alphabet (such as G, R, C, Q,

NOR) that denotes the type of banding and more precisely by three alphabets
that denote: 1) The type of banding observed, 2) The treatment being used and 3)
by the stain being used.
For example: G Banding is also known as GTG banding indicating
G for G Banding
T for Trypsin when used in culture
G for Geimsa stain when used in culture
a) G-banding: This technique does not involve a fluorochrome-based
pretreatment. During mitosis, the 23 pairs of human chromosomes condense
and are visible under a light microscope. A karyotype analysis usually involves
blocking cells in mitosis and staining the condensed chromosomes with
Giemsa dye at metaphase stage. The dye stains regions of chromosomes that
are AT rich (i.e. rich in the DNA base pairs Adenine and Thymine) producing
a dark band. The G-light bands are thought to be relatively GC-rich (rich in
the DNA base pairs guanine and cytosine). Furthermore, the light bands
represent the regions which are relatively open and which contain most of
the genes, including house keeping genes (genes active in every cell type).
On the other hand, the G-dark bands represent regions which are relatively
compact and contain few genes. The genes in the dark regions are mainly
tissue-specific (Fig. 3.1).
b) R-banding: This method involves a moderate use of alkaline with or without

heating to obtain a banding pattern that is reverse to G Banding. Here the AT
rich region with more heterochromatin is lightly stained and the more active
GC regions form the dark bands. In this method centromeric regions do not
take up staining.
c) C-banding: In this method, method of staining only the constitutive

heterochromatin regions of chromosomes is stained. That is only the
centromeres and the satellite region on chromosomes gets darkly stained.
Hot alkali is used to accomplish this effect; treatment with same would bring
about depurination of DNA at regions that are vulnerable. As constitutive
heterochromatin represents the most resistant region on the chromosome to
such treatment, it remains intact and is stained.
d) Q-banding: This banding pattern is obtained by treating with a fluorochrome

or the fluorescent dye quinacrin. They can be identified by a yellow
fluorescence of different intensity. Most parts of the stained DNA are
heterochromatin. Quinacrin binds those regions which are rich in AT and G-
C, but fluorescences only A-T-quinacrine regions. A-T regions are seen more
in heterochromatin than in euchromatin. Therefore, by this banding method
heterochromatin regions are labeled preferentially. The characters of the
47
Human Cytogenetics banding regions and the specificity of the fluorochrome are not exclusively
dependent on their affinity to regions rich in A- T, but it depends on the
distribution of A- T and its association with other molecules such as histone
proteins.
e) NOR Banding: Human chromosomes belonging to the D (13, 14 and 15) as

well as the G (21 and 22) group of chromosomes contain secondary
constrictions called satellites. These regions are in fact the Nucleolar
Organizing Regions, which come together to form the Nucleolus. This is the
site for rRNA synthesis- which is the most abundant type of RNA found in
mammalian cells. Here in addition to alkali treatment, Sivler Nitrate staining
is used which gets preferentially deposited in these regions, making them
darkly stained.
Fig. 3.1: GTG Banded Male Chromosomes

Source: http://carolguze.com/images/chromosomes/ideochrm.gif
3.4 CYTOGENETIC APPROACHES TO MAP

GENES
The very nature of cytogenetic analysis lends to identifying the location of gene
i.e. Gene Mapping. This is because of the fact that most disorders are caused by
mutations in genes. If the mutation involves a chromosomal aberration, then it
follows that by identifying the defect we can trace the location of the gene on to
a specific chromosome. Cytogenetic approaches in addition to providing
associations, between chromosomal abnormalities and disease, have also allowed
researchers to map genes to particular chromosomes. However in conventional
chromosomal analysis some of the following limitations are:
1) Low resolution limit: Unable to identify subtle chromosomal aberrations

such as microdeletions and cryptic translocations, both of which involve
very small chromosomal segments but are the genetic cause for disease.
48
2) Inability to identify copy number variants that arise due to gene duplications Recent Trends in Human
Cytogenetics
or deletions.
3) Delay in culturing cells to understand presence or absence of a gene.
3.5 FLUORESCENCE IN SITU HYBRIDIZATION

(FISH)
Overview
It essentially involves the hybridization of a genetic ‘probe’sequence to its
complimentary region in the human genome.In order to accomplish this, the
target chromosomes are first denatured. The probe of course is composed of
DNA/ RNA or cDNA from the gene of interest. The probe is essentially a stretch
of labeled oligonucleotide that is used to identify the location of a gene on a
chromosome. The principle of this method lies in choosing probes that have a
greater specificity.
In early work, probes were labeled with radioactive isotopes and target sequences
were identified by autoradiography. This method of labeling and detection limits
both the sensitivity of the technique and its resolution. In particular, the original
protocol only allowed the detection of tandemly repeated sequences such as the
ribosomal genes and satellite DNA. By 1981, however, investigators had
optimized the insitu protocol for use in mapping single copy mammalian
sequences, and in 1984 an improved method was developed for better resolution
of chromosome banding patterns.
Nevertheless, the technique is still not ideal because with single-copy radioactive
probes, localization of genes can not be determined within the chromosomes of
a single cell; instead, it is necessary to perform a statistical analysis of silver
grain distributions in 50-100 sets of metaphase chromosomes.
Two critical changes in the protocol now allow the detection of single-copy
sequences and their high-resolution mapping through the direct observation of
single chromosomes. The first change made is in the nature of the label with the
substitution of fluorescent tags for radioactive ones and dramatic improvement
of the physical resolution of the hybridization site. The modified in situ protocol
that utilizes fluorescent tags is referred to as FISH (fluorescent in situ
hybridization).
The second change was in the nature of the hybridization cocktail. With the
inclusion of a large excess of unlabeled total genomic DNA, it is possible to
block dispersed repetitive sequences — present in essentially every genomic
region larger than a few kilobases in length — from hybridization to their targets
throughout the genome.
FISH (fluorescence in situ hybridization) is a cytogenetic technique developed

by biomedical researchers in the early 1980s that is used to detect and localize
the presence or absence of specific DNA sequences on chromosomes. FISH uses
fluorescent probes that bind to only those parts of the chromosome with which
they show a high degree of sequence complementarity. FISH is often used for
finding specific features in DNA for use in genetic counselling, medicine, and
species identification. FISH can also be used to detect and localize specific 49
Human Cytogenetics mRNAs within tissue samples. In this context, it can also help define the spatial-
temporal patterns of gene expression within cells and tissues.
Fig. 3.2: Overview of the FISH Method

Source: http://www.bio.davidson.edu/courses/molbio/molstudents/spring2003/baxter/FISH.gif
The FISH method involves four steps: fixation, hybridization, washing, and
detection.
Fig. 3.3: Overview of the Steps Involved FISH Technique
50
Types of Probes Recent Trends in Human
Cytogenetics
A probe is a stretch of DNA sequence that hybridizes with DNA/RNA based on
the complementary base pairing property. When probes developed from known
sequence of a gene hybridize with test DNA sample, it indicates the presence of
the complementary sequence or the gene in the sample tested. The different types
of probes are:
a) Locus specific probes: These probes bind to a particular region of a

chromosome. This type of probe is useful when scientists have isolated a
small portion of a gene and want to determine on which chromosome the
gene is located.
b) Repeat binding probes: These probes bind to part of the human genome
that contains certain types of repeats. Some such elements include
Centromeric, Telomeric and Alu repeat (a type of transposon) probes. These
probes are used to detect the presence of the repeats and detect centromere
related aberrations.
c) Whole chromosome probes: They actually are collections of smaller probes,

each of which binds to a different sequence along the length of a given
chromosome. Using multiple probes labeled with a mixture of different
fluorescent dyes, scientists are able to label each chromosome in its own
unique color. The resulting is a full-color map of the chromosome. Whole
chromosome probes are particularly useful for examining chromosomal
abnormalities by screening the whole genome-for example, when a piece of
one chromosome is attached to the end of another chromosome.
Fig. 3. 4: Types of Probes Used in FISH Technique

Source: http://www.austincc.edu/mlt/mdfund/pictures/FISHprobes.jpg
d) Arm specific probes: These probes hybridize to unique sequences either p

or q arms of all chromosomes (except p-arm of acrocentric chromosome).
Their use in molecular cytogenetic examination of patients include analysis
of chromosome patterns involved in translocations, to study mutagenesis in
human chromosomes, analysis of complex chromosomal rearrangments in
51
Human Cytogenetics neoplatic cells. Arm specific probes are available in two colors: green and
red.
Fig. 3.5: FISH Image Showing Chromosome with Telomeric Probes

The chromosomes are counter stained with DAPI
Source: http://childrenshospital.org/az/Site1198/Images/Karyotype_Fluroscent_in_
situ_hybridization.jpg
e) Band specific probes: Band specific probes are capable of detecting small
chromosomal segments those involved in subtle translocations with break
points. These particular probes increase the resolution typically obtained
with whole chromosome probes when identifying chromosomal
abnormalities.
The NOR probe is specific for p-arm of acrocentric chromosome, where as the
Alu probe will detect Alu repeat sequences found in primate chromosomes.
3.6 ADVANCES IN MOLECULAR

CYTOGENETIC ANALYSIS
After the development of FISH several advances in FISH based methodology
were developed, some of these are described below.
3.6.1 Whole Chromosome Painting and M-FISH

In some cases it is advantageous to label larger segments of chromosome such as
part of a arm, one arm or the entire chromosome itself. All these can then be used
to track chromosomal aberrations including translocations (as illustrated in Fig.
3.6). However it is not possible to span the entire chromosome using a single
probe. Hence chromosome paint probes are used. These are probes that contain
overlapping ends such that they will hybridize at different points along the desired
target chromosome giving a fluorescent label to the entire region. By using several
combinations of probes each chromosome in the human genome can be given a
separate color. Such a combinatorial approach is known as M-FISH or Multicolor
FISH. Spectral Karyotyping (SKY) and Comparative Genomic Hybridization
(CGH) are types of M-FISH.
52
Recent Trends in Human
Cytogenetics
Fig. 3.6: FISH Analysis by whole Chromosome Painting (Source: http://

www.biomedcentral.com/content/figures/1471-2431-6-11-3-l.jpg)
The figure shows a translocation of SRY material to the q-arm of the del(X). The
X chromosome is painted in green and the Y chromosome in red/orange. Normal
cross hybridization of the Y painting probe is seen in proximal Xq of both the
normal X chromosome and the del(X), whereas normal cross hybridization to
Xp is only seen in the normal X chromosome as these sequences are missing
from del(X). The del(X) also shows a signal at distal Xq, corresponding to
translocated Y sequences. Inset (A): SRY material (red/orange) is located at distal
Xq while X centromere is in green. Inset (B): The G- banding of del (X) and
normal X.
Advantages
1) Easy to detect structural and numerical aberrations.
2) Each chromosome can be given a different label allowing screening of the
entire genome.
Disadvantage
1) Costly to label the entire genome using probe combinations.
2) Cannot detect paracentric inversions.
3.6.2 Spectral Karyotyping (SKY)

Spectral karyotyping is a molecular cytogenetic technique used to simultaneously
visualize all the pairs of chromosomes in an organism in different colors.
Fluorescently labeled probes for each chromosome are made by labeling
chromosome-specific DNA with different fluorophores. Because there are a
limited number of spectrally-distinct fluorophores, a combinatorial labeling
method is used to generate many different colors. Spectral differences generated
by combinatorial labeling are captured and analyzed by using an interferometer
attached to a fluorescence microscope; this device is used to distinguish minor
changes in the fluorescent signal that cannot be observed by the human eye.
53
Human Cytogenetics Then the image processing software assigns pseudocolors to each spectrally
different combinations, allowing the visualization of the individually colored
chromosomes. Hence this method can be used as a screening method for analyzing
the entire chromosomal compliment at once.
Advantages
1) A sensitive method, can detect complex translocation involving two or more
chromosomes.
2) Provides a critical screening method that can analyze all the chromosomes
at once.
Disadvantages
1) Cannot detect inversions especially paracentric inversions.
2) Due to the nature of the probes they are very expensive.
Fig. 3.7: Schematic Representation of SKY Hybridization Experimental Set Up

Source: http://atlasgeneticsoncology.org/Deep/Images/ComparCancCytogFig2.jpg
54
3.6.3 Comparative Genomic Hybridization (CGH) Recent Trends in Human
Cytogenetics
This method is based on ratiometric analysis. This method uses the following
approach:
1) DNA is extracted from the sample that needs to be tested. It is labeled using
a fluorescent dye (such as TRITC- Tetramethyl Rhodamine Isothiocyanate)
by the Nick Translation method.
2) A suitable control is also taken; this too is labeled but with a distinctly different
colored fluorescent dye (for. Ex. FITC- Fluoresce in Isothiocyanate which
gives a green color).
3) Both these labeled DNAs will then be hybridized on to a slide containing
Normal Human Metaphase Chromosomes.
4) Once the hybridization is completed the analysis is done.
Here the analysis is done by comparing the test or sample DNA as compared to
the control DNA.
Three outcomes are possible while applying this procedure. They are:
1) No loss or gain of genetic material in a particular region. This results in a
balanced color being formed and balance between both the dyes (in this case
it would appear orange= Red labeled DNA = Green labeled DNA).
Fig. 3.8: Schematic Representation of the CGH Process

Source: http://atlasgeneticsoncology.org/Deep/Images/ComparCancCytogFig3.jpg 55
Human Cytogenetics 2) Regions which have been deleted in the test sample will be showing a greater
signal of the normal DNA. In this case it would result in a red signal. (Green
label DNA< Red Labeled DNA).
3) Region where there has been a gain of genetic material in the sample DNA
as compared to the normal DNA. In this case it would show an excess of the
sample’s fluorescent color (Green label DNA>Re Labeled DNA).
This method is greatly used in the analysis of copy number variants (CNVs) in
genes. CGH is widely used in Cancer diagnosis and research as well as to study
evolutionary changes in the human genome by carrying out CGH using ancestral
DNA (Ex. Chimpanzee) with Human DNA.
Fig. 3.9: Microphotograph of a CHG Metaphase and a Schematic Representation of the

Ratiometric Analysis
Source: http://www.aist.go.jp/aist_e/aist_today/2003_07/p20_1.jpg
Advantages
1) Highly sensitive method can detect minor changes in copy number variations
(CNVs.)
2) A screening method that can screen the entire genome for CNVs.
Disadvantages
1) Whole genome labeling is expensive.
2) Can detect only gain/ loss in the sample’s DNA but can not detect any other
56 type of aberration.
3.6.4 Array CGH (aCGH) Recent Trends in Human
Cytogenetics
DNA microarrays allow for simultaneous analysis of genes products or DNA
copy numbers for thousands of loci. These microarrays contain defined human
chromosomal segments (isolated from a chromosomal library), that have been
‘spotted’ or fixed onto a glass slide. The spotting is done in a very precise manner
such that the location of each spot as well its content is clearly known. The
microarray will contain several hundreds of such ‘spots’. Once this is complete,
then standard CGH protocol will be followed to determine gain or loss of genetic
material for all the spots on the microarray. The microarray is then incubated
with the labeled test and control DNA. The array is then washed to remove DNA
that is not bound, and the positions in the microarray with labeled DNA fragments.
The resolution that can be achieved with this type of analysis is greater than
what can be done with conventional CGH. This is because the spots on the
microarray can have a defined size. In addition to this the analysis can be done
for Single Nucletide Polymophism which can be mapped using aCGH. However,
the resolution of SNP arrays is currently limited to about 10,000 SNPs per chip.
Fig. 3.10: Schematic Representation of the Array CGH Assay and Analysis of the Results
Source: http://www.ebioservice.com/sbc_2009/images/pic_11.jpg
Advantages
1) Highly sensitive, can carry out analysis for several thousands of variants
simultaneously.
2) CNV as well as SNP analysis can be done.
Disadvantages
1) Very costly to carry out due to high cost of array production and analysis.
2) Low reproducibility of tests.
3.7 FLOW KARYOTYPING

Flow Cytometry is a method that is used to distinguish and separate particles
such as cells or chromosomes. The mechanism involved uses the combinations
of fluorescent labels to create unique labels for the desired chromosomes. The 57
Human Cytogenetics chromosomes in a suitable buffer are then passed through a narrow nozzle of the
flowcytometer. The nozzle is so narrow that each droplet will contain only a few
chromosomes. The drops are then scanned with a laser beam that excites the
flours present. The fluorescent signals are then picked up by a detection system;
the signal is then amplified and based in the presence or absence of a particular
signal the drop is charged using a charging ring. This charged droplet is deflected
using charged deflection plates into suitable collection vials. In this method the sorting
can be done based on the type of signal being observed as well as the strength of the
signal. The overview of the method has been represented in Fig. 3.11.
One of the most common methods is the use of two different dyes. One is, called
Hoechst 33269, binds to A-T base pairs of DNA the other is Chromomycin A
which binds to the G-C rich regions. This combination can be used to sort all the
chromosomes based on the principle that larger the chromosome, greater will be
the AT and GC content, the greater this content the greater will be the resultant
signal strength. Using the strength of the signal the chromosomes can be sorted.
As illustrated in Figure 3.11, the smallest chromosome i.e. 21 shows the lowest
Hoechst and chromomycin staining intensity. Chromosomes 1 and 2, which are
the largest, show the highest Hoechst and chromomycin staining.
Advantages
1) Highly sensitive, capable of carrying out analysis in real time.
2) High throughput, large number of sample can be analyzed.
Disadvantages
1) Trained personnel required to handle instrument.
2) Currently can only detect numerical aberration accurately, used most
commonly to determine ploidy in samples.
Fig. 3.11:Schematic representation of the discrimination and sorting of human chromosomes

FACS (Source: http://www.nature.com/scitable/nated/content/6044/10.1038_nrg
905-f3_thumb_0.gif)
58
Chromosomes that are released from mitotic cells are stained with two DNA- Recent Trends in Human
Cytogenetics
binding dyes with different base-pair specificities, and the fluorescence intensities
of each of several thousand chromosomes are measured in a two-laser flow
cytometer. In the example shown, the two dyes are Hoechst 33258, which binds
preferentially to A-T base pairs, and chromomycin A3, which binds to C-G base
pairs. The resulting bivariate “flow karyotype” (bottom right panel) resolves all
chromosomes except for the 9–12 group. In this example, maternal and paternal
homologous of both chromosomes 21 and 19 are resolved into separate peaks
owing to differences in their DNA content. After measurement, droplets that
contain desired chromosomes, such as chromosome 3 in this example can be
deflected into tubes for molecular analyses. UV, ultraviolet.
3.8 SUMMARY
Traditional banding methods like GTG banding offer cost-effective methods for
screening chromosomes for structural changes. Development of ‘Molecular
Cytogenetics” techniques have revolutionarised the analysis of Human
Chromosomes. It involves the use of modern molecular tools to study different
aspects of chromosomal alterations. These newer techniques are more sensitive
and can detect smaller changes. The discovery of Fluorescent probes have enabled
wide spread use of molecular cytogenetics in a variety of fields. Techniques such
as SKY and CGH are being used to provide valuable insight into complex
chromosomal rearrangements as well as change in the copy number of the genes
(CNVs). Such cytogenetic analysis is particularly useful in the field of prenatal
genetic diagnosis and genetic counseling. Although each technique has several
advantages the disadvantages have limited their applications. Hence a more
common practice would be to combine more than one of the methods described
above. The type of analysis show that the focus is now shifting to cost effective
high throughput chromosomal analysis that is required for genetic diagnosis and
adoption of prophylactic/preventive measures.

Mutulsky, A. 2010. Genetic Disorders and the Fetus: Diagnosis, Prevention
and Treatment. 6th Ed. Wiley-Blacwell Publications.
Cynthia L. Anderson and Charles E. L. Brown. 2009. Fetal Chromosomal
Abnormalities: Antenatal Screening and Diagnosis. American Family
Physician. 15;79 :117-123.
Jeffrey M. Levsky and Robert H. Singer. 2003. Fluorescence in situ hybridization:
past, present and future. Journal of Cell Science, 116, 2833-2838.
Levitsky G.A. 1931. The morphology of chromosomes. Bull. Applied Bot. Genet.
Plant Breed. 27: 19-174.
Miriam S. Dimaio, Joyce E. Fox, Maurice J. Mahoney. 2010. Prenatal Diagnosis:
Cases and Clinical Challenges. Wiley-Blacwell Publications.
Sample Questions
1) What is a Karyotype?
2) Describe the medium most commonly used for Lymphocyte Culture.
59
Human Cytogenetics 3) What are the drawbacks in conventional karyotyping?
4) Describe different Chromosomal banding techniques.
5) What is FISH? What are the different types of Probes used in FISH analysis
6) What is SKY? Describe its applications, advantages and disadvantages.
7) Describe in detail the methods of CGH and aCGH.
8) What is Flow Karyotyping?
60
MANE-001
Human Genetics
Indira Gandhi
Block
4
HUMAN BIOCHEMICAL GENETICS
UNIT 1
Meaning, Scope and Genetic Variation 5
UNIT 2
Enzyme and Protein Diversity in Human Populations 21
UNIT 3
Inborn Errors of Metabolism 31
Expert Committee
Andhra University Dr. P. Venkatramana
Visakhapatnam Assistant Professor
Punjabi University, Patiala Dr. Rukshana Zaman
Assistant Professor
Prof. A. Papa Rao Discipline of Anthropology
Dept. of Anthropology IGNOU, New Delhi
Sri Venkateswara University
Tirupati Dr. Mitoo Das
Assistant Professor
Dr. Roli Mathur Discipline of Anthropology
Scientist ‘C’ IGNOU, New Delhi
Division of Basic Medical Sciences Dr. K. Anil Kumar
Indian Council of Medical Research Assistant Professor
New Delhi Discipline of Anthropology
Dr. Seema Kalra IGNOU, New Delhi
Assistant Professor Academic Assistance provided by
Dept. of Biochemistry Dr. N.K. Mungreiphy, Research Associate
IGNOU, New Delhi (DBT) for the Expert Committee meeting.
Content Editor
Prof. P. Veerraju (Retd.)

Unit Writers
Prof. C.R. Srikumari Srisailapathy (Unit 1) Cover Design
Department of Genetics, University of Madras Dr. Mitoo Das
Chennai Asstt. Professor
Prof. S.M.S.Chahal (Unit 2) Anthropology
Department of Human Biology, Punjabi University, Patiala SOSS, IGNOU
New Delhi
Prof. P.K.Das (Unit 3)
Department of Anthropology, Utkal University, Bhubaneswar
Authors are responsible for the academic content of this course as far as the copyright issues are concerned.
Print Production
Mr. Manjit Singh
July, 2012
ISBN-978-81-266-6136-7
Printed at :
BLOCK 4 HUMAN BIOCHEMICAL
GENETICS
Human genetic variation can be normal and abnormal. The nature of normal
variation is in general more frequent while that of abnormal variation is usually
rare. Further for most of the genetic characters/diseases described in literature so
far, biochemical basis is illustrated only in some conditions. The discussion of
these conditions (normal genetic characters as well as abnormal genetic diseases/
disorders) whose biochemical basis is identified constitute the subject matter of
human biochemical genetics. Therefore the discussion on metabolic diseases
falls under the purview of abnormal variation while that of genetic characters
such as blood groups, red cell enzymes and serum proteins falls under the purview
of normal variation and again the sum total of the discussion of these two
categories of variation fall within the framework of human biochemical genetics.
Concerning the normal genetic characters such as blood groups, red cell enzymes
and serum proteins, the techniques employed to detect these types of the characters
are different. While the agglutination techniques are employed for detection of
blood group antigens present on the surface of the red blood cell, the
electrophoretic techniques are employed for detection of enzymes found within
the red cell (that is, in the cytoplasm of the cell). For identification of the serum
proteins also electrophoretic techniques are employed. That is to say while the
corpuscular or cellular part of the blood, that is, the red cell is used for the
elucidation of blood groups and red cell enzymes, the liquid portion of the blood
i.e., the plasma or serum is used for illustration of plasma/serum proteins.
To enlighten yourself with the different aspects of biochemical genetics we have

included few examples of blood groups systems and metabolic diseases (otherwise
called inborn errors metabolism).
Here in this Block, you will be able to enlighten yourself with human genetic
variation having biochemical basis to enable us to detect these variations in a
way to focus further on treatment aspect of the genetic diseases, having a clinical
significance.
Human Biochemical
Genetics
4
Meaning, Scope and
UNIT 1 MEANING, SCOPE AND GENETIC Genetic Variation
VARIATION
Contents
1.1 Biochemical Genetics
1.1.1 History
1.1.2 Garrod’s Inborn Errors of Metabolism (IEM)
1.1.3 Beadle and Tautum – Genetic Analysis Led to the One-Gene-One Enzyme
Hypothesis
1.1.4 Genetic Code
1.1.5 Revisiting the Question about what is a Gene?
1.2 Biochemical or Metabolic Diseases
1.2.1 Disorders of Amino Acid Metabolism
1.2.2 Disorders of Branched Chain Amino Acid Metabolism
1.2.3 Urea Cycle Disorders
1.2.4 Disorders of Carbohydrate Metabolism
1.2.5 Disorders of Steroid Metabolism
1.2.6 Disorders of Lipid Metabolism
1.2.7 Lysosomal Storage Disorders
1.2.8 Lipid Storage Diseases
1.2.9 Disorders of Purine/Pyramidine Metabolism
1.2.10 Disorders of Copper Metabolism
1.3 Human Blood Group Substances
1.3.1 Introduction to Human Blood Groups
1.3.2 The ABO Blood Group System-History
1.3.3 ABO Blood Groups Substances
1.3.4 Antigens and Antibodies
1.4 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
Once you have studied this unit, you will be able to:
Ø know about introduction to human bio-chemical genetics;
Ø describe one gene one polypeptide concept;
Ø depict Inborn errors of metabolism with typical examples; and
Ø elucidate human ABO blood group system and its fundamentals.
1.1 BIOCHEMICAL GENETICS

In the light of the understanding of basic aspects of genetic variation, let us now
move on to one of the very important specialty in human genetics – known as
Biochemical Genetics.
5
Human Biochemical 1.1.1 History
Genetics
Gregor Mendel (1822 – 1884) (Fig. 1.1) is well known as the founder of modern
genetics. He conducted breeding experiments from 1856 to 1863 and presented
his results in 1865. Using the different varieties of pea plants interms of the
flower colour, the seed coat type and many such simple characteristics carefully
chosen as the varieties, he analysed the pattern of transmission of these traits in
subsequent generations. This led to the discovery of principles of heredity which
is now known as Mendelian Inheritance in his honour.
The impact of this research, appeared to be initially minimal and no one realized
that Mendel has discovered the basic principles of inheritance. Unfortunately,
the work remained dormant for nearly 44 years.
In 1900, three botanists Hugo de Vries, Erich von Tschermark, and Karl Correns
did similar experiments with plants and arrived at conclusions similar to those
of Mendel.
Fig. 1.1: Gregor Mendel (Source:rocketmanagement.co.uk)
1.1.2 Garrod’s Inborn Errors of Metabolism (IEM)

At the time that Mendel’s work was being discovered, English Physician and
biochemist Archibald Garrod was studying a rare condition (incidence of 1 in
250,000) known as alkaptonuria (uria means “in the urine”) otherwise healthy
new born with the disorder, usually had one striking feature. Their urine upon
standing in contact with air, turned black. In their later years, affected individuals
show darkening of portions of ears, whites of eye, cartilage and tendons. One to
the deposits in the cartilage they suffer with arthritis. Males develop black stones
in the prostrate at later age). The dark substance in the urine was the oxidation
product of alkapton now called homogentisic acid, which contains a six- carbon
ring structure. Other researchers found that the excretion of homogentisic acid
in urine was increased, when people with alkaptonuria were fed excess protein
or the amino acid tyrosine and phenylalanine, both of which contain benzene
rings. Yet individuals who have no alkaptonuria never excrete any homogentisic
acid in urine.
6
Garrod suggested that homogentisic acid is an ordinary product of metabolism Meaning, Scope and
Genetic Variation
that is broken down in normal people but is not degraded in people with
Alkaptonuria. This metabolic block results in homogentisic acid being excreted
intact in the urine. More specifically, Garrod thought that people with alkaptonuria
do not properly metabolize ring- containing fractions of proteins because they
lack a special enzyme that is present in unaffected individuals. He proposed that
during the normal break down of proteins, phenylalanine is converted to tyrosine,
which in turn is changed to homogentisic acid and then simpler to complex
products.
Garrod’s analysis did not stop with the concept of metabolic blocks, however.
The brilliance of his proposal lay in the genetic connection that he and population
geneticist William Bateson were able to make. Garrod noted that alkaptonuria
tended to occur in several sibs of a family whose parents were unaffected and
also that many affected children were the offspring of first-cousin marriages.
This pattern of inheritance fit the requirements for a rare recessive trait, the first
human application of Mendel’s newly discovered laws.
Garrod classified Alkaptonuria and three other conditions that he called as Inborn
Errors of Metabolism. The four canonical inborn errors described by Garrod are
Albinism, Alkaptonuria, Cystinuria and Pentosuria. He suggested that these four
genetic conditions must represent only a tiny fraction of the errors of metabolism
that exist in human populations, pointing out that many of them may produce no
obvious externally manifesting phenotypic effects.
Archibald Garrod (Fig. 1.2) served from 1915 to 1919 as a colonel in the British
Army Medical Services in Malta. Then although Garrod’s medical career was
extremely successful and distinguished, his pioneering insights into the nature
of metabolic disorders and the principle of biochemical individuality was not
appreciated during his life time.
Fig.1.2: Archibald Garrod (1857-1936) (Source: powerofthegene.com).
Garrod an extraordinary physician scientist made discoveries that were ahead of

his time and died long before, we would appreciate fully the information, the
knowledge and the wisdom he had passed on to us. Garrod belonged to the
period 1857 to 1936. During his lifetime the natural sciences changed our view
of the world, and genetics began its journey to the double helix.
7
Human Biochemical Thus was born the Garrod’s bold hypothesis of “inborn errors of metabolism”
Genetics
with its far- reaching assumption that genes were there to produce chemical
catalysts, one gene to each highly specialized catalyst.
Garrod the initial founder of human “Biochemical Genetics” belonged to a unique

community ahead of his times as rightly appreciated by Scriver (2001) in his
felicitation lecture, that Garrod belonged to the clinical-scientic community. He
introduced a paradigm new for its day in medicine: he thought that biochemistry
is dynamic and different from the static nature of organic chemistry. So this led
him to think about metabolic path ways and heredity could explain an “inborn
error of metabolism”. During Garrod’s time, he had no idea about the nature of
gene. Genes are now well understood: Genomes are being described for Homo
sapiens and it is understood that genomes “speak biochemistry ( not phenotype)”
Scriver (2011).
1.1.3 Beadle and Tautum – Genetic Analysis Led to the One-

Gene-One Enzyme Hypothesis
Garrod’s ideas, like Mendel’s were largely ignored for over thirty years although
Garrod published a book and several papers on inborn errors of metabolism. The
concepts have to be rediscovered by the American geneticists in their influential
experiments connecting genes with enzymes. This was carried out in 1940s by
George W. Beadle and Edward L. Tautum using a filamentous fungus called
Neurospora crassa commonly called red bread mould. They chose this organism
because both genetic and biochemical analysis could be done with ease.
Fig.1.3: Beadle and Tautum (Source: Sandwalk.blogspot.com)
In these experiments they identified new mutations that each caused a block in
the metabolic pathway for the synthesis of some needed nutrients and showed
that each of these blocks corresponded to a defective enzyme needed for one
step in the pathway. The experimental approach now called genetic analysis was
important because it solidified the link between the genetics and biochemistry.
N. crassa grows in the form of filaments on a great variety of substrates including

laboratory medium containing only inorganic salts, a sugar and one vitamin.
Such a medium is called as minimal medium because it contains only the nutrients
that are essential for growth of the organism. The filaments consists of a mass of
branched threads separated into interconnected, multinucleate compartments
8
allowing free interchange of nuclei and cytoplasm. Each nucleus contains a single Meaning, Scope and
Genetic Variation
set of seven chromosomes. Beadle and Tatum recognized that the ability of
Neurospora to grow in minimal medium implied that the organism must be able
to synthesize all of the other small molecules needed for growth such as amino
acids. If the biosynthetic pathways needed for growth are controlled by genes,
then a mutation in a gene responsible for synthesizing an essential nutrient would
be expected to render a strain unable to grow unless the strain were provided
with the nutrient.
The classic experiments of Beadle and Tautum thus showed that the relationship
is usually remarkably simple: one gene code for one enzyme. The pioneering
experiments united genetics and biochemistry, and for the “one gene one enzyme”
concept Beadle and Tautum were awarded a Nobel prize in 1958.
Beadle and Tautum were fortunate to study metabolic pathways in relatively

simple organism in which each gene specifies a single enzyme, a relation often
called the one enzyme hypothesis.
1.1.4 Genetic Code

In 1953 James Watson and Francis Crick solved the structure of DNA and
identified the base sequence as the carrier of genetic information. But the way in
which the base sequence of DNA specifies the amino acid sequence of proteins
(the genetic code) was not obvious until 10 years.
Fig. 1.4: Watson (left) and Crick (right) (Source: A.Barrington Brown/Science Photo
Library/Photo Researchers).
Three nucleotides are necessary to specify a single amino acid. This is the basic
unit of the genetic code. So the set of basis that encode a single amino acid is
called as a codon. Using limitations in bacteriophage Francis Crick and his
9
Human Biochemical colleagues confirmed in 1961 that the genetic code is a triplet code in which
Genetics
three nucleotides encode each amino acid in a protein. Proteins are very important
to all living processes; they are in some cases enzymes, which are the biological
catalyst and conduct the chemical reactions of the cell. In other cases proteins
are structural components of a cell like muscle, nail, lens in the eye. Some proteins
help in the function of transporting substances others help in the regulation of
vital pathways, communication between cell to cell or in defending a cell from
external threat.
Every protein is composed of amino acids, aligned end to end. Twenty common
amino acids are known to constitute different proteins. Each amino acid has a
central carbon atom bonded to an amino group (NH3+), a hydrogen atom ,a
carboxyl group (COO-)and an R (Radical) group. The Radical group differs for
each amino acid. The amino acids in proteins are joined together by peptide
bonds.
Thus it is very important for you to remember some important concepts like
1) The products of many genes are proteins whose action produce the traits
encoded by these genes. Proteins are polymers consisting of amino acids
linked by peptide bonds. The amino acid sequence of a protein is its primary
structure.
2) This structure folds to create the secondary and tertiary structures; two or
more polypeptide chains may associate to create a quaternary structure.
3) The genetic code is a triplet code in which three nucleotides encode each
amino acid in a protein.
Fig. 1.5: Genetic Code (Source: Benjamin A. Pierce Genetics: A Conceptual Approach
4th Edition 2012)
10
Because we now know that some enzymes contain polypeptide chains encoded Meaning, Scope and
Genetic Variation
by two (or occasionally more) different genes, a more accurate statement of the
principle is “one gene, one polypeptide”.
1.1.5 Revisiting the Question about what is a Gene?

After studying the developments of Genetics as it unfolded above you may be
able to appreciate in a nut shell that:
i) The Mendelian concept of a gene views it as a discrete unit of inheritance
that affects phenotype.
ii) Morgan and his colleagues assigned genes to specific loci on chromosomes.
iii) We can also view gene as a specific type nucleotide sequence along a region
of a DNA molecule as put forth by Watson and Crick.
iv) We can define a gene functionally as a DNA sequence that codes for a specific
polypeptide chain.
Even the one gene one polypeptide definition must be refined and applied
selectively, because:
i) Most eukaryotic genes contain large introns that have no corresponding
segments in polypeptides.
ii) Promoters and other regulatory regions of DNA are not transcribed either,
but they must be present for transcription to occur.
iii) Our definition must also include the various types of RNA that are not
translated into polypeptides.
Hence a gene is a region of DNA whose final product is either a polypeptide or

an RNA molecule.
1.2 BIOCHEMICAL OR METABOLIC DISEASES

Now we will move on to consider single gene biochemical diseases. The spectrum
of disorders known under this category is vast (200 inborn errors of metabolism
are known) and a flavor of this fascinating branch of genetic medicine will be
given. The metabolic disorders can be grouped based on either the metabolite,
metabolic pathway, function of the enzymes or cellular organelle involved.
Only a few IEM are inherited in an autosomal dominant manner. This is because
the defective protein in the most inborn errors is an enzyme which is diffusible,
and there is usually sufficient residual activity in the heterozygous state for the
enzyme to function normally in most situations. If, however, the reaction catalyzed
by an enzyme, is rate limiting or the gene product is part of a multimeric complex,
the disorder can manifest in the heterozygous state, i.e., be dominantly inherited.
1.2.1 Disorders of Amino Acid Metabolism

The best known under this category are phenylketonuria (PKU), alkaptonuria,
occulocutaneous albinism, homocystinuria, maple syrup urine disease.
11
Human Biochemical
Genetics
Fig. 1.6: Sites of biochemical block in phenylketonuria, alkaptonuria and albinism

(Source:transtutors.com)
Fig. 1.7: A boy with albinism (Source: human-albinism-eye-color.seebyseeing.net)
Fig. 1.8: A photograph of siblings born with Phenylketonuria (PKU)

12 (Source:drustapbio.wikia.com).
The untreated 11 year old boy (left) is severely retarded. His two and half year Meaning, Scope and
Genetic Variation
old sister (right) who was treated from early infacy with a low phenylalanine
diet, has normal intelligence. Phenylketonuria can lead to severe brain damage
and mental retardation.
1.2.2 Disorders of Branched Chain Amino Acid Metabolism

The essential branched chain amino acids leucine, isoleucine and valine have a
part of their metabolic pathways in common like the previous set mentioned
above. Maple syrup urine disease comes under this category. It is an autosomal
recessive disorder that presents with vomiting in the first week of life followed
by death within a few weeks. There is a specific odour of the urine similar to the
maple syrup. This results in the excretion of increased branched chain amino
acids leucine, isoleucine and valine in the urine. Treatment involves a diet that
limits the three branched chain amino acids to the extent that it is necessary only
to help the new born to grow. Affected individuals are susceptible to deterioration
due to catabolic degradation of proteins.
1.2.3 Urea Cycle Disorders

Urea cycle helps to remove waste nitrogens from the amino groups of amino
acids arising from the day to day production of proteins. The sight of action is
mainly liver cells and the cycle has a five step metabolic pathway. Deficiencies
of enzyme in the urea cycle will result in intolerance of protein due to the
accumulation of ammonia in the body. This is also known as hyperammonemia.
In normal individuals without enzyme deficiency it converts two molecules of
ammonia and one bicarbonate into urea. Excess of ammonia levels are toxic to
the central nervous system and it can also result in coma and death when untreated.
These disorders are fortunately rare.
1.2.4 Disorders of Carbohydrate Metabolism

Examples are Galactosemia, hereditary fructose intolerance, glycogen storage
diseases of liver and muscle.
1.2.5 Disorders of Steroid Metabolism

This is an inborn error in the biosynthetic pathways of cortisol. Due to this disorder
new born female infants present with virilization of the external gentalia that is
the commonest cause of ambiguous gentalia in female new borns. Affected infants
in addition to requiring urgent correct assignment of gender are treated with
replacement cortisol along with fludrocortisone if they have salt losing form of
defect.
1.2.6 Disorders of Lipid Metabolism

Familial hypercholesterolemia where the person will have raised cholesterol level
with high risk of developing coronary artery disease. The high cholesterol level
is due to deficient or defective function of LDL receptors leading to increased
levels of endogenous cholesterol synthesis.
13
Human Biochemical
Genetics
Fig. 1.9: Familial hypercholesterolemia with multiple cutaneous xanthomas

(Source: gfmer.ch)
Fig. 1.10: Cutaneous Xanthomas in Homozygous Familial Hypercholesterolemia

(Source:nejm.org)
1.2.7 Lysosomal Storage Disorders

While the previous six types of inborn errors of metabolism were due to enzyme
defects leading to accumulation of intermediate metabolic precursors, there are
other metabolic disorders due to accumulation of very large polysaccharides.
Certain macro molecules which are complex need to be degraded consistently in
the cell.
Children born with lysosomal disease are apparently normal at birth but tend to
accumulate a variety of macro molecules due to a deficiency of lysosomal
enzymes. Examples are Hurler Syndrome, Hunter Syndrome, Sanfilippo
Syndrome, Morquio syndrome, all put together known as Mucopolysaccharidoses
(MPS).
14
Meaning, Scope and
Genetic Variation
Fig. 1.11: Hunter Syndrome (Source:thesun.co.uk)
Face of a male with mucopolysaccharidosis. Note the characteristic coarsening

of their facial features.
1.2.8 Lipid Storage Diseases

Tay-Sachs disease is the best known lipid storage diseases where in there is a
progressive deposition of lipid or glycolipid primarily in the liver and spleen.
Central nervous system involvement results in progressive mental deterioration,
deafness, visual impairment, spasticity and progressive rigidity . 1 in 3600 persons
of Ashkenazi Jewish ancestry are known to be affected with this disorder.
1.2.9 Disorders of Purine/Pyramidine Metabolism

Lesch-Nyham Syndrome is a good example. Accumulation of excessive amounts
of uric acid and some of its metabolic precursors. The main effect on the central
nervous system resulting in uncontrolled movements, spasticity, mental
retardation and compulsive self- mutilation.
Fig. 1.12: Lesch-Nyhan Syndrome (Source:EmpowHER.com)
15
Human Biochemical
Genetics
Fig. 1.13: Lesch-Nyhan syndrome: A case report (Source:gfmer.ch)
Fig. 1.14: Self-mutilation in the Lesch–Nyhan syndrome (Source:Neurology.org)
1.2.10 Disorders of Copper Metabolism

Good examples are Menkes Disease and Wilson Disease.
Fig. 1.15: Wilson’s disease (Source:eurowilson.org)

16
Meaning, Scope and
1.3 HUMAN BLOOD GROUP SUBSTANCES Genetic Variation
1.3.1 Introduction to Human Blood Groups

The red blood cells of human blood contain a great many antigens mostly proteins
and according to the presence of antigens, human blood can be classified into
different blood group systems, e.g ABO blood group, MN blood group, RH blood
group. All of these blood groups in man are under genetic control, each blood
group system being under the genetic control of genes at a single locus or of
genes that are closely linked and behave in heredity as though they were in single
locus.
1.3.2 The ABO Blood Group System- History

Blood has two main components: Serum and cells. Karl Landsteiner noted that
the sera of some individuals caused the red cells of others to agglutinate. This
observation led to the discovery of the ABO blood group systems. Based on the
reactions between the red blood cells and the sera, he was able to divide individuals
into three groups: A, B, and O. Two years later, two of his students discovered
the fourth and rarest type, namely AB. Landsteiner described A, B, and O groups;
Alfred von decastello and Adriano sturli discovered the fourth type, AB, in 1902.
Fig. 1.16: Karl Landsteiner (Source: http://www.biography.com/people/karl-landsteiner-

9372736)
Karl Landsteiner was born June 14, 1868 in Vienna, Austria. In 1897 he pursued
his interest in the emerging field of immunology and in 1901 published his
discovery of the human ABO blood group system. He won the 1930 Nobel Prize
for Physiology or Medicine for his discovery of the major blood groups and the
development of the ABO system of blood typing that has enabled blood
transfusions.
Due to less developed communication system in those days, it was subsequently
found that Czech serologist Jan Jansky had also independently pioneered the
classification of human blood into four groups, although his name is not so much
talked about, except in Russia and former states of USSR around that time in
America, Moss published a similar work on blood group in 1910, from USA.
17
Human Biochemical Ludwik Hirszfeld and von Dungern discovered the heritability of ABO blood
Genetics
groups in 1910–11. Felix Bernstein earns the credit for studying the blood group
inheritance pattern to be due to, multiple alleles at one locus in 1924.
1.3.3 ABO Blood Groups Substances

Watkins and Morgan, in England, discovered that the ABO epitopes were
conferred by sugars, to be specific:
i) N-acetylgalactosamine for the A-type
ii) Galactose for the B-type.
Published literature states that the ABH substances are all attached to
glycosphingolipids – a long polylactosamine chain that contains the major portion
of the ABH substances attached to it.
Later, Yamamoto’s group showed the precise glycosyl transferase designates the
A, B and O epitopes. Epitope is the antigenic determinant on an antigen to which
the paratope (the specific site in the immunoglobulin) on an antibody binds.
Fig. 1.17: Diagram showing the carbohydrate chains that determine the ABO blood group
(Source: http://en.wikipedia.org/wiki/ABO_blood_group_system)
The genetic basis of the ABO blood group system is an example of multiple
alleles. There are three alleles, A, B, and O, at the ABO locus on chromosome 9.
The expression of the O allele is recessive to that of A and B, which are said to
be co-dominant. Thus, the genotypes AO and AA express blood type A, BO and
BB express blood type B, AB expresses blood type AB, and OO expresses blood
type O. In the past, ABO blood group typing was used extensively both in forensic
cases as well as for paternity testing.
18
Meaning, Scope and
Genetic Variation
Fig. 1.18: ABO blood group antigens present on red bllod cells and IgM antibodies present
in the serum (Source: http://en.wikipedia.org/wiki/ABO_blood_group_system)
The ABO blood group system is an important blood group system to be considered
during human blood transfusion. The associated anti-A antibodies and anti-B
antibodies are usually IgM antibodies, which are usually produced in the first
years of life by sensitization to environmental substances such as food, bacteria,
and viruses. ABO blood types are also present in apes such as chimpanzees,
bonobos, and gorillas.
Thus ABO group substances are distinct, genetically determined group of human
erythrocyte antigens represented by two blood factors (A and B) and four blood
types (A, B, AB, and O).
1.3.4 Antigens and Antibodies

Blood grouping, is essentially based on the definition of antigen and antibody.
An antigen is a substance, usually a protein or a glycoprotein, when injected into
a human (or other organism) that does not have the antigen, will cause antibody
to be produced. Antibodies are a specific type of immune-system proteins known
as immunoglobulins, whose role is to fight infections by binding themselves to
antigens. In the case of the ABO blood groups, the antigens are present on the
surface of the red blood cell, while the antibodies are in the serum. These
antibodies are unique to the ABO system and are termed “naturally occurring
antibodies.” The table shows the relationships between blood types and antibodies.
Relationships Between Blood Types And Antibodies

Blood Antigens on Can Donate Antibodies Can Receive
Type Red Blood Cell Blood To in Serum Blood From
A A A, AB Anti-B A, O
B B B, AB Anti-A B, O
AB A and B AB None AB, O
O None A, B, AB, O Anti-A and anti-B O
19
Human Biochemical ABO blood group-matching is very important in transfusion. Blood group O
Genetics
individuals are said to be universal donors, because their blood can be used for
transfusion in individuals who have any one of the four blood types. On the
other hand, individuals with blood type A can only donate to either type A or
type AB, and individuals with blood type B can only donate to B or AB types.
AB individuals can only donate to type AB. However, before any transfusions,
donor blood is mixed with serum from the recipient (a process called cross
matching) to ensure that no agglutination will occur after transfusion.
1.4 SUMMARY
The scope for Genetics is amazing and most of the sub disciplines emerged as
the understanding of Genetics nurtured the development of the science. Human
biochemical genetics was the first ideal model to pave way for this development.
Improvements in genetic technologies have helped us now stand on a platform
where we have a detailed knowledge of the human genome and its variations.
Suggested Reading
Benjamin, A. Pierce. 2008. Genetics: A Conceptual Approach. 3rd Edition W.H.
Freeman & Company.
Elaine Johansen Mange and Arthur P.Mange. 1999. Basic Human Genetics. 2nd
Edition. Sunderland Publishers.
Mandal, S. 2002. Fundamentals of Human Genetics. 2nd Edition. New Central
Book Agency.
Peter, D Turnpenny and SianEllard. 2007. Emery’s Elements of Medical Genetics.
13th Edition. Elsevier Publications.
Robert, C. King and William D. StansField. 2002. A Dictionary of Genetics. 6th
Edition. Oxford University Press.
Scriver, CR. 2001. Work, the clinician-scientist and human biochemical genetics.
Clin Invest Med, Vol. 24, No. 4.
Thomas, D.Gelehrter and Francis S.Collins. 1999. Principles of Medical Genetics.
3rd Edition. Williams and Wilkins.
Sample Questions
1) Describe with example some classic examples of inborn errors of metabolism.
2) Discuss the concept of gene in the light of Beadle and Tautum’s work.
3) Define the basis of human ABO blood group systems.
20
Meaning, Scope and
UNIT 2 ENZYME AND PROTEIN DIVERSITY Genetic Variation
IN HUMAN POPULATIONS
Contents
2.1 Introduction
2.2 Genes and Isozymes
2.3 Genetic Variation of Red Cell (Erythrocyte) Enzymes and Serum Proteins
2.4 Haemoglobins: Normal and Abnormal Haemoglobins
2.5 Structural Variation in Haemoglobin (Haemoglobin Variants)
2.6 Quantitative Variation in Haemoglobin (Thalassaemias)
2.7 Geographic Distribution of HB*S, HB*D and HB*E in Indian Populations
2.8 Summary
References
Suggested Reading
Sample Questions
Learning Objectives
&
Ø define genes and isozymes and explain the concept of genetic polymorphism
of red cell enzymes and proteins in man;
Ø discuss with reference to normal and abnormal haemoglobins and their
structural variation; and
Ø explain the geographical distribution of some abnormal haemoglobins in
Indian populations.
2.1 INTRODUCTION
Human beings are exceedingly diverse. They differ from one another in their
normal physical, physiological and behavioural attributes. These variations are
caused partially by differences in the environmental conditions in which they
live but more importantly they also depend on inborn (genetic) differences. Human
variation can be visible (e.g., differences in skin colour, hair colour and form
and or head shape) or invisible (biochemical differences, e.g., blood groups,
blood protein/red cell enzyme polymorphisms or DNA markers). At the beginning
of the 20th century, Landsteiner discovered ABO blood groups and Hirschfeld
and Hirschfeld (1919) suggested that these could be used to delineate biochemical
races. Blood protein haemoglobin polymorphism, including the gene for sickle
cell anaemia, was reported by the middle of the century, followed by serum
protein haptoglobin (HP) polymorphism in mid-1950’s and by mid-1970’s most
red cell enzyme and blood protein polymorphisms were discovered.
Anthropologists had studied these genetic markers with the primary aim of
documenting genetic differences among various populations inhabiting different
parts of the world and also for human racial classifications. Thus the existence
of Mendelian genetic traits, demonstrated from human blood in the 20th century,
21
Human Biochemical provided important powerful tools for investigation of biological variation in
Genetics
humans along with traditional anthropometric/morphological and dermatoglyphic
traits, among others.
2.2 GENES AND ISOZYMES

A gene can be defined as a unit of information and corresponds to a discrete
segment of DNA (exon) that encodes the amino acid sequence of a polypeptide.
Human cells contain about 25,000 genes which are dispersed on chromosomes
and are separated by noncoding inter-genic DNA (introns). Isozymes result from
point mutations or from insertion-deletion (indel) events that affect the DNA
coding sequence of the gene.
The term isozyme was coined by Hunter and Markert (1957) who defined
isozymes as different variants of the same enzyme having identical functions or
present in the different individuals. In fact, isozymes refer to the existence of
different molecular forms of an enzyme that catalyze the same biochemical
reaction but which differ in their electrophoretic properties. The existence of
isozymes permits the fine-tuning of metabolism to meet the particular needs of a
given tissue or developmental stage.
2.3 GENETIC VARIATION OF RED CELL

(ERYTHROCYTE) ENZYMES AND SERUM
PROTEINS
A variety of different enzymes and proteins are synthesized in the human body,
and the primary amino acid sequence of each of their distinctive polypeptide
chains is coded in the DNA of a separate gene locus. Blood proteins, including
red cell (erythrocyte) enzymes are composed of amino acids joined by covalent
peptide bonds to form polypeptides. The sequences or “primary structures” are
genetically determined. Each of the 20 amino acids has a unique side chain,
characterized by its shape, size and charge. The side chains on lysine, arginine
and histidine are positively charged (NH3+) and thus basic; those on aspartic acid
and glutamic acid are negatively charged (COO-) and thus acidic.
The charged side chains are responsible for the movement of the proteins or
enzymes through a gel matrix during electrophoresis. In an electric field, the
anions (i.e. negatively charged molecules) migrate towards the anode (i.e. positive
electrode), and the cations (i.e. positively charged molecules) migrate towards
the cathode (i.e. negative electrode). The speed of migration is primarily related
to net charge on the protein or enzyme molecule and the electrical field strength
applied through the electrodes. Thus proteins/enzymes, the main products of
genes, move in an electric field with mobility that depends on their chemical
structure. The amino acid sequences of proteins are changed by mutations in the
encoding DNA locus. Such mutations may alter shape and net charge and
electrophoresis aims to reveal as many of these changes as possible.
The electrophoretic enzyme pattern in homozygous individuals usually show

one major zone of enzyme activity, which may be accompanied by minor zones
of secondary isozymes (Shaw, 1969). Such pattern in heterozygous individuals
may, however, show different degrees of complexity i.e. it shows one or more
22
components which are not present in either homozygote. These extra enzyme Enzyme and Protein
Diversity in Human
components found only in heterozygotes are referred to as “hybrid enzymes” Populations
and show an electrophoretic mobility intermediate to those of the parental
homozygote enzymes. In a heterozygote, in the case of a dimer enzyme there
will be a triple banded pattern, in the case of a trimer enzyme a four banded
pattern and in the case of a tetramer enzyme a five banded pattern. In each case
the outermost bands correspond to the two parental homozygotes, and the band(s)
with intermediate mobilities represent the “hybrid enzyme(s)”.
Electrophoretic investigations on a variety of different enzymes and proteins

have led to the discovery of a large number of structurally variant forms which
are genetically controlled. The inherited variants of enzymes/proteins which we
find in human populations today must be attributed to specific gene mutations
which occurred in single individuals among our ancestors in earlier generations.
Thus it appears that at such loci a large number of different mutant alleles which
may be generated by separate mutations, actually exist among living members
of our species. The incidence of the majority of such mutant alleles is rather low
in human populations. Occasionally, some occur with a polymorphic frequency
(=1%) giving rise to the well-known phenomenon of genetic polymorphism in
which the individual members of a population are sharply classified into two or
more relatively common genetically determined phenotypes due to occurrence
together of (usually) two or more alleles at a particular locus. The first example
of electrophoretically detectable biochemical polymorphism in humans was that
of the well-known blood protein haemoglobin (HB) (Pauling et al., 1949).
In man, both proteins (present in serum portion of the blood) and enzymes (present
within the red blood cells/erythrocytes) have been screened for polymorphisms.
Generally, the discovery of polymorphisms of serum protein preceded that of
red cell enzymes in man. The first to be discovered was haptoglobin (HP) reported
by Smithies (1955), followed by Transferrin (TF) (Poulik and Smithies, 1958),
group specific component (GC) (Hirschfeld, 1959), complement component 3
(C3) (Wieme and Demeulenaere, 1967) and properdin factor B (BF) (Alper et
al., 1971), among others.
Using the technique of starch gel electrophoresis pioneered by Smithies (1955)
and through the use of very sensitive biochemical staining reactions (Hunter and
Markert, 1957), the polymorphisms of red cell enzymes began to be reported
from the early 1960’s. The first example was that of acid phosphatase locus 1
(ACP1) discovered by Hopkinson et al. (1963), followed by phosphoglucomutase
locus 1 (PGM1) (Spencer et al., 1964), adenylate kinase locus 1 (AK1) (Fildes
and Harris, 1966), adenosine deaminase (ADA) (Spencer et al., 1968),
phosphohexose isomerase (PHI) (Detter et al., 1968), esterase D (ESD)
(Hopkinson et al., 1973) and glyoxalase locus 1 (GLO1) (Kompf et al., 1975),
among others. Harris et al. (1977) observed that of the 104 different loci coding
for enzymes that had been investigated, 33 were found to exhibit an
electrophoretically detectable polymorphism. In other words, one out of every
three human loci coding for enzymes is polymorphic. It is important to mention
that although an electrophoretic difference indicates a difference in structure
between the polymorphic forms of an enzyme/protein, it does not in general
provide information about possible functional difference, if any.
Like different blood groups which are serological markers, various red cell enzyme
and serum protein polymorphisms are biochemical markers, and alongwith with
23
Human Biochemical the former help in characterization of human populations genetically. A large
Genetics
body of data on serum protein and red cell enzyme polymorphisms has been
generated in world populations and these have been compiled and authoritative
accounts written on their distribution (Mourant et al., 1976). For the people of
India, such an exercise was performed by Bhasin et al. (1992, 1994a) and a brief
account of the distribution of different biochemical genetic markers in Indian
populations is given in the following.
In serum protein haptoglobin polymorphism, the average frequency of HP*1 is

0.160 in Indian populations; in general, the frequency of this allele is higher in
people of North India (0.208) than in South India (0.131). The frequency is also
high in people of West India (0.215), followed by East India (0.192).
In transferrin polymorphism, the average frequency of TF*C is 0.991 in Indian

populations with a range of 0.898 to 1. The frequencies of other alleles of this
serum protein polymorphism such as TF*D and TF*B are rather meager. The
frequency of TF*D is highest in peninsular (South) Indian populations and it
starts decreasing in the Indus-Ganga-Brahmaputra plains of North India (0.005).
In serum protein group specific component polymorphism, the average frequency

of GC*2 in people of India is 0.253 with a range of 0.089 to 0.409. The frequency
of the allele is low in West India (0.224) and high in North India (0.277). In the
Himalayas, the frequency is almost similar in Eastern and Western regions (0.244
and 0.248, respectively) while in Central Himalayan region it is comparatively
higher (0.312).
In acid phosphatase locus 1 system, like other world populations, in Indian

populations the ACP1*B allele is preponderant (0.756), followed by ACP1*A
(0.242) while the third allele of the system ACP1*C has a trace frequency (0.002).
The average frequency of ACP1*A allele in people of India is 0.242, ranging
from 0.035 to 0.467. The distribution of this red cell enzyme polymorphism in
five geographical regions of the country i.e. North, West, Central, East and South
India was studied by Chahal et al. (1985) who observed that the populations of
North India are characterized by relatively high frequencies of ACP1*A and
ACP1*C, which differentiate them from populations of all other regions. It was
also observed that the incidence of both these alleles is generally higher in the
non-tribal populations compared to the tribals of India. Indeed, as stated by
Roberts et al. (1980) “the distribution of ACP1*C is essentially non-tribal in
India.”
In red cell enzyme phosphoglucomutase locus 1 polymorphism, the average

frequency of PGM1*2 is 0.300 in Indian populations, varying from 0.05 in
Chaudhuri of West India to 0.558 in Kurumba of South India. In populations
with Mongoloid affinities inhabiting Eastern Himalayas the frequency of the
allele is somewhat higher (0.309) compared to those of South India (0.298). In
general, the frequency of PGM1*2 is low in North India and it gradually starts
increasing in West and East India while it decreases in East, Central and South
India.
In adenylate kinase locus 1 polymorphism, the average frequency of AK1*2 in

Indian populations is is 0.076 with a range of nil to 0.205. The frequency of the
allele is low in the people of Himalayas having varying degrees of Mongoloid
24
admixture (0.058) but in populations of the peninsular (South) India it is Enzyme and Protein
Diversity in Human
comparatively high (0.082). Chahal et al. (1986a) studied the distribution pattern Populations
of this red cell enzyme polymorphism in the five geographical regions of India
and found that there is a clear distinction between non-tribal (range 0.086-0.099)
and tribal (range 0.042-0.064) populations inhabiting these regions. Thus tribal
populations of India are characterized by having comparatively much lower
AK1*2 frequency.
In red cell enzyme adenosine deaminase system, the average frequency of ADA*2
is 0.118 in various populations of India, varying from 0.015 in Jalari of Andhra
Pradesh to 0.5 in Muslims and Kacharis of Assam. However, most of the Indian
populations fall in a range of 0.015 – 0.214 for this allele. The frequency of the
allele is quite low in the populations with Mongoloid ethnicity inhabiting
Himalayas (0.087), followed by the peninsular populations of South India with
Australoid (Pre-Dravidian) and Caucasoid (Dravidian) racial affinities compared
to people of Indus-Ganga-Brahmaputra plains of North India with Caucasoid
(Aryan) affinities (0.151).
In esterase D system, the average frequency of ESD*2 in India is 0.271, ranging

from as low as 0.022 in Gaddi of Kangra in Himachal Pradesh to 0.582 in people
of Andhra Pradesh. The frequency is low in people of Himalayas (0.253) and
Indus-Ganga-Brahmaputra plains (0.256) while it is comparatively higher in that
of peninsular India (0.322). In fact, there exists a north-south cline of increasing
ESD*2 frequency in this red cell enzyme polymorphism in India (Chahal et al.,
1986b).
The data on red cell enzyme glyoxalase I polymorphism in Indian populations

are rather limited, especially among tribals. Apparently there are no great
differences in GLO1*1 frequency in them. The frequency of GLO1*1 ranges
from about 0.2 to 0.3 in most of them. Chahal et al. (1986) found somewhat
elevated frequenciy of the allele in people of West India and attributed it mainly
to the inclusion of two immigrant populations of the Parsi and Irani.
In red cell enzyme glucose phosphate isomerase (phosphohexose isomerase)

system the frequency of the GPI*1 allele is unity in most world populations,
except Asiatic Indians and Japanese in which rare alleles, respectively, GPI*3
and GPI*4 are present. Various Indian populations have been screened for variants
of GPI (Papiha and Chahal, 1984) and the rare allele GPI*3 attain polymorphic
proportions in many of them. With a frequency as high as 0.110 of the allele, the
Bhotia of Chamoli district in Garhwal region of Uttarakhand stand out from all
populations of India (Chahal et al., 2008). In addition to GPI*3, other variant
alleles reported from the country include GPI*2, GPI*4, GPI*5, GPI*7, GPI*8
and GPI*9, albeit some of them are limited to specific ethnic groups or
geographical regions.
2.4 HAEMOGLOBINS: NORMAL AND

ABNORMAL HAEMOGLOBINS
Haemoglobin (HB), the red respiratory protein found in mammalian erythrocytes,
is one of the most informative molecules in primate blood. It is the best known
blood protein that gives rise to the most thoroughly studied genetic polymorphism
25
Human Biochemical in man – the polymorphism that includes the gene for sickle cell anaemia (Cavalli-
Genetics
Sforza and Bodmer, 1971). The study of haemoglobin has made several significant
contributions towards the development of molecular biology.
Normal adult human haemoglobin is composed of three different types which

can be separated by electrophoresis. They are all tetramers having the general
formula X2Y2, where X2 refers to a pair of α polypeptide chains and Y2 to a pair
of β, γ, δ or ε chains (Giblett, 1969). For example, HBA, the major haemoglobin
in the blood of adults, has the molecular formula αA2βA2. The sequence of the
141 amino acid residues in the α chain and of the 146 residues in the β and other
non-α chains has been determined. While most of the haemoglobin in normal
human subjects past infancy is HBA (95-98%), HBA2 is also present, but in a
concentration of only 1.5-3% of the total haemoglobin content. Its molecular
formula is αA2δ2 , indicating that the two α chains are identical with those of
HBA, but that the other two identical chains are sufficiently different from β
chains to warrant the designation δ. In fact, the δ chain has the same number of
amino acid residues as the β chain and there are only 10 differences in the
sequence. Another example of normal haemoglobin is HBF. It has a concentration
of less than 0.5% after the first few years of life in normal subjects, but it is the
major haemoglobin component during fetal development. Like HBA and HBA2,
HBF contains two αA chains, but a different pair of chains, called γ, completes
the tetramer, so the molecular formula is αA2γF2. The γ chain differs from the β
chain in 39 amino acid residues, although the total number of residues is the
same.
The abnormal haemoglobins differ from normal haemoglobins in molecular

structure. They have structure similar to that of normal haemoglobin except slight
alteration in the sequence of amino acids (usually in the β chain) and hence may
be designated as mutant or variant haemoglobins. Most of the abnormal
haemoglobins appear to be products of point mutations with a single amino acid
substitution in the α, β, γ or δ peptide chain. The resultant change in the whole
haemoglobin molecule may be so benign that no physiological effect is detectable
and even the rate of synthesis remains normal. A large number of the apparently
‘benign’ abnormal haemoglobins have so far been detected in humans. In some
instances, these variants have been observed in combination with thalassaemia,
which depresses the synthesis of either α or β chain product of the homologous
locus. Detection of structurally abnormal haemoglobin is usually demonstrated
by electrophoresis.
The term haemoglobinopathies covers a group of hereditary abnormalities in

which either (a) the haemoglobin structure is altered (like in HBS, HBC, HBD,
HBE etc.) or (b) there is a defect in globin chain synthesis of one of the normal
haemoglobin chains (i.e. α or β) (thalassaemias). The term thallasaemia is applied
to a group of inherited disorders in which there is a variable decrease in net
synthesis of a particular globin chain without an associated change in the structure
of that chain. There are two principal types of thalassaemia namely alpha (α)
and beta (β). β thalassaemia is of two subtypes viz., β-thalassaemia major
(homozygous) and β-thalassaemia minor (heterozygous). α thalassaemia is
present in two forms – haemoglobin Barts (four γ chains, no α chain produced)
and haemoglobin H (excess β chains form unstable tetramer). Haemoglobinopathies
are the most frequent genetic disease, affecting approximately 7 per cent of the
world population.
26
Enzyme and Protein
2.5 STRUCTURAL VARIATION IN Diversity in Human
Populations
HAEMOGLOBIN (HAEMOGLOBIN
VARIANTS)
Variant haemoglobins such as HBS, HBC, HBD and HBE, among others, are
the products of point mutation and their detection is dependent on a difference in
their altered electrophoretic mobility. Worldwide more than 470 genetically
controlled haemoglobin variants, mostly of the β chain, are known (Honig and
Adams III, 1986). Haemoglobin variants may occur independently or in
association with thalassaemia.
Haemoglobin S (HBS)
One of the most interesting and widespread abnormal human haemoglobin, first
described by Pauling et al. (1949), is designated haemoglobin S (HBS)(αA2βS2),
more specifically, αA2β26Glu?Val. The notation signifies that HBS differs from its
normal counterpart HBA by a single amino acid substitution i.e. valine replaces
glutamic acid at position six in the β polypeptide chain (Ingram, 1957). It may
be noted that the mutation has only affected the β chain while the α chain is
normal. Haemoglobin S may be separated from haemoglobin A by electrophoresis
or by performing sickling test on fresh blood. Individuals who have one sickle
mutant gene and one normal beta gene i.e. heterozygote (HBAS) are referred as
sickle cell trait, which is benign. The sickling of red cells of homozygote (HBSS)
is more severe than that of heterozygote (HBAS). Haemoglobin S is also known
to occur in combination with other abnormal haemoglobins, for example, sickle
cell HBC (HBS/HBC), sickle cell HBD (HBS/HBD), sickle cell HBE (HBS/
HBE) and sickle cell thalassaemia (HBS/HBTh), among others.
Sickle cell trait occurs with highest frequency in tropical Africa (0.1-0.4), with
high frequency in India, Greece and Southern Turkey (0.05-0.1) and less than
0.1 frequency in populations inhabiting Palestine, Tunisia, Algeria and Sicily,
situated around the Mediterranean Sea.
Haemoglobin D (HBD)
Like HBS, HBD (also known as HBD-Punjab) is a β chain variant of haemoglobin
in which glutamine replaces glutamic acid at position 121 in the β polypeptide
chain (αA2β2121Glu?Gln). Both homozygote (HBDD) and heterozygote (HBAD)
phenotypes have been reported among individuals with reasonable health.
Haemoglobin D occurs mainly in North-West India, Pakistan and Iran. The
electrophoretic mobility of HBAD is identical to that of HBAS at alkaline pH in
cellulose acetate, but to distinguish these variants separation may be carried out
in agarose gel using a different buffer system.
Haemoglobin E (HBE)
Like HBS and HBD, HBE is also an abnormal haemoglobin with a single
point mutation in the β polypeptide chain i.e. at position 26 in the chain there is
a change of one amino acid from glutamic acid to lysine (αA2β226Glu?Lys). The
mutation is estimated to have arisen within the last 5,000 years resulting in the
second most common variant of normal haemoglobin in the world. Persons with
homozygote haemoglobin E (HBEE) have a mild haemolytic anaemia and mild
splenomegaly; heterozygote haemoglobin E (HBAE) is benign. Haemoglobin E
27
Human Biochemical is extremely common in Southeast Asia (Thailand, Myanmar, Cambodia and
Genetics
Laos, among others) where its prevalence can reach 30-40% and in some areas
equals haemoglobin A frequency. In Thailand the mutation can reach a frequency
as high as 50-70%. In India, this abnormal haemoglobin is most prevalent
in North-East region, where in certain areas carrier (HBAE) incidence reaches
as high as 60% of the population.
2.6 QUANTITATIVE VARIATION IN

HAEMOGLOBIN (THALASSAEMIAS)
Quite a number of inherited abnormalities are known in man in whom the central
defect is the deficiency of a particular protein, and many of these are probably
due to mutations which result in a gross but specific reduction in the rate of
synthesis of one or more polypeptide chains. The most extensively studied of
such conditions are those which involve defects in the synthesis of haemoglobin.
Among them are a series of chronic haemolytic anaemias collectively known as
the thalassaemias. They appear to be determined by a series of distinct abnormal
genes in different heterozygous and homozygous combinations. It is useful to
classify the various thalassaemias according to the polypeptide chain primarily
concerned in causing the haemoglobin deficit (Ingram and Stretton, 1959). Thus
in the β-thalassaemia there is defective synthesis of β-chains whereas in α-
thalassaemia, there is defective synthesis of α-chains. β-thalassaemia is
characterized in the heterozygote by variable depression in β chain synthesis, a
moderate increase in HBA2 (6-7%) and in about half the cases, a slight increase
in HBF (1-5%). Defective synthesis of α chains i.e. complete or nearly complete
absence of α chain characterizes α-thalassaemia which is incompatible with life
because α-chains are required for all of the normal haemoglobins and their
structural variants.
Thalassaemia (thalassa - the Greek word for the sea), appears in two clinical
states – thalassaemia major and thalassaemia minor. The former, also known as
Cooley’s anaemia or Mediterranean anaemia, is a severe haemolytic anaemia
and afflicted individuals cannot survive unless they receive blood transfusions
regularly or undergo bone marrow transplantation. Thalassaemia major is a clinical
entity found in individuals homozygous for α or β chain defect i.e. HBαTh/HBαTh
or HBβTh/HB βTh, where Th denotes thalassaemia. Thalassaemia minor occurs in
individuals heterozygous for either α or β chain defect i.e. HBαN/HBαTh or HBβN/
HB βTh, where N denotes normal production of α or β chain.
In India, the occurrence of both α and β thalassaemias has been reported. β-

thalassaemia major has been reported predominantly from East India while cases
of it, both major and minor, have been reported from other parts of India, including
Uttar Pradesh, Punjab, Gujarat and Kerala. Various haemoglobin variants, more
frequently HBE, occur in combination with β-thalassaemia. In α thalassaemia,
haemoglobin Barts was detected in 2.4% Bengali population while haemoglobin
H (HBH) cases have been reported from Calcutta in East India and West India.
Sukumaran (1974) observed that β-thalassemia is probably the commonest
inherited haemoglobin disorder in the Indian subcontinent.
28
Enzyme and Protein
2.7 GEOGRAPHIC DISTRIBUTION OF HB*S, Diversity in Human
Populations
HB*D AND HB*E IN INDIAN POPULATIONS
HB*S
It is the most common variant haemoglobin allele in India and is present mostly
in South, West and Central India which inhabit sizeable autochthonous tribal
population of the country. The allele has not been reported from North India,
except in Chandigarh with a frequency of 0.011. HB*S shows polymorphic
proportions in the states of Karnataka (0.082), Andhra Pradesh (0.038), Tamil
Nadu (0.047), Kerala (0.045), Gujarat (0.065), Maharashtra (0.023), Dadra and
Nagar Haveli (0.08) and Madhya Pradesh (0.061). The incidence of the allele for
entire India has been estimated to be 0.031 (Bhasin et al., 1994).
HB*D
Though a distinct characteristic of populations originating from North-West
border Indian state of Punjab, this variant allele of haemoglobin occurs
sporadically almost all over North India. Bird et al. (1956) found 5 out of 279
Sikh subjects and one out of 13 Punjabi Hindu subjects to carry haemoglobin D.
Five of these had haemoglobins A and D in heterozygous form (HBAD) and one
had homozygous haemoglobin D (HBDD), giving a value 2.05% for haemoglobin
D variants and a frequency of 0.012 for HB*D in Punjab. The authors concluded
“It is clear, however, that haemoglobin D, though not common, is something
more than a sporadic mutant as had been suspected when it had been found only
in one Sikh” (Bird et al., 1955). In addition, this variant haemoglobin has also
been reported in Audich Brahmin of Gujarat in 2 out of 200 subjects, giving a
value of 1% for HBD variant and a frequency of 0.05 for HB*D (Parikh et al.,
1969).
HB*E
It is the second most common variant haemoglobin allele present in people of
India. But the distribution of the allele in the country is essentially limited to
East India, where it has been reported with a frequency of 0.303 in Assam, 0.066
in Manipur, 0.363 in Meghalaya, 0.006 in Sikkim and 0.007 in West Bengal; the
allele being polymorphic in the former three states. Thus, in general, HB*E is
confined to people of East India, particularly the Eastern Himalayan populations
with Mongoloid affinities. The allele is totally absent from West, Central and
South India and from North India there is a solitary report from Uttar Pradesh.
Like any other tropical country of the world, India is a “great reservoir for
abnormal haemoglobins” (Saha and Banerjee, 1971) and therefore further studies
are desirable to find out the true incidence of haemoglobin variants in this mega
diversity country. Needless to mention electrophoresis is essentially the technique
of choice for such investigations.
2.8 SUMMARY
Isozymes refer to the existence of different molecular forms of an enzyme that
catalyze the same biochemical reaction but which differ in their electrophoretic
properties. Electrophoretic investigations have led to the discovery of a large
number of structurally variant forms of enzymes/proteins attributable to specific
29
Human Biochemical gene mutations. The first example of electrophoretically detectable biochemical
Genetics
variation in humans was that of the well-known blood protein haemoglobin (HB),
followed by polymorphisms of serum proteins HP, TF, GC, C3 and BF, and red
cell enzymes ACP1, PGM1, AK1, ADA, GPI, ESD and GLO1, among others.
The term haemoglobinopathies comprises a group of hereditary abnormalities in
which either (a) the haemoglobin structure is altered (e.g. HBS, HBD, HBE) or
(b) there is a defect in globin chain synthesis of one of the normal haemoglobin
chains (α, or β) resulting, respectively, in α or β thalassaemia. Most variant
haemoglobins are products of point mutations and their detection is dependent
on a difference in their altered electrophoretic mobility. HB*S is the most common
variant haemoglobin allele in India, followed by HB*E and HB*D.
References
Bhasin, M. K., Walter, H. and Danker-Hopfe, H. 1992. The Distribution of
Genetical, Morphological and Behavioral Traits among the Peoples of Indian
Region. Delhi: Kamla-Raj Enterprises.
Chahal, S. M. S., Singh, P., Singh, H., Bansal, R. and Bansal, I. J. S. 2008.
Genetic variation and structure of the people of Uttarakhand, Central Himalayas,
India. Hum. Biol., 80: 409-434.
Pauling, L., Itano, H. A., Singer, S. J. and Wells, I. C. 1949. Sickle cell anaemia,
a molecular disease. Science, 110: 543-548.
Shaw, C. R. 1969. Isozymes: classification, frequency, and significance. Int. Rev.
Cytol., 25:297-332.
Suggested Readings
Bhasin, M. K., Walter, H. and Danker-Hopfe, H. 1994. People of India: An
Investigation of Biological Variability in Ecological, Ethno-economic and
Linguistic Groups. Delhi: Kamla-Raj Enterprises.
Cavalli-Sforza, L. L. and Bodmer, W. F. 1971. The Genetics of Human
Populations. San Francisco: Freeman.
Giblett, E. R. 1969. Genetic Markers in Human Blood. Oxford: Blackwell
Scientific Publications.
Harris, H. 1977. The Principles of Human Biochemical Genetics. Amsterdam:
Elsevier / North-Holland.
Mourant, A. E., Kopec, A. C. and Domaniewska-Sobczak, K. 1976. The
Distribution of the Human Blood Groups and Other Polymorphisms. London:
Oxford University Press.
Sample Questions
1) List different serum protein and red cell enzyme polymorphisms discovered
in man. What are the uses of these genetic markers in anthropology?
2) What are normal and abnormal haemoglobins and what techniques are used
to study them?
3) Discuss the two major components of haemoglobinopathies in man.
4) Give an account of the distribution of variant haemoglobin alleles in Indian
30
populations.
Enzyme and Protein
UNIT 3 INBORN ERRORS OF METABOLISM Diversity in Human
Populations
Contents
3.1 Introduction
3.2 Inborn Errors of Metabolism: Genesis
3.3 Inborn Errors of Metabolism in Man
3.3.1 Phenylketonuria
3.3.2 Alkaptonuria
3.3.3 Galactosemia and Galactosuria
3.3.4 Disorders of Lipid Metabolism: Familial Hypercholesterolemia
3.4 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
Ø define and explain with regard to metabolism;
Ø discuss inborn errors of metabolism; and
Ø discuss the examples for inborn errors of metabolism such as Phenylketonuria,
Alkaptonuria, Galactosemia & Galactosuria; and Hypercholesterolemia.
3.1 INTRODUCTION
Metabolism broadly refers to the sum total of all the chemical changes occurring
in a cell, a tissue or the body, and these chemical changes are performed through
organized multistep pathways involving a number of enzymes, proteins and bio-
chemical ingredients. There are several pathways or cycles that intersect with
each other forming a cohesive co-ordinated network of chemical reactions. The
sum total of chemical reactions performed through different pathways can be
classified as either Catabolic (degradative) or Anabolic (Synthetic). The breaking
down of complex molecules such as proteins, polysaccharides and lipids etc. to
simple molecules such as Co2, NH3 (ammonia) and water is the example of
catabolic reaction. The synthetic or anabolic path way refers to the chain of events
that lead to the formation of complex products from simple precursors; for
example the synthesis of polysaccharide, glycogen from glucose. Investigation
of metabolism involves elucidation of complex path ways. Each path way is
characterized by action of multienzyme sequences, and each enzyme, in turn,
may display important catalytic or regulatory features. As far as Catabolism is
concerned, the degradation of complex molecules occurs in three stages and
Adenosine Triphosphate (ATP) is released as chemical energy as a degradation
of energy-rich molecules. Three stages of Catabolism are: a) Hydrolysis of
Complex molecules; b) Conversion of building blocks to simple intermediates
c) Oxidation of acetyl CoA. Anabolism refers to the process of formation of
complex molecules such as protein, polysaccharides, lipids, nucleic acids from
small molecules such as amino acids, sugars, fatty acids, nitrogenous bases etc.
31
Human Biochemical Anabolic reactions require energy, which is generally provided by the breaking
Genetics
down of ATP to ADP and Pi. The figure 3.1 given below demonstrates a
comparison of catabolic and anabolic pathways.
Fig. 3.1: Enzymatic pathways of metabolism of amino acids in Humans (Courtesy : Champe,
P.C, Harvey, R.A and Ferrier, D.R (Ed). 2005. Biochemistry).
3.2 INBORN ERRORS OF METABOLISM:

GENESIS
Sir Archibald Garrod’s Paper on “The incidence of Alkaptonuria : A study of
Chemical individuality” published in 1902, was a monumental paper that ushered
in a new paradigm so far as the history of human genetics is concerned. The
publication of the paper by Garrod opened up new perspectives for two reasons.
32
First, the results obtained by Garrod on genetics of Alkaptonuria reinforced the Inborn Errors of
Metabolism
application of Mendel’s paradigm on humans. Second, the findings of the paper
subsequently led to the emergence of a new concept as well as an important area
of study in human genetics under the rubric “Inborn Error Metabolism”. With
the accumulation of evidences on genetic basis of enzyme action in man, the
study of inborn errors of metabolism in humans has become an important area of
study in human bio-chemical genetics having tremendous application value in
medical / clinical genetics.
Garrod’s work gave a strong ground in favour of the concept of one gene-one
enzyme hypothesis, which was established in the 1940s and 1950s by the
pioneering work of Beadle and Tatum, who were awarded Nobel Prize.
Principles of Inborn – errors of Metabolism

Metabolism broadly refers to complex bio-chemical pathways functioning as an
integrated system of chemical reactions controlled in some manner by genes and
these genes regulate or control specific reactions in the system by acting directly
as enzymes or by determining the specificities of enzymes, where as inborn error
metabolism denotes inability on the part of humans to catalyze certain metabolic
pathways completely due to alterations of enzymes, and this modification of the
action of enzymes is attributed to genetic factor or an inborn factor. These defects
or errors or blockages in the action of enzymes are due to mutations in the gene/
genes that code for the enzyme/enzymes. Normally, they usually affect only one
in a series of iso-enzymes. If more than one iso-enzyme is affected, these variant
iso-enzymes may share common polypeptide chain or secondary effects may
occur on the structure of enzyme. The deficiency of an enzyme caused by mutation
of a gene that is active only in one tissue affects the phenotypes of its carrier in
different ways as compared to an enzyme deficiency affecting many tissues. This
is analogous to pleiotropic effect of the gene. However, this phenomenon does
not always occur in all humans. It may so happen that an enzyme defect that is
found in all tissues some time lead to phenotypic anomaly in one tissue only -
this is due to the fact that defect is ameliorated more early in other tissues.
3.3 INBORN ERRORS OF METABOLISM IN MAN

The following are the four examples for the Inborn Errors of Metabolism in
Man. They are Phenylketonuria (PKU), Alkaptonuria, Galactosemia &
Galactosuria and hypercholesterolemia.
3.3.1 Phenylketonuria (PKU)

This metabolic disorder was first described by Folling in 1934 in mentally retarded
patients, who emitted a peculiar “mousy” odor. PKU is known as one of the best
known inborn errors of metabolism of amino acid in humans. The enzymology
of PKU established that L-phenylalanine is an essential amino acid with respect
to protein synthesis. It is known that only a small proportion of L-phenylalanine
is utilized in normal humans for protein synthesis. The larger proportion is
oxidized primarily to tyrosine due to action of enzyme phenylalanine hydroxylase.
The hydroxylase structurally contains two protein components: 1) one which is
labile and found only in the liver. 2) the other with stable feature is found in
other tissues. PKU is primarily caused by complete deficiency of action the
enzyme – phenylalanine hydroxylase mostly found in liver. The non-action of
33
Human Biochemical the enzyme phenylalanine hydroxylase leading to phenylketonuria is in fact a
Genetics
recessive mutation in the gene that codes for the enzyme phenylalanine
hydroxylase and the gene for PKU is located on chromosome 12. PKU is an
autosomal recessive disorder whose frequency in Northern European populations
is about 1/10,000 live births. The Pathways of phenylalanine metabolism is
presented in figures 3.2 and 3.3 and the pathways of phenylalanine metabolism
in normal individuals and in patients with PKU is presented in figure 3.4.
Fig. 3.2: Enzymatic steps in the catabolism of phenylalanine and tyrosine to aceto-acetic
acid (Courtesy: Gelehrter, T.D and Collins, F.S. 1998. Principles of Medical
Genetics).
Fig. 3.3 : A deficiency in Phenyllalanine Hydroxylase results in the disease Phenylketonuria

(PKU) (Courtesy: Champe, P.C, Harvey, R.A and Ferrier, D.R (Ed). 2005.
Biochemistry).
34
Inborn Errors of
Metabolism
Fig. 3.4: Pathways of phenylalanine metabolism in normal individuals (above) and in

PKU patients (below) (Courtesy: Champe, P.C, Harvey, R.A and Ferrier, D.R
(Ed). 2005. Biochemistry) 35
Human Biochemical Characteristics of PKU
Genetics
a) Elevated phenylalanine
The phenotypic–clinical feature of patients with PKU is characterized by
microcephaly (small head) and profound mental retardation. As stated above
the genetic mutation that blocks the action of the enzyme phenylalanine-
hydroxylase in the hepatic system leads to low concentration of tyrosine and
high concentration of phenylalanine in plasma. The concentration of
phenylalanine is elevated in tissues, plasma and urine in persons with PKU.
The reason is that three types of metabolites of phenylalanine such as phenyl
lactate, phynyl acetate, and phenyl pyruvate, which are not formed in normal
individuals due to action of enzyme phenylalanine hydroxylase, are produced
in elevated concentration in PKU patients. Thus the name of the disease
phenylketonuria (PKU) which signifies the presence of phenyl ketone in the
urine in the form of phenyl pyruvate. Such high concentration phenylalanine
metabolites such as phenyl-ketones are excreted through urine, giving a
characteristic ‘Mousy’ odor. The high concentration phenylalanine in plasma
is attributed to mental retardation among infants. It is known that the
formation of tyrosine from phenylalanine is catalyzed by the action of enzyme
phenylalanine hydroxylase. The reaction requires molecular oxygen and
coenzyme - tetrahydrobiopterin (BH4) which is synthesized by the body.
One atom of molecular oxygen becomes the hydroxyl group of tyrosine, the
other atom is reduced to water. During reaction teatrahydrobiopterin is
oxidized to dihydro hydrobiopterin in a separate reaction needing NADPH.
Hyper-phenylalanimenia may also caused by deficiencies in the formation
of enzyme, that synthesizes or reduces the hydroxylases co-enzyme -
tetrahydrobiopterin.
b) CNS Syndrome: Mental retardation, failure to walk, talk, seizures,
hyperactivity, tremor, microcephaly and failure to grow are characteristic
findings in PKU.
c) Hypo-pigmentation: Patients with PKU with high levels of phenylalanine
demonstrate a deficiency of pigmentation (fair hair, light skin colour, and
blue eyes).
Treatment of PKU : As stated earlier, the PKU is a disease of metabolic disorder,
caused by an autosomal recessive mutation, that inhibits the action of enzyme
which is responsible for catabolizing phenylalanine to tyrosine. Since PKU has
a genetic basis, both prevention as well as treatment of patients of varying age
groups both at family level and community level are regarded as public health
problem. The most pressing need is to address the issue of rise in phenylalanine
metabolites in urine along with high incidence in the serum phenylalanine level.
The therapy that was first administered for reducing phenylalanine intake through
dietary supplementation was made by Bickel in 1953. Since then, several groups
attempted on dietary supplementation programme and have achieved success.
The evidence is now confirmed that dietary therapy used have the most
ameliorating effect on the development of PKU patients. Two important guidelines
have to be borne in mind while treating PKU.
i) In order to prevent brain damage the diet should be started as soon as possible
within the first week of life.
ii) The metabolic status of the child especially phenylalanine levels should be
36 monitored carefully.
Adults do not require life long treatment since adult frames are resistant to rise Inborn Errors of
Metabolism
to metabolite concentration found in PKU.
3.3.2 Alkaptonuria (AKP)

Alkaptonuria is a rare metabolic disorder involving a deficiency in the enzyme
“homogentisic acid oxidase”, which is in fact responsible for the formation of
maleylacetoacetate from Homogentisate. The bio-chemical pathway involving
the Alkaptonuria is shown in figure 3.1.
Sir Archibald Garrod’s first monumental study on Alkaptonuria in 1902 brought
about a new perspective in human genetics. He could establish through his seminal
paper that metabolic disorders have genetic basis. This was the first example
that genes may register their effect by coding for enzymes genetically.
Alkaptonuria was thus recognized as the first autosomal recessive human disease
that emanates from the deficiency of an enzyme. The characteristic symptoms of
the disease are:
a) Formation of homogentisic aciduria: In this condition, the patients urine
contains elevated levels of homogentisic acid, which is oxidized to a dark
pigment on standing leading to black colour (fig. 3.5)
b) Development of Arthritis, particularly in the spine and large joints due to
the degenerative changes.
c) The deposition of endogenous homogentisic acid autooxidation products in
the cartilage and collagenous tissue lead to blue or black ochronotic
pigmentation of cartilage, and black deposits in the sclera of the eyes, other
features of this condition can include heart problems, kidney stones and
prostrate stone.
Fig. 3.5. A patient with alkaptonuria A. Urine and B. Vertebrae.

37
Human Biochemical How common is AKP?: This condition is rare, affecting I in 250,000 to 1 million
Genetics
people world wide. AKP is more common in certain Areas of Slovakia (1 in
19,000) and in the Dominican Republic.
Genetics of Alkaptonuria : It is now clearly established that mutation in HGD

gene causes Alkaptonuria. The gene encoding an enzyme called homogentisate
1, 2- dioxgenase (also known as homogentisate oxidase). The gene for HGD is
located on chromosome 3 in region 3q21-q23.
The enzyme Homogentisate Oxidase is primarily active in the liver and kidney.
It is chiefly responsible for breaking down the amino acid phenylalanine and
tyrosine, into a molecule called homogentisic acid. Homogentisic acid oxidase
adds two oxygen atoms to homogentisic acid converting homogentisic acid into
another molecule called Maleylacetic acetate.
More than 40 mutations in HGD gene have been detected in people with
Alkaptonuria. The substitution of the amino acid valine for methionine at position
368 is the most common form of HDG mutation in European population. The
mutation in this gene inactivates the enzyme. Without HGD normal gene
functioning, the enzyme homogentisic oxidase become ineffective accounting
for building up homogentisic acid in the body. The gene for Alkaptonuria is
inherited as autosomal recessive trait. The person with Alkaptonuria inherits
both copies of the recessive genes from parents who are heterozygotes for
Alkaptonuria.
3.3.3 Galactosemia and Galactosuria

Galactosemia & Galactosuria are identified as disorders of carbohydrate
metabolism especially of Galactose metabolism.
The major source of Galactose is obtained from lactose – the principal source of
milk and milk products. However, some amount of galactose can be obtained by
lysosomal degradation of complex carbohydrates such as glycoproteins, and
glycolipids – the membrane components of tissues.
Metabolic Pathways: The metabolic pathways that involve metabolism of

Galactose are as follows:
a) Phosphorylation of Galactose
b) Formation of UDP-galactose
c) Use of UDP-galactose as a carbon source for glycolysis or gluconeogenesis
d) Role of UDP -Galactose in biosynthesis reaction.
38
The figure 3.6 showing metabolism of galactose is given below: Inborn Errors of
Metabolism
Fig 3.6: Metabolism of Galactose (Courtecy: Champe, P.C, Harvey, R.A and Ferrier, D.R
(Ed). 2005. Biochemistry)
Galactosemia and galactosuria arise in individuals who are deficient in secreting

enzymes– a) Galacto kinase that metabolizes Galactose to Galactose 1-P
phosphate. b) Galactose 1. Phosphate Uridyl transferase that converts
Galactose1-Phosphate to UDP-Galactose and Glucose1-Phosphate. Galactosuria:
As stated earlier the cases of galactosuria and galactosemia are due to the
deficiency of galactokinase enzyme that converts galactose to galactose1phosphate.
Classic Galactosemia: It is in fact a deficiency of the enzyme Uridyltransferase.

The deficiency is due to autosomal recessive disorder. It causes both galactosemia
and galactosuria . The frequency of this deficiency is 1 in 23,000 births. Individuals
with Uridyl transference enzyme deficiency facilitate the accumulation of
Galactose 1-Phosphate, and consequently excess of galactose in the body lead to
vomiting, diarrohea and jaundice. In some cases, the excess accumulation of
galactose 1-Phosphate also causes liver damage, severe mental retardation and
cataract. Genetically this disorder is an autosomal recessive mutation in the gene
that codes for the enzyme Galactose 1-Phosphate uridyl transferase.
3.3.4 Disorders of Lipid Metabolism: Familial

Hypercholesterolemia
Familial Hypertension (FH) is an important cause of heart disease. It is one of
the most common autosomal dominant disorder. In the individuals with FH the
plasma cholesterol levels are twice higher than normal (i.e. about 300-400 mg/
dl). The high cholesterol level is due to deficient or defective LDL receptors
leading to enhanced levels of endogenous cholesterol synthesis.
All cells require cholesterol as a component of their plasma membrane. They

can either synthesize their own cholesterol or they get it from the extra cellular
environment, where it is carried principally by low density lipoprotein (LDL). In
a process known as endocytosis (fig. 3.7) LDL-bound cholesterol is taken into
39
Human Biochemical the cell via receptor on cell surfaces. In view of the lack of normal number of
Genetics
LDL receptors, cellular cholesterol uptake is reduced, and thereupon circulating
cholesterol levels rise. The gene for FH is located on chromosome 19.
Fig. 3.7: The process of receptor mediated endocytosis (Courtesy: Jorde, L.B, Carrey,
J.C, Bamshad, J.C and White, R.L. 2000. Medical Genetics, 2nd edition).
In case of homozygotes (cholesterol levels raising from 600 to 1200 mg/dl) the
distinctive cholesterol deposits in the skin and tendons called xanthomas occur.
3.4 SUMMARY
The present unit describes few examples of inborn errors of metabolism in man
such as phenylketonuria, alkaptonuria, galactosuria, and hypercholesterolemia
with reference to biochemical and genetic aspects. These topics constitute the
central theme of one important area of human biochemical genetics, covering
the abnormal aspect of human genetic variation. The study of these metabolic
diseases focuses on early diagnosis as well as treatment, aspects which are also
important from clinical point of view.
40
Suggested Reading Inborn Errors of
Metabolism
Champe, P.C, Harvey, R.A and Ferrier, D.R (Ed). 2005. Biochemistry, 3rd edition.
MD: Lippincott Williams & Wilkins.
Gelehrter, T.D and Collins, F.S. 1998. Principles of Medical Genetics, Second
edition, USA:Williams and Wilkins Co.
Jorde, L.B, Carrey, J.C, Bamshad, J.C and White, R.L. 2000. Medical Genetics,
2nd edition, St Louis: Mosby.
Vogel, F. and Motulsky, A.G. 1996. Human Genetics: Problems and Approaches,
Berlin: Springer.
Sample Questions
1) Discuss on example of error of amino acid metabolism. Can you treat it by
any means?
2) Give a brief note on an example of error of lipid metabolism leading to heart
disease.
3) What is the difference between galactosaemia and galactosuria? Comment
4) Write a note on the first metabolic disorders described by Garrod?
41
MANE-001
Human Genetics
Indira Gandhi
Block
6
APPLIED AND EMERGING TRENDS IN HUMAN
GENETICS
UNIT 1
Introduction to New and Emerging Areas in Human
Genetics 5
UNIT 2
Genetic Epidemiology and Epigenetics 26
UNIT 3
Prevention of Genetic Diseases 39
UNIT 4
Genetics and Human Issues 48
Expert Committee
Andhra University Dr. P. Venkatramana
Visakhapatnam Assistant Professor
Punjabi University, Patiala Dr. Rukshana Zaman
Assistant Professor
Prof. A. Papa Rao Discipline of Anthropology
Dept. of Anthropology IGNOU, New Delhi
Sri Venkateswara University
Tirupati Dr. Mitoo Das
Assistant Professor
Dr. Roli Mathur Discipline of Anthropology
Scientist ‘C’ IGNOU, New Delhi
Division of Basic Medical Sciences Dr. K. Anil Kumar
Indian Council of Medical Research Assistant Professor
New Delhi Discipline of Anthropology
Dr. Seema Kalra IGNOU, New Delhi
Assistant Professor Academic Assistance provided by
Dept. of Biochemistry Dr. N.K. Mungreiphy, Research Associate
IGNOU, New Delhi (DBT) for the Expert Committee meeting
Content Editor
Prof. P. Veerraju (Retd.)

Unit Writers
Dr. S.A.A. Latheef (Unit 1) Dr. Roli Mathur (Unit 4) Cover Design
Post Doctoral Fellow (CREBB) Scientist ‘C’
Division of Basic Medical Sciences Dr. Mitoo Das
School of Life Sciences
Indian Council of Medical Research Asstt. Professor
University of Hyderabad, Hyderabad
New Delhi Anthropology
Dr. Kumud Sarin (Unit 2) SOSS, IGNOU
Technical Director, Indian Biosciences New Delhi
and Research Institute, NOIDA
Dr. P. Venkatramana (Unit 3)
Assistant Professor,
Faculty of Anthropology
SOSS, IGNOU, New Delhi
Authors are responsible for the academic content of this course as far as the copyright issues are concerned.
Print Production
Mr. Manjit Singh
November, 2012
ISBN-978-81-266-
Printed at :
BLOCK 6 APPLIED AND EMERGING
TRENDS IN HUMAN GENETICS
In recent years, the application of advanced technologies has created a number

of new emerging subfields in the field of genetics. Of late, with the availability
of latest sequencing technologies leading to the sequencing of genomes of various
organisms including human, large scale public-domain genomic databases have
been created. To treat this data, the field of Bioinformatics has emerged.
Bioinformatics is defined as the computational handling and processing of genetic
information. Various tools have been used in this subfield. Further sequencing
of the genomes has led to the origin of proteomics dealing with the understanding
of post transcriptional and post translational modifications of various proteins.
Proteomics has subfields like structural, expression, functional proteomics etc.
Various tools like databases, mass spectrophotometry, software tools and protein
separation technologies have been used for Proteomics.
Further, a new field of pharmacogenomics has emerged which is concerned with

genome wide analysis of genetic determinants of drug efficacy and toxicity.
Besides, various factors that influence the drug response like age, sex, race,
ethnicity, disease state and genetics also play an important role in drug response.
Further stem cell research has made a great impact on the applied value of genetics.
Various types of stem cells have been characterised and the applications of these
cells vary from an in vitro model to therapeutic tool.
Genetic epidemiology aims at diseases that are caused by genetic alterations

among closely related individuals or in a Mendelian population. It measures the
frequency and prevalence of a genetic disease, gene - gene interaction, gene -
environment interaction, genotype and phenotype correlation, the extent of
expression of default gene in families or in a population. When there is no fault in
the structure of a gene, a disease may occur in the faulty expression of a gene.
Such changes are – DNA methylation and histone modification. It is called as
epigenetics. Segregation, association and linkage analysis are important methods
used in Genetic epidemiological studies. Using these methods internationally, a
Haplotype map of humans (HapMap) was constructed to understand common
genetic variation and its association with diseases.
Genetic disease is caused by variation or alteration called mutation in gene, or

alteration in chromosome. Genetic diseases can be classified into simple and
complex diseases. Simple genetic diseases are also called as monogenetic or
Mendelian diseases caused by a mutation. Complex diseases have multi-factorial
causation. They are caused by the interaction of many genes and gene –
environmental interaction. Screening the genetic diseases in the population and
genetic counselling to the couples is a prerequisite in avoiding the defective
progeny. To prevent the genetic diseases prenatal diagnosis and termination of
defective zygote is one of the best ways. Gene therapy is the treating method for
genetic diseases, it involves in correcting the default genetic sequence. Currently
available method for preventing genetic diseases is to identify the faulty genetic
code at an early stage and change the life style. By changing the life style we can
prevent some late onset genetic diseases. In curing the genetic diseases future
research may bring success in gene therapy.
Applied and Emerging The last decade has witnessed tremendous advances in science and technology
Trends in Human Genetics
and the prospects of genetic testing, genetic engineering, cloning, stem cell
research, prenatal testing, DNA diagnostic etc. all have raised many ethical
dilemmas in the minds of scientists and society. There are advantages of such
new technologies but there is also the fear of the unknown distant possibilities
which needs careful examination. Weighing of risk benefit ratio, protection of
privacy and confidentiality and sharing of burdens and benefits are some of the
main issues. Close monitoring of research in these areas is important. Education
has the potential power to prevent stigmatization and discrimination by
emphasising that genetic disorders are not caused by the behaviour of affected
persons or families but the fact that most people may carry some recessive lethal
mutations and that our offspring or we are all at genetic risk. For all kinds of
genetic testing and research respect for persons is important and should include
informed consent, right to referral, full disclosure, protection of confidentiality,
and respect for minority groups, women and children. The implications of these
various ethical, legal and social issues concerning the application of genetic
technologies are outlined here.
4
Introduction to New and
UNIT 1 INTRODUCTION TO NEW AND Emerging Areas in Human
Genetics
EMERGING AREAS IN HUMAN
GENETICS
Contents
1.1 Introduction
1.2 Proteomics
1.3 Bioinformatics
1.4 Pharmacogenomics
1.5 Stem Cell Research
1.6 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
Ø appreciate the definition, importance, summary of proteins and their
functions, subfields, tools, applications and challenges of proteomics;
Ø describe scope, historical development, tools, biological databases, applications
and challenges of bioinformatics;
Ø gain insight on scope, classic examples, evolutionary aspects, approaches,
in vitro and in vivo models, applications and challenges of pharmacogenomics;
and
Ø discuss scope and evolution of stem cell research, types of stem cells, applications
and challenges of stem cell research.
1.1 INTRODUCTION
Like any discipline human genetics is growing by leaps and bounds with the
advancement of science and technologies for the noble mission of human welfare
and enhancement of quality of life of the people.
Sequencing of the genomes has led to an accumulation of a wealth of sequence

data. The functions of a large number of genes are unknown. Deciphering the
functions of genes will require a clearer understanding of post transcriptional
and post translational modifications. Since defective proteins are the ultimate
causes of most diseases, it is important to consider the proteome (set of all
proteins) in relation to the genome, the study of which constitutes the subject
matter of proteomics.
Advancement of sequencing technologies, and the consequent of sequencing of

genomes of various organisms including human, and availability of large-scale
public-domain genomic and related databases have necessitated the development
of the discipline of Bioinformatics. Bioinformatics has been useful for the 5
Applied and Emerging maintenance and analysis of sequences within the reach of scientific community
and public in the form of databases. Development of various algorithms have
facilitated the comparison of sequences and genomes for predicting the genes
and their function, translation of nucleotide sequences into amino acid sequences,
predicting the structure of proteins by homology modeling, single nucleotide
polymorphism discovery, finding the susceptible biomarkers (or genetic markers)
of diseases and identification of drug targets for the better management of diseases.
There is a difference of about 0.1% in the DNA sequences of any two individuals.
This variation often resulted in variation in drug response. Studying at genome
level for characteristic genetic variants responsible for variation in response to
drugs has resulted in the birth of pharmacogenomics. Lack of adequate knowledge
of genotype characteristics that contribute to adverse reactions to various drugs
is also increasing patient-care costs. Genotype guided management of diseases
holds great promise.
Decreasing birth rates, improvement of nutrition and control of infectious diseases

have improved the lifespan, and at the same time increased the prevalence of
diseases like diabetes, cardiovascular diseases and cancers. With the advancement
of medical technology and pharmaceutical research many of these diseases can
be managed clinically. Finally, patients of these diseases sometimes face end-
stage organ dysfunction requiring organ transplantation. Lack of awareness on
organ donation and pending clearances on cadaver organ transplantation have
fostered the development of stem cell research efforts. Somatic cell nuclear
transfer is one of the tools of stem cell research which helps in developing
autologous and immune rejection free cells for therapeutic purposes.
Developments in the stem cell research have helped to shape the therapies for
the management of some disorders. Stem cell research has raised the hope of
suffering patients, although the implementation of the results of this research for
patient welfare is still in its infancy.
Let us discuss in detail on the above said areas of Human Genetics.
1.2 PROTEOMICS
The term ‘Proteome’ was coined by Marc Wilkins in 1994. This term is a linguistic
equivalent to genome and deals with large scale analysis of the complete, or at
least the major, set of proteins. The Proteome can be defined in terms of the
sequence, structure, abundance, localisation, modification, interaction and
biochemical function of its components.
Importance of proteomics
1) Genes are instruction carriers, while the proteins are the functional molecules
of the cells and a true understanding of them can come from the direct study
of proteins.
2) Unlike the genome whose content with few exceptions remain the same
irrespective of cell type or environmental conditions, the proteome is dynamic
whose content varies under different conditions due to the regulation of
transcription, RNA processing, protein synthesis and protein modification.
Study of the proteome can provide the glimpse of the cell in action.
6
3) A good understanding on the structure and function of a protein may provide Introduction to New and
Emerging Areas in Human
clues to introduce mutations in order to better understand their function. Genetics
4) Transcriptome may not represent the true insight on proteome, because not
all mRNA in the cell are translated and rates of protein synthesis and protein
turnover may vary among transcripts.
5) Difference in the stability of mRNA and efficiencies in translation can affect
the generation of new proteins. Some transcripts may give rise to multiple
proteins. For instance, 22 different forms of alpha-1-antitrypsin were
observed in plasma. The individual functions of these proteins can be studied
at the protein level only.
6) In certain body fluids like serum, cerebrospinal fluid and urine where nucleic
acids are not represented, proteins only provide information about
determinants of disease progression. In case of degradation and cross linking
of nucleic acids in fixed biological specimens, protein may only act as a
source material for further study. In many diseases proteins are the drug
targets.
7) Proteomics attempts to bridge the gap between our understanding of genome
sequence and cellular behaviour.
A brief account on proteins is as follows:

Proteins: The term ‘protein’ is derived from the Greek word ’Proteios’, meaning
of the first order. J.J.Berzelius in 1938 coined the term ‘protein’ to describe a
class of macromolecules abundant in living organisms. Proteins constitute about
50% of dry weight of the cell. They are made up of amino acids which were
earlier 20 in number, but recently two more such as selenocysteine and pyrrolysine
were added to the list. Except in marine microorganisms, in which both D and L
amino acids were found, proteins contain L-amino acids only. The D and L refers
to the property of amino in response plane polarized light. The amino acids form
peptide bonds involving carboxylic group of one amino acid with amino group
of other amino acids. The involved amino acids are called amino residues.
Depending on the number of amino acid involvement in peptide bonds they are
called bi, tri, tetra etc. A protein may have one or more polypeptides (a string of
amino acids) folded mostly into either globular or fibrous form.
Proteins are synthesized by the translation of mRNA into polypeptides on

ribosomes. After translation, they undergo 400 types of reversible and irreversible
chemical reactions like glycosylation, phosphorylation, which are collectively
called as post translational modifications. At any given time in a cell, the level of
protein depends on the rate of transcription of the gene, the efficiency of translation
of mRNA into protein and the rate of degradation of the protein. Various agents
like oxidants, radiation, chemicals cause modification of proteins which lead to
their degradation. Phosporylation accompanied by conjugation with ubiquitinin
and lysosomal enzymes also effect degradation of proteins.
Structure: The structure of protein can be explained at four levels.

a) Primary: This contains the linear sequence of amino acids which are bonded
by covalent peptide bonds or linkages. This structure determines its function
and the composition of amino acids is responsible for physical and chemical
properties.
7
Applied and Emerging b) Secondary: This is formed by twisting of polypeptide chain leading to spatial
arrangement of protein. The basis of secondary structure depends on the
pattern of hydrogen bonds between amide and carboxylic groups. á helix
and â sheets are the known two main types of secondary structures. á helix
has a rigid arrangement of a polypeptide chain in which amino acid side
chains extend outward from the central axis. It is stabilized by extensive
hydrogen bonding. In case of â sheets, hydrogen bonds are observed between
the neighbour segments of polypeptide chains. The arrangement of
polypeptide in â sheets is either parallel (same direction) or anti-parallel
(opposite direction).
c) Tertiary: This structure provides the stability of the protein. It is the three
dimensional structure. In this, hydrophobic side chains are held interior and
hydrophilic groups are seen on the surface of the protein.
d) Quaternary: It is the spatial arrangement of subunits (polypeptide

chains).These subunits are held together by noncovalent bonds like hydrogen
bonds, hydrophobic interactions and ionic bonds. Depending on the number
of polypeptides these subunits are known as mono, di,tri or tetramers. If
they are identical they are called homo or if unrelated they are known hetero.
Fig. 1.1: Protein Structure (source: bioweb.wku.edu)
Subfields of Proteomics
1) Sequence and Structural proteomics: Protein sequences allow the designing
of probes or primers which can be used to isolate the cDNA or genomic
sequence. It is the protein sequence which acts as a bridge between the activity
of a protein and the genetic basis of a particular phenotype. Increasing
deposition of protein sequences and consequent development of statistical
techniques are facilitating the comparison of proteins. Three primary sequence
databases are Genbank, EMBL (European Molecular Biology Laboratory),
DDBJ (DNA Data Bank of Japan) that provide translated protein sequences
from DNA sequences, whereas, SWISSPROT is a dedicated protein sequence
data bank.
Similar sequences may gives rise to similar structures and this idea has given
birth to new branch of proteomics known as structural proteomics which
paved the way for storage, presentation, comparison, inferring evolutionary
relationships and prediction of theoretical protein models, a boon in the
absence of crystallographic protein structures, for drug discovery research.
8
2) Expression proteomics: It is concerned with the analysis of protein Introduction to New and
abundance, separation of protein mixtures, the identification of individual Genetics
components and their systematic quantitative analysis. This sub branch lays
emphasis on differences representing alternative states like health and disease
and characterisation of post-translational modifications. The key tools used
in investigations involve 2D gel electrophoresis, mass spectrometry, multi-
dimensional chromatography and protein chips.
3) Interaction proteomics: It deals with the genetic and physical interactions
among proteins as well as interactions between proteins and nucleic acids or
small molecules. Study of protein interactions not only provides insight on
the function of individual proteins but also how proteins function in pathways,
networks, and complexes. It seeks to achieve creation of proteome linkage
map based on binary interactions between individual proteins and higher
order interactions determined by the systematic analysis of protein complexes.
Interactions between proteins and nucleic acids emphasize on processes such
as gene regulation, while interaction of proteins with small molecules may
enlighten on the interaction of enzymes with substrates and receptors with
their ligands and also may play an important role in drug development process.
The key approaches used in studies of this kind of interaction are yeast, two
hybrid system, mass spectrometry, biochemical assays and X-ray
crystallography.
4) Functional Proteomics: This lays emphasis on testing protein functions on
a large scale such as testing expressed proteins for different enzymatic
activities.
Tools used in Proteomics
1) Databases: Protein Expressed sequence tag and complete genome sequence
provide information on all the expressed proteins in organisms.
2) Mass Spectrometry: It provides information on molecular measurement

(>100KDa) and sequence analysis of proteins.
3) Soft ware tools: These tools determine the sequence of a protein with the
aid of specialised algorithms and provide automated survey of large amounts
of mass spectrometry data for protein sequence matches.
4) Protein Separation technologies: They resolve complex protein mixtures

into individual proteins and permit comparison of differences in protein levels
between two samples. The key technologies include 2Dimensional gel
electrophoresis, SDS-Poly acrylamide gel electrophoresis, high performance
liquid chromatography, capillary electrophoresis, affinity and ion exchange
chromatography.
Applications
1) Identification and cataloguing of proteins.
2) Identification of proteins in a sample of differentiation, developmental state,
disease state and exposed to a drug, chemical or physical stimulus.
3) Determinate how proteins interact with each other in living systems and
characterisation of proteins in more complex networks.
4) Mapping of proteins in post-translational modifications. 9
Applied and Emerging Challenges: No single technological approach is suitable for every application.
Integration and automation of these approaches, using of better materials,
advancement in instrument design and methodology for improving sensitivity,
resolution and repeatability are the challenges before the proteomics community
in order to provide a comprehensive analysis of complex biological system.
1.3 BIOINFORMATICS
information. Its goal is to enable the discovery of new biological insight as well
as to create a global perspective from which unifying principles can be perceived.
It lays emphasis on organizing the data for accessing and generating information,
developing tools to analyse the data and interpret the data in a biologically
meaningful manner. In analysing the data, two approaches like data mining and
knowledge discovery are taken into consideration. These approaches involve
generating testing hypothesis regarding the function or structure of a gene or
protein of interest by homology searching. Besides deriving meaningful biological
information from the data; bioinformatics also serves the scientific community
with resources such as databases.
Bioinformatics plays an important role in many areas of biological research like

genomics, transcriptomics, proteomics, structural biology, genetics, molecular
biology and evolutionary biology. Bioinformatics knowledge is utilised in
genomics particularly, genome sequencing, mapping, genome annotation,
comparing multiple genomes, calculating evolutionary distance and single
nucleotide polymorphism discovery. Transcriptomics applications of
bioinformatics includes study of transcribed sequences, both full length cDNA
and expressed sequence tags and analysis of gene expression data. In proteomics,
bioinformatics is helpful in the analysis of protein sequences, protein abundance
and in determination of protein structure either empirically or computationally.
In molecular biology, analysis of protein-protein interactions and molecular
pathway and in systemic studies of gene regulation bioinformatics has significant
contribution. In genetics, bioinformatics is useful in the discovery of new
molecular genetic markers such as SNP’s and use of these and other markers to
dissect the genetic basis of disease and other phenotypes. Bioinformatics is also
helpful in the studies of evolution and phylogeny.
Tools used in Bioinformatics: Various tools are used in bioinformatics research

like internet, search engines like Google, Scirus, AltaVista, Lycos, HotBot,
Northern Light, Dogpile, databases like National centre for biotechnology
information (NCBI), PubMed and sequence analysis tools like BLAST, FASTA,
multiple sequence alignment (MSA), and visualisation tools such as RasMol,
Jmol and Cn3D.
Computational methods help in analysing the data and formulate hypotheses.

Sequence data is the most abundant type of biological data available electronically.
Pairwise sequence comparison is used in bioinformatics applications for sequence
based database searching, building evolutionary trees, identification of
characteristic features of protein families, create homology models, compare
genomes, explore sequence determinants of protein structure and to connect
expression data to genomic information.
10
Sequence data can be used for sequence analysis to know the sequence Introduction to New and
characteristics, sequence comparison, multiple sequence alignment, motif Genetics
discovery and phylogenetic inference. Sequence databases can be found on
internet. Databases are searched mostly for similarity search. The tools used for
similarity search includes BLAST and FASTA.
BLAST: It stands for basic local alignment search tool. This algorithm is used to
perform sequence similarity search. A server at NCBI was established to support
BLAST. This server is used widely for sequence database searches. An
independent set of BLAST program was developed at Washington University
known as WU-BLAST. This BLAST also performs the similarity search like
NCBI and produces gapped local alignments. The BLAST requires different
statistical methods to evaluate sequence similarity score. BLAST algorithm
increases the speed of sequence alignment by searching first for common words
or k-tuples in query sequence and each database sequence. It searches the words
that are significant. In case of proteins, the significance of word matching is
evaluated by BLOSUM 62 amino acid substitution matrix. The word length is 3
for proteins and 11 for nucleic acids in BLAST algorithm. The latest version of
BLAST is BLAST 2. It reports the gapped alignment of query and database
sequences. BLAST has filtering feature for searching low complexity regions in
query sequence (repeats of sequence character) which produces artificial high
score alignments.
There are number of variations of BLAST programs like Blastp for comparing
an amino acid query sequence against a protein sequence of a database; Blastn
for comparing a nucleotide query sequence against nucleotide sequence of a
database; Blast x for searching six frame translation product of nucleotide
sequence against a protein database; Tblastn for searching a protein sequence
against a translated nucleotide sequence of a database; and Tblastx for comparing
six frame translations of nucleotide sequence query sequence against a six frame
translations of a nucleotide sequence data base. MegaBLAST searches similar
sequences that are 300 to 100,000 bp long. A long word is used for searching and
the gap penalty is calculated from the match and mismatch scores. RPS BLAST
scans conserved domains in a protein sequence. BLASTcl3 is a network client
BLAST which is used to access the BLAST server. Standalone BLASTs are
executable versions of all the BLAST program for the operating systems
Windows, Unix and Macintosh. PSI-BLAST (Position specific iterated BLAST),
PHI BLAST (pattern hit initiated BLAST) are used to search for domains in
query protein sequence and in database sequences. BEAUTY (BLAST enhanced
alignment utility) adds additional features to the BLAST like summarizing the
locations of HSPs, PFAM domains and Prosite pattern. BLAST searching with
cobbler sequence (consensus) is used to find majority residues in multiple
sequence alignment. BLAST2 program is used to align very long sequences.
FASTA: This program is used for aligning pairs of protein and DNA sequences.
It searches for matching sequence patterns or words called k-tuples. Patterns
contain k consecutive matches of letters. It attempts to build a local alignment
on word matches. This program is used for database searches. FASTA compares
the query protein or DNA sequences to the target sequences in the database and
give the best matched sequence and local alignment of matched sequences. To
search for similarity FASTA uses hashing method in which a table of the positions
of each word of length k, or k tuple is constructed for each sequence. The position
11
Applied and Emerging of each word is calculated by subtracting the position in the first sequence from
the position in the second and words having the same offset position show a
region of alignment between the two sequences. The number of comparisons
increases as the average sequence length. The k tuple length is 1or 2 for protein
and 4-6 for nucleic acid sequences in FASTA program. There are other versions
of the FASTA also reported. Among them TFASTA compares the query protein
sequence to a six frame translation of DNA sequence of the database; FASTF/
TFASTS compares a set of short peptide fragments against a protein sequence
database or a DNA sequence database translated in all six reading frames; FASTX
and FASTY translate a query DNA sequence in all three reading forwad frames
and compare all three frames to a protein sequence database; and TFASTX and
TFASTY compare a query protein sequence to a DNA sequence database,
translating each DNA sequence in all six possible reading frames.
Multiple Sequence alignment (MSA): It is an alignment of three or more

sequences and aims to place sequence positions related by function and evolution
in the same column of the alignment allowing for mismatches and gaps (deletions
or insertions). In msa, both global and local alignments are used. In global
alignment, dynamic programming algorithm is used for alignment of three
sequences, more than this number, only a small number of relatively short
sequences may be analysed. The methods used include progressive methods
(ClustalW,ClustalX, MAFFT, MAVID,MSA, MULTIPIPMAKER, POA,
PRALINE, T-COFFEE) which start by aligning most alike sequences followed
by building an alignment by the addition of more sequences; iterative methods
(DIALIGN, PRRP, SAGA) initially align group of sequences and then revise the
alignment to achieve a more reasonable result; methods of aligning the sequences
based on conserved pattern found in the same order in the sequences; statistical
methods generating probabilistic models of the sequences and graph based
methods.
Local MSA methods align the most similar regions in sequences. The approaches
include profile analysis which identifies highly conserved portion of the alignment
and produces a scoring matrix called a profile. A profile includes scores for
amino acid substitutions and gaps in each column of the conserved region. In
block analysis, blocks (substituted regions without gaps) are searched and used
in sequence alignments. Pattern searching or statistical methods scan a localised
region of sequence similarity in a set of sequences.
Structure visualisers: Protein structure data is stored as collections of x,y,z

coordinates. The connectivity between atoms in proteins has to be taken into
account and for the visualisation to be effective a virtual 3D environment which
needs to be created. A protein structure visualisation program needs to be able to
display use selected subsets of atoms with correct connectivity, draws standard
cartoon representations of proteins such as ribbons and cylinders and recolour
subsets of a molecule according to a specified parameter.
RasMol: It is a structure visualisation program tool and available for a wide

range of operating systems. It reads molecular structure files in the standard
PDB format. It comes in three display depths 8, 16 and 32 bit. The molecule can
be rotated in window. It has file menu commands for opening molecular structure
file, display menu commands for the molecular display style to formats including
ball and stick, cartoons and space fill. The colour menu allows colour changes of
12
the molecule, option menu allows changes of the display style and export menu Introduction to New and
facilitates writing the displayed images in common electronic image formats Genetics
such as GIF, PostScript and PPM. Help common allows the creation of own
combination of colours and structure display formats.
Cn3D: It allows viewing protein structure files NCBI ASN.1 format. It opens
two windows: a colour structure viewer in which a molecule can be rotated,
coloured according to different properties and rendered in different display
formats; a sequence viewer, which allows you to view sequences and alignments
corresponding to the displayed protein and to add graphics to the sequence display
to highlight the location of secondary structure features.
Biological Databases: A biological database is a large, organised body of

persistent data, usually associated with computerised software designed to update,
query and retrieve components of the data stored within the system. These
databases are helpful to gain a insight into biological phenomena from the
structure of biomolecules and their interactions to the whole metabolism of
organism and to understand the evolution of species. Databases are classified as
primary databases (DDBJ, EMBL, Gene Bank), protein sequence databases
(SWISS-PROT, Protein Information Resource), protein sequence databases
(Pfam, PROSITE) protein structure databases (PDB, SCOP), protein-protein
interaction databases (BioGRID, STRING), pathway databases (KEGG),
microarray databases (Array express, Gene expression omnibus).
DDBJ (DNA Data Bank of Japan): It is run by National Institute of Genetics,

Japan. It is the only nucleotide sequence database in Asia. It works in collaboration
with EMBL and Gene Bank. It collects experimentally determined sequence
data mainly from Japanese researches but also accepts from others as well. The
database is a collection of “entry” which is the unit of the data. Each entry includes
nucleotide sequence and the information of submitters, references, source
organisms, and the biological nature such as gene function and other property of
the sequence
EMBL(European Molecular Biology Laboratory): This database is maintained

by European Molecular Bioinformatics Institute, Cambridge, U.K. It is Europe
primary nucleotide sequence database. The data consists of DNA and RNA
sequences drawn from individual researchers, genome sequencing projects and
patent applications. As on 30th August, 2012 it contain 252,106,363 sequence
entries comprising 450,481,663,919 nucleotides.
Gene Bank: It is a NIH genetic sequence database. As on April 2011, it had a

collection of 126,551,501,141 bases in 135,440,924 sequence record. Entrenz
nucleotide is used for sequence identification and annotations. Entrez nucleotide
is divided into core nucleotide (main collection), dbEST (expressed sequenced
tags) and dbGSS (genome survey sequences). BLAST programme can be used
to align query sequences to Genebank sequences.
SWISS-PROT: It is a curate protein sequence database formed in 1986 and

maintained by the Department of Medical Biochemistry of the University of
Geneva and the European Bioinformatics Institute (EBI). The characteristic
features of SWISS-PROT include availability of high level annotations, a minimal
redundancy and integration with other databases.
13
Applied and Emerging PIR (Protein Information Resource): It was established in 1984 by the National
Biomedical Research Foundation (NBRF) and helps researchers in the
identification and interpretation of protein sequence information and provides
tools.
Pfam: It is a database of protein families. It has two components namely Pfam-

A and Pfam-B. Pfam-A contains large portion of sequences with high quality
and manually curated protein families, while, the Pfam-B has a collection of low
quality families and useful for identifying functional regions. Pfam also generates
clans, a grouping of related protein families.
PROSITE: This database has a collection of protein families and domains.

Patterns and profiles of more than thousand protein families and domains data is
available in this database.
PDB (Protein Data Bank): This database is of experimentally determined

structures of proteins, nucleic acids and complex assemblies.It was established
in 1971 at Brookhaven National Laboratories. In 1998 it came under the umbrella
of Research colloboratory for structural bioinformatics. It contains information
about coordinates, deposited structures and method of structure determination.
As on October 2nd 2012, 85 thousand records of structures were available.
SCOP (The Structural Classification of Proteins): It organises and classifies

proteins based on their evolutionary and structural relationships. It is organised
into four hierarchical levels: family, super family, fold, and classes.
BioGRID (The Biological General Repository for Interaction Datasets): It

is a database with collections of genetic and protein interaction data from model
organisms and humans. It has holdings of 557,934 interactions scanned from
34,996 publications in the primary literature as on 1st October, 2012.
STRING (Functional Protein Association Network): It is a database of known

and predicted protein interactions. The interactions include direct (physical) and
indirect (functional) associations. The data is drawn from genomic context, high-
throughput experiments, co expression and previous knowledge. This database
makes an attempt to integrate interaction data from these sources for a large
number of organisms and transfers information between organisms. It has a
collection of 5214234 proteins of 1133 organisms.
KEGG: It was initiated in 1995. This database integrates genomic, chemical

and systemic functional information. It provides a reference knowledge base for
linking genomes to life through the process of PATHWAY mapping to infer
systemic behaviours of the cell or the organism. It also links genomes to the
environment via BRITE mapping. KEGG BRITE, an ontology database showcase
functional hierarchies of various biological objects, including molecules, cells,
organisms, diseases and drugs and also relationships among them. KEGG
PATHWAY presently has a combined map of about 120 existing pathway maps.
Smaller pathway modules are stored in KEGG MODULE. KEGG DRUG
contains information about all approved drugs in the US and Japan, and KEGG
DISEASE provide a link in to disease genes, pathways, drugs and diagnostic
markers.
14
Micro array databases: Microarray is a hybridization of a nucleic acid sample Introduction to New and
(target) to a very large set of oligonucleotide probes, which are attached to a Genetics
solid support, to determine sequence or to detect variations in a gene sequence
or expression or for gene mapping. Various organisations have created microarray
databases like National Center for Biotechnology Information,US-Gene
expression Omnibus, European Bioinformatics Institute -Array express and
National Institute of Genetics, Japan- Center for information biology gene
expression.The purpose of creation of these databases is to store the minimum
information about microarray experiments and to allow the researchers to repeat
the experiments.
Applications of Bioinformatics (BI):

• is useful for gene and protein prediction, evolutionary distance calculation,
active site identification, construction of novel mutations and characterisation
of alleles of diseases.
• is applied in the analysis of the organisation of genes and genomes.
• may be helpful in identification of regulatory elements in genes.
• focuses on the development of algorithms to assess relationships among
members of large data sets.
• allows the study of evolutionary events like gene duplication, lateral gene
transfer.
• is useful in conservation of genomes of endangered species and biodiversity
management.
• facilitate matching of data generated by mass spectrometers to the protein
sequence databases.
• is helpful in the automation, processing, quantification and analysis of large
amount of data from biomedical images.
• provide first hand information on chemical structure, reaction kinetics and
synthetic methods, toxic chemical substances in the form of databases.
• can be used to study invention, implementation of structures and algorithms
to improve communication, understanding and management of medical
information.
• may be used to develop models for simulating intracellular molecular
processes to predict dynamic behaviour of living cells.
• tools are used for prediction of function of genes and 3D structure prediction
of proteins, selection of suitable ligands, identification of protein motifs and
domains.
• is useful to maintain the sequence data and allow analysis of data by making
availability of tools.
Challenges: The key challenges to bioinformatics involve the management of

current flood of raw data, aggregate information, the diversity of the sources and
formats, variable conditions and descriptions of experimentation, the quality of
experimental evidence for data, data processing and evolving knowledge arising
from the study of the genome and its manifestations.
15
Applied and Emerging
Trends in Human Genetics 1.4 PHARMACOGENOMICS
Pharmacogenomics may be defined as the genome wide analysis of genetic
determinants of drug efficacy and toxicity. This branch of science began as
pharmacogenetics when Vogel gave its name in 1959.The main goal of
pharmacogenomics is evaluating the role of genetic variants in drug metabolism
and effect, developing innovative ways of minimizing harmful drug effects and
optimising care for individual patients. Various tools like gene mapping, gene
sequencing, statistical genetics and gene expression are used to derive information.
Various factors influence the drug response like age, genetics, sex, race/ethnicity,
disease state, absorption, distribution, metabolism, excretion, body weight, height,
receptor sensitivity, organ dysfunction, accompanying medications, smoking,
diet, alcohol, stress, pollution, socio-economic status, drug adherence,
physiological changes including pregnancy, lactation, unmeasured nucleotide or
structural variation, complex methylation/epigenetic mechanisms and gene-
environment interactions. Around 30 to 60% of medication response rate for
treating many diseases like depression, schizophrenia, rheumatoid arthritis has
been observed. It has been reported that genetic factors can account 20 to 95%
variation in drug response. Patients are classified into poor, normal and rapid
metabolizers depending on the response to the drug intake. When a standard
dose is given to the poor metabolizer, the drug is metabolized slowly resulting in
an increased risk of toxicity and for the ultra metabolizer, the standard dose may
be ineffective.
Genetic variations related to drug response can be classified in to three types

namely pharmacokinetic, pharmacodynamic and idiosyncratic, based on their
mechanism of action. Variations involving pharmacokinetics are associated with
drug transporters and metabolizing enzymes and lead to alterations in the uptake,
distribution and elimination of drugs. The Pharmacodynamic type of variations
occur in the drug target or a component of the target pathway leading to altered
drug efficacy. The target of pharmacodynamics includes receptors, ion channels,
enzymes, transducer and regulatory proteins and immune molecules. A third
type of variations known as idiosyncratic involved in unintended actions of a
drug outside its therapeutic indication.
Inter individual variations in drug response have been reported based on genetic
variations in drug metabolizing enzymes, receptors, transporters and pathways.
The drug metabolizing enzymes are heterogeneous group of proteins involved
in metabolism of drugs. They are two groups namely oxidative drug metabolizing
enzymes and conjugative drug metabolizing enzymes. The oxidative drug
metabolizing enzymes include cytochrome P450 and Flavin mono oxygenase;
these catalyze the introduction of an oxygen atom into substrate molecules leading
to hydroxylation or demethylation. The conjugative enzymes catalyze the coupling
of endogenous small molecules to xenobiotics that results in the formation of
soluble compounds that are more readily excreted. This enzyme family has UDP
glycosyltransferases (UGTs), glutathione transferases, sulfotransferases and N
acetyltransferases as members.
Classical examples of variation in drug response: Though many examples

are available, few are given below.
16
Warfarin: It is an anticoagulant used to prevent stroke and venous Introduction to New and
thromboembolism. Its use is limited by narrow therapeutic window, variability Genetics
in dose–response, interactions with drugs and diet and risk of serious bleeding.
The dose is prescribed based on anticoagulation response measured by laboratory
assay like internalised normalised ratio. Clinical factors account for 17-21% of
variation and genetic polymorphism in genes such as Cytochrome P450(CYP)2C9
and vitamin K expoxide reductase complex subunit 1(VKORC1) are responsible
for 30-35% variation in warfarin dosing. Over coagulation and risk of bleeding
was observed in carriers of at least one or more variant alles of the CYP2C9
genotype. Incease risk of adverse cardiac events were observed in those who
possess the variant VKORC1. A 42.6% benefit of warfarin treatment was observed
after genotype guided drug regimen.
Clopidogrel: In cardiac patients, who are undergoing percutaneous coronary

interventions (PTCA) clopidogreal is a standard medication. Clopidogreal is a
prodrug that requires metabolic activation in a reaction catalyzed by chytochrome
P450 enzyme CYP2C19 into its active metabolite. It has been reported that around
25% of patients experience subtherapeutic antiplatlet response. A lower capacity
to metabolize clopidogrel into its active metabolite and inhibit platelet activation
and higher risk of adverse cardiovascular events were observed variant allele
carriers when compared to wild type allele of CYP2C19 .Another mediator of
Clopidogrel platelet effect has been reported and it was Paraoxagenase 1(PON1).
It was found to drive the conversion of the drug into the active metabolite. A
polymorphism in PON1 (PON1Q192R) was observed to affect the platelet
response, clopidogrel pharmacokientics and the risk for thrombosis. Limited
platelet inhibition and decreased plasma levels of both active PON1 and
clopidogrel metabolites were observed homozygous individuals of PON1QQ192.
Flaxacillin: It is an antibiotic used for the treatment of staphylococcal infections.

The usage of this drug has been associated with cholestatic hepatitis in
approximately 8.5 cases per 100,000 patients. A single nucleotide polymorphism
in HLA-B*5701 has shown strong association with hepatic injury.
Abacavir: It is a nucleoside analogue used to treat patients with HIV type 1

infection. Within six weeks of teatment, approximately 5% of patients developed
a hypersensitivity reaction involving multisystem with symptoms of fever, rash
and gastrointestinal discomforts which subsided within 72 hours of
discontinuation of the drug. Approximately 74% carriers of haplotype HLA-
B*5701 showed hypersensitivity when administered with abacavir.
Ribavirin: Chronic hepatitis C is a liver disease characterised by hepatitis C

infection. The patients with this infection are treated with pegylated interferon
and ribavirin. Approximately 50% of patients depending on ethnic origin show
positive response to this treatment and become virus free. Pharmacogenomic
studies have shown that CC genotype at the SNP rs12979860, 3kb upstream of
the IL28B gene is associated with response to pegylated interferon and ribavirin
for patients with chronic genotype 1 infection and natural clearance and the
presence of G allele at rs8099917 is associated with non response.
Approaches of Pharmacogenomics
Candidate gene approach: Candidate gene use experimentally derived a priori
knowledge about a disease or a drug involving both public and proprietary
17
Applied and Emerging databases for identifying candidate genes whose expression may impact drug
action or disease pathogenesis. In this approach, genes are identified based on
metabolic pathways, molecular targets, biological response pathways and/or
disease risk. Based on the perceived likelihood of involvement of drug response
the genes are ranked. Though this approach is tested in unrelated subjects, family
studies, but population based studies are commonly employed as they detect
relative risk as low as 1.5. The main focus of this approach is finding whether
there are differences between the case (non responder) and the control (responder)
in genetic variation that is assumed to be functional and involved in the observed
phenotypic variability. One of the successful examples of this approach is the
identification of individual response to the drug 6-mercaptopurine. The drawbacks
of this approach is that it fails to consider a potential contribution of other genes
particularly those whose function is yet to be understood; it is always not possible
to have a information on the functionality of genetic variability or may be
unreliable; it relies on the variability of specific point in the whole gene sequence.
Genome wide approach: This approach does not require a prior knowledge of
the target gene. It attempts to identify the association between genetic variants
and a given disorder by directing marker SNPs and analysing differences between
case and control groups. This approach has been successful in mapping rare
highly penetrant diseases in family pedigrees and identifying genes for monogenic
traits. The strategies in this approach are based on the Linkage Disequilibrium
relationships and structuring of haplotype blocks in the genome. It requires
thousands of single nucleotide polymorphism (SNP) as genetic markers and it
has been estimated that a minimum of 300,000 to 500,000 evenly spaced SNPs
needed to find a marker within the range of disequilibrium. One of the successful
examples of genome wide approach is identification of genetic variant in the
drug transporter gene SLCO1b1 responsible for statin induced myopathy. The
success of genome wide approach depends on study design, sample size, quality
control of genotype, collection bias, individual sample data, and ability of high
throughput technologies to produce volume of data and ethnicity details.
Validating data in an independent cohort in unbiased approach is requisite. The
reported odds ratios are relatively small. The practical utility of information
generated by using this approach remains controversial. Whole genome studies
involve usage of microarrays which is out of reach of routine clinical practice.
Complexity in analysis and requirement of additional guarantees in diagnosis
make this approach far from applicable. Matching control groups to factors such
as underlying disease and ancestry, contributions of genetic variants not detected
by current platforms, analysis of gene-gene and gene-environment interactions
in determining phenotype, affordable sequencing, storing of sequence data,
information management and methods of genome analysis are the challenging
issues in this approach.
Applications of Pharmacogenomics
1) Pharmacogenomic studies are helpful in developing therapeutic agents
suitable for genetically identifiable human sub group populations.
2) Pharmacogenomics research can decrease the time and number of subjects
needed for clinical trials.
3) Pharmacogenomics may facilitate the identification of biomarkers to optimize
drug selection, dose and treatment duration and avert adverse drug reactions.
18
4) Pharmacogenomics may be helpful in reducing national health care bills in Introduction to New and
developing countries by taking into consideration of genomic variations Genetics
between populations.
5) Study of the genotypes of populations with little admixture may be helpful
in predicting drug responses without testing each individual.
6) Pharmacogenomics may help to improve our understanding of the
mechanisms underlying variability in human physiology and its response to
drug therapy with a final goal of improving therapy.
7) Information generated from pharmacogenomics studies may help health
professionals and patients to make informed decisions about treatment
options.
8) Generation of data on new and existing drugs will help in effective utilisation
of scarce resources.
9) Pharmacogenomics may be helpful in reducing the costs associated with
inappropriate drug treatments or hospitalisations due to serious adverse
reactions.
10) Pharmacogenomics testing may produce collateral information which may
be medically beneficial for ex. polymorphism in dopime receptor though
pharmacogenomics information may help in smoking cessation.
11) Long term applications of pharmacogenomics include reducing the burden
of disease, improving the economic efficiency of the health care system and
reducing some disparities in health care acess and health outcomes.
12) Pharmacogenomics may be helpful in offering alternatives to the traditional
drug development.
Challenges: The challenges of pharmacogenomics include establishing the

clinical utility in order to support the value of genotyping; unaffordability of
technology for wider application of pharmacogenomics outside the research and
development setting; unequal treatment or health disparities due to social and
the consequent ethical and legal issues connected to pharmacogenomics testing;
measurement challenges such as presence of multiple pathways involved in drug
effects, multiple polymorphisms, gene-environment interactions, length of time
between testing and clinical outcomes and multiple determinants of clinical
outcomes; time and cost intensivity; developing technology to findout specific
SNP; finding patients who fit into the criteria and possible users of the drugs;
defining cut-off within adverse drug reponse distributions; lack of reproducibility
of some gene-drug pairs and the questionable utility of the findings in a large
population.
1.5 STEM CELL RESEARCH

Stem cells are precursor undifferentiated cells that are characterised by self
renewal and differentiation. The most common definition is based on the
properties of hematopoietic stem cells such as multipotency, asymmetric divisions,
quiescence, life- long self renewal, niche dependence and long term repopulation
ability upon in vivo transplantation. All stem cells may not follow these properties
like embryonic stem cells not self renewing in vivo beyond the blastocyst stage;
19
Applied and Emerging muscle cells are not multipoint; and mesenchymal stem cells do not transplant
robustly. Based on context and organism, stem cell properties of monopotency,
transient proliferation, lack of niche and inability to transplant in vivo are
acceptable. Some stem cells like mesenchymal stem cells have the potential of
generating cells not only of their lineage but also other lineages. This phenomenon
is known as plasticity or transdifferentiation. Homeostatis is the central
mechanism in mammalian cells through which stem cells maintain and preserve
organ and tissue integrity by self renewal and multilineage differentiation.
Stem cell populations are heterogeneous. Though stem cells express specific
protein markers but accumulating evidence suggests that these markers are
transient and dynamic. Stem cells express a vast range of genes at the mRNA
levels. Stem cells undergo asymmetric mitotic division and produce two identical
daughter cells. Of the two cells, at least one cell retains the stem cell properties,
while other differentiates. This process is governed by stem cell niche (environment)
and the detachment from this niche would result in differentiation. Stem cells
may also follow stochastic differentiation, wherein stem cells make a combination
of asymmetric divisions and symmetric ones leading to the formation of either
two stem cells (symmetric renewal) or two differentiated cells (symmetric
differentiation). Stem cells in olfactory epithelium and muscle follow this kind
of cell division.
There is no consensus on the uniformity in the classification of stem cells in the

literature. Stem cells were classified as embryonic or adult/non-embryonic/
somatic (postnatal to adult)/extra- embryonic stem cells (adult, cancer and induced
pluripotent) or hematopoietic and non-hematopoietic (mesenchymal stem cells),
based on their origin. In terms of developmental potential, stem cells were
categorized as totipotent, multipotent and unipotent. Totipotent stem cells are
able to differentiate into all types of embryo tissues in the trophoblast. These
cells are found after the first cell divisions in zygote (ex.zygote). Stem cell are
pluripotent because of their ability to differentiate into cells of the three germinal
layers (ectoderm, mesoderm and endoderm) except trophectoderm lineage.
Embryonic stem cells belong to this category. Multipotent stem cells like
hemopoietic can produce a limited range of differentiated cell lineages. Only
one specific cell type is generated by unipotent stem cells such as muscle
progenitors.
Types of stem cells

Embryonic stem cells
1) These cells are primitive cells and can self renew and differentiate into all
cells from all three germ layers such as ectoderm, endoderm and mesoderm.
2) Derived from inner cell mass of blastocyst stage at approximately five days
of development using a immunosurgical technique.
3) Sources are embryos created via in vitro fertilisation/somatic cell nuclear
transfer and fetuses obtained through elective abortion.
4) These cells do not conform to several cell requirements such as niche
dependence, capacity to undergo asymmetrical cell division.
5) Mouse not human embryonic stem cells require leukemia inhibitor factor
20
for their propagation.
6) These cells are grown on feeder layers. Introduction to New and
7) These cells can be maintained in undifferentiated state for at least 80 passages. Genetics
8) They can form embryoid bodies, the cell aggregations containing all three
embryonic germ layers.
9) These cells have the potential of forming teratomas in vivo.
10) These cells are considered as the optimal stem cell source for regenerative
medicine applications in view of their potential to form any tissue in the
body.
11) Application of these cells are limited by ethical, political, biologic and
regulatory hurdles.
Epiblast-stem cells (EpiSC)
1) Cells are derived from pre- gastrula embryo.
2) Express surface markers like mouse embryonic stem cells, Oct4, Nanog and
Ssea-1, and form teratoma.
3) These cells do not require feeders or leukemia inhibitory factor (Lif) for
culture but can be expanded in the presence of Activin/nodal signaling.
4) These cells are unable to contribute to somatic cells and the germ line
following injection into blastocyst or following morula aggregation.
XEN Stem cells
1) These cells are isolated from extra embryonic endoderm.
2) Express markers like Sox7, Hnf4, Gata4 and Foxa2 but lack expression of
Oct4 and Nanog.
3) In a chimera assay, these cells contributed to the parietal endoderm and to
the parietal yolk sac at later stages during embryo development.
XEN P Stem cells

1) Express genes Oct4, Gata 6 and Ssea-1 and isolated from rat blastocysts.
2) These cells require leukemia inhibitory factor (Lif) for exvivo maintenance.
3) Upon morula aggregation or injection in the blastocyst, these cells contribute
to primitive/visceral and parietal extra embryonic endodermal lineages but
not the embryo proper.
4) They form tumors when injected postnatal.
Hematopoietic stem cells (HSCs)

1) These are best characterised stem cells.
2) The size of the total pool of HSCs remains roughly the same in the absence
of injury, about half of all HSC divisions must, at the population level, be
self-renewing.
3) In the steady state, HSCs redistribute via the bloodstream among distinct
anatomical locations and therefore are likely to be found in all tissues of the
body.
21
Applied and Emerging 4) These cells are multipotent and can differentiate into all myeloid and
lymphoid blood lineages.
5) Through fusion HSC contribute to other tissues.
6) Sources of these cells are bone marrow, peripheral blood and umbilical cord
blood.
7) These stem cell transplantations are performed using HLA matched siblings,
parents or donors.
8) These cells represent less than 0.05% of the total bone marrow.
9) Enriched using a complement of cell surface antigens.
Mesenchymal Stem cells

1) These are adherent cells with fibroblast like morphology and are capable of
self replication through many passages.
2) These cells are pluripotent and are capable to differentiate into multiple types
of tissue like bone, cartilage, muscle, neuron, cardiomyocyte and hepatocytes.
3) These cells have proangiogenic and immunomodulatory effects.
4) These cells have the potential utility for treating a variety of diseases and
disorders like graft versus host disease, organ transplantation, cardiovascular
disease, brain and spinal cord injury, lung, liver and kidney diseases and
skeletal injuries.
5) They have conserved long telomere lengths and do not form teratomas in
vivo.
6) These cells are isolated from a number of tissues like bone marrow, adipose
tissue, umbilical cord blood, placenta, amniotic fluid, amniotic membrane,
gingival, circulating blood, synovium, trabecular bone, dermis, dental pulp
and lung and have the capacity of expansion in vitro on a clinical scale.
7) These cells participate in maintaining essential environment to support the
hematopoietic stem cells in the bone marrow.
Pancreatic stem cells (PSC)
1) They provide an alternative renewable source of surrogate â cells.
2) They have the potential for lineage-restricted differentiation and are capable
of developing into a pancreatic phenotype.
3) The adult pancreatic stem or progenitor cells are found in duct cells, exocrine
tissue, nestin positive islet-derived progenitor cells, neurogenin-3-positive
cells, pancreas-derived multipotent precursors and mature â cells.
4) In the present state of knowledge, the expansion potential of PSC is limited.
5) Pdx-1, nestin and Ngn-3 markers have been shown to be expressed by these
cells.
22
Cancer stem cells (CSCs) Introduction to New and
1) These are small population of cancer cells that have the ability of unlimited Genetics
growth, self renewal, as well as differentiation into more specialised cancer

cell types.
2) CSCs have been identified and isolated in various hematological as well as
solid malignancies.
3) CSC may form new tumour tissue when transferred into immunodeficient
animal models and have been shown to survive and regenerate tumours tissue
even after large percentage of tissues has been destroyed by chemotherapy.
4) Standard pathways for self-renewal of normal stem cells, such as Wnt, Notch
and Hedgehog signaling, are also present in CSCs and have an important
role in their function.
5) These cells produce higher levels of proangiogenic factors than their
differentiated counterparts, and exhibiti more potent proangiogenic capability.
Applications
1) Stem cells provide an opportunity to study the growth and differentiation of
cells into tissues.
2) Stem cells can be used to produce large amounts of one cell type.
3) These cells can be to test new drugs for effectiveness and chemicals for
toxicity.
4) The damaging side effects of medical treatments might be repaired with
stem cell treatment.
5) Somatic cell nucleus transfer technique stem cells created by using patient
cell would avoid any tissue rejection problems that could be encountered in
other stem cell therapeutic approaches.
6) In view of their migratory properties these cells can be used to target organs
ex.tumours.
7) These cells can be used as vehicles to carry therapeutic molecule which they
excrete spontaneously.
8) Stem cell therapies, in future, may circumvent the traditional use of chemicals
as therapeutic drugs.
9) Stem cell transplantations are used to treat or greatly ameliorate a variety of
genetic diseases ranging from inherent defects of hematopoietic cell
production (thalassaemia) or function to metabolic diseases (lysosomal
storage diseases) mostly affecting solid organs.
10) In acute myeloid leukemia and high grade lymphoma, hematopoietic cell
therapy is used as adjuvant therapy.
11) Stem cells therapies are promising in the management of variety of disease
conditions like cardiovascular diseases, neurological diseases (parkinson’s
disease, Amyotrophic lateral sclerosis, Huntington’s diseases or Alzheimer’s
disease, Duchenne muscular dystrophy), diabetes, eye diseases and bone
diseases. 23
Applied and Emerging 12) Mesenchymal stem cells have been shown to be helpful in rapid engraftment
of allogenic bone marrow transplantations. These cells were found inhibiting
T cell growth, reducing graft versus host disease and effective in a large
number of steroid resistant patients.
13) Early wound healing, delayed progression in human multiple system atrophy
and beneficial effects in patients with hemorrhagic cystitis, penmomediastium
and perforated colon due to the transplantion of mesenchymal stem cells.
14) In experimental studies entire organs were generated from stem cells and
this raises the hope of using stemcells/progenitors for tissue engineering
applications to generate organs for therapeutic purposes.
Challenges: Overcoming the immunological barriers, understanding of tissue

restrictive signals, betterment of methodologies for stem cell isolation, in vitro
propagation and transplantation either allo or xeno conditions by awakening
resident stem cells, lineage tracing and long term real time follow-up of single
cells including the real time assessments of gene and protein expression may go
a long way in better utilisation of stem cell therapies for improving the quality of
life in people afflicted with various disease conditions.
1.6 SUMMARY
The Proteome can be defined in terms of the sequence, structure, abundance,
localisation, modification, interaction and biochemical function of its components.
Proteomics has subfields like sequence and structural proteomics, expression
proteomics, interactional and functional proteomics. Various tools are used in
proteomics like databases, mass spectrometry, software tools and protein
separation technologies.

information. The goal of this field is to enable the discovery of new biological
insight as well as to create a global perspective from which unifying principals
can be perceived. Various tools like multiple sequence alignment, BLAST,
FASTA, visualisation tools like RasMol, CnD3 are used in this subfield.
Biological databases are helpful to gain a insight into biological phenomena
from the structure of biomolecules and their interactions to the whole metabolism
of organism and to understand the evolution of species. Databases are classified
as primary databases (DDBJ, EMBL, Gene Bank), protein sequence databases
(SWISS-PROT, Protein Information Resource), protein sequence databases
(Pfam, PROSITE) protein structure database (PDB, SCOP), protein-protein
interaction databases (BioGRID, STRING), pathway databases (KEGG),
microarray databases (Array express, Gene expression omnibus).
Pharmacogenomics may be defined as the genome wide analysis of genetic

determinants of drug efficacy and toxicity. Besides, various factors that influence
the drug response like age, sex, race/ethnicity, disease state, genetics also play
an important role in drug response. Genetic variations related to drug response
can be classified in to three types namely pharmacokinetic, pharmacodynamic
and idiosyncratic, based on their mechanism of action. Candidate gene, genome
wide and risk of disease approach are used for the study of pharmacogenomics.
Randomized clinical trials, case-control and cohort designs are used in this
24
discipline. Lymphoblastoid cell lines, NC160 cell line panel, various blood cells Introduction to New and
as in vitro models and animal models in pharmacogenomics. Genetics
Stem cells are precursor undifferentiated cells that are characterised by self
renewal and differentiation. Stem cell populations are heterogeneous in nature.
Stem cells were classified as embryonic or adult/non-embryonic/somatic
(postnatal to adult)/extra- embryonic stem cells (adult,cancer and induced
pluripotent) or hematopoetic and non-hematopoietic (mesenchymal stem cells),
based on their origin. In terms of developmental potential, stem cells were
categorized as totipotent, multipotent and unipotent. Applicatiions of stem cells
vary from a invitro model to therapeutic tool.
Suggested Reading
Dov Zipori (ed). 2009. Biology of Stem cells and the Molecular basis of the
stem state. New York: Humana Press.
Kalow W. 2005. Pharmacogenomics: Historical perspective and status. In:
Pharmacogenomics, Methods in Molecular Biology Innocenti, F (Ed). Totowa
NJ: Humana Press Inc. Vol 311.
Krishna Rao, A and Raghu KA. 2011. Stem cells and regenerative medicine.
From molecular embryology to tissue engineering. New York: Humana Press.
Liebler, D.C. 2002. U.K.Introduction to Proteomics: Tools for the New Biology.
NewJersy: Humana Press, Totowa.
Mount, DW. 2004. Bioinformatics. Sequence and Genome Analysis. 2nd edition,
New Delhi: CBS publishers and distributors.
Ouzounis, CA, Valencia, A. 2003. Early bioinformatics: the birth of a discipline-
a personal view. Bioinformatics, 17: 2176-2190.
Richard JS, 2003. Proteins and proteomics: A Laboratory manual. New York:
cold spring harbor laboratory press.
Searls, DB. 2010. The roots of bioinformatics. PLOS Computational Biology.
6(6):e1000809.
Trifonov, EN. 2000. Earliest pages of bioinformatics. Bioinformatics, 16:5-9.
Twyman, R.M. 2004. Principles of Proteomics. Oxon: Garland Science/Bios
Scientific Publishers.
Sample Questions
1) What is bioinformatics? Mention in brief the important sequence analysis tools.
2) What are the different subfields of proteomics?
3) Give a brief note on genome wide approach.
4) What are the different types of stem cells?
5) What are the tools employed in proteomic studies?
6) What is Pharmacogenomics? Discus with examples.
25
Trends in Human Genetics UNIT 2 GENETIC EPIDEMIOLOLGY AND
EPIGENETICS
Contents
2.1 Introduction
2.2 Scope of Genetic Epidemiology
2.3 Methods of Genetic Epidemiology
2.4 Epigenetics
2.4.1 Epigenetic Mechanisms
2.4.2 Epigenetics and Inheritance
2.5 DNA Methylation
2.6 The role of DNA Methylation in Mammalian Epigenetics
2.7 The Hap Map Project
2.7.1 Method of Study
2.7.2 International Hap Map Project
2.7.3 Genetic Variation and Use of Hap Map
2.8 Summary
Suggested Reading
Sample Questions
Learning Objectives
&
After studying this unit, you would be able to:
Ø explain the concept of Genetic Epidemiology and its scope in areas of
medicine, genetics etc;
Ø discuss the meaning of Epigenetics and the factors responsible for the
occurrence of epigenetics;
Ø elucidate the importance of epigenetics in the understanding of DNA
Methylation or noncoding RNA;
Ø explain the methods employed for the study of Genetic Epidemiology; and
Ø to understand Hap Map project, the new advancement in Human Genetics.
2.1 INTRODUCTION
The Mendel’s Laws of Heredity discovery led to emergence of new biological
field of Genetics which is the study of heredity and variation i.e. how certain
characteristics or traits are passed from parents to offspring. His discoveries
paved the way for today’s understanding of the role of genetics in human
development and in the treatment of genetic disorders. Presently, genetic research
has moved from Mendelian genetics to sequence maps for the study of natural
human genetic variation at the level of the genome. The inheritance in
contemporary populations, uniting genetics with epidemiology, medicine,
psychology, and (in other species) with agriculture and with this concept the
26 field of genetic epidemiology emanated.
Genetic epidemiology is the study of the role of genetic factors in determining Genetic Epidemiology and
Epigenetics
health and disease in families and in populations, and the interplay of such genetic
factors with environmental factors. Genetic epidemiology was defined by Morton
as “a science which deals with the etiology, distribution, and control of disease
in groups of relatives and with inherited causes of disease in populations. It is of
two types. Classical epidemiology and Molecular Epidemiology. The former
deals with disease patterns and factors associated with causation of diseases
with the ultimate aim of preventing the disease and the latter measures exposure
to specific substances (DNA adducts) and early biological response (somatic
mutations), evaluates host characteristics (genotype and phenotype) mediating
response to external agents, and use of markers of a specific effect (like gene
expression) to refine disease categories (such as heterogeneity, etiology and
prognosis). The study methods of Genetic Epidemiology are mentioned below:
• Familial aggregation studies: Is there a genetic component to the disease,
and what are the relative contributions of genes and environment?
• Segregation studies: What is the pattern of inheritance of the disease (e.g.
dominant or recessive)?
• Linkage studies: On which part of which chromosome is the disease gene
located?
• Association studies: Which allele of which gene is associated with the
disease?
2.2 SCOPE OF GENETIC EPIDEMIOLOGY

The goals of genetic epidemiology contrast with those of “traditional”
epidemiology and population genetics. “Traditional” epidemiology studies the
relationship between the environment and the incidence of a given disease,
although it recognizes the significance of the host and his or her genetic makeup.
Population genetics, on the other hand, seeks to predict the influences of
population structure and selection and mutation on bodily phenotypes and
diseases. Finally, genetic epidemiology studies the way environmental risk factors
interact with the genetic makeup of a given population.
Further the scope of genetic epidemiology has expanded to include common

diseases for which many genes each make a contribution (polygenic, multifactorial
or multigenic disorders). Human Genome Project has led to study the association
between diseases and genotypes. Advancement in the technology made it feasible
to conduct large-scale genome-wide association studies. Genetic epidemiology
is relatively new discipline that seeks to unravel the role of genetic factors and
their interactions with environmental factors in the etiology of diseases, using
population/family study approaches.
2.3 METHODS OF GENETIC EPIDEMIOLOGY

Genetic epidemiology uses two types of research strategies: descriptive and
analytic. The descriptive strategy, at the population as well as at the family level,
is based on the study of time, location, and the individual.
27
Applied and Emerging Family Recurrence Studies
A fundamental aspect of genetic epidemiology is the study of aggregation (or
recurrence) of certain diseases in given families. Is this familial aggregation
associated with common environmental exposure, hereditary susceptibility, or
cultural inheritance of risk factors? If there is genetic susceptibility, how is it
inherited? The existence of familial aggregation can be determined by observing
the prevalence of a given disease in family members of the index case (the index
case is the affected individual who introduces the family into the study) and of
controls (individuals who are not affected). This method is efficient and
inexpensive, but one of its limitations is that information about characteristics
of family members and controls may give rise to biased.
Twin studies
Twin studies have typically been used to determine whether genetic factors play
a role in the etiology of certain diseases. Such studies consist of comparing the
difference in concordance between identical or monozygotic twins (MZ) and
fraternal or dizygotic twins (DZ). MZ twins share 100% of their genetic material,
whereas DZ twins share, on average, 50% of their genes. If sets of twins are
being studied, and the MZ twins are found to be concordant (both have the same
disease, for example) with greater frequency than the DZ twins, it is possible to
conclude that genetic factors are at least partially involved in the etiology of that
disease. It is important to note, however, that genetic differences may exist
between MZ twins. They may differ, for example, in the series of T-cell antibodies
and receptors, in the number of mitochondrial deoxyribonucleic acid (DNA)
molecules, in somatic mutations in general, and in the inactivation pattern of the
X chromosome in female twins. It is also well known that MZ twins may differ
from DZ twins as a result of environmental factors. One of two calculations is
normally made in twin studies, based on the method used to select the twins: (1)
pair concordance rate, which describes the proportion of twin pairs where both
siblings are affected; and (2) index case concordance rate, which is the proportion
of affected individuals among the co-twins of those selected as index cases.
Although the pair concordance rate is the simplest method of determining whether
genes affect a specific phenotype, it does not measure the magnitude of such an
effect. For that purpose, use of the index case concordance rate is preferable.
Twin studies are limited by several factors; in particular those associated with
the way participants are selected for the studies. For example, it has been observed
that studies that depend exclusively on volunteers have a greater proportion of
MZ twins, female pairs, and participants who are concordant for the phenotype
under study. Such differences may influence the concordance rate that is
calculated, which is why several countries— Sweden is a prime example—have
launched population-based twin registries. Another limitation, especially in
behavior studies, is that MZ twins tend to share environmental factors more
frequently than DZ twins.
Allelic Association Studies

1) The allele in question is actually the cause of the phenotype.
2) The allele does not cause the phenotype but is in linkage disequilibrium
with the causal allele. Linkage disequilibrium takes place when the causal
allele of the phenotype is physically close (or linked) to the allele being
studied.
28
The steps, a genetic epidemiologic research follows, are: Genetic Epidemiology and
Epigenetics
1) Establishing that there is a genetic component of the disorder.
2) Establishing the relative size of that genetic effect in relation to other sources
of variation in disease risk (environmental effects such as intrauterine
environment, physical and chemical effects as well as behavioral and social
aspects).
3) Identifying the gene(s) responsible for the genetic component.
All of these can be achieved either in family studies (segregation, linkage,
association) or in population studies (association).
General methods employed in genetic epidemiology are:

Genetic risk studies: What is the contribution of genetics as opposed to
environment to the trait?
Segregation analyses: What does the genetic component look like (oligogenic
‘few genes each with a moderate effect’, polygenic ‘many genes each with a
small effect’, etc.)? What is the model of transmission of the genetic trait?
Segregation analysis requires multi generation family trees preferably with more
than one affected member.
Linkage studies: What is the location of the disease gene(s)? Linkage studies
screen the whole genome and use parametric or nonparametric methods such as
allele sharing methods (affected sibling-pairs method) with no assumptions on
the mode of inheritance, penetrance or disease allele frequency (the parameters).
The underlying principle of linkage studies is the co segregation of two genes
(one of which is the disease locus).
Association studies: What is the allele associated with the disease susceptibility?
The principle is the coexistence of the same marker on the same chromosome in
affected individuals (due to linkage disequilibrium). Association studies focus
on population frequencies, whereas linkage studies focus on concordant
inheritance. Association studies have several practical advantages over linkage
studies.
2.4 EPIGENETICS
The cells in a multicellular organism have normally identical DNA sequences
(and therefore the same genetic instruction sets), yet maintain different terminal
phenotypes. This nongenetic cellular memory, which records developmental and
environmental cues (and alternative cell states in unicellular organisms), is the
basis of epi-(above)–genetics. The lack of identified genetic determinants that
fully explain the heritability of complex traits, and the inability to pinpoint
causative genetic effects in some complex diseases, suggest possible epigenetic
explanations for this missing information. The desire to understand the
“deprogramming” of differentiated cells into pluripotent/totipotent states, has
led to “epigenetic” becoming shorthand for many regulatory systems involving
DNA methylation, histone modification, nucleosome location, or non-coding
RNA. Epigenetics was coined by Waddington (1942) to refer to the study of the
“causal mechanisms” by which “the genes of the genotype bring about phenotypic
effects.”
29
Applied and Emerging An epigenetic system is heritable, self-perpetuating, and reversible. Whether
histone modifications (and many non-coding RNAs) are epigenetic is debated;
it is likely that relatively few of these modifications or RNAs will be self-
perpetuating and inherited.
Robin Holliday defined epigenetics as “the study of the mechanisms of temporal

and spatial control of gene activity during the development of complex organisms”
The development and maintenance of an organism is orchestrated by a set of
chemical reactions that switch parts of the genome off and on at strategic times
and locations. Epigenetics is the study of these reactions and the factors that
influence them.
Epigenetics has different meanings for different scientists. Molecular biologists

define epigenetics as “the study of mitotically and/or meiotically heritable changes
in gene function that cannot be explained by changes in DNA sequence” (Riggs
et al. 1996). Functional morphologists Herring (1993), for whom epigenetics
refers to “the entire series of interactions among cells and cell products which
leads to morphogenesis and differentiation” and further it was stated that
“epigenetic influences range from hormones and growth factors to ambient
temperature and orientation in a gravitational field.”
2.4.1 Epigenetic Mechanisms

Several epigenetic mechanisms regulate genes i.e. DNA methylation and changes
to histone proteins, around which DNA is packed, or involve functional non
coding RNAs. In general, low levels of DNA methylation (hypomethylation) are
associated with higher gene activity and high levels of methylation with gene
silencing. Repeat associated CpG islands and non regulatory CpG sites generally
exist in a methylated state.
Fig. 2.1: Epigenetics, environment, and development. A. Dynamic epigenetic profile

throughout the life course, with both genome-wide remodeling and tissue-specific
programming events.
(Source:aje.oxfordjournals.org)
30
2.4.2 Epigenetics and Inheritance Genetic Epidemiology and
Epigenetics
Epigenetic inheritance is an unconventional finding. It goes against the idea that
inheritance happens only through the DNA code that passes from parent to
offspring. It means that a parent’s experiences, in the form of epigenetic tags,
can be passed down to future generations.
The Challenges of Proving Epigenetic Inheritance

Proving epigenetic inheritance is not always straightforward. To provide a
watertight case for epigenetic inheritance following postulates:
• Rule out the possibility of genetic changes. In organisms with larger
genomes, a single mutation can hide like a needle in a haystack.
• Show that the epigenetic effect can pass through enough generations to
rule out the possibility of direct exposure.
In a pregnant mother; three generations are directly exposed to the same
environmental conditions at the same time. An epigenetic effect that continues
into the 4th generation could be inherited and not due to direct exposure.
The Human Epigenome Project

Research into epigenetics has provided new and exciting advances in plant
technology, potential cancer treatments and new tools for researchers trying to
identify the function of genes. In recognition of the importance of DNA
methylation in epigenetics, it is now the subject of the multi-million dollar Human
Epigenome Project.
2.5 DNA METHYLATION

In DNA, methylation occurs in the CpG islands, a CG rich region, upstream of
the promoter region. The letter “p” here signifies that the C and G are connected
by a phosphodiester bond. In humans, DNA methylation is carried out by a group
of enzymes called DNA methyltransferases. These enzymes not only determine
the DNA methylation patterns during the early development, but are also
responsible for copying these patterns to the strands generated from DNA
replication. DNA methylation is a biochemical process that is important for normal
development in higher organisms. It involves the addition of a methyl group to
the 5' position of the cytosine pyrimidine ring or the number 6 nitrogen of the
adenine purine ring and the modification is inherited through cell division.
DNA methylation stably alters the gene expression pattern in cells such that
cells can “remember where they have been” or decrease gene expression; for
example, cells programmed to be pancreatic islets during embryonic development
remain pancreatic islets throughout the life of the organism without continuing
signals telling them that they need to remain islets. DNA methylation is typically
removed during zygote formation and re-established through successive cell
divisions during development. However, the latest research shows that
hydroxylation of methyl group occurs rather than complete removal of methyl
groups in zygote. Some methylation modifications that regulate gene expression
are inheritable and are referred to as epigenetic regulation. DNA methylation is
essential for normal development and is associated with a number of key processes
including genomic imprinting, X-chromosome inactivation, suppression of
31
Applied and Emerging repetitive elements, and carcinogenesis. Alterations of DNA methylation have
been recognised as an important component of cancer development.
Hypomethylation, in general, arises earlier and is linked to chromosomal
instability, loss of imprinting, whereas hypermethylation is associated with
promoters that can arise secondary to gene (oncogene suppressor) silencing, but
might be a target for epigenetic therapy.
DNA Methylation Analysis Flowchart
Sampled Material: Cells, Blood, Tissue, Feces, Fungi,

Insects, Plants, etc.
Locus-specific
Enrichment Purified Genomic DNA Methylation
Quantitation
Bisulfite Treatment
Purified Bisulfite
Converted DNA
PCR Amplification of
Converted DNA
Analysis Analysis
• Array • Bisulfite Sequencing Bisulfite Dependent

• qPCR • MSP
Bisulfite Independent
• Ultra-Deep • COBRA
Sequencing • SNuPE
• qMSP
• Pyrosequencing
• MassArray
• HRM
Fig. 2.2: DNA Methylation Analysis Flowchart
32
Epigenetics Genetic Epidemiology and
Epigenetics
Methylation contributing to epigenetic inheritance can occur through either DNA
methylation or protein methylation.
DNA methylation in vertebrates typically occurs at CpG sites (cytosine-phosphate-

guanine sites, that is, where a cytosine is directly followed by a guanine in the
DNA sequence) and the methylation results in the conversion of the cytosine to
5-methylcytosine. The formation of Me-CpG is catalyzed by the enzyme DNA
methyltransferase. Human DNA has about 80%-90% of CpG sites methylated,
but there are certain areas, known as CpG islands, that are GC-rich (made up of
about 65% CG residues), wherein none are methylated. These are associated
with the promoters of 56% of mammalian genes, including all ubiquitously
expressed genes. One to two percent of the human genome is CpG clusters,
where there is an inverse relationship between CpG methylation and transcriptional
activity.
Protein Methylation typically takes place on arginine or lysine amino acid residues
in the protein sequence. Arginine can be methylated once (monomethylated
arginine) or twice, with either both methyl groups on one terminal nitrogen
(asymmetric dimethylated arginine) or one on both nitrogens (symmetric
dimethylated arginine) by peptidyl arginine methyltransferases (PRMTs). Lysine
can be methylated once, twice or three times by lysine methyltransferases. Protein
methylation has been most-studied in the histones. The transfer of methyl groups
from S-adenosyl methionine to histones is catalyzed by enzymes known as histone
methyltransferases. Histones that are methylated on certain residues can act
epigenetically to repress or activate gene expression. Protein methylation is one
type of post-translational modification.
2.6 THE ROLE OF DNA METHYLATION IN

MAMMALIAN EPIGENETICS
Genes constitute only a small proportion of the total mammalian genome, and
the precise control of their expression in the presence of an overwhelming
background of noncoding DNA presents a substantial problem for their regulation.
Noncoding DNA, containing introns, repetitive elements, and potentially active
transposable elements, requires effective mechanisms for its long-term silencing.
Genes are transcribed from methylation-free promoters even though adjacent
transcribed and nontranscribed regions are extensively methylated. Gene
promoters are used and regulated while keeping noncoding DNA, including
transposable elements, suppressed.
Role of DNA methylation in Regulating Gene Activity

DNA methylation prevents the expression of genes by altering the amount of
messenger RNA. Enzymes attach chemical tags called methyl groups to the bases
from which DNA is made.
DNA Methylation in Plants

DNA methylation in plants is more diverse than in animals. In addition to
methylating CpGs, plants also methylate the cytosine at CpNpG and CpNpNp
sequences, where N can be any base. Plants also have a greater variety of enzymes
33
Applied and Emerging involved in methylating DNA than animals. Methylation of plant DNA occurs in
transposon sequences, regions of repeated DNA sequences and in the coding
region of genes.
DNA Methylation Patterns are Heritable

Once a gene has been methylated, all the daughter cells from that cell retain the
methylation, making it a heritable change. Some genetic conditions are caused
by inappropriate over or under methylation of the same region of DNA, such as
Prader-Willi and Angelman’s syndromes.
The link between DNA Methylation and Cancer

Cancer is now recognised as both a genetic and epigenetic disease. While some
types of cancers can be inherited, other cancers result from changes to DNA that
accumulates throughout life. There are three types of cancer-causing genes:
oncogenes, tumour suppressor genes and DNA repair genes.
Age Related Cancers

DNA methylation is a dynamic process, with the enzymes involved constantly
working to methylate and demethylate CpG sites throughout the genome.
Inappropriate methylation patterns leads to inactivation of genes that should be
expressed, which poses a particular problem when those genes are tumour
suppressor genes vital for controlling normal cell growth.
2.7 THE HAP MAP PROJECT

Linkage studies played an important role to understand pattern of inheritance in
the human populations particularly in genetically isolated subpopulations, i.e. a
group of alleles for neighboring genes on a segment of a chromosome are inherited
together. Such a combination of linked alleles is known as a haplotype. When a
new mutation occurs in a single individual and is passed down to his or her
descendants, and is carried on a specific chromosome. Therefore, every person
has a unique combination of alleles of all genes which are not inherited on a
completely random basis but come in bunches, that is, haplotype. The successful
completion of Human Genome Project led to characterise and sequence the entire
genomes of several other organisms, many of which are used extensively in
biological research. Identification of the sequence or function of genes in a model
organism is an important approach in finding and elucidating the function of
human genes. The next key step of the Human Genome Project (HGP) (following
the creation of the genetic, physical, sequence and SNP maps) is the generation
of a “haplotype” map of the human genome which consists of a high density of
SNPs defining the small number of ancestral haplotype (blocks of tightly
correlated genetic variants) in each region of the human genome. Knowledge of
these haplotype will open a new path for biomedical research.
The variations have an effect on individual’s disease risk and the sites in the
DNA sequence where individuals differ at a single DNA base are called single
nucleotide polymorphisms (SNPs). Sets of nearby SNPs on the same chromosome
are inherited in blocks. This pattern of SNPs on a block is a haplotype. The Hap
Map is a map of these haplotype blocks and the specific SNPs that identify the
haplotype are called tag SNPs. The “Hap Map,” is a tool to find genes and genetic
variations that affect health and disease. The Hap Map is valuable by reducing
34
the number of SNPs required to examine the entire genome for association with Genetic Epidemiology and
Epigenetics
a phenotype from the 10 million SNPs that exist to roughly 500,000 tag SNPs.
The HAPMAP would help in genome scan approaches to finding regions with
genes that affect diseases much more efficient and comprehensive, since effort
is not wasted in typing more SNPs than necessary and all regions of the genome
are included.
In addition to its use in studying genetic associations with disease, the Hap Map
is a powerful resource for studying the genetic factors contributing to variation
in response to environmental factors, susceptibility to infection, and to study the
adverse responses to drugs and vaccines.
2.7.1 Method of Study

HapMap results would help to study based on the expectation that there are
higher frequencies of the contributing genetic components in a group of people
with a disease or particular response to a drug, vaccine, pathogen, or environmental
factor than in a group of similar people without the disease or response. Using
just the tag SNPs, researchers are able to find chromosome different haplotype
distributions in the two groups of people, those with a disease or response and
those without. Each region is then studied in more detail to discover which variants
in which genes in the region contribute to the disease or response, leading to
more effective interventions. These investigations will lead to the development
of tests to predict which drugs or vaccines would be most effective in individuals
with particular genotypes for genes affecting drug metabolism. Thus the haplotype
map should be generated rapidly and made freely available to researchers
worldwide.
2.7.2 International Hap Map Project

The International Hap Map Project is an organisation that aims to develop a
haplotype map (Hap Map) of the human genome, which describes the common
patterns of human genetic variation. Hap Map is a key resource for researchers
to find genetic variants affecting health, disease and responses to drugs and
environmental factors. The information produced by the project will be made
freely available to researchers around the world. The International Hap Map
Project is collaboration among researchers at academic centers, non-profit
biomedical research groups and private companies in Canada, China, Japan,
Nigeria, the United Kingdom, and the United States.
The Hap Map project proposes a shortcut. Although any two unrelated people
share about 99.5% of their DNA sequence, some people may have an A at a
particular site on a chromosome while others have a G instead. Such a site is
known as a single nucleotide polymorphism (SNP), and each of the two
possibilities is called an allele. The Hap Map project focuses only on common
SNPs, those where each allele occurs in at least 1% of the population. Each
person has two copies of all chromosomes, except the sex chromosomes in males.
For each SNP, the combination of alleles a person has is called a genotype.
Genotyping refers to uncovering what genotype a person has at a particular site.
To find the genetic factors involved in a particular disease, one can proceed as
follows. First a certain region of interest in the genome is identified, possibly
from earlier inheritance studies. In this region one then locates a set of tag SNPs
35
Applied and Emerging from the Hap Map data; these are SNPs that are very well correlated with all the
other SNPs in the region, so that knowledge of the alleles of the tag SNPs in an
individual will determine the individual’s haplotype with high probability. Next,
one determines the genotype for these tag SNPs in several individuals, some
with the disease and some without. By comparing the two groups, one can then
determine the likely locations and haplotype that are involved in the disease.
Hap Map resource is to guide the design and analysis of genetic association
studies, shed light on structural variation and recombination identifies loci that
may have been subject to natural selection during human evolution. Despite the
ever-accelerating pace of biomedical research, the root causes of common human
diseases remain largely unknown, preventative measures are generally inadequate
and available treatments are seldom curative. Family history is one of the strongest
risk factors for nearly all diseases—including cardiovascular disease, cancer,
diabetes, autoimmunity, psychiatric illnesses and many others—providing the
tantalizing but elusive clue that inherited genetic variation has an important role
in the pathogenesis of disease. Identifying the causal genes and variants would
represent an important step in the path towards improved prevention, diagnosis
and treatment of disease. More than a thousand genes for rare, highly heritable
diseases have been identified so far.
2.7.3 Genetic Variation and Use of Hap Map

Most common diseases, such as diabetes, cancer, stroke, heart disease, depression,
and asthma, are affected by many genes and environmental factors. Discovering
the DNA sequence variants that contribute to common disease risk offers one of
the best opportunities for understanding the complex causes of disease in humans.
Sites in the genome where the DNA sequences of many individuals differ by a
single base are called single nucleotide polymorphisms (SNPs). For example,
some people may have a chromosome with an A at a particular site where others
have a chromosome with a G. Each form is called an allele.
A part of two chromosomes showing a SNP. Both the A and G alleles are
shown.
Each person has two copies of all chromosomes except the sex chromosomes.
The set of alleles that a person has is called a genotype. For this SNP a person
could have the genotype AA, AG, or GG. for basic genetics information). The
term genotype can refer to the SNP alleles that a person has at a particular SNP
or for many SNPs across the genome. A method that discovers what genotype a
person has is called genotyping. About 10 million SNPs exist in human
populations, where the rarer SNP allele has a frequency of at least 1%. Alleles of
SNPs that are close together tend to be inherited together. A set of associated
SNP alleles in a region of a chromosome is called a “haplotype”. Most
chromosome regions have only a few common haplotype (each with a frequency
of at least 5%), which account for most of the variation from person to person in
a population. A chromosome region may contain many SNPs, but only a few
“tag” SNPs can provide most of the information on the pattern of genetic variation
in the region.
36
Genetic Epidemiology and
Epigenetics
A chromosome region with only the SNPs shown. Three haplotype are
shown. The two SNPs in color are sufficient to identify (tag) each of the
three haplotype. For example, if a chromosome has alleles A and T at
these two tag SNPs, and then it has the first haplotype.
The Hap Map describes the common patterns of genetic variation in humans.
Population and Sample
Most of the common haplotype occur in all human populations; however, their
frequencies differ among populations. Therefore, data from several populations
are needed to choose tag SNPs.
Impact on Biomedical Research

The availability of a haplotype map of the human genome will have a substantial
impact on human genetic studies. Specifically, these studies include:
• Genome-wide association studies.
• Human population structure and history.
Numbers of SNPs to be genotyped
Haplotype could be used to greatly simplify the potential task of genetic testing
to determine the genetic disease risks in the context of hundreds of common
haplotype rather than considering all of the individual interactions of tens of
thousands of genes, each with their own unique distributions among various
subpopulations. There are many other clinical manifestations of human genetic
variation. In fact, all disease has a genetic component, and all therapies should
consider genetic variations (perhaps that can become the motto for the new era
of genomic medicine). The physician should be aware of the genetic components
of susceptibility versus resistance to various pathogens, variations in disease
severity or symptoms, reactions to drugs (pharmacogenomics), and the variable
disease course and prognosis that emerges as a synthesis of all of these factors.
2.8 SUMMARY
Genetic epidemiology aims at diseases that are caused by genetic alterations
among closely related individuals or in a Mendelian population. It measures the
frequency and prevalence of a genetic disease, gene - gene interaction, gene -
environment interaction, genotype and phenotype correlation, the extent of
expression of default gene in families or in a population. When there is no fault
in the structure of a gene, a disease may occur in the faulty expression of a gene.
Such changes are due to DNA methylation and histone modification. It is called
as epigenetics. Segregation, association and linkage analysis are important
methods used in Genetic epidemiological studies. Using these methods
internationally, a Haplotype map of humans (HapMap) was constructed to
understand common genetic variation and its association with diseases.
37
Applied and Emerging Suggested Reading
Andreas Ziegler , Inke R. König. 2010. A Statistical Approach to Genetic
Epidemiology. Concepts and Applications.2nd Edition.,Weinheim: Wiley-VCH
Verlag GmbH and Co.KGaA.
Dawn Teare (ed). 2011. Genetic epidemiology. Methods in molecular
biology.Vol.713, Newyork: Springer.
Francis CR. 2011. Epigenetics: The Ultimate mystery of Inheritance. Newyork:
W.W.Norton & Company.
Francis CR. Epigentics: How environment shapes our genes.W.W.Norton and
Company, 2012.
Lyle J. Palmer, Paul Burton and George Davey Smith (Editors). 2011. An
Introduction to Genetic Epidemiology (Health & Society Series). First edition.
Bristol, U.K: The Policy Press.
Morton, N and Chin Sik Chung. Genetic Epidemiology. London: Academic press.
Trygve Tollefsbol. (eds). 2010. Handbook of epigenetics: The new molecular
and medical genetics. London:Academic Press.
Sample Questions
1) Define Genetic Epidemiology?
2) Give a brief account on the scope of genetic epidemiology.
3) Explain the term epigenetics. Epigenetics concept has given new ideas to
Human Genetics. Justify the statement.
4) DNA Methylation is an important process to understand gene-expression.
Explain DNA Methylation process.
5) HAP MAP Project is an essential innovation for biomedical research. State
the aims of the project.
38
Genetic Epidemiology and
UNIT 3 PREVENTION OF GENETIC Epigenetics
DISEASES
Contents
3.1 Introduction
3.2 Genetic Screening
3.3 Genetic Counselling
3.4 Prenatal Diagnosis
3.5 Gene Therapy
3.6 Summary
Further Reading
Sample Questions
Learning Objectives
&
It is expected that after reading this unit, you would be able to:
Ø explain what is genetic disease and types of genetic diseases;
Ø discuss the processes of genetic screening and genetic counselling;
Ø describe on prenatal diagnosis; and
Ø explain gene therapy and its importance.
3.1 INTRODUCTION
Genetic diseases are those pathological conditions that are caused or influenced
by abnormalities in the genetic material (genome) of a person and these are caused
by genemutations and chromosomal abnormalities. Genetic diseases place a
substantial health, emotional, and economic load on affected people, their families
and on the society. There are a number of diverse types of genetic disorders.
Geneticists group genetic disorders into four categories: single gene/monogenic
genetic diseases, multifactorial/polygenic genetic diseases, chromosomal diseases
and mitochondrial DNA disorders.
Single Gene Genetic diseases: These are also called as monogenic genetic
diseases or Mendelian genetic disorders. These type of disorders are caused by
changes or mutations that occur in the DNA sequence of a single gene. Single
gene disorders are passed on between generations from parents to offspring.
Four patterns of inheritance occur: autosomal dominant, autosomal recessive,
X-linked dominant and X-linked recessive. Some of the diseases of single gene
disorders are sickle cell anaemia, cystic fibrosis, Aicardi Syndrome, Huntington’s
disease etc.
Polygenic genetic diseases: These diseases are also called multifactorial genetic
disorders. These diseases are influenced by the interaction of multiple genes and
interaction between genes and environmental factors. Heart disease, diabetes,
hypertension, Alzheimer’s disease are some of the examples of polygenic diseases.
39
Applied and Emerging Chromosomal diseases: These diseases are caused by the loss or gain of one or
more chromosomes or by alterations in chromosome structure. Down syndrome,
Turner syndrome and Klinefelter syndrome are some of the examples for
chromosomal diseases.
Mitochondrial DNA disorders: involve the defects in mitochondrial DNA not

nuclear DNA. Ex: Some rare neurological and skeletal disorders.
So far we have studied what are genetic disease and their types. Now let us
discuss how to prevent them. The desire of all parents is to have normal and
healthy children. Hence many parents think ways to prevent or lower the risk of
passing the genetic diseases to their offspring by preventing the genetic diseases.
To prevent genetic diseases, parents have to undergo certain preventive measures
such as Genetic screening, Genetic counselling, Prenatal diagnosis and Gene
therapy. A brief description of the above mentioned preventive measures is
described below.
3.2 GENETIC SCREENING

Genetic screening is a routine diagnostic procedure devised to detect those who
are carriers of, or who are themselves affected by, a hereditary disease. Genetic
screening applies to populations rather than to individuals.
The most-widespread application of genetic screening in the United State is for

phenylketonuria (PKU). All hospitals in the United States screen newborn babies
for PKU by a blood test called Guthrie test.
After genetic screening if both the parents are heterozygous for a genetic disease
and the genotypes of both the prospective parents become known and they can
decide to produce a child or not. It is simple matter to work out the probability of
their child inheriting the disease. This can be done through appropriate tests
around 2-3 months after conception. This is achieved through amniocentesis or
through chorionic villus biopsy; the cultured fetal cells may be used for
determining their karyotype, levels of the critical enzymes and restriction patterns
of DNA. Such an antenatal diagnosis is now available for several genetic diseases
and for a variety of chromosomal defects. The purpose of such a diagnosis is
premature termination of abnormal fetuses.
Genetic counselling and antenatal diagnosis provide definite relief to the

prospective parents and reduce the frequency of genetically defective individuals
in the population. However, it is unlikely that these measures would eliminate
the deleterious alleles from a population. This is so because most genetic defects
are recessive and heterozygotes for such alleles. Thus even after a total ban on
reproduction by the homozygotes for such recessive alleles they would remain
in the population through the heterozygots, therefore even such an extreme
selection would lead to only a slow decline in their frequency. Further, it is not
likely that all the couples in any society will willingly submit themselves, at
least in the foreseeable near future, to these procedures. But genetic counselling
has become a routine aspect of medical practice in most developed countries.
It has been advocated that defective genes may be corrected through sophisticated
genetic techniques either during the early stages of embryo development (embryo
40
therapy) or in specific tissues of the adult patient (patient therapy); such an Prevention of Genetic
Diseases
approach is referred to as genetic surgery. Embryo therapy would involve:
1) In vitro fertilization of egg.
2) Production of several copies of the normal allele of the defective gene.
3) Introduction of this DNA into the zygote or in the cells of the developing
embryo.
4) Integration of DNA, preferably in place of the defective allele, so that it may
function normally.
The aim of patient therapy is to introduce the normal gene into the critical tissue
of the patient that is affected by a genetic disease, i.e., the tissue where the
concerned gene is required to express itself the most e.g., pancreas in the case of
diabetes. The steps involved in patient therapy would be similar to those of embryo
therapy. But in this case, cells from the concerned tissues may have to be exercised
and treated in vitro to correct their genetic defects and then reintroduced into the
tissue where they may function normally. Techniques for isolation, identification
and multiplication of many human genes are now available, and for many others
they are likely to be developed soon. The techniques for gene transfer in eukaryotes
are being refined and it may not remain a great problem in the near future.
A suggestion has also been made to use highly specific chemical mutagens that
will correct the defect in the concerned gene. Such a directed mutagenesis however
is a dream that may be more difficult to fulfil the patient and embryo therapies
through DNA mediated genetic modifications. Genetic screening and counselling
may also lead to certain problems. The cases of mistaken paternity, the problem
of confidentiality, delayed counselling are important among them.
3.3 GENETIC COUNSELLING

Genetic counselling is essentially a communication process that informs
prospective parents about the nature of genetic disorders, about the risk of their
having a genetically defective child, and about the options available to them in
dealing with that risk. Or it can help them cope with the care of an existing
genetically handicapped child. The advanced knowledge of the applied aspect of
human genetics has gained importance. Therefore genetic counseling is an
important area of applied human genetics. The counselor should have adequate
knowledge in the counseling process. The counselor is preferably a medical doctor
or a profession who is having knowledge in human genetics. The duty of a
counselor is to offer the necessary genetic information and also the information
about social, economic and psychological aspects related through the case. The
persons receiving genetic counseling are called the consultands.
Genetic Counselling, as defined by Harper (1984), is “the process by which

patients or relatives at risk of a disorder that may be hereditary are advised of the
consequences of the disorder, the probability of developing and transmitting it,
and the ways in which this may be prevented or ameliorated”. However the
American Society of Human genetics (1975) formulated the definition as “Genetic
counselling is a communication process which deals with the human problems
associated with the risk of occurrence of a genetic disorder in a family”. This
process involves an attempt by one or more appropriately trained persons to help
41
Applied and Emerging the individual or family to: (1) comprehend the medical facts including the
diagnosis, probable course of the disorder, and the available management, (2)
appreciate the way hereditary contributes to the disorder and the risk of recurrence
in specified relatives, (3) understand the alternatives for dealing with the risk of
recurrence, (4) choose a course of action which seems to them appropriate in
their view of their risk, their family goals, and their ethical and religious standards
and act in accordance with that decision, and (5) to make the best possible
adjustment to the disorder in an affected family member and/or to the risk of
recurrence of that disorder.
Genetic counselling involves the following steps:

The prospective parents either suffering from or suspected to be heterozygous
for some genetic disease on the risk of their children suffering from the same
disease should be educated. By creating a suitable social environment such parents
may be encouraged to voluntarily abstain from producing children. To identify
people suffering from a genetic disease is relatively easy for a trained clinician.
It is difficult to identify a carrier for genetic disease and in most cases not possible.
Information on the likelihood of an individual being a carrier for a genetic disease
can be obtained by the analysis of family pedigree in some conditions or possible
in case of certain conditions by biochemical and molecular tests.
The process of Genetic counselling
1) After genetic screening of a disorder, patients or their parents should be
informed about the genetic or medical implications of the disease;
2) The likelihood of occurrence of such genetic disorder in the family should
be calculated; and
3) To suggest ways in which the occurrence of the genetic disorder can be
controlled.
Pedigree Analysis
Pedigree is a family history of hereditary condition or diagram of a family history
indicating the family members, their relationships to proband (the affected
individual that brings family to medical attention), and their status with respect
to a particular hereditary condition.
Pedigree analysis assists the counsellor to decide if a trait is Mendelian. It also

helps to establish the mode of inheritance. The first step in pedigree analysis is
to observe the number and relationships of all individuals who express the same
or similar clinical features. From this, it should be possible to determine if the
disorder is dominant or recessive, autosomal or X-linked or Y-linked by looking
for the typical patterns of inheritance. For example, a Y-linked disease can usually
be distinguished by seeing male-to-male transmission of mutation, but since
males pass only the Y chromosome to their sons, should never be father to son
transmission of an X-linked gene. Males will be most commonly affected in an
X-linked disease, whereas males and females should be equally affected in
autosomal disorders. In general, a dominant disease will be seen in approximately
half of the individuals in each generation, but recessives occur very rarely. If the
mutation is in the mitochondrial genome, affected mothers will pass the trait to
all of their children, but none of the offspring of an affected male should have
the disease.
42
Once the inheritance pattern of the disorder is determined, the status of family Prevention of Genetic
Diseases
members in the pedigree can be evaluated. By carefully observing the position
of affected individuals, mutation carriers may be identified. From this data, the
risk of carrier status for other family members or the chance that a couple may
have an affected child can be estimated.
3.4 PRENATAL DIAGNOSIS

Prenatal diagnosis is the detection or exclusion of abnormality in the foetus prior
to birth. In the process of having healthy progeny, prenatal diagnosis useful in
detecting health of a baby to be born. It is useful to detect genetic disorders
where the couple or populations are at high risk of inheriting genetic disorders.
If an abnormality is detected in the pregnancy, the parents can take decision as to
whether to continue with the abnormal foetus or to go for abortion. Prenatal
diagnosis enables: (1) Timely medical or surgical treatment of a condition before
or after birth, (2) parents to abort a foetus with the diagnosed condition, and (3)
parents he to be prepared psychologically, socially, financially and medically for
a baby with a health problem or disability or for likelihood of a still birth.
Prenatal diagnosis for genetic diseases is now commonly available for pregnancies
at risk. Prior to prenatal diagnosis genetic counselling could only give likelihood
of recurrence, based on Mendelian laws or empirical data. If an abnormality is
detected in the pregnancy the medical people have to convey the information to
parents and allow the parents to take a decision as to whether to continue with
the abnormal foetus or to go for abortion. The couples at high risk of having a
child with a genetic disorder has to choose between taking the risk or considering
other reproductive options such as long term conception, sterilization and
termination of pregnancies. Most parents would terminate an affected pregnancy
but some choose to use the information to prepare for the birth of an affected
child. When the foetus is found to be normal it allows the parents to continue the
pregnancy with mental relief.
Many factors are to be considered before undertaking prenatal diagnosis, like

risk of inheriting a genetic disorder, severity of genetic disease etc. Some genetic
diseases lead to death in utero, or infancy or childhood. Some diseases are
compatible with survival for many years with severe handicaps. Many genetic
diseases cannot be cured even if the basis for the diseases is known. In some
cases gene therapy may help. Currently prenatal diagnosis tests are available for
more than 200 genetic disorders. Before going to a test one should be careful in
finding the reliability of the test.
Indications for Prenatal Diagnosis

There are many indications for offering prenatal diagnosis. While undertaking
prenatal diagnosis the risk of an abnormal foetus is at least as great as risk of the
procedure itself. The following are some of the indications:
Advanced maternal age: Women who are pregnant at 35 or more have higher
risk of giving birth to a baby with the defect in chromosomes. Down syndrome
(trisomy 21) is the common chromosomal defect. A child with Down syndrome
can be born to parents of any age; however, the risk rises steeply once the mother’s
age is over 35 years.
43
Applied and Emerging Previous child with a chromosome abnormality: Parents who have had a child
with trisomy 21 (Down syndrome) or any other trisomy are at increased risk of
having a trisomy in subsequent pregnancies.
Family history of a chromosome defect: A pregnant woman with a family

history of chromosome defect are often advised for prenatal diagnosis. The most
common abnormality is Down syndrome (Trisomy 21).
Family history of a neural tube defect: If a first-degree relative of the foetus

(parent or sib) has a neural tube defect, the risk to the foetus is in the 2 to 5
percent range. If more remote relatives are affected, the risk of the foetus is less
but may still be above the population risk.
Other indications for prenatal diagnosis include structural aberrations in a family

or previous pregnancy, single gene genetic disorders, parental consanguinity,
mental retardation etc.
Techniques of prenatal diagnosis: There are several techniques available for

prenatal diagnosis. The following are some of the methods.
Amniocentesis: In this technique amniotic fluid would be aspirated by inserting

a needle through the abdomen into the mother’s amniotic cavity (Fig. 3.1). This
procedure is to be performed under ultrasound guidance. Amniocentesis is usually
carried out between 14-16 weeks of gestation and 10-20ml of amniotic fluid is
aspirated. The cells have to be cultured for an average of 8-14 days to obtain a
foetal karyotype. The risk of the method appears very small; however there is a
small risk of inducing miscarriage. With this method Karyotyping and some
biochemical disorders can be detected.
Fig. 3.1: Aspiration of amniotic fluid (source:gi.net.au)
Chorionic villus sampling: This technique is carried out between 9 and 12

weeks of gestation and involves the removal of small amount of placenta. This
44
technique is suitable for chromosome analysis following the determination of a Prevention of Genetic
Diseases
high risk of chromosome abnormality. The advantage of this technique is early
and definitive chromosomal analysis. This test bears a risk of pregnancy loss
varying from 1 to 3 percent. In this technique karyotyping, DNA and biochemical
disorders can be detected.
Foetal blood sampling: This technique is also called cordocentesis. It involves

the removal of small amount of foetal blood by inserting a small needle into the
site where the cord joins the placenta. In this technique rapid karyotyping can be
done.
3.5 GENE THERAPY

Gene therapy can be defined as the insertion of genetic material into cells for the
treatment of disease. Although gene therapy was envisaged initially as a means
of treating inherited genetic diseases, disciplines as diverse as oncology,
cardiology, endocrinology, and infectious diseases are currently developing novel
therapeutic strategies that have in common gene transfer into cells.
Gene therapy naturally intends to supplement a defective mutant allele with a

functional one. In most gene therapy studies, a normal gene is inserted into the
genome to supplement an abnormal disease causing gene. To deliver the
therapeutic gene to the patient’s target cells, a carrier called a vector have to be
used. Currently, the most common vector is a virus that has been genetically
altered to carry normal human DNA. The vector unloads its genetic material
containing the therapeutic human gene into the target cell. The generation of a
functional protein product from the therapeutic gene restores the target cell to a
normal state.
Types of Gene Therapy

Gene Therapy can be classified into two types: Somatic gene therapy and Germ
line gene therapy.
Somatic gene therapy

In this gene therapy, the therapeutic genes are moved into the somatic cells or
body of a patient. Due to somatic gene therapy the modifications that occur will
be restricted to the individual patient only. But these modifications will not be
inherited by the patient’s offspring or later generations.
Germ line gene therapy

In this type, germ cells such as sperm or eggs are modified by the introduction of
genes which are in function and these functional genes are included into their
genomes. In this type the modifications would be heritable to and passed on to
later generations. But this type is highly controversial for a variety of technical
and ethical reasons.
The gene therapy can be categorised into two types: in vivo therapy and ex vivo
therapy. In the case of in vivo therapy the therapeutic genes are directly introduced
in to the patient’s body (fig. 3.2) and in ex vivo category the cells are removed
from the patient and after manipulation they are returned to the patient (fig. 3.3).
45
Fig. 3.2: Schematic representation of in vivo Gene therapy

(source: gene-therapy.yolasite.com)
Fig. 3.3: Schematic representation of ex vivo Gene therapy (source: en.wikibooks.org)
3.6 SUMMARY
Genetic disease is caused by variation or alteration called mutation in gene, or
alteration in chromosome. Genetic diseases can be classified into simple and
complex diseases. Simple genetic diseases are also called as monogenetic or
Mendelian diseases caused by a mutation. Complex diseases have multi-factorial
causation. They are caused by the interaction of many genes and gene -
46
environmental interaction. Screening the genetic diseases in the population and Prevention of Genetic
Diseases
genetic counselling to the couples is a prerequisite in avoiding the defective
progeny. To prevent the genetic diseases, prenatal diagnosis and termination of
defective zygote is one of the best ways. Gene therapy is the treating method for
genetic diseases, it involves in correcting the default genetic sequence. Currently
available method for preventing genetic diseases is to identify the faulty genetic
code at an early stage and change the life style. By changing the life style we can
prevent some late onset genetic diseases. In curing the genetic diseases future
research may bring success in gene therapy.
Further Reading
Gardner, A, Howell, R.T and Davies, T. 2008. Human Genetics. New Delhi:
Viva Books private Ltd.
Hartl, D.L. 1991. Basic Genetics. Boston: Jones and Bartlett Publishers.
Mueller, RF and Young, ID. 1995. Emery’s Elements of medical genetics. New
York and London: Churchill Livingstone.
Thompson, JS and Thompson, MW. 2005. Genetics in Medicine. Philadelphia
and London: WB Saunders Company.
Uhlmann, WR, Schuette, JL and Yashar, BM. 2009. A guide to Genetic counseling.
New Jersey: Wiley-Blackwell.
Verma, PS and Agarwal, VK. 1999. Cell Biology, Genetics, Molecular Biology,
Evolution and Ecology. New Delhi: S. Chand & company Ltd.
Sample Questions
1) What is a genetic disease? Briefly explain on various genetic diseases.
2) Discuss briefly about Prenatal diagnosis.
3) What is genetic screening? Explain its processes.
4) Write short notes on the following:
a) Gene therapy
b) Genetic counselling
47
Trends in Human Genetics UNIT 4 GENETICS AND HUMAN ISSUES
Contents
4.1 Introduction
4.1.1 Human Genome Project
4.1.2 What is Ethics?
4.1.3 Ethical, Legal, Social Issues in Genetics
4.2 Genetic Testing and Research
4.2.1 General Concerns
4.2.2 Ethical Principles in Genetics Research
4.2.2.1 Autonomy or Respect for Persons
4.2.2.2 Beneficence and Non Maleficence
4.2.2.3 Justice
4.2.3 Special Ethical Issues in Genetics Studies
4.2.3.1 Informed Consent
4.2.3.2 Vulnerable Participants
4.2.3.3 Genetic Counselling
4.2.3.4 Risks and Benefits
4.2.3.5 Pedigree Studies
4.2.3.6 Privacy and Confidentiality
4.2.3.7 Inducement vs Compensation
4.2.3.8 Genetic Screening
4.2.3.9 DNA Testing
4.2.3.10 Prenatal Testing
4.2.3.11 Presymptomatic and Susceptibility Testing
4.2.3.12 Gene Therapy
4.2.3.13 DNA and Cell-line Banking/Repository
4.2.3.14 Cloning
4.2.3.15 Stem Cell Research and Therapy
4.2.4 Other Concerns in Genetics Research
4.2.4.1 Commercial Issues
4.2.4.2 Patenting
4.2.4.3 Research in International Collaboration
4.3 Summary
Sample Questions
Learning Objectives
&
Ø describe how ethical issues in human genetics have emerged and why it is
important to take care of them;
Ø understand about the various ethical principles and their importance; and
Ø discuss the emerging ethical, legal, social concerns in genetic testing and research.
48
Genetics and Human Issues
4.1 INTRODUCTION
Hereditary conditions affect millions of families throughout the world. About
5% of all pregnancies result in the birth of a child with a significant genetic
disorder, congenital malformation or disability. The burden of genetic disorders
and birth defects is yet to be recognised. It has been estimated that there is a high
prevalence of genetic disorders in India with about 495,000 infants with congenital
malformations, 390,000 with G6PD deficiency, 21,400 with Down syndrome,
9000 with Beta thalassaemia, 5,200 with sickle cell disease and 9760 with amino
acid disorders born each year (Verma and Bijarnia, 2002). A high prevalence of
inborn errors of metabolism of 1 in 1000 live births has been reported from India
(Rama Devi and Naushad, 2004). It is estimated that 8000-10000 children are
born with thalassaemia every year and there are about 20 million carriers of b-
thalassaemia in the country (Mohanty et al, 2002). Most non-infectious diseases,
may have a genetic component. Therefore, continued efforts are required to
develop effective treatments and make them available in India for diseases that
are important to the health of communities as well as individuals and families.
4.1.1 Human Genome Project (HGP)

The human genome project (HGP) was an international research effort, with the
aim to sequence the entire human DNA and also determine the location of all
identified genes which was carried out from the year 1990 to 2003. This project
was coordinated by the U.S. Department of Energy and the National Institutes of
Health. The project was initiated with a hope to develop new ways to diagnose,
treat, and someday prevent the thousands of disorders that affect us.
Goals of Human Genome Project

identify all the approximately 20,000-25,000 genes in human DNA.
determine the sequences of the 3 billion chemical base pairs that make up
human DNA.
store this information in databases.
improve tools for data analysis.
transfer related technologies to the private sector.
address the ethical, legal, and social issues (ELSI) that may arise from the
project.
Upon completion of this project enormous amount of genetic information has

been made available. All adults have a right to know their genetic makeup and
also implications for the health of their potential to next generation. HGP has
raised some concerns in regard to issues such as access to genetic information,
diagnostic services, privacy and confidentiality, disclosure to family members,
freedom of reproductive choices, misuse of genetic information, stigmatization/
discrimination of individuals based on their genetic makeup etc. Therefore though
there is potential for advances through better diagnostic and preventive methods
however on the other hand this knowledge has increased concerns about genetics
in the public. It is therefore important to improve public knowledge and create
better understanding about genetics. To remove the fear from the minds of people
as well as help to protect families with genetic disabilities, it is important to
understand societal and the ethical issues. The following are some examples of
what could be the implications of genetic knowledge to various people: 49
Applied and Emerging • individuals and families – whether to participate in testing, with whom to
share the results, implications for individual and other family members;
• health professionals – when to offer genetic testing, obtaining informed
consent, how to ensure quality, how to interpret results, counsel patients,
whom to disclose information;
• employers, insurers, the courts, other social institutions – the value of genetic
information to the decision they must make about individuals;
• governments – how to regulate the use of genetic tests and information they
provide and how to provide access to testing and counselling services for
society; and
• society – how to improve public understanding of science and its social
implications and increase participation of the public in science policy making.
The scientific community should address the above mentioned questions before
use of this knowledge could be considered as ethically valid. As the challenges
are conquered we will begin to harness genomics for the benefit of our populations
(Hardy, 2008, Seguin, 2008).
4.1.2 What is Ethics?

Ethics, as a field in philosophy or religion, is concerned with systematic reflection
on the moral life and its conflicts. “Ethics” is a generic term for various ways of
understanding and examining the moral life and for resolving ethical problems
(Beauchamp and Childress, 1994). Biomedical ethics (or bioethics) is an
interdisciplinary field for the systematic study of ethical issues that arise in
research, medicine and society. Medical ethics is a system of moral principles
that apply values and judgments to the practice of medicine or its practical
application in clinical settings. To be ethically correct these principles should be
based on the community that is served and in view of their religious, social or
cultural value systems so as to adequately protect their rights, welfare and safety.
Under the principles of ethics there is an obligation to confer benefits, to prevent
and remove harms, and to weigh and balance the possible goods against possible
harms of an action.
4.1.3 Ethical Legal and Social Issues (ELSI) in Genetics

As you know during the last 1-2 decades there has been explosion in knowledge
in human genetics, and several new technologies have been developed for example
gene therapy, genetic engineering, stem cell therapy, cloning, prenatal diagnosis,
preimplantation diagnosis, creating designer babies, genetic screening etc. In
addition new issues have also emerged, for example those relating to patenting
of DNA sequences, Intellectual Property Rights (IPR) issues and potential for
bio-terrorism. In this rapidly evolving field there is a need to continuously monitor
developments and respond to emerging ethical issues promptly and judiciously
since improper use of these can have far reaching implications for human race.
You may be surprised to know that in no other area of biomedical research there
has been a greater concern for ethical issues than in the field of human genetics.
With the successful completion of Human Genome sequencing in April, 2003,
number of guidelines were laid identifying the ethical, legal and social issues
and measures that may be taken for improving awareness and understanding of
human genetic disorders.
50
The integration of genetic technologies into the public health raises significant Genetics and Human Issues
challenges. How can we assure the quality and accuracy? What impact will these
new technologies have on existing programs? Issues of autonomy, privacy,
confidentiality will require special consideration. Will it be possible to obtain
fully informed consent from large populations? How to protect privacy in genetic
registries and databases? How can group stigmatization and discrimination be
prevented? None of these questions have easy answers, but they raise important
challenges for the community. These are the various ethical, legal and social
issues that address the societal concerns emerging from the new genomic
information and technologies.
4.2 GENETIC TESTING AND RESEARCH

4.2.1 General Concerns
It is important for you to note that in human genetics the concerns may not only
be to the individual but also the family, community or society from which s/he
has been drawn. Kindly note some of these concerns.
What are the Concerns?

• Genetic information is sensitive and private and needs adequate
protection. In genetic research the harm may not only be physical, but
also psychosocial which may produce anxiety and depression or damage
familial relationship.
• There is a likelihood of social stigmatization and discrimination in
schooling, employment, health and general insurance, which requires
much great care.
• When involving participants in research it is important to obtain written
informed consent and maintain confidentiality of their personal or other
details or data collected from them.
• There is great importance of spoken word in medical genetics, since
genetic counselling is akin to therapy in other fields. Which means that
the ‘word’ is equivalent to drug/ intervention in other fields of medicine.
Appropriate communication skills are necessary for genetic counselling.
• Genetic manipulations have consequences for the future, some of which
are unknown and long term. Hence, greater care towards potential
dangers is necessary.
• Any biomedical research conducted by student, or faculty on human
participants should be reviewed by an independent committee known
as the “Institutional Ethics Committees” or IEC to ensure protection of
participants in research.
4.2.2 Ethical Principles in Genetics Research

There are three main ethical principles for all kinds of biomedical research
including genetics research in human participants :
4.2.2.1 Autonomy or Respect for Persons
This principle refers to respecting the self-determination of individuals and
protecting those persons with diminished autonomy. Informed consent is one 51
Applied and Emerging way of protecting this principle i.e., rights and voluntary decisions of individuals.
For all biomedical research the informed consent of the individual, or legal
guardian should be obtained. It protects the individual’s freedom of choice to
voluntarily agree/ disagree to participate in research or give samples for genetic
testing. Adequate information about the testing is given in a simple and easily
understandable language in a document known as the Informed Consent Form
with Participant/ Patient Information Sheet.
4.2.2.2 Beneficence and Non Maleficence

In simple terms it just means doing good and protection from harm. Beneficence
involves giving importance to the welfare of persons and providing maximum
benefits. On the other hand Non-maleficence refers to preventing from harm or
trying to reduce harm and is derived from the traditional medical norm of “do no
harm”. The principle of beneficence involves giving highest loyalty to the welfare
of people and families with the goal to improve the health of population.
4.2.2.3 Justice
This principle requires treating persons with fairness. It involves distributing
benefits and burdens of health care as fairly as possible in society. Therefore
persons should be treated fairly, giving them what they deserve, or are entitled
to. Distributing the benefits and the burdens of health care ought to be governed
by ethically justified rules such as: to each according to need, to each according
to an equal share or opportunity, etc.
Table 4.1: Examples highlighting use of ethical principles in genetic testing
• Involve voluntary approach in testing and treatment; avoid coercion (force)
by society, or health professionals (autonomy).
• Respect for human diversity and for those whose views are in the minority
and respect for people’s basic intelligence, regardless of their knowledge
(autonomy).
• Education about genetics for the public, medical and other health
professionals, teachers, and other persons (beneficence).
• Protecting privacy & confidentiality (autonomy)
• Prevention of unfair discrimination in employment, insurance, or schooling
based on genetic information (non-maleficence).
• Teamwork with other professionals through a network of referrals to provide
better tests, care and treatment (beneficence).
• Timely provision of indicated services or follow-up treatment (non-
maleficence).
• Refraining from providing tests or procedures not medically required (non-
maleficence).
• Providing good quality of services, including lab procedures (non-
maleficence).
• Sharing results as well as benefits of research with communities
(Beneficence, justice).
• Equitable selection of participants from community (justice).
• Protection of poor, vulnerable groups (justice).
52
4.2.3 Specific Ethical Issues in Genetic Studies Genetics and Human Issues
4.2.3.1 Informed Consent

A well informed consent and understood consent is essential part of all genetic
testing. The central issue of human research in respect to the individual’s
autonomy is achieved by obtaining “Informed consent” from adult individuals
who are capable of giving a valid informed consent after they have been provided
with complete information regarding the condition and the tests. Those persons
who are tested are entitled to receive all information in a way that they can
understand what is proposed to be done, they must be made aware of any risk,
they must be given time to decide whether or not they would like to participate
or withdraw from genetics testing/screening. In addition to this the details about
the disorder to be screened and its inheritance pattern, reliability of the screening
test and what will be done with the samples should also be explained. Information
about the implications of a positive screening test (abnormal) should also be
explained. In the case of an individual who is not capable of giving informed
consent (for example individuals such as children, mentally challenged persons
or prisoners etc), the consent of a legal guardian should be taken. Adequate
information about the research given in a simple and easily understandable language
in a document known as the Informed Consent Form with Participant/ Patient
Information Sheet. Table 2 gives the details of elements that should be given in an
informed consent form/ patient information sheet (ICMR Guidelines, 2006).
Table 4.2: Elements of Informed Consent Form
1) Nature and purpose of study stating it as research.
2) Duration of participation with number of participants.
3) Procedures to be followed.
4) Investigations, if any, to be performed.
5) Foreseeable risks and discomforts adequately described and whether
project involves more than minimal risk.
6) Benefits to participant, community or medical profession as may be
applicable.
7) Policy on compensation.
8) Availability of medical treatment for such injuries or risk management.
9) Alternative treatments if available.
10) Steps taken for ensuring confidentiality.
11) No loss of benefits on withdrawal (from participation).
12) Benefit sharing in the event of commercialization.
13) Contact details of PI or local PI/Co-PI in multicentric studies for asking
more information related to the research or in case of injury.
14) Contact details of Chairman of the IEC for appeal against violation of rights.
15) Voluntary participation.
16) If test for genetics and HIV is to be done, counseling for consent for
testing must be given as per national guidelines.
17) Storage period of biological sample and related data with choice offered
to participant regarding future use of sample, refusal for storage and receipt
of its results.
53
Applied and Emerging A copy of the participant/patient information sheet should be given to the
participant for her/ his record. When the written consent (signature or thumb
impression) is not possible due to sensitive nature of the project or the participant
is unable to write, then oral consent can be taken after ensuring its documentation
by an unrelated witness. However the approval for oral consent has to be taken
from an ethics committee beforehand. When human biological material or samples
are collected, whether in a research or clinical setting, it is appropriate to ask
persons for their consent to future storage and use of their samples.
4.2.3.2 Vulnerable Participants
Vulnerable individuals are those persons who are unable to give valid and
understood consent for e.g., minors, mentally disadvantaged, prisoners,
institutionalised individuals, terminally ill, students, subordinates and people
who do not speak the language etc. Further there are influences of culture or
customs which can make certain communities vulnerable. Even adult women
may be incapable of giving informed consent without consulting family members
like mother in law or husband. In community research where even if consent of
the community leaders or head of family is taken, individual consent of every
person is a must. In telling about test results (e.g., carrier status for a recessive
disorder; which parent carries a balanced autosomal translocation that has caused
a disorder in their child; incidental discovery of non-paternity) and in assisting
couples to reach reproductive decisions, professionals should be careful to protect
the interests of those who may be vulnerable to harm from a hostile environment.
Similarly children, persons of diminished mental capacity, and some other groups
may not be in a position to make a decision due to their limited capacities. Such
people may be vulnerable to harm because of their position in society and need
protection from any potential adverse effects of genetic testing. Minority groups
are entitled to respect, to their beliefs, customs or way of thinking even if the
medical geneticist disagrees with these views. They should be treated equally
with persons whose views are in the majority. They should be provided with due
information and be given opportunity to take their own decisions.
4.2.3.3 Genetic Counselling
Every individual should be provided with complete information and opportunity
to make choices regarding one’s health. This is important to the person’s integrity
and contributes to psychological well-being. All genetic testing should be
accompanied with pre-test counselling (to tell about the nature of tests, what is
expected etc) as well as a post test counselling (to explain the results of the
testing and its implications). Pretest and post test counseling is an integral part
of prenatal diagnosis (Kabra, 2003). In order to help a person to make a valid
choice, he/she should be provided with more than one alternative. Only those
persons who are qualified and experienced in communicating the meaning of
genetic information should undertake genetic counselling.
Purpose of genetic counselling
• provide detailed information about the genetic disease in question.
• help individuals/couples understand options and present state of medical
knowledge so they can make informed decisions.
• help individuals/couples adjust to and cope with their genetic problems.
• the removal or lessening of guilt or anxiety or fear that they may have.
• helping individuals/couples achieve their parenting goals.
54
4.2.3.4 Risks and Benefits Genetics and Human Issues
Any research procedure that exposes a person to any risk should be done only if
there is proper justification for doing so and there should be expected benefits of
the research. All expected or potential risks as well as benefits should be discussed
in detail before participation of the person. Also it is important for you to note
that in genetic research, the primary risk may not be physical but rather may be
psychosocial and can have effects or implications on other members of the family
as well. Genetic testing therefore should be offered when the probability of harm
is less and the expected benefits are more. Adequate counseling should be given
to participants on the meaning of genetic information they receive.
4.2.3.5 Pedigree Studies

Pedigrees involve obtaining history of other members of the family of the patient
or the proband under investigation. It is an important tool in genetics however it
may reveal information about the likelihood of other members of the family
being either carriers of genetic deseases or being affected by the disease. Special
privacy and confidentiality concerns arise in genetic family studies because of
relationship between the participants. It should be kept in mind that within families
each person is an individual who has the right to keep the information about
himself or herself confidential. Family members are not entitled to know each
other’s diagnosis. Other members are secondary subjects and they are not entitled
to know about the genetic diseases of other members without appropriate informed
consent. Before revealing medical or personal information about individuals to
other family members, investigator must obtain consent of the individual to do
so.
To explain this further I will give you an example:

In view of the cultural background of our country where woman is still a
vulnerable and exploited participant, revealing information to the husband that
his wife is the carrier of balanced chromosomal translocation (leading to recurrent
abortions or a genetic syndrome in her child) or that she is a carrier of a single
gene causing ‘X’ linked or recessive disease, may lead to grounds for a divorce
despite the fact that the husband himself is a carrier of the autosomal recessive
disorder. While general principles of counseling require presence of both the
spouses, necessary care must be taken not to end up in breaking the families. In
view of above concerns appropriate caution may be exercised. We must
understand that revealing who else in the family has agreed to participate may
lead to breach of confidentiality. Also if there is a patient, out of personal interest
s/he may put undue pressure on relatives to enroll in the study which may not be
acceptable to other members.
4.2.3.6 Privacy and Confidentiality

Secure safeguards should be in place for protecting private ‘identifying
information’ of participants and maintaining confidentiality of research data.
Identifying information comprises of all details like name, date of birth, contact
details, and other personal information that can be used to identify an individual
and therefore needs to be protected. Adequate care should be taken in keeping
genetic records, however participants should be told beforehand regarding the
limits to safeguard confidentiality and of the anticipated consequences of breach
of confidentiality. If the result of the research is of benefit to the health of the
55
Applied and Emerging participant, then they should be communicated. Once study is over genetic data
should be coded or delinked with clinical details to maintain confidentiality
(anonymised). Adequate measures should be in place to restrict access of records
to unauthorised persons. It needs to be emphasized that consent for screening or
a subsequent confirmatory test does not imply consent to any specific treatment
or termination of the pregnancy. Specific consent is required from the affected
patient to share his/ her genetic information with family members who may be
benefited from it.
4.2.3.7 Inducement vs Compensation

Individuals who participate in research may need to be duly compensated for
their participation. Provisions should be made for adequate compensation to
reimburse extra travel expenses, loss of wages, compensation and medical care
in case of any injury. However the amounts should be reasonable and should not
become undue inducement, i.e., so huge that it becomes the only reason for
participation as an extra income and motivation factor for a person to give samples
for research. Inducement can be in cash as well as in kind. Making promises for
extra services or facilities may induce a person to agree to participate in testing
even if it is not of any direct benefit to the person. Such promises for extra
payments in cash or kind and the amount of compensation must be seen reviewed
and approved by the ethics committees before it is provided to individuals. In
case of any injury happens due to participation of a persons in research it is the
obligation of the researcher/ physician to provide adequate treatment or
compensation to cover the extra costs incurred due to this.
4.2.3.8 Genetic Screening
Genetic screening implies search in population or individuals who have, or are
susceptible to have a serious genetic disease. It also includes persons who, though
not at risk themselves, are carriers and therefore at risk of having children with
the particular genetic disease. It is essential that screening must be done with
specific purpose using validated tests. Genetic screening should be done for
conditions if it can be ensured that a suitable treatment/ management of the
disease is possible. Depending on nature of the genetic defect that is identified
and its pattern of inheritance, siblings and other blood relations as well as existing
and future generation/offspring may be affected. Screening of newborns is
permissible to detect those genetic diseases like phenylketonuria where serious
effects of the disease could be prevented by early intervention such as special
diet or treatment. It should not be done when there is no cure or for diseases
which manifest later in life. Screening of children should be deferred till the
time they are old enough to understand and are able to participate in the decision
making process, unless the intervention based on result of the test is likely to be
of direct benefit to them at a younger age. Anonymous screening may be conducted
on general population in order to establish prevalence of genetic traits/diseases.
Anonymous samples means all identifying information about person who has
contributed sample is removed and there is no way to know whose sample is it.
Left over anonymous blood spots collected for screening newborns for treatable
disorders could also be used for this purpose.
4.2.3.9 DNA Testing

For all kinds of DNA diagnosis the general principles of informed consent,
confidentiality and other criteria used for any investigation in genetics should be
56
followed. Since the knowledge in this field is new, and relatively complex, a Genetics and Human Issues
DNA test must be preceded and followed by appropriate genetic counselling.
The laboratories carrying out DNA diagnosis should make adequate provisions
to explain fully the nature of testing, implications of results to families. Preferably
they should prepare brochures in simple language which can be understood by
the persons. Differentiating between clinical practice and research can be difficult
in genetics as genetic investigations may extend to other individuals as well as
families (Parker, 2004).
4.2.3.10 Prenatal Testing

It is aimed at detecting presence of abnormalities in the foetus. The foetal sample
for examination may be obtained through amniocentesis, chorionic villi sampling,
cordocentesis or other biopsies. Foetal cells in maternal circulation can also be
used for prenatal testing. Non-invasive methods like ultrasound should be
preferred whenever available. Prenatal diagnosis should be performed only for
reasons relevant to the health of the foetus or the mother and not to select the sex
of the child (in the absence of an X-linked disorder). Prenatal diagnosis can be
used to prepare parents for the birth of a child with a disability or they have a
choice to go for abortion of affected foetus before 22 weeks of pregnancy.
Professionals should recognise the human and economic costs involved in prenatal
diagnosis and should limit its use to situations where there is a clear benefit.
Many of the centers in tertiary care hospitals or urban centers have now initiated
carrier screening for some common genetic ailments. Thalassaemia screening
an effective control program is being carried out at the Institute of
Immunohaematology, Mumbai, India. More than 14,000 women were screened
and carriers identified, followed up and offered prenatal diagnosis (Mohanty et
al, 2002).
Sex selection, whether for male or female, is very harmful to society since it
creates an imbalance in sex ratios. For example you must be aware about the
change in the sex ratio in India as commonly pregnancies with girl foetuses are
being terminated. The situation is very bad in several states of the country
including Delhi, Punjab, Haryana, Rajasthan, Bihar where sex ratio is greatly
altered. Concerned with the misuse of genetic tests, particularly for the pre-
selection of sex, the Government of India has enacted a law known as “The
Prenatal Diagnostic Techniques (Regulation & Prevention of Misuse) Act 1994”
amended in 2003 to include the Preconceptual diagnostic techniques also. Pre-
implantation DNA diagnosis is also a type of prenatal diagnosis. Same precautions
and safeguards should be adopted for this purpose also.
4.2.3.11 Presymptomatic and Susceptibility Testing
Presymptomatic testing (e.g., for Huntington disease) identifies individuals who
will develop a genetic disorder later in life. Susceptibility testing (often referred
to as ‘predictive testing’) identifies persons who are at increased risk for
developing common diseases, such as heart disease, but who may never develop
the disease in question. In some cases, presymptomatic testing (e.g., for familial
polyposis coli) can lead to prevention of the disorder’s most serious effects (e.g.,
by colon surgery to prevent cancer). Susceptibility testing can lead to preventive
programmes for heart disease or regular examinations to make possible early
diagnosis and treatment (e.g., for breast cancer). In other cases, where successful
prevention or treatment are not possible, as in Huntington disease, the major
benefit of presymptomatic testing is to provide information for planning one’s 57
Applied and Emerging life and for deciding whether or not to have children. Pre-morbid diagnosis
(diagnosing before appearance of adverse symptoms) in children should not be
done for which there is no available intervention. Pre-morbid diagnosis in adults
may be carried out with informed consent and appropriate genetic counselling.
4.2.3.12 Gene Therapy

Somatic cell gene therapy is permissible for the purpose of preventing or treating
a serious disease when it is the only therapeutic option. It should be restricted to
alleviation of life threatening or seriously disabling genetic disease in individual
patients and should not be permitted to change normal human traits. The
guidelines and clearance for gene therapy is regulated by the National Bioethics
Committee under Department of Biotechnology (DBT) and clearance from the
local Institutional ethics committee should be obtained. Safety should be ensured
especially because of the possibility of unpredicted consequences of gene
insertion. All gene therapy trials should have the provision for long term
surveillance. Germ Line Therapy is prohibited at present. Gene Therapy for
enhancement of genetic characteristics (so called designer babies) should not be
attempted, as long term effects are not understood regarding alterations to genetic
machinery of humans. Similarly it would be unethical to use genetic engineering
for improvement of intelligence, memory, physical abilities etc. even if specific
gene/genes are identified in future. Eugenic Genetic Engineering for selection
against personality, character, formation of body organs, fertility, intelligence
and physical, mental and emotional characteristics is prohibited (ICMR Ethical
Guidelines, 2006).
4.2.3.13 DNA and Cell-line Banking/ Repository

Human genetic material can be enormously precious and especially if it is
regarding rare disorders or is derived from special communities or population
groups. This material needs adequate preservation and protection for future use
and from potential exploitation. Biobanks/Repositories collect, store, and
distribute human biological materials for research purposes. Human biological
samples in biobanks include organs, tissues, cells, body fluids or samples like
serum, buffy coat, DNA, hair, nails, excreta, sweat, buccal scrapings etc. The
samples may be anonymously stored with or without its corresponding clinical
information in a database. Appropriate informed consent is needed for long term
storage of samples for future testing and research. Issues related to use of samples,
their control and ownership, and the benefit sharing to the individuals or
community also need discussion. To prevent any exploitation and protect the
rights of participants, the three main requirements are individual informed consent
for future research, approval of the IEC and the Repository Ethics Committee,
wherever applicable.
4.2.3.14 Cloning
Research using human stem cells to grow new tissues (in order to repair or replace
those damaged by disease) holds potential promise. Some of this research may
involve nuclear fusion of an adult individual’s cell with an enucleated egg, a
first step toward potential human cloning. The possible benefits of research using
nuclear fusion to produce tissues for the treatment of disease are recognized,
provided that there would be no attempt to reproduce an entire human being. At
the present time, “reproductive human cloning” is unsafe and should not be
58 attempted.
4.2.3.15 Stem Cell Research and Therapy Genetics and Human Issues
The stem cell research holds a great promise for improving human health by
control of degenerative diseases and restoration of damage to organs by various
injuries. At the same time it also raises several ethical and social issues such as
destruction of human embryos to create human embryonic stem (HES) cell lines,
potential for commodification in human tissues and organs, possible use of
technology for germ-line engineering and reproductive cloning etc. The research
in this field, therefore, needs careful consideration. It is important to protect
safety and rights of those donating gametes/ blastocysts/ somatic cells for
derivation of stem cells; or fetal tissues/umbilical cord cells/ adult tissue (or
cells) for use as stem cells. Safeguards are also needed to protect research
participants receiving stem cell transplants, and patients at large from unproven
therapies/remedies. Most of the stem cell procedures are still in the research or
experimental phase and long term effects are unknown therefore stem cell studies
should be done as a clinical trial and not offered as proven therapy to patients.
4.2.4 Other Concerns in Genetics Research

4.2.4.1 Commercial Issues, Stigmatisation and Discriminations Based
on Genetic Characteristics
When commercial companies are involved in research, it is necessary to protect
researchers and participants from possible coercion or inducement to participate
in the study. Academic institutions conducting research in alliance with industries
or commercial companies require a strong review to probe possible conflicts of
interest between scientific responsibilities of researchers and business interests
(e.g. ownership or part-ownership of the investigator in the company developing
a new product). Prospective participants in research should also be informed of
the sponsorship, so that they can be aware of the potential for conflicts of interest
and commercial aspects of the research.
The other concern is regarding insurance issues where knowing about certain
types of genetic information can lead to discrimination by insurance companies
who may refuse to provide insurance or charge higher premium. Similarly there
is a potential threat that employers may not provide jobs to individuals with
certain type of genotypes or school may not admit children based on their genetic
diagnosis. There are also major concerns regarding stigmatisation of certain
population groups or certain communities based on the genetic information. Many
of these examples may sound theoretical today however with emerging new
tools for genetic diagnosis there is a need to make provisions in advance for
protecting populations or groups from such potential harm. It is need for us to be
aware of these scenarios and protect our rich heritage.
4.2.4.2 Patenting
Biomedical research in human genetics can lead to the development of diagnostic
and pharmaceutical products. Patents may be necessary to raise funding to develop
such products commercially, but gene sequences without proven utility should
not be granted patents. Patenting has the potential to impede international
collaboration, especially between developing and developed countries, to the
ultimate detriment of service delivery to those with genetic disorders. Genetics
differs from many areas of research in that important new knowledge can come
from a family, or an ethnic group, with a particular genetic variant. If this leads
59
Applied and Emerging to the development of a diagnostic test or new therapies, equity requires that the
donors, or the community generally, should receive some benefit.
4.2.4.3 Research in International Collaboration

India with its rich biodiversity and genetic resources, conserved gene pools,
indigenous population groups is often an attractive destination for researchers
from other countries. However it should not only be provider of samples but be
an equal collaborating partner in research to ensure development in science.
Such collaborative partnerships should lead to development of capacity within
the country for better genetic research rather than mere transfer of samples abroad
for diagnostic purposes. At present a lot of genetic research is carried out in
International collaboration. This requires adequate care so that the rights of the
communities/ persons from whom samples are derived from are adequately
protected if there is transfer of biological material across borders. On one hand,
collaboration in genetics helps build capacity and is useful for betterment of
scientific knowledge but on the other it should not give the impression of
experimentation on the population of one country by another. There is a Govt of
India notification on “Exchange of Human Biological Material for Biomedical
Research” issued on 19.11.97 by Ministry of Health and Family Welfare.
Appropriate regulatory clearances are needed for international collaboration and
Ethics committee approval has to be taken before the initiation of research. Some
special concerns are given below in Table 4.3.
Table 4.3: Safeguards for Research in International Collaboration
• The collaborating investigators, institutions and countries can function as

equal partners by building appropriate safeguards.
• Careful consideration should be given to protect the dignity, safety and
welfare of the individuals if there is any possibility of exploitation of
participants/ populations.
• Choice of study populations for genetic study should be justified in scientific
and ethical terms.
• Nature, magnitude, and probability of all foreseeable harms resulting from
participation in a collaborative research programme should be explained to
participants.
• Research protocol should outline the benefits that persons / communities /
countries should experience as a result of their participation.
• The burden and the benefit should be equally borne by the collaborating
countries.
• Guidelines, rules, regulations and cultural sensitivities of countries
participating in collaborative research should be respected.
• Issues such as intellectual property rights (IPR), exchange of biological
materials, data transfer should be carried out as per signed Memorandum
of understanding (MoU).
• Collaborative research requires clearance from ethics committees as well
as from Health Ministry Screening Committee (HMSC) as per regulatory
requirements.
60
Genetics and Human Issues
4.3 SUMMARY
The last decade has witnessed tremendous advances in science and technology
and the prospects of genetic testing, genetic engineering, cloning, stem cell
research, prenatal testing, DNA diagnostic etc. all have raised many ethical
dilemmas in the minds of scientists and society. There are advantages of such
new technologies but there is also the fear of the unknown distant possibilities
which needs careful examination. Weighing of risk benefit ratio, protection of
privacy and confidentiality and sharing of burdens and benefits are some of the
main issues. Close monitoring of research in these areas is important. Education
has the potential power to prevent stigmatization and discrimination by
emphasizing that genetic disorders are not caused by the behaviour of affected
persons or families but the fact that most people may carry some recessive lethal
mutations and that our offspring or we are all at genetic risk. For all kinds of
genetic testing and research, respect for persons is important and should include
informed consent, right to referral, full disclosure, protection of confidentiality,
and respect for minority groups, women and children. The following statements
summarize the issues:
• Genetic services should be voluntary but should be made available to those
interested in them.
• Genetic counselling should be non-directive to let the decision making be
done by individuals without any force or coercion.
• All clinically relevant information that may affect the health of an individual
or fetus should be disclosed and various options explained.
• Confidentiality of genetic information should be maintained. When there is
a high risk of serious harm to family members at genetic risk, the information
should be used to avert this harm.
• Individual privacy should be protected from third parties, such as employers,
insurers, schools, commercial entities etc.
• Prenatal diagnosis should be performed only for reasons relevant to the health
and only to detect genetic conditions or malformations.
• Choices about counselling, screening, testing and abortion following prenatal
diagnosis should be available on a voluntary basis.
• Optimum support and education should be provided for children and families
with genetic conditions.
• Research protocols should follow established procedures for ethical review
and informed consent.
Ethical Guidelines for Biomedical Research on Human Participants, 2006.
Guidelines for Exchange of Human Biological Material for Biomedical Research

Purposes, 1997.
61
Applied and Emerging Hardy BJ, Séguin B, Goodsaid F, Jimenez-Sanchez G, Singer PA, Daar AS. 2008.
The next steps for genomic medicine: challenges and opportunities for the
developing world. Nat Rev Genet. Oct;9 Suppl 1:S23-7.
Kabra, M. 2003. Prenatal diagnosis. Indian J Pediatr. 70:81-5.
Mohanty D, Colah RB, Gorakshakar AH, Nadkarni AH, Phanasgaonkar SP, Shetty
S, Ghosh K, Mukherjee MB. 2002. Genetic Disorders in Haematological Practice
in India. Community Genetics, 5:197-200.
National Guidelines for Stem Cell Research and Therapy, 2007.
Nuffield Council on Bioethics. 1993. Genetic screening and public policy. In
Genetic Screening, Ethical Issues. London: Nuffield Council on Bioethics, 75–
81.
Parker, M Ashcroft R, AOM Wilkie, A Kent, 2004. Ethical review of research
into rare genetic disorders. British Medical Journal, 329:288–9.
Rama Devi AR, Naushad SM. 2004. Newborn screening in India. Indian J Pediatr;
71: 157-60.
Séguin B, Hardy BJ, Singer PA, Daar AS. 2008. Genomic medicine and
developing countries: creating a room of their own. Nat Rev Genet. 9 (6):487-
93.
The Universal Declaration on the Human Genome and Human Rights, 29th session
General Conference UNESCO, 11 November 1997.
The ethics of patenting DNA: a discussion paper. Nuffield Council on Bioethics
July 2002.
Tom L. Beauchamp, James F. Childress. 1994. Principles of Biomedical Ethics,
Oxford University Press.
Verma IC, Bijarnia S. 2002. The burden of genetic disorders in India and a
framework for community control. Community Genetics, 5:192-196.
Sample Questions
1) Write a short note on Human Genome Project and its implications.
2) What do you understand by Genetic Counselling and why is it important?
3) What are the ethical, legal and social issues? Discuss.
4) Write a note on the Ethical Principles in Genetic research.
5) What is informed consent in research? Give a few main elements of informed
consent.
6) What do you understand by vulnerable persons/ populations?
7) Why should there be adequate provisions to protect the privacy and
confidentiality of persons in genetic research?
8) Describe any three specific concerns in genetics research.
9) Write a short note on biobanks.
10. What safeguards should be in place for genetic research in International
Collaboration?
62

Ignou Physical Anthropology-1

Uploaded by

Copyright:

Available Formats

Ignou Physical Anthropology-1

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Ignou Physical Anthropology-1

Uploaded by

Copyright:

Available Formats

[Type the document title]

TOPICS ARE ARRANGED ACCORDING TO THE NEEDS OF

(b) Biological Anthropology.

1.5 Characteristics of Primates; Evolutionary Trend and Primate Taxonomy; Primate

9.3 Concept of genetic polymorphism and selection, Mendelian population, Hardy

Consanguineous and non-consanguineous mating, genetic load, genetic effect of

9.4 Chromosomes and chromosomal aberrations in man, methodology.

(a) Numerical and structural aberrations (disorders).

Print Production Cover Design

Physical anthropology is about humans’ place in nature. It is a very sought-after

Learning Objectives &

Broadly speaking, Physical Anthropology comprises of biological evolution,

The discipline thereby facilitates us in investigating the sources of variation which

What makes physical anthropology so indispensable? The answer lies in the

Human diversity, another important component of physical anthropology takes

The inclusion of human genetics as an essential component of physical

Growth and development in physical anthropology has its own importance, be it

Recent years have witnessed physical anthropology playing undeniable services

Anthropological Society of Paris, first in the field of Anthropology, was founded

Subsequently, with the advent of nineteenth century, it was anthropometry which

Ales Hrdlicka (1869–1943), a physician, studied physical anthropology in France,

Right in the middle of twentieth century in 1951, a Hooton alumnus, Sherwood

1.6 BRANCHES AND ITS DEVELOPMENT

The significance of measurements and indices was certainly well understood in

Human Growth and Development: This branch of physical anthropology

Human Genetics: Human genetics involves the study of inheritance of genes-

Primatology: It is basically concerned with the study of primates. Anthropologists

Palaeoanthropology: Palaeoanthropology is the study of fossil hominid

Human Osteology: The study of human bones is termed as Human Osteology.

Nutritional Anthropology: This branch of physical anthropology enjoys wide

Molecular Anthropology: Molecular anthropology is a comparatively newer

Anthropological Genetics: Genetic methods are used to learn about human in

Genetic Anthropology: This is a very new branch of scientific study which

Physiological Anthropology: The word physiology is from Greek: “physis”

Dental Anthropology: This branch engages the scientific study of people

Anthropometry: Anthropometry as the name suggests consists of Greek word

Ergonomics: Ergonomics is derived from two Greek words, “ergon” meaning

Demography: Demography is the scientific study of uniqueness and movement

Human Diversity: It is concerned with study of human evolution and human

Palaeoprimatology: It is well understood that man is a primate evolved from

Population Genetics: Population genetics concerns the genetic structure of

Reddy, R. 1992. Physical Anthropology, Evolution and Human Genetics. Tirupati,

Sarkar, R.M. 2000. Fundamentals of Physical Anthropology. Calcutta, Vidyodaya

Shukla, B. R.K. and Rastogi, S. 1999. Physical Anthropology and Human

Learning Objectives &

2.2 INTERDISCIPLINARY AND

2.2.1 Forensic Science

Forensic anthropologists often work in combination with forensic pathologists,

What is the role of physical anthropologist in arriving at a conclusion? What is

Anthropologists are able to calculate approximately the person’s weight by the

Police utilise the expertise of physical anthropologists for facial reconstruction,

2.2.2 Life Sciences

2.2.3 Medical Sciences

2.2.6 Environmental Sciences

2.2.7 Social Sciences

2.2.8 Human Engineering and Technology

2.2.9 Physical Sciences

Reddy, R. 1992. Physical Anthropology, Evolution and Human Genetics. Tirupati,

Sarkar, R.M. 2000. Fundamentals of Physical Anthropology, Calcutta, Vidyodaya

Shukla B. R.K. and Rastogi, S. 1999. Physical Anthropology and Human