Getting Started With Python in The Lab
Getting Started With Python in The Lab
started with
Python in
the lab
It has been my impression for some time, that many life science researchers
are missing out on some of the wonderful computational tools that are out
there, and that could be invaluable in helping them to manage and analyze their
laboratory data. This may be due to a lack of awareness that these tools exist
and that many of them are inexpensive or free, or it may be out of fear that
learning to use them will take too much time out of an already hectic schedule.
In starting this series of code tutorials for life science computing, I hope to
point life scientists with relatively little exposure to programming languages, in
the right direction to be able to start using these tools to write useful code that
can solve real problems.
We’ll be writing our code using the nice clean IDLE development environment
that comes with Python. IDLE is really a kind of specialized text editor that can
actually run the Python code you type into it. On Mac OS X or Linux, it can be
launched from a terminal window (usually by just typing “idle” if everything is
installed and con gured correctly). On Windows you will probably need to
launch it from the command line (“run”) window.
Just Do It
mysequence = “atcg”
len(mysequence)
If everything went well, IDLE should now display the number 4 which is the
length of the string in characters returned by the ‘len’ function. Now try typing
the following lines. Make sure you indent the ‘print ch’ line by one tab space
just as I have done and you will have to hit the return key twice after the ‘print
ch’ line to actually run the code.
for ch in mysequence:
print ch
You should now see your sequence printed out in order, one character per line
like this
The code you just typed translates into english as “for each item in
‘mysequence’, give the item the temporary name ‘ch’ then print ‘ch'”. This kind
of loop construction is known as an iterator in Python. Python knows that
strings are made up of smaller items, in this case characters, so when you
iterate over a string using the ‘for’ command, the iterator returns each
character in the string, in order of occurrence. I used the name ‘ch’ because the
items in this case are characters, but I could just have easily used any other
name like ‘item’ or ‘c’ or ‘roger_the_shrubber‘.
The indent in the ‘print ch’ line is signi cant. Indents are the way to create
blocks of code in Python that are to be executed all together. Every line of
code that is indented by one level underneath the ‘for’ statement, gets
executed on each round trip through the loop, so if we had for example, also
wanted to print the position of the nucleotide in the sequence, we could have
added one or two more indented lines under the ‘for’ statement like this
i=0
for ch in mysequence:
print ch
print i
i += 1
a
0
t
1
c
2
g
3
If we were to unindent the ‘i += 1’ line, this would remove it from the loop and
it would become the rst line to be executed after all the passes through the
loop had been completed. Can you figure out how this would change the output
printed by the loop?
Another feature of strings (and all list-based objects in Python) is that their
characters/items can also be accessed according to their numerical position in
the object, starting from 0 (all lists, sequences, arrays and so on in Python are
numbered from 0), up to 1 minus the length of the object. So mysequence[0] =
‘a’, mysequence[1] = ‘t’ and so on. You can also slice strings up using [from:to]
syntax like this
Note the following features of Python indices: the last number in the ‘from:to’
range is exclusive; if the ‘from’ or ‘to’ index is excluded, the beginning or end of
the string/list is assumed; a negative index for a string/list denotes the position
-n from the end of the string.
So now we know how to create DNA sequences as strings and how to iterate
over them, let’s introduce the Python dictionary. Dictionaries resemble in
some aspects the kind of list object that we already encountered in strings, but
instead of the items being labeled according to their numerical positions, they
can be labeled pretty much any old way we choose. For example …
mydictionary = {“galahad”:”pure”,”lancelot”:”brave”}
you get
‘brave’
and so on. Dictionaries are composed of ‘key:value’ pairs and the stored value
for each key can be accessed using the mydictionary[key] syntax. Dictionaries
can also be added to like this
mydictionary[“bedevere”] = “wise”
nucleotides = {‘a’:131.2,’t’:304.2,’c’:289.2,’g’:329.2}
Note that we used single quotes here. Python allows both single and double
quotes to be used interchangeably but the closing quote must be the same as
the opening quote. What this dictionary does in effect, is to translate the
symbol for the nucleotide into a molecular weight, for example
print nucleotides[‘t’]
304.2
When you run this code, you get the molecular weight for our little 4
nucleotide sequence
1053.8
Now we could also do all kinds of fancy stuff like adding the molecular weight
of a 5′ phosphate if one is present, or accounting for DNA adducts or
chemically modified bases, but you get the general idea.
Since we’re going to want to use the same molecular weight calculation on
different sequences, let’s create a Python function that takes a DNA sequence
as input and returns its molecular weight.
def calculateMolecularWeight(sequence):
molecularWeight = 0.0
for ch in sequence:
molecularWeight += nucleotides[ch]
return molecularWeight
Now that we have our function, we can calculate the molecular weight for any
DNA sequence that we give it as an input parameter, like this
mwt = calculateMolecularWeight(mysequence)
mwt = calculateMolecularWeight(“gatgctgtggataa”)
So now let’s look at adding the nal feature – the ability to detect restriction
sites in the sequence and calculate the molecular weights of all the DNA
fragments produced by a restriction digest.
bamH1 = “ggatcc”
sma1 = “cccggg”
bamH1 = [“ggatcc”,0]
sma1 = [“cccggg”,2]
print sma1[1]
Remember that Python lists are numbered from 0, so ‘sma1[1]’ is actually the
2nd item in the list. Now that we have our restriction sites, we need a way to
search for them in a DNA sequence. Fortunately there is a very handy ‘ nd’
method for Python strings that does exactly what we want to do. The ‘ nd’
method is a property of strings in Python and such a property can be accessed
using the dot notation like this
position = mysequence.find(“tag”)
position = mysequence.find(“tag”,172)
Then for example, if you nd the rst stop codon at position 172, you can
search again from that position to look for the next occurrence and so on. If no
position parameter is supplied to ‘ nd’ (as in the rst example), the search is
always done from the beginning of the string.
We already have our molecular weight function, so let’s add another function
for doing restriction digests of our sequences. This function will take a
sequence and a restriction site de nition as input and return a list of the
digested DNA fragments. Here it is …
The line ‘frags = []’ creates an empty list that we will use to store our DNA
fragments. The variable ‘last’ will be used to record the last place that we
found the restriction site de ned in ‘rs’. Initially, ‘last’ must obviously be set to
0 so that the search starts at the beginning of the sequence.
The Python ‘while’ command is another kind of iterative loop that works
differently from the ‘for’ loop that we have already encountered. The ‘while’
loop will continue to cycle for as long as the condition after ‘while’ is true. It is
easier to understand how the ‘while’ loop works by studying this example
x=0
while x < 10:
print x
x += 1
In our function then, the loop would seem to run forever since 1 is always true
and never gets changed. If you look in the indented body of the loop however,
you will see the ‘break’ command which exits the loop. The loop in our function
i s essentially con gured to run forever, until we encounter the situataion
where there are no more occurrences of the restriction site motif (in which
case sequence. nd() returns -1) and then we simply add the remainder of the
sequence to our list of fragments and exit the loop using the ‘break’ command.
Now we can nally put it all together to create a Python script that will
calculate the molelcular weights of the DNA fragments produced by a
restriction digest. You will notice that the ‘digestDNA’ function returns a list of
DNA sequences, so after we have run the function, we can use our iterative
‘for’ loop to go through the returned list of fragments one at a time and
calculate the molecular weight of each one, like this
fragmentList = digestDNA(s,sma1)
for fragment in fragmentList:
…
…
we just used the function itself directly where the variable would go. This is
perfectly OK to do in Python and in fact, it is often good form to do this to
make the code more concise and readable.
So let’s create a fake sequence with a couple of SmaI restriction sites in it and
test our code.
s = “atcgatcgatcgcccgggatcgatcgcccgggatcgatcgatcg”
for fragment in digestDNA(s,sma1):
print fragment
print calculateMolecularWeight(fragment)
If everything went well, running this code should yield the following output
atcgatcgatcgcc
3739.8
cgggatcgatcgcc
3962.8
cgggatcgatcgatcg
4438.2
One of the great things about Python is that it is a very popular language with a
large and ourishing community. This means that for most problem domains,
including the life sciences, somebody somewhere has probably already
developed a library of Python functions for your particular problem. As you
might have guessed, there already exist Python libraries for the kind of
bioinformatics problems that we have tackled here. Since the goal here was to
learn enough basic Python to be able to write some useful code, we did not rely
on any of them for our simple problem. Here are some links however, to give
you an idea of the kinds of life science libraries that are available in Python.
So now that you have hopefully seen enough to appreciate how easy it can be
to write useful code, we encourage you not to stop here. We will be publishing
future tutorials, but in the meantime, why not head on over and browse the
many fantastic references, tutorials and other resources for new Python users
that can be found at the documentation area of the Python web site.
If you really want to take your Python to the next level, and are interested in
learning enough Python to be able to really incorporate it into your work
and/or your research, check out our book Python For The Life Sciences,
scheduled for publication in the Summer/Fall of 2016.