1 s2.0 S1055790322001701 Main

Molecular Phylogenetics and Evolution 175 (2022) 107557
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev
Deconstructing Difflugia: The tangled evolution of lobose testate amoebae

shells (Amoebozoa: Arcellinida) illustrates the importance of convergent
evolution in protist phylogeny
Rubén González-Miguéns a, *, Milcho Todorov b, Quentin Blandenier c, Clément Duckert c,
Alfredo L. Porfirio-Sousa d, Giulia M. Ribeiro d, Diana Ramos a, Daniel J.G. Lahr d,
David Buckley e, f, Enrique Lara a, *
a
Real Jardín Botánico (RJB-CSIC), Plaza Murillo 2, 28014 Madrid, Spain
b
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Science, 1113 Sofia, Bulgaria
c
Laboratory of Soil Biodiversity, University of Neuchâtel, Emile-Argand 11, 2000 Neuchâtel, Switzerland
d
Department of Zoology, Institute of Biosciences, University of São Paulo, Brazil
e
Department of Biology (Genetics), Universidad Autónoma de Madrid, Spain
f
Centro de Investigación en Biodiversidad y Cambio Global (CIBC-UAM), Universidad Autónoma de Madrid, Spain
A R T I C L E I N F O A B S T R A C T
Keywords: Protists, the micro-eukaryotes that are neither plants, animals nor fungi build up the greatest part of eukaryotic
Arcellinida diversity on Earth. Yet, their evolutionary histories and patterns are still mostly ignored, and their complexity
Convergent evolution overlooked. Protists are often assumed to keep stable morphologies for long periods of time (morphological
Mitochondrial editing
stasis). In this work, we test this paradigm taking Arcellinida testate amoebae as a model. We build a taxon-rich
Phylomorphospace
phylogeny based on two mitochondrial (COI and NADH) and one nuclear (SSU) gene, and reconstruct
Tangled evolution
Testate amoeba morphological evolution among clades. In addition, we prove the existence of mitochondrial mRNA editing for
the COI gene. The trees show a lack of conservatism of shell outlines within the main clades, as well as a
widespread occurrence of morphological convergences between far-related taxa. Our results refute, therefore, a
widespread morphological stasis, which may be an artefact resulting from low taxon coverage. As a corollary, we
also revise the groups systematics, notably by emending the large and highly polyphyletic genus Difflugia. These
results lead, amongst others, to the erection of a new infraorder Cylindrothecina, as well as two new genera
Cylindrifflugia and Golemanskia.
1. Introduction leading to homoplastic evolution of similar morphological adaptations

in far-related organisms across the phylogenetic tree (Losos et al., 1998;
Dobzhansky’s famous sentence (Dobzhansky, 1973) “Nothing in Ruedi and Mayer, 2001). On the other hand, stabilizing selection may
Biology Makes Sense Except in the Light of Evolution” reflects the promote the conservation of a morphological phenotype for long periods
importance of understanding the evolutionary history of organisms to of evolutionary time (stasis) (Muñoz et al., 2014; Szudarek-Trepto et al.,
make inferences on their biology. These evolutionary patterns can be 2021). The effects of these evolutionary forces has been largely observed
inferred by unravelling the phylogenetic relationships between groups, in the field and experimentally tested in the laboratory, mostly on large
based on the comparative analysis of independent homologous charac organisms such as plants and animals (Blount et al., 2018). However,
ters (De Luca et al., 2019; Gorospe et al., 2020; Peters et al., 2017; Zumel most of eukaryotic diversity is of microscopic size and classified as
et al., 2021). Furthermore, the effect of selective pressures may lead to protists (Adl et al., 2019); for this reason, protists must imperatively be
predictable patterns along these phylogenies. For instance, positive se taken into account in any generalization patterns about the evolution of
lection may favour a particular trait in a specific environment, typically eukaryotic life.
Abbreviations: COI, Cytochrome Oxidase subunit I; NADH, nicotinamide adenine dinucleotide dehydrogenase; SSU, SSU rRNA gene.
* Corresponding authors.
E-mail addresses: [email protected] (R. González-Miguéns), [email protected] (E. Lara).
https://doi.org/10.1016/j.ympev.2022.107557
Received 23 March 2022; Received in revised form 25 May 2022; Accepted 31 May 2022
Available online 28 June 2022
1055-7903/© 2022 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
R. González-Miguéns et al. Molecular Phylogenetics and Evolution 175 (2022) 107557
One of the most conspicuous protist groups are Arcellinida, a group Soler-Zamora et al., 2021) and transcriptomic data (Lahr et al., 2019),
of Amoebozoa characterized by a self-constructed shell or test which show that the general shape of the shell seemed more in agreement with
shape, size and composition has been used to build up the systematic molecular results to construct the Arcellinida systematics.
classification of the group (Fig. 1); while shape and size were used for To trace the evolutionary patterns of Arcellinida, their general shell
species delimitation, shell composition was proposed as a criterion for shape was compared with the Neoproterozoic vase shaped microfossils
deep taxonomy. Species were classified into different infra-orders (Lahr et al., 2019), which are considered as the oldest fully reliable
depending on if their shell was organic or included mineral elements eukaryotic fossils (Porter and Knoll, 2000). These comparisons seemed
(Anderson, 1988; Meisterfeld, 2002). This initial attempt of systematic to confirm the hypothesis of phenotypic continuity between Precam
classification was proved inaccurate by molecular phylogenetics, as brian fossils and extant forms, which was formulated based on the
organisms with similar shell composition were shown to belong to striking resemblance between fossils and extant species (Lahr, 2021;
different evolutionary lineages (Lara et al., 2008). Phylogenies based on Porter et al., 2003). More recent fossils were also attributed to extant
single genes (Dumack et al., 2020, 2019; Gomaa et al., 2017, 2012; genera, species and even subspecies (Farooqui et al., 2014; Singh et al.,
Fig. 1. Scanning electron images of the different infraorders described in Glutinoconcha (Arcellinida). The white bars represent a scale of 50 μm for each species.
Bottom part of the figure: original drawings where Difflugia proteiformis and its allies are represented.
2
2015). These taxonomic assignations were based on the assumption that avoid confusions and errors in further nomenclature acts.
resembling organisms would be likely close related, allowing the Taxonomic identification of the cells collected were carried
description and systematic classification of new genera based solely on comparing with the original drawings, the atlas of testate amoebae in
shell morphology (Bobrov and Mazei, 2020; Nasser et al., 2021). From Bulgaria (Todorov and Bankov, 2019), the Sphaerothecina revision of
an evolutionary point of view, this implies that each lineage became González-Miguéns et al., (2021), Eugène Penard’s collection (accessible
stabilized through selection into a given morphology that lasted for online at https://commons.wikimedia.org/wiki/Commons:P%C3%A9n
hundreds of million years (=morphological stasis hypothesis) because of ard_project/taxon_without_categories, accessed 5 September 2021).
long lasting and constant selective pressure or morphological constraints Taxonomic and systematic decisions taken in this study were based
on the shell morphologies. on congruent phylogenetic signals between nuclear and mitochondrial
Alternatively, non-linear evolutionary patterns including conver molecular markers. We took nomenclature acts only when the three
gences and extinctions imply, among others, the intervention of positive molecular markers supported the monophyly of the clades; here, we
natural selection along with adaptive processes (tangled evolution hy chose not to focus on species level. The nomenclatural acts were taken
pothesis). The non-linear morphological diversification in Arcellinida based on the International Code of Zoological Nomenclature (ICZN,
has been recently proposed in family Arcellidae, where similar mor 1999) rules and recommendations, as they apply to Arcellinida (Lahr
photypes occur in similar habitats, although species are genetically et al., 2012).
relatively far related (González-Miguéns et al., 2021). Such patterns
suggest similar adaptations to similar environmental pressures, in other 2.2. Sampling and specimen preparation
words, convergent evolution as a product of positive natural selection
acting on shell diversification. Shell traits are well characterized, and Sampled substrates included soil, dry mosses, Sphagnum and fresh
have been show to correlate well with habitat types and ecosystem water sediments. We aimed at recovering the most common Arcellinida
conditions, thus suggesting an adaptive value of the shell (Fournier genera still lacking molecular data (Table 1). Testate amoebae were
et al., 2015; Marcisz et al., 2020). For instance, compressed shapes, concentrated by filtering the samples, transferring living cells to a petri
lateral apertures and smaller biovolumes are correlated with drier mi dish to be observed under inverted light microscopy. We used a Leica
crohabitats as found in the Galeripora arenaria species complex (Koenig DMI8 inverted microscope with up to 200 × magnification DIC for
et al., 2018). In another species complex, Hyalosphenia papilio, shell size observing specimens. We isolated only active cells showing pseudopodia
and pore numbers are correlated with moisture and climate (Mulot et al., mobility. Organisms were documented with a Leica MC170 HD camera
2017). using the software Leica application suite v.4.12.0 (Fig. S1 and S2). We
Nevertheless, drawing conclusions on the evolutionary history of used the software ImageJ v.1.52 (Schneider et al., 2012) to take mea
clades and characters can be perilous if the taxa included are insuffi surements from the shells directly from the images. These active cells
ciently sampled. In fact, more than half of all Arcellinida genera lack were isolated individually and washed several times with sterile water to
molecular information; furthermore, the infraorder Hyalospheniformes remove as much as possible other microorganisms associated with the
is overrepresented within barcoded genera (14/27 genera; Lahr et al., shells. We deposited then the specimens into Eppendorf tubes, in order
2019). Among all genera, Difflugia is particularly species rich and has to proceed to single cell DNA extraction and amplification, following
been largely undersampled. Indeed, there are over 300 species described different procedures: 1) 100 μL of guanidine thiocyanate buffer
(Mazei and Warren, 2012). These species were grouped only based on (Chomczynski and Sacchi, 1987) for total DNA extraction (to amplify
their agglutinated shell and the lack of other remarkable traits. An several genes from the same cell), 2) 10 μL sterile water, for direct DNA
investigation of the diversity of genus Difflugia together with other amplification without extraction (to amplify only a single gene from
agglutinating genera should be instrumental in stabilizing the phylog single cell), and 3) 2.3 μL cell lysis mix, following the procedure of Lahr
eny of the Arcellinida as a whole (Gomaa et al., 2017) and establishing et al. (2019) (for RNA extraction from an active specimen of Difflugia cf.
the background of its evolutionary history. acuminata). Scanning electron microscope images were taken from
In this work, we aim at inferring patterns of deep evolution in Todorov & Bankov (2019). Sample preparation followed the procedure
Arcellinida, and more concretely testing how widespread instances of described in González-Miguéns et al. (2021). These experimental pro
homoplastic shells are (“tangled evolution hypothesis”) versus the cedures are described in detail in the next paragraph.
“morphological stasis hypothesis”. In that purpose, we focus on genus
Difflugia and other agglutinating genera using the nuclear SSU rRNA 2.3. DNA extraction, amplification, and sequencing
(SSU), backed with the mitochondrial markers cytochrome oxidase (COI)
and nicotinamide adenine dinucleotide dehydrogenase (NADH), and Total DNA from of isolated cells conserved in guanidine thiocyanate
expanding the taxon sampling to genera that have never been molecu buffer (1) was extracted following the procedure described in (Duckert
larly characterized. Also, we investigated how conserved shell mor et al., 2018). This protocol includes an isopropanol precipitation for 12 h
phologies remain stable through evolutionary times within deep at 4 ◦ C, followed by de-salting steps using 70% and 96% ethanol solu
lineages (infaorders) by computing the phylo-morphospaces and tions. Pelleted DNA was resuspended into 20 μL of sterile water and
phylogenetic signals of the different infraorders classified as Difflugia. stored at 4 ◦ C prior to downstream applications. Amplifications by po
Based on the obtained phylogenetic reconstructions, we tested the lymerase chain reaction (PCR) were performed in the following mix: 6
importance of partial taxon sampling on ancestral state reconstructions μL of distilled water, 12 μL MyTaq Red DNA polymerase Mix (BioLine),
of habitat and shell composition. 1 μL of each primer (10 μmol) and 3 μL of DNA template, resulting in a
final reaction volume of 23 μL. We then aimed at amplifying three
2. Materials and methods marker genes per DNA extraction whenever possible (Table S1): (1)
cytochrome oxydase COI (COI) using the universal primer pair LCO 1490
2.1. Bibliographic search and taxonomic decisions (5′ GGTCAACAAATCATAAAGATATTGG 3′ ) and HCO 2198 (5′
TAAACTTCAGGGTGACCAAAAAATCA 3′ ) (Folmer et al., 1994), using
We collected the original references for all Arcellinida genera the following PCR cycling profile: initial denaturation at 96 ◦ C for 5 min,
compiled from Lahr et al. (2019) (see taxonomic actions), gathering all then 40 cycles at 94 ◦ C for 15 s, 40 ◦ C for 15 s and 72 ◦ C for 90 s, finished
the references to facilitate further search into Arcellinida systematics. with a final extension step at 72 ◦ C for 10 min; (2) nicotinamide adenine
Also, we added all the genera names not included as well as the newly dinucleotide dehydrogenase (NADH) using the primers NAD9 386F (5′
described ones in the official registry of zoological nomenclature public TGGTTAGAACGAGAAGTTTGGGATATGT 3′ ) and NAD7 67R (5′
database “zoobank” (https://zoobank.org/), providing the names to GTGCGCAGCAGGRTGTTGWGGWCC 3′ ) developed by (Blandenier
3
Table 1
Sequenced organism in this study, with information of the locality and habitat.
Species locality coordinates Habitat GenBank GenBank GenBank
COI NADH SSU
Suborder Glutinoconcha
Infraorder Sphaerothecina
Family Arcellidae
Arcella conica Bulgaria: Sofia, Sofia Southern Park 42◦ 39′ N 23◦ 18′ E Freshwater: submerged – OL549119 OL677467
vegetation
Family Netzeliidae
Netzelia lithophila Spain: Madrid, Hoyo de Manzanares 40◦ 35′ N 4◦ 55′ W Freshwater: submerged OL549143 – –
vegetation
Infraorder Cylindrothecina
Family Cylindrifflugidae
Cylindrifflugia acuminata Spain: Madrid, Parla 40◦ 14′ N, 3◦ 46′ Freshwater: submerged OL549144 – –
W vegetation
W vegetation
W vegetation
Cylindrifflugia acuminata Spain: Madrid, Parla 40◦ 14′ N, 3◦ 46′ Freshwater: submerged OL549124 – OL677466
(mRNA) W vegetation
Cylindrifflugia acuminata Bulgaria: Rhodopes Mountains 41◦ 44′ N, 24◦ 08′ Freshwater: Sphagnum OL549149 – –
E subsecundum
Cylindrifflugia elegans Spain: Madrid, Hoyo de Manzanares 40◦ 35′ N 4◦ 55′ W Freshwater: submerged OL549138 – –
vegetation
Cylindrifflugia elegans Spain: Madrid, Hoyo de Manzanares 40 35 N 4 55 W
◦ ′ ◦ ′
Freshwater: submerged OL549137 – –
vegetation
Cylindrifflugia elegans Spain: Madrid, Hoyo de Manzanares 40◦ 35′ N 4◦ 55′ W Freshwater: submerged OL549136 – –
vegetation
Cylindrifflugia lanceolata Bulgaria: Rhodopes Mountains 41◦ 44′ N, 24◦ 08′ Freshwater: Sphagnum OL549150 – –
E
Cylindrifflugia lanceolata Bulgaria: Rhodopes Mountains 41◦ 44′ N, 24 08 ◦ ′
Freshwater: Sphagnum teres – – OL677469
E
Cylindrifflugia lanceolata Bulgaria: Rhodopes Mountains 41◦ 44′ N, 24◦ 08′ Freshwater: Sphagnum teres – – OL677470
E
Cylindrifflugia lanceolata Bulgaria: Rhodopes Mountains 41◦ 44′ N, 24◦ 08′ Freshwater: Sphagnum teres – – OL677471
E
Infraorder Excentrostoma
Family Centropyxidae
Awerintzewia sp. Spain: Pontevedra, Catoira 42◦ 41′ N, 8◦ 43′ Terrestrial: wet mosses near the OL549135 – –
W sea
Bullinularia gracilis Bulgaria: Stara Planina Mountain, 42◦ 53′ N, 23◦ 10′ Terrestrial: Rock mosses OL549122 – –
Ljulyaka hut E
Bullinularia gracilis Bulgaria: Stara Planina Mountain, 42◦ 53′ N, 23◦ 10′ Terrestrial: Rock mosses OL549123 – –
Ljulyaka hut E
Centropyxis aculeata Spain: Madrid, Aldea del Fresno 40◦ 19′ N 4◦ 12′ W Freshwater: submerged OL549142 – –
vegetation
Centropyxis aerophila Spain: Madrid, San Lorenzo de El 40◦ 34′ N 4◦ 09′ W Terrestrial: granite, wet moss – – OL677465
Escorial
Golemanskia viscidula Bulgaria: Rhodopes Mountains 41◦ 44′ N, 24◦ 08′ Freshwater: Sphagnum teres OL549127 OL549114 OL677472
E
Golemanskia viscidula Bulgaria: Rhodopes Mountains 41◦ 44′ N, 24◦ 08′ Freshwater: Sphagnum teres OL549128 OL549113 OL677473
E
Plagiopyxis callida Bulgaria: Rila Mountains 42◦ 14′ N, 23◦ 28′ Terrestrial: above “Mechit” Hut OL549126 – –
E Picea abies
Infraorder Longithecina
Family Difflugiidae
Difflugia bryophila Spain: Madrid, Navacerrada 40◦ 46′ N, 4◦ 00′ Freshwater: submerged OL549140 – –
W vegetation in a spring
Difflugia bryophila Spain: Madrid, Navacerrada 40◦ 46′ N, 4◦ 00′ Freshwater: submerged OL549141 – –
W vegetation in a spring
Difflugia oblonga Bulgaria: Rhodopes Mountains 41◦ 44′ N, 24◦ 08′ Freshwater: Sphagnum teres OL549147 OL549117 –
E
Difflugia oblonga Bulgaria: Rhodopes Mountains 41◦ 44′ N, 24◦ 08′ Freshwater: Sphagnum teres OL549148 OL549118 –
E
Difflugia nodosa Bulgaria: Sofia, Sofia Southern Park 42◦ 39′ N 23◦ 18′ E Freshwater: submerged – OL549115 –
vegetation
Difflugia pyriformis Bulgaria: Sofia, Sofia Southern Park 42 39 N 23 18 E
◦ ′ ◦ ′
Freshwater: submerged OL549151 OL549116 –
vegetation
Difflugia pyriformis Bulgaria: Sofia, Sofia Southern Park 42◦ 39′ N 23◦ 18′ E Freshwater: submerged – OL549120 –
vegetation
Difflugia pyriformis Bulgaria: Sofia, Sofia Southern Park 42◦ 39′ N 23◦ 18′ E Freshwater: submerged – OL549121 –
vegetation
Zivkovicia compressa Bulgaria: Rhodopes Mountains 42 39 N 23 18 E
◦ ′ ◦ ′
vegetation
Zivkovicia sp. Spain: Madrid, Hoyo de Manzanares 40◦ 35′ N 4◦ 55′ W Freshwater: submerged OL549139 – –
vegetation
(continued on next page)
4
Table 1 (continued )
Species locality coordinates Habitat GenBank GenBank GenBank
COI NADH SSU
vegetation
vegetation
Zivkovicia sp. Spain: Madrid, Hoyo de Manzanares 40 35 N 4 55 W
◦ ′ ◦ ′
vegetation
vegetation
vegetation
Incertae sedis
Trigonopyxis arcula Bulgaria: Rila Mountains, Vada hut 42◦ 13′ N, 23◦ 20′ Terrestrial: Soil from a spruce OL549125 OL549111 –
E forest
Trigonopyxis arcula Bulgaria: Rila Mountains, Vada hut 42◦ 13′ N, 23◦ 20′ Terrestrial: Soil from a spruce – OL549110 –
E forest
Trigonopyxis arcula Bulgaria: Rila Mountains, Vada hut 42◦ 13′ N, 23◦ 20′ Terrestrial: Soil from a spruce – OL549112 –
E forest
et al., 2017), using the following PCR cycling profile: initial denatur 2014) with the following PCR profile: 1 cycle 50 ◦ C during 90 min
ation at 94 ◦ C for 3 min, then 38 cycles at 94 ◦ C for 30 s, 61 ◦ C for 30 s (switching between the reverse transcriptase and template), then 10
and 72 ◦ C for 60 s, finished with a final extension step at 72 ◦ C for 10 cycles at 55 ◦ C for 2 min (unfolding of RNA secondary structures) and
min; and (3) SSU rRNA (SSU) using the universal eukaryotic primers 50 ◦ C for 2 min (completion and continuation of switching between
EK555F (5′ AGTCTGGTGCCAGCAGCCGC 3′ ) and EK1498R (5′ CACC reverse transcriptase and template), finished with 1 cycle at 70 ◦ C during
TACGGAAACCTTGTTA 3′ ) with the following PCR cycling profile: 15 min (enzyme inactivation). Finally, we synthesized complementary
initial denaturation at 96 ◦ C for 5 min, then 40 cycles at 94 ◦ C for 30 s, DNA (cDNA) using KAPA HiFi HotStart ReadyMix (Roche) and IS PCR
58 ◦ C for 30 s and 72 ◦ C for 90 s, finished with a final extension step at primers (10 µM) with the following PCR profile: 1 cycle 98 ◦ C during 3
72 ◦ C for 10 min. min, then 20 cycles at 98 ◦ C for 20 s, 67 ◦ C for 15 s and 72 ◦ C for 6 min,
For the cells deposited in 10 μL sterile water (2), direct PCR was finished with 1 cycle at 72 ◦ C for 10 min. PCR products were stored at
performed, adding 8 μL of Phire Green Hot Start II PCR Master Mix − 80 ◦ C. We used a Qubit 3 Fluorometer with dsDNA high sensitivity
(ThermoFisher) and 1 μL of each primer (10 μmol), using only one single (HS) assay kits (ThermoFisher) for cDNA quantification.
cell in each PCR. As the cells were sequenced directly, without any prior We sequenced the obtained cDNA with the protocol developed by
DNA extraction, only one gene was sequenced in this case. We used the Oxford Nanopore Technologies (ONT) and prepared the library
universal primer described by (Folmer et al., 1994) to amplify the COI, following the protocol Direct RNA sequencing (SQK-RNA002). Resulting
with the following PCR cycling profile: initial denaturation at 98 ◦ C for Nanopore libraries were sequenced using a MinION Mk1b with a R9.4.1
5 min, then 40 cycles at 98 ◦ C for 5 s, 40 ◦ C for 5 s and 72 ◦ C for 30 s, flow cell left running for 19 h. Data were generated using the software
finished with a final extension step at 72 ◦ C for 10 min. MinKNOW UI 4.2.8 and basecalled with Guppy 4.5.2. The output was
All the PCR products were checked by electrophoresis on a 1% checked in real time with MinKNOW UI 4.2.8 and plotted using the R
agarose gel using 3 μL of the reaction to confirm fragment size and check package NanoR (Bolognini et al., 2019) (Fig. S3).
for contaminations. Electrophoresis bands with an expected size were
cut from the gel and stored at 4 ◦ C. These bands were sequenced with
2.5. Data preparation and phylogenetic analyses
Sanger dideoxy-technology, in both directions, by the company Mac
rogen Inc. (Macrogen Europe, Madrid, Spain). The resulting sequences
COI, NADH and SSU sequences were aligned using the MAFFT
were checked and assembling both directions with the software Gene
(Katoh et al., 2002) auto algorithm as implemented in Geneious Prime.
ious Prime (v.2019.0.4). To ensure that our sequences were the closest
After the removal of primers and unalignable regions, we obtained
related to Arcellinida we performed blastn analysis (Altschul et al.,
alignments of, respectively 643 (COI), 263 (NADH) and 1426 (SSU) bp.
1990) against the GenBank and our databases.
The number of taxa and detailed information are in Table S1. Tree to
pologies and node supports were evaluated with Bayesian inferences
2.4. Single cell RNA extraction and sequencing (BI), with the following procedure:
First, we checked the best substitution model and among-site rate
Mitochondrial mRNA editing has been identified in several eukary variation using “ModelFinder” (Kalyaanamoorthy et al., 2017), imple
otes (Bondarenko et al., 2019; Yang et al., 2017), usually consisting in mented in IQ-TREE ver. 2.0 (Nguyen et al., 2015), under the Bayesian
indels that change the reading frame, and suspected in Arcellinida information criterion (BIC), for each gene (COI, NADH and SSU). In all
(Kosakyan et al., 2012). This editing might, potentially, influence three genes, we employed the among-site rate variations with an esti
phylogenetic analyses. To test this, we compared the mRNA and DNA mated proportion of invariable sites and a gamma shaped distribution of
sequences for the COI gene (see “Data preparation and phylogenetic variable sites (I + G). Then, to perform the Bayesian inference (BI) an
analyses”). For RNA extraction and amplification, we followed the alyses, we used MrBayes 3.2.7a (Ronquist et al., 2012), implementing
protocol described in Lahr et al. (2019), modified from Picelli et al. two independent runs, with four chains for each run and 20* 106 gen
(2014). First, we placed a single Difflugia cf. acuminata cell in a cell lysis erations for the Markov chain Monte Carlo (MCMC) setting; trees were
mix which contained Rnase-Inhibitors, 0.2%-TritonX-100 and Diethyl sampled every 1000 generations. Substitution models were selected
pyrocarbonate (DEPC) H2O. Then, we performed a thermal shock by with the reversible-jump MCMC method (Huelsenbeck et al., 2004).
alternating cycles with Liquid nitrogen and warm water. We performed Finally, we discard 25% if the sampled trees, and evaluated the
a reverse transcriptase PCR using SuperScript™ IV Reverse Transcrip convergence of the different runs with TRACER v.1.7.1, with all the
tase (ThermoFisher) and LNA using the enhanced oligonucleotide TSO effective sample sizes (ESSs) values over 200. The resulting trees for
(5’AAGCAGTGGTATCAACGCAGAGTACATrGrG + G 3’) (Picelli et al. each gene were summarized in a 50% majority rule consensus tree.
5
For quality control and taxonomic assignation of ONT reads, we used species not included in the hypervolume, in which only a single char
the cloud based What’s In My Pot? WIMP via EPI2ME (v 3.2.1), with a acter has been measured, we take the morphological data from the
quality average of 9.37 (Fig. S4). We first discarded human and bacterial original description; in the case of the species Difflugia acuminata and
reads. We used two approaches in order to gather all transcriptomic D. lanceolata which seem to represent species complexes rather than
information related to Difflugia cf. acuminata (1) we aligned our obtained single species, we inferred values directly from the barcoded in
nanopore FASTQ sequences with the database generated Lahr et al. dividuals. Then we reconstruct the ancestral states along the morpho
(2019) using the software MinKNOW UI 4.2.8, to find homologous genes space (Sidlauskas, 2008), determined by the three PC (Table S2), using
that can be used in the phylogenetic analysis, and (2) we follow the the function “phylomorphospace” in the R package phytools (Revell,
pipeline of isONcorrect (Sahlin et al., 2021); first we use pychopper v2 to 2012). Finally, using the same phylogenetic and morphological data as
orient and trim the reads (https://github. for phylomorphospaces (Table S2), we measured the strength of the
com/nanoporetech/pychopper, RRID:SCR_018966). Then we clustered phylogenetic signal (Blomberg and Garland, 2002) using the package
the reads using isONclust (Sahlin and Medvedev, 2020), and finally we “phylosignal” (Keck et al., 2016). First, we created three databases: (1)
corrected the errors using isONcorrect (Sahlin et al., 2021) merging the morphological data of the PC1, which explain the majority of the total
reads, which were compared with the data from Lahr et al. (2019) with variation of the morphological data, (2) data generated under Brownian
blastx in BLAST+ (Altschul et al., 1997; Camacho et al., 2009). Outputs motion model with the function “rTraitCont” of the package Ape ver. 5.2
of both procedures were processed in Geneious Prime (v.2019.0.4). We (Paradis and Schliep, 2019) and (3) random data. Then, we compute
obtained 192 COI and 258,889 SSU good quality reads, respectively, Local Indicators of Phylogenetic Association (LIPA), a local Moran’s I
which were assembled using MinKNOW UI 4.2.8. (Anselin, 1995), for each species to detect hotspots of autocorrelation in
To characterize the mitochondrial editing in Arcellinida, we each PC of the “phylomorphospace”.
compared COI mitochondrial DNA and cDNA (from mRNA) sequences as
obtained with our transcriptome of Difflugia cf. acuminata. The com 2.7. Ancestral state reconstruction
parisons were performed in the software Geneious Prime (ver. 019.0.4),
aligning the sequences using the MAFFT auto algorithm (Katoh et al., To test the effect of taxon sampling on inferences on Arcellinda
2002), and translating the sequences into amino acids to compare the evolutionary patterns, we performed ancestral state reconstruction
reading frames between the sequences. We also performed this com (ASR) with two phylogenetic trees: (1) including all the Arcellinida se
parison between native DNA sequence and cDNA on the SSU gene in quences (Fig. 7, nodes in green squares) and (2) removing the species
order to formally confirm the presence of introns in ribosomal sequences considered as incertae sedis (Argynnia dentistoma and Physochila griseola)
(Lara et al.,2008; Gomaa et al., 2012), based on the published sequence from the last dataset (Fig. 7, nodes in red squares). We based our
JQ366064. We tested for saturation in all datasets by plotting the raw or ancestral state reconstruction on the SSU tree, as this marker is the one
uncorrected pairwise genetic distances in an alignment against model- that includes most molecular data on Arcellinida. Another reason for
corrected genetic distances, using the R package “ape” (ver. 5.5) choosing this marker is that the latest SSU tree (Soler-Zamora et al.,
(Paradis and Schliep, 2019) as in Philippe et al. (1994) and 2021) is congruent with the latest phylotranscriptomic tree (Lahr et al.,
(https://www.kmeverson.org/blog/simple-dna-saturation-plots-in-r), 2019).
taking this as an exploratory analysis. First, we removed outgroups with the function “drop.tip” in R
package ape. Then, we constructed two databases, for the two phylo
2.6. Morphometric analyses (Hyper-phylomorphospace) and phylogenetic genetic trees, to infer 1) ancestral habitats, considering only aquatic and
signal terrestrial environments, considering as aquatic (“freshwater”) habitats
with permanent high humidity (such as Sphagnum) or submerged and
To test whether the morphological diversification is consistent with terrestrial (“soil”) habitats with varying humidity (dry mosses e.g.
molecular diversification within Difflugia (“mineral agglutinated”), we Grimmia, forest litter) and 2) ancestral shell composition, considering
followed the procedure described in (González-Miguéns et al., 2022). “organic” organisms that form a proteinaceous shell (such as Galeripora),
First, we pruned the SSU tree leaving only the species historically clas “self-secreted” organism that construct an agglutinated shell with self-
sified as Difflugia (Difflugia, Netzelia and Phryganella), with the function secreted mineral elements (like Lesquereusia), “prey agglutinated”
“drop.tip” (Fig. 6a), using the package Ape ver. 5.5 (Paradis and Schliep, (kleptosquamic) organisms that take the inorganic plates from the preys
2019). We retrieved morphological data of each organism from the (as Nebela) and “mineral agglutinated”, organism that construct the shell
original articles where SSU sequences were obtained, as well as in agglutinating mineral particles acquired from the environment (as Dif
Todorov & Bankov (2019). Our recompiled morphological database flugia). The ancestral habitat and shell composition assignation may be
contains then five continuous traits: (1) shell width, (2) shell length, (3) subjective, as the same species can inhabit several environments or
aperture width on the largest axis (4) shell length/aperture width ratio construct shells with different components in function to the materials
and (5) shell length/shell width ratio. We obtained data for a total of 309 present in the environment. Therefore, we selected the characters based
cells (available in supplementary material). on habitat and shell composition based on the original article from
We performed an exploratory Principal Components Analysis (PCA), which sequences derive. To perform the ASR we used the software
using the R package stats and plotting the results with the R package “MrBayes Ancestral States with R” (MBASR) (Heritage, 2021), using
ggplot2 (Wickham, 2016) (Fig. 6b). We used the R package factoextra 50,000 generations (500 samples), that used the native continuous-time
ver. 1.0.7 (Kassambara and Mundt, 2020) to evaluate the contribution of Markov modelling implemented in MrBayes ver. 3.2 (Ronquist et al.,
each morphological variable measured in the analysis (Fig. S5). 2012) to provide the likelihood for the discrete character states
To visualize the morphospace of the continuous characters described described above at ancestral tree nodes.
above, we performed a hypervolume analysis. First, we computed a PCA
using only data from Todorov & Bankov (2019), which contain the full 3. Results
set of characters for each species. We excluded from the analysis all
species where only one single character was measured. Then, using the 3.1. Phylogenetic results
first three principal components (PC) obtained in the PCA, we computed
hypervolumes using the R packaged hypervolume ver. 2.0.12 (Blonder We used 63 sequences to build the mitochondrial cytochrome oxidase
et al., 2014), with a quantile threshold of 0.05 (Fig. 6c). We then subunit I (COI) tree, which includes 4 sequences of Tubulinea as out
computed phylomorphospaces using the centroids generated in the groups (Fig. 2; Table 1 and S1). Our phylogenetic analyses recovered the
hypervolume of each specie in the pruned SSU tree (Fig. 6a). For those monophyly of Arcellinida with a Bayesian posterior probability (PP) of
6
1, and the monophyly of the different infraorders characterized in Lahr into the family Plagiopyxidae. Zivkovicia compressa and an unidentified
et al. (2019): Sphaerothecina (blue color in Fig. 2, PP = 0.99), Excen member from the same genus branch together within Longithecina I;
trostoma (yellow color in Fig. 2, PP = 0.89), and Hyalospheniformes this genus had not been formerly placed within a known infraorder. The
(green color in Fig. 2, PP = 1). Like in previous phylogenies of the species Difflugia viscidula branches also within Excentrostoma, an un
Arcellinida, Longithecina appears paraphyletic (Gomaa et al., 2017; expected result given the terminal position of the aperture. Likewise, an
Macumber et al., 2020); it contains the two directly unrelated groups unidentified species from genus Awerintzewia branches also robustly
Longithecina I (red color in Fig. 2, PP = 0.99) and Longithecina II (pink within Excentrostoma; genus Awerintzewia was formerly considered as
color in Fig. 2, PP = 0.60). Genus Trigonopyxis did not appear unam incertae sedis (Lahr et al., 2019).
biguously related to any surveyed infraorder and still needs to be We used 29 sequences for the mitochondrial nicotinamide adenine
considered incertae sedis. The relationships between these infraorders dinucleotide dehydrogenase (NADH), including 27 Arcellinida and 2
differ with respect to the phylotransciptomic tree of Lahr et al. (2019), Centramoebida species as outgroups (Fig. 3; Table 1 and S1). Our
which can be explained in part by the saturation level reached by COI phylogenetic analyses recovered the monophyly of Arcellinida with a
when resolving the deepest nodes (Fig. 5). This is reflected by the low PP Bayesian posterior probability (PP) of 0.99. We also obtained the
values that support basal nodes as well as some infra-orders (Longi monophyly of Sphaerothecina (blue colour in Fig. 3, PP = 0.98); here
thecina II, Excentrostoma). Higher PP values are nevertheless obtained again, Longithecina I (red colour in Fig. 3, PP = 0.99) and Longithecina
within infraorders, and morphologically close-related species are well II (pink colour in Fig. 3, PP = 0.1) appear as separated groups, giving
differentiated. Plagiopyxis callida and Bullinularia gracilis do not form a further support to the paraphyly of Longithecina. Here also, there is no
monophyletic clade, even though they have a similar aperture hidden good support for any close relationship between Trigonopyxis and other
behind a “visor” (cryptostomy) which placed them together formally infra-orders and remain as incertae sedis; Difflugia viscidula is not related
Fig. 2. Bayesian phylogenetic tree based on COI sequences of the suborder Glutinoconcha (Arcellinida). Posterior probability values are represented at each node.
The colours represent the different infraorders in Glutinoconcha. The images of the right are scanning electron microscopy photographs showing typical shell
morphologies for each infraorder.
7
Fig. 3. Bayesian phylogenetic tree based on NADH sequences of the suborder Glutinoconcha (Arcellinida). The colours represent the different infraorders in Glu
tinoconcha. The images of the right are scanning electron microscopy photographs showing typical shell morphologies for each infraorder and an illustration of a
typical habitat.
neither to Longithecina I or II, nor to Sphaerothecina. Like in COI, NADH mitochondrial editing (Fig. 5a). Indeed, it presents deletions or in
seems to reach saturation in deep nodes, which results in a lack of sertions of single nucleotides which influence the reading frame in the
support at the base of the tree. messenger RNA, reminding patterns observed in deep-branching Het
The SSU rRNA (SSU) tree was performed with a total of 59 sequences, erolobosea (Discoba) (Yang et al., 2017). Thus, Arcellinida mitochon
including 4 outgroup sequences (Tubulinea) and 55 Arcellinida (Fig. 4; drial DNA sequences cannot be translated into proteins as such without
Table 1 and S1). Our phylogenetic analyses recovered the monophyly of knowing the correct reading frame. Within COI, these deletions only
Arcellinida (PP = 1). In average, infraorders were better supported than affect a few nucleotides (three in Fig. 5a), which still allow comparisons
with the two former molecular markers; Sphaerothecina (blue colour in between native mitochondrial sequences; it is still a good marker for
Fig. 4), Hyalospheniformes (green colour in Fig. 4) and Volnustoma Arcellinida systematics. Likewise, regions of the nuclear gene SSU are
(Turquoise colour in Fig. 4) obtained total support (PP = 1); Excen found in native sequences and not in the cDNA; we conclude that these
trostoma (yellow colour in Fig. 4) received a low support (PP = 0.72). regions are introns (Fig. 5b). These regions are best discarded from
Deeper nodes were better supported than with mitochondrial markers. phylogenetic analyses, as the homology between sequences needs stills
For instance, the relationship between Sphaerothecina and Longithecina to be characterized.
I (PP = 1), or the suborder supports like for Glutinoconcha (PP = 0.72), The saturation plots reach a plateau first for NADH, then for COI
Organoconcha (PP = 0.92) and Phryganellina (PP = 1), were recovered (Fig. 5c); the SSU, in turn, does not stabilize totally. This suggests that
with similar support than in the transcriptomic analyses (Lahr et al., the phylogenetic information is less saturated than for the mitochondrial
2019). Here again, Longithecina is divided between Longithecina I (red markers, even though all Arcellinida suborders are covered with SSU.
colour in Fig. 4, PP = 0.98), Longithecina II (pink colour in Fig. 4, PP =
1) and its paraphyly is supported. Single sequences of Argynnia and
Physochila are not clearly related to any infraorder and remain as incertae 3.2. Morphometrics and Hyper-PhyloSignalMorphospace
sedis. Here again, Difflugia viscidula is robustly rooted within Excen
trostoma, thus confirming its position as inferred with mitochondrial We used 17 species barcoded with SSU (Fig. 7a) to create the mor
data. The species Difflugia lanceolata and D. acuminata appear para phogroups which include the full set of measurements for each organ
phyletic, which reveals the existence of a hidden diversity also within ism. These organisms originally classified as Difflugia are currently
these groups. divided in 5 groups: suborder Glutinoconcha, including Sphaerothecina,
The comparison between the native and cDNA COI sequences of Excentrostoma, Longithecina I and II (blue, yellow, red and pink colour,
Difflugia acuminata (Longithecina II) shows a characteristic pattern of respectively in Fig. 6) and suborder Phryganellina (black colour in
Fig. 6).
8
Fig. 4. Bayesian phylogenetic tree based on SSU sequences of the order Arcellinida. Posterior probability values are represented at each node. The colours represent
the different suborders and infraorders in Glutinoconcha. The circles in the nodes represents the most recent common ancestor for each suborder. The images of the
right are scanning electron microscopy photographs showing typical shell morphologies for each infraorder of Glutinoconcha and the suborder Phryganellina.
The first two axes in the Principal Component Analysis (PCA) explain existence of complexes of (pseudo)cryptic species.
98.5% (PC1 = 87.4%; PC2 = 11.1%) of the morphological variables The principal component 1 does not show phylogenetic signal K =
(Fig. 6b). The variables with the highest contributions are length and the 0.4537697 (P-value = 0.105 Table S5), K = 0.5329809 under Brownian
width of the shell (Fig. S5). The PCA and the “Hyper-phylomorpho Motion (P-value = 0.062). The clade of P. hemisphaerica and P. acropodia
space” do not show a clear morphological pattern in the different higher shows autocorrelation with positive values in local Moran’s I; species
taxonomic groups. For instance, Longithecina I and Longithecina II show like D. viscidula and D. alhadiqa shows the opposite pattern with negative
some degree of overlap, sharing thus the same morphospace (Fig. 6b and values.
c) (Table S3). Sphaerothecina has its own morphospace not shared with
other taxonomic groups. Some morphologically defined species (Dif
flugia acuminata, D. lanceolata) do not appear monophyletic in the 3.3. Ancestral state reconstruction (ASR)
phylogeny and cover large morphospaces (Fig. 6), which suggests the
The ancestral state reconstructions of the habitat reveal the
9
Fig. 5. (A) comparison between cDNA and mRNA sequences of COI gene in Cylindrifflugia cf. acuminata, showing mitochondrial editing. The nucleotides in a red
square are present in the native mitochondrial sequence but are removed by editing, changing the reading frame. (B) comparison between cDNA and mRNA of SSU
gene in close related C. acuminata showing the presence of introns and secondary structures. (C) comparison of Bayesian trees of COI, NADH and SSU genes
respectively. Colours represent the different infraorders of Glutinoconcha. (D) Saturation plot between COI, NADH and SSU genes. (For interpretation of the ref
erences to color in this figure legend, the reader is referred to the web version of this article.)
Fig. 6. (A) Bayesian phylogenetic tree based on SSU gene, pruned leaving one tip per species considered Difflugia; branch colours represent the infraorder and the
symbols the different morphospecies. (B) Principal component analysis (PCA). (C) “Hyper-PhylosingalMorphospace” of the phylogeny (A); lines represent the Kernel
density of the random points generated in the hypervolume and colour squares represents the Local Morn’s Index for each PC.
10
Fig. 7. Ancestral state reconstruction of habitat and shell construction over the SSU tree. The nodes inside red squares represent probabilities without Argynnia
dentistoma and Physochila griseola (incertae sedis); and the green squares represent the probability considering these group. (For interpretation of the references to
color in this figure legend, the reader is referred to the web version of this article.)
considerable influence of taxon sampling on the reconstructions. The (Fig. 7). The ancestor of suborder Glutinoconcha seems to have had a
incorporation of the incertae sedis taxa Argynnia and Physochila showed mineral agglutinated shell. The infraorders in Glutinoconcha shows
the character state soil as the most likely habitat for the common clear patterns: the ancestors of, respectively, Sphaerothecina, Longi
ancestor of Arcellinida (Fig. 7). In turn, if these species are not consid thecina I, Longithecina II and Excentrostoma had a mineral agglutinated
ered, then the most probable habitat becomes “freshwater”. The origin shell. Hyalospheniformes and Volnustoma ancestors had most probably
of the whole order Arcellinida is, therefore, still unclear. Nevertheless, an ancestor with a xenosomic agglutinated shell. The Arcellidae organic
some preliminary patterns can be guessed from the best sampled fam shell construction seems therefore to be a derived character which
ilies and infraorders; the ancestors of the infraorders Sphaerothecina, appeared within a group with mineral agglutinated shells. Despite the
Longithecina I and II (blue, red and pink, respectively in Fig. 7) lived apparent consistency of the results, more data are still necessary to
most probably in aquatic environments; the ancestors of the infraorders obtain a clear and complete picture of the evolutionary patterns in
Hyalospheniformes and Volnustoma (green and turquoise colour Arcellinida.
respectively in Fig. 7) were probably terrestrial. Given the sensitivity of A visible pattern that emerges from all analyses is a correlation be
the results of ASR to taxon addition/removal, and the fact that over 1300 tween habitat and shell type. The mineral agglutinated shells appear
species have been described overall in Arcellinida, these results must be related to aquatic habitats, with independent transitions to the soil
taken nevertheless with caution. environment (Fig. 7). Xenosomic shells are correlated principally with
The shell construction ASR shows constant results with or without terrestrial environment. Organic shells seem to be less specialized and
the incertae sedis genera Argynnia and Physochila, supporting the idea can be found in aquatic and terrestrial environments.
that the last common ancestor of all Arcellinida had an organic shell
11
4. Discussion increase the support for this node. Likewise, suborder Organoconcha
receives a moderate support with SSU (PP = 0.92), resulting from the
4.1. More genes and more species to de(re)construct the systematics of highly diverging branch lengths encountered; further organism sam
Arcellinida pling will likely reduce long branch attraction and increase node sup
port, even if only a few more species are added (Wiens, 2005).
The search for neutral, homologous characters is a prerequisite for Our ancestral state reconstructions illustrate the important influence
building phylogenies on which systematics can be based. Molecular of taxon sampling on the inferences that can be drawn from our analyses
markers used for reconstructing Arcellinida phylogenies (SSU rRNA, COI (Fig. 7). Given our datasets, patterns emerge at the infra-ordinal level;
and NADH genes) have been applied successfully in other micro and for instance, the ancestral Hyalospheniformes were probably terrestrial,
“macro-“ eukaryotes (Heger et al., 2011; Rach et al., 2008; Sánchez- and built their tests out of their preys’ mineral scales. Longithecina I,
Vialas et al., 2020). Especially in protists, for which the number of Longithecina II and Netzeliidae (ex-Difflugia) had all aquatic ancestors
morphological traits is limited, molecular data are the objective back and built their shells by agglutinating particles found in the environ
ground against which evolutionary hypotheses can be tested. Accord ment. However, our sampling remains biased as many taxa still need to
ingly, molecular studies have challenged Arcellinida traditional be barcoded and may modify our conclusions. Some taxa, despite having
systematics, using the SSU rRNA as marker (Gomaa et al., 2015; been barcoded, have still an uncertain position in the tree, like Argynnia
Kudryavtsev et al., 2009; Nikolaev et al., 2005), NADH (Blandenier and Physochila (Fig. 5); adding more species can change their position,
et al., 2017; Macumber et al., 2020) or COI (González-Miguéns et al., and thus affect conclusions on general evolutionary patterns. Many
2021; Kosakyan et al., 2016b, 2013). However, our analyses also show other genera are still awaiting to be barcoded, and their position can
that each of these markers saturates at different taxonomic depths, first change topologies as well. In addition, the existence of extinct groups
NADH, then COI and finally SSU (Fig. 5). The consequence is that the has not been considered.
deepest nodes appear unstable in single gene phylogenies (see references In Arcellinida, there is still many genera that have not been geneti
above). A phylotranscriptomic approach, however, has been carried out, cally characterized and remain considered incertae sedis as their sys
providing internal nodes with a robustness never reached before (Lahr tematic position remains unresolved (Adl et al., 2019; Lahr et al., 2019).
et al., 2019). The groupings that emerged from this analysis allowed the The addition of these taxa to SSU trees will probably help stabilizing
erection of four new infraorders within suborder Glutinoconcha: Hya weakly supported nodes between infraorders. Moreover, expanding
lospheniformes, Longithecina, Excentrostoma and Volnustoma. How taxon sampling can possibly add new major subdivisions within Arcel
ever, this approach for single cell organisms is still challenging, linida. There is evidence from previous works that genus Difflugia is
definitively costly, and computation intensive when performed at large paraphyletic (Macumber et al., 2020) even after all Netzelia species have
scales, which prevents, for the moment, the expansion of these analyses been included within Sphaerothecina (Kosakyan et al., 2016a). This
to a wide number of taxa. Low taxon coverage can bias the systematics pattern is recovered in our SSU tree as well as with the other molecular
and its posterior interpretations (Heath et al., 2008; Sanderson et al., markers (Figs. 2, 3 and 4). This implies the erection of a new infraorder
2010). Therefore, single cell barcoding remains very useful as a quick to designate all members of Longithecina II, which we name Cylin
way to retrieve data from a larger number of taxa to resolve the phy drothecina. To resolve further the paraphyly of Difflugia, we erected the
logeny and systematics of Arcellinida, to characterize the biodiversity of new genus Cylindrifflugia to group all members of Difflugia belonging to
the different infraorders. Cylindrothecina (see Taxonomic actions). Our SSU tree shows even a
Amongst these molecules, SSU rRNA gene has been, until now, the weakly supported relationship between Cylindrothecina and Excen
most frequently used single marker to reconstruct Arcellinida phylog trostoma (PP = 0.87; Fig. 5); further taxon sampling may also confirm
enies, as well as for barcoding and metabarcoding (Ruggiero et al., the existing of this deep clade. Furthermore, genus Trigonopyxis does not
2020). Obtaining SSU sequences from Arcellinida is often a difficult task, seem to be related to any known infraorder, and more genes/taxa will be
as other eukaryotes (symbionts, undigested preys) are often preferably instrumental in associating it to a known group or erecting another new
amplified in the PCR process (Gomaa et al., 2012). The presence of in infraorder.
trons and secondary structures, such as the evidenced in this work in
Cylindrifflugia acuminata sensu lato (Fig. 5) difficult amplifications by 4.2. Homoplasic morphological evolution in Arcellinida
expanding fragments size, as well as alignment. Mitochondrial markers,
besides being easier to amplify, are well suited to build intra-infraorder An examination of the SSU, NADH and COI gene trees (Figs. 2, 3 and
phylogenies and to differentiate organisms at the species level 4) shows different instances in which morphology changes quickly
(Kosakyan et al., 2013; Blandenier et al., 2017; González-Miguéns et al., within infraorders. Excentrostoma included genera with a lateral aper
2021). As shown in this study, mRNA COI undergoes mitochondrial ture like Bullinularia, Centropyxis and Plagiopyxis. Here, we show that
editing, which consists in removing single nucleotides (usually a species with a terminal aperture such as Awerintzewia sp. and Difflugia
thymine) with respect the native DNA sequence. This thus changes the viscidula also belong to Excentrostoma. Moreover, a lateral aperture
reading frame as documented in the far-related group Heterolobosea seems to have evolved independently at least twice in the infraorder, as
(Yang et al., 2017). However, when performing the phylogenies directly Bullinularia spp. and Centropyxis spp. belong to two well separated clades
on nucleotide sequences, only a few individual nucleotides are con (Figs. 2 and 4). The inclusion of D. viscidula within Excentrostoma makes
cerned (three in all COI alignment Fig. 5) which does not affect tree Difflugia paraphyletic again, which calls for a taxonomic action; we erect
topology, although negatively influences node support values. here the new genus Golemanskia (see Taxonomical actions). Intra-
In this work, we reconstructed Arcellinida phylogeny by increasing infraorder variations in general test outline occur also within Longi
the number of taxa and the number of markers, an approach that has not thecina where complex two-chamber tests appear (genus Zivkovicia;
been followed before in this group. Our phylogenetic reconstructions Fig. 2) as well as convoluted, spiral-shaped tests like in Lesquereusia
based on two mitochondrial and one nuclear marker (Figs. 2, 3 and 4) (Fig. 4). The bicameral organization of genus Apodera within the
are congruent among themselves, and with previous works on Arcelli otherwise pyriform compressed Hyalospheniformes has already been
nida systematics, which validates our approach. The SSU tree (Fig. 4) documented (Duckert et al., 2021). Other infraorders (e.g., Cylin
recovers the same topology as the phylogenomic tree in Lahr et al., drothecina, Volnustoma) appear to have more conserved morphologies,
2019; all infraorders receive total support (PP = 1) except Excen but this picture may well change when new species will be barcoded. All
trostoma, in which the position of genus Bullinularia remains weakly these instances show that morphologies may vary quicker than expected
supported (but confirmed with COI, Fig. 2). It is likely that further within infraorders.
sampling of related genera (Hoogenraadia, Planhoogenraadia) will Arcellinida shells shape seems to have a non-linear evolution,
12
following the “tangled evolution” model, in which similar morphologies 4.3. Taxonomic decisions: The history of Difflugia proteiformis
appear in different parts of the tree. Within Arcellidae, far related spe
cies with similar shells have been shown to occupy similar ecosystems The current taxonomic and systematic situation in Arcellinida is
(González-Miguéns et al., 2021). Here, we show that similar conclusions analogousto the first name ever given to a Difflugia (and Arcellinida)
can be drawn at the scale of the whole order Arcellinida. Species with a species. This genus was originally erected by Leclerc (1815). Lamarck,
mineral agglutinated shell construction and cylindrical morphology can based in his illustrations placed the newly described organisms amongst
be found both in Longithecina and Cylindrothecina. These species can be the “polyps”, under the name Difflugia proteiformis. This first description
found in lotic systems, and no single morphological trait has been found included several Arcellinida morphotypes (Fig. 1), which later made
to discriminate members from both infraorders (Fig. 6); as an example, Ehrenberg (1838) split the species into several taxonomic units.
individuals classified as Difflugia oblonga have been placed phylogenet Amongst these new species was Difflugia acuminata, which he had found
ically in both groups (Figs. 2 and 4). Netzeliidae have a unique mor previously in Berlin (Ehrenberg, 1830) and distinguished from other
phospace (Fig. 6), reflected in their (sub-)spherical shape which may be species by a tip on the shell fundus (Fig. 1). Those shells without tip were
correlated with their unique temporally planktonic lifestyle (Han et al., designated D. oblonga, and the smallest morphotypes remained
2011). Terrestrial genera Bullinularia and Plagiopyxis, formerly classified D. proteiformis. Given the high morphological diversity of testate
within a single family Plagiopyxidae (Bonnet, 1959a) based on their slit- amoebae with agglutinated shells, several authors started to describe
like aperture with a protective “visor” have converged towards a similar newly encountered organisms as D. proteiformis, describing several
morphology, most probably to fight desiccation (Fig. 4). Genera variants of the same species and leaving it polymorphic. For instance,
Argynnia and Physochila, previously classified within Hyalospheniformes Perty (1849) described new morphologies in his illustrations which did
because of their similar general test outline appear unrelated in mo not match with Ehrenberg’s interpretations. During the next twenty
lecular phylogenies (Lara et al., 2008); both share similar sub-aquatic years, the number of species and of Difflugia and variants of
environments with many Hyalospheniformes species. In sum, shells D. proteiformis increased to more than 100. This led Leidy (1877) to point
are likely to undergo changes in the evolutionary history whenever new out that most Difflugia were badly characterized, thus inflating species
environments are colonized and selective pressures are modified. Like numbers as the “same things having been described over and over again
wise, Excentrostoma, Longithecina, Cylindrothecina and Phryganella under different names”. The problem of D. proteiformis was eventually
share the same morphospace (Fig. 6) which means it is currently pointed out by Leidy (1879), and Penard (1902) finally invalidated this
impossible to classify species within one of these clades based solely on species to avoid more taxonomic confusions, including this species
morphology. These examples advocate for the “tangled evolution” hy within Difflugia pyriformis.
pothesis rather than for the “morphological stasis” along lineages. This historical chaos is the result of the difficulty in setting bound
What is true for extant species verifies also for assigning taxonomi aries between Difflugia species as well as the lack of synapomorphic
cally fossils, as ancient shells have been placed into extant genera and characters to separate genera. Therefore, grouping species by shell
even subspecies based on their shell morphology (Farooqui et al., 2014; similarity leads often to mistakes, as exemplified here by the poly
van Hengstrum et al., 2007). We have shown that morphologies can phyletic phylogenetic position of Difflugia. Nowadays, molecular tech
change fast in evolutionary times. On the other hand, evolutionary niques and integrative approaches are available, using the history of
convergences can cause the pooling of far-related taxa under the same independent characters to see if they coalesce into concordant results. As
species. Therefore, we recommend the highest caution with the tax a result, the classification of genera into higher taxonomic classification
onomical assignation of Arcellinida fossils. Like in macroscopic organ levels based only on shell morphology is virtually impossible. For these
isms, let aside a few notable exceptions improperly called “living fossils” reasons, we recommend an integrative taxonomy approach to (re)clas
organisms that have been considered as unchanged for long periods of sify the many orphan Arcellinida genera and species, leaving the genera
time (Mathers et al., 2013) morphologies change fast in evolutionary not correctly classified as Incertae sedis (see Summarized Classification
times. Under our “tangled evolution” scenario and the lack of morpho of the Arcellinida).
logical stability in most lineages, linking extant Arcellinida with the This integrative approach is also applied to family Plagiopyxidae,
Precambrian Vase Shaped Microfossils appears premature. Even if we which was described by Bonnet & Thomas (1960) based on the aperture
admit that current lineages actually descend from VSM, it is not clear if shape and position “Lobose testate amoebae with bilaterally symmetri
they derive from one or more lineages (Lahr, 2021), as there could be cal organic test covered with fragments of mineral grains, diatoms, and
extinctions events eliminating the Precambrian lineages. These ques organic debris; aperture a more or less invaginated slit on the ventral
tions may only be answered based on a continuous fossil record side, eccentric, overhung by an anterior lip, in ventral view often diffi
including many Phanerozoic fossils and, also, more genetic data on cult to observe (cryptostome)”. Under this definition, Plagiopyxis and
missing genera. Bullinularia should branch together excluding Centropyxis, a topology
Evolutionary convergences in shells is not a particular case in which is not supported neither by SSU nor by COI. Therefore, we
Arcellinida, but seems to be widespread amongst protists (Leander, invalidate the family Plagiopyxidae, grouping all the genera in the
2008). In particular, correlations between morphotypes and habitat family Centropyxidae.
have been found in Foraminifera (Coxall et al., 2007), in diatoms (Pin In line with this, the three molecular markers result in the mono
seel et al., 2019), Euglyphida testate amoebae (González-Miguéns et al. phyly of Longithecina I and II, which should be then formally described.
2022) and radiolarians (Kachovich et al., 2019). Likewise, some fora We erect Longithecina II as a new infraorder, Cylindrothecina, which
miniferan shells (Lagenammina) resemble strongly genus Difflugia (Ste hosts for now genus Cylindrifflugia. Genus Difflugia will remain within
fanoudis et al., 2016), making it difficult it differentiate only with Longithecina (I) as its type species is D. pyriformis.
general shape of the shell. Beyond the microbial world, similar evolu New infraorder Cylindrothecina González-Miguéns, Todorov,
tionary patterns appear in caddisflies (Trichoptera), where shell shape is Porfirio-Sousa, Ribeiro, Ramos, Lahr, Buckley & Lara 2022.
correlated with water oxygenation rather than with phylogenetic posi Type family: Cylindrodifflugiidae.
tion (Williams et al., 1987). Convergent evolution in shell or test Diagnosis: can be diagnosed by its specific sequences of the mito
morphology is therefore most probably a widespread phenomenon in chondrial and nuclear DNA markers (COI, NADH and SSU) and by its
Eukaryotes, which matches these general patterns of ‘rampant homo phylogenetic placement.
plastic morphological evolution’ found in other groups as well (e.g., New family Cylindriflugiidae González-Miguéns, Todorov, Porfirio-
Wake et al., 2011). Sousa, Ribeiro, Ramos, Lahr, Buckley & Lara 2022.
Type genus: Cylindrifflugia.
Diagnosis: can be diagnosed by its specific sequences of the
13
mitochondrial and nuclear DNA markers (COI, NADH and SSU) and by Genera: Cylindrifflugia new genus González-Miguéns, Todorov,
its phylogenetic placement. Blandenier, Porfirio-Sousa, Ribeiro, Ramos, Lahr & Lara (urn:lsid:zoo
New genus Cylindrifflugia González-Miguéns, Todorov, Porfirio- bank.org:act:62C7FAA1-CD5D-4865-BB4E-46CC77ED5C2E).
Sousa, Ribeiro, Ramos, Lahr, Buckley & Lara 2022. Infraorder Excentrostoma Lahr et al., 2019.
Type species: Cylindrifflugia acuminata (Ehrenberg, 1838). Family Centropyxidae Jung, 1942
Penard collection: https://commons.wikimedia.org/wiki/Category: Genera: Awerintzewia Schouteden, 1906 (urn:lsid:zoobank.org:act:
Difflugia_acuminata. E0F308AB-8FA3-459D-9493-7C32B53B3657), Bullinularia Deflandre,
New species combinations in Cylindrifflugia: 1953 (urn:lsid:zoobank.org:act:06366D36-DD64-4C0C-8C02-FC26EB7
Cylindrifflugia acuminata (Ehrenberg, 1838) comb. nov. D61E6), Centropyxis Stein, 1859 (urn:lsid:zoobank.org:act:2F7FCC8B-
Zoobank registration: lsid:zoobank.org:act:09799CDB-9F1F-4E3D- 1A4C-41C9-8CB1-5697B80E92B6), Golemanskia González-Miguéns,
B880-02237BA49D73. Todorov, Blandenier, Porfirio-Sousa, Ribeiro, Ramos, Lahr & Lara (urn:
Cylindrifflugia elegans (Penard, 1890) comb. nov. lsid:zoobank.org:act:DF9D1D11-06FA-4F24-8362-17132CB23FBE),
Zoobank registration: lsid:zoobank.org:act:B8C232C6-E51D-4C29- Plagiopyxis Penard, 1910 (urn:lsid:zoobank.org:act:CEBB0164-90B6-
BE40-2ABFE1D71B89. 4137-AC5F-7FD328FC60DA).
Cylindrifflugia lanceolata (Penard, 1890) comb. nov. Infraorder Hyalospheniformes Lahr et al., 2019.
Zoobank registration: lsid:zoobank.org:act:59893EE0-F131-4598- Family Hyalospheniidae Schultze, 1877 emend. Kosakyan et al.,
9A95-BC8F88BE3128. 2012.
Cylindrifflugia bacillariarum (Perty, 1849) comb. nov. Genera: Alabasta Duckert et al., 2018 (urn:lsid:zoobank.org:
Zoobank registration: lsid:zoobank.org:act:64D55BAC-19DC-46D1- act:7408C1E9-2DD6-4098-97DA-3CF743954B5F), Alocodera Jung,
A13D-1AEEAADB0CA9. 1942 (urn:lsid:zoobank.org:act:38495728-64C4-4B53-BE70-D6FD189A
Cylindrifflugia hiraethogii (Ogden, 1983) comb. nov. A555), Apodera Loeblich and Tappan, 1961 (urn:lsid:zoobank.org:
Zoobank registration: lsid:zoobank.org:act:BC13C9A1-7AFB-438A- act:2A253E61-6C8B-4324-9E61-9A2D304BD848), Certesella Loeblich
A110-B0C0AADFE081. and Tappan, 1961 (urn:lsid:zoobank.org:act:CBA76680-88D8-40F4-
New genus Golemanskia González-Miguéns, Todorov, Blandenier, A5A3-5EEFF8B38F0A), Cornutheca Kosakyan et al., 2016b (urn:lsid:
Porfirio-Sousa, Ribeiro, Ramos, Lahr & Lara 2022. zoobank.org:act:C2B0C4FF-4BAE-46ED-BC9C-CC7B77510389), Gibbo
Type species: Golemanskia viscidula (Penard, 1902). carina Kosakyan et al., 2016b (urn:lsid:zoobank.org:act:76D63465-
New species combinations in Golemanskia: 04BC-4A6C-9FB8-CB148B787DC0), Hyalosphenia Stein, 1859 (urn:
Golemanskia viscidula (Penard, 1902) comb. nov. lsid:zoobank.org:act:C1CB7196-8C45-4076-975A-1053018DFAB4),
Zoobank registration: lsid:zoobank.org:act:5FCEB4DB-9AF9-4699- Longinebela Kosakyan et al., 2016b (urn:lsid:zoobank.org:
90CA-FDF437070214. act:6A69AF6F-60B8-4383-95FA-05911D806FE4), Mrabella Kosakyan
As demonstrated with the molecular results, the diversity of Arcel et al., 2016b (urn:lsid:zoobank.org:act:E9D5B101-EB13-436D-8B10-
linida is far from being characterized. Quoting Leclerc (1815); “Besides, 0E43C00DEDB6), Nebela Leidy, 1874 (urn:lsid:zoobank.org:act:26F
I am far from believing that my task is finished, and having drawn the 54823-8DA3-4395-8EE9-EBA0845E1CA8), Padaungiella Lara et
attention of naturalists to this singular animal which, without doubt, has Todorov, 2012 (urn:lsid:zoobank.org:act:7050AE36-A879-46 EB-A3C2-
passed many times unnoticed under the lens of the observer, I do not 051C8241234F), Planocarina Kosakyan et al., 2016b (urn:lsid:zoobank.
believe that I am exempt from devoting mine to it once again, and I shall org:act:0706752B-4BAD-4FF5-9DE6-D044A6CDB72B), Porosia Jung,
endeavour to arrive at some results that are more satisfactory than those 1942 (urn:lsid:zoobank.org:act:D8A54F6C-5751-4C2E-BFB0-57E7F547
which I am reduced to presenting to you today”. 071F), Quadrulella Cockerell, 1909 (urn:lsid:zoobank.org:act:54DF
C2D4-AEDC-44F3-819C-F20651B2A3AB).
4.4. Summarized classification of the Arcellinida: Infraorder Volnustoma Lahr et al., 2019.
Family Heleoperidae Jung, 1942.
Suborder Glutinoconcha Lahr et al., 2019. Genus Heleopera Leidy, 1879 (urn:lsid:zoobank.org:act:3AA5030B-
Infraorder Sphaerothecina Kosakyan et al., 2016a. BF41-43AD-958B-00FF70FFCA3C).
Family Arcellidae Ehrenberg, 1843. Suborder Organoconcha Lahr et al., 2019.
Genera: Arcella Ehrenberg, 1830 (urn:lsid:zoobank.org:act:D31423F5- Family Microchlamyiidae Ogden, 1985.
E6E6-4E54-B404-37241F932F99), Galeripora González-Miguéns et al., Genera: Microchlamys Cockerell, 1911 (urn:lsid:zoobank.org:act:7
2021 (urn:lsid:zoobank.org:act:73C0B8C8-FFA4-48CC-8AE5-B0266D9839 D3AFE77-D4D3-4927-A971-4C8D0BB3C3CC), Spumochlamys Kudryavt
95). sev & Hausmann, 2007 (urn:lsid:zoobank.org:act:CABAC4CB-0453-46F2-
Family Netzeliidae Kosakyan et al., 2016a. AA33-3E95DB46FBC1), Pyxidicula Ehrenberg, 1838 (urn:lsid:zoobank.
Genera: Cucurbitella Penard, 1902 (urn:lsid:zoobank.org: org:act:3E1971A0-0637-426C-98CB-D6CFD2B31090).
act:2BD82251-DD63-405E-8921-1D8483E15044), Cyclopyxis Deflan Suborder Phryganellina Bovee, 1985.
dre, 1929 (urn:lsid:zoobank.org:act:2C3A445F-6B5E-44B5-AC63-5922F Family Phryganellidae Jung, 1942.
52FB8B5), Netzelia Ogden, 1979 (rn:lsid:zoobank.org:act:1F34795D- Genus Phryganella Penard, 1902 (urn:lsid:zoobank.org:act:
5774-46A6-A4FA-5CF44E58A56C). E7D4C306-B826-4B5A-BD68-08992AD0B71D).
Infraorder Longithecina Lahr et al., 2019. Family Cryptodiflugiidae Jung, 1942.
Family Difflugiidae Wallich, 1864. Genus Cryptodifflugia Penard, 1890 (urn:lsid:zoobank.org:
Genera: Difflugia Leclerc, 1815 (urn:lsid:zoobank.org:act:642F3 act:1E182D4B-74C8-4790–9454-4C2E460DF85C).
774-1053–4549-949E-5157434B4BCD), Zivkovicia Ogden, 1983 (urn: Incertae Sedis (*genus barcoded):
lsid:zoobank.org:act:A1F9C197-AB87-43E7-B82A-F02CDF0244C0). Genera: Acipyxis Jung, 1942 (urn:lsid:zoobank.org:act:6811D231-
Family Lesquereusiidae Jung, 1942. 6DA0-4D28-BD6F-AFB8C4EDF61C), Apolimia Korganova, 1987 (urn:lsid:
Genera: Lesquereusia Schlumberger, 1845 (urn:lsid:zoobank.org: zoobank.org:act:CEA558F4-49DF-47A9-A6D4-A92E5797DB9E), Argyn
act:89A05EC5-1B4E-4F66-94E7-99C844A333F0). nia* Vucetich, 1974 (urn:lsid:zoobank.org:act:BCB3A3BE-355D-4E65-
Infraorder Cylindrothecina González-Miguéns, Todorov, Blande 8AC0-521501DA3831), Armipyxis Dekhtjar, 2009 (urn:lsid:zoobank.org:
nier, Porfirio-Sousa, Ribeiro, Ramos, Lahr & Lara new infraforder. act:A5E855AD-B404-4F69-9B10-E577FC07CC60), Conicocassis Nasser &
Family Cylindrifflugiidae González-Miguéns, Todorov, Blandenier, Patterson, 2015 (urn:lsid:zoobank.org:act:CF0D9768-05CE-4703-9A7F-
Porfirio-Sousa, Ribeiro, Ramos, Lahr & Lara new family. 3B43521C2217), Cornuapyxis Coûteaux & Chardez, 1981 (urn:lsid:zoo
14
bank.org:act:2CA46A68-90C2-4218-B53A-9C75B1E56C82), Ellipsopyx pressures and constrains. These examples illustrate the versatility of
ella Bonnet, 1975a (urn:lsid:zoobank.org:act:726EDDA0-98B3-4C63-8829- morphological evolution in Arcellinida clades, which follow then a
8DC5DADF475D), Ellipsopyxis Bonnet, 1965 (urn:lsid:zoobank.org: “tangled evolution” model instead of a “morphological stasis”. Conver
act:56D4AE49-1F38-4260-8F11-F933FD438861), Erugomicula Nasser gent shell evolution has not only been documented in Arcellinida but
et al., 2021(urn:lsid:zoobank.org:act:A42A7EB9-B8CC-45E6-867E-2CDBC happens also in diatoms, foraminifera and in animals such as caddisflies
A038B23) Frenopyxis Bobrov & Mazei, 2020 (urn:lsid:zoobank.org: (Trichoptera). We speculate that such convergences could be due to
act:63C16117-92E0-47F8-91A2-3CD5D3FDA221), Geamphorella Bonnet, positive (directional) selection acting on shell evolution, whose effects
1959b (urn:lsid:zoobank.org:act:405A3645-1162-4BC9-BDAD-C031A37D can be witnessed in microbial as well as in multicellular eukaryotes
C458), Geoplagiopyxis Chardez, 1960 (urn:lsid:zoobank.org:act:9BF9B alike. The entirety of convergence patterns can only be revealed once a
9F9-4C5E-462F-8533-AC2EB6CF3B04), Geopyxella Bonnet & Thomas, robust phylogeny for the group is thoroughly completed. To paraphrase
1955 (urn:lsid:zoobank.org:act:4A7A0CB7-20D5-4E67-8F18-46EA047C8 Dobzhansky’s famous quote, “Nothing in evolution makes sense except
D65), Hoogenraadia Gauthier-Liévre & Thomas, 1958 (urn:lsid:zoobank. in the light of systematics”.
org:act:F1B3B043-2BF7-458E-9551-18167E35C6D8), Jungia Loeblich Fundings.
and Tappan, 1961 (urn:lsid:zoobank.org:act:EE13920C-FB94-4ED6-A8E9- This work was funded by the Spanish Government PGC2018-
359EF5548B8D), Lagenodifflugia Medioli & Scott, 1983 (urn:lsid:zoobank. 094660-B-I00 /https://doi.org/10.13039/501100011033/ (MCIU/
org:act:255C48A1-9425–4647-B4A4-9EE979B4286E), Lamptopyxis Bon AEI/FEDER,UE) and the program ‘Atracción de Talento Investigador’,
net, 1974 (urn:lsid:zoobank.org:act:07556E10-9CC9-4C04-953B-FB00A9 grant awarded to EL by the Consejería de Educación, Juventud y
AD512D), Lamtoquadrula Bonnet, 1975b (urn:lsid:zoobank.org:act: Deporte, Comunidad de Madrid (Spain) (2017-T1/AMB-5210)
C9D9F207-CBC8-4C5A-AD18-0881D93E9539), Leptochlamys West, 1901 /https://doi.org/10.13039/501100011033/.
(urn:lsid:zoobank.org:act:FB2129A3-9C44-4379-86D1-CFFCAFFBDAF8),
Maghrebia Gauthier-Liévre & Thomas, 1958 (urn:lsid:zoobank.org: CRediT authorship contribution statement
act:88C90F6F-FCB9-49E8-A909-3D977704A0D8), Meisterfeldia Bobrov,
2016 (urn:lsid:zoobank.org:act:378A8BE0-F641-42E7-9D45-BD0A83900E Rubén González-Miguéns: Conceptualization, Methodology, Soft
49), Microquadrula Golemansky, 1968 (urn:lsid:zoobank.org:act:E005C6 ware, Validation, Formal analysis, Investigation, Resources, Data cura
3B-6E52-45BB-84E8-C73B8FED660A), Nabranella Snegovaya & Alek tion, Writing – original draft, Writing – review & editing, Visualization.
perov, 2009 (urn:lsid:zoobank.org:act:F5391958-704A-4B80-9E11-9BFF Milcho Todorov: Investigation, Resources, Writing – review & editing.
D7E9DE45), Oopyxis Jung, 1942 (urn:lsid:zoobank.org:act:670A7D1B- Quentin Blandenier: Resources, Writing – review & editing. Clément
1A03-49C6-BF03-CC344C15A7C9), Paracentropyxis Bonnet, 1960 (urn: Duckert: Resources. Alfredo L. Porfirio-Sousa: Writing – review &
lsid:zoobank.org:act:9790F11C-BEB5-4373-ABB9-D74B299549C3), Para editing. Giulia M. Ribeiro: Writing – review & editing. Diana Ramos:
quadrula Deflandre, 1932 (urn:lsid:zoobank.org:act:2041AE2D-4D49- Resources, Writing – review & editing. Daniel J.G. Lahr: Writing – re
4D48-A795-0F095A49F60B), Pentagonia Gauthier-Liévre & Thomas, 1958 view & editing. David Buckley: Investigation, Writing – review &
(urn:lsid:zoobank.org:act:3A99093A-D4DD-4299-B963-9C75EA65126A), editing. Enrique Lara: Conceptualization, Validation, Resources,
Physochila* Jung, 1942 (urn:lsid:zoobank.org:act:3BDD5D3C-548D-41A1- Writing – original draft, Writing – review & editing, Visualization,
96EA-8D14970EB4CF), Planhoogenraadia Bonnet, 1977 (urn:lsid:zoo Funding acquisition.
bank.org:act:CCEFFB8F-6E49-4372-9E10-C1E29627005C), Pomoriella
Golemansky, 1970 (urn:lsid:zoobank.org:act:EC215477-3616-4D69-B0F Declaration of Competing Interest
8-485F1B9395A6), Pontigulasia Rhumbler, 1895 (urn:lsid:zoobank.org:
act:2A1965E3-1822-49AD-973A-4049392799E2), Proplagiopyxis Schön The authors declare that they have no known competing financial
born, 1964 (urn:lsid:zoobank.org:act:1CB758D2-71A4-4A71-8709-3AAA interests or personal relationships that could have appeared to influence
D5E79A3A), Protoplagiopyxis Bonnet, 1962 (urn:lsid:zoobank. the work reported in this paper.
org:act:157F1593-1095–4610-92BF-B0AD6FE2BCF0), Protocucurbitella
Gauthier-Liévre & Thomas, 1960 (urn:lsid:zoobank.org:act:9138B2DC- Acknowledgements
C53C-4D2D-A68F-8665141D3E24), Pseudawerintzewia Bonnet, 1959b
(urn:lsid:zoobank.org:act:F8A7DE7B-54B0-47A5-8C3A-095E6A28575F), We express our gratitude to I. Cacabelos, C. G. Cerqueiras, Luis Lara-
Pseudonebela Gauthier-Liévre & Thomas, 1953 (urn:lsid:zoobank.org:act: Hollenstein, M. Miguéns-Gomez and Patricia Lara-Hollenstein for the
BA3A05F0-9AC0-471E-8BD2-95AA890ADE90), Schoenbornia Decloître, help in the field work. We wish also to acknowledge the help in the
1964 (urn:lsid:zoobank.org:act:FEB00E4B-2065-4B1B-8E91-170DBEDEA8 molecular biology laboratory of E. Cano, M. Baur, M. García-Gallo, N.
C9), Sexangularia Awerintzew, 1906 (urn:lsid:zoobank.org:act:093805 Bankov and Y. Ruiz-León. F.J., Siemensma for the webpage at: https://
BA-54BF-4CBD-96BF-EF2A005AFB67), Suiadifflugia Green, 1975 (urn: www.arcella.nl/and the help in taxonomic identification, and P.
lsid:zoobank.org:act:B18FFF6A-3EE8-4C23-9F23-E8CD13256702), Trig Garrido-Alique for the illustration in the graphical abstract. Finally, we
onopyxis* Penard, 1912 (urn:lsid:zoobank.org:act:0F46EE16-5C36-4B4D- thank A. Berlinches, A. Coello, A. Guillén-Oterino, C. Soler-Zamora,
B957-D18C94B867CA), Wailesella Deflandre, 1928 (urn:lsid:zoobank.org: Prof. Edward A. D. Mitchell, F. Useros, I. García-Cunchillos, M.
act:3D0EE5DE-E390-41D6-9106-F5C5C9038CAA). Blázquez, M. Martínez, M. Villar de Pablo and S. Nogal for fruitful
discussions.
5. Conclusion
Appendix A. Supplementary material
In this study, we established the systematics of Arcellinida by
increasing the taxon sampling, and using three genes (COI, NADH and Supplementary data to this article can be found online at https://doi.
SSU). These topology resulting from SSU gene is equivalent to that of the org/10.1016/j.ympev.2022.107557.
phylotranscriptomic study of Lahr et al. (2019). All genes recovered the
monophyly of the new infraorder Cylindrothecina and the inclusion of References
genus Awerintzewia (only with COI) and new genus Golemanskia within
Excentrostoma, despite of their Difflugia-like morphology. They also Adl, S.M., Bass, D., Lane, C.E., Lukeš, J., Schoch, C.L., Smirnov, A., Agatha, S., Berney, C.,
supported the idea that the similar aperture found in genera Plagiopyxis Brown, M.W., Burki, F., Cárdenas, P., Čepička, I., Chistyakova, L., del Campo, J.,
Dunthorn, M., Edvardsen, B., Eglit, Y., Guillou, L., Hampl, V., Heiss, A.A.,
and Bullinularia is the result of a convergence, possibly since that these Hoppenrath, M., James, T.Y., Karnkowska, A., Karpov, S., Kim, E., Kolisko, M.,
organisms inhabit similar environments and undergo similar selective Kudryavtsev, A., Lahr, D.J.G., Lara, E., Le Gall, L., Lynn, D.H., Mann, D.G.,
15
Massana, R., Mitchell, E.A.D., Morrow, C., Park, J.S., Pawlowski, J.W., Powell, M.J., Deflandre, G., 1932. Paraquadrula nov. gen. Irregularis (Archer). Conjugaison et
Richter, D.J., Rueckert, S., Shadwick, L., Shimano, S., Spiegel, F.W., Torruella, G., enkystement. Comptes rendus Hebd. des Séances la Société Biol. ses Fil Assoc. 109,
Youssef, N., Zlatogursky, V., Zhang, Q., 2019. Revisions to the Classification, 1346–1347.
Nomenclature, and Diversity of Eukaryotes. J. Eukaryot. Microbiol. 66 https://doi. Deflandre, G., 1929. Le genre Centropyxis Stein. Arch. für Protistenkd. 67, 322–375.
org/10.1111/jeu.12691. Deflandre, G., 1928. Deux genres nouveaux de Rhizopodes testacés. Ann. Protistol.
Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local 37–43.
alignment search tool. J. Mol. Biol. 215 https://doi.org/10.1016/S0022-2836(05) Dekhtjar, M.N., 2009. The peculiarities of shell morphology and taxonomic composition
80360-2. of the family Centropyxidae (Testacealobosia, Rhizopoda). Vestn. Zool. 43, 297–303.
Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., Dobzhansky, T., 1973. Nothing in Biology Makes Sense except in the Light of Evolution.
1997. Gapped BLAST and PSI-BLAST: A new generation of protein database search Am. Biol. Teach. 35 https://doi.org/10.2307/4444260.
programs. Nucleic Acids Res. https://doi.org/10.1093/nar/25.17.3389. Duckert, C., Blandenier, Q., Kupferschmid, F.A.L., Kosakyan, A., Mitchell, E.A.D.,
Anderson, O.R., 1988. Testate Amoebae (Classes: Lobosea and Filosea). Comparative Lara, E., Singer, D., 2018. En garde! Redefinition of Nebela militaris (Arcellinida,
Protozoology: Ecology, Physiology, Life History. Springer-Verlag, New York. Hyalospheniidae) and erection of Alabasta gen. nov. Eur. J. Protistol. 66 https://doi.
Anselin, L., 1995. Local Indicators of Spatial Association—LISA. Geogr. Anal. 27 https:// org/10.1016/j.ejop.2018.08.005.
doi.org/10.1111/j.1538-4632.1995.tb00338.x. Duckert, C., Blandenier, Q., McKeown, M., Hohaia, H., Luketa, S., Wilmshurst, J.,
Awerintzew, S., 1906. Rhizopodenstudien. Ann. Biol. Lacustre 1, 321–326. Lara, E., Mitchell, E.A.D., 2021. Superficially described and ignored for 92 years,
Blandenier, Q., Lara, E., Mitchell, E.A.D., Alcantara, D.M.C., Siemensma, F.J., rediscovered and emended: Apodera angatakere (Amoebozoa: Arcellinida:
Todorov, M., Lahr, D.J.G., 2017. NAD9/NAD7 (mitochondrial nicotinamide adenine Hyalospheniformes) is a new flagship testate amoeba taxon from Aotearoa (New
dinucleotide dehydrogenase gene)—A new “Holy Grail” phylogenetic and DNA- Zealand). J. Eukaryot. Microbiol. 68 https://doi.org/10.1111/jeu.12867.
barcoding marker for Arcellinida (Amoebozoa)? Eur. J. Protistol. 58 https://doi.org/ Dumack, K., Görzen, D., González-Miguéns, R., Siemensma, F., Lahr, D.J.G., Lara, E.,
10.1016/j.ejop.2016.12.002. Bonkowski, M., 2020. Molecular investigation of Phryganella acropodia Hertwig et
Blomberg, S.P., Garland, T., 2002. Tempo and mode in evolution: Phylogenetic inertia, Lesser, 1874 (Arcellinida, Amoebozoa). Eur. J. Protistol. 75 https://doi.org/
adaptation and comparative methods. J. Evol. Biol. https://doi.org/10.1046/j.1420- 10.1016/j.ejop.2020.125707.
9101.2002.00472.x. Dumack, K., Kahlich, C., Lahr, D.J.G., Bonkowski, M., 2019. Reinvestigation of
Blonder, B., Lamanna, C., Violle, C., Enquist, B.J., 2014. The n-dimensional Phryganella paradoxa (Arcellinida, Amoebozoa) Penard 1902. J. Eukaryot.
hypervolume. Glob. Ecol. Biogeogr. 23 https://doi.org/10.1111/geb.12146. Microbiol. 66 https://doi.org/10.1111/jeu.12665.
Blount, Z.D., Lenski, R.E., Losos, J.B., 2018. Contingency and determinism in evolution: Ehrenberg, G.C., 1838. Die infusionsthierchen als vollkommene organismen. Ein blick in
Replaying life’s tape. Science (80-). https://doi.org/10.1126/science.aam5979. das tiefere organische leben der natur. Verlag Von Leopold Voss, Leipzig.
Bobrov, A., 2016. Description of a new testate amoebae genus meisterfeldia with notes Farooqui, A., Aggarwal, N., Jha, N., 2014. Thecamoebians from Late Permian Gondwana
on the systematics of the suborder phryganellina (Amebozoa; tubulinea; arcellinida). sediments of peninsular India. Eur. J. Protistol. 50 https://doi.org/10.1016/j.
Acta Protozool. 55 https://doi.org/10.4467/16890027AP.16.020.6007. ejop.2013.05.003.
Bobrov, A., Mazei, Y., 2020. Frenopyxis stierlitzi gen. nov., sp. nov.—new testate amoeba Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for
(Amoebozoa: Arcellinida) from the urban parks with notes on the systematics of the amplification of mitochondrial cytochrome c oxidase subunit I from diverse
family Centropyxidae Jung, 1942. Zootaxa 4885. https://doi.org/10.11646/ metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3 https://doi.org/10.1071/
zootaxa.4885.3.4. ZO9660275.
Bolognini, D., Bartalucci, N., Mingrino, A., Vannucchi, A.M., Magi, A., 2019. NANOR: A Fournier, B., Lara, E., Jassey, V.E.J., Mitchell, E.A.D., 2015. Functional traits as a new
user-friendly R package to analyze and compare nanopore sequencing data. PLoS approach for interpreting testate amoeba palaeo-records in peatlands and assessing
One 14. https://doi.org/10.1371/journal.pone.0216471. the causes and consequences of past changes in species composition. Holocene 25.
Bondarenko, N., Smirnov, A., Nassonova, E., Glotova, A., Fiore-Donno, A.M., 2019. https://doi.org/10.1177/0959683615585842.
Mitochondrial genomes of Amoebozoa. Protistology 13. https://doi.org/10.21685/ Gauthier-Liévre, L., Thomas, R., 1960. Le genre Cucurbitella Penard. Arch. für
1680-0826-2019-13-4-1. Protistenkd. 104, 569–602.
Bonnet, L., 1977. Nouveaux thécamoebiens du sol (IX). Bull. la Société d’Histoire Nat. Gauthier-Liévre, L., Thomas, R., 1958. Les genres Diffluqia, Pentagonia, Maghrebia et
Toulouse 113, 152–156. Hooqenraadia (Rhizopodes testacés) en Afrique. Arch. für Protistenkd. 103,
Bonnet, L., 1975a. Nouveaux Thécamoebiens du sol (VII). Bull. la Société d’Histoire Nat. 241–370.
Toulouse 110, 283–290. Gauthier-Liévre, L., Thomas, R., 1953. Les genres Nebela, Paraquadrula et Pseudonebela
Bonnet, L., 1975b. Lamtoquadrula gen. nov. et la structure plagiostome chez les (Rhizopodes testacés) en Afrique. Bull. la Société d’Histoire Nat. l’Afrique du Nord
Thécamoebiens nébéliformes. Bull. la Société d’Histoire Nat. Toulouse 110, 44, 324–366.
297–299. Golemansky, V., 1970. Rhizopodes nouveaux du psammon littoral de la mer Noire.
Bonnet, L., 1974. Les Lamtopyxidae fam.nov. et la structure propylostome chez les Protistologica 6, 365–371.
Thécamoebiens (Rhizopoda Testacea). Comptes rendus des Séances l’Académie des Golemansky, V., 1968. Materiaux sur la faune thecamoebienne (Rhizopoda, Testacea) de
Sci. Paris 278, 2935–2937. Cuba. Acta Protozool. 6, 335–340.
Bonnet, L., 1965. Nouveaux thécamoebiens du sol. Bull. la Société d’Histoire Nat. Gomaa, F., Lahr, D.J.G., Todorov, M., Li, J., Lara, E., 2017. A contribution to the
Toulouse 100, 330–332. phylogeny of agglutinating Arcellinida (Amoebozoa) based on SSU rRNA gene
Bonnet, L., 1962. Thécamoebiens du sol. Biol. l’Amérique Australe 1, 43–47. sequences. Eur. J. Protistol. 59 https://doi.org/10.1016/j.ejop.2017.03.005.
Bonnet, L., 1960. Thécamoebiens du sol d’Angola. Publicaçes Cult. da Cia. Diam. Angola Gomaa, F., Todorov, M., Heger, T.J., Mitchell, E.A.D., Lara, E., 2012. SSU rRNA
78–86. Phylogeny of Arcellinida (Amoebozoa) Reveals that the Largest Arcellinid Genus,
Bonnet, L., 1959a. Dékystement, phase trophique et enkystement chez Plagiopyxis Difflugia Leclerc 1815, is not Monophyletic. Protist 163. https://doi.org/10.1016/j.
minuta Bonnet (Thécamoebiens). Incid. systématiques Comptes rendus Hebd. des protis.2011.12.001.
Séances l’Académie des Sci. Paris 249, 2617–2619. Gomaa, F., Yang, J., Mitchell, E.A.D., Zhang, W.J., Yu, Z., Todorov, M., Lara, E., 2015.
Bonnet, L., 1959b. Nouveaux Thécamoebiens du sol. Bull. la Société d’Histoire Nat. Morphological and Molecular Diversification of Asian Endemic Difflugia
Toulouse 94, 177–188. tuberspinifera (Amoebozoa, Arcellinida): A Case of Fast Morphological Evolution in
Bonnet, L., Thomas, R., 1955. Etude sur les Thécamoebiens du sol (1). Bull. la Société Protists? Protist 166. https://doi.org/10.1016/j.protis.2014.11.004.
d’Histoire Nat. Toulouse 90, 411–428. González-Miguéns, R., Carmen, S.-Z., Villar, M. villar-dePablo, Todorov, M., Lara, E.,
Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., 2021. Multiple convergences in the evolutionary history of the testate amoeba family
Madden, T.L., 2009. BLAST+: Architecture and applications. BMC Bioinformatics 10. Arcellidae (Amoebozoa: Arcellinida: Sphaerothecina): when the ecology rules the
https://doi.org/10.1186/1471-2105-10-421. morphology. Zool. J. Linn. Soc. https://doi.org/https://doi.org/10.1093/
Chardez, D., 1960. Note sur les Thécamoebiens d’Otrange (Hesbaye) et découverte d’un zoolinnean/zlab074.
genere nouveau. Ann. la Société R Zool. Malacol. Belgique 91, 39–43. González-Miguéns, R., Soler-Zamora, C., Useros, F., Nogal-Prata, S., Berney, C., Blanco-
Chomczynski, P., Sacchi, N., 1987. Single-Step Method of RNA Isolation by Acid Rotea, A., Carrasco-Braganza, M.I., de Salvador-Velasco, D., Guillén-Oterino, A.,
Guanidinium Thiocyanate–Phenol–Chloroform Extraction. Anal. Biochem. 162, Tenorio-Rodríguez, D., Velázquez, D., Heger, T.J., Sanmartín, I., Lara, E., 2022.
156–159. https://doi.org/10.1006/abio.1987.9999. Cyphoderia ampulla(Cyphoderiidae: Rhizaria), a tale of freshwater sailors: The
Cockerell, T.D., 1911. The nomenclature of the Rhizopoda. Zool. Anz. 38, 136–137. causes and consequence of ecological transitions through the salinity barrier in a
Cockerell, T.D., 1909. New names for two genera of Protozoa. Zool. Anzriger 34, 565. family of benthic protists. Mol. Ecol. https://doi.org/https://doi.org/10.1111/
Coûteaux, M.M., Chardez, D., 1981. Thécamoebiens édaphiques et muscicoles de Guyane mec.16424.
Française. Rev. d’Écologie Biol. du Sol 18, 193–208. Gorospe, J.M., Monjas, D., Fernández-Mazuecos, M., 2020. Out of the Mediterranean
Coxall, H.K., Wilson, P.A., Pearson, P.N., Sexton, P.F., 2007. Iterative evolution of Region: Worldwide biogeography of snapdragons and relatives (tribe Antirrhineae,
digitate planktonic foraminifera. Paleobiology 33. https://doi.org/10.1666/ Plantaginaceae). J. Biogeogr. 47 https://doi.org/10.1111/jbi.13939.
06034.1. Green, J., 1975. Freshwater ecology in the Mato Grosso, central Brazil, IV: Associations
De Luca, D., Sarno, D., Piredda, R., Kooistra, W.H.C.F., 2019. A multigene phylogeny to of testate Rhizopoda. J. Nat. Hist. 9, 545–560.
infer the evolutionary history of Chaetocerotaceae (Bacillariophyta). Mol. Han, B.P., Wang, T., Xu, L., Lin, Q.Q., Jinyu, Z., Dumont, H.J., 2011. Carnivorous
Phylogenet. Evol. 140 https://doi.org/10.1016/j.ympev.2019.106575. planktonic Difflugia (Protista, Amoebina Testacea) and their predators. Eur. J.
Decloître, L., 1964. Rectification: Schoenbornia nov. gen. (Testacea). Limnologica 2, 336. Protistol. 47 https://doi.org/10.1016/j.ejop.2011.04.002.
Deflandre, G., 1953. Traité de Zoologie; anatomie, systématique, biologie 1. Heath, T.A., Zwickl, D.J., Kim, J., Hillis, D.M., 2008. Taxon sampling affects inferences of
Protozoaires : Rhizopodes, Actinopodes, Sporozoaires, Cnidosporidies. Masson and macroevolutionary processes from phylogenetic trees. Syst. Biol. https://doi.org/
Co., Paris. 10.1080/10635150701884640.
16
Heger, T.J., Pawlowski, J., Lara, E., Leander, B.S., Todorov, M., Golemansky, V., Losos, J.B., Jackman, T.R., Larson, A., De Queiroz, K., Rodríguez-Schettino, L., 1998.
Mitchell, E.A.D., 2011. Comparing potential COI and SSU rDNA barcodes for Contingency and determinism in replicated adaptive radiations of island lizards.
assessing the diversity and phylogenetic relationships of cyphoderiid testate Science (80-) 279. https://doi.org/10.1126/science.279.5359.2115.
amoebae (Rhizaria: Euglyphida). Protist 162. https://doi.org/10.1016/j. Macumber, A.L., Blandenier, Q., Todorov, M., Duckert, C., Lara, E., Lahr, D.J.G.,
protis.2010.05.002. Mitchell, E.A.D., Roe, H.M., 2020. Phylogenetic divergence within the Arcellinida
Heritage, S., 2021. MBASR: Workflow-simplified ancestral state reconstruction of (Amoebozoa) is congruent with test size and metabolism type. Eur. J. Protistol. 72
discrete traits with MrBayes in the R environment. bioRxiv. https://doi.org/10.1016/j.ejop.2019.125645.
Huelsenbeck, J.P., Larget, B., Alfaro, M.E., 2004. Bayesian phylogenetic model selection Marcisz, K., Jassey, V.E.J., Kosakyan, A., Krashevska, V., Lahr, D.J.G., Lara, E.,
using reversible jump Markov chain Monte Carlo. Mol. Biol. Evol. 21 https://doi. Lamentowicz, Ł., Lamentowicz, M., Macumber, A., Mazei, Y., Mitchell, E.A.D.,
org/10.1093/molbev/msh123. Nasser, N.A., Patterson, R.T., Roe, H.M., Singer, D., Tsyganov, A.N., Fournier, B.,
Iczn, 1999. International Code of Zoological Nomenclature (ICZN). International 2020. Testate Amoeba Functional Traits and Their Use in Paleoecology. Front. Ecol.
Commission on Zoological Nomenclature, London. Evol. https://doi.org/10.3389/fevo.2020.575966.
Jung, W., 1942. Südchilenische Thekamöben (Aus dem südchilenischen Küstengebiet, Mathers, T.C., Hammond, R.L., Jenner, R.A., Hänfling, B., Gómez, A., 2013. Multiple
Beitrag 10). Arch. für Protistenkd. 95, 253–356. global radiations in tadpole shrimps challenge the concept of “living fossils”. PeerJ
Kachovich, S., Sheng, J., Aitchison, J.C., 2019. Adding a new dimension to investigations 2013. https://doi.org/10.7717/peerj.62.
of early radiolarian evolution. Sci. Rep. 9 https://doi.org/10.1038/s41598-019- Mazei, Y., Warren, A., 2012. A survey of the testate amoeba genus Difflugia Leclerc, 1815
42771-0. based on specimens in the E. Penard and C. G. Ogden collections of the natural
Kalyaanamoorthy, S., Minh, B.Q., Wong, T.K.F., Von Haeseler, A., Jermiin, L.S., 2017. History Museum, London. Part 1: species with shells that are pointed aborally and/or
ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods have aboral protuberances. Protistology 7.
14. https://doi.org/10.1038/nmeth.4285. Medioli, F.S., Scott, D.B., 1983. Holocene Arcellacea (Thecamoebians) from Eastern
Kassambara, A., Mundt, F., 2020. Package ‘ factoextra .’ CRAN- R Packag. Canada. Cushman Found. Foraminifer. Res. Spec. Publ. 21, 1–63.
Katoh, K., Misawa, K., Kuma, K.I., Miyata, T., 2002. MAFFT: A novel method for rapid Meisterfeld, R., 2002. Order Arcellinida Kent, 1880, in: An Illustrated Guide to the
multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30 Protozoa. Society of Protozoologists, Lawrence, Kansas, U.S.A, pp. 827–860.
https://doi.org/10.1093/nar/gkf436. Mulot, M., Marcisz, K., Grandgirard, L., Lara, E., Kosakyan, A., Robroek, B.J.M.,
Keck, F., Rimet, F., Bouchez, A., Franc, A., 2016. Phylosignal: An R package to measure, Lamentowicz, M., Payne, R.J., Mitchell, E.A.D., 2017. Genetic Determinism vs.
test, and explore the phylogenetic signal. Ecol. Evol. 6 https://doi.org/10.1002/ Phenotypic Plasticity in Protist Morphology. J. Eukaryot. Microbiol. 64 https://doi.
ece3.2051. org/10.1111/jeu.12406.
Koenig, I., Christinat, K., D’inverno, M., Mitchell, E.A.D., 2018. Impact of two hot and Muñoz, M.M., Stimola, M.A., Algar, A.C., Conover, A., Rodriguez, A.J., Landestoy, M.A.,
dry summers on the community structure and functional diversity of testate amoebae Bakken, G.S., Losos, J.B., 2014. Evolutionary stasis and lability in thermal
in an artificial bog, illustrating their use as bioindicators of peatland health. Mires physiology in a group of tropical lizards. Proc. R. Soc. B Biol. Sci. 281 https://doi.
Peat 21. https://doi.org/10.19189/MaP.2018.OMB.327. org/10.1098/rspb.2013.2433.
Korganova, G.A., 1987. Apolimia gen n, a new genus of soil-dwelling testate amoebae Nasser, N.A., Gregory, B.R.B., Singer, D., Patterson, R.T., Roe, H.M., 2021. Erugomicula,
from the Western Samoa Islands and some remarks on the composition of the family a new genus of arcellinida (Testate lobose amoebae). Palaeontol. Electron. 24
Hyalospheniidae Arcellinida. Zool. Zhurnal 662, 165–169. https://doi.org/10.26879/807.
Kosakyan, A., Gomaa, F., Lara, E., Lahr, D.J.G., 2016a. Current and future perspectives Nasser, N.A., Patterson, R.T., 2015. Conicocassis, a new genus of Arcellinina (testate
on the systematics, taxonomy and nomenclature of testate amoebae. Eur. J. Protistol. lobose amoebae). Palaeontol. Electron. 18 https://doi.org/10.26879/538.
55 https://doi.org/10.1016/j.ejop.2016.02.001. Nguyen, L.T., Schmidt, H.A., Von Haeseler, A., Minh, B.Q., 2015. IQ-TREE: A fast and
Kosakyan, A., Gomaa, F., Mitchell, E.A.D., Heger, T.J., Lara, E., 2013. Using DNA- effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol.
barcoding for sorting out protist species complexes: A case study of the Nebela Biol. Evol. 32 https://doi.org/10.1093/molbev/msu300.
tincta-collaris-bohemica group (Amoebozoa; Arcellinida, Hyalospheniidae). Eur. J. Nikolaev, S.I., Mitchell, E.A.D., Petrov, N.B., Berney, C., Fahrni, J., Pawlowski, J., 2005.
Protistol. 49 https://doi.org/10.1016/j.ejop.2012.08.006. The testate lobose amoebae (order Arcellinida Kent, 1880) finally find their home
Kosakyan, A., Heger, T.J., Leander, B.S., Todorov, M., Mitchell, E.A.D., Lara, E., 2012. within Amoebozoa. Protist 156. https://doi.org/10.1016/j.protis.2005.03.002.
COI Barcoding of Nebelid Testate Amoebae (Amoebozoa: Arcellinida): Extensive Ogden, C., 1983. The significance of the inner dividing wall in Pontigulasia Rhumbler
Cryptic Diversity and Redefinition of the Hyalospheniidae Schultze. Protist 163. and Zivkovicia gen. nov. (Protozoa: Rhizopoda). Protistologica 19, 215–229.
https://doi.org/10.1016/j.protis.2011.10.003. Ogden, C., 1979. Siliceous structures secreted by members of the subclass Lobosia
Kosakyan, A., Lahr, D.J.G., Mulot, M., Meisterfeld, R., Mitchell, E.A.D., Lara, E., 2016b. (Rhizopodea: Protozoa). Bull. Br. Museum 36, 203–207.
Phylogenetic reconstruction based on COI reshuffles the taxonomy of hyalosphenid Paradis, E., Schliep, K., 2019. Ape 5.0: An environment for modern phylogenetics and
shelled (testate) amoebae and reveals the convoluted evolution of shell plate shapes. evolutionary analyses in R. Bioinformatics 35. https://doi.org/10.1093/
Cladistics 32. https://doi.org/10.1111/cla.12167. bioinformatics/bty633.
Kudryavtsev, A., Hausmann, K., 2007. Spumochlamys iliensis ngn sp. (Testacealobosia, Penard, E., 1912. Notes sur quelques Sarcodinés. Rev. Suisse Zool. 20, 1–29.
Microchlamyiidae) from Central Asia, with notes on the diversity of Microchlamys- Penard, E., 1910. Rhizopodes nouveaux. Rev. Suisse Zool. 18, 929–940.
like testate amoebae. Eur. J. Protistol. 43, 185–191. Penard, E., 1902. Faune rhizopodique du bassin du Léman. Henry Kündig, Genéve.
Kudryavtsev, A., Pawlowski, J., Hausmann, K., 2009. Description and phylogenetic Penard, E., 1890. Études sur les Rhizopodes d’eau douce. Mémoires la Société Phys.
relationships of Spumochlamys perforata n. sp. and Spumochlamys bryora n. sp. d’Histoire Nat. Genève 31, 1–230.
(Amoebozoa, Arcellinida). J. Eukaryot. Microbiol. 56 https://doi.org/10.1111/ Perty, M., 1849. Mikroskopische Organismen der Alpen und der Italienischen Schweiz.
j.1550-7408.2009.00430.x. Mitth. der Naturforschenden Gesellschaft Bern 165, 153–176.
Lahr, D.J., 2021. An emerging paradigm for the origin and evolution of shelled amoebae, Peters, R.S., Krogmann, L., Mayer, C., Donath, A., Gunkel, S., Meusemann, K., Kozlov, A.,
integrating advances from molecular phylogenetics, morphology and paleontology. Podsiadlowski, L., Petersen, M., Lanfear, R., Diez, P.A., Heraty, J., Kjer, K.M.,
Mem. Inst. Oswaldo Cruz 116. https://doi.org/10.1590/0074-02760200620. Klopfstein, S., Meier, R., Polidori, C., Schmitt, T., Liu, S., Zhou, X., Wappler, T.,
Lahr, D.J.G., Kosakyan, A., Lara, E., Mitchell, E.A.D., Morais, L., Porfirio-Sousa, A.L., Rust, J., Misof, B., Niehuis, O., 2017. Evolutionary History of the Hymenoptera.
Ribeiro, G.M., Tice, A.K., Pánek, T., Kang, S., Brown, M.W., 2019. Phylogenomics Curr. Biol. 27 https://doi.org/10.1016/j.cub.2017.01.027.
and Morphological Reconstruction of Arcellinida Testate Amoebae Highlight Philippe, H., Sörhannus, U., Baroin, A., Perasso, R., Gasse, F., Adoutte, A., 1994.
Diversity of Microbial Eukaryotes in the Neoproterozoic. Curr. Biol. 29 https://doi. Comparison of molecular and paleontological data in diatoms suggests a major gap
org/10.1016/j.cub.2019.01.078. in the fossil record. J. Evol. Biol. 7 https://doi.org/10.1046/j.1420-
Lahr, D.J.G., Lara, E., Mitchell, E.A.D., 2012. Time to regulate microbial eukaryote 9101.1994.7020247.x.
nomenclature. Biol. J. Linn. Soc. https://doi.org/10.1111/j.1095-8312.2012.01962. Picelli, S., Faridani, O.R., Björklund, Å.K., Winberg, G., Sagasser, S., Sandberg, R., 2014.
x. Full-length RNA-seq from single cells using Smart-seq2. Nat. Protoc. 9 https://doi.
Lara, E., Heger, T.J., Ekelund, F., Lamentowicz, M., Mitchell, E.A.D., 2008. Ribosomal org/10.1038/nprot.2014.006.
RNA Genes Challenge the Monophyly of the Hyalospheniidae (Amoebozoa: Pinseel, E., Kulichová, J., Scharfen, V., Urbánková, P., Van de Vijver, B., Vyverman, W.,
Arcellinida). Protist 159. https://doi.org/10.1016/j.protis.2007.09.003. 2019. Extensive Cryptic Diversity in the Terrestrial Diatom Pinnularia borealis
Leander, B.S., 2008. A hierarchical view of convergent evolution in microbial eukaryotes, (Bacillariophyceae). Protist 170. https://doi.org/10.1016/j.protis.2018.10.001.
in. Journal of Eukaryotic Microbiology. https://doi.org/10.1111/j.1550- Porter, S.M., Knoll, A.H., 2000. Testate amoebae in the Neoproterozoic Era: evidence
7408.2008.00308.x. from vase-shaped microfossils in the Chuar Group, Grand Canyon. Paleobiology 26.
Leclerc, M., 1815. Note sur la Difflugie, nouveau genre de Polype amorph. Mémoires du https://doi.org/10.1666/0094-8373(2000)026<0360:taitne>2.0.co;2.
Muséum d’Histoire Nat. París 2, 474–478. Porter, S.M., Meisterfeld, R., Knoll, A.H., 2003. Vase-shaped microfossils from the
Leidy, J., 1879. Fresh-water Rhizopods of North America. Rep. United States Geol. Surv. Neoproterozoic Chuar Group, Grand Canyon: A classification guided by modern
Territ. 12, 1–324. testate amoebae. J. Paleontol. 77 https://doi.org/10.1017/s0022336000044140.
Leidy, J., 1877. Remarks upon Rhizopods, and notice of a new form. Proc. Acad. Nat. Sci. Rach, J., DeSalle, R., Sarkar, I.N., Schierwater, B., Hadrys, H., 2008. Character-based
Philadelphia, 3rd Ser. 29, 293–294. DNA barcoding allows discrimination of genera, species and populations in Odonata.
Leidy, J., 1874. Notice of some Rhizopods. Proc. Acad. Nat. Sci. Philadelphia, 3rd Ser. 26, Proc. R. Soc. B Biol. Sci. 275 https://doi.org/10.1098/rspb.2007.1290.
155–157. Revell, L.J., 2012. phytools: An R package for phylogenetic comparative biology (and
Loeblich, A.R.J., Tappan, H., 1961. Remarks on the systematics of the Sarkodina other things). Methods Ecol. Evol. 3 https://doi.org/10.1111/j.2041-
(Protozoa), renamed homonyms and new and validated genera. Proc. Biol. Soc. 210X.2011.00169.x.
Washington 74, 213–234. Rhumbler, L., 1895. Beiträge zur Kenntnis der Rhizopoden (Beitrag III, IV und V).
Zeitschrift für Wissenschaftliche Zool. 61, 38–110.
17
Ronquist, F., Teslenko, M., Van Der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Soler-Zamora, C., González-Miguéns, R., Guillén-Oterino, A., Lara, E., 2021. Arcellinida
Larget, B., Liu, L., Suchard, M.A., Huelsenbeck, J.P., 2012. Mrbayes 3.2: Efficient testate amoebae as climate miner’s canaries in Southern Spain. Eur. J. Protistol. 81
bayesian phylogenetic inference and model choice across a large model space. Syst. https://doi.org/10.1016/j.ejop.2021.125828.
Biol. 61 https://doi.org/10.1093/sysbio/sys029. Stefanoudis, P.V., Schiebel, R., Mallet, R., Durden, J.M., Bett, B.J., Gooday, A.J., 2016.
Ruedi, M., Mayer, F., 2001. Molecular systematics of bats of the genus Myotis Agglutination of benthic foraminifera in relation to mesoscale bathymetric features
(Vespertilionidae) suggests deterministic ecomorphological convergences. Mol. in the abyssal NE Atlantic (Porcupine Abyssal Plain). Mar. Micropaleontol. 123
Phylogenet. Evol. 21 https://doi.org/10.1006/mpev.2001.1017. https://doi.org/10.1016/j.marmicro.2015.12.005.
Ruggiero, A., Grattepanche, J.D., Weiner, A.K.M., Katz, L.A., 2020. High Diversity of Stein, S.F., 1859. Über die ihm aus eigener Untersuchung bekannt gewordenen
Testate Amoebae (Amoebozoa, Arcellinida) Detected by HTS Analyses in a New SüsswasserRhizopoden. Abhandlungen der Koniglische Bohm. Gesellschaft der
England Fen using Newly Designed Taxon-specific Primers. J. Eukaryot. Microbiol. Wissenschaften 5, 41–43.
67 https://doi.org/10.1111/jeu.12794. Szudarek-Trepto, N., Kazmierski, A., Dabert, J., 2021. Long-term stasis in acariform
Sahlin, K., Medvedev, P., 2020. De Novo Clustering of Long-Read Transcriptome Data mites provides evidence for morphologically stable evolution: Molecular vs.
Using a Greedy, Quality Value-Based Algorithm. Journal of Computational Biology. morphological differentiation in Linopodes (Acariformes; Prostigmata). Mol.
https://doi.org/10.1089/cmb.2019.0299. Phylogenet. Evol. 163 https://doi.org/10.1016/j.ympev.2021.107237.
Sahlin, K., Sipos, B., James, P.L., Medvedev, P., 2021. Error correction enables use of Todorov, M., Bankov, N., 2019. An Atlas of Sphagnum-Dwelling Testate Amoebae in
Oxford Nanopore technology for reference-free transcriptome analysis. Nat. Bulgaria. An Atlas of Sphagnum-Dwelling Testate Amoebae in Bulgaria. https://doi.
Commun. 12 https://doi.org/10.1038/s41467-020-20340-8. org/10.3897/ab.e38685.
Sánchez-Vialas, A., García-París, M., Ruiz, J.L., Recuero, E., 2020. Patterns of van Hengstrum, P.J., Reinhardt, E.G., Medioli, F.S., Gröcke, D.R., 2007. Exceptionally
morphological diversification in giant Berberomeloe blister beetles (Coleoptera: preserved Late Albian (Cretaceous) Arcellaceans (Thecamoebians) from the Dakota
Meloidae) reveal an unexpected taxonomic diversity concordant with mtDNA Formation near Lincoln, Nebraska. USA. J. Foraminifer. Res. 37 https://doi.org/
phylogenetic structure. Zool. J. Linn. Soc. 189 https://doi.org/10.1093/zoolinnean/ 10.2113/gsjfr.37.4.300.
zlz164. Vucetich, M.C., 1974. Comentarios criticos sobre Argynnia Jung, 1942 (Rhizopoda,
Sanderson, M.J., McMahon, M.M., Steel, M., 2010. Phylogenomics with incomplete Testacea). Neotropica 20, 126–128.
taxon coverage: The limits to inference. BMC Evol. Biol. 10 https://doi.org/ Wake, D.B., Wake, M.H., Specht, C.D., 2011. Homoplasy: From detecting pattern to
10.1186/1471-2148-10-155. determining process and mechanism of evolution. Science (80-). https://doi.org/
Schlumberger, P., 1845. Observations sur quelques nouvelles espèces d’infusoires de la 10.1126/science.1188545.
famille des Rhizopodes. Ann. des Sci. Nat. 3, 254–256. Wallich, G.C., 1864. XXVI.—On the extent, and some of the principal causes, of structural
Schneider, C.A., Rasband, W.S., Eliceiri, K.W., 2012. NIH Image to ImageJ: 25 years of variation among the Difflugian Rhizopods. Ann. Magaz. Nat. History, Ser. 13,
image analysis. Nat. Methods. https://doi.org/10.1038/nmeth.2089. 215–245.
Schönborn, W., 1964. Bodenbewohnende Testaceen aus Deutschland. II. Untersuchungen West, G.S., 1901. On some British freshwater Rhizopods and Heliozoa. J. Linn. Soc.
in der Umgebung des Grossen Stechlinsees (Brandenburg). Limnologica 2, 491–499. London, Zool. 28, 308–342.
Schouteden, H., 1906. Les Rhizopodes testacés d’eau douce, d’aprés la Monographie du Wickham, H., 2016. ggplot2 Elegant Graphics for Data Analysis (Use R!). Springer.
Prof. A. Awerintzew. Ann. Biol. Lacustre 327–382. Wiens, J.J., 2005. Can incomplete taxa rescue phylogenetic analyses from long-branch
Schultze, F.E., 1877. Rhizopodenstudien VI: Archiv für mikroskopische. Anatomie 13, attraction? Syst. Biol. 54 https://doi.org/10.1080/10635150500234583.
9–30. Williams, D.D., Tavares, A.F., Bryant, E., 1987. Respiratory Device or Camouflage?: A
Sidlauskas, B., 2008. Continuous and arrested morphological diversification in sister Case for the Caddisfly. Oikos 50. https://doi.org/10.2307/3565400.
clades of characiform fishes: A phylomorphospace approach. Evolution (N. Y.) 62. Yang, J., Harding, T., Kamikawa, R., Simpson, A.G.B., Roger, A.J., 2017. Mitochondrial
https://doi.org/10.1111/j.1558-5646.2008.00519.x. genome evolution and a novel RNA editing system in deep-branching
Singh, V., Pandita, S.K., Tewari, R., Van Hengstum, P.J., Pillai, S.S.K., Agnihotri, D., heteroloboseids. Genome Biol. Evol. 9 https://doi.org/10.1093/gbe/evx086.
Kumar, K., Bhat, G.D., 2015. Thecamoebians (Testate Amoebae) straddling the Zumel, D., Buckley, D., Ron, S.R., 2021. The Pristimantis trachyblepharis species group, a
permian-triassic boundary in the Guryul Ravine Section, India: Evolutionary and clade of miniaturized frogs: description of four new species and insights into the
palaeoecological implications. PLoS One 10. https://doi.org/10.1371/journal. evolution of body size in the genus. Zool. J. Linn. Soc. https://doi.org/10.1093/
pone.0135593. zoolinnean/zlab044.
Snegovaya, N., Alekperov, I., 2009. New testate amoebae (Protozoa, testacea) from the
Northern-East Azerbaijan inland water bodies. Protistology.
18

1 s2.0 S1055790322001701 Main

Uploaded by

Copyright:

Available Formats

1 s2.0 S1055790322001701 Main

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

1 s2.0 S1055790322001701 Main

Uploaded by

Copyright:

Available Formats

Molecular Phylogenetics and Evolution 175 (2022) 107557

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

Deconstructing Difflugia: The tangled evolution of lobose testate amoebae

1. Introduction leading to homoplastic evolution of similar morphological adaptations

You might also like