Scribd
Upload
6 views4 pages

DAA La-3 0050

Uploaded by

Ramagopal Vemuri

This document contains code to solve two problems - finding the longest common subsequence between two strings, and finding the minimum cost of matrix chain multiplication. For longest common subsequence, it uses a dynamic programming approach with time complexity of O(m*n) where m and n are the lengths of the input strings. For matrix chain multiplication, it also uses dynamic programming with time complexity of O(n^3) where n is the number of matrices. The output provided analyzes the time complexities of the two algorithms.

Copyright:

© All Rights Reserved
Download as DOCX, PDF, TXT or read online from Scribd
Download as docx, pdf, or txt

DAA La-3 0050

Uploaded by

Ramagopal Vemuri
6 views4 pages
This document contains code to solve two problems - finding the longest common subsequence between two strings, and finding the minimum cost of matrix chain multiplication. For longest common subsequence, it uses a dynamic programming approach with time complexity of O(m*n) where m and n are the lengths of the input strings. For matrix chain multiplication, it also uses dynamic programming with time complexity of O(n^3) where n is the number of matrices. The output provided analyzes the time complexities of the two algorithms.

Original Description:

digital assignment

Original Title

DAA la-3 0050 (2)

Copyright

© © All Rights Reserved

Available Formats

DOCX, PDF, TXT or read online from Scribd

Did you find this document useful?

Is this content inappropriate?

This document contains code to solve two problems - finding the longest common subsequence between two strings, and finding the minimum cost of matrix chain multiplication. For longest common subsequence, it uses a dynamic programming approach with time complexity of O(m*n) where m and n are the lengths of the input strings. For matrix chain multiplication, it also uses dynamic programming with time complexity of O(n^3) where n is the number of matrices. The output provided analyzes the time complexities of the two algorithms.

Copyright:

© All Rights Reserved
Download as DOCX, PDF, TXT or read online from Scribd
Download as docx, pdf, or txt
6 views4 pages

DAA La-3 0050

Uploaded by

Ramagopal Vemuri
This document contains code to solve two problems - finding the longest common subsequence between two strings, and finding the minimum cost of matrix chain multiplication. For longest common subsequence, it uses a dynamic programming approach with time complexity of O(m*n) where m and n are the lengths of the input strings. For matrix chain multiplication, it also uses dynamic programming with time complexity of O(n^3) where n is the number of matrices. The output provided analyzes the time complexities of the two algorithms.

Copyright:

© All Rights Reserved
Download as DOCX, PDF, TXT or read online from Scribd
Download as docx, pdf, or txt
You are on page 1/ 4

DAA

21BBS0050 LAB DA -3
R. ADIHTYA PAVAN

1.
#include <iostream>

#include <vector>

#include <algorithm>

using namespace std;

int longestCommonSubsequence(string s1, string s2, string& lcs) {

int m = s1.length();

int n = s2.length();

vector<vector<int>> dp(m + 1, vector<int>(n + 1, 0));

for (int i = 1; i <= m; i++) {

for (int j = 1; j <= n; j++) {

if (s1[i - 1] == s2[j - 1]) {

dp[i][j] = dp[i - 1][j - 1] + 1;

} else {

dp[i][j] = max(dp[i - 1][j], dp[i][j - 1]);

int length = dp[m][n];

lcs.resize(length);

int i = m, j = n;
while (i > 0 && j > 0) {

if (s1[i - 1] == s2[j - 1]) {

lcs[length - 1] = s1[i - 1];

i--;

j--;

length--;

} else if (dp[i - 1][j] > dp[i][j - 1]) {

i--;

} else {

j--;

return dp[m][n];

int main() {

string s1 = "ACCGGTCGATGCGGGAACATAAC";

string s2 = "GTCGTTACC";

string lcs;

int result = longestCommonSubsequence(s1, s2, lcs);

cout << "The length of the longest common subsequence is: " << result << endl;

cout << "The longest common subsequence is: " << lcs << endl;

return 0;

OUTPUT:
The overall time complexity O(m * n), indicating a linear relationship between the input sizes and the time
required to compute the longest common subsequence.

2)

#include <iostream>

#include <climits>

#include <vector>

using namespace std;

int matrixChainMultiplication(vector<int>& dimensions) {

int n = dimensions.size() - 1;

vector<vector<int>> dp(n, vector<int>(n, 0));

for (int len = 2; len <= n; len++) {

for (int i = 0; i < n - len + 1; i++) {

int j = i + len - 1;

dp[i][j] = INT_MAX;

for (int k = i; k < j; k++) {

int cost = dp[i][k] + dp[k + 1][j] + dimensions[i] * dimensions[k + 1] * dimensions[j + 1];


if (cost < dp[i][j])

dp[i][j] = cost;

return dp[0][n - 1];

int main() {

vector<int> dimensions = {4, 10, 3, 12, 20, 7};

int minimumCost = matrixChainMultiplication(dimensions);

cout << "Minimum cost of matrix chain multiplication: " << minimumCost << endl;

return 0;

Output:

The time complexity is O(n^3), indicating a cubic relationship between the number of matrices and the time
required to compute the minimum cost of matrix chain multiplication.

You might also like