Archives of Oral Biology 149 (2023) 105655

Contents lists available at ScienceDirect

Archives of Oral Biology

journal homepage: www.elsevier.com/locate/archoralbio

Identification of the antibacterial action mechanism of curcumin on

Streptococcus mutans through transcriptome profiling
Li Ke a, 1, Jiajun Wang b, c, d, 1, Yanhua Liu e, Zhongyi Sun a, Yirong Li b, c, d, *, Xiao Xiao b, c, d, *
a
Department of Critical Care Medicine, Zhongnan Hospital of Wuhan University, Wuhan, China
b
Department of Laboratory Medicine, Zhongnan Hospital of Wuhan University, Wuhan, China
c
Hubei Engineering Center for Infectious Disease Prevention, Control and Treatment, Wuhan, China
d
Wuhan Research Center for Infectious Diseases and Tumors of the Chinese Academy of Medical Science, Wuhan, China
e
Department of clinical laboratory, Hospital of China University of Geosciences, Wuhan, China

A R T I C L E I N F O A B S T R A C T

Keywords: Objective: The purpose of this study was to explore the effect and mechanism responsible for how curcumin
Streptococcus mutans affects the biofilm formation by Streptococcus mutans (S. mutans).
Biofilm Design: The antibacterial activity of curcumin was evaluated by measuring the minimum inhibitory concentration
Curcumin
(MIC) and the minimum bactericidal concentration (MBC). The mass of the biofilm was measured by crystal
Dental caries
violet staining. Transcriptome sequencing was used to obtain all the transcript information associated with the
biological activity of curcumin-treated S. mutans. Real-time quantitative PCR (qRT-PCR) was performed to
examine the expression levels of related biofilm formation genes.
Results: The MIC value for curcumin was 64 μM. Curcumin inhibited the formation of a biofilm by S. mutans and
degraded mature biofilms. A gene ontology enrichment analysis showed that the DEGs were significantly rele­
vant to biofilm formation. In addition, 17 significantly enriched Kyoto Encyclopedia of Genes and Genomes
pathways (p ≤ 0.01) were identified and were potentially associated with the biochemical metabolic processes of
S. mutans. DEGs associated with the biofilm formation of S. mutants, including gtfB, gtfC, rgpG, spaP, spxA1,
spxA2, bacA, lrgB, and gshAB. The qRT-PCR results were consistent with transcriptome sequencing that the
expression levels of gtfB, gtfC, rgpG, and spaP significantly decreased in the curcumin-treated group, whereas the
expression levels of spx1, spx2, bacA, lrgB, and gshAB were up-regulated.
Conclusions: Curcumin showed marked inhibitory effects against the formation of biofilms by S. mutans and
degradation of formed biofilms.

1. Introduction of microbial biofilms on the surface of teeth, restorative materials, or­

thodontics appliances, dental implants, and others (Lemos, PP. 3, - et al.,
Dental caries is an acid by-product produced by bacterial fermenta­ 2019, 0051, 2018). Streptococcus mutans (S. mutans), a natural and major
tion of dietary carbohydrates, which causes local damage to the tough inhabitant of the human oral cavity (more specifically, dental plaque),
tissues of susceptible teeth (Pitts et al., 2017). Its aetiology involves has long been recognized as the major pathogen most closely associated
complex interactions of multiple predisposing factors (Selwitz et al., with dental caries (Simon-Soro & Mira, 2015). This depends mainly on
2007). Dental caries is the most common infectious dental disease. Its its ability to (a) produce glycosyltransferase, an enzyme that results in
development is a complex process, mainly dependent on the formation the production of both insoluble and soluble dextran, thus promoting

Abbreviations: S. mutans, Streptococcus mutans; DEGs, differentially expressed genes; BHI, brain heart infusion; BHIS, brain heart infusion with 1% sucrose; CFU,
colony-forming units; PBS, phosphate-buffered saline; MIC, minimum inhibitory concentration; MBC, minimum bactericidal concentration; KEGG, Kyoto Encyclo­
pedia of Genes and Genomes; GO, gene ontology; qRT-PCR, real-time quantitative PCR; EPS, extracellular polysaccharide; CO2, carbon dioxide; DMSO, dimethyl
sulfoxide; S.D, standard deviation; PCA, principal component analysis; H₂O₂, hydrogen peroxide; eDNA, extracellular DNA.
* Correspondence to: Department of Laboratory Medicine, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071, China.
E-mail addresses: [email protected] (L. Ke), [email protected] (J. Wang), [email protected] (Y. Liu), [email protected] (Z. Sun), liyirong838@
163.com (Y. Li), [email protected] (X. Xiao).
1
Contributed equally.

https://doi.org/10.1016/j.archoralbio.2023.105655
Received 28 November 2022; Received in revised form 11 February 2023; Accepted 13 February 2023
Available online 15 February 2023
0003-9969/© 2023 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
L. Ke et al. Archives of Oral Biology 149 (2023) 105655

Fig. 1. (A) Curcumin inhibits the formation of biofilms by S. mutans. Cultures of S. mutans were inoculated into the wells of 96-well plates. The curcumin groups were
treated with (0.5, 1, 2, 4, 8, 16, 32, or 64 μM) for 24 h, respectively. Biofilms were then measured by a crystal violet staining assay (n = 3, compared with one-way
ANOVA). (B) Curcumin disrupts mature S. mutans biofilms. Biofilms were formed by culturing S. mutans for three days. On the last day, the medium was refreshed
and supplemented with curcumin (0.5, 1, 2, 4, 8, 16, 32, or 64 μM) for 24 h. Biofilms were then measured by crystal violet staining assays (n = 3, compared with one-
way ANOVA and Dunnett’s test). Data are presented as the mean ± SD. * **p < 0.001; * *p < 0.01; *p < 0.05 when comparing the values between the control
(absence of curcumin) and curcumin groups.

the formation of oral biofilms on the surface of the teeth; (b) metabolize was confirmed in pure culture. The bacterial solution was adjusted to 1
a variety of carbohydrates into organic acids, reduce the pH of the oral × 108 CFU/ml and diluted 10-fold (1 × 107 CFU/ml) for the experiment.
environment; (c) can be grown at a pH below 5.5, which is the threshold Biofilms were formed in BHI with 1 % sucrose (1 % BHIS).
pH at which the tooth begins to dissolve and demineralize (Krzysciak
et al., 2014a; Lin et al., 2021). 2.2. Minimum inhibitory concentration (MIC) and minimum bactericidal
In clinical practice, preventive and preservation approaches have concentration (MBC)
been a mainstay in the management of dental caries. Fluoride toothpaste
is the most effective intervention for preventing the development of The minimum inhibitory concentration (MIC) and minimum bacte­
dental caries at home (Cheng et al., 2022). Dental caries is treated by ricidal concentration (MBC) were used to evaluate the antimicrobial
removing contaminated and demineralized dental tissue (Cheng et al., activity of curcumin against S. mutans. The curcumin was dissolved in
2022). dimethyl sulfoxide (DMSO) and diluted in BHI before use. 100 μL diluted
As public awareness of oral health care has increased recently, some S. mutans (1 × 106 CFU/ml) solution mixed with 100 μL curcumin was
compounds from natural foods have been assessed as alternative stra­ inoculated into a 96-well round-bottom plate and incubated overnight at
tegies for preventing dental caries. Among the compounds examined, 37 ◦ C in an atmosphere of 5 % CO2. The final concentration of curcumin
curcumin, a phenolic compound derived from Curcuma longa, has been ranged with different concentrations (1, 2, 4, 8, 16, 32, 64, 128, 256,
a subject of interest. Turmeric is used as a pigment in various foodstuffs 512 μM). The corresponding concentrations of DMSO were used as
(Tsuda, 2018). Studies have shown that curcumin can exert various control. Three parallel samples were prepared at each concentration.
beneficial pharmacological effects on human diseases, including The resulting samples were incubated at 37 ◦ C and 5 % CO2 for 24 h. The
anti-oxidation, anti-inflammation, anti-coagulation, lipid-lowering, MIC was defined as the lowest dilution required to achieve no turbidity
anti-arteriosclerosis, anti-aging, elimination of free radicals elimination, after incubation. The adjusted inoculum was spread evenly over the BHI
and inhibiting the growth of certain types of tumors (Khorsandi et al., medium. Colonies were incubated at 37 ◦ C and in an atmosphere of 5 %
2019). Previous studies have shown that polysaccharide nanoparticles CO2 for 24 h. The samples were then diluted and counted by a plate
loaded with curcumin have antimicrobial properties against S. mutans colony count. The minimum dilution capable of killing 99.9 % of the
(Maghsoudi et al., 2017). It has also been demonstrated that the binding S. mutans cells was defined as MBC. Three independent experiments
of curcumin to EDTA through photodynamic inactivation strongly in­ were performed for MIC and MBC.
hibits S. mutans in planktonic cultures (Nima et al., 2021). This finding is
supported by a clinical study showing that in association with blue LED,
curcumin significantly reduces the number of colony-forming units 2.3. Effect of the curcumin on S. mutans biofilm formation
(CFU) (Panhoca et al., 2016). However, the specific mechanism
responsible for how curcumin inhibits the action of S. mutans has yet to Crystal violet staining assays were performed to assess the inhibitory
be studied in detail. Therefore, this study aimed to investigate the effect of curcumin on oral biofilm formation. S. mutans solution (1 × 108
mechanism responsible for how curcumin inhibits S. mutans via a tran­ CFU/ml) was shaken at 220 rpm/h and cultured for 16 h. Then was
scriptome analysis. diluted 10-fold (1 × 107 CFU/ml), inoculated into a 96-well flat plate,
and incubated in 1 % BHIS. The experimental groups were 200 μL ali­
2. Materials and methods quots of cultures of S. mutans that had been treated with 0.5, 1, 2, 4, 8,
16, 32, and 64 μM curcumin, respectively. The corresponding concen­
2.1. Bacterial strains and culture conditions trations of DMSO were used as control. Samples were grown at 37 ◦ C in 5
% CO2 for 24 h. The culture medium was removed, and the wells were
The S. mutans strain UA159 used was obtained from Zhongnan gently washed with phosphate-buffered saline (PBS). Then, tap the
Hospital of Wuhan University. It was cultured in brain heart infusion miniature plate vigorously on a napkin to remove excess liquid and air
(BHI) broth medium at 37 ◦ C with a 5 % carbon dioxide (CO2) anaerobic dry. Subsequently, 0.1 % crystal violet was added to the well, and the
atmosphere, observed after 24 h. The colonies were collected and resulting mixture was incubated at room temperature for 15 min and
incubated into the BHI culture solution after the bacterial morphology washed twice with PBS. After adding 33 % acetic acid, the sample was
incubated at room temperature for 30 min. The optical density at 630

2
L. Ke et al. Archives of Oral Biology 149 (2023) 105655

Table 1
Nucleotide sequence of primers used for qRT-PCR.
Gene Primer sequence (5′ − 3′ )

Forward Reverse

16S RNA AGCGTTGTCCGGATTTATTG CTACGCATTTCACCGCTACA

gtfB TTAACTACACTTTCGGGTGGCTTGG TCTTGCTTAGATGTCGCTTCGGTTG
gtfC CCAAAATGGTATTATGGCTGTCG GAGTCTCTATCAAAGTAACGCAGT
spaP GGAGTGCGAGTAAGGAAGCTGAAC CATCGGCATCTTGGACAACATTGAC
rgpG TGCTTGCTATGGGATTCACTCATCG TTCCAAAGCAAAGGCAACACCAATC
spxA1 GATGACAAGCGTCTTCAGATAGG TAAAGCTGCCCGTAAACGAG
spxA2 TTGCTTCGCCGTCCTATTATCATGG TCTTCTCCCTCAACTTCCGCTCTG
lrgB CCTCCCTATTGCTCACGCTATCG ACCTAAGCCAACACCGATTTCACTC
gshAB GCTCAGACACCTCATCCAACAGTAC GAGCGACAGGCGTGATTAGTTCC
bacA AACAGGTACAAGTCAGTGGACACAG CCAGCAGCAAAATCTTGAGCCATG

nm was measured using a spectrophotometer to quantify the inhibitory (qRT-PCR). The experimental approach is the same as in transcriptome
effect of curcumin on oral biofilm formation. Three individual experi­ analysis. The SYBR reaction mix was used for qRT-PCR in the Light­
ments were performed. Cycler96 Real-Time PCR Detection System (Hoffmann-La Roche Ltd.,
Shanghai, China). Three independent experiments were performed. The
2.4. Effect of the curcumin on S. mutans biofilm degradation primer sequences used in the experiment are listed in Table 1.

Biofilms were produced by culturing S. mutans (1 × 107 CFU/ml) for 2.7. Statistical analysis
48 h in 1 % BHIS on a 96-well flat plate. The medium was refreshed
every day. The mature biofilms were incubated with gradient concen­ Data are presented as the mean ± standard deviation (S.D) for each
trations of curcumin (0.5, 1, 2, 4, 8, 16, 32, or 64 μM) for an additional group. The homogeneity of variance test was performed using the
24 h at 37 ◦ C in an atmosphere of 5 % CO2. The corresponding con­ Brown-Forsythe test. Normal distribution was checked by the Shapir­
centrations of DMSO were used as control. Biofilm degradation was o–Wilk test which confirmed that the data presented a normal distri­
measured using a crystal violet staining assay. Three individual exper­ bution (p > 0.05). One-way analysis of variance (ANOVA) and
iments were performed. Dunnett’s test were performed for multiple groups. An unpaired t-test
was performed for two groups. GraphPad Prism version 8.0 (GraphPad
2.5. Transcriptome analysis Software, San Diego, CA) and R software version 4.2.0 (Vienna, Austria)
were used to perform all statistical analyses and drawings. P-values＜
Three independent experiments were performed on curcumin- 0.05 were considered to be statistically significant.
treated S. mutans and the control group. Curcumin at a concentration
of 16 μM strongly inhibited biofilm formation by about 80 % (Fig. 1). 3. Results
Therefore, 16 μM was considered an appropriate concentration for
transcriptome analysis. S. mutans solution was shaken at 220 rpm/h and 3.1. Curcumin inhibits the growth of S. mutans
cultured for 16 h. Then was diluted 10-fold (1 × 107 CFU/ml) and
inoculated into 6-well plates. The experimental groups were 2 ml ali­ The MIC for curcumin was identified at concentrations of 64 μM. In
quots of cultures of S. mutans and treated with 16 μM curcumin for 24 h. addition, even when the concentration of curcumin reached 512 μM, the
The corresponding concentrations of DMSO were used as control. The growing number of S. mutans was still 1.0 × 106 CFU/ml, indicating that
culture medium was removed, and the wells were washed three times curcumin does not inhibit the growth of S. mutans.
with sterile PBS. The biofilm is then collected using a cell scraper. Total
RNA was extracted from S. mutans using RNA Isolator Total RNA 3.2. Curcumin inhibited the S. mutans from forming the biofilm and
Extraction Reagent (Vazyme, R401-01). Ribosomal RNA was removed degraded mature biofilms
using a Ribo-zero™ magnetic kit (Epicentre) following the recom­
mended instructions. The remaining messenger RNA was then frag­ Biofilm formation was investigated using a crystal violet staining
mented, and the cDNA was reverse transcribed and purified with the assay. As shown in Fig. 1 A, biofilm formation in S. mutans decreased
RNA-Seq sample preparation kit (Illumina, San Diego, USA). The puri­ with increasing concentration of curcumin, suggesting that curcumin
fied double-stranded cDNA was repaired, a tail was added, and the may inhibit biofilm formation in S. mutans. The higher the concentra­
sequencing linker was ligated. The fragment size was then selected with tion, the more pronounced biofilm suppression. Biofilm formation was
AMPure XP beads, and the final cDNA library was enriched by PCR. The significantly inhibited by 35.6 % when the concentration of curcumin
library was prepared and sequenced on the Illumina Novaseq platform was 1 μM (p < 0.05).
in paired-end mode. The volcano map was drawn using the ‘‘ggplot2′ ’ Since curcumin could inhibit biofilm formation in S. mutans, we
package in R. The heatmaps and MA plot of the differentially expressed performed additional experiments to determine whether curcumin can
genes (DEGs) were drawn using the ‘‘DESeq’’ package in R. The adjusted destroy previously formed biofilms. As shown in Fig. 1B, the absorbance
P value < 0.01 was defined as the selection criteria for DEGs. The DEGs decreased with increasing curcumin concentration. When the concen­
were analyzed using a gene set enrichment analysis of the Kyoto Ency­ tration of curcumin was 1 μM, the reduction of biofilm decreased by
clopedia of Genes and Genomes (KEGG) and gene ontology (GO) data­ 21.4 %, suggesting that the biofilm was significantly destroyed by cur­
base. The false discovery rate (FDR) < 0.01 was set as a significant cumin. These results confirm that curcumin inhibits biofilm formation
difference. A P value< 0.05 was set as the threshold for GO and KEGG and significantly disrupts biofilm formation by S. mutans.
analysis.
3.3. RNA-Seq and analysis of DEGs
2.6. Analysis of gene expression by real-time quantitative PCR
Since 16 μM curcumin resulted in the significant inhibition of the
The expression of DEGs was evaluated by real-time quantitative PCR biofilm formation caused by S. mutans, S. mutans treated with 16 μM

3
L. Ke et al. Archives of Oral Biology 149 (2023) 105655

control and curcumin groups were screened based on an adjusted

p < 0.01. As shown in the volcano plot, heatmap, and MA plot in Fig. 3,
357 genes were upregulated, and 390 were downregulated.

3.4. Function enrichment analysis

DEGs were functionally annotated using GO and KEGG enrichment

analysis. The GO enrichment analysis of the molecular function, bio­
logical process, and cellular component indicated that these DEGs are
involved, most of which were significantly relevant to the biofilm for­
mation, enriched in translation in the subset of biological process,
enriched in the plasma membrane in the subset of cellular component,
and enriched in RNA binding in the subset of molecular function (Fig. 4).
In addition, 17 significantly enriched KEGG pathways were identified
Fig. 2. Principal component analysis (PCA) of S. mutans biofilms treated with and were found to be potentially associated with the biochemical
curcumin. The first principal component is represented by the x-axis, while the
metabolic processes of S. mutans, such as pyruvate metabolism, glycol­
y-axis represents the second principal component. The distance between data
ysis/gluconeogenesis, cysteine and methionine metabolism, thiamine
points provides a relative measure of similarity among the data sets, with closer
data points being more similar.
metabolism and glycine, serine, and threonine metabolism (Fig. 5).
Some of these pathways, particularly glycolysis/glucogenesis and py­
ruvate metabolism, are crucial for biofilm formation.
curcumin and those under control conditions were further subjected to a
transcriptome analysis to observe genome-wide changes in gene
expression induced by curcumin. A principal component analysis (PCA) 3.5. Transcriptome analysis of differentially expressed genes
showed that all biological replicates were grouped, indicating that gene
expression was significantly affected by the curcumin treatment S. mutans form biofilms through two independent mechanisms,
compared with untreated samples, which explains the 83.513 % vari­ sucrose-dependent and sucrose-independent pathways, respectively
ance observed in the complete data set (Fig. 2). The DEGs between the (Krzysciak et al., 2014b). The sucrose-dependent mechanism is based on
the glycosyltransferase (gtfB, gtfC, and gtfD) produced by S. mutans and

Fig. 3. Identification of DEGs between control and curcumin groups. (A) Volcano map of all DEGs. Red plots represent up-regulated genes. Green plots represent
down-regulated genes. Black plots represent normally expressed mRNAs. The DEGs were screened based on an adjusted P value < 0.01. (B) Heatmap of all DEGs. The
horizontal axis represents the sample, and the vertical axis represents different genes; the red color indicates increased gene expression, and the blue indicates
decreased gene expression. (C) MA plot of all DEGs. Red plots represent up-regulated genes. Green plots represent down-regulated genes. Black plots represent
normally expressed mRNAs. An adjusted P value < 0.01 was considered statistically significant. (For interpretation of the references to color in this figure legend, the
reader is referred to the web version of this article.)

4
L. Ke et al. Archives of Oral Biology 149 (2023) 105655

Fig. 4. GO enrichment analysis of DEGs. The screening criteria was P value < 0.05. (A) The biological process of DEGs. (B) The cellular component of DEGs. (C) The
molecular function of DEGs.

the glucan-binding protein (GBP) (Bowen & Koo, 2011a). 4. Discussion

Sucrose-independent mechanisms are guided by the recognition of
specific substrates and the adhesion of surface adhesins, such as SpaP Dental caries is one of the most common oral diseases in the world. It
(Loimaranta et al., 2005). To further explore more genes that might be is caused by the biofilm formed by bacteria and adheres to the surface of
related to biofilms of S. mutans and to better understand the mechanisms teeth. Effective elimination of the cariogenic biofilm and its pathogenic
responsible for the inhibitory effect of curcumin, we summarized the microorganisms is crucial to preventing dental caries. S. mutans, the
DEGs based on the transcriptome sequencing results. As shown in main pathogenic microorganism associated with biofilms, plays a vital
Table 2, the expression levels of gtfC, gtfB, rgpG, and spaP were role in the occurrence and development of dental caries due to its strong
down-regulated in the curcumin-treated group, while the transcription capacity to produce acids (Bowen, 2016). Curcumin is a potent anti­
levels of spx1, spx2, bacA, lrgB, and gshAB were up-regulated. bacterial agent. A systematic review of 12 studies has shown that cur­
cumin has significant anti-caries effects. It can reduce the production of
3.6. Effect of curcumin on biofilm formation related genes of S. mutans biofilm extracellular polysaccharides (EPS), alter biofilm structure, and
have an anti-adhesion effect against S. mutans (Ehteshami et al., 2021).
As shown in Fig. 6, compared to the control group, the expression All these curcumin effects suggest that curcumin has great potential for
levels of gtfB, gtfC, rgpG, and spaP were all significantly decreased in the treating dental caries. However, a comprehensive transcriptome anal­
curcumin-treated group, and the expression levels of spx1, spx2, bacA, ysis of curcumin-treated biofilms has yet to be performed. Therefore, in
lrgB, and gshAB were up-regulated (All p values ＜0.05). this study, we mainly explored the genetic mechanism by which cur­
cumin affects the biofilm of S. mutans.

5
L. Ke et al. Archives of Oral Biology 149 (2023) 105655

Fig. 5. KEGG pathway enrichment analysis of DEGs. The screening criteria was P value < 0.05.

Table 2
9 differentially expressed genes.
id Name Annotation pval padj direction

SMU_1004 gtfB glucosyltransferase-I 6.29E-29 9.05E-28 down

SMU_1005 gtfC glucosyltransferase-SI 3.49E-08 1.40E-07 down
SMU_610 spaP cell surface antigen SpaP 3.72E-18 3.58E-17 down
SMU_246 rgpG glycosyl transferase N-acetylglucosaminyltransferase RgpG 3.64E-03 7.14E-03 down
SMU_2084c spxA1 transcriptional regulator Spx 7.94E-16 6.62E-15 up
SMU_1142c spxA2 transcriptional regulator Spx 4.43E-07 1.53E-06 up
SMU_574c lrgB hypothetical protein 7.27E-39 1.52E-37 up
SMU_267c gshAB bifunctional glutamate–cysteine ligase/glutathione synthetase 1.96E-77 1.47E-75 up
SMU_1342 bacA bacitracin synthetase 1 2.97E-10 1.60E-09 up

pval: p-value, padj: p-adjust value.

It should be noted here that curcumin rarely has antibacterial ac­ several biochemical metabolic processes, including pyruvate meta­
tivity against planktonic S. mutans based on the results of MIC (64 μM) bolism, glycolysis/gluconeogenesis, cysteine and methionine meta­
and MBC (> 512 μM). Consistent with previous studies, the MIC of bolism, thiamine metabolism, and glycine, serine, and threonine
curcumin against S. mutans was 125 μM to 375 μM (Hu et al., 2013; metabolism. Some of these pathways, especially glycolysis/gluconeo­
Nima et al., 2021; Song et al., 2012), and no inhibitory effect on the genesis and pyruvate metabolism, are vital for biofilm formation (Lei
growth of S. mutans in vitro was detected. However, our results clearly et al., 2021). In addition, the differential expressed genes associated
show that curcumin inhibits the formation of biofilms produced by with the biofilm formation of S. mutans were analyzed, including gtfB,
S. mutans and degrades formed biofilm. Consequently, curcumin appears gtfC, rgpG, spaP, spxA1, spxA2, bacA, lrgB, and gshAB. In particular, rgpG,
to be capable of degrading or reducing the synthesis of spxA1, spxA2, lrgB, gshAB, and bacA were found, for the first time, to be
biofilm-associated substances as well as inhibiting the survival of associated with the antibiofilm activity of curcumin.
S. mutans isolates in biofilms that are in a quiescent state (Li et al., 2020). RgpG is a cell envelope-associated protein related to S. mutans bio­
To further decode the genes involved in the biofilm activity of film formation (De A et al., 2017). RgpG, the first enzyme in the
S. mutans, transcriptome analysis was performed. The results showed rhamnose-containing glucose polymer (RGP) biosynthesis pathway, is
that DEGs were significantly relevant to biofilm formation, enriched in the major surface antigen of Streptococcus viridans responsible for
translation in the subset of biological process, enriched in the plasma different serotypes (Yamashita et al., 1999). A gene deficiency of rgpG
membrane in the subset of cellular component, and enriched in RNA results in a significant reduction in cell surface antigens and major de­
binding in the subset of molecular function. A KEGG function enrich­ fects in cell morphology and cell division without impairing growth
ment analysis showed that DEGs were potentially associated with (Bischer et al., 2020; De A et al., 2017). rgpG-deficient mutants display

6
L. Ke et al. Archives of Oral Biology 149 (2023) 105655

lengthened, the structure of the EPS was severely damaged, and the
biofilm thickness and the total number of bacteria were significantly
reduced. The results presented herein show that gshAB was upregulated
in the curcumin-treated group, indicating that curcumin inhibits biofilm
activity by producing less EPS caused by the elevated transcription of
gshAB.
As major particulates in the biofilm matrix, membrane vehicles play
a significant role in biofilm formation. S. mutans produces membrane
vehicles containing proteins and eDNA, enhancing biofilm formation
(Senpuku et al., 2019). Wen et al. (2021) reported that a deficiency of
bacA, a putative surfactin synthetase homolog, resulted in a significant
increase in membrane vehicle yield in S. mutans. In our study, the
transcripts of bacA in S. mutans that had been treated with curcumin
were increased, suggesting that curcumin reduces membrane vehicles
and disrupts the biofilm structure through bacA.
Fig. 6. Results of qRT-PCR to examine the gene expression of DEGs between Glycosyltransferases are essential enzymes that stimulate the for­
control and curcumin groups. Different gene expression levels were normalized mation of glucans to form sucrose by bacteria and play a vital role in
to the level of 16sRNA gene transcripts (n = 3, compared with the unpaired t- biofilm formation and the development of dental caries (Bowen & Koo,
test, *p < 0.05, **p < 0.01, ***p < 0.001). Data are presented as the 2011b). gtfB, -C, and -D appear to play distinct but overlapping roles in
mean ± SD. biofilm formation. gtfC is adsorbed by the enamel inside the biofilm,
while GtfB binds strongly to bacterial cells, thus promoting tight cell
long chains of swollen “Square” dividing cells and form fewer biofilms aggregation and enhancing biofilm cohesion. gtfD forms a soluble
regardless of the carbohydrate origin (De A et al., 2017). In the present polysaccharide rapidly metabolized and serves as a primer for gtfB
study, rgpG was downregulated in the curcumin-treated group, sug­ (Bowen & Koo, 2011b). In this study, gtfB and gtfC were found to be
gesting that curcumin affects cell division and reduces biofilm formation downregulated in the curcumin-treated group compared with the con­
by targeting rgpG. trol, which is consistent with previously reported results (Li et al., 2020),
In the oral environment, acid and oxidative stress are the main confirming the glycosyltransferases are key factors for biofilm formation
environmental challenges encountered by S. mutans (Galvao et al., of S. mutans and serve as vital targets of curcumin.
2015). Most strains of S. mutans are susceptible to the action of hydrogen S. mutans also produces a variety of high-affinity surface adhesins
peroxide (H₂O₂) produced through the metabolism of other species in and can form colonies even in the absence of sucrose (Nobbs et al.,
dental plaque, such as Streptococcus oxygens, or as an ingredient in oral 2009). One of the most widely studied adhesins is spaP, also known as
hygiene and dental bleaching products (Higuchi et al., 1999). Zheng P1, dual antigen I/II, or PAC (Nobbs et al., 2009). This
et al. (2011) reported that S. sanguinis produced hydrogen H₂O₂ as an multifunction-attachment factor mediates the attachment of bacteria to
antimicrobial agent to inhibit susceptible niche competitors such as the saliva of teeth through interactions with the host surface membrane
S. mutans during initial biofilm formation. Exposure to high levels of glycoprotein GP340 (Demuth & Irvine, 2002). Crowley et al. (1999)
H₂O₂ and its damaging breakdown products, hydroxyl and superoxide reported that a spaP-deficient mutant showed reduced binding to saliva
anions, can rapidly cause irreversible cell damage. Spx, including two or GP340-coated surfaces, aberrant biofilm formation, and reduced
homologues, SpxA1 and SpxA2, are responsible for the transcription of cariogenicity in a rat caries model relative to the wild-type. In the pre­
nearly all of the major activated oxidative stress response genes in sent study, the downregulation of spaP caused by curcumin is another
S. mutans (Baker et al., 2014; Ganguly et al., 2020; Kajfasz et al., 2017). vital reason for biofilm destruction.
In this study, SpxA1 and SpxA2 were elevated in the curcumin-treated
group, which could cause an increase in H₂O₂ production by the tran­ 5. Conclusion
scriptional activation of oxidative stress response genes, ultimately
resulting in biofilm degradation. Curcumin plays a vital role in inhibiting the formation of biofilms
lrgB, a component of the lrgAB operon, encodes proteins that appear and the destruction of already formed biofilms of S. mutans, suggesting
to prevent homo-oligomerization of CidAB, which is closely related to that curcumin is beneficial not only in preventing dental caries but also
the stress response of S. mutans (Rice & Bayles, 2008). Extracellular DNA in their treatment. In addition, Curcumin might inhibit the biofilm ac­
(eDNA) is an important biofilm matrix component required for biofilm tivity of S. mutans by regulating the expression of genes involved in
formation (Campoccia et al., 2021; Whitchurch et al., 2002). Studies biofilm formation. In conclusion, curcumin may be an alternative
have shown that the single inactivation of lrgB leads to increased cell treatment for dental caries or a useful anti-biofilm agent with a wide
lysis and the accumulation of eDNA in a biofilm, and lrgB knockout range of clinical applications.
mutants show increased biofilm accumulation (Beltrame et al., 2015;
Wang et al., 2019). These results suggest that the inhibition of biofilms Funding
by curcumin may be achieved by increasing the expression of lrgB and,
thus, reversing the regulation of eDNA. This work was supported by the Zhongnan Hospital of Wuhan Uni­
gshAB encodes a bifunctional enzyme that catalyzes the synthesis of versity, Science, Technology and Innovation Seed Fund (grant number.
glutathione, a major antioxidant in most aerobic organisms (Walker CXPY2020050); Translational Medicine and Interdisciplinary Research
et al., 2019). Glutathione has been reported to activate the expression of Joint Fund of Zhongnan Hospital of Wuhan University (grant number.
virulent genes and contribute to optimal biofilm formation (Ku & Gan, ZNJC202208), Key Research and Development Program of Hubei
2021). Zheng et al. (2013) reported that the gshAB in-frame deletion Province (grant number. 2022BCA019) and 2021 Hubei Provincial
strain of S. mutans was more sensitive to H₂O₂ but produced more EPS by Leading Public Health Talents Project (grant number:
up-regulating the expression of glycosyltransferases, causing the devel­ WSJKRC2022012).
opment of cellular clumps within either single- or dual-species biofilms.
Li et al. (2018) reported that curcumin could disrupt the structure of EPS CRediT authorship contribution statement
in the short term, reducing the biomass, total bacterial content, and
viable bacterial percentage of EPS. As the curcumin exposure time Li Ke: Conceptualization, Methodology, Investigation, Writing -

7
L. Ke et al. Archives of Oral Biology 149 (2023) 105655

original draft, Writing - review & editing. Jiajun Wang: Methodology, of novel antioxidant pathways regulated by Spx. Scientific Reports, 7(1), 16018.
https://doi.org/10.1038/s41598-017-16367-5
Visualization, Writing – original draft. Yanhua Liu: Methodology,
Khorsandi, K., Hosseinzadeh, R., & Shahidi, F. K. (2019). Photodynamic treatment with
Writing – review & editing. Zhongyi Sun: Validation, Writing – review anionic nanoclays containing curcumin on human triple-negative breast cancer cells:
& editing. Yirong Li: Conceptualization, Writing – review & editing, Cellular and biochemical studies. Journal of Cellular Biochemistry, 120(4),
Supervision. Xiao Xiao: Conceptualization, Writing – review & editing, 4998–5009. https://doi.org/10.1002/jcb.27775
Krzysciak, W., Jurczak, A., Koscielniak, D., Bystrowska, B., & Skalniak, A. (2014a). The
Supervision. virulence of Streptococcus mutans and the ability to form biofilms. European Journal
of Clinical Microbiology & Infectious Diseases, 33(4), 499–515. https://doi.org/
10.1007/s10096-013-1993-7
Krzysciak, W., Jurczak, A., Koscielniak, D., Bystrowska, B., & Skalniak, A. (2014b). The
Conflict of interest virulence of Streptococcus mutans and the ability to form biofilms. European Journal
of Clinical Microbiology & Infectious Diseases, 33(4), 499–515. https://doi.org/
The authors declare that they have no conflicts of interest with the 10.1007/s10096-013-1993-7
Ku, J., & Gan, Y. H. (2021). New roles for glutathione: Modulators of bacterial virulence
contents of this article.
and pathogenesis. Redox Biology, 44, Article 102012. https://doi.org/10.1016/j.
redox.2021.102012
Data availability Lei, L., Zeng, J., Wang, L., Gong, T., Zheng, X., Qiu, W., Zhang, R., Yun, L., Yang, Y., &
Li, Y. (2021). Quantitative acetylome analysis reveals involvement of
glucosyltransferase acetylation in Streptococcus mutans biofilm formation.
The original data presented in the study are included in the article. Environmental Microbiology Reports, 13(2), 86–97. https://doi.org/10.1111/1758-
Further inquiries should be directed to the corresponding authors upon 2229.12907
reasonable request. Lemos, J. A., Palmer, S. R., Zeng, L., Wen, Z. T., Kajfasz, J. K., Freires, I. A., Abranches, J.,
& Brady, L. J. (2019). The biology of Streptococcus mutans. Microbiology Spectrum, 7
(1). https://doi.org/10.1128/microbiolspec.G
References Li, B., Li, X., Lin, H., & Zhou, Y. (2018). Curcumin as a promising antibacterial agent:
Effects on metabolism and biofilm formation in S. mutans. Biomed Research
International, 2018, 4508709. https://doi.org/10.1155/2018/4508709
Baker, J. L., Derr, A. M., Karuppaiah, K., MacGilvray, M. E., Kajfasz, J. K.,
Li, B., Pan, T., Lin, H., & Zhou, Y. (2020). The enhancing antibiofilm activity of curcumin
Faustoferri, R. C., Rivera-Ramos, I., Bitoun, J. P., Lemos, J. A., Wen, Z. T., &
on Streptococcus mutans strains from severe early childhood caries. BMC
Quivey, R. J. (2014). Streptococcus mutans NADH oxidase lies at the intersection of
Microbiology, 20(1), 286. https://doi.org/10.1186/s12866-020-01975-5
overlapping regulons controlled by oxygen and NAD+ levels. Journal of Bacteriology,
Lin, Y., Chen, J., Zhou, X., & Li, Y. (2021). Inhibition of Streptococcus mutans biofilm
196(12), 2166–2177. https://doi.org/10.1128/JB.01542-14
formation by strategies targeting the metabolism of exopolysaccharides. Critical
Beltrame, C. O., Cortes, M. F., Bonelli, R. R., Correa, A. B., Botelho, A. M., Americo, M. A.,
Reviews in Microbiology, 47(5), 667–677. https://doi.org/10.1080/
Fracalanzza, S. E., & Figueiredo, A. M. (2015). Inactivation of the autolysis-related
1040841X.2021.1915959
genes lrgB and yycI in Staphylococcus aureus increases cell lysis-dependent eDNA
Loimaranta, V., Jakubovics, N. S., Hytonen, J., Finne, J., Jenkinson, H. F., &
release and enhances biofilm development in vitro and in vivo. PLoS One, 10(9),
Stromberg, N. (2005). Fluid- or surface-phase human salivary scavenger protein
Article e138924. https://doi.org/10.1371/journal.pone.0138924
gp340 exposes different bacterial recognition properties. Infection and Immunity, 73
Bischer, A. P., Kovacs, C. J., Faustoferri, R. C., & Quivey, R. J. (2020). Disruption of l-
(4), 2245–2252. https://doi.org/10.1128/IAI.73.4.2245-2252.2005
Rhamnose biosynthesis results in severe growth defects in Streptococcus mutans.
Maghsoudi, A., Yazdian, F., Shahmoradi, S., Ghaderi, L., Hemati, M., & Amoabediny, G.
Journal of Bacteriology, 202(6). https://doi.org/10.1128/JB.00728-19
(2017). Curcumin-loaded polysaccharide nanoparticles: Optimization and
Bowen, W. H. (2016). Dental caries - not just holes in teeth! A perspective. Molecular
anticariogenic activity against Streptococcus mutans. Materials Science & Engineering
Oral Microbiology, 31(3), 228–233. https://doi.org/10.1111/omi.12132
C Materials for Biological Applications, 75, 1259–1267. https://doi.org/10.1016/j.
Bowen, W. H., & Koo, H. (2011a). Biology of Streptococcus mutans-derived
msec.2017.03.032
glucosyltransferases: Role in extracellular matrix formation of cariogenic biofilms.
Nima, G., Soto-Montero, J., Alves, L. A., Mattos-Graner, R. O., & Giannini, M. (2021).
Caries Research, 45(1), 69–86. https://doi.org/10.1159/000324598
Photodynamic inactivation of Streptococcus mutans by curcumin in combination
Bowen, W. H., & Koo, H. (2011b). Biology of Streptococcus mutans-derived
with EDTA. Dental Materials, 37(1), e1–e14. https://doi.org/10.1016/j.
glucosyltransferases: Role in extracellular matrix formation of cariogenic biofilms.
dental.2020.09.015
Caries Research, 45(1), 69–86. https://doi.org/10.1159/000324598
Nobbs, A. H., Lamont, R. J., & Jenkinson, H. F. (2009). Streptococcus adherence and
Campoccia, D., Montanaro, L., & Arciola, C. R. (2021). Extracellular DNA (eDNA). A
colonization. Microbiology and Molecular Biology Reviews, 73(3), 407–450. https://
major ubiquitous element of the bacterial biofilm architecture. International Journal
doi.org/10.1128/MMBR.00014-09
of Molecular Sciences, 22(16). https://doi.org/10.3390/ijms22169100
Panhoca, V. H., Florez, F., Batista, D. F. N. J., Rastelli, A. N., Tanomaru, J., Kurachi, C., &
Cheng, L., Zhang, L., Yue, L., Ling, J., Fan, M., Yang, D., Huang, Z., Niu, Y., Liu, J.,
Bagnato, V. S. (2016). Evaluation of antimicrobial photodynamic therapy against
Zhao, J., Li, Y., Guo, B., Chen, Z., & Zhou, X. (2022). Expert consensus on dental
Streptococcus mutans biofilm in situ. Journal of Contemporary Dental Practice, 17(3),
caries management. International Journal of Oral Science, 14(1), 17. https://doi.org/
184–191. https://doi.org/10.5005/jp-journals-10024-1825
10.1038/s41368-022-00167-3
Pitts, N. B., Zero, D. T., Marsh, P. D., Ekstrand, K., Weintraub, J. A., Ramos-Gomez, F.,
Crowley, P. J., Brady, L. J., Michalek, S. M., & Bleiweis, A. S. (1999). Virulence of a spaP
Tagami, J., Twetman, S., Tsakos, G., & Ismail, A. (2017). Dental caries. Nature
mutant of Streptococcus mutans in a gnotobiotic rat model. Infection and Immunity,
Reviews Disease Primers, 3, 17030. https://doi.org/10.1038/nrdp.2017.30
67(3), 1201–1206. https://doi.org/10.1128/IAI.67.3.1201-1206.1999
Rice, K. C., & Bayles, K. W. (2008). Molecular control of bacterial death and lysis.
De A, Liao, S., Bitoun, J. P., Roth, R., Beatty, W. L., Wu, H., & Wen, Z. T. (2017).
Microbiology and Molecular Biology Reviews, 72(1), 85–109. https://doi.org/10.1128/
Deficiency of RgpG causes major defects in cell division and biofilm formation, and
MMBR.00030-07
deficiency of LytR-CpsA-Psr family proteins leads to accumulation of cell wall
Selwitz, R. H., Ismail, A. I., & Pitts, N. B. (2007). Dental caries. Lancet, 369(9555), 51–59.
antigens in culture medium by Streptococcus mutans. Applied and Environmental
https://doi.org/10.1016/S0140-6736(07)60031-2
Microbiology, 83(17). https://doi.org/10.1128/AEM.00928-17
Senpuku, H., Nakamura, T., Iwabuchi, Y., Hirayama, S., Nakao, R., & Ohnishi, M. (2019).
Demuth, D. R., & Irvine, D. C. (2002). Structural and functional variation within the
Effects of complex DNA and MVs with GTF extracted from Streptococcus mutans on
alanine-rich repetitive domain of streptococcal antigen I/II. Infection and Immunity,
the oral biofilm. Molecules, 24(17). https://doi.org/10.3390/molecules24173131
70(11), 6389–6398. https://doi.org/10.1128/IAI.70.11.6389-6398.2002
Simon-Soro, A., & Mira, A. (2015). Solving the etiology of dental caries. Trends in
Ehteshami, A., Shirban, F., Gharibpour, F., Bagherniya, M., Sathyapalan, T., &
Microbiology, 23(2), 76–82. https://doi.org/10.1016/j.tim.2014.10.010
Sahebkar, A. (2021). Does curcumin have an anticaries effect? A systematic review
Song, J., Choi, B., Jin, E. J., Yoon, Y., & Choi, K. H. (2012). Curcumin suppresses
of in vitro studies. Advances in Experimental Medicine and Biology, 1291, 213–227.
Streptococcus mutans adherence to human tooth surfaces and extracellular matrix
https://doi.org/10.1007/978-3-030-56153-6_12
proteins. European Journal of Clinical Microbiology & Infectious Diseases, 31(7),
Galvao, L. C., Miller, J. H., Kajfasz, J. K., Scott-Anne, K., Freires, I. A., Franco, G. C.,
1347–1352. https://doi.org/10.1007/s10096-011-1448-y
Abranches, J., Rosalen, P. L., & Lemos, J. A. (2015). Transcriptional and phenotypic
Tsuda, T. (2018). Curcumin as a functional food-derived factor: Degradation products,
characterization of novel Spx-regulated genes in Streptococcus mutans. PLoS One, 10
metabolites, bioactivity, and future perspectives. Food & Function, 9(2), 705–714.
(4), Article e124969. https://doi.org/10.1371/journal.pone.0124969
https://doi.org/10.1039/c7fo01242j
Ganguly, T., Kajfasz, J. K., Abranches, J., & Lemos, J. A. (2020). Regulatory circuits
Walker, E. A., Port, G. C., Caparon, M. G., & Janowiak, B. E. (2019). Glutathione
controlling Spx levels in Streptococcus mutans. Molecular Microbiology, 114(1),
synthesis contributes to virulence of streptococcus agalactiae in a murine model of
109–126. https://doi.org/10.1111/mmi.14499
sepsis. Journal of Bacteriology, 201(20). https://doi.org/10.1128/JB.00367-19
Higuchi, M., Yamamoto, Y., Poole, L. B., Shimada, M., Sato, Y., Takahashi, N., &
Wang, S., Wang, Y., Wang, Y., Duan, Z., Ling, Z., Wu, W., Tong, S., Wang, H., & Deng, S.
Kamio, Y. (1999). Functions of two types of NADH oxidases in energy metabolism
(2019). Theaflavin-3,3′ -digallate suppresses biofilm formation, acid production, and
and oxidative stress of Streptococcus mutans. Journal of Bacteriology, 181(19),
acid tolerance in Streptococcus mutans by targeting virulence factors. Frontiers in
5940–5947. https://doi.org/10.1128/JB.181.19.5940-5947.1999
Microbiology, 10, 1705. https://doi.org/10.3389/fmicb.2019.01705
Hu, P., Huang, P., & Chen, M. W. (2013). Curcumin reduces Streptococcus mutans
Wen, Z. T., Jorgensen, A. N., Huang, X., Ellepola, K., Chapman, L., Wu, H., &
biofilm formation by inhibiting sortase A activity. Archives of Oral Biology, 58(10),
Jeannine, B. L. (2021). Multiple factors are involved in regulation of extracellular
1343–1348. https://doi.org/10.1016/j.archoralbio.2013.05.004
membrane vesicle biogenesis in Streptococcus mutans. Molecular Oral Microbiology,
Kajfasz, J. K., Ganguly, T., Hardin, E. L., Abranches, J., & Lemos, J. A. (2017).
36(1), 12–24. https://doi.org/10.1111/omi.12318
Transcriptome responses of Streptococcus mutans to peroxide stress: Identification

8
L. Ke et al. Archives of Oral Biology 149 (2023) 105655

Whitchurch, C. B., Tolker-Nielsen, T., Ragas, P. C., & Mattick, J. S. (2002). Extracellular Zheng, L. Y., Itzek, A., Chen, Z. Y., & Kreth, J. (2011). Oxygen dependent pyruvate
DNA required for bacterial biofilm formation. Science, 295(5559), 1487. https://doi. oxidase expression and production in Streptococcus sanguinis. International Journal
org/10.1126/science.295.5559.1487 of Oral Science, 3(2), 82–89. https://doi.org/10.4248/IJOS11030
Yamashita, Y., Shibata, Y., Nakano, Y., Tsuda, H., Kido, N., Ohta, M., & Koga, T. (1999). Zheng, X., Zhang, K., Zhou, X., Liu, C., Li, M., Li, Y., Wang, R., Li, Y., Li, J., Shi, W., &
A novel gene required for rhamnose-glucose polysaccharide synthesis in Xu, X. (2013). Involvement of gshAB in the interspecies competition within oral
Streptococcus mutans. Journal of Bacteriology, 181(20), 6556–6559. https://doi.org/ biofilm. Journal of Dental Research, 92(9), 819–824. https://doi.org/10.1177/
10.1128/JB.181.20.6556-6559.1999 0022034513498598