Curcumol alleviates liver fibrosis by

inducing endoplasmic reticulum

stress-mediated necroptosis of hepatic
stellate cells through Sirt1/NICD pathway
Sumin Sun1, Sheng Huan1, Zhanghao Li1, Yue Yao2, Ying Su1,
Siwei Xia1, Shijun Wang3, Xuefen Xu1, Jiangjuan Shao1, Zili Zhang1,
Feng Zhang1, Jinbo Fu4 and Shizhong Zheng1
1
Jiangsu Key Laboratory for Pharmacology and Safety Evaluation of Chinese Materia Medica,
Nanjing University of Chinese Medicine, Nanjing, China
2
School of Pharmacy, East China University of Science and Technology, Shanghai, China
3
Shandong Co-innovation Center of TCM Formula, College of Traditional Chinese Medicine,
Shandong University of Traditional Chinese Medicine, Jinan, China
4
Department of Pharmacy, Jiangsu Province Hospital of Chinese Medicine, Affiliated Hospital of
Nanjing University of Chinese Medicine, Nanjing, China

ABSTRACT
Liver fibrosis is a repair response process after chronic liver injury. During this
process, activated hepatic stellate cells (HSCs) will migrate to the injury site and
secrete extracellular matrix (ECM) to produce fibrous scars. Clearing activated HSCs
may be a major strategy for the treatment of liver fibrosis. Curcumol isolated
from plants of the genus Curcuma can effectively induce apoptosis of many cancer
cells, but whether it can clear activated HSCs remains to be clarified. In the present
study, we found that the effect of curcumol in treating liver fibrosis was to clear
activated HSCs by inducing necroptosis of HSCs. Receptor-interacting protein
kinase 3 (RIP3) silencing could impair necroptosis induced by curcumol.
Interestingly, endoplasmic reticulum (ER) stress-induced cellular dysfunction was
Submitted 24 January 2022 associated with curcumol-induced cell death. The ER stress inhibitor 4-PBA
Accepted 13 April 2022 prevented curcumol-induced ER stress and necroptosis. We proved that ER stress
Published 12 May 2022 regulated curcumol-induced necroptosis in HSCs via Sirtuin-1(Sirt1)/Notch
Corresponding authors signaling pathway. Sirt1-mediated deacetylation of the intracellular domain of Notch
Jinbo Fu, [email protected] (NICD) led to degradation of NICD, thereby inhibiting Notch signalling pathway to
Shizhong Zheng,
[email protected]
alleviate liver fibrosis. Specific knockdown of Sirt1 by HSCs in male ICR mice further
exacerbated CCl4-induced liver fibrosis. Overall, our study elucidates the anti-fibrotic
Academic editor
Ursula Stochaj effect of curcumol and reveals the underlying mechanism between ER stress and
necroptosis.
Additional Information and
Declarations can be found on
page 13
Subjects Biochemistry, Cell Biology, Molecular Biology, Gastroenterology and Hepatology,
DOI 10.7717/peerj.13376 Histology
Copyright Keywords Curcumol, Necroptosis, ER stress, Sirt1, NICD, Liver fibrosis
2022 Sun et al.
Distributed under INTRODUCTION
Creative Commons CC-BY 4.0 Liver fibrosis is the repair reaction process after chronic liver injury. Although fibrogenesis
and fibrosis represent the attempt to limit the consequences of chronic liver injury in

How to cite this article Sun S, Huan S, Li Z, Yao Y, Su Y, Xia S, Wang S, Xu X, Shao J, Zhang Z, Zhang F, Fu J, Zheng S. 2022. Curcumol
alleviates liver fibrosis by inducing endoplasmic reticulum stress-mediated necroptosis of hepatic stellate cells through Sirt1/NICD pathway.
PeerJ 10:e13376 DOI 10.7717/peerj.13376
 chronic wound healing reaction to some extent, they represent the common pathological
process of various chronic liver diseases eventually leading to cirrhosis and liver failure
(Parola & Pinzani, 2019; Zhang et al., 2021). Myofibroblasts (MFs), which are not present
in the normal liver, are activated in response to liver injury. MFs are the main source of
ECM in the fibrotic liver and therefore are the main target for anti-fibrotic therapy
(Higashi, Friedman & Hoshida, 2017). In the case of chronic liver injury, HSCs are
activated through the process of activation and transdifferentiation into MFs-like cells.
HSCs, located in the Disse space, are in close contact with hepatocytes, hepatic sinusoidal
endothelial cells, adjacent stellate cells, and nerve terminals through cytoplasmic
protrusions, and are physiologic responsible for the synthesis and remodeling of ECM,
storage and metabolism of vitamin A and retinoid (Tacke & Trautwein, 2015; Jiang et al.,
2021). Activated HSCs are cells that exhibit the unique characteristics of liver MFs, and
the elimination of activated HSCs is a strategy to reverse liver fibrosis. Necroptosis is a
novel form of programmed cell death dependent on RIP1/RIP3, characterized by plasma
membrane disruption, swollen cell lysis and release of damage-associated molecular
patterns (Yuan, Amin & Ofengeim, 2019). There are few studies on necroptosis in HSCs,
and it is of great significance to investigate the underlying mechanisms.
ER stress refers to the reduced ability of the ER to process intracellular proteins in
response to a variety of pathological stimuli, resulting in the accumulation and misfolding
of large amounts of proteins in the lumen of the ER, disrupting the original intracellular
homeostasis (Chen & Cubillos-Ruiz, 2021; Lebeaupin et al., 2018). In response to
changes in the external environment, the ER initiates a series of signaling pathways to
process the unfolded and misfolded proteins, which is collectively known as the unfolded
protein response (UPR) (Lebeau et al., 2018). Therefore, signature molecules of UPR,
such as Glucose regulated protein 78 (GRP78), ER stress effector proteins (PERK, ATF6,
iRE-1), are commonly used to indicate the occurrence of ER stress (Mao et al., 2020).
However, when ER stress is too severe or lasts too long, UPR is insufficient to restore
homeostasis and becomes a toxic signal leading to cell death (Zhang et al., 2018a; Qi et al.,
2020). There is increasing evidence that ER stress-induced cellular dysfunction and
death are associated with several human diseases, such as neurodegenerative diseases,
inflammation, and cancer (Ghemrawi & Khair, 2020; Sprenkle et al., 2017; Li et al., 2019).
Whether ER stress is involved in necroptosis of HSCs induced by curcumol deserves
further investigation.
The Notch signaling pathway is extensively involved in liver regeneration, injury repair,
and metabolic processes, and plays an important role in the transdifferentiation process of
HSCs (Xie et al., 2013). The Notch family of transmembrane receptors (Notch1-4)
determines cell fate by binding to ligands and γ-secretase mediated cleavage to generate the
Notch intracellular domain (NICD), which binds RBPJ-k (recombination signal binding
protein for immunoglobulin kappa J) and MAML1 (mastermind-like transcriptional
coactivator 1) to activate transcription of target genes such as Hes and Hey family genes,
exerting the corresponding biological effects (Jeong et al., 2021). Importantly, Sirt1 is
involved in the regulation of Notch signaling pathway. Sirt1 acts as a lysine deacetylase,
which regulates the subcellular localisation of NICD by reducing the acetylation level of

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 2/18

 NICD. The degradation of NICD is also dependent on its hypoacetylation (Marcel et al.,
2017; Bai et al., 2018). In recent years, it has been found that Notch signaling pathway
is closely related to ER stress, and small-molecule Notch inhibitors can block Notch
signaling pathway and induce apoptosis through ER stress pathway (Nolin et al., 2019).
Therefore, we have reason to believe that Sirt1/NICD signaling pathway may mediate the
bridge between ER stress and necroptosis of HSCs.
Curcumol is isolated from plants of the genus Curcuma, and has many biological
activities such as anti-cancer, anti-microbial, and anti-fungal (Wei et al., 2019). Curcumol
has great potential to become an anti-cancer drug because it can exert its effects against
cancer by inhibiting the cell cycle, inducing cell apoptosis, and regulating various signaling
cascades (Li et al., 2018; Liu et al., 2019; Zuo et al., 2020). However, little research has
been done on its role in liver fibrosis. In this study, we clarified the ameliorative effects of
curcumol on liver fibrosis and tried to reveal the potential link between ER stress and
necroptosis.

MATERIALS AND METHODS

Reagents and antibodies
Curcumol (C15H24O2) was obtained from Sigma-Aldrich (St Louis, MO, USA). Dulbecco’s
modified essential medium (DMEM), fetal bovine serum (FBS), and trypsin-EDTA
were bought from GIBCO BRL (Grand Island, NY, USA). Primary antibodies against
GRP78, CHOP, Sirt1, a-SMA, RIP3 were provided from Proteintech Group (Rosemont,
IL, USA). Main antibodies against XBP1, RIPK1, ATF4, and COL1A1 were procured
from ABclonal Biotechnology Co., Ltd (Wuhan, China). The NICD antibody was obtained
by Cell Signaling Technology (Danvers, MA, USA). Z-VAD-FMK and 4-PBA were
purchased from MCE (Monmouth Junction, NJ, USA). RO4929097 was provided by
APExBIO (Houston, TX, USA). SRT1720 was purchased by Shanghai yuanye
Bio-Technology Co., Ltd (Shanghai, China).

Animal procedures and treatments

All animal care and experimental procedures complied with the National Institutes of
Health (Bethesda, MD, USA) guidelines and were approved by the Institutional and Local
Committee on the Care and Use of Animals of Nanjing University of Chinese Medicine
(approve number: 202009A048). Animal studies were reported in compliance with the
ARRIVE guidelines. Forty-four male ICR mice were purchased from Hangzhou Medical
College (Hangzhou, China). All mice were maintained in a 12:12 light/dark cycle and
provided food and water freely. These mice were randomly divided into six groups
(six each in the normal and model groups and eight each in the other groups), using a
computer based random order generator. Mice of six groups were treated with olive oil,
CCl4, CCl4+curcumol, CCl4+VA-Lip-Sirt1-shRNA, CCl4+VA-Lip-Control-shRNA
+curcumol, CCl4+VA-Lip-Sirt1-shRNA+curcumol, respectively. The mice except the
control group were intraperitoneally injected with 0.5 ml/100 g mixture of CCl4 and
olive oil (1:9 (v/v)) three times a week for 8 weeks. The control group was given the same
volume of olive oil. From the fifth week onwards, curcumol was administered

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 3/18

 intraperitoneally at a dose of 30 mg/kg daily. CCl4+VA-Lip-Sirt1-shRNA and CCl4+VA-
Lip-Control-shRNA were synthesized by Nanjing JinTing biotechnology Co., LTD. and
were injected intravenously at a dose of 0.75 mg/kg, 3 times a week for 2 weeks. At the end
of the experiment, all mice were anesthetized with pentobarbital (50 mg/kg) and then
sacrificed. Part of the liver tissue was taken for histopathology and immunofluorescence
studies. The rest of the liver was used to extract protein.

Histological analysis
The obtained liver tissues were fixed with 4% paraformaldehyde for 12–24 h, and then
dehydrated in ethanol at different concentrations, embedded in paraffin, and stained for
HE, Masson, Sirius Red and immunohistochemistry, respectively, as needed (Zhang et al.,
2018b).

Cell culture
Human hepatic stellate cells HSC-LX2 (BNCC337957) were purchased from BeNa culture
collection (Beijing, China). The cells were cultured in DMEM containing 10% FBS and 1%
antibiotics, and incubated at 37  C in a cell incubator containing 5% CO2.

Trypan blue staining

HSCs were planted in 24-well plates covered with glass slides at appropriate densities,
incubated until walled, then test materials were added as needed for the experiment and
incubation continued for 24 h. Next, the HSCs were incubated with trypan blue (KeyGEN,
#KGY015) for 1–3 min and removed the slides for photographs.

Cell viability assay

On the basis of previous literature (Lu et al., 2015), we used the MTT method to detect cell
viability. The absorbance values at 490 nm was measured using Synergy2 Microplate
reader (BioTek, Winooski, VT, USA).

SiRNA transfection
RIP3 small interfering RNA (siRNA) was synthesized by GenScript (Nanjing, China). Sirt1
siRNA was purchased from KeyGEN (Jiangsu, China). The transfection method was
carried out as described earlier (Zhang et al., 2017b).

Real-time PCR
The total RNA was extracted and qPCR was performed using the HieffÒ qPCR SYBR
Green Master Mix (YEASEN, #11202ES03). Primer sequences were shown in Table 1.
Gadph levels were taken for normalization.

Western blot analysis

After 24 h of incubation with curcumol, proteins were extracted from HSCs. Western blot
procedures were then performed according to the manufacturer’s instructions (Bio/Rad,
Hercules, CA, USA). The relevant protein bands were quantified using Image Lab software.

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 4/18

 Table 1 Primer sequences used in this study.
Gene Forward sequence Reverse sequence
chop TCCAACTGCAGAGATGGCAG TCCTCCTCTTCCTCCTGAGC
atf6 GCAGAAGGGGAGACACATTT TTGACATTTTTGGTCTTGTGG
sirt1 GACTCCAAGGCCACGGATAG TGTTCGAGGATCTGTGCCAA
gadph ATTCCACCCATGGCAAATTCC GACTCCACGACGTACTCAGC

Immunofluorescence analysis
The slides were soaked in 75% alcohol for 30 min, and the residual alcohol was evaporated
on an alcohol lamp before placing the slides in a 24-well plate, adding the cell suspension,
waiting for the cells to adhere to the wall, then adding test materials and incubating for 24
h. According to previous reports (Lu et al., 2015), immunofluorescence analysis was
performed. Briefly, cells on slides were first fixed using 4% paraformaldehyde and left
to stand at room temperature for 30 min, followed by permeabilization with 1% Triton-
100. Next, the cells were transferred to 1% BSA solution and blocked for 60 min. After
blocking, they were incubated with the dilution solution containing the target antibody at
4  C overnight. The secondary antibody was added and incubated for 2 h at 37  C in
an oven protected from light, then the nucleus were stained with DAPI, and finally the
slices were sealed with anti-fluorescence blocking quenching solution, and the fluorescence
intensity was observed under a microscope.

Transmission electron microscopy (TEM)

HSCs were inoculated into 4-well Chambered Coverglass (Thermo Scientific, Waltham,
MA, USA) with a cell density of 2 × 104 cells/mL (14,000 cells/well), and then TEM was
used to observe the changes in organelle morphology of HSCs after curcumol treatment
(Zhang et al., 2018b).

Co-Immunoprecipitation (Co-IP) experiment

Co-IP was used to observe the interaction between proteins, and the experimental
procedures refer to our previously published article (Li et al., 2020).

Determination of acetylation levels

After the corresponding treatment of the cells, the above IP assay was performed, and then
pan-acetylation antibody (Affinity Biosciences, Cincinnati, OH, USA) was used to detect
the acetylation level of the NICD.

Statistical analysis
Both individual cell experiments and animal experiments were performed in duplicate or
triplicate, and the matched control group was used to repeat three times, and the data
were pooled. All results were expressed as mean ± standard deviation (SD) using the
GraphPad Prism 8 (GraphPad software version 8.0). Statistical analysis was performed
using either Student’s t-test (two-group comparison) or one-way analysis of variance

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 5/18

 Figure 1 Curcumol attenuates liver fibrosis by inducing necroptosis of HSCs. HSCs were incubated at the specified concentration of curcumol or
DMSO for 24 h. (A) Curcumol chemical structure. (B) Protein abundance of a-SMA and COL1A1 were detected. (C) Observing the death of HSCs
with trypan blue staining. (D, F) Cell viability was assayed by MTT. (E) The necroptosis-related proteins were analyzed. (G) TEM of HSCs. White
arrows indicate mitochondria. Data are expressed as mean ± SD (n = 3);  P < 0.05,  P < 0.01, and  P < 0.001 vs DMSO. ##P < 0.01, ###P < 0.001 vs
siCtrl. N.S., not significant. Full-size  DOI: 10.7717/peerj.13376/fig-1

followed by Tukey’s test (more than two groups). In all analysis, values of P < 0.05,
P < 0.01, and P < 0.001 levels were considered significant. N.S., not significant.

RESULTS
Curcumol attenuates liver fibrosis by inducing necroptosis of HSCs
In order to observe the inhibitory effect of curcumol on HSC-LX2 cells in vitro, we first
detected the protein abundance of a-SMA and COL1A1 at the specified concentration.
Our data fully demonstrated the inhibitory action of curcumol on HSCs activity (Fig. 1B).
Furthermore, trypan blue staining showed that curcumol induced HSCs death in a
dose-dependent manner (Fig. 1C). Curcumol is involved in the apoptosis process of
many cancer cells, but the inhibition of curcumol on HSCs activity was not reversed
under the action of apoptosis inhibitor Z-Vad-FMK (Fig. 1D), suggesting that curcumol
induced the death of HSCs in a non-apoptotic form. When the apoptotic program fails,
necroptosis is often found. Consistently, the experimental results showed that curcumol
upregulated RIP1 and RIP3 protein expression in HSCs in a dose-dependent manner
(Fig. 1E), and the damaging effect of curcumol on HSCs was significantly weakened after
silencing RIP3 (Fig. 1F). Subsequently, TEM also observed that HSCs treated with
curcumol exhibited typical necrotic states such as swelling of cells and organelles (Fig. 1G).

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 6/18

 Figure 2 Curcumol induces ER stress in HSCs. (A) The protein abundances of GRP78, XBP1, CHOP and ATF4 were determined after treatment
with various concentrations of curcumol for 24 h. (B) ER stress related genes were analyzed. (C, D) The expression of GRP78 (green) and CHOP
(green) was analyzed by immunofluorescence assay. Data are expressed as mean ± SD (n = 3);  P < 0.05,  P < 0.01, and  P < 0.001 vs DMSO.
Full-size  DOI: 10.7717/peerj.13376/fig-2

These results suggested that curcumol reduced liver fibrosis by scavenging activated HSCs
through the necroptosis pathway.

Curcumol induces ER stress in HSCs

ER stress is a signal response pathway system, which belongs to the cell self-protection
mechanism. However, if the stress response is too strong or too long, it will cause cell
damage (Zhang et al., 2018a; Qi et al., 2020). Whether and how the ER stress is involved in
the removal of activated HSCs remains unclear. We therefore investigated the potential
mechanisms of curcumol-induced HSCs death by detecting ER stress-related mediators.
Western blot analysis showed that the protein abundance of GRP78, X box-binding
protein-1 (XBP1), C/EBP-homologous protein (CHOP) and activating transcription factor
4 (ATF4) increased with increasing curcumol dose (Fig. 2A). The transcript levels of chop
and atf6 were also enhanced (Fig. 2B). Beyond that, the same results were observed by
immunofluorescence (Figs. 2C, 2D). Overall, these results indicated that curcumol
activated ER stress, which might be the underlying mechanism for the clearance of
activated HSCs.

ER stress inhibitor impairs the induction effect of curcumol on HSCs

necroptosis
To further explore the role of ER stress in curcumol-induced HSCs necroptosis, we used
the ER stress inhibitor 4-PBA to block ER stress signalling for reverse validation. First,

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 7/18

 Figure 3 The activation of ER stress may mediate curcumol-induced necroptosis. (A) The inhibitory effect of 4-PBA on ER stress was verified.
(B) Cell viability was assayed by MTT. (C) Western blot was used to test the effects of 4-PBA (5 mM) or curcumol (30 µM) on RIP1 and RIP3 in
HSCs. (D) Observing the death of HSCs with trypan blue staining. (E, F) Immunofluorescence staining of RIP1 (green) and RIP3 (green). Data are
expressed as mean ± SD (n = 3);  P < 0.05,  P < 0.01, and  P < 0.001 vs DMSO. ###P < 0.001 vs curcumol. @P < 0.05, @@P < 0.01 vs 4-PBA 0 mM.
Full-size  DOI: 10.7717/peerj.13376/fig-3

we verified the inhibitory effect of 4-PBA, and the results showed that 4-PBA could
significantly weaken the induction of curcumol on the ER stress marker GRP78 in HSCs
(Fig. 3A). Next, we tested the effect of 4-PBA on the viability of HSCs. 4-PBA-mediated ER
stress blockage significantly reversed the curcumol-induced HSCs damage (Figs. 3B, 3D).
Most importantly, Western blot and immunofluorescence results showed that the
promoting effect of curcumol on RIP1 and RIP3 was significantly reduced after 4-PBA
intervention (Figs. 3C, 3E, and 3F). In short, these findings supported that the necroptosis
induced by curcumol was caused by ER stress.

ER stress regulates curcumol-induced necroptosis through Sirt1 in

HSCs
We further explored the potential mechanism of ER stress promoting necroptosis of HSCs.
As an NAD+ dependent class III deacetylase, Sirt1 plays vital physiological function in a
variety of diseases such as tumors and metabolic diseases (Alves-Fernandes & Jasiulionis,
2019; Yu et al., 2018), including liver fibrosis (Ramirez et al., 2017). We found that

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 8/18

 Figure 4 ER stress regulates curcumol-induced necroptosis through Sirt1 in HSCs. (A) The protein abundance of Sirt1 was analyzed.
(B) Regulation of Sirt1 at the transcriptional level by curcumol. (C) Western blot was used to test the effect of 4-PBA (5 mM) on Sirt1 in HSCs.
(D) The protein expressions of RIP1 and RIP3 after silencing/overexpressing Sirt1 were analyzed. (E) Observing the death of HSCs with trypan blue
staining. (F) Cell viability was assayed by MTT. Data are expressed as mean ± SD (n = 3);  P < 0.05,  P < 0.01, and  P < 0.001 vs DMSO. ##P < 0.01,
###
P < 0.001 vs curcumol. @P < 0.05, @@@P < 0.001 vs siCtrl. Full-size  DOI: 10.7717/peerj.13376/fig-4

curcumol promoted Sirt1 protein expression (Fig. 4A), and the same results were obtained
at the transcription level (Fig. 4B). Importantly, the promotion effect of curcumol on
Sirt1 was significantly weakened after 4-PBA treatment (Fig. 4C). Next, we observed
the effect of Sirt1 on curcumol-induced necroptosis. Using siSirt1/SRT1720 to silence/
stimulate Sirt1 expression, we found that knocksdown of Sirt1 followed by curcumol
treatment significantly reduced the protein expression of RIP1 and RIP3 compared to
HSCs given curcumol intervention alone, while the Sirt1 agonist SRT1720 exhibited an
effect consistent with curcumol, significantly inducing necroptosis in HSCs (Fig. 4D).
Finally, trypan blue staining and MTT assay showed that the damaging effect of curcumol
on HSCs was dependent on Sirt1 (Figs. 4E and 4F). Collectively, these data showed that the
regulation of ER stress on necroptosis in HSCs was closely related to Sirt1.

Sirt1-mediated deacetylation of NICD is required for curcumol-induced

necroptosis in HSCs
Notch signaling pathway plays an important role in liver fibrosis (Xie et al., 2013). Under
the intervention of curcumol, the expression level of NICD decreased in a dose-dependent
manner (Fig. 5A), and laser confocal observations showed that curcumol significantly
inhibited the entry of NICD into the nucleus (Fig. 5B). Next, we looked at whether this
effect of curcumol was associated with Sirt1. Sirt1 silencing mediated by siRNA

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 9/18

 Figure 5 Sirt1-mediated deacetylation of NICD is required for curcumol-induced necroptosis in HSCs. (A) The protein abundance of NICD
was analyzed. (B) Immunofluorescence staining of NICD (green). (C) The protein abundances of NICD after Sirt1 knockdown was investigated.
(D) The inhibitory effect of γ-secretase inhibitor Ro4929097 (1 µM) on NICD was verified. (E) Cell viability was assayed by MTT. (F) Western blot
was used to test the effect of Ro4929097 on RIP1 and RIP3 in HSCs. (G) CO-IP assay detected the interaction between Sirt1 and NICD. (H) The
acetylation level of NICD was assayed by IP assay. Data are expressed as mean ± SD (n = 3);  P < 0.05,  P < 0.01, and  P < 0.001 vs DMSO.
$
P < 0.05, and $$$P < 0.001 vs curcumol. ###P < 0.001 vs Cur+siCtrl. @P < 0.05, @@@P < 0.001 vs Cur+siSirt1.
Full-size  DOI: 10.7717/peerj.13376/fig-5

significantly reversed curcumol induced NICD reduction (Fig. 5C). The molecular
mechanism of curcumol damage to HSCs was further validated by reducing NICD protein
abundance with the γ-secretase inhibitor Ro4929097 (Fig. 5D). MTT assay showed that
silencing Sirt1-induced upregulation of HSCs activity was significantly reversed by
intervention with Ro4929097 (Fig. 5E). Western blot assay further showed that Sirt1
silencing impaired curcumol induced necroptosis of HSCs, and Ro4929097 further
reversed this effect (Fig. 5F). These experimental results suggested that curcumol might
regulate necroptosis of HSCs through Sirt1/NICD signaling pathway. Next, we
conducted an in-depth study on how Sirt1 regulates NICD. Co-IP results showed that the
interaction between Sirt1 and NICD was enhanced in the presence of curcumol, and the
acetylation level of NICD was significantly reduced (Figs. 5G, 5H), suggesting that Sirt1
might promote the degradation of NICD through deacetylation, thereby promoting the
necroptosis of HSCs.

Curcumol alleviates liver fibrosis through Sirt1 in vivo

To further investigate the effects of curcumol on liver injury and liver fibrosis, we
established a classical mouse model of liver fibrosis by intraperitoneal injection of CCl4 to

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 10/18

 Figure 6 Curcumol reduces liver fibrosis through Sirt1-mediated necroptosis in vivo. (A) The morphology and HE staining of mouse livers were
analyzed. (B) Analysis of collagen deposition in mouse livers by Masson and Sirius red staining. (C) The expression of a-SMA and COL1A1 in liver
tissues. (D, E) The expression and co-localization of a-SMA (red) with RIP1 (green) and RIP3 (green) were determined by immunofluorescence
double staining. Full-size  DOI: 10.7717/peerj.13376/fig-6

observe the therapeutic effects of curcumol. We first determined whether curcumol could
ameliorate liver injury in vivo. The liver index (liver weight/body weight) was positively
correlated with the degree of liver injury (Li et al., 2020). Compared with the normal
group, the liver index of mice in the model group was significantly higher, while the
liver index of mice in the curcumol group was significantly lower than that of mice in the
model group (Fig. S1A). Through morphological observation, we found that the livers of
mice in the control group was bright red and shiny with no histological lesions, while
the livers of model mice had obvious fibrotic lesions. It was noteworthy that the
improvement effect of curcumol on liver fibrosis in mice was mediated by Sirt1. HSCs
specific knockout of Sirt1 impaired the ameliorative effect of curcumol on hepatic
fibrosis in mice (Fig. 6A). Subsequently, histological examination was performed on the
livers of each group of mice. Inflammatory cell infiltration and collagen deposition induced
by CCl4 were significantly alleviated by curcumol, and this effect was significantly reversed
when Sirt1 was silenced (Figs. 6A, 6B and Fig. S1B). In addition, Western blot analysis
showed that curcumol could effectively inhibit the expression of a-SMA and COL1A1 in
HSCs, and this effect depended on the upregulation of Sirt1 (Fig. 6C).
To clarify the role of necroptosis in the treatment of liver fibrosis with curcumol, we
performed double fluorescence staining of liver tissues to label HSCs with a-SMA and
detected the expression of RIP1 and RIP3. The results showed that RIP1 and RIP3
co-localized with a-SMA, and the promotion of RIP1 and RIP3 by curcumol was mediated

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 11/18

 by Sirt1 (Fig. 6D). All together, these results indicated that the ameliorative effect of
curcumol on liver fibrosis in mice depended on Sirt1-mediated necroptosis.

DISCUSSION
Liver fibrosis is a dynamic and highly integrated molecular, cellular, and tissue process
characterized by excessive deposition of ECM components, which are mainly derived from
hepatic MFs (Schuppan et al., 2018). In chronic liver injury, HSCs will activate and
transdifferentiate into MF-like cells, breaking the balance between ECM production and
degradation. Therefore, inducing the death of activated HSCs or returning them to a
resting state by drug-based interventions is an effective strategy to alleviate liver fibrosis
(Higashi, Friedman & Hoshida, 2017). Curcumol is a kind of bioactive sesquiterpenoid
isolated from Zingiberaceae plants, which can induce apoptosis of a variety of cancer cells
(Wei et al., 2019). However, its role in liver fibrosis is rarely studied, and whether it can
alleviate liver injury by removing MF-like HSCs remains to be revealed. Our study showed
that curcumol could reduce liver fibrosis by promoting necroptosis of HSCs, and this
process was associated with over-activated ER stress.
Because HSCs are rich in ER and secreted proteins, they may be more sensitive to
changes in ER homeostasis. ER is an evolutionarily conserved response to dysfunction of
the ER caused by genetic and environmental damage that can lead to cell death (Hu et al.,
2019). The markers of ER stress may be up-regulation of some related genes, such as ATF6,
CHOP, GRP78, etc. (Bian et al., 2019). ER plays a critical role in cell clearance
mechanisms, which may be mediated by death receptor and mitochondrial pathways.
The classic apoptosis is induced by mitochondria and death receptor, so ER stress has
been the focus of the new apoptosis mechanism (Bian et al., 2019). Necroptosis and
apoptosis share some upstream signals. Recent studies have shown that necroptosis may be
another downstream cell death mode of ER stress. Chang et al. (2019) showed that in the
myocardial infarction disease model, down-regulation of the RIP3-CaMKII signaling
pathway can alleviate ER stress-related necroptosis and play a role in protecting the
heart. Kishino et al. (2019) demonstrated that ER stress can induce either apoptosis of
auditory cells or necroptosis. However, the potential relationship between ER stress and
necroptosis has not been confirmed in HSCs. In our study, we evaluated the ameliorative
effects of curcumol on liver injury and liver fibrosis in vivo and in vitro, and found that
curcumol reduced CCl4-induced liver fibrosis in vivo and significantly inhibited HSCs cell
viability in vitro. The damage of curcumol on HSCs depended on the occurrence of
necroptosis of HSCs, and this effect was caused by ER stress. Under the action of ER stress
inhibitor 4-PBA, the induction effect of curcumol on the necrosome markers RIP1 and
RIP3 was significantly reversed. These results suggested that targeting the induction of ER
stress and necroptosis of HSCs might be an effective strategy for the treatment of liver
fibrosis.
Next, we explored the potential mechanism of curcumol in regulating ER stress and
necroptosis. Sirt1 is an NAD+-dependent type III histone deacetylase, which can catalyze

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 12/18

 the deacetylation of histone and non-histone lysine residues, and plays a vital role in
regulating cell apoptosis (Zhang et al., 2017a), the occurrence and development of
tumors (Alves-Fernandes & Jasiulionis, 2019), metabolic diseases (Yu et al., 2018) and
anti-aging (Xu et al., 2020). Curcumol promoted the expression of Sirt1 in HSCs in a
dose-dependent manner, and the effect of curcumol was significantly weakened after
4-PBA treatment. Importantly, we demonstrated the regulatory effect of Sirt1 on
necroptosis. After silencing of Sirt1, the induction of necroptosis by curcumol was
significantly attenuated, while the expression levels of RIP1 and RIP3 were significantly
increased in HSCs in response to the Sirt1 agonist SRT1720. Notch signaling is involved in
liver regeneration and repair, liver fibrosis and metabolic processes. Due to these extensive
and important roles, the role of Notch signaling in liver development and disease
progression and the regulatory mechanisms of this pathway in the liver have been the
subject of research in recent years (Xie et al., 2013). Our experimental results showed that
Sirt1 could interact with the Notch intracellular domain NICD in HSCs, and promoted its
degradation by deacetylating the NICD, thereby inhibiting the Notch signaling pathway.
From this, we conclude that ER stress regulates the necroptosis of HSCs induced by
curcumol through Sirt1/Notch pathway.

CONCLUSIONS
We reported for the first time the potential connection between ER stress and necroptosis
in HSCs, and further clarified that curcumol exerted its anti-fibrotic effects through the
Sirt1/Notch signalling pathway, providing a new target and perspective for the treatment
of liver fibrosis and the development of related drugs.

ABBREVIATIONS
HSCs Hepatic stellate cells
ECM Extracellular matrix
RIP Receptor-interacting protein kinase
a-SMA a-smooth muscle actin
COL1A1 Collagen type I alpha 1 chain
Sirt1 Sirtuin 1
UPR Unfolded protein response
GRP78 Glucose regulated protein 78
ATF6 Activating transcription factor 6
CHOP C/EBP-homologous protein
XBP1 X box-binding protein-1
ER Endoplasmic reticulum

ADDITIONAL INFORMATION AND DECLARATIONS

Funding
The work was supported by the National Natural Science Foundation of China
(82073914, 82000572, 81870423), the Natural Science Foundation of Jiangsu Province

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 13/18

 (BK20200840), the Major Project of the Natural Science Research of Jiangsu Higher
Education Institutions (19KJA310005), the General Projects of the Natural Science
Research of Jiangsu Higher Education Institutions (20KJB310003), the Joint Project of
Jiangsu Key Laboratory for Pharmacology and Safety Evaluation of Chinese Materia
Medica and Yangtze River Pharmaceutical (JKLPSE202005), the Natural Science
Foundation of Nanjing University of Chinese Medicine (NZY82000572), the Postgraduate
Research & Practice Innovation Program of Jiangsu Province (KYCX21_1732,
KYCX21_1637 and SJCX20_0569), and the Open Project of Chinese Materia Medica
First-Class Discipline of Nanjing University of Chinese Medicine (2020YLXK022 and
2020YLXK023). The funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript.

Grant Disclosures
The following grant information was disclosed by the authors:
National Natural Science Foundation of China: 82073914, 82000572, 81870423.
Natural Science Foundation of Jiangsu Province: BK20200840.
Natural Science Research of Jiangsu Higher Education Institutions: 19KJA310005.
Natural Science Research of Jiangsu Higher Education Institutions: 20KJB310003.
Jiangsu Key Laboratory for Pharmacology and Safety Evaluation of Chinese Materia
Medica and Yangtze River Pharmaceutical: JKLPSE202005.
Natural Science Foundation of Nanjing University of Chinese Medicine: NZY82000572.
Postgraduate Research & Practice Innovation Program of Jiangsu Province:
KYCX21_1732, KYCX21_1637 and SJCX20_0569.
Chinese Materia Medica First-Class Discipline of Nanjing University of Chinese Medicine:
2020YLXK022 and 2020YLXK023.

Competing Interests
The authors declare that they have no competing interests.

Author Contributions
 Sumin Sun conceived and designed the experiments, performed the experiments,
analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the
paper, and approved the final draft.
 Sheng Huan performed the experiments, analyzed the data, prepared figures and/or
tables, authored or reviewed drafts of the paper, and approved the final draft.
 Zhanghao Li performed the experiments, analyzed the data, prepared figures and/or
tables, and approved the final draft.
 Yue Yao performed the experiments, analyzed the data, prepared figures and/or tables,
and approved the final draft.
 Ying Su performed the experiments, analyzed the data, prepared figures and/or tables,
and approved the final draft.
 Siwei Xia performed the experiments, analyzed the data, prepared figures and/or tables,
and approved the final draft.

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 14/18

  Shijun Wang conceived and designed the experiments, authored or reviewed drafts of
the paper, and approved the final draft.
 Xuefen Xu conceived and designed the experiments, authored or reviewed drafts of the
paper, and approved the final draft.
 Jiangjuan Shao conceived and designed the experiments, authored or reviewed drafts of
the paper, and approved the final draft.
 Zili Zhang conceived and designed the experiments, authored or reviewed drafts of the
paper, and approved the final draft.
 Feng Zhang conceived and designed the experiments, authored or reviewed drafts of the
paper, and approved the final draft.
 Jinbo Fu conceived and designed the experiments, authored or reviewed drafts of the
paper, and approved the final draft.
 Shizhong Zheng conceived and designed the experiments, authored or reviewed drafts of
the paper, and approved the final draft.

Animal Ethics
The following information was supplied relating to ethical approvals (i.e., approving body
and any reference numbers):
All experimental procedures were approved by the Nanjing University of Chinese
Medicine (Nanjing, China) institutional and local animal care and use committees. All of
the animals were cared for humanely, according to National Institutes of Health
guidelines.

Data Availability
The following information was supplied regarding data availability:
The raw measurements are available in the Supplemental Files.

Supplemental Information
Supplemental information for this article can be found online at http://dx.doi.org/10.7717/
peerj.13376#supplemental-information.

REFERENCES
Alves-Fernandes DK, Jasiulionis MG. 2019. The role of SIRT1 on DNA damage response and
epigenetic alterations in cancer. International Journal of Molecular Sciences 20(13):3153
DOI 10.3390/ijms20133153.
Bai X, He T, Liu Y, Zhang J, Li X, Shi J, Wang K, Han F, Zhang W, Zhang Y, Cai W, Hu D.
2018. Acetylation-dependent regulation of notch signaling in macrophages by SIRT1 affects
sepsis development. Frontiers in Immunology 9:762 DOI 10.3389/fimmu.2018.00762.
Bian M, He J, Jin H, Lian N, Shao J, Guo Q, Wang S, Zhang F, Zheng S. 2019. Oroxylin a induces
apoptosis of activated hepatic stellate cells through endoplasmic reticulum stress. Apoptosis
24(11–12):905–920 DOI 10.1007/s10495-019-01568-2.
Chang L, Wang Z, Ma F, Tran B, Zhong R, Xiong Y, Dai T, Wu J, Xin X, Guo W, Xie Y, Mao Y,
Zhu YZ. 2019. ZYZ-803 mitigates endoplasmic reticulum stress-related necroptosis after acute
myocardial infarction through downregulating the RIP3-CaMKII signaling pathway. Oxidative
Medicine and Cellular Longevity 2019:6173685 DOI 10.1155/2019/6173685.

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 15/18

 Chen X, Cubillos-Ruiz JR. 2021. Endoplasmic reticulum stress signals in the tumour and its
microenvironment. Nature Reviews Cancer 21(2):71–88 DOI 10.1038/s41568-020-00312-2.
Ghemrawi R, Khair M. 2020. Endoplasmic reticulum stress and unfolded protein response in
neurodegenerative diseases. International Journal of Molecular Sciences 21(17):6127
DOI 10.3390/ijms21176127.
Higashi T, Friedman SL, Hoshida Y. 2017. Hepatic stellate cells as key target in liver fibrosis.
Advanced Drug Delivery Reviews 121(Suppl. 3):27–42 DOI 10.1016/j.addr.2017.05.007.
Hu H, Tian M, Ding C, Yu S. 2019. The C/EBP Homologous Protein (CHOP) transcription factor
functions in endoplasmic reticulum stress-induced apoptosis and microbial infection. Frontiers
in Immunology 9:3083 DOI 10.3389/fimmu.2018.03083.
Jeong GY, Park MK, Choi HJ, An HW, Park YU, Choi HJ, Park J, Kim HY, Son T, Lee H,
Min KW, Oh YH, Lee JY, Kong G. 2021. NSD3-induced methylation of H3K36 activates
NOTCH signaling to drive breast tumor initiation and metastatic progression. Cancer Research
81(1):77–90 DOI 10.1158/0008-5472.
Jiang Y, Xiang C, Zhong F, Zhang Y, Wang L, Zhao Y, Wang J, Ding C, Jin L, He F, Wang H.
2021. Histone H3K27 methyltransferase EZH2 and demethylase JMJD3 regulate hepatic stellate
cells activation and liver fibrosis. Theranostics 11(1):361–378 DOI 10.7150/thno.46360.
Kishino A, Hayashi K, Maeda M, Jike T, Hidai C, Nomura Y, Oshima T. 2019. Caspase-8
regulates endoplasmic reticulum stress-induced necroptosis independent of the apoptosis
pathway in auditory cells. International Journal of Molecular Sciences 20(23):5896
DOI 10.3390/ijms20235896.
Lebeau J, Saunders JM, Moraes VWR, Madhavan A, Madrazo N, Anthony MC, Wiseman RL.
2018. The PERK arm of the unfolded protein response regulates mitochondrial morphology
during acute endoplasmic reticulum stress. Cell Reports 22(11):2827–2836
DOI 10.1016/j.celrep.2018.02.055.
Lebeaupin C, Vallée D, Hazari Y, Hetz C, Chevet E, Bailly-Maitre B. 2018. Endoplasmic
reticulum stress signalling and the pathogenesis of non-alcoholic fatty liver disease. Journal of
Hepatology 69(4):927–947 DOI 10.1016/j.jhep.2018.06.008.
Li Y, Jin C, Shen M, Wang Z, Tan S, Chen A, Wang S, Shao J, Zhang F, Zhang Z, Zheng S. 2020.
Iron regulatory protein 2 is required for artemether -mediated anti-hepatic fibrosis through
ferroptosis pathway. Free Radical Biology and Medicine 160(48):845–859
DOI 10.1016/j.freeradbiomed.2020.09.008.
Li X, Liu H, Wang J, Qin J, Bai Z, Chi B, Yan W, Chen X. 2018. Curcumol induces cell cycle
arrest and apoptosis by inhibiting IGF-1R/PI3K/Akt signaling pathway in human
nasopharyngeal carcinoma CNE-2 cells. Phytotherapy Research 32(11):2214–2225
DOI 10.1002/ptr.6158.
Li W, Yang J, Luo L, Jiang M, Qin B, Yin H, Zhu C, Yuan X, Zhang J, Luo Z, Du Y, Li Q, Lou Y,
Qiu Y, You J. 2019. Targeting photodynamic and photothermal therapy to the endoplasmic
reticulum enhances immunogenic cancer cell death. Nature Communications 10(1):3349
DOI 10.1038/s41467-019-11269-8.
Liu H, Wang J, Tao Y, Li X, Qin J, Bai Z, Chi B, Yan W, Chen X. 2019. Curcumol inhibits
colorectal cancer proliferation by targeting miR-21 and modulated PTEN/PI3K/Akt pathways.
Life Sciences 221:354–361 DOI 10.1016/j.lfs.2019.02.049.
Lu C, Zhang F, Xu W, Wu X, Lian N, Jin H, Chen Q, Chen L, Shao J, Wu L, Lu Y, Zheng S. 2015.
Curcumin attenuates ethanol-induced hepatic steatosis through modulating Nrf2/FXR signaling
in hepatocytes. IUBMB Life 67(8):645–658 DOI 10.1002/iub.1409.

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 16/18

 Mao Y, Wang C, Tian X, Huang Y, Zhang Y, Wu H, Yang S, Xu K, Liu Y, Zhang W, Gu X, Ma Z.
2020. Endoplasmic reticulum stress contributes to nociception via neuroinflammation in a
murine bone cancer pain model. Anesthesiology 132(2):357–372
DOI 10.1097/ALN.0000000000003078.
Marcel N, Perumalsamy LR, Shukla SK, Sarin A. 2017. The lysine deacetylase Sirtuin 1 modulates
the localization and function of the Notch1 receptor in regulatory T cells. Science Signaling
10(473):eaah4679 DOI 10.1126/scisignal.aah4679.
Nolin E, Gans S, Llamas L, Bandyopadhyay S, Brittain SM, Bernasconi-Elias P, Carter KP,
Loureiro JJ, Thomas JR, Schirle M, Yang Y, Guo N, Roma G, Schuierer S, Beibel M,
Lindeman A, Sigoillot F, Chen A, Xie KX, Ho S, Reece-Hoyes J, Weihofen WA,
Tyskiewicz K, Hoepfner D, McDonald RI, Guthrie N, Dogra A, Guo H, Shao J, Ding J,
Canham SM, Boynton G, George EL, Kang ZB, Antczak C, Porter JA, Wallace O,
Tallarico JA, Palmer AE, Jenkins JL, Jain RK, Bushell SM, Fryer CJ. 2019. Discovery of a ZIP7
inhibitor from a Notch pathway screen. Nature Chemical Biology 15(2):179–188
DOI 10.1038/s41589-018-0200-7.
Parola M, Pinzani M. 2019. Liver fibrosis: pathophysiology, pathogenetic targets and clinical
issues. Molecular Aspects of Medicine 65(3):37–55 DOI 10.1016/j.mam.2018.09.002.
Qi J, Zhou N, Li L, Mo S, Zhou Y, Deng Y, Chen T, Shan C, Chen Q, Lu B. 2020. Ciclopirox
activates PERK-dependent endoplasmic reticulum stress to drive cell death in colorectal cancer.
Cell Death & Disease 11(7):582 DOI 10.1038/s41419-020-02779-1.
Ramirez T, Li YM, Yin S, Xu MJ, Feng D, Zhou Z, Zang M, Mukhopadhyay P, Varga ZV,
Pacher P, Gao B, Wang H. 2017. Aging aggravates alcoholic liver injury and fibrosis in mice by
downregulating sirtuin 1 expression. Journal of Hepatology 66(3):601–609
DOI 10.1016/j.jhep.2016.11.004.
Schuppan D, Ashfaq-Khan M, Yang AT, Kim YO. 2018. Liver fibrosis: direct antifibrotic agents
and targeted therapies. Matrix Biology 68–69(9615):435–451
DOI 10.1016/j.matbio.2018.04.006.
Sprenkle NT, Sims SG, Sánchez CL, Meares GP. 2017. Endoplasmic reticulum stress and
inflammation in the central nervous system. Molecular Neurodegeneration 12(1):42
DOI 10.1186/s13024-017-0183-y.
Tacke F, Trautwein C. 2015. Mechanisms of liver fibrosis resolution. Journal of Hepatology
63(4):1038–1039 DOI 10.1016/j.jhep.2015.03.039.
Wei W, Rasul A, Sadiqa A, Sarfraz I, Hussain G, Nageen B, Liu X, Watanabe N, Selamoglu Z,
Ali M, Li X, Li J. 2019. Curcumol: from plant roots to cancer roots. International Journal of
Biological Sciences 15(8):1600–1609 DOI 10.7150/ijbs.34716.
Xie G, Karaca G, Swiderska-Syn M, Michelotti GA, Krüger L, Chen Y, Premont RT, Choi SS,
Diehl AM. 2013. Cross-talk between Notch and Hedgehog regulates hepatic stellate cell fate in
mice. Hepatology 58(5):1801–1813 DOI 10.1002/hep.26511.
Xu C, Wang L, Fozouni P, Evjen G, Chandra V, Jiang J, Lu C, Nicastri M, Bretz C, Winkler JD,
Amaravadi R, Garcia BA, Adams PD, Ott M, Tong W, Johansen T, Dou Z, Berger SL. 2020.
SIRT1 is downregulated by autophagy in senescence and ageing. Nature Cell Biology
22(10):1170–1179 DOI 10.1038/s41556-020-00579-5.
Yu Q, Dong L, Li Y, Liu G. 2018. SIRT1 and HIF1a signaling in metabolism and immune
responses. Cancer Letters 418:20–26 DOI 10.1016/j.canlet.2017.12.035.
Yuan J, Amin P, Ofengeim D. 2019. Necroptosis and RIPK1-mediated neuroinflammation in
CNS diseases. Nature Reviews Neuroscience 20(1):19–33 DOI 10.1038/s41583-018-0093-1.

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 17/18

 Zhang M, Du H, Huang Z, Zhang P, Yue Y, Wang W, Liu W, Zeng J, Ma J, Chen G, Wang X,
Fan J. 2018a. Thymoquinone induces apoptosis in bladder cancer cell via endoplasmic
reticulum stress-dependent mitochondrial pathway. Chemico-Biological Interactions 292:65–75
DOI 10.1016/j.cbi.2018.06.013.
Zhang J, Li Y, Liu Q, Huang Y, Li R, Wu T, Zhang Z, Zhou J, Huang H, Tang Q, Huang C,
Zhao Y, Zhang G, Jiang W, Mo L, Zhang J, Xie W, He J. 2021. Sirt6 alleviated liver fibrosis by
deacetylating conserved lysine 54 on Smad2 in hepatic stellate cells. Hepatology 73(3):1140–1157
DOI 10.1002/hep.31418.
Zhang Z, Yao Z, Wang L, Ding H, Shao J, Chen A, Zhang F, Zheng S. 2018b. Activation of
ferritinophagy is required for the RNA-binding protein ELAVL1/HuR to regulate ferroptosis in
hepatic stellate cells. Autophagy 14(12):2083–2103 DOI 10.1080/15548627.2018.1503146.
Zhang Z, Yao Z, Zhao S, Shao J, Chen A, Zhang F, Zheng S. 2017b. Interaction between
autophagy and senescence is required for dihydroartemisinin to alleviate liver fibrosis. Cell
Death & Disease 8(6):e2886 DOI 10.1038/cddis.2017.255.
Zhang M, Zhang Q, Hu Y, Xu L, Jiang Y, Zhang C, Ding L, Jiang R, Sun J, Sun H, Yan G. 2017a.
miR-181a increases FoxO1 acetylation and promotes granulosa cell apoptosis via SIRT1
downregulation. Cell Death & Disease 8(10):e3088 DOI 10.1038/cddis.2017.467.
Zuo HX, Jin Y, Wang Z, Li MY, Zhang ZH, Wang JY, Xing Y, Ri MH, Jin CH, Xu GH, Piao LX,
Ma J, Jin X. 2020. Curcumol inhibits the expression of programmed cell death-ligand 1 through
crosstalk between hypoxia-inducible factor-1a and STAT3 (T705) signaling pathways in hepatic
cancer. Journal of Ethnopharmacology 257:112835 DOI 10.1016/j.jep.2020.112835.

Sun et al. (2022), PeerJ, DOI 10.7717/peerj.13376 18/18