Circular Permutation of Red Fluorescent Proteins

Bo Shui1, Qi Wang2, Frank Lee1, Laura J. Byrnes2, Dmitry M. Chudakov3, Sergey A. Lukyanov3, Holger
Sondermann2, Michael I. Kotlikoff1*
1 Department of Biomedical Sciences, College of Veterinary Medicine, Cornell University, Ithaca, New York, United States of America, 2 Department of Molecular Medicine,
College of Veterinary Medicine, Cornell University, Ithaca, New York, United States of America, 3 Shemyakin-Ovchinnikov, Institute of Bioorganic Chemistry, Russian
Academy of Science, Moscow, Russian Federation

Abstract
Circular permutation of fluorescent proteins provides a substrate for the design of molecular sensors. Here we describe a
systematic exploration of permutation sites for mCherry and mKate using a tandem fusion template approach. Circular
permutants retaining more than 60% (mCherry) and 90% (mKate) brightness of the parent molecules are reported, as well
as a quantitative evaluation of the fluorescence from neighboring mutations. Truncations of circular permutants indicated
essential N- and C- terminal segments and substantial flexibility in the use of these molecules. Structural evaluation of two
cp-mKate variants indicated no major conformational changes from the previously reported wild-type structure, and cis
conformation of the chromophores. Four cp-mKates were identified with over 80% of native fluorescence, providing
important new building blocks for sensor and complementation experiments.

Citation: Shui B, Wang Q, Lee F, Byrnes LJ, Chudakov DM, et al. (2011) Circular Permutation of Red Fluorescent Proteins. PLoS ONE 6(5): e20505. doi:10.1371/
journal.pone.0020505
Editor: Anil Kumar Tyagi, University of Delhi, India
Received December 29, 2010; Accepted May 3, 2011; Published May 27, 2011
Copyright: ß 2011 Shui et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grant R01GM086736 from the National Institutes of Health (MIK and HS), grants from the Molecular and Cell Biology
Program of the Russian Academy of Sciences and the Russian Foundation for Basic Research (08-04-01702-a)(to DMC), and a PEW Scholar award in Biomedical
Sciences (to HS). Structural studies were conducted at the Cornell High Energy Synchrotron Source (CHESS), which is supported by award DMR-0225180 from the
National Science Foundation and RR-01646 from the National Institutes of Health (to CHESS). The funders had no role in study design, data collection and analysis,
decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: [email protected]

Introduction mCherry (pRSET-tdmCherry). For the former, the mKate (231

AA) coding sequence was amplified from plasmid TagFP635(Ev-
Circular permutation of GFP and its variants has markedly rogen) using Phusion High-Fidelity DNA Polymerase (Finnzymes)
expanded the utility of fluorescent proteins (FPs), enabling the with copy 1, forward (F1) BamHI-mK-1F (atcaggatccatgtctgagct-
development of genetically encoded sensors [1,2,3] and facilitating the gattaaggaga) and reverse (R1) HindIII-mK-231R (ctacaagcttt-
use of FPs in fluorescence complementation assays [4,5]. The catttgtgccccagtttgctagg) primers (restriction sites intalicized). The
extension of this technology to red fluorescent proteins, while amplified product was inserted into the BamHI/HindIII sites of
potentially quite useful, has been limited; bright and thermostable pRSET-A (Invitrogen) to produce pRSET-mKate. The second
circular permutants or complementary peptides have been difficult to
copy of the mKate reading frame was amplified from the
design [1,2], likely because the local chromophore environment is
TagFP635 template with (F2) BamHI-mK-1F and (R2) BamHI-
altered by the rearrangements attempted to date [6]. In an effort to
mK-231R-linker (ctacggatccgccggtaccgcctttg tgccccagtttgctagg)
address this limitation, we undertook a systematic effort to produce
primers. Note the absence of a stop codon in the reverse primer
bright and stable circularly permutated variants of two naturally
(R2) and the underlined linker such that the BamHI site provides
occurring proteins, mCherry, a monomeric variant of the Discosoma sp.
the residues GS in the linker peptide GGTGGS. The PCR
coral protein DsRed [7], and mKate, a monomeric variant of the
product was inserted into the BamHI site of pRSET-mKate and
anemone Entacmaea quadricolor protein eqFP578 [8,9]. Both proteins
proper orientation was determined by PCR and DNA sequencing.
have advantageous tissue imaging properties, including relative bright-
ness and long wavelength emission characteristics; moreover, both are The final plasmid (pRSET-tdmKate) contains two tandem mKate
spectrally distinct from GFP and its derivatives, potentially expanding coding sequences separated by the coding sequence for linker
the color palette of genetically encoded sensors or complementation peptide GGTGGS, in a contiguous reading frame (Fig. 1A). A
pairs that can be used simultaneously with GFP-based constructs. similar strategy was used to construct pRSET-tdmCherry using
Here we report the systematic evaluation of circular permutation sites the mCherry (236 AA) coding sequence from pRSET-B mCherry
in mCherry and mKate, and the development of highly efficient [7], primers (F1) BamHI-mC-1F (ctacggatccatggtgagcaagggcgag-
circularly permutated red fluorescent proteins (cp-RFPs). gagga), (R1) HindIII-mC-236R (ctacaagctttcacttgtacagctcgtccat), (F2)
BamHI-mC-1F and (R2) BamHI-mC-236R-linker (ctacggatccgccgg-
Materials and Methods taccgcccttgtacagctcgtcca). The tandem fusion templates were used
as PCR templates to generate cp-RFPs by systematically varying
Generation of cp-RFPs from Tandem Fusion Templates the N- and C-terminal primers. To construct cp-mKate156-155, the
To efficiently probe multiple permutation sites, we created XhoI site was replaced with the NheI in the forward primer and the
tandem fusion templates [10] of mKate (pRSET-tdmKate) and amplified fragment was cloned into the NheI and EcoRI sites of

PLoS ONE | www.plosone.org 1 May 2011 | Volume 6 | Issue 5 | e20505

 Circular Permutation of mKate and mCherry

Figure 1. Schematic plasmid and protein sequences of cp-Red Fluorescent Proteins. A. Circular permutants were constructed from a
tandem fusion template with forward (new N-terminal) and reverse (new C-terminal) primers, producing a full length amplicon beginning and ending
at any desired site. Strategy for mKate circular permutation is shown. B. Diagram of cp-RFP final proteins with the N-terminal leader peptide from the
expression vector pRSET-A; C (n+1 to 231) and N (1 to n) -terminal residues of mKate were joined by a GGTGGS linker and the LE linker between RSET
and cp-mKate was encoded by the XhoI site. C. Amino acid sequences of DsRed from the Discosoma sp. coral, DsRed-derived mCherry, and mKate
from the sea anemone Entacmaea quadricolor. Chromophore forming residues are underlined; beta-strands forming residues are shown in bold.
doi:10.1371/journal.pone.0020505.g001

pRSET-A to prevent recreation of cp-mKate154-155 variant at 4uC and resuspended in 20 mM HEPES (pH7.4) with
(Fig. 1B,C). Truncated cp-mKate variants were constructed from 350 mM NaCl and 0.1% TritonX-100. Cultures were sonicated
the tandem fusion mKate template using a similar PCR strategy. and cell debris removed by centrifugation at 20,0006g for 30
minutes at 4uC. The cleared lysate was mixed with 3 ml of
Screening of cp-RFPs in E.coli Profinity IMAC Ni-Charged Resins (Bio-Rad) and incubated on
E.coli BL21 Star (DE3) pLysS (Invitrogen) cells were trans- a rocker platform for 5 minutes, the resin poured onto a
formed with either pREST-cp-mCherry or pRSET-cp-mKate 0.864 cm chromatography column (Bio-Rad), washed 3 times
variant plasmids and plated on LB agar plates supplemented with with 20 mM HEPES (pH 7.4) buffer containing 350 mM NaCl
100 mg/mL ampicillin. After incubation at 37uC for 24 h, colonies and 0.1% TritonX-100, and 3 times with 20 mM HEPES
were screened for red fluorescence using a widefield macroimaging (pH 7.4) containing 350 mM NaCl; each wash was followed by
system (OV100, Olympus, Japan; 545 nm excitation/570– low speed centrifugation at 8006g for 30 seconds. Proteins were
625 nm emission). Colonies were rescreened after 1–7 days at eluted with 20 mM HEPES (pH 7.8) containing 350 mM NaCl
2–8uC. Images were analyzed for brightness using Image J and and 300 mM imidazole buffer and the pooled protein fractions
normalized to mCherry or mKate –transformed colonies; vector desalted and concentrated using an Amicon Ultra-15 device
control colonies were used as the zero fluorescence background. (Millipore) with 20 mM HEPES (pH 7.4), refilling 2–3 times.
Protein purity was checked by SDS-PAGE and the concentration
Protein Expression and Purification was measured (Pierce BCA Protein Assay).
Overnight seed cultures of transformed BL21 Star (DE3)
pLysS cells were used to inoculate (1:40 dilution) 500 mL Terrific Spectroscopy of cp-RFPs
Broth containing 100 mg/mL ampicillin. The cultures were The spectral properties of RSET-tagged proteins in 20 mM
incubated at 37uC (250 rpm) until OD600 ,1.0; 0.5 mM IPTG HEPES (pH 7.4) were measured at 20uC. Absorption spectra were
was added and cultures incubated for 16 h at 20uC (250 rpm). acquired on a DU 730 UV/visible spectrophotometer (Beckman
Cells were collected by centrifugation at 60006g for 10 minutes Coulter), and fluorescence spectra on a FluoroMax-3 spectrofluo-

PLoS ONE | www.plosone.org 2 May 2011 | Volume 6 | Issue 5 | e20505

 Circular Permutation of mKate and mCherry

rimeter (Jobin Yvon Horiba). Extinction coefficients of cp-mCherry

proteins were measured using the alkali denaturation method with
0.1 M NaOH [11,12]. Quantum yield (W) for cp-mCherrys and cp-
mKates was measured using the parent molecules (mCherry:
W = 0.22; mKate: W = 0.33) as the reference standards [13]. The
fluorescence of 5 mM protein solutions in 20 mM HEPES (pH 7.4)
was measured using a Synergy 2 Multi-Mode Microplate Reader
(Biotek; excitation 575/15, emission 620/15).

Crystallization and Structure Determination

For crystallization the coding region of cp-mKate154-153 and cp-
mKate168-167 was amplified and cloned into a modified pET28a
expression plasmid (Novagen) yielding an N-terminal hexahisti-
dine SUMO fusion protein, with the tagged moiety cleavable with
the protease Ulp-1 from S. cervisiae.
E.coli BL21 (DE3) cells (Novagen) were transformed by cp-
mKate plasmids. Protein expression and purification were
performed according to protocols described previously [6].
Crystals were obtained by hanging drop vapor diffusion by mixing
equal volumes of protein (,35 mg/ml) and reservoir solution
followed by incubation at 20uC. Crystals were obtained with the
reservoir solution containing 0.1 M Tris-HCl pH 7.4, 0.2 M
MgCl2 and 18% PEG3350 (for cp-mKate154-153) or 0.1 M
Magnesium formate dihydrate and 14% PEG 3350 (for cp-
mKate168-167). All crystals were cryo-protected using crystallization
solutions supplemented with 20% xylitol, frozen in liquid nitrogen,
and kept at 100 K during data collection.
Data sets were collected using synchrotron radiation at the
Cornell High Energy Synchrotron Source (CHESS, Ithaca).
Data reduction was carried out with the software package
HKL2000 [14]. Phases were obtained from molecular replace-
ment using the software package PHENIX [15] with the
available structure of mKate (1.8 Å, pH 2.0, PDB code: 3BX9)
[16] as the search models. Manual refinement in COOT [17]
and minimization using PHENIX [15] yielded the final models
with good geometry.

Results
Circular Permutation of mCherry
To efficiently scan mCherry for promising circular permutation
sites we created multiple cp-mCherry clones by PCR amplification
of a tandem-mCherry template (pRSET-tdmCherry, Methods)
and directly compared the red fluorescence of bacterial colonies
with those transformed by pRSET-mCherry. Initial cp-mCherry Figure 2. Circular permutation sites scanned in mCherry and
mKate. mCherry and mKate were numbered by primary amino acid
constructs targeted the loops of mCherry from the 4th to 10th b- sequences as shown in Fig. 1C. Open circles indicate sites with
strands (Fig. 2). None of the cp-mCherry variant colonies fluorescence, closed circles sites without fluorescence. Three highly
exhibited appreciable fluorescence after overnight incubation at homologous regions of circular permutation tolerant sites in mCherry
37uC when compared with colonies transformed with wildtype and mKate: Loop 7–8 region located in the loop between the 7th and
mCherry, whereas after further incubation for 24 h at either room 8th b-strands and flanking sites on the b-strands, Loop 8–9 region
temperature or 2–8uC, fluorescence was detected in cp- located in the loop between the 8th and 9th b-strands and flanking sites
on the b-strands, and Loop 9–10 region flanked by the 9th and 10th
mCherry158-157, cp-mCherry175-174, and cp-mCherry193-192 colo- b-strands.
nies. Other variant colonies did not exhibit appreciable fluores- doi:10.1371/journal.pone.0020505.g002
cence even after 7 days at 2–8uC (data not shown).
Initial screening identified three sites in distinct loops connecting 10th b-strands, and extending to ends of flanking b-strands in each
b strands. We probed the flanking sequences at each of these sites region, respectively (Fig. 2). Validation of the bacterial colony
by constructing and analyzing additional cp-mCherry variants. fluorescence assay with fluorescence measurements of purified cp-
The brightest colony (cp-mCherry194-193) exhibited only 1% of mCherry proteins in 20 mM HEPES (pH 7.4) indicated that cp-
mCherry after 24 h incubation at 37uC, indicating that the mCherry194-193 is the brightest variant from all of the screened
circularly permutated proteins matured slowly in E.coli. Based on circular permutations, displaying approximately 90% relative
this observation all screens were scored after 24 h at 37uC and brightness on a chromophore basis and 60.6% protein brightness
further 72 h at 2–8uC (Table 1). Colony fluorescence data compared to mCherry (Table 2). The difference between these
indicated that permissive sites were grouped in three loops measurements indicates suboptimal protein folding, as discussed
between 7th and 8th b-strands, 8th and 9th b-strands, 9th and below. cp184-mCherry was previously reported to display 18% of

PLoS ONE | www.plosone.org 3 May 2011 | Volume 6 | Issue 5 | e20505

 Circular Permutation of mKate and mCherry

Table 1. Screening of circular-permutated mCherry variants Table 1. Cont.

in E.coli.

c
Numbered by the amino acid sequence of DsRed as shown in Fig. 1C [18,19].
Colony brightness 24 h Colony brightness 72 h cp184-mCherry corresponds to cp191-190, with three duplicated residues at
Variant * at 376C (% of mCherry) at 2–86C (% of mCherry) N-terminus (188-190). The cp193-mCherry and cp193g7 (with 6 mutated amino
acids) correspond to cp197-196, with three duplicated residues (197-199) at the
mCherry 100 100 C-terminus.
pRSET-A 0 0 doi:10.1371/journal.pone.0020505.t001

cp99-98 0 0
native mCherry fluorescence when proteins are expressed in E.coli,
cp107-106 0 0
and 37% of fluorescence when the isolated proteins are compared
cp119-118 0 0
[18]. Evolution of cp193-mCherry to cp193g7 (corresponding to
cp143-142 0 0 cp-mCherry197-196) by random mutagenesis improved the bright-
cp149-148b 0 0 ness of this variant, achieving 61% of mCherry brightness on a
cp153-152 0 0 protein basis [19].
Loop 7–8 region and flanking sites
cp156-155 0 0
Circular Permutation of mKate
We performed a similar circular permutation analysis of the
cp157-156 0 0.7
monomeric far-red protein mKate, which derives from the sea
cp158-157a 0 2.8 anemone Entacmaea quadricolor and shares structural similarities
cp159-158 0.1 17.5 with mCherry. Based on structural and sequence similarities, we
cp160-159 0.1 12.3 first tested three cp-mKate variants that corresponded to the
cp161-160 0 0.3 brightest cp-mCherry variants in each region of permissive sites.
Fluorescence was detected in colonies transformed with cp-
cp162-161 0 0
mKate151-150, cp-mKate167-166, and cp-mKate189-188. As with the
Loop 8–9 region and flanking sites
cp-mCherry evaluation, we also screened the sequences flanking
cp171-170 0 0 the three identified circular permutation sites in mKate for
cp172-171 0 0.4 additional tolerant sites. In contrast to the slow development of
cp173-172 0 1.1 fluorescence in cp-mCherry colonies, most of the fluorescent cp-
cp174-173 0.1 6.4
mKate variants exhibited appreciable fluorescence after 24 h
incubation at 37uC (Table 3). cp-mKate189-188 is the bright-
cp175-174a 0.3 19.8
est circular permutation variant in E.coli. However, analysis of
cp176-175 0 3.9 purified proteins in 20 mM HEPES (pH 7.4) indicated that the
cp177-176 0 4.3 brightness of cp-mKate149-148, mKate151-150, cp-mKate167-166, and
cp178-177 0 1.0 cp-mKate168-167 was quite high, exceeding 80% of fluorescence of
cp179-178 0 0 native mKate, indicating highly efficient fluorescent configura-
tions. The 442 nm absorption peak (Fig. 3B), which emits green
Loop 9–10 region and flanking sites
fluorescence at 532 nm, revealed a slight augmentation of green
cp188-187 0 0
fluorescence in cp-mKates. The ratio of absorption at 588 nm and
cp189-188 0 0.7 442 nm (Table 4) indicated a relatively high percentage of green
cp190-189 0.4 36.3 components in cp-mKate154-153, cp-mKate168-167, cp-mKate187-
186
cp191-190 0.3 19.8 , and cp-mKate189-188, whereas cp-mKate149-148 displays a
cp192-191 0 11.0
fluorescence spectrum similar to the native mKate. The quantum
yield at 588 nm for the cp-mKates is only slightly lower than
cp193-192a 0.2 17.2
mKate, whereas the ratio of A588/A280 indicated that a number of
cp194-193 1.0 39 cp-mKate molecules (cp-mKate154-153, cp-mKate187-186, cp-
cp195-194 0 3.3 mKate189-188) have a substantially lower absorption at 588 nm
cp196-195 0.2 3.1 with matched protein concentration (Table 4).
cp197-196 0.3 3.8 We also screened cp-mKate variants that correspond to the site
in cp-EGFP used to develop the GCaMP family of calcium sensors
cp198-197 0.1 3.8
[2,3], based on structural and sequence alignments of mKate and
cp199-198 0 0
EGFP. Colonies transformed with cp-mKate139-138, cp-mKate140-
Published cp-mCherryc 139
, cp-mKate141-140, cp-mKate144-143 did not display red
cp184 ,0.5 18 fluorescence, even when incubated up to 7 days at 2–8uC
cp193 ,0.5 1 (Table 3).
cp193g7 69 100
Truncations of cp-mKate
*
Circular-permutated mCherry variants were numbered by the primary amino To explore the possibility that the fluorescence of individual
acid sequence of mCherry as shown in Fig. 1C. Variants are labeled with the
new amino and carboxy termini (e.g. cp159-158 has the new N-terminus from
circular permutations is influenced by N- or C-terminal residues,
the native carboxy amino acids 159 to 236 and the new C-terminus from the we next determined the sensitivity of fluorescence to deletions at
amino residues 1 to158). the amino and carboxy termini of the fluorescent cp-mKate
a
Fluorescent variants from the initial screening in each region. permutants. A series of variants with truncated amino or carboxy
b
Aligns to cp-EGFP in GCaMP2.
ends were constructed. In this regard an individual construct could

PLoS ONE | www.plosone.org 4 May 2011 | Volume 6 | Issue 5 | e20505

 Circular Permutation of mKate and mCherry

Table 2. Properties of circular-permutated mCherry variants. Table 3. Screening of circular-permutated mKate variants in
E.coli.

Brightness
Extinction Relative of proteine Colony brightness 24 h Colony brightness 72 h
coefficientb Quantum brightnessd (% of Variant * at 376C (% of mKate) at 2–86C (% of mKate)
Proteina (M-1 cm21) yieldc (% of mCherry) mCherry)
mKate 100 100
mCherry 91,000f 0.22 100 100
pRSET-A 0 0
cp159-158 91,000 0.21 95 37.4
cp139-138a 0 0
cp160-159 89,000 0.21 93 22.0
cp140-139a 0 0
cp175-174 91,000 0.20 91 41.5
cp141-140a 0 0
cp190-189 88,000 0.21 92 59.1
cp144-143a 0 0
cp191-190 93,000 0.20 93 53.3
Loop 7-8 region and flanking sites
cp193-192 93,000 0.20 93 51.7
cp148-147 0 0
cp194-193 90,000 0.20 90 60.6
cp149-148 1.1 32.3
cp184 26,600g 0.22 NDi 37.0
g
cp150-149 0.2 11.7
cp193g7 42,000 0.23 NDi 60.6
cp151-150b 7.5 28.4
a
All circular-permutated variants from native mCherry sequence shown in this cp152-151 5.1 21.4
table, except cp184 (not determined), have the same excitation (587 nm) and
emission (610 nm) maxima as mCherry. The excitation and emission maxima of cp153-152 2.9 20.8
the cp193g7, with 6 amino acid mutations, are 580 nm and 602 nm, cp154-153 10.9 19.4
respectively [19].
b
Extinction coefficients were measured by alkali-denatured chromophore cp155-154 0 0
method. cp156-155 0 0
c
Quantum yields were measured using mCherry as the reference standard.
d Loop 8–9 region and flanking sites
Relative brightness of chromophore (extinction coefficient 6 quantum yield)
was compared with mCherry (91,00060.22). cp164-163 0 0
e
Fluorescence of cp-mCherry relative to mCherry with fixed protein
cp165-164 1.9 13.2
concentration (BCA assay).
f
Our data; the published data are 72,000 [7], 78,000 [9]. cp166-165 10.2 24.7
g
Published values [18,19], which were based on the protein quantification
cp167-166c 6.6 21.6
(absorption at 280 nm).
i
Not determined. cp168-167 3.6 22.2
doi:10.1371/journal.pone.0020505.t002 cp169-168 1.6 16.3

be regarded as either an amino or carboxy deletion; thus cp170-169 0 0

cp-mKate154-150, for example, is an amino truncation of cp- Loop 9–10 region and flanking sites
mKate151-150, or a carboxy truncation of cp-mKate154-153. As cp180-179 0 0
shown in Table 3, for Loop 9–10 region of cp-mKates, the cp181-180 0 0
fluorescent variants contain the N-terminal residue from 182
cp182-181 11.5 12.6
to192 and the
cp183-182 23.7 30.0
C-terminal residue from 181 to 191, respectively). Most of the
truncated variants from cp-mKate183-182 and cp-mKate182-181 cp184-183 18.7 28.4
markedly decreased fluorescence in E.coli, except the cp-mKate185- cp185-184 9.7 17.5
182
, which had similar performance to that of the cp-mKate183-182 cp186-185 21.2 27.7
(Table 5). The N- and C-terminal boundary for truncation in cp187-186 26.7 30.8
which fluorescence was preserved were 192 and 181, respectively,
cp188-187 9.9 19.7
indicating that truncations within the region of circular permu-
tation were tolerated. Similar experiments were performed in the cp189-188d 33.9 55.2
region of Loop 7–8 and Loop 8–9 cp-mKate variants, indicating cp190-189 12.1 18.3
that the amino and carboxy boundaries for truncation were cp191-190 8.3 15
residues 154 and 148 for Loop 7–8 region, and 169 and 164 for cp192-191 0.4 6
Loop 8–9 region (data not shown).
cp193-192 0 0
cp194-193 0 0
Crystal Structure of cp-mKate
154-153 168-167
X-ray crystallography on cp-mKate and cp-mKate *
The circularly permuted variants are labeled with the new amino and carboxy
allowed us to resolve the structure of the two permutants at 3.0Å termini.
a
and 1.7Å resolution, respectively (Table 6 and Fig. 4). The Align to cp-EGFP in GCaMP2.
b
Aligns to cp-mCherry159-158.
resolved structure is quite similar to that previously reported for c
Aligns to cp-mCherry 175-174.
wild-type mKate [13] (route mean square deviations of 0.31Å and d
Aligns to cp-mCherry194-193.
0.23Å, respectively), revealing an elliptical b-barrel that is properly doi:10.1371/journal.pone.0020505.t003
folded in cp-mKate168-167 and indistinguishable in tertiary
structure to that of wild-type mKate (Fig. 4A). The linker that
connects the two reoriented components of the circularly
permutated molecule appears in the loop structure and locates

PLoS ONE | www.plosone.org 5 May 2011 | Volume 6 | Issue 5 | e20505

 Circular Permutation of mKate and mCherry

Figure 3. Absorption spectra of cp-mCherry and cp-mKate variants. Spectra were normalized to the 280 nm absorption for each protein.
A. Absorption spectra of mCherry and cp-mCherry variants. B. Absorption spectra of mKate and cp-mKate variants.
doi:10.1371/journal.pone.0020505.g003

Table 4. Properties of circular-permutated mKate variants.

Absorptionb Quantum yieldc Absorptiond Brightness of proteine

Proteina (A588/A442) (588 nm) (A588/A280) (% of mKate)

mKate 4.13 0.33 0.74 100

cp149-148 4.79 0.33 0.68 90.1
cp151-150 3.25 0.31 0.61 83.6
cp154-153 0.81 0.28 0.19 21.2
cp166-165 2.88 0.28 0.58 70.5
cp167-166 2.73 0.32 0.61 81.6
cp168-167 1.8 0.30 0.65 84.0
cp187-186 1.45 0.30 0.25 30.4
cp189-188 1.47 0.29 0.27 36.3

a
Red fluorescence of all circular-permutated mKate variants shown in this table, with a N-terminal leader peptide from pRSET vector, have the same excitation (588 nm)
and emission (620 nm) maxima as mKate; whereas the published emission maximum of mKate are 635 nm [9], and 625 nm [24].
b
Absorption maxima for red and green chromophores are 588 nm and 442 nm, respectively.
c
Red fluorescence quantum yield at 588 nm excitation were measured using mKate as the reference standard.
d
Ratio of red chromophore absorption at 588 nm and protein absorption at 280 nm.
e
Fluorescence of cp-mKate relative to mKate with fixed protein concentration (BCA assay).
doi:10.1371/journal.pone.0020505.t004

PLoS ONE | www.plosone.org 6 May 2011 | Volume 6 | Issue 5 | e20505

 Circular Permutation of mKate and mCherry

Table 6. X-ray Data Colletion and Refinement Statistics of cp-

Table 5. Truncation of circular-permutated mKate variants.
mKate154-153 and cp-mKate168-167.

Colony brightness 24 h Colony brightness 72 h

Variant at 376C (% of mKate) at 2–86C (% of mKate) cp-mKate154-153 cp-mKate168-167

cp183-182* 21.4 24.6 Data collection

cp185-182 23.1 24.2 X-ray source CHESS A1 CHESS A1

cp188-182 15.1 13.3 Wavelength (Å) 0.978 0.978

cp191-182 7.9 11.5 Space group P212121 C2

cp193-182 0 0 Unit cell parameters

cp182-181* 16.9 16.9 a, b, c (Å) 71.46, 71.44, 367.73 109.357, 93.280,194.370

cp186-181 2.6 2.2 a, b, c (u) 90.0, 90.0, 90.0 90.0, 96.52, 90.0

cp191-181 1.8 3.1 Resolution (Å) 38.98-3.00 (3.11-3.00) 38.31-1.75 (1.81-1.75)

cp192-181 0.2 1 No. of reflections

cp193-181 0 0 Total 330773 (32752) 180131 (15380)

cp181-180* 0 0 Unique 37589 (3680) 45032 (4660)

pRSET-A 0 0 Completeness (%) 99.9 (100.0) 92.5 (79.6)

mKate 100 100 Redundancy 8.8 (8.9) 4.0 (3.3)

I/s(I) 15.3 (2.0) 39.4 (7.26)
*Original symmetric cp-mKate.
Rmeas (%) 11.9 (47.7) 5.1 (14.5)
doi:10.1371/journal.pone.0020505.t005
Refinement
at one end of the b-barrel (Fig. 4A). Minor conformational Rwork/Rfree (%) 21.7/27.8 18.0/21.1
changes in cp-mKate were restricted to the loop structures at both r.m.s. deviations
ends of the b-barrel and may account for the reported red–green
Bond length (Å) 0.009 0.007
shift. The chromophore resides entirely in cis-conformation,
however, with hydrogen-bonding with Trp 90, Arg92 and Bond angles (u) 1.590 1.164
Ser143 (Fig. 4B). No. of atoms
Protein 14974 16094
Discussion Water 2 1453

The generation of large numbers of circular permutations by doi:10.1371/journal.pone.0020505.t006

tandem template PCR and fluorescence screening of bacterial
colonies is a highly efficient approach to exploring the potential decreased brightness of the cp-mCherry proteins is due to
permutation variants of fluorescence proteins. We have system- incomplete folding of a significant fraction of the protein. This
atically examined mCherry and mKate by creating circular interpretation is further supported by the fact that the 6 amino
permutants at the loop regions in which the greatest flexibility acid mutations in cp193g7, which have been shown to improve
would be expected. In attempting to develop a highly fluorescent protein folding efficiency, resulted in a much higher fluorescence
circularly permutated red protein, design strategies aimed at than observed in cp193-mCherry [19], similar to the brightness
structurally mimicking cp-EGFP, which is the basis for the effect of the superfolder green fluorescent protein [22].
successful GCaMP Ca2+ sensors [3,20,21], proved not to be a In general the fluorescence of cp-mCherry permutants from
successful approach, as the analogous cp variants of both native mCherry developed more slowly, and achieved much
mCherry and mKate failed to show significant fluorescence. higher brightness when bacteria were further incubated at lower
Structural analysis revealed three highly homologous loop regions temperature. By contrast, cp-mKate variants developed significant
in mCherry and mKate, and these areas along with flanking sites fluorescence in bacteria by 24 h at 37uC (Table 3). The brightest
were systematically explored. Each region tolerated circular variant in the bacterial assay was cp-mKate189-188, with colonies
permutation, but fluorescence varied markedly, with most achieving 55.2% of the brightness of native mKate after 72 h
efficient permutation sites tending to occur within the central incubation. However, the brightness of bacterial colonies did not
loop regions. strictly correlate with protein fluorescence, and proteins isolated
As shown in Table 1 and Table 2, the brightest mCherry from only modestly fluorescent colonies were among the brightest
variant (cp-mCherry194-193) retained 60.6% of the brightness of proteins identified. Thus although cp-mKate189-188 demonstrated
native mCherry on a protein basis, but strong fluorescence was the brightest colony fluorescence, the purified protein displayed
also observed for circular permutations cp-Cherry159-158, cp- 36.3% of native mKate fluorescence, whereas the relative
Cherry160-159, cp-mCherry175-174, cp-mCherry190-189, cp- fluorescence of cp-mKate149-148, cp-mKate151-150, cp-mKate167-
166
mCherry191-190 and cp-mCherry193-192. All of the cp-mCherry , and cp-mKate168-167 exceeded 80% at pH 7.4. The higher
variants displayed similar absorption spectra as native mCherry fluorescence of these proteins may relate to cytosolic factors such
(Fig. 3A). Moreover, the red chromophore in cp-mCherry as pH, resulting in higher percentage of properly folded protein
variants and mCherry are functionally similar, having nearly and mature red chromophore in the purified proteins.
equivalent extinction coefficient and quantum yield values. Thus, Individual sites for the modification of mKate that tolerate circular
the marked difference in relative brightness between cp-mCherry permutation or splitting have been previously reported. A voltage
variants and native mCherry when evaluated on a chromophore probe used a cp-mKate(180) [23] that contained 3 duplicated amino
and equivalent concentration of protein basis indicates that the acids at the N-ternimus and otherwise corresponded to the

PLoS ONE | www.plosone.org 7 May 2011 | Volume 6 | Issue 5 | e20505

 Circular Permutation of mKate and mCherry

Figure 4. Crystal structure of cp-mKate154-153 and cp-mKate168-167. A. Cartoon presentation of mKate (pH 7.0), cp-mKate154-153 and
cp-mKate168-167. The figures are drawn with PyMol (DeLano Scientific). B. 2mFo-Fc electron density map near chromophore region. The map is
contoured at 1.0s.
doi:10.1371/journal.pone.0020505.g004

moderately bright cp-mKate183-182. A reported functional split site for (cp-mKate151-150, cp-mKate167-166, and cp-mKate168-167) exceed
mKate (151) for a BIFC system [24] belongs to the highly fluorescent 80% of mKate fluorescence, constituting new permutants
Loop 7–8 region (Table 3). We also confirmed the tolerance of available for implementation as sensor or complementation pairs.
selected sites to peptide insertions, which was found to be robust (data Moreover, the discovery of bright sensors with substantial green
not shown). fluorescence, such as cp-mKate168-167, or a stabilized cp-
Although mKate and its variants have been widely used as red mKate154-153, may be useful in the development of green/red
fluorescent proteins, these proteins exhibit green fluorescence to a ratiometric sensors.
variable degree [25]. We found that circular permutation of Truncation variants showed that in each region of cp-mKate,
mKate enhanced green fluorescence in several constructs, aug- there are minimum native N-terminal and C-terminal fragments
menting absorption at 442 nm. As any green fluorescence of required to maintain fluorescence. For example, the minimum C-
mKate proteins will contribute to the total fluorescence after terminal and N-terminal fragments were 192-231 and 1-181, for
alkaline-denaturation, a precise measurement of the extinction Loop 9–10 region cp-mKate. The ability to truncate variants
coefficient of the red chromophore in cp-mKates by this method is without loss of significant fluorescence provides significant
not valid. As with mCherry circular permutants, red fluorescence flexibility in the linkage of these permutants to other functional
quantum yield is only slightly decreased in cp-mKates. In the case peptides.
of mCherry, the extinction coefficients of circularly permutated Finally, crystallization and structural analysis of cp-mKate154-153
and wild-type proteins are quite similar, and the decrease in the and cp-mKate168-167 revealed the expected tertiary structure
A587/A280 absorption ratio indicates that the contribution of previously reported for mKate [16], with only slight variations
poorly folded proteins is the major factor in loss of brightness around the permutation point. Future studies will be directed at
(Table 2 and Fig. 3A). However, for mKate variants with lower determining the structural basis for fluorescence variation in
brightness than the native protein, similar A588/A280 ratios circular permutants of mKate.
between these forms reflects not only the effect of improperly In summary, we report several highly fluorescent circularly
folded protein, but the extent to which permutation has resulted in permutated variants of mCherry and mKate. These variants are
a red–green shift. Interestingly, we found very bright cp-mKates grouped in 3 regions and constitute the brightest red circularly
with substantial red–green shifts, such as cp-mKate168-167, and permutated proteins with native protein sequences reported to
very bright variants without a substantial shift, such as cp- date. The reported bright circularly permutated mKate proteins,
mKate149-148 (Table 4 and Fig. 3B). The overall brightness of and further stabilized mCherry variants, should provide additional
these constructs suggests minimal effects of incomplete folding at candidates for the construction of red sensors and complementa-
pH 7.4, whereas loss of brightness in variants with similar red– tion tools.
green shifts, such as seen in a comparison of cp-mKate168-167 and
cp-mKate187-186, indicates less efficient folding and chromophore
stabilization in the latter variant (Table 4 and Fig. 3B). cp- Accession Numbers
mKate149-148 was the brightest protein identified with over 90 Atomic coordinates and structure factors have been deposited in
percent of native brightness, but 3 additional variants the RCSB Protein Data Bank under ID code 3rwt and 3rwa.

PLoS ONE | www.plosone.org 8 May 2011 | Volume 6 | Issue 5 | e20505

 Circular Permutation of mKate and mCherry

Acknowledgments Author Contributions

We thank the technical support of the Microscopy and Imaging Facility at Conceived and designed the experiments: BS QW LJB HS MIK.
Cornell University, the scientists and staff members at Cornell High Performed the experiments: BS QW LJB. Analyzed the data: BS QW
Energy Synchrotron Source (CHESS) for assistance with synchrotron data FL LJB DMC SAL HS MIK. Contributed reagents/materials/analysis
collection. tools: DMC SAL. Wrote the paper: BS QW HS MIK.

References
1. Baird GS, Zacharias DA, Tsien RY (1999) Circular permutation and receptor 14. Otwinowski Z, Minor W (1997) Processing of X-ray diffraction data collected in
insertion within green fluorescent proteins. Proc Natl Acad Sci U S A 96: oscillation mode. Macromolecular Crystallography, Pt A 276: 307–326.
11241–11246. 15. Adams PD, Grosse-Kunstleve RW, Hung LW, Ioerger TR, McCoy AJ, et al.
2. Nagai T, Sawano A, Park ES, Miyawaki A (2001) Circularly permuted green (2002) PHENIX: building new software for automated crystallographic structure
fluorescent proteins engineered to sense Ca2+. Proc Natl Acad Sci U S A 98: determination. Acta Crystallogr D Biol Crystallogr 58: 1948–1954.
3197–3202. 16. Pletnev S, Shcherbo D, Chudakov DM, Pletneva N, Merzlyak EM, et al. (2008)
3. Nakai J, Ohkura M, Imoto K (2001) A high signal-to-noise Ca(2+) probe A crystallographic study of bright far-red fluorescent protein mKate reveals pH-
composed of a single green fluorescent protein. Nat Biotechnol 19: 137–141. induced cis-trans isomerization of the chromophore. J Biol Chem 283:
4. Ghosh I, Hamilton AD, Regan L (2000) Antiparallel leucine zipper-directed 28980–28987.
protein reassembly: Application to the green fluorescent protein. Journal of the 17. Emsley P, Cowtan K (2004) Coot: model-building tools for molecular graphics.
American Chemical Society 122: 5658–5659. Acta Crystallogr D Biol Crystallogr 60: 2126–2132.
5. Zhang S, Ma C, Chalfie M (2004) Combinatorial marking of cells and organelles 18. Li Y, Sierra AM, Ai HW, Campbell RE (2008) Identification of sites within a
with reconstituted fluorescent proteins. Cell 119: 137–144. monomeric red fluorescent protein that tolerate peptide insertion and testing of
6. Wang Q, Shui B, Kotlikoff MI, Sondermann H (2008) Structural basis for corresponding circular permutations. Photochem Photobiol 84: 111–119.
calcium sensing by GCaMP2. Structure 16: 1817–1827. 19. Carlson HJ, Cotton DW, Campbell RE (2010) Circularly permuted monomeric
7. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, et al.
red fluorescent proteins with new termini in the beta-sheet. Protein Sci 19:
(2004) Improved monomeric red, orange and yellow fluorescent proteins derived
1490–1499.
from Discosoma sp. red fluorescent protein. Nat Biotechnol 22: 1567–1572.
20. Tallini YN, Ohkura M, Choi BR, Ji G, Imoto K, et al. (2006) Imaging cellular
8. Merzlyak EM, Goedhart J, Shcherbo D, Bulina ME, Shcheglov AS, et al. (2007)
signals in the heart in vivo: Cardiac expression of the high-signal Ca2+ indicator
Bright monomeric red fluorescent protein with an extended fluorescence
GCaMP2. Proc Natl Acad Sci U S A 103: 4753–4758.
lifetime. Nat Methods 4: 555–557.
9. Shcherbo D, Merzlyak EM, Chepurnykh TV, Fradkov AF, Ermakova GV, et al. 21. Tian L, Hires SA, Mao T, Huber D, Chiappe ME, et al. (2009) Imaging neural
(2007) Bright far-red fluorescent protein for whole-body imaging. Nat Methods activity in worms, flies and mice with improved GCaMP calcium indicators. Nat
4: 741–746. Methods 6: 875–881.
10. Chiang JJ, Li I, Truong K (2006) Creation of circularly permutated yellow 22. Pedelacq JD, Cabantous S, Tran T, Terwilliger TC, Waldo GS (2006)
fluorescent proteins using fluorescence screening and a tandem fusion template. Engineering and characterization of a superfolder green fluorescent protein. Nat
Biotechnol Lett 28: 471–475. Biotechnol 24: 79–88.
11. Gross LA, Baird GS, Hoffman RC, Baldridge KK, Tsien RY (2000) The 23. Gautam SG, Perron A, Mutoh H, Knopfel T (2009) Exploration of fluorescent
structure of the chromophore within DsRed, a red fluorescent protein from protein voltage probes based on circularly permuted fluorescent proteins. Front
coral. Proc Natl Acad Sci U S A 97: 11990–11995. Neuroengineering 2: 14.
12. Ward WW (2005) Biochemical and physical properties of green fluorescent 24. Chu J, Zhang Z, Zheng Y, Yang J, Qin L, et al. (2009) A novel far-red
protein. In: M. Chalfie and S.R. Kain, Editors, Green Fluorescent Protein: bimolecular fluorescence complementation system that allows for efficient
Properties, Applications and Protocols (Second Edition), Wiley and Sons, visualization of protein interactions under physiological conditions. Biosens
Hoboken, NJ (2005), pp 39–65. Bioelectron 25: 234–239.
13. Horiba Scientific. A guide to recording fluorescence quantum yields. http:// 25. Lin MZ, McKeown MR, Ng HL, Aguilera TA, Shaner NC, et al. (2009)
www.horiba.com/fileadmin/uploads/Scientific/Documents/Fluorescence/ Autofluorescent proteins with excitation in the optical window for intravital
quantumyieldstrad.pdf. imaging in mammals. Chem Biol 16: 1169–1179.

PLoS ONE | www.plosone.org 9 May 2011 | Volume 6 | Issue 5 | e20505