Ni Hms 902603

HHS Public Access
Author manuscript
Nat Protoc. Author manuscript; available in PMC 2017 September 28.
Author Manuscript
Published in final edited form as:

Nat Protoc. 2014 November ; 9(11): 2663–2681. doi:10.1038/nprot.2014.180.
Influenza A Virus Isolation, Culture and Identification

Amie J. Eisfeld1, Gabriele Neumann1, and Yoshihiro Kawaoka1,2,3,4,*
1InfluenzaResearch Institute, Department of Pathobiological Sciences, School of Veterinary
Medicine, University of Wisconsin-Madison, 575 Science Drive, Madison, WI 53711, USA
2ERATO Infection-Induced Host Responses Project, Japan Science and Technology Agency,
Saitama 332-0012, Japan
Author Manuscript
3Division of Virology, Department of Microbiology and Immunology, Institute of Medical Science,

University of Tokyo, Tokyo 108-8639, Japan
4Department of Special Pathogens, International Research Center for Infectious Diseases,
Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo 108-8639, Japan
SUMMARY
Influenza A viruses (IAV) cause epidemics and pandemics that result in considerable financial
burden and loss of human life. To manage annual IAV epidemics and prepare for future
pandemics, improved understanding of how IAVs emerge, transmit, cause disease, and acquire
pandemic potential is urgently needed. Fundamental techniques essential for procuring such
knowledge are IAV isolation and culture from experimental and surveillance samples. Here, we
Author Manuscript
present a detailed protocol for IAV sample collection and processing, amplification in chicken
eggs and mammalian cells, and identification from samples containing unknown pathogens. This
protocol is robust, and allows for generation of virus cultures that can be used for downstream
analyses. Once experimental or surveillance samples are obtained, virus cultures can be generated
and the presence of IAV can be verified in 3–5 days. Increased time-frames may be required for
less experienced laboratory personnel, or when large numbers of samples will be processed.
INTRODUCTION
Influenza A viruses (IAVs) cause seasonal epidemics that are responsible for 3–5 million
severe human cases and ≥ 250,000 deaths worldwide annually1, and sporadic pandemics that
can induce an even higher disease burden and loss of human life. Seasonal epidemics are
Author Manuscript
caused by antigenic drift, a process facilitated by a combination of immune pressure and an

intrinsically high IAV mutation rate. Specifically, when the hemagglutinin (HA) protein of a
circulating IAV acquires mutations that enable immune evasion, such a virus can spread
efficiently in humans that lack preexisting antibodies against the antigenically drifted
*
Corresponding author’s telephone and fax numbers: +1 (608) 265-4925 (office); +1 (608) 262-9641 (fax),
[email protected].
AUTHOR CONTRIBUTIONS STATEMENTS
AJE, GN, and YK wrote the manuscript.
COMPETING FINANCIAL INTERESTS
The authors declare that they have no competing financial interests.
Eisfeld et al. Page 2
variant. For this reason, seasonal IAV vaccines must be reformulated every 1–3 years.
Author Manuscript
Pandemic IAVs emerge when novel avian IAVs, or reassortant IAVs possessing genes
derived from avian, human, and/or swine viruses – for which most humans lack immunity –
are transmitted to humans from reservoir species (i.e., birds and swine). Five IAV pandemics
occurred during the 20th and 21st centuries (i.e., in 1918, 1957, 1968, 1977, and 2009); the
worst of these was the 1918 Spanish influenza, which was responsible for ≥ 50 million
deaths2.
IAVs are diverse. Virus subtypes are categorized based on the antigenic properties of the HA
and neuraminidase (NA) virion surface proteins, and to date, 17 HA subtypes (e.g., H1, H2
etc.) and 10 NA subtypes (e.g., N1, N2 etc.) have been identified. All HA and NA subtypes
are found in avian species (with the exception of H17 and N10, which have been detected
only in bats3), whereas viruses of only a few subtypes are found in swine. Currently, viruses
of the H1N1 and H3N2 subtypes circulate in humans; however, since 1997, highly
Author Manuscript
pathogenic avian influenza (HPAI) viruses of the H5N1 subtype (H5N1-HPAI) have
occasionally transmitted from birds to humans, and to date such zoonotic events have caused
at least 667 clinically confirmed human cases and 393 deaths (58.9% mortality)4. The steep
mortality rate associated with human H5N1-HPAI infections is alarming, but the lack of
efficient human-to-human transmission has, so far, prevented these viruses from causing a
pandemic. Nonetheless, recent reports indicate that only a few mutations may be needed for
H5N1-HPAI viruses to acquire transmission capability in mammals, and some of these
mutations are already present in human isolates5–7. In the spring of 2013, viruses of the
H7N9 subtype emerged in humans in China8, and the ongoing epidemic comprises >400
infections9. These H7N9 viruses already are capable of limited transmission in humans10
and in mammalian infection models11–14, suggesting that they possess pandemic potential.
Author Manuscript
Surveillance to detect IAVs in human and animal populations is necessary to guard against
seasonal epidemics, as well as novel and potentially devastating pandemic viruses. In
particular, routine surveillance is conducted in humans year-round, and is critical for
monitoring influenza activity, evaluating vaccine efficacy, and to assist in vaccine strain
selection for upcoming IAV seasons. Surveillance is also performed in animal reservoirs to
identify potential pandemic threats. Fundamentally, a successful surveillance program
requires the ability to isolate, amplify, and identify IAV from various sources. In this
protocol, we describe standard procedures for IAV surveillance sample collection, virus
culture, and virus identification, which have been developed over decades of research. The
protocol is presented in three parts (a flowchart of the protocol is depicted in Figure 1),
focusing on sample collection and processing (Part 1); virus culture in either embryonated
chicken eggs or mammalian cells (Part 2); and verification of the presence of IAV using
Author Manuscript
hemagglutination (HA) assays and reverse transcriptase polymerase chain reaction (RT-
PCR) analysis (Part 3).
Protocol Design
It should be noted that this protocol is primarily designed for use in research, and is not a
clinical protocol. In addition, it is important to appreciate that the described techniques are
applicable not only for surveillance samples, but also for experimental samples generated

during basic research. For additional information extending beyond the scope of the current
Author Manuscript
protocol, readers are referred to the World Health Organization (WHO) Global Influenza
Surveillance Network (GISN) “Manual for the Laboratory Diagnosis and Virological
Surveillance of Influenza”15, the WHO “Manual on Animal Influenza Diagnosis and
Surveillance”16, the WHO informational document describing the molecular diagnosis of
influenza in humans17.
Sample collection—Most IAV surveillance samples are collected from humans exhibiting
respiratory disease symptoms and are processed and analyzed in local, national, and global
laboratories throughout the world (for examples, see references18–20). However, human
samples also may be collected and processed by research laboratories in the context of
clinical trials, or for occupational medical surveillance programs. Animal surveillance
samples are collected from swine, poultry, wild birds and other species to advance overall
knowledge of IAV epizootiology, pinpoint the source(s) of emerging or pandemic viruses,
Author Manuscript
and for other medical, veterinary, or experimental purposes. The collection and processing
of the following types of samples are described in this protocol:
• Swab samples from humans (nasal, nasopharyngeal, or oropharyngeal); avian

species (oropharyngeal, tracheal, cloacal, or fecal); and non-human, mammalian
species (nasal, naso- or oropharyngeal, tracheal, rectal, or fecal)
• Liquid samples from environmental sources (e.g., water from lakes or troughs in
live poultry markets); experimentally infected animals (e.g., nasal wash,
bronchoalveolar lavage); and humans (nasopharyngeal aspirates, naso- or
oropharyngeal gargles, bronchoalveolar lavage, sputum, or tracheal aspirates)
• Tissue samples from experimentally sacrificed animals, or from slaughtered or

Author Manuscript
dead animals (tissues may include blood, respiratory organs [nasal turbinate,
trachea, bronchus and lung], intestinal tract, liver, kidney, spleen, pancreas, brain
and/or other tissues)
IAV identification workflows—Once samples have been collected, the workflow for
virus identification may proceed in several ways (Figure 1). The ‘gold standard’ for IAV
identification is virus culture in embryonated chicken eggs or mammalian cells, followed by
a positive result in an HA assay, and subsequent verification of IAV in HA-positive samples
by use of a more specific assay, such as RT-PCR analysis of genomic viral RNA (each of
these methods is described in detail below). This workflow is highly sensitive and quickly
produces a virus isolate ‘stock’ that can be used for further analysis and/or sent to WHO
Collaborating Centre reference laboratories21 to enable vaccine strain selection and efficacy
monitoring, or to aid in the identification of unknown virus subtypes. However, the ‘gold
Author Manuscript
standard’ workflow is time-consuming and labor-intensive, and may not be feasible when
rapid results are imperative or when hundreds or thousands of samples need to be assessed.
Moreover, this approach may fail to identify IAV when viral material is present in samples
but infectious virus is not, because no virus will be amplified in egg or cell cultures. An
alternative approach to hasten sample evaluation and ensure IAV identification in the
absence of infectious virus is to directly analyze sample material by using a rapid, specific
and sensitive assay (i.e., RT-PCR). Both standard and real-time RT-PCR may be suitable for

this purpose22,23, although real-time RT-PCR is more practical for large numbers of samples
Author Manuscript
or when under a restrictive deadline because results are reported during the thermocycling
procedure, without requiring subsequent gel electrophoresis and imaging steps. After the
presence of IAV has been identified by using RT-PCR, virus cultures can then be prepared
only from positive samples for use in downstream analyses. One disadvantage of this ‘fast’
workflow is that it may report false negative results in cases where viral RNA copy numbers
are below the threshold for detection. Therefore, a third possible workflow – combining the
‘gold standard’ and ‘fast’ workflows – may be considered when both rapid and accurate
results are needed. In this ‘combined’ workflow, samples are subjected to RT-PCR analysis
directly to produce a preliminary set of positives within a short time period (i.e., usually the
same day). In parallel, all samples are also subjected to virus culture, with follow-up HA
assays and/or RT-PCR analyses to identify a secondary set of IAV-positive samples (virus
culture may increase the identification of positive samples due to amplification of low initial
Author Manuscript
virus amounts). Preliminary and secondary sets of positives are then compared to identify
the complete set of positive samples. Selection of the appropriate IAV identification
workflow should be determined according to project needs and laboratory resources.
Virus cultures—To prepare virus cultures from surveillance samples, aliquot(s) should be
inoculated into embryonated chicken eggs or cell cultures, depending upon the sample’s
origin. Most IAVs derived from avian species replicate efficiently in embryonated eggs (as
originally demonstrated by Goodpasture et al.24), and eggs are the preferred substrate for
virus amplification from avian sources. Avian IAVs possess HA proteins that preferentially
bind to terminal α2-3-linked sialic acid moieties on cell surface molecules. These are
abundant on the cells that line the allantoic cavity of embryonated eggs25 (Figure 2A–B),
and therefore, avian virus egg inoculations are directed to this region. Human IAV HA
proteins prefer α2-6 sialic acid linkages and replicate in the egg amniotic cavity (Figure 2A–
Author Manuscript
B) because both α2–3 and α2–6 sialic acids are present in this compartment25, although it
should be noted that recent H3N2 viruses replicate poorly in this cavity26–28.
Historically (i.e., before the availability of cell culture systems), human viruses were grown
in eggs, and currently, most seasonal influenza vaccines are still produced this way.
However, some human and swine IAVs replicate inefficiently in eggs, and passaging
mammalian viruses in eggs can result in the acquisition of mutations that affect receptor
binding specificity and/or antigenicity25,29,30. As an alternative, IAVs can be amplified in
mammalian cell cultures. Several primary and continuous mammalian cell types are suitable
for IAV propagation, but the most frequently used is the Madin-Darby canine kidney
(MDCK) cell line. MDCK cells were first described in 196631 and were shown to support
replication of some IAVs shortly thereafter32. Later studies indicated that addition of trypsin
Author Manuscript
to MDCK cultures allowed for more efficient propagation and sensitive detection of IAVs
from human specimens when compared to cultures lacking trypsin33–35. Trypsin facilitates
virus growth in MDCK cells by mediating cleavage of the virion surface glycoprotein
precursor – HA0 – into HA1 and HA2 subunits36,37, an event that is required for HA fusion
with the endosomal membrane and release of genetic material into a newly infected cells38.
MDCK cells are relatively resistant to continuous culture with trypsin and express proteins
bearing sialic acids with both α2-3 and α2-6 linkages at their surfaces25, making them an

ideal cell type for propagation of IAVs that do not grow well in eggs. MDCK cells are
Author Manuscript
usually permissive for mammalian IAVs, but are less so for viruses derived from avian
species. Of note, a recent innovation in the isolation and propagation of current human
influenza viruses is the generation of MDCK cells that are engineered to express increased
levels of α2,6-linked sialic acid receptors39. These cells may enhance the isolation of human
IAVs from clinical specimens and increase virus culture titers relative to standard MDCK
cells, and can be used interchangeably with standard MDCK cells in the techniques
described in this protocol.
HA assay—A widely used, inexpensive, rapid and standard screening method for the
detection of IAVs is the hemagglutination (HA) assay (originally developed by Hirst40 and
Francis et al.41), which is based on the ability of the viral HA protein to bind to and
‘agglutinate’ red blood cells (RBCs). HA binding to RBCs is mediated by α2,3- and/or
α2,6-linked sialic acid moieties at the RBC surface. HA assays are performed by mixing
Author Manuscript
dilutions of virus-containing samples with a standard amount of RBCs in microtiter plates

and observing agglutination patterns after a period of incubation. Agglutination causes
RBCs to form a sheet that settles at the bottom of a well – giving a cloudy appearance –
while the lack of agglutination results in RBC settling to the bottom of the well in the form
of a point of cells (i.e., a ‘button’) or a circle of cells (i.e., a ‘halo’), surrounded by relatively
translucent buffer.
The amount of IAV HA protein in surveillance samples is usually insufficient to yield

positive results in the HA assay; however, this assay is effective for screening large numbers
of virus cultures before performing additional – more specific – diagnostic analyses (i.e.,
RT-PCR). Importantly, several factors need to be considered when using this assay, including
the following: (1) a positive HA assay indicates the presence of viral HA protein, but does
Author Manuscript
not require infectious virus; (2) some IAVs do not agglutinate RBCs efficiently, even if their
infectivity is high; (3) the origin of the RBCs (e.g., chicken, turkey, guinea pig, horse) can
significantly affect the HA activity of an IAV, due to species-specific expression patterns of
α2,3- and α2,6-linked sialic acid moieties on RBC surfaces42; and (4) hemagglutinin
proteins from other viruses (e.g., paramyxoviruses) can induce RBC agglutination, so a
positive HA assay result should always be followed with a secondary assay that can
specifically identify the IAV. Avian RBCs (e.g., turkey) are preferred for use in HA assays
because they are nucleated, heavy, and settle quickly in microtiter plates; thus, negative
activity can be clearly differentiated from positive, agglutinating activity. In contrast, lighter,
non-nucleated mammalian RBCs (i.e., guinea pig and human RBCs) can form ‘halos’ upon
settling, making the differentiation between positive and negative activity potentially less
clear. Currently circulating human H3N2 viruses lack the ability to agglutinate chicken
Author Manuscript
RBCs43, and therefore, chicken RBCs should not be used for HA assays for these viruses. In
addition, some human IAVs have been shown to agglutinate guinea pig RBCs with high
efficiency44. With these points in mind, the source of RBCs for use in HA assays should be
carefully selected depending on the viruses that are expected to be present. When the HA
assay is used to screen samples for the presence of IAVs, useful controls include cell culture
medium or egg fluids without virus (negative control) and a sample known to contain an IAV
with efficient agglutinating activity (positive control).

RT-PCR—For specific IAV identification (from original surveillance samples or after virus
Author Manuscript
culture in embryonated chicken eggs or cells), it is preferable to use a method that will
detect viruses irrespective of antigenic differences in the HA protein, especially when the
HA subtype of the prospective virus is unknown. Although IAV genomic sequences vary
widely across subtypes and species-specific virus groups, the ‘M’ gene segment is relatively
highly conserved. Therefore, the presence of IAV can be evaluated by using either standard
or real-time RT-PCR with primers that recognize the M gene of viruses of all subtypes. Real-
time RT-PCR is favored because results can be obtained more rapidly; however, M gene
sequences amplified by using standard RT-PCR can be evaluated by using gel
electrophoresis with only a modest increase in the time necessary to complete the analysis,
provided that the number of samples is relatively low. For quality control purposes, an egg or
tissue culture sample known to contain an IAV should be included in all procedures required
for the RT-PCR analysis (e.g., RNA extraction, cDNA synthesis, PCR amplification, and
Author Manuscript
agarose gel electrophoresis), so that concerns about procedural efficacy can be excluded
when no positive samples are identified. Importantly, care should be taken to avoid cross-
contamination between the known positive sample and all other samples (e.g., by using
aerosol-resistant micropipette tips and preparing the RT-PCR master mix in a clean
location), and all RT-PCR reactions should include a ‘no-template negative’ control to
ensure that the reagents used are not a source of contamination.
Other assays for IAV identification—HA assays and RT-PCR analysis are described in
this protocol because they represent the most widely used and reliable methods for the
identification of IAVs in surveillance samples and virus cultures. However, additional
antigen-based methods also can be used for IAV identification. These include rapid, point-of
care assays that can both detect and distinguish between influenza A and influenza B viruses
in about 30 minutes (e.g., Directigen EZ™ Flu A+B, Binax NOW® Influenza A & B), and
Author Manuscript
immunofluorescence assays using influenza-specific antibodies. It is important to note that

the successful use of rapid and immunofluorescence-based assays is highly dependent on the
cellularity of the sample (i.e., more cells typically produce more accurate results)45, and
further that many reports indicate variable levels of sensitivity for these assays, which can
lead to inadvertent false negative identifications (e.g., see45–49). Moreover,
immunofluorescence assays may require considerable sample manipulation, the use of sharp
objects (i.e., glass slides) and the availability of specialized equipment (i.e., fluorescence
microscopes), all of which provide significant obstacles when working under high
containment conditions (i.e., in biosafety level 3 laboratories). Nonetheless, both rapid and
immunofluorescence-based assays are used frequently by clinical diagnostic laboratories
when assessing specimens derived from humans exhibiting influenza-like illness. As a final
point, serology-based assays (e.g., hemagglutination inhibition41,50 and
Author Manuscript
micronetralization51) can be used to retrospectively (and indirectly) identify IAV infection

through the detection of IAV-specific antibodies in serum, but are not useful for the direct
isolation and identification of viruses from clinical or research specimens. In sum, for the
reasons just described, antigen- and serology-based assays are not considered further in this
protocol. For additional information about antigen-based assays, readers are referred
to15,16,52; and for procedural overviews of these assays, readers are referred to53.

Limitations of the Protocol

Author Manuscript
The procedures described in this protocol have been used extensively to isolate, propagate,
and identify IAVs of all subtypes from all types of experimental and surveillance samples.
The protocol is robust, and virus amplification is likely to be successful in most cases.
However, the amplification procedure may be unsuccessful if: (1) the samples contain very
low amounts of virus; (2) the samples are mishandled (e.g., not kept at 4°C during transport
and/or not frozen within 48–72 h of receipt); (3) the samples are contaminated with other
organisms (e.g., fecal material with bacterial contamination); or (4) in rare instances, the
samples contain IAVs that do not grow efficiently in eggs or mammalian cells (e.g., IAVs
from bats3). In addition, it must be emphasized that neither the HA assay nor RT-PCR
analysis with M-gene-specific primers can differentiate between IAV subtypes. Therefore, if
a positive identification of IAV has been made for a particular sample, then subsequent
analyses must be performed to identify the specific subtype (e.g., by use of subtype-specific
Author Manuscript
RT-PCR primer panels17, genome sequencing with universal primer sets54, or subtype-
specific antibody panels in hemagglutination inhibition assays55). These additional analyses
are outside the scope of the current protocol, and thus, will not be discussed further here.
Safety Considerations
Shipping Infectious Biological Materials—Frequently, surveillance or other IAV-
containing samples must be shipped (i.e., transferred) between national and international
sites. Government-issued import and export permits or licenses may be required for national
and/or international transfer of infectious (or potentially infectious) substances. To remain
compliant with national and international laws and regulations, personnel planning to import
or export samples known or expected to contain IAV should: (1) contact the appropriate
national agencies to identify the required permits and licenses; and (2) obtain the required
Author Manuscript
permits and licenses prior to making or receiving any shipments. Only personnel trained and
certified in the shipment of hazardous materials should prepare shipments of infectious
substances, and only personnel trained in the handling of infectious substances should
receive and unpack shipments.
Biosafety—All methods involving the manipulation of samples containing (or potentially

containing) infectious IAVs must be performed in a class II biosafety cabinet in appropriate
biosafety level 2 (BSL-2) or BSL-3 containment conditions, while using appropriate
personal protective equipment (PPE). The proper containment level and PPE requirements
should be identified based on the actual or potential IAVs that are (likely to be) present,
before any procedures are performed. Generally, BSL-2 conditions are suitable for
contemporary human IAV strains (H1N1 and H3N2). However, a higher containment level
Author Manuscript
may be necessary if a strain poses a pertinent threat to human or agricultural animal

populations. BSL-3 containment is required for work with highly pathogenic avian influenza
viruses (e.g., H5N1); the recently emerged H7N9 viruses from China; any newly emerging
human IAV for which limited knowledge is available; and historical pandemic viruses that
have caused extremely high human mortality (e.g., 1918 IAV) or for which little or no
immunity exists in the human population (e.g., H2N2 IAV). Personnel planning experiments
with samples that are known or expected to contain IAV must consult with institutional
committees and governmental agencies to ensure that all appropriate permits and licenses

are acquired prior to initiating any work. An excellent resource describing various types of
Author Manuscript
biosafety containment and PPE is the ‘Biosafety in Microbiological and Biomedical

Laboratories, 5th Edition’ (BMBL5), which is published by the United States Centers for
Disease Control (CDC) and can be freely downloaded from the CDC website56.
MATERIALS
Reagents
Biosafety
• 70% ethanol
• Disinfectant (e.g., Microchem Plus, 5%)
Sample collection
Author Manuscript
• Source of sample. See Introduction for information about the types of samples
that can be used.
!CAUTION Experiments involving live animals must conform to local and

national regulations. Legally effective informed consent may be required for
experiments involving samples acquired from human subjects. Experiments
involving human subjects must conform to local and national regulations.
• Phosphate-buffered saline (PBS), pH 7.2, autoclaved and stored at room

temperature (20–25°C)
• Sterile glycerol, stored at room temperature
• Deionized water (dH2O), autoclaved and stored at room temperature

Author Manuscript
• 10X Minimum Essential Medium (MEM) (+) Earle’s salts, (−) L-glutamine, (−)
sodium bicarbonate (Gibco, cat. no. 11430-030); stored at 4°C for ≤ 2 months
• Bovine serum albumin (BSA) fraction V solution, 7.5% (Sigma-Aldrich, cat. no.
A8412-100ml); stored at 4°C for ≤ 2 months or aliquoted, stored at −20°C, and
thawed before use
▲CRITICAL STEP Some commercial sources of BSA fraction V impair

TPCK-trypsin activity (unpublished data), which is required for IAV culture in
cells. BSA from these sources should not be used for making media that will be
used for sample collection or virus propagation (see below). We recommend
Sigma-Aldrich BSA fraction V solution.
Author Manuscript
• Sodium bicarbonate solution, 7.5% (Gibco, cat. no. 25080-094); stored at 4°C
for ≤ 2 months
• MEM amino acids, 50X (Gibco, cat. co. 11130-051); stored at 4°C for ≤ 2
months or aliquoted, stored at −20°C, and thawed before use
• MEM vitamin solution, 100X (Gibco, cat. no. 11120-052); aliquoted, stored at
−20°C, and thawed before use

• L-glutamine, 200 mM (Gibco, cat. no. 25030-081); aliquoted, stored at −20°C,

Author Manuscript
and thawed before use
• ‘Anti-Anti’ antibiotic-antimycotic mixture (10,000 units/ml of penicillin, 10,000

μg/ml of streptomycin, and 25 μg/ml of Fungizone™), 100X (Gibco, cat. no.
15240-062); aliquoted, stored at −20°C, and thawed before use
Virus culture in eggs

• Fertilized (embryonated), pathogen-free chicken eggs, 10–12 days old
!CAUTION Experiments involving live animals must conform to local and

national regulations.
• Egg sealant (e.g., paraffin wax, nail polish, or Elmer’s™ glue)
• PBS (prepare as described above)

Author Manuscript
• Anti-Anti (prepare as described above)
• Blood-agar plates (to check for bacterial contamination)
Virus culture in cells

• Madin-Darby canine kidney (MDCK) cells, (ATCC, cat. no. CCL 334)
• 0.25% trypsin-EDTA (Gibco, cat. no., 25200-056)
• PBS, autoclaved dH2O, 10X MEM, BSA fraction V, sodium bicarbonate, MEM
amino acids, MEM vitamin solution, L-glutamine, and ‘Anti-Anti’ (prepare each
component as described above)
Author Manuscript
• Normal calf serum (NCS), heat-inactivated (Thermo Scientific, cat. no.

SH30118.30); aliquoted, stored at −20°C, and thawed before use
• Tosyl phenylalanyl chloromethyl ketone (TPCK)-treated trypsin (‘TPCK-

trypsin’) (Worthington Biochemical Corporation, cat. no. TRTPCK)
▲CRITICAL STEP The addition of TPCK to trypsin preparations impairs the

activity of contaminating chymotrypsin57, which does not promote IAV
infectivity but can cause damage to cell monolayers. We recommend using only
TPCK-treated trypsin for IAV culture in MDCK cells.
HA assay
• Turkey red blood cells (RBCs), 10% (Rockland, cat. no. R408-0050)
Author Manuscript
• Guinea pig RBCs, 10% (Rockland, cat. no. R402-0050)
• PBS (prepare as described above)
RNA isolation
• Qiagen RNeasy mini RNA isolation column kit (Qiagen, cat. no. 74104)
• 2-mercaptoethanol

• 70% ethanol, molecular grade

Author Manuscript
Standard RT-PCR
• nuclease-free dH2O
• dNTP mix, 10 mM (Life Technologies, cat. no. 18427013)
• RNasin Plus RNase inhibitor (Promega, cat. no. N2611)
• Superscript III one tube reverse transcriptase system (Invitrogen, cat. no.
12574-018)
• Forward and reverse oligonucleotide primers to the IAV M gene segment (as
previously described in Annex 1-A of17; these primers have been validated for
the universal detection of IAVs of all subtypes from human samples). They can
be ordered from IDT, Inc.; diluted to 10 μM in dH2O and stored at −20°C until
Author Manuscript
use. The primer sequences are listed in the table below; “Y” refers to C or T; “N”
refers to and A, G, C, or T:
M30F2/08, ATGAGYCTTYTAACCGAGGTCGAAACG
M264R3/08, TGGACAAANCGTCTACGCTGCAG
▲CRITICAL STEP It should be noted that the primer set detailed above
represents one of multiple validated primer sets described in17. Researchers with
concerns about the appropriate primers to use in standard RT-PCR analysis
should contact a WHO Collaborating Centre21,58 for additional guidance.
Real-time RT-PCR
• nuclease-free deionized H2O
Author Manuscript
• dNTP mix, 10 mM (Life Technologies, cat. no. 18427013)
• 10X PCR buffer I with 15 mM MgCl2 (Applied Biosystems, cat. no. 4379876)
• Random hexamer, 50 μM (Applied Biosystems, cat. no. 8080127)
• MuLV Reverse Transcriptase 50 U/μl (Applied Biosystems, cat. no. 8080018)
• Forward and reverse oligonucleotide primers (diluted to 10 μM) and fluorogenic

probes (diluted to 5 μM) to the IAV M gene segment (as previously described in
Annex 2-A of17; these primers have been validated for the universal detection of
IAVs of all subtypes from human samples); ordered from IDT, Inc. and diluted in
dH2O. Prepare a ‘Primer/Probe Master Mix’ by mixing equal volumes of each;
aliquot and store at −20°C until use. The sequence of each primer is given in the
Author Manuscript
table below:
FLUAM-1F, AAGACCAATCCTGTCACCTCTGA
FLUAM-1P, 5′-(FAM)-TTTGTGTTCACGCTCACCGT-(TAMRA)-3′
FLUAM-1R, CAAAGCGTCTACGCTGCAGTCC
FLUAM-2F, CATTGGGATCTTGCACTTGATATT
FLUAM-2P, 5′-(FAM)-TGGATTCTTGATCGTCTTTTCTTCAAATGCA-(TAMRA)-3

FLUAM-2R, AAACCGTATTTAAGGCGACGATAA
Author Manuscript
▲CRITICAL STEP It should be noted that the primer set detailed above
represents one of multiple validated primer sets described in17. Researchers with
concerns about the appropriate primers to use in real-time RT-PCR analysis
should contact a WHO Collaborating Centere21,58 for additional guidance.
• LightCycler® FastStart™ DNA Master HybProbe kit (Roche Applied Sciences,

cat. no. 03 003 248 001)
Agarose gel electrophoresis

• 1 KB Plus DNA Ladder (Invitrogen, cat. no. 10787-018)
• 6X EZ-Vision One DNA loading dye, ethidium bromide-free (Amresco, cat. no.
N472-KIT)
Author Manuscript
• Seakem ME agarose powder (Lonza, cat. no. 50014)
• dH2O, autoclaved and stored at room temperature
• 10X TAE (Biorad, cat. no. 161-0773)
Equipment
Biosafety
• Class II biosafety cabinet fitted with an ultraviolet (UV) light
• Approved biosafety level 2 (BSL-2) or enhanced BSL-2 (BSL-2+) laboratory

facilities for working with most mammalian and some avian IAVs
Approved biosafety level 3 (BSL-3), enhanced BSL-3 (BSL-3+) or BSL-3

Author Manuscript
•
Agriculture (BSL-3-Ag) containment facilities for handling highly pathogenic
avian IAVs
▲CRITICAL STEP Identify the proper BSL-2 or BSL-3 containment level

based on the actual or potential IAV subtypes that are (likely to be) present in the
sample(s), and ensure that all experiments conform to relevant institutional and
governmental biosafety regulations.
• Personal protective equipment (PPE). For BSL-2, powder-free latex or nitrile

gloves, laboratory coats, and eye protection. For BSL-3, scrubs, dedicated shoes,
shoe covers, powder-free latex or nitrile gloves, water-proof Tyvek™ jumpsuits,
water-proof Tyvek™ shrouds, powered air purifying respirators, water-proof
Tyvek™ sleeve covers
Author Manuscript
• Biohazard trash bags
• Biohazard sharps containers
• Paper towels
• Spray bottles for 70% ethanol

• Dedicated container for disinfecting solid and liquid waste contaminated with
Author Manuscript
virus
• Autoclave
Common equipment
• Micropipettes (1–1000 μl capacity)
• Pipet-Aid™
• Vortex mixer
• Electronic scientific or analytical balance
• Water bath, 37°C
• Refrigerated microcentrifuge (for 1.5 ml and 2 ml microtubes)

Author Manuscript
• Refrigerated table-top centrifuge (for 15 ml and 50 ml conical tubes)
• Freezers and refrigerators: −80°C, −20°C, 4°C
• Ice machine and ice buckets
Common consumables
• Sterile glass or plastic bottles (500 ml)
• Sterile polypropylene conical tubes, 15 ml (BD Falcon, cat. no. 352096) and 50
ml (BD Falcon, cat. no. 352070)
• Sterile screw-cap microtubes, 2 ml (Sarstedt, cat. no. 72.964)

Author Manuscript
• Snap-cap microtubes, 1.5 ml, autoclaved (Eppendorf, cat. no. 022363204)
• Sterile, aerosol-resistant micropipette tips (1–1000 μl capacity)
• Cotton-plugged, sterile serological pipettes (1–25 ml capacity)
• 0.2 μm syringe and bottle-top microfilters
Sample collection and processing

• Polyester fiber-tipped swabs (e.g., nylon or Dacron™) with plastic or wire shafts;
for each swab sample collection scenario, use the largest swab size that maintains
human or animal safety
▲CRITICAL STEP For improved sample collection, we suggest using ‘flocked

Author Manuscript
swabs’ (Copan Diagnostics, Inc.), which have high absorbency, promote the
collection of solid and semi-solid materials, and efficiently elute samples into
transport medium. Flocked swabs have been reported to produce better clinical
specimens for diagnosis59; have outperformed standard, invasive nasal aspiration
methods in collection of IAVs from humans60,61; and have been found to yield
higher virus amounts compared to rayon swabs62. Calcium alginate and cotton
swabs are not recommended because residues present in these materials interfere

with PCR assays63 (which will be performed downstream), and wooden shafts
Author Manuscript
should be avoided because they may contain formaldehyde and/or other toxins.
• For tissue harvesting and processing: Tissue dissection tools (scissors, forceps),
cleaned with soap and water and sterilized with 70% ethanol; a small brush for
cleaning tools between specimen collections; 5-mm stainless steel
homogenization beads, autoclaved (Qiagen, cat. no. 69989); homogenization
bead dispenser (Qiagen, cat. no. 69965); TissueLyser II (Qiagen, cat. no. 85300)
• Ice packs, coolers and liquid nitrogen dry shipping containers for field
collections
Virus culture in eggs

• Egg trays
Author Manuscript
• Egg candling light
• Rotating and static egg incubators (35°C, humidified)
• Egg piercing tool: 20-gauge, 1.5″ catheter punched through a rubber stopper (for
piercing egg air sacs; Figure 2C, panel i); an appropriately sized rubber stopper
can be obtained from a 2-ml blood collection tube (e.g., Becton Dickinson, cat.
no. 367844)
• 1-ml syringes with 27-gauge, 1″ or 1.5″ hypodermic or blunt-end needles (for

inoculating eggs)
• 3-ml syringe with a 21-gauge, 1″ hypodermic needle (for harvesting allantoic

fluids)
Author Manuscript
• Sterile forceps
Virus culture in cells

• Tissue culture incubator (33–37°C, humidified, 5% CO2)
• Straight neck polystyrene tissue culture flasks with vented caps, 25 cm2 (BD
Falcon, cat. no. 354484), 75 cm2 (BD Falcon, cat. no. 353136), and 175 cm2 (BD
Falcon, cat. no. 353112)
• 6-, 12- or 24-well polystyrene tissue culture plates with lids (BD Falcon, cat. nos.
353046, 353043, or 353047, respectively)
• TC20 automated cell counter and plastic cell counting slides (Biorad) or a
hemacytometer
Author Manuscript
• Cell culture microscope
HA assay
• Sterile gauze
• 96-well microtiter plates, U-bottom (Thermo Scientific, cat. no. 2205)

Standard RT-PCR
Author Manuscript
• PCR strip tubes, 0.2 ml (Eppendorf, cat. no. 951010022)
• Thermocycler
Real-time RT-PCR
• MicroAmp fast optical 96-well reaction plates, 0.1 ml (Applied Biosystems, cat.
no. 4346906)
• Real-time thermocycler (e.g., 7900 HT Fast Real-Time PCR System, Applied

Biosystems)
• Real-time RT-PCR analysis software (e.g., SDS Software, version 2.3, Applied
Biosystems)
Author Manuscript
Agarose gel electrophoresis

• Microwave
• 500-ml, glass Erlenmeyer flask
• Agarose gel casting tray
• Electrophoresis chamber
• Power supply
• UV light box
• Imaging system for capturing images of agarose gels

Author Manuscript
Reagent Setup
• Glycerol-saline transport medium (‘GSTM’) for collecting samples that will
be inoculated into eggs. Dilute 100X Anti-Anti at a ratio of 1:100 (v/v) with a
1:1 (v/v) solution of autoclaved PBS and sterile glycerol. Store at 4°C and use
for up to 1 month.
▲CRITICAL STEP Use this solution only for collecting samples that will be
inoculated into eggs. GSTM imparts longer term stability to viruses than does
MEM-BSA (see details about MEM-BSA preparation below), particularly in
conditions where samples cannot be placed immediately on ice16. However, the
high glycerol concentration in GSTM is not suitable for mammalian cell
cultures64 and should not be used to collect samples that will be inoculated into
MDCK cells.
Author Manuscript
• PBS-AA (PBS containing 1X Anti-Anti) for diluting samples that will be

inoculated into eggs. Dilute 100X Anti-Anti at a ratio of 1:100 (v/v) in
autoclaved PBS. Store at 4°C and use for up to 1 month.
• 10–12-day-old embryonated chicken eggs. Prior to use, “candle” eggs by

placing them in front of a light source. Ensure that the egg is fertilized and
viable, and that the shell is not damaged. Using a pencil or an ethanol-resistant

marker, designate a position just above the interface between the air sac and the
Author Manuscript
allantoic sac that is free of veins (this position will be used for inoculation)
(Figure 2B).
• MEM-BSA for collecting samples that will be inoculated into MDCK cells
and for virus culture in MDCK cells. First, prepare and store a 2X MEM-BSA
solution as follows: In a 500-ml bottle, mix the following components (total
solution volume, 500 ml): 270 ml of dH2O; 100 ml of 10X MEM (+) Earle’s
salts, (−) L-glutamine, (−) sodium bicarbonate (final concentration: 2X (v/v)); 40
ml of 7.5% BSA fraction V solution (final concentration: 0.6% (v/v)); 30 ml of
7.5% sodium bicarbonate solution (final concentration: 0.45% (v/v)); 20 ml of
50X MEM amino acids solution (final concentration: 2X (v/v)); 10 ml of 100X
MEM vitamins solution (final concentration: 2X (v/v)); and 20 ml of 200 mM L-
glutamine (final concentration: 16 mM (v/v)). Filter the mixture using a bottle-
Author Manuscript
top 0.2-μm filter, and then add 10 ml of 100X Anti-Anti (final concentration: 2X
(v/v); or 400 units/ml penicillin, 400 μg/ml streptomycin, and 1 μg/ml of
Fungizone). Prepare media in advance, store at 4°C, and use it for up to one
month. On the day of the experiment, prepare the required amount of MEM-BSA
by mixing 2X MEM-BSA at a 1:1 ratio with dH2O.
• MEM-NCS (MDCK cell growth medium, containing 10% NCS). In a 500-ml

bottle, mix the following components (total solution volume, 500 ml): 380 ml of
dH2O; 50 ml of 10X MEM (+) Earle’s salts, (−) L-glutamine, (−) sodium
bicarbonate (final concentration: 1X (v/v)); 25 ml NCS (final concentration: 5%
(v/v)); 15 ml of 7.5% sodium bicarbonate solution (final concentration: 0.23%
(v/v)); 10 ml of 50X MEM amino acids solution (final concentration: 0.5X (v/
v)); 5 ml of 100X MEM vitamins solution (final concentration: 1X (v/v)); and 10
Author Manuscript
ml of 200 mM L-glutamine (final concentration: 8 mM (v/v)). Filter the mixture

using a bottle-top 0.2-μm filter, and then add 5 ml of 100X Anti-Anti (final
concentration: 1X (v/v); or 200 units/ml penicillin, 200 μg/ml streptomycin, and
0.5 μg/ml of Fungizone). Prepare media in advance, store at 4°C, and use it for
up to one month.
• TPCK-trypsin stock solution (1 mg/ml in dH20) for use in virus growth

medium (see below). Prepare a stock solution in advance and store 1-ml aliquots
at −20°C; thaw individual aliquots at the time of use. For the stock solution,
dissolve 0.1 g of TPCK-trypsin into 100 ml of autoclaved dH2O and vortex
vigorously to mix. Filter the solution by passaging through a 0.2-μm syringe
microfilter before aliquoting into microtubes.
Author Manuscript
▲CRITICAL STEP Prior to use for virus propagation in MDCK cells, titrate
the maximum TPCK-trypsin concentration (from a thawed aliquot) that can be
tolerated by MDCK cells (i.e., the highest concentration at which minimal or no
detrimental effects are observed34), and use this concentration for all IAV
propagation assays in the same cell stock. Tolerable concentrations vary between
TPCK-trypsin stock solutions and MDCK cell stocks, so titration should be
performed every time a new stock solution is generated or when using MDCK

cells from an alternate source. In our experience, tolerable TPCK-trypsin levels

Author Manuscript
range from 0.5–1 μg/ml final concentration in MEM-BSA.
• MEM-BSA-TPCK (virus growth medium). Prepare MEM-BSA as described

above and add TPCK-trypsin to a final concentration of 0.5–1 μg/ml.
• MDCK cell culture. To establish MDCK cell cultures, thaw a low passage (<
10) vial of liquid nitrogen-preserved cells (containing 10% DMSO), dilute with
10 ml of cold MEM-NCS, centrifuge (200 × g, 2 minutes at room temperature),
and resuspend the pellet in 20 ml cold MEM-NCS. Seed a 75-cm2 flask with the
entire volume of resuspended cells and incubate at 37°C. Roughly 48 h later,
split the cells at a 1:10 dilution and continue to do so every 2–3 days.
• Turkey RBCs, 0.5%, for HA assays. Filter 10% RBCs through sterile gauze,
pellet cells by centrifugation (200 × g, 10 minutes at 4°C) and remove plasma,
Author Manuscript
Alsever’s solution, and buffy coat. Wash RBCs three times with excess, cold
PBS, and then resuspend to 0.5% in cold PBS for use.
• Guinea pig RBCs, 0.75%, for HA assays. Prepare as just described for turkey
RBCs, except resuspend to 0.75% in cold PBS for use.
• 1X TAE for agarose gel electrophoresis. Mix 10X TAE with dH2O at a 1:10
(v/v) ratio to the desired volume.
• 1% agarose gel. Mix 1 g of agarose with 10 ml of 10X TAE and dH2O to 100
ml in a 500-ml glass Erlenmeyer flask. Microwave on high for 1–2 minutes or
until the agarose is completely dissolved. Cool the agarose solution slightly, pour
into an agarose gel cast, and allow the gel to set.
Author Manuscript
Equipment Setup
• Class II biosafety cabinet. Ensure the biosafety cabinet (BSC) is air-flow
certified and fully decontaminated with 70% ethanol and UV light prior to use. A
dedicated plastic container containing an appropriate disinfectant should be
placed inside the BSC prior to beginning any work with infectious agents for
decontaminating solid and liquid waste containing viruses. A biohazard sharps
collection container also should be placed inside the BSC whenever sharp objects
will be used in conjunction with IAVs.
• Centrifuges. All centrifugation steps must be performed at 4°C; therefore, cool

all centrifuges prior to use. Use only rotors with aerosol-tight lids for
centrifuging samples containing (or potentially containing) IAVs.
Author Manuscript
• Electrophoresis chamber. Place the casted 1% agarose gel into the

electrophoresis chamber and cover with 1X Tris-acetate-
ethylenediaminetetraacetic acid (TAE).
• Incubators. Set incubator(s) to the appropriate temperatures for cell and virus
cultures, and supply a tray of water to provide humidity. For cell culture
incubators, infuse with an atmosphere of 5% CO2.

• Autoclave. For decontamination of laboratory wastes (e.g., pipettes, tissue

Author Manuscript
culture vessels, used tubes) and discarded PPE, program autoclaves to cycle for
at least 1 hour at 125°C and 20 pounds of pressure.
!CAUTION If animal or egg remains are frozen prior to autoclaving, ensure that
they are completely thawed before initiating decontamination by autoclaving.
PROCEDURE
Part 1: Sample collection and preparation for virus amplification
1 If samples are swabs or liquid, follow option A for collection and
preparation. If samples are tissues, follow option B
A) Swab and liquid sample collection and preparation
i. Prepare sample collection tubes for swab samples by dispensing 1–3 ml of the
Author Manuscript
appropriate transport medium into sterile plastic tubes. For swab samples that
will be inoculated into MDCK cell cultures, use MEM-BSA; for those that will
be inoculated into eggs, use either MEM-BSA or GSTM. Use sterile plastic
collection tubes without transport medium for liquid sample collections. If
feasible, chill all sample collection tubes and transport buffers to 0–4°C prior to
use, as this temperature has been shown to preserve viral RNA, hemagglutinating
activity and virus infectivity65–67.
■PAUSE POINT Tubes can be prepared in advance and stored at 4°C for up to
1 week before use.
ii. Fully saturate dry polyester fiber-tipped swabs by inserting into the target
mucous membrane region, pausing for a few seconds, and then removing while
Author Manuscript
gently rotating and wiping as much surface area as possible. For nasal or
nasopharyngeal surfaces, obtain specimens from both nostrils using the same
swab. Obtain fecal samples by coating a swab tip in freshly excreted, wet fecal
material. Collect liquid samples directly from the source without using a swab.
iii. Immediately place saturated swabs into plastic collection tubes (prepared as
described in substep i); break off the swabs’ shafts, leaving the heads immersed,
close tubes, and place them on ice. For non-swab liquid samples, immediately
close the collection tube and place on ice.
iv. Transfer samples directly to the laboratory, or if in the field, to a liquid nitrogen
dry shipping container for transport. Once in the laboratory, store samples that
previously were not frozen at 0–4°C if processing and inoculation can be
Author Manuscript
performed within 48–72 h; otherwise, freeze samples at −80°C.
■PAUSE POINT Do not store samples longer than 72 h at 4°C to avoid loss of
viability65–67. If frozen, samples can be stored at −80°C for a minimum of
several months. However, some loss of viability will occur after the initial freeze,
and further viability reductions are increasingly likely as the length of storage
time is increased68.

▲CRITICAL STEP Avoid repeated freeze-thaw cycles, as each cycle reduces

IAV viability68. Consider dividing samples into aliquots. Samples should not be
Author Manuscript
frozen or shipped on dry ice unless they are sealed, taped, and double-bagged
because CO2 exposure can rapidly reduce IAV viability/infectivity69.
v. To prepare samples for inoculation, thaw rapidly in a 37°C water bath or

incubator (if required). Vortex vigorously and allow debris to settle for 30
minutes while holding on ice. After debris has settled, advance to virus
amplification steps (Part 2) and/or RT-PCR analysis (Part 3); return any
remaining sample to −80°C. Do not filter samples.
▲CRITICAL STEP It is important to avoid using microfilters to remove

bacteria and fungi from samples (even fecal samples), as microfilters frequently
also remove viruses. To prevent bacterial and fungal outgrowth in inoculated
cultures, include antibiotics and antimycotics in all transport, inoculation, and
Author Manuscript
culture media, as described in ‘Reagent Setup’.
B) Tissue sample preparation and processing

i. Prepare sterile sample collection tubes without transport medium for each
individual organ sample. If feasible, chill sample collection tubes on ice prior to
sample collection.
ii. Dissect tissues from deceased animals as soon as possible following their
expiration. For larger organs (e.g., ferret lung), collect multiple tissue samples
from several unique locations to increase the likelihood of virus isolation.
Immediately place the dissected tissue samples on ice.
iii. Transfer tissue samples to the laboratory or to a liquid nitrogen dry shipping
Author Manuscript
container for transport to the laboratory. Once in the laboratory, immediately

process tissue samples that were not frozen; and if this is not possible, freeze
(without transport medium) at −80°C.
■PAUSE POINT Tissue samples can be stored at −80°C for a minimum of

several months. However, some loss of virus viability will occur after the initial
freeze, and further viability reductions are increasingly likely as the length of
storage time is increased68.
iv. Prepare tissues for downstream analysis by homogenizing them. Thaw frozen
tissues on ice and weigh using a scientific or analytical balance (the balance
should be placed inside the biosafety cabinet). Transfer a section of each thawed
tissue (≤ 0.5 g) to a 1.5-ml microtube or a 2-ml cryovial, along with one sterile
Author Manuscript
stainless steel 5-mm homogenization bead and 1 ml of PBS-AA (for egg

inoculations) or MEM-BSA (for MDCK cell inoculations).
v. Secure all tube caps, load the tubes into a TissueLyser II rack, and attach the rack
to the TissueLyser II clamps; then run one homogenization cycle (30 Hz
oscillation frequency for 3 minutes).

vi. Remove the tubes from the homogenization rack and visually check for complete
Author Manuscript
tissue disruption. If tissue pieces remain, repeat the homogenization cycle until
the tissues are completely homogenized. Prevent sample heating by resting the
tubes on ice between homogenization cycles.
?TROUBLESHOOTING
vii. Centrifuge completely homogenized tissues at 4°C for 10 minutes (20,000 × g)

to pellet debris, and transfer the cleared tissue supernatants (containing released
virus) into new sterile microtubes or cryovials. As described in subpart v, do not
microfilter the supernatants.
viii. Place the tissue supernatants on ice and proceed to the virus amplification (Part
2) and/or RT-PCR analysis (Part 3). Following inoculation, return any remaining
tissue supernatants to −80°C.
Author Manuscript
Part 2: Virus amplification in and harvest from embryonated chicken eggs or MDCK cell
cultures
2 Perform virus amplification and harvest in embryonated chicken eggs
(option A) or MDCK cell culture (option B). Further information about which
system to use for particular samples is given in the Introduction
A) Embryonated eggs
i. Determine the number of eggs required for the samples to be tested. For initial
virus recovery from human or other surveillance or experimental samples, use 3
eggs per sample to be assayed. When very low rates of positive samples are
anticipated from a large number of specimens, consider pooling samples prior to
Author Manuscript
egg inoculation. If a pooled sample is identified as positive for IAV, individual

samples that make up the pool may be tested subsequently. To prepare stocks of
known viruses, inoculate multiple eggs with the same sample.
ii. Spray the required number of candled and marked eggs (in an egg carton tray)
with 70% ethanol to decontaminate surfaces, and then place the tray inside of a
biosafety cabinet (see ‘Reagent Setup’ for additional details on egg candling).
iii. Using a homemade egg piercing tool, made from a 20-gauge catheter pushed
through a rubber stopper, gently pierce the egg shell at the location marked
during candling (Figure 2A–B and 2C, panels i and ii). Avoid cracking the egg
shell.
!CAUTION To avoid unnecessary sharps use in BSL-3 containment, perform all

Author Manuscript
egg piercings in BSL-2 prior to entering BSL-3 containment to perform

inoculations.
iv. For each inoculation, draw up 100 μl of sample and 100 μl of PBS-AA into a 1-
ml syringe with a 27-gauge, 1″ needle (for inoculation of the allantoic cavity) or
a 1.5″ needle (for inoculation of both the allantoic and amniotic cavities).
v. For inoculation of both the allantoic and amniotic cavities, insert the inoculation
needle (1.5″) at a 45° angle into the pierced region of the egg, gently push

through the allantoic sac and into the amniotic sac, and inject 100 μl (one half) of
Author Manuscript
the inoculum (Figure 2C, panel iii). Pause to allow the inoculum to flow
completely from the syringe, and then draw the needle back into the allantoic
region and expel the remainder of the inoculum. For inoculation of the allantoic
cavity only, insert the inoculation needle (1″) directly into the allantoic sac and
expel the contents.
!CAUTION To prevent inadvertent exposures, handle sharps (i.e., needles) with

extreme caution when manipulating samples that contain (or potentially contain)
infectious IAVs. In particular, we recommend using blunt-ended (not
hypodermic) needles for all allantoic cavity inoculations, and to avoid
performing amniotic cavity inoculations – thereby eliminating the need for
hypodermic needles – whenever possible.
?TROUBLESHOOTING
Author Manuscript
vi. Remove the syringe and safely discard it into a sharps container within the
biosafety cabinet.
vii. Seal the piercing using a drop of melted wax, glue, or nail polish.
viii. When all eggs have been inoculated and sealed, decontaminate egg surfaces by
spraying with 70% ethanol and then remove them from the biosafety cabinet.
ix. Incubate eggs at 35°C in a humidified, static incubator for 2–3 days.
x. At the completion of the incubation period, prepare eggs for fluid harvesting by
placing them on ice (at 0–4°C) for 1h.
■ PAUSE POINT Eggs can be kept at 0–4°C overnight.

Author Manuscript
▲CRITICAL STEP The 0–4°C treatment is required to euthanize the embryo

and to prevent bleeding during fluid harvesting procedures. Because influenza
viruses adsorb to RBCs, the presence of RBCs in egg fluids may reduce the
amount of recoverable virus, as heavy debris (including RBCs) will be removed
by centrifugation in a later step.
xi. Remove eggs from the 0–4°C treatment, decontaminate surfaces by spraying
with 70% ethanol, and place in a biosafety cabinet.
xii. Use sterile forceps to crack the egg in the region of the air sac (Figure 2D, panel
i). Remove cracked pieces of shell and dispose of them in a container of
disinfectant.
Author Manuscript
!CAUTION Avoid removing pieces of eggshell below the top of the allantoic sac
to prevent premature disruption and/or allantoic fluid spills, which could result in
a major biohazard.
▲CRITICAL STEP Decontaminate forceps between egg harvests by using

70% ethanol or an alternative disinfectant.
xiii. To obtain the allantoic fluid, use sterile forceps, a micropipette tip, or a
serological pipette to gently detach the allantoic membrane from the shell and

pull it toward the center of the egg, while avoiding breaking blood vessels or the
Author Manuscript
yolk (Figure 2D, panel ii). Fluids will accumulate in the region between the shell
and the allantoic membrane. Harvest these fluids into a conical tube by using a
micropipette (Figure 2D, panel iii) or a serological pipette (not shown).
Typically, 5–10 ml of allantoic fluid can be harvested from each egg.
▲CRITICAL STEP Because the presence of blood or yolk may affect the
resultant virus titer or the efficacy of downstream assays, avoid harvesting egg
fluids mixed with these substances.
▲CRITICAL STEP If using forceps, decontaminate between egg harvests by

using 70% ethanol or another appropriate disinfectant.
?TROUBLESHOOTING
xiv. To harvest amniotic fluid, locate the amniotic sac by slowly inverting the egg
Author Manuscript
over a container of disinfectant. Harvest the amniotic fluid by using a 3-ml

syringe with a 21-gauge, 1″ needle.
!CAUTION To avoid the unnecessary risk of a biohazard spill, do not perform

this step if or when highly pathogenic avian IAVs may be present. Such viruses
typically replicate well in the allantoic tissues, so amniotic sac inoculation and
fluid collection is unnecessary.
xv. If desired, check for the presence of bacterial contamination in egg cultures. To
do this, spread egg fluids onto blood-agar plates, incubate plates at 37°C for 24
hours, and observe bacterial growth relative to a negative control (e.g., fluid from
a fresh, non-inoculated egg). Alternatively, inoculate tubes of fresh MEM
(containing serum and lacking antibiotics/antimycotics) with egg fluids, incubate
Author Manuscript
at 37°C, and examine the tubes for turbidity and pH change over a 24–72 hour
period, relative to a negative control. Discard contaminated cultures and do not
use them in downstream analyses.
xvi. Discard egg remains by placing them in a biohazard bag inside the biosafety
cabinet, and then autoclaving and incinerating them.
xvii. If necessary, perform an HA assay or RT-PCR (standard or real-time) analysis to

determine or verify the presence of IAV as described in Part 3. Depending on the
results, process the egg fluids as described in Box 1.
■PAUSE POINT Fluids from inoculated eggs can be stored for up to 72 h at

4°C until HA or RT-PCR assays are completed.
Author Manuscript
B) MDCK cells
i. Grow up an appropriate number of MDCK cells. For initial virus recovery from
human or other surveillance or experimental samples, use one 25-cm2 vented
tissue culture flask of MDCK cells for each sample to be assayed. Alternatively,
individual wells of tissue culture plates (6-, 12- or 24-well) may be used. Use
larger vented flask(s) of cells (e.g., 175 cm2) when preparing larger stocks of
known viruses.

ii. One day before inoculation, prepare MDCK cells by splitting actively growing,
Author Manuscript
sub-confluent cultures and seeding inoculation cultures. To split cells, wash cells
twice with PBS and incubate with 0.25% trypsin-EDTA (2 ml per 175-cm2 flask,
10–20 minutes at 37°C) to create a single cell suspension. Neutralize the trypsin-
EDTA by adding a 4-fold volume of MEM-NCS, and briefly vortex the mixture
to create a homogenous solution.
iii. Determine the cell number using a hemacytometer or a TC20 automated cell
counter and seed cells in MEM-NCS at a sufficient number to produce 80%–
90% confluence within 24 h (i.e., the time of inoculation). The precise number of
cells will differ based on the passage number, medium freshness, and other
experimental variables. Incubate the cells at 37°C in a humidified atmosphere of
5% CO2 for 16–24 h.
?TROUBLESHOOTING
Author Manuscript
iv. On the day of inoculation, remove the MDCK growth medium (MEM-NCS) and
wash the cells 2–3 times with PBS, leaving the final wash on the cells until just
before the inoculation. Cells also can be washed with MEM-BSA.
▲CRITICAL STEP This step is necessary to remove traces of serum and other
inhibitors of TPCK- trypsin activity and IAV infectivity34.
v. Prepare virus growth medium (MEM-BSA-TPCK) for use in all inoculation and
incubation procedures. See ‘Reagent Setup’ for additional details.
vi. Dilute inoculation samples 1:100–1:1000 (v/v) in MEM-BSA-TPCK. Prepare a

volume that covers cells (e.g., 300 μl in a 25-cm2 flask or 2 ml in a 175-cm2
flask), and vortex the dilution for 10 seconds to mix.
Author Manuscript
vii. Remove the final wash from the cells (from substep iv) and cover with the
inoculum (from substep vi). Incubate cells with inoculum for 1 h at 37°C.
During the incubation period, manually rock or tap the flasks every 10 minutes to
evenly distribute the inoculum across the monolayer and to avoid cell drying in
the flasks’ central regions.
viii. At the completion of the incubation period, remove the inoculum and wash the
cells once with PBS. Cover the inoculated, washed cells with MEM-BSA-TPCK,
in a volume suitable for MDCK cell culture over several days (e.g., 4 ml in a 25-
cm2 flask or 25 ml in a 175-cm2 flask).
ix. Incubate inoculated cells in a 33–37°C, humidified tissue culture incubator with
an atmosphere of 5% CO2 for 2–5 days, proceeding to the next step after 1 day.
Author Manuscript
▲CRITICAL STEP Most mammalian viruses will grow well at 35°C, so this is
an appropriate temperature for initial isolation experiments with viruses whose
properties are unknown. However, some viruses exhibit optimal growth at other
temperatures (e.g., 37°C and 33°C), and in cases where viral replication levels
are modest, alternative incubation temperatures should be considered. Do not
perform medium changes during the incubation period, as this will remove most
of the viruses that are present.

x. Monitor MDCK cultures microscopically on a daily basis to observe cytopathic

Author Manuscript
effects (CPE). IAV-induced CPE include visible cell rounding and detachment
from the growth surface (Figure 3); 2–3 days of virus amplification is usually
sufficient to produce this effect in the majority of cells in a culture. If CPE is
observed within 5 days, proceed to substep xi, otherwise proceed to substep xii.
xi. When ≥ 90% of cells in a given culture have detached from the flask, transfer the
culture medium into a conical tube (samples derived from the same source can be
pooled) and centrifuge to pellet the cellular debris (3,200 × g, 4°C, 10 minutes).
Aliquot the cleared supernatant into cryovials (0.5–1 ml per aliquot). Retain
aliquots for HA assay and/or RT-PCR analysis, if required, and freeze the
remaining aliquots at −80°C.
▲CRITICAL STEP Abundant CPE will induce moderate turbidity in the

culture medium, although medium should remain semi-transparent. If excess
Author Manuscript
turbidity (i.e., opaque medium) is visually observed; or if small, uniform

granules (i.e., bacteria) or clumps or mats (i.e., yeast or fungi) are
microscopically observed, the culture should be discarded due to contamination.
▲CRITICAL STEP Do not freeze IAV stocks at −20°C, as the virus is highly
unstable at this temperature68.
xii. If CPE are not observed after 5 days of MDCK cell culture incubation, passage
an aliquot of culture medium from the inoculated cells onto a fresh flask of
MDCK cells. A total of three passages (including the original inoculation)
without any observed CPE is sufficient to classify a sample as ‘negative’ for IAV
amplification in cell culture.
Author Manuscript
?TROUBLESHOOTING
xiii. At the end of all cell culture experiments, decontaminate flasks and other
contaminated plastics by soaking them in disinfectant; dispose of them in
biohazard waste, and then autoclave and/or incinerate them.
xiv. To determine whether MDCK supernatants contain IAV, proceed to Part 3 to

perform an HA assay or RT-PCR (standard or real-time) analysis
▲CRITICAL STEP RT-PCR is required only for surveillance samples, in

which the presence of IAV is unknown; observation of CPE in cultures
inoculated with a known IAV is sufficient to classify these cultures as IAV-
positive.
■PAUSE POINT MDCK culture supernatants can be stored for up to 72 h at

Author Manuscript
4°C until HA or RT-PCR assays are completed.

Part 3: Virus Detection by use of HA Assay, Standard RT-PCR, or Real-Time RT-PCR

Author Manuscript
3 If appropriate, the presence of IAV in egg or MDCK cultures can be

determined by using an HA assay (option A), standard RT-PCR (option B) or
real-time RT-PCR (option C)
A) HA Assay
i. Prepare turkey or guinea pig RBCs (see ‘Reagent Setup’).
ii. Add 100 μl of undiluted allantoic fluid or MDCK culture medium to the ‘first’
well (upper left) of a 96-well U-bottomed microtiter plate and perform serial 1:2
dilutions (50 μl of egg fluid or cell culture medium in an equal volume of PBS)
in the eleven adjacent wells (from left to right, 20 – 2−11 dilutions). Discard the
excess 50 μl from the final dilution well. Repeat (in empty rows) for all samples
to be tested.
Author Manuscript
iii. Add 50 μl of washed RBCs (turkey, 0.5%; guinea pig, 0.75%) to each well of
each serial dilution series and tap the plate to mix the well contents.
iv. Incubate for 30 minutes (turkey RBCs) or 1 hour (guinea pig RBCs) at room
temperature (20–25°C) without disturbing the plate.
v. Observe all wells for agglutination activity, which is characterized by uniform

RBC distribution throughout the well (i.e., a cloudy appearance; Figure 4A and
B). Alternatively, in agglutination-negative samples, RBCs will settle to the
bottom of the well and form a ‘button’ (turkey RBCs; Figure 4A and B) or a
‘halo’ (guinea pig [or human] RBCs; Figure 4A), surrounded by relatively
translucent buffer. Samples that genuinely contain IAVs typically exhibit positive
HA activity over a range of dilutions (Figure 4B).
Author Manuscript
?TROUBLESHOOTING
B) Standard RT-PCR analysis

i. Harvest a 200 μl aliquot from surveillance samples, HA-positive egg fluids, or
MDCK culture medium and mix with an equal volume of Qiagen RLT lysis
buffer (from the Qiagen RNeasy mini RNA isolation kit) and 4 μl of 2-
mercaptoethanol (1% of the total volume).
ii. Add 400 μl of 70% ethanol and incubate the sample at room temperature (20–
25°C) for 10 minutes. At this point, all infectious IAVs are neutralized, and the
sample can be manipulated in BSL-2 containment, provided that all appropriate
procedures for removing samples from BSL-3 containment have been observed.
Author Manuscript
iii. Advance through the remainder of the Qiagen RNeasy mini kit protocol
according to the manufacturer’s instructions. Briefly, pass the RLT lysate over an
RNeasy spin column, wash column-bound RNA once with buffer RW1 and then
twice with buffer RPE; then elute the RNA into 50 μl of RNase-free dH2O.
■PAUSE POINT Eluted RNA can be frozen (−20° to −80°C) indefinitely.

iv. Set up a one-tube cDNA synthesis (i.e, reverse transcriptase) and PCR
Author Manuscript
amplification reaction by using the Superscript III reverse transcriptase system

and IAV M gene-specific primers (M30F2/08 and M264R3/08), according to the
manufacturer’s instructions. Use 0.2-ml PCR strip tubes to carry out the reaction.
For each reaction, use 1–5 μl of template RNA, 1 μl of each primer, and include 1
μl of RNasin RNase inhibitor. Carry out the reaction in a thermocycler, as
described in the following program for IAV M-gene specific cDNA synthesis and
standard RT-PCR:
Cycle cDNA synthesis Denaturation Annealing Extension Hold
1 50°C for 30
minutes
2 94°C for 2 minutes

Author Manuscript
3–47 94°C for 15 50°C for 30 68°C for 1

seconds seconds minute
48 1 cycle: 68°C for

5 minutes.
49 4°C for
up to 1
week
▲CRITICAL STEP To avoid false positive results due to carry-over from

previous reactions, it is essential to practice precautionary measures. Assay setup
and analysis must be performed in dedicated spaces with dedicated equipment,
and clean gloves must be used for setting up all assays. Equipment and
Author Manuscript
workspaces should be decontaminated after each use, and if possible,

thermocyclers should be exposed to UV light before use.
■PAUSE POINT Hold completed RT-PCR reactions at 4°C for up to 1 week

until the presence of an M-gene amplification product can be evaluated by use of
agarose gel electrophoresis.
v. To determine whether products were amplified in the RT-PCR reaction, prepare a

1% agarose gel (see ‘Reagent Setup’) and submerge it in 1X TAE.
vi. Dilute RT-PCR reactions by adding 10 μ1 of 6X DNA EZ Vision DNA loading

dye to each 50 μl reaction.
vii. Run 10–20 μl of each reaction on the 1% agarose gel.

Author Manuscript
viii. By using a UV light box, determine whether a band consistent with the size of
the M gene amplicon (244 base pairs) is present. No amplification should be
observed in negative controls. Image the gel using a gel imaging system.
?TROUBLESHOOTING

C) Real-time RT-PCR
Author Manuscript
i. i. Extract RNA as described for standard RT-PCR analysis (Step 3, Option B,

substeps i-iii).
ii. ii. Set up a cDNA synthesis (reverse transcriptase) reaction as described below:
Reagent Volume (μl) Final Concentration
10X PCR buffer I with 15 mM MgCl2 2 1X, 1.5 mM MgCl2
25 mM MgCl2 2.8 3.5 mM
dNTPs (2.5 mM) 8 1 mM
Random hexamer 50 μM 1 2.5 μM

Author Manuscript
RNase inhibitor (40 U/μl) 1 40 U
Reverse transcriptase (50 U/μl) 1 50 U
Extracted RNA 4.2 varied
Total 20
Vortex to mix, incubate at room temperature for 10 minutes, and then at 42°C for
at least 15 minutes.
iii. Deactivate the reverse transcriptase by incubating at 95°C for 5 minutes, and
then chill the reactions on ice.
iv. Set up the real-time PCR reaction in a MicroAmp fast optical 96-well reaction
Author Manuscript
plate as described in the table below. Note that the Primer/Probe Master Mix
contains primer/probe sets against two highly conserved regions of the IAV M
gene, and that the FastStart DNA Master HybProbe mix used is from the Roche
LightCycler - FastStart DNA Master HybProbe kit.
Reagent Volume (μl) Final Concentration
dH2O 7.6 Not applicable
25 mM MgCl2 2.4 3 mM
Primer/Probe Master Mix (see ‘Materials’) 3 0.75 μM primer0.375 μM probe
10X LightCycler® FastStart DNA Master HybProbe 2 1X

Author Manuscript
cDNA from step ii 5 varied
Total 20
v. Perform the IAV M-gene specific real-time RT-PCR in a real-time thermocycler

as described below:
Cycle Activation Denaturation Annealing Elongation Cooling

1 95°C for 10
Author Manuscript
minutes
2–51 95°C for 10 56°C for 15 72°C for 10

seconds seconds seconds
53 40°C for 30
seconds
vi. When the reaction is complete, view the amplification plots according to the real-
time apparatus manufacturer’s instructions. Ensure that the threshold is set just
above the background signal and real-time RT-PCR.
?TROUBLESHOOTING
Box 1: Further analysis of egg fluids

Author Manuscript
If you performed virus amplification and harvest in chicken eggs, you may need to proceed
with one of the following options depending on the results of the HA assay and/or RT-PCR
analysis. If HA activity or a positive RT-PCR result is obtained, follow option A. If samples
are negative for HA activity or a negative RT-PCR result is obtained, follow option B.
A) If HA activity or a positive RT-PCR result is obtained

i. Pool all positive egg fluids from the same source into a 50-ml conical tube.
ii. Centrifuge to remove debris (3,200 × g, 4°C, 10 minutes).
iii. Aliquot cleared supernatants into cryovials (0.5–1 ml per aliquot).
iv. Freeze aliquots at −80°C.

Author Manuscript
▲CRITICAL STEP Do not freeze IAV stocks at −20°C, as the virus is highly
unstable at this temperature68.
B) For samples that are negative by HA and/or RT-PCR assays

i. Passage the harvested egg fluids from the initial infection into fresh embryonated
chicken eggs to amplify any existing virus (as described in Step 2, Option A,
Substeps i-xvii).
ii. If egg fluids remain HA- and/or RT-PCR-negative after the second passage, the
sample is considered ‘negative’ for IAV amplification in eggs.
?TROUBLESHOOTING
Author Manuscript
TIMING
Part 1: Sample collection and preparation for virus amplification
Step 1, Option A: Swab and liquid sample collection and preparation
• Substeps i–iv (swab and liquid surveillance sample collections), 1 h to multiple
days, depending on the number and type of samples
• Substep v (swab and liquid surveillance sample processing), < 1 h

Step 1, Option B.: Tissue sample preparation and processing

Author Manuscript
• Substeps i–iii (animal tissue collection), 1–6 h, depending on the number of

animals
• Substeps iv–viii (animal tissue homogenization), 1–2 h
Part 2: Virus amplification and harvest in embryonated chicken eggs or MDCK cell cultures
Step 2, Option A: Embryonated chicken egg inoculation, fluid harvest and
fluid processing
• Substeps i–ix (inoculation), 1 h followed by 2–3 days incubation
• Substep x (egg chilling), 1–16 h
• Substeps xi–xiv (egg fluid harvesting), 1–6 h depending on the number of

Author Manuscript
samples
• Substep xv (check egg fluids for contamination), 1–3 days
• Substep xvi (clean up), 15 minutes
• Substep xvii (assess presence of IAV), see Part 3
Step 2, Option B: MDCK cell inoculation and supernatant harvest

• Substeps i–iii (MDCK preparation), 1 h plus a 16–24 h incubation
• Substeps iv–ix (MDCK inoculation), 2–3 h plus a 2–5 day incubation
• Substep x (monitor MDCK cells for CPE), 10–30 minutes
• Substep xi (harvest MDCK culture supernatants), 1–2 h

Author Manuscript
• Substep xii (MDCK passaging), see timing for substeps i-xi
• Substep xiii (cleanup), 15 minutes
• Substep xiv (assess presence of IAV), see Part 3
Part 3: Virus Detection by use of HA Assay, Standard RT-PCR, or Real-Time RT-PCR

Step 3, Option A: HA Assay
• Substeps i–v (HA assay), 2 h
Step 3, Option B: Standard RT-PCR analysis

• Substeps i–iii, (RNA harvest), 30 minutes to 1 h
Author Manuscript
• Substep iv (one-tube RT-PCR reaction), 2.5–3 h
• Substeps v–viii (agarose gel electrophoresis), 2 h
Step 3, Option C: Real-time RT-PCR

• Substep i, (RNA harvest), 30 minutes to 1 h
• Substep ii–v, (cDNA synthesis and real-time PCR reaction), 2–3 h

Box 1: Further analysis of egg fluids

Author Manuscript
• Substeps i–iv, part A, (egg stock preparation), 1–2 h
• Substep i–ii, part B, (egg passaging), see timing for substeps i-xvii
TROUBLESHOOTING
See Table 1 for troubleshooting guidance.
ANTICIPATED RESULTS
Examples of typical assay results are provided in Figure 3 (cytopathic effects in MDCK
cells), Figure 4 (HA assay) and Figure 5 (standard and real-time RT-PCR), and are described
in more detail below.
Author Manuscript
Cytopathic effects in IAV-infected MDCK cells (Figure 3)

IAV-induced cytopathic effects in MDCK cells are characterized by cell rounding and
detachment from the monolayer. For actively replicating cultures, this can be verified readily
by the existence of floating cellular debris in the culture medium, a loss of monolayer
coverage over the surface of the plate, and altered cellular morphology relative to mock-
infected control monolayers (see Figure 3). In some cases, cytopathic effects may be more
difficult to observe, particularly in earlier time points (e.g., see the CA04 panel of Figure 3),
and so it is critical to always include a mock-infected control culture so that direct
comparisons can be made. Complete loss of the monolayer is usually observed within 2–3
days post-inoculation (data not shown). It is important to note that bacterial or fungal
contamination can result in the appearance of floating debris and, on occasion, changes in
the cellular monolayer. Thus, personnel examining virus cultures should note drastic
Author Manuscript
changes in pH and excessive turbidity of virus culture medium, as these observations

strongly suggest the presence of undesirable contaminants.
HA assay (Figure 4)
The results of HA assays can be directly scored by eye and do not require the use of a plate
reader. As described above, agglutination causes RBCs to remain in a sheet at the bottom of
wells – giving a cloudy appearance – while the lack of agglutination results in RBC settling
to the bottom of the well in the form of a button or halo surrounded by relatively translucent
buffer (see Figure 4, panel A for examples of each of these phenomena). A sample that is
authentically HA-positive will usually exhibit agglutination at multiple dilutions, and partial
agglutination may be observed in HA-positive samples at dilutions that immediately precede
Author Manuscript
the first negative dilution (Figure 4, panel B; see the wells highlighted by blue circles for
examples of partial agglutination). Partially agglutinated positive samples should not be
mistaken for negative halos, which are observed when using mammalian RBCs. To calculate
a sample’s HA titer, take the reciprocal of the highest dilution at which complete
agglutination is observed. For example, if the highest completely agglutinated dilution is
2−7, the virus is considered to have 128 HA units.

Standard RT-PCR (Figure 5, panel A)

Author Manuscript
The results of a standard RT-PCR assay are assessed by use of agarose gel electrophoresis of
the PCR product. In Figure 5 (panel A), we show a typical result for the standard RT-PCR
reaction using universal primers to the M gene, as described in this protocol. This PCR
reaction detects M-gene fragments from IAVs of a variety of origins, although variability
may be observed.
Real-time RT-PCR (Figure 5, panel B)

The results of real-time RT-PCR assays are determined by observing the normalized reporter
(Rn) value for each reaction, which is calculated as the ratio of the fluorescence of the
FAM™ dye divided by the fluorescence of a passive reference dye (ROX™) at the end of
each cycle. Results are reported as a Ct (cycle threshold) value, which is the number of
cycles required for the Rn value to intersect the threshold line (established by negative
Author Manuscript
control reactions), and is a relative measure of the concentration of target in the RT-PCR
reaction. A typical Ct value for positive target amplification is ≤ 35.0, and the Rn value
should exhibit a sigmoidal amplification curve. Any Ct signal above 35 cycles may be
considered suspect and could require further confirmation. In Figure 5 (panel B), we show
typical sigmoidal amplification curves for several different IAVs when using the real-time
RT-PCR procedure described in this protocol. Some minor variability is noted between the
Rn values of the viruses examined here (Figure 5, panel C). It should be emphasized that,
while the primers for both the standard and real-time RT-PCR assays described in this
protocol are ‘universal’ (i.e., designed to detect highly conserved M gene regions), it is
possible that some IAVs may not be detected if primers are imperfectly matched to their M
gene.
Author Manuscript
SUMMARY
The procedures described in this protocol allow the isolation, culture and identification of
IAVs from different types of surveillance and research samples, and the resultant virus
culture stocks can be retained and used in downstream analyses. For surveillance samples,
additional subtype-specific RT-PCR (or other) assays may be performed to determine the
specific HA and NA subtypes of isolated IAVs, and full genome sequencing may be
employed to study the phylogenetic relationships of newly isolated viruses to known IAVs
that originated in humans and/or reservoir species. Moreover, the assembled human
surveillance data from multiple sources may be used by public health officials to determine
the severity of a particular IAV season, to assess IAV vaccine efficacy, and to make
recommendations for IAV vaccine strain selection for upcoming seasons. For H5N1-HPAI
and H7N9 viruses isolated from animal surveillance samples, it is particularly important to
Author Manuscript
identify genetic markers that are known to enhance virus growth and/or transmission in
mammals (i.e., evidence for pandemic potential), and follow-up in vivo experiments should
be performed to validate whether specific viruses exhibit pathogenicity or transmission in
mammalian models of infection. In sum, this protocol is essential to enhance knowledge
about IAVs that are currently circulating in humans and reservoir species, and to more
clearly define potential IAV pandemic threats.

Acknowledgments
Author Manuscript
The authors are grateful to Masato Hatta, Shufang Fan, Jihui Ping, Zachary Najacht, and Alexander Karasin for
helpful discussions, to Peter Jester and Zachary Najacht for assistance with HA assay and RT-PCR figure
components, and to Susan Watson for scientific editing of the manuscript. This work was supported by grants-in-aid
from the Ministry of Health, Labour, and Welfare, Japan, by ERATO (Japan Science and Technology Agency), by
National Institute of Allergy and Infectious Diseases Public Health Service research grants, and by an NIAID-
funded Center for Research on Influenza Pathogenesis (CRIP, HHSN266200700010C).
References
1. World Health Organization (WHO). Influenza (Seasonal) Fact sheet N°211. 2013. <http://
www.who.int/mediacentre/factsheets/fs211/en/index.html>
2. Taubenberger JK, Morens DM. Influenza: the mother of all pandemics. Emerging infectious
diseases. 2006; 12:15–22. 1918. DOI: 10.3201/eid1201.050979 [PubMed: 16494711]
3. Tong S, et al. A distinct lineage of influenza A virus from bats. Proceedings of the National
Academy of Sciences of the United States of America. 2012; 109:4269–4274. DOI: 10.1073/pnas.
Author Manuscript
1116200109 [PubMed: 22371588]

4. WHO. Influenza at the human-animal interface – Summary and assessment as of 27 June 2014.
2014. <http://www.who.int/influenza/human_animal_interface/
Influenza_Summary_IRA_HA_interface_27June14.pdf?ua=1>
5. Imai M, et al. Experimental adaptation of an influenza H5 HA confers respiratory droplet
transmission to a reassortant H5 HA/H1N1 virus in ferrets. Nature. 2012; 486:420–428. DOI:
10.1038/nature10831 [PubMed: 22722205]
6. Herfst S, et al. Airborne transmission of influenza A/H5N1 virus between ferrets. Science. 2012;
336:1534–1541. DOI: 10.1126/science.1213362 [PubMed: 22723413]
7. Chen LM, et al. In vitro evolution of H5N1 avian influenza virus toward human-type receptor
specificity. Virology. 2012; 422:105–113. DOI: 10.1016/j.virol.2011.10.006 [PubMed: 22056389]
8. Gao R, et al. Human infection with a novel avian-origin influenza A (H7N9) virus. The New
England journal of medicine. 2013; 368:1888–1897. DOI: 10.1056/NEJMoa1304459 [PubMed:
23577628]
Author Manuscript
9. WHO. WHO Risk Assessment, Human infections with avian influenza A(H7N9) virus, Summary of
surveillance and investigation findings as of 27 June 2014. 2014. <http://www.who.int/influenza/
human_animal_interface/influenza_h7n9/riskassessment_h7n9_27june14.pdf?ua=1>
10. Qi X, et al. Probable person to person transmission of novel avian influenza A (H7N9) virus in
Eastern China, 2013: epidemiological investigation. British Medical Journal. 2013; 347:f4752–
4759. [PubMed: 23920350]
11. Watanabe T, et al. Characterization of H7N9 influenza A viruses isolated from humans. Nature.
2013; 501:551–555. DOI: 10.1038/nature12392 [PubMed: 23842494]
12. Belser JA, et al. Pathogenesis and transmission of avian influenza A (H7N9) virus in ferrets and
mice. Nature. 2013; 501:556–559. DOI: 10.1038/nature12391 [PubMed: 23842497]
13. Zhu H, et al. Infectivity, transmission, and pathology of human-isolated H7N9 influenza virus in
ferrets and pigs. Science. 2013; 341:183–186. DOI: 10.1126/science.1239844 [PubMed:
23704376]
14. Zhang Q, et al. H7N9 Influenza Viruses Are Transmissible in Ferrets by Respiratory Droplet.
Science. 2013; 341:410–414. DOI: 10.1126/science.1240532 [PubMed: 23868922]
Author Manuscript
15. WHO. Manual for the Laboratory Diagnosis and Virological Surveillance of Influenza. 2011.
<http://whqlibdoc.who.int/publications/2011/9789241548090_eng.pdf>
16. WHO. Manual on Animal Influenza Diagnosis and Surveillance. 2002. <http://www.who.int/csr/
resources/publications/influenza/en/whocdscsrncs20025rev.pdf>
17. WHO. WHO information for molecular diagnosis of influenza virus in humans - update. 2012.
<http://www.who.int/influenza/gisrs_laboratory/
molecular_diagnosis_influenza_virus_humans_update_201211.pdf>

18. WHO. Global Influenza Surveillance and Response System (GISRS). 2013. <http://www.who.int/
influenza/gisrs_laboratory/en/>
Author Manuscript
19. CDC. Seasonal Influenza Activity and Surveillance. 2013. <http://www.cdc.gov/flu/weekly/

fluactivitysurv.htm>
20. ECDC. European Influenza Surveillance Network (EISN). 2013. <http://ecdc.europa.eu/en/
activities/surveillance/EISN/Pages/index.aspx>
21. WHO. WHO Collaborating Centres for influenza and Essential Regulatory Laboratories. 2013.
<http://www.who.int/influenza/gisrs_laboratory/collaborating_centres/list/en/>
22. Fouchier RA, et al. Detection of influenza A viruses from different species by PCR amplification
of conserved sequences in the matrix gene. Journal of clinical microbiology. 2000; 38:4096–4101.
[PubMed: 11060074]
23. van Elden LJ, Nijhuis M, Schipper P, Schuurman R, van Loon AM. Simultaneous detection of
influenza viruses A and B using real-time quantitative PCR. Journal of clinical microbiology.
2001; 39:196–200. DOI: 10.1128/JCM.39.1.196-200.2001 [PubMed: 11136770]
24. Goodpasture EW, Woodruff AM, Buddingh GJ. The Cultivation of Vaccine and Other Viruses in
the Chorioallantoic Membrane of Chick Embryos. Science. 1931; 74:371–372. DOI: 10.1126/
Author Manuscript
science.74.1919.371 [PubMed: 17810781]

25. Ito T, et al. Differences in sialic acid-galactose linkages in the chicken egg amnion and allantois
influence human influenza virus receptor specificity and variant selection. Journal of virology.
1997; 71:3357–3362. [PubMed: 9060710]
26. Lu B, Zhou H, Chan W, Kemble G, Jin H. Single amino acid substitutions in the hemagglutinin of
influenza A/Singapore/21/04 (H3N2) increase virus growth in embryonated chicken eggs. Vaccine.
2006; 24:6691–6693. DOI: 10.1016/j.vaccine.2006.05.062 [PubMed: 16814431]
27. Lu B, Zhou H, Ye D, Kemble G, Jin H. Improvement of influenza A/Fujian/411/02 (H3N2) virus
growth in embryonated chicken eggs by balancing the hemagglutinin and neuraminidase activities,
using reverse genetics. Journal of virology. 2005; 79:6763–6771. DOI: 10.1128/JVI.
79.11.6763-6771.2005 [PubMed: 15890915]
28. Stevens J, et al. Receptor specificity of influenza A H3N2 viruses isolated in mammalian cells and
embryonated chicken eggs. Journal of virology. 2010; 84:8287–8299. DOI: 10.1128/JVI.00058-10
[PubMed: 20519409]
Author Manuscript
29. Katz JM, Webster RG. Efficacy of inactivated influenza A virus (H3N2) vaccines grown in
mammalian cells or embryonated eggs. The Journal of infectious diseases. 1989; 160:191–198.
[PubMed: 2760480]
30. Kodihalli S, Justewicz DM, Gubareva LV, Webster RG. Selection of a single amino acid
substitution in the hemagglutinin molecule by chicken eggs can render influenza A virus (H3)
candidate vaccine ineffective. Journal of virology. 1995; 69:4888–4897. [PubMed: 7609057]
31. Gaush CR, Hard WL, Smith TF. Characterization of an established line of canine kidney cells
(MDCK). Proc Soc Exp Biol Med. 1966; 122:931–935. [PubMed: 5918973]
32. Gaush CR, Smith TF. Replication and plaque assay of influenza virus in an established line of
canine kidney cells. Applied microbiology. 1968; 16:588–594. [PubMed: 5647517]
33. Tobita K, Sugiura A, Enomote C, Furuyama M. Plaque assay and primary isolation of influenza A
viruses in an established line of canine kidney cells (MDCK) in the presence of trypsin. Medical
microbiology and immunology. 1975; 162:9–14. [PubMed: 1214709]
34. Davies HW, Appleyard G, Cunningham P, Pereira MS. The use of a continuous cell line for the
isolation of influenza viruses. Bulletin of the World Health Organization. 1978; 56:991–993.
Author Manuscript
[PubMed: 310738]
35. Meguro H, Bryant JD, Torrence AE, Wright PF. Canine kidney cell line for isolation of respiratory
viruses. Journal of clinical microbiology. 1979; 9:175–179. [PubMed: 219021]
36. Lazarowitz SG, Choppin PW. Enhancement of the infectivity of influenza A and B viruses by
proteolytic cleavage of the hemagglutinin polypeptide. Virology. 1975; 68:440–454. [PubMed:
128196]
37. Klenk HD, Rott R, Orlich M, Blodorn J. Activation of influenza A viruses by trypsin treatment.
Virology. 1975; 68:426–439. [PubMed: 173078]

38. Skehel JJ, Wiley DC. Receptor binding and membrane fusion in virus entry: the influenza
hemagglutinin. Annual review of biochemistry. 2000; 69:531–569. DOI: 10.1146/
Author Manuscript
annurev.biochem.69.1.531
39. Hatakeyama S, et al. Enhanced expression of an alpha2,6-linked sialic acid on MDCK cells
improves isolation of human influenza viruses and evaluation of their sensitivity to a
neuraminidase inhibitor. Journal of clinical microbiology. 2005; 43:4139–4146. DOI: 10.1128/
JCM.43.8.4139-4146.2005 [PubMed: 16081961]
40. Hirst GK. The Agglutination of Red Cells by Allantoic Fluid of Chick Embryos Infected with
Influenza Virus. Science. 1941; 94:22–23. DOI: 10.1126/science.94.2427.22 [PubMed: 17777315]
41. Francis T, Pearson HE, Salk JE, Brown PN. Immunity in Human Subjects Artificially Infected with
Influenza Virus, Type B. American journal of public health and the nation’s health. 1944; 34:317–
334.
42. Ito T, et al. Receptor specificity of influenza A viruses correlates with the agglutination of
erythrocytes from different animal species. Virology. 1997; 227:493–499. DOI: 10.1006/viro.
1996.8323 [PubMed: 9018149]
43. Medeiros R, Escriou N, Naffakh N, Manuguerra JC, van der Werf S. Hemagglutinin residues of
Author Manuscript
recent human A(H3N2) influenza viruses that contribute to the inability to agglutinate chicken
erythrocytes. Virology. 2001; 289:74–85. DOI: 10.1006/viro.2001.1121 [PubMed: 11601919]
44. Wiriyarat W, et al. Erythrocyte binding preference of 16 subtypes of low pathogenic avian
influenza and 2009 pandemic influenza A (H1N1) viruses. Veterinary microbiology. 2010;
146:346–349. DOI: 10.1016/j.vetmic.2010.05.031 [PubMed: 20579820]
45. Gavin PJ, Thomson RB Jr. Review of Rapid Diagnostic Tests for Influenza. Clinical and Applied
Immunology Reviews. 2003; 4:151–172.
46. Hurt AC, Alexander R, Hibbert J, Deed N, Barr IG. Performance of six influenza rapid tests in
detecting human influenza in clinical specimens. Journal of clinical virology: the official
publication of the Pan American Society for Clinical Virology. 2007; 39:132–135. DOI: 10.1016/
j.jcv.2007.03.002 [PubMed: 17452000]
47. Nutter S, et al. Evaluation of indirect fluorescent antibody assays compared to rapid influenza
diagnostic tests for the detection of pandemic influenza A (H1N1) pdm09. PloS one. 2012;
7:e33097. [PubMed: 22479360]
48. Al Johani SM, Al Balawi M, Al Alwan B, Al Hefdhi R, Hajeer A. Validity of two rapid point of
Author Manuscript
care influenza tests and direct fluorecence assay in comparison of real time PCR for swine of
origin Influenza virus. Journal of infection and public health. 2011; 4:7–11. DOI: 10.1016/j.jiph.
2010.10.004 [PubMed: 21338954]
49. Rahman M, et al. Performance of Directigen flu A+B enzyme immunoassay and direct fluorescent
assay for detection of influenza infection during the 2004–2005 season. Diagnostic microbiology
and infectious disease. 2007; 58:413–418. DOI: 10.1016/j.diagmicrobio.2007.03.011 [PubMed:
17509800]
50. Hirst GK. The Quantitative Determination of Influenza Virus and Antibodies by Means of Red Cell
Agglutination. The Journal of experimental medicine. 1942; 75:49–64. [PubMed: 19871167]
51. Rowe T, et al. Detection of antibody to avian influenza A (H5N1) virus in human serum by using a
combination of serologic assays. Journal of clinical microbiology. 1999; 37:937–943. [PubMed:
10074505]
52. WHO. Serological Diagnosis of Influenza by Microneutralization Assay. 2006. <http://
www.who.int/influenza/gisrs_laboratory/
Author Manuscript
2010_12_06_serological_diagnosis_of_influenza_by_microneutralization_assay.pdf>
53. St George, K. Influenza Virus: Methods and Protocols Methods in Molecular Biology. Kawaoka,
Y., Neumann, G., editors. Humana Press; 2012. Ch 4
54. Hoffmann E, Stech J, Guan Y, Webster RG, Perez DR. Universal primer set for the full-length
amplification of all influenza A viruses. Archives of virology. 2001; 146:2275–2289. [PubMed:
11811679]
55. Lee CW, Senne DA, Suarez DL. Development and application of reference antisera against 15
hemagglutinin subtypes of influenza virus by DNA vaccination of chickens. Clinical and vaccine

immunology: CVI. 2006; 13:395–402. DOI: 10.1128/CVI.13.3.395-402.2006 [PubMed:

16522783]
Author Manuscript
56. CDC. Biosafety in Microbiological and Biomedical Laboratories (BMBL) 5th Edition. 2009.
<http://www.cdc.gov/biosafety/publications/bmbl5/>
57. Kostka V, Carpenter FH. Inhibition of Chymotrypsin Activity in Crystalline Trypsin Preparations.
The Journal of biological chemistry. 1964; 239:1799–1803. [PubMed: 14213354]
58. WHO. WHO Collaborating Centres. 2013. <http://www.who.int/collaboratingcentres/en/>
59. Daley P, Castriciano S, Chernesky M, Smieja M. Comparison of flocked and rayon swabs for
collection of respiratory epithelial cells from uninfected volunteers and symptomatic patients.
Journal of clinical microbiology. 2006; 44:2265–2267. DOI: 10.1128/JCM.02055-05 [PubMed:
16757636]
60. Walsh P, et al. Comparison of respiratory virus detection rates for infants and toddlers by use of
flocked swabs, saline aspirates, and saline aspirates mixed in universal transport medium for room
temperature storage and shipping. Journal of clinical microbiology. 2008; 46:2374–2376. DOI:
10.1128/JCM.00714-08 [PubMed: 18463214]
61. Munywoki PK, et al. Improved detection of respiratory viruses in pediatric outpatients with acute
Author Manuscript
respiratory illness by real-time PCR using nasopharyngeal flocked swabs. Journal of clinical
microbiology. 2011; 49:3365–3367. DOI: 10.1128/JCM.02231-10 [PubMed: 21775539]
62. Hernes SS, et al. Swabbing for respiratory viral infections in older patients: a comparison of rayon
and nylon flocked swabs. European journal of clinical microbiology & infectious diseases: official
publication of the European Society of Clinical Microbiology. 2011; 30:159–165. DOI: 10.1007/
s10096-010-1064-2
63. Wadowsky RM, Laus S, Libert T, States SJ, Ehrlich GD. Inhibition of PCR-based assay for
Bordetella pertussis by using calcium alginate fiber and aluminum shaft components of a
nasopharyngeal swab. Journal of clinical microbiology. 1994; 32:1054–1057. [PubMed: 8027309]
64. Wiebe JP, Dinsdale CJ. Inhibition of cell proliferation by glycerol. Life sciences. 1991; 48:1511–
1517. [PubMed: 1901931]
65. Miller GL. Influence of pH and of certain other conditions on the stability of the infectivity and red
cell agglutinating activity of influenza virus. The Journal of experimental medicine. 1944; 80:507–
520. [PubMed: 19871433]
Author Manuscript
66. Wang X, Zoueva O, Zhao J, Ye Z, Hewlett I. Stability and infectivity of novel pandemic influenza
A (H1N1) virus in blood-derived matrices under different storage conditions. BMC infectious
diseases. 2011; 11:354. [PubMed: 22192363]
67. Beato MS, et al. Infectivity of H7 LP and HP influenza viruses at different temperatures and pH
and persistence of H7 HP virus in poultry meat at refrigeration temperature. Virology. 2012;
433:522–527. DOI: 10.1016/j.virol.2012.08.009 [PubMed: 23017502]
68. Greiff D, Blumenthal H, Chiga M, Pinkerton H. The effects on biological materials of freezing and
drying by vacuum sublimation. II. Effect on influenza virus. The Journal of experimental
medicine. 1954; 100:89–101. [PubMed: 13163341]
69. WHO. Collecting, preserving and shipping specimens for the diagnosis of avian influenza
A(H5N1) virus infection. 2006. <http://www.who.int/csr/resources/publications/surveillance/
CDS_EPR_ARO_2006_1.pdf>
Author Manuscript

Author Manuscript
Author Manuscript
Figure 1. IAV isolation, culture, and identification protocol flowchart

Author Manuscript
Protocol parts and subcomponents are indicated by the dark and light boxes, respectively.
Specific text sections describing the steps for each technique are indicated at the right. The
‘gold standard’ workflow is shown by solid lines with arrows, and the ‘fast’ workflow is
shown by dashed lines with arrows. Workflows start from the ‘Part 1’ box at the upper left.
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Figure 2. Embryonated egg inoculation and allantoic fluid harvest

Author Manuscript
(A) A graphical longitudinal section of an embryonated egg’s interior anatomy. “Em,”

embryo. (B) Photograph of a candled, 10-day-old embryonated chicken egg with an
inoculation puncture. Anatomic regions, as described in (A), are indicated. (C) Photographs
of (i) an ‘in-house’ egg piercing tool consisting of a 20-gauge, 1.5″ catheter punched
through a rubber stopper; (ii) the generation of the inoculation puncture by using the egg
piercing tool; and (iii) the egg inoculation procedure. (D) Photographic representation of the
egg allantoic fluid harvest procedure. After the egg was chilled at 4°C overnight, its shell

above the air sac was cracked and removed (i); the allantoic membrane was pulled back (ii);
Author Manuscript
and the allantoic fluids were harvested (iii).

Author Manuscript
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Figure 3. IAV-induced cytopathic effects (CPE) in MDCK cells

MDCK cells were mock-infected (with MEM-BSA containing TPCK-trypsin but lacking
Author Manuscript
any virus) or infected with 1:1000 dilutions of stock viruses of influenza A/Kawasaki/
173/2001 (H1N1; ‘K173’), A/Yokohama/2017/2003 (H3N2; ‘Y2017’), or A/California/
04/2009 (H1N1; ‘CA04’), as described in Step 2, Option B, substeps i-x. Twenty-four
hours later, monolayers were examined for CPE by using a light microscope (4X objective;
the red scale bar in the lower right of each panel represents a length of 200 μM). Prominent
and moderate CPE were observed in K173 and Y2017 infections, respectively. The blue
arrow in the CA04 panel indicates minor CPE. By 48 h post-infection, all cells in all

infections were completely detached and floating in the cell culture medium (data not
Author Manuscript
shown).
Author Manuscript
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Figure 4. Hemagglutination (HA) assay

(A) Samples lacking agglutinating activity (left panel) or containing IAV with agglutinating
activity (center panel) were mixed with an equal volume of turkey RBCs (0.5%) in a U-
bottomed microtiter plate and incubated for 30 minutes at room temperature; and a sample
lacking agglutinating activity (right panel) was mixed with an equal volume of human RBCs
(0.75%) in a U-bottomed microtiter plate and incubated for 1 hour at room temperature. At
the end of each incubation period, 4X magnified images of individual microtiter plate wells
Author Manuscript
were captured using a tissue culture microscope fitted with a digital camera. The left panel
shows a characteristic negative ‘button’ result; the central panel shows the evenly
distributed, ‘cloudy’ appearance of a positive agglutination result; and the right panel shows
a thick ring of cells, i.e. a ‘halo’, negative result. (B) Samples containing IAV with
agglutinating activity (see rows A, B, and D-G) or lacking IAV with agglutinating activity
(see rows C and H) were subjected to an HA assay. Samples were 2-fold serially diluted (20
– 211) in a 50-μl final volume, and then mixed with an equal volume of turkey RBCs (0.5%)
in a U-bottomed microtiter plate. The entire microtiter plate was photographed after 30

minutes incubation at room temperature. The dilutions for each column and the
Author Manuscript
corresponding HA units are indicated at the top of the panel, and the HA titer for each
sample is indicated to the right. Wells exhibiting partial agglutination are indicated by dark
blue circles.
Author Manuscript
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Figure 5. RT-PCR Analysis

Author Manuscript
RNA was harvested from virus stocks of CA04 (H1N1), K173 (H1N1), Y2071 (H3N2), A/
Vietnam/1203/2004 (H5N1; ‘VN1203’), and A/Anhui/1/2013 (H7N9; ‘AH1’), and the
resultant RNA was subjected to standard RT-PCR (A) or real-time RT-PCR (B-C)
procedures as described in this protocol. (A) Products from the standard RT-PCR reaction
(1/3 of the total volume) were analyzed by agarose gel electrophoresis and an image of the
gel is shown. The M-gene fragment location (~274 nt) is indicated by a bar at the right, sizes
of double-stranded DNA standards are indicated at the left (Nt = nucleotides) and lane

descriptions – indicating the input template virus RNA – are provided to the right of the gel
Author Manuscript
panel. (B) Real-time RT-PCR Rn/Ct plots for each virus template are shown. (C) The graph
depicts the Ct value for each of the reactions plotted in panel (B). The dotted red line
indicates the threshold for identification of a positive sample (the Ct value of the sample
must be below this line to be confidently considered ‘positive’).
Author Manuscript
Author Manuscript
Author Manuscript

TABLE 1
Troubleshooting table
Author Manuscript
Step Problem Possible Reason Solution

1 Tissue pieces do not (a) Tissue sections are too large. (a) Reduce the tissue section size.
Part B break up well in the (b) The tube volume does not permit (b) Reduce the media volume to 500 μl for the
Subpart vi homogenizer. sufficient tissue mobility during the homogenization cycle, and add an additional 500 μl once
homogenization cycle. the tissue has been completely dispersed.
2 Difficulty Inoculation must be done blindly. Inexperienced researchers should practice egg
Part A inoculating allantoic inoculations with Coomassie stain (0.5%) prior to sample
Subpart v or amniotic sacs inoculations, and visually check where the stain settled to
ensure appropriate inoculum targeting.
2 Difficulty harvesting Albumin is trapped in the pipette. Expel pipette contents and try to avoid albumin.
Part A allantoic fluid
Subpart xiii
2 MDCK cells do not Unhealthy MDCK cell cultures were used Avoid allowing cells to become over-confluent before
Part B grow well in seeded for seeding. passaging. Avoid using high passage number cells or
Subpart iii cultures expired cell culture medium. Check cells for mycoplasma
contamination.
Author Manuscript
2 Lack of CPE in (a) The culture does not contain IAV. (a) No further steps are required.
Part B MDCK cultures If the inoculated sample is known to (b) Passage the culture in MDCK cells to amplify any
Subpart xii contain IAV: virus that is present, or repeat the inoculation using eggs.
(b) The IAV does not grow well in MDCK (c) Be sure to add TPCK-trypsin to the inoculation and
cells. virus culture medium.
(c) TPCK-trypsin was not included in the (d) Wash the monolayer three times before inoculation
culture. using PBS or MEM-BSA.
(d) Inefficient monolayer washing prior to (e) Avoid using cultures that are high passage number or
inoculation. overgrown. Avoid using expired cell culture medium.
(e) MDCK cells are not metabolically Only inoculate cultures at 80%–90% confluence.
active.
3 Difficulty discerning (a) Microtiter plates were disturbed during (a) Avoid disturbing microtiter plates during the
Part A positive vs. negative the incubation period. incubation period.
Subpart v HA assay results (b) Flat-bottomed microtiter plates were (b) Only use U-bottomed plates for HA assays.
improperly used.
3 Lack of M gene (a) The culture does not contain IAV. (a) No further steps are required.
Part B amplification If the inoculated sample is known to (b) Assay RNA levels of RNeasy preps by using
Subpart viii contain IAV: spectrophotometry. Check for amplification of M gene
and (b) RNA isolation was not successful. sequences in a positive control prepared in parallel.
Author Manuscript
3 Part C (c) Primer mis-match occurred between the (c) Check for amplification of M gene sequences in a
Subpart v conserved M gene sequence of the primer positive control prepared in parallel; use an alternative set
and that of M gene in the sample. of primers
(d) PCR reagents are degraded or expired. (d) Repeat the assay using new reagents.
Box 1 Lack of (a) The culture does not contain IAV. (a) No further steps are required.
Part B agglutinating If the inoculated sample is known to (b) Passage the culture in eggs to amplify any virus that is
Subpart ii activity in egg fluids contain IAV: present, or repeat the inoculation using MDCK cell
(b) The IAV does not grow well in eggs. cultures.
(c) The egg was inoculated improperly. (c) See the solution for Step 2, Part A Subpart v.
(d) The IAV in question does not (d) Repeat the HA assay with RBCs from another
agglutinate RBCs derived from the species species.
in use.
Author Manuscript

Ni Hms 902603

Uploaded by

Copyright:

Available Formats

Ni Hms 902603

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Ni Hms 902603

Uploaded by

Copyright:

Available Formats

HHS Public Access

Published in final edited form as:

Influenza A Virus Isolation, Culture and Identification

3Division of Virology, Department of Microbiology and Immunology, Institute of Medical Science,

caused by antigenic drift, a process facilitated by a combination of immune pressure and an

Nat Protoc. Author manuscript; available in PMC 2017 September 28.

• Swab samples from humans (nasal, nasopharyngeal, or oropharyngeal); avian

• Tissue samples from experimentally sacrificed animals, or from slaughtered or

Nat Protoc. Author manuscript; available in PMC 2017 September 28.

Nat Protoc. Author manuscript; available in PMC 2017 September 28.

dilutions of virus-containing samples with a standard amount of RBCs in microtiter plates

The amount of IAV HA protein in surveillance samples is usually insufficient to yield

Nat Protoc. Author manuscript; available in PMC 2017 September 28.

immunofluorescence assays using influenza-specific antibodies. It is important to note that

micronetralization51) can be used to retrospectively (and indirectly) identify IAV infection

Nat Protoc. Author manuscript; available in PMC 2017 September 28.

Limitations of the Protocol

Biosafety—All methods involving the manipulation of samples containing (or potentially

may be necessary if a strain poses a pertinent threat to human or agricultural animal

Nat Protoc. Author manuscript; available in PMC 2017 September 28.

biosafety containment and PPE is the ‘Biosafety in Microbiological and Biomedical

• Disinfectant (e.g., Microchem Plus, 5%)

!CAUTION Experiments involving live animals must conform to local and

• Phosphate-buffered saline (PBS), pH 7.2, autoclaved and stored at room

• Sterile glycerol, stored at room temperature

• Deionized water (dH2O), autoclaved and stored at room temperature

▲CRITICAL STEP Some commercial sources of BSA fraction V impair

Nat Protoc. Author manuscript; available in PMC 2017 September 28.

• L-glutamine, 200 mM (Gibco, cat. no. 25030-081); aliquoted, stored at −20°C,

and thawed before use

• ‘Anti-Anti’ antibiotic-antimycotic mixture (10,000 units/ml of penicillin, 10,000

Virus culture in eggs

!CAUTION Experiments involving live animals must conform to local and

• Egg sealant (e.g., paraffin wax, nail polish, or Elmer’s™ glue)

• PBS (prepare as described above)

• Anti-Anti (prepare as described above)

• Blood-agar plates (to check for bacterial contamination)

Virus culture in cells

• 0.25% trypsin-EDTA (Gibco, cat. no., 25200-056)

• Normal calf serum (NCS), heat-inactivated (Thermo Scientific, cat. no.

• Tosyl phenylalanyl chloromethyl ketone (TPCK)-treated trypsin (‘TPCK-

▲CRITICAL STEP The addition of TPCK to trypsin preparations impairs the

• Guinea pig RBCs, 10% (Rockland, cat. no. R402-0050)

• PBS (prepare as described above)

Nat Protoc. Author manuscript; available in PMC 2017 September 28.

• 70% ethanol, molecular grade

• dNTP mix, 10 mM (Life Technologies, cat. no. 18427013)

• RNasin Plus RNase inhibitor (Promega, cat. no. N2611)

• dNTP mix, 10 mM (Life Technologies, cat. no. 18427013)

• Random hexamer, 50 μM (Applied Biosystems, cat. no. 8080127)

• MuLV Reverse Transcriptase 50 U/μl (Applied Biosystems, cat. no. 8080018)

• Forward and reverse oligonucleotide primers (diluted to 10 μM) and fluorogenic

Nat Protoc. Author manuscript; available in PMC 2017 September 28.

• LightCycler® FastStart™ DNA Master HybProbe kit (Roche Applied Sciences,

Agarose gel electrophoresis

• Seakem ME agarose powder (Lonza, cat. no. 50014)

• dH2O, autoclaved and stored at room temperature

• 10X TAE (Biorad, cat. no. 161-0773)

• Approved biosafety level 2 (BSL-2) or enhanced BSL-2 (BSL-2+) laboratory