a

Original Article ISSN 0101-2061 (Print)

Food Science and Technology ISSN 1678-457X (Online)

DOI: https://doi.org/10.1590/fst.94522

Protective effects of lemongrass (Cymbopogon citratus STAPF) extract mediated

mitochondrial fission and glucose uptake inhibition in SW1417
Maha Abdulla ALWAILI1* 

Abstract
This study investigated the anticarcinogenic effect of lemongrass extract on human SW1417 colon cancer cells. SW1417 cells
were cultured and allocated into five groups to apply the treatment with the lemongrass extract using 5 separate fluctuated
concentrations: 0, 50, 100, 150 and 200 μg/mL for 24 h. The mRNA expressions of the oxidative pressure genes (HO-1 and
NQO1) were measured using the RT-PCR technique. Additionally, mitochondrial morphology was evaluated using Biotium
(100 nM MitoView™ 405-Blue) within a free culture. The antitumor activity value (IC50) in SW1417 cells was done at 150 µg/mL.
Besides, the changes of mitochondrial morphology in the treated SW1417 cells at all the concentrations of lemongrass extract
were markedly observed as mitochondrial fission, which increased with increasing the concentrations and led to an apoptotic
effect. For more validation, mRNA levels of the oxidative pressure genes HO-1 and NQO1 were confirmed the obtained data,
HO-1 and NQO1 genes expressions recorded significant (P < 0.05) increase which associated with increasing the concentrations
of lemongrass extract standardized to β-actin housekeeping gene and contrasted to untreated cells (0 μg/mL). In conclusion,
our findings indicate that lemongrass extract provided an anticarcinogenic action against the cell proliferation of human colon
cancer cells.
Keywords: lemongrass (Cymbopogon citratus STAPF) extract; human colon cancer cells (SW1417); anticancer; apoptosis;
mitochondrial fission.
Practical Application: The extract of lemongrass acts as an anti-carcinogenic agent against the cell proliferation of SW1417.

1 Introduction
Lemongrass (Cymbopogon citratus STAPF) leaves have foci development induced by carcinogens azoxymethane and
been widely consumed as infusions in Brazilian folk medicine diethylnitrosamine, respectively (Nomier et al., 2021; Okada et al.,
to treat ailments through the anti-spasmodic, analgesic, 2021; Zhi et al., 2021).
antiinflammatory, antipyretic, diuretic and sedative properties
Cancer chemoprevention is defined as the prevention,
of this species (Blanco et al., 2009; Negrelle & Gomes, 2007).
Essential oil of lemongrass is of immense commercial value as inhibition, or reversion of cancer by the administration of natural
a food preservative, flavoring agent and ingredient in fragrances or synthetic agents (Flora & Ferguson, 2005; George et al., 2021).
and cosmetics (Ganjewala & Luthra, 2010). In addition, various Chemopreventive agents may inhibit cancer development either
in vitro and in vivo pharmacological activities of lemongrass by limiting exposure to carcinogens (e.g. carcinogenformation
essential oil (LGEO) have been described, including anxiolytic inhibitors and blocking agents) or by decreasing tumor promotion/
and anticonvulsant activities (Blanco et al., 2009; Silva et al., progression stages (e.g. suppressing agents) (George et al., 2021).
2010) and antibacterial, antifungal and antiprotozoal properties Many compounds of medicinal or dietary plants have been identified
(Duarte et al., 2007; Irkin & Korukluoglu, 2009; Oliveira et al., as potential chemopreventive agents capable of inhibiting DNA
2009; Santoro et al., 2007; Silva et al., 2008). Previous studies have damage, and even retarding or reversing the carcinogenesis process
shown antimutagenic and antioxidant activities of lemongrass in both in vitro and in vivo bioassays (Aggarwal & Shishodia,
extracts, or their specific compounds (i.e. citral, b-myrcene and 2006; Flora & Ferguson, 2005; Malik et al., 2022; Patra et al.,
geraniol) in different in vitro and in vivo systems (Aboagye et al., 2021). Furthermore, there are various epidemiological studies
2021; Cheel et al., 2005; Faheem et al., 2022; Mitić-Ćulafić et al., that associate dietary intakes of fruit, cereal, vegetables, and
2009; Pereira et al., 2009; Rabbani et al., 2006; Tapia et al., 2007). teas with a lower risk of several human cancers (Khan et al.,
Moreover, geraniol has been found to reduce the proliferative 2008; Patra et al., 2021). Therefore, the impressive findings of
activity of Caco-2 human colon and MCF-7 human breast cancer basic research and clinical trials are stimulating the search for
cells lines (Agnihotri et al., 2022; Zhi et al., 2021). In addition, potential cancer chemoprevention agents. This study aimed to
lemongrass ethanolic extract given orally to male Fischer 344 rats validate the impact of lemongrass (Cymbopogon citratus STAPF)
inhibited both colonic aberrant crypt foci (ACF) and hepatic essential oil mediated mitochondrial fission contributed to
glutathione S-transferase placental form (GST-P) positive induced apoptosis in human colon cancer cells.

Received 12 Aug., 2022

Accepted 13 Oct., 2022
1
Department of Biology, College of Science, Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia
*Corresponding author: [email protected]

Food Sci. Technol, Campinas, 43, e94522, 2023 1

 Anticancer effect of lemongrass against colon cancer

2 Materials and methods and incorporated Biotium (specifically 100 nM MitoView™ 405-
Blue) within a free culture. After two time-washing with PBC,
2.1 Lemongrass essential oil extraction
nuclei were stained by Hochest 33342-blue stain for 10 min.
Lemongrass leaves (Cymbopogon citratus STAPF) were Afterwards, the cells have been investigated using the inverted
collected from the local medicinal plants (Biology Department phase-contrast microscopy (developed by Carl Zeiss Microscopy,
Farm, College of Science, Princess Nourah bint Abdulrahman Germany) with 40X magnitude to view the mitochondrial
University) and deposited with a voucher specimen (496). morphology and following the methods described in previous
The essential oil was extracted from fresh lemongrass leaves report (Alkhateeb et al., 2021). All chemical agents used in the
through 3 h of boiling hydrodistillation using a Clevenger experiment were retrieved from Sigma (USA).
apparatus and as described in (Bidinotto et al., 2011). The extract
was stored at 4 °C in a dark receptacle until the moment of use as. 2.6 Measurement of glucose uptake
2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-
2.2 Cell culture D-glucose (2-NBDG) was used to treat SW1417 cells for 30 min,
Human SW1417 colon cancer cell line was bought from the after lemongrass extract-treatment for 24 h. SW1417 colon
American Type Culture Collection (ATCC, Manassas, VA, USA) cancer cells glucose uptake was assayed using flow cytometry
and kept in DMEM/Ham’s F-12 (1:1 v/v) medium enhanced (Becton-Dickinson, San Jose, CA).
with 100 mL/L FBS, 1.5 g/L sodium bicarbonate, 400 μg/mL
hydrocortisone, 10 mL/L penicillin and streptomycin (0.1 mg/mL). 2.7 Determination of (ROS)-Reactive Oxygen Species
production
2.3 Cell treatment Subcellular ROS was examined fluorometrically by estimating
From the humidified hatchery, cells seeding was additionally the of a non-fluorescent test 2,7-dichloro-fluorescein diacetate
done at 1 × 106 cells/well or 1 × 105 cells/well in 96 well tissue (DCF-DA) oxidation to a fluorescent metabolite dichlorofluorescein
culture plates separately. The extract from (Cymbopogon citratus (DCF) via mitochondrial ROS just as depicted beforehand with
STAPF) lemongrass was put on to a culture media and the cells slight adjustments (Elbekai et al., 2004). Gathered cells were
were then treated with 5 separate fluctuated concentrations 0, suspended in 500 mL of PBS and mixed in with 10 mM (last
50, 100, 150 and 200 μg/mL for 24 h. centralization) of dichloro-dihydro-fluorescein diacetate (DCFH-
DA) for 20 min at 37 °C. The cells suspension was deposited at
1200 rpm for 5 min. Therefore, the cells were washed thrice with
2.4 Cytotoxicity assay
500 mL of Phosphate-Buffered Saline (PBS)/pellet to evacuate
The extract from lemongrass (0.10 mL) were dissolved in 9.90 mL excess DCFH-DA. The ROS level was tested by flow cytometry
of DMSO to get a working concentration of 1 mg/mL. The active (Becton-Dickinson, San Jose, CA).
concentration was prepared freshly and filtered through 0.45 µ
filter before each assay. In brief, 10 mL of extract was prepared in 2.8 RNA extraction and cDNA synthesis
a concentration of 1 mg/mL. For each sample, 500 µL were poured
in ten Eppendorf tubes. The samples were syringe-filtered using All out RNA was separated utilizing Invitrogen-TRI-zol
0.45 µM filter to remove contaminants. 500 µL of the sample’s working reagent as indicated by the maker’s guidelines and evaluated by
concentration was further added to the first Eppendorf tube and estimating the absorbency at 260 nm. The quality of RNA was
mixed well. Then, 500 µL of this volume was transferred from first controlled by estimating 260/280 proportions. From that point,
to last tube by serial dilution to obtain the desired concentration of the synthesizing of the cDNA-strand was produced utilizing
the lemongrass extract. As a result, the volume remains constant, the High-Amplitude cDNA turn around interpretation pack
but there was a gradual change in concentration. The cytotoxicity (Applied Biosystems) as indicated by the maker’s directions
assessment was performed using MTT assay. (Zordoky et al., 2008).

For this assay, SW1417 cells were plated in 96-well culture 2.9 Measurement of mRNA expressions by Real-Time
plates (1 x 104 cells/well). The cells were exposed to five Polymerase Chain Reactions (RT-PCR)
concentrations of 0, 50, 100, 150 and 200 μg/mL of lemongrass
extract for 24 hours. The measurements were performed in The primers were utilized in the present examination
triplicate. The colors developed in the plates were read at 550 nm (Table 1) were bought from (Invitrogen, USA). Measure controls
by using DMSO as a blank. The percentage of cell viability was were consolidated in separated wells but onto a similar plate,
expressed using the following formula (Equation 1): to be more specific. All the samples and controls were run in
triplicates on an ABI 7500 Fast Real-time PCR. The quantitative
% Cell viability = mean absorbance of treated cells /
(1)
mean absorbance of control cells × 100 Table 1. The sequence of primers.
Gene Forward primer Reverse primer
2.5 Evaluating mitochondrial morphology HO-1 ATGGCCTCCCTGTACCACATC TGTTGCGCTCAATCTCCTCCT
Non-controlled living SW1417 cells have been cultivated for NQO1 CGCAGACCTTGTGATATTCCAG CGTTTCTTCCATCCTTCCAGG
15 minutes in the same medium that was preliminary warmed β-actin GCACCACACCTTCTACAATG TGCTTGCTGATCCACATCTG

2 Food Sci. Technol, Campinas, 43, e94522, 2023

 Alwaili

RT-PCR data was breaking down by a near edge (Ct) strategy, 3.2 Impact of lemongrass extract on mitochondrial morphology
and the overlap acceptances of treated examples were contrasted
During the study, the mitochondrial morphology (MM)
and the untreated examples. Relative quality expression (i.e.,
has been investigated utilizing the Biotium stain in relation to
ΔΔCT) strategy as earlier outlined was used to analyse the data
living SW1417 cells covering both treated and non-treated cells.
on the RT-PCR (Livak & Schmittgen, 2001). β-actin was utilized
The special effect was obtained by applying lemongrass extract
as an interior reference gene to standardize the declaration of
at five separate doses, namely (0, 50, 100, 150 and 200 μg/mL)
the selected genes.
throughout 24-hour processing. Non-treated SW1417 cells
manifested standard structure with non-affected mitochondrial
2.10 Statistical analysis conditions; however, upon adding lemongrass extract, MM was
Analytical examinations were performed by use of SigmaStat visibly modified demonstrating an elevation in the fragmentation
programming adaptation 3.5 (Systat Software, San Jose, CA, effects as well as punctiform colonial morphology. This happened
USA). Quantitative outcomes were presented as mean standard supposedly due to recorded mitochondrial damage that caused
deviations. Esteems of p being lower than 0.05 were deemed an elevation in the consistencies of lemongrass extract in the
statistically imperative. processed SW1417 cells. Technically, the top mitochondrial
damage was noticed at doses 100, 150 and 200 µg/mL (Figure 2).
3 Results
3.3 Glucose uptake inhibition
3.1 Effect of lemongrass leaves extract on SW1417 cell
proliferation During glucose metabolism, ATP production and cell
proliferation, both are significant in cell growth. Nevertheless,
To determine the ability of lemongrass leaves extract to
inhibit growth and proliferation of SW1417 colon cancer cells
were treated with steadily increasing concentrations of lemongrass
leaves extract (0, 50, 100, 150 and 200 μg/mL) for 24 h, after
which cell reasonability and expansion were determined using
MTT assay. Figure 1 exhibits that endurance of SW1417 cells
were altogether diminished after incubation with lemongrass
leaves separate in a focus subordinate way when contrasted with
untreated SW1417 cells (Figure 1), proposing that lemongrass
leaves extract is tumor cell selective. The determined IC50 for
lemongrass leaves extract is around 150 μg/mL.

Figure 2. The effect of lemongrass extract on SW1417 cells showing

Figure 1. Cytotoxicity assessment by MTT assay on SW1417 colon abnormal shape of nuclei by (Hochest 33342-blue stain) and mitochondrial
cancer cells exposed to various concentrations of lemongrass leaves fusion by (100 nM MitoView™ 405- Blue stain). A) represents untreated
extract for 24 h. Stars indicate statistically significant differences of SW1417 cells with normal structure and undamaged mitochondrial status.
cytotoxicity and cell viability assessment between the concentrations In contrast, other SW1417 cells were treated by lemongrass extract had
(0, 50, 100, 150 and 200 μg/mL). Values are put as percentages of the mitochondrial changes in shape with fragmented patterns and punctiform
control (mean ± SEM, n = 5) ***P < 0.001, **P < 0.01, *P < 0.05 in morphology when SW1417 cells treated at four different concentrations
comparison to the control (0 μg/mL). (50, 100, 150 and 200 µg/mL) as seen in B, C, D, and E respectively.

Food Sci. Technol, Campinas, 43, e94522, 2023 3

 Anticancer effect of lemongrass against colon cancer

if glucose absorption was inhibited there is a subsequent of Lemongrass essential oil (LEO) carries a significant amount
cell growth suppression. We discovered that the uptake of of numerous bioactive compounds, such as citral (mixture
glucose (2-NBDG) uptake was affected by lemongrass extract. of geranial and neral), isoneral, isogeranial, geraniol, geranyl
The glucose take-up restraint was eased by a dose-subordinate acetate, citronellal, citronellol, germacrene-D, and elemol, in
way in SW1417 cells with lemongrass extract for 24 hours as addition to other bioactive compounds. These components confer
shown in (Figure 3). various pharmacological actions to LEO, including antifungal,
antibacterial, antiviral, anticancer, and antioxidant properties
3.4 Effect of lemongrass extract on the expression of (Mukarram et al., 2022; Pan et al., 2022).
oxidative stress genes and ROS production in SW1417 cells The outcomes from the phytochemical subjective examination
To examine if lemongrass extract interceded oxidative stress, of lemongrass extract demonstrated that most of the credited
we determined the capacity of lemongrass extract to balance the bioactivty, as cancer prevention agent has been ascribed to its
declaration of oxidative pressure genes in SW1417 human colon compounds (e.g. citral and b-myrcene) have shown antioxidant and
cancer cells. Consequently, SW1417 cells were treated with same antigenotoxic/antimutagenic activities against different mutagens
convergence of lemongrass extract for 24, from that point ROS (Bidinotto et al., 2011; Rao et al., 2009; Rabbani et al., 2006).
creation and NQO1 and HO1 mRNA levels were estimated by DCF The findings showed that the treatment with lemongrass
and RT-PCR measure, respectively. Our outcomes demonstrated extract reduced the cell viability of SW1417 cells were gradually
that lemongrass extract essentially expanded the ROS creation at with increase the concentrations of lemongrass extract, especially
all concentrations with a most extreme acceptance of 3, 6, 9 and after the dose 100 μg/mL of this extract in comparison to the
10-overlays accomplished by 100, 150 and 200 μg/mL of lemongrass
control (0 μg/mL), the decrease in the number of living cells is
extract, respectively (Figure 4). While it fundamentally initiated
due to glucose uptake inhibition that affects ATP production and
HO-1 mRNA levels in SW1417 cells in a fixation subordinate way
cell proliferation, both are significant in cell growth. Nevertheless,
(Figure 5a) nonetheless; actuated HO-1 mRNA levels just at the
if glucose absorption was inhibited there is a subsequent of cell
most noteworthy concentrations tried (150 and 200 μg/mL) for 24 h.
growth suppression, apoptotic genes and oxidative stress activation,
Interestingly, increasing the concentrations of lemongrass extract
and intracellular ROS accumulation (Alkhateeb et al., 2021;
was associated with decrease the mRNA levels of NQO1 except
Manosroi et al., 2006). Moreover, significantly high ROS levels
the first concentration of lemongrass extract (50 μg/mL) which
in mitochondria can result in free radicals’ attacks on membrane
recorded significant (P < 0.05) increase in the gene expression
phospholipids that go before mitochondrial film depolarization.
of NQO1 (Figure 5b).
Mitochondrial depolarization, viewed as an irreversible advance in
apoptosis (Manosroi et al., 2006). The improvement of ROS creation
4 Discussion prompted expanded apoptosis occasions (Figure 2). Provided that
The prominent cultivation of lemongrass (Cymbopogon spp.) mitochondrial morphology influences imbalances in energy and is
relies on the pharmacological incentives of its essential oil. ceaselessly changed via fission and fusion events, tight coordination

Figure 3. Restraint of glucose take-up was measured by flow cytometry Figure 4. ROS creation in SW1417 cells was treated for 24 h with different
on SW1417 colon cancer cells that were treated by four concentrations of groupings of lemongrass leaves extract (0, 50, 150, and 250 μg/mL)
lemongrass leaves extract for 24 h. Stars indicate statistically significant for 24 h. DCF arrangement was estimated fluorometrically utilizing
differences of the values based on the concentrations (0, 50, 100, 150 and excitation/outflow frequencies of 484/535 nm. Values were introduced
200 μg/mL). Values were recorded as mean ± SEM, (n = 5) ***P < 0.001, as means ± SEM, (n = 10). ***P < 0.001, **P < 0.01, *P < 0.05 contrasted
**P < 0.01, *P < 0.05 contrasted with control (0 μg/mL). with control (0 μg/mL).

4 Food Sci. Technol, Campinas, 43, e94522, 2023

 Alwaili

Figure 5. Effect of lemongrass leaves extract on oxidative pressure genes HO-1 (a) and NQO1 (b) mRNA levels in SW1417 cells treated for 24 h
with different concentrations of lemongrass leaves extract (0, 50, 100, 150, and 200 μg/mL). From there on, the mRNA levels of HO-1 and NQO1
were measured utilizing RT-PCR and standardized to β-actin housekeeping gene. Data were recorded as means ± SEM (n = 5) of three free
investigations. ***P < 0.001, **P < 0.01, *P < 0.05 contrasted to untreated cells (0 μg/mL).

betwixt inter-organelle interactions and mitochondrial dynamics leaves extract (0, 50, 100, 150, and 200 μg/ mL) and recorded
is vital. Mitochondrial splitting outcomes in a disabled insulin- significant increase at only the first concentration of lemongrass
subordinate glucose take-up (Hsu et al., 2015). Apoptosis is a extract (50 μg/mL) followed by nonsignificant and gradually
firmly controlled procedure heavily influenced by a few flagging decrease in the gene expression at (100, 150 and 200 μg/mL)
pathways, for example, mitochondrial pathways and caspases with increasing the concentrations, these data indicated that
(Bonora et al., 2021). Apoptosis induction with ROS generation the higher concentrations of lemongrass extract returned the
by malignant growth chemoprotective agents, for example, levels of NQO1 gene expression to the normal lower levels.
doxorubicin (Elbekai et al., 2004), incites disease cell passing as Yang et al. (2022) reported that the analysis of NQO1 mRNA
well as purposes DNA harm and genomic insecurity (George et al., gene expression indicated 50-fold higher levels in untreated
2021; Elbekai et al., 2004; Zordoky et al., 2008). Nevertheless, a large liver tumors and in the tissue surrounding the tumors of
portion of these malignant growth chemoprotective treatments patients with hepatocarcinoma than in normal individuals
are cytotoxic and their utilization is related to toxicities. Thus, the (Yang et al., 2022). Also, previous studies presented that
generation of new chemopreventive specialists ready to repress NQO1 gene expression is elevated in some human cancers
cell expansion and actuate apoptosis in malignant growth cells such as breast, colon, and lung and colorectal cancer before
however with less or no reactions is significant and foreseen. applying the treatment (Licznerska et al., 2021; Mizumoto et al.,
Along these lines, to display the in vivo circumstance, human 2019; Preethi et al., 2022; Yadav et al., 2018; Yang et al., 2022).
colon malignancy SW1417 cell lines were utilized in the present
examination to anticipate human reactions to lemongrass extract 5 Conclusion
by researching the limit of this extract to hinder SW1417 cells The findings of the present study indicate that lemongrass
development and expansion and investigate the job of apoptosis extract showed a potential anticarcinogenic activity (i.e. suppressing
in lemongrass extract extricate—interceded impact. These data effect) in vitro using human colon cancer cell line (SW1417) by
are consistent with a recent study that applied the lemongrass inducing mitochondrial fission, ROS production, and apoptosis
extract to APCmin/+ transgenic mice and led to the reduction of in addition to glucose uptake inhibition. However, these results
intestinal tumors using oral administration lemongrass extract require further testing to identify whether or not these findings
(Ruvinov et al., 2019), this study showed that the lemongrass will be happened in healthy cell lines and further investigations
extract was well tolerated and effective at inhibiting colon cancer for its potential contributions as a cancer treatment for other
xenograft growth in mice. The effect of lemongrass leaves extract types of cancer, prevention, and prevention of relapse.
on oxidative pressure gene HO-1 mRNA level in SW1417 cells
were treated for 24 h with different concentrations (0, 50, 100,
150, and 200 μg/mL), showed significant increase with increasing
Ethical approval
the concentrations which consistent with the data reported in Not applicable.
(Alkhateeb et al., 2021).
Furthermore, NQO1 mRNA levels in SW1417 cells Conflict of interest
treated for 24h with different concentrations of lemongrass The author declares that there is no conflict of interest.

Food Sci. Technol, Campinas, 43, e94522, 2023 5

 Anticancer effect of lemongrass against colon cancer

Availability of data and material Duarte, M. C. T., Leme, E. E., Delarmelina, C., Soares, A. A., Figueira, G.
M., & Sartoratto, A. (2007). Activity of essential oils from Brazilian
The datasets used and/or analysed during the current study medicinal plants on Escherichia coli. Journal of Ethnopharmacology,
are available from the corresponding author on reasonable request. 111(2), 197-201. http://dx.doi.org/10.1016/j.jep.2006.11.034.
PMid:17210236.
Funding Elbekai, R. H., Korashy, H. M., Wills, K., Gharavi, N., & El-Kadi, A. O.
Princess Nourah bint Abdulrahman University Researchers (2004). Benzo [a] Pyrene, 3-Methylcholanthrene and ß-Naphthoflavone
induce oxidative stress in Hepatoma Hepa 1c1c7 cells by an AHR-
Supporting Project number (PNURSP2022R227), Princess
dependent pathway. Free Radical Research, 38(11), 1191-1200. http://
Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. dx.doi.org/10.1080/10715760400017319. PMid:15621696.
Faheem, F., Liu, Z. W., Rabail, R., Haq, I. U., Gul, M., Bryła, M., Roszko,
Author contributions M., Kieliszek, M., Din, A., & Aadil, R. M. (2022). Uncovering the
MAA: Conceptualization, Methodology, Software, Formal industrial potentials of lemongrass essential oil as a food preservative:
analysis, Writing - Original Draft, Review & Editing. a review. Antioxidants, 11(4), 720. http://dx.doi.org/10.3390/
antiox11040720. PMid:35453405.
Flora, S., & Ferguson, L. R. (2005). Overview of mechanisms of cancer
Acknowledgements chemopreventive agents. Mutation Research. Fundamental and
Princess Nourah bint Abdulrahman University Researchers Molecular Mechanisms of Mutagenesis, 591(1-2), 8-15. http://dx.doi.
org/10.1016/j.mrfmmm.2005.02.029. PMid:16107270.
Supporting Project number (PNURSP2022R227), Pricess Nourah
bint Abdulrahman University, Riyadh, Saudi Arabia. Ganjewala, D., & Luthra, R. (2010). Essential oil biosynthesis and
regulation in the genus Cymbopogon. Natural Product Communications,
5(1), 163-172. http://dx.doi.org/10.1177/1934578X1000500137.
References PMid:20184044.
Aboagye, G., Tuah, B., Bansah, E., Tettey, C., & Hunkpe, G. (2021). George, B. P., Chandran, R., & Abrahamse, H. (2021). Role of phytochemicals
Comparative evaluation of antioxidant properties of lemongrass in cancer chemoprevention: insights. Antioxidants, 10(9), 1455.
and other tea brands. Scientific African, 11, e00718. http://dx.doi. http://dx.doi.org/10.3390/antiox10091455. PMid:34573087.
org/10.1016/j.sciaf.2021.e00718. Hsu, W. H., Lee, B. H., & Pan, T. M. (2015). Leptin-induced mitochondrial
Aggarwal, B. B., & Shishodia, S. (2006). Molecular targets of dietary agents fusion mediates hepatic lipid accumulation. International Journal of
for prevention and therapy of cancer. Biochemical Pharmacology, Obesity, 39(12), 1750-1756. http://dx.doi.org/10.1038/ijo.2015.120.
71(10), 1397-1421. http://dx.doi.org/10.1016/j.bcp.2006.02.009. PMid:26119995.
PMid:16563357. Irkin, R., & Korukluoglu, M. (2009). Effectiveness of Cymbopogon
Agnihotri, S., Dobhal, P., Ashfaqullah, S., Chauhan, H. K., & Tamta, S. citratus L. essential oil to inhibit the growth of some filamentous
(2022). Review of the botany, traditional uses, pharmacology, threats fungi and yeasts. Journal of Medicinal Food, 12(1), 193-197. http://
and conservation of Zanthoxylum armatum (Rutaceae). South dx.doi.org/10.1089/jmf.2008.0108. PMid:19298215.
African Journal of Botany, 150, 920-927. http://dx.doi.org/10.1016/j. Khan, N., Afaq, F., & Mukhtar, H. (2008). Cancer chemoprevention
sajb.2022.08.038. through dietary antioxidants: progress and promise. Antioxidants
Alkhateeb, M. A., Al-Otaibi, W. R., AlGabbani, Q., Alsakran, A. A., & Redox Signalling, 10(3), 475-510. http://dx.doi.org/10.1089/
Alnafjan, A. A., Alotaibi, A. M., & Al-Qahtani, W. S. (2021). Low- ars.2007.1740. PMid:18154485.
temperature extracts of purple blossoms of basil (Ocimum basilicum Licznerska, B., Szaefer, H., & Krajka-Kuźniak, V. (2021). R-sulforaphane
L.) intervened mitochondrial translocation contributes prompted modulates the expression profile of AhR, ERα, Nrf2, NQO1, and
apoptosis in human breast cancer cells. Biological Research, 54(1), GSTP in human breast cell lines. Molecular and Cellular Biochemistry,
2. http://dx.doi.org/10.1186/s40659-020-00324-0. PMid:33407904. 476(2), 525-533. http://dx.doi.org/10.1007/s11010-020-03913-5.
Bidinotto, L. T., Costa, C. A., Salvadori, D. M., Costa, M., Rodrigues, PMid:33064289.
M. A., & Barbisan, L. F. (2011). Protective effects of lemongrass Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression
(Cymbopogon citratus STAPF) essential oil on DNA damage and data using real-time quantitative PCR and the 2− ΔΔCT method.
carcinogenesis in female Balb/C mice. Journal of Applied Toxicology, Methods, 25(4), 402-408. http://dx.doi.org/10.1006/meth.2001.1262.
31(6), 536-544. http://dx.doi.org/10.1002/jat.1593. PMid:21089157. PMid:11846609.
Blanco, M. M., Costa, C. A. R. A., Freire, A. O., Santos, J. G. Jr., & Costa, Malik, S., Kaur, K., Prasad, S., Jha, N. K., & Kumar, V. (2022). A perspective
M. (2009). Neurobehavioral effect of essential oil of Cymbopogon review on medicinal plant resources for their antimutagenic potentials.
citratus in mice. Phytomedicine, 16(2-3), 265-270. http://dx.doi. Environmental Science and Pollution Research International, 29(41),
org/10.1016/j.phymed.2007.04.007. PMid:17561386. 62014-62029. http://dx.doi.org/10.1007/s11356-021-16057-w.
Bonora, M., Missiroli, S., Perrone, M., Fiorica, F., Pinton, P., & Giorgi, PMid:34431051.
C. (2021). Mitochondrial control of genomic instability in cancer. Manosroi, J., Dhumtanom, P., & Manosroi, A. (2006). Anti-proliferative
Cancers, 13(8), 1914. http://dx.doi.org/10.3390/cancers13081914. activity of essential oil extracted from Thai medicinal plants on KB
PMid:33921106. and P388 cell lines. Cancer Letters, 235(1), 114-120. http://dx.doi.
Cheel, J., Theoduloz, C., Rodríguez, J., & Schmeda-Hirschmann, G. org/10.1016/j.canlet.2005.04.021. PMid:15979235.
(2005). Free radical scavengers and antioxidants from lemongrass Mitić-Ćulafić, D., Žegura, B., Nikolić, B., Vuković-Gačić, B., Knežević-
(Cymbopogon citratus (DC.) Stapf.). Journal of Agricultural and Food Vukčević, J., & Filipič, M. (2009). Protective effect of linalool,
Chemistry, 53(7), 2511-2517. http://dx.doi.org/10.1021/jf0479766. myrcene and eucalyptol against t-butyl hydroperoxide induced
PMid:15796587. genotoxicity in bacteria and cultured human cells. Food and

6 Food Sci. Technol, Campinas, 43, e94522, 2023

 Alwaili

Chemical Toxicology, 47(1), 260-266. http://dx.doi.org/10.1016/j. chloride in mouse micronucleus test system. Pakistan Journal of
fct.2008.11.015. PMid:19049815. Pharmaceutical Sciences, 19(2), 108-113. PMid:16751120.
Mizumoto, A., Ohashi, S., Kamada, M., Saito, T., Nakai, Y., Baba, K., Rao, B. S. S., Shanbhoge, R., Rao, B. N., Adiga, S. K., Upadhya, D., Aithal,
Hirohashi, K., Mitani, Y., Kikuchi, O., Matsubara, J., Yamada, A., B. K., & Kumar, M. R. S. (2009). Preventive efficacy of hydroalcoholic
Takahashi, T., Lee, H., Okuno, Y., Kanai, M., & Muto, M. (2019). extract of Cymbopogon citratus against radiation-induced DNA
Combination treatment with highly bioavailable curcumin and damage on V79 cells and free radical scavenging ability against
NQO1 inhibitor exhibits potent antitumor effects on esophageal radicals generated in vitro. Human and Experimental Toxicology,
squamous cell carcinoma. Journal of Gastroenterology, 54(8), 687- 28(4), 195-202. http://dx.doi.org/10.1177/0960327109104822.
698. http://dx.doi.org/10.1007/s00535-019-01549-x. PMid:30737573. PMid:19734270.
Mukarram, M., Choudhary, S., Khan, M. A., Poltronieri, P., Khan, M., Ruvinov, I., Nguyen, C., Scaria, B., Vegh, C., Zaitoon, O., Baskaran, K.,
Ali, J., Kurjak, D., & Shahid, M. (2022). Lemongrass essential oil Mehaidli, A., Nunes, M., & Pandey, S. (2019). Lemongrass extract
components with antimicrobial and anticancer activities. Antioxidants, possesses potent anticancer activity against human colon cancers,
11(1), 20. http://dx.doi.org/10.3390/antiox11010020. PMid:35052524. inhibits tumorigenesis, enhances efficacy of FOLFOX, and reduces its
Negrelle, R. R. B., & Gomes, E. C. (2007). Cymbopogon citratus (DC.) adverse effects. Integrative Cancer Therapies, 18, 1534735419889150.
Stapf: chemical composition and biological activities. Revista http://dx.doi.org/10.1177/1534735419889150. PMid:31845598.
Brasileira de Plantas Medicinais, 9(1), 80-92. Retrieved from https:// Santoro, G. F., Cardoso, M. G., Guimarães, L. G. L., Freire, J. M., &
api.semanticscholar.org/CorpusID:56066104 Soares, M. J. (2007). Anti-proliferative effect of the essential oil
Nomier, Y., Asaad, G. F., Alshahrani, S., Safhi, S., Medrba, L., Alharthi, of Cymbopogon citratus (DC) Stapf (lemongrass) on intracellular
N., Rehman, Z., Alhazmi, H., & Sanobar, S. (2021). Antidepressant amastigotes, bloodstream trypomastigotes and culture epimastigotes
and anxiolytic profiles of Cymbopogon Flexuosus ethanolic extract of Trypanosoma cruzi (Protozoa: Kinetoplastida). Parasitology, 134(Pt
in chronic unpredictable mild stress induced in rats. Biomedical & 11), 1649-1656. http://dx.doi.org/10.1017/S0031182007002958.
Pharmacology Journal, 14(1), 175-185. http://dx.doi.org/10.13005/ PMid:17686189.
bpj/2112. Silva, C. B., Guterres, S. S., Weisheimer, V., & Schapoval, E. E. S. (2008).
Okada, F., Izutsu, R., Goto, K., & Osaki, M. (2021). Inflammation-related Antifungal activity of the lemongrass oil and citral against Candida
carcinogenesis: lessons from animal models to clinical aspects. spp. The Brazilian Journal of Infectious Diseases, 12(1), 63-66. http://
Cancers, 13(4), 921. http://dx.doi.org/10.3390/cancers13040921. dx.doi.org/10.1590/S1413-86702008000100014. PMid:18553017.
PMid:33671768. Silva, M. R., Ximenes, R. M., Costa, J. G. M., Leal, L. K. A. M., Lopes, A.
Oliveira, V. C., Moura, D. M., Lopes, J. A., Andrade, P. P., Silva, N. H., & A., & Viana, G. S. B. (2010). Comparative anticonvulsant activities of
Figueiredo, R. C. (2009). Effects of essential oils from Cymbopogon the essential oils (EOs) from Cymbopogon winterianus Jowitt and
citratus (DC) Stapf., Lippia sidoides Cham., and Ocimum gratissimum Cymbopogon citratus (DC) Stapf. in mice. Naunyn-Schmiedeberg’s
L. on growth and ultrastructure of Leishmania chagasi promastigotes. Archives of Pharmacology, 381(5), 415-426. http://dx.doi.org/10.1007/
Parasitology Research, 104(5), 1053-1059. http://dx.doi.org/10.1007/ s00210-010-0494-9. PMid:20237771.
s00436-008-1288-6. PMid:19085009. Tapia, A., Cheel, J., Theoduloz, C., Rodríguez, J., Schmeda-Hirschmann,
Pan, D., Machado, L., Bica, C. G., Machado, A. K., Steffani, J. A., & G., Gerth, A., Wilken, D., Jordan, M., Jiménez-González, E., Gomez-
Cadoná, F. C. (2022). In vitro evaluation of antioxidant and anticancer Kosky, R., & Mendoza, E. Q. (2007). Free radical scavengers from
activity of lemongrass (Cymbopogon citratus (DC) Stapf). Nutrition Cymbopogon citratus (DC.) stapf plants cultivated in bioreactors
and Cancer, 74(4), 1474-1488. http://dx.doi.org/10.1080/01635581 by the temporary immersion (TIS) principle. Zeitschrift für
.2021.1952456. PMid:34282694. Naturforschung C, 62(5-6), 447-457. http://dx.doi.org/10.1515/
Patra, S., Pradhan, B., Nayak, R., Behera, C., Das, S., Patra, S. K., znc-2007-5-620. PMid:17708453.
Efferth, T., Jena, M., & Bhutia, S. K. (2021). Dietary polyphenols in Yadav, U., Kumar, P., & Rai, V. (2018). NQO1 gene C609T polymorphism
chemoprevention and synergistic effect in cancer: clinical evidences (dbSNP: rs1800566) and digestive tract cancer risk: a meta-analysis.
and molecular mechanisms of action. Phytomedicine, 90, 153554. Nutrition and Cancer, 70(4), 557-568. http://dx.doi.org/10.1080/01
http://dx.doi.org/10.1016/j.phymed.2021.153554. PMid:34371479. 635581.2018.1460674. PMid:29652514.
Pereira, R. P., Fachinetto, R., Prestes, A. S., Puntel, R. L., Silva, G. N. S., Yang, X., Duan, J., & Wu, L. (2022). Research advances in NQO1-
Heinzmann, B. M., Boschetti, T. K., Athayde, M. L., Bürger, M. E., responsive prodrugs and nanocarriers for cancer treatment. Future
Morel, A. F., Morsch, V. M., & Rocha, J. B. T. (2009). Antioxidant Medicinal Chemistry, 14(5), 363-383. http://dx.doi.org/10.4155/
effects of different extracts from Melissa officinalis, Matricaria recutita fmc-2021-0289. PMid:35102756.
and Cymbopogon citratus. Neurochemical Research, 34(5), 973-983. Zhi, H., Cui, J., Yang, H., Zhang, Y., & Zhu, M. (2021). Research progress
http://dx.doi.org/10.1007/s11064-008-9861-z. PMid:18853256. of geraniol in tumor therapy. Proceedings of Anticancer Research,
Preethi, S., Arthiga, K., Patil, A. B., Spandana, A., & Jain, V. (2022). 5(1), 26-30. http://dx.doi.org/10.26689/par.v5i1.1882.
Review on NAD (P) H dehydrogenase quinone 1 (NQO1) pathway. Zordoky, B. N., Aboutabl, M. E., & El-Kadi, A. O. (2008). Modulation of
Molecular Biology Reports, 49(9), 8907-8924. http://dx.doi.org/10.1007/ cytochrome P450 gene expression and arachidonic acid metabolism
s11033-022-07369-2. PMid:35347544. during isoproterenol-induced cardiac hypertrophy in rats. Drug
Rabbani, S. I., Devi, K., Khanam, S., & Zahra, N. (2006). Citral, a Metabolism and Disposition: the Biological Fate of Chemicals, 36(11),
component of lemongrass oil inhibits the clastogenic effect of nickel 2277-2286. http://dx.doi.org/10.1124/dmd.108.023077. PMid:18725507.

Food Sci. Technol, Campinas, 43, e94522, 2023 7