Biology WA ATAR Units 3 & 4 Student Book With 1 X 26 Month NelsonNetBook Access Code

nehs xaM/segamI ytteG
Biology WA ATAR Units 3&4 © 2020 Cengage Learning Australia Pty Limited
1st Edition
Mya Skirving Copyright Notice

ISBN 9780170452922 This Work is copyright. No part of this Work may be reproduced, stored in a
The publisher would also like to acknowledge the original contributions from retrieval system, or transmitted in any form or by any means without prior
the following authors: written permission of the Publisher. Except as permitted under the
Pam Borger, Tony Chiovitti, Jacinta Duncan, Wayne Gerdtz, Patrick-Jean Guay, Copyright Act 1968, for example any fair dealing for the purposes of private study,
Genevieve Martin, Katrina Walker, Jim Woolnough, Jane Wright
research, criticism or review, subject to certain limitations. These limitations
include: Restricting the copying to a maximum of one chapter or 10% of this
Publishers: Teresa Attley and Kirstie Irwin book, whichever is greater; providing an appropriate notice and warning with the
copies of the Work disseminated; taking all reasonable steps to limit access to
Editors: Jeanette Birtles, Organic Editing, John Birtles, Birtles Tech Editing
these copies to people authorised to receive these copies; ensuring you hold the
Proofreader: Jane Fitzpatrick
appropriate Licences issued by the Copyright Agency Limited (“CAL”), supply a
Indexer: Max McMaster
remuneration notice to CAL and pay any required fees. For details of CAL licences
Text design: Alba Design
Cover design: Watershed Art & Design and remuneration notices please contact CAL at Level 11, 66 Goulburn Street,
Sydney NSW 2000, Tel: (02) 9394 7600, Fax: (02) 9394 7601
Project designer: Justin Lim
Email: [email protected]
Permissions researcher: Helen Mammides
Website: www.copyright.com.au
Production controller: Karen Young
Typesetter: SPi Global
For product information and technology assistance,
in Australia call 1300 790 853 ;
Any URLs contained in this publication were checked for currency during the
in New Zealand call 0800 449 725
production process. Note, however, that the publisher cannot vouch for the
ongoing currency of URLs.
For permission to use material from this text or product, please email
[email protected]
National Library of Australia Cataloguing-in-Publication Data
A catalogue record for this work is available from the National Library of
Australia.
Cengage Learning Australia

Level 7, 80 Dorcas Street
South Melbourne, Victoria Australia 3205
Cengage Learning New Zealand

Unit 4B Rosedale Office Park
331 Rosedale Road, Albany, North Shore 0632, NZ
For learning solutions, visit cengage.com.au
Printed in Singapore by 1010 Printing International Limited.

1 2 3 4 5 6 7 24 23 22 21 20
iii
CONTENTS
Foreword by Lyn Beazley vi Activity and investigation 77
Author and reviewer team vi Chapter summary 80
Acknowledgements vii Chapter glossary 80
Using Biology WA ATAR vii Chapter review questions 83
Practice exam questions 84
UNIT 3 4 VARIATION AND MUTATION 85

CONTINUITY OF SPECIES x 4.1 The phenotypic expression of genes 86
4.2 Environmental factors 88

1 SCIENCE INQUIRY SKILLS 1
4.3 Mutations cause variation 91
1.1 Investigations 2
4.4 Causes of mutations: errors in DNA
1.2 The scientific method 2 replication and cell division 93
1.3 Communicating your results 15 4.5 Causes of mutations: mutagens 95
Chapter summary 18 4.6 Types of mutations 97
Chapter glossary 18 4.7 Sexual reproduction increases

variation 107
Chapter review questions 20
Investigation 111
Chapter summary 114
2 PROCESSES FOR THE CONTINUITY Chapter glossary 114
OF LIFE 25
2.1 The continuity of life 26 Practice exam questions 121
2.2 Cell division 31
5 GENETICS 123
2.3 Fertilisation 43
Activity 45 5.1 Genetics introduction 124
Chapter summary 47 5.2 Genetics today 129
Chapter glossary 47 5.3 The test cross 134
Chapter review questions 50 5.4 Multiple alleles for one gene 137
Practice exam questions 51 5.5 The dihybrid cross 138
5.6 Polygenic inheritance 146

3 DNA STRUCTURE AND FUNCTION 52 5.7 Dominance inheritance patterns 148
3.1 The discovery of DNA 53 5.8 Modes of inheritance 152
3.2 Structural properties of the DNA molecule 56 Activity and investigation 159
3.3 DNA structure enables DNA replication 60 Chapter summary 162
3.4 Coding and non-coding DNA 63 Chapter glossary 162
3.5 Protein synthesis 65 Chapter review questions 164
3.6 Proteins 74 Practice exam questions 166
9780170452922
iv
6 BIOTECHNOLOGY – ITS TOOLS AND 8.4 Evidence for the theory of evolution:
TECHNIQUES 168 the fossil record 262
8.5 Evidence for the theory of evolution:

6.1 Introduction to biotechnology 169
comparative embryology and anatomy 269
6.2 DNA tools used in biotechnology 170
8.6 Types of evolution: divergent versus
6.3 DNA techniques and vocabulary 174
convergent 276
6.4 DNA sequencing 186
Activity and investigations 280
6.5 DNA profiling 193
Chapter summary 285
6.6 Recombinant DNA technology and
Chapter glossary 285
transgenic organisms 195
Activity and investigations 199
Chapter summary 207
Chapter glossary 207 9 MECHANISMS OF EVOLUTION AND

Chapter review questions 210 SPECIATION 292
Practice exam questions 213 9.1 Evolution and its mechanisms 293
9.2 A mechanism for evolution: mutation 293
7 BIOTECHNOLOGY IN AGRICULTURE 9.3 A mechanism for evolution:

AND ENVIRONMENTAL CONSERVATION 215 natural selection 296
9.4 A mechanism for evolution:

7.1 DNA identification technologies
genetic drift 305
in agriculture 216
9.5 A mechanism for evolution: gene flow 307
7.2 Recombinant DNA technology
in agriculture 218 9.6 The bigger picture of evolution 309
7.3 DNA technologies 9.7 Speciation 310

in environmental conservation 224
9.8 Extinction of species 316
7.4 Ethical issues associated with
Investigation 321
transgenic organisms 232
Chapter summary 324
7.5 Emerging technologies 237
Activity 240
Chapter summary 242
Practice exam questions 245 UNIT 4

SURVIVING IN A CHANGING
8 EVIDENCE FOR THE THEORY ENVIRONMENT 330
OF EVOLUTION 247
10 HOMEOSTASIS AND
8.1 Living things change and diversify 248
THERMOREGULATION 331
8.2 Life has changed and diversified over
time 250 10.1 Homeostasis 332
8.3 Evidence for the theory of evolution: 10.2 Negative feedback: the mechanism
comparative genomics 254 for maintaining homeostasis 338
9780170452922
v
10.3 Tolerance limits 341 Chapter summary 425
10.4 Thermoregulation 349 Chapter glossary 425
10.5 Adaptations for thermoregulation 351 Chapter review questions 427
Activity 364 Practice exam questions 429
Chapter summary 365

13 SPREAD OF PATHOGENS 430
Chapter review questions 369 13.1 The life cycle of a pathogen 431
Practice exam questions 370 13.2 Modes of transmission 432
13.3 Pathogen life cycles for some

11 REGULATION OF WATER, significant diseases 435
SALTS AND GASES 372 13.4 Factors that affect the spread of a disease 450
11.1 Water: essential to life 373 Investigation 459
11.2 Nitrogenous wastes 375 Chapter summary 462
11.3 Kidneys maintain water balance 377 Chapter glossary 464
11.4 Adaptations for water balance 379 Chapter review questions 467
11.5 Water transport in plants 385 Practice exam questions 468
11.6 Specialist plant adaptations for

regulation of water, salts and gases 389 14 PATHOGEN MANAGEMENT STRATEGIES 469
Investigation 397 14.1 Why do we need pathogen
Chapter summary 400 management strategies? 470
Chapter glossary 400 14.2 Strategies that control the

spread of pathogens 472
14.3 Monitoring disease activity 495
Activities and investigations 499
12 INFECTIOUS DISEASES 406 Chapter summary 505

12.1 What is an infectious disease? 407
12.2 Non-cellular pathogens 410
12.3 Cellular pathogens 413
Activity and investigations 423 Index 510
9780170452922
vi
FOREWORD BY LYN BEAZLEY

I am delighted and honoured to provide a preamble for this very special book.
I have been inspired by biology since my youngest days back in England,
spurred on by a school visit to Charles Darwin’s house and a chance to look
through his microscope. I was then off to Oxford and Edinburgh to study
biology, but it was only when I moved to Western Australia that I realised just
how extraordinary the life forms on our planet truly are.
I came from a part of the world that has around 1500 species of flowering
plants. Western Australia, a world-recognised biodiversity hotspot, has many
times that number, spanning diminutive subterranean orchids to among the
tallest trees in the world. Then there are our amazing land animals – aestivating
frogs, marsupial moles, echidnas, honey possums (feeding exclusively on pollen
and nectar), numbats and kangaroos. The creatures on our coasts and in our
oceans range from elegant sea dragons and fairy penguins to mysterious whale
sharks, the largest fish in the world.
Our amazing biodiversity exists across a vast land mass that varies from
tropical to temperate, and is very occasionally icy. It has both lush forests and
deserts, and is framed by reef-fringed coasts and deep oceans. Australia has
been shaped in isolation over millions of years as it drifted north from the
supercontinent Gondwanaland. It has been less impacted by the disruptive effects of glaciation and volcanic activity
than many parts of our planet. Yet now we are witnessing the impact of climate change within a human lifetime.
I can think of no better way to introduce biology to our school students than through a book such as this,
based on Western Australian examples of animals and plants with which they have grown up.
I hope the next generation of our students enjoy and benefit from this book, learn from it and are inspired,
so they in turn can play a part in ensuring this most precious part of planet Earth is protected and can sustain
generations to come.
Lyn Beazley AO, FAA, FTSE
AUTHOR AND REVIEWER TEAM

Author
Mya Skirving
During Mya Skirving’s teaching career, she has completed a Master of
Science Education degree and been appointed as Science Curriculum
Coordinator, WACE and HSC Biology Marker (over a 12-year period),
Level 3 Classroom Teacher, and 2iC in the science department of an academic
selective school. Several of her students have been awarded a WACE Subject
Exhibition. She enjoys providing useful resources for other teachers as well
as students, and worked for a number of years with university students as a
Teacher Advocate. Her love of the biological world, coupled with her love of
education, inspired her to write this set of textbooks and NelsonNet material
to fill the need for a biology resource with a particularly Western Australian
flavour.
9780170452922
vii
Reviewer
Jane Brandenburg
Jane fills a number of roles at a top-ranked Western Australian school, including Learning Coordinator, Creativity
Activity Service Coordinator and Year Coordinator. She is also a teacher of Years 11 and 12 Biology and Human
Biology, and of Science and Mathematics, including the International Baccalaureate Middle Years Programme.
Consultant
Helen Lydon
Helen Lydon is an advocate for the study of biology in Western Australia, where she has taught and examined Biology
and other Sciences for over twenty years in both private and public schools, and chaired advisory committees for the
School Curriculum and Standards Authority. She is delighted to collaborate with Mya on this outstanding new text.
AUTHOR’S ACKNOWLEDGEMENTS
I am sincerely appreciative of my very supportive and reassuring husband (David), our three kids (Saasha, Sophie
and Justin) and our dog (Leo). Their random acts of kindness (cooking and coffees, Reabold Hill and riding), endless
patience waiting for me to finish writing the various sections, and hugs eased any stress and made this experience
achievable and enjoyable. Thank you – you all bring sunshine into my life.
The students, colleagues and scientists I have worked with, past and present, have all taught and inspired me,
especially Ant, who had faith in my ability.
I am in awe of the beauty and resilience of our natural biological world. Nothing humans have created even comes
close. I hope this book plays a part in preserving it, and I hope it will inspire passionate science students to solve big
biological problems, such as infectious disease control, wise biotechnology advancement, and ecosystem rejuvenation.
Special thanks go to the following scientists, who even when busy made time for me, vastly improving the
integrity of the material presented here: Lyn Beazley, extraordinary former chief scientist of WA and inspiration for
many of us; Pauline Charman, former Education Outreach Manager, Harry Perkins Institute of Medical Research, a
science educator with a unique skill set and knowledge in the area of biotechnology; Stephen D Hopper AC, Professor
of Biodiversity, Centre of Excellence in Natural Resource Management, School of Agriculture & Environment, UWA;
Professor John S Mackenzie, Emeritus Professor, Curtin University, Co-initiator and Vice-chair of One Health, world
expert in Ross River virus and Australian bat lyssavirus, and Consultant for the WA Biosecurity Council and WHO
(Steering Committee of the Global Outbreak Alert and Response Network); Dr Peter Mawson, Perth Zoo Science
Program Leader, Department of Biodiversity, Conservation and Attractions, Western Australian Government; and
Samantha Setterfield, Associate Professor, School of Biological Sciences, University of Western Australia.
The support of the Harry Perkins Institute (a medical research facility in Perth, WA, and an educational outreach
program for high school students) and Plant Energy Biology (PEB), who have so many innovative and collaborative
projects happening around the globe) has been greatly appreciated.
Lastly, thank you to Jeanette Birtles and John Birtles (editors), Jane Fitzpatrick (proofreader), Helen Lydon
(consultant) and Jane Brandenburg (reviewer). Their queries and advice have helped shape the book into a clearer and
more up-to-date and reliable resource.
USING BIOLOGY WA ATAR

This new Biology WA ATAR (Units 1–4) series has been created and designed to fully meet the requirements of the
Government of Western Australia, School Curriculum and Standards Authority (SCSA) Syllabus (2017). The series uses
an enquiry-based approach to enhance and deepen learners’ conceptual understanding and their ability to apply
their knowledge. This educational package provides the resources necessary to address the Science Understanding
concepts and Science as a Human Endeavour applications and Science Inquiry Skills described in the syllabus. The
content is clearly illustrated, structured and presented, making it accessible to students of all levels so they can
achieve maximum understanding and academic success.
9780170452922
viii
Each page has been carefully planned so as to include all the information needed without appearing cluttered or
overwhelming. Navigating through each chapter is easy. Activities and/or practical investigations have been included
for each chapter, connecting the conceptual and the practical aspects of biology. Below is a list of the features to be
found in each chapter so that students can navigate and fully utilise this resource.
Each chapter begins with a chapter opening page

1
UNIT 3
SCIENCE INQUIRY
including starter questions and the learning
CONTINUITY
outcomes from the SCSA Biology ATAR Syllabus
CHAPTER 1 CONTENT
SKILLS By the end of this chapter, you will be able to use the following
OF SPECIES
science inquiry skills.
that will be covered in the chapter. This gives

SCIENCE INQUIRY SKILLS
» identify, research and construct questions for investigation;
propose hypotheses; and predict possible outcomes
» design investigations, including the procedure(s) to be
followed, the materials required, and the type and amount of
students the opportunity to monitor their own

primary and/or secondary data to be collected; conduct risk
assessments; and consider research ethics, including animal
ethics
» conduct investigations, including the use of probabilities
to predict inheritance patterns, real or virtual gel
progress and learning.

electrophoresis, and population simulations to predict
population changes, safely, competently and methodically
for the collection of valid and reliable data
» represent data in meaningful and useful ways, including the
use of mean, median, range and probability; organise and
analyse data to identify trends, patterns and relationships;
discuss the ways in which measurement error, instrumental
accuracy, the nature of the procedure and the sample size
may influence uncertainty and limitations in data; and select,
synthesise and use evidence to make and justify conclusions
» interpret a range of scientific and media texts, and evaluate
models, processes, claims and conclusions by considering
the quality of available evidence, and use reasoning to
construct scientific arguments
ORPEICS - yrarbiL otohP ecneicS/segamI ytteG
» communicate to specific audiences and for specific purposes

using appropriate language, nomenclature, genres and
modes, including scientific reports
ATA R B i o l o g y S y l l a b u s , G o v e r n m e n t o f We s t e r n A u s t r a l i a ,
School Curriculum and Standards Authority
9780170452922 9780170452922
Important ideas, 374 UNIT 4 | BIOLOGY WA ATAR UNITS 3 & 4
Key concept Question set 11.1

375
Question sets
concepts and theories Osmoregulation refers to the gain and loss of water and the concentration of solutes. Osmosis is the
passive movement of water across a membrane. Solutions can be isotonic (of equal concentration,
water movement is equal or net zero), hypertonic (more concentrated outside the membrane, water
moves out) or hypotonic (less concentrated outside the membrane, water moves in).
REMEMBERING
1 Why is water essential to life?
2 Name and describe the three types of
5 a Explain the difference between solute
and solvent.
b Why might water be known as the
universal solvent?
throughout each
are highlighted in chapter enable
solution that may surround a cell.
3 State three main functions of the kidney. APPLYING
The kidneys UNDERSTANDING 6 Draw a diagram of a nephron and label
Kidneys are essential organs involved in maintaining a constant internal environment. They play an 4 Differentiate between filtration and the main parts.
key concept boxes , formative assessment

important role in osmoregulation. Their osmoregulatory function includes: reabsorption in nephrons.
1 removal of nitrogenous wastes
Formation of urine
This website contains an 2 regulation of water concentration in the blood
animated tutorial and
quiz summarising the 3 maintaining ion levels in the blood. 11.2 NITROGENOUS WASTES
structures and function
providing repetition in bite-size chunks

The cortex and medulla make up two of the main layers in a kidney and are composed of
Excretion is the removal of nitrogenous wastes. In mammals, the nitrogenous waste urea is removed Nitrogenous wastes
of the kidney. individual filtering units known as nephrons, which filter the blood in order to regulate chemical To further your
concentrations and produce urine. At one end of each nephron, in the cortex (outer layer) of the
as part of the urine. The elimination of nitrogenous wastes (formed from the breakdown of protein knowledge and
kidney, are cup-shaped structures called Bowman’s capsules. Each one surrounds a group of
molecules and nucleic acids) is essential. One such nitrogenous waste is ammonia, which is extremely understanding of
toxic. A build-up of ammonia in cells can affect their pH, making them more basic, which can nitrogenous wastes,
capillaries called a glomerulus. Blood travels from the renal arteries into the glomerulus of each
denature enzymes and compromise their function. This, in turn, can reduce metabolic activity. The
visit this website.
and summary for graded from

nephron. At the glomerulus, plasma is forced out through the walls of the glomerulus, then in
toxicity can be lessened if the ammonia can be diluted in water, but that depends on the availability of
through the outer layers of the Bowman’s capsule to its interior, being filtered in the process. After
water. Various organisms have different ways of coping with this waste product. Some animals excrete
entering the capsule, the filtered fluid (filtrate) flows along the proximal convoluted tubule to the
ammonia directly, while many others expend energy to convert ammonia to a less toxic form, urea or
loop of Henle, and then to the distal convoluted tubule and the collecting ducts, finally flowing into
uric acid, before excretion.
the ureter. Each of the various components of the nephrons are selectively permeable to different
improved assimilation Remembering to

molecules, and enable the complex regulation of water and ion concentrations in the body. Renal
Proteins Nucleic acids
arteries carry blood to the kidney and renal veins carry blood away from the kidney. The glomerulus
is the site in the nephron where fluid and solutes are filtered out of the blood to form a glomerular
filtrate. The process is called filtration. The proximal and distal tubules, the loop of Henle, and Amino acids Nitrogenous bases
the collecting ducts are sites for the reabsorption of water and ions. Reabsorption is the process
of new ideas. Creating, offering

of water, ions and other substances in the filtrate being absorbed back into the blood. Together, —NH2
filtration and reabsorption in the mammalian nephron regulate body fluid concentrations. Amino groups
Proximal Distal
regular opportunities
tubule tubule
Glomerulus
Renal
artery Renal
pelvis
Collecting duct Most aquatic animals, Mammals, most adult amphibians, Birds, insects, many
to recall new terms

including many fishes and sharks, some bony fish; reptiles, land snails;
Renal
vein juvenile amphibians; need to conserve water need to conserve water
Renal Bowman’s
artery can afford to lose water
capsule O
Ureter
Renal H
medulla Renal NH2 C
HN C N
Renal
and review recent

vein O C CO
cortex NH2 C C N
NH3 CN
H H
Loop of Henle
Ammonia Urea Uric acid
(most toxic) (less toxic) (least toxic)
concepts.
To ureter
FIGURE 11.2 Three types of nitrogenous wastes and where they occur, which relates to water availability in the
FIGURE 11.1 Structures of the human kidney and nephron substances that are reabsorbed (blue represents organism’s environment
water; grey represents salts and other substances)
9780170452922 9780170452922
Scientific literacy boxes discuss a scientific text or

media item, encouraging students to use evidence to
evaluate the claims and conclusions presented.
Application boxes offer opportunities for students

to accurately apply models and scientific principles Case studies provide opportunities to see how
to complex systems in both familiar and unfamiliar science is applied using up-to-date, real-world and
contexts. local Western Australian examples of context.
9780170452922
ix
422 UNIT 4 | BIOLOGY WA ATAR UNITS 3 & 4 423
The activities and investigations offer

What does a million look like? 12.1
opportunities to develop the Science
YTIVITCA
You will need
Inquiry Skills listed in the SCSA

• Small quantity of rice
• A balance
What to do
1 Weigh out 1 g of rice.
Biology ATAR Syllabus. Southern Biological and Cengage
/0.4/yb/sesnecil/gro.snommocevitaerc//:ptth ecneciL
2 Count the grains.
0.4 YB-CC .dtL erutaN regnirpS ,stropeR cfiitneicS

3 Calculate the mass of rice that would provide one million grains.
What did you discover?

Were you surprised by what a million looks like?
have collaborated to ensure they are effective, exciting and

FIGURE 12.16 Scanning electron micrograph of Giardia lamblia (yellow) in the human small intestine. This
flagellated protist contaminates drinking water, causing intestinal upsets.
Developed exclusively by Southern Biological
Key concept Fomites and pathogens

12.1
The structural features of protists include that they:
current. Some of the investigations written by Southern

Some bacteria can survive for days or even weeks on surfaces such as handrails, chopping boards and
NOITAGITSEVNI
• are relatively small 2–1000 μm bathroom sinks. In this investigation, you will test the degree of contamination of four different fomites,
• are eukaryotes, with a membrane-bound nucleus by swabbing the objects and counting the number of bacterial colonies that grow on agar plates.
• are mostly unicellular
• can reproduce sexually and/or asexually Aim
• can exist in different forms during their life cycle, depending on their classification (for To compare the degree of contamination of four different fomites
Biological are exclusive to Cengage, and all investigations

example, spores or zoospores, filaments, hyphae and mycelia)
• can be plant-like, animal-like or fungi-like in their structural or reproductive features. Materials
Class requires:
• Incubator set to 25°C
Each group requires:
have been rigorously stress-tested by Southern Biological

12.1 Fungi have cell walls. Phytophthora cinnamomi was originally classified as a fungus. It has a life • 4 nutrient agar plates
cycle and reproduces in a similar way to a fungus. The pathogen grows fine filaments, called • Marking pen
hyphae. Similarly to a fungus, it produces spores. It has a cell wall. • Unopened box of sterile cotton swabs
NOITACILPPA
Can you explain why it is currently classified as a protist instead of a fungus? • Sticky tape
(Hint: Phytophthora cell walls are made of cellulose. Its similarity to fungi is considered to • Disinfectant solution
to ensure that they will work in the classroom. Some

be a case of convergent evolution.)
Risks
WHAT ARE THE RISKS IN DOING THIS EXPERIMENT? HOW CAN YOU MANAGE THESE RISKS TO STAY SAFE?
Micro-organisms will grow on the agar plates. Do not open plates once they are securely taped.
Question set 12.3b
investigations have taking it further ideas at the end,

Dispose of plates appropriately.
REMEMBERING UNDERSTANDING Disinfectants may damage clothes and cause skin irritation. Wear gloves and lab coats.
1 Recall the structural features eukaryotic 5 Discuss the relationship between type of
pathogens have in common. pathogen and type of symptoms. Procedure
2 Name and describe a plant disease caused 6 Distinguish between the features of a Note: to minimise contamination, wipe the bench down with bleach or alcohol before you start.
suggesting how to extend or adapt them for further study.

by a protist agent. fungal pathogen and a bacterial pathogen. 1 Choose four objects, such as a doorknob, chopping board or coin, that you think may be covered
3 Describe the symptoms caused by 7 Describe the difference between malaria with bacteria. Write a hypothesis to predict the degree of contamination of your four different
Plasmodium falciparum . and Plasmodium. fomites.
4 Distinguish between the structural 2 Sample one of your objects by rubbing a sterile swab tip across its surface.
features of fungi and protists.
9780170452922 9780170452922
466 UNIT 4 | BIOLOGY WA ATAR UNITS 3 & 4 CHAPTER 13 | Spread of pathogens 467
Chapter summary sections and a glossary of

important terms introduced in the chapter
CHAPTER 13 SUMMARY CHAPTER 13 REVIEW QUESTIONS
• To survive, pathogens require an effective • Globalisation is the process by which
life cycle. The pathogen needs: a portal of the world is becoming increasingly Remembering
entry, to exploit nutrients, to avoid host interconnected. Trade of goods and services 1 For a pathogen, state the purpose of a host.
support revision and self-reflection. Chapter

defence mechanisms, to replicate, a portal of and tourism facilitate regional and global 2 Describe the generic life cycle of a pathogen.
exit and a mode of transmission. movement of pathogens. Therefore, disease 3 List three interrelated factors that can affect the rate of spread of a pathogen.
• Transmission can be direct or indirect. is spreading globally at a much higher rate
than prior to globalisation.
• Direct transmission is the transfer of a Understanding
pathogen from a current infected host, or • Climate change is causing a rise in average
4 Summarise the life cycle of the pathogen that causes chytridiomycosis.
review questions provide, in larger chunks, further

other reservoir, to a susceptible future host air temperature and extreme weather
5 Describe the site/s and form/s of the parasite Plasmodium during
by direct contact or droplet spread. events, including floods. Mosquitoes are
a sexual reproduction
• Indirect transmission is the transfer of more active in warmer temperatures. As
b asexual reproduction.
a pathogen from a reservoir to a host previously cold areas become warmer,
6 Name two diseases with more than one mode of transmission and describe the modes.
through non-living vectors (vehicles/ mosquitoes will spread further, along
scaffolding for summative assessment, including

inanimate objects), living vectors (living with the pathogens they carry. Mosquitoes
intermediaries) or suspended air particles. exploit the extra bodies of water bodies left Applying
after floods and rains as breeding grounds, 7 Discuss the possible impacts of global climate change on the distribution of mosquito-borne
• Pathogens have adaptations that facilitate
increasing the area in which they can diseases.
their transmission by various mechanisms,
including through direct contact, contact breed and the number of offspring they can 8 Describe two major differences between the pathogen that causes malaria and the pathogen that
Creating questions. Practice exam questions

with bodily fluids, through the air and via produce. causes Ross River virus.
contaminated food, water or disease-specific • Environmental factors contribute to the 9 Provide a rationale for spending money on biosecurity to prevent the varroa mite from entering
vectors. selective forces on populations, including Australia.
• The spread of a disease can be influenced pathogen populations. The environment 10 Differentiate between an epidemic and a pandemic.
is changing at a faster rate due to climate 11 Explain why tuberculosis spreads easily in urban areas of poor countries.
(WACE exam questions) give practice in answering

by three interrelated factors: the host
population density, the population of the change. Factors such as increased average
pathogen and the mode of transmission. air temperature and habitat loss are
All three factors need to reach a certain driving forces behind rapid evolution of
threshold for spread to be possible. pathogens.
PRACTICE EXAM QUESTIONS
exam questions specifically related to the content

1 A pandemic is most likely to arise from a A stay the same
new influenza virus strain that: B increase
CHAPTER 13 GLOSSARY A spreads easily among humans C decrease
Airborne droplet A tiny particle of liquid proboscis, a tube-like mouthpiece, into the B causes a high mortality rate in humans D fluctuate.
suspended in the air as part of an aerosol skin and blood vessel of a host to feed on C cannot replicate in humans
students have been studying.

[Q29 2017 SCSA]
(solution in air) that is sneezed or coughed into blood; during the bite, the mosquito’s saliva is D has the same protein coat as an existing
4 An outbreak of a serious new strain of
air; a droplet can be suspended in an air current transferred to the host; the saliva exiting the strain.
influenza occurs on a cruise ship at sea. The
for a period of time before being inhaled or mosquito, or the blood being ingested by the [Q16 2018 SCSA]
best method of preventing the influenza
landing on a surface such as a table mosquito may potentially carry pathogens
2 A pathogen that infected plants has cells from spreading to populations on land is to:
Anaerobic bacteria Bacteria that will only Climate change The current climate change with a true nucleus, mitochondria and a cell A keep all people on the ship until
germinate and multiply in hypoxic (low oxygen) occurring on Earth is an increase in global wall made of chitin and is therefore a: everyone has recovered
conditions average air and ocean temperature, rising global A bacterium B send crew members ashore to obtain
Antibiotic An antimicrobial chemical that sea levels, long-term sustained widespread B fungus antiviral medication
inhibits or destroys bacteria reduction in snow and ice cover, and changes in C protist C disinfect all eating and recreational
atmospheric and ocean circulation and regional D virus. areas on the ship
Asymptomatic Refers to the state of being
weather patterns, which influence seasonal [Q17 2017 SCSA] D bring in medical personal to vaccinate
infected but not experiencing any signs or
rainfall conditions in global average air and people on the ship.
symptoms 3 In the course of an influenza epidemic, the
ocean temperature, rising global sea levels, long- [Q8 2016 SCSA]
Blood feed The method used by female number of susceptible hosts will:
term sustained widespread reduction of snow
mosquitoes to ingest blood: they insert their
9780170452922 9780170452922
NELSONNET
NelsonNet is your protected portal to the premium digital resources for Nelson textbooks, located at
WS www.nelsonnet.com.au. Once your registration is complete, you will have access to comprehensive
digital resources that supplement each chapter, including:
• worksheets
• practice exams
• activities
• useful weblinks
• answers.
Icons in your NelsonNetBook will link you to these resources.
Teachers will have access to these resources plus chapter tests, answers to practice exams, practice
tests, videos of lab investigations (provided by Southern Biological), chapter PowerPoints, syllabus mapping
and teaching plan documents, and a PDF version of the student book.
NELSONNETBOOK
The NelsonNetBook is a customisable, interactive eBook that can be used online and offline. Accessible on desktops,
laptops, tablets and interactive whiteboards, it reproduces the student text in digital form. Annotate your eBook with
notes, highlights, weblinks and voice recordings, and access resources directly from the NelsonNet student website.
Teachers can share their personalised version of the eBook with the class or particular groups. It is also possible to
download an offline version of the book, and iPad and Android apps.
Disclaimer
Please note that complimentary access to NelsonNet and the NelsonNetBook is only available to teachers who
use this student book as a core educational resource in their classroom. Contact your Education Consultant for
information about access codes and conditions.
9780170452922
ORPEICS - yrarbiL otohP ecneicS/segamI ytteG
9780170452922
CONTINUITY
OF SPECIES
UNIT 3
1
1
SCIENCE INQUIRY CHAPTER 1 CONTENT
By the end of this chapter, you will be able to use the following
SKILLS science inquiry skills.

» identify, research and construct questions for investigation;
propose hypotheses; and predict possible outcomes
» design investigations, including the procedure(s) to be
followed, the materials required, and the type and amount of
primary and/or secondary data to be collected; conduct risk
assessments; and consider research ethics, including animal
ethics
» conduct investigations, including the use of probabilities
» represent data in meaningful and useful ways, including the
use of mean, median, range and probability; organise and
analyse data to identify trends, patterns and relationships;
discuss the ways in which measurement error, instrumental
accuracy, the nature of the procedure and the sample size
may influence uncertainty and limitations in data; and select,
synthesise and use evidence to make and justify conclusions
» interpret a range of scientific and media texts, and evaluate
models, processes, claims and conclusions by considering
the quality of available evidence, and use reasoning to
construct scientific arguments
» communicate to specific audiences and for specific purposes
using appropriate language, nomenclature, genres and
modes, including scientific reports
ATAR Biology Syllabus, Government of Western Australia,
9780170452922
2 UNIT 3 | BIOLOGY WA ATAR UNITS 3 & 4
1.1 INVESTIGATIONS
Investigations use a scientific process to answer a question, explore an idea or solve a problem. They
require activities such as planning a course of action, collecting data, interpreting data, reaching a
conclusion and communicating about these activities. They can involve observation, data collection,
research, field work, laboratory experimentation and manipulation of simulations. Investigations are
central to our understanding of the biological world.
Sometimes an important advance in science begins with a lucky accident. For example, after
hearing from milkmaids that people who contracted cowpox (a relatively harmless disease picked
up after working with cattle) were protected from deadly smallpox, the British physician Edward
Jenner effectively kickstarted the science of vaccination. Jenner used samples from open cowpox
sores on a dairymaid’s hands to inoculate a young boy and protect him against smallpox. In this
process, he introduced a microorganism that caused a mild form of the disease, and it resulted in the
boy developing immunity. However, nearly 100 years would pass and significant research would be
required before scientists were able to show that microorganisms caused infectious disease. Lucky
accidental discoveries like this may begin a new field of research, but they need to be followed up by
carefully planned investigation.
Usually, advances in science come from a process of systematic observation and
experimentation, inductive and deductive reasoning, and the formation and testing of hypotheses
and theories. How these activities are carried out can vary greatly, but there are some common
factors that we will explore below. The process by which science advances is known as the scientific
method .
When an investigation has finished, it is good practice to check whether the findings align with
current theories. Theory can be used to explain experimental results. A theory is ‘a set of concepts,
claims and/or laws that can be used to explain and predict a wide range of related observed or
observable phenomena. Theories are typically founded on clearly identified assumptions, are testable,
produce reproducible results and have explanatory power.’
Key concept
The main role of science is to observe, question and investigate the natural world. The scientific
method enables science to proceed.
1.2 THE SCIENTIFIC METHOD

Investigations can vary greatly, so the generic steps for conducting an investigation will need to be
adapted to the task.
The generic steps are:
1 Make an observation (or observations).
2 Ask questions about the observation(s).
3 Form a hypothesis and make predictions based on that hypothesis.
4 Test the hypothesis using a planned procedure that is reproducible, and uses the appropriate
models and instruments.
5 Record results, analyse the data (usually by graphing it) and draw conclusions; accept or reject
the hypothesis or modify the hypothesis if necessary.
6 Reproduce the experiment until there are no discrepancies between the observations and
the modified hypothesis.
7 Discuss and evaluate the results and the procedure.
9780170452922
CHAPTER 1 | Science inquiry skills 3
Observations
Determine whether data

support or disprove Propose questions.
hypotheses.
Perform background
Determine how conclusions research.
fit in with other information.
Conclusions Hypotheses
Check experimental results

for reproducibility.
Select or develop models.
Analyse data and
Design experiments to test
compare them with
hypotheses.
predicted values.
Controlled experiments
FIGURE 1.1 The scientific method
Researching and refining your question

After recording your observation(s) and formulating a question, the next step is to find out what is
already known about the concepts. Use the Internet, your textbooks and the library to find out. Make
sure you keep a record of the information that you find, as well as the sources of the information.
Australian Academy of
You should start a logbook at this stage. Your logbook will contain the planning of your investigation, Science
the raw data you obtain, and the draft of your report. Good record keeping is important in scientific This is a useful resource
research, and it begins at this stage of the investigation.
for up-to-date science
news.
Read a range of scientific media and texts. Published journal articles (e.g. CSIRO articles) can be
Australian Society
helpful. Be critical of what you read. Do not assume that everything you read online, or even in books, for Biochemistry and
is true. Evaluate the claims and conclusions, and check that they were written relatively recently Molecular Biology
and have not been superseded by more recent research. Scientists spend a lot of time reading other
This resource aims to
promote education and
scientist’s published work so as to build on current knowledge. For example, scientists working research in biology.
on medications and vaccines for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), CSIRO (Commonwealth
the virus causing COVID-19, read widely about other pathogenic coronaviruses affecting humans, Scientific and
including SARS-CoV-1 and the Middle Eastern respiratory syndrome coronavirus (MERS-CoV). Industrial Research
Organisation)
Immunologists at Harvard Medical School demonstrated in 2003 that SARS-CoV-1 used its spikes to This website contains
penetrate cells. In 2020, scientists at the Chinese Academy of Sciences confirmed that SARS-CoV-2 useful information on
all fields of scientific
attaches to the same receptor. Scientists working on the SARS-CoV-2 vaccine are using previous research, including
knowledge and recently developed vaccine technology (such as recombinant protein vaccines) to resources for students
develop a safe and effective vaccine (Figure 1.2, page 4). and teachers.
When you are conducting an investigation, you may find examples of similar investigations to
the one you are thinking of. It is a good idea to look at these, so you can learn from the experience
of other researchers. However, in general, it is better not to try to replicate or copy someone else’s
investigation exactly. If you do decide to replicate someone else’s investigation, then you need to
acknowledge and carefully reference their work. See the section on referencing (page 16). If you do
not do so, it is plagiarism. This is a very serious form of academic misconduct.
9780170452922
a SARS-CoV-2 b
RNA RNA
Spike protein Spike protein
Surface of
susceptible cell
Activated
spike protein
ACE-2 receptor Cleaved

ACE-2 receptor TMPRSS2
c Viral entry into cell
Cell membrane
TMPRSS2
FIGURE 1.2 Scientists have found that the protein spikes on SARS-CoV-2 penetrate a cell by attaching to a host cell surface receptor protein
called the ACE-2 receptor. The enzyme TMPRSS2 facilitates virus entry. They are using this knowledge to develop an effective vaccine.
Forming a hypothesis
A hypothesis is a scientific statement, based on the available information, that can be tested by
experimentation. It can be thought of as ‘an educated prediction’. It should describe an expected
relationship between the independent and dependent variables in observable phenomena. Once you
have decided on your research question, what you are trying to find out, you need to turn it into a
hypothesis.
If your research question is in the form of ‘What effect does a new fertiliser have on root growth?’
it can be turned into a hypothesis such as, ‘If a new fertiliser is applied to a plant, then the rate of root
growth will increase’.
If the hypothesis is written correctly, the independent and dependent variables should be easy
to identify. Usually, an investigation will have one dependent variable and one independent variable
in each trial. A variable is a factor that can change. There may be several factors that can cause
change in a particular variable. To conduct a trial that produces valid results, only one of these factors,
the independent variable, should be manipulated (changed). The other factors, which need to
be kept consistent between the control group and the experimental group, are called the
9780170452922
controlled variables. The factor that changes as a result of the change in the independent variable
is called the dependent variable. It is the set of changes in the dependent variable that is observed,
measured and recorded and which becomes the investigation’s results. The results will either support
or not support the hypothesis. A sound hypothesis is falsifiable, and results that do not support the
hypothesis can be of as much value as those that do in accumulating scientific knowledge.
Even if your hypothesis meets these criteria, do not be surprised if you change or modify it during
the course of your investigation. In scientific research, the question you set out to answer is often only
a starting point for more questions.
For the hypothesis ‘If a new fertiliser is applied to a plant, then the rate of root growth will increase’,
are you able to determine the independent and dependent variables? (The term rate refers to change
in a quantity, usually per unit time. Root growth rate is likely to be measured in millimetres per day.) In
the first half of the hypothesis, we see that the factor to be varied by the investigator is the type of
fertiliser. This is the independent variable. In the second half of the hypothesis, we see that the factor
to be observed and measured is the rate of root growth, the dependent variable. A controlled variable
might be the amount of fertiliser added.
Key concept
A research question informs a hypothesis. A hypothesis describes the relationship between the
independent and dependent variables.
Planning
Keep the hypothesis and the purpose of the investigation clearly in mind during the planning of the
procedure. Your predictions about what you think may happen will help with your planning. It is
helpful to ask yourself some questions first.
• What data will you need to collect?
• What materials and equipment will you need?
• When and where will you collect the data?
• If you are working in a group, who will collect the data?
• Who will be responsible for record keeping?
• How will the data be analysed?
The data that you collect will always
include primary data, and will usually include
secondary data. Secondary data are data
collected by a person or group other than
the person or group using the data. Primary
data are data collected directly by the person
conducting the investigation.
Consider how you will analyse the data.
Will you need access to specific software,
such as a graphing or statistics package?
Keep a record of your planning. This should
go in your logbook. Writing down what
otohP ekaT/moc.kcotsrettuhS
you plan to do, and why, will help you stay

focused during the investigation. If you
are working in a group, then a record of
what each person agrees to do during the
investigation can be very important.
When variables have a numerical value, FIGURE 1.3 These seedlings are being grown under
you make quantitative measurements. You consistent conditions to control the independent variables.
9780170452922
measure each numerical value in the appropriate units. For example, you might measure root length
in centimetres, or the weight of roots in grams.
Continuous variables can take any possible value, usually within a particular range. Length, time
and current are continuous variables. In the root growth example, root length is a continuous variable
because it can take any value within a range. A variable that can take only fixed values is called a
discrete variable. Data for discrete quantitative variables (e.g. number of electrons in an atom) are
usually whole numbers because the quantity cannot be broken into fractions. In the root growth
example, the number of roots is a discrete variable.
In some investigations, you may have qualitative measurements as data. Qualitative data can
include words or descriptions and can at times be subjective. For example, a chemical reaction may
lead to a colour change. You would usually describe the colour in words, such as ‘pink’ or ‘green’,
rather than using a number. Sometimes you use a combination of qualitative and quantitative data.
For example, you may describe roots as reaching a maximum length in centimetres (quantitative), but
growing in a particular direction or pattern (qualitative).
Once you have decided on the variables you will be measuring, you will be able to identify the
equipment and other resources you will need.
Risk assessment
You may be required to complete a risk assessment before you begin your investigation. Even if this is
not a requirement, it is a good idea to think about risks. You need to consider three things.
1 What are the possible risks to you, to other people, to property and to the environment?
2 How likely is it that there will be an injury or damage?
3 If there is an injury or damage, how serious are the consequences likely to be?
A ‘risk matrix’, such as Table 1.1, can be used to assess the severity of a risk associated with an
investigation. The consequences are listed across the top, from negligible to catastrophic,
and the likelihood of each consequence occurring increases as you look down the rows. A
negligible consequence may be getting clothes dirty or a very minor injury such as a scratch.
A marginal consequence might be a bruise from falling off a bike, or a broken branch in a tree.
A severe consequence could be a more substantial injury or a broken window. A catastrophic
consequence could be a death or the release of a toxin into the environment. In general, you need
to ensure that your investigation is low risk. You can use a risk matrix either for individual identified
risks, or for the investigation overall.
TABLE 1.1 Matrix for assessing severity of risk
CONSEQUENCES NEGLIGIBLE MARGINAL SEVERE CATASTROPHIC
LIKELIHOOD
Rare Low risk Low risk Moderate risk High risk
Unlikely Low risk Low risk High risk Extreme risk
Possible Low risk Moderate risk Extreme risk Extreme risk
Likely Moderate risk High risk Extreme risk Extreme risk
Certain Moderate risk High risk Extreme risk Extreme risk
Once you have considered what the possible risks are, you need to think about what you will do
about them: what you can do to minimise them, and how you would deal with the consequences if
something did happen. This may be as simple as deciding to ‘Always wear a lab coat, gloves and safety
glasses’. You can use a risk assessment table similar to Table 1.2.
9780170452922
TABLE 1.2 Example of risk assessment
WHAT ARE THE RISKS INVOLVED IN DOING HOW CAN YOU MANAGE THESE RISKS TO
THIS EXPERIMENT? STAY SAFE?
The fertiliser might be spilled on clothes or skin during Wear a lab coat, gloves and safety glasses.
application. Clean up spills immediately.
Safe use and disposal of biological material

When dealing with many biological materials, it is important to be aware of safe handling and disposal.
For example, when growing known or unknown microbes on agar plates, it is important to use safe
sterile techniques (discussed below) and to wear a lab coat, gloves, safety glasses and, if required, face
mask. Treat all microbes on agar plates as potentially pathogenic, and autoclave used plates before
disposing of them. An autoclave is a machine that can heat an object to very high temperatures. It is
sometimes used to kill pathogens.
Animal ethics
Activities that affect living organisms need to comply with the Australian Code for the Care and Use of
Animals for Scientific Purposes .
The main thrust of ethics is treating animals, other people and the environment with care and
Australian Code for
respect. If your investigation will be using humans, then you need to make sure you do not harm the Care and Use of
them, either physically or psychologically. If you are working with animals, then there are animal Animals for Scientific
ethics to consider. The welfare of animals used for the purposes of research is legislated by state and Purposes
Respect for animals
federal laws, and respect for all animals (vertebrate and invertebrate) used in research is of the utmost must underpin all
importance. When using animals for research, scientists must adhere to the ‘3Rs’. These are: decisions and actions
• Reduction alternatives: methods that obtain comparable levels of information from the use of involving the care
and use of animals for
fewer animals in scientific procedures, or more information from the same number of animals. scientific purposes. Read
• Refinement alternatives: methods that alleviate or minimise potential pain and distress, and about animal ethics
here.
enhance animal wellbeing.
• Replacement alternatives: methods that permit the given purpose of an activity or project to be
achieved without the use of animals or with the use of non-sentient animals or animals of a lower
sentient value (those that lack a nervous system).
kuhcnaP myskaM/moc.kcotSi
FIGURE 1.4 The use of animals for research purposes is governed by state and federal laws.
9780170452922
CASE
STUDY
Animal ethics
Anyone working with animals in Australia is vaccine; computer simulations can be fed real-
bound by guidelines and laws to safeguard world data to generate predicted outcomes.
animals. Research is conducted on animals Animals such as mice, guinea pigs, rats, pigs
other than humans for several reasons: some and non-human primates are commonly used
animals have lower sentience; also, the time as models for research because, as mammals,
between generations is shorter in some animals,
they share a lot of genetic code with humans
which reduces the waiting time for results. The
and have a likelihood of responding to tests in
precise meaning of sentience is contested in a similar way. A range of vaccines, infectious
science and in philosophy, but it can be defined
agents and chemicals have been tested on
as the ability to experience consciousness, animals such as these to find out the possible
pleasure, self-awareness and pain. Some effects on humans.
invertebrates (such as jellyfish) do not have a Since the discovery of the susceptibility
central nervous system that is as sophisticated
of ferrets (Mustela putorius furo) to influenza
as that of humans, and they are considered tovirus in the 1930s, they remain one of the
have a lower sentience than humans. most useful animal models for studying
RSPCA Australia promotes ethical influenza infection. They have a similar
treatment of animals as observing what should,
respiratory system to that of humans, their
rather than what could, be done to animals. lung physiology is similar, they are susceptible
Scientists should have an understanding of the
to similar viruses, and (unlike guinea pigs and
pain physiology of the animals used in their mice) ferrets sneeze, experience fever and
research. They also need to be able to recognise
produce nasal discharge.
normal and abnormal behaviour, so they can More recently, COVID-19 researchers have
assess an animal’s welfare and make an ethical
been using ferrets for the testing of infection
decision about whether or not to continue a trial.
and vaccines. The research team of Dr Rob
A model is ‘a representation that Grenfell, Director of Health and Biosecurity,
describes, simplifies, clarifies or provides an
CSIRO, aims to understand how the infection
explanation of the workings, structure or progresses and how it behaves so as to be able
relationships within an object, system or idea’.
to create an effective vaccine. However, ferrets
feel pain in the same way we do, so strict ethical
guidelines for the use of ferrets and other

A model can be used to test outcomes that animals in Australian research laboratories
might be expected in the real world: for must be followed. The guidelines are to be found
example, an animal that has a similar immune in the Australian Code for the Care and Use of
response to humans can be used to test a Animals for Scientific Purposes.
Key concept
When using animals for research, scientists must adhere to the 3Rs: reduction, refinement and
replacement alternatives.
Procedure
The procedure is a planned set of steps enabling you to approach your research systematically. It is
important to describe clearly what you plan to do (noting any modifications you make) so you can review
the procedure later and communicate it to others. It is written in the past tense. A fellow student should
be able to follow your procedure and reproduce the results you have recorded. Let’s examine an exemplar
procedure for a given hypothesis. The first task is identifying the independent variable (the variable that
you will vary), the dependent variable (the variable you will measure) and the controlled variables (those
you will keep constant). (Note: fungicides are chemicals that are used to treat fungal diseases, such as rust
in plants. The symptoms of rust include orange-brown patches on the leaves of affected plants.)
9780170452922
HYPOTHESIS If a particular brand of fungicide is applied to the plant, then symptoms of rust will
disappear.
INDEPENDENT Type of fungicide
VARIABLE
DEPENDENT Extent of symptoms (orange-brown patches)
VARIABLE
CONTROLLED Volume of water used, time of day for watering plants, plant species, ambient temperate,
VARIABLES soil type, light conditions
PROCEDURE 1 One hundred plants of the same species infected with the same species of rust
(fungus) were obtained. All individual organisms had a similar leaf area of orange-brown
patches.
2 Fifty plants were treated with the fungicide and 50 plants were left untreated.
3 Other than presence or absence of the fungicide, the conditions listed as ‘controlled
variables’ were the same for both the experimental and control groups.
4 After a set time, each plant was examined to check the number and size of
orange-brown patches.
5 The results were recorded in an appropriate table.
6 Repeat trials were conducted, and again the results were recorded. Averages of the
number and size of orange-brown patches were calculated for the fungicide group and
the non-fungicide group.
Once you have written a procedure, a checklist is useful to ensure your procedure has been
written correctly. Check that:
• you have a relatively large sample size
• the independent variable will be present or varied in the experimental group, but absent or kept
constant in the control group
• all other variables will be kept constant
• data will be collectable within the time frame you have available
• the method for measuring the dependent variable and the units of measurement are clear
• multiple trials will be conducted and an average will be calculated.
Key concept
Good design of an investigation is systematic and clear. It includes a procedure, materials, data
collection, risk assessments and ethical considerations.
Results: recording the data

The raw data should always be recorded directly into a logbook, unless it is recorded using data
loggers connected to a computer. In that case, a printout of the data should be attached to the
logbook, and the file name and location recorded. Make sure that you measure and record everything
you will need for your analysis. Use appropriate units (e.g. centimetres for lengths and grams for
weights). Note that the accuracy of your measurements will often be restricted by the accuracy of
the instruments you use to take them. For example, a ruler may only have markings down to 0.1 cm.
Make a note of these restrictions, as they may affect the accuracy of your final results, especially if the
changes measured are very small.
If you are going to be collecting multiple data points, it is a good idea to record them in a
table. Label the columns in the table with the name and units of the variables. Do not put the
units in the table cells. The first column usually contains the measurements for the independent
variable. Table 1.3 (page 10) provides an example of a table of data. These data were recorded
during an investigation into the use of a specific fertiliser and its impact on the yield of a species
of wheat.
9780170452922
TABLE 1.3 Results of investigation into soil fertiliser and wheat yield
FERTILISER APPLICATION TRIAL 1 YIELD TRIAL 2 YIELD AVERAGE YIELD

(kg/ha) (BUSHELS/ha) (BUSHELS/ha) (BUSHELS/ha)
0 29 31 30
25 40 42 41
50 51 49 50
75 60 58 59
100 70 70 70
Results: analysing the data

Once you have collected your data, you can begin to analyse it. Performing statistical calculations,
such as finding the mean, median, range and probability, allows you to represent the raw data in a
more meaningful and useful way.
Calculating mean, median and range

The mean or average of a set of numerical data is found by:
1 adding all the data points together
2 dividing by the number of data points.
The median of a data set is the value that has half of the data points above it and half below it.
The median of a data set can be found by:
1 arranging the data points in ascending order
2 selecting the middle data point; or, if there is an even number of data points, taking the mean of
the two central values.
The range describes the total spread of the data. It can be calculated by:
1 ordering the data from lowest to the highest
2 subtracting the lowest value from the highest value.
The inter-quartile range of a data set is the middle 50% of values in a data set when they are
ordered from lowest to highest. It is found by:
1 dividing the ordered data set into two halves
2 finding the median of the lower half of the set (Q1) and the median of the upper half of the set (Q3)
Quartiles and
inter-quartile range 3 subtracting the median of the lower half from the median of the upper half (Q3 – Q1).
This resource
works through an General graphing rules
example of calculating
inter-quartile range. The most reliable way to present patterns in data, and help identify the relationships between
variables, is to plot a graph. Graphs show points of data for at least two variables. Because of their
visual nature, graphs can reveal relationships or trends that statistics and data tables cannot.
1 When presented with quantitative data, you need to decide whether they are discontinuous
(discrete) or continuous (measurable) data and select the appropriate type of graph to use.
2 Line graphs are used when the independent variable is continuous (can take any numerical value
within the range of the data) and the dependent variable is quantitative (can be measured or counted).
3 If the independent variable provides discontinuous quantitative data or qualitative data, a column
(bar) graph is usually selected. The bars in a column graph do not touch.
4 Histograms look like column graphs for continuous quantitative data, but the bars do touch. Each
bar on the x-axis represents a range of values for the independent variable. The y value is the
number of individuals associated with each range of x values.
5 Pie charts are an alternative way of displaying data for a qualitative independent variable and are
used to show what percentage or fraction of the whole each category represents. The data add
up to 100% or ‘1’, respectively.
9780170452922
6 Column (vertical bar) and bar (horizontal bar) charts are useful for comparing two data sets in
which at least one data set is qualitative. Examples would be average root length varying with
different types of fertiliser, or the number of endangered species in the different states and
territories of Australia. The bars do not touch (see Figure 1.6, page 12). However, do not use a
column or bar chart to try to show a mathematical relationship between variables.
7 The independent variable measurements are on the x axis. The axis is labelled, and the units are
included in brackets [e.g. Time (years)].
8 The dependent variable measurements are on the y axis. Again, the axis is labelled and the units
are included in brackets [e.g. Length (cm)].
9 Include a title to help the reader determine what the graph is showing. The title should
include the variables involved and, when appropriate, the specific time over which the
experiment was conducted (e.g. ‘The effect of temperature on the amount of sugar dissolved
in tea after 2 minutes’).
10 The graph should take up more than 50% of the graph space provided. The scale should
be worked out to maximise the filling of the graph space, while allowing some space for
extrapolation of data. The data points should not extend outside of the given graph space. The
intervals can be worked out by dividing the range of data by the number of available intervals on
the axis. In Figure 1.7 (page 13), you will see an example of a set of data points for the investigation
on soil fertiliser and wheat yield.
The range of the data is 0 to 100 kg/ha on the x-axis and 0 to 70 bushels/ha on the y-axis. There
are 12 graph intervals on the x-axis and 16 graph intervals on the y-axis. Allowing some room for
extrapolation within the graph space available, using 10 of the 12x-axis intervals for 100 units of
data, and 14 of the 16 y-axis intervals for 70 units of data works well.
If the number of intervals on the y-axis is 6, to allow some room for extrapolation, this could be
reduced to 5 intervals. Each interval thus represents 20 kg/ha.
As a guideline, use sensible interval values (such as 1, 2, 5, 10 or 50) to make the graph easy to
plot and interpret. Poorly spaced scales can lead to inaccurate readings. Always start from zero.
On rare occasions, to manipulate the scale to fit, you may need to ‘break’ the axis after zero and
then select equal intervals for the scale after the break.
11 When showing multiple sets of data on the same set of axes, a key should be used. You can use
symbols such as Δ, × or ο. The name of the data set that each line on the graph represents can be
written near it.
Graphs drawn in biological science

1 To see whether there is a trend, carefully rule short straight lines between each of the plotted
data points.
2 Do not extend the line further beyond the minimum or maximum recorded data. However, if
asked to extrapolate, you can rule a dashed line for a short distance beyond the last data point if
the graph is approximately linear.
3 The title should include the independent and dependent variables and, if appropriate, the time
period over which the experiment was conducted. It does not need to be brief. Words such as
‘versus’ or ‘against’ are just restating the axis labels and should not be used in graph titles. Instead,
rephrase it for easier reading, as shown in Figures 1.5–1.8 (pages 12–13).
4 Do not draw a line of best fit unless you have good reason to expect there is a linear relationship
between the independent and the dependent variables. The relationship may not be linear, the
variables may not be controlled enough to produce a straight line, and there are often insufficient
data points to be confident about the values in between.
9780170452922
5 Interpolation involves reading points, other than data points, within the region in which
you have data. It is a prediction made between two known data points. Linear extrapolation
involves reading points other than data points in the region beyond your measured points.
Interpolation is more reliable than extrapolation, because it involves a prediction within
the range of the known data points. Linear extrapolation is an estimation determined by
extending the last line, using the gradient of the last two data points if there is a relationship
between the variables. For the purposes of this course, when a relationship between the
independent and dependent variables has been established, extrapolation is done by
extending the line joining the last two data points for a short distance with a dotted line.
Note that many scientists, however, extrapolate by extending the line of best fit. If one of
the last two points is an outlier, the gradient of the line connecting them will not be a good
indicator of the trend. An outlier is a data point that does not fit the pattern shown by other
measured data points. The line of best fit is a line ruled through the data points with an equal
number of data points either side of it. It can be created mathematically for more accuracy,
and published scientific papers often contain examples of this technique.
Data points and line graphs
Water temperature over 14 days

Biology for life
30
This website contains
some helpful advice on
deciding the number of
data points.
)C°( erutarepmet retaW
Graphing with Excel

After learning the skill
of hand-drawing graphs, 25
students interested in
creating graphs using
Excel can use these
tools.
20
0
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Day number
FIGURE 1.5 A typical line graph in a biological sciences ATAR course
Effects of fertiliser on root growth

15
Standard deviation
Standard deviation
)mc( htgnel toor ni egnahC
calculations can inform 10

a scientist about the
spread of the results. A
high standard deviation
indicates that the data
points are quite varied 5
from the average,
whereas a low standard
deviation indicates that
most points are very
close to the average. 0
Standard fertiliser New fertiliser
FIGURE 1.6 Bar graph of two data sets, with amount of uncertainty indicated by the error bar at the top of each
data set
9780170452922
The effect of a new fertiliser on wheat yield

(average no. bushels/ha)
80
70
Continuous variation: height of a class of Year 12 students
60 8
)ah/slehsub( dleiy taehw egarevA
7
50
6
stneduts fo rebmuN
5
40
4
30
3
20 2
Key
1
Interpolation
10 Extrapolation
0
08
55
07
58
09
56
57
06
1
1
1
1
1
<
<–
<–
<
<
<
<
<–
–0
–0
–0
–5
–5
0 20 40 60 80 100 120
56
07
55
51
71
81
81
61
1
1
Fertiliser application (kg/ha) Height (cm)
FIGURE 1.7 Graph demonstrating interpolation and FIGURE 1.8 Histogram showing continuous variation in height
extrapolation from the results of the investigation on
soil fertiliser and wheat yield. Interpolation indicated
62 bushels/ha. Extrapolation indicated 74 bushels/ha.
Key concept
Interpolation is prediction of a data point within the range of the known data points.
Extrapolation is prediction of a data point outside the range of the measured data.
Discussion
The discussion needs to include an evaluation of the procedure and the results. It can be broken into
sections such as the following.
1 An evaluation of the reliability and validity of the procedure and the accuracy of the results
You can almost always make suggestions to improve the procedure.
Reliability is the degree to which an assessment instrument or protocol consistently and
repeatedly measures an attribute and achieves similar results for the same population.
When you repeat an experiment and get the same results, the data are considered reliable.
Reliable data can be obtained by repetition and replication if the procedure is valid and good
experimental technique is used. Repetition involves multiple trials within the same investigation
or using a large sample size. Replication is the same investigation being conducted several
times, possibly by more than one investigator. An average (mean) can often be calculated
from the quantitative results obtained by both repetition and/or replication. This can reduce
anomalous data/outliers.
Validity is the extent to which tests measure what was intended, and the extent to which data,
inferences and actions produced from tests and other processes are accurate. Valid data can
be achieved by identifying the variables that should be controlled and then controlling them. It
can also be gained by the use of a control group. A control refers to a standard or group that is
the same as the experimental group but for which the independent variable does not vary. The
purpose of the control group is to ascertain that the cause of any change in the experimental
group is due to change in the one independent variable.
9780170452922
Accuracy is the extent to which a measurement result represents the quantity it purports
to measure; an accurate measurement result includes an estimate of the true value and an
estimate of the uncertainty. It is the degree of closeness of a measurement of a quantity to its
actual true value.
2 A discussion of the ways in which measurement error may have affected the data
Measurement error is the difference between the experimental result and its true value.
Systematic error, mistakes and random error can all contribute to measurement error.
Systematic error is error that is due to instrument accuracy and use; for example, the failure
to zero an instrument before use or using the wrong type of instrument for the investigation.
Reading an instrument from a consistent but non-90° angle can produce this type of error. A
potometer may leak water and indicate a higher rate of transpiration than is correct. If a student
consistently reads the volume of a liquid at the same but wrong part of the meniscus, there will
be systematic error. Systematic error can shift measurements in a consistent direction. This will
have an impact on the reliability of the results, because if the investigation is repeated without the
error, the results will not be the same.
Mistakes, or avoidable measurement error, may arise from carelessness or incorrect use of an
instrument. If a student knows to measure a water level at the bottom of the meniscus, but does
not take care that their eye is level with the meniscus, avoidable measurement error can occur.
Such error will also affect the results.
Finally, random error may occur. The only way to reduce this type of error is to increase the
sample size or the number of trials.
3 Future applications and implications of the investigation.
Interpreting your results: conclusions

If your results support your hypothesis, then this can be stated in a conclusion, along with a statement
about the relationship between the variables shown by the results.
A sample conclusion for the investigation on soil fertiliser and wheat yield could be as follows.
The results supported the hypothesis. As the fertiliser application increased from 0 to 100 kg/ha,
the average number of bushels per hectare rose from 30 to 70. An increase in fertiliser application
caused an increase in wheat yield.
There needs to be clear evidence for any relationship claimed in the conclusion. The evidence in
this case will be of a quantitative nature, because the data recorded were quantitative. If you gather
qualitative results, then key qualitative data are needed as evidence for the conclusion about the
hypothesis.
If the results do not support the hypothesis, this can be stated in the conclusion instead. Possible
reasons for this may be suggested in the discussion.
It may be that the nature of the procedure did not take into account all of the variables. For
example, in the root growth experiments, it may be that the new fertiliser works best at a particular
temperature, or over a longer time, or in conjunction with certain soil conditions.
It may be that the sample size used in the experiment was too limited to fully test the hypothesis.
Thus, you might conclude that further experiments are required to increase the total sample size
being tested.
Before you decide that the hypothesis was wrong, it is a good idea to check carefully that you
have not made any mistakes or ignored any variables needing to be controlled.
Key concept
The discussion and conclusion critically evaluate the procedure and results of an investigation,
discussing their reliability, validity and accuracy, and, when relevant, suggest ways the
investigation could be improved.
9780170452922
1.3 COMMUNICATING YOUR RESULTS

If research is not reported, then no-one else can learn from it. An investigation is not complete until
the results have been communicated. The majority of scientific investigations are first communicated
to others through the publication of written reports.
Writing reports
A report is a formal and carefully structured account of your research. It is based on the data and
analysis in your logbook. However, the report is a summary. It contains only a small fraction of what
appears in the logbook. Your logbook contains all your ideas, rough working and raw data. The report
typically contains none of this.
A report consists of several distinct sections, each with a particular purpose. It usually includes
the following:
• Introduction
• Procedure
• Results and analysis
• Discussion
• Conclusion
• Acknowledgements
• References
• Appendices.
Reports are always written in the past tense, because they describe what you have done.
Introduction
The introduction tells the reader why you did the investigation and what your research question and
hypothesis is. This is the place to explain why your research is interesting or important.
The introduction also provides any background information needed to be able to understand the
rest of the report. This is the place to summarise any existing theories. You need to do this to put your
hypothesis into context. You should also summarise any similar investigations. All of this should be
correctly referenced, as described in the section on referencing (page 16).
Procedure
The procedure describes what you did. It summarises what you measured and how you measured
it, step by step. Write your procedure using sentences, not dot points. There should be enough
detail for another student to be able to replicate the experiment. Remember that it needs to be
written in past tense. For example, you would write, ‘the length was measured’, not ‘measure the
length’. Include any diagrams, such as apparatus set-ups, that are needed to make your procedure
clear. The diagrams in your logbook will usually be rough sketches. The diagrams in your report
should be very neat and carefully labelled. Flow charts can be useful for describing any procedures
in which a series of steps has been followed. Each diagram should have a figure number, and you
should refer to it within the text of your report. Position the diagram close to the relevant part of
the text. Now is a good time to learn how to position figures neatly using your word processor
software. When including images taken on a microscope, a scale bar and magnification must
always be noted.
9780170452922
Results and analysis

The results section is a summary of your results. It is usually combined with the analysis section,
although they may be kept separate.
When you draw a table of results, the independent variable is usually positioned in the first
column and the dependent variable in the second column. If a table has more than a few rows of
data, it is better to represent that data in some other way. Usually this will be a graph. Think about
what sort of graph would be appropriate. (Refer to pages 10–13 for guidance.) Do not use a column
or bar chart to try to show a mathematical relationship between variables.
Discussion
The discussion should explain what your results mean. If you began with a research question, give the
answer to the question here. If you began with a hypothesis, state whether or not your results support
your hypothesis. If not, analyse your procedure and results to explain why. Was your hypothesis
incorrect? Or was the procedure or model used not suitable for the investigation?
If there are any implications of your work, such as implications for better agricultural processes or
the design of better medicines, put them here.
Conclusion
Refer to Interpreting your results: conclusions (page 14).
References
When writing a report that includes information from existing literature, use a citation to indicate
within the report that you are using someone else’s information or ideas, then include a list of
references at the end. A reference list acknowledges the sources you used, which helps you to avoid
plagiarism and strengthens your arguments. References can include journal articles, books, book
chapters, websites, newspaper articles, conference proceedings, podcasts etc.
American Psychology Association (APA) referencing is commonly used in science reports. The
APA citation style within the body of the report is an ‘author–date’ style: write, for example, ‘(Tian and
Castillo, 2016)’, ‘Roberts et al., 2019’ or ‘Tian and Castillo (2016) observed …’. ‘et al.’ means there are
APA referencing by
Murdoch University more than two authors.
A science bibliography The reference list allows readers to locate sources easily and usually follows the chosen
usually uses APA referencing style, APA in this case. Write the surname of the author(s) followed by their initials with a
referencing.
comma between authors, then the year of publication within parentheses, the title, the publisher and
the place of publication. For example:
Tian M, Castillo TL (2016) Solar heating uptake in Australia: rates, causes and effects . Energy
Efficiency Reports. Report no. 10, The Department of Sustainability and Environment, Canberra.
When a website without an author is used, the listing looks like this:
ABC News. (2003) $250 m funding boost for malaria vaccine . Retrieved from https://www.abc.
net.au/news/2003-09-22/250m-funding-boost-for-malaria-vaccine/1482220
Other ways of communicating your results

You may want to present the results of your investigation in another format. Scientists
communicate their findings in many ways: posters, seminars, journal articles, reports and
websites. Scientists usually use more than one means to communicate their research when it
is of particular interest.
9780170452922
Look at examples of articles in the scientific literature and the Multimedia presentations
• PowerPoint®
popular media. This will give you an idea of how different styles
• Canva®
are used in different contexts. Think about the purpose of the
communication. Is it to inform, to persuade or both? What sort of Oral presentations
language is used? • Informative
• Persuasive
Think about your audience and use appropriate language and
style. A poster is not usually as formal as a report. A website may be Journal articles
more or less formal, depending on the audience. • Research
• Case study
FIGURE 1.9 Examples of formats

for reporting an investigation
)rehpargotohp( sizairiK neleH fo noissimrep htiw decudorpeR
FIGURE 1.10 A poster session is a common way to present scientific findings at a conference.
9780170452922
WS
CHAPTER 1 SUMMARY
Chapter 1 • Science involves investigations. Prior ethics: reduction, refinement and
Activity sheet
to an investigation, scientists: identify, replacement.
research and construct questions; propose • Scientists write a clear procedure to ensure
hypotheses; and predict possible outcomes. the investigation collects accurate, valid and
• The scientific method is used to conduct reliable data.
an investigation. The sequence followed in
• Raw data are recorded in a logbook and
an investigation may include: observation,
tables, and analysed using statistical
question, research, hypothesis, prediction,
methods (e.g. mean, median, range,
procedure, results, graph, discussion and
probability and standard deviation).
conclusion.
• Data can be displayed in a meaningful way
• Scientists read and interpret a range of
by plotting graphs.
scientific and media texts. Scientists use
critical thinking to evaluate claims and • The discussion and conclusion sections
conclusions, which leads them to construct of a written report evaluate ways in which
logical scientific arguments. measurement error, instrumental accuracy,
• Primary and/or secondary data are collected the nature of the procedure or the sample
to test a hypothesis. size may influence uncertainty in and
• Prior to an investigation, a scientist should limitations of the data.
conduct risk assessments and consider • Written reports are often used by scientists to
research ethics. communicate their investigations. Posters, oral
• Any investigations that use animals and multimedia presentations at conferences,
must consider the three Rs of animal and journal articles are also used.
CHAPTER 1 GLOSSARY
Accuracy The extent to which a measurement Dependent variable A variable that changes as
result represents the quantity being measured; a result of changes to the independent variable
an accurate measurement result includes an
Discrete variable A variable that may only take
estimate of the true value and an estimate of the certain values, e.g. number of individuals, or
uncertainty number of legs on an animal
Autoclave A device used to sterilise
Extrapolation Extension beyond the measured
equipment, reagents or contaminated waste;
range of data to predict or construct new data
autoclaves work by subjecting contents to
that has not been measured
pressurised steam at 121°C for a set time
Falsifiable Able to be disproved
Continuous variable A variable that is able
to take any value within a range; length, time Hypothesis (plural hypotheses) A scientific
and temperature are examples of continuous statement based on the available information
variables that can be tested by experimentation (‘an
Control group A comparison group that is educated prediction’). It may describe an
as similar as possible to the experimental expected relationship between the independent
group, except for the variable being tested (the and dependent variables based on observed
‘independent variable’); the independent variable phenomena
is absent or unchanged in the control group Independent variable A variable intentionally
Controlled variable A variable that is controlled varied by an experimenter to see what the
by the experimenter and kept constant during outcome will be for another variable (the
the experiment ‘dependent variable’)
9780170452922
Inoculate To inject a harmless form of a disease Quantitative measurement A measurement

into an organism to induce immunity without with numerical values
causing the disease
Rate Commonly, total change in a variable
Interpolation Predicting or constructing a new divided by the time taken; it is a mathematical
data point that has not been measured but is ratio of two measurements with different units;
within the range of the measured data sometimes the second variable is not time – a
Inter-quartile range The middle 50% of values rate can be the change in a variable per unit of
in a data set when they are ordered from lowest length or mass, etc.
to highest, found by subtracting the median of Reduction Using only the minimum number
the lower half of the values from the median of of animals needed to satisfy the statistical
the upper half of the values requirements of research
Investigation A scientific process of answering Reference The source of a specific piece of
a question, exploring an idea or solving information or quotation
a problem; it requires activities such as
Refinement Decrease in the incidence or
planning a course of action, collecting data,
impact of procedures applied to animals that are
interpreting data, reaching a conclusion and
needed for research
communicating these activities. Investigations
can include observation, research, field work, Reliability The degree to which an assessment
laboratory experimentation and manipulation of instrument or protocol is able to consistently
simulations and repeatedly measure an attribute and
achieve similar results for the same population
Logbook The record of an experiment or
investigation kept by the scientist performing Reliable data Data that have been judged to
the experiment; it is a legal record of the have a high level of reliability
experiments and their results Replacement Substitution of insentient
Mean The average of a set of values, found by materials for conscious living animals
adding all the values together and dividing by Research question The specific question that
the number of values a particular experiment or investigation is
Measurement error The difference between the attempting to answer
measurement result and a currently accepted or Scientific method A process of systematic
standard value of a quantity observation and experimentation, inductive
Median The central value in a data set, found and deductive reasoning, and the formation and
by placing the values in ascending order and testing of hypotheses and theories
selecting the middle value or, if there is an even Secondary data Data or information that have
number of values, taking the average of the two been collected by someone else
central values
Sentience The capacity to feel and experience
Model A representation that describes, emotions such as pain, fear, joy and pleasure
simplifies, clarifies or provides an explanation
Theory A collection of models and concepts
of the workings, structure or relationships
that explains specific systems or phenomena;
within an object, system or idea
scientific theories allow predictions to be made
Outlier A data point that does not fit the and hence are falsifiable
pattern shown by other measured data points
Validity The extent to which tests measure
Plagiarism Presenting someone else’s work, what was intended, and the extent to which
including their words or ideas, as your own data, inferences and actions produced from tests
Primary data Data that you have measured or and other processes are accurate
collected yourself Variable Something that can change or be
Qualitative measurement A measurement with changed, as distinct from a constant, which does
descriptive or non-numerical results not change
9780170452922
CHAPTER 1 REVIEW QUESTIONS

Remembering
1 A scientist in Australia observed the effects of a potential vaccine on some ferrets and recorded
the data in a table. The Australian scientist sent the data to a scientist working for the World
Health Organization. Which scientist collected primary data and which scientist collected
secondary data? State the criteria for your selection.
2 Scientists have studied the effects of the amount of annual/seasonal rainfall (mm) on
agricultural beef production (measured in a standard cattle unit). Rainfall varies in different
areas of WA. Some pastoralists are exploring the use of supplementary irrigation systems to
grow improved tropical pastures such as sorghum and cowpea for the production of hay to feed
cattle during periods of low rainfall.
For the research already conducted on beef production, state the independent and dependent
variables.
Understanding
3 If one student reads 27.5°C and another student reads 27.8°C when taking the temperature
of the same solution, suggest two strategies they could adopt to decrease the error, and thus
increase the reliability of their readings.
Applying
4 Identify whether each of the following statements is a prediction, hypothesis, inference or
conclusion.
a I deduce that a Year 12 student with dark circles around his eyes has had little sleep.
b If the amount of regular homework completed decreases, then a student’s assessment marks
will decrease. (The trend is going to be investigated with an experiment.)
c A Year 12 student will know more about biology than a Year 2 student.
d It was found that 93% of students who handed in homework regularly achieved a
satisfactory or above grade. This supported the hypothesis that regular homework has a
positive impact on assessment scores.
5 In recent years, WA has exported more than 350 000 live cattle per annum. WA has an excellent
clean animal health status and a National Livestock Identification System that allows the
strictest biosecurity protocols to be practised. For the time period of 2016/17, the main export
markets for WA live cattle were Indonesia, Vietnam, Israel, Turkey and Malaysia.
Construct a pie chart for the following data. Use a ruler and a protractor if you are drawing by
hand, or use a software program such as Excel.
Indonesia 46%
Vietnam 18%
Israel 18%
Turkey 15%
Malaysia 2%
Other markets 1%
9780170452922

Questions 1 and 2 relate to the information The numbers of seeds per flower for each of
below. the five plants were as follows.
Some businesses provide life insurance for pets. FLOWER 1 FLOWER 2 FLOWER 3 FLOWER 4
Data were obtained from one business on the Plant 1 17 22 18 18
cause of death of insured cats over the period
Plant 2 12 2 9 –
1999–2006. The data are shown in the table
Plant 3 40 16 13 14
below.
Plant 4 21 18 – –
CAUSE OF DEATH NUMBER OF INSURED CATS Plant 5 41 – – –
Kidney failure 907 The mean number of seeds per flower for
Traffic accidents 411 Plant 2 is:
A 5.8
Other accidents 153
B 7.7
Skin cancers 165 C 14.5
Blood cancers 235
D 18.8.
[Q16 2017 SCSA]
Other cancers 128
4 In an experiment, the factor that is
Viral infections 407
manipulated by the experimenter is called:
Bacterial infections 24 A a control
Heart disease 421 B a dependent variable
C an independent variable
Hormonal disease 98
D a replicate.
1 What proportion of cats in the data above
[Q22 2017 SCSA]
died from cancers?
A 0.04 5 A man’s resting heart rate was measured
B 0.12 at weekly intervals over a 5-week period
C 0.14 during which the man undertook fitness
D 0.18 training. The data are tabulated below.
[Q19 2019 SCSA] WEEK RESTING HEART RATE (BEATS PER MINUTE)
2 Which of the following is a valid conclusion 1 84
from the data? 2 80
A Few owners vaccinate their cats against 3 71
viral infections. 4 69
B Kidney failure is the most common 5 66
cause of death in uninsured cats.
C Infectious diseases killed more insured These data indicate that the man’s resting
cats than heart disease. heart rate:
D Cat owners mainly insure their cats A was above 90 beats per minute before
when the cats are ill. the experiment began
B will drop below 60 beats per minute if
[Q20 2019 SCSA]
the fitness training continues
3 Biologists counted the number of seeds C declined at the fastest rate between
produced by the flowers on five plants weeks 2 and 3
infected with a disease. The data are shown D increased by 20 beats per minute over
in the table. Note that some plants had more the 5 weeks.
flowers than others. [Q6 2016 SCSA]
9780170452922
6 An increase in the sample size of an d Explain why the biologist waited for
experiment will: 15 minutes before measuring the heart
A increase the reliability and validity of rate of the Daphnia at the assigned
the experiment temperature. (3 marks)
B increase the reliability of the experiment e One of the Daphnia had a heart rate of
but not the validity 208 beats per 20 seconds. A biologist
C increase the validity of the experiment concluded that this Daphnia must have
but not the reliability been assigned to a temperature of 30°C.
D not affect the reliability or validity of Evaluate this conclusion. (4 marks)
the experiment. [Q32 2019 SCSA]
[Q12 2016 SCSA]
8 Soil salinity is a problem in agricultural
7 The water flea Daphnia is a small areas because many crop species cannot
crustacean that lives in fresh water. tolerate high concentrations of salt.
When Daphnia are examined under low Biologists conducted an experiment to
magnification with a microscope, the investigate why barley is more tolerant of
heart is clearly visible and the beats can soil salt than lupins are. They germinated
be counted. A biologist wanted to study 90 barley plants and 90 lupin plants and
the influence of temperature on the heart grew the plants in identical conditions
rate of Daphnia. He collected 50 Daphnia, except for variation in the concentration of
randomly assigned 10 individuals to each salt in the soil. After 6 weeks, the biologists
of five temperatures and measured the heart measured the concentration of salt in the
rate of each individual after 15 minutes at xylem tissue of the plants. The results are
the assigned temperature. The results are shown in the table below.
shown in the table below.
MEAN SALT
HEART RATE OF 10 CONCENTRATION
DAPHNIA (BEATS PER 20 s) IN THE XYLEM (mmol L-1 )
TEMPERATURE (°C) MEAN RANGE SALT

CONCENTRATION BARLEY LUPINS
2 59 39–85
IN SOIL (mmol L-1 )
10 119 82–151
0 0 0
20 142 92–234
25 2 No data
30 257 178–328
50 2 3
40 401 206–596
75 No data 7
a Graph the mean heart rate of the 100 5 6
Daphnia against temperature. (6 marks) 125 No data 6
b i Estimate the heart rate for Daphnia
150 4 No data
at 15°C. (1 mark)
175 No data 59
ii Estimate the heart rate for Daphnia
200 7 No data
at 45°C. (1 mark)
iii In which estimate do you have the a Graph the mean salt concentration
greater confidence? Give a reason for found in the xylem for both barley and
your answer. (2 marks) lupins against the salt concentration in
c i What is the independent variable in the soil. (6 marks)
this study? Give a reason for your b i Estimate the mean xylem salt
answer. (2 marks) concentration for barley for a soil
ii State one way of improving the salinity of 175 mmol L-1. (1 mark)
reliability of the study. (1 mark) ii Estimate the mean xylem salt
iii Propose a hypothesis for the study. concentration for lupins for a soil
(1 mark) salinity of 150 mmol L-1. (1 mark)
9780170452922
iii In which of the above estimates do except for the variation in soil salinity.
you have more confidence? Give a (3 marks)
reason for your answer. (2 marks) d Explain why the biologists used 90 plants
c Explain why the biologists grew the of each species rather than 18. (3 marks)
plants under identical conditions [Q34 2018 SCSA]
9 A group of biologists developed a model for predicting the spread of influenza in human
populations. As a part of this, they collected data on the number of individuals per household
in two locations, which are shown in the figure below.
Location 1 Location 2
100
sdlohesuoh fo rebmuN
140
80 120
100
60
80
40 60
40
20
20
0 0
1 2 3 4 5 6+ 1 2 3 4 5 6+
Number of people per household Number of people per household
Compare the number of people per household in the two locations. Use the data provided in
the graphs to support your answer. (4 marks)
[Q32a 2016 SCSA]
10 Biologists suspected that a species of fruit fly was developing resistance to a commonly
used insecticide. They collected 1000 fruit flies from an orchard sprayed regularly with this
insecticide. In the laboratory, they sprayed the fruit flies from the orchard with the recommended
dose of insecticide and measured the percentage survival of the flies over the next 100 hours. At
the same time, they also sprayed a group of 1000 laboratory-reared fruit flies of the same species
that had never been exposed to insecticide and recorded their percentage survival over the next
100 hours. Fruit flies in both groups were kept under identical culture conditions. The data are
shown below.
% FRUIT FLIES FROM THE % LABORATORY-REARED FRUIT

TIME SINCE SPRAYING (HOURS)
ORCHARD SURVIVING FLIES SURVIVING
0 100 100
20 97 8
40 51 4
60 50 2
80 49 2
100 49 0
a Graph the percentage of fruit flies surviving over time for both the fruit flies from the
orchard and those from the laboratory. (6 marks)
b i State a hypothesis for the fruit fly experiment. (2 marks)
ii Does the fruit fly experiment have a control? Explain your answer. (3 marks)
9780170452922
c i Calculate the number of flies from the orchard that died between 20 and 40 hours after
being sprayed. Show your workings. (2 marks)
ii Using your graph, estimate the time by which 50% of the fruit flies from the laboratory
had died. (1 mark)
iii Explain how you could modify the experiment to improve the accuracy of the estimate
of the time by which 50% of the fruit flies from the laboratory had died. (2 marks)
[Q33 2017 SCSA]
9780170452922
25
2
PROCESSES FOR CHAPTER 2 CONTENT
By the end of this chapter, you will have covered the following
THE CONTINUITY material.
OF LIFE STARTER QUESTIONS

1 Can you describe the processes required for the genetic code
to be transferred to the next generation?
2 How do single cells and whole organisms transfer their
genetic material to daughter cells? Is the transfer similar?
3 Do all cells duplicate their chromosomes before division?
SCIENCE UNDERSTANDING
» continuity of life requires the replication of genetic material
and its transfer to the next generation through processes,
including binary fission, mitosis, meiosis and fertilisation
» DNA is a helical double-stranded molecule that occurs
bound to proteins in chromosomes in the nucleus, and as
unbound circular DNA in the cytosol of prokaryotes, and in
the mitochondria and chloroplasts of eukaryotic cells
» variations in the genotype of offspring arise as a result of the
processes of meiosis, including crossing over and random
assortment of chromosomes, and fertilisation, as well as a
result of mutations
9780170452922
2.1 THE CONTINUITY OF LIFE

All living things are made of cells and all cells originate from pre-existing cells. Each cell contains
genetic information that codes for traits that are passed on to future generations. For life to continue,
the processes of cell division must occur. Cell division is the splitting of a cell into new functioning
cells. Organisms require cell division for growth, development, repair and reproduction. In biology,
heredity is the study of the processes that are involved in transmitting genetic material to the next
generation. For example, when black swans breed to produce a cygnet, the process of meiosis is
required to create the cells that will fuse (during fertilisation) to form the cygnet’s first cell. After
meiosis and fertilisation, mitosis plays a major role in the growth of the cygnet.
elaD acisseJ/moc.kcotsrettuhS
FIGURE 2.1 This cygnet has been formed by the process of cell division.
All individual organisms have a finite life span, but their species continue to exist. This is because
some members of the species reproduce and pass on specific instructions embedded in their DNA
(deoxyribonucleic acid). DNA is a double-stranded helix with repeating units (building blocks) called
nucleotides. A nucleotide is made up of three parts: a five-carbon sugar, a phosphate group and a
nitrogenous base .
It is the DNA that determines the characteristics that define species. In all living things, DNA is the
molecule that contains the instructions, written in a chemical code, for the production of proteins
by the cell; the information it contains is sufficient for the making and maintaining of an organism. In
addition, DNA is the genetic material that passes on this information to the next generation.
Key concept
DNA is a helical, double-stranded molecule that contains the building blocks of life. It
determines the characteristics of all species and is passed down from generation to generation.
Living things that originate from one parent cell are said to be the product of asexual
reproduction. In this process, the offspring are produced without fusion of gametes. It usually
results in identical offspring that closely resemble their parent because they have only one source of
inherited information.
Organisms that reproduce via sexual reproduction have two sources of hereditary material.
Sexual reproduction is a process in which specialised male and female reproductive (sex) cells, called
gametes, are produced, and then fuse to form a zygote. Fertilisation occurs when the two gametes
join to form the zygote. Sexually reproducing organisms have a much greater potential for differences
in characteristics between generations than asexually reproducing organisms.
9780170452922
CHAPTER 2 | Processes for the continuity of life 27
Chromosomes of eukaryotes
Eukaryotic cells are complex cells containing many membrane-bound organelles, including a
nucleus. In eukaryotic cells, DNA is found in the nucleus bound to histone proteins. DNA is also found
in the chloroplasts and mitochondria; however, this form is not bound to proteins. The combination
of DNA and histone proteins found in the nucleus is called chromatin.
When the cell is not dividing, the chromatin is organised into a relatively loosely coiled form. As
the cell prepares to divide, chromatin coils more tightly and becomes visible as chromosomes. During
the process of cell division, the chromosomes appear in the nucleus as duplicated structures linked at
a point called the centromere. Chromosomes are normally only visible under the microscope during
cell division, and only then when stained (Figure 2.2).
Key concept
In eukaryotic cells, DNA is bound to histone proteins in the nucleus and is unbound in the
mitochondria and chloroplasts.
1400 nm
2 nm
c
b
30 nm
700 nm
d
11 nm
FIGURE 2.2 Levels of organisation of a human chromosome. a A tightly coiled and condensed human
chromosome (only visible during cell division and when stained). b A nucleosome, consisting of a section of
a DNA molecule looped twice around a core of eight histone proteins. c Interacting proteins package loops
of coiled DNA and protein, called chromatin, which is organised as a cylindrical fibre. d Chromatin is further
condensed to make chromosomes.
Key concept
A chromosome is made up of a double-stranded DNA molecule wrapped around its associated
histone proteins.
In many eukaryotes, there are pairs of chromosomes, with one chromosome of each pair being
inherited from each parent. Examination of a prepared microscope slide of stained cells in the process
of nuclear division reveals a jumbled cluster of chromosomes that differ in size and shape. The
chromosomes visible in a photographic image of the microscope slide can be arranged into matched
and ordered pairs to create a karyotype, the standard graphical form used to display and analyse
chromosomes (Figure 2.3, page 28). Most of the chromosomes are ordered according to length, from
largest to smallest. Each species of organism typically has a particular number of chromosomes in
each cell.
9780170452922
1 2 3 4 5 6
7 8 9 10 11 12
13 14 15 16 17 18
19 20 21 22 X Y
23
FIGURE 2.3 A male human karyotype showing 23 pairs of chromosomes
The nucleus of each somatic cell (body cell) of a human contains 46 chromosomes, which
form 23 pairs, of which 22 are matched homologous chromosomes (Figure 2.4). The nucleus
of a Tasmanian devil somatic cell contains 14 chromosomes, which form 7 pairs, of which 6 are
homologous. The chromosomes are recognisable individually by their size, position of centromere
and banding pattern. The bands on the chromosomes correspond to large groups of genes.
Maternal Paternal
chromosome chromosome
This locus a A
contains
gene A
b B
This locus C c
contains
gene C
Centromere
d D Gene D : alleles D or d
E e Gene E : alleles E or e
f F Gene F : alleles F or f
FIGURE 2.4 Stylised representation of a pair of chromosomes. In the somatic cells of diploid organisms, one of
each pair of chromosomes comes from the male parent and the other from the female parent.
9780170452922
The paternal chromosome in each pair of chromosomes comes from the male parent (via
the male gamete), and the maternal chromosome comes from the female parent (via the female
gamete).
The matched homologous pairs of chromosomes are also called autosomes. In humans the 23rd
pair of chromosomes is matched in females (XX) and unmatched in males (XY). As such, this pair of
chromosomes in males is called a heterosome. Because the X and Y chromosomes determine the
sex of an individual, they are also referred to as sex chromosomes. The 7th pair of chromosomes in a
Tasmanian devil’s karyotype are the sex chromosomes.
Early in an embryo’s development, its germline cells specialise into male or female gametes
through the process of differentiation.
The number of chromosomes in each somatic cell is called the diploid number and is
represented as 2n. As chromosomes occur in pairs, n stands for the number of chromosomes in one
complete set found in one gamete, and the number of pairs that the particular species has in each
of its other cells. This is called the haploid number. A human somatic cell has 23 pairs, so its diploid
number is 2n = 46 and its haploid number is n = 23.
Along the length of each DNA molecule, there are regions of DNA (genes) that code for specific
proteins. These proteins determine the particular characteristics or traits of the organism. The
location of a specific gene on a chromosome is referred to as its locus (plural loci). In homologous
chromosomes, the corresponding gene is found at the same locus on each of the pair of
chromosomes. Alternative forms of the same gene are called alleles. Alleles are versions of the same
gene with slight differences. Sometimes there is just one single difference in the genetic sequence,
but it may be enough to cause large variation in the functioning of the gene. For example, a change
in the genetic sequence in a single gene causes juvenile hereditary cataracts (JHC) in French bulldogs
that have two copies of the changed allele. A normal, diploid organism has two of each gene in every
somatic cell with a nucleus. One is on the maternal chromosome and the other on the paternal
chromosome in a particular homologous pair, so one gene comes from each parent. For the majority
of genes, there is only one allele (or gene variant), but it is the different alleles that exist for some
genes that give individuals distinct traits.
Chromosomes of prokaryotes
Membrane-bound organelles, such as a nucleus, are not present in the single-celled organisms
known as prokaryotes. The DNA within these cells generally forms a single circular chromosome that
lies in direct contact with the cytosol (intracellular fluid) (Figure 2.5, page 30). The chromosome is
often joined to the cell membrane at a single point. Although not contained by an internal membrane,
the chromosome can be in a distinct region of the cell called a nucleoid. Additional small rings of
DNA, called plasmids, may also be present in the cytosol. Non-essential proteins are commonly
encoded on these plasmids. Plasmids can replicate independently of the main chromosome. They
have become important tools in genetic engineering, because they can be easily transferred from one
bacterium to another and replicate rapidly.
Key concept
In prokaryotes, DNA is found in the cytosol as unbound circular DNA.
Eukaryotic chromosomes are linear, with longer lengths of DNA than is present in prokaryotes,
and they need to condense into a small volume. A number of proteins work together to fold and
condense the DNA into chromatin. Prior to dividing, chromatin is condensed even further by
supercoiling to form chromosomes. Prokaryotic cells have less DNA because they are generally
haploid (i.e. only contain one copy of each gene) and they contain less repetitive non-coding DNA.
9780170452922
Ribosomes Bacterial Cell Cell wall Cytosol Plasmid

chromosome membrane
FIGURE 2.5 DNA in a prokaryotic cell
Just as with many other strategies in nature, there are exceptions. Not all bacteria have a single
circular chromosome. There are some bacteria with more than one circular chromosome. Other
bacteria have linear chromosomes and linear plasmids. Another notable difference between the
chromosomes in prokaryotes and those in eukaryotes is the presence of histones. Most prokaryotes
do not have histones (with the exception of some species in the domain Archaea).
TABLE 2.1 Differences between typical prokaryotic and eukaryotic cells
FACTOR PROKARYOTIC CELL EUKARYOTIC CELL

Typical diameter 1–5 micrometres 10–100 micrometres
Location of DNA In cytosol (in nucleoid) In nucleus, mitochondria and chloroplasts
Membrane-bound No membrane-bound organelles Membrane-bound organelles, including a
organelles nucleus
Ribosomes Yes, they float freely in the cytosol Yes, they can float freely in the cytosol or
be attached to the endoplasmic reticulum
Chromosome(s) A single circular DNA strand (typically, DNA is wrapped around proteins
without histones) (called histones), creating units called
nucleosomes. This loosely coiled form of
DNA and protein is called chromatin. The
chromatin coils more tightly (‘condenses’)
to form chromosomes in preparation for
mitosis or meiosis.
Question set 2.1

REMEMBERING 3 Draw a pair of chromosomes and label the
1 Define: centromere, genes and loci.
a cell division UNDERSTANDING
b sexual reproduction 4 Explain the difference between haploid
c asexual reproduction. and diploid numbers of chromosomes,
2 Describe the process of constructing a using an example.
karyotype.
9780170452922
5 Explain why fertilisation only occurs ANALYSING

during sexual reproduction. 8 Analyse the information about eukaryotic
6 Discuss the relationship between genes and prokaryotic cells, and describe three
and traits. of the similarities.
7 Distinguish between prokaryotic cells and
eukaryotic cells.
2.2 CELL DIVISION

Within an organism, eukaryotic cells pass on their instructions for growth and development from
one generation of cells to the next during cell division. To complete the process of cell division, both
nuclear division (mitosis or meiosis) and cytoplasmic division (cytokinesis) must occur. Mitosis is
a type of nuclear division occurring in somatic cells that maintains the parental diploid number of
chromosomes in the daughter cells; it is the basis of both bodily growth and asexual reproduction in
many eukaryotic species.
The terms ‘parent’ and ‘daughter’ cells are used for communication purposes to help distinguish
the original cell from the newly formed cells.
Under normal circumstances, cell division takes place through an orderly process. Mitosis and
cytokinesis result in the formation of two diploid daughter cells, which each contain identical sets of
chromosomes.
Meiosis is the form of eukaryotic cell division concerned with the production of gametes (sex
cells) in sexually reproducing organisms. Meiosis, a type of cellular division involving one cycle of DNA
replication and two rounds of cell division, results in the production of four haploid daughter cells
from each original diploid parent cell.
At fertilisation, two haploid gametes, a male and a female, combine to form a diploid zygote.
Key concept
Eukaryotic cell division involves a number of phases, including nuclear division (mitosis or
meiosis) and cytoplasmic division (cytokinesis). The processes of mitosis and meiosis allow for
the replication and transfer of genetic material to the next generation.
The cell cycle

The sequence of events from one cell division to another is called the cell cycle (Figure 2.6, page 32).
The cell cycle is the ordered sequence of events in the life of a cell. It begins when the cell is formed
from its parent cell and is completed with its own division. Even though we describe this cycle as
taking place in phases, in reality it is usually a continuous process. The cell division stage, in which
nuclear division and cytokinesis occur (known as M phase, or mitotic phase), is only a small part of the
cycle. The stage between cell divisions is called interphase, and it incorporates a period of metabolic
activity and growth (G1 phase, or first ‘gap’ phase), duplication of the chromosomes (DNA replication)
and of the centrosomes (S phase, or ‘synthesis’ phase), and further growth and reproduction
of organelles as the cell prepares to divide (G2 phase). A further phase, G0, can also be seen in
Figure 2.6. Cells in G0 are in the non-proliferating state – they are undergoing an extended G1 but are
not preparing to replicate their DNA and divide. Cells in G0 have withdrawn from the active cell cycle
and can only re-enter the cell cycle under certain circumstances.
9780170452922
The length of the cell cycle varies from cell to cell, and not all cells divide. For example, most
specialised cells, such as nerve cells and retinal cells in adult humans, do not divide. On the other
hand, during developmental growth and in areas of high wear, cells divide frequently. Cells can
Control of the Cell Cycle
Game divide to create new organs or tissues. For example, cells in a growing root tip may divide every
As a ‘cell division 20–24 hours. Cells in high-wear areas, such as in the skin or in the lining of the mouth or gut, divide
supervisor’ inside the to replace the dead cells ‘sloughed off’ due to mechanical disturbance, or in response to new cells
cell nucleus, you are to
steer the cell division growing below.
process to make sure
G0 phase
everything happens in
the right order.
G1 phase
NI
RET
Cell growth before
DNA replication
P
Generalised
ESAH
animal cells S phase
DNA replication
C phase
Cytokinesis
Mitosis
Nucleus G2 phase
divides Cell prepares
for division
PH
M
AS
E
FIGURE 2.6 The life cycle of a cell. Most cells spend the majority of their time in interphase.
Question set 2.2a

REMEMBERING
1 Define:
a interphase
b mitosis
c meiosis.
2 List and define the six phases of the cell cycle.
UNDERSTANDING
3 Explain why the terms ‘parent’ cell and ‘daughter’ cell are used.
4 Distinguish between mitosis and cytokinesis.
ANALYSING
5 After analysing the cell cycle, draw and label a cell cycle of your own.
9780170452922
Mitosis in eukaryotic cells

Prior to any cell division, a doubling of the genetic material needs to take place. This happens
during interphase (Figure 2.6). Chromosomes are not visible during interphase and cannot be clearly
distinguished under a light microscope or an electron microscope. As the cell leaves interphase
and begins mitosis, the chromatin threads get shorter and thicker, becoming visible under a light
microscope. The centrosome, which contains two centrioles, becomes visible and is duplicated
during the S phase in many cells. The centrosomes produce the spindle fibres during mitosis and
meiosis. They also facilitate correct separation of the chromosomes into the daughter cells.
Also during the S phase, the chromatin duplicates and the cell doubles its amount of genetic
material. Chromosomes form from the chromatin during the first phase of cell division in the cell
cycle, known as prophase. The DNA and histones condense, and each chromosome becomes
visible for the first time, appearing as an ‘X’ shape. The ‘X’ is made up of two chromatids attached
to each other over a small region of their DNA called the centromere (Figure 2.7). Even though
each chromosome consists of two chromatids, it is still considered to be one chromosome. The
centromere is important for the attachment of chromosomes to spindle fibres. Spindle fibres are
generated by the centrioles, which are the two small organelles inside each centrosome. Centrioles
use the spindle fibres to move the sister chromatids to opposite ends of the cell during cell division.
Homologous chromosomes Homologous chromosomes
Replication
Centromere
Sister Sister
chromatids chromatids
FIGURE 2.7 Homologous chromosomes at two different stages of the cell cycle
Mitosis is a relatively short part of the cell cycle, and is broken down into four phases: prophase,
metaphase, anaphase and telophase. The phases of mitosis are described in detail in Table 2.2
(page 34). At the conclusion of mitosis, there is a diploid number of chromosomes in the daughter
cells, but they have half the genetic material of the parent cell in prophase. It is important to
remember that one chromosome can consist of either one DNA double helix or two DNA double
helices connected by a centromere. This helps clarify why the chromosomes of a parent cell at the
start of mitosis look different from those of a daughter cell at the end of mitosis, even though there is
a diploid number of chromosomes in both of them.
Following mitosis, cytokinesis occurs, which forms two separate, diploid daughter cells. The
daughter cells produced by mitosis are usually identical, and therefore very little variation in offspring
arises during mitosis. Mitosis is nuclear division, during which the genetic material in the parent cell is
replicated, and cytokinesis is the division and separation of the cytoplasm to create the new daughter
cells.
Key concept
Identical daughter cells are produced as a result of mitosis; in other words, variation between
daughter cells is limited in mitosis.
9780170452922
TABLE 2.2 Mitosis – four main phases
PHASE LABELLED ILLUSTRATION

Prophase
Centromere
1 Chromatin threads condense to form chromosomes and become Spindle
visible under the microscope. fibre
2 Chromosomes consist of two sister chromatids held together by

a centromere.
3 The nuclear membrane disintegrates and the nucleolus (organelle
inside the nucleus where ribosomes are assembled) disappears.
4 The mitotic spindle begins to form and is completed by the end
of prophase. The spindle fibres attach to each chromosome at its Cytosol
centromere.
5 The two centrosomes (each containing two centrioles) move
Chromosome Nucleolus Centrosome
towards opposite poles of the cell.
FIGURE 2.8 Prophase
Metaphase Metaphase Centrioles

1 The chromosomes move to the centre of the cell and line up plate
along the equator of the cell. The equator is also referred to as
the metaphase plate.
2 The centromeres of the chromosomes are aligned on the
equator.
3 The centrioles are located at opposite poles of the cell.
Cell
membrane
Spindle
Centromere fibre
FIGURE 2.9 Metaphase
Anaphase
1 The spindle microtubules shorten and pull on the centromeres;
the sister chromatids separate. Sister chromatids separate to become
separate chromosomes
2 The spindle microtubules pull the sister chromatids to opposite
poles of the cell.
3 The centromere, being attached to the microtubules (spindle
fibres), is the first part of each chromosome to be pulled towards
the poles. The ‘arms’ of each chromatid follow as they are pulled
along by the centromere.
4 At the end of this phase, each pole has a complete identical set of
maternal and paternal chromosomes. (The genetic material doubled
during the S phase, before cell division started, so the amount of
DNA at each pole is the same as that of the interphase parent in G1.) FIGURE 2.10 Anaphase
5 The sister chromatids are now referred to as chromosomes.
Telophase
1 Chromosomes decondense to form chromatin, at which time
they can no longer be seen under the microscope.
2 Two new nuclear membranes (also known as nuclear envelopes)
form, one for each new daughter cell.
3 Nucleoli reappear and the spindle apparatus disappears.
4 The cell elongates and a cleavage furrow forms to become ready Cleavage furrow
for cytokinesis.
FIGURE 2.11 Telophase
9780170452922
Prophase Metaphase
ekhcseR dE/segamI ytteG

Anaphase Telophase
FIGURE 2.12 These micrographs show prophase, metaphase, anaphase and telophase in onion root tip cells.
Cytokinesis in eukaryotic cells

Plant cells
The cytoplasm of plant cells divides with the formation of a structure called a cell plate. Figure 2.13
shows how parts of the cell wall fuse with parts of the spindle, forming the cell plate. Cellulose is
deposited at this site, forming a wall that divides the parent cell into two daughter cells, each one with
a cell membrane.
Spindle equator Vesicles gathering Cell plate growing Two daughter cells
FIGURE 2.13 Cytokinesis in a plant cell involves the formation of a cell plate; cellulose is deposited on the cell plate to complete the cell
walls of the two new daughter cells.
Animal cells
Animal cells do not have a cell wall, and so cytokinesis in animal cells does not require the formation
of a cell plate. In animal cells, the cytoplasm divides by a process known as cleavage. The cell
membrane around the middle of the cell draws together to form a cleavage furrow. The cleavage
furrow continues to develop until the cell membrane eventually meets at a point, and the cell is then
cleaved, or split, resulting in two new daughter cells (Figure 2.14).
9780170452922
a b
spillihP divaD .rD/ecruoS ecneicS
spillihP .M divaD/ecruoS ecneicS
Cleavage furrow
FIGURE 2.14 a Micrographs of an animal cell during cytokinesis, showing the cleavage furrow from a distance and b close up. c After
formation of a cleavage furrow, the cell divides to produce two new daughter cells.
Centrosome
containing Spindle made up Condensed
Nucleus pair of centrioles of microtubules Chromosomes chromosomes
begin to condense
Mitosis and meiosis
animations
Watch this animation
that explains mitosis
and meiosis side by side.
Nucleolus Nuclear
envelope
Interphase Early prophase Transition to metaphase
Metaphase Anaphase Telophase Interphase
FIGURE 2.15 Mitosis is a continuous process.
9780170452922
Question set 2.2b

REMEMBERING 5 Discuss whether homologous
1 Name the four phases of mitosis. chromosomes have the same number of
2 Draw and label a chromosome prior to the genes or identical genes.
S phase and after the S phase in the cell cycle. 6 Compare the diploid number of
3 What is one major difference between chromosomes at the beginning of mitosis
cytokinesis in plant cells and animal cells? in the parent cell with the diploid number
of chromosomes at the end of mitosis in
UNDERSTANDING the daughter cells.
4 Draw a labelled diagram to show your
understanding of the following terms: APPLYING
a maternal and paternal homologous 7 Construct a diagram showing the
chromosomes four phases of mitosis and cytokinesis
b diploid using three pairs of homologous
c spindle microtubules (spindle fibres) chromosomes.
d centromere.
Marsupial chromosomics: bridging the gap between CASE

STUDY
genomes and chromosomes
The number and general appearance of a sequenced only a decade ago, but since
set of chromosomes within the nucleus of a then advances in biotechnology have made
typical human body cell was first published the sequencing of many more marsupials
in 1956. The process of pairing and ordering possible. Comparing chromosomes of Evolution of marsupial
genomes
the chromosomes of an organism is called different marsupial genomes can help What do genomes have
karyotyping. A karyotype provides a snapshot scientists start to unravel mysteries relating to say about marsupial
history?
of an organism’s genome (all of the genetic to speciation, adaptation and survival.
material contained in an organism or a Questions
cell). One of the first organisms that had its
chromosomes ordered and paired was Thale 1 Name one of the first organisms to have
cress, a small flowering plant that has five its chromosomes’ DNA sequenced.
chromosomes. 2 Describe the relationship between a
Over time, parts of chromosomes can karyotype and a genome.
change. Researchers at CSIRO and the 3 State one reason why it may take longer
University of Canberra have spent time to sequence a marsupial’s genome,
investigating these changes in marsupial compared with that of a plant such as
genomes. The first marsupial genome was Thale cress.
namhcaB lliB/otohP kcotS ymalA
FIGURE 2.16 Genomic studies of marsupials, such as this tiny western pygmy possum, are being used to
find their evolutionary relationships.
9780170452922
Binary fission
Cell reproduction is more complex in eukaryotes than in prokaryotes. As prokaryotes lack a nucleus
and have only a single chromosome with no centromere, they cannot be properly said to undergo
mitosis. They reproduce by binary fission. Binary fission can be defined as a process of asexual
reproduction whereby a prokaryotic cell divides into two identical daughter cells. The process
includes DNA replication, chromosome segregation and cytokinesis. As in mitosis, binary fission
produces daughter cells with the same number of chromosomes as the parental cell.
There is limited variation in prokaryotic populations other than that due to mutation. However,
binary fission is a process that happens relatively fast compared with other cell division processes,
which means the mutation rate is much higher.
Prokaryotic bacterial cells replicate their single DNA strand, signalling the beginning of binary
fission. Following replication, each DNA copy attaches to a different part of the cell membrane. When
the cell begins to lengthen during cell division, the replicate (copy) and original chromosomes are
separated. A wall forms across the cell and divides it into two cells of identical genetic composition.
A process similar to binary fission occurs in eukaryotic cells when mitochondria and chloroplasts
divide to form new organelles. They divide independently of the nuclear DNA but segregate evenly
into the two daughter cells during cytokinesis.
Binary fission can be summarised into six steps, but it is helpful to note that, like mitosis and
meiosis, binary fission is actually a continuous process, not one that stops and starts.
1. Prior to binary fission, the single chromosome is tightly coiled.
2. The genetic material in the chromosome and any plasmids replicates and separates.
3. The original and replicate chromosomes attach to the cell membrane and are
/gro.snommocevitaerc//:sptth( 0.3 AS YB CC .41notgniddocE/aidemikiW
pulled to separate poles as the cell elongates.
4. The new cell wall starts to grow. As this process commences, a cleavage furrow
develops in the cell membrane.
5. The new cell wall fully develops.

)ne.deed/0.3/as-yb/sesnecil
6. The two cells separate (cytokinesis), forming two identical daughter cells.
The chromosomes become tightly coiled again.
FIGURE 2.17 Prokaryotic cells reproduce by binary fission.
Question set 2.2c

REMEMBERING UNDERSTANDING
1 Place the following terms in order for the 2 Explain what causes variation in
main processes of binary fission. prokaryotes and why this may occur at a
Cleavage furrow develops Cytokinesis higher rate than in eukaryotes.
Chromosome replicates Cell elongates 3 Draw a labelled diagram to show the
New cell wall is completed sequence of events of binary fission. You
may like to create a binary fission poster.
9780170452922
Meiosis in eukaryotic cells

Meiosis occurs in specialised organs in sexually reproducing animals and plants. It results in the
production of gametes, also known as sex cells. In animals, male and female gametes are called
sperm and eggs (ova). In many plants, male and female gametes are found within pollen and ovules.
In some plants, spores are produced that grow into haploid plants (gametophytes).
Meiosis is a unique type of cell division in that the daughter cells produced have only half the
number of chromosomes of the parent cell. This prevents the doubling up of the diploid number of
chromosomes at fertilisation. In meiosis, two divisions of the nucleus of the parent cell take place.
In the first division, the chromosomes of each pair separate and go to either end of the cell. In
the second division, the chromatids of each chromosome separate from each other. Four haploid
gametes are thus produced, each carrying half the original number of chromosomes. As the number
of chromosomes is reduced by half, meiosis is called a reduction division.
The reason why there are pairs of chromosomes in somatic cells, two of each chromosome
type, is because one is from the father and one is from the mother. The pair are often referred to as
paternal and maternal homologous chromosomes. As mentioned previously, scientists use the letter n
to represent the number of chromosomes in one gamete; it is also the number of chromosome pairs
in an organism. During meiosis, the chromosomes of each homologous pair separate to each gamete
at random, contributing to the variation in offspring.
The phases of meiosis represent the continuous process by which a diploid parent cell gives rise
to four haploid, non-identical daughter cells. Prior to meiosis, duplication of DNA occurs. The amount
of genetic material doubles, without changing the number of chromosomes. This results in each
chromosome taking the form of two identical sister chromatids joined to each other by a centromere.
In meiosis, in order to produce four cells, each with half the original number of chromosomes, a
second division occurs.
During meiosis I, the homologous chromosomes pair up and physically connect (each pair is now
called a bivalent) in a process called synapsis. During the first step of meiosis, prophase I, there is
an exchange of genetic material between maternal and paternal homologous chromosomes (i.e.
between non-sister chromatids of the homologous chromosomes). This process is called crossing
over. Crossing over allows DNA from the person’s maternal chromosome to swap with DNA from the
Cells alive
paternal chromosome. At the end of meiosis, the chromosomes in the gametes are a recombination
Watch the meiosis
of maternal and paternal genes. In eukaryotic cells, crossing over, independent assortment and animation and
random fertilisation contribute to variation in a population. The independent assortment occurs due determine whether the
phases match those
to random orientation of the maternal and paternal homologous chromosomes during metaphase I, found in Table 2.3
which results in their random assortment into the gametes at the conclusion of meiosis. (page 40).
Key concept Homologous

Chromatids with
non-sister chromatid
The crossing over and random assortment chromosomes Bivalent DNA
of chromosomes during meiosis contribute

to variations in offspring.
Non-sister Sister Chiasma

chromatids chromatids
FIGURE 2.18 Crossing over
9780170452922
TABLE 2.3 Phases of meiosis
PHASE LABELLED ILLUSTRATION

Prophase I Prophase I Pair of
centrioles
1 Chromatin threads condense to form chromosomes and become visible under the Sister
chromatids Spindle fibres
microscope.
Nuclear
2 Maternal and paternal homologous chromosomes are attracted to each other and Homologous membrane
chromosomes
pair up (synapsis); crossing over occurs.
Duplicated homologous chromosomes
3 Each chromosome consists of two sister chromatids held together by a centromere. pair up and exchange segments
4 The nuclear membrane disintegrates and the nucleolus disappears.
5 The meiotic spindle begins to form and attaches to chromosomes at the Metaphase I
centromeres. Centromere Metaphase
plate
6 The centrosomes move to opposite poles of the cell.
Metaphase I
1 The maternal and paternal homologous chromosomes line up along the metaphase
Chromosomes line up in homologous pairs
plate (cell’s equator) in pairs.
2 The lining up of the homologous chromosomes in metaphase I is called indepen-
Anaphase I
dent assortment because each pair is lined up on one side or the other, independent Sister chromatids
remain attached
of every other pair. This results in a random assortment (random combination) of
chromosomes in the four daughter cells.
3 The spindle fibres are attached to centromeres.
Anaphase I
Each pair of homologous chromosomes separates
1 The spindle fibres shorten, pulling on the centromere of each chromosome.
2 One member of each pair of homologous chromosomes moves to each end of the
Telophase I / Cytokinesis I
cell. A random combination of maternal and paternal chromosomes are dragged to
Cleavage
each pole. furrow
Telophase I
1 New nuclear membranes form and the chromosomes uncoil.
Two haploid cells form; each chromosome
2 The spindle fibres disintegrate. still consists of two sister chromatids
Cytokinesis I: separation of the cytoplasm

FIGURE 2.19 Meiosis I
The cell splits into two cells. The daughter cells are considered haploid because they
contain only one chromosome from each pair of homologous chromosomes. No
further DNA replication occurs.
Prophase II Prophase II
1 Chromatin condenses to form visible chromosomes again.

2 New spindle fibres are produced.
3 The nuclear membrane disintegrates.
Metaphase II Metaphase II
1 Individual chromosomes line up single file along the equator in random order.
2 The spindle fibres attach to the sister chromatids at the centromeres.
Anaphase II
1 The centromeres of each chromosome disconnect, allowing the sister chromatids
to separate. Anaphase II
2 The spindle fibres shorten and individual sister chromatids move to opposite poles Sister
chromatids
of the cell. separate
3 In animal cells, the cell membrane pinches inwards to form a cleavage, whereas in
plant cells new cell wall plates form.
Telophase II Telophase II / Cytokinesis II
1 Chromosomes unwind, loosen and reform chromatin. Haploid
daughter
2 Four new nuclear membranes form around the nuclei, one in each new daughter cell. cells forming
Cytokinesis II: separation of the cytoplasm
The cells separate into four new non-identical, haploid daughter cells.
FIGURE 2.20 Meiosis II
9780170452922
Possible arrangement 1 Possible arrangement 2
Homologous
chromosomes
Homologous pairs line up with the two
paternal chromosomes either on the same side
of the metaphase plate or on opposite sides.
Meiosis I
Results in
different
genetic
Key combinations
Paternal chromosome 1
Maternal chromosome 1 Meiosis II
Paternal chromosome 2
Maternal chromosome 2
Gametes Gametes
FIGURE 2.21 Independent assortment during metaphase I. Note: Mendel’s law of independent assortment states that when gametes are
formed, the assortment of one pair of chromosomes/alleles between the daughter cells is independent of that of another pair of alleles.
Meiosis I
Interphase Prophase I Metaphase I Anaphase I Telophase I Cytokinesis I
The pairs of centrioles are Spindle equator

moving towards opposite poles
Nucleus
Two pairs Paired homologous Centromere

Sister chromatids separate to
of centrioles chromosomes (a bivalent)
become two individual chromosomes
Four haploid cells (n)
Cytokinesis II Telophase II Anaphase II Metaphase II Prophase II Interphase-type stage

with no replication (2 n)
Meiosis II
FIGURE 2.22 The stages of meiosis
9780170452922
TABLE 2.4 Comparison of mitosis and meiosis
FEATURES MITOSIS MEIOSIS
Function Nuclear and cellular division for Nuclear and cellular division for
growth, repair and replacement of producing gametes.
tissues.
Number of cell divisions One Two
Number of chromosomes Each of the two identical daughter Each of the four, non-identical
in daughter cells cells contains the diploid number of daughter cells contains the haploid
chromosomes (2n). number of chromosomes (n).
Variation New cells or offspring produced Offspring produced show variation

by this kind of reproduction do between them due to crossing
not show variation between them over in prophase I and independent
unless there are environmental assortment in metaphase I.
influences or mutations; they are
genetically identical to one another
(i.e. clones).
Diversity Diversity of offspring does not increase. Diversity of offspring is increased.
Type of cells involved Somatic cells Germline cells
Key concept
Cell division allows for the replication and transfer of genetic information in prokaryotes and
eukaryotes. Prokaryotes divide by binary fission. Somatic cells of eukaryotes divide by mitosis.
Germline cells of eukaryotes divide by meiosis.
Question set 2.2d

REMEMBERING
1 Name the eight main phases of meiosis.
2 Describe the role of cytokinesis I and II in meiosis.
3 What is the process of synapsis?
UNDERSTANDING
4 Draw a labelled diagram to show your understanding of crossing over.
5 State the phase in which independent assortment occurs and identify why it is important.
6 Distinguish between the daughter cells of mitosis and the daughter cells of meiosis.
APPLYING
7 Complete the following table for two different organisms in mitosis and meiosis.
FACTOR HUMAN TASMANIAN DEVIL
2n (diploid number) 14
Number of chromosomes in a parent cell 46
Number of chromosomes in a somatic cell at the end of

mitosis
Number of chromosomes in a sex cell (gamete) at the end of
meiosis
Number of chromosomes at the end of telophase I 7
9780170452922
Inputs
2.3 FERTILISATION Adult
female
Adult
male
2n 2n
Meiosis begins the process of transferring genetic
information to the next generation by replicating DNA
and producing male and female gametes. Fertilisation Process Meiosis Meiosis
is the joining of the two gametes to form a zygote. The
zygote receives one of each of its pairs of chromosomes
Egg
from each parent. Fertilisation completes the transfer of Sperm
genetic information to the next generation. Outputs

n
In the process of fertilisation, male and female n
haploid sex cells fuse to produce a diploid zygote. Two
Zygote
gametes from different individuals (usually one male
2n
and one female) of the same species need to combine
to produce a new individual of that species. This is
called sexual reproduction. Organisms produced by
Mitosis
sexual reproduction have a different combination of
DNA from that of either parent.
The zygote formed is a cell with approximately Growth and development
twice the amount of DNA that each gamete had.
FIGURE 2.23 The inputs and outputs of meiosis
Meiosis halves the amount of DNA, but fertilisation
restores the amount of DNA to the required amount
for a particular species. In humans, the gametes produced by meiosis contain 23 chromosomes.
Fertilisation restores the number of chromosomes to 46 (23 + 23 = 46), the number of chromosomes
in somatic cells. Different species have different numbers of chromosomes. For example, many species
of eucalyptus have 22 chromosomes, potatoes have 48 and hermit crabs have 254.
Key concept
Fertilisation leads to increased variation in offspring because it involves the fusing of two
haploid cells from two different parents to form one diploid cell (the zygote).
Maths in biology 2.1

During prophase I, maternal and paternal homologous chromosomes orient themselves
NOITACILPPA
randomly at the equator. Each maternal chromosome randomly positions itself closer to one pole
than the other, and independently of the other maternal chromosomes. The number of possible
orientations is equal to 2 raised to the power of the number of chromosome pairs. For example,
for a haploid number of n, 2n is the number of possible outcomes. Humans have a haploid number
of 23, so the number of possible assortments is 223, which gives a value of over 8 million. This
means that there are over 8 million possible combinations of chromosomes in a gamete from
one individual, just from the random orientation of the homologous chromosomes. If we add the
effects of crossing over, the number of combinations increases even further.
Question
Calculate the number of possible combinations of chromosomes in a Tasmanian devil’s
gametes (n = 7).
The role of the sex chromosomes

In humans, normally all female gametes contain 22 autosomes and an X chromosome. On the
other hand, 50% of male gametes contain 22 autosomes and a Y chromosome and 50% contain
22 autosomes and an X chromosome. Thus, in humans there is a 50% chance that, in fertilisation, a
9780170452922
sperm cell bearing a Y chromosome will fuse with an egg cell, resulting in a male zygote (XY), and
a 50% chance that a sperm cell bearing an X chromosome will fuse with an egg cell, resulting in a
female zygote (XX).
Not all life continues

Cells do not live forever; they are pre-programmed to age and die after a given life span. For example,
some skin cells known as keratinocytes live for about 3 weeks. The dead cells form a surface layer
that is continually shed. Keratinocytes self-destruct in an orderly and programmed manner called
apoptosis.
Far from being detrimental to an organism, cell death by apoptosis is a vital and formative process
that is essential for development and the shaping of organs and tissues. Apoptosis can cause some
cells to die at a particular stage of development. For example, dying cells enable a tadpole to lose its
tail as it becomes a frog, and a human embryo to lose the webbing between its fingers and toes. In
fact, almost all multicellular organisms have cells that are born to die.
Question set 2.3

REMEMBERING parent, whereas offspring produced from
1 Define sexual reproduction are different from
a fertilisation their parents.
b autosomes 5 Is the process of apoptosis beneficial to an
c apoptosis. organism? Explain.
2 What are the inputs and outputs of APPLYING
meiosis? 6 Explain why genetic material needs to
3 Describe the role of the sex chromosomes. halve when gametes are created, prior to
UNDERSTANDING fertilisation.
4 Explain why offspring produced from
asexual reproduction resemble their
Letting in sunlight can kill dark-loving bacteria,

YCARETIL CIFITNEICS
study shows
Prokaryotes multiply and survive under a range of conditions, but the conditions need to
be appropriate for the particular type of prokaryote. Bacteria have been studied in light and
dark conditions. In an article in the journal Microbiome, it was reported that an abundance
of sunlight was significantly associated with lower amounts of certain types of bacteria.
Researchers at the University of Oregon found that in dark rooms about 12% of bacteria,
on average, were able to reproduce. In sunlight, only 6.8% thrived. That figure was down to
6.1% of bacteria exposed to UV light. Dr Ashkaan Fahimipour, the postdoctoral researcher in
biology who conducted the study, commented during an interview with ABC News that this
could actually have an impact on health. He and his colleagues found smaller communities of
different types of bacteria grew under greater light exposure.
Questions
ABC News
Read the interview with 1 What were the independent and dependent variables in this study?
Dr Fahimipour. 2 Write a conclusion for the study, using relevant data to support your answer.
3 Create a hypothesis for a factor other than light that may affect the rate of binary fission.
9780170452922
CHAPTER 2 ACTIVITY
Staring mutations in the face: exploring the chromosomal anomalies 2.1
of the devil facial tumour disease
YTIVITCA
As the world’s largest living carnivorous marsupial, the Tasmanian devil (Sarcophilus harrisii) is
an Australian icon. Sadly, since the mid-1990s a sizeable proportion of the wild population has
succumbed to a rare and often fatal form of transmissible cancer called the devil facial tumour disease
(DFTD) (Figure 2.24).
The cancer is spread between animals when they bite each other, often during courtship.
Analysis of DFTD cells has demonstrated that tumour cells all have a similar karyotype (with just
a few variations), even though they may have been isolated from genetically different animals from
different locations, and that the DFTD karyotype is quite different from that of the Tasmanian devil
host animals. Transmission relies on the recipient of the DFTD failing to mount an immune response
against the foreign DFTD cells. This is now understood to be due to the tumour evolving a mechanism
that prevents the Tasmanian devil’s immune system from overcoming it.
Each strain of the cancer is thought to have arisen in a single host and then spread. The tumour
cells themselves are the infectious agent being passed from devil to devil. A cytogeneticist at the
Royal Hobart Hospital performed the karyotyping for several DFTD samples. Analysis of the samples
revealed two different DFTDs, one originating from a female (DFTD1), and a more recent one
originating from a male (DFTD2). Both DFTDs are transmissible, grow in a host via cloning, and have
a different genetic makeup from the host cells. That research was reported in 2015, and since then at
least two other strains have been found. Mutations are
described in further
detail in Chapter 4
sttaW evaD /devreser sthgir llA EPACSUA
The Biology Corner 1

Construct a
karyotype of
Tasmanian devil
chromosomes
The Biology Corner 2
Follow-up activity
FIGURE 2.24 A Tasmanian devil infected with devil facial tumour disease
Aim
To construct and compare two karyotypes for the Tasmanian devil – one for a healthy cell and the
other for a cell taken from a DFTD tumour – and to consider what mutations may have occurred to
give rise to DFTD. The cancer that causes DFTD is caused by an infectious pathogen. The fact that it
can be transmitted is considered rare for cancer.
You will need
Pencil, scissors, glue, blank sheet of paper, photocopy of the chromosome images in Figure 2.25
(page 46), red and blue pens or pencils
9780170452922
FIGURE 2.25 A mixture of the chromosomes from a healthy cell (red) and a DFTD cell (blue) from a Tasmanian
devil
What to do
Referring to Figure 2.25, on a photocopy of the diagram, outline the chromosomes from the healthy
cell in red, and those from the DFTD cell in blue.
1 Cut out each chromosome and add it to a red (healthy cell) pile or a blue (tumour cell) pile.
Assemble the red cut-out chromosomes into a karyotype by pairing them and ordering them
from largest to smallest.
2 Orientate a sheet of paper in landscape format. Secure the karyotype by gluing the chromosome
pairs onto the top half of the paper, leaving a space of approximately 10 cm on the right-hand side.
The largest chromosomes should be on the left, the smallest on the right.
3 Label the chromosome pairs by numbering the largest pair ‘1’ and continue labelling them
sequentially down to the second smallest pair. The two smallest chromosomes are the sex
chromosomes, and should be labelled as such.
Now work on the ‘blue’ chromosomes from the DFTD cell.
4 Pair up any matching chromosomes. Leave aside any that cannot be paired.
5 Compare the paired chromosomes from the DFTD cell with those in the karyotype of the healthy
cell. Arrange the paired chromosomes from the DFTD cell underneath the corresponding
chromosomes from the healthy cell and glue them onto the paper.
6 Compare the unpaired chromosomes from the DFTD cell with those of the healthy cell. If any
DFTD chromosomes look similar to any of those in the healthy karyotype, glue them onto the
paper underneath the corresponding chromosomes.
7 You will be left with unpaired chromosomes from the DFTD cell that cannot be identified from
the healthy karyotype. Arrange these from largest to smallest and glue them onto the page in the
space to the right-hand side of the DFTD cell chromosomes.
8 Label the identifiable DFTD cell chromosomes, including any unpaired chromosomes, with the
same labels as for the healthy cell. Label the remaining DFTD cell chromosomes on the right-hand
side as ‘M1’, ‘M2’ etc. (M represents ‘mutation’.)
1 What features of the chromosomes did you use to match corresponding pairs?
2 What are the diploid and haploid numbers for healthy cells?
3 What is the sex of the animal from which the healthy cell was taken? How do you know?
4 What differences are there between the karyotypes of the healthy cell and the DFTD cell?
5 Discuss what changes might have occurred to the chromosomes of the Tasmanian devil to give
rise to DFTD.
9780170452922
CHAPTER 2 SUMMARY WS
• Cell division is essential for growth, (i.e. one of each pair of homologous Chapter 2
Activity sheet
development, repair and reproduction. chromosomes) is found in gametes.
• Heredity is the study of the patterns and • Homologous chromosomes have the same
mechanisms of genetic inheritance through genes at the same position (locus), but there
generations. may be alternative forms of the gene, called
• Asexual reproduction results in limited alleles.
genetic variation. Sexual reproduction • Chromosomes in prokaryotic cells are
combines genetic information from two generally circular and found in a region of
parent cells and increases the genetic the cell called the nucleoid.
variation in offspring. • Small rings of DNA called plasmids may
• In eukaryotic chromosomes, the DNA in also be present in prokaryotic cells.
the nucleus is coiled around the histone • Prokaryotic cells reproduce by binary
proteins to form nucleosomes. fission.
• When matched and ordered, eukaryotic • The sequence of events in cell division is
chromosomes can be displayed in a called the cell cycle.
karyotype, and different chromosome sizes, • Eukaryotic cell division involves
centromere positions, and banding patterns nuclear division (mitosis or meiosis) and
can be observed. cytoplasmic division (cytokinesis).
• Somatic or body cells have pairs of • In mitosis, the cell divides once after
homologous chromosomes; one chromosome passing through four phases (prophase,
of each pair comes from the male parent and metaphase, anaphase and telophase). Cells
the other from the female parent. formed by mitosis generally have the same
• Sex chromosomes that determine an genetic material as their parent cell.
individual’s sex are generally matched in • In meiosis, the cell divides twice (meiosis I
one sex (e.g. XX) and unmatched in the and II). Cells formed by meiosis are called
other sex (e.g. XY). gametes.
• A diploid number (2n) of chromosomes is • Fertilisation is the fusion of gametes from
found in somatic cells; a haploid number (n) two different parent cells to form a new cell.
CHAPTER 2 GLOSSARY
Allele One of various versions of the same undergoes binary fission to form two identical
gene (at the same locus) distinguished by small daughter cells; a form of asexual reproduction
differences in the DNA sequence Bivalent A structure (visible in a cell during
Apoptosis A programmed series of events that prophase I of meiosis) made up of two
leads to cell death (as a result of the dismantling homologous chromosomes joined together
of the internal contents of the cell by various Cell cycle An ordered sequence of events in
enzymes, including caspases) the life of a cell from when it was formed from a
Asexual reproduction The process by which a parent cell until its own division
single parent produces offspring and that does Cell division The splitting of a cell into two
not involve fusion of gametes; a process that new functioning cells
usually results in identical offspring Cell plate The structure produced by dividing
Autosome A chromosome that is not a sex plant cells in the place where the new cell wall
chromosome is forming
Binary fission The division of a cell into Centriole A minute rod-shaped organelle
two cells without mitosis; a prokaryotic cell present in many resting cells, just outside the
9780170452922
nuclear membrane that helps make the spindle an example of cell differentiation is the
fibres for cell division; a centrosome contains development of root tip cells of plants into
two centrioles; it is usually absent in plants phloem, xylem and root hairs; during the
Centromere The waist-like constriction in a process of differentiation, cells gain specialised
chromosome where the spindle fibres attach; it structures and functions
enables the movement of chromosomes during Diploid (2n) Describes a cell or organism
cell division that has a genome that contains two copies
Centrosome An organelle containing a pair of each chromosome; the diploid number of
of centrioles; it duplicates during cell division, chromosomes is represented by 2n
while the DNA is duplicating, and the two DNA (deoxyribonucleic acid) The information-
centrosomes then separate to opposite poles containing molecule present in all living things
of the dividing cell; it produces the spindle that contains the instructions, written in a
during cell mitosis and meiosis, and one of the chemical code, for the production of proteins
centrosomes goes into each daughter cell by the cell; the information it contains is
Chromatid Daughter strand of a duplicated sufficient for the making and maintaining of
chromosome that is joined to another chromatid the organism; in addition, DNA is the genetic
by a centromere material that passes this information on to the
Chromatin An organised, loosely coiled next generation
complex of DNA and its proteins that is found Eukaryotic cell A complex cell containing
in eukaryotic non-dividing cells; it is more membrane-bound organelles, including a
compact than the DNA of prokaryotes; chromatin nucleus
supercoils to become the chromosomes
Fertilisation The fusion of haploid male and
observable during eukaryotic cell division
female gametes during sexual reproduction to
Chromosome A structure composed of DNA produce a diploid zygote; the random union of
and protein that contains linear arrays of genes gametes is known as random fertilisation
carrying genetic information; prokaryotes
generally have one circular chromosome, Gamete A male or female reproductive cell;
one of each type combine at fertilisation; in
whereas eukaryotes have a number of linear
humans, the gametes are ova and sperm cells;
chromosomes
in flowering plants, pollen grains contain male
Cleavage The division of the cytoplasm in an gametes and ovules contain female gametes
animal cell
Gene A unit of heredity that transmits
Cleavage furrow A shallow, ring-like
information from one generation to the next; a
depression that forms on the surface of
segment of DNA that codes for a polypeptide
an animal cell undergoing cytokinesis as
contractile microfilaments pull the cell Genetic Refers to the mechanisms and patterns
membrane inward; it defines where the of inheritance; relating to the transmission
cytoplasm will be divided to make two cells of coded chemical instructions from one
generation to the next
Crossing over The exchange of genetic material
between maternal and paternal homologous Genome All of the genetic material contained
chromosomes (of non-sister chromatids) in an organism or a cell; it includes the
that occurs during the first step of meoisis chromosomes within the nucleus and the DNA
(prophase I) in mitochondria and chloroplasts
Cytokinesis The division of the cytoplasm Germline cell A specialised sex cell that
immediately after mitosis, meiosis I or meiosis II gives rise to gametes; early in an embyro’s
to create two separate daughter cells development, its germline cells specialise into
Differentiation The process during male or female germ cells
development whereby newly formed cells Haploid (n) Describes a cell or organism
become more specialised as they mature; that has a genome that contains one copy of
9780170452922
each chromosome; the haploid number of ribosomes are made from protein and RNA
chromosomes is represented by n subunits
Heredity The study of inheritance; the genetic Nucleotide The basic building block of
transmission of characteristics from one nucleic acids (DNA and RNA); nucleotides are
generation to another linked together by phosphodiester bonds; each
Heterosome One of the non-identical nucleotide is made up of a five-carbon sugar, a
chromosomes that pairs up at meiosis (e.g. the X phosphate group and a nitrogenous base
and Y chromosomes in male humans) Nucleus The dense organelle of a eukaryotic
Histone A protein around which DNA winds cell that contains genetic material in the form
in eukaryotic cells to form a nucleosome of chromosomes and is enclosed by a nuclear
membrane; in its resting phase, the genetic
Homologous chromosomes A pair of
chromosomes of the same size and shape and material takes the form of loosely coiled
that has the same genes at the same locations chromatin; the chromatin supercoils and
condenses to form chromosomes before cell
Interphase The stage between nuclear
division
divisions that involves metabolic activity,
growth, and duplication of chromosomes Organelle A specialised part of a cell that has
its own specific function; a ‘little organ’
Karyotype A display of the number and
appearance of the chromosomes of an organism Paternal chromosome The chromosome
or cell as observed at metaphase in a pair of chromosomes that came from the
father
Locus (plural loci) The position a gene occupies
on a chromosome Plasmid A small circular piece of DNA,
found in bacteria, that is able to replicate
Maternal chromosome The chromosome in a
independently of the cell’s chromosomes;
pair of chromosomes that came from the mother
engineered plasmids may carry antibiotic-
Meiosis A type of cellular division in sexually resistance markers
reproducing organisms that involves two rounds
of cell division, but only one round of DNA Prokaryote A single-celled organism that
lacks membrane-bound organelles such as a
replication; during meiosis, the chromosome
nucleus
number of a cell is halved so that the daughter
cells are haploid; meiosis is the basis of gamete Sex chromosome A chromosome that
formation in some plants and animals and of determines the sex of an organism and affects
spore formation in other plants sexual traits
Mitosis A type of nuclear division in somatic Sexual reproduction A form of reproduction in

cells that maintains the parental diploid which offspring are produced from two parents
number of chromosomes in the daughter cells; by the fusion of male and female gametes
it is the basis of bodily growth and of asexual Somatic cell A body cell that is not a germ cell
reproduction in many eukaryotic species Synapsis The pairing of homologous
Nitrogenous base A structural component of chromosomes during prophase I of meiosis
the nucleotides that make up DNA or RNA An inheritable characteristic; phenotype
Trait
Nucleoid The region within a prokaryotic cell Zygote The first cell of a new individual;
that contains the genetic material it is formed by fusion of a male and a
Nucleolus A structure found within the female gamete (fertilisation) during sexual
nucleus of a non-dividing cell; a site in which reproduction
9780170452922

Remembering
1 Draw and label a chromosome. Include the following labels: locus, chromatid, centromere,
chromosome.
2 Explain how a karyotype can indicate the sex of an organism.
3 Describe the movement of genetic material in a cell during the cell cycle.
Understanding
4 The amount of nuclear DNA in any given cell can be measured quite accurately. Predict the
stages of the cell cycle in which you would expect to see changes in the amount of nuclear
DNA.
5 Compare and contrast binary fission with mitosis.
6 Compare and contrast the concept of a chromosome with the concept of a gene.
Applying
7 Predict what would happen if cytokinesis did not occur during a cell cycle.
Analysing
8 When animals of different species are kept together in captivity, they sometimes mate and
produce offspring. A donkey has a diploid number of 62, and a zebra has a diploid number of 44.
a Name the type of cell in the donkey that would be expected to contain 31 chromosomes.
b Name the type of cell in the zebra that would be expected to contain 44 chromosomes.
c Estimate how many chromosomes you would expect to find in the somatic cells of the
donkey.
d If a ‘zonkey’ (a hybrid formed by the fertilisation of a female donkey egg by a zebra sperm)
is produced, predict its 2n number.
e Describe how a zonkey karyotype would differ from the karyotype of a zebra.
f Suggest problems that might occur when the zonkey produces gametes.
g Explain why most hybrid animals are infertile.
9 Draw a simple table that compares mitosis and meiosis. Include the number of daughter cells
produced by each parent cell, the number of chromosomes in each daughter cell, and whether
the daughter cells are identical or non-identical.
Evaluating
10 All chromosomes are double stranded and linear in shape. Do you agree with this statement?
Justify your answer.
11 ‘Cells produced by meiosis only contain half the amount of DNA compared with their parent
cells. This means DNA does not replicate during meiosis.’ Do you agree with this statement?
Justify your answer.
12 Explain why meiosis is necessary for gamete formation, rather than mitosis.
13 A group of cells being studied were never observed to undergo division. Explain whether this
means the cells were dead. Justify your answer.
14 Prokaryotes divide by means of binary fission and generally produce cells identical to one
another and to the parent cell. Complex organisms produce sex cells that combine to form
a new individual. Identify an advantage and a disadvantage for each of asexual and sexual
reproduction.
9780170452922
Creating and reflecting

15 Reflect on what you have learned about mitosis and meiosis. Draw a mind map to summarise
your knowledge.

1 Bacterial cells reproduce by: The diploid numbers of chromosomes in the
A binary fission only horse and donkey are 64 and 62, respectively.
B meiosis only A mule is the offspring of a cross between a
C binary fission and mitosis horse and a donkey. Mules survive but are
D mitosis and meiosis. sterile because they cannot produce functional
[Q4. 2017 SCSA] gametes.
2 Crossing over is the: 5 On the basis of the above information, how

A exchange of alleles between homologous many chromosomes would be present in a
chromosomes diploid cell of a mule? Explain your answer.
B exchange of alleles between (4 marks)
non-homologous chromosomes [Q32a. 2018 SCSA]
C segregation of homologous
6 Explain why mules cannot produce
chromosomes to different poles
functional gametes. (4 marks)
D segregation of non-homologous
[Q32b. 2018 SCSA]
chromosomes to different poles.
[Q27. 2017 SCSA] 7 Name and describe the process by which a
bacterial cell reproduces. (4 marks)
3 In mitosis, a parent cell usually produces:
[Q31a. 2016 SCSA]
A four daughter cells, each of which has
the same number of chromosomes as the 8 Describe the process of meiosis and explain
parent cell how this process produces genetic variation.
B four daughter cells, each of which has (10 marks)
half the number of chromosomes as the [Q36b. 2016 SCSA]
parent cell
Look at the diagram below and answer the
C two daughter cells, each of which has
questions that follow.
the same number of chromosomes as the
parent cell A B D
D two daughter cells, each of which has
C
half the number of chromosomes as the
parent cell.
[Q11. 2016 SCSA] E
4 Meiosis produces:
A four diploid gametes 9 Provide labels A to D for the diagram.
B two haploid gametes (4 marks)
C two diploid gametes [Q31a. 2014 SCSA]
D four haploid gametes.
10 Name the process occurring at E and
[Q6. 2014 SCSA]
explain the biological importance of the
Use the following information to answer process. (3 marks)
questions 5 and 6. [Q31b. and c. 2014 SCSA]
9780170452922
52
3
DNA STRUCTURE CHAPTER 3 CONTENT
By the end of this chapter, you will have covered the
AND FUNCTION following material.
STARTER QUESTIONS
1 Describe the structure of DNA, including the following:
a shape
b names of the matching bases
c three main components that make up the molecule. Hint:
two form the ‘backbone’ of the molecule.
2 How does the unique structure of DNA enable it to perform
its functions?
3 List three roles of DNA in a cell.
» DNA is a helical double-stranded molecule that occurs
bound to proteins in chromosomes in the nucleus, and as
unbound circular DNA in the cytosol of prokaryotes, and in
the mitochondria and chloroplasts of eukaryotic cells
» the structural properties of the DNA molecule, including
nucleotide composition and pairing and the hydrogen bonds
between strands of DNA, allow for replication
» the genetic code is a base triplet code; genes include ‘coding’
and ‘non-coding’ DNA, and many genes contain information
for protein production
» protein synthesis involves transcription of a gene into
messenger RNA in the nucleus, and translation into an amino
acid sequence at the ribosome
» proteins, including enzymes and structural proteins, are
essential to cell structure and functioning

» select, construct and use appropriate representations,
including models of DNA replication, transcription and
translation, Punnett squares and allele frequencies in gene
pools, to communicate conceptual understanding, solve
problems and make predictions
9780170452922
CHAPTER 3 | DNA structure and function 53
3.1 THE DISCOVERY OF DNA

Many secrets of DNA (deoxyribonucleic acid) were unlocked
in 1952 at King’s College, when Rosalind Franklin took the first
clear X-ray diffraction image of DNA. Franklin’s photograph
helped confirm the spiral nature of DNA. Without her consent,
her colleague Maurice Wilkins took her photographs to
James Watson and Francis Crick. The photographs gave them
segamI yrotsiH ecneicS/otohP kcotS ymalA

evidence for the 3D structure they had previously theorised
for DNA. Using these results and other accumulated evidence,
Watson and Crick suggested that DNA consists of the now
familiar two strands, resembling the uprights of a ladder, linked
by ‘rungs’ (made of the four types of nucleotides), twisted to
form a double helix. Rosalind Franklin had already died when
Wilkins, Watson and Crick received a Nobel prize for their work
in discovering the structure of DNA.
It is now known that nucleic acids such as DNA do form a FIGURE 3.1 Rosalind Franklin,
an expert X-ray crystallographer,
double helix: two linear strands, each containing a sequence of
worked on the structure of DNA
nucleotide subunits, twisted together into a spiral.
in the early 1950s. Her work was
Some years earlier, an Austro-Hungarian biochemist
pivotal in enabling Watson and Crick
working in the USA, Erwin Chargaff, used a technique called
to propose their hypothesis for the
chromatography to work out the ratios of the four types of structure of DNA.
nitrogenous bases [adenine (A), cytosine (C), guanine (G) and
thymine (T)] present in the nucleotide subunits. He found that the amount of guanine was equal to
the amount of cytosine, and the amount of adenine was equal to the amount of thymine.
FIGURE 3.2 An X-ray diffraction photograph of DNA. The DNA molecule was too small to see using conventional
methods, so X-rays were used. The image produced an accurate 3D shape.
The pairs of nitrogenous bases are known as complementary base pairs. Complementary pairing
is the phenomenon whereby guanine always hydrogen bonds with cytosine, and adenine always
hydrogen bonds with thymine. Guanine and cytosine share three hydrogen bonds, and adenine
and thymine share two hydrogen bonds. The complementary pairing helps produce the 3D helical
structure of DNA. Nucleotides are the base units of DNA.
9780170452922
S U I A C & E L L I V N O G © , N W O R B N OT G N I R R A B . A / y r a r b i L o t o h P e c n e i c S
Where is DNA found in eukaryotes
and prokaryotes?
DNA occurs bound to proteins in chromosomes within the
nucleus of eukaryotic cells. The nucleus is enclosed in a
nuclear membrane to protect its interior. DNA is also found
in prokaryotes, but as unbound circular DNA in the nucleoid
region of the cytosol. The nucleoid region is not bound by a
nuclear membrane, and therefore the DNA is not contained
like it is in a eukaryotic cell. Unbound, circular DNA is also
EGELLOC
found in the mitochondria and chloroplasts of eukaryotic cells.
FIGURE 3.3 Watson (left) and Crick in 1953

with their model of part of a DNA molecule
Prokaryote Eukaryote
Linear chromosomes
Circular in membrane-bound
chromosome nucleus
in nucleoid
region of cell
Cell membrane
Genetic information
encoded by DNA
Cytosol
Ribosomes
Cell wall
FIGURE 3.4 Structural similarities and differences between a prokaryotic cell and a eukaryotic cell
9780170452922
Core of eight
histone molecules DNA double helix
2 nm
DNA coiled
around histones
30 nm
300 nm
More coiling
700 nm
1000 nm
Mitotic chromosomes
FIGURE 3.5 In the nucleus of eukaryotes, linear DNA is found bound to proteins and becomes tightly coiled to form chromosomes.
DNA is found in chloroplasts in eukaryotic plant and protist cells: DNA is found in mitochondria in all eukaryotic cells:
Outer
Thylakoids Chloroplast Ribosome
membrane
DNA
Intermembrane Inner Mitochondrial
space membrane DNA Ribosome
Inner
membrane
Matrix
Granum
Mitochondrial
Thylakoid matrix
space (lumen) Intermembrane
space
Stroma Outer Folds of the
Thylakoid membrane
membrane inner membrane
(cristae)
FIGURE 3.6 Circular DNA, which is not bound to proteins, is found in chloroplasts and mitochondria.
Key concept
DNA is a double-stranded helical molecule. In eukaryotic cells, DNA is found in a linear form bound
to proteins in the nucleus, and in an unbound circular form in chloroplasts and mitochondria. In
prokaryotic cells, DNA is found in an unbound circular form in the nucleoid region of the cytosol.
9780170452922
3.1 DNA and who it gets passed to

NOITACILPPA DNA contains instructions that make each species unique, and it is passed from parent cells to
daughter cells during cell division, and from adults to their offspring during reproduction. In sexual
reproduction, organisms inherit half of their nuclear DNA from the male parent and half from the
female parent. However, organisms inherit all of their mitochondrial DNA from the female parent.
This occurs because only egg cells, and not sperm cells, keep their mitochondria during fertilisation.
Question set 3.1

REMEMBERING ANALYSING
1 List the scientists mentioned so far in this 5 Copy the following table and complete
chapter who contributed to the discovery it using Chargaff’s ratio of nucleotide
of the structure of DNA. subunits.
2 Describe Watson and Crick’s model of DNA. ADENINE CYTOSINE THYMINE GUANINE
UNDERSTANDING 7 3 7
3 Explain why DNA is not found in the
21 25 25
nucleus of a prokaryotic cell.
4 Copy and complete the table of 43 44
complementary base pairs in DNA. 6 The average percentage composition of
NITROGENOUS COMPLEMENTARY adenine in human DNA is 30%. Predict the
BASE BASE PAIR percentage of the other three nucleotides.
A
3.2 STRUCTURAL PROPERTIES OF THE DNA

MOLECULE
Nucleotides – the building blocks of DNA

DNA is a nucleic acid made up of nucleotides. Each nucleotide consists of three parts: a five-carbon
(pentose) sugar known as deoxyribose sugar, a phosphate group and a nitrogenous base (adenine,
cytosine, guanine or thymine). A nucleotide is the basic 5' end
O
structural unit of DNA. O
P
O T
Each phosphate group is attached to two sugar molecules O– CH2
(5') O
by ‘ester’ bonds and is then called a phosphodiester bond (see C C (1')
(4') H
Figure 3.8). The five carbon atoms in each sugar molecule,
H C C(2') H
(3')
Phosphate group
H
O
O
Phosphodiester P
P C Nitrogenous bond O CH2
base O– (5') O
(e.g. cytosine) C
S
H C
(3')
OH
Deoxyribose sugar 3' end
FIGURE 3.7 A nucleotide FIGURE 3.8 A phosphodiester bond
9780170452922
which form a ring, are numbered 1' to 5'. One of the ester bonds is formed with the 3' carbon of one
sugar ring and the other is formed with the 5' carbon of the next sugar ring. The chain of alternating
sugar molecules and phosphate groups is called the sugar–phosphate backbone.
RNA (ribonucleic acid) has a similar structure to DNA, except deoxyribose sugar is replaced with
ribose sugar.
A strand of nucleotides has directionality described using the phrase 5' to 3'. The 5' end starts with a
phosphate and the 3' end finishes with a sugar. DNA and RNA synthesis occurs in the 5' to 3' direction.
The structure of the DNA molecule

The shape of a DNA molecule is a double helix. The term ‘double’ refers to the two strands, which
are joined by the weak hydrogen bonds between complementary pairs of nitrogenous bases. The
complementary base pairing means that adenine always pairs with thymine, and cytosine always
Build DNA
pairs with guanine. The term ‘helix’ describes the helical (spiral) molecular shape: the two linear Practise building DNA
strands run in opposite directions to each other (i.e. are anti-parallel) and are twisted into a helix. using complementary
pairing.
Drawing and labelling DNA
Drawing and labelling DNA structure is an essential component of the course. This takes practice.
Follow the steps below as you draw your own DNA structure. If you can draw it, then you know it!
TABLE 3.1 Steps for how to draw and label DNA structure
STEP DRAW AND LABEL

1 Draw the anti-parallel 5' 3'
deoxyribose sugars
(pentagons) for the two
strands. On one strand draw
them upright, and on the
other strand draw them
upside down to show they
are anti-parallel. Then draw
the phosphodiester bonds
(circles, each with a ‘red’ and
a ‘black’ bond) connecting
the sugars in a chain. The
‘red’ covalent bond joins each
3' 5'
phosphate to a 3' carbon,
and the ‘black’ covalent bond FIGURE 3.9 Two anti-parallel strands of DNA
joins it to a 5' carbon.
2 Draw the complementary 5' 3'
C G
base pairs. Indicate the
C = cytosine
weak hydrogen bonds with G = guanine
dotted lines: 2 hydrogen A = adenine
T = thymine A T
bonds between adenine and
thymine and 3 hydrogen
bonds between cytosine and
guanine. G C
3 Make a key listing

the full names of the
nitrogenous bases and their T A
complementary pairs.
3'
Hydrogen bonds 5'
FIGURE 3.10 Complementary bases are paired
9780170452922
STEP DRAW AND LABEL

4 Circle one nucleotide. Label
C cytosine Sugar– Sugar–
5 Base pairs
its three parts. G 5 guanine phosphate phosphate
backbone backbone
A adenine
Nucleotides are very
5
T 5 thymine
important because they are
the building blocks of each Hydrogen bonds
5' 3'
strand. P C G
S
5 Label the sugar–phosphate S
P
backbone sections of
P A T
the molecule, base pairs, S
S
‘phosphate’, ‘nucleotide’ and P
‘deoxyribose’. In each sugar

P G C
symbol write an ‘S’, and in S
S
each phosphate circle write P
Nucleotide
a ‘P’. P T A
S
6 Next to the chemical S
Phosphate P
structure you have just 3'
5'
drawn, draw a simplified Deoxyribose
Nitrogenous
base
smaller-scale DNA molecule, sugar
demonstrating its double-

helix structure.
FIGURE 3.11 The sugar–phosphate backbones and the double-helix structure
Key concept
The base unit of DNA is a nucleotide, which consists of one nitrogenous base, one deoxyribose sugar
and one phosphate group. The two strands of DNA are held together by weak hydrogen bonding
between the complementary nitrogenous bases: adenine and thymine, cytosine and guanine.
The structure of DNA enables it to function

DNA is the genetic material common to all organisms. It carries information coded in the segments of
its molecule known as genes. DNA thus enables certain traits to be passed on to the next generation.
A trait is an inheritable characteristic.
DNA is chemically the same in all organisms, although different species usually have different
proportions of the various nucleotides, and each organism has a unique DNA sequence. The DNA
sequences of individuals within a species have a lot more similarity than those of individuals of
different species. In addition, DNA molecules in eukaryotes and prokaryotes generally differ in their
associated proteins and in overall shape and appearance.
We now understand how DNA is transmitted between generations, how genes are controlled and
how differences in genes can cause changes in the way organisms develop and behave. This knowledge
has allowed us to manipulate genes to achieve desired characteristics. New technologies have enabled
us to accurately examine the interrelationships between species and to account for changes that have
occurred in species over time.
DNA stores the code for making proteins, and the inheritance of particular gene variants causes
an individual to have a specific combination of proteins in its makeup. A section of DNA that codes
for a specific protein (or polypeptide) is called a gene. It is now known that genes may code for more
than one kind of polypeptide, and that genes interact with one another, causing changes in their
expression (i.e. in the production of proteins). DNA, therefore, controls the growth and development
of an organism.
9780170452922
The structural properties of the DNA molecule [its nucleotide composition, pairing and hydrogen
bonding (see Figure 3.12b)] are what allow DNA replication to occur. This is because the DNA strands
can function as template strands.
b
Hydrogen bonds
3 ' end
Base
P
S
T
S A
P
C G
P T A
S Sugar–
phosphate G C Nitrogenous
G
backbone bases
C C G
S
P
5 ' end A T
c
C G
C
Sugar C G
T A
Phosphodiester bond
T
Phosphate
G
FIGURE 3.12 a The DNA helix is a double-stranded molecule. b The two strands are held together by hydrogen
bonding between complementary nitrogenous bases. c As well as nitrogenous bases, nucleotides have a sugar–
phosphate backbone, in which the sugar molecules are linked by phosphodiester bonds.
DNA structure
View this link to
Question set 3.2 reinforce your learning.
DNA structure and
REMEMBERING UNDERSTANDING replication
1 State the three components of a DNA 4 Explain what is meant by the term ‘anti- DNA learning centre
nucleotide. parallel’.
2 Draw and label your own diagram of DNA, ANALYSING
following the instructions found in Table 5 Relate DNA’s structure to three of its
3.1 (page 57). functions.
3 What is one main difference between the
structure of DNA and RNA?
9780170452922
CASE
STUDY
DNA: further accumulation of knowledge
When the structure of DNA was deduced, it is not only the roughly 1% of our DNA that
seemed to be the final piece of a biological contains genes that code for proteins that has
puzzle. It taught us how hereditary a function. The non-coding DNA (DNA that
information (the passing on of which was does not code for protein) appears to have
demonstrated by Mendel) was encoded. very important roles, such as regulatory and
Between the 1950s and 1980s, scientists structural functions. ENCODE scientists are
studying DNA thought most of our DNA was theorising that 80% of ‘junk DNA’ is active.
useless. They knew that small sections of DNA, See Coding and non-coding DNA, page 63.
known as genes, seemed to code for proteins, Today, scientists analyse DNA for many
but they wondered about the other sections purposes other than the study of heredity.
of the DNA. We now know genes can interact Genomics, such as is researched at the
with one another and with the environment to Australian Museum’s Australian Centre for
result in traits, but scientists still do not know Wildlife Genomics, is the study of the entire
what most of an organism’s DNA does. DNA sequence of an organism and of its
In the 1950s–1960s, Watson and Crick genes. Scientists know how to sequence the
and other collaborators had determined DNA (work out the order of nucleotides).
that DNA guides the production of RNA, and They do this for a range of purposes, such
RNA guides the production of protein, which as identification of individuals, paternity
may then be manifested as an observable testing, sex determination, measure of
characteristic. But the biology of DNA is much species relatedness, conservation, population
more complex than was initially thought. management and forensics.
Researchers working for the Encyclopedia
of DNA Elements (ENCODE) project, a Questions
public research consortium launched by 1 Define the term ‘knowledge accumulation’
the US National Human Genome Research and apply it to DNA discoveries.
Institute, have been mapping the parts of 2 List five uses of DNA analysis.
human chromosomes that are transcribed 3 Explain how Franklin’s first clear X-ray
(copied). In addition, they have been studying diffraction image of DNA laid some of the
how the copying of DNA is regulated and groundwork for the current uses of DNA
how the process is affected by the way the analysis. (Hint: structure can indicate the
DNA is packaged. In 2012, they found that it mechanisms for function.)
3.3 DNA STRUCTURE ENABLES DNA REPLICATION

DNA contains the genetic code that determines the structure and function of all living things. The
product of DNA replication is two identical, double-helix DNA molecules, each consisting of one
parental strand and one new strand. DNA replication is referred to as semi-conservative replication
because one of the two strands is conserved, or retained, from one generation to the next, while the
other strand is new. DNA replication occurs during the S phase of interphase during the cell cycle (see
‘The cell cycle’ in Chapter 2, pages 31–32).
The purpose of DNA replication is to duplicate the code it carries. The code can then be passed
on to daughter cells. In eukaryotic cells, the chromosomes gain a sister chromatid and become
double stranded. DNA replication occurs in preparation for mitosis and meiosis.
Key concept
DNA replication is semi-conservative. Each of the new DNA molecules that are produced have
one strand that is conserved (i.e. the parental strand) and one that is new (i.e. the daughter
strand).
9780170452922
DNA replication begins with an enzyme

called DNA helicase ‘unzipping’ the long
molecule of double-stranded DNA by breaking
the weak hydrogen bonds between the
nucleotides and thus exposing the nucleotide Parental DNA
bases. This separation of the parental DNA
Replicated DNA molecules
strands happens along a small section at a time.
Replication fork
The hydrogen bonds that hold the two strands
of the DNA molecule together are weak, and the FIGURE 3.13 Movement of the replication fork along
enzyme is easily able to separate them. parental DNA causes unwinding of the original DNA
The junction between the unwound single double strands and rewinding of the two newly
strands of DNA and the intact double helix is replicated double strands.
called the replication fork. The replication fork
moves along the parental DNA strand so that there is a continuous unwinding of the parental strands
(Figure 3.13). Within the nucleus, stockpiles of free nucleotides attach to the exposed bases, according to
the base-pairing rule (Figure 3.14), with the help of the enzyme DNA polymerase. Another enzyme, DNA
ligase, seals the new short stretches of nucleotides into a continuous double strand that rewinds. Ligase
catalyses the formation of phosphodiester bonds. The nucleotides link together in what is called a 5' to 3'
direction, forming long molecules.
Parental double helix
Parental
strand
Daughter strands
FIGURE 3.14 Replication of DNA. The specific relationships between A and T and between C and G ensure that
the sequence of bases in the daughter DNA is exactly the same as that in the parent DNA.
As DNA strands are antiparallel, DNA polymerase moves in opposite directions on the two strands
during synthesis. On the leading strand, DNA polymerase is moving towards the replication fork
and synthesises continuously. On the lagging strand, DNA polymerase is moving away from the
replication fork and synthesises in pieces called Okazaki fragments. The process of DNA replication is
summarised in Table 3.2 (page 62).
9780170452922
TABLE 3.2 DNA replication
STEPS VISUAL AID

1 DNA helicase unwinds and separates the double
Helicase
strand by breaking the weak hydrogen bonds
between complementary base pairs. Each half of
the parent molecule is used as a template.
2 The enzyme RNA primase attaches a short Primer

sequence of RNA, known as a primer, to show DNA
polymerase where to start adding nucleotides.
RNA
primase
3 Free nucleotides are added by DNA polymerase

Daughter strand
according to complementary base-pairing rules.
Synthesis of the new daughter strand is in a 5' to 3' DNA
polymerase
direction. Adenine pairs with thymine, and cytosine
pairs with guanine.
4 DNA ligase removes and replaces the primers. The

result is two identical DNA molecules that are each
made of one original parent strand and one new DNA
daughter strand. DNA replication is described as ligase
semi-conservative.
5 In eukaryotic organisms, two identical sister chro-

matids are now ready for cell division. In prokary-
otes, two identical circular chromosomes are now
ready for binary fission.
FIGURE 3.15 DNA replication involves enzymes
Figure 3.16 illustrates the continuous and discontinuous synthesis of DNA along each of the
strands. Synthesis is continuous along the leading strand, with additional nucleotides being added
one after the other. It is discontinuous along the lagging strand because it is a 3' to 5' strand and DNA
polymerase can only synthesise new DNA in a 5' to 3' direction. Primers are attached at short intervals,
starting from the replication fork. DNA polymerase synthesises short strands of new DNA starting at
each primer, in a 5' to 3' direction. The short strands are called Okazaki fragments.
DNA polymerase moves in opposite directions on the two anti-parallel parent strands. DNA
polymerase removes the RNA primers and replaces them with DNA nucleotides. DNA ligase joins
the Okazaki fragments together to create a continuous strand. Ligase catalyses the formation of a
phosphodiester bond.
9780170452922
Free nucleotides DNA polymerase

Adenine
Thymine
Cytosine
Guanine
Leading strand
3' 5'
Helicase
5' 3'
Lagging
Original strand
DNA
molecule
Replication
fork
Okazaki fragment
DNA polymerase Original (template)

DNA strand
Chromosome
FIGURE 3.16 DNA replication showing the leading and lagging strands
Question set 3.3

REMEMBERING
1 State the role of DNA helicase, polymerase and ligase in DNA replication. DNA replication
2 Draw a flow diagram to summarise the process of DNA replication. The one below has been View the link to
included as an example of how to set it out. reinforce your
understanding of DNA
Helicase Primer DNA replication.
separates initiates polymerase DNA structure and
attaches replication
UNDERSTANDING
3 Explain why the process of DNA replication is described as semi-conservative.
ANALYSING
4 Describe the relationship between DNA replication and cell division.
5 Predict the nucleotide sequence for the complementary strand of a fragment of a DNA
chain with the nucleotide bases GCCTATTGCA.
3.4 CODING AND NON-CODING DNA

DNA is a molecule consisting of a sequence of nucleotides. The entire order of the nucleotides in
a human cell’s DNA have been sequenced. The sequence of consecutive DNA ‘letters’ spanning all
the chromosomes of a cell from start to finish is known as the genome sequence. Some sections of
the sequence code for proteins and are called coding DNA. The coding DNA sections are also called
genes. The coding DNA specifies sequences of amino acids, which are the building blocks of proteins.
Proteins are responsible for nearly all cell functions. Humans have around 20 000 protein-coding
genes. (Corn has around 32 000 genes and Escherichia coli (E. coli) bacteria has around 4400 genes.)
Approximately 1–2% of the DNA in a human is comprised of coding DNA. Genes contain information
9780170452922
for the production of proteins, and proteins are the link between the stored genetic code, the
genotype, and observable traits, called the phenotype.
The majority of the human genome is comprised of non-coding DNA. The German botanist
Hans Winkler invented the term ‘genome’ in 1920 by combining the words GENe and chromosOME.
A short definition of genome is ‘all the DNA in a cell’, and this includes the genes and also DNA that is
not part of any gene. The sections of DNA that do not code for a protein are classified as non-coding
DNA. Some non-coding DNA is transcribed into functional non-coding RNA molecules, such as
transfer RNAs and regulatory RNAs. Historically, non-coding DNA was referred to as ‘junk DNA’, but
through recent advances in knowledge, scientists have found that some of the non-coding DNA is
important and therefore not actually ‘junk’.
Nucleus
Chromosome
Regions of DNA that

code for protein (coloured section)
Gene 1 Gene 2
Regions of DNA that do not

code for proteins (white sections);
FIGURE 3.17 Coding versus non-coding DNA in a eukaryotic cell: 75% of non-coding DNA occurs between
genes. Introns occur within genes and they make up the remaining 25% of non-coding DNA.
The genetic code The genetic code Gene
Watch the animation. 1 Double

Describe how the code The genetic code is the term used for the way strand
is stored. that the four nitrogenous bases of DNA, adenine, of DNA
Triplet Triplet Triplet
thymine, guanine and cytosine, are ordered. The
base order is ‘read’ by cellular machinery and
2 Sense
turned into a protein via a process called protein strand
synthesis. Cellular machinery consist of ‘biological of DNA
machines’ that work to manufacture a biological

Transcription
molecule. The transcription machinery includes
RNA polymerase and binding factors/proteins.
The translation machine is the ribosome. 3 mRNA
In the genetic code, each set of three DNA
nucleotides in a row counts as a triplet and codes
Codon Codon Codon
for an mRNA (messenger RNA) triplet called a
codon. The mRNA codon (three nucleotides) is FIGURE 3.18 The genetic code is a base triplet code.
9780170452922
again read by cellular machinery and is translated into a single amino acid. Each sequence of three
nucleotides codes for an amino acid. Given that some proteins are made up of hundreds of amino
acids, the code that would make one protein could have hundreds, sometimes even thousands, of
triplets contained in it.
Key concept
The genome sequence consists of coding DNA (genes) and non-coding DNA. Three coding DNA
nucleotides make a triplet, which matches an mRNA codon.
Question set 3.4

1 Define: 3 Differentiate between a DNA triplet and a
a genome sequence codon.
b coding DNA ANALYSING
c non-coding DNA.
2 State the link between an organism’s 4 Why are nucleotide sequences read in
genotype and phenotype. threes?
3.5 PROTEIN SYNTHESIS

Proteins are essential to the structure and function of cells, and thus also to the structure and function
of organisms. Protein synthesis is the process of making new proteins from the genetic information
encoded in DNA. There are two main processes that facilitate the flow of information from gene to
protein: transcription and translation. Transcription is the synthesis of mRNA using the stored DNA code.
The synthesised mRNA is a chain of RNA nucleotides complementary to the DNA strand, except uracil
(rather than thymine) is the base pair of adenine in RNA. Translation is the synthesis of a polypeptide
using the information in the mRNA. The RNA nucleotide code is translated into an amino acid sequence.
Codons
A series of three nucleotides found in mRNA.
They act as a code for an amino acid e.g.
Enzymes
UAU codes for the amino acid tyrosine.
Help break or form new bonds
A START codon (AUG) initiates translation, and
e.g. RNA polymerase
a STOP codon (UAG) brings the process to an end.
Essential materials needed

for the process of protein
synthesis
Nucleic acids Amino acids
DNA stores the code. Twenty amino acids are the building blocks
mRNA transports the code from the of the polypeptides and proteins.
nucleus into the cytoplasm and to the ribosome. The sequence of amino acids in a protein
tRNA is found in the cytoplasm. is a type of code that specifies the structure
For each codon, a tRNA carries a specific amino acid to the and function of the protein, making it
ribosome for incorporation into the growing polypeptide. different from other proteins.
FIGURE 3.19 Major materials required in protein synthesis and their roles
Genes are found in chromosomes in cells. They are sequences of DNA that code for a protein. It is
only during cell division that the DNA can leave the nucleus of a eukaryotic cell. Otherwise, it remains
there, ready for future cell division (mitosis or meiosis). Thus, the DNA code (genes) must be transcribed
into messenger RNA (mRNA) while still inside the nucleus. The mRNA can fit through the nuclear pores
because it is a short, single-stranded molecule. Therefore, the mRNA can carry the code of instructions
9780170452922
to the ribosome, where translation can take place. The ribosome binds to the mRNA. Each codon
attracts the corresponding anticodon that forms part of a tRNA (transfer RNA) molecule. The tRNA
molecule carries the amino acid that is specific to the codon. As one codon at a time moves into and is
read by the ribosome, successive tRNAs transport amino acids to it, translating the code by dropping off
amino acids in a sequence that matches the sequence of codons. Gradually, a polypeptide is produced
(a string of amino acids, joined by peptide bonds). The polypeptide can detach and fold to form a
protein by itself, or attach to other polypeptides and then fold to form a protein.
Transcription and translation in prokaryotes

In a prokaryotic cell (a cell that lacks membrane-bound organelles, including nuclei), the
chromosome is generally in the form of a closed circle that is not wrapped around histone proteins.
It is found in the region of the cell known as the nucleoid. In addition to the single chromosome,
bacteria may contain plasmids, which are small rings of DNA. Plasmids code for traits but are not
essential to the survival of the cell (although they may aid in its survival). Transcription begins when a
section of the double-stranded chromosome is separated and enzymes synthesise an mRNA product
complementary to the template strand. In prokaryotes, transcription and translation are simultaneous;
that is, translation begins while the mRNA is still being synthesised, during transcription. Numerous
ribosomes concurrently translate the mRNA transcripts into polypeptides. In contrast, a eukaryotic cell
performs transcription in the nucleus, and translation in the cytoplasm.
Question set 3.5a

REMEMBERING function of each in the synthesis of a
1 Describe why protein synthesis is needed. protein.
2 State the two main processes involved in ANALYSING
protein synthesis. 4 In eukaryotes, translation follows
transcription. Differentiate between
UNDERSTANDING transcription and translation in
3 Describe four essential materials required prokaryotes and eukaryotes, and state
for protein synthesis and include the why it may be simpler in prokaryotes.
Transcription in eukaryotes
Transcription, a process that produces mRNA from DNA, occurs in the nucleus in eukaryotes. During
transcription, one section of DNA, called a gene, is unwound and separated ready for copying.
RNA polymerase moves step by step along the DNA molecule, separating the two strands. Only
the template strand is copied. The template strand is also known as the antisense or non-coding
strand. The other strand is known as the non-template, sense or coding strand. The coding strand
has the same code as the mRNA, except in RNA uracil replaces thymine. The sequence of the DNA
nucleotides determines the sequence of the RNA nucleotides, because RNA polymerase attaches
the RNA nucleotide that is complementary to each DNA base. The complementary pairs are added
according to the base-pair rules, shown in Table 3.3.
TABLE 3.3 The complementary base pairs attach during transcription according to base pair rules.
DNA NITROGENOUS BASE COMPLEMENTARY RNA NITROGENOUS BASE IN THE

RNA NUCLEOTIDE
Adenine Uracil
Thymine Adenine
Cytosine Guanine
Guanine Cytosine
9780170452922
A promoter attaches to help the DNA template strand to locally separate from the non-template
strand, initiating transcription. RNA polymerase binds to the DNA to get ready to start synthesis. RNA
polymerase synthesises the mRNA in a 5' to 3' direction, anti-parallel to the template strand. The mRNA
nucleotide triplets are called codons. The codons are complementary to the template strand but
almost identical to the non-template/coding strand, except for uracil replacing thymine. After the RNA
polymerase enables elongation of the strand, the mRNA molecule detaches as pre-mRNA. Pre-mRNA
requires processing before it exits the nucleus via the nuclear pore. Stretches of non-coding DNA (known
as introns) are removed and the remaining stretches of DNA (known as exons) join to form mature mRNA.
Introns and exons
YCARETIL CIFITNEICS
As part of the normal process of generating proteins from genes stored in DNA, the code for
constructing a particular protein is passed from stored DNA to a form that is transportable
known as messenger RNA (mRNA). The strip of mRNA that is first formed when the DNA code
is copied has excess baggage. In most eukaryotes, the mRNA initially carries the instructions
for making a protein, but also carries extra nucleotides that are not needed. The unrefined
mRNA is called pre-mRNA.
Before the mRNA can leave the cell nucleus, non-coding regions called introns are cut out
in a process called (pre-)mRNA splicing. The remaining exons join together as the final set of
refined instructions, ready to move out of the nucleus via a nuclear pore. The refined mRNA
is called mature mRNA. It performs the function of carrying the code to the translation site,
where proteins are built one amino acid at a time according to the code.
The discovery of mRNA splicing in the late 1970s was simultaneous with the revelation mRNA splicing
that a single species of pre-mRNA could be spliced in different ways, creating multiple, distinct Watch this animation
to help you understand
mature mRNAs. This is now known as ‘alternative splicing’. The various mature mRNAs pre-mRNA splicing:
contain different combinations of exons. The different combinations give rise to different
proteins.
Scientists at the American Society
for Microbiology have studied alternative
splicing in Apicomplexan parasites.
Apicomplexan parasites are pathogens
(organisms that cause an infectious disease)
found in humans and domestic animals.
These parasites have also been reported
MSI/LOP NIALA/yrarbiL otohP ecneicS
by CSIRO as being parasitic on Australian

reptiles, mammals such as the echidna, and
the green tree frog. Funding for research
into parasites of Australian wildlife is sparse,
and anti-parasitic drugs have been hard
to develop. Perturbation (interruption) of
alternative splicing has been found to be FIGURE 3.20Toxoplasma gondii, a species of
detrimental to these parasites, making it a Apicomplexan parasite
worthy drug target to pursue if we wish to
reduce disease in humans and domestic animals.
Questions
1 Describe pre-mRNA splicing.
2 Explain the rationale for spending money on research into parasites of Australian
wildlife.
3 Describe the relationship between studying alternative splicing and anti-parasitic
drugs.
9780170452922
TABLE 3.4 Summary of transcription
STEP VISUAL AID

Preliminary information
Only one of the two
strands of DNA is used for Non-template strand
transcription: the template DNA DNA
rewinds unwinds
strand (also known as the
non-coding strand or the RNA polymerase
antisense strand).
1 RNA polymerase binds Template
to a promoter region. strand
It breaks the weak

hydrogen bonds joining
the complementary
nucleotides and unzips mRNA transcript
(unwinds) a portion of
the double helix.
FIGURE 3.21 RNA polymerase binds to a promoter region and an area of one gene on the DNA
molecule becomes unzipped, beginning transcription.
2 Moving along the 5' Non-template strand
3'
template DNA strand T A C T G CC T AG T CG GCG T T CGC C T T A A CCG C T G T A T T
in a 3' to 5' direction,
the RNA polymerase 5' RNA transcript 3'
adds free-floating U A CUG CC U AG UCG GCG UU RNA polymerase

nucleotides to the A T G AC GG A T C A G CCG C A AG CG G A A T T G GCG AC A T A A
3' 5'
growing mRNA Template strand
sequence according
to the complementary FIGURE 3.22 mRNA is synthesised in a 5' to 3' direction by RNA polymerase.
base-pair rules, but in
RNA uracil pairs with
adenine. The new strand
of mRNA is synthesised
in a 5' to 3' direction.
3 The DNA bases are Single coding Double strand
strand of DNA of DNA
in triplets, and the
Gene
complementary mRNA
triplets produced are
called codons. The
process continues until
there is a termination
signal and the Triplet
G A C A C T G A C T C T C G T T A C T C T G A C C A T
pre- mRNA is released.
G A
Transcription
U
C U G U G A C U G A G A G C A A U G A G A C U G G U A
C
Codon
Strand of mRNA
FIGURE 3.23 The mRNA produced contains codons that are complementary to the DNA triplets.
9780170452922
STEP VISUAL AID

4 Only the coding region Gene
(gene) of DNA is
transcribed. Pre-mRNA
consists of introns and
exons. The introns are
removed and the exons Promoter region Coding region
are joined to create
mature mRNA. Mature
mRNA then exits the
nucleus via a nuclear Transcription
pore. Pre-mRNA 5' Intron Exon Exon Intron Exon 3'
Untranslated Untranslated
region region
Mature mRNA 5' UTR Exon Exon Exon UTR 3'
FIGURE 3.24 The coding region of DNA is transcribed into pre-mRNA, which is then processed to make
mature mRNA.
Key concept
Protein synthesis in eukaryotes includes the process of transcription. Transcription occurs in
the nucleus and is the process of transcribing the code from DNA into a smaller molecule called
mRNA, which can then leave the nucleus.
Question set 3.5b

REMEMBERING APPLYING
1 Explain the purpose of transcription. 4 Apply what you have learned about coding
2 State the site for eukaryotic transcription. and non-coding DNA to differentiate
UNDERSTANDING between introns and exons.
3 Differentiate between a DNA triplet and
an mRNA codon.
9780170452922
Translation in eukaryotes Growing

polypeptide
Protein synthesis involves both transcription
3D animation of DNA to
RNA to protein and translation. These processes enable
genetic information to flow from DNA to
Amino acid
tRNA
mRNA to protein. Transcription is the process
of synthesising a copy of the DNA code in the
form of mRNA. Translation is the RNA-directed
synthesis of a polypeptide. C
CC
Ribosomes facilitate the interaction of mRNA
A A A UCG
and tRNA to position and connect a specific
G GG UUU AGC
sequence of amino acids. Ribosomes are mostly
mRNA
composed of ribosomal RNA (rRNA), which is
non-coding.
Process of translation Movement of ribosome
After mRNA moves out from the nucleus through FIGURE 3.25 Ribosomes read codons to construct
a nuclear pore, it enters the cytoplasm and polypeptides.
travels to a ribosome, where it will be read and
translated. The translation process can be divided into three main stages: initiation, elongation and
termination.
Initiation
A ribosome binds to a molecule of mRNA. It ‘reads’ the mRNA nucleotides in threes. A group of three
consecutive nucleotides is called a codon. A special codon, AUG, is the start codon and codes for the
amino acid methionine. It signals the start of translation and the beginning of a polypeptide chain.
The tRNA molecule that contains the anticodon UAC is attracted to the start codon and pairs with it.
This tRNA molecule brings with it the amino acid methionine. At initiation, two codons enter and are
bound to the ribosome, but after that only one codon enters and is translated at a time.
Elongation
A tRNA molecule, which includes in its sequence an anticodon, is attracted to the corresponding
codon on the mRNA due to complementary base pairing. Each tRNA molecule carries an amino acid
specified by the codon that it pairs with. As one codon is read and exits the ribosome, another one
slides in to be read. tRNAs transfer the amino acids to the mRNA–ribosomal complex in the order
specified by the codons of the mRNA. The ribosomes catalyse the formation of covalent peptide
bonds between adjacent amino acids. The mRNA is moved through the ribosome in one direction
only. Once a tRNA molecule has dropped off its amino acid, it will return to the cytoplasm to reload
with the same type of amino acid. Note that the tRNA is not used up during translation, and some
amino acids are coded for by more than one codon.
Termination
Elongation continues until a stop codon in the mRNA enters the ribosome. The nucleotide base
triplets UAG, UAA and UGA do not code for an amino acid. Instead, any one of them acts as a signal
From DNA to protein
Watch this short video to stop translation. The polypeptide is then released and the mRNA leaves the ribosome. Once
on protein synthesis. removed, the polypeptide may fold (or join with another polypeptide to fold) to become a structural
or functional protein. The protein will either be used in the cell it was formed in or be transported out
of the cell for use elsewhere. Note that the tRNA is not used up during the translation process, and
some amino acids are coded for by more than one codon.
9780170452922
TABLE 3.5 Summary of translation
STEP VISUAL AID

1 The short, single-
stranded mRNA leaves Nucleus DNA
the nucleus via a
Nuclear pore
nuclear pore to bind
with a ribosome in the
cytoplasm. A subunit
of the ribosome binds Synthesis of mRNA
to mRNA to begin (transcription)
mRNA
protein synthesis.
Movement of mRNA
Cytoplasm
mRNA
Ribosome
Synthesis of protein
(translation)
Polypeptide
FIGURE 3.26 mRNA leaves the nucleus and binds with a ribosome in the cytoplasm.
2 A start codon (AUG) in

the mRNA molecule
Amino acid Met
signals for a tRNA
molecule with the
complementary
anticodon (UAC) to
arrive for base pairing. Ribosome
tRNA
The tRNA molecule
carries the first amino mRNA
acid, methionine.
Anticodon UAC
A U G G G U G U A C C C (etc.)
Start codon
FIGURE 3.27 The start codon in mRNA is usually AUG.
9780170452922
STEP VISUAL AID

3 The next codon
attracts a new tRNA
molecule with the Met Gly
corresponding
anticodon and amino
acid attached. One
tRNA molecule at a
time, with its specific
amino acid attached,
moves into the
ribosome while the
other, now minus its
amino acid, leaves
the ribosome. After
each codon partners UAC CCA
with an anticodon, the A U G G G U G U A C C C (etc.)

amino acid is removed
from the tRNA and is
joined to a growing
amino acid chain by
a covalent peptide FIGURE 3.28 Amino acids are attached one at a time and according to the order of the codons.
bond. The ribosome
‘reads’ one codon at
a time.
4 When a stop
codon appears, Free
elongation ceases polypeptide
Release factor
and the polypeptide
is released from
the ribosome. The
ribosome separates
from the mRNA. tRNA
3' 3'
5' 5'
mRNA
Ribosome
Stop codon
FIGURE 3.29 The polypeptide is formed and released.
9780170452922
STEP VISUAL AID

5 The polypeptide Primary structure
Amino acid sequence
either folds to form a
Phe Gly
protein or joins with Glu Asn
another polypeptide Gln
to fold to become a Ala
3D protein ready to
Arg
perform a function. Pro Tyr Ser
Trp
Primary, secondary, Asp Ile Met
Cys Leu Lys
tertiary and quaternary
describe different Val
His
levels of protein
structure, from simple
to complex.
Secondary structure
Regular substructures
Interactions
between side
chains create
the 3D structure
Quaternary structure Tertiary structure

Complex of protein molecules 3D structure
FIGURE 3.30 Protein synthesis is complete.
Key concept
Protein synthesis in eukaryotes includes translation. Translation occurs at a ribosome in the
cytoplasm, and uses the code in mRNA to produce a sequence of amino acids called a polypeptide.
Question set 3.5c

REMEMBERING CREATING
1 Define polypeptide. 4 Create a flow diagram showing the
2 State the enzyme(s) involved in separating summarised steps of transcription and
the two strands of DNA and synthesising translation.
an mRNA strand.
UNDERSTANDING
3 Describe the relationship of tRNAs to
mRNA and amino acids.
9780170452922
3.6 PROTEINS
Proteins are built of their basic units or monomers (known as amino acids) and are essential to cell
structure and functioning. Some proteins are quite rigid, such as collagen (which plays a structural
role in the connective tissue of mammals). Other types of protein, such as enzymes, perform
functional tasks. Enzymes (e.g. lipase and trypsin) are catalysts that increase the rate of virtually all
of the chemical reactions within cells. The protein shape at the active site of an enzyme determines
the specificity of the enzyme: only specific enzymes can fit with specific substrates. In addition
to providing mechanical support and functioning as catalysts, proteins transport and store other
molecules (such as oxygen), provide immune protection, generate movement, transmit nerve
impulses, and control growth and differentiation.
A protein’s structure is vital to its function. A slight change in structure can alter the function
of a protein to the extent that cell death may be triggered. Programmed cell death (apoptosis) is
an important strategy for disposing of damaged or infected cells and those no longer needed in a
multicellular organism.
Proteins are built from a selection of 20 different amino acids. The amino acids are linked
together by peptide bonds to form polypeptide chains, which fold and/or are modified to form the
protein. The sequence of amino acids in a polypeptide is determined by the sequence of mRNA
codons in a strand of mRNA. If the sequence of codons is known, the sequence of amino acids can
be determined from an amino acid table (also known as a codon table, Figure 3.31. A codon table is
a translation table that identifies the amino acids that correspond to the mRNA codons. To find the
amino acid coded for by an mRNA codon, look for the three nitrogenous base letters in the table.
There are 64 possible base triplets (4 × 4 × 4), and three of these are stop codons that signal for
translation to stop.
Second base
U C A G Ala = alanine
Arg = arginine
UUU UCU UAU UGU
Phe Tyr Cys U
Asn = asparagine
UUC UCC UAC UGC
C
U Ser Asp = aspartic acid
UUA UCA UAA Stop UGA Stop A
Leu Cys = cysteine
UUG UCG UAG Stop UGG Trp G
Gln = glutamine
CUU CCU CAU CGU Glu = glutamic acid

U
His
CUC CCC CAC CGC C Gly = glycine
C Leu Pro Arg
CUA CCA CAA CGA A His = histidine
esab drihT
esab tsriF
Gln
CUG CCG CAG CGG G Ile = isoleucine
Leu = leucine
AUU ACU AAU AGU U Lys = lysine
Asn Ser
AUC Ile ACC AAC AGC C Met = methionine
A
Thr
AUA ACA AAA A Phe = phenylalanine
AGA
AUG Met/ ACG Lys Arg G
AAG AGG Pro = proline
Start
Ser = serine
GUU GCU GAU GGU U Thr = threonine
Asp
GUC GCC GAC GGC C Trp = tryptophan
G Val Ala Gly
GUA GCA GAA GGA A Tyr = tyrosine
Glu
GUG GCG GAG GGG G Val = valine
FIGURE 3.31 The genetic code is shown by a codon table. The mRNA codons correspond to the 20 amino acids
used to build polypeptides during translation on the ribosomes. Three codons act as stop codons, and (under
certain conditions) the codon AUG initiates protein synthesis.
9780170452922
The genetic code for keratin, a protein building block for hair, is transcribed and translated by
specialist cells underneath growing hair. The following sequence is part of the mRNA molecule that is
transcribed from the gene for keratin: AUGUCUCGUGAAUUUUCC.
To determine the sequence of amino acids, divide the nucleotides from the gene into sets of three.
AUG UCU CGU GAA UUU UCC
Then use the codon table (Figure 3.31) to translate the code. The first codon (AUG) is a start
codon that codes for an amino acid called methionine. Continuing along the gene, the entire
sequence for this section of the code is:
methionine–serine–arginine–glutamic acid–phenylalanine–serine
Question set 3.6

1 Define protein. 5 Use the codon table (Figure 3.31) to
2 State two of the main types of proteins determine the chain of amino acids for the
needed in an organism. following DNA code:
3 Give an example of each of the two types UACAGAGCACUUAAAAGG.
of protein in your answer to the previous
question, and describe their functions.
UNDERSTANDING
4 Compare and contrast a codon and
anticodon.
The koala’s DNA has been sequenced CASE

STUDY
Koala populations in NSW and Queensland
dropped by 42% between 1990 and 2010,
according to the federal Threatened Species
Scientific Committee. Reasons for the decline
included chlamydia (an infectious disease),
bushfires (destroying their habitat), wild dogs
and climate change. Koalas are particularly
vulnerable to climate change because they
are heavily reliant on trees for their homes
and food. The severe population declines
experienced by koalas have prompted WWF-
Australia and other groups to nominate the
koala for to have its listing changed from
vulnerable to endangered.
A team of Australian and international
scientists, led by Adjunct Professor and
Australian Museum Research Institute
director Rebecca Johnson (pictured) and
samorH acisseJ/sotohP xafriaF
Professor Katherine Belov at the University

of Sydney, completed the world-first full
sequencing of the koala genome in 2018. The
entire sequence of nucleotides found in a
koala’s DNA was recorded. FIGURE 3.32 Researchers such as Rebecca
The Australian-led Koala Genome Johnson aim to help koala conservation using
Consortium of 54 scientists from 29 genomic studies.
9780170452922
institutions across seven countries sequenced Some of the 26 000 koala genes
the more than 3.4 billion base pairs and more identified in the koala genome project help
than 26 000 genes in the koala genome, explain the koala’s extraordinary ability to
which makes it slightly larger than the human survive almost exclusively on eucalypt leaves,
genome. a diet high in toxins. Researchers found an
You may be wondering how this helps abundance of genes for bitter taste receptors
the plight of the Australian koala? Koala joeys (which would allow koalas to identify the
are born after 35 days of gestation, when they least toxic leaves), as well as genes that code
are the size of a jelly bean. While they are in for proteins that help detoxify the poisonous
their mother’s pouch, they are protected by substances.
antimicrobial peptides in her milk. However,
when they are weaned they no longer have Questions
this protection. They are then susceptible 1 Propose a logical reason why it took
to a bacterial infection called chlamydia. so long for the nucleotides in a koala’s
Sequencing the genome has allowed scientists DNA to be sequenced (i.e. the order of
to characterise the architecture of their nucleotides to be determined)?
immune system and to identify genes that 2 List four changes in the koala’s environment
play a role in resistance and susceptibility to that makes them vulnerable today.
chlamydia. The DNA data can be used to help 3 Explain how our knowledge of the
develop vaccines, manage koala populations sequence of nucleotides (the genome)
and ultimately help with their long-term may be useful for the koala’s long-term
survival. survival.
9780170452922
CHAPTER 3 ACTIVITY AND INVESTIGATION

The genetic code 3.1
The nucleus of eukaryotic cells is packed
YTIVITCA
with DNA, the molecule that is the template Ser
Amino acid
for all the proteins produced by the cell.
Ribosomes, the sites of protein synthesis,
are found in the cytoplasm, outside the
membrane of the nucleus. DNA is unable
to move through the nuclear membrane,
so in order to produce a protein, a message
must be sent from the nuclear DNA to the
ribosome. tRNA
To do this, two processes take place:
1 transcription of the message from the
DNA into an mRNA molecule
2 translation of the message in the mRNA
into a specific amino acid sequence at
the ribosome. U C G
The molecule of mRNA is transcribed
from the template DNA strand using the Anticodon
complementary sequences. However, the FIGURE 3.33 The amino acid serine being carried by a
thymine present in DNA is replaced with tRNA molecule
uracil in RNA. The complementary pairs in
RNA are A–U and G–C.
Translation of the mRNA message occurs at ribosomes, where the sequence of nitrogenous bases
in the mRNA is read in groups of three called codons. Each tRNA molecule contains an anticodon
that is complementary to the codon of the mRNA, and each tRNA binds a specific amino acid.
The tRNA molecules bring their amino acids to the ribosome, where the amino acids are bonded
together, forming a long chain in a specific sequence according to the sequence of the mRNA being
translated.
Aim
To simulate the production of a protein from a sequence of DNA
You will need
• A3 paper
• Coloured pencils
What to do
The sequence of nucleotides that will be used in this activity codes for the enzyme lysozyme.
ATGACCCATGCGTTAGGC
Refer to the genetic code in Figure 3.31 (page 74), the sequence of nucleotides in mRNA that codes
for each of the specific amino acids needed in the synthesis of proteins in nearly all organisms.
1 Divide a piece of A3 paper into six sections.
2 In the first section of the A3 paper, draw a nucleus containing the DNA template for the
complementary strand, using the sequence provided above.
3 In the second section of the A3 paper, show the process of transcription of the template DNA into
mRNA.
4 In the third section of the A3 paper, show the movement of mRNA out of the nucleus.
9780170452922
5 In the fourth section of the A3 paper, show the process of translation of the message.
6 In the fifth section of the A3 paper, describe in words, the process of protein synthesis that you
have just illustrated in diagrams.
1 Describe in your own words the processes of transcription and translation. Include an explanation
of where in the cell each process takes place and which other molecules are involved in each
process. Explain why the cell needs each process for sustaining life.
2 Describe how the hydrogen bonds are re-joined between complementary DNA nucleotides during
transcription.
3 State the sequence of the nucleotides in the transcribed mRNA sequence of lysozyme.
4 DNA is transcribed to make mRNA, but not all transcribed DNA contains codes for a protein.
These non-coding sections get broken down to make nucleotides for re-use in the nucleus. What
is the name for these sections?
5 State the anticodon sequence for the lysozyme protein. Explain the importance of anticodons in
these processes.
6 State the final amino acid sequence coded for by the length of DNA you are working with.
7 Explain the role of uracil in the process of transcription.
3.1 Strawberry DNA extraction

Background
NOITAGITSEVNI
Strawberries have eight sets of chromosomes, making them octoploid (along with pansies, dahlias and
sugar cane). Strawberries are a very effective model for DNA extraction, because their juice provides a
pink solution in which, when treated, the white strands of DNA can be clearly observed.
Aim
To use restriction enzymes to cut DNA into fragments of varying length
Time requirement
30 mins
Materials
• 3 strawberries
• 1 resealable plastic storage bag
• 10 mL DNA extraction buffer
• 5 mL protease enzyme
• 1 inoculation loop
• Test tube
• 2 plastic pipettes
• 1.5 mL centrifuge tube
• Filter paper
• Glass funnel
• 5 mL ice-cold 95% ethanol
• Personal protective equipment, such as lab coats, safety glasses, gloves
9780170452922
Risks
WHAT ARE THE RISKS IN THIS INVESTIGATION? HOW CAN YOU MANAGE THESE RISKS TO STAY SAFE?
Ethanol is highly flammable. Store and use away from ignition sources. Do not heat in a
container over an open flame; use a water bath that is spark proof.
Protease enzyme may cause skin irritation. Wear appropriate personal protective equipment at all times,
including eye protection and gloves. Wash skin immediately if
contact does occur.
Disposable gloves may pose an allergy risk. Use a type of glove that has no allergy risk and is suitable for the
chemicals being used.
Strawberries may pose an allergy risk. Never allow any food to be eaten in class. Check whether anyone
has a known allergy.
Procedure
1 Place three strawberries in a plastic storage bag and re-seal.
2 Squeeze the strawberries in the bag with your fingers until it they are lightly crushed.
3 Open the storage bag and add 10 mL of the DNA extraction buffer.
4 Re-seal the bag and crush the contents again, using your hands to mix the ingredients. Continue
until a thick juice is produced.
5 Using a plastic pipette, add 5 mL of protease enzyme and hand mix through for one minute.
6 Filter the strawberry juice into a test tube. To do this, place filter paper in a glass funnel over the
test tube. Pour the strawberry juice into the filter paper. A clear, pulp-free juice will filter through
into the test tube.
7 Remove the filtering apparatus and slowly pour approximately 5 mL of cold ethanol or 70–90%
isopropyl alcohol into the test tube to cover the strawberry juice solution. Do not agitate the
solution. The ethanol should sit separately on top of the strawberry solution.
8 The cell walls will break down and white strands of strawberry DNA will become visible in the ethanol
layer as the DNA is extracted from within the nuclei. The strands will look like very fine spider webs.
9 Use an inoculation loop to ‘spool’ strands of DNA and observe them more closely. Alternatively,
hold the test tube at eye level and use a pipette to draw up the DNA strands in the top layer of the
fluid.
10 Transfer the DNA strands to a centrifuge tube for further examination.
Results
Describe what you see.
Discussion
1 What roles did the detergent, protease enzyme, ethanol and salt have in the process of DNA
extraction? Many of the foods we consume contain DNA. Explain why ingesting DNA from other
plants and organisms does not cause us harm or alter our DNA.
2 What is the function of DNA?
3 Where is DNA located within a cell?
4 Draw a diagram of DNA. Include five pairs of nucleotide bases and label the hydrogen bonds
between these bases.
5 Explain why the ability to remove DNA from cells is important to scientists.
6 Why does DNA go up towards the surface when the ethanol is added?
7 Summarise your findings and include a flow chart detailing the steps taken to release DNA from
the strawberry cells.
Taking it further
Perform another DNA extraction using alternative plants, such as banana, kiwifruit and wheatgerm.
Following the same procedure, compare the results of the DNA extraction between the various plant
samples.
9780170452922
WS
CHAPTER 3 SUMMARY
Chapter 3 • Rosalind Franklin, James Watson, Francis the newly formed molecule is new and the
Activity sheet
Crick and Maurice Wilkins are credited with other is from the original strand.
the discovery of the structure of DNA in 1953. • The enzymes helicase, polymerase and
• DNA is bound to proteins, forming ligase facilitate DNA replication.
linear chromosomes in the nucleus of • All of the DNA in the cell of an organism
eukaryotes, but unbound and circular in the is referred to as its genome or genetic code,
mitochondria and chloroplasts. and the nucleotides are grouped into threes
• DNA also exists in an unbound, circular (triplets).
form in the nucleoid region of the cytosol of • DNA includes coding and non-coding
prokaryotes. sections. Coding DNA contains instructions
• DNA is composed of four different types for the production of a protein.
of nucleotides; each nucleotide has a • Protein synthesis involves transcription
deoxyribose sugar, a phosphate group and a of a gene into messenger RNA (mRNA) in
nitrogenous base. the nucleus, and translation of the mRNA
• The two strands of a DNA double helix are code into an amino acid sequence at the
linked by weak hydrogen bonds between ribosome.
the complementary bases: adenine (A) pairs • A chain of amino acids is called a
with thymine (T), and cytosine (C) pairs polypeptide. At the conclusion of protein
with guanine (G). synthesis, a polypeptide will fold or be
• Like DNA, RNA is composed of nucleotides; modified to become an active protein.
however, in RNA each nucleotide has a ribose • Protein structure determines function, and
sugar, and it contains uracil (U) instead of can be described as primary, secondary,
thymine (T). tertiary or quaternary.
• The sugar–phosphate backbone of the • Proteins are essential for an organism’s
nucleotides is arranged in a 5' to 3' direction. survival. Two of the main protein types
• DNA replicates by a semi-conservative are structural proteins (e.g. collagen) and
mechanism, whereby one of the strands in enzymes (e.g. lipase).
CHAPTER 3 GLOSSARY
5' to 3' The direction of synthesis on a e.g. transcription machinery includes RNA
nucleotide strand polymerase and binding factors or proteins; the
Amino acid An organic compound that is a translation machine is the ribosome
building block within a polypeptide or protein Chromosome A structure composed of DNA
Amino acid table See codon table and protein that contains linear arrays of genes
carrying genetic information; prokaryotes
Anticodon A set of three consecutive
nucleotides that is part of a tRNA molecule generally have one circular chromosome,
and is complementary to a codon; the three whereas eukaryotes have a number of linear
nucleotides consist of any of the four bases chromosomes
adenine, uracil, guanine or cytosine Coding DNA The sections of DNA that code
Apoptosis A programmed series of events that for a protein; they contain instructions that
leads to cell death (as a result of the dismantling determine the order of the codons in the mRNA,
of the internal contents of the cell by various which in turn determines the order of the amino
enzymes, including caspases) acids in a polypeptide or protein
Cellular machinery ‘Biological machines’ that Codon A set of three consecutive nucleotides
work to manufacture a biological molecule; found in a DNA or an mRNA molecule; it
9780170452922
carries codes for a specific amino acid; the three DNA; two linear strands that run opposite to
nucleotides consist of any of the four bases each other and twist together
adenine, thymine, guanine and cytosine in the Enzyme A reusable, biological catalyst that
case of DNA, or adenine, uracil, guanine and lowers the activation energy of a chemical
cytosine in the case of mRNA reaction, making it proceed faster; it is a protein
Codon table (amino acid table) A translation that is sensitive to factors such as temperature
table for determining the amino acid coded for and pH
by an mRNA codon; the three nitrogenous base Gene A unit of heredity that transmits
letters can be looked up in the table to find the information from one generation to the
name of the specified amino acid next; a segment of DNA that codes for a
Complementary base pairing The phenomenon polypeptide
whereby guanine always hydrogen bonds Genetic code The term used for the way that
with cytosine and adenine always hydrogen the four nitrogenous bases of DNA (adenine,
bonds with thymine; guanine and cytosine thymine, guanine and cytosine) are ordered and
share three hydrogen bonds, and adenine contain information to direct the production of
and thymine share two hydrogen bonds; the specific proteins
complementary pairing enables the helical
Genome All of the genetic material contained
structure of DNA to form
in an organism or a cell; it includes the sequence
DNA (deoxyribonucleic acid) The information- of the DNA in the chromosomes within the
containing molecule present in all living things nucleus, mitochondria and chloroplasts
that contains the instructions, written in a
Genome sequence The sequence of
chemical code, for the production of proteins by
consecutive DNA ‘letters’ spanning all the
the cell; the information it contains is sufficient
chromosomes of a cell from start to finish
for the making and maintaining the organism; in
addition, DNA is the genetic material that passes Genomics The study of the genome – how
this information on to the next generation genes interact with one another, the environment
and the resultant proteins produced; knowledge
DNA helicase An enzyme that helps the two
of an organism’s entire DNA sequence
strands of the DNA double helix unwind and
separate Heredity The study of inheritance, the genetic
transmission of characteristics from one
DNA ligase An enzyme used to catalyse the
generation to another
formation of a bond between two pieces of DNA
Lagging strand The DNA strand that
DNA polymerase A member of a class of
is synthesised discontinuously in small
enzymes found in all living things, that
fragments, called Okazaki fragments, in a
synthesises new strands of DNA based
5' to 3' direction
on a template strand and according to
complementary base-pair rules; DNA Leading strand The DNA strand that is
polymerases are important tools in synthesised continuously in a 5' to 3' direction
biotechnology because they are capable of Mature mRNA mRNA that has been processed
making exact copies of fragments of DNA, after transcription; non-coding introns have
enabling efficient and accurate amplification of been removed and the remaining exons joined
DNA templates mRNA (messenger RNA) The RNA molecule
DNA replication The process a DNA molecule that carries the information from a gene to a
undergoes to make a complete and identical ribosome for translation into a polypeptide; in
copy of itself, readying a cell for cell division; eukaryotes it carries the message from the DNA
it is a semi-conservative process, and the two in the nucleus out through a nuclear pore to a
daughter molecules contain exact copies of the ribosome in the cytoplasm
genetic material in the parent molecule Nitrogenous base A structural component
Double helix The structure formed by double- of the nucleotides that make up DNA or
stranded molecules of nucleic acids such as RNA
9780170452922
Non-coding DNA All of the DNA sequences Promoter A relatively short nucleotide
within a genome that are not found within sequence in the DNA of a gene that attaches
mRNA-coding exons; examples include introns, RNA polymerase to the start of the strand to
promoters and enhancers of genes; they have no begin synthesis of RNA during transcription
known function Protein A type of essential biological
Non-template/sense/coding strand The coding macromolecule; the structure of each protein is
strand is also known as the sense strand; this vital to its function; proteins are made of one or
strand has the same code as the mRNA strand, more folded and modified polypeptides
except uracil replaces thymine; it is not read
Protein synthesis The process whereby cells
during transcription produce proteins from instructions encoded in
Nuclear pore A small opening in the nuclear genes found in the coding section of the cell’s
membrane through which relatively small DNA; the process can be divided into two major
single-stranded molecules such as mRNA steps: transcription and translation
can fit
Replication fork The junction between the
Nucleoid The region within a prokaryotic cell unwound single strands of DNA and the intact
that contains the genetic material double helix during DNA replication
Nucleotide The basic building block of
Ribosome An organelle found in prokaryotes
nucleic acids (DNA and RNA); nucleotides are
and eukaryotes; it facilitates the interaction
linked together by phosphodiester bonds; each
of mRNA and tRNA in transporting and
nucleotide is made up of a five-carbon sugar, a
connecting specific sequences of amino acids into
phosphate group and a nitrogenous base polypeptides (translation); it is mostly composed
Okazaki fragment A short fragment of DNA of rRNA and can be found attached to endoplasmic
synthesised during DNA replication; multiple reticulum or alone in the cytosol of a cell
fragments are joined together to make the
RNA (ribonucleic acid) A molecule consisting
lagging strand during replication
of a single strand of nucleotides; it plays an
Organelle A specialised part of a cell that has essential role in protein synthesis (as messenger
its own specific function; a ‘little organ’ RNA or transfer RNA) and as a structural
Peptide bond A covalent bond that links amino component of ribosomes
acids in a polypeptide
Semi-conservative replication The production
Phosphodiester bond A covalent bond that of two new DNA double-helix molecules,
links a 3' carbon in one sugar to a 5' carbon in each consisting of one parental strand and one
another sugar in DNA and RNA; it consists of a daughter strand
phosphate group, its covalent ester bond with
Sequencing The process of determining the
the 3' carbon and its covalent ester bond with the
order of nucleotides in a strand of DNA
5' carbon; this bond connects nucleotides, which
form the backbone of a DNA or RNA chain Template/antisense/non-coding strand The
strand of DNA that is read by a polymerase
Plasmid A small, circular piece of DNA,
found in bacteria, that is able to replicate enzyme in order to attach the complementary
independently of the cell’s chromosome; base pairs
engineered plasmids may carry antibiotic- Trait An inheritable characteristic; phenotype
resistance markers Transcription The synthesis of mRNA in which
Polypeptide A string of amino acids, joined by the sequence of nucleotides is complementary
peptide bonds to the sequence in the stored DNA code, except
Pre-mRNA The strand of precursor mRNA that that in RNA, uracil replaces thymine
is first produced after transcription of a gene; it Translation The synthesis of a polypeptide
contains introns and exons (from non-coding using the information in mRNA; the RNA
and coding DNA, respectively); it is processed nucleotide code is translated into an amino acid
to become mature mRNA sequence
9780170452922
Triplet A set of three consecutive tRNA (transfer RNA) An RNA molecule that
nucleotides in DNA; the three nucleotides contains an anticodon (complementary to
may consist of any of the four possible an mRNA codon); it carries an amino acid
nitrogenous bases: adenine, thymine, guanine (specified by the codon) to a ribosome during
or cytosine protein synthesis

Remembering
1 State the type of chemical bond that holds the two strands of a DNA double helix together.
2 Describe the structure of DNA, including at least eight different features.
3 Describe the composition of an organism’s genome.
Understanding
4 Define enzyme, and differentiate between the enzymes used in DNA replication and those used
in protein synthesis.
5 Explain how accumulated information led to our current knowledge of DNA structure.
6 Describe how DNA may contain coding and non-coding DNA.
7 Explain why each of the following statements is incorrect and rewrite it as a correct statement.
aOne strand of the DNA double-helix ladder is maternal and the other strand is paternal.
bDifferent organisms have different types of DNA, so they are very different from one
another.
8 Describe the effect of a protein’s structure on its function.
Applying
9 State two similarities and two differences between transcription and DNA replication.
10 Explain how nucleotides join together to form a polynucleotide chain.
11 Differentiate between pre-mRNA and mature mRNA.
12 Explain how the weak hydrogen bonding between nucleotides (complementary base pairing) in
a DNA molecule allows semi-conservative DNA replication to occur.
13 Four amino acids are linked together in a very short section of a collagen protein.
Glycine–Proline–Proline–Alanine
Use the amino acid table (Figure 3.31, page 74) to determine the mRNA and DNA genetic code
for this short section of the protein.
Analysing
14 Write the full names of DNA and RNA and record their structural differences in a table.
15 Scientists from the Australian-led Koala Genome Consortium have sequenced the koala
genome. Analysis of the data reveals there are more than 26 000 genes on the 16 chromosomes.
a Name the nucleotide that would be present in approximately the same number as the
adenine nucleotides sequenced.
b Explain whether you would expect the sequence of DNA to be exactly the same in all
members of the koala species.
c Estimate how many chromosomes a baby koala would get from its mother.
d State a koala’s diploid number and its haploid number.
9780170452922
Evaluating
16 ‘DNA is self-replicating.’ Discuss whether DNA needs anything else in order to replicate itself.
17 DNA polymerase synthesises DNA in a 5' to 3' direction. Does this mean DNA polymerase
moves in the same direction as helicase on the leading and lagging strands?
Creating
18 Create a poster describing DNA structure.
19 Make a clear set of instructions for a cell to make a protein.
Reflecting
20 Watson and Crick used the contributions of scientists before them as a basis for their
hypothetical model of DNA. Explain how your own understanding of DNA structure developed
through your accumulation of knowledge.

1 In a DNA molecule, cytosine pairs with: 5 DNA is made of units called nucleotides.
A adenine Draw and label a diagram of a nucleotide.
B guanine (5 marks)
C thymine [Q31a 2017 SCSA]
D uracil.
6 a List the two sets of complementary base
[Q1 2018 SCSA]
pairs that occur in DNA molecules.
2 If 30% of the bases in a DNA molecule are (2 marks)
adenine, what percentage will be guanine? b Name the type of chemical bond that
A 20 links the complementary base pairs in a
B 30 DNA molecule. (1 mark)
C 60 c Name the base in mRNA that is
D 70 complementary to thymine in DNA.
[Q2 2018 SCSA] (1 mark)
[Q31b (i, ii, iii) 2017 SCSA]
3 In protein synthesis, transcription is the
process whereby: 7 Describe the structure of mRNA (3 marks)
A information in DNA is copied into mRNA [Q31c 2017 SCSA]
B information in DNA is copied into tRNA
8 Describe the role of tRNA in protein
C information in RNA is copied into tRNA
synthesis. (4 marks)
D information in transfer RNA is copied
into mRNA. [Q31d 2017 SCSA]
[Q10 2018 SCSA] 9 Describe two differences between DNA and

RNA molecules. (4 marks)
4 During DNA replication, the two new DNA
strands are synthesised from the template [Q31b 2016 SCSA]
strands at the same time. These strands are 10 Describe the structure of DNA and the
synthesised: main steps in DNA replication in a cell.
A in the same direction (10 marks)
B in opposite directions [Q36a 2016 SCSA]
C by RNA polymerase
D by DNA helicase.
[Q18 2018 SCSA]
9780170452922
85
4
VARIATION AND CHAPTER 4 CONTENT
MUTATION By the end of this chapter, you will have covered the
following material.
STARTER QUESTIONS
1 After a protein is made from a gene, how does this relate to
an observable trait?
2 Can you explain how genes and the environment interact? Is
there evidence for this?
3 Mutations can cause great harm in organisms, even death.
How can they possibly be beneficial?
4 Are mutations the only source of variation in a population?
» the phenotypic expression of genes depends on the
interaction of genes and the environment
» mutations in genes and chromosomes can result from
errors in DNA replication or cell division, or from damage by
physical or chemical factors in the environment
» variations in the genotype of offspring arise as a result of the
processes of meiosis, including crossing over and random
assortment of chromosomes, and fertilisation, as well as a
result of mutations
9780170452922
4.1 THE PHENOTYPIC EXPRESSION OF GENES

A gene carries a set of instructions for how to make a protein. When the gene is read, transcribed and
translated into a protein, the gene is said to be expressed. The protein will have a specific function,
depending on the gene. The protein may be a structural protein, contributing to the physical properties
of cells or organisms. Examples are found in microtubules, muscle, membranes and hair. Alternatively,
the protein may be an enzyme that catalyses one of the chemical reactions of cells. By coding for
proteins, genes determine important facets of biological structure and function. These observable
traits are known as the phenotype. However, genes cannot dictate the structure of an organism by
themselves. The other crucial component involved is the environment. Twins may have the same gene
and protein for a trait, but the trait may look different in the two individuals because the environment
can influence the final phenotype. Heredity is the
transmission of traits from one generation to the
next. Although traits can be passed on, offspring
are not identical to their parents, particularly
in sexually reproducing organisms. There is a
diversity of genetic and phenotypic traits within
and between populations known as variation.
It is important to note that, within a
odranoeloreupma/moc.kcotSi
multicellular organism, each of its cells has
the same DNA and therefore the same genes.
However, multicellular organisms have
differentiated cells that perform specialised
functions. Differentiated cells only have a small
number of genes activated; for example, muscle FIGURE 4.1 Genetic variation can be observed in the
cells only have those genes turned on that phenotype of little penguins found on Penguin Island,
control muscle factors. Western Australia.
A colourful example of variation: the Gouldian finch

YCARETIL CIFITNEICS
A bird with vivid splashes of yellow, lilac and green hops onto a branch and tips her black-
topped head from side to side. She is a Gouldian finch (Erythrura gouldiae). The Gouldian finch
is a native inhabitant of the tropical grasslands of northern Australia, as well as a popular
aviary bird. There are three distinctive forms distinguishable by head colour: red, black, and
yellow-orange (Figure 4.2). They were once found across northern Australia in their millions,
but now are distributed sparsely in small flocks in the Kimberley and Northern Territory.
The colour variation is associated with a suite of other differences in the birds. For example,
the red-headed birds tend to be the most aggressive and frequently establish themselves at the
top of the pecking order. By contrast, black-headed birds tend to be more inquisitive and are more
likely to explore novel features in their environment. There are physiological differences, too.
The red-headed birds are comparatively sensitive
to starvation if food becomes scarce, and during
breeding they respond by reducing the number of
eggs they lay. Under the same conditions, however,
nujeemesar ianiV/moc.kcotsrettuhS
black-headed birds continue to lay the same number

of eggs and work harder to find food.
Females primarily seek a mate whose head
colour matches their own. The head colouration
is a mark of genetic compatibility. If a black-
headed female mates with a red-headed male,
comparatively few of their hatchlings survive FIGURE 4.2 The three forms of Gouldian finch
9780170452922
CHAPTER 4 | Variation and mutation 87
to maturity. Around 60% of the sons and less than 20% of the daughters from such a pairing
survive.
The Gouldian finch offers insights into the nature of variation. Variations in many features
are observed between members of the same species.This is termed intraspecific variation. The
form that any particular feature takes in an individual organism is described as a phenotype.
Phenotypic variations can be classified according to whether they relate to the organism’s
appearance, chemical make-up or function.
What is the cause of the variation observed between individual birds? In essentially
every case, the phenotype is shaped by the presence or absence of specific proteins and the
activity of those proteins. For example, whether a bird’s head feathers are yellow, black or
red depends on the presence of specific enzymes that generate the pigments that colour the
feathers. A bird’s response to starvation is dependent upon the types and activities of the
hormones and metabolic enzymes it has to sustain it during the period of an altered diet. As
proteins are the products of genes, it is a straightforward conclusion that each phenotype
has an underlying genetic basis.
Recall that diploid (2n) cells have two copies of every gene, each copy residing on one of a
pair of homologous chromosomes. However, each copy of a particular gene is not necessarily
identical. There are often small differences in the DNA sequence of the gene from one copy
to another. These different versions of the same gene are called alleles. Essentially, all of the
body cells of an individual Gouldian finch carry the same chromosomes. Each cell therefore
possesses two alleles for any particular gene, and the two alleles may be the same or they may
be different. If a single gene determines the colour of the head feathers, it is the combination of
alleles the bird has (the genotype) that determines whether that colour will be yellow or black
or red (the phenotype).
The colour of the head feathers, the position occupied in the social hierarchy, the response
to environmental challenges, mate selection and many other features are, largely, an outward
expression of the alleles each bird possesses. The Gouldian finch also demonstrates, however,
that variation is not entirely explained by the alleles each individual has. The size a bird grows
to and the physiological state of the animal are influenced by the availability of food. Breeding
behaviour and outcomes are influenced by the availability of potential mates. To a greater or
lesser extent, the organism’s environment also plays a part.
Questions
1 State the colour variation you can observe in the finches in Figure 4.2.
2 Describe the main genetic source of the observed colour variation.
3 The literature describes other phenotypic variants, such as size, that are affected by
the environment. Choose one and describe how the environment influences the phenotype.
Variation
Variation can be observed among siblings in a family, within a population of a species and between
populations of a species. In this chapter, we explore the mechanisms that drive variation. Three
main mechanisms will be discussed: environmental factors, mutation and sexual reproduction
processes. Environmental factors may influence genotypic and phenotypic diversity. Mutation and
sexual reproduction processes may increase genetic diversity. Genetic factors such as dominance,
recessiveness, codominance and other allele systems also influence phenotype, and these will be
discussed in Chapter 5.
A phenotype is an observable trait produced by the actions of one or more gene-encoded
proteins. The phenotype is influenced by the genotype and the effects of the environment. The
genotype is the genetic composition of an organism for a particular trait. It is the set of alleles that an
organism has for a particular trait. An allele is a form of a gene. Different alleles code for the same trait
but result in different versions of the trait.
9780170452922
Sexual
Mutations
reproduction
Genotype Environment
Phenotype
FIGURE 4.3 Phenotype is influenced by three mechanisms: mutations, sexual reproduction and environment.
Variation also exists between different species; for example, in penguins. Since penguins live
at varying latitudes, and feathers account for nearly 85% of a bird’s insulation, it should follow
that different species would have different feathering patterns. All penguins maintain a body
temperature of around 38°C, but they live in temperatures that range from 32°C on Penguin Island
to –60°C on the sea ice of Antarctica. Banded penguins, such as Humboldt and African penguins,
have featherless patches on their faces and feet to which they divert blood for cooling when they
are overheating. In contrast, the Adélie penguin, one of two Antarctic species, has complete feather
coverage up to the base of its beak.
Key concept
The interaction between genes and the environment leads to variation in observable traits (the
phenotype) of individuals.
Question set 4.1

1 Define: 4 Explain the relationship between the terms
a variation alleles, genotypes, proteins and phenotypes.
b phenotype APPLYING
c genotype
d allele. 5 Penguins are found in various
2 Name the main sources of genotypic environments, with temperatures ranging
variation. from –60°C to 32°C. Calculate:
3 State two mechanisms of phenotypic a the mean temperature
variation. b the median temperature.
4.2 ENVIRONMENTAL FACTORS

Phenotype is shaped by the presence or absence of specific proteins and the activity of those
proteins. In turn, phenotypic expression of genes depends on the interaction of genes and
environmental factors. The alleles for a particular gene are found on homologous chromosomes
and form the genotype. The genotype strongly influences the phenotype, but there can be a range
of phenotypes due to environmental influences. Genotypes for height, size, skin colour and flower
colour are some traits that can have a range of phenotypes given the same genotype. However,
there are some traits that are strictly defined by genotype, such as the ABO blood group system.
9780170452922
Environmental factors that influence phenotype can be external or internal. External

environmental factors include temperature, pH, availability of food, light exposure and wind exposure.
For example, for crocodiles, alligators, and certain lizard and turtle species, an embryo can become
either a male or a female depending on the temperatures it experiences while in the egg.
Another example of phenotype being
affected by the external environment is
hydrangea flower colour. The range of
colours can be traced back to the pH
in the soil, and ratios of additives such
as aluminium ions. A more acidic soil is
oknehcjerdnA aniraM/moc.kcotsrettuhS
conducive to blue flowers. The pH does
not change the genome (the total DNA
content of the individual organism) because
the genotype does not change. It is the
interaction of the environment with either
the gene or the protein it codes for that
determines the sex in turtles and the flower
colour in hydrangeas. FIGURE 4.4 Soil pH can affect flower colour in hydrangeas.
Rising temperatures turning sea turtles female CASE

STUDY
Researchers studying green sea turtles had to use invasive techniques to find out
found rising global temperatures were the sex of individual turtles. Blood samples
affecting female-to-male ratios faster than were taken to test for specific hormone
expected. The ratio of males to females levels. On Raine Island (off the coast of
was in decline. Sea turtles reproduce northern Queensland), most of the results
sexually, so the reduction in numbers of showed females. This is an extreme change,
males puts sea turtles at risk of extinction. considering that in the 1970s a study
The sex of a sea turtle is a phenotype that showed along the northern Great Barrier
is affected by an environmental factor – Reef that the ratio of females to males was
temperature. Sea turtles bury their newly around 6:1.
laid eggs in sand. The temperature of the Temperatures continue to rise, and so
sand determines the sex phenotype. Cooler the temperatures of sand where eggs are
temperatures produce males; warmer incubating continue to be affected. What
temperatures, 29.1°C and above, produce has scientists most concerned is the rate
females. Relatively recently, rising air and at which the temperatures are changing
water temperatures have affected the and the relatively little time animals have
amount of heat gained by the incubating to adapt to the change. Average global
sand. Consequently, scientists predicted a temperatures are predicted to increase
slight increase in numbers of females and 2.6°C by 2100. Scientists are investigating
a decrease in numbers of males. Scientists ways to help reduce the impact of rising
found they were underestimating the rate of temperatures on the eggs. Strategies include
change in the ratio. A study on a sea turtle the creation of natural and artificial shade
rookery in the Pacific Ocean found the ratio over areas where eggs are laid, and watering
of females to males was 116:1. the sand to cool it down. These strategies
Marine biologist Michael Jensen teamed have resulted in a healthier ratio of male
up with other experts to test Great Barrier to female hatchlings. Many scientists are
Reef sea turtles’ sex to find out if climate hopeful that turtle species can eventually
change had already altered the ratio of become independent again by adapting to the
males to females in hatchlings. Scientists changes.
9780170452922
soyuC oaJ/moc.kcotsrettuhS
FIGURE 4.5 Temperature affects sex determination in sea turtles.
Questions
1 Explain the cause of the abnormal male-to-female ratios in the green sea turtles?
2 Describe the impact this may have on green sea turtles over the long term.
3 Evaluate the method used in this case study to re-establish a more natural sex ratio. Can you
design a better method?
Internal environmental factors include the action of hormones. For example, the release of
gonadotrophin-releasing hormone (GnRH) triggers the start of puberty in humans. Some hormones
are driving forces for growth, and low levels can result in small birth weights and slow development.
A group of veterinary drugs called ‘hormonal growth promotants’ (HGPs) mimic cattle growth
hormones and are used in Australia to increase muscle growth and meat yield.
Epigenetics can affect phenotype

The study of inheritable (but reversible) changes in gene expression without a change in the
Epigenetics research
DNA sequence is called epigenetics. The prefix ‘epi’ means above. In relation to the genome, the
Be inspired by the
sketch video. Try to epigenetic factors are ‘above’ the DNA and exert control over it by activating and deactivating
make your own sketch. genes without altering the DNA. Epigenetics can influence phenotype by controlling gene
Lick your rats expression.
Can the epigenome be Environmental factors can contribute to the addition or subtraction of epigenetic chemical
inherited even though
it does not change factors and turn certain genes on or off. Environmental factors such as diet and stress can also affect
the genome? And are chromatin structure and gene expression. For example, the addition of an acetyl group to the chromatin
epigenetic changes
reversible? structure appears to promote transcription, and turn a gene on. However, the addition of a methyl group
to a histone can reduce transcription, and turn a gene off. Removal of some methyl groups can also turn
genes on. Chromatin modifications via histone acetylation and DNA methylation do not change the DNA
sequence, yet they may still be passed on to future generations.
Epigenetics affects gene expression, and therefore it can affect the growth and development of
organisms. A mother who smokes during pregnancy can cause epigenetic factors to be modified in
her unborn child, causing the child to be more at risk of obesity. When the epigenome is altered, it
does not alter the DNA sequence permanently and is therefore not a mutation. However, changes to
the epigenome can still affect the phenotype.
9780170452922
Key concept
Internal and external environmental factors can influence phenotype. Internal environmental
factors include hormones, which are chemical messengers. External environmental factors
include temperature and access to nutrients. Epigenetics can also influence phenotype by
controlling gene expression.
Question set 4.2

REMEMBERING 3 Explain how epigenetics can affect
1 List four environmental factors that phenotype. Use an example to
can affect the phenotype in a specified demonstrate your explanation.
organism, and classify them as internal, UNDERSTANDING
external or epigenetic. 4 Using a real example, describe how the
2 Name four phenotypes in mammals interaction of a gene and the environment
that display variation due to the can affect the phenotypic expression of a
environment. gene.
4.3 MUTATIONS CAUSE VARIATION

Permanent changes to an organism’s DNA sequence are termed mutations. Mutations may arise
spontaneously during DNA replication or cell division (spontaneous mutations), or they may be
induced by physical or chemical environmental factors called mutagens, or through the action of
biological agents. Mutations that occur in genes often affect the proteins they code for. These effects
are sometimes subtle. More often they are severe, with potentially catastrophic effects for the survival
of the organism that bears them. Rarely, they can enhance the function of the protein or make an
organism better suited to the environment it inhabits. The effect of a mutation depends upon whether
it has occurred in non-reproductive (body, or somatic) cells or in reproductive (germline) cells.
A mutation in a somatic cell only affects the body cell in which it occurs and the daughter cells
produced from it by mitosis (Figure 4.6). All other cells of that organism lack the mutation. Cancer is
a consequence of some mutations in somatic cells. Mutations associated with cancer can occur in
particular genes or regions of the DNA, and they accelerate the rate of cell division, affect the cell’s
ability to undergo apoptosis or increase the rate of mutations within the cell.
A mutation
occurs
Normal cell
Cell with mutation
FIGURE 4.6 A mutation in a somatic cell affects only the cell in which it occurs and its daughter cells.
9780170452922
Mutations that occur in germline cells affect sex cells called gametes, and they have the
potential to be inherited (passed on to the next generation) and be incorporated into every cell
of the offspring (Figure 4.7). Often, the germline mutation results in developmental abnormalities
that cause the affected embryo or foetus to be spontaneously aborted. If carried through to birth,
the germline mutation may result in congenital disorders in the offspring, with varying degrees
of severity. Occasionally, a gene mutation changes or enhances the function of the protein that
it codes for. If circumstances suit, it can enhance the survival of the organism. If the mutation is
consistently passed on from one generation to the next, a new allele becomes established in the
population. Such mutations in germline cells may contribute to the species’ gene pool and can
influence whole populations and their evolution.
Meiosis
Normal cell
Cell with mutation
FIGURE 4.7 Mutations in germline cells affect all body cells of the individual organism that inherits them.
Recessive mutations that lead to a loss of function can be masked if a normal copy of the gene
is present; for the mutant phenotype to occur, both recessive alleles must contain the mutation.
Dominant mutations lead to a mutant phenotype even in the presence of a normal copy of the
gene. The phenotypes associated with dominant mutations may represent either a loss or a gain of
function.
Question set 4.3

REMEMBERING allele and when a mutation produces a
1 Define: recessive allele.
a mutation UNDERSTANDING
b mutagen 3 Differentiate between mutations that
c somatic cell occur in somatic cells and mutations that
d germline cell. occur in germline cells.
2 Describe two main differences between
when a mutation produces a dominant
9780170452922
4.4 CAUSES OF MUTATIONS: ERRORS IN DNA

REPLICATION AND CELL DIVISION
DNA replication errors

Spontaneous mutations can occur during the S (synthesis) phase of the cell cycle, when the DNA is
exposed during replication and is vulnerable to damage. DNA replication is an extremely accurate
process, but mistakes can occasionally occur when DNA polymerase inserts the wrong nucleotide.
Adenine, for example, normally base-pairs with thymine, but may spontaneously undergo a chemical
change that makes it resemble a guanine, which pairs with cytosine. During DNA replication, the
chemically different form of adenine may be mistaken, and a nucleotide containing guanine may be
introduced into the DNA sequence instead. Repair mechanisms can correct the mistakes, but in rare
cases mistakes are not corrected, leading to mutations.
Errors may also be introduced into DNA sequences by highly corrosive chemicals containing
oxygen. These chemicals, termed reactive oxygen species, may be generated naturally by the cell’s own
metabolism or by the action of mutagens. Enzymes in the cell, such as catalase, remove many of these
chemicals, but if there is for any reason an excess of reactive oxygen species, they readily react with
DNA to cause damage to the DNA structure.
During the G2 phase of the cell cycle (see Chapter 2, pages 31–32), DNA is proofread, and
any errors that are detected are
repaired. Repair often depends A T G A G G
on one of the DNA strands being T A C T C C

intact. The intact strand serves
Original DNA A base-pair substitution
as a template for proofreading
and restoration of the damaged Action of repair enzymes
complementary strand. However,
if a mutation is not repaired or A T G A G G
it is repaired improperly, the or
T A C T C C
mutation becomes part of the
Mistake fixed Gene mutation
DNA sequence and persists
through subsequent cell divisions FIGURE 4.8 Base-pair substitution results in either a mistake being fixed
(Figure 4.8). or a mutation.
Mutation studies
The DNA repair mechanisms are usually highly effective, so mutations are comparatively rare.
Mutation rates vary, however, from one species to another. Low mutation rates made it difficult for
geneticists to investigate mutations until the discovery in 1927 by an American biologist, H. J. Muller,
that the mutation rate in the fruit fly (Drosophila melanogaster) can be greatly accelerated by
irradiation with X-rays. Since then, it has been found that other environmental mutagens speed up
the mutation rate. The discovery of mutagens made it easier to study the cause and transmission
of mutations. Bacteria and plants are used in most experiments, although scientists also perform
experiments on animal cells using tissue culture techniques.
From these studies, three main ideas have emerged.
First, mutations arise spontaneously and are not directed by the environment. Environmental
influences can greatly affect the mutation rate, but they cannot induce a particular mutation to occur.
Second, mutations are persistent. They tend to be transmitted through many cell divisions
without further change, although there is always the possibility that another mutation may occur,
either producing a new feature or a return to the original condition.
9780170452922
Third, the majority of mutations confer disadvantages on the organisms that inherit them. The
premature death of organisms with harmful mutations (before reproductive age) prevents harmful
mutations accumulating in populations. The occurrence of a useful mutation is an extremely rare
event.
Cell division errors

Mutations can occur in somatic (body) cells during mitosis, or in the germline cells in the gonads
during meiosis, when gametes are formed.
Mutations can result from a number of events, including unequal crossing over during meiosis
(Figure 4.9). If non-sister chromatids misalign during crossing over, one gamete may gain extra
nucleotides (leading to an insertion mutation), and one may lose some nucleotides (leading to a
deletion mutation). (Crossing over does not happen during mitosis.)
TTAA
AATT
TTAA
AATT
TTAA
AATT
Repeat
sequences
TTAA
AATT
Alignment Misalignment Unequal crossing over
.4002 ,noitidE dn2 ,hcaorppA lautpecnoC A :sciteneG ,ecreiP nimajneB

TTAA
AATT
TTAA
AATT
TTAA
AATT
TTAA
TTAA
Deletion Insertion
FIGURE 4.9 When homologous chromosomes misalign during meiosis, unequal crossing over may occur. The
result is the deletion of a DNA sequence in one chromosome, and the insertion of a DNA sequence in the other
chromosome.
Larger-scale mutations can occur during anaphase in mitosis and during anaphase I or
anaphase II in meiosis when homologous chromosomes or sister chromatids do not separate at the
centromere. These larger chromosomal mutations will be discussed later in the chapter.
9780170452922
Key concept
Mutations in DNA can cause permanent changes in genes and chromosomes, and can lead to
variation within species. Mutations can arise spontaneously during DNA replication. Insertion
and deletion mutations can arise during crossing over during meiosis.
Question set 4.4

1 Recall the purpose of DNA replication. 4 Explain how a mutation can occur during
2 Describe the ways in which a mutation crossing over in anaphase I. How would
can occur during DNA replication. this affect gamete formation?
3 Relate how the discovery of mutagens 5 If a spontaneous mutation occurs during
helped scientists understand mutations. DNA replication, will it always be passed
on during cell division?
4.5 CAUSES OF MUTATIONS: MUTAGENS
Physical mutagens
Physical mutagens include various types of high-energy radiation that cause DNA damage (Table
4.1). One example is ultraviolet light (UV light), a natural component of sunlight. Public awareness
campaigns have drawn attention to the risks of excessive exposure to UV light, such as increased risk
of skin cancer. Physical mutagens often affect the nitrogenous bases of DNA, causing distortions in
the double helix. UV light, for example, fuses adjacent thymines or cytosines in the DNA sequence.
Ionising radiation, such as X-ray irradiation, causes the loss of adenine and guanine bases, although
the DNA backbone remains intact, creating gaps in the double helix. These aberrations disrupt
complementary base pairing. Ultimately, incorrect bases may be inserted in their place during DNA
replication.
TABLE 4.1 Some physical mutagens and their effects
PHYSICAL MUTAGEN EFFECT

UV light Structural distortion by cross-linking neighbouring nucleotides
X-rays Gene and chromosome aberrations
Nuclear radiation Breaks in DNA strands
Physical mutagens frequently also cause double-strand breaks, which are essentially
complete breaks in the chromosomes (Figure 4.10). Sometimes the broken ends leave single-
stranded overhangs that are complementary to one another. This enables them to bind to one
another and facilitates repair of the broken sequences. Other times the double-strand break
has no overhangs, or the DNA at the fragment ends is damaged so that these ends no longer
match. In such cases, mistakes can occur during repair, and the consequences may be especially
hazardous to the cell. Broken ends can be rejoined inappropriately to the wrong fragments of DNA.
Intervening segments of broken DNA can be lost. These kinds of anomalies result in chromosomal
rearrangements. An accumulation of double-strand breaks that occurs upon intense exposure to
physical mutagens is often lethal to the cell. Apoptosis of the cell in this situation helps to guard
against cancer formation.
9780170452922
a b c
A G G G C T T C T A A A G A G G G C T T C A G G G C T T
T C C C G A A G A T T T C T C C C G T C C C G A A
T A A A G C T A A A G
A A G A T T T C G A T T T C
FIGURE 4.10 Compare a a single-stranded break in DNA with b and c double-stranded breaks. The double-
stranded break in c is the most difficult of the three for the cell to repair.
Chemical mutagens
The mechanisms by which chemical mutagens exert their effects vary (Table 4.2); however, a
common outcome is the substitution of one nucleotide for another. Mustard gas was introduced in
World War I as a chemical warfare agent, and was also found to be mutagenic during World War II
experiments. Sulfur mustard is a powerful irritant and blistering agent that damages the skin, eyes and
respiratory (breathing) tract. Sulfur mustard damages DNA, especially in the bone marrow. It can be
absorbed through the skin or inhaled.
Some chemical mutagens, such as 5-bromouracil, act directly as a substituting base. The
5-bromouracil resembles thymine and can become incorporated in place of it during replication.
However, unlike thymine, the incorporated 5-bromouracil can form hydrogen bonds with either
adenine or guanine. The ambiguous pairing affects DNA replication during subsequent cell divisions,
leading to a C–G pair being swapped for the original T–A pair.
TABLE 4.2 Some chemical mutagens and their effects
CHEMICAL MUTAGEN EFFECT

Mustard gas (sulfur mustard) Mustard gas affects the base guanine, causing a substitution mutation
2-aminopurine, 5-bromouracil Nucleotide substitution
Colchicine Prevents spindle formation in mitosis and so doubles chromosome number
Nitric acid Adenine in DNA is deaminated so it behaves like guanine
Biological agents
Genetic mutations sometimes arise because of the action of invasive pathogens, such as bacteria and
viruses. Occasionally, the DNA of these pathogens becomes permanently integrated into the host
cell’s DNA, causing mutations in subsequent daughter cells (as in the case of Tasmanian devil facial
tumour disease, see page 45).
Bacteria and viruses, and horizontal gene transfer

Bacteria of the genus Agrobacterium cause crown gall disease in the stems of plants of several species
(Figure 4.11). The bacterium achieves this by inserting a plasmid, called a Ti plasmid, into a cell of the
host plant. The Ti plasmid contains genes that code for enzymes that cut the host plant’s DNA and
integrate a segment of the Ti plasmid into it. The cell of the host plant thus becomes modified by
horizontal gene transfer. The integrated bacterial DNA contains additional genes that essentially hijack
the host plant cell machinery to produce nitrogen- and carbon-rich compounds that the bacterium
uses as a nutritional source. The infected cell is also induced to produce hormones that stimulate the
plant cells to rapidly divide and grow. The increased rate of cell division results in the formation of the
distinctive tumour-like gall that is, in effect, a food factory that sustains the expanding population of
bacteria. The capacity to carry out horizontal gene transfer has made specially engineered strains of
Agrobacterium a valuable cloning vector for genetically modifying plants.
9780170452922
A number of viruses are also capable of horizontal gene transfer. Notable among them is the human
papillomavirus (HPV), which infects epithelial cells of human skin and mucosal membranes.
a b
detimilnU slausiV/yrarbiL erutciP erutaN
otohP kcotS lacideM motsuC/ymalA

FIGURE 4.11 a Crown gall disease of a rose bush caused by b the bacterium Agrobacterium tumefaciens
Key concept
Environmental factors that cause mutations are called mutagens. Mutagens can be physical,
chemical or biological.
Question set 4.5
1 Complete the following table: 5 A unique segment of DNA consisting of
MUTAGEN EXAMPLE EFFECT
2907 nucleotide pairs first appeared in the
genome of the wild fruit fly (Drosophila
Physical
melanogaster) in the mid-20th century.
Chemical Since then, it has spread throughout
Biological
wild populations and increased in copy
number within individual flies. Discuss
2 Define double-strand break. what might account for these changes
3 Explain the difference between a physical in the fruit fly DNA over the last half
and a chemical mutagen. century.
UNDERSTANDING
4 Explain how bacteria of the genus
Agrobacterium causes crown gall disease
in plants.
4.6 TYPES OF MUTATIONS

Point mutation
Point mutations simulation
Use the simulator to
The simplest form of mutation is a point mutation, in which just a single nucleotide within the original perform transcription
and translation, then
DNA sequence is affected by a substitution, addition or deletion. edit the DNA to observe
the effects of a point
Substitution mutation.
A substitution occurs when one nucleotide is replaced by another (e.g. adenine substituted for Mutations activity
Find out how a point
guanine). Substitution mutations are a source of novel SNPs and have a number of possible effects mutation can alter a
on the translated protein. gene.
9780170452922
Differences between sequences of just one nucelotide are also called single nucleotide
polymorphisms (SNPs, often pronounced as ‘snips’). If the SNP occurs in a gene, the mutated gene
sequence can be transcribed and translated into a protein that is the same as that encoded by the
original form of the gene, or it may be altered. When the protein is altered, the mutation may have a
subtle or a dramatic effect on its structure and function.
A synonymous mutation, also referred to as a silent mutation, occurs when the substituted base
results in a codon (also known as a triplet) that codes for the same amino acid as the original codon.
For example, AGA and AGG both specify the addition of an arginine amino acid in a polypeptide chain
(Figure 4.12). The protein encoded by the mutated gene is therefore identical to that encoded by the
original gene. Synonymous mutations
are possible because there is a level of
redundancy in the genetic code. Recall
that the genetic code consists of 64
codons that code for 20 amino acids
and the instructions to start and stop
translation. Therefore, any individual FIGURE 4.12 Synonymous mutation
amino acid can be encoded by more than
one codon.
A missense mutation arises when
a SNP changes the amino acid. For
example, substitution in an AGA codon
to generate an AGC codon results in
a serine amino acid being added to
the polypeptide instead of the original FIGURE 4.13 Missense mutation
arginine (Figure 4.13).
A nonsense mutation occurs when a
SNP creates a new stop codon within the
original gene sequence (Figure 4.14). This
leads to early termination of translation
of the transcribed gene sequence. As the
remaining sequence downstream of the
new stop codon is not translated, the
result is the production of an incomplete
polypeptide. FIGURE 4.14 Nonsense mutation
Insertions and deletions

As the name suggests, an insertion mutation is the addition of one or more nucleotides at a site
within the original gene sequence. A deletion mutation is the loss of nucleotides from a site within
the original gene. The effect of this type of mutation is frequently a frameshift mutation, in which
the reading frame for the corresponding amino acids has been nudged away from the original,
and all the codons downstream of the mutation are affected. The consequence for the translated
protein is that the amino acids
downstream of the mutation bear
no resemblance to those of the
original polypeptide (Figure 4.15).
Under such circumstances, even a
single nucleotide insertion or deletion
can have a profound effect on the FIGURE 4.15 An insertion in the gene sequence results in a
corresponding protein. frameshift mutation.
9780170452922
Key concept
Point mutations can cause changes in a DNA sequence by either (i) substitution of a nucleotide
(SNP) or (ii) insertion or deletion of nucleotides (indels). Substitutions can be classified as
synonymous, missense or nonsense mutations. Insertion and deletion mutations are classified
as frameshift mutations.
Effects of mutations on survival

A protein’s function is dependent on its structure. Mutations that change a protein’s structure can
have consequences for protein function, with potential impacts on the organism’s survival. Mutations
can therefore also be classified according to whether the effect of the mutation on the protein’s
function and the organism’s survival is unchanged, changed for the worse, or changed for the better.
Neutral mutations
In the case of synonymous mutations, the protein product is unchanged compared with the original,
so the organism’s survival is unaffected by the change. This is said to be a neutral mutation. Missense
substitutions are sometimes also neutral mutations, provided that the original amino acid is swapped
with another that has similar properties. For example, in the ABCA1 gene, which codes for a protein
involved in cholesterol transport, a missense substitution in a single GAA codon creates a GAC codon
and causes one amino acid (glutamic acid), to be swapped for another (aspartic acid). Both amino
acids are negatively charged, however, and reside on the surface of the protein, where they interact
with the surrounding water, so the properties and function of the protein remain essentially the same.
Deleterious mutations
A living organism can be compared with a complex product of engineering, such as an aeroplane, in
which the components are so intricately integrated that an indiscriminate change to any component
can harm the overall operation of the aircraft and make it unfit to fly. Similarly, random mutations may
disrupt the function of the encoded protein, undermining the organism’s overall ability to carry out its
basic processes and survive. Such mutations are referred to as deleterious mutations. The majority of
mutations are deleterious.
Nonsense mutations are typically deleterious, because they result in the production of an
incomplete protein that is non-functional. However, these deleterious mutations may persist if the
individual who carries them also has a copy of the normal allele that encodes the functional version
of the protein. The deleterious mutation is thus masked within the phenotype of the organism. If
the organism is unfortunate enough to have only non-functional alleles for a particular gene, the
condition usually results in the death of the organism before it has the opportunity to reproduce and
pass the alleles on to any offspring.
Beneficial mutations
Occasionally, gene mutations produce a new allele that benefits the survival of the organism. The
type of beneficial mutation can vary: it could be a missense mutation that changes the function of
the original protein, or it could be a nonsense mutation that eliminates a protein that may have been
harmful to the organism in some circumstances.
The human immunodeficiency virus (HIV) causes acquired immunodeficiency syndrome (AIDS).
Without treatment, AIDS is fatal in essentially all cases. A few individuals have been exposed to the
virus but have proved to be resistant to infection. These individuals have a nonsense mutation that
results in the elimination of one of the surface proteins required by HIV to enter cells. This deletion
confers resistance to HIV infection.
9780170452922
Key concept
Mutations can be categorised as neutral, beneficial or deleterious, depending on the effect they
have on the survival of the individual.
FIGURE 4.16 The effects of point mutations on transcription and translation
Question set 4.6a

REMEMBERING a substitution
1 Define point mutation. b insertion
2 Describe the following types of genetic c deletion.
mutations:
9780170452922
3 Describe the effect of the following enzyme that detoxifies the antibiotic
mutations on a coded protein: ampicillin.
a synonymous mutation c A nonsense mutation in the human
b missense mutation SURF1 gene encodes a protein crucial
c nonsense mutation for formation of a key metabolic
d frameshift mutation. enzyme.
UNDERSTANDING d A synonymous mutation in the codon
for an amino acid occurs at the active
4 Classify the following mutations as site of bovine salivary amylase.
neutral, deleterious or beneficial to an e Various mutations in a gene for the
organism’s chances of survival. enzyme alcohol dehydrogenase result
a An indel in the human in different versions of the functional
hexosaminidase A gene results in enzyme.
improper neural development. f A mutation that extends expression of
b A mutation in the beta-lactamase a human lactase gene enables lactose
gene of the bacterium Escherichia digestion to continue into adulthood.
coli generates a new version of the
Chromosome mutations
Genetic variations can also occur because of wholesale changes to the chromosomes. Alterations to
chromosomes differ from single point mutations because they can affect many genes simultaneously.
Some of the variations that occur with chromosomes, such as chromosome number, are quite natural
in certain situations and are therefore integral to the functioning and continuity of the species. Others
arise because of anomalies that occur during the formation of the gametes.
Chromosome alterations can be observed and analysed by examination of a prepared microscope
slide of stained cells photographed in the process of nuclear division. This reveals a jumbled cluster of
chromosomes that differ in size, shape and banding. Photographic images of chromosomes can be
rearranged into matched and ordered pairs to create a karyotype, the standard format used to display
and analyse chromosomes (Figure 2.3, page 28). Chromosomes are ordered by length, from largest to
smallest, and they have characteristic banding patterns. Species are characterised by having a particular
number of chromosomes in each cell.
Variations in chromosome number

In many eukaryotic organisms, the
somatic cells are diploid (2n): the cells
contain two sets of chromosomes, with Meiosis I
Non-disjunction
one set inherited from each parent.
The gametes are haploid (n). There are
consequences for organisms when the
Meiosis II
complement of chromosomes in the Non-
somatic cells varies from the usual diploid disjunction
state.
Gametes
Monoploidy n+1 n+1 n–1 n–1 n+1 n–1 n n
In many colonial insects such as ants, Number of chromosomes
bees and wasps, the males of the species Non-disjunction of homologous Non-disjunction of sister
chromosomes in meiosis I chromatids in meiosis II
are monoploid (1n) (Figure 4.18). By
contrast, the females, including the FIGURE 4.17 Chromosome non-disjunction and its effects on
queen, are diploid. The males do not gametes
9780170452922
need to become diploid to function,

as do the haploid gametes of regular
diploid animals. Their chromosomes
represent a single complete and
operational set, and the males function
like any other multicellular animal.
In contrast, in haploid gametes, the
chromosomes represent half of the
complete set and are packaged in a
dormant state, awaiting the fertilisation
rerheL/moc.kcotsrettuhS
event that will activate them. In these
insects, the queen produces eggs by
meiosis, whereas the males produce
sperm by mitosis. Fertilisation results in
diploid female offspring. The males are
FIGURE 4.18 Bees maintain their colony structure with diploid
instead produced by parthenogenesis,
females and monoploid males.
a process in which an entire organism
is regenerated from a single egg cell,
without the need for fertilisation.
Many fungi and algae are also monoploid, and there are examples of monoploid fish, amphibians
and reptiles. Monoploidy seems economical because only one set of chromosomes is required, so
why are diploid organisms so much more common? The advantage for diploid organisms is that
any defective alleles that arise can be compensated for by a functional allele on the corresponding
chromosome. In monoploid organisms, a defective allele is the only allele available for a particular
gene, and the consequences are likely to be deleterious.
Polyploidy
Sometimes the cell divisions that give rise to haploid gametes fail altogether, so that half the gametes
contain two copies of each chromosome (diploid, 2n) and the rest have none. If a diploid gamete
fuses with a normal haploid gamete, the resulting individual is triploid (3 n): it has three of each
type of chromosome. If two diploid gametes fuse, a tetraploid (4 n) individual will be produced. It is
therefore possible for an organism to acquire one or more complete extra sets of chromosomes, a
phenomenon called polyploidy.
Polyploidy is particularly common in
flowering plants, ferns and green algae;
approximately half of all flowering plant
species are polyploid. Polyploidy also
occurs in fungi and in some fish and
amphibian species. There are advantageous
commercial applications of polyploidy in
gnroH uaM/moc.kcotsrettuhS
plants: for example, increased fruit size,

hardiness and infertility, which lead to
increased profits for farmers and businesses
(Figure 4.19).
Polyploidy is lethal in humans. In the
rare situation of a pregnancy continuing to FIGURE 4.19 The application of polyploidy to create
a live birth (1% of human polyploids), the infertile fruit, such as seedless grapes, is of considerable
newborn dies within a month. commercial significance.
9780170452922
Aneuploidy
Aneuploidy is the condition in which there is an addition or loss of one chromosome (or a few
chromosomes) from a cell (i.e. 2n + 1 or 2n – 1). Tasmanian devil populations have suffered from a Tasmanian devils and
facial cancer that is infectious. The Tasmanian devil facial tumour cells have been karyotyped and aneuploidy
Read about aneuploidy
compared with a normal devil’s karyotype. Significant aneuploidy (one or more extra or missing in Tasmanian devils.
chromosomes) was evident. Reproductive failure by miscarriage is common, and it has been found
that many miscarried embryos are aneuploids. To understand how this comes about, consider the
process of meiosis. Normally in meiosis, identical chromosomes come together and then segregate
into separate cells, so that the gametes finish up with only one of each pair of chromosomes.
Occasionally, however, the two identical chromosomes do not separate, but go into the same cell.
This phenomenon is known as non-disjunction. Generally, non-disjunction only takes place with one
pair of homologous chromosomes, while the rest behave normally. It can occur during either the first
or second meiotic division. Non-disjunction results in the formation of two types of gametes in equal
proportions, but one type has two copies of a particular chromosome and the other type has none
(Figure 4.20).
Parent cell
Meiosis I
Homologous
chromosomes
fail to segregate
Meiosis II
Gametes Gametes
FIGURE 4.20 In non-disjunction, the chromosomes fail to segregate, so half the gametes contain two
chromosomes of a pair (bivalent) each, and the other half contain no chromosomes at all.
The fusion of a gamete containing both homologous chromosomes with a normal gamete
containing one of the chromosomes produces a zygote with three such chromosomes; the
normal pair plus an extra one. This condition is called trisomy. Fusion of a gamete with none of the
homologous chromosomes with a normal gamete gives rise to an individual with only one of this
particular type of chromosome in each cell. This condition is called monosomy.
Non-disjunction can cause various chromosome abnormalities in humans. For example, Turner
syndrome is an example of monosomy in the sex chromosomes. Foetuses with 22 normal pairs of
9780170452922
autosomes and a single Y chromosome never survive to birth. However, children may be born with 22
normal pairs of autosomes and a single X chromosome. Such individuals have the genetic constitution
X0. They are females and occur with an incidence of approximately 4 in 10 000 live-born girls. Most of
the phenotypic effects of Turner syndrome are minor, but the person is infertile. Individuals are usually
shorter than normal and have a characteristic webbed neck. Oestrogen replacement therapy can allow
normal pubertal development, and growth can be stimulated with growth hormone.
Approximately two in every thousand men have a trisomy in sex chromsomes (XXY), which is
known as Klinefelter syndrome. This may result either from the fusion of a Y sperm with an XX egg or
from the fusion of an XY sperm with an X egg. Although XXY individuals are phenotypically men, they
have very small genitals and are infertile. In addition, they may develop breasts, although testosterone
therapy at puberty can reduce this effect.
Down syndrome is a trisomy caused by the presence of an extra copy (i.e. a total of three copies)
of chromosome 21 (one of the smallest chromosomes) in every cell. Children with Down syndrome
vary in their symptoms, but most show moderately to severely delayed development, characteristic
almond-shaped eyes, a round face, shortened body parts, loose joints, and weak muscles and
muscle reflexes. About 40% of children with Down syndrome develop heart defects, and they are
more susceptible to infections, both of which can cause their lives to be shorter. They are usually
affectionate, cheerful people, often deriving great pleasure from music and dancing. Down syndrome
is an example of autosomal trisomy, because a non-sex chromosome is added (Figure 4.21). It is the
most common autosomal trisomy in humans.
IRNC/YRARBIL OTOHP ECNEICS
FIGURE 4.21 False-colour karyotype from a female with Down syndrome. The syndrome is the result of there
being three copies of chromosome number 21. This condition is also known as trisomy 21.
Key concept
Chromosome mutations relate to entire chromosomes. Mutations that change the number of
chromosomes lead to polyploidy and aneuploidy.
9780170452922
Variations in chromosome structure

Changes in chromosome structure largely come about due to the occurrence of two or more
double-strand breaks in chromosomes and the rearrangement of the broken segments of the
chromosomes. Some of these breaks occur naturally during meiosis as the chromosomes entangle
around one another, cross over and move apart. Others occur because of exposure to mutagens
that accelerate the rate of double-strand breaks. The breaks are normally repaired, but occasionally
mistakes are made in the way the segments are relocated in the repaired chromosomes. There are
several classes of these chromosomal rearrangements: deletions, inversions, translocations and
duplications (Figure 4.22).
a Deletion b Inversion
A A A
A A
B B B
B A B Middle
C C C
C B C piece of
Break Break
D C D F chromosome
D
E G E E falls out,
E
F H F F D rotates
Break Break
G G I G G through 180°
H H H G and then
H H
I I I I rejoins.
I
D
E Middle piece
F of chromosome
falls out.
c Translocation d Duplication
A A
B B A
C A A B
Break C
D B B C
C D
E C A piece of D
E
F chromosome F E
1 breaks off G F
Chromosome 1 and joins H G
D H
D chromosome 2. I
E I
E Chromosomes
F
F 1 and 2 are not
homologous. F An extra length
W
G of chromosome is
X W H added on.
Y X I
Z Y
Z
Chromosome 2
FIGURE 4.22 Abnormalities caused by chromosomal mutations may arise by a deletion, b inversion, c translocation or d duplication.
Deletions
A chromosome may undergo double-strand breaks at two positions, and the section in between
may drop out, removing all its genes with it. If the two ends then re-join, a shorter chromosome
results with a segment missing. This is called a chromosome deletion (Figure 4.22a). As it leads to
an absence of certain genes, it can have a profound effect on the development of an organism. All
but the shortest deletions are usually fatal, and the few organisms that survive usually suffer from
adverse effects.
Williams syndrome is an example of a condition that arises because of a deletion event that
affects about 1 in 10 000 people. Patients are characterised by certain physical (Figure 4.23)
and temperamental features, including an unusually cheerful and affectionate disposition, and
an exaggerated predilection for music and dance. The syndrome is associated with an unusual
9780170452922
development of the nervous system,

developmental delay and life-threatening
cardiovascular problems. Williams syndrome
is caused by the deletion of around
1.5 million nucleotide base pairs from one
copy of chromosome 7. The DNA segment
carries between 15 and 25 genes of known
and unknown function. The syndrome
demonstrates that both copies of one or
more of these genes are required for normal
CNI SSERP AMUZ/OTOHP KCOTS YMALA

development.
Inversions
Another kind of chromosomal rearrangement
occurs if a chromosome breaks in two
places and the segment in the middle rotates
through 180° before being re-joined within
the chromosome, reversing the normal FIGURE 4.23 A person with Williams syndrome is
sequence of genes (Figure 4.22b). This is characterised by a facial appearance with a low nasal
called an inversion. The effects of inversions ridge.
are usually less dramatic than other types of
chromosomal changes, because genes have been neither gained nor lost, and the genes within the
inverted segment can still function normally. The inversion may, however, disrupt a gene in which it
occurs or cause two different genes to become fused together. Also, if the chromosomes do not align
properly for meiosis, the affected individual may have reduced fertility.
Translocations
Sometimes a section of one chromosome breaks off and reattaches to another chromosome. This is
known as a translocation (Figure 4.22c). An example of a translocation in humans is when a segment
The devil is in the of chromosome 8 ends up within chromosome 14, or vice versa. Normal control over the genes in
details that segment is lost, often resulting in a form of cancer. In addition to aneuploidy, a Tasmanian devil
Read about Tasmanian facial tumour cell karyotype shows translocation of chromosome 5.
devil facial tumour and
translocation Duplications
A duplication occurs when an extra copy is made of a section of a chromosome and inserted either
into the same chromosome or into another chromosome (Figure 4.22d). Gene sequences can be
replicated several times, sometimes thousands of times. Like other chromosomal abnormalities
that change the number of copies of particular genes, duplications of chromosomes are frequently
harmful. However, on occasions they may be advantageous. The various genes that control
the different haemoglobins produced in human red blood cells are thought to have arisen by
duplications. Changes to chromosome structure such as inversion, deletion, translocation and
duplication of chromosome segments are another cause of genetic variation.
Key concept
Structural mutations to chromosomes include deletions, inversions, translocations,
duplications and frameshift mutations.
9780170452922
TABLE 4.3 Major classes of mutations, their types and their effects on DNA
CLASS OF MUTATION TYPE OF MUTATION DESCRIPTION

Point mutation Substitution One base is replaced by another during replication,
as is its base pair in the corresponding position on
the complementary strand.
Insertion One or more extra nucleotides are inserted into
replicating DNA, often resulting in a frameshift.
Deletion One or more nucleotides is ‘skipped’ during replication
or otherwise cut out, often resulting in a frameshift.
Chromosomal mutation Inversion One region of a chromosome is flipped and reinserted.
Deletion A region of a chromosome is lost, resulting in the
absence of all the genes in that area.
Translocation A region from one chromosome is aberrantly attached
to another chromosome.
Duplication A region of a chromosome is repeated, resulting in an
increase in copies of the genes in that region.
Question set 4.6b

REMEMBERING 5 Draw an annotated diagram of two
1 Define karyotype. chromosomes, showing that one of
2 Describe the differences between: them has had two double-strand
a haploid and diploid breaks. Draw the possible chromosomal
b monoploid and haploid rearrangements that might occur when
c monoploid, diploid and polyploid the fragments of the broken chromosome
d diploid and aneuploid. are re-joined.
3 Describe four types of DNA structural 6 Create an electronic or hard copy
rearrangements that result in mind map to summarise the gene and
chromosomal abnormalities. chromosome mutation types you have
learned about. You could use Prezi or
UNDERSTANDING MindMeister.
4 Draw an annotated diagram of a diploid 7 Defend or refute the statement,
cell with four chromosomes undergoing ‘Aneuploidy is always deleterious’, and
meiosis. Show two ways that non- explain your reasoning.
disjunction can occur. Indicate the kind of
chromosome anomalies that can arise in APPLYING
a zygote formed by fertilisation between 8 How can karyotypes be used to determine
each of the resulting gametes and one variation in a population?
normal gamete.
4.7 SEXUAL REPRODUCTION INCREASES

VARIATION
Variations in the genotype of offspring arise as a result of the processes of meiosis, including crossing
over, random assortment of chromosomes, and fertilisation.
The genetic component of variation is predominantly determined by alleles. Alleles are
transmitted from generation to generation through the production of gametes by meiosis, and the
union of those gametes through fertilisation. During meiosis, homologous chromosomes pair and
then randomly move to different daughter cells (independent assortment). This results in gametes
9780170452922
with different combinations of parental chromosomes and therefore different combinations of

parental alleles. When homologous chromosomes pair up in the first division of meiosis, they
sometimes exchange segments with one another. This crossing over further rearranges the
combinations of inherited alleles available on each homologous chromosome. Fertilisation comes
about by the union of two random gametes, one from each parent, providing even further variation in
the possible combinations of inherited alleles.
Crossing over
Crossing over is the swapping of alleles that occurs in meiosis during prophase I only. During the
formation of egg and sperm cells in meiosis, paired maternal and paternal homologous chromosomes
align so that corresponding DNA sequences from the paired chromosomes are able to cross over one
another.
Crossing over is important for genetic Non-sister chromatids
Prophase I held together during
variation, because it allows the exchange of of meiosis synapsis
alleles between the maternal and paternal Pair of
homologous chromosomes (non-sister homologs
chromatids). This forms chromatids with

Chiasma
new combinations of alleles (this can be
Centromere
referred to as recombination of linked genes).
Chromatids that have a combination of alleles
different from that of either parent are called
Anaphase I
recombinants (Figure 4.24). It is also important
to note that crossing over occurs at a random
point, and more than one chiasma can form
per homologous pair. The chiasmata are the Anaphase II
points of contact between two (non-sister)
chromatids belonging to a set of maternal and
paternal homologous chromosomes.
Daughter
At the end of meiosis, there are four cells
possible gametes. The four haploid cells contain
Recombinant chromosomes
chromosomes that are genetically different from
the parent cells and from one another. FIGURE 4.24 Recombinant chromosomes
Independent assortment and random segregation

The Law of Independent Assortment refers to the random orientation of maternal and paternal
homologous chromosomes at the equator during metaphase I. Each member of the homologous pair
is randomly orientated towards one pole or the other, and each pair is unaffected by the orientation of
any other homologous pair. In Figure 4.25 (page 109), the left-hand possibility in gamete production
shows the paternal chromosome (shown in blue) orientated to the left in two homologous pairs of
chromosomes. In the right-hand possibility, one paternal chromosome is orientated to the left and
the other to the right.
An allele on one chromosome has an equal chance of being paired with, or separated from, any
allele on another chromosome (their inheritance is independent). Since the homologous pairs of
chromosomes are orientated randomly at the equator, maternal and paternal homologues can orientate
towards either pole. The number of possible orientations is equal to 2 raised to the power of the number
of chromosome pairs. For example, for a haploid number of n, 2n is the number of possible outcomes.
For humans, the possible number of combinations is 223. This means that there are over 8 million possible
combinations of alleles just through the random orientation of the homologous chromosomes. If we add
the effects of crossing over, the number of combinations increases even more.
9780170452922
During anaphase I, the randomly lined up maternal and paternal homologous chromosomes
move to opposite poles of the cell. This random separation of a pair of homologous chromosomes
is described as the Law of Random Segregation. Each gamete ends up with a random selection of
Independent
maternal and paternal chromosomes. The chromosomes have segregated (separated) randomly into assortment
the four gametes (Figure 4.25). Study independent
assortment by watching
Possibility 1 Possibility 2 the animation.
Two equally probable

arrangements at metaphase I
give rise to different
chromosome combinations
A A a a A A a a
Metaphase II
B B b b b b B B
A A a a A A a a
Gametes
B B b b b b B B
Combination 1 Combination 2 Combination 3 Combination 4
FIGURE 4.25 Independent assortment and random assortment lead to different combinations of chromosomes
in gametes.
Random fertilisation
Fertilisation is the union of haploid male and female gametes during sexual reproduction to produce a
diploid zygote. The random union of gametes is known as random fertilisation. Random fertilisation
can lead to variation. Fertilisation brings together chromosomes from two different parents, creating
new combinations of alleles in the offspring. When a female gamete is made during meiosis, it receives
50% of the mother’s genetic information. The same is true for a male gamete. Due to independent
assortment and random distribution of the chromosomes when the cells split during meiosis, each
gamete has a different combination of chromosomes from that of other gametes. Therefore, each
gamete has a unique set of alleles. Fertilisation promotes variation because a male gamete can fertilise
any of the female gametes, resulting in a unique combination of the maternal and paternal genes. An
additional source of variation in the possible gamete combinations is the random selection of a mate.
The offspring produced in sexual reproduction are genetically different to one another and to their
parents. Sexual reproduction results in variation within a population because it involves the mixing of
genetic information.
Fertilisation can occur internally (as in humans) or externally (as in the majority of corals).
Gametes contain recombinations of genetic material, and the different gamete combinations possible
during fertilisation increases variation.
Key concept
Sexual reproduction contributes to variation. Crossing over and independent assortment occur
during meiosis to produce variety in gametes, and a random selection of these gametes will be
randomly fertilised. The result of fertilisation is an individual with a different genotype to that
of its parents.
9780170452922
a b Stigma Anther c
Filament Stamen
Style
ECNEICS FO EYE/yrarbiL otohP ecneicS
Pistil
owdA/moc.kcotsrettuhS
Ovary
Ovule Sepal Petal
Receptacle
FIGURE 4.26 Fusion of male and female gametes occurs in sexually reproducing species. a A coloured scanning electron micrograph
of a human sperm and egg. b Pollen contains the male gametes of a flowering plant and is found on the stamen, or male structure, of
a flowering plant. Ovules contain the female gametes of a plant and are found in the pistil, or female structure, of the plant. The pollen
travels to the stigma (i.e. ‘pollination’ occurs), then fertilisation takes place in the ovule. Variation is enhanced in plants if the flower does
not self-pollinate. c Coral at Ningaloo Reef, WA, sexually reproduce 7–10 days after the full moon in March. The coral polyps spawn – that
is, they release eggs and sperm into the water – at the same time. The eggs and sperm randomly fertilise to form larvae known as planulae.
Question set 4.7

REMEMBERING 4 Draw an annotated diagram showing how
1 Recall the function, process and products independent assortment contributes to
of meiosis. variation in a population.
2 Define: APPLYING
a crossing over 5 Explain why sexual reproduction leads
b chiasmata to more variation in a population than
c independent assortment asexual reproduction.
d random segregation
e fertilisation.
UNDERSTANDING
3 Draw an annotated diagram of a diploid
cell with two homologous chromosomes
undergoing crossing over.
4.1 Editing the epigenome

Researchers at the Harry Perkins Institute of Medical Research are using advanced genomic,
NOITACILPPA
molecular, genetic and computational techniques to study the epigenome, including next-
generation sequencing technologies to generate whole-genome high-resolution maps of
the epigenome and associated molecular processes. Professor Ryan Lister hopes to develop
molecular tools for editing the epigenome.
Questions
1 What is an epigenome?
2 What is DNA methylation and why is it important?
3 ‘Research aims to elucidate the mechanistic underpinnings of how the epigenome is
established and dynamically modified, and how it affects the cellular readout of the
underlying genetic information, and to develop molecular tools for editing the epigenome.’
What does this mean in terms of treatment of genetic diseases?
9780170452922
CHAPTER 4 INVESTIGATION
Developed by Southern Biological
The effect of UV light on Saccharomyces cerevisiae 4.1
NOITAGITSEVNI
Background
We classify the broad spectrum of electromagnetic radiation from the sun into segments according
to the effects we experience. For example, the warm sensation of sunshine on our skin is caused by
invisible infrared radiation with wavelengths ranging from 700 nm to 1 000 000 nm (1 mm). Visible
light is comprised of wavelengths of between 400 nm (violet) and 700 nm (red). Radiation with a
wavelength shorter than 400 nm but longer than 10 nm is classified as ultraviolet (UV) radiation.
Radiation with a wavelength shorter than 10 nm is classified as X-rays.
Some exposure to UV radiation is necessary for humans to produce vitamin D, but a careful
balance is required, because X-rays and UV radiation are destructive of many biological molecules,
including DNA. Fortunately, Earth’s atmosphere acts as a protective screen and filters out almost all
the sun’s radiation that has wavelengths shorter than 290 nm. Nevertheless, the narrow UV band
from 290 nm to 400 nm that can penetrate the atmosphere and reach Earth’s surface is capable of
causing photochemical damage to DNA that can lead to skin cancer, so it is important to avoid over-
exposure. As a defence against UV exposure, most organisms that are subject to the sun’s rays have
evolved to incorporate some level of DNA repair in their cellular mechanisms. This confers a limited
amount of inherent UV resistance.
Aim
To determine how UV radiation can be destructive of many biological molecules.
Time requirement
55 minutes
Materials
• UV-sensitive yeast starter plate • 2 sterile culture tubes
• Wild-type yeast starter plate • Ethanol or bleach
• 8 sterile swabs • Bunsen burner
• 8 YED agar plates • Adhesive tape
• 4 plastic pipettes • Permanent marker
• Sterile water • PPE: lab coats, safety glasses, disposable
• 2 sterlie inoculation loops gloves
Risks
While lab strains are usually harmless, fungi may cause Wear lab coats, safety glasses and gloves; wash hands
disease, so assume them to be pathogenic. thoroughly at end of activity.
Decontaminate benches before and after activity. Flood
spills with bleach.
Dispose of plates appropriately after autoclaving.
Disposable gloves may pose an allergy risk. Use a type of glove that has no allergy risk and is suitable
to the chemicals being used.
9780170452922
Procedure – inoculation of exposure plates

To use aseptic technique, wipe your bench down with ethanol (or bleach) and keep your work near the
Bunsen burner to waft potential contaminants away from your materials.
1 Collect 8 YED agar plates and label them as follows using a permanent marker.
UV–5 UV–15 WT–5 WT–15
UV–10 UV–20 WT–10 WT–20
Key
UV = UV-sensitive yeast (mutated strain)
WT = Wild-type yeast
Number = Time plate will be exposed to sunlight
FIGURE 4.27 Labelled petri dishes
2 Use a plastic pipette to place 1 mL of sterile water into a sterile culture tube.
3 Use a sterile inoculation loop to carefully scrape a single colony of the UV-sensitive yeast from the
starter plate.
4 Select a large colony (>4 mm in diameter), or if the colonies are small, scrape up two (or even
three) onto the loop.
5 Place the loop in to the sterile tube and spin/swirl it to transfer the yeast into the sterile water.
6 Visually check that the cell mass has transferred from the loop into the water.
7 Immediately, use a 1 mL plastic pipette to pump the liquid to distribute and suspend the yeast
cells in the water. Avoid introducing air bubbles or splashing the liquid up the sides of the tube.
When you have finished, hold the tube up to the light to check that there are no visible lumps or
particles in the water.
8 Dip a sterile swab into the yeast suspension and, as you withdraw it, press it against the sides of
the tube to squeeze out excess water. It should come out moist but not dripping.
9 Using an aseptic technique, swab the surface of a YED agar plate in three directions to inoculate
for a lawn culture.
10 Immediately cover the plate to shield it from light, and allow it to rest (right-way up) for a period
of at least 15 minutes and up to 1 hour. This allows the moisture from the swab to be absorbed by
the agar.
11 Repeat steps 8–10 for the remaining three UV-sensitive yeast plates. Then repeat this procedure
for the four plates using the wild-type yeast.
Procedure – exposure to sunlight
1 State your hypothesis for this experiment.
2 After the post-inoculation resting period, expose one inoculated plate from each strain to direct
sunlight for 5, 10, 15 and 20 minutes, respectively.
3 Immediately after exposure, incubate the plates in darkness for 48 hours at 30°C or 4 days at
room temperature.
4 For best results, follow these guidelines:
• Keep the plate shielded from light until the last moment.
9780170452922
• Use adhesive tape to attach the lid of the petri dish to the base, but do not allow the tape to
extend onto the surface of the lid where it would absorb UV light and shield the yeast from
exposure.
• Orientate the plate so the lid is pointing directly at the sun. Aim to minimise the size of the
shadow. If the angle between the sun’s rays and the lid is small, most of the UV light will be
reflected and the effectiveness of the exposure will be reduced.
• Schedule the investigation at a time of year when you can be sure of bright, sunny conditions.
• After the incubation period, observe and compare the level of coverage between the plates.
Results
Copy and complete the table below with the results of your experiment. Use the key below to indicate
the level of coverage of the yeast on each agar plate.
Key
+++ High coverage
++ Medium coverage
+ Low coverage
– No coverage
TABLE 4.4 UV exposure results
EXPOSURE TIME (minutes) UV-SENSITIVE YEAST COVERAGE WILD-TYPE YEAST COVERAGE

0
5
10
15
20
1 Compare the results of your UV-sensitive yeast sample with those of the wild-type yeast sample.
What differences do you observe?
2 What conclusions can you draw from this data?
3 Draw a graph of your results.
Discussion
1 What is your independent variable?
2 What is the range of your independent variable?
3 What is your dependent variable?
4 What are your control variables and how did you control them?
5 What type of mutation does the UV-sensitive yeast display?
6 Compare your results with those of others in your class. Were the results consistent?
7 Did your experiment support or refute your hypothesis, or were your results inconclusive?
8 Based on your findings, how does UV light impact the two different yeast strains? Do they differ?
Explain why, if they do.
Taking it further
To protect our skin from harmful UV rays, we apply different sunscreens with different sun protection
factor (SPF) values. Do these values have any merit, and are commercially produced screens any better
9780170452922
WS
CHAPTER 4 SUMMARY
Chapter 4 • Phenotype is affected by the genotype of the • Mutations can be classified as point
Activity sheet
individual and the environment in which (including single nucleotide polymorphism,
the individual lives. Variation in DNA, SNP) or chromosome (large-scale change)
genes and chromosomes causes variation mutations.
between individuals and species. • Point mutations include substitutions
• Environmental factors include internal (e.g. (synonymous, missense, nonsense)
hormones), external (e.g. temperature) and and additions or deletions (frameshift
epigenetic factors that affect gene expression mutations) and can be neutral, harmful or
without changing the DNA sequence. beneficial to the survival of the organism.
• Mutations are permanent changes to a DNA • Chromosome mutations include variations
sequence. Mutations can occur in somatic in the number of chromosomes (polyploidy
cells where they are not passed on to the and aneuploidy) and variations in the
next generation) and in germline cells structure of chromosomes (deletions,
(through which they can be passed on to the inversions, translocations, duplications and
next generation). frameshift mutations).
• Mutations can be caused by errors during • Sexual reproduction produces variation
DNA replication (spontaneous mutations); in offspring through crossing over of
errors during cell division (crossing over); homologous chromosomes, independent
or the action of physical, chemical or assortment and random segregation, and the
biological mutagens. fertilisation of random gametes.
CHAPTER 4 GLOSSARY
Allele One of various versions of the same Cloning vector In cloning, the vector is the
gene (at the same locus) distinguished by DNA molecule that is used to carry the cloned
small differences in the DNA sequence piece of DNA
Aneuploidy Describes a genome that Codon A set of three consecutive nucleotides
varies from the conventional genome found in a DNA or an mRNA molecule; it carries
through the loss or addition of one or a few a code for a specific amino acid
chromosomes Crossing over An event during meiosis, in
Apoptosis A programmed series of events that which homologous chromosomes (non-sister
leads to cell death as a result of the dismantling chromatids) exchange alleles (genetic segments)
of the internal contents of the cell by various with one another
enzymes, including caspases Deleterious mutation A mutation that
Behaviour Responses and reactions of an decreases an organism’s chances of survival
organism in particular situations and reproduction
Beneficial mutation A mutation that increases Deletion mutation A mutation in which one
an organism’s chances of survival and or more nucleotide pairs have been lost from a
reproduction segment of DNA
Chiasma The point of contact between Diploid (2n) Describes a cell or organism that
two (non-sister) chromatids belonging to a has a genome that contains two copies of each
set of maternal and paternal homologous chromosome, represented by 2n
chromosomes where crossing over may Double-strand break A mutation involving
occur breaks in the sugar–phosphate backbones of both
Chromatin The complex of proteins and DNA DNA strands at the same nucleotide pair, resulting
found in eukaryotic non-dividing cells in the complete breakage of a chromosome
9780170452922
Epigenetics The study of inheritable, but Independent assortment The random

reversible, changes caused by chemicals orientation of maternal and paternal
that control the activity of DNA; it involves homologous chromosomes at the equator during
activation and deactivation of genes, without metaphase I; the orientation of each homologous
any change in the DNA sequence or code pair is randomly to one side or the other, and
Expressed Describes a gene that has been read, each pair is unaffected by the orientation of any
transcribed and translated into a protein other homologous pair
Fertilisation The union of haploid male and Insertion mutation A mutation in which one
female gametes during sexual reproduction to or more nucleotide pairs have been added to a
produce a diploid zygote; the random union of segment of DNA
gametes is known as random fertilisation Intraspecific variation Differences between
Frameshift mutation A mutation that changes individuals of the same species
the reading frame used in translation, during Karyotype A display that presents the number
polypeptide synthesis and appearance of the chromosomes of an
Gamete A sex cell; it can be a male or organism or cell as observed at metaphase
female sex cell and has a haploid number of
Meiosis A type of cellular division in sexually
chromosomes reproducing organisms that involves two rounds
Gene A unit of heredity that transmits of cell division, but only one round of DNA
information from one generation to the next; a replication; during meiosis, the chromosome
segment of DNA that codes for a polypeptide number of a cell is halved
Genetic code The term used for the way that Missense mutation A gene mutation that
the four nitrogenous bases of DNA (adenine, results in one amino acid being replaced by
thymine, guanine and cytosine) are ordered and another amino acid in the encoded protein
contain information to direct the creation of
Monoploid (1n) Describes a cell or organism
specific proteins
that has a functional genome consisting of one
Genome All of the genetic material contained copy of each chromosome, represented by 1n
in an organism or a cell; it includes the
Monosomy The condition in which somatic
chromosomes within the nucleus and the DNA
cells of an organism are missing one copy of a
in mitochondria and chloroplasts
particular chromosome
Genotype The specific combination of alleles
for each gene locus that belongs to an individual Mutagen An agent capable of inducing
mutations
or cell
Mutant A cell or organism that bears a mutation
Germline cell The cell line in eukaryotic
organisms from which the gametes are derived Mutation A permanent change in the DNA
sequence of a gene; a source of new alleles
Haploid (n) Describes a cell or organism that
has a genome that contains one copy of each in a population’s gene pool; the process of
chromosome; represented by n generating a mutation
Heredity The study of inheritance; the genetic Mutation rate The number of changes per gene
transmission of characteristics from one copy in a population over a period of time
generation to another Neutral mutation A mutation that has no
Homologous chromosome A pair of effect on an organism’s chances of survival and
chromosomes that have the same size and reproduction
shape; they have genes at the same locations; Non-disjunction The failure of sister
one is maternal and one is paternal chromatids in mitosis or homologous
Horizontal gene transfer The process by which chromosomes in meiosis to separate and go to
genetic material from one organism becomes opposite poles
incorporated into the genome of another Nonsense mutation A mutation in which a
organism codon for an amino acid is changed to one
9780170452922
that codes for a stop codon, terminating lined-up maternal and paternal homologous
translation chromosomes move to opposite poles of the cell,
illustrating the Law of Random Segregation;
Parthenogenesis The production of offspring,
usually from a female gamete without the each gamete ends up with a random selection of
requirement for fertilisation maternal and paternal chromosomes
Phenotype The actual observable form taken Silent mutation See synonymous mutation
by a specific feature in a particular individual, Single nucleotide polymorphism (SNP)
based on their genotype and influenced by A single nucleotide difference that occurs at a
the environment; it can be used in reference given position in the genomes of two or more
to particular traits or characteristics or to the individuals
overall form of an individual Somatic cell A body cell that is not a germ cell
Plasmid A small circular piece of DNA Species A group of similar organisms capable
(found in bacteria) that is able to replicate of breeding and exchanging genes with one
independently of the cell’s chromosomes; another and whose offspring are capable of
engineered plasmids can carry antibiotic- doing the same
resistance markers Spontaneous mutation A mutation occurring
Point mutation A mutation that affects a single in the absence of exposure to mutagens
base-pair within a gene Substitution mutation A mutation in which a
Polyploidy A cell or organism with a genome single nucleotide is swapped for another in the
comprising three or more copies of each original gene sequence
chromosome, represented by 3n, 4n, 5n, 6n etc. Synonymous mutation A mutation in which
Random fertilisation The union of a male the DNA codon for one amino acid becomes
gamete and a female gamete, both haploid, another DNA codon for the same amino acid;
which results in a diploid cell called a zygote; it also referred to as a ‘silent’ mutation
is random because there is no way of knowing Trisomy A condition in which somatic cells
which two gametes, each genetically unique, contain three copies of a particular chromosome
will form the zygote Variation The diversity of genetic and
Random segregation The phenomenon that phenotypic traits within and between
starts during anaphase I, when the randomly populations

Remembering
1 Identify which kind of phenotypic variation is represented by each of the following.
a You enjoy solving mathematical puzzles, whereas your friend is frustrated by them.
b The daily amount of milk produced varies between different individuals of a particular
variety of cow (Bos taurus).
c The girth of mature mountain ash (Eucalyptusregnans) trees varies.
d Some cowpeas (Vignaunguiculata) grow better in acidic soils than others.
e The presence or absence of a hydroxyl (OH) group on the anthocyanin pigment differs
between individual corn plants (Zea mays).
9780170452922
Understanding
2 Figure 4.28 is a representation of segments of chromosomes with genes numbered along their
lengths. Identify the mutation that has occurred in each of these structural rearrangements from
the original for each of a to d.
Original a b c d
1 1 1 1 1
2 2 2 2 2
3 3 3 3 7
8
2
6 6
4
3
3
5
5
4
4
4
6
5
5
6
6
FIGURE 4.28 Chromosomal mutations

3 Discuss the relationship between SNPs (substitutions) and synonymous, missense and
nonsense mutations.
Applying
4 Identical twins, like the French bulldog puppies in Figure 4.29, usually have the same genotype.
yrarbiL erutciP erutaN/otohP kcotS ymalA
FIGURE 4.29 French bulldog puppies

Explain why one may grow to be a larger size than the other.
9780170452922
5 What might account for the fact that most forms of aneuploidy are rarely, if ever, observed in
humans?
6 A transposable element consisting of precisely 270 nucleotide pairs lands in the intron of a
functional gene without affecting the splicing sites for the transcribed RNA.
a What kind of genetic mutation does this represent?
b Describe the effect of the extra nucleotides on the protein sequence.
c Would this be likely to be a neutral, beneficial or deleterious mutation?
7 Compare the four human karyotypes i to iv in Figure 4.30.
a Determine which of the four is a normal karyotype and identify the sex of the individual.
b Determine the aberration in each of the other three karyotypes.
c Explain how the three aberrations could have come about.
i
latipsoH sekoorbneddA ,scitenegotyC lacinilC fo tpeD/yrarbiL otohP ecneicS
ii
latipsoH sekoorbneddA ,scitenegotyC lacinilC fo tpeD/yrarbiL otohP ecneicS
9780170452922
iii
ogaV eppilihP rP/MSI/yrarbiL otohP ecneicS

iv
ogaV eppilihP rP/MSI/yrarbiL otohP ecneicS
FIGURE 4.30 Four human karyotypes
8 Copy and complete Table 4.5 using the information provided in Table 4.6. Note that more than
one type of mutation may have the same effect on the protein.
TABLE 4.5 Four human karyotypes
GENETIC MUTATION AMINO ACID TYPE OF GENETIC MUTATION EFFECT ON PROTEIN

GTCCCA Valine–Proline Substitution Synonymous
↓ ↓
GTCCCT Valine–Proline
TCAATA Serine–Lysine
↓ ↓
TAATA
AGAGGT Arginine–Glycine
↓ ↓
AGATGT
GCAAGA Alanine–Arginine
↓ ↓
GAAAGA
CAGTAC Glutamine–Tyrosine
↓ ↓
CACGTAC
9780170452922
TABLE 4.6 Properties, names and DNA codons for each of the 20 amino acids
CHARACTERISTICS NAME DNA CODONS
Small, hydrophobic Glycine GGT, GGC, GGA, GGG
Alanine GCT, GCC, GCA, GCG
Valine GTT, GTC, GTA, GTG
Leucine TTA, TTG, CTT, CTC, CTA, CTG
Isoleucine ATT, ATC, ATA
Cyclic Proline CCT, CCC, CCA, CCG
Bulky, hydrophobic Phenylalanine TTT, TTC
Tyrosine TAT, TAC
Tryptophan TGG
Sulfur-containing, Methionine (START) ATG

hydrophobic
Cysteine TGT, TGC
Hydrophilic Serine TCT, TCC, TCA, TCG, AGT, AGC
Threonine ACT, ACC, ACA, ACG
Asparagine AAT, AAC
Glutamine CAA, CAG
Positively charged, Aspartic acid GAT, GAC,

hydrophilic
Glutamic acid GAA, GAG
Negatively charged, Histidine CAT, CAC

hydrophilic
Lysine AAA, AAG
Arginine CGT, CGC, CGA, CGG, AGA, AGG
STOP TAA, TAG, TGA
Analysing
9 List all the codons that could result from a synonymous mutation of GGG. What observation
can you make about which of the three nucleotides in the codon is most prone to being
mutated?
10 An exceptionally large plant with enlarged fruit grows among a natural population. Discuss
what genetic change might have occurred in this individual and describe how you could test it
to find out.
11 ‘X-ray imaging of a newborn child and a fully grown adult are equally risky.’ Consider whether
you agree or disagree with the statement and explain your reasoning.
Evaluating
12 Polycyclic aromatic hydrocarbons are a diverse collection of compounds produced by
combustion, occurring, for example, in cigarette smoke. With reference to effects, mutations,
mutation rates and level of exposure, provide an explanation for the statistical link between
cigarette smoking and the increased incidence of lung cancer.
9780170452922
13 Imagine a situation in which a child of dark-skinned parents has inherited a mutated form
of a gene that confers light skin pigmentation. Predict whether this mutation would be
neutral, beneficial or deleterious if the individual is located in the Arctic Circle, rather than
in equatorial Africa, and explain your reasoning. Discuss how, if at all, your interpretation of
‘neutral’, ‘beneficial’ and ‘deleterious’ is influenced by the individual’s environment.
Creating
14 Design a poster to show how an addition mutation can lead to a frameshift.
15 Construct a concept map to summarise the factors and processes involved in each of the three
main mechanisms of variation.
Reflecting
16 What are some of the potential mutagens you encounter in your daily life, and how might you
reduce your exposure to some of them?

1 The diploid number of chromosomes in 3 X-radiation (X-rays) is an agent that:
the chimpanzee is 48. A chimpanzee with A repairs DNA and decreases the mutation
stunted growth and other abnormalities was rate
found to have 49 chromosomes. The most B damages DNA and decreases the
likely source of the extra chromosome in mutation rate
this chimpanzee is: C repairs DNA and increases the mutation
A a viral infection in the chimpanzee rate
B a viral infection in one of the parents of D damages DNA and increases the
the chimpanzee mutation rate.
C an error in meiosis in the chimpanzee [Q3 2016 SCSA]
D an error in meiosis in one of the parents
Questions 4 and 5 relate to the information
of the chimpanzee.
that follows. A biologist measured the amount
[Q18 2017 SCSA]
of genetic diversity in five populations of the
2 Crossing over is the: Australian platypus. The amount of genetic
A exchange of alleles between homologous diversity in each population is indicated by the
chromosomes diversity index. Values of the diversity index
B exchange of alleles between range from 0 (no diversity) to 1 (maximum
non-homologous chromosomes diversity).
C segregation of homologous
chromosomes to different poles TABLE 4.7 Genetic diversity in five populations of the
D segregation of non-homologous Australian platypus
chromosomes to different poles.
POPULATION DIVERSITY INDEX
[Q27 2017 SCSA]
Central Victoria 0.597
Northwestern Tasmania 0.606
King Island 0.032
Kangaroo Island (wild) 0.419
Kangaroo Island 0.431
(sanctuary)
9780170452922
4 The mean value of the diversity index in the 8 Describe the effect that UV light has on
five platypus populations is: DNA structure. (4 marks)
A 0.346 [Q35d 2019 SCSA]
B 0.417
9 Explain why mutation is the ultimate
C 0.236
source of genetic variation. (4 marks)
D 0.504.
[Q35e 2019 SCSA]
[Q22 2016 SCSA]
10 A study has shown that barn swallows
5 On the basis of the information in the
living in an area contaminated by
table, which of the following platypus
nuclear radiation have a higher
populations is at the greatest risk of
incidence of abnormalities compared with
extinction due to genetic factors?
those in uncontaminated areas. Provide
A Kangaroo Island (wild)
a plausible explanation for the higher
B Kangaroo Island (sanctuary)
incidence of abnormalities in the barn
C Northwestern Tasmania
swallows that live in the contaminated
D King Island
area. (4 marks)
[Q23 2016 SCSA]
[Q31e 2017 SCSA}
6 Explain the role of fertilisation in sexual
11 Describe the process of meiosis and
reproduction. (4 marks)
explain how this process produces genetic
[Q35b 2019 SCSA]
variation. (10 marks)
7 Outline how crossing over creates genotypic [Q36b 2016 SCSA]
variation. (2 marks)
[Q35c(i) 2019 SCSA]
9780170452922
123
5
GENETICS CHAPTER 5 CONTENT
following material.
STARTER QUESTIONS
1 How did Mendel work out the inheritance of dominant
and recessive traits without knowledge of genes and their
different forms?
2 How are critical thinking skills applied in genetics?
3 Can you predict the mode of inheritance of a disease by
examining a pedigree and using a systematic method?
» frequencies of genotypes and phenotypes of offspring are
determined by patterns of inheritance, including dominance,
autosomal and sex-linked alleles, multiple alleles and
polygenes

» select, construct and use appropriate representations,
including models of DNA replication, transcription and
translation, Punnett squares and allele frequencies in gene
pools, to communicate conceptual understanding, solve
problems and make predictions
9780170452922
5.1 GENETICS INTRODUCTION

Have you noticed your hairline directly above your forehead? Does the hair take a V shape around the
centre of the hairline, known as a ‘widow’s peak’? Is a widow’s peak present or absent? The presence
of a widow’s peak is dominant over the absence (straight hair-line). If someone you know has a
widow’s peak, then one of their biological parents will definitely have this characteristic too. How do
we know this for certain? Firstly, we can thank the father of genetics, Gregor Mendel, for studying
traits in the 1800s and coming up with the basic principles of inheritance, and then thank all the
scientists since who have further added to this knowledge.
a b
Widow's peak
oiduts EMOHYAW/moc.kcotsrettuhS
aidemkaerbevaw/moc.kcotsrettuhS
FIGURE 5.1 a Presence and b absence of a widow’s peak on the hairline
To study patterns of inheritance, we will turn back the clock to examine the innovative
experiments and observations of the Austrian monk, Gregor Mendel. Inheritance is the passing of
traits from parents to offspring. Sexually reproducing organisms have two copies of almost every
gene, one copy from the female parent and one copy
from the male parent. The way genes are inherited can
be studied, because there are patterns that emerge.
Although offspring receive a combination of genetic
material from two parents, certain genes will dominate
in the expression of some traits. During this chapter on
genetics, the principles of heredity and inherited variation
will be investigated.
The principles of heredity

The principles of heredity (inheritance of traits from one
serutciP efiL emiT/segamI ytteG
generation to the next) and patterns of inheritance were

first established by Gregor Mendel (1822–84) in the 19th
century. In about 1856, Mendel carried out a number of
breeding experiments on pea plants in the garden at his
monastery. The conclusions he drew from his studies
form the foundations on which the study of heredity is
FIGURE 5.2 Mendel discovered the key
built.
principles of inheritance in his pea garden.
9780170452922
CHAPTER 5 | Genetics 125
Mendel’s peas and the inheritance principles

In the early stages of his work, Mendel studied the inheritance of seven pairs of contrasting
characteristics in pea plants (Figure 5.3). These included variations such as yellow or green pea
pods, round or wrinkled seeds, and tall-stemmed or dwarf-stemmed plants. Pea plants were ideal
for his work: the characteristics (‘variables’) had no intermediate forms, pea plants self-pollinated
and therefore self-fertilised, and the characteristics that he studied were largely unaffected by
environmental factors.
Seed shape
Round Wrinkled
Seed colour Flower position

Yellow Green
Flower colour
Axial Terminal
Purple White
Pod shape
Inflated Constricted Stem height
Pod colour
Yellow Green Tall Dwarf
FIGURE 5.3 The pairs of characteristics of pea plants that Mendel studied
To understand Mendel’s principles, some genetic vocabulary is required.
Genetics vocabulary
Paternal Maternal
Allele chromosome chromosome
• A gene is the stored set of instructions

for a protein, found on a specific locus r r Locus
(position) on a chromosome.
• Alleles are different forms of a gene.
P P
• Pairs of alleles are found on a set of At each genetic locus,
an individual has
maternal and paternal homologous two alleles, one on
A A
chromosomes. each homologous
chromosome.
• A set of alleles (one from each parent) is
called a genotype. FIGURE 5.4 Pairs of alleles on homologous chromosomes
Dominant allele
• A dominant allele is always expressed in the phenontype.
• A dominant allele will mask a recessive allele.
• A dominant allele has the same effect on the phenotype whether it is paired with another
dominant allele or a recessive one.
• A capital letter represents a dominant allele. W w
Recessive allele WW = Widow’s peak

W WW Ww
• A recessive allele is only expressed in the Ww = Widow’s peak
ww = Straight
phenotype when present with the same allele
w Ww ww
(homozygous) e.g. ww.
• A recessive allele is masked by a dominant allele.
• A lower-case letter represents a recessive allele. FIGURE 5.5 Dominant and recessive alleles
9780170452922
Pure breed
• A pair of alleles in a pure breed are identical (it is homozygous).
• The set of alleles in a pure breed are either both dominant or both recessive for a specific trait.
• A pure breed for widow’s peak can be either WW for widow’s peak or ww for straight hairline.
• Pure breeds are used when studying inheritance and can be identified by a test cross.
Homozygous
• Homozygous means possessing two Homologous chromosome pair Homologous chromosome pair
that is homozygous for all alleles that is heterozygous for all alleles
identical alleles of a gene.
• AA is a homozygous dominant A A A a
B B b B
genotype.
• aa is a homozygous recessive C C c C
genotype.
D D
D d
Heterozygous
• Heterozygous means possessing two E E e E
different alleles of a gene.
• Aa is a heterozygous genotype. FIGURE 5.6 Homozygous and heterozygous alleles
• The dominant allele will be

expressed.
Autosomal trait
• An autosomal trait is inherited on an autosome – a X X X Y
chromosome that is not a sex chromosome.
• A gene on an autosome is called autosomal.
Sex-linked trait
• A sex-linked trait is inherited on a sex chromosome (X or Y). A
gene on a sex chromosome is called sex-linked.
• Note: the Y chromosome is short and contains relatively
few genes. Most of them code for sex-related traits. X
female male
chromosomes are longer and contain more genes. They carry
genes for sexual development as well as for certain other traits. FIGURE 5.7 Sex chromosomes
Punnett square Parental

genotypes
• A Punnett square is a table that displays all the possible offspring D d
genotypes (given the parental alleles) that can be produced at

D DD Dd
fertilisation. You can determine the likelihood of producing a
child with a particular trait using a Punnett square. Assuming the
d Dd dd
genotypes of the parents for a trait are known using a Punnett
square allows you to work out the potential genotypes of their D = dominant allele
offspring, as well as to determine the likelihood of a particular d = recessive allele
offspring having the trait.

FIGURE 5.8 A Punnett square
Mendel’s experiments
In one of Mendel’s experiments, he took a pure-breeding tall pea plant and crossed it with a
pure-breeding short pea plant. Pure-breeding plants are ones that, when crossed among themselves,
always give rise to offspring that are like the parents. The way Mendel crossed the plants was to take
pollen grains containing sperm cells from the anthers of one plant and dust them onto the stigma of
another plant, having first removed the anthers of this second plant to ensure that it could not
self-pollinate (Figure 5.9). This is referred to as hand pollination.
9780170452922
nilttaC legiN/ecruoS ecneicS

rekraP drawdE/ymalA
FIGURE 5.9 Removing anthers to prevent self-pollination FIGURE 5.10 Tall and short pea plants:
two different phenotypes for height
Mendel collected the seeds that resulted

from the crosses between the tall pea plants
and the short ones, and sowed these. He found
that the seeds, once they had germinated and
P generation: Tall x Short
grown into adult plants, always developed into
tall offspring. In these crosses, we refer to the
original pure-breeding parent plants as the
parental generation (P). The offspring belong to
what we call the first filial generation (F1). The
term ‘filial’ means son or daughter.
F1 generation: All tall plants
Mendel then took the tall F1 plants and
self-pollinated each of them, this time taking
precautions to prevent them from being
pollinated by any other kind of pollen. The
resulting seeds were sown and the offspring,
belonging to the second filial generation (F2),
F2 generation: ¾ tall; ¼ short
were examined. Mendel found that some of these
F2 plants were tall and some were short. Overall, FIGURE 5.11 An example of Mendel’s crosses: tall vs
he counted 1064 plants. Of these, 787 (74%) short pea plants
were tall and 277 (26%) were short. It seemed as
though approximately three-quarters of the F2 generation were tall and one-quarter were short. In
other words, the ratio of tall to short plants was approximately 3:1.
Mendel’s conclusions
The first striking fact to notice in Mendel’s results is that in the F1 and F2 generations there are no
medium-sized plants; that is, there are no plants that are intermediate between the tall and the short
parents. From this, we conclude that inheritance of this characteristic is not the result of the two
parents’ features blending together in the offspring. Rather, definite factors, which may or may not
show themselves in the outward appearance of the organism, pass from parents to offspring. That
such factors exist is borne out by the observation that, despite its absence in the F1 generation, the
short form reappears in the F2 generation.
9780170452922
The second conclusion is drawn from the observation that there were no short plants in the
F1 generation, despite the fact that one of the parent plants was short. Short plants reappeared,
however, in the F2 generation. From this we can conclude that, although the F1 plants are tall, they
must receive a factor for shortness from their short parent, which remains ‘hidden’ in the F1 plants and
does not reveal its presence until the F2 generation.
A third conclusion is that the factor for shortness, which fails to show itself in the F1 generation,
must be masked in some way by the factor for tallness. Only in the absence of this factor will the
factor for shortness show itself in the outward appearance of the plant. In other words, the factor for
tallness is dominant over the factor for shortness. Shortness is described as recessive.
Each generation can be predicted if the parent genotypes are known. The predictions of the
offspring genotypes and phenotypes can be represented by Punnett squares.
Key concept
A phenotype describes the observable characteristics of an individual. Mendel was able to study
the principles of genetics through careful observation of the phenotypes of pea plants and
using selective breeding techniques. He found dominant traits masked recessive traits.
Inheritance principles: Punnett squares

A Punnett square is a diagram that shows all possible combinations of alleles and, therefore, all the
possible genotypes of the offspring.
Reginald Punnett developed the ‘Punnett Square’ to depict the number and variety of genetic
combinations.
How to construct a Punnett square

1 Draw a 2 by 2 Punnett square. Include an extra row and
column for the parent alleles.
2 Decide on an appropriate letter to denote the dominant
and recessive alleles. The dominant allele should have
a capital letter (and be written first if the genotype is
heterozygous), and the recessive allele should have a
lower-case letter. This should be visible in a key along with
the parent genotype cross.
3 Add the maternal parent genotype to the header
Cross
row and the paternal parent genotype to the first
Parent cross = TT × tt
column (or vice versa).
T T
The results for Mendel’s pure-breeding tall and
short peas will be used as an exemplar. The t
alleles are separated, as they are in meiosis. The
single alleles would be found in gametes without t
their pair, ready for fertilisation.
Key:
Alleles
T = tall (dominant allele) T T
t = short (recessive allele)

t Tt Tt
4 Write out the possible combinations of the genotypes
of the offspring of this successive generation. t Tt Tt
The offspring represent the possible F1 generation.
9780170452922
5 After the Punnett square is complete, determine the genotype and phenotype ratios. The ratios
can be displayed as whole numbers, fractions or percentages.
Genotype ratio: 4 Tt OR ⁴/₄ = 1 Tt (simplify fractions) OR 100% Tt
Phenotype ratio: 4 tall OR ⁴/₄ = 1 tall OR 100% tall
The F2 generation can be represented in the same way. Cross
Key: Parent cross = Tt × Tt
Alleles T t
T = tall (dominant allele)
t = short (recessive allele) T TT Tt
t Tt tt Punnett square
calculator
Genotype ratio: 1TT : 2 Tt :1tt OR ¼ TT : ½ Tt : ¼ tt OR 25% TT : 50% Tt : 25% tt
Phenotype ratio: 3 tall : 1 short OR ¾ tall : ¼ short OR 75% tall : 25% short
Always include a genotype and phenotype key and ratios (even when not instructed to).
Key concept
A Punnett square is a visual representation that can be used to study and predict patterns of
genetic inheritance.
Question set 5.1

REMEMBERING homozygous or heterozygous and
1 Define pure-breeding. whether they result in a dominant or
2 Distinguish between a locus, a gene and recessive phenotype.
an allele. ANALYSING
3 Define genotype and phenotype. 7 Determine the phenotype ratio for the
4 Define the P, F1 and F2 generations. offspring of a homozygous tall pea plant
5 Define heterozygous and homozygous crossed with a heterozygous tall pea
and state one example of a genotype for plant. Show your working out in a Punnett
each. square.
UNDERSTANDING 8 Explain Mendel’s reasoning behind his
6 How many different genotypes are conclusion that the factors he studied in
possible for the tall and short traits of pea plant height excluded an intermediary
Mendel’s peas? List them and classify form (there was no blending of traits;
them according to whether they are plants were either tall or short).
5.2 GENETICS TODAY

Instead of ‘factors’ we use the term ‘gene’. As Mendel observed, the gene controlling height in the
pea plant exists in two forms, which we now call alleles. One allele functions in a certain way and is
responsible for producing a tall plant. The other influences development in such a way that, if two
copies of that allele are present together, a short plant is produced. Therefore, there are two distinct
variations.
We can apply what we know about genetics today to Mendel’s results. In Figure 5.12 (page 130),
the allele for tallness is represented by T and the allele for shortness by t. We shall assume that each
parent plant (or, more strictly, each somatic cell of each parent plant) contains a pair of identical
alleles: TT in the case of the tall parent, tt in the case of the short parent. When an organism contains
9780170452922
identical alleles like this, it is said to be

homozygous. In making this statement, we are
describing the genetic make-up of the parent
plants for height. The genetic composition
(set of alleles) of an organism is known as its
genotype. In essence, the genotype describes
the alleles that a cell or organism has at a
particular gene locus for a particular trait.
The way genes are expressed in the outward
appearance of the organism is known as
its phenotype. In the case of the parental
generation of pea plants described earlier,
plant height is the phenotype. Pea plants with
the ‘tall’ phenotype have the genotype TT or
Tt. and pea plants with the ‘short’ phenotype
have the genotype tt.
The T allele is present in each of the
gametes produced by the tall parent, and
the t allele is present in each of the gametes
produced by the short parent. Fertilisation
brings the T and t alleles together, so that
all the F1 offspring have the genotype Tt.
Phenotypically, they are all tall, because tall
is dominant over short. When an organism
contains two dissimilar alleles, it is said to be
heterozygous. If the organism is heterozygous
with respect to one particular gene, it is called
a monohybrid. In this particular instance,
the T allele expresses itself in the phenotype,
FIGURE 5.12 Summary of the cross between a pure-
and the expression of the t allele is masked breeding tall pea plant and a pure-breeding short pea
by the expression of the T allele. A dominant plant. This is an example of a monohybrid cross, because
phenotype is expressed whether it occurs only one gene is involved on one locus.
in the homozygous or the heterozygous
condition. However, a recessive trait is only
expressed when in the homozygous condition.
Monohybrid cross: inheritance of a single

autosomal gene
The 3:1 ratio Mendel predicted in the F2 generation was based on observations of many different
crosses using a variety of pea plant characteristics. Mendel could not explain why he observed this
ratio because he had no knowledge of meiosis.
We can relate the behaviour of chromosomes at meiosis to the 3:1 ratio obtained. In meiosis,
homologous chromosomes separate from each other, so that haploid gametes receive only one of
each type of chromosome, instead of the two chromosomes present in diploid cells. In diploid cells,
alleles occur in pairs, one of each pair being located on each of two homologous chromosomes
(Figure 5.13). When homologous chromosomes separate in meiosis, the alleles are separated, so each
gamete receives only one of a pair of alleles, just as they receive only one of a pair of homologous
chromosomes (Figure 5.14).
9780170452922
In describing the genotype

Homologous
of a plant as Tt, we mean
chromosomes
that there is a pair of
alleles for height, or T t
tallness. One chromosome
of this pair carries a T allele
Alleles of the and the other a t allele
same gene
T t
In meiosis, the two
Different
homologous
genes
chromosomes
come together.
A a
Then they segregate T t

Homozygous into separate gametes.
Loci B B alleles for the
dominant trait
Heterozygous Thus, each gamete

C c
alleles contains one of
each of the
original
pair of alleles.
Homozygous T t
d d alleles for the
recessive trait
FIGURE 5.13 Combinations of alleles on homologous FIGURE 5.14 The segregation of alleles in inheritance corresponds to the
chromosomes segregation of homologous chromosomes in meiosis.
Key concept
Inheritance of alleles of a single autosomal gene can be analysed using a monohybrid cross.
If the P generation is pure-breeding, the proportion of dominant to recessive alleles in the
F2 generation is typically 3:1.
A monohybrid cross involves fusion of gametes from two monohybrids (parents with genotypes
consisting of one dominant and one recessive allele) that differ in only one characteristic. Only one
gene is investigated. Recall that a monohybrid is an organism that is heterozygous with respect to a
single gene. Monohybrids are the offspring from a cross between parents who are both homozygous
but have different alleles from each other. Mendel performed crosses with pure-breeding pea plants,
which produced monohybrids heterozygous for the gene of interest. This was the F1 generation.
When he crossed two organisms of the F1 generation, he was crossing two monohybrids. The
offspring of the monohybrid cross, known as the F2 generation, gave rise to a 3:1 ratio of the
dominant and recessive phenotypes. Mendel’s cross between the offspring of the tall and short
pea plants is an example of a monohybrid cross, using a parental generation with the genotypes
(phenotypes in brackets) of TT (tall) and tt (short), and obtaining an F1 generation of Tt (tall). The
segregation of the alleles into the gametes can be explained in terms of meiosis, as illustrated in
Figure 5.15.
When a monohybrid cross is presented to you in a question, a Punnett square can be used to
predict the genotypes and phenotypes of the offspring, and in some cases to infer the genotypes
and phenotypes of the parents. This technique can help plant or animal breeders develop varieties
9780170452922
Homozygous Homozygous
dominant parent recessive parent
T t
T t
Chromosomes duplicated
before meiosis
Meiosis I
T T t tt
T T t
T T Meiosis II t t
T T t t
T TT T t t t t
Gametes Gametes
Fertilisation produces
heterozygous offspring
T
t
FIGURE 5.15 The segregation of chromosomes in a monohybrid cross: two homozygous parents with different
phenotypes can only produce heterozygous offspring.
that have desirable traits. To solve genetics problems, you will need to apply your understanding
and use critical thinking. Critical thinking involves reasoning with information to arrive at the best
possible solution. It involves using your knowledge and understanding in a systematic way to solve
problems and provide structured reasoning for your conclusions.
Worked example 5.1

Solving monohybrid cross questions
A pea plant that is heterozygous and has green pea pods is crossed with a pure-breeding pea
plant for yellow pods. Predict the proportion of offspring that will produce green pea pods.
Sample marking allocation
a Key (assign the alleles and state the cross). (1 mark)
b Draw the Punnett square and enter the female and male gametes. (1 mark)
c Determine the genotypes of all the possible offspring. (2 marks)
d Determine the proportions of the genotypes and phenotypes of the offspring. (2 marks)
9780170452922
STEP STRUCTURED REASONING WORKING OUT MARK
ALLOCATION
a If the green pea pod plant is heterozygous Key: 1 mark
but still green, then the green allele is Alleles
being expressed and is therefore the G = green pod
dominant allele. The dominant allele is g = yellow pod
represented by a capital letter. Cross
Parent cross = Gg × gg
If the alleles are not defined, you will need
to allocate an appropriate letter after you
deduce which trait is dominant.
The first parent genotype is Gg.
The other parent is pure-breeding and

therefore homozygous recessive. The
recessive allele is represented by a lower-
case letter.
The second parent genotype is gg.

b Due to meiosis and random segregation 1 mark
G g
of chromosomes, each allele is separated,
representative of the haploid gamete in g
which it resides. Place the parent alleles in
g
separate columns and rows.
c The next step simulates fusion of the 2 marks

G g
male and female gametes, giving all the
possible allele combinations. g Gg gg
Complete the Punnett square by pairing g Gg gg

up the alleles to make diploid offspring.
d Each genotype with at least one G allele Genotype ratio 2 marks
must express the dominant phenotype. 2Gg : 2gg = 1 Gg : 1 gg
The Punnett square shows that two of the OR
four squares for the offspring have at least 50% Gg : 50%gg
one G allele.
Phenotype ratio
Only the gg genotype will express the 2 green : 2 yellow pods
recessive phenotype. = 1 green : 1 yellow pod
OR
Whole number ratios must be simplified
50% green pods : 50% yellow pods
or represented as percentages or
fractions.
Try these yourself

Using the alleles P and p, draw Punnett squares to show the ratio of purple to white plants
among the offspring from the following crosses. Be careful you do not mix up your capital and
lower-case letters.
1 A pure-breeding purple plant with a pure-breeding white plant.
2 A cross between two pea plants of the F1 generation from the parental cross in Question 1.
9780170452922
Question set 5.2

REMEMBERING
1 Distinguish between dominant and recessive alleles in terms of expression.
2 Define monohybrid cross.
3 State the purpose of a Punnett square.
UNDERSTANDING
4 Explain why the same genotype can result in a number of different phenotypes.
5 Complete the table of results of Mendel’s crosses (Table 5.1) by simplifying F2 ratios. The
first two have been done for you as exemplars.
TABLE 5.1 Phenotype ratios
PURE-BREEDING F1 PHENOTYPES F2 PHENOTYPES F2 RATIO F2 RATIO ROUNDED TO

PARENTAL PHENOTYPES THE NEAREST WHOLE
NUMBER
Tall plants × short plants All tall 787 tall, 277 short 2.84:1 3:1
Purple flowers × white All purple 705 purple, 224 3.15:1 3:1
flowers white
Green pods × yellow pods All green 428 green, 152
yellow
Yellow peas × green peas All yellow 6022 yellow, 2001
green
Round peas × wrinkled All round 5474 round, 1850
peas wrinkled
6 Write a conclusion based on the table of results in Question 5.

ANALYSING
7 Describe the relationship between the process and products of meiosis and Mendel’s 3:1
ratio in monohybrid crosses.
CREATING
8 Construct Punnett squares, determine the genotype and phenotype ratios, and provide an
answer for the following questions.
a The presence of freckles is a dominant characteristic. An unborn child’s mother has
no freckles and its father is heterozygous for freckles. What is the probability that this
child will have freckles?
b In a variety of garden peas, the allele for tall plants (T) is dominant over the allele for
short plants (t). A cross between a tall plant and a short plant resulted in 50% of the
offspring being short. What were the genotypes of the parents?
5.3 THE TEST CROSS

If an organism’s genotype is unknown, and it is displaying a dominant phenotype, it is possible to
predict the genotype by performing a test cross. This technique involves crossing the individual
whose genotype is unknown but that has a dominant phenotype (it could be homozygous dominant
or heterozygous dominant) with an organism that is homozygous recessive at the locus in question.
This is called a test cross. The ratio of phenotypes in the offspring reveals the unknown genotype. We
can illustrate this by reference to an animal that is used in many genetic experiments – the fruit fly,
Drosophila melanogaster .
9780170452922
D. melanogaster has a large number of variants or forms. Most individuals have long wings,
but some have small or ‘vestigial’ wings (Figure 5.16). The long-winged condition (V) is dominant
to vestigial wing (v). Accordingly, if a pure-breeding long-winged fly (VV) is mated with a vestigial-
winged fly (vv), the F1 individuals are all heterozygous at this locus (Vv) and have long wings. If two of
these F1 flies mate with each other, a mixture of long-winged and vestigial-winged flies are produced
in a ratio of approximately 3:1 (Figure 5.17).
a b
oC ylppuS lacigoloiB aniloraC/ecruoS ecneicS
sciP ygoloiB/ecruoS ecneicS

FIGURE 5.16 The fruit fly D. melanogaster may have a long wings or b vestigial wings.
P Long wing Vestigial wing

homozygous homozygous
dominant recessive
VV × vv
F1 Long wing (interbred)

heterozygous
Vv
F2 Long wing Vestigial wing

V V, V v vv
FIGURE 5.17 Monohybrid cross showing inheritance of wing length in fruit flies
This is expected for a monohybrid cross. But how can we decide whether a given F2 long-winged
fly is homozygous dominant (VV) or heterozygous (Vv)? The simplest way to solve this problem is
to cross it with a vestigial-winged fly. We know that a vestigial-winged fly must be vv (homozygous
recessive); it cannot be anything else. If the long-winged fly whose genotype we wish to determine is
VV, then crossing it with a vestigial-winged fly will give nothing but long-winged flies. If, however, the
unknown fly has the genotype Vv, then the cross will give a mixture of long- and vestigial-winged flies
in approximately equal numbers. This is summarised in Figure 5.18 (page 136).
9780170452922
Parents Long wing × Vestigial wing Long wing × Vestigial wing

VV vv Vv vv
1 1
— —
Gametes All V All v 2 V 2 v All v
F1
1
—
1
— 2 vestigial
2 long wing wing
Vv vv
All long wing
Vv
FIGURE 5.18 A test cross to determine whether a fruit fly is homozygous or heterozygous for long wings
Test crosses using homozygous recessive

individuals are a routine method of establishing an
organism’s genotype.
In guinea pigs, black fur colour is dominant
over white. A test cross could be performed to
find out the genotype of a black pet guinea pig
of unknown genotype. If the owner wanted to be
certain their pet was homozygous dominant black,
lawgruBJW/moc.kcotSi
for breeding purposes, they could breed the pet
with a guinea pig who was homozygous recessive
white.
When an organism displaying a dominant
phenotype is crossed with an organism that is FIGURE 5.19 A test cross can help determine the
homozygous recessive for the condition, there are genotype of a pet guinea pig.
two possible outcomes. Either 100% or 50% of the
offspring will present the dominant phenotype. Below are the two possible crosses, given the black
phenotype could have arisen from the homozygous or heterozygous set of alleles. Compare the
results.
PUNNETT SQUARE IF THE BLACK GUINEA PIG’S PUNNETT SQUARE IF THE BLACK GUINEA PIG’S
GENOTYPE IS BB GENOTYPE IS Bb
B B B b
b Bb Bb b Bb bb
b Bb Bb b Bb bb
Genotype ratio 100%Bb Genotype ratio 50%Bb : 50%bb

Phenotype ratio 100% black Phenotype ratio 50% black : 50% white
9780170452922
A conclusion about the genotype can be drawn after analysing the offspring phenotype ratios. If
any offspring appear white, a breeder can be certain the unknown genotype was heterozygous (Bb). If
the offspring are all black, the breeder can conclude the unknown genotype is homozygous (BB).
Question set 5.3

1 State the purpose of a test cross. 4 In the fruit fly, D. melanogaster, the ebony-
2 To find the genotype of an individual body allele (e) is recessive to the normal
displaying a dominant phenotype, what yellow-body allele (E). Predict the genotype
type of genotype should it be crossed of a male fly with a yellow body by:
with? a constructing the two possible Punnett
squares for a test cross with an ebony
UNDERSTANDING body female fly
3 Explain how a test cross helps a b converting your predicted offspring into
breeder determine the genotype of an i percentages
organism. ii fractions.
5.4 MULTIPLE ALLELES FOR ONE GENE

Only two alleles account for each of the pea plant traits that have been discussed so far. For
most traits, there are more than two alleles for a gene. This phenomenon is known as having
multiple alleles. In any one individual, of course, only two alleles are normally present. A multiple
allele system is present when three or more alleles of a gene exist among the members of a
population. An example of this is the ABO blood group system in humans, where there are three
alleles possible for one gene. The phenotype expressed by allele IA, which is codominant with IB,
produces molecular markers on red blood cells. We discuss codominance in more detail later in
this chapter (see page 148). The phenotype expressed by the third allele i is recessive to both IA and
IB and produces no marker (O). Table 5.2 summarises the genotypes and the resulting phenotype
(blood groups).
TABLE 5.2 Genotypes and phenotypes for human blood groups
PHENOTYPE GENOTYPE
Blood type A IAIA or IAi
Blood type B IBIB or IBi
Blood type AB IAIB
Blood type O ii
The fact that there are more than two alleles responsible for determining blood group makes no
difference to their transmission, which takes place in a normal Mendelian fashion. Thus, a child whose
parents are both blood group O must be blood group O. Consider the offspring of a man who is
blood group AB and a woman who is heterozygous blood group B. A Punnett square can still be used
to determine the possible genotype and phenotype ratios.
Key:
Alleles
IA = Group A IA IB
IB = Group B
IB IA IB IB IB
i = Group 0
Cross i IA i IB i
Parent cross = I I × I i
A B B
9780170452922
Genotype ratios: 1 IA IB : 1 IB IB : 1 IAi : 1 IB i

Phenotypes ratios: 1 blood group AB : 2 blood group B : 1 blood group A
In the population, there are four possible phenotypes, 50
with no one showing variation that is in between each 45
noitalupop fo egatnecreP
40
blood group. This produces discontinuous variation,
35
because only one set of alleles for one gene determines
30
the phenotype. Discontinuous variation is a set of discrete 25
phenotypic categories controlled by a single gene and its 20
set of alleles. A human is either blood group A or B or AB 15
or O, because these are the discrete categories coded for 10
5
by one set of alleles for one gene. When characteristics
0
are controlled by a single gene, the phenotypes fall into A B AB O
separate categories. Blood group
Discrete variation in a population can be represented FIGURE 5.20 Blood groups in a population,
on a bar graph. showing discontinuous variation
Question set 5.4

1 State the possible genotypes for blood 5 The baby ID bracelets of three newborns
group A and blood group O. in the maternity ward of a hospital
2 Define discontinuous variation. have been misplaced. Testing reveals
UNDERSTANDING the blood type of the babies to be one
each of AB, A and O. For a couple where
3 Draw a Punnett square to show that a the mother is homozygous type A and
person with blood group AB cannot have the father is type O, predict which of the
children with blood group O. three babies is theirs. Ensure you include
4 Provide an explanation for why a bar Punnett squares and ratios in your
graph is used to display discontinuous working out.
variation.
5.5 THE DIHYBRID CROSS

Dihybrid crosses involve two genes with two different alleles for each gene. In Mendel’s genetic
experiments on pea plants, he studied the inheritance of two traits at the same time. He also
studied how these traits were inherited through two generations, finding the ratios of the
resulting offspring. One pair of traits that he studied at the same time in pea plants was height
and flower colour. He took pure-breeding (homozygous for both traits) strains of pea plants
and crossed them. One plant was tall and had purple flowers. The other plant was short and had
white flowers. He found that the offspring of a cross between these parents always produced
plants that were tall and purple-flowered. This was the F1 generation.
Members of the F1 generation were then self-pollinated. In the F2 generation, there were four
different phenotypes: tall plants with purple flowers; tall plants with white flowers; short plants with
purple flowers; and short plants with white flowers. In other words, the offspring showed the two
pairs of characteristics (tall, short; purple, white) combined in every possible way.
As before, Mendel counted the different types of plants and found 96 tall purple plants, 31 tall
white plants, 34 short purple plants and 11 short white plants, giving a ratio of approximately 9:3:3:1.
The results of the experiment are summarised in Figure 5.22. What conclusions can be drawn from
these results? First, the observation that all the F1 plants were tall with purple flowers confirms that
tall is dominant to short, and purple flower is dominant to white flower. This is as expected from the
results of the monohybrid crosses.
9780170452922
a b
trahrebE yllaW/detimilnU slausiV

FIGURE 5.21 Pea plant flowers may be a purple or b white.
P Tall, purple flowers × Short, white flowers
Tall, purple flowers (interbred)

F1
F2 Tall, purple Tall, white Short, purple Short,

flowers flowers flowers white flowers
9 : 3 : 3 : 1
FIGURE 5.22 Summary of Mendel’s dihybrid cross
Figure 5.23 (page 140) shows how the alleles were transmitted in this dihybrid cross. T represents
the allele for tallness, t for shortness, P for purple flowers and p for white flowers. Mendel always
started his experiments with pure-breeding plants, so the parent plants were homozygous for both
genes. The genotype of the tall plant with the purple flowers was, therefore, TTPP, and that of the
9780170452922
short plant with white flowers DIHYBRID CROSS: FLOWER COLOUR AND STEM LENGTH
was ttpp. From Mendel’s earlier Key for alleles: TT and Tt = tall; tt = short; PP and Pp = purple; pp = white
work, we know that the gametes Parental generation
produced by the parent plants were

TP from the tall purple parent and
tp from the short white parent. All
the F1 offspring, therefore, had the
TTPP ttpp
genotype TtPp, heterozygous for (tall, purple flowers) (short, white flowers)
both genes.
Punnett square Possible gametes for parents
The next step in the line of tp tp tp tp
reasoning is crucial. Since all TP TtPp TtPp TtPp TtPp
four possible combinations of
TP TtPp TtPp TtPp TtPp
characteristics showed up in the
TP TtPp TtPp TtPp TtPp
F2 generation, we must conclude
(as Mendel did) that the F1 plants TP TtPp TtPp TtPp TtPp
produced four kinds of gamete: F1 generation

TP, Tp, tP and tp. Figure 5.24 shows
the different ways these gametes
could combine, together with the
genotypes of the F2 offspring. To be
tall, the genotype of the plant must 100% TtPp
(100%, tall, purple flowers)
contain at least one T allele; to be
purple, it must contain at least one P F1 generation
allele. From the Punnett square, we

can see that there are 16 possible
combinations. Of these, 9 give tall
purple plants, 3 tall white plants,
TtPp TtPp
3 short purple plants and 1 short (tall, purple flowers) (tall, purple flowers)
white plants. The observed 9:3:3:1 Punnett square Possible gametes (same for both parents)
ratio can be accounted for if all the TP Tp tP tp
possible combinations occur with TP TTPP TTPp TtPP TtPp
equal likelihood.
Tp TTPp TTpp TtPp Ttpp
The basic structure of a dihybrid
tP TtPP TtPp ttPP ttPp
cross Punnett square is a 4 × 4 grid
for possible offspring, with the four tp TtPp Ttpp ttPp ttpp
possible gamete allele combinations

F2 generation 9 genotypes 4 phenotypes
of one parent written across the top Phenotype ratio:
9 tall, purple: 1 × TTPP
row and those of the other parent 3 tall, white:
2 × TTPp
written down the left column. A key 3 short, purple: 9 tall, purple flowers
1 short, white
is drawn up for the alleles and the 2 × TtPP
cross. 4 × TtPp
1 × TTpp
Key concept
3 tall, white flowers
2 × Ttpp
Inheritance for two unlinked

autosomal genes can be analysed 1 × ttPP
3 short, purple flowers
with a dihybrid cross. If the 2 × ttPp
P generation are pure-breeding

with respect to all traits, the 1 × ttpp 1 short, white flowers
F2 generation typically shows a

ratio of 9:3:3:1.
FIGURE 5.23 Dihybrid cross: F1 and F2 genotypes and phenotypes
9780170452922
P Tall purple Short white

TTPP ttpp
Segregation Segregation
Gametes All TP All tp

Gametes
fuse
Tall purple Tall purple

F1
TtPp (self-pollinated) TtPp
Segregation with Segregation with

independent assortment independent assortment
Gametes 1 TP 1 Tp 1 1 1 TP 1 Tp 1 1
4 4 4
tP 4
tp 4 4 4
tP 4
tp
Punnett square to show fusion of F1 gametes
Male gametes
1 1 1 1
4
TP 4 Tp 4 tP tp
4
1 1 1 1
1 16 16 16 16
4
TP TTPP TTPp TtPP TtPp
Tall purple Tall purple Tall purple Tall purple
1 1 1 1
1 16 16 16 16
Tp
setemag elameF
4 TTPp TTpp TtPp Ttpp

Tall purple Tall white Tall purple Tall white
1 1 1 1
16 16 16 16
1
4 tP TtPP TtPp ttPP ttPp
Tall purple Tall purple Short purple Short purple
1 1 1 1
16 16 16 16
1
4 tp TtPp Ttpp ttPp ttpp
Tall purple Tall white Short purple Short white
F2 9
Tall purple 3 3 Short purple 1
16 16 Tall white 16 16 Short white
FIGURE 5.24 Dihybrid cross of a pure-breeding tall purple-flowering pea plant with a pure-breeding short
white-flowering pea plant: how to derive the possible combinations of alleles for each gamete.
Worked example 5.2

Solving a dihybrid cross
A pure-breeding fruit fly that has curly wings and red
eyes is crossed with a pure-breeding fruit fly that has
straight wings and purple eyes (Figure 5.25). Their
offspring all have curly wings and red eyes. Show this ×
in a Punnett square.
Two of the F1 generation flies are crossed. If the alleles
for wing shape and eye colour assort independently,
predict the phenotypes of the F2 generation and the FIGURE 5.25 Pure-breeding fruit flies with curly wings and red
proportions of each phenotype. eyes are crossed with pure-breeding fruit flies with straight wings
and purple eyes.
9780170452922
Sample marking allocation

a Key (assign the alleles and state the cross). (1 mark)
b Draw the Punnett square and enter the female and male gametes. (1 mark)
c Determine the genotypes of all the possible offspring. (2 marks)
d Determine the proportions of the genotypes and phenotypes of the offspring. (2 marks)
STEP STRUCTURED REASONING WORKING OUT
a The P generation flies are pure-breeding, so they are Key:
homozygous for wing shape (curly or straight) and eye Alleles
colour (red or purple). C = curly wing
c = straight wing
Due to meiosis and random segregation of chromosomes
R = red eyes
and their alleles, each allele is separated from its pair, as are
r = purple eyes
all the alleles in the haploid gamete it occurs in. Place the
Cross
parent alleles in separate columns/rows.
Parent cross = CCRR × ccrr
It follows that all the F1 generation must be heterozygous
The different combinations of alleles are represented in the
with respect to both wing shape and eye colour.
parent row and column.
All the F1 generation have curly wings and red eyes. This
CR CR CR CR
indicates that curly wings are dominant to straight wings and
cr CcRr CcRr CcRr CcRr
red eyes are dominant to purple eyes.
b The F1 cross is between heterozygous fruit flies. The F1 cross = CcRr × CcRr:
The alleles for each trait (Cc and Rr) assort independently of CR Cr cR cr
one another, so four equally likely combinations of alleles CR
are present in the gametes of the F1 generation Cr
A Punnett square is used to determine the possible cR
genotype and phenotype ratios of the F2 generation. cr
c As with the monohybrid cross, each square is filled with the The possible F2 generation of offspring is filled in.
product of the combining female and male gametes. CR Cr cR cr
This simulates fusion of the male and female gametes, CR CCRR CCRr CcRR CcRr
giving all the possible allele combinations. Cr CCRr CCrr CcRr Ccrr
The 16 offspring represent the possible zygotes formed by cR CcRR CcRr ccRR ccRr
different combinations of gametes. cr CcRr Ccrr ccRr ccrr
9780170452922
d Nine of the 16 squares show offspring with at least one To determine the ratio of phenotypes, it is helpful to code
C and at least one R allele, and these offspring will have the different categories.
both dominant phenotypes, curly wings and red eyes. Key:
Three of the 16 squares show offspring with at least one Blue = curly wings and red eyes
C allele for curly wing shape and two rr alleles for purple Orange = curly wings and purple eyes
eye colour. Green = straight wings and red eyes
Three of the 16 squares show offspring with two cc alleles Yellow = straight wings and purple eyes
for straight wings and at least one R allele for red eyes.
Just one of the 16 squares shows offspring with the CR Cr cR cr
genotype ccrr for both recessive phenotypes: straight wings
and purple eyes.
CR CCRR CCRr CcRR CcRr
Therefore the phenotypic ratio is 9:3:3:1.
Cr CCRr CCrr CcRr Ccrr
cR CcRR CcRr ccRR ccRr
cr CcRr Ccrr ccRr ccrr
The phenotypic ratio is:

9 curly wings and red eyes : 3 curly wings and purple eyes :
3 straight wings and red eyes :
1 straight wings and purple eyes
Try these yourself

1 A pure-breeding fruit fly that has curly wings and long legs is crossed with a pure-breeding fruit fly that has
straight wings and short legs. Their offspring all have curly wings and long legs. Two of the F1 generation flies
are crossed. If the alleles for wing shape and leg length assort independently, predict the phenotypes of the F2
generation and the proportions of each phenotype.
2 A pure-breeding pea plant with yellow wrinkled peas was crossed with a pure-breeding pea plant bearing round
green peas. All the F1 offspring have round yellow peas. If two of the F1 pea plants are crossed, predict the possible
combinations of pea phenotypes with respect to shape and colour and the proportions in which they are likely to
occur.
Explanation of dihybrid ratios

The observation that characteristics such as height and flower colour are inherited independently of
one another is known as independent assortment. The explanation for this lies in the behaviour of
the chromosomes at meiosis, which is just like the segregation of alleles that Mendel observed in his
monohybrid crosses.
Independent assortment occurs when the genes concerned are carried on different chromosomes;
for example, the alleles of the gene for flower colour are located on one pair of chromosomes and the
alleles of the gene for height are located on another pair of chromosomes. In metaphase I of meiosis,
homologous chromosomes line up side by side on the spindle prior to separating at anaphase I.
9780170452922
The different pairs of homologous chromosomes

act independently of one another: the way one
pair of homologous chromosomes arranges itself t T
on the spindle and subsequently separates has no

effect whatsoever on the behaviour of any other P p
pair of chromosomes.
The consequence of the independent
behaviour of non-homologous chromosomes in T t Independent t T
meiosis is shown in Figure 5.26, which illustrates assortment
P p P p
how the four different types of gametes (TP,
Tp, tP and tp) can be formed from a plant that
is heterozygous for height and flower colour Cell division
(TtPp).
T t t p T
We can summarise the situation by saying P p P
that the alleles for height and flower colour
1 2 3 4
segregate and assort independently because they
are carried on separate chromosomes, which FIGURE 5.26 Meiosis provides the explanation for
themselves segregate and assort independently the independent assortment that Mendel observed
in meiosis. in dihybrid crosses. The independent assortment
of alleles in inheritance corresponds to the free
assortment of chromosomes during meiosis.
Question set 5.5

REMEMBERING
1 State the expected phenotypic ratio
for a dihybrid cross for an organism RRTT RRTt RrTT RrTt
heterozygous for both genes. RRTt RRtt RrTt Rrtt

2 Define non-homologous chromosomes.
UNDERSTANDING RrTT RrTt rrTT rrTt
3 Relate the term ‘non-homologous RrTt Rrtt rrTt rrtt

chromosomes’ to the 9:3:3:1 phenotypic
ratio seen in the F2 generation of a a Deduce the genotypes and
dihybrid cross. phenotypes of the parents.
ANALYSING b Explain how the phenotypic ratio
4 The genotypes of the offspring resulting would differ depending on whether
from a dihybrid cross are shown in the two genes are carried on homologous
Punnett square that follows. chromosomes or on two non-
Key: homologous chromosomes.
Alleles 5 Two pure-breeding rabbits are mated: a
R = red flowers doe with grey fur and black eyes is mated
r = yellow flowers with a buck with white fur and red eyes.
T = tall plant The litter contains only offspring with
t = dwarf plant grey fur and black eyes. Assign the alleles
and show the genotypes of the P and F1
individuals. Draw a Punnett square to
show a cross between individuals of the
F1 generation and predict the ratio of
phenotypes with respect to fur and eye
colour in the F2 generation.
9780170452922
Genetic crossing in Australian agriculture for high-yield, CASE

STUDY
drought- and disease-resistant wheat varieties
The Grains Research and Development traits. In the past, crop improvements were
Corporation (GRDC) is a statutory authority made by selecting plants for breeding based
established to plan and invest in research, on phenotypes and, through a system of
development and extension of the Australian trial and error over generations, obtaining
grain industry. The grain industry contributed seeds containing alleles for the desirable
$12.8 billion to the total gross value of farm characteristics. Modern genetic analysis
production in 2019, with wheat being the techniques enable scientists to be more
most valuable crop. precise and efficient in this endeavour.
The image below shows the GRDC grain Phenotypes that are desirable in grains are
regions in Australia. salt tolerance, disease resistance, large grains,
Drought, pests, frost, soil salinity and and drought resistance. If the right alleles
the disease wheat rust are ongoing issues for can be identified, Australian farmers may
farmers of grains. These factors affect the continue harvesting grains, despite climate
financial performance of farmers and the export change.
industry. WA is the largest exporter of wheat The traits (phenotype characteristics)
of the Australian states and territories, with breeders can work with are affected by the
markets in Asia and the Middle East, including plant’s set of alleles. Alleles of a particular
Indonesia, Japan, South Korea, Malaysia and gene are variant forms of the same gene.
Sudan. Scientists and farmers are working In grain crops, the allele for a tall stem is
together to develop grains that are high yield, dominant and the allele for a short stem
and drought and disease resistant. Australian is recessive. Alleles are represented by a
Grain Technologies (AGT) have started looking single letter and are passed onto offspring
at a number of genes that have the potential to in different combinations. If famers allow
enable wheat to tolerate drought conditions. only tall plants to produce offspring, then all
Plant breeders have developed techniques offspring will have the same tall phenotype,
for breeding crops with more desirable increasing yield.
.noitaroproC tnempoleveD & hcraeseR sniarG :ecruoS
Northern
Southern
Western
FIGURE 5.27 GRDC grain regions in Australia
9780170452922
Currently, the GRDC funds research programs at the University of Western Australia, such
as chickpea crop resilience.
Adapted from The science of crossing and crops - Grains Research and Development Corporation
Questions
1 List the environmental factors that affect grain production in WA.
2 Recall the relationship between genotype and phenotype.
3 Explain how a scientist may find out which allele is dominant or recessive in wheat plants.
4 Farmers choose specific wheat varieties to breed. Justify this decision.
IKSNINOV ARAMAT/sotohP xafriaF

FIGURE 5.28 Wheat species growing in Beacon, WA – a very dry environment. Scientists are looking at various
genes that have the potential to help wheat cope with drought conditions.
5.6 POLYGENIC INHERITANCE

‘Poly’ comes from the Greek word for many. Polygenic inheritance is the inheritance of more than
one gene that affects the inheritance of a single characteristic. For one characteristic, two or more
genes and therefore two or more sets of alleles contribute to a phenotype. A characteristic controlled
by more than one gene is known as a polygenic characteristic. Polygenes are genes that have a small
additive effect on a phenotype, and each gene consists of multiple alleles.
An example of polygenic inheritance is human height. Unlike Mendel’s pea plants, which were
either tall or short, humans have a range of heights, with a smooth gradation from one extreme to
another. This can be seen when you line up for your school photographs each year. Whether it is a
year or other group photograph, the students will vary in height. According to the Australian Bureau of
Statistics’ Health Survey of 2011–12, the average adult height in Australia was 161.8 cm for women and
175.6 cm for men. In the last 40 years, many genes contributing to height have been identified by their
association with short stature or overgrowth. Additional genes associated with human height have been
identified recently through studies of the human genome, and the total now exceeds 200 genes.
The condition of showing a range of phenotypes is called continuous variation. Traits that show
continuous variation are controlled by two or more genes (polygenes). The greater the number
of genes and the greater the influence of environmental factors (e.g. nutrition and the standard of
medical care), the greater the expected distribution of all phenotypes for height, and the smaller the
difference between any two individuals ordered along the spectrum of variation.
9780170452922
Continuous variation in a group of individuals can be shown using a histogram (Figure 5.29).
Discontinuous variation occurs when only one gene is involved. It results in a small number of
discrete phenotypes, such as pea plants with either purple flowers or white flowers, but no colours
other than these.
a b
0.3
ABC ABc AbC aBC Abc aBc abC abc
htiw gnirpsffo fo ytilibaborP

ABC 6 5 5 5 4 4 4 3
ABc 5 4 4 4 3 3 3 2
enot niks hcae

0.2
AbC 5 4 4 4 3 3 3 2
aBC 5 4 4 4 3 3 3 2
Abc 4 3 3 3 2 2 2 1
aBc 4 3 3 3 2 2 2 1 0.1
abC 4 3 3 3 2 2 2 1
abc 3 2 2 2 1 1 1 0
0
Skin tone
FIGURE 5.29 Continuous variation in skin tone is due to the additive effects of at least three melanin-producing
genes, represented here as A, B and C. The alleles a, b and c do not produce melanin. a Punnett square of
genotypes and b histogram showing the probability of each phenotype in the offspring of AaBbCc parents.
Key concept
An organism’s phenotype is influenced by the alleles in its genotype. The inheritance of alleles
can be either single-gene inheritance (two or more alleles at a single locus) or polygenic
inheritance (multiple alleles at multiple loci, each contributing to the phenotype).
TABLE 5.3 Comparing continuous and discontinuous variation
FACTOR CONTINUOUS VARIATION DISCONTINUOUS VARIATION

Type of inheritance Polygenic inheritance (multiple alleles for Single-gene inheritance (but multiple
each gene and several genes) alleles)
Cause Genetic and environmental factors Genetic factors
Description Variation that shows gradual changes Variation that shows clear and discrete
from one trait to another. Differences are changes between traits. There is no
slight, along a continuum. intermediate form.
Type of graphical Histogram (a line graph can be Bar graph
representation superimposed to show continuous data)
Examples Height, weight, skin colour Ability or inability to tongue roll;
attached or detached ear lobes; blood
groups A, B, AB and O
Question set 5.6

1 Define polygenic inheritance. 5 Provide a human and a non-human
2 Describe independent assortment. example of polygenic inheritance
3 Distinguish between multiple alleles and controlling a trait.
polygenes. 6 Sketch a graph that shows the expected
UNDERSTANDING variation of a named polygenic trait
within a population.
4 Explain why some phenotypes, such as
height, can show continuous variation, yet
others show discontinuous variation.
9780170452922
5.7 DOMINANCE INHERITANCE PATTERNS

Inheritance is not always controlled by simple Mendelian genetics, in which one allele is completely
dominant over a recessive allele. There are two more kinds of dominance: incomplete dominance
and codominance .
Incomplete dominance
Incomplete dominance occurs when two different alleles
are present, but neither allele is completely dominant.
Both alleles contribute to the phenotype, but only partially.
A third intermediary phenotype is observed. If a pure-
breeding red snapdragon plant is crossed with a pure-
breeding white snapdragon plant, as shown in Figure 5.31,
the F1 offspring all have pink flowers. When these F1 pink
snapdragons are crossed, the F2 offspring have flowers
in the ratio of 1 red : 2 pink : 1 white. This is known as
incomplete dominance or partial dominance, because
samohT nairdA/yrarbiL otohP ecneicS

one trait is not fully dominant over its partner, and the
heterozygous phenotype (pink) is intermediate between the
homozygous parental phenotypes (red and white).
A special notation is used to indicate inheritance
of partially dominant traits. A suitable upper-case letter
designates the gene for the trait (e.g. C for colour) and
upper-case superscript letters indicate the alleles FIGURE 5.30 In pure-breeding
(e.g. CR = red colour, CW = white colour). Figure 5.31 snapdragons, incomplete dominance of
is a diagram using the appropriate notation to describe the red flower colour and white flower
inheritance of flower colour in snapdragons. colour results in a pink flower colour.
P Pink × Pink
CR CW CR CW
Gametes CR CW CR CW
F1
Red Pink Pink White

CRCR CRCW CWCR CWCW
1 1 1
— — —
4 2 4
FIGURE 5.31 The result of crossing snapdragons with pink flowers among themselves is a phenotypic ratio of
approximately 1 red : 2 pink : 1 white.
Codominance
Codominance occurs when two alleles are completely dominant. Both alleles are expressed
and observed in the phenotype. In humans, blood group AB is a joint phenotype. The alleles that
contribute to the trait are IA and IB . Both alleles are completely dominant and completely expressed.
9780170452922
The study of certain coat colours in horses and cattle also reveals this type of dominance relationship.
Both alleles in the genotype are fully expressed in the heterozygote. Such traits are said to be
codominant. In shorthorn cattle, alleles for coat colour are inherited in this way, and the two alleles
are expressed as red coat (CR ) and white coat (CW ). This is similar to the incomplete dominance shown
in snapdragon flowers, but in this case, the offspring of the pure-breeding red and white parents have
roan coats (CW CR), which are a mixture of red and white hair. The codominant inheritance of coat
colour in shorthorn cattle is illustrated in Figure 5.32. An outline of the differences between the types
of dominance relationships is provided in Table 5.4.
P White bull × Red cow
CWCW CRCR
F1 Roan calves (interbred)

CWCR
F2 White cattle Roan cattle Red cattle

1 1 1 R R
— CWCW — CWCR — C C
4 2 4
FIGURE 5.32 In shorthorn cattle, codominant inheritance causes a roan coat colour in the offspring of
pure-breeding red and white parents.
Key concept
The alleles in the genotype of an individual can be classified as homozygous or heterozygous.
The interaction between alleles can be expressed as phenotypes that are dominant, recessive,
incompletely dominant or codominant.
TABLE 5.4 Three types of dominance
DOMINANCE CRITERIA EXAMPLE

Complete One allele in a pair shows
dominance complete dominance
over the other. In a
heterozygote, the dominant
allele is expressed and
masks the recessive allele.
BB Bb bb
Only the dominant trait is
observed in the phenotype. Homozygous Heterozygous Homozygous
The phenotypes of dominant recessive
the heterozygote and B = purple allele ; b = white allele
the homozygote are
indistinguishable. FIGURE 5.33 Complete dominance (purple and white flower colours)
9780170452922
Incomplete There is an intermediate

dominance phenotype. Neither allele is
completely dominant. One × =
allele for a specific trait is
not completely expressed
over its paired allele.
FIGURE 5.34 Incomplete dominance (white, red and pink flower colours)
Codominance Both alleles are completely,

independently and equally
expressed. Both alleles in
the genotype are observed
in the phenotype.
Genotype: CWCW CRCR CRCW
Phenotype: White Red Roan
FIGURE 5.35 Codominance (white, red and roan coat colours)
TABLE 5.5 Differences between the types of dominance relationships in terms of genotype and phenotype
COMPLETE DOMINANCE INCOMPLETE (PARTIAL) CODOMINANCE

DOMINANCE
Parents BB, bb CBCB , CW CW CBCB , CW CW
Gametes Bb CCB w
CBCw
F1 genotype Bb CBCW CBCW
Phenotype Black Grey Black and white patches
Gametes Bb, Bb CBCW , CBCW CBCW , CBCW
F2 genotype BB, Bb, bb CC ,C C ,C C
B B B W W W
CBCB , CBCW , CW CW
Phenotype Black Black Black
White Grey Black and white patches
White White
Heterozygote Same as dominant Intermediate between Properties of both
homozygous parents homozygous parents
B
Note: B and C 5 alleles for black coat colour; b and CW
5 alleles for white coat colour.
Question set 5.7

REMEMBERING parents have a roan coloured coat, due to
Codominance and
incomplete dominance 1 Contrast complete dominance, incomplete the presence of red and white hairs.
Continue investigating dominance and codominance. a If a white bull is crossed with a roan
the inheritance of cow, predict the offspring genotype
codominance and UNDERSTANDING and phenotype ratios and show your
incomplete dominance
using this resource. 2 Explain why a pink snapdragon flower working out using a Punnett square.
Dominance, multiple
phenotype is an example of incomplete b A farmer who breeds only roan cattle
alleles and polygenic dominance. noticed one generation with 50%
inheritance
APPLYING red and 50% roan cattle. The farmer
Inheritance factors such
as dominance, multiple 3 In the shorthorn cattle breed, coat colour is suspected a neighbouring bull had
alleles and polygenic
inherited. White and red coat colour alleles interfered with the breeding program.
inheritance contribute
to the phenotype of an are codominant. The offspring of a cross Deduce the genotype and phenotype
organism. Investigate between pure-breeding red and white of the unknown bull.
these further.
9780170452922
What are Australian Sheep Breeding Values?
YCARETIL CIFITNEICS
Scientists study the inheritance factors that affect sheep breeding. If the right sheep genes
are selected, flocks will display beneficial phenotypes based on those selected genotypes. The
Australian Sheep Breeding Values (ASBVs) help sheep breeders select sheep with the most
desirable traits for breeding. ASBVs are based on precise genetic analysis and can be used to
improve flock genetics. Only rams and ewes found to have the advantageous alleles are bred.
This can result in permanent genetic changes in a population of sheep.
Desirable genetic changes in a flock result in improved phenotypes for traits such as body
weight, fleece weight, growth rate, disease resistance and diameter of the wool fibre. Farmers
can then sell sheep and sheep products at a higher price, leading to economic growth. This has
been the case in WA.
The slower, less accurate method of selective breeding or artificial selection (the
breeding of plants and animals to produce desirable traits in successive generations) uses a
hypothesis-based approach. This approach involves the assumption that selected sheep that
display specific phenotypes always carry the genes that code for that trait. Another assumption
is that all of the offspring will have the trait. However, several genes may be required for
the production of a particular trait, and not all of them will be passed to all of the offspring.
Additionally, linked genes are inherited together more frequently because they are located
near one another on the same chromosome, leading to further uncertainty. More modern
techniques involve biotechnology. Using a map of the sheep genome and DNA profiles of
individual sheep has led to faster and more accurate selective breeding programs. However,
this technology is in its infancy.
Variants in phenotypes are affected by genetics and the environment. Scientists are
trying to develop better technology in order to more accurately match the cause (genotype
and environment) and effect (phenotype) for a particular trait. Currently, technology cannot
tell farmers which specific alleles cause which changes to a phenotype. For polygenic traits,
this will be the sum effect of all the genes affecting a particular trait. For some traits, this
means studying thousands of genes for just one trait.
Source: Western Australian Agriculture Authority,
Department of Primary Industries and Regional Development
Questions
1 Scientists studying the effects of specific genes on a trait try to keep other variables
consistent, such as feeding levels. Can you think of other environmental factors that should
be kept constant to enable results to
be valid (e.g. age and sex)?
2 List sheep products that are used in
Australia.
3 Describe the breeding objectives a
sheep farmer might have.
4 Once breeding objectives are decided
01paT/moc.kcotsrettuhS
upon, farmers look for factors that

can help them reach their objectives.
Use your knowledge of genetics
to discuss the types of crosses a
farmer might employ to achieve their FIGURE 5.36 Improvements in sheep genetics have led
objectives. to economic growth in Western Australia.
9780170452922
5.8 MODES OF INHERITANCE

There are four main modes of single-gene inheritance that are observed in human populations:
autosomal dominant, autosomal recessive, X-linked dominant and X-linked recessive. The type of
inheritance depends on whether the gene is found on an autosomal chromosome (autosome) or a
sex chromosome. It also depends on whether the trait is dominant or recessive. Recall that traits are
Genes and inheritance dominant if only one copy of the allele is required for expression of the trait. Traits are recessive if two
Click through the
animations step by copies of an allele are required for expression of the trait. The patterns of inheritance can be analysed
step to understand the using pedigrees. It is important to understand the various modes of inheritance to predict how genetic
patterns of inheritance. conditions are passed on from parents to offspring.
Autosomal recessive patterns

An allele on a non-sex chromosome being passed to offspring is known as autosomal inheritance.
Alleles usually come in pairs. One gene in each pair comes from the mother, and the other gene
comes from the father. Recessive inheritance of a disease means both genes in a pair must be
abnormal in order to cause the disease. People with only one defective allele in the pair of alleles
are called carriers. These people are most often not affected with the condition. However, they can
pass the abnormal gene on to their children.
Female Marriage
The parents of an affected person are always
line
at least carriers of the allele. A carrier is usually Male
Affected male
unaffected, because a dominant allele will I
with trait Line of
silence the effects of the recessive allele that descent
Deceased
causes the condition.
Twins
Analysis of a pedigree can be used to II Sibling line
determine patterns of inheritance across Adopted
generations in a family. There are some Miscarriage Generation number
universal symbols used in pedigrees
(Figure 5.37). FIGURE 5.37 Pedigree symbols
Analysis
In the pedigree illustrated in Figure 5.38, we see that two unaffected parents in the F1 generation had
Pedigree analysis 1: an affected son. At least one of the parents would need to have had the allele causing the condition
How to solve a genetic to pass it on to the son. If the allele was dominant, the F1
pedigree No. 1
Andrew Douch uses a parent would have been affected. As the parents are carriers, I
hypothesis strategy to rather than being affected by the condition, the allele must
solve pedigree problems.
be recessive.
If the mode of inheritance was X-linked and recessive,
II
the P generation female parent would have the genotype
XrXr. Her sons would have to be affected, because they
would have received their one and only X chromosome from
her, and she only had the allele with the condition to pass III
on to them. This rules out the chance of it being X-linked
and confirms that the mode of inheritance is autosomal FIGURE 5.38 Pedigree for an autosomal
recessive. recessive condition
9780170452922
Autosomal dominant patterns

In autosomal dominant inheritance, a single dominant allele is
responsible for the occurrence of a phenotype. Each affected
person usually has an affected parent, and the phenotype occurs in
every generation. A single copy of the affected allele is enough to
cause the condition. A parent with a single copy of a dominant allele
on an autosome (heterozygous) will theoretically pass it on to 50% FIGURE 5.39 A pedigree
of the offspring. If the parent is homozygous for the dominant trait, demonstrating an autosomal
dominant pattern of inheritance
then 100% of the offspring will be affected.
Analyse the pedigree in Figure 5.39 to help you understand autosomal dominant inheritance patterns.
The trait affecting individuals is a dominant trait. We know it is dominant because two of the
offspring are unaffected, yet both parents are affected. This means both parents were able to pass a
recessive ‘normal’ allele to the unaffected offspring, which means both parents are heterozygous and
affected. If the allele for the condition was recessive, the parents would be unaffected carriers. But
can we confirm whether the mode is autosomal or X-linked? Yes! The unaffected female offspring
means there must be two recessive healthy alleles, one from each parent. If the trait was carried on
the X chromosome, the affected father would have passed the condition to 100% of his daughters,
because he only has one X chromosome. So this pedigree tells us that the trait is autosomal.
Key concept
A pedigree is another type of visual representation that can be used to study and predict
patterns of genetic inheritance.
Sex-linked inheritance
A pair of sex chromosomes is present in sexually reproducing organisms. In humans, females carry XX
sex chromosomes and males carry XY sex chromosomes. Human sex is determined by the presence or
absence of a Y chromosome. If a Y chromosome is present along with the X chromosome, the embryo
develops into a male. If a Y is absent, the embryo develops into a female.
Genes carried on the sex chromosomes show inheritance patterns that can be described as sex-
linked. Sex-linked inheritance can be detected from phenotypes that segregate differently between
males and females. It is not possible to be certain about sex linkage from a pedigree chart, because
autosomal traits could produce the same pattern of inheritance. At
times, signs that a trait is not X-linked will become evident.
X-linked inheritance can be eliminated as a possibility if a Locus
father passes a trait to his son. Fathers cannot pass X-linked traits
to their sons because their X chromosomes are passed to their
daughters. They only pass their Y chromosomes to their sons.
Conversely, mothers pass their X chromosomes to their sons as
well as their daughters, making it possible for X-linked traits to pass
from mother to sons or daughters. As males contain only a single X
chromosome, the chance of X-linked inheritance of disease is higher
in males than in females. This is because the dominant or recessive Y
allele on the single X chromosome will always be expressed: there is
no other allele present (see Figure 5.40). If the allele locus was on an
autosome, there would be a homologous chromosome with a paired
X
allele that could affect expression.
The locus (location) of a particular gene found on the FIGURE 5.40 An allele on the X
X chromosome does not correspond to any locus on the Y chromosome has no corresponding
chromosome; hence, it is an X-linked gene. allele on the Y chromosome.
9780170452922
There are several sex-linked disorders in humans and other animals. In the same way they
are used for studying autosomal traits, Punnett squares can be used to help predict genotype and
phenotype ratios for sex-linked inheritance. The allele symbols are different and need to be carefully
adhered to. The letters X and Y are used in the Punnett square to indicate sex-linked inheritance
is being studied. Other superscripted letters are used to show whether the allele is dominant
or recessive. For example, Duchenne muscular dystrophy is a condition that causes muscles to
progressively weaken. Individuals with this disease often die during their teens or early 20s. Muscular
dystrophy is caused by a recessively inherited mutation to a gene that codes for the protein
dystrophin. The recessive allele Xd for this gene is located on the X chromosome. Possible genotypes
and phenotypes for Duchenne’s muscular dystrophy are listed in Table 5.6. To determine genotype
and phenotype ratios, Punnett squares can be used. For example, if an unaffected female carrier
married an unaffected male, can you work out the probability of their offspring being an affected male
or an affected female? A Punnett square will help work out the probability.
TABLE 5.6 Possible phenotypes and genotypes for Duchenne muscular dystrophy
PHENOTYPE AND GENDER GENOTYPE

Affected male Xd Y
Unaffected male XDY
Affected female Xd Xd
Unaffected female carrier (heterozygous) XDXd
Unaffected female (homozygous) XDXD
Key: Parent cross = XD Y × XDXd

Alleles XD Y
Xd = muscular dystrophy allele
XD XDXD XDY
XD = normal allele
Genotype ratios: 1 XD XD : 1 XDXd : 1 XDY : 1 Xd Y Xd XDXd Xd Y
Phenotype ratios: 1 unaffected female : 1 unaffected female carrier : 1 unaffected male : 1 affected
male
There is a 50% chance of having a son. The probability of a son having the condition is 50%, so
the probability of having a son with the condition is 50% × 50% = 25%.
Diseases caused by mutated genes located on the X chromosome can be inherited in either a
dominant or recessive manner.
X-linked recessive patterns

The allele locus for an X-linked recessive condition is on the X chromosome. When a recessive
phenotype under investigation is determined by an allele on the X chromosome, it is said to be an
X-linked recessive phenotype. Males who have the recessive allele on their X chromosome will always
express the phenotype, because they only have one X chromosome. Females will only express the
phenotype when both X chromosomes have the affected allele. For a female child to be affected, the
father must be affected and the mother must be either affected or a carrier. A heterozygous female
will be a carrier.
Consequently, males show X-linked recessive phenotypes much more often than females do.
However, this trend is not enough to confirm the mode of inheritance. Red–green colour blindness
and haemophilia are two recessive conditions in humans that are transmitted to offspring through
X-linked inheritance.
In this type of inheritance, a male with the phenotype cannot pass on the trait to his sons,
because they inherit his Y chromosome only. His daughters will get the affected X chromosome, but
they will only show the phenotype if they inherit another affected X chromosome from their mother.
As with an autosomal recessive phenotype, some generations may not have any members showing
the phenotype.
9780170452922
Analyse the pedigree in Figure 5.41 to help you further understand X-linked inheritance patterns.
Because her
father is affected,
the daughter will receive
his X chromosome
with the X-linked recessive
trait and be a carrier.
noitareneG sciteneG :ecruoS
Because the mother is a carrier for the trait,

there is a 50% chance each son will receive
and express the X-linked trait.
FIGURE 5.41 A pedigree demonstrating an X-linked recessive inheritance pattern
Golden retriever muscular dystrophy is also

caused by an X-linked recessive allele. Dogs who
,”seigetarts cituepareht ni esu rieht dna yhportsyD ralucsuM

enehcuD fo sledom eninaC“ .la te .N .J ,yagenroK :ecruoS
suffer from this condition experience progressive
degeneration of skeletal and cardiac muscles.
Symptoms such as difficulty swallowing and muscle
weakness (where standing is difficult) appear at
.aideM ssenisuB & ecneicS regnirpS

around 6–8 weeks of age and worsen until the
disease becomes fatal by around 6 months.
X-linked dominant patterns

The allele locus for an X-linked dominant condition
is on the X chromosome. This type of inheritance
FIGURE 5.42 Golden retriever with muscular
is similar to X-linked recessive inheritance, except
dystrophy
that heterozygous females will always show the
phenotype, and any individuals with the phenotype
must have a parent with the phenotype. Males showing the phenotype will not pass the affected
allele on to their sons (because sons must inherit their father’s Y chromosome), but they will pass it
on to all their daughters, who will also show the phenotype. This is because daughters always inherit
their father’s X chromosome. A heterozygous female is expected to pass on the allele to 50% of her
offspring, regardless of their sex. The condition should appear in every generation. An affected male
receives the dominant allele from an affected mother.
Y-linked patterns
If a trait is carried on the Y chromosome, it is said to be Y-linked. Only males are affected. Y-linked
traits are rare because the Y chromosome is short and has a limited number of genes, most of which
code for male sexual development. ‘Maleness’ in humans is determined to a large extent by the SRY
gene carried on the Y chromosome. Other Y-linked genes are relevant to testis development and
sperm production. By definition, inheritance of genes that appear on the Y chromosome is along the
male line, from father to son.
Key concept
The inheritance of genes that are found on the X chromosome can be X-linked recessive or
X-linked dominant, and show different patterns for males and females. X-linked recessive
phenotypes are more common in males because they only have one X chromosome and will be
affected regardless of whether the allele is dominant or recessive. Y-linked phenotypes are only
seen in males because they are the only sex to carry a Y chromosome.
9780170452922
AUTOSOMAL DOMINANT AUTOSOMAL RECESSIVE
The allele cannot be recessive as two affected The allele cannot be dominant as two unaffected
parents could not have an unaffected offspring. parents could not have an affected offspring.
The parents MUST be heterozygous. The parents MUST be heterozygous.
X-LINKED DOMINANT X-LINKED RECESSIVE
Sex linkage cannot be confirmed. Sex linkage cannot be confirmed.

100% incidence of affected daughters from an 100% incidence of affected sons from an
affected father suggests X-linked dominance. affected mother suggests X-linked recessive.
FIGURE 5.43 Not all modes of inheritance can be determined from a pedigree.
Affected individuals have an affected parent?

(All generations affected?)
Yes No
Dominant Recessive
Male–male All (or almost all)

transmission? affected are males?
Yes No Yes No
Autosomal May be X-linked X-linked Autosomal

dominant dominant recessive recessive
No
Are all daughters of an
affected male affected?
Yes
X-dominant
FIGURE 5.44 Using a dichotomous key to determine likely mode of inheritance from a pedigree
9780170452922
Remember: when you answer mode of inheritance questions, you may not always be able
to confirm the mode of inheritance. You can make predictions based on the evidence and using
visual representations such as Punnett squares and pedigrees; however, you cannot confirm these
predictions without conducting genetic tests (e.g. using biotechnology, see Chapter 6).
Question set 5.8

REMEMBERING
1 Define:
a autosomal
b sex-linked inheritance
c X-linked inheritance
d Y-linked inheritance
2 Define carrier.
UNDERSTANDING
3 Describe and explain the occurrence of phenotypes that are:
a X-linked recessive
b X-linked dominant
c Y-linked.
APPLYING
4 Ichthyosis is an inherited condition characterised by scaly skin. One form of the condition
affects around 1 in 6000 males, but female cases are almost unknown.
a What might account for the differences in occurrence of this type of ichthyosis
between males and females?
b From which parent would an affected male have inherited the condition?
c What is the probability the affected male would pass the responsible gene on to his
sons? Explain your reasoning.
5 The novel Xg blood group is an X-linked phenotype that is observed in approximately equal
proportions in males and females.
a Explain how an X-linked phenotype could be observed in equal proportions in both sexes.
b What is the probability that Xg sons are born to a heterozygous mother with Xg and
a father without Xg? What is the probability that daughters of this mother and father
show the Xg trait?
c What is the probability that Xg sons are born to a mother without Xg and a father with
Xg? What is the probability that these parents have Xg daughters?
ANALYSING
6 After studying the pedigree in Figure 5.45, use a method like the dichotomous key or
elimination method to determine the pattern of inheritance of the particular characteristic.
FIGURE 5.45 Pedigree for an inherited characteristic
9780170452922
7 The pedigree below shows the inheritance of freckles in a family. The allele for freckles (F)
is dominant to the allele for no freckles (f). What is the genotype of individuals I2 and II4?
I
1 2
II
1 2 3 4 5 6
III
1 2 3 4 5 6
FIGURE 5.46 Pedigree demonstrating the inheritance of freckles
9780170452922
CHAPTER 5 ACTIVITY AND INVESTIGATION

Continuous variation: student height 5.1
Aim
YTIVITCA
To be able to distinguish continuous data from discontinuous data
You will need
Metre ruler or tape measure
What you will do
Record the heights of all students in your class or cohort, either in one communal table on the white
board or in a table projected onto a screen. A minimum sample size should be around 20 students.
Studying your results
Group the data in a frequency table.
HEIGHT (CM) FREQUENCY
150–<155
155–<160
160–<165
165–<170
170–<175
175–<180
180–<185
185–<190
Analysis of results
1 Draw a histogram of the results or use Word or Excel to create a chart.
2 Evaluate the reliability of your data in relation to how repeatable the results are and how
representative your data are for the human population.
3 Your chart (graph) should look like a bell curve. Explain why that would be.
4 Calculate the mean and median.
5 Differentiate between a bar graph and a histogram.
6 You may like to collect a discontinuous data set by surveying whether the students in your class
have attached or detached earlobes.
7 Tabulate the discontinuous data then construct a bar graph.
8 Explain how the results indicate that human height is caused by polygenes and not just multiple
alleles of one gene.
9780170452922
5.1 Patterns of inheritance in heterozygous barley seeds

Background
NOITAGITSEVNI
Barley (Hordeum vulgare L.) was one of the first cultivated grains. A member of the grass family, barley is
now grown in over 100 countries. Barley has 14 chromosomes and self-pollinates asexually to reproduce.
A single gene with two alternative alleles controls pigmentation in barley. The dominant allele results
in a phenotype with green pigmentation. The other allele produces no pigmentation, and when
homozygous, it results in a white (or albino) recessive phenotype. In the heterozygote, the dominant
expression of green pigment masks any expression of the allele coding for no pigment (albino).
Aim
To perform a monohybrid cross and predict phenotypic ratios
Time requirement
20 minutes
Materials
• 25 seeds of genetically selected barley
• Filter paper
• Disposable plastic Petri dish
• Plastic pipette
• Forceps
• Scissors
• PPE: lab coats, safety glasses, gloves
Risks
Some people may be allergic to particular seeds. Do not eat seeds. Be aware of any known allergies.
Procedure
1 Place a piece of filter paper into the bottom half of a Petri dish. Trim the paper as necessary so it
lies flat.
2 Soak the filter paper with tap water using a pipette. Remove or drain any excess water that is not
absorbed by the paper.
3 Sprinkle the seeds evenly over the moistened paper in the Petri dish. Using your forceps, ensure
the seeds are evenly spread out (approximately 1 cm apart).
4 Place the Petri dish with seeds on a bench with sufficient access to sunlight, keeping them at
room temperature.
5 Rehydrate the seeds twice a day using a pipette to prevent them from drying out. This process of
twice daily rehydration should continue until the barley seedlings reach 2 cm in height, which will
take approximately 1 week.
6 Propose a hypothesis about the phenotypic ratio you would expect to see using a Punnett square
(monohybrid cross), where ‘ A’ represents pigment produced (green, dominant) and ‘ a’ represents
no pigment produced (white, recessive albino).
A a
9780170452922
7 Observe the seedlings at the end

of 1 week. Some seedlings will
be pale (albino) with little or no
green pigment. Other seedlings Barley
shoots
will have green areas forming.
When nearly all the seedlings
have germinated, count the Petri
dish
Cotton
wool
number of green seedlings and
the number of albino seedlings.
Record your results and then
contribute your individual data FIGURE 5.47 Set-up to test for patterns of inheritance in
to the class data. heterozygous barley seeds
Results
1 Record your individual and class data in the table below:
TOTAL NUMBER OF NUMBER OF SEEDLINGS OF EACH COLOUR
SEEDLINGS GREEN ALBINO
Individual data
Class data
2 Calculate the ratio of green seedlings to albino seedlings for:

a your individual data
b the class data.
3 How do your individual data compare with the ratio for the class data?
Discussion
1 What is one limitation of this procedure?
2 How could you improve the reliability and validity of the data produced in this investigation?
3 Was your predicted ratio (based on your Punnett square) correct?
4 Were there any inconsistencies in the results? If so, explain why they may have occurred.
5 Based on the class data, what would you assume is the mode of inheritance for green pigmentation
in barley? Would your answer be the same if it was based only on your individual data?
6 Homozygous green barley plants are indistinguishable visually from heterozygotes. To identify
the genotype of an individual plant showing the dominant characteristic, a geneticist undertakes
a test cross. Describe a test cross.
7 If presented with 120 seedlings, approximately how many would you expect to be green? Show
your working out.
Conclusion
Summarise your findings in this investigation, commenting on your hypothesis about the mode of
inheritance for pigmentation in barley.
Taking it further
1 In this investigation, you have conducted a monohybrid cross. What type of investigations could
you conduct to demonstrate
a a dihybrid cross
b a sex-linked cross?
2 Calculate the chi-square value for this experiment. Do your observed frequencies deviate
significantly from the expected frequencies for this cross?
9780170452922
WS
CHAPTER 5 SUMMARY
Chapter 5 • The genotype of an organism is the resulting genotypes and phenotypes and
Activity sheet
combination of alleles it has for a particular their proportions.
gene or multiple genes. • Observed phenotypic ratios for any cross
• For any gene, an individual may have two may vary from those predicted by a Punnett
alleles that are identical (homozygous) or square. This is due to:
different (heterozygous). • random assortment of alleles on
• For single-gene inheritance, the presence chromosomes during meiosis
or absence of certain alleles determines • the fertilisation of random gametes.
an organism’s phenotype. Phenotypes • A test cross can be used to determine the
may be described as dominant, recessive, genotype of an individual displaying the
codominant or incomplete. dominant phenotype. It involves crossing
• In a monohybrid cross between two pure- the individual with a homozygous recessive
breeding (homozygous) parents: mate and analysing the offspring.
• the F1 offspring are all heterozygous and • Discontinuous variation is displayed by
show the dominant phenotype phenotypes that are governed by a single
• in a subsequent cross between gene. Continuous variation is shown for
F1 individuals, the F2 offspring are phenotypes that are governed by polygenic
predicted to show dominant and inheritance.
recessive phenotypes in the ratio of 3:1. • Sex-linked inheritance is suggested when
• In a dihybrid cross between two parents there is an unequal phenotypic ratio between
pure-breeding for two independently males and females, although this does not
assorting characteristics: confirm it.
• the F1 offspring are heterozygous for • X-linked recessive phenotypes are more
both traits and show both dominant common in males than in females. An
phenotypes affected daughter must have an affected
• in a subsequent cross between father.
F1 individuals, the F2 offspring are • X-linked dominant phenotypes are observed
predicted to show four combinations in all affected females and males.
of phenotypes, dominant–dominant : • A pedigree is a helpful representation of
dominant–recessive : recessive– inheritance; however, it cannot confirm the
dominant : recessive–recessive in the mode of inheritance.
ratio of 9:3:3:1. • Y-linked phenotypes are exclusively male
• Punnett squares are a convenient way because the allele is only present on a Y
to represent crosses, and to predict the chromosome.
CHAPTER 5 GLOSSARY
Allele One of various versions of the same Autosomal trait A trait coded for by a gene
gene (at the same locus) distinguished by small on an autosome, a chromosome that is not a
differences in its DNA sequence sex chromosome; a gene of this kind is called
Artificial selection The breeding of plants autosomal
and animals to produce desirable traits in Carrier In reference to a genetic disease, a
successive generations; also known as selective carrier is a healthy, heterozygous organism
breeding carrying an allele for a recessive phenotype;
Autosomal inheritance The passing on of a the organism may transmit the recessive
trait through a gene located on an autosome, a allele and its associated phenotype to its
chromosome that is not a sex chromosome offspring
9780170452922
Codominance A state in which both alleles of Inheritance The genetic acquisition of

a heterozygous individual are fully expressed in characteristics by offspring from their parents
the phenotype Linked genes Genes or alleles that are
Continuous variation Variation in a phenotype inherited together more frequently because
characteristic that shows a smooth range; this they are located near one another on the same
occurs when a trait is controlled by many genes; chromosome
when graphed, such variation forms a bell- Monohybrid An organism that is heterozygous
shaped (normal) curve with respect to a single gene
Critical thinking The analysis and evaluation Monohybrid cross A cross between two
of a concept using logic and connection between monohybrids (see monohybrid); only one gene
ideas is involved, and the cross is between two
Dihybrid cross A cross between two organisms organisms that are heterozygous at one gene
that are heterozygous at two gene loci locus for a dominant and a recessive allele
Discontinuous variation Variation in a Multiple alleles The term given when three or
characteristic that shows two or just a few more alleles of a gene exist among members of a
clearly distinct phenotypes population
Dominant A phenotype that requires only one Non-homologous chromosomes Chromosomes

copy of its allele for it to be expressed in an that do not belong to the same pair; they contain
individual different sets of genes
First filial generation (F1) The first generation of Parental generation (P) Two individuals or
offspring produced from a cross between two lines that represent the start of a breeding
parents (P) experiment; their offspring are the F1 generation
Gene A set of instructions that specifies the Partial dominance See incomplete dominance
structure of a protein Phenotype The actual form taken by a specific
feature in a particular individual, based on their
Genetics The study of the mechanisms and
patterns of inheritance associated with the genotype and influenced by the environment;
transmission of coded chemical instructions it can be used in reference to particular traits
from one generation to the next or characteristics, or to the overall form of an
individual
Genotype The specific combination of alleles
for a particular gene locus belonging to an Polygene A gene whose alleles have a small,
individual or cell additive effect on a phenotype; many polygenes
together contribute to continuous variation in a
Heredity The study of inheritance; the genetic phenotype
transmission of characteristics from one
generation to the next Polygenic inheritance Transmission between
generations of characteristics that are controlled
Heterozygous A genotype with two different by polygenes (see polygenes)
alleles for a single gene locus
Punnett square A Punnett square is a table that
Homozygous A genotype with two identical displays all the possible offspring genotypes
alleles for a single gene locus given the parent alleles that can pair up at
Incomplete dominance The state in fertilisation; it can be used to determine
which a heterozygous individual has a the likelihood of producing offspring with
phenotype that is intermediate between those of particular genotypes and phenotypes from
the corresponding homozygous individuals known parental genotypes, and sometimes
to deduce parental genotypes given offspring
Independent assortment Random orientation
of maternal and paternal homologous genotype and phenotype percentages
chromosomes at the equator during metaphase Pure-breeding A line of organisms that always
I, resulting in random combinations of alleles in produce offspring with the same phenotype
the gametes at the conclusion of meiosis when crossed with one another
9780170452922
Recessive A phenotype that requires two interest on a sex chromosome is described as

copies of its allele in an individual in order to sex-linked
be expressed Test cross A technique used by geneticists
Second filial generation (F2) Offspring of in which an individual whose genotype is
the F1 generation; the second generation unknown for a dominant phenotype (it could
produced from a cross between two be homozygous dominant or heterozygous
homozygous parents (P) dominant) is crossed with an individual that is
homozygous recessive at the locus in question
Selective breeding A process by which humans
domesticate animals or plants by purposely Trait An inheritable characteristic; phenotype
choosing individuals with the most desirable X-linked Related to a gene located on the
characteristics as parents for each successive X chromosome
generation of breeding
X-linked recessive When a phenotype is
Sex-linked Describes a gene located on a sex determined by a recessive allele on the
chromosome X chromosome
Sex-linked trait A trait inherited on a sex Y-linked Related to a gene located on the
chromosome (X or Y chromosome); the gene of Y chromosome

Remembering
1 Describe the relationship between the following terms:
a gene and allele
b genotype and allele
c genotype and phenotype.
2 Match each item in the first column with a description in the second column. Each item can
only be used once.
Heterozygous Only one copy of the allele is required for the phenotype to be observed.
Homozygous Two different alleles are both fully expressed in the phenotype.
Recessive The phenotype is intermediate between each of those determined by two different
alleles.
Dominant Two copies of the same allele are present for a particular gene locus.
Codominant Two different alleles are present for a particular gene locus.
Partially dominant Two copies of the allele are required for the phenotype to be observed.
Understanding
3 Explain what ‘pure-breeding’ means. Why was it important for Mendel to use pure-breeding
plants in his experiments?
4 Explain why siblings are not identical, even though they inherit their chromosomes from the
same parents.
5 Explain why none of the offspring of a tall pea plant and a short pea plant are of intermediate
height.
6 Distinguish between the effects of random assortment of alleles and linked alleles on
phenotype, and explain what accounts for these differences.
9780170452922
Applying
7 Two grey rats are mated. Half the offspring are grey, one-quarter are white and one-quarter are
black.
a Assign the alleles for coat colour.
b Describe the genotypes of the parents and the offspring.
c What kind of dominance is this?
8 There are four possible phenotypes for ABO blood groups in humans: A, B, AB and O. The
most common of these, O, is the recessive phenotype. The phenotypes are determined by three
alleles, of which IA and IB are codominant and i is recessive to both.
a Write each possible genotype and the corresponding phenotype.
b If a woman is heterozygous with blood type A and a man is heterozygous with blood type
B, predict their children’s possible blood type(s) and the probability of each. Support your
conclusions with a Punnett square.
9 Some fruit flies carry an X-linked recessive gene for white eye colour, over which the red-eyed
phenotype is dominant. Predict the proportion of red-eyed and white-eyed offspring and their
gender resulting from a cross between an F1 female and an F1 male. Use a Punnett square to
support your prediction.
10 In mice, coat colour is determined by an autosomal gene, and pink coat colour is dominant
to brown. Dwarfism is caused by an X-linked recessive allele. If a brown female dwarf mouse
mates with a pure-breeding pink male of normal size, what will the phenotypic ratios in each
gender be in the F1 and F2 generations?
11 In cherry tomatoes, a tall vine is dominant to a dwarf vine, round fruit is dominant to pear-
shaped fruit, and red fruit is dominant to yellow fruit. If you crossed a pure-breeding tall,
round-fruited, red-fruited plant with a short, pear-shaped-fruited, yellow-fruited plant,
what would you expect to be the appearance of the F1 generation? Assuming that the genes
controlling these three characteristics are inherited independently, what are the possible
combinations of genes in the gametes of the F1 generation?
Analysing
12 The snapdragon (Antirrhinummajus) can show a condition called ‘aurea’, in which the leaves
appear a golden colour instead of green. A pair of aurea snapdragons with golden leaves was
crossed and they produced 101 offspring: 67 with golden leaves and 34 with green leaves. Draw
a Punnett square for the cross and use the data to explain how the ratio seen in the F2 offspring
could have arisen.
13 A test cross of fruit flies with curly wings and red eyes produces offspring with red eyes, half of
which have curly wings, and half, straight wings. Identify the genotype of the original red-eyed
fruit fly with curly wings and provide evidence to support your conclusion.
14 A male pure-breeding fruit fly with a standard brown body is crossed with a female pure-
breeding fruit fly with a yellow body. All of the male offspring have yellow bodies, whereas all
of the female offspring have brown bodies.
a Explain where the gene is located.
b Predict the proportions of the phenotypes in the offspring produced by crossing the F1 fruit
flies.
Evaluating
15 Discuss the benefits and limitations of studying Mendelian inheritance patterns in humans.
9780170452922
Creating
16 Would you consider most phenotypes to be caused by a single gene or polygenic? Discuss the
observations you would cite in support of your point of view.

1 Like mammals, the fruit fly Drosophila fruit phenotypes in the progeny of these
has an XY system of sex determination. plants is:
Drosophila usually have large, round eyes, A all bitter fruit
but a dominant allele at the Bar gene on the B all sweet fruit
X chromosome causes small, narrow eyes, C 50% bitter fruit and 50% sweet fruit
called ‘Bar eyes’. If a male with Bar eyes D 75% bitter fruit and 25% sweet fruit.
is crossed with a female with normal eyes, [Q11 2017 SCSA]
then:
4 Like humans, cattle have an XY system of
A half of the female offspring will have
sex determination. In cattle, a disease called
Bar eyes but none of the males
AED is caused by a recessive allele at a gene
B half of the male offspring will have Bar
on the X chromosome. Two cattle that do not
eyes but none of the females
have AED disease produce a male offspring
C all of the male and female offspring will
with AED disease and a female without AED
have Bar eyes
disease. What is the probability that the
D all of the female offspring will have Bar
female offspring is a carrier of AED, i.e. has
eyes but none of the males.
one copy of the AED allele?
[Q10 2019 SCSCA]
A 100%
2 Tail length in mice is a polygenic trait. B 50%
This means that variation in tail length in a C 25%
population of mice will be: D 0%
A discontinuously distributed and [Q28 2017 SCSA]
controlled by the alleles at multiple
5 In domestic cats, a dominant allele at an
genes
autosomal gene results in extra toes, while a
B discontinuously distributed and
recessive allele results in a normal number
controlled by the alleles at a single gene
of toes. Two cats with extra toes, both
C continuously distributed and controlled
heterozygous for the allele that results in
by the alleles at multiple genes
extra toes, are crossed and produce a litter
D continuously distributed and controlled
of kittens. Cats have an XY system of sex
by the alleles at a single gene.
determination like humans. What is the
[Q17 2018 SCSA] probability that the first-born kitten will be
3 In watermelons, fruit bitterness is a male with a normal number of toes?
determined by two alleles at a gene, and A 0.750
the allele for bitter fruit is dominant over B 0.375
the allele for sweet fruit. A plant that is C 0.250
heterozygous for these two alleles is crossed D 0.125
with a plant with sweet fruit. The expected [Q30 2016 SCSA]
9780170452922
6 Albinism is an inherited trait that results generation were crossed with one another to
in a lack of colour in the eyes and fur of produce a second generation (the F2 generation).
mammals, including guinea pigs. Non-
7 On the basis of the above information, what
albino guinea pigs have coloured fur.
seed phenotypes would be present in the
a A non-albino male and a non-albino
F2 generation and in what proportions
female guinea pig were crossed and
would they occur? Show your workings.
produced a litter containing some albino
Use S1 to indicate the allele that produces
and some non-albino offspring.
smooth seed and S2 to indicate the allele
b Both male and female albino offspring
that produces wrinkled seed. (5 marks)
were produced in the cross described in
[Q31c 2016 SCSA]
part a. On this basis, explain in words
why albinism cannot be a sex-linked 8 The vinegar fly, Drosophila melanogaster,
trait in guinea pigs. (4 marks) has an XY system of sex determination like
c i What is the probability of obtaining humans. White eyes, due to the eyes lacking
an albino offspring from the cross pigment, is determined by a gene on the
described in part a? (1 mark) X chromosome. The allele that causes
ii Draw a Punnett square to show white eyes is recessive to the allele for
how you obtained your answer normal (pigmented) eyes. List all possible
in part c i. Indicate clearly the genotypes for the white eyes gene for the
genotypes and phenotypes of the following flies. Use ‘ w’ to designate the
offspring. (4 marks) white eyes allele and ‘+’ to indicate the
[Q33a,b 2018 SCSA] allele that produces normal eyes. (4 marks)
1 a male with white eyes
Use the following information to answer
2 a male with normal eyes
questions 7–9.
3 a female with white eyes
In the maize plant, the texture of the seed is 4 a female with normal eyes
either smooth or wrinkled. Seed texture is [Q31d 2016 SCSA]
determined by the alleles at a single gene.
9 Explain what a polygenic trait is. Give a
A plant with wrinkled seeds was crossed
specific example. (3 marks)
with a plant with smooth seeds (the Parental
[Q31e 2016 SCSA]
generation). The parent plant with smooth seeds
was a homozygote for the seed texture gene. 10 Distinguish between a dominant allele and a
All of the offspring of the cross had smooth recessive allele (2 marks)
seeds (the F1 generation). Individuals in the F1 [Q34c(ii) 2015 SCSA]
9780170452922
168
6
BIOTECHNOLOGY – CHAPTER 6 CONTENT
ITS TOOLS AND following material.
TECHNIQUES STARTER QUESTIONS

1 Do you know what a genome map is and how it can be used
in animal and plant conservation?
2 Can you describe some of the biotechnology tools used to
construct a personalised DNA profile?
3 Are our agricultural biotechnology techniques effective
enough to feed our world’s population? How can they be
improved?
» DNA sequencing enables mapping of species genomes; DNA
profiling identifies the unique genetic makeup of individuals
SCIENCE AS A HUMAN ENDEAVOUR

» Transgenic organisms have been engineered for desirable
traits, including resistance, faster growth rate, greater
product quality and yield, and tolerance to adverse
environmental conditions

» Conduct investigations, including the use of probabilities
9780170452922
CHAPTER 6 | Biotechnology – its tools and techniques 169
6.1 INTRODUCTION TO BIOTECHNOLOGY

The term biotechnology refers to the tools and techniques used on organisms or the products
of organisms to make a product or solve a problem for human benefit. Biotechnology combines
knowledge of biology and technology and can be used to improve our lives and the health of our
planet. For over 10 000 years, humans have used traditional forms of biotechnology to selectively
breed plants and animals.
More recent advancements in biotechnology have enabled scientists to change the genetic sequence
in living things, enabling them to create new plants and domestic animals with enhanced phenotypes.
Modern DNA biotechnology uses tools (e.g. restriction enzymes, plasmids, vectors and microarrays)
and techniques (e.g. DNA sequencing, polymerase chain reaction (PCR), gel electrophoresis and
recombinant DNA technology) to extract, analyse and manipulate DNA to make useful products.
Biotechnology is used in many industries, such as environmental conservation, the agriculture sector, food
technology, forensics, and medical devices and diagnostics. It also plays an important role in producing
clean technologies, including recycling and renewable energy. Along with technological developments
comes the added responsibility to consider economic, social and ethical issues.
Traditional biotechnology
Traditional biotechnology involves purposefully selecting organisms with desirable and useful traits
for breeding and cultivation. The domesticated dairy cows you see in farmers’ fields today bear
little resemblance to the ancient aurochs from which they are descended. And the large, yellow
corn you eat is the domesticated version of a small wild grass called teosinte. In both cases, the
organisms identified as having more desirable phenotypes were selected for producing offspring with
those favourable phenotypes. Modern biotechnology methods also involve purposefully selecting
organisms with desirable and useful traits, but results can sometimes be achieved very quickly.
Selective breeding makes very small changes to phenotypes over many years. The differences we see
in the cows and corn of today have taken thousands of years to produce.
zuhtreN/moc.kcotSi
Auroch (wild cow: ancestor Domesticated dairy cow

of all domesticated cattle)
FIGURE 6.1 The selectively bred domestic dairy cow had a wild ancestor.
/RELLUF REGAR ELLOCIN/yrarbiL otohP ecneicS
NOITADNUOF ECNEICS LANOITAN
FIGURE 6.2 Selectively bred corn: ancient teosinte and modern corn
9780170452922
Key concept
Both traditional and modern biotechnology methods can be used to improve our lives. Modern
biotechnology builds upon our accumulated knowledge of the structure and functioning of
DNA to develop new varieties of organisms much more quickly than traditional methods.
6.2 DNA TOOLS USED IN BIOTECHNOLOGY

Modern biotechnology involves processing and manipulating DNA. Just as in the construction of
buildings, tools and techniques are used for specific purposes. Biotechnology has its own set of
specialised tools and techniques, which are mostly derived from organisms. These include tools for
synthesising, cutting and pasting DNA, along with tools and techniques for viewing and analysing
DNA. Many of these tools are enzymes.
TABLE 6.1 DNA tools
Restriction Enzymes that cut DNA molecules at recognition

enzymes sites (specific nucleotide sequences), usually
4–8 bases long. Naturally occurring restriction
enzymes protect bacteria by cutting foreign DNA A
TC
GAATA T
and then removing invading organisms. C G
A T
C
G
There are two types of cuts: T AG G C
GC
CT
1 sticky ends (one strand has overhanging
complementary bases, specific)
2 blunt ends (no overhang, non-specific).
FIGURE 6.3 Restriction enzymes act like scissors.

DNA ligase An enzyme that uses complementary base pairing Sticky end Plasmid DNA
to seal and reassemble DNA strands in the process
of ligation. DNA ligase catalyses a strong covalent G A T CC C T A
bond, closing up the sugar–phosphate backbone
GA G G GAT
to hold the two strands of DNA together. Useful
for recombinant DNA technology. C T C CTAG
DNA Ligase
fragment
FIGURE 6.4 DNA ligase acts like glue.

DNA A class of enzymes that synthesises new strands of
dNTPs
polymerase DNA based on a template strand and according to
complementary base-pair rules. DNA polymerase
adds free nucleotides one at a time. As it 5'
moves along a template strand, it attaches the 5'

3'
complementary nucleotide to make a new strand.
Template New DNA DNA
This is used in amplifying DNA during PCR.
DNA strand polymerase
FIGURE 6.5 Polymerase enzymes can attach new nucleotides.

Primers Short fragments of single-stranded DNA or RNA. DNA template
5' 3'
Primers assist in the synthesis of new strands of
5'
DNA by acting as a signal for the polymerase to Primer
begin synthesis.
Primer
5' DNA template
3' 5'
FIGURE 6.6 Primers are short fragments made of nucleotides.
9780170452922
Restriction enzymes: cutting DNA

One of the essential requirements in genetic engineering is the ability to cut segments of DNA
at known sequences. The cutting tools used are enzymes known as restriction endonucleases
(‘endo’ = within, ‘nuclease’ = an enzyme that cleaves nucleic acids), or restriction enzymes. These
are like molecular scissors, cutting DNA molecules into smaller pieces, called restriction fragments,
in a controlled way. DNA cut with restriction enzymes is often said to be ‘digested’ by the enzymes.
Restriction enzymes only cut specific sequences of DNA, known as restriction sites. Different
restriction enzymes have different restriction sites, though some restriction enzymes do share
restriction sites with other restriction enzymes. Restriction enzymes are not specific to a species, but
to a specific sequence of bases.
Restriction enzymes occur naturally in bacteria, where they cleave (cut) foreign DNA from
invading viruses, thus destroying any potential threat. Restriction enzymes are named according to the
bacterial strain from which they are derived. The first restriction enzyme was isolated from Escherichia
coli RY13 strain and was thus named EcoRI. Table 6.2 lists a number of common restriction enzymes
and their sources, but there is no need to memorise the table’s contents.
TABLE 6.2 Common restriction enzymes and their restriction sites
ENZYME BACTERIAL SOURCE RESTRICTION SITE AFTER CUTTING

EcoRI Escherichia coli ↓
5' GAATTC3' 5'G AATTC3'
3' CTTAAG5' 3'CTTAA G5'
↑
HindIII Haemophilus parainfluenzae ↓
5' AAGCTT3' 5'A AGCTT3'
3' TTCGAA5' 3'TTCGA A5'
↑
AluI Arthrobacter luteus ↓
5' AGCT3' 5'AG CT3'
3' TCGA5' 3'TC GA5'
↑
BamHI Bacillus amyloliquefaciens H ↓
5' GGATCC3' 5'G GATCC3'
3' CCTAGG5' 3'CCTAG G5'
↑
To date, almost 4000 different restriction enzymes have been identified. Although each enzyme
recognises a specific sequence of between four and eight nucleotide base pairs (bp) of double-
stranded DNA, multiple enzymes isolated from different organisms can recognise the same sequence.
Restriction enzymes bind to their restriction site and cut the double-stranded DNA at that point. The
cuts may form either overhanging steps, called sticky ends, which leave some nucleotides exposed
(Figure 6.7), or blunt ends (Figure 6.8), in which the cut has occurred at the same position in each
strand of the DNA and there are no overhanging strands.
9780170452922
FIGURE 6.7 Sticky ends produced by cutting DNA with the restriction enzyme EcoRI
FIGURE 6.8 Blunt ends produced by cutting DNA with the restriction enzyme AluI
TABLE 6.3 Differences between sticky end restriction enzymes and blunt end restriction enzymes
FEATURE RESTRICTION ENZYMES THAT RESTRICTION ENZYMES THAT

PRODUCE BLUNT ENDS PRODUCE STICKY ENDS
Exposed nucleotides Blunt ends do not have exposed Sticky ends contain an overhanging,
nucleotide bases at each end. The single-stranded sequence of exposed
ends of the remaining DNA and of the nucleotides (known as a recognition site)
removed fragment are blunt. that is ready for complementary base
pairing.
Specificity Non-specific Specific
Advantage Fragments can join with any other blunt Fragments can join efficiently with a
end fragment. desired fragment that is cut with the
same restriction enzyme. They can
produce specific products at a faster rate.
DNA ligase: recombining DNA

At times, molecular biologists may want to combine two fragments of DNA. DNA ligase is an enzyme
that is used to join pieces of DNA together. DNA ligase acts by forming a phosphodiester bond
between two fragments of DNA. It joins the 3' hydroxyl end of one nucleotide to the 5' phosphate
end of another nucleotide.
Two DNA fragments that have been cut with the same enzyme will have identical sticky ends,
and thus complementary bases will be exposed. DNA ligase can then be used to recombine these
two fragments, even if they are from two unrelated organisms. For example, EcoRI can be used to
cut both human DNA and bacterial plasmid DNA, leaving sticky ends that are complementary, and
increasing the chance of two complementary ends coming together (Figure 6.9). Fragments with
blunt ends can also be joined by DNA ligase, but without the complementary overhangs there is
no formation of hydrogen bonds to stabilise the structure, and the process is much less efficient.
The technology that recombines DNA from different sources to modify the DNA sequence is called
recombinant DNA technology.
9780170452922
Foreign DNA
A T
(e.g. human) T A A
T A Cut Sticky A
C G end G
Cut G C C
A T
A T DNA
T A T
segment
T A Cut T Sticky A
cut by C end T A
C G
G C restriction G T G
Cut C
A T enzyme C
G
DNA segment
T inserted into T
T A
A T plasmid and C A
A Cut
A A joined by G G
T Plasmid cut T
T DNA ligase C
G by restriction T
C C
G C enzyme G
Cut A
T T
C A A
G
G A
C G Foreign DNA is joined with bacterial DNA
A C
T
Bacterial plasmid
FIGURE 6.9 DNA ligases are used to join two pieces of DNA (one from a foreign source). Joining works most
effectively when the two pieces of DNA have complementary sticky ends.
Primers: marking DNA

Primers are short, single-stranded (chemically synthesised) DNA molecules used in the DNA
technique called PCR. During this process, DNA is synthesised using special DNA polymerase
enzymes in a step called extension. The polymerase enzymes do not know where to start
extending by themselves. Therefore, primers are used to mark the two ends of a target sequence
of DNA that the experimenter wishes to amplify (make multiple copies of) in a test tube. The
primer’s sequence of nucleotides is complementary to specific sequences of DNA at either end
of the target sequence. Primers join at the 3' end of the template strand, enabling extension/
synthesis to be in a 5' to 3' direction. Note that the primer for initiating synthesis in DNA
replication is made out of RNA.
A primer is synthesised by an enzyme called primase. This can be done in a laboratory, and
scientists can manufacture primers that best suit their needs. The synthesis of a primer is necessary
because the enzymes that synthesise DNA, which are called DNA polymerases, can only attach new
DNA nucleotides to an existing strand of nucleotides. The primer therefore serves to prime and lay a
foundation for DNA synthesis.
Key concept
Biotechnology tools include the use of restriction enzymes (often from bacteria) to cut DNA,
ligases to recombine DNA (using base-pairing rules), and primers to mark the strand of target
DNA that is needed.
9780170452922
FIGURE 6.10 Primers anneal (attach by base pairing) to the beginning of a target gene.
Question set 6.2

REMEMBERING 5 Explain why primers are needed when
1 1 Recall the purpose of the following tools: DNA is being synthesised.
a restriction enzymes ANALYSING
b DNA ligase 6 If a restriction enzyme made one cut
c primers. in a plasmid and one cut in a piece of
2 Define recognition site. linear DNA, explain why the number of
3 Recall the bond that forms when DNA fragments that result differs.
ligase joins two fragments of DNA.
UNDERSTANDING
4 Contrast sticky-end and blunt-end cuts
made by restriction enzymes.
6.3 DNA TECHNIQUES AND VOCABULARY

DNA tools are used in conjunction with DNA techniques to help make products or solve biological
problems. Techniques such as PCR and gel electrophoresis are used in multiple biotechnological
processes, such as DNA sequencing, mapping, profiling and recombinant DNA methods. Microarrays
will be discussed in addition to the main two techniques. Firstly, the language of biotechnology
is needed to enable you to better understand the processes. The main terms are summarised in
Table 6.4 (pages 175–177).
9780170452922
TABLE 6.4 DNA vocabulary used in DNA-based biotechnology
TERM DEFINITION/DESCRIPTION VISUAL AID

Amplify To greatly increase the number of
copies of a DNA sequence. This can
be achieved, either in vivo by inserting
the sequence into a cloning vector
that replicates within a host cell, or in
vitro by PCR.
amplification
FIGURE 6.11 Amplification

Annealing Joins (hybridises) two pieces of DNA
by complementary base pairing
(joining of overhanging sticky ends).
The two pieces are joined by weak
hydrogen bonds only, and therefore
temporarily. It is a biochemical
process of bonding two segments
of DNA at an optimal temperature of
50–60°C.
FIGURE 6.12 Annealing occurs between complementary base pairs.

DNA ladder A collection of DNA fragments of
known base pair lengths; a ladder is
a standard or a set of molecular size
markers used to compare the sample
DNA with known DNA.
FIGURE 6.13 DNA marker (ladder)
9780170452922

Identification Restriction enzymes can be used
GENE
and to identify a gene of interest. DNA
extraction of fragments (genes) are cut out of their
target gene normal position in the chromosome.
Restriction Restriction
Automated DNA sequencing enables enzyme site enzyme site
mapping of genes on chromosomes
to help identify and extract target FIGURE 6.14 Isolating the gene of interest
genes.
Genome All of an organism’s genetic
information, including all of the
DNA that makes up the genes on
chromosomes, mitochondria and (in
the case of plants) chloroplasts.
DNA
A genome is a complete set of (deoxyribonucleic acid)
instructions for making and operating Base pairs
an organism. Your genome contains Histones Nucleosomes
the information (encoded in the Gene
DNA) to build your cells and your
/scimoneg-tuoba/vog.emoneg.www//:sptth( etutitsnI
cells’ components. It also carries the
hcraeseR emoneG namuH lanoitaN :ysetruoC

information necessary for the cells to
)scimoneG-ot-ediuG-feirB-A/steehs-tcaf
function. Chromosome
Cells Cell during

prophase
FIGURE 6.15 An organism’s genome

Plasmid A plasmid is an extra-chromosomal
circular DNA molecule, distinct
from the normal bacterial genome
and non-essential for cell survival.
It can replicate independently of
the bacterial chromosome. Some Nucleoid
plasmids are capable of integrating
into a host genome. A number of
artificially constructed plasmids
are used as cloning vectors. They
can be inserted as well as removed
from bacteria. The loop is small and
therefore contains only a few genes, Bacterial
but the genes are functional. chromosome Plasmids
(circular)
FIGURE 6.16 Plasmids found in a bacterium
9780170452922

Micropipette A tool that dispenses small amounts
of samples into PCR tubes or into
the wells of an elecrophoresis gel.
The volume is adjustable, and the tips
OADNAEUD ADARAHCTAHP/moc.kcotsrettuhS
are removed after every use to avoid
contamination.
FIGURE 6.17 A micropipette
Short STRs are sequences of DNA that STR

tandem repeat a certain number of times.
repeat (STR) They are highly variable segments Individual 1 GTACTAGACTACTACTACTACTACTGGTG…
of DNA, typical of non-coding 5 repeats
and non-regulatory DNA, that

Individual 2 GTACAAGACTACTACTACTACTACTACTGGTG…
occur throughout the genome 6 repeats
and contain repeats of the same
sequence of several nucleotides Individual 3 GTACAAGACTACTACTACTACTACTACTACTGGTG…
7 repeats
(e.g. CTACTACTACTA). The number
of times the sequence is repeated is FIGURE 6.18 STRs are unique to each individual
unique in different individuals.
Vector A vehicle that transports and

Viral vector
introduces foreign DNA/genes into
host cells. Using the host cell, the
foreign DNA is reproduced in large
quantities (cloned) and/or expressed.
Integration
Vectors are often recombinant into host genome
molecules containing DNA sequences
from several sources.
Bacterial Host DNA Recombinant viral DNA

host cell
FIGURE 6.19 A viral vector and a bacterial host cell
9780170452922
PCR: amplifying DNA

Each eukaryotic somatic cell generally has two copies of each gene, and prokaryotic cells have one
copy. This small amount of DNA poses a problem for scientists wishing to work with it. Similarly,
only a small sample of DNA may be available for analysis, for example, from a crime scene or in
DNA samples obtained from bones. To increase the amount of DNA of a particular sequence,
the biotechnologist has a technique to work with called PCR. PCR is a cyclic method used to
rapidly amplify (replicate many times) relatively small numbers of particular sequences of DNA into
extremely large numbers of copies. The DNA is then suitable for further laboratory uses such as
gel electrophoresis and DNA profiling. PCR makes use of the enzyme taq DNA polymerase, which
catalyses the formation of new DNA molecules from free nucleotides. Taq polymerase is used
because of its ability to resist denaturing at high temperatures. This heat-stable polymerase was
named after the bacterial species from which it was first isolated. The bacterial species Thermus
aquatics lives in hot springs at temperatures of up to 95°C. Most enzymes would denature at this
temperature, but taq polymerase remains stable.
A number of components are required for PCR: the DNA that is to be copied (template), the
special DNA polymerase (taq polymerase), a buffer solution that contains salts and other chemicals to
maintain the correct pH at which the polymerase can function, a supply of the four nucleotides (i.e.
A, T, C, G, also known as deoxynucleotide triphosphates or dNTPs, from which to build the new DNA
molecules), and two sets of single-stranded DNA primers. The primers are short, single-stranded DNA
sequences (of around 20 nucleotides), chosen because they are complementary to the nucleotide
sequences at either end of the DNA section that is to be copied. These are necessary as a starting
sequence of nucleotides to which the DNA polymerase can begin to add new DNA nucleotides.
DNA polymerase can only extend a DNA strand from an existing nucleotide; it cannot create a new
complementary strand without primers to begin extending from.
The process of PCR involves a series of temperature cycles. Once this was carried out by moving
tubes through various water baths, but it is now controlled automatically in machines known as
thermal cyclers, or thermocyclers. Thermocyclers provide tight control over both the reaction
temperature and the duration of each temperature step, ensuring efficient amplification. Within a few
hours, billions of copies of the DNA sample can be made.
PCR has three steps (Figure 6.20).
1 Denaturation: The double-stranded DNA is heated to around 95°C, breaking the weak hydrogen
bonds between the bases and thus causing the two template strands to denature (separate). The
template strands have exposed nucleotides, ready for complementary base pairing, and will be
used for the synthesis of the new strands.
2 Annealing: The temperature is reduced to 50–60°C, allowing the single-stranded DNA primers to
anneal (join via hydrogen bonds) to complementary sequences on opposite ends of each strand.
The DNA used is either genomic DNA or PCR products generated during the previous cycle. The
reduced temperature is necessary to allow base pairing and the formation of hydrogen bonds.
3 Extension: The temperature is raised to 72°C, the optimum temperature for the DNA taq (heat-
stable) polymerase used in PCR. Starting from the primers, new DNA strands are synthesised using
DNA polymerase and the available nucleotides. At the end of this phase, there are two copies of
each strand of DNA.
Overview of PCR This cycle is repeated until sufficient quantities of the DNA are obtained to work with. Each cycle
Click on ‘Application
overview’. doubles the number of DNA strands; therefore, in just 20 cycles more than one million copies of the
target DNA will be produced.
PCR
View the interactive to PCR is a process that amplifies a specific DNA sequence for analysis. The sequence of the primers
learn more about PCR. determines the DNA sequence to be amplified.
9780170452922
Double-stranded DNA
5' 3’
A C T G T C G A
T G A C A G C T
3' 5’
Heat to 95°C.
1 Denaturation DNA strands will separate as hydrogen bonds are broken.
5' 3'
A C T G T C G A
T G A C A G C T
3' 5'
Cool to 50–60°C.
Primers anneal to template DNA strands.
2 Annealing
5' 3'
A C T G T C G A
Reverse primer
A C T G
A G C T
Forward primer
T G A C A G C T
3' 5'
Heat to 72°C.
3 Extension Taq polymerase synthesises new DNA strands.
5' 3'
A C T G T C G A
A G C T Reverse primer
Forward primer A C T G
T G A C A G C T
3' 5'
5' 3'
A C T G T C G A A C T G T C G A
T G A C A G C T T G A C A G C T
3' 5'
FIGURE 6.20 Amplifying DNA using PCR
ngiseD setnaD/moc.kcotserettuhS
puorGvU/moc.kcotsrettuhS
FIGURE 6.21 A thermal cycler, in which PCR is carried FIGURE 6.22 Thermal cyclers cycle through set
out as an automated process temperatures.
9780170452922
TABLE 6.5 Summary of the PCR steps after the mixture is added to the thermal cycler
NAME OF STEP TEMPERATURE OF MIXTURE DESCRIPTION

Denaturation 95°C The double-stranded DNA is heated to around 95°C,
breaking the weak hydrogen bonds between the
complementary bases, causing the two template
strands to denature (separate).
Annealing 50–60°C The temperature is reduced to 50–60°C, allowing
the single-stranded DNA primers to anneal (join via
hydrogen bonds) to complementary sequences on
opposite ends of each strand. The primers attach
according to complementary base-pairing rules to the
3' end of each template strand.
Extension 72°C DNA taq polymerase extends the new strand, starting
from the primers. New DNA strands are synthesised
using taq polymerase and the available nucleotides.
At the end of this phase, there are two copies of each
original strand of the double-stranded DNA.
Repeat cycle The process is repeated many Each new strand can act as template strand; therefore,
times. the DNA is amplified exponentially.
Question set 6.3a

REMEMBERING 5 State the components of a PCR reaction.
1 Define: UNDERSTANDING
a amplify 6 Describe the three steps of PCR.
b anneal
c vector APPLYING
d genome. 7 If you start with five copies of a region of
2 Describe STRs and how they are used in DNA, how many copies will be produced
identification techniques. if your sample goes through 10 cycles of
3 Name the machine used for PCR PCR?
reactions.
4 Name the main steps in PCR and the
temperatures at which they happen.
Gel electrophoresis: visualising DNA

DNA molecules are far too small to see, but they have an overall negative charge due to the
phosphate groups in the sugar–phosphate backbones, and this can be used to make their location
visible.
Gel electrophoresis is a technique that can separate large, charged molecules (such as dyed
fragments of DNA or proteins) according to size and charge, so that they can be visualised and
identified by comparison with a standard. An agarose gel is melted and poured into a flat mould
to cool. Wells are created by placing a plastic comb into the gel as it sets, creating indentations.
The DNA samples and a DNA ladder are pipetted into separate wells in the row of wells. The
medium commonly used for electrophoresis of proteins and nucleic acids is agarose gel because
it allows the molecules and an electric current to flow through it.
9780170452922
The gel is placed in a tray filled with buffer solution, and positive and negative electrodes are
attached at each end of the gel. When the electric current runs, the fragments are repelled by
the negative electrode and move towards the positive electrode at the other end. The gel acts
as a large sieve through which the DNA strands move under the influence of the electric current.
Smaller strands can move through the gel matrix faster than the larger strands, which take longer
to migrate through the gel. This method therefore separates DNA strands based on their size.
DNA itself will not be visible in the gel. To view the separated DNA fragments, ethidium
bromide or another fluorescent DNA-binding dye is added to the agarose gel before it sets.
The dye binds to the DNA and fluoresces under UV light at the completion of the investigation,
showing a pattern of bands that can then be photographed. Each band on the gel contains many
thousands of pieces of DNA of the same length. A band is a well-defined line in a lane on a gel.
A lane is a corridor through which DNA passes after it leaves a well. The bands in each lane are
compared with the bands in the standard. DNA fragments of the same length will overlap and be
seen as one band.
resarF nomiS/yrarbiL otohP ecneicS
FIGURE 6.23 A researcher pipetting genetic material into an agarose gel for electrophoresis
The position of bands on an agarose gel depends on the size of the DNA fragments in each band;
the smaller the fragments, the further they move in a given time. To determine the size of a given
piece of DNA, molecular biologists use a standard set of molecular size markers (the ‘ladder’). These
are pieces of DNA of a known number of base pairs (bp). By comparing the location along the gel
of the DNA sample with that of the known molecular size markers, the size of the separated DNA
fragments can be determined (Figure 6.24, page 182).
9780170452922
rekram raluceloM
2 elpmaS
1 elpmaS
3 elpmaS
– Electrode Wells where
the DNA is
loaded
1700 bp Largest DNA

fragment
1000 bp Direction the

Agarose gel
DNA travels
500 bp
200 bp Smallest DNA

fragment
+ Electrode
bp = base pairs
FIGURE 6.24 A set of molecular markers of known size (a ladder) is run alongside the samples and allows
identification of the size of the DNA fragments migrating through the gel.
TABLE 6.6 Summary of the main steps of gel electrophoresis
NAME OF STEP DESCRIPTION VISUAL AID

Set up the Set an agarose gel and make wells with a comb.
apparatus Place the gel into the apparatus and pour a
buffer solution over it for regulating pH. Cut the
DNA fragments with restriction enzymes. Dye
them with a binding chemical, such as ethidium
snoitcudorpTecnatsbuS/moc.kcotsrettuhS
bromide, which fluoresces under UV light.
FIGURE 6.25 A comb is used to make wells.

Pipette samples Pipette the samples and DNA ladder into the
wells of the agar. Make sure the negatively
charged samples are at the end of the apparatus
where the negative electrode is situated. Discard
used micropipette tips after each use.
otohP baL/moc.kcotsrettuhS
FIGURE 6.26 A micropipette is used to transfer the samples into

the wells.
9780170452922
NAME OF STEP DESCRIPTION VISUAL AID

Turn current on The negative molecules are repelled by the
negative electrode and travel (migrate) towards
the positive electrode, which they are attracted
to. The smaller fragments move faster and
further, and the larger molecules move more
slowly and not so far.
otohp ecneics/moc.kcotsrettuhS
FIGURE 6.27 The current is turned on.
Visualise and Visualise the fragments by shining a UV light on
compare the apparatus and photographing the results.
The bands in each lane can be compared with
the ladder to determine the length of the sample
in bp.
olleiramreF oruaM/yrarbiL otohP ecneicS

FIGURE 6.28 Visualisation of the bands may require UV light.
Hints for loading • Slowly lower the pipette. Don’t stab the gel.
a gel Putting your tip too deep into a well or against
the side of the well can result in puncturing
the gel, allowing your sample to leak.
• Use two hands on the pipette! You are aiming
for a small target. Use your dominant hand to
operate the pipette. Use your other hand to
steady your pipette by placing a finger on the
pipette shaft near where it meets the pipette
tip.
• Steady your arms by resting your elbows on
the laboratory bench.
Question set 6.3b

REMEMBERING
1 State the charge on a DNA molecule.
2 Describe the function, in gel electrophoresis, of the following:
a agarose gel
b primer
c well
d pipette.
3 Describe the process of gel electrophoresis.
9780170452922
UNDERSTANDING Samples
4 Describe the purpose of gel
electrophoresis. Marker A B C
5 Explain why a ladder is used when

running an electrophoresis gel.
ANALYSING 1200 bp
6 Analyse the electrophoresis gel 1000 bp

shown in Figure 6.29. 900 bp
a Which sample had the shortest 800 bp
fragment? 700 bp
b State the length of the fragment 600 bp
in sample A. 500 bp
c Are the wells situated near the 400 bp
negative or positive terminal?
300 bp
200 bp
100 bp
FIGURE 6.29 Results of a gel electrophoresis
Microarrays: probing for genes

Another identification tool used in biotechnology is called a microarray. A microarray is a collection of
gene probes attached to a solid surface. A gene probe is a specific length of single-stranded DNA of
between 20 and 40 nucleotides, or sometimes as large as 1000 nucleotides, that is complementary
to a known sequence of DNA from a particular gene. A gene probe can measure the level of gene
expression in a sample of DNA, and a microarray can screen a large number of genes at the same
time. It is efficient and fast, identifying genes that
are being expressed in certain individuals or breeds 1 A probe is a sequence of DNA that is made radioactive.
and also showing those genes that are not being
TA GCGA
expressed, for comparison. The tool can be used
when scientists are trying to discern between genes
2 The target for the probe is double-stranded
that are desirable and genes that are not. For example, DNA containing the sequence being studied.
if some individuals are resistant to a disease, they may
T AGCGA
have a unique form of a gene that scientists would like A TCGC T
to locate and analyse.
The DNA being investigated is heated to separate
the two strands and expose their bases. The single- 3 The target DNA is heat-treated to separate the strands.
stranded probes then bind to any complementary T AGCGA

sequences (Figure 6.30). Hydrogen bonds break.
A TCGC T
Gene probes have either a radioactive tag
attached to them, which will show up when the
microarray is exposed to photographic film, or a 4 The radioactive probe is introduced to find the gene.
fluorescent dye tag, which shows up when the
T AGCGA
microarray is exposed to an ultraviolet light source. In A TCGC T
the case of Huntington’s disease, this technique can
be used to determine which family members have FIGURE 6.30 A probe is made up of 20–40
the allele and will therefore develop the disease later nucleotides complementary to its target
in life. sequence.
9780170452922
Most genes are present in the same quantity in every body cell – namely, one copy per haploid
cell or two copies per diploid cell. However, only a small percentage of the genome is expressed in
each cell, and the level at which a gene is expressed can vary widely.
Studying which genes are active and which are inactive in various cell types helps scientists to
understand both how these cells function normally and how they are affected when various genes do
not perform properly. In the past, scientists have only been able to conduct these genetic analyses on
a few genes at once. With the development of DNA microarray technology, however, scientists can
now determine the expression of thousands of genes at one time.
Gene probes can be natural nucleotide sequences, or they can be synthesised in the laboratory.
They have a variety of uses, including finding a certain fragment of a gene after a sample has been
separated by gel electrophoresis, identifying the position of a gene on a chromosome, and detecting
an allele of a specific gene associated with a genetic disease.
Gene probing uses a single-stranded DNA molecule complementary to a gene of interest to
identify, isolate or locate that gene on a chromosome.
A microarray consists of thousands of DNA probes arrayed on a single glass microscope slide
or silicon chip (Figure 6.31). Each probe is designed to be complementary to a gene of interest
in the target cell. The mRNA of the target cell is extracted, reverse transcribed into DNA (now
called copy DNA, or cDNA) and labelled with a fluorescent marker. Fluorescently labelled DNA
is then hybridised (allowed to bind) under
stringent conditions to the probes on the
slide. A scanner measures the fluorescence
for each DNA probe on the slide. From this
information, scientists can work out the
activity of the genes in the cell: the stronger
the fluorescence, the more mRNA in the
original sample and therefore the greater the
activity of each of the genes.
Microarray technology can be used to
detect genetic diseases. For example, genes
that are usually turned off in normal cells may
be turned on, leading to uncontrolled cell
division and cancer. Conversely, genes that FIGURE 6.31 A DNA microarray indicating binding
suppress the development of tumours may be of cDNA to the DNA probes in one sample (red
turned off. Microarray technology offers a way fluorescence), in another sample (green) and in both
of diagnosing a cancer at the molecular level. samples (yellow)
Key concept
Biotechnology techniques include PCR to amplify (increase) the amount of DNA, gel
electrophoresis to visualise DNA, and microarrays to detect genes and their expression.
Question set 6.3c

1 What is a microarray? 5 Apply your knowledge of biotechnology
2 Describe the purpose of a microarray. tools and techniques to provide
UNDERSTANDING evidence for why microarrays are useful
in medical diagnosis.
3 Explain the meaning of hybridisation.
4 Explain how microarrays measure the
level of gene expression.
9780170452922
6.4 DNA SEQUENCING

DNA sequencing refers to the methods and technologies used to determine the orders of the
nucleotide bases [adenine (A), guanine (G), cytosine (C) and thymine (T)] in a DNA molecule. DNA
sequencing enables us to perform a thorough analysis of the DNA because it provides us with very
comprehensive information: the sequence of the nucleotides. Scientists cut DNA into fragments to
sequence one section at a time. The entire set can then be put together to create a whole genome.
The genomes of thousands of species have been sequenced, allowing genomes and genes to be
compared. Knowing the sequences can help scientists determine the genetic code for particular
phenotypes. There may be survival benefits in identifying, for example, genes that increase drought
resistance or salt tolerance in plants. In addition, sequencing genes of different species has assisted
scientists in determining genetic relatedness and evolutionary links.
DNA sequencing was originally done manually, using gel electrophoresis, and was called Sanger
sequencing. It is now done using an automatic DNA sequencer that can sequence a large amount
of DNA in a very short time. In this process, the four nucleotides are labelled with four differently
coloured fluorescent dyes. As electrophoresis proceeds, a laser scans across the bottom of the gel,
detecting the different dyes and consequently determining the base sequence. A computer can then
automatically analyse the information from the gel to read the base sequence.
Faster and cheaper sequencing technologies are continually becoming available for use
by biotechnologists. These methods are collectively called next-generation sequencing (NGS)
techniques, and they use whole genomic DNA as a template, resulting in much greater sequencing
efficiency. For example, one million DNA fragments of 700 bp can be sequenced in 24 hours, which is
the equivalent of one full human genome every 5 days. Both Sanger and NGS apply the principles of
complementary base pairing to determine the nucleotide sequence.
The first genome to be sequenced was that of a bacterial virus, and it was accomplished by
Fred Sanger. The first species to have its genome sequenced was the bacterium Haemophilus
influenzae, and it was done by Craig Venter in the 1980s. This was followed by the sequencing of
larger genomes, such as those of the fruit fly, Drosophila melanogaster, and humans, Homo sapiens.
The human genome took 13 years to sequence and was completed by 2003.
DNA sequencing can identify the exact nucleotide sequence of DNA fragments, which can then
be used to determine the genetic basis for particular phenotypes.
The Sanger method: original, slower method

The Sanger method, also referred to as dideoxynucleotide sequencing or chain-termination
sequencing, is based on the use of dideoxynucleotide triphosphates (ddNTPs) in addition to
the normal nucleotide triphosphates (dNTPs) found in DNA. ddNTPs are essentially the same as
nucleotides, except they contain a hydrogen group (H) on the 3' carbon instead of a hydroxyl group
(OH). These modified nucleotides, when integrated into a DNA sequence, prevent the addition
of further nucleotides, thus stopping the elongation of the DNA chain. This occurs because a
phosphodiester bond cannot form between the dideoxynucleotide and the next incoming nucleotide,
and thus the DNA chain is terminated.
Although the various reagents, equipment and strategies for carrying out DNA sequencing have
changed to improve the simplicity, speed and reliability of the process, the basic procedure has not
changed over the decades since its invention.
The following steps form the basis of the Sanger method:
1 The region of DNA to be sequenced is identified, cut and amplified (using a tool such as PCR) and
then heated and denatured to produce single-stranded template DNA.
2 Template DNA, primer, DNA polymerase, all four types of dNTPS (A,T,C,G) and one type of dyed
ddNTP are added into the reaction mixture.
9780170452922
3 The sequencing DNA primer is annealed to the single-stranded DNA at the 3' end of the original
strand, which provides a starting sequence for synthesis.
4 DNA polymerase extends the new strand by attaching complementary dNTPs in the 5' to 3'
direction.
5 When a dideoxynucleotide that has been coloured with fluorescent dye attaches randomly, the
newly synthesised strand terminates (the ddNTP prevents the formation of a phosphodiester
bond).
6 By performing four separate reactions, four separate sets of chain-terminated fragments are
produced.
7 Following the termination step, heating to denature the partially double-stranded molecules
releases the single-stranded chain termination molecules of the various lengths from their
templates.
8 They can then be separated using gel electrophoresis. The nucleotides, which are differently
coloured, run in separate lanes.
9 As gel electrophoresis proceeds, a laser scans across the bottom of the gel, detecting the
different dyes and revealing the base sequence. The terminated strands line up from smallest to DNA sequencing
interactive and
largest. The various colours enable identification of the nucleotide in each position. animation
10 The sequence of the original region of DNA is then finally deduced by examining the relative View these resources
to further your
positions of the dideoxynucleotide chain termination products in the four lanes of the denaturing understanding of
gel. Sanger sequencing.
4 × PCR (+ one dideoxynucleotide)
Use a
ddTTP ddATP ddGTP ddCTP G A C T G A A G C T
sequencing
machine
DNA sequence
5' 3'
C T G A C T T C G A
T A G C
G A C T G A A G C T
A C T G A A G C T
C T G A A G C T
T G A A G C T
G A A G C T
Separate
A A G C T with a gel
A G C T
G C T
C T
FIGURE 6.32 The Sanger sequencing method. The terminated nucleotides are separated and then lined up to produce a sequence.
9780170452922
Next-generation sequencing: a new, more

efficient method
NGS applies the same principles as the Sanger method, but the technology is more advanced.
The basic steps are DNA preparation, sequencing and analysing.
1 DNA preparation
DNA is isolated and purified, then cut into fragments of approximately 300 bp in length. The
fragments are then amplified using a PCR-type method to create massive numbers of identical
copies. The resulting fragments are single stranded. The different types of fragments are placed
into unique wells and barcoded.
2 Sequencing
The multi-well plate contains the assorted fragments. In each well, modified versions of the
four types of DNA nucleotides wash over the mixture. The nucleotides hydrogen bond to the
DNA template strand according to complementary base-pairing rules. Each nucleotide has one
of four fluorescent tags attached. The tags indicate the positions and thus the order of the four
nucleotides in the sequence being analysed. A terminating set of nucleotides is also in the mix,
which prevents further elongation of the new strand. After copying the forward DNA strand, the
reverse strand is similarly processed. Each time a chemically tagged nucleotide attaches to the
template strand, there is a flash of light and this is recorded. A different colour of light flashes for
each different type of nucleotide added.
3 Data analysis
The recorded light flashes reveal the sequence of nucleotides of the template strand in each well.
The sequencing software identifies the nucleotides by the order of the colours recorded.
In both NGS and Sanger sequencing, DNA polymerase adds fluorescent nucleotides one by one
onto a growing DNA template strand. Each incorporated nucleotide is identified by its fluorescent tag.
One colour represents one nucleotide. The major difference between Sanger sequencing and NGS
is the number of fragments that can be sequenced at once: one versus many. The Sanger method
only sequences a single DNA fragment at a time. In contrast, NGS sequences millions of fragments
simultaneously per run. NGS can sequence hundreds to thousands of genes at one time.
Genome sequencing is mostly used in medicine to identify abnormal gene function via DNA
microarrays. However, with the more rapid sequencing techniques, the applications are widening to
include conservation and agriculture.
6.1 Comparative genomics between humans and fruit flies

Comparative genomics involves the comparison of different genomes. Recent studies have
NOITACILPPA
discovered that humans share 60% of their genes with fruit flies, Drosophila melanogaster.
Two-thirds of the genes involved in human cancer have equivalent genes in the fruit fly
genome. The evolutionary links between species, or their genetic relatedness, can also be
determined by comparing genomes. Humans and fruit flies diverged from each other about
990 million years ago (mya), but we only diverged from chimpanzees about 5 mya.
CASE
STUDY
Use of next-generation sequencing to study ecosystem
biodiversity
Professor Michael Bunce is a molecular surroundings, usually their habitat. Michael
biologist at Curtin University in Perth, Bunce’s team extract, amplify (using PCR)
Australia. He uses NGS to analyse and analyse degraded DNA. Using a
environmental DNA (eDNA). eDNA is the DNA combination of DNA barcoding and NGS,
that organisms shed into their immediate samples of DNA that in the past were too
9780170452922
small or degraded to analyse can now be

analysed successfully.
The team’s first published paper
showed that DNA could be extracted from
prehistoric Siberian permafrost cores
and New Zealand cave sediments, then
sequenced successfully. This was landmark
ytisrevinU nitruC fo ysetruoC

work, because it demonstrated that we don’t
need fossils to identify the animals that were
present in an area many centuries ago. We
can detect the DNA that these animals left
behind and use the data it provides to study FIGURE 6.33 Professor Michael Bunce from Curtin
how plants and animals have changed over University
time. Prior to NGS, Michael’s team used
the slower Sanger sequencing technique.
They had to extract DNA from the sample,
clone it into bacteria, and then sequence the
bacterial plasmids one bacterium at a time.
ytisrevinU nitruC fo ysetruoC

It was time consuming, costly, and didn’t
delve deeply enough into the species present
in the sample.
Thanks to NGS, the team can more
accurately and rapidly sequence eDNA. This
means that, from prehistoric DNA, they FIGURE 6.34 Taking environmental DNA samples at
can determine what species lived where. Rottnest Island
They have been able to concentrate their

attention on genes that have evolved and swamps, archaeological sites, seawater, faecal
genes that have been conserved over time. samples and herbal medicines.
One method they use is to concentrate a Currently, in collaboration with CSIRO,
litre of seawater down, leaving its organic Michael’s team have been analysing samples
components, from which they can extract collected off the coast of Rottnest Island, near
the DNA. This method yields information Perth. They have been successfully isolating
about the biodiversity in each sample. and sequencing eDNA, seeking insights
For example, it is possible to design PCR into past ecosystems and endeavouring to
assays that use ‘molecular magnets’ able to make predictions about future marine life in
latch onto certain sequences of fish DNA relation to our changing climate. In addition,
to study what fish have been in a sample of marine environmental DNA biomonitoring
seawater. A species list can then be created. has revealed seasonal patterns in biodiversity,
The presence or absence of various taxa and identified ecosystem responses to
can be used to build a holistic picture of the unusual climatic events. Michael is hoping
biota in a specific environment and how it to get high school students involved in this
interacts. monitoring program.
Recent studies by Michael’s team have
assessed biodiversity in marine samples Questions
and evaluated rehabilitation success in 1 Describe what eDNA is.
restoring native ecosystems after mining or 2 Explain how the sequencing of eDNA can
oil exploration. They have used these eDNA help scientists predict ecosystem changes
analysis approaches on ice cores, dirt from in the future.
9780170452922
Question set 6.4a

1 State the purpose of DNA sequencing. 4 Describe the main differences between
2 Recall the steps of Sanger sequencing. Sanger sequencing and NGS.
3 Name the species that was the first to 5 Explain what the flashing lights during
have its whole genome sequenced. NGS represent.
DNA sequencing enables mapping of species’ genomes

A genome includes the entire set of genetic instructions, both the genes and non-coding sequences,
of an organism. DNA sequencing has enabled the mapping of genomes. Genetic mapping involves
identifying and recording the positions (or relative positions) of genes on chromosomes. When a
species’ genome is mapped, all of the chromosomes in a somatic cell are mapped. Once the position
of a gene, known as its locus, is known, it can be shown on a diagram.
A genetic marker (‘landmark’) is a nucleotide sequence that is associated with a specific trait.
Genetic markers may include short DNA sequences, such as STRs, or longer sequences, such as
genes. Genomics is the study of entire genomes, including the complete nucleotide sequence and
organisation, and the variation in the sequence both between individuals and between species.
Variations in the sequence can be identified as being associated with identifiable disorders or
beneficial phenotypes.
Working out the genetic map is complex. Gene mapping is supported by the theory of crossing
over of chromosome segments during meiosis. When small sections of chromosomes are swapped,
genes that are located close to one another are likely to be swapped at the same time. As a result,
those genes would be inherited together. Two genes that are on the same chromosome are said to
be ‘linked’, and the distance between those genes is called the ‘linkage distance’. The smaller the
distance, the more likely it is that the two genes will be inherited together.
If several generations of offspring inherit the same disease (or beneficial trait, such as salt
tolerance) and the same DNA marker, it is probable that there is a gene with an allele associated
with the disease (or beneficial trait) located near the marker. That kind of information can enable
scientists to map a gene for a particular phenotype at a cytogenetic location (relative position) on a
chromosome. The cytogenetic location is illustrated by using the distinctive patterns of bands created
when chromosomes are stained with certain chemicals.
DNA tools can be used to extract DNA fragments from samples and to detect subtle differences
in DNA patterns (such as in STRs) that help distinguish one individual from others of the same
species. Individuals with a disease or trait of interest may have a slight variation in a DNA pattern
compared with other individuals unaffected by that disease or trait. DNA markers of this type don’t,
by themselves, identify the gene responsible for the disease or trait. They may, however, indicate to
researchers that an allele associated with the disease or trait is present and approximately where the
relevant gene is located on the chromosome carrying that marker.
Another type of mapping, called physical mapping, determines the precise molecular location of
the genes on a chromosome. The molecular location is based on the sequence of the nucleotides.
Physical mapping can be used to improve the accuracy of genetic mapping. Scientists may be able
to calculate the physical distance in base pairs (bp) between known DNA sequences, such as genes,
by working out how many base pairs are between them. Physical mapping can also indicate the size
of genes. Both genetic maps and physical maps are required for building a complete picture of the
genome.
9780170452922
Sequencing enables mapping, and mapping enables sequencing

One strategy used is to build a genetic map by sequencing a genome. Sequenced DNA fragments
(parts of the genome) can be pieced together by comparing them with the growing genome
sequence. The loci of some genes may then be found and they can then be added to genetic maps.
On the other hand, the map may help form the framework for sequencing the genome. Figure 6.35
is a genetic map of the chromosomes of a fruit fly. The distance between genes and the reference
position 0.0 is shown on the left of each chromosome and the associated phenotypes are on the
right. Genetic markers, linkage mapping and physical mapping are all used in genetic mapping and
building our understanding of the genome.
Chromosome 1 (X) Chromosome 2 Chromosome 3 Chromosome 4
0.0 Yellow body 0.0 Aristaless 0.0 Roughoid eyes

antenna
1.5 White eyes
2.0 Eyeless
6.1 Curly wings
3.0 Sparkling
11.0 Female sterile
13.7 Crossveinless eyes
16.5 Clot eyes
wings
21.0 Singed bristles

26.0 Sepia eyes
27.5 Tan body
36.1 Miniature
wings 39.3 Daughterless
43.0 Sable body 44.0 Scarlet eyes

48.5 Black body
51.1 Scalloped
wings
54.5 Purple eyes
56.7 Forked
bristles
62.0 Stripe body
67.0 Vestigial wings

68.1 Little fly
70.7 Ebony body
75.5 Curved wings
88.0 Mahogany
eyes
94.5 Smooth
abdomen
100.7 Claret eyes
104.5 Brown eyes
FIGURE 6.35 A genetic map of the chromosomes of the fruit fly, Drosophila melanogaster
Question set 6.4b

1 Define genome map. 4 Explain how DNA sequencing can enable
2 Describe a genetic marker. genome mapping.
3 State the purpose of a genetic marker in 5 Describe the role of a genetic (linkage)
gene mapping. map.
9780170452922
Using genetic markers in the quest to save our vulnerable

YCARETIL CIFITNEICS burrowing bettong
Nationwide, the population of burrowing bettongs (Bettongia lesueur) is estimated at 19 000
individuals, although their population does fluctuate with rainfall. In WA their conservation
status is deemed ‘conservation dependent’. The decline in numbers of burrowing bettongs
on the mainland appears to be largely due to predation by feral cats and foxes. Conservation
of burrowing bettongs is reliant upon the establishment of feral predator-free areas on the
mainland and on preventing cats and foxes from establishing populations on islands. The
Australian Wildlife Conservancy is working with the Shark Bay Marsupials Recovery Team to
support their conservation in the field.
Meanwhile, the School of Biological Sciences at the University of Western Australia
are working with DNA to support the bettong conservation efforts. Genetic variation in
the bettong is decreasing because only small populations remain. Their isolation prevents
interbreeding between populations. Some reasons for the loss in genetic variation are
inbreeding and genetic drift (random loss of alleles over generations).
Scientists recently published a report about a population genomics study. To increase
genetic variation in the bettong, the scientists facilitated the mating of two bettong subspecies,
a strategy known as genetic admixing. Genetic admixture is the introduction of DNA, through
an individual from a distantly related population or species, as a result of interbreeding
between populations or species that have been reproductively isolated and become genetically
differentiated. Admixture results in the introduction of new genetic lineages into a population.
Using high-resolution genomic markers through double-digest restriction site–associated
DNA sequencing (ddRAD-seq) and life history data collected over 9 years of monitoring, this
study investigated the genetic and fitness consequences of admixing two genetically distinct
subspecies of Bettongia lesueur in a conservation translocation. The study supported the
hypothesis that mixing multiple source populations would be beneficial in the conservation of
the threatened species.
The introduction of individuals into inbred populations can provide a ‘genetic rescue’ effect
by infusing new genetic variation and relieving the deleterious effects of inbreeding, leading to
improved fitness and adaptive potential. This is an example of admixture being used to improve
conservation outcomes for threatened species, and this technique has been documented in a
range of mammals, including the mountain pygmy possum.
Genomic DNA was extracted from the biopsied ear tissue of burrowing bettongs,
sequenced and studied with the use of genetic markers. Individuals from two subspecies
were mated and any outbreeding
depression (subsequent loss of
fitness) was assessed. The admixed
population showed significant
increases in all genetic diversity
parameters compared with either
founder population. Using high-
resolution genomic markers
namhcoL iriJ/yrarbiL erutciP erutaN
through ddRAD sequencing, this

study showed that the two founder
populations were genetically distinct
and readily interbred, resulting in an
increase in genetic diversity, with no
negative effects on survivorship or
reproductive capacity. FIGURE 6.36 The burrowing bettong’s survival is under threat.
9780170452922
Questions
1 State the conservation status of the burrowing bettong in WA.
2 Describe how workers in the field and workers in the laboratory are helping in the fight to
conserve these animals.
3 How were genetic markers used in this study?
6.5 DNA PROFILING

DNA profiling (also known as DNA fingerprinting) is a technique used by scientists to identify an
individual by comparing an unknown sample of DNA with known DNA profiles. The scientist looks for
a match within the non-coding regions of an individual's genome. Non-coding regions of DNA have
satellite DNA – long stretches of DNA made of repeating units called short tandem repeats (STRs).
Typically, individuals, even of the same species, possess unique banding patterns of DNA that make up
their STRs. This reflects their unique genetic information. The banding patterns are visualised by gel
electrophoresis and compared with known DNA profiles to distinguish between individuals.
STRs are sections of non-coding DNA that are repeated many times. The repeating units of STRs are
2–5 bases in length (e.g. AGAGAGAG). Larger sequences that are repeated are called variable nucleotide
tandem repeats (VNTRs) and are greater than five bases in length. These are genetic markers that are
highly variable from individual to individual. For example, one organism may have the sequence ACAT
repeated 12 times, whereas another organism of the same species may have 18 repeats. The repeated
sequence can be cut using restriction enzymes, amplified using PCR, and fluorescently tagged. Its length
(number of repeats) can be determined, and it can be visualised using gel electrophoresis.
A summary of the process of DNA profiling follows.
1 DNA fingerprinting starts with isolating a DNA sample from any somatic (body) cell. A specific
fragment is cut at a recognition site using restriction enzymes.
Fuse school: DNA
2 PCR makes many copies of the small amount of DNA. fingerprinting
3 The fragments can be separated, the length of the fragments visualised and the number of Watch this video
to further your
repeats determined by the use of gel electrophoresis. Smaller fragments have fewer STRs. They understanding of DNA
migrate further during electrophoresis. fingerprinting.
4 The DNA is visualised under a UV light.
5 The profile is the unique set of patterns of bands. The patterns of bands are different because we
are all genetically different and unique (other than identical individuals from multiple births).
The STR and VNTR repeats
are present in all members of Person 1 The STRs shown on a gel
the population, but the number
G A G A GA Person 1 Person 2
of the repeats varies between
individuals (Figure 6.37). Each 3 repeats
10
individual usually has two alleles
8
for each STR, one from each 5 repeats
homologous chromosome. DNA 6

Person 2
profiling identifies people based on PCR primer binding sites
differences in the length of their 4 repeats 4
DNA repeats for a large number of

individual STRs. As every individual 7 repeats 2
has their own unique numbers
Pair of homologous chromosomes
of repeats, this forms the basis of
identification. FIGURE 6.37 STRs vary between individuals.
9780170452922
6.2 Superb fairy-wrens – not as faithful as you thought!

NOITACILPPA DNA profiling can be used to
determine paternity. Through the use
of microsatellite markers, a type of
STR, researchers have established that
approximately three in four superb
fairy-wren (Malurus cyaneus) chicks are
sired by a male other than their social
fathers. This has come as a surprise,
because females have never been seen
tsiwT neB/emitsmaerD
copulating with males other than
their partners. It is believed that all
copulations with other males take place
under the cover of darkness, either early FIGURE 6.38 Paternity testing shows that superb
in the morning or late in the evening. fairy-wrens are promiscuous.
Questions
1 What is paternity testing?
2 Describe three different uses of paternity testing.
3 Are there any disadvantages in using paternity testing?
Key concept
DNA sequencing and profiling use the tools and techniques of biotechnology to study a species’
complete genome and identify individuals within a species.
Question set 6.5

REMEMBERING 4 Explain how DNA profiles enable
1 What does the acronym ‘STR’ stand scientists to distinguish between two
for? individuals. Describe the factor that
2 List three genetic tools or techniques used makes them unique.
to build an individual’s DNA profile. ANALYSING
UNDERSTANDING 5 Analyse the image below to work out
3 Describe the role of PCR and gel which DNA profile (labelled 1–3) matches
electrophoresis in DNA profiling. the STRs found in the individual’s DNA.
A B C
900 550 50 1200 250 100 Length of STR
Restriction sites
1 2 3
-
Direction of DNA fragment lengths

movement as seen with
gel electrophoresis
FIGURE 6.39 DNA profiles of three individuals
9780170452922
6.6 RECOMBINANT DNA TECHNOLOGY AND

TRANSGENIC ORGANISMS
Recombinant DNA is DNA that is composed of one or more genes from two different organisms,
usually two different species. ‘Foreign’ DNA is transferred into the genome of the host organism and
is then expressed in the host. The host organism is known as a transgenic organism or a genetically
modified organism (GMO). The introduced gene instructs the transgenic organism to produce the
desired trait through gene expression. The trait may be passed on to future generations. Recombinant
DNA technology is widely used in agriculture, environmental conservation and medicine. Many
careers that require this technology include agricultural, environmental, medical, veterinary and
forensic science.
Recombinant DNA technology includes the use of DNA tools and techniques including restriction
enzymes, ligases, vectors and cloning. A vector can be introduced into a host organism, which is
grown to produce multiple copies of an incorporated DNA fragment in culture (gene cloning). Next,
clones containing a relevant DNA fragment may be selected and harvested. This process involves the
insertion of DNA fragments that have a desirable gene sequence (from a variety of sources) into a
target organism via an appropriate vector.
Many scientists work on transforming organisms into transgenic organisms. Transgenic
organisms have been engineered for a variety of desirable traits, including disease-resistance,
faster growth rate, greater product quality and yield, and tolerance to adverse environmental
conditions. For example, a sheep may be transformed with a gene for the blood clotting factor IX
so that this protein is secreted in its milk. Factor IX can then be harvested from the milk and used
to treat people with certain forms of haemophilia. For genes to be inserted into complex animals
and plants, a method is needed for delivering the gene to the organism’s cells. The gene needs to
be able to function when it arrives in the host organism, whether it is a plant or an animal.
Plasmids are a common tool used by scientists to produce recombinant bacteria. Plasmids
have been highly engineered as vectors for molecular cloning and for the subsequent large-scale
production of important molecules, such as insulin. A valuable characteristic of plasmid vectors is
the ease with which a foreign DNA fragment can be introduced. The same principles apply when
plasmids are used as vectors for larger host organisms. Several human proteins are expressed in the
milk of transgenic sheep and goats, and some are expressed in the eggs of chickens. Staples like
corn, potatoes and tomatoes were the first crop plants to be genetically engineered.
Plasmids are used to insert DNA into bacteria. A plasmid is a circular piece of DNA that is
found in bacteria and which reproduces independently of the bacterial chromosome. The key
to using plasmids as DNA copiers lies in our ability to incorporate foreign genes into plasmid
DNA and in their ability to replicate in bacteria. A number of steps are involved in this process
(Table 6.7, pages 196–197). An alternative to using PCR to generate a large number of copies of a
DNA sequence is to insert it into bacteria. This process is called gene cloning and it has multiple
advantages. It allows replication of larger segments of DNA and permits the analysis of any gene,
and its associated proteins, including those of DNA sequences from the environment where the
organisms are living and active.
9780170452922
TABLE 6.7 Summary of the technique used to create a transgenic organism (GMO) using a plasmid
STEP DESCRIPTION VISUAL AID
Identify and isolate The use of DNA sequencing or mapping Cutting donor DNA
A-A-T-T-C-A-C-C-
the desired gene may help scientists locate a desired gene.
Extract using To cut the gene of interest out of a Sticky end G-T-G-G-
restriction enzymes donor organism, an enzyme that cuts

at a specific recognition site is used. (It -C-T-C-G-A-T-G Sticky end
does not cut at a random site but only at
-G-A-G-C-T-A-C-T-T-A-A
the sequence of nucleotides it codes for.)
Use the same Plasmids are extracted from bacteria by
restriction enzymes rupturing the cell walls. Then the plasmid
Plasmid Sticky end
to cut the plasmid/ is cut open using the same restriction
vector enzyme that was used for the gene to be
inserted, so that both pieces of DNA have
complementary sticky ends.
FIGURE 6.40 The same restriction enzyme is used to cut the donor
DNA and the plasmid DNA.
Annealing and Weak attractive forces (hydrogen bonds) DNA fragments join
at sticky ends Sticky end
ligation draw the complementary nucleotides
together. This is annealing. Then DNA
G
ligase binds the foreign DNA fragment A A T T
C T T A A
into the plasmid DNA (‘ligation’) by
Sticky end
catalysing the formation of two covalent
phosphodiester bonds between the 3'
hydroxyl group of one nucleotide and
the 5' phosphate group of another. After
binding, the DNA fragment becomes
a permanent part of the recombinant Recombinant DNA
plasmid.
FIGURE 6.41 Annealing occurs between the complementary sticky
ends, and ligation joins the sugar–phosphate backbone between the
two fragments.
Place recombinant The recombinant plasmids function as Chromosome Plasmid
plasmid into bacteria vectors as they are added to a bacterial DNA fragment
containing the required
for cloning culture. They are taken up by some
gene (code for
bacteria, in which they replicate many insulin production)
times. This is known as gene cloning.
In the normal process of growth and
division, bacteria replicate the plasmid
via binary fission, and thus numerous
copies of the incorporated foreign DNA
are made. Recombinant
DNA
Transformation and The process of bacteria taking up the
expression plasmid (containing foreign DNA) and
incorporating the desired gene into its
genome is called transformation. If the Binary fission
gene is expressed, it has been transcribed
and translated into a protein that may be
used by the host organism. Insulin-
producing
bacteria
FIGURE 6.42 Transformation of bacteria and gene expression
9780170452922
STEP DESCRIPTION VISUAL AID

Vector for another To make a transgenic species, the Enzymes
host organism bacterial vector is inserted into a host
Bt gene
organism by a gene gun or other
method, such as mixing it with embryos.
An example of this is Bt corn – a
recombinant corn species that contains
Bt gene insertion
the Bt gene for insect resistance. into corn expression
New phenotype The desired gene expression is the cassette
observed phenotype that was originally observed

in the donating organism. For example,
Promoter Terminator
Bt corn has a new phenotype of
resistance to cotton bollworm. The
desired gene was found in a Bt bacterial Bacterial vector
cell. containing multiplied
transgene
Plasmid
Foreign genes
inserted into
the corn cell
genome
GM corn
FIGURE 6.43 Bacterial vectors can deliver the target gene into a host.
Vectors: transferring genes

A number of different methods, including gene guns with gold particles coated in DNA, have been
used to deliver genes. In most cases, the gene is inserted into a vector that will carry the gene to
the target organism. In this context, a vector is a tool that can be used to transport DNA from one
organism to a recipient host. Plasmids and viruses can act as vectors because they can transport small
sections of DNA from one organism to another.
Plasmid vectors
Agrobacterium tumefaciens is a bacterium that acts like a vector in nature by transferring genes found
on its plasmids to other organisms. It is commonly used in recombinant DNA technology. Plasmids
can be copied numerous times, regardless of whether the bacterial host is replicating its own DNA,
and every time a plasmid vector is replicated, so is the introduced DNA that it contains. Purified
recombinant plasmids can be inserted into a new organism directly. However, despite showing great
potential, this method is not currently an efficient method of gene delivery, because plasmid DNA is
not very stable in body cells in this form.
9780170452922
Viral vectors
Viruses infect target cells by injecting their nucleic acid into the host cell. By using recombinant DNA
techniques, it is possible to insert desired genes into viral DNA or RNA, and use the virus to insert this
new gene into the target cells. Viruses can accept large DNA inserts, making it relatively easy for them
to accept foreign genes. As viruses are pathogens, it is also necessary to remove or disable the genes
Mechanism of in the virus that cause disease symptoms. Two types of virus currently being used in this way are the
recombination (genetic adenovirus and the retrovirus (Figure 6.44). The main problem with using viruses as vectors is that
engineering) human immune systems attack viruses, and this may decrease their chance of survival within their
Watch the animation
then answer the new host. Furthermore, viral DNA insertion in the host genome can sometimes disrupt normal gene
questions below. regulation and result in the development of cancer.
a b Human gene
within retrovirus
FIGURE 6.44 A vector can be a an adenovirus or b a retrovirus.
Key concept
Recombinant DNA technology uses the tools and techniques of biotechnology to create
transgenic organisms (combining foreign DNA with host DNA). Vectors can be used as
transgenic organisms to transfer genes into another organism.
Question set 6.6

REMEMBERING • A gene is inserted into a plasmid,
1 Define transgenic organism. usually by joining sticky ends
2 Define vector. and complementary base pairing
3 List some desirable traits that inspire (annealing).
scientists to create transgenic organisms. • The sticky ends are sealed together by
UNDERSTANDING DNA ligase.
4 Draw a labelled and annotated diagram to • The recombinant plasmids are
show the sequence of events that results cloned and many copies produced
in the formation of recombinant DNA. OR the recombinant plasmids are
inserted into new host cells (via a
Annotations to include: virus, a bacteriophage or a bacterial
• A gene of interest is isolated and cut vector) by shooting, spraying,
out with a restriction enzyme, and microencapsulation or heat treatment.
a plasmid is cut open with the same • A gene is expressed in a recombinant
restriction enzyme. organism.
9780170452922
CHAPTER 6 ACTIVITY AND INVESTIGATIONS

Brood parasitism and family size in black swans 6.1
Family size in black swans usually varies between one and seven. Interestingly, family size
YTIVITCA
distribution seems to be bimodal, with some families containing 1–3 cygnets, but others containing
up to about 14 cygnets. This has led many to speculate that the larger families are the result of brood
parasitism – a female laying her eggs in the nest of a second female and leaving this second female
to raise her young. This process is quite common in ducks but has not been investigated thus far in
black swans.
One way to determine whether a female is the biological mother of her cygnet is to create a DNA
profile for both the mother and the cygnet and determine whether the cygnet shares half of the
mother’s profile.
Aim
To determine, using DNA profiling, whether brood parasitism occurs in black swans and whether this
might explain the larger number of cygnets in some families
You will need
Each student will require a ruler.
What to do
Consider the DNA profile in Figure 6.50 (page 212). The necessary DNA was obtained by capturing
swans, collecting a small blood sample from each, and extracting the DNA. Five STRs have been
identified in black swans (Cam1, Cam2, Cam3, Cam4 and Cam5). Using PCR, these five regions were
amplified in all of the adults and cygnets from eight families of swans. The PCR products were then
separated using agarose gel electrophoresis. Figure 6.50 shows the resulting gel. Each individual has
two alleles for each STR, but sometimes only one band is observed (if the individual has two identical
alleles).
Compare the profile of the mother of each family with the profile of each cygnet in her family and
determine whether the female could have been the biological mother.
Results
Copy the table below and record the results in the second column.
FAMILY BIOLOGICAL CYGNETS PARASITIC CYGNETS
9780170452922
1 Calculate the proportion of parasitic cygnets in each family and include the results in the third
column.
2 Does there appear to be any difference in the proportion of parasitic cygnets between small and
large families?
Analysis of results
1 Using your results, identify any evidence of brood parasitism in black swans.
2 Calculate the maximum proportion of parasitic cygnets in this sample.
Discussion
1 Explain whether your results support the belief that large black swan families are the result of
brood parasitism.
2 Describe how you could determine whether a cygnet has been fathered by a male other than its
social father.
6.1 Bacterial transformation

Background
NOITAGITSEVNI
DNA can mutate spontaneously or after an error is made in DNA replication. Biotechnologists have
developed methods of controlling DNA mutation, intentionally mutating cell DNA to alter how the
cell behaves. In addition, it is possible to transfer DNA from one organism into another. This is called
genetic transformation, and it uses an engineered molecule of DNA to transfer a gene or genes from
one organism to another so that the target organism is capable of producing the protein encoded by
the transforming gene.
Aim
To perform a bacterial transformation using the green fluorescent protein plasmid pGreen
Time requirement
50 minutes
Materials
• Escherichia coli (E.coli) MM294 starter plate
• 10 μL pGreen plasmid
• 2 Luria broth (LB) agar plates
• 2 LB with ampicillin agar plates
• 10 mL LB, sterile
• 10 mL CaCl2, 50 mmol L-1, sterile, ice cold
• 2 transformation tubes, sterile
• 8 plastic pipettes, 1 mL, sterile
• 3 inoculation loops, sterile, disposable
• 4 inoculation spreaders, sterile, disposable
• 2-20 μL variable micropipette
• Sterile tips for 2-20 µL micropipette
• Water bath
• Ice bath
• Fine-point marker pen
9780170452922
• Stopwatch
• Microtube rack
• Adhesive tape (to seal plates)
• Thermometer
• Incubator
• Ethanol
• PPE: lab coats, safety glasses, disposable glove
Risks
Some bacteria may cause disease, so assume them to be Wear lab coats, safety glasses and gloves; wash hands
pathogenic. thoroughly at end of activity.
(Note: E. coli MM294 is a harmless school-safe Decontaminate benches before and after activity. Flood
biological) spills with bleach.
Dispose of plates appropriately after autoclaving.
Disinfectants or bleach may leave a corrosive residue. After wiping the bench clean with bleach, ensure the
residue is wiped off; ensure lab coat sleeves are rolled
down and gloves are worn.
Procedure – Preparing the transformation solution

To use aseptic technique, wipe your bench down with ethanol (or
bleach) and keep your work near the Bunsen burner to waft potential
contaminants away from your materials.
1 Label one transformation tube ‘+ plasmid’ and the other
‘– plasmid’. Keep the tubes cold by placing them upright in the 1.5 1.5
ice bath. Tubes should be kept capped at all times except when
in use. 1.0 1.0
2 Add 250 μL of ice-cold CaCl2 solution to each transformation + -
tube, using a sterile plastic pipette. Maintain the temperature by 0.5 0.5
placing the tubes back into the ice bath.

0.1 0.1
Procedure – Suspending the bacteria
1 Transfer a single colony of E. coli from the starter plate to the
ice-cold CaCl2 solution in the ‘+ plasmid’ transformation tube
using a sterile inoculation loop. To dislodge the
E. coli cells from the loop, spin the loop rapidly in the
solution. Observe whether the cell mass has transferred
successfully.
2 Immediately pump the liquid in the tube several times
to suspend the cell mass in the CaCl2 solution using a
sterile 1-mL transfer pipette. Do not entrain air bubbles
in the liquid or allow any liquid to splash up the sides of
the tube. You should see the solution begin to become
milky white as the cell mass is suspended. To check
there are no lumps or particles in the tube, hold it up to
the light; then return the tube to the ice.
3 Repeating the same steps as for the ‘+ plasmid’
transformation tube, transfer a single colony of E. coli
from the starter plate to the ice-cold CaCl2 solution in
9780170452922
the ‘– plasmid’ transformation tube using a sterile inoculation loop. To dislodge the E. coli cells
from the loop, spin the loop rapidly in the solution. Observe whether the cell mass has transferred
successfully.
4 Immediately pump the liquid in the tube several times to suspend the cell mass in the CaCl2
solution using a sterile plastic pipette. Do not entrain air bubbles in the liquid or allow any liquid
to splash up the sides of the tube. You should see the solution begin to become milky white as the
cell mass is suspended. To check there are no lumps or particles in the tube, hold it up to the light;
then return the tube to the ice.
Procedure – Adding the plasmid
1 The technician or your teacher will
bring the plasmid to your work
station. Transfer 10 μL of plasmid
solution to the transformation
tube labelled ‘+ plasmid’ using a LB LB/AMP
micropipette. Add the plasmid + plasmid + plasmid
directly to the liquid in the tube

without allowing it to touch the sides.
2 Immediately return the tube to the
ice bath and mix the plasmid into
the bacterial suspension by rapidly
spinning a sterile inoculation loop
with your fingers. Incubate the two
tubes for 15 minutes on ice.
3 Label the four plates as follows: LB
– plasmid
LB/AMP
– plasmid
The first LB plate: ‘LB + plasmid’
The second LB plate: ‘LB – plasmid’
The first LB/Amp plate: ‘LB/Amp +
plasmid’
The second LB/Amp plate: ‘LB/Amp –
plasmid’
Procedure – Heat shock
1 Extract the two tubes from the ice bath, transfer them to the warm water bath (42°C) and
hold them there for 90 seconds with your gloved hands, keeping the tube caps from being
fully submerged in the water. Gently agitate the tubes while they are warming up in the water.
Immediately move the tubes back to the ice bath when the time is up.
2 Allow the tubes to rest in the ice bath for at least 1 minute before continuing.
Procedure – Recovery
1 Add 250 μL of Luria broth to each tube using a sterile plastic pipette. Mix the liquids at the base of
each tube by gently grasping the top and tapping the base with your finger.
2 Allow the tubes to recover in the microtube rack at room temperature for 10 minutes.
Procedure – Plate inoculation
1 Transfer two drops of liquid from the ‘+ plasmid’ tube to the ‘LB + plasmid’ plate using a sterile
plastic pipette. Quickly spread the liquid evenly over the plate surface using a sterile spreader.
2 Transfer two drops of liquid from the ‘+ plasmid’ tube to the ‘LB/Amp + plasmid’ plate using a sterile
3 Transfer two drops of liquid from the ‘– plasmid tube’ to the ‘LB – plasmid plate’ using a sterile
9780170452922
4 Transfer two drops of liquid from the ‘– plasmid’ tube to the ‘LB/Amp – plasmid’ plate using
a sterile plastic pipette. Quickly spread the liquid evenly over the plate surface using a sterile
spreader.
1.5 1.5
LB LB/AMP
1.0 1.0
+ plasmid + plasmid
+ +
0.5 0.5
0.1 0.1
1.5 1.5
LB LB/AMP
1.0 1.0
– plasmid – plasmid
– –
0.5 0.5
0.1 0.1
5 Secure the lid of each petri dish to its base using tape. Leave the plates to rest on the bench
for 5 minutes and then place them in a 33°C incubator for 24–36 hours. You can inspect the
growth after this time. You should see either a bacterial lawn, single colonies, or no growth on
the individual plates. Take the plates into a dark room to observe evidence of fluorescence in the
transformed colonies. (Use of a UV light may enhance the fluorescence.)
6 To count the number of individual colonies, mark each colony with a marker as you count it. Any
plates with cell growth too dense to count as individual colonies can be marked as a ‘lawn’.
Results
1 Record the results of your experiment in a copy of Table 6.8 below.
TABLE 6.8 Bacterial colony results
PLATE RESULT
- Plasmid on LB agar
+ Plasmid on LB agar
- Plasmid on LB/Amp agar
+ Plasmid on LB/Amp agar
2 What growth and phenotypes can you observe?

3 Describe what you see on your plates when you look at your plates under UV light?
Discussion
1 Why is the plasmid–bacteria solution placed on ice for 5 minutes?
2 Which plate forms the control in this experiment? Explain.
3 Explain the function of the Luria broth. What is the purpose of incubating the cells at room
temperature?
4 Explain how the DNA plasmid is put into bacteria. What is the advantage of being able to do this?
Consider what the plasmid DNA allows the bacteria to do.
5 Explain how we are able to recognise that the plasmid DNA is in the bacteria.
6 Explain what a plasmid is.
9780170452922
Conclusion
Summarise your findings and discuss your results.
Taking it further
Investigate how genetic engineering and bacterial transformation enable the advancement of medical
treatments; for example, in insulin production.
6.2 The effect of restriction digestion enzymes

on Lambda DNA
NOITAGITSEVNI
Background
Restriction digestion is the process of cutting DNA molecules into smaller pieces with special
enzymes called restriction endonucleases (or restriction enzymes). These special enzymes recognise
specific sequences in the DNA molecule (e.g. EcoRI GAATTC) wherever that sequence occurs.
Aims
To use restriction enzymes to cut DNA into fragments
To analyse restriction digestion using gel electrophoresis apparatus
Time requirement
55 minutes
Restriction digestion materials
• 8 μL Lambda DNA (1 μg)/ μL
• 20 μL restriction digestion buffer
• 1 μL EcoRI enzyme
• 1 μL HindIII enzyme
• 1 μL BamHI enzyme
• 200 μL sterile nuclease-free water
• 4 sterile 0.5 mL (500 μL) microtubes
• 5–50 μL variable pipette
• 0.5–10 μL variable micropipette
• Microtube rack
• Sterile pipette tips
• Water bath
• Micro-centrifuge (optional)
• PPE: lab coats, safety glasses, disposable gloves
Electrophoresis materials
• 25 μL TBE buffer
• 0.8% agarose gel with 2 μL of Midori green safe stain (for pre-staining technique)
• 50 μL loading dye
• 2–20-μL variable micropipette
• Electrophoresis chamber (blue-gel)
• Power supply 100 V (if using an alternative to blue-gel)
• Blue-light transilluminator (optional)
9780170452922
Please note: the above measurements are based on using a blue-gel electrophoresis apparatus. If an
alternative electrophoresis chamber is being used, increase the TBE quantities based on chamber size.
Risks
WHAT ARE THE RISKS IN THIS HOW CAN YOU MANAGE THESE RISKS TO STAY SAFE?
INVESTIGATION?
TBE buffer can cause skin irritation. Wear appropriate personal protective equipment at all times, including
eye protection and gloves. Wash skin immediately if contact does occur.
Disposable gloves may pose allergy risk. Use a type of glove that has no allergy risk and is suitable for the
chemicals being used.
Procedure – Restriction digestion

1 Collect four 0.5 mL microtubes, and label them as follows:
Key
1.5 1.5 1.5 1.5
H = HindIII
1.0 1.0 1.0 1.0 E = EcoRI
H E B C B = BamHI
0.5 0.5 0.5 0.5
C = Control
0.1 0.1 0.1 0.1
2 Using a micropipette, add 42 μL of nuclease-free water to each of the microtubes.

3 Add 2 μL of Lambda DNA to each of the microtubes.
4 Using a fresh micropipette tip, add 5 μL of restriction digestion buffer to microtubes ‘E’, ‘B’, ‘H’ and
‘C’.
5 Using a fresh micropipette tip for each sample, add 1 μL of the EcoRI enzyme to ‘E’, 1 μL of the
BamHI enzyme to ‘B’, 1 μL of the HindIII enzyme to ‘H’ and 1 μL of nuclease-free water to ‘C’.
6 Mix the samples thoroughly by pipetting up and down a few times using the larger micropipette
with fresh tips for each sample. Continue until the samples have an even consistency. To collect
the liquid at the base of the tubes, spin with a microcentrifuge.
7 Place the microtubes in a 37°C water bath for 10 minutes.
Procedure – Analysing your digestion using gel electrophoresis
1 Collect the four tubes from the water bath and add 10 μL of loading dye to each sample.
2 Mix the samples thoroughly by pipetting up and down a few times using the larger micropipette
with fresh tips for each sample until the solutions look consistent throughout. To collect the liquid
at the base of the tubes, spin with a micro-centrifuge. Your samples are now ready to be loaded
into the gel.
3 Place the prepared 0.8% agarose gel into the gel electrophoresis chamber, ensuring that the wells
are at the top or negative electrode section of the chamber.
4 Pour TBE buffer into your gel electrophoresis chamber, ensuring the surface of the gel is
completely covered.
5 Using a fresh pipette tip for each sample, load 10 μL of each of your restriction digest samples into
the wells located near the negative electrode and note the specific lanes into which the different
samples were loaded.
6 Carefully place the lid on the gel chamber, press the ‘on’ button and let the gel run for 30 minutes.
(Turn on the built-in blue light to visualise the DNA band separation if using a blue-gel
electrophoresis chamber.)
9780170452922
Note: if using a gel electrophoresis chamber that requires an external power supply, carefully
plug the positive and negative electrodes into the gel box without dislodging the gel. The negative
end should be connected to the end closest to the DNA samples. Plug the power source in (set at
100 V), turn it on and let the gel run.
7 After 30 minutes has passed, turn the power supply off and visualise your results either by
turning on the blue light or transferring the gel to a blue-light transilluminator.
(Note: if you are using the post-strain method, the DNA will not be visible until the gel has been
soaked in methylene blue or an equivalent dye for up to 24 hours.)
Results
1 How many cuts did each restriction enzyme make?
2 Measure the distance travelled by the DNA fragments in millimetres and fill in a copy of the table
below.
3 Graph your results for HindIII digest to determine the sizes of the EcoRI digest and or BamHI
digest. [Try graphing the Log (base pairs) vs distance.]
4 Do those fragments add up to the size of Lambda DNA? If not, provide a possible explanation(s) as
to why not.
Analysis of restriction digests of DNA
HindIII EcoRI BamHI
DISTANCE SIZE (BP) DISTANCE CALCULATED SIZE (BP) DISTANCE CALCULATED SIZE (BP)
(mm) (mm) NO. OF BP (mm) NO. OF BP
23 130 21 226 16 841
9 416
6 557
4 361
2 322
2 027
Discussion
1 Why was 1 μL of nuclease-free water added to the microtube labelled ‘C’?
2 Why do we incubate the restriction digests at 37°C?
3 What is the purpose of the dye?
4 What would occur if the gel electrophoresis chamber was filled with distilled water instead of TBE
buffer?
5 Explain why DNA samples must be loaded at the negative end of a gel electrophoresis chamber.
6 What would occur if the electrodes in the electrophoresis chamber were reversed?
Conclusion
Summarise your findings and discuss your results.
Taking it further
Investigate real-world examples of where restriction enzymes are used and how they assist in medical
disease diagnosis.
9780170452922
• Biotechnology provides ways to improve separate DNA fragments according to size Chapter 6
Activity sheet
our lives and the health of our planet by and to visualise them by using a DNA-
extracting, analysing and manipulating DNA binding dye that fluoresces under UV light.
to make useful products. • Gene probing uses a single-stranded DNA
• DNA biotechnology uses tools such as molecule to identify, isolate or find the
restriction enzymes, plasmids, vectors and position of a gene on a chromosome.
microarrays. Multiple probes form a microarray and help
• DNA biotechnology techniques include scientists measure gene expression.
DNA sequencing, PCR, gel electrophoresis • DNA sequencing allows determination
and recombinant DNA. of the exact nucleotide sequence of DNA
• Restriction enzymes are enzymes isolated fragments. Sequencing can help to identify
from bacteria that cut DNA at specific sites genetic mutations that cause disease, and
known as restriction sites. These sites are also enable gene mapping.
four to eight nucleotides long. Cutting can • DNA profiling is a technique that can be
result in the formation of either sticky ends used to create individual genetic profiles in
or blunt ends. order to differentiate between the DNA of
• DNA ligase is an enzyme used to join two individuals of the same species.
DNA molecules with complementary sticky • Genes can be transferred from one organism
ends or with blunt ends. to another using different vectors, including
• DNA polymerase uses complementary plasmids and viruses, using recombinant
base pairing to synthesise new fragments DNA techniques.
of DNA. • Gene cloning is a process through which a
• Primers use complementary base pairing to large number of copies of a gene of interest
mark a target strand of DNA, showing DNA can be made in bacteria by incorporating the
polymerase where to begin synthesis. gene in a plasmid.
• PCR is a process through which a specific • Transgenic organisms (genetically modified
DNA sequence can be amplified for analysis. organisms) have genes from foreign DNA
• Using gel electrophoresis, it is possible to inserted into their genome.
CHAPTER 6 GLOSSARY
Agarose gel The medium commonly used for Biotechnology The use of living organisms
electrophoresis of proteins and nucleic acids. It and biological systems and processes for human
allows these molecules and an electric current benefit
to flow through it, but also acts as a sieve, Blunt end The end of a DNA fragment that
sorting out the different-sized fragments; shorter is created following cleavage by a restriction
DNA fragments migrate through the gel more enzyme that cuts DNA at the same position on
quickly than longer ones both strands
Annealing In PCR, annealing is the process of Denature In PCR, denaturing is changing
joining separate strands of DNA together as a the molecular structure of a protein or DNA
result of hydrogen bond pairing; it occurs when by applying a high temperature; in DNA, the
the temperature is lowered hydrogen bonds break and the two strands
Band on the gel A well-defined line in a lane separate
on a gel; it contains millions of pieces of DNA of DNA ligase An enzyme used to catalyse the
the same size formation of a bond between two pieces of DNA
9780170452922
DNA polymerase A member of a class may include short DNA sequences, such as
of enzymes found in all living things, STRs, or they may be whole genes
which synthesises new strands of DNA See
Genetically modified organism (GMO)
based on a template strand and according
transgenic organism
to complementary base-pair rules; DNA
polymerases are important tools in Genome All of the genetic material contained
in an organism or a cell; it includes the
biotechnology because they are capable of
chromosomes within the nucleus and the DNA
making exact copies of fragments of DNA,
in mitochondria and chloroplasts
enabling efficient and accurate amplification of
DNA templates Ladder A standard collection of DNA
DNA profiling A process that is able to fragments of known lengths (molecular size
identify natural variations that exist within markers) used in gel electrophoresis
individual genomes, by using STRs, PCR and Lane A corridor through which DNA passes
gel electrophoresis after it leaves a well
DNA sequencing The process of establishing Linkage mapping Using frequencies of genes
the nucleotide sequence of a piece of DNA that cross over together to determine the relative
Ethidium bromide a chemical that binds to positions of genes on a chromosome in genetic
double-stranded DNA and fluoresces pink mapping
when exposed to ultraviolet light; used Micropipette A tool that dispenses small
to locate DNA in an agarose gel following amounts of samples into PCR tubes or into gel
electrophoresis wells; the volume is adjustable
Gel electrophoresis A technique that separates
Molecular size marker A piece of DNA of
large molecules (either fragments of DNA or known length; a set of molecular size markers
proteins) according to their size and charge, for are run alongside the samples in a gel to
visualisation and identification purposes estimate the size of the DNA fragments in the
Gene cloning The process of using plasmids sample (see ladder)
and bacteria to make numerous identical copies
Next-generation sequencing (NGS) An
of a gene
automatic process that finds the order of
Gene expression The translating of a gene nucleotides in a strand of DNA. The four
into a protein by an organism; the phenotype is nucleotides are labelled with four differently
directly affected by gene expression coloured fluorescent dyes. As electrophoresis
Gene probe A specific short length of single- proceeds, a laser scans across the bottom of
stranded DNA that can bind to a particular gene the gel, detecting the different dyes and thus
of interest the base sequence. A computer can then
Genetic engineering Manipulation of genetic automatically analyse the information from the
material, including altering DNA in an organism gel to read the base sequence.
to suppress or enhance a gene’s activity, or Physical mapping A precise description of a
combining genetic material from different gene’s position on a chromosome; the gene’s
species position is measured and located by the use of
Genetic mapping Identifying and recording base pairs
the relative positions of genes on a chromosome Plasmid A small circular piece of DNA,
using genetic markers, linkage mapping and found in bacteria that is able to replicate
physical mapping independently of the cell’s chromosomes;
Genetic marker A nucleotide sequence that is engineered plasmids can carry antibiotic-
associated with a specific trait; genetic markers resistance markers
9780170452922
Polymerase chain reaction (PCR) A cyclic between individuals and can be used in DNA
method used to rapidly amplify (replicate) profiling; an STR has a repeat sequence of two
relatively small amounts of DNA into extremely to five bases
large amounts, for further laboratory uses such Sticky end The end of a DNA fragment that is
as gel electrophoresis and DNA profiling created when a restriction enzyme cuts DNA at
Primer A short fragment of single-stranded different positions on each of the two strands
nucleic acid (DNA or RNA); primers can be Thermal cycler A machine used in PCR
made in a laboratory, are about 20 nucleotides that provides tight control over both the
long and are usually labelled with an enzyme, reaction temperature and the duration of
or radioactive or fluorescent dye tag; a each temperature step, ensuring efficient
primer is attracted to a target DNA strand by amplification
complementary base pairing and marks where
Transformation The process by which DNA
elongation/synthesis should start is taken from one organism and inserted into
Recognition site A specific sequence of DNA at another organism, usually of another species, to
which a restriction enzyme will cut obtain a desired characteristic
Recombinant DNA technology Tools and Transgenic organism An organism that has
techniques used to transfer a gene from a cell been modified by incorporating into its genome
of a member of one species to the genome of a a piece of foreign DNA; also called a genetically
different species modified organism (GMO)
Recombinant plasmid A plasmid with foreign Variable nucleotide tandem repeats (VNTRs)
DNA inserted into it Short non-coding regions of DNA that are
repeated many times in the genome of an
Restriction endonuclease (restriction enzyme)
An enzyme that cuts DNA at a specific organism; they are highly variable between
restriction site individuals and can be used in DNA profiling;
VNTRs have a repeat sequence of more than
Restriction enzyme See restriction five bases
endonuclease
Vector In medicine, a vector is an agent that
Restriction fragment A short fragment of DNA transmits pathogens from one host to another;
generated when a restriction enzyme cuts a in genetics, it refers to a vehicle used to transfer
longer DNA sequence DNA sequences from one organism to another
Restriction site A specific nucleotide sequence, Well An indentation in a gel used in a gel
usually 4–8 base pairs long, that is recognised as electrophoresis apparatus. It is made by
a cleaving site for a restriction enzyme inserting a comb into the gel as it sets and is
Short tandem repeat (STR) A short non-coding placed at the negatively charged end of the
region of DNA that is repeated many times in apparatus. DNA samples and a standard are
the genome of an organism; it is highly variable pipetted into a row of wells
9780170452922

Remembering
1 Match each item in the first column with a description in the second column. Each item can
only be used once.
DNA ligase Small circular self-replicating DNA molecule
Vector Sorts DNA molecules based on size and charge
Primer Joins two single-stranded sections of DNA together
Sticky ends Specific site at which restriction enzymes cut DNA
Plasmid Vehicle to introduce DNA into a host cell
Restriction site An enzyme that catalyses the synthesis of DNA
Gel electrophoresis Result from cleavage by a restriction enzyme at different positions on the two strands of DNA
DNA polymerase Synthetic short, single-stranded DNA molecule
2 Recall the two most common virus vectors.

3 State why the temperature is lowered to 50–60ºC during the annealing phase of PCR.
Understanding
4 Predict whether the following cuts made by restriction enzymes will produce sticky or blunt
ends. The arrows show where the cuts occur in the double-stranded DNA.
a b c
TCCGCGGA AGGGCCT GCGGCCGC
AGGCGCCT TCCCGGA CGCCGGCG
FIGURE 6.45 Restriction enzymes cutting DNA

5 Summarise why radioactive or fluorescent tags are added to gene probes.
6 Outline the major disadvantage of using viruses as vectors to transfer genes from one organism
to another.
Applying
7 Predict the minimum band-sharing percentage in the DNA profiles of a mother and her baby.
8 Look carefully at the gel in Figure 6.47. Based on the figure, match the size of fragments in
lanes 1, 2, 3 and 4 to the sets of measurements presented below.
Power supply Lane 1 Lane 2 Lane 3 Lane 4
Electrode – + Electrode
Buffer
Sample solution
wells
Direction
of movement
Electrophoresis tank
FIGURE 6.46 DNA electrophoresis kit FIGURE 6.47 Electrophoresis gel
9780170452922
a 200, 250 and 900 bp

b 150, 400 and 600 bp
c 50, 450 and 650 bp
d 100, 100 and 450 bp
9 Predict whether digestion of the human genome with AluI or EcoRI would result in the larger
number of fragments.
10 The section of DNA in Figure 6.48 shows a sequence of 120 bases in one strand of DNA. Refer
to Table 6.2 on page 171 for restriction sites.
A T A T G T G T GGA T CCG T C T T AGG T T A TCG A A T T CT AG AGCT
ATGGC CT A T T AGC T TC C TGGA TCC A A CCTG TA T AGAGCT A
C T CG T CA G C T ATTGC T A CG G G AT C C T AGC TG A T T GGA T T C
FIGURE 6.48 DNA sequence
a How many BamHI and AluI restriction sites are there in the sequence?
b If the sequence is cut by BamHI, how many kinds of fragments of DNA would be produced?
c If the sequence was cut by AluI, how many kinds of fragments of DNA would be produced?
d If the sequence was cut by both BamHI and AluI, how many kinds of fragments would be
produced?
e If the piece of DNA was circular and not linear, how many cuts would have been made by
BamHI to get the number of fragments stated in part b?
11 Looking at the profiles (Figure 6.50, page 212) of the black swan family of eight (family 3,
Figure 6.49), determine whether the male is the biological father of all cygnets.
alafibH/emitsmaerD
FIGURE 6.49 A black swan family
9780170452922
Family 1 Family 2 Family 3 Family 4
C1 C2 C1 C2 C3 C4 C5 C1 C2 C3 C4 C5 C6 C1 C2
Cam 1
Cam 2
Cam 3
Cam 4
Cam 5
Family 5 Family 6 Family 7 Family 8
C1 C2 C3 C1 C2 C3 C1 C2 C3 C4 C5 C6 C7 C1 C2
Cam 1
Cam 2
Cam 3
Cam 4
Cam 5
FIGURE 6.50 DNA profile for eight black swan families, which each include a social mother (♀), a social father (♂)
and cygnets (C)
Analysing
12 Identify some of the instances when only a small sample of DNA may be available.
Creating
13 Based on the knowledge you have acquired while studying this chapter, design a way to test
for a mutation resulting in the deletion of a region of 100 nucleotides that does not contain any
restriction sites.
14 Explain how you would use DNA profiling to design a breeding program that minimises
inbreeding of an endangered species.
Reflecting
15 Complete the following sentences
a Before I started studying this topic, I thought biotechnology involved …
b After studying this topic, I think biotechnology involves …
9780170452922

1 Which of the following statements about the 4 Which row in the following table correctly
movement of DNA fragments through an matches an enzyme with its function?
agarose gel is correct? [Q21 2015 SCSA]
A Larger fragments move faster than
smaller fragments because it is easier for ENZYME FUNCTION
them to move through the gel. Cuts a DNA molecule at a

A DNA polymerase
B Larger fragments move faster than specific sequence
smaller fragments because they have a B RNA polymerase Degrades RNA molecules
higher negative charge. C Ligase
Joins two DNA molecules
C Smaller fragments move faster than together
larger fragments because it is easier for D
Restriction Synthesises a new strand
them to move through the gel. enzyme of DNA
D Smaller fragments move faster than
5 A breeder kept only albino guinea pigs.
larger fragments because they have a
The breeder put one female and two
lower negative charge.
male guinea pigs in the same enclosure.
[Q8 2019 SCSA] The female had a litter of offspring. The
2 In genetic engineering, plant viruses are breeder wanted to know which of the
sometimes used to introduce a foreign gene male guinea pigs was the father of the
into a plant cell. This is because viruses are: litter. Explain how biotechnology can be
A non-living and therefore easy to store in used to determine the father of the litter.
the laboratory (4 marks)
B non-living and therefore there are no [Q33e 2018 SCSA]
ethical issues with using them in this
6 List the main steps involved in producing a
way
DNA profile for an organism. (4 marks)
C able to invade the cell and produce
a large number of viral particles very 7 A number of people who had visited a
quickly particular dental practice were later found
D able to invade the cell and merge their to be infected with a hepatitis virus. Health
genetic material with that of the cell. authorities suspected that these people had
[Q26 2018 SCSA] contracted the virus through the dental
practice. Explain how DNA profiling could
3 In gene cloning, the main purpose of
be used to determine whether this was the
plasmids is to
case. (4 marks)
A identify the gene for cloning
[Q35c 2016SCSA]
B extract the desired gene from a donor
organism 8 State the role that the following factors play
C produce many copies of the desired in gene cloning. (4 marks)
gene a restriction enzymes
D introduce the desired gene into a b ligase
recipient organism. c plasmid
[Q10 2015 SCSA] d vector
9780170452922
9 Chymosin is an enzyme produced to genetically modify bacteria to produce

by nursing calves to assist with the chymosin. (6 marks)
digestion of milk. Humans also use 10 Artificial selection and transgenesis (the
chymosin to make cheese. Traditionally, production of transgenic organisms) are
chymosin for cheesemaking was two methods that humans use to change the
obtained from the stomach of calves features of plants or animals. Describe how
that had been killed for their meat. artificial selection and transgenesis can each
It is now obtained from genetically be used to change the features of plants or
modified microorganisms. Describe how animals. (5 marks)
recombinant DNA technology can be used [Q38 2015 SCSA]
9780170452922
215
7
BIOTECHNOLOGY CHAPTER 7 CONTENT
IN AGRICULTURE By the end of this chapter, you will have covered the
following material.
AND STARTER QUESTIONS

1 Do you know any plant or animal species that are
endangered? Can biotechnology help save them?
ENVIRONMENTAL 2 How is biotechnology applied to agriculture? Are the
modifications proving to be beneficial or harmful?
CONSERVATION 3 How do you benefit from environmental conservation?
» recombinant DNA technology and DNA identification
technologies are applied in agriculture and environmental
conservation

» transgenic organisms have been engineered for desirable
traits, including resistance, faster growth rate, greater
product quality and yield, and tolerance to adverse
environmental conditions
» using transgenic organisms may have adverse effects on
genetic diversity and the environment, including
– the effects on non-target organisms
– more rapid evolution of pesticide-resistant species
– the possibility of gene flow from crop species to weed
species resulting in the emergence of ‘super weeds’
» biotechnology can be used in environmental conservation
for
– monitoring endangered species
– assessing gene pools for breeding programs
– quarantine
» conservation planning to maintain viable gene pools includes
consideration of
– biogeography
– reproductive behaviour
– population dynamics
9780170452922
7.1 DNA IDENTIFICATION TECHNOLOGIES

IN AGRICULTURE
Agriculture is the science of growing crops and livestock, and cultivating the soil and
micro-organisms in which they grow.
In the past several decades, science has allowed us to decipher much of the genetic code of the
crops and animals that are farmed. Instead of traditionally crossbreeding corn plants to determine
which traits cause them to, for example, grow taller or require less water, we can find the desirable
traits in the corn plant’s genetic map. Then we can use biotechnology to isolate the relevant gene
and transfer it into another plant, thus producing a new variety of plant that possesses the beneficial
characteristics.
Identification technologies can be used to accurately trace the genetics of desirable traits and to
pass those traits to other plants within a generation. These techniques are enabling scientists to increase
the availability and quality of food for our growing human population. To help increase the availability
and quality of food, scientists call on identification technologies, including the tools and techniques used
in building DNA profiles (fingerprints), such as analysing single tandem repeats (STRs). In addition, they
use restriction enzymes, polymerase chain reaction (PCR), gel electrophoresis, DNA sequencing, gene
markers and genome mapping.
Using marker-assisted breeding, plant scientists can examine the DNA of seeds to find the ones
that will produce the best plants. First, genetic markers are identified in a plant's DNA that are linked
to important traits such as disease resistance, drought tolerance, yield, taste or nutrition. The markers
are then used to screen all of the plants available for breeding and accurately select and breed only
the seeds that will produce plants with the desirable traits.
Application to wheat breeding

Wheat is an important staple, not only in human diets, but also in livestock feeds. It is the world’s most
widely cultivated crop. Leaf rust (Puccinia triticina) is a fungal leaf disease specific to wheat that can pose
a significant threat to the yield and quality of WA wheat crops, in some seasons causing up to 30% yield
loss in susceptible varieties. Yellow (stripe) rust (Puccinia striiformis) is another globally important disease
in wheat. Researchers at CSIRO have used PCR and gel electrophoresis to reveal molecular markers
for characterising loci that confer resistance in the adult plant to leaf rust and yellow (stripe) rust. They
have also established a biotechnology laboratory that is charged with acquiring, validating and applying
markers for certain traits that are important to wheat breeders. Use of PCR-based markers, coupled with
rapid DNA extraction procedures, has enabled the application of markers to a wide range of material.
Genetic engineering procedures have also been used to establish procedures for experimenting with
genes that confer resistance to various biotic and abiotic stresses in wheat.
a b
gnidrahtrebor/otohP kcotS ymalA
iroela/moc.kcotsrettuhS
FIGURE 7.1 a A healthy wheat crop; b wheat leaf displaying signs of wheat rust disease
9780170452922
CHAPTER 7 | Biotechnology in agriculture and environmental conservation 217
To meet the future demands of a projected

world population of 9.6 billion by 2050, wheat
productivity needs to increase by 1.6% each
year. To preserve biodiversity, water, and nutrient
resources, the majority of this increase has to
be achieved via crop and trait improvement on
land currently being cultivated, rather than by
.gnihsilbuP ORISC morf noissimrep htiw )8002( .la te lliG morf decudorpeR
committing new land to cultivation.
The wheat genome was sequenced and
published in 2018, and has enabled scientists to
undertake more accurate mapping of desirable
genes, such as disease-resistance genes.
With the reference genome sequence
completed, breeders have new tools for
addressing these challenges at their disposal.
They can rapidly identify genes and regulatory
elements underlying complex agronomic traits
such as yield, grain quality, resistance to fungal
diseases, and tolerance to abiotic stress –
and produce hardier wheat varieties. CSIRO FIGURE 7.2 Approximate locations of mapped leaf
has used PCR and gel electrophoresis to reveal rust–resistance genes on a map of wheat chromosomes
PCR markers that are now assisting farmers in
identifying genes that improve rust resistance.
Application to the pork industry

The Government of Western Australia issued the Western Australian Pork Industry Strategic Plan
2012–20 to increase consumption of fresh pork, increase productivity, reduce costs across the
supply chain, and develop and grow export markets for pork. DNA identification technologies play
an important role in the genetic management systems of this plan. The larger breeding companies
use computer programs like PIGBLUP to monitor the progress of their breeding program. BLUP is
an acronym for Best Linear Unbiased Prediction, and it can accelerate the rate of genetic progress
(especially for traits of low heritability, such as litter size) by giving a more accurate measure of each
animal’s breeding value.
PBMARKER takes into account information on molecular genetic markers in genetic evaluation.
Using molecular genetic information aids selection in economically important traits. These
identification technologies allow pig farmers to
select the pigs with the most desirable traits for Animal Genetics and
Breeding Unit
breeding. Desirable traits include increased litter For further information
size and growth rate, and improved carcase about animal genetics
addubaeurK nanawuhT/moc.kcotsrettuhS
quality (e.g. taste and tenderness). A side effect and breeding, visit
the Animal Genetics
of selecting genetically superior animals is the and Breeding Unit
increase in genetic relatedness and decreasing website developed by
genetic diversity within the population. More
the University of New
England in New South
information on breeding programs is available Wales.
from the Animal Genetics and Breeding Unit
based at the University of New England in New
South Wales. FIGURE 7.3 Breeding superior pigs to increase productivity
9780170452922
Key concept
Biotechnology is used in agriculture to improve yield, quality and productivity of crops and
animals. However, this can result in reduced genetic diversity in the population.
Question set 7.1

REMEMBERING
1 Define agriculture.
2 List three types of DNA identification technologies used in agriculture.
UNDERSTANDING
3 Describe the use of DNA identification technologies in breeding:
a wheat
b pigs.
4 In your answer to Question 3, state the desired trait(s) being pursued and the reason(s) why
they are desired by farmers.
7.2 RECOMBINANT DNA TECHNOLOGY

IN AGRICULTURE
Millions of people around the world are malnourished. Scientists have been using molecular
tools and techniques to modify food crops, resulting in increases in their nutritional value and
crop yields. Biotechnology has also been applied to reducing the impact of pests on crops, thus
increasing the amount of food available in developing countries. The process most commonly used
is transformation: taking a gene from one species and inserting it into another to obtain a desired
characteristic. The technology used for this process is termed recombinant DNA technology.
Transgenic organisms, also known as genetically modified organisms (GMOs), have been
engineered for desirable traits, including disease resistance, faster growth rate, greater product quality
and yield, and tolerance to adverse environmental conditions. Bioengineering is the combination of
biology and engineering tools to create a usable product like a transgenic organism.
The transfer of a desirable gene can be via a gene gun or a viral vector. Another interesting
method uses the soil bacterium Agrobacterium tumefaciens. This bacterium has evolved the ability to
penetrate cell walls with its plasmid and insert specific genes into the genome of the host plant cells.
The Ti plasmid in A. tumefaciens causes an infectious disease in plants known as crown gall disease
(see chapters 12–14). Scientists have learned how to control and make use of this phenomenon
in order to make GMOs that are desirable to humans. A desired gene is cut from a foreign source,
inserted into the Ti plasmid to make a recombinant plasmid, and returned to A. tumefaciens
for cloning. The bacterial vector can then be cultured with plant cells that are susceptible to
penetration by the Ti plasmid. Once the plasmid has penetrated a host cell, the genes are be inserted,
transforming the host plant into a genetically modified (GM) crop. The petri dish GMOs can then be
cross-bred with breeding stock many times.
Transgenic organisms engineered for resistance

Herbicide-resistant crops
A major problem for farmers is the large number of weeds that grow throughout their crops.
Herbicides are substances used to control weeds, ideally leaving a crop unharmed. They can be
classified as selective or non-selective, depending on the types of plants they affect. Spraying
herbicides on crops to kill the weeds usually damages the crop as well. Herbicide-tolerant crops have
9780170452922
been developed, which are proving to be an effective solution for farmers. These include canola,
soybean and sugar beet. There are a few different GM soybeans grown in Australia. The popular
glyphosate-resistant Roundup Ready® soybeans have a gene inserted into them from a bacterium.
Roundup Ready crops are tolerant to the herbicide called Roundup Ready, which contains the active
ingredient glyphosate. Glyphosate inhibits a biochemical pathway in plants, preventing them from
producing essential amino acids and causing them to die.
Roundup is a brand name for the glyphosate herbicide. While Roundup is a great weed killer, its
broad-spectrum effects make it a crop killer, too. A company named Monsanto was the first to make
a GM soybean resistant to glyphosate. In this case, the gene providing resistance to glyphosate was
taken from Agrobacterium.
Herbicide-resistant crops may be more productive and may be more environmentally sustainable,
but their use is questioned by many. It is too soon to be sure of the long-term effects on the
environment and on other organisms.
Protein
Protein
Regular crops/weeds Roundup Ready crop Regular crops/weeds Roundup Ready crop
FIGURE 7.4 Roundup Ready crops are resistant to glyphosate. Regular crops and weeds are inhibited from making essential proteins.
Disease-resistant crops
Stem rust is a disease of wheat in eastern
Australia. It is treated by spraying plants with
fungicides. However, the pathogens that cause
stem rust can develop resistance to fungicides,
and new strains of the stem rust frequently
appear. CSIRO has developed a method of
cnI sciP ngiseD/otohP kcotS ymalA
isolating the rust-resistant gene L6 from a

rust-resistant flax plant and then introducing
it into a rust-susceptible wheat plant. This
genetically engineered plant grows with
resistance to rust. Other similar examples
include ringspot virus-resistant papayas and
FIGURE 7.5 Bt cotton is resistant to cotton bollworm.
yellow mosaic virus-resistant zucchini.
Cotton plants are susceptible to Helicoverpa armigera, more commonly known as the cotton
bollworm. The larvae of this moth munch on precious crops in Asia, Europe, Africa and Australia,
9780170452922
causing damage estimated at greater than $2 billion each year. Normally, regular spraying of
insecticide has been used to eradicate this pest. However, it has been discovered that the soil
bacterium Bacillus thuringiensis (Bt bacteria) produces a range of proteins that are toxic to some
insects. Genes that make proteins toxic to the bollworm are taken from this bacterium and inserted
into cotton plants, and when expressed, the GM cotton produces the same toxin. The use of
genetically engineered cotton reduces the use of insecticides, cutting farming costs. Unfortunately,
resistant strains have evolved in various insects.
In providing farmers of GM cotton with alternative weed and pest management options, GM
cotton could help reduce the environmental impacts that previous management of non-GM cotton
crops has caused. Since 2011, WA farmers have been authorised to grow GM cotton commercially,
and currently more than 99% of cotton grown in Australia is GM cotton.
Faster growth rate

The first GM animal in the world to be grown for human consumption was a transgenic
Atlantic salmon known as AquAdvantage salmon®. It is capable of growing at double the rate of
conventional Atlantic salmon. A more effective hormone-regulating gene normally found in the
Pacific Chinook salmon replaced the normal hormone-regulating gene in Atlantic salmon. Both
genes regulate growth. In addition, a promoter gene normally found in ocean pout was inserted
into the Atlantic salmon. The purpose of the modifications was to increase the speed at which the
fish grows, without affecting its ultimate size or other qualities (Figure 7.6). GM fish grow to market
size in 16–18 months, rather than 3 years. The first US and Canadian harvests of the GM salmon are
expected in 2020.
After an approval process that took nearly 20 years, the US Food and Drug Administration (FDA)
said the GM salmon posed no health risks and they could find no reason not to approve it. However,
the Australian food safety regulator, Food Safety Australia New Zealand (FSANZ), issued a statement to
Australian consumers saying the GM salmon had not been approved for sale in Australia.
smraF ytnuoB auqA/otohP PA/otohP PAA
FIGURE 7.6 GM and non-GM Atlantic salmon
Greater product quality and yield

Increase in quality (nutrition) in rice
The World Health Organization estimates that 124 million people suffer from vitamin A deficiency,
and that one to two million die each year from this deficiency. The deficiency results in between
250 000 and 500 000 irreversible cases of blindness annually, mainly in children, half of whom die
within a year of becoming blind. Most of these people live in urban slums, where poverty restricts
their diet to a daily ration of rice. Vitamin A is a fat-soluble vitamin that helps maintain normal
reproduction, vision and immune function.
9780170452922
Beta-carotene (β-carotene) is also

known as provitamin A because it is
the precursor to vitamin A. It is a plant
pigment that occurs naturally in corn,
daffodils and mangoes, giving them
their golden colour. Scientists created
a variety of rice by inserting the gene
for β-carotene into rice, giving it a
sretueR/ortsaC ed kirE /otohP PAA

golden colour (see Figure 7.7).
Golden Rice® is a bioengineered
transgenic rice crop with a yellow-
coloured grain (endosperm) containing
β-carotene. To produce Golden Rice,
a gene from the daffodil plant and
FIGURE 7.7 Golden Rice grains are easily recognisable by their
a gene from a soil bacterium were
yellow–orange colour, caused by β-carotene (pro Vitamin A).
extracted. These genes were inserted
into a plasmid. The recombinant
plasmid was then inserted into Agrobacterium. Agrobacterium reproduced and was then mixed with
rice plant embryos. The DNA was taken up by rice embryos, which expressed the two genes when the
transgenesis process was successful.
One concern about Golden Rice is the actual effectiveness of the β-carotene after the rice has
been cooked. Another concern is cost – it may be less expensive to give those in need supplements.
Many argue that the nutrient level of Golden Rice is not significant enough to help alleviate vitamin A
deficiency. In addition, there are fears that it will crossbreed with and contaminate wild rice, and, as
with other GMOs, worries that transgenic organisms might harm people and be controlled by large
corporations more concerned with profit than people.
In December 2019, the use of Golden Rice as a food was approved by the Philippine Government,
the first Asian government to approve it. It seems like a massive victory for the Golden Rice Project
because they have faced intense activism against the use of this GMO. The World Health Organization
lists Filipino mothers as being moderately vitamin A deficient, and children less than 5 years old
as being severely vitamin A deficient. The Golden Rice Project predicts that a source of vitamin A
will reduce child mortality by 23–34%, and cases of measles by up to 50%, thanks to the
immune-boosting effects of vitamin A.
Key concept
Recombinant DNA is used in agriculture to improve yield, quality and productivity. Further
research needs to be done to assess the efficacy of transgenic organisms in improving nutrition.
Tolerance to adverse environmental conditions

Crops face a multitude of abiotic stresses in their environment. Climate change is arguably
aggravating these abiotic stresses. The term ‘climate’ refers to the statistical description of weather,
and it affects the conditions of oceans, land surfaces and ice sheets. It includes consideration of
averages, variability and extremes. Climate change is an alteration in the pattern of climate over a
long period of time, and may be due to a combination of natural and human-induced causes. The
climate change currently being observed is mostly due to human activity, primarily the burning
of fossil fuels causing a 40% increase in heat-trapping carbon dioxide in the atmosphere, causing
a rise in the average global surface temperature. This has led to extreme weather conditions,
which can be the source of adverse environmental conditions. Some abiotic factors, or adverse
conditions, affecting crops include extreme temperatures, drought, flooding, high salinity, and
deficient soil nutrients. Adverse conditions are factors in the environment that affect the survival of
9780170452922
an organism. Monsanto Australia gained approval to grow, sell and use drought-tolerant GM corn
in Australia in 2010. This new variety of corn was genetically modified to tolerate cultivation under
water-limited conditions. The corn line also contains a commonly used marker gene encoding
antibiotic resistance. The drought-tolerance trait is conferred by expression of a single bacterial
gene, cspB, from the bacterium Bacillus subtilis, which encodes cold shock protein B. Cold
shock proteins are widely found in bacteria and facilitate adaptation to suboptimal temperatures
by preserving protein synthesis. Similar proteins are found in plants and enable them to tolerate
various abiotic stresses.
In the Southwest of WA, salt-affected agricultural land currently exceeds one million hectares.
This is increasing with time, along with the simultaneous rise of the water table. The implications for
WA’s agricultural industry are substantial – it results in reductions in fertile land, crop yield and quality,
and millions of dollars of lost revenue.
Scientists such as Professor Edward Barrett-Lennard and his team successfully trialled GM wheat
and barley tolerant to high saline conditions in 2013–16. Two genes were introduced into the wheat
plant to create a transgenic organism; an OAT gene from a common plant species A thaliana and
the cyanamide hydratase (CAH) gene derived from the soil fungus Myrothecium verrucaria. The OAT
gene codes for an enzyme that assists growth in elevated salt conditions. The CAH gene codes for an
enzyme that is used as a marker to assist in the selection of the GM plants in the laboratory.
One method of introducing the genes into the wheat genomes for transformation is via
microprojectile bombardment. Gold particles carrying the genes on linear fragments were shot into
wheat embryos using a helium pressure gun. The embryos with the transformed genomes were
selected in the presence of cyanamide (a toxin) using the CAH marker gene.
The professor and his team performed trials in high saline areas abiding by strict criteria to reduce
the risk of potential hazards. They showed that the gene responsible for the tolerance was of low
potential risk as an allergen because the protein products, which are different in structure to known
allergens, are found in food that humans already eat safely. The potential for a transfer of the foreign
genes into non-target organisms was evaluated. Wheat is predominantly self-pollinating (95%).
Although the approximated 5% chance of cross pollination exists, the risks during the trials were
removed because it can only cross pollinate with species of the same genus. Due to geographical
isolation, there were no closely related species close enough for a transfer.
The GM wheat was subjected to different levels of salinity and compared to the non-GM wheat
control group. The GM wheat results were conclusive – where non-GM wheat growth was inhibited
by salt levels, GM wheat survived and grew successfully. The future of this line of wheat is uncertain
without further funding and support.
norihC yhtoroD/moc.kcotsrettuhS
strAeralF/moc.kcotsrettuhS
FIGURE 7.8 Dryland salinity causes huge reductions in crop yield. FIGURE 7.9 GM wheat can grow in higher salt areas.
9780170452922
Long-chain omega-3 oils in grains CASE

STUDY
Omega-3 oils, especially the long-chain fatty In 2013, the team reported obtaining similar
acid docosahexaenoic acid (DHA), are critical levels of DHA in oil from Camelina sativa,
for brain and eye development in infants and oilseed crop.
are an essential part of a healthy adult diet. Since then, the CSIRO team has managed
These healthy oils are not synthesised by to obtain fish-oil-like levels of DHA from
humans and thus must be obtained through their canola crop in the laboratory. They
diet. Land plants do not normally produce are continuing to develop GM canola, as its
DHA. Marine microalgae alone are known adaptability to a variety of growing regions
to possess the biochemical machinery to and its high oil content promise commercial
synthesise DHA. Fish contain large amounts viability. Field trials began in 2014, and
of DHA because they feed on those algae. canola containing long-chain DHA is now
Fish are therefore the major dietary source commercially available for fish feed and
of DHA, but fishing pressure is causing a human consumption.
worldwide decline in fish stocks.
In collaboration with Nuseed and the Questions
Grains Research and Development Corporation 1 Learn about omega-3 oils. Find alternative
(GRDC), scientists from CSIRO are working sources of these oils that are currently
on a project aiming to solve this problem. The available, aside from fish. Where would
Canberra-based team is working towards the vegetarians source these oils?
production of GM canola that contains long- 2 Think about alternatives. Would it not be
chain DHA levels similar to those of fish. simpler to eat algae, rather than make
After years of research and development, crops that produce DHA? Why do you
in 2012, the CSIRO team created transgenic think this approach was not selected?
Arabidopsis thaliana (a commonly used 3 How would you feel about eating bread
laboratory model plant) by inserting genes and cake enriched with DHA obtained
(sourced from microalgae) coding for DHA from genetically engineered oil?
synthesis enzymes into its genome. This was 4 Why stop there? What genetically
a breakthrough, because these plants then engineered crops can you imagine will
produced seeds with levels of DHA similar to be developed to produce other essential
that found in commercially available fish oils. nutrients or medications?
Gill B. S., Huang L., Kuraparthy V., Raupp W. J., Wilson D. L., Friebe B. (2008) Alien genetic resources
for wheat leaf rust resistance, cytogenetic transfer, and molecular analysis. Australian Journal of
Agricultural Research 59, 197–205. https://doi.org/10.1071/AR07315
FIGURE 7.10 The CSIRO research team, left to right, front row to back row: Dr Surinder Singh, Mr Lijun Tian;
Dr Qing Liu, Dr Yoko Kennedy; Dr Srinivas Belide, Dr Pushkar Shrestha, Ms Anne Mackenzie and
Dr James Petrie
9780170452922
Genetically engineered animals

In addition to AquAdvantage Salmon®, other genetically engineered animals have been developed.
These include cows that produce milk similar to human breast milk, and enviropigs that release
less phosphorus in their manure. As well as these examples of farmed animals, laboratory animals
(including rats and mice) have been engineered to contain alleles that make them model organisms
for studying human disease and for discovering the functions of various genes.
Question set 7.2

1 Define: 4 Create a mind map summarising the
a Roundup Ready crop information provided here about the
b herbicide engineering of transgenic organisms for
c β-carotene. resistance to pests and diseases, faster
2 Describe climate change. growth rate, greater product quality
UNDERSTANDING and yield, and tolerance to adverse
environmental conditions. Include the
3 Explain how climate change can increase name of the GMO, the name of the
adverse conditions affecting crops. organism that naturally contains the
gene, and a description of the desired trait
and the advantage it confers.
7.3 DNA TECHNOLOGIES IN ENVIRONMENTAL

CONSERVATION
Right now, a pollution and extinction crisis threatens our living world. Slowing climate change
and habitat destruction are our biggest challenges. On 8 November 2019, the Australian state
and territory environment ministers endorsed a new approach to biodiversity conservation
through ‘Australia’s Strategy for Nature 2019–2030’. The strategy is supported by a dedicated
website: Australia’s Nature Hub. Both the Strategy and the Hub are owned and being developed
by the Commonwealth, all state and territory governments and the Australian Local Government
Association. In addition to protecting biodiversity, the new approach will focus on incorporating
adaptation, resilience and natural resource management in our urban, rural and natural (terrestrial
and aquatic) environments. Conservation biology is the integrated study of ecology, physiology,
evolution, molecular biology and genetics with a view to sustaining biological diversity at all
levels. It is a broad approach to preserving what remains, and determining the due care and
attention needed for protecting it for the future. Biotechnology can be used in environmental
conservation for:
• monitoring endangered species
• assessing gene pools for breeding programs
• quarantine.
Biological diversity levels include genetic, species and ecosystem diversity. The levels are
interconnected. This section of the chapter will focus on how biotechnology is used to maintain viable
gene pools. A gene pool is a collection of all the alleles for all the genes in the reproducing members
of a population at a given time. It is the genetic reservoir from which a population can obtain its traits.
A large gene pool has large genetic variation and a small gene pool has little variation. A small gene
pool is likely to be present in an isolated population, particularly when that population is small. A viable
gene pool contains sufficient alleles and genes to give enough diversity for survival in a changing
9780170452922
environment and which avoids loss of fitness as a result of inbreeding. When the environment
changes, a population rich in variation will have many alleles present, making it likely that some will
suit the new environmental factor. Nature selects those traits that give a survival advantage, through
the process known as natural selection. For natural selection to occur there needs to be variation.
Preserving high levels of inheritable variation helps to retain a population’s current reproductive fitness
and also to maintain its evolutionary potential (its capacity to adapt to environmental change over the
long term). An important role of conservation is the protection of viable gene pools.
The importance of conservation

Australia has more endemic mammals and reptiles than any other country in the world and more
endemic plants than 98% of the world’s countries. Endemic species are those that occur nowhere
else on Earth. These plants and animals are as much a part of our heritage and identity as significant
natural sites, such as Kakadu, Ningaloo, Uluru and the Great Barrier Reef. In addition to contributing to
our economy, our native species confer other benefits on the environment. For example, our native
bats and birds help control pest insects, spread seeds and maintain our forests. Our plants provide
food and shelter for many species, while capturing and storing carbon, combating salinity, keeping
riverbanks stable, reducing erosion and improving water quality. Additionally, Australia is home to an
agricultural industry that relies in part on natural systems and which feeds us and many other parts of
the world.
Conservation is important to protect and ensure the survival of our native species, and it requires
careful planning to be successful. Conservation plans should be based on the best available scientific
information. Conservation planning to maintain viable gene pools should consider:
• biogeography
• reproductive behaviour
• population dynamics.
Biogeography
To maximise the number of species secured in an ecosystem, there needs to be active protection
and restoration of native habitats, mitigation of threats and management of risks to environments.
Before an action plan is made, there also needs to be an understanding of the biogeography of the
ecosystem.
Biogeography is the study of the distributions of animal and plant species and how those
distributions relate to the environment, to the origins of the species and to the changes that have
occurred over time. It reveals the spatial organisation of biological diversity. An understanding of the
spatial arrangement of each species (the distribution of its population) is vital. The geographical size of
an ecosystem, the habitats it contains, and the changes it has undergone over seasonal to geologic time
scales all have an impact on its biodiversity. We need to know that nature reserves are large enough
and that they have biotic and abiotic factors that are suitable for maintaining a viable gene pool of each
individual species. Biogeographical regions have characteristics, such as temperature, elevation, soil
types and typical species of plants and animals. If the distribution of a species changes over time, this
can help scientists decide whether or not an area needs active protection, restoration or management.
As the climate of a particular area changes, so does its ecology. Modern biogeography often
employs the use of Geographic Information Systems (GISs) to understand the factors affecting the
distribution of organisms, and to predict future trends in those distributions. Biogeographical studies
of invasive species can show how they are dispersing, their likely eventual distribution, and how they
might affect the biotic and abiotic factors in the environment, for example, by causing a decline in
the population numbers and genetic diversity of other species. Geoscience Australia and CSIRO
are working together to generate high-resolution mapping of seabed environments and terrestrial
vegetation to better understand the distribution of habitats, which is key to the support of threatened
species.
9780170452922
Reproductive behaviour
Reproductive behaviour is behaviour related to the production and care of offspring, including the
establishment of mating systems, courtship, sexual behaviour, fertilisation and raising of young. For
animals to reproduce successfully, they must have a favourable situation, often they must undertake
particular behaviours leading to the union of male and female gametes, and they must help with the
survival and development of the young.
For each species, there is a complex set of behavioural adaptations that coordinate the timing
and pattern of reproductive activity. Reproductive behaviour tends to be relatively stereotyped within
a species, but diverse among different species, especially if they are distantly related. Reproduction
produces viable, fertile offspring that, in turn, will reproduce and thus perpetuate the species.
Reproductive behaviour needs to be considered when planning conservation strategies to prevent
inbreeding and loss of advantageous alleles, gene pool diversity, and reproductive fitness.
Population dynamics
Population dynamics is the study of the number, gender, age and relatedness of individuals in a
population. Population size is directly affected by the number of births, deaths, immigrations and
emigrations. All of these changes can cause a shift in dynamics. But there are many other factors that
can affect dynamics, and most of them are complex in their effects.
If a disturbance (such as a bushfire) affects dispersal, then dispersal can become the factor that
triggers a major change in population dynamics. Other density-independent factors (such as an
infectious disease or tree logging) can cause major changes in population dynamics.
If habitat size and health changes, this can lead to limitations of resources such as food and
shelter. These are density-dependent factors that can cause increased competition and predation in a
population.
Population growth, density, urbanisation and migration (immigration and emigration) are factors
to be considered in population dynamics. A small population usually has a small gene pool. Small
populations therefore have a higher risk of losing genetic diversity (especially due to genetic drift), and
population size is a key consideration when planning conservation strategies.
Uses of biotechnology in environmental conservation:

monitoring endangered species
More than 80% of Australia's mammals and 90% of our trees, ferns and shrubs occur nowhere
else on Earth. But since European colonisation, in just over 200 years, more than 130 of Australia’s
known species have become extinct. The list of those threatened with extinction continues to
grow. Australia’s threatened species are
our responsibility to protect and we all
have a role to play. But how do we know
if a species’ numbers are dangerously
low and how would we know if their
numbers became stable? Monitoring
endangered species is a crucial part of
oidutS ylataN/moc.kcotsrettuhS
conservation, because it helps scientists

identify species threatened with extinction
and provides evidence of the effectiveness
of conservation strategies. Monitoring
data can be used to diagnose the causes
of population decline and to measure FIGURE 7.11 The endangered Gouldian finch (Erythrura
management effectiveness. gouldiae)
9780170452922
Factors that are monitored may

include behaviour, geographical
movements, reproduction, diversity,
population size (births/deaths/
migration) and population growth.
ygolocE murtcepS – allicnaC neimaD

DNA technologies can help monitor
endangered species: for example, the
Gouldian finch is being monitored with
the use of a probe that identifies DNA in
water bodies frequented by this critically
endangered species. The method for
analysing the DNA was developed FIGURE 7.12 Conservation scientist releasing a northern quoll
by researchers from the University of after taking measurements
Western Australia and Charles Darwin
University.
Environmental DNA (eDNA) is DNA left behind in an environment by an organism, and it can
be used to monitor the platypus (Ornithorhynchus anatinus). EnviroDNA is the company using this
technology, collecting data about the changing distribution of the platypus over time. As platypuses
are difficult to observe in the wild, their eDNA may be the only evidence available for where the
vulnerable species is distributed.
The northern quoll is a carnivorous marsupial and can be identified by its distinct white spots.
Disconnected populations inhabit the northern part of Australia, including northern WA. Northern
quoll populations have declined significantly with land clearing, the increase in the population and
distribution of cane toads, and predation by other feral animals such as cats. They are now listed
as endangered under the Commonwealth Environment Protection and Biodiversity Conservation
Act 1999.
Long-term monitoring of northern quolls is being conducted in the Pilbara to develop better
understanding of the factors that are contributing to their decline, and of the factors that may
contribute to their survival. Knowing the range boundaries of populations and understanding the
barriers to gene flow between them can assist scientists in providing more effective support.
Scats were collected for analysis from the deep gorges the quolls inhabit. DNA analysis and
sequencing was conducted by the Department of Parks and Wildlife (now the Department of
Biodiversity, Conservation and Attractions), and individuals were identified using DNA profiling.
This made it possible to assess the genetic health (diversity) of the populations, which helps guide
conservation management. Scientists now know the northern quoll consists of a single genetic
population across the arid Pilbara region and can pinpoint areas where laying feral cat baits is likely to
have the greatest benefit.

breeding programs
Many of the techniques we have discussed thus far have also been employed in efforts to preserve
biodiversity and to help manage vulnerable populations. In small populations of animals and plants,
there is a risk that closely related (genetically similar) individuals will breed together. The resulting
offspring will have an increased risk of deleterious recessive alleles becoming homozygous, making
them vulnerable to genetic diseases. This is called inbreeding depression. Biotechnologists can
use various techniques, including DNA profiling, to selectively breed individuals. This is a common
practice in captive breeding programs (conservation breeding programs) of threatened species such
as the mountain pygmy possum, the Tasmanian devil and the orange-bellied parrot.
9780170452922
Studies have also been carried out to determine the genetic diversity of the gene pool of
populations of elephants and cheetahs. These studies will provide information about, and be used to
help preserve, the genetic diversity that exists in their populations and thus improve their chances of
long-term survival. DNA was extracted from material in their droppings (scats). A major advantage of
collecting faecal DNA is that it does not require capturing the animal. This avoids stress to the animal
and danger to the researcher.
Saving the Tasmanian devil

The Tasmanian devil (Sarcophilus harrisii) once occupied mainland Australia but is now endemic
only to Tasmania. Feral animals and farmer culling in the 1800s reduced their numbers greatly. In
1941, they became a protected species and their numbers grew steadily; however, their genetic
diversity could not. Tragically, the devil facial tumour disease (DFTD) has killed tens of thousands of
them since the mid-1990s. DFTD is one of the rare cancers that can spread as a contagious disease.
The mode of spread from an infected devil to a healthy devil is direct, mostly through biting. When
a tumour cell is transferred to a healthy devil, most devil’s immune systems are not capable of
responding effectively. Due to their close contact interactions when they are feeding and fighting for
territory and mates, the disease has spread easily in many populations. They are now classified as a
vulnerable species.
Maintaining genetic diversity in threatened species is important because it underlies their ability
to adapt to changes in the environment and it prevents inbreeding. Genetic methods have been used
in Tasmanian devil breeding programs to preserve genetic diversity and minimise inbreeding (the
mating of closely related organisms, leading to the expression of rare recessive alleles). Inbreeding
can decrease a population’s reproductive fitness. Pedigrees, PCR techniques, sequencing and
mapping of genomes have helped scientists determine the genetic variation remaining and the
relatedness between individual devils. Restriction enzymes have been used to fragment the genome
in a systematic way, allowing scientists to sequence sections of the genome. Scientists then compare
the sequences of individuals to determine how closely related they are, and store the data on shared
databases to assist breeders in selecting the most distantly related individuals to breed. The goal is to
maintain or, ideally, increase genetic diversity in the population.
F F M M F
300 bp
200 bp
100 bp
M F X F M
sahretzsE izuS rehpargotohP/serutciP nedniM
300 bp
200 bp
100 bp
X F F M M
300 bp
200 bp
100 bp
FIGURE 7.14 Tasmania Zoo's precinct is home to a very
FIGURE 7.13 DNA profiling of Tasmanian devils using successful breeding program for Tasmanian devils.
DNA from non-invasive sources: tissues a, hair b and The biosecure breeding pens are referred to as 'Devil's
scat c. heaven'.
9780170452922
Biotechnology has been used to reconstruct more accurate pedigrees to improve the
effectiveness of the Tasmanian devil breeding program on Maria Island, a small island just off the
coast of Tasmania.
In this study, a multiplex PCR-based assay was used to determine the sex of individual Tasmanian
devils. The assay used a new species-specific primer set that amplified a fragment of the SRY gene and
an autosomal micro-satellite marker as an internal positive control. Sex could be found out using DNA
obtained from tissue, hair samples or scats (faeces). This use of biotechnology represents an important
step towards effective monitoring and management of Tasmanian devils.
A disease-free population was released onto Maria Island in 2012 and monitored. The Maria
Island devils are an insurance population (a population brought in from the wild as a safeguard
against the species’ extinction) in case the disease makes the devils extinct on the main island
of Tasmania. DNA analysis showed inbreeding on Maria Island had reduced the genetic diversity
to 77%. Computer modelling showed that introducing eight new individuals every 3 years would
maintain the Maria Island population above 95% gene diversity for the next 40 years. The Tasmanian
devil insurance population breeding program provides a good example of the many ways genetics
can inform conservation of a species.

quarantine
Quarantine is another active conservation strategy employed in Australia.
Quarantine is the isolation of organisms that have arrived from elsewhere or been exposed to
an infectious or contagious disease. They are monitored until scientists confirm the possibility of
disease is no longer present. The Australian Quarantine Inspection Service plays an important role in
preventing the entry of exotic pests and diseases that could affect plant, animal and human health,
and the environment.
The Khapra beetle (Trogoderma granarium) is a quarantine-status pest in Australia. Khapra
beetle is a regulated quarantine pest in many countries and is currently absent from Australia. Our
international trade would be severely impacted if it became established here. It could infest wheat
being shipped interstate or overseas. It is more difficult to control than other stored product pests
because of its tendency to colonise cracks and crevices, avoiding pesticide treatments. The Khapra
beetle is considered the most serious pest of stored grain in the world. It is often confused with a less
detrimental pest known as the warehouse beetle. Identification through observation is less accurate
than DNA fingerprinting, so the latter is widely used. It involves the extraction of random fragments
of beetle DNA that are cut and amplified and tested to see if they are unique to that species. The
likelihood of different species having the same DNA fragments is very low. DNA fingerprinting
techniques enable biosecurity officers to quickly and accurately identify the Khapra beetle. In the
future, developments in the technology are likely to make the process more rapid and more reliable.
a b c
zsydjelK zsamoT /moc.kcotsrettuhS
decruoS PBC/sotohP kcotS ymalA

AWFAD/otohP PAA
FIGURE 7.15 Khapra beetle: one of the world's most destructive pests of grains such as wheat: a adult; b multiple life stages; c larvae
9780170452922
In recent years, a devastating disease of pigs known as African swine fever (ASF) has been
spreading globally. There has been a number of outbreaks worldwide, which has increased the risk of
the disease entering Australia. There is no vaccine. Pigs can become infected by eating contaminated
food, by direct contact with other infected pigs, or from contaminated soil or farm equipment. The
disease has a high death rate. The most likely way ASF could enter Australia is through infected pork
products that are then fed to pigs. Pork products that have been seized at international airports or
mail centres are sent to a laboratory for testing. Testing in 2019 found nearly half the products seized
contained ASF virus fragments, up from just 11% in 2018. One way to test for ASF is to use a PCR
technique. To prevent the entry and spread into Australia, diagnostic laboratories must have rapid and
accurate procedures for specific ASF virus detection, such as PCR.
With the spread of ASF into new countries, a sampling and testing program for ASF in goods
surrendered or seized from passengers, or found in mail parcels, was introduced in late 2018. This
will help monitor the risk of ASF entering Australia through food products. Using genetic technology,
samples can be readily tested for evidence of ASF, and other viruses such as foot and mouth disease
(FMD).
The CSIRO Australian Animal Health Laboratory (AAHL) tested samples of pork products
(taken from airline passengers and from mail centres) for ASF virus in late 2018, early 2019 and
again in September 2019. In the first two periods, the samples were collected in Melbourne and
Sydney and in the latter period in Melbourne, Sydney, Perth and Brisbane.
In late 2018, 6 out of 152 samples contained ASF virus fragments. Over the second period, in
early February 2019, 40 out of 283 samples contained ASF virus fragments and 2 products tested
positive for FMD virus fragments. In September 2019, 202 out of 418 samples tested positive for
ASF virus fragments and 3 products tested positive for FMD virus fragments.
)/0.3/yb/sesnecil/gro.snommocevitaerc//:sptth( 0.3 YB-CC seirtsudnI kcotseviL/ORISC
FIGURE 7.16 The CSIRO AAHL biocontainment laboratory in Geelong
9780170452922
Inbred koalas 7.1

Kangaroo Island is host to koalas that were introduced from French Island in Victoria. By
NOITACILPPA
studying their DNA and creating a genetic profile for each individual koala, researchers found
that the genetic diversity within the Kangaroo Island population was low. With little to no
variation between members of the population, they are vulnerable to a rapid population crash.
Are koalas functionally

extinct?
Read about the current
extinction issues faced
by koalas.
Kangaroo Island – a
safe haven for koalas
58tsactuo/moc.kcotSi
Read about the
chlamydia-safe
haven for koalas.
FIGURE 7.17 The koala population on Kangaroo Island only has a low level of genetic diversity as it originated
from the introduction of a small number of koalas from Victoria.
Use of recombinant DNA in environmental conservation

Environmental pollution is a major problem that affects biodiversity, public health and ecosystems
worldwide. This issue cannot currently be solved using conventional technology, because such
methods are expensive, ineffective and time consuming. Conventional methods focus unduly on
the separation, rather than the destruction, of contaminants. The use of genetically engineered
organisms for bioremediation would be an environmentally friendly and cost-effective alternative for
the management and remediation of pollutants in contaminated sites. Different types of genetically
engineered microbes have been developed through recombinant DNA and RNA technologies,
and these have been used to remove heavy metals and toxic substances from contaminated sites.
With advancements in biotechnology and microbiology, genetically engineered bacteria are being
used in environmental restoration, resulting in bioremediation that is more viable and eco-friendly.
Bioremediation is the consumption and breakdown of environmental pollutants by deliberately
introduced or naturally occurring micro-organisms. The process is used to treat contaminated water
and soil. Usually environmental conditions are altered to stimulate the growth of micro-organisms for
the breakdown of a pollutant.
Chlorinated hydrocarbon 1,2,3-trichloropropane (TCP) is a manufactured compound that can be
used in varnish remover and other cleaning products. However, it is highly toxic and is carcinogenic.
TCP is frequently detected in groundwater because of improper waste disposal. It is a dangerous
pollutant because it resists biodegradation. Biodegradation is the breakdown of an organic substance
by micro-organisms such as bacteria through decomposition. TCP has a higher density than water
and is moderately water soluble, so it moves easily into deeper groundwater layers, leading to
widespread contamination. It then infiltrates drinking water, becoming a hazard for ecosystems.
However, it can be broken down to some degree by the enzyme haloalkane dehalogenase. To
address this environmental problem, a gene encoding improved haloalkane dehalogenase (dhaA31)
was placed into a plasmid and cloned. This engineered haloalkane dehalogenase gene was then
introduced into the bacterium Pseudomonas putida MC4, to be used in the bioremediation of the
pollutant TCP.
9780170452922
Key concept
Biotechnology tools and techniques used in conservation include restriction enzymes, PCR,
recombinant DNA, DNA profiling and pedigree analysis.
Question set 7.3

1 Define: 3 Describe the difference between a viable
a conservation biology and a non-viable gene pool.
b inbreeding depression 4 Differentiate between biodegradation and
c quarantine bioremediation.
d biodegradation. REFLECTING
2 State one reason why environmental
scientists should consider each of the 5 Provide a rationale, relevant to your needs
following factors when planning for as a citizen of Earth, for environmental
conservation: conservation.
• biogeography
• reproductive behaviour
• population dynamics.
7.4 ETHICAL ISSUES ASSOCIATED WITH

TRANSGENIC ORGANISMS
The ability to manipulate and modify DNA carries responsibility. The implications of gene technology
and the issues associated with the application of gene technology have to be considered in any
decisions about what should or should not be done. GMOs such as crops are theoretically very
appealing: farmers get a better yield, spend less on pesticides and herbicides, and don’t pour
dangerous chemicals into our environment. Yet, how is the modified crop going to affect the
ecosystem?
Since the first approval for the commercial sale of GM food in the 1990s (1996 in Australia), there
has been significant uptake of its cultivation across the globe. By 2015, nearly 180 million hectares of
GM crops had been grown by more than 18 million farmers in 28 countries. Maize, soybeans, cotton
and canola are the primary GM crops, and account for 99% of the area devoted to GM production.
As of 2018, GM canola, cotton, safflower and blue carnations are the only GM crops that
have been licensed to be grown in Australia by the Office of the Gene Technology Regulator for
commercial cultivation in Australia. GM cotton was introduced into the Australian market in 1996
and now represents almost all of the cotton grown here. Monsanto is the trademark owner of the
licensed variety, which is resistant to insecticides and other herbicides. In WA, GM cotton and GM
canola have been commercially grown since 2008 and 2010, respectively. GM safflower is the most
recent addition to the GM crops being grown in Australia, with the first crop being produced in 2018.
It is mainly grown in New South Wales, Victoria and South Australia, and is used for industrial oil
production and animal feed.
Farming of GM cotton has increased greatly in WA; however, the law governing the growing
of GMO and neighbouring crops is not very protective for farmers of non-GMO crops. A court
proceeding between a non-GMO farmer and a GMO farmer recently highlighted the need for laws
to be developed to protect economic loss for a non-GMO farmer if the non-GMO crops become
contaminated. Buffer areas between farms only provide limited protection, due to wind dispersal.
Organic standards have been stated as a zero tolerance to GMOs, and the presence of GMOs is
prohibited in any segment of the organic food chain.
9780170452922
The seriousness of potential gene flow into non-target crops became obvious when a GMO
farmer was accused of contaminating a non-GM farmer’s crops, causing the subsequent loss of his
farm's organic certification.
The WA farmer’s case (Marsh v Baxter) came before the Supreme Court in 2014. Mr Marsh had
farmed organic non-GM cereal crops from 2004 and canola from 2000. Adjacent to Mr Marsh’s
farm was Mr Baxter’s farm, on which GM canola seed was grown. Two hundred and forty-five canola
swathes (a row of cut grain) containing GM seeds, blew onto Mr Marsh’s farm, which led his organic
certifier, the National Association for Sustainable Agriculture Australia (NASAA), to decertify 70% of his
land in 2010.
Although his land was recertified in 2013, Mr Marsh had suffered economic loss. He took Mr Baxter
to court, but lost at trial and again on appeal. It was difficult to demonstrate that the GM material
actually came from Mr Baxter’s farm, and it was found that Mr Baxter had not acted negligently and
could not be held responsible. Additionally, Mr Marsh was not farming canola or any other genetically
compatible species at the time. (Therefore, there could not have been transfer of genes.) Although
Mr Marsh did not win the case, it did bring to light further ethical issues surrounding GMOs.
Using GMOs may have adverse effects on genetic diversity and on the environment: there may be
effects on non-target organisms, more rapid evolution of pesticide-resistant species, and the possibility
of gene flow from crop species to weed species, resulting in the emergence of superweeds.
Effects on non-target organisms

Some transgenic organisms have been engineered to produce toxins deadly to target organisms. For
example, Bt cotton has a gene from Bt bacteria inserted into its genome that creates a protein that
makes a toxin that affects bollworm. This prevents bollworm from consuming crops. However, there
are concerns that other non-target species will be harmed.
The effect of GMOs on non-target species is not yet clear. Some researchers once claimed that
the pollen from pest-resistant corn could threaten the monarch butterfly, but these claims have now
been disproved. However, further testing of pollinating, non-target insects such as butterflies, bees
and water fleas is currently being conducted. The insects being tested include species feeding on the
transgenic Bt crops that produce the deadly toxin.
The World Health Organization is not opposed to GMOs, but they do raise concerns that should
be addressed. Gene transfer from GM foods to cells of the body or to bacteria in the gastrointestinal
tract would cause concern if the transferred genetic material adversely affects human health. This
would be particularly relevant if antibiotic-resistance genes, used as markers when creating GMOs,
were to be transferred. Although the probability of transfer is low, the use of gene transfer technology
that does not involve antibiotic-resistance genes is encouraged.
Additionally, they are concerned about outcrossing. Outcrossing is the migration of genes from
GM plants into conventional crops or related species in the wild. Outcrossing and the mixing of GM
crops with crops derived from conventional seeds may have an indirect effect on food safety and
food security. Cases have been reported in which GM crops approved for animal feed or industrial
use were detected at low levels in products intended for human consumption. Several countries have
adopted strategies to reduce mixing, including a clear separation of the fields within which GM crops
and conventional crops are grown.
More rapid evolution of pesticide-resistant species

Studies in India have demonstrated the evolution of toxin resistance in aphids and mealy bugs,
resulting in the inefficacy of GM corn.
Roundup Ready crops became popular in the mid-1990s. Farmers bought seeds with the genetic
modification for tolerating glyphosate (a chemical used in Roundup Ready). Glyphosate is the primary
active ingredient in this brand of commercial weedkiller. After decades of use, some detrimental
effects have been observed. Some invasive plants (weeds) have also developed resistance through
9780170452922
natural selection, a mechanism of evolution. This

has led to farmers using more of the chemical to
kill weeds to protect crops. Research conducted
in the south-west of the US found that GM crop
farming uses 25 per cent more herbicides than
non-GM farming.
GM for good Another concern is that transgenic organisms
Watch this video from
the ABC's science show themselves, with herbicide resistance engineered,
'Catalyst'. may evolve quickly with the limiting factor(s) for
Genetic Literacy Project growth removed. If an adverse condition was
Read current news removed from the environment of a herbicide-
about genetics and resistant crop, for example, the transgenic crop
biotechnology here.
growth rate could be much higher, resulting in
the transgenic organism evolving into a pest. The
GMO pest could then outcompete native plants or
other crop plants and deplete the soil of nutrients.
Key concept
ailgirteP onurB/yrarbiL otohP ecneicS

As crops and weeds develop resistance to
herbicides, more herbicides are applied
by farmers to control weeds. The increase
in herbicide spraying has sped up the
evolution of resistant weeds by natural
selection, and has also increased the level
of pollution entering ecosystems. FIGURE 7.18 Herbicide-resistant horseweeds
Emergence of superweeds
What about the spread of modified genes into the surrounding environment? This depends on how
the plant is pollinated. Plants such as cotton are usually wind pollinated. This could lead to the
spread of modified plants to other nearby crops belonging to farmers who may not want to use
this type of crop because of the unknown long-term effects or its poor acceptance among some
consumers.
Gene flow may occur from transgenic crop plants to other species via wind or contaminated
tools. This means the introduced gene may be transferred. The introduced gene may have been
selected for herbicide resistance, pest resistance or drought resistance. The newly modified species
may be transformed to start expressing the gene, assisting it to increase its growth rate and become a
pest/weed. Farmers may be unable to control the growth of such a weed. This type of weed is known
as a superweed.
Canola is typically alternated on a 2-yearly cycle with a cereal crop such as wheat. Multiple-
resistant oil seed rape appears as a weed in the following year’s crop, especially around field margins
where seeds spilled during harvest can gather. A Canadian study found that these plants contained
resistance genes from up to three GM varieties – so-called gene stacking. Farmers were then forced
to resort to a different and much more persistent herbicide, 2,4-D, to control them.
9780170452922
Reduction in genetic diversity in GMO crop plants

The use of transgenic crops may lead to a loss of genetic diversity. Usually, farmers plant a single crop
that has a desired gene inserted into its genome. The crop is a single strain of the plant species and
is therefore a monoculture. The favourable characteristic may help it survive a specific factor in the
environment such as drought. However, the gene pool is limited for surviving other changes in its
environment. If a new pest or disease emerges, there may not be a suitable allele in the monoculture’s
gene pool that will enable it to survive. The lower a crop’s genetic diversity, the higher its susceptibility
to environmental change. This is an important issue, because climate change is causing new
environmental factors to emerge.
Arguments for and against transgenic organisms

Another concern raised by consumers relates to a belief that an increased allergenic effect might be
induced when combining genes from two organisms. If a gene that produces a protein from one
plant is introduced into a second plant to give it a desired trait, there is a chance that the introduced
transgene might cause an allergic reaction in some people.
The application of biotechnology is fraught with controversy: there are arguments for and against,
and the merits of each application have to be evaluated from a number of perspectives. Scientific,
industrial, commercial and governmental interests have to be examined, along with the views of the
rest of society. Gene technology is costly, and who does it benefit? We have powerful tools available
to us, capable of changing the course of life, and their use needs to be debated.
TABLE 7.1 Arguments for and against biotechnology
FOR AGAINST
Biotechnology is natural; genetic engineering has Biotechnology is not natural; selective breeding only
existed for years; for example, farmers breed specific involves individuals from the same species, whereas
cattle to achieve the desired traits. Biotechnology is biotechnology can mean transferring genes across
simply an extension of this process. species, which rarely happens naturally.
Modifying plants and animals and releasing them into the environment raises the possibility of
them affecting organisms in ecosystems. Table 7.2 presents some of the arguments for and against
the use of biotechnology in terms of its environmental effects.
TABLE 7.2 The effects of biotechnology on the environment
POSSIBLE POSITIVE EFFECTS ON THE POSSIBLE NEGATIVE EFFECTS ON THE

ENVIRONMENT ENVIRONMENT
Herbicide-resistant crops could be made resistant to Herbicide-resistant crops may encourage farmers
a herbicide that is not very toxic to the environment. to use more herbicide on their crops, which could
This might enable farmers to use a less toxic herbicide, potentially be more damaging for the environment.
rather than use one that may be more damaging to
the environment.
Researchers, so far, have found that there is little There may be gene transfer between closely related
transfer of genes between species. species; weeds may become resistant to the herbicide.
We may not know what gene transfers have occurred.
We may not know what transgenic organisms have
escaped into the environment.
9780170452922
Proteins are being produced for use by humans, using other animals or bacteria, and plant crops
are produced that have a higher yield. Fruit such as bananas and tomatoes are being modified so that
they don’t bruise on the way to market or ripen too quickly. With these advancements come another
set of issues for people who are going to eat the GMOs (Table 7.3).
TABLE 7.3 Arguments for and against genetically engineering foods with respect to public health
ARGUMENTS FOR ARGUMENTS AGAINST

Biotechnology can vastly improve the health, Selective breeding has provided us with crop
nutritional value and growth capacity of agricultural improvements in the past and can be a source of
species, and therefore greatly help to combat a global steady improvement in crop quality.
food crisis and benefit public health.
There are strict guidelines that aim to ensure all The long-term effects of genetic modification of crops
genetically engineered food is as safe as non- are essentially unknown.
genetically engineered food. The genetic code is
common in all living species.
With the increased use of biotechnology, governments of the world have an obligation to keep
the public informed about issues that are important to them. Many issues have emerged from the use
of genetic engineering. Advisory committees have been set up worldwide for the purpose of alerting
the authorities to any risk factors and to ensure guidelines are consistent worldwide.
Superweed outbreak starts herbicide race

YCARETIL CIFITNEICS
In the US’ Farm Belt, superweeds such as pigweed that are immune to what had previously
been the most effective weedkiller, Roundup, are taking over prime crop fields. This has caused
large farming businesses to use greater amounds of very harsh older herbicides.
Monsanto, the company that makes Roundup also sells seeds for plants that are not
affected by Roundup, including corn and cotton. This means that farmers can spray these crops
without worrying about it harming them. These `Roundup-ready ’ crops now account for 80%
of all the corn grown in the US.
Roundup proved so effective that many of the older herbicides that damaged both weeds
and crops ceased to be used. But these new superweeds that are proving resistant to Roundup
have seen chemical companies start to increase production on the older herbicides to try to
wipe out the superweeds.
In addition, the chemical companies are creating new crop varieties that are resistant
to the old herbicides. This will mean that farmers can spray the herbicides on to their crops
without worry, rather than be very careful about where they spray the herbicide.
Questions
1 Glyphosate is the active ingredient of Roundup. Research and explain why Monsanto
initially chose to engineer crops that are resistant to glyphosate rather than to another
chemical.
2 Evaluate the return to older, more powerful herbicides as a long-term solution to this
problem.
3 Suggest how pigweed may have acquired glyphosate resistance.
4 Given the information provided above, discuss the benefits of herbicide-resistant
crops to farmers and how this balances with the benefits to the company that produces
them.
9780170452922
Question set 7.4

REMEMBERING the issues this case highlighted for the
1 Explain the term superweed. farming industry?
4 ‘The problem with producing herbicide-
UNDERSTANDING resistant crops is that weeds also become
2 Differentiate between target and resistant and farmers have to use more
non-target organisms in the context herbicides to control the weeds.’ Discuss
of GM crops. why this problem is an issue for farmers
REFLECTING and the environment.
3 Summarise the events that led up to the 5 Draw a table and make a summary of the
Marsh vs Baxter case. What are some of benefits and risks of transgenic crops.
7.5 EMERGING TECHNOLOGIES

Biotechnologists are investigating a number of new techniques that use DNA, including cloning
and stem cell therapy. In the future, these may be used on their own or in conjunction with other
processes for benefits in both medicine and agriculture.
Cloning
Cloning is the process of making an identical copy of an original. In biology, it is used in two contexts.
First, there is cloning a gene, which involves using recombinant technology: a gene is extracted from
one organism and then inserted into a bacterium, where it is reproduced many times for various uses
and further study.
Second, there is biological cloning, which involves cloning an entire organism: reproductive
cloning. Cloning can make it possible for cattle or sheep with desirable characteristics, such as high
milk production or fine wool growth, to be produced more rapidly than through the normal cycles of
reproduction and selection. It is achieved by embryo splitting or by nuclear transfer.
Embryo splitting
In embryo splitting, egg cells are removed from the donor female and fertilised in vitro (i.e. in tissue
culture) by sperm from the male. After the zygote has divided, the coat around the two cells that
promotes cell division is removed and the two cells are separated. Each cell is then given an artificial
coating that promotes cell division. Embryos that have just begun to differentiate, called blastocysts,
are implanted into surrogate mothers. The individuals are genetically identical; they are like identical
twins but are carried by different surrogate mothers.
Nuclear transfer
The process of cloning by nuclear transfer came to prominence when Dolly the sheep was cloned
in 1996. Nuclear transfer involves removing mature donor somatic cells from a mature animal and
a recipient egg cell from another mature animal of the same species (Figure 7.19 on page 238).
The donor cells are cultured in a nutrient medium before being inactivated, and the nucleus of the
recipient egg cell is removed.
The intact nucleus from a donor cell is fused with the hollow egg from the recipient cow by
an electrical impulse. The new single-celled embryo is cultured for about a week, then cell division
is activated and the developing blastocyst is surgically implanted into the surrogate mother. The
offspring is genetically identical to the nucleus donor.
9780170452922
Recipient egg
Donor cow from ovary
Nucleus containing DNA is removed
Donor cells
are cultured
Donor cell’s nucleus is

electrically fused with the hollow egg
New single-celled
embryo, containing
the DNA of the
Laboratory culture for donor cow only
1 week
Embryo is transferred to
surrogate or frozen for later use
Embryo is transferred
to surrogate cow for
gestation
Cloned cow, genetically

identical to the donor cow
FIGURE 7.19 Using nuclear transfer to clone a cow from a donor cow
Cloning using nuclear transfer has not been without controversy. The success rate of live births is
low, and many of the offspring suffer from severe deformities. For these reasons alone, the scientific
world is almost universally opposed to experimenting with reproductive cloning of humans.
Stem cell research (optional extra study)

Most of the cells of our body, for example blood, liver, brain and nerve cells, are specialised to
perform particular functions. These specialised cells have become differentiated by following a
particular developmental pathway, and for them there is no turning back. In contrast, stem cells
are undifferentiated cells that have the potential to develop into many different kinds of cell. Unlike
differentiated cells, stem cells also have the capacity to keep dividing and renewing themselves.
These two characteristics make them ideal for cell-based therapies that aim to replace tissues that
have degenerated or been damaged, such as in Parkinson’s disease, diabetes, heart failure and spinal
injuries. Stem cells may prove useful in the development of new methods for gene therapy, or for
researching early stages in human development, and for understanding cell differentiation and
function. Research into stem cells may also provide answers as to why cells become cancerous and
how this may be prevented. When grown in culture, stem cells can be useful for testing drugs safely
before they are trialled in humans, or for screening pesticides for the effects of potential toxins before
they are used in the environment.
There are two main types of stem cell: embryonic and adult. Embryonic stem cells are derived
from a 4–5-day-old embryo. They have the ability to form virtually any type of cell found in the
human body, and are therefore said to be pluripotent, which makes them particularly attractive for
cell-based therapies. Embryos are obtained from parents who have completed fertility treatment
9780170452922
and have consented to donate excess embryos to Inner cell mass

research. However, to obtain the stem cells requires Embryo
the destruction of an embryo, which raises significant

ethical issues, and governments have had to ensure
that there are strict regulations for controlling the
use of this technology. Embryonic stem cells grown Inner cell mass
in culture (Figure 7.20) also have a tendency to form
tumours called teratomas, which may limit their
usefulness.
Clumps of cells
Adult stem cells are undifferentiated cells found
among differentiated cells in a tissue or organ after
birth. They are multipotent and can give rise to a
more limited range of cell types, which may limit Colonies of
embryonic
their usefulness in cell-based therapies. However,
stem cells
they do not form teratomas and therefore may be
safer to use. Adult stem cells also have the advantage Differentiation factors
of avoiding the ethical issues associated with the
use of embryonic cells, and tissues generated from
these cells can circumvent problems with transplant
rejection if they are derived from the person who is
to receive the stem cell therapy.
Colony of Colony of Colony of
Under specific circumstances, differentiated
blood cells skin cells bone cells
cells can also be made to divide again by artificially
inducing the expression of specific genes. These are
called induced pluripotent stem cells, and they also
can be used as a source of stem cells. Considerable
research is being undertaken to try to understand
how to make and use induced pluripotent stem cells.
There are pros and cons for using the various
types of stem cells, and research is continuing. Other FIGURE 7.20 Embryonic stem cells from humans
research is also looking into the obtaining of stem can be cultured and made to differentiate into
cells from umbilical cords and placentas. any type of human tissue.
Key concept
New DNA technologies, such as cloning and stem cell research, provide hope for solving the
current issues with DNA technology as well as hope regarding future applications.
Question set 7.5

1 Define: 4 Describe how genetically similar a clone
a cloning of you would be to yourself.
b stem cell. 5 Summarise the differences between
2 Recombinant DNA technology is a form of embryonic stem cells and adult stem cells.
which type of cloning? 6 Explain why stem cells may be useful
3 List the two techniques used in biological for treating diseases such as Parkinson’s
cloning. disease and diabetes.
9780170452922
CHAPTER 7 ACTIVITY
7.1 Speciation and conservation: the eastern barred bandicoot
The eastern barred bandicoot
YTIVITCA
(Parameles gunnii) belongs to the

marsupial family Peramelidae. It
is small (body about 300 mm, tail
200 mm), grey-brown in colour and
has four pale stripes or ‘bars’ on its
hindquarters. It has three claws on its
front feet, which it uses for digging,
while the back feet are long, similar to
namfuaK evetS/segamI ytteG

those of a kangaroo.
Populations of the eastern barred
bandicoot were once common over a
wide area of south-western Victoria, but
numbers were reduced dramatically FIGURE 7.21 The eastern barred bandicoot (Perameles gunnii)
in the 1900s. The Victorian population
of the eastern barred bandicoot got to the brink of extinction in the late 1980s. This was the result of
widespread loss of habitat (from clearing of woodlands, growing of exotic pasture grasses, and grazing by
domestic stock) and the introduction of cats and foxes.
Conservation plans for the eastern barred bandicoot depended heavily on how its populations
were classified. A subspecies is a level of classification below species. It refers to a race of a species
that is fairly permanently geographically isolated from other populations of the species, and which
may in future diverge to become a separate species. Because of the relatively healthy eastern barred
bandicoot populations in Tasmania, the eastern barred bandicoot was not regarded as an endangered
species. If the Victorian population were classified as a different species, or subspecies, however, then
it could be recognised independently for conservation purposes.
A number of studies were conducted on the Victorian and Tasmanian populations. The bandicoots
were trapped, small blood samples taken, and the animals released immediately where they were
caught. The blood was snap frozen, and later a DNA fingerprint was taken by analysing the genomic
Hamilton
DNA: 23% variation within
population Eastern barred bandicoot
Mitochondrial DNA: 0%
variation within the population
Between populations
Between species
DNA: 44.8% variation
Mitochondrial DNA:
Mitochondrial DNA:
2% variation
2.3% variation
Tasmania
DNA: 21.8% variation within
population Long-nosed bandicoot
Mitochondrial DNA: 1.1–1.7%
variation within the population
FIGURE 7.22 DNA variability in different populations of eastern barred bandicoots. A 2% variation is the average
difference between subspecies of a mammal species.
9780170452922
variable nucleotide tandem repeats (VNTRs). The average percentage difference in the VNTRs within
the populations around Hamilton was found to be about 23%, and for those in Tasmania it was 21.8%.
The average percentage difference between the Hamilton and Tasmanian populations was 44.8%.
Further testing was done using mitochondrial DNA (mtDNA) restriction fragment length
polymorphism (RFLP) analysis. This revealed a 0% nucleotide variation within the Tasmanian
populations and a 1.1–1.7% variation within the Victorian populations. The percentage variation
between the Victorian and Tasmanian populations was 2.3%. A variation of 2% is the average
difference between subspecies of a mammal species.
There was no doubt that the two populations had diverged to some extent, due to geographical
isolation (see ‘Divergent evolution’, page 276). The two populations are now considered separate
subspecies. This is vital to how the conservation of these two populations of eastern barred
bandicoots can be managed.
Biologists currently use a variety of species concepts, all of which are based on the theory
of evolution. The biological species concept defines a species as a reproductive community of
populations that occupies a specific niche in nature. The identification of species often uses data from
genetic analysis, and DNA fingerprinting is often used to determine which groups are related – that
is, share a gene pool – and which aren’t. A species defined according to this concept would be the
smallest group of organisms that share a common ancestor not shared by any other organism.
The Australian Government, through the Department of Sustainability, Environment, Water,
Population and Communities, has now listed two subspecies of P. gunnii. The following is an excerpt
from the listing for the eastern barred bandicoot.
Scientific name: Perameles gunnii unnamed subspecies
Common name: eastern barred bandicoot (mainland)
The genetic diversity, as measured by the variable number of tandem repeat markers and
mitochondrial DNA restriction fragment length polymorphisms, among specimens from
Hamilton, Victoria was greater than that found in widespread populations of the Tasmanian
subspecies (Perameles gunnii gunnii). The justification for considering the mainland form to be
distinct is based in part on morphological comparisons of island and mainland forms, and that
mtDNA data indicated separation of 270 000–620 000 years ago.
A long-term captive breeding program, followed by a collaborative genetic rescue program,
was undertaken, because the genetic variation within the mainland subspecies was found to have
been depleted, threatening their long-term persistence. Male bandicoots from genetically diverse
Tasmanian populations were brought across to breed with Victorian females at the Mount Rothwell
Conservation and Research Centre. The program was successful and the scientists involved
celebrated a 200% increase in genetic variation in that population. A successful captive breeding
program commenced in 1991 has now established a population at Mt Rothwell. Other releases at
Hamilton, Churchill Island and Phillip Island are looking promising.
Aim
To investigate speciation in the eastern barred bandicoot and relate this to conservation approaches
Questions
Coming to the
1 Which species definition could be used to justify classifying the two populations as separate genetic rescue of
subspecies? our endangered
2 How might the recognition of two separate subspecies by the Australian Government help in marsupials
Learn more about
re-establishing the eastern barred bandicoot in mainland Victoria? genetic rescue at
3 In your opinion, could losing the mainland subspecies of the eastern barred bandicoot affect the this site.
long-term survival of the species as a whole? Explain.
9780170452922
WS
CHAPTER 7 SUMMARY
Chapter 7 • DNA identification technologies are applied for example, the introduction of GM
Activity sheet
in agriculture to identify genes in crops and micro-organisms to polluted areas for the
animals that offer increased yield, quality biodegradation of pollutants.
and productivity. • Conservation breeding programs require
• DNA identification technologies are careful planning and should consider the
applied in environmental conservation following factors:
to maintain genetic diversity. Specific • biogeography
applications are: • reproductive behaviour
• monitoring of endangered species • population dynamics.
• assessing gene pools for breeding • Using transgenic organisms may have
programs adverse effects on genetic diversity and on
• quarantine. the environment, including:
• Recombinant DNA technology is being • effects on non-target organisms
applied in agriculture as genes that increase • more rapid evolution of pesticide-
yield can be identified, extracted and resistant species
inserted into crops. • the possibility of gene flow resulting in
• Transgenic organisms have been engineered superweeds
for: • reduced genetic variation.
• resistance to pests and diseases • Australia has strict laws governing the
• faster growth rate commercialisation of GMOs; however,
• greater product quality and yield the protection of non-GMO crop farming
• tolerance to adverse environmental remains an issue.
conditions. • Emerging technologies are being further
• Recombinant DNA technology is being developed, including cloning and stem cell
applied in environmental conservation: research.
CHAPTER 7 GLOSSARY
Adverse conditions Factors in the environment those distributions have changed over geologic
detrimental to the survival or growth of an time
organism
Bioremediation Consumption and breakdown
Agriculture The science and management of environmental pollutants by deliberately
of growing crops and livestock, including introduced or naturally occurring micro-
cultivation of the soil or other medium organisms; the process is used to treat
Beta-carotene (β-carotene) A plant pigment contaminated water and soil
that can be converted to vitamin A after
Captive breeding program (conservation breeding
consumption
program) A breeding program that aims to
Biodegradation The breakdown of an organic maintain or increase genetic variation in a
substance by micro-organisms (such as bacteria population of an endangered species in order to
or fungi) through decomposition avoid extinction
Bioengineering The combination of biology Climate change The current climate change
and engineering tools to create a usable product, occurring on Earth encompasses increasing
such as a transgenic organism global average air and ocean temperatures,
Biogeography The study of the distributions of rising global sea levels, long-term sustained
living things over a geographical area and how widespread reduction in snow and ice cover,
9780170452922
and changes in atmospheric circulation, ocean in a population; population growth, density,

circulation and regional weather patterns, urbanisation and migration (immigration and
which in turn influence seasonal rainfall emigration) are factors considered in population
conditions. The current change is thought to dynamics
be mostly due to human activity, primarily the Quarantine A period of isolation serving to
burning of fossil fuels prevent the spread of a contagious disease;
Conservation biology The integrated study suspected cases are isolated from local,
of ecology, physiology, evolution, molecular susceptible populations until at least the
biology and genetics with a view to sustaining incubation period is finished, clinical signs and
biodiversity at all levels; a broad approach symptoms have passed and a scientist confirms
to preserving what biodiversity remains, and the suspected pathogen is no longer present
determining the due care and attention needed Recombinant DNA technology Tools and
for protecting it for the future techniques used to transfer a gene from a cell
Emigration Leaving a country or region of a member of one species to the genome of a
Endangered species A species threatened with different species
extinction Reproductive behaviour Patterns of animal
behaviour related to the production and care
Gene flow The transfer of genes from one
population to another; in relation to agriculture, of offspring, including the establishment of
this could mean from GMO crops to other species mating systems, courtship, sexual behaviour,
fertilisation, and raising of young
Gene pool A collection of all the alleles for
all the genes in the reproducing members of Roundup Ready® crop Crop tolerant to the
a population at a given time; it is the genetic herbicide called Roundup Ready, which
reservoir from which a population can obtain its contains the active ingredient glyphosate
traits Superweed A species of plant, transformed by
See a gene from a GMO to increase its growth rate,
Genetically modified organism (GMO)
disease resistance or tolerance of environmental
transgenic organism
limits, that has become difficult to control; it is
Herbicide Substance used to control or kill
able to outcompete native or crop species and
weeds, ideally leaving a crop unharmed
has become a significant weed
Immigration Moving to a new country or region
Transformation The process by which DNA
Inbreeding depression Occurs in small, isolated is taken from one organism and inserted into
populations of animals and plants that are another organism, usually of another species, to
closely related, and thus genetically similar; the obtain a desired characteristic
offspring have an increased risk of deleterious
Transgenic organism An organism that has
recessive alleles becoming homozygous, causing
been modified by incorporating into its genome
genetic diseases
a piece of foreign DNA
Insurance population A population brought in
Viable gene pool A minimum collection of
from the wild as a safeguard against a species’
alleles and genes that have enough diversity for
extinction
survival in a changing environment, even when
Marker-assisted breeding Selection of seeds limited to inbreeding within the population
for a breeding program by plant scientists that
Vitamin A A fat-soluble vitamin that helps
involves checking the seeds for DNA markers
maintain normal reproduction, vision and
that are associated with beneficial traits
immune function
Monoculture The practice of growing a single
Yield A measure of production of a crop per
strain or variety of crop in a particular area
unit area of land cultivation, and the seed
Outcrossing The migration of genes from GM generation of the plant itself; farmers calculate
plants to conventional crops or wild species the yield by counting the number of grains in
Population dynamics The study of the number, at least 10 heads or pods and calculating the
gender, age and relatedness of individuals average number of grains per head or pod
9780170452922

Remembering
1 Describe an example of the application of a transgenic organism in agriculture to obtain an
increase in yield.
2 List three endangered species involved in a captive breeding program.
Understanding
3 Some critics of GMOs are concerned about potential cross-pollination of GMOs with organic
crops, because pollen, a male gamete, can be carried by the wind to neighbouring fields.
Cross-pollination does occur naturally in the wild and produces hybrid plants. For
cross-pollination of a GMO to succeed with another species, the species needs to be
similar. Explain what this means.
4 PCR can be applied both in identification and in recombinant biotechnology processes.
Describe its role in both.
Analysing
5 One concern raised about GM crops is that some traits may be ‘too advantageous’. Explain why
this may be a concern.
The following relates to Questions 6 and 7. GM salmon (AquAdvantage salmon ®) have been bred
to reach market weight in half the time taken by their non-GM form. Many people are concerned
about what would happen if they escaped into the wild. Some believe that engineered salmon
would grow at a faster rate than non-GM salmon in a natural environment, which is what occurs
in a hatchery environment. The results of one study, performed in a similar transgenic salmon, are
summarised in the graph in Figure 7.23.
350
300
250
)sertemillim( htgneL
200
150
100
50
0
Non-GM GM Non-GM GM
Hatchery environment Simulated natural environment
FIGURE 7.23 Length of non-GM and GM salmon bred in different environments
6 Using the information in the graph, determine the following:

a the average length of a GM salmon in a hatchery environment
b the length of a GM salmon divided by the length of a non-GM salmon in a hatchery
environment
c the length of a GM salmon divided by the length of a non-GM salmon in a simulated natural
environment.
9780170452922
7 Select the correct word in the following conclusion and rewrite the statement.
It was shown that the increase in the growth rate of the GM fish compared with the wild fish in
the simulated natural habitat was greater/less than that observed in the hatchery tank.
Evaluating
8 Describe the potential impact escaped GM fish might have on non-GM fish.
9 Describe three potential benefits of GMOs.
10 Discuss three possible harmful effects of genetic modification.
11 State the purpose of a captive breeding program.
12 Describe the role of DNA profiling in a captive breeding program.
13 Due to habitat loss and bushfires, koala distribution has become fragmented. Isolation of
populations has led to inbreeding. Explain the impact of inbreeding on a population.
14 State four ways in which agriculture has been improved through the use of biotechnology.
Reflecting
15 Discuss the potential benefits of the application of biotechnology in biology.

1 Biogeography is the study of: Use the following information to answer
A population dynamics Questions 3 and 4.
B reproductive behaviour
A biologist measured the amount of genetic
C infectious diseases
diversity in five populations of the Australian
D species’ distributions.
platypus. The amount of genetic diversity in
[Q23 2018 SCSA] each population is indicated by the diversity
index. Values of the diversity index range from
2 The following list shows the main steps
0 (no diversity) to 1 (maximum diversity).
in a genetic engineering experiment, in no
particular order.
POPULATION DIVERSITY INDEX
Step A. Enzyme cuts source DNA at specific Central Victoria 0.597
sites.
North-western Tasmania 0.606
Step B. Bacterial cells with recombinant
King Island 0.032
plasmid reproduce.
Kangaroo Island (wild) 0.419
Step C. Source DNA is combined with a
Kangaroo Island (sanctuary) 0.431
plasmid.
Step D. Bacterial cells with recombinant
3 The mean value of the diversity index in
plasmid are selected.
the five platypus populations is:
Which of the following lists these steps
A 0.346
in the order in which they occur in the
B 0.417
experiment?
C 0.236
A A→C→D→B
D 0.504.
B B→D→A→C
[Q22 2016 SCSA]
C C→B→A→D
D D→C→B→A
[Q25 2018 SCSA]
9780170452922
4 On the basis of the information in the 8 Discuss why populations with reduced
table, which of the following platypus genetic diversity face an increased risk of
populations is at the greatest risk of extinction and how biotechnology can be
extinction due to genetic factors? used to reduce this risk. (10 marks)
A Kangaroo Island (wild) [Q37b 2018 SCSA]
B Kangaroo Island (sanctuary)
9 Chymosin is an enzyme produced by
C north-western Tasmania
nursing calves to assist with the digestion
D King Island
of milk. Humans also use chymosin to
[Q23 2016 SCSA]
make cheese. Traditionally, chymosin
5 Agrobacterium is commonly used in the for cheesemaking was obtained from the
production of transgenic plants (its capacity stomach of calves that had been killed
to cause disease is deactivated first). for their meat. It is now obtained from
Outline the role that Agrobacterium plays genetically modified micro-organisms.
in the production of transgenic plants and Describe the advantages of obtaining
explain why it is well suited to this role. chymosin for cheesemaking in this way.
(4 marks) (4 marks)
[Q34e 2019 SCSA] [Q36a 2017 SCSA]
6 Explain how biotechnology can be used to 10 In making conservation plans to maintain

determine the father of a litter. (4 marks) viable gene pools, why do biogeography,
[Q33e 2018 SCSA] reproductive behaviour and population
dynamics need to be considered? (10 marks)
7 Explain how the use of transgenic crop
[Q36b 2017 SCSA]
plants may have adverse biological effects.
(10 marks)
[Q37b 2019 SCSA]
9780170452922
247
8
EVIDENCE FOR CHAPTER 8 CONTENT
THE THEORY OF By the end of this chapter, you will have covered the
following material.
EVOLUTION STARTER QUESTIONS

1 Preserved bones and tracks are two types of fossils. Can you
describe other types of fossils?
2 Do you know what a theory is? Can you explain why
evolution is described as a theory?
3 Bioinformatics is a science that is integral to most aspects
of biological research: sequence analysis, next-generation
sequencing analysis, working out evolutionary relationships
and phylogeny. But do you know what it involves?
» life has existed on Earth for approximately 3.5 billion years
and has changed and diversified over time
» evidence for the theory of evolution includes
– comparative genomics (molecular evidence)
– the fossil record
– comparative anatomy and embryology
» evolutionary relationships between groups can be
represented using phylogenetic trees

» technological developments in the fields of comparative
genomics, comparative biochemistry and bioinformatics
have enabled identification of further evidence for
evolutionary relationships
9780170452922
8.1 LIVING THINGS CHANGE AND DIVERSIFY

Life has existed on Earth for approximately 3.5 billion years and has changed and diversified over
time. The life forms we see on Earth today are incredibly varied and beautiful. In addition, many of the
characteristics of these diverse life forms seem to help the various species to survive in their unique
environmental conditions.
The diversity has come about through many changes. Changes that occur in a population of
living things accumulate over generations (over a long period of time), because they are inheritable
and transform a population’s gene pool. This type of change is known as evolution. Evolution is the
process of cumulative, inheritable change in a population over many generations.
Information on Australian species has traditionally been housed in museums, universities, and
government departments and organisations. In 2006, however, a collaboration between CSIRO,
Australia’s museums and herbaria, universities, and the Australian Government commenced
development of the Atlas of Living Australia (ALA), a national project focused on making biodiversity
information accessible and usable. As part of this project, CSIRO has created a free online database
to support the research and monitoring of Australia’s biodiversity, showcasing Australia’s amazing
variety of animals and plants. They built the tool so that all Australians interested in monitoring and
maintaining our biodiversity can collaborate, accessing and sharing data quickly.
Atlas of Living
Australia Australia has environments ranging from tropical rainforest to desert to coastal to alpine. As a
Click on the ‘Community result, we also have a wide range of unique native species. Figure 8.1 shows a selection of animals
and Schools’ tab. Then
click on the ‘Explore native to WA. You can observe, and you may also have some previous knowledge of, some of the
Your Area’ option. Type differences between these species and the traits they possess. What information could you gain about
in your postcode and the relationships between these species from morphological studies? Do you think these species
view some of the diverse
species that inhabit your are closely related or not at all related? Could genetic investigations assist with providing further
local area. information?
a b
namreJ naJ/moc.kcotsrettuhS
otohpsoiB/otohP kcotS ymalA
c d
)ne.deed/0.2/as-yb/sesnecil/gro.snommocevitaerc//:sptth(
0.2 AS YB-CC 43sicnarFdivaD/snommoC aidemikiW
notsuoH yrreT rehpargotohp :muesuM AW
FIGURE 8.1 The diversity of life in WA: a Mitchell’s diurnal cockroach; b peacock spider; c ground shield bug;
d Dawson’s burrowing bee
9780170452922
CHAPTER 8 | Evidence for the theory of evolution 249
The word ’evolve’ means to develop gradually. It is important to note that the development of an
individual organism is not considered evolution. Individual organisms do not evolve. The changes in
populations that are considered evolutionary are those that are inheritable via the genetic material
that is passed on from one generation to the next. If there are enough changes in the gene pool of
a population, a new species may arise. Evolution may be slight or substantial; it embraces everything
from slight changes in the proportions of different forms of a gene within a population, such as the
alleles that determine the different human blood types, to the alterations that occurred on the path
from the earliest organisms to dinosaurs and humans.
A history of evolutionary thought

In the late 1600s, Western civilisations believed in the idea of ‘natural theology’ – that every kind of
organism has essential, unalterable characteristics. As biological studies blossomed, naturalists began
noticing variability in species, and the discovery of the remains of animals unlike anything seen before
introduced the idea of extinction, which challenged natural theology: where did these giant animals
come from, and where did they go?
Questions like this prompted naturalist Jean-Baptiste Lamarck to devise the theory of
‘transmutation of species’. Lamarck suggested that organisms pass on to their offspring characteristics
that they acquire during their lifetimes; that is, individual behaviours during the lifetimes of organisms
were the mechanism that drives adaptation. Although now discredited, this was the first theory that
embraced evolution.
The theory of evolution by natural selection

In the 1850s, two naturalists named Alfred Russel Wallace and Charles Darwin were studying and
collecting forms of life in different parts of the world. Working separately, they both arrived at
the same idea about how species ‘came to be’, refuting Lamarck’s theory. Darwin referred to ‘this
principle, by which each slight variation, if useful, is preserved, by the term of Natural Selection’.
Originally published in 1859 as On the Origin of Species by Means of Natural Selection, or the
Preservation of Favoured Races in the Struggle for Life , Darwin’s work is now commonly known as
The Origin of Species .
Natural selection is the principle theoretical mechanism for evolution. The theory of evolutionary
change through natural selection links all species to a common ancestor. An ancestor is a species
from which other species have evolved, and a common ancestor refers to an ancestor that is shared
by different species. This is supported by molecular evidence: the fact that there is a common genetic Diversity in nature
code in the form of DNA and RNA. A theory is an explanation that has not been proven as fact but An evolutionary
biologist and his
is supported by evidence. The evidence for the theory of evolution, discussed in this chapter, is a photographer have
substantial body of observed data collected over many years. captured images of
The basis of Darwin’s theory of evolution was that individuals within a population showed a
39 species of birds
of paradise. Birds of
range of variation in their characteristics. Those with characteristics, or traits, most suited to their paradise are renowned
environment would have an advantage over other individuals, making them more likely to survive and for their beauty, and
for their peculiar and
pass these traits to the next generation. In each generation, the favourable traits (i.e. alleles) would outrageous adaptations.
become more common, and the population would gradually change to become better suited to its
environment. Darwin provided evidence for descent with modification (branching evolution) in the
form of patterns in variation of domesticated and wild species, and patterns in species’ distributions in
time and space.
This was a new approach to understanding evolutionary relationships. Much of the previous
work had viewed relationships between organisms to be like a ladder, and assumed that life could
be organised into a hierarchy of lower to higher organisms. Darwin proposed a ‘tree-like’ scenario,
in which life’s lineages could be mapped on a branching diagram. Using this analogy, the forks in
9780170452922
the branches mark points at which new species arise – evolutionary events that occurred when
populations became so different from other populations of the same species that they could no longer
interbreed. This important concept is the basis of phylogeny. Phylogeny seeks to reconstruct the
evolutionary history of any given group of organisms, studying the similarities and differences between
them. Evolutionary biologists are still wondering, though, how life first started. How did the inanimate
transform into the animate?
Key concept
Evolution is gradual: organisms with small and favourable genetic changes survive more often
due to natural selection; these changes are passed to the next generation and accumulate over
a long time.
The detailed history of the evolution of today’s many life forms is complex, and our path in
coming to understand those details has involved a great many hypotheses, investigations and
analyses. The contemporary view of evolution, the modern evolutionary synthesis, has come
from more than 150 years of research and observation. There are currently five main sources of
evidence for the theory of evolution: biogeography (long term studies on life on earth) comparative
genomics (genetics), the fossil record (palaeontology), comparative embryology (developmental
biology) and comparative anatomy.
Question set 8.1

REMEMBERING transmutation of species by spontaneous
1 Define generation and Darwin’s theory of
a evolution evolution by natural selection.
b common ancestor. 4 Compare the definition of evolution with
2 For how long has life has existed on the theory of evolution.
Earth? 5 Explain why evolution is applied to a
population, rather than an organism.
UNDERSTANDING
3 Explain the similarities and differences
between Lamarck’s theory of
8.2 LIFE HAS CHANGED AND DIVERSIFIED

OVER TIME
The life and times of Earth (so far)

Scientists use a geological timescale within which they can place the major changes that have
occurred in the history of Earth and of life. Time has been divided into segments covering millions,
sometimes billions, of years. First, geologic time is divided into eons, then eons are split into eras,
eras into periods and periods into epochs. Geologic time is usually expressed as mya (millions of
years ago). Conditions on Earth have changed significantly over time, and populations have adapted
or become extinct. One of the major changes on Earth is the process of continental drift, which
includes the changes in the landmasses on Earth from one supercontinent called Pangaea to the
number of continents we have today, and their relative movements. Key events that have occurred so
far in Earth’s time line are summarised in Table 8.1.
9780170452922
TABLE 8.1 Geologic timeline and key events in the history of life on Earth
EONS ERAS PERIODS (AND MYA CONTINENTAL LIFE

EPOCHS) ASSOCIATIONS
Hadean, Precambrian 4560–542 First life (prokaryotes:
Archaean Archaea) 3.500 mya
and First bacteria
Proterozoic
First eukaryotes
First multicellular
organisms
Phanerozoic Palaeozoic Cambrian 542–488 Australia is part of First invertebrates
Gondwana Arthropods (including
trilobites) Super fossil finder
Diverse marine Follow the instructions
communities
to simulate a fossil dig.
Align the fossils with
Jawless fish their geological time
period.
First land plants and
arthropods
Jawed fish
First trees
First land vertebrates
Ordovician 488–444 Ferns dominant
Silurian 444–416 Swampy forests
Vascular plants diversify
Devonian 416–359 Insects appear – the first
winged animals – and
become dominant
Carboniferous 359–299 Gondwana moves First reptiles and
south amphibians – become
dominant
Permian 299–251 Laurasia and Reptiles dominant, rise
Gondwana unite to of reptilian ancestors of
form Pangaea mammals
Mesozoic Triassic 251–200 Catastrophic mass
extinction eliminates
most life. Surviving
organisms start to
diversify, including
dinosaurs
First mammals
Dinosaurs dominant
Jurassic 200–146 180 mya: Pangaea Gymnosperms are the
begins to break up dominant plants
160 mya: Africa
breaks from
Gondwana
9780170452922
EONS ERAS PERIODS (AND MYA CONTINENTAL LIFE

EPOCHS) ASSOCIATIONS
Cretaceous 146–66 Remaining part of First flowering plants
Gondwana breaks (angiosperms)
up Arrival of marsupials in
Australia via Antarctica
Dinosaurs populate
huge rift valley between
southern Australia and
Antarctica
Cainozoic Palaeogene 66–23 Australia begins Dinosaurs now extinct
(Palaeocene, to break from Flowering plants, birds
Eocene and Antarctica and drift and mammals radiate
Oligocene north into newly vacant niches
epochs) Inland seas form as left by dinosaurs
eastern highlands First Eucalyptus species
lift
Rainforests contract to
Antarctic ice cap the equator
begins to form
Neogene 23–3 Separation of First Acacia species
(Miocene Australia and Large marsupials are well
and Pliocene Antarctica established
epochs) complete
Quaternary 3–present Australia close enough to
(Pleistocene Asia to allow exchange
and Recent/ of plants and animals
Holocene (e.g. bats and rodents)
epochs) Major ice ages
First humans arrive and
increase in range
Species extinction due to changes in climate, sea level and

atmospheric oxygen
Over the course of its history, Earth’s climate has oscillated between hot, humid periods and cold, dry
periods. Evidence for this has been found in ice cores drilled in Greenland and Antarctica. Some ice
cores are several kilometres long and contain a record of the climate dating back 100 000 years. It
appears that past fluctuations have been dramatic.
For much of its history, Earth was considerably warmer than it is today, and the temperature
gradation from the equator to the poles was not as great. In contrast, towards the end of the
Precambrian era, over a period including the Carboniferous and Permian periods, and from the
Oligocene epoch till around 12 000 years ago, snow, glaciers and sheets of ice covered much of
Earth. Between these cold, dry periods there were long periods, millions of years long, of warmer
temperatures, when the ice melted, the sea level was higher, humidity was generally higher and
vegetation was generally more tropical. Such climate variations inevitably affect life, and it is possible
to track some of these changes through the fossil record, especially fossil plants.
A critical environmental factor for life is the composition of the atmosphere. Earth’s first
atmosphere most likely had little oxygen. Evidence from ice cores shows that the oxygen
concentration began to increase about 2.5 billion years ago. By 1.5 billion years ago, the level
was about 1% of the present level. By 600 mya it had risen to about 5% of the present level. The
increase in the level of oxygen in the atmosphere is credited to photosynthetic cyanobacteria
9780170452922
living in the oceans. Cyanobacteria were able to use carbon dioxide and water to produce organic
compounds and oxygen, much like plants do. It is likely that increased levels of oxygen in the
atmosphere enabled the growth, evolution and diversification of eukaryotes, which relied on
oxygen for respiration.
Biogeography
Biogeography is the study of the distribution of organisms and ecosystems across the world and
through geologic time. The fauna and flora of Australia owe their uniqueness to the isolation of the
landmass. However, Australia and other landmasses in the southern hemisphere share many plant and
animal groups. By looking at the pattern of these distributions today, and that of the fossils, we are
able to reconstruct its evolutionary history.
Many genera of Indian plants are similar to those of the monsoonal environments of northern
Australia. Some Malaysian rainforest genera occur in the rainforests of tropical eastern Australia.
Southern beech trees, Nothofagus, are found as both living and fossil specimens in mainland
Australia, Tasmania, Papua New Guinea, New Caledonia, New Zealand, Antarctica and South America
(Figure 8.2). The mountains and dry valleys of Antarctica have fossils of Glossopteris seed ferns
(embedded in rocks and coal seams) that are the same as those found in coal deposits in India, South
America, South Africa and Australia. The far-flung distribution of these groups provides evidence that
these countries were once connected as Gondwana.
FIGURE 8.2 The red-shaded areas show where southern beech trees, Nothofagus, are found as both living and fossil specimens in
Australia, Papua New Guinea, New Caledonia, New Zealand and South America.
Key concept
Evolution of new species arises gradually and has been influenced by geographical changes
over time.
9780170452922
Question set 8.2

REMEMBERING 4 Refer to Table 8.1 (pages 251–252) to
1 Define biogeography. complete the following tasks.
a Identify the era in which life first
UNDERSTANDING appeared.
2 Describe how the study of biogeography b List all periods in which dinosaurs
can provide evidence for evolution. existed.
3 Discuss possible effects on a population c Determine whether Eucalyptus
of large land herbivores if their climate species would be found naturally in
becomes warmer and wetter. Africa. Explain your reasoning.
8.3 EVIDENCE FOR THE THEORY OF EVOLUTION:

COMPARATIVE GENOMICS
Genomics is the study of the whole set of genes of a species and the interactions of the genes
within a genome. The genomes of many species have been fully sequenced. Complete genomes are
now available for humans, chimpanzees, koalas and bacteria, among others. Some organisms share
molecular homologies with one another, as well as the observed structural (morphological) ones.
Homology is similarity between a pair of structures, or genes in the case of molecular homology, due
to shared ancestry. DNA itself is a very simple example of a molecular homology that links all life on
Earth. Both DNA and RNA possess a four-base code that is shared by all living things. All organisms
possess sequences of the same four nucleotides. This is known as the universal genetic code and is
evidence for all life having a common ancestor.
By comparing the genomes of different species, sets of conserved genes that define a taxon’s
characteristics can be determined. A taxon (plural taxa) is a named group of organisms, such as
beetles or reptiles. A clade is a group of organisms that includes all the descendants of a common
ancestor and the ancestor species itself. For example, birds, dinosaurs, crocodiles and their common
ancestor form a clade. Scientists use this information to measure the relatedness of two species.
Relatedness is a measure of evolutionary distance. The relatedness of groups of organisms is reflected
in the similarity of their DNA sequences. Taxa that share a more recent common ancestor with one
another are more closely related than are taxa with a less recent common ancestor further in the past.
Comparative genomics
Comparative genomics is a field of biological research in which researchers use a variety of tools to
compare the genome sequences of different species. The more similar in sequence the genes and
genomes of two species are, the more closely related those species are in their evolutionary history,
Comparative genomics because less time has passed in which mutation and other genetic changes have accumulated. By
Read more about
comparative genomics determining the evolutionary relationships between species from the similarities and differences in
here. their DNA, scientists can better understand how the appearance, behaviour and biology of living
things have changed over time. Features shared by very different kinds of animals, such as humans
and fish, can be encoded by identical genes sequences that have been conserved in both of them.
Such sequences indicate that they share a common ancestor, even though, over time, they have
diverged from one another.
On the other hand, when genomes of closely related species such as humans and chimpanzees
have been studied, certain sequences have been shown to differ, and the nucleotide differences can
be measured.
9780170452922
Scientists don’t always agree about the best way to measure genetic relatedness. Sometimes
particular genes are compared. Sometimes repeated intron sequences (e.g. short tandem repeats)
are compared. Sometimes all of the differences between the DNA sequences in the genome are
compared. For example, the chimpanzee and human genomes have been compared, revealing
a very close evolutionary relationship. The difference between their genomes is about 4%. The
relatively few genes that differ in the genomes of closely related species are likely to be the genes
that cause the observed differences between them and that make them unique. Additionally, by
comparing the genomes of different species, scientists can gain information about the rate of
change in genes. They have found certain genes have been changing (evolving) faster in humans
than in chimpanzees.
In the past, DNA–DNA hybridisation methods have been widely used to analyse the
relatedness of pairs of species, but they can be unreliable when comparing closely related species.
In DNA–DNA hybridisation, DNA is extracted from two organisms, purified and cut into fragments.
It is unwound and the hydrogen bonds joining the two sugar–phosphate backbones are
broken. The resulting single strands of DNA from the two organisms are mixed. Some of the
double-stranded DNA that forms contains DNA from each of the two species and is known as
hybrid DNA. Some lengths of DNA will not pair up because the bases do not match (i.e. they
are not complementary).
The double-stranded molecules are then heated. Greater similarity in the hybridised sequences
means there will be more complementary bonds – the hybrid strands will bind together more strongly
and be more resistant to separating when heated. The resistance to separating can be measured to
work out evolutionary relatedness. The differences are detected as percentage hybridisation. More
matching indicates the two organisms are more closely related.
Analysis of gene similarities has disproved some evolutionary trees that were based on structural
(morphological) characteristics. For example, comprehensive analysis of the genes of wading birds,
through both DNA–DNA hybridisation and DNA sequencing, has shown that the closest living relative
of the flamingo is not a long-legged, graceful wading bird, as previously thought, but the squat grebe
(Figure 8.3). The diving, piscivorous grebes have in the past been grouped with loons. Long-legged,
long-necked flamingos have over the years been grouped variously with storks, waterfowl and stilts.
Multiple DNA studies have confirmed, however, that flamingos and grebes are more closely related to
each other than to the other groups of waterbirds.
a b
nesnnaJ nairB/otohP kcotS ymalA
ave_mup/moc.kcotSi
FIGURE 8.3 Evolutionary relationships can be supported by DNA evidence, such as the genetic links between the
a pink flamingo and the b horned grebe.
Through analysing variation in DNA or RNA sequences, scientists can obtain a measure of
the difference between organisms and trace evolutionary relationships. Ribosomal RNA (rRNA) is
9780170452922
sometimes used in comparative genomics, because across different T. thermophilus E. coli
species the code is very similar and there are relatively fewer differences: 3' 5' 3' 5'
G A G A
it is a highly conserved code. Subtle phenotypic differences between G–C C–G
G*U G*U
species are due to mutations in genes and the resultant differences in
U*G U*G
the sequences of bases. Over evolutionary time, organisms very slowly C–G A–U
C–G C–G
accumulate changes in the sequences of the genes that encode the G–C C–G
ribosome. Any large, rapid change is unlikely to persist, because the C–G C–G
C–G C–G
functioning of the ribosomes is so critical for all aspects of life and A G U U
G C C
reproduction in an organism. The rRNA of two microbes that have
been sequenced and compared is shown in Figure 8.4, illustrating the FIGURE 8.4 Small differences in
subtleness of the changes. rRNA base sequences between
two microbes
Comparative genomics is made possible

with bioinformatics
The comparison of genome sequences of different species or individuals gives a very broad picture
of DNA sequence conservation and mutation frequencies, making it possible to trace evolutionary
processes responsible for the divergence of two genomes. Comparative genomics, however,
produces huge amounts of data that must be stored and analysed in a logical way.
The scale of the computational framework for this volume of biological analysis is huge. Only very
recently has it become possible to undertake these analyses, thanks to bioinformatics – the culmination
of advancements in engineering, computer science, mathematics and biology. Bioinformatics is the
digital storage, retrieval, organisation and analysis of an enormous volume of biological data such as
nucleotide and amino acid sequences from different species. Bioinformatics has dramatically increased
the size, accuracy and scope of data sets, such as those needed for comparative genomics.
Bioinformatics has provided significant advances in our knowledge of the entire genomes of
organisms, and this has revealed yet more evidence of evolution. The base-pair composition of genes
of seemingly unrelated organisms that code for comparable structures is remarkably similar. For
example, the protein that controls building eyes in vertebrates such as humans, which corresponds
to the PAX6 gene, is more than 69% similar in its arrangement to the protein responsible for building
the eyes of an octopus. The similarities in sequence, function and abundance of these genes across
a broad spectrum of phyla are an example of homology, in this case at a molecular level. This is an
example of how the identification of molecular homologies via comparative genomics can reveal the
shared common ancestry of diverse species (Figure 8.5).
Tardigrada Arthropoda
Annelida
Nematoda
Echinodermata
Mollusca
Tunicata
Bryozoa
Brachiopoda Vertebrata
Platyhelminthes
Cnidaria
Porifera
Ancestral PAX-like gene
evolved here
FIGURE 8.5 Comparative genomics has found shared eye-building genes across all animals with eyes. From
these data, we can draw a phylogenetic tree.
9780170452922
Molecular homologies such as these also have application in building branching phylogenetic
trees, a technique of molecular phylogeny. In the example of the eye-building PAX6 gene, it is
possible to conclude that as descendent lineages evolved, the gene was modified in a variety of ways
in different lineages, giving rise to the diversity of eye-building genes seen in modern animals.
Phylogenetic trees
Evolutionary relationships between groups can be represented using phylogenetic trees. These diagrams
show how organisms are related to each other, but the tree is hypothetical, not a certain fact. A
phylogenetic tree can be built using physical information like body shape, bone structure, or behaviour,
or it can be built from molecular information, like genetic sequences. Any DNA, RNA or protein sequence
can be used to generate a phylogenetic tree; however, DNA sequences are most commonly used in
generating trees today. The pattern of branching in a phylogenetic tree reflects how species or other
groups evolved from a series of common ancestors. The more closely related species have a more
recent common ancestor. The more distantly related species have a distant common ancestor.
TABLE 8.2 Phylogenetic tree vocabulary
TERM DEFINITION
Species A species (or sometimes another taxon, such as a group of similar species) is found at each tip
of a phylogenetic tree. It is a group of organisms or populations that can only interbreed among
themselves to produce viable, fertile offspring.
Tip A tip is found at the end of a branch, where a species/taxon name is found. If the species/taxon is still
living (not extinct), the name is aligned with the other species’ names.
Node Each point where two branches split is called a node. A node represents a common ancestor shared by
at least two species. A node is the most recent common ancestor of all species on those branches.
Root If you go all the way down to the bottom of the phylogenetic tree, the last node is called the root.
This is the common ancestor of all the species in the tree.
Field guide:
Branch A branch is a line drawn in the phylogenetic tree. At the end of the branch is the tip, where you find a Squarish-corner tree
species/taxon. The length of a branch can represent the divergence time. View the transition from
one style to another;
Taxon A taxon (plural taxa) is a named group of organisms, such as beetles or reptiles. different styles can
Clade A clade is a group of organisms that includes all the descendants of a common ancestor and that be used to show the
ancestor.
same evolutionary
relationships.
Note: every species to the right of the root would have diverged from a single common ancestor at the root.
Tip
Species A
Node Clade
Species B
Species C
Species D
Clade
Species E
Root
Node
Species F
Branch Taxon
FIGURE 8.6 The relationships between parts of phylogenetic trees
Differences between legless lizards and snakes include the facts that legless lizards lack venom
glands, they cannot constrict prey and they have a fleshy tongue rather than a forked tongue.
Morphological (physical) traits help us describe species, but they do not define them. Snakes and
9780170452922
legless lizards do have structural differences, but they also seem morphologically similar due to the
absence of legs. However, DNA sequencing indicates that legless lizards and snakes evolved from
different lineages of legged lizards. This is an example of convergent evolution, which is discussed
later in this chapter.
a b
LN.LAATIGIDOTOHP /MOC.KCOTSRETTUHS
SHTIFFIRG NEK/MOC.KCOTSRETTUHS
FIGURE 8.7 a Legless lizard; b snake. Snakes diverged from their common ancestor a relatively long time before legless lizards.
To build your own phylogenetic tree, to show relative evolutionary relatedness (how recently
two species shared a common ancestor), you need to know about either morphological differences
or genetic differences. Use the guidelines in Worked example 8.1 to practise constructing your own
phylogenetic tree.
Worked example 8.1

Draw a phylogenetic tree
Consider the following table of data and use it to construct a phylogenetic tree.
ANIMAL JAWS LIMBS HAIR PLACENTA
Salamander Yes Yes No No
Mouse Yes Yes Yes Yes
Jellyfish No No No No
Koala Yes Yes Yes No
Salmon Yes No No No
STEP VISUAL AID

1 After arranging your species in a table of
differentiating features, find the species that is
the most different from the other species. This is Jellyfish
the species that diverged first. It is the one that
does not have any of the traits observed and is
called the outgroup, The simplest hypothesis is
that it has the most distant common ancestor
with all the other species and is the most
distantly related to them.
2 Draw a deep branching out point to show there

is a further common ancestor not mentioned. FIGURE 8.8 The most distantly related species have
Then draw your second branch to a tip to the most distant common ancestor.
include that first distantly related species you
identified in step 1.
9780170452922
STEP VISUAL AID

3 Find the feature that all of the remaining species
have in common, and label the first section of Jellyfish Salmon
the diverging branch with that feature. Next,

find the species that only has that one feature
in common with the others, and draw a branch
from the main branch to a tip. Write the name Limbs
of this species at the tip.
Jaws
4 Find the next most common trait. Write the trait
on the next section of the tree, showing that
the remaining species have this in common. FIGURE 8.9 Draw the next branch to represent
However, find the species that only has that in the species with one feature in common with the
common, and draw another branch showing it remaining species.
diverging after this trait has appeared.
5 Continue until all the species have diverged. Jellyfish Salmon Salamander Koala Mouse
0 mya
Remember the tree is a set of hypotheses, and
Placenta
when you are unsure about which species to
Hair
diverge next, opt for the simplest explanation
Limbs Time
(parsimony).
Jaws
6 Draw an arrow alongside the tree to indicate the How to draw a
direction of time from the past to the present. phylogenetic tree
Time is usually measured in mya, zero being at Watch the video and
the tips of the branches. FIGURE 8.10 The tree is a set of hypotheses. draw along with the
host.
Mutation rate
In the absence of external influences, such as ionising radiation and chemical mutagens, a baseline
rate of mutation occurs naturally in DNA. If mutations cause a change in the structure or function
of the proteins that are encoded by the DNA, they may affect whether those proteins are passed to
the next generation, and they will become either more or less common in subsequent generations.
In many cases, mutations arise in non-coding regions, or may change a codon to one that encodes
the same amino acid as before, resulting in a neutral mutation. The frequency of new mutations in a
single gene or organism over time is fairly constant within a species and is called the mutation rate.
When comparing the genomes of two species, the mutation rate can be used as a molecular clock
to estimate at what point in time those species diverged from a common ancestor. For humans, the
mutation rate is estimated to be approximately 10–8 (changed nucleotides) per nucleotide base pair
per generation.
Comparative biochemistry and protein conservation

Organisms consist primarily of organic compounds, including proteins. They rely on enzymes to
control chemical reactions, and they share a similar cell membrane structure. The amino acid sequence
of certain proteins found in many organisms (such as haemoglobin and cytochrome-c) has been
analysed across a range of organisms, and the similarities provide evidence for evolution. Comparative
biochemistry is the study of different kinds of proteins (including enzymes), their fundamental units
(amino acids) and cell machinery. It involves analysis of the similarities and differences, and the results
enable evolutionary biologists to estimate relatedness between species.
Proteins, and the alleles that encode them, are subject to the same mechanisms of evolution as
the larger traits that individuals possess. A protein that is well suited to its function will be preserved,
9780170452922
or conserved, while other traits around it may evolve. Two distantly related species may share very
similar protein sequences for proteins whose function is much the same in those species, such as the
histone proteins.
Mutations that arise over time may alter a protein’s function, usually making it less suited to its
function. If a point mutation results in the loss of an amino acid that is essential for the protein’s
function, the mutation may not be preserved. Protein sequences can be compared across species,
and conserved amino acids can be identified. This is another line of enquiry when working out the
evolutionary relationships between different species.
Occasionally, mutations may arise that change an encoded amino acid to one with a very similar
charge and shape. Thus, the protein is still essentially conserved, as the substituted amino acid will
allow the protein to have the same function.
Proteins consist of long chains of amino acids, and each protein differs in the number, type and
sequence of its amino acids. The number of amino acid differences in the same protein in different
species is used to determine the relationship between species. A small number of differences
indicates a recent divergence from a common ancestor. A large number of differences indicates
a more distant evolutionary relationship. For example, the differences in sequence of the 146
amino acids that make up the blood protein haemoglobin are an indicator of the closeness of the
relationships between certain primates, as shown in Table 8.3. These comparisons indicate that
chimps and gorillas are the nearest living relatives to humans.
TABLE 8.3 Differences in the amino acid sequence of haemoglobin between humans and other primates
PRIMATE NUMBER OF DIFFERENCES IN THE AMINO ACID SEQUENCE

Chimpanzee 0
Gorilla 1
Gibbon 3
Orangutan 4
Macaque (monkey) 8
Lemur 5
Key concept
Comparative genomics utilises biotechnology to study the genome of a species and to compare
the genomes of different species. Relationships between species can be displayed using
phylogenetic trees.
Question set 8.3

REMEMBERING
1 State the purpose of a phylogenetic tree.
2 Define bioinformatics.
UNDERSTANDING
3 Define:
a comparative genomics
b comparative biochemistry.
4 Explain the advantage of mass data storage (provided by technological advances in the use
of bioinformatics) when determining the relationships between seemingly unrelated taxa.
9780170452922
5 Legless lizards and snakes are both legless; however, legless lizards are more closely related
to other species of lizards than they are to snakes. Use the image below to answer the
following questions.
Geckos
No limbs
Ancestral lizard Snakes
(with limbs)
Iguanas
Monitor
lizard
No limbs
Legless
lizard
FIGURE 8.11 Reptile phylogenetic tree
a Name the animal that is most closely related to the legless lizard.
b Which animals are in the same clade as geckos?
c Draw the same phylogenetic tree, representing the same evolutionary relationships,
using a different style of tree.
CREATING
6 Construct a phylogenetic tree for the plant species found in the table below. You do not
have to use all of the features listed.
VASCULAR TISSUE SEEDS CONES SPORES TRUE FLOWERS
(XYLEM AND ROOTS AND FRUITS
PHLOEM)
Bryophyta – – – Yes – –
(e.g. mosses)
Filicinophyta Yes – – Yes Yes –
(e.g. ferns)
Coniferophyta Yes Yes Yes – Yes –
(e.g. pine trees)
Angiospermophyta Yes Yes – – Yes Yes
(e.g. roses)
9780170452922

THE FOSSIL RECORD
Fossils are the preserved remains and traces that
provide evidence of past life. These remains can
be hard parts, such as teeth, bones and shells,
or impressions in the rock where the organism’s
tissue has decayed. Most fossilised hard parts of
animals or plants are found in rocks that have
been derived from sediment, that is, sand, silt
or clay. Along with animal bones, such as the
skeleton of Ceratoichthys (Figure 8.12), fossils
can also include footprints, burrows and even
preserved waste products such as coprolites
(fossilised faeces). The study of fossils is called
palaeontology .
What can the fossil record tell us? Much
of our knowledge of the changes that have
occurred in living things over time is derived
snemelClecraM/moc.kcotsrettuhS
from fossils. Only a very small percentage of
organisms leave fossilised remains. Many fossils
are destroyed by natural processes such as
weathering and erosion. Even so, fossils show
that there has been a clear change over time
from simple to very complex organisms, which is
evidence for evolution. FIGURE 8.12 An immaculately preserved fossil of
the extinct fish Ceratoichthys: a rare example of a
complete fossilised skeleton
Fossilisation
The process of fossilisation requires very specific, and rare, conditions. The remains of the
vast majority of long-extinct animals may never be found because they have been destroyed.
Consequently, the fossil record is incomplete and biased toward organisms that lend themselves
more easily to fossilisation. To become a fossil, organic matter needs to quickly be deposited and
covered in sediments, creating an environment that lacks oxygen, preventing decomposition. Plant
and animal remains can be preserved if they are covered in waterborne mud, sand or clay, depriving
the remains of oxygen, as can happen in the beds of lakes and rivers or in calcium-rich sea beds. In
many fossils, minerals from the sediments have replaced the natural bone or shell material, making
the remains harder and more likely to fossilise. This type of fossilisation is called mineralisation.
Fossils can form when organisms are covered with sedimentary material, such as mud, silt or
sand, generally carried by rivers and streams and deposited. These materials are consolidated to form
sedimentary rock. This overlying sedimentary material protects organic matter from scavengers and
also slows its decay long enough for it to fossilise. The resulting fossils generally only contain the hard
parts of organisms (which are slow to decay), but on rare occasions they can include more delicate
tissue such as feathers. Fossils of this type are not found in volcanic rocks, because molten lava
solidifies at about 1000°C, which is hot enough to burn any organic material; however, they can be
found in sedimentary layers of eroded volcanic ash. Metamorphic rock does not usually bear fossils,
because the pressure and heat of metamorphism generally (although not always) destroys any trace
of fossils.
9780170452922
Thin tissue, such as leaves and muscle, is sometimes preserved as films or impressions left in the
rock. Fossils are also formed when soft material, such as volcanic ash, fills an impression, or when
minerals later form in a pocket in sedimentary rock left by a decomposed organism, which can result
in fossils composed of opal. A 3.8-million-year-old set of footprints from a family of early humans,
including children, has been preserved in this way in the Afar Triangle region of Africa. Dinosaur
footprints can also be found in sandstone and mudstone.
There are several other ways a fossil can form. It can form as a result of freezing and subsequent
dehydration. Plants are also quite commonly fossilised. The original plant material may be partly
dissolved and some tissue replaced with dissolved salts, which petrify the material (i.e. replace it
with rock). Entire tree trunks have been preserved by petrification in fossilised forests in Arizona and
Antarctica. Fossilisation can tell us a great deal about past life and how it differs from what we see in Fossil ‘platypus’ jaw
found
the world today. But in order for this to make any sense, we need to calculate the age of the fossils. Read about an ancient
This can be done using dating techniques. Australian monotreme
Ancient platypus found in New South Wales 8.1

The jaw bone of an ancient relative of the platypus was discovered at Lightning Ridge in New
NOITACILPPA
South Wales. At more than 100 million years old, this is one of Australia’s most ancient mammal
fossils. It is a small jaw with three teeth beautifully preserved in translucent opal. The tiny
details of the root and nerve canals can all be seen.
Principle of superposition
Fossils found in rocks lower down in the earth are older than fossils found closer to the surface
(unless folding has occurred). The principle of superposition is fundamental to the interpretation of
Earth’s history, because at any one location it indicates the relative ages of the rock layers and the
fossils within them. The basic principle is that the oldest rock layer is found at the bottom of the rock,
with each consecutive layer above being relatively younger.
Youngest
Youngest Youngest
Layers with Layers with

same fossils same fossils
Oldest Oldest
Oldest
Youngest Youngest
The rock layers from all

three places can be combined
into one relative sequence.
Match the layers with

the same fossils.
Oldest Oldest
FIGURE 8.13 Studying fossils in rock layers at three different locations
9780170452922
Because fossils can be dated, the sequence of changes from the very earliest life to the present
can be observed. The layers of rock in an area being surveyed form a profile. Each layer of rock in a
profile is known as a stratum (plural strata). The type of rock is often sedimentary but can be volcanic
The principle of
superposition in origin. Volcanic ash or volcanic rock that has been eroded is sometimes compacted to form a special
Examine the cliffs and type of sedimentary rock that can be dated using radiometric dating. Strata are arranged in the order
work out which layers
were youngest and in which they were deposited, with the oldest layers being at the bottom unless they have shifted due
which were oldest. to geological processes. Knowing the date of one layer can help position a strata in geologic history.
Dating fossils according to the strata in which they are found is a relative dating method. It only enables
palaeontologists to determine whether one fossil is older or younger than another fossil in a different
stratum. Absolute dating tells the actual age of a fossil. Nearly all absolute dating methods utilise
radioactive elements that occur naturally in the minerals or organic matter found in the fossil. Dating is
discussed in more detail on page 266.
Transitional forms and the pace of evolution

There are many examples of intermediate states between an organism and its ancestral form, such
as the famous dinosaur–bird Archaeopteryx (Figures 8.14 and 8.15). Archaeopteryx was a small flying
dinosaur with feathers. It appeared in the late Jurassic period. It had features in common with both
birds and reptiles, suggesting that birds evolved from reptiles. Its reptile-like features include a long
tail, claws, no keel, solid bones, and teeth. Its bird-like features include a wish-bone, feathers and
reduced fingers. Intermediate states such as Archaeopteryx are called transitional forms. Transitional
forms exhibit common traits found in both the ancestral form and the more modern species. They
give us evidence for evolution of major groups, documenting change over time on a broad scale.
Transitions between species are harder to identify due to the limited nature of the fossil record.
ecneciL 0.4 YB CC .tratS yendoR rehpargotohP/airotciV muesuM
)/0.4/yb/sesnecil/gro.snommocevitaerc//:sptth(
sdleihS nitraM/otohP kcotS ymalA
FIGURE 8.14 A reconstructed model of the bird-like FIGURE 8.15 Cast of Archaeopteryx
dinosaur Archaeopteryx, an example of a transitional lithographica. The presence of feathers can
form between unfeathered dinosaurs and modern birds be seen clearly in the fossilised specimen.
The evolution of the horse is a good example of how the fossil record can be used as evidence
for evolution. Fossils reveal how changes in ancestral species led to the modern horse. Our
understanding of the evolution of horse feet is derived from a scattered sampling of horse fossils from
within the multibranched horse evolutionary tree. These fossil organisms represent branches on the
tree and not a direct line of descent leading to modern horses. However, Figure 8.16 clearly shows
the transitional stages whereby the four-toed foot of Hyracotherium, otherwise known as Eohippus,
9780170452922
4 mya Equus (modern horse)
Pliohippus (one-toed horse)
Parahippus
Miohippus
55 mya Hyracotherium (early horse)
FIGURE 8.16 Transitional forms in the horse fossil record
gave rise to the single-toed foot of Equus. The transitional forms predicted by evolution were actually
found to have existed.
Scientists have long hypothesised about the changes in horse species over time that are evident
from the fossil record. The first horses were small, agile herbivores, well suited to the dense forest
and soft terrain of their environment. Their multi-toed appendages distributed their body weight,
preventing them from sinking too much into the soft ground, and their small size enabled them to
duck and weave around closely positioned trees.
Horse anatomy and size changed as the environment changed. A cooler, dryer climate resulted
in fewer trees and more grasslands, and the ground became harder. Anatomical changes in emerging
species of horses included a reduced number of ‘toes’, which allowed them to manoeuvre efficiently
and escape predators (to whom they were now more visible) and ‘cheek-teeth’ (molars), which
enabled them to chew the tough grass that had become their food. Evolution continued, partly due
to the mechanism of natural selection. Larger horses with better-developed molars had a survival
advantage. The selective pressures of the environment meant that those horses would have been
more likely to survive and pass their well-developed molars and fewer, shorter toes on to offspring.
Traits that give individuals in a population a better chance of surviving selective pressures make them
fitter than other individuals, so they are more likely to pass their alleles to the next generation.
Equus, a genus including zebras, donkeys, modern domestic horses and relatively recent fossil
horses, has a taller body, longer legs and longer, squarer teeth than earlier horses. The changes
depicted in Figure 8.16 occurred over an extended period of time – around 55 million years.
9780170452922
There is always bias in the fossil record. Given the specific requirements for fossilisation and thus
the limited nature of the remains that can be fossilised, there will always be chapters missing from
the story. Even with this bias in the fossil record, it is possible to observe many examples of gradual
change over time in organisms as their shape or size transitioned from one form to another. In other
cases, no such gradual transition is evident – the changes seem sudden and inexplicable and the
fossil record gives the impression of a burst of evolutionary speed because of what appears to be a
gap. Such apparent gaps may be explained by aspects of two theories about evolutionary patterns:
gradualism and punctuated equilibrium.
Gradualism
The concept of gradualism assumes that evolution occurs as a steady, slow divergence of lineages
(ancestral tree branches) at an even pace. Gradualism states that apparently sudden bursts of
evolution implied by the fossil record are not a real indication of an evolutionary history, but an
illusion of the fossil record. Evolution only appears as a burst because of the absence of sediments
containing fossils that document such a transition, or perhaps a change in conditions that made
fossilisation impossible. Even if a small section of potentially fossil-bearing sediments were absent,
this may account for fossils missing from millions of years in the fossil record. Were this section of
strata still present, gradualism proposes, the fossils within it would show a divergence pattern that was
slow, even and steady, in other words, gradual.
Punctuated equilibrium
In contrast to gradualism, the theory of punctuated equilibrium states that the apparent bursts of
evolution are not an illusion, but real. It states that species remain fairly stable for long periods of time,
but may swiftly change to a new species, for example, in response to rapid changes in the species’
environment. Like gradualism, punctuated equilibrium accepts the existence of transitional forms
between species, but over such brief periods that they were not preserved as fossils. Punctuated
equilibrium proposes that there have been successive periods of stasis, each followed by a period of
rapid change in a subset of the population.
Both gradualism and punctuated equilibrium are compatible with the theory of natural selection,
and there appear to be examples of both in the fossil record. Whether there is relatively sudden or
more gradual evolution could be expected to be related to whether change in the environment was
sudden or gradual.
Key concept
Transitional forms exhibit common traits found in both the ancestral form and the more
modern species. They give us evidence for evolution of major groups, documenting change over
time on a broad scale.
Fossil dating methods

In order to make sense of the fossil record and to use it to learn about evolution, we need some basic
information about fossils and their geological settings: how old particular fossils are, which organisms
arose first, and which organisms lived at the same time. These questions can only be answered if
we are able to accurately determine the age of the fossils. Both comparative and absolute dating
techniques are used to estimate the ages of sedimentary rocks and the fossils within them.
The law of
superposition Comparative dating
Read about the law of Comparative dating (also called relative dating) is used to determine the age of a rock, or a fossil
superposition and watch
the animation that contained in the rock, relative to other rocks or fossils found nearby. This approach to dating relies on
explains it. our understanding of how sedimentary rock is formed (see page 262).
9780170452922
Sedimentary rock is composed of sediment: weathered material from the Earth’s surface (such
as gravels, silts, sands and muds) that have been transported by water and deposited in river beds,
flood plains and sea floors. Sediment transport and deposition is an ongoing process; it has been
continuously occurring on Earth for billions of years and can still be observed today. Over time, these
deposited sediments form defined layers that consolidate into sequences of sedimentary rock. As
discussed earlier, these sequenced layers are called strata, and a section showing successive layers
of sedimentary deposition is called a stratification. Strata are deposited in a time sequence, with
the oldest on the bottom and the youngest on the top, assuming natural processes like tectonic
movement haven’t twisted or inverted the layers. Palaeontologists assign relative ages to fossils based
on the strata in which they are found. While this technique can’t give an age in years, the sequence of
the fossils can be deduced.
Absolute dating
Absolute dating refers to any technique that assigns a numerical age in years to a fossil or rock.
There are three main types of absolute dating: radiometric dating, electron spin resonance and
luminescence. Unlike comparative dating, which is based on assumptions about the sequence of strata
(layers of rock), absolute dating is based on physical or chemical properties of materials in the rock.
Radiometric dating
The most common method of absolute dating is radiometric dating, which uses the known rates
of decay of naturally occurring radioactive isotopes present in a rock or fossil. The various isotopes
of an element have the same atomic number (the same number of protons) but a different atomic
mass (different numbers of neutrons). For example, carbon has three natural isotopes: carbon-12,
carbon-13 and carbon-14. Carbon-12 (12 C) has 6 protons and 6 neutrons in each nucleus, and
carbon-14 (14 C) has 6 protons and 8 neutrons. Some isotopes have an unstable nucleus that emits
energy in the form of radioactivity (alpha, beta or gamma rays) at a measurable rate. The half-life of an
isotope is the time taken for half of the radioactive nuclei in an initial sample to decay.
Carbon-14 is a radioactive isotope that breaks down at a known rate to produce nitrogen-14
(14N) (Figure 8.17). This measurable rate of decay is the basis of carbon dating.
100% parent isotope

100 (carbon-14)
gniniamer 41-nobrac fo egatnecreP
75% parent isotope

75
uN
bm
50% parent isotope

re
50
fo
p
en
ra
ti
so 25% parent isotope
to
pe
a to
25 ms 12.5% parent isotope
( ca
r bo
n- 1
4)
0
0 1 2 3
Number of half-lives of carbon-14 elapsed
FIGURE 8.17 Graph of the half-life of carbon-14
Using the half-life of carbon-14 (5730 years), we can determine the age of the sample: in other
words, the time taken for the original amount to decay to the present amount. The percentage of
carbon-14 remaining compared with that of atmospheric carbon-14 can be converted into calendar
9780170452922
years. However, data from tree rings show that the amount of carbon-14 in the atmosphere can
change with time. For this reason, the time calculated from carbon dating is usually expressed as
± x years.
The older the object, the greater the margin of error. Carbon dating is thought to be accurate for
samples up to about 12 000 years old. After this time, it is difficult to measure the level of carbon-14
accurately; instead, other radioisotopes, such as potassium-40 (which decays into argon), are used
(Table 8.4).
TABLE 8.4 Half-life and product of decay of some elements used in radiometric dating
ELEMENT PRODUCT HALF-LIFE (YEARS)

Thorium-232 (232 Th) Lead-208 (208 Pb) 14 billion
Carbon-14 (14 C) Nitrogen-14 (14 N) 5730
Rubidium-87 ( Ru)
87
Strontium-87 ( Sr)
87
48 billion
Carbon-14 dating is not always used on fossils for two main reasons: (i) in most cases fossils
have been mineralised and the organic (carbon-containing) tissue has been chemically altered or
replaced, and (ii) the process of fossilisation generally takes longer to occur than the maximum age of
accuracy for carbon-14. However, by determining the various radioactive isotopes present in a sample
containing a fossil, an age in years can be estimated for the sample and the fossil.
Key concept
While not complete, the fossil record provides evidence of evolution in transitional fossil forms.
Applying the law of superposition (comparative dating) and using absolute dating techniques
contribute to our understanding of the fossil record.
Question set 8.4

1 Recount the steps involved in the process 6 A fossilised fish skeleton is found in
of fossilisation. sandstone, 1 metre below the surface, at
2 State the principle of superposition. location X. A very similar skeleton is found
UNDERSTANDING at location Y, 2 metres below the surface
3 Most of our knowledge of the evolution and 1 kilometre away from location
X. A third similar skeleton is found at
of sharks is based on the remains of location Z, 3 metres below the surface
fossilised shark teeth. Suggest why other and 3 kilometres away from location X.
fossilised body parts of sharks haven’t Describe what can be inferred about:
been found in abundance. a the way in which the rocks were
4 Given we have more than just fossils formed
available in the case of sharks, suggest b the age of the fossil at location Y.
alternative ways to determine how closely 7 Ancient stone tools have been found close
related various present-day animals may to campfire charcoal. Explain how the
be to one another. technique of carbon dating could be used
5 Palaeontologists have found tracing the to determine the time at which the tools
evolution of sea jellies (jellyfish) to be were made.
very challenging. With your knowledge
of fossils and the process of fossilisation,
suggest why this may be the case.
9780170452922

COMPARATIVE EMBRYOLOGY AND ANATOMY
Close examination of the physical characteristics of species, at both the embryonic and adult stages,
can reveal further evidence for evolution. Comparative anatomy is the study of the similarities
and differences in structure between different organisms. Structural features are also called
morphological features.
Embryology
Embryology is the study of the anatomy of embryos and how they develop over time until the adult
stage. Comparative embryology is used to establish evolutionary relationships and common ancestry
on the basis of the similarities and differences in anatomy and development between embryos of
different species. It is thought that the longer embryos remain structurally similar during development,
the more closely related they are. For example, all members of the phylum Chordata have, at some
stage of their development, a dorsal notochord (a solid tissue running along the back), pharyngeal
slits (which turn into gill slits in fish), a dorsal nerve cord and a tail that extends past the anus. The
embryos of the different vertebrates are very similar and show features that are not present in
adults. This suggests that these vertebrates evolved from a common aquatic ancestor, such as the
crossopterygian fish (Figure 8.19, page 270).
Sea squirts are the most unlikely members of this phylum – the adults look more like marine
invertebrates than the other vertebrates to which they are more closely related (Figure 8.18a). Sea
squirt larvae, however, have the requisite characteristics for classification as being closely related to
vertebrates, including a notochord (Figure 8.18b). Adult vertebrates have lost the notochord and it has
been replaced with vertebrae.
a Inhalent opening b
(mouth)
Exhalent
opening Pharyngeal
slit
Dorsal nerve
Test
Mouth tube
(hard ‘skin’)
Notochord Post-anal tail
Atrial
Perforated
cavity
pharynx
Anus
Heart
Intestine
Stomach
Gonad Pharynx
Segmental muscle
Atrium Intestine blocks (myotomes)
FIGURE 8.18 a The adult sea squirt shows few characteristics of chordates; b the free-swimming larva of the sea
squirt, however, shows the characteristic features of chordates, revealing an evolutionary connection.
Key concept
Comparative embryology is the study of the similarities and differences between embryos of
different taxa in order to establish evolutionary relationships.
9780170452922
Fish Frog Reptile Bird Mammal
FIGURE 8.19 Similarities between chordate embryos suggest a common aquatic ancestor.
Comparative anatomy: homologous structures

The structures different species have in common can be evidence of inherited characteristics from
a common ancestor. Comparative anatomy shows how seemingly disparate kinds of organisms
actually share many fundamental similarities, and strongly supports the notion that those similarities
are derived from a common ancestor. The differences we see in modern organisms are the result
of changes over time as organisms have adapted to their various environments – in other words,
evolution.
Anatomical structures that are common to more than one species and were inherited from a
common ancestor, but have different functions, are known as homologous structures. Homologous
structures show the same structural plan but perform different functions due to the different species
Understanding
evolution living in different environments with different selective pressures (conditions).
Read more about When adaptive radiation occurs, organisms retain many of the same basic structures because they
comparative anatomy have the same genetic history. For example, all lizards have scaly skin; this is a defining characteristic
here.
of their classification. However, the scales can differ in colour, hardness and shape in response to
the conditions in the habitat that they occupy, serving varying functions of defence, temperature
maintenance or camouflage. The different types of scales are examples of homologous structures.
The lizard scale example of a homologous structure is one that has a relatively recent
evolutionary history. Some homologous structures have evolved from a much more distant common
ancestor, and they may have very different functions in the various taxa. The wing of a bird, the wing
of a bat, the leg of a crocodile, the flipper of a whale and the arm of a human all have the same basic
structure: the pentadactyl limb, with a hand or foot with five fingers or toes. In the different animal
groups, however, it has been modified to suit a variety of different functions, demonstrated by the
different bone lengths and coverings of the limbs (Figure 8.20).
The leaves of land and aquatic plants all have the same basic components, but they have enormous
variety in size, shape, colour and function. Some leaves function as coloured petals, some as support
9780170452922
Lizard
Frog
Bird
Humerus
Humerus
Humerus
Ulna Radius
Ulna Radius
Ulna Radius
1 Carpal Carpal
Carpal
2 1
1
3
2
4 3
5 3
5 4
2
Humerus
Humerus Ulna
Radius
Carpal
Humerus
Humerus 1
Ulna
Radius
Radius
Ulna
Carpal
Ulna
Radius 5
Carpal
5
4 1
1
4
2
Carpal
5 2
4 3 Bat
1 3
3
Human
2 2
5
3 Whale
4
Cat
FIGURE 8.20 The principle of homologous structures is illustrated by the adaptive radiation of the forelimb of a selection of vertebrates.
In each group it shows the basic pentadactyl pattern, but it has been modified for different uses.
structures in buds, and others as defensive spines or fleshy water stores. The plants in Figure 8.21
(page 272) demonstrate features that have been derived from the same basic structure, but now
have different forms that serve different functions. In other examples, homologous structures can share
the same function. The environment can influence the form and the use of homologous structures.
Homologous structures can be used to infer phylogenetic (i.e. evolutionary) relationships,
because only organisms with a common ancestor are likely to have structures with the same basic
arrangement.
9780170452922
a bb
gnotapmajaynap/moc.kcotsrettuhS
rtijnawK/moc.kcotsrettuhS
FIGURE 8.21 Homologous structures derived from leaves: a the spines of a cactus; and b the bracts of Heliconia
Vestigial homologous structures

In some cases, homologous structures stemming from a common descent can eventually cease
to have any functional use for an organism; the structure may not necessarily impede a particular
adaptation of an organism, but at the same time, it no longer serves a useful purpose. These
structures are called vestigial structures. Vestigial structures are quite common and can take a variety
of forms, including bones, soft tissues, organs, cells or molecules.
Vestigial organs are evidence for evolution, because it is hypothesised that they were once
present and functional in their ancestors. Changes in the environment have rendered these organs
redundant, so over time they have lost their functionality. They demonstrate the evolutionary
divergence of a species from a past behaviour or activity.
An example of a vestigial organ is the pelvic bone in a whale – this bone serves no current
purpose and is a remnant of a time when whales were terrestrial mammals.
Wherever vestigial structures may be found, they are usually either rudimentary or atrophied.
Among humans, we need look no further than our vermiform appendix, a small, pouch-like structure
on the colon. It appears to be the shrunken remains of the caecum, a far more extensive structure
found in the digestive tract of other, more predominantly herbivorous primates.
Analogous structures
Analogous structures are features of organisms that have the same function but a different basic
structures that evolved independently. The eyes of octopuses and vertebrates are remarkably similar,
even down to fine points of detail, and an observer could conclude that they are homologous
structures (Figure 8.22, page 274). However, in the vertebrate eye, the nerve fibres lie in front of the
sensory cells of the retina, whereas in the octopus eye they lie behind them. Because of this, the
vertebrate eye has a blind spot where the optic nerve emerges from it, whereas the octopus eye lacks
a blind spot. The developmental process is different, which indicates that they are the products of two
distinct lines of evolution. Bat and insect wings are another example of analogous structures.
9780170452922
‘Terror bird’ was a scary-looking vegetarian
YCARETIL CIFITNEICS
Giant prehistoric ‘terror birds’ looked so fierce that many palaeontologists assumed they
were terrifying predators, but new research finds that the supposed carnivores were probably
herbivores.
The terror bird, aka Gastornis, grew to nearly 1.5 metres tall. It lived between 55 and 40 mya
in what is now Europe and possessed a huge, sharp beak.
‘The terror bird was thought to have used its huge beak to grab and break the neck of its
prey, which is supported by biomechanical modelling of its bite force,’ says Professor Thomas
Tütken from the University of Bonn, who led the research.
‘It lived after the dinosaurs became extinct and at a time when mammals were at an early
stage of evolution and relatively small; thus, the terror bird was thought to have been a top
predator at that time on land.’
Wrong, according to the latest findings, presented by Tütken and his team at the
Goldschmidt conference in Florence this week.
An early clue came by way of footprints likely left behind by an American cousin of
Gastornis. The footprints do not show imprints of sharp claws, which would have been expected
as tools to grapple prey. Today’s raptors, for example, sport such sharp claws.
Another clue is more obvious – the bird’s hefty size and build. Can you imagine Sesame
Street’s Big Bird (with a big beak) running swiftly after prey? All of that bulk would not make
for a very swift hunter. Some researchers theorised that terror birds ambushed prey, but even
that seems pretty far-fetched.
To further explore the possibilities, Tütken and colleagues took a geochemical approach.
They analysed the fossilised bones of the birds, focusing on calcium isotope composition.
Isotopes are atoms of the same element with different numbers of neutrons.
In prior experiments, the scientists determined that the calcium isotopic composition
becomes ‘lighter’ as it passes through the food chain. They tested the method first with
herbivorous and carnivorous dinosaurs – including top predator T. rex – as well as mammals
living today. For this latest study, they applied the method to terror bird bones housed at the
Geiseltal collection at Martin Luther University in Halle.
They discovered that the calcium isotope compositions of terror bird bones are similar to
those of herbivorous mammals and dinosaurs, and not to carnivorous ones.
‘Tooth enamel preserves original geochemical signatures much better than bone, but since
Gastornis didn’t have any teeth, we’ve had to work with their bones to do our calcium isotope
assay,’ Tütken explains.
As for many scientific puzzles, the case isn’t completely closed just yet.
‘Because calcium is a major proportion of bone – around 40% by weight – its composition
is unlikely to have been affected much by fossilisation,’ he says.
‘However, we want to be absolutely confident in our findings by analysing known
herbivores and carnivores using fossilised bone from the same site and the same time period.
This will give us an appropriate reference frame for the terror bird values.’
Even if the food was just plant based, it had to have been large and tough, given the
impressive beaks the birds evolved.
Viegas, J. (2013) ‘‘Terror bird’ was scary-looking vegetarian’, Discovery News online, 29 August 2013.
Questions
1 Suggest why it had been assumed that Gastornis was a predator, and what evidence may
have pointed away from this before the so-called ‘geochemical approach’.
2 Outline the reason for Tütken’s caution in applying this geochemical analysis to fossil birds.
3 Suggest an alternative reason for the apparent absence of raptor-like toe claws on
Gastornis .
9780170452922
a b
sotohP adanaC llA/otohP kcotS ymalA
segamiretipuJ/moc.sotohP
FIGURE 8.22 a Octopus eyes and b human eyes are solutions to the same problem with similar adaptations, even
though octopuses and humans are not closely related. An important control gene for building eyes, however,
belonged to a very ancient common ancestor.
Key concept
Comparative anatomy involves comparing the morphological features of different species.
Morphological features include homologous structures (same structure but different
functions), vestigial homologous structures (same structure but no longer used) and analogous
structures (same function but different structures).
CASE
STUDY
Dr Erich Fitzgerald and the evolution of baleen whales
Dr Erich Fitzgerald is Senior Curator of internationally has been a huge benefit to
Vertebrate Palaeontology at Museum palaeontology; it means we are forced to
Victoria. Erich researches the evolutionary access a wider range of data in order to get
history of marine mammals. To undertake an accurate evolutionary picture of what
his research, he uses a combination of field we are looking at. Computers can deal
work and interpretation of the fossils and with large data sets of measurements and
animal remains that are housed in museums characteristics and identify patterns that
around the world. Erich seeks to answer could easily be otherwise overlooked; as such,
questions on what drives the evolution and computers are as important to palaeontology
extinction of marine mammals. as a hammer and chisel.’
His research would not be possible Erich’s research has unveiled unexpected
without advances in information technology, results. ‘For a long time, there was a gap in
such as computational phylogenetic analysis. our knowledge of the relationships between
‘To get to the bottom of the evolutionary the toothed ancestors of modern whales –
history of organisms, you need to place Archaeocetes – and living baleen whales.
them in an evolutionary context. To do How on earth does such a specialised feeding
that, we subject fossils and living species structure like baleen evolve? For some time,
to phylogenetic analysis, computationally there was the idea that Archaeocetes probably
estimating the evolutionary “tree”’ based closed their jaw and used their teeth like a
on large data sets of characteristics across sieve, like some seals do today.’
large numbers of taxa. We then use different Extensive data sets, including
programs to interrogate that tree for other measurements from the skulls, teeth and
patterns to test our hypothesis. other bones of fossil and contemporary
‘Using computers as a way of capturing animals, allow for the use of computational
data, imagery, 3D and CT scanners and phylogenetics, showing some surprising
communication between researchers results. ‘Our research points to a complex
9780170452922
story of “false starts” and “experiments” in 2 Using the example of baleen whales
evolution. It shows whales didn’t have an and their diet, assess and discuss
intermediate stage using both teeth and whether the evolutionary ‘false starts’ WA Museum
WA Museum was
baleen; the evidence suggests the transition and ‘experiments’ that the fossil record closed for four years
between teeth and baleen happened a shows are examples of divergent until November 2020.
different way. The question is now how did evolution . It boasts a merger of
culture and science.
this happen; that’s what I’m trying to solve. 3 Prior to the advent of computer-assisted It promises to be
Understanding the evolution of organisms phylogenetic analysis, estimating somewhere to visit to
is vital. In order to gain any understanding evolutionary relationships of vertebrates see extinct species such
as dinosaurs and newly
of the dynamics of biodiversity, you have was based largely on bone and tooth discovered species.
to understand how it has occurred over the morphology, or shape. Phylogenetic
time scales over which it has evolved.’ analysis now incorporates other elements
in order to develop phylogenetic trees.
Questions Explain how computational technology
1 Account for how our view of current has made the identification of possible
biodiversity is biased if we ignore relationships of fossils and living animals
evolutionary history and the fossil more efficient and rigorous than was
record. previously possible.
esizerT luaP/xipsweN
FIGURE 8.23 Erich Fitzgerald and the fossil skull of the ancestral toothed whale Janjucetus hunderi
Question set 8.5

REMEMBERING 5 Describe how embryology provides
1 Define morphological features. evidence for the theory of evolution.
2 Describe examples of homologous and EVALUATING
analogous structures. 6 Evaluate the reliability of vestigial
3 List two structural features found in the
structures as evidence for the theory of
embryos of vertebrate animals that are evolution.
not present in the adult form of the same 7 Explain why seemingly unrelated
species. organisms could have a high percentage
UNDERSTANDING of very similar genes.
4 Compare homologous and analogous
structures.
9780170452922
8.6 TYPES OF EVOLUTION: DIVERGENT VERSUS

CONVERGENT
Divergent evolution
Divergence is a pattern of evolution in which differences between groups of organisms accumulate
to a critical point that leads to speciation, the development of a new species. This pattern is usually
the result of the dispersal of a single species to different environments; that is, groups from the same
species become isolated from one another. The isolation stops the gene flow between these separated
populations. The populations may have been separated by physical barriers such as mountains or rivers,
or by other factors such as changes in reproductive timing.
A group of organisms that has a recent common ancestor may have evolved different adaptations
in response to a range of environmental pressures. Homologous structures indicate that there has
been divergent evolution, because new species have the same fundamental structural plan, but the
structures may perform a different function.
Adaptive radiation
As members of the population develop adaptations, by natural selection favouring certain mutations
over successive generations, they may diverge enough to become new species. This process is
referred to as adaptive radiation.
For example, koalas (tree-dwelling herbivores), Tasmanian devils (ground-dwelling carnivores) and
marsupial moles (dune-burrowing insectivores) are related because they have a common marsupial
ancestor (Figure 8.24). However, they show quite different dentition (teeth) that enables them to
consume different diets.
Koalas possess complex molar teeth (suited to chewing eucalyptus leaves) and blades on each
tooth (which help cut the leaves).
Tasmanian devils have four pairs of upper incisors and three pairs of lower incisors that are long
and sharp, suited to tearing meat and crushing bones.
The teeth of marsupial moles are unusual. They are degenerate and bear no resemblance to koala
or Tasmanian devil teeth. The premolar is the largest of the anterior teeth. The incisors and canines
vary in size, but are little more than conical projections, suitable for their insectivorous diet.
a b
c
ediwdlrowstohstoh/kcotsknihT
hguHcM moT/ecruoS ecneicS

58tsactuo/moc.kcotsrettuhS
FIGURE 8.24 Examples of the divergent evolution of marsupials: a koalas, b Tasmanian devils and c marsupial moles evolved from a
common ancestor that probably lived during the Eocene epoch.
9780170452922
Adaptive radiation occurs particularly when environmental changes trigger the availability of new
resources and environmental niches. A clear example of this can be found in Australia’s fossil record,
which indicates that during the Middle Miocene epoch (approximately 15 mya), dense tropical forests
covered central Australia where the Simpson Desert is now. Forests, lakes and permanent rivers
provided a lush habitat for marsupials, such as giant koala-like possums, shrewish insectivores and
sheep-sized browsers. Flamingos, crocodiles, turtles and dolphins flourished in the waterways. The
range of habitats allowed an extensive radiation of animal species, which adapted to the available
resources and are, therefore, an example of adaptive radiation.
Slowly, the tropical centre of Australia began to dry out during the Pliocene epoch (approximately
5 mya). This brought an end to the tropical climate, which meant that the tropical forests gave way to
broad grasslands. As the tropical forests retreated from central Australia, the animals they once supported
were forced to compete for diminishing resources and became vulnerable to extinction. The large
browsing mammals called diprotodontids (Figure 8.25) and a variety of possums were unable to survive
the reduction in trees and the subsequent limited food availability.
The remnants of the tropical forests and their inhabitants are now confined to Papua New Guinea
and pockets of northern Queensland. The grasslands that replaced the forests provided new habitats
that allowed for adaptive radiation of other Australian mammals: the kangaroos and wallabies.
Didelphimorphia
Monodelphis
Didelphis
Metachirus
Paucituberculata
Rhyncholestes
Caenolestes
Microbiotheria
Dromiciops
6340001.oibp.lanruojF2%1731.01F2%iodA3%ofni/elcitra/gro.ygoloibsolp.www//:ptth .la te nossliN 0102 ©

Notoryctemorphia
Australidelphia Notoryctes
Dasyuromorphia
Phascogale
Dasyurus
Sminthopsis
Myrmecobius
Euaustralidelphia
Peramelemorphia
Macrotis
Perameles
Isoodon
8002 noitaroproC latsoP nailartsuA © relsurT reteP :tsitrA
Diprotodontia
Tarsipes
Pseudocheirus
Trichosurus
Macropus
Potorous
Vombatus
FIGURE 8.26 Adaptive radiation of marsupials began in South

America, which was then joined to modern Australia in the
FIGURE 8.25 The giant Diprotodon optatum was a supercontinent Gondwana. Most surviving marsupials are now
type of megafauna that browsed on leaves. restricted to the Australian continent.
9780170452922
Convergent evolution
Convergent evolution is a pattern that occurs when unrelated organisms evolve similar adaptations
in response to their environment. An example of convergent evolution is provided by anteaters. Many
animals eat ants and white ants (or termites), and they have developed similar structures, even though
they are not closely related.
Modern anteaters include echidnas (which are monotremes), numbats (which are marsupials)
and pangolins (which are placentals) (Figure 8.27). All of these species have an elongated snout that
functions as a smelling and digging device, a long, extendible tongue that can extract ants from
crevices, and powerful claws that are used for digging up ant and termite nests.
The different species of ant-eating mammals have a common ancestor, but not a recent one;
they belong to different orders. They have developed ant-eating adaptations independently and
coincidentally, rather than it being a legacy from their common ancestor. The first mammal-like
animal probably emerged in the Triassic period, around 208 mya.
a b
topm/otohpkcotSi
c
esneciL tohsotohP/nolavA/otohP kcotS ymalA

lleB naitsirK/moc.kcotsrettuhS
FIGURE 8.27 Ant-eating mammals show convergent evolution in their ant-eating structures: a echidnas (monotremes);
b numbats (marsupials); c pangolins (placentals).
The results of convergent evolution often show up as analogous structures: adaptations

of very different types of structures that solve a problem in a similar way. The structures are
genetically relatively different, but their functionality is very similar. Dolphins and sharks demonstrate
convergent evolution. The dolphin is a mammal and the shark is a fish. They both inhabit the marine
environment, which imposes the same selection pressures on both types of organism. Both groups
have a streamlined body shape, and fins for propulsion and stability. These features are adaptive for
movement in water. Analogous structures, such as the streamlined body, occur due to environmental
pressures, not because they share a recent common ancestor. Instead, they share a very distant
common ancestor.
9780170452922
Key concept
Divergent evolution is when populations of a species differentiate to become separate species
(e.g. different marsupial species). Adaptive radiation is an example of divergent evolution, and
homologous structures provide evidence for this.
Convergent evolution occurs when species that are not closely related independently
develop similar adaptations to their environment (e.g dolphins and sharks). Analogous
structures provide evidence for convergent evolution.
Question set 8.6

UNDERSTANDING ANALYSING
1 Define divergent evolution and give an 3 Classify the pentadactyl limb as
example of evidence for it in the evolution homologous or analogous and give a
of species. reason why.
2 Define convergent evolution and give an 4 Explain the importance of using both
example of evidence for it in the evolution living and fossil forms in constructing
of species. phylogenies.
9780170452922

8.1 Looking at fossils
Evidence of evolution comes from studying the organisms living today, but further evidence
YTIVITCA
can be obtained by studying the animals and plants of the past as seen in the fossil record.
Fossilisation is a rare occurrence and requires precisely the right conditions for it to occur.
But how do fossils form and how much information can they reveal to us about organisms that
lived in the past?
Aim
To investigate how fossils are formed and what they can reveal about organisms that lived in the
past
You will need
• 4 fossil samples (e.g. fossilised coral, fossil footprint, trilobite, ammonite, shark’s tooth,
leaf fossil)
• Reference material with information on fossils
• A hand lens (one per group)
What to do
1 For each of the fossils that you have been given, complete as many observations as possible and
record them. Your observations should include the following:
• Sketch of fossil
• Name of organism
• Phylum or classification
• Location or habitat where fossil was found
• Type of rock in which fossil was found.
2 Examine the individual fossil specimens carefully and attempt to classify them into the phylum (or
class or order if possible) to which they belong.
3 Using a hand lens, examine the rock surrounding the fossil specimen and try to identify the type
of material it is. Check to see if the information provided with the fossils gives you any insight
into what the material might be.
4 Sketch the fossil specimen and note which parts have been preserved and which have not.
1 Deduce and explain how each of the fossils has been preserved. Compare the material the
fossil is made of with the original living tissue. Explain how the two are different and how the
composition of the fossil may have come about.
2 Compare the fossilised specimens with similar species that exist today, and identify which
parts have been preserved and which parts have disappeared. Explain why this would be the
case.
3 Explain how much information scientists can gain about an animal from a single fossilised
tooth. Investigate this topic on the Internet, using the example of Carcharodon megalodon (an
extinct shark) as the focus of your research. Find out why this particular example of animal
reconstruction has a controversial history.
9780170452922
Homologous structures 8.1

Charles Darwin noted that many animals share similarities in body structure. He argued that
NOITAGITSEVNI
this seemed to suggest that the structures had developed from a common ancestral form. Is this
explanation of the similarities in structures as obvious as he suggested?
Aim
To investigate homologous structures in the pentadactyl limb of various vertebrates
You will need
Four examples of vertebrate pentadactyl limb. These could be actual skeletons, models, photographs
or illustrations of the limbs (e.g. frog, bird, dolphin, dog, cat).
Forelimb (arm) Hindlimb (leg)
Upper arm Humerus Femur Thigh
Elbow Knee
Forearm Radius Tibia

Shank
Ulna Fibula
Carpals Tarsals
Wrist (carpus) Ankle (tarsus)
Metacarpals Metatarsals
Phalanges Phalanges Foot
Hand
Digits (fingers) 1 Digits (toes)
5
2 3 4
FIGURE 8.28 A generalised pentadactyl limb
What to do
For each of the samples that you have been given, complete as many observations as possible and note
them in your results.
1 Carefully examine the forelimbs and hind limbs of the generalised pentadactyl limb (Figure 8.28)
and of each specimen, and draw a quick sketch of each in your results section. Make a table and
record the number of bones that make up each section of the forelimbs and another table for the
hindlimbs. Include the hand/foot area, wrist/ankle area, forearm/shin area, and the upper arm/
thigh area.
2 Describe any other differences that you may have observed for each specimen when it was
compared to the generalised diagram of a pentadactyl limb.
Results
Your results should include:
• Name of organism
• Sketch of forelimb
• Sketch of hindlimb
• Summary table of counts
• Descriptions of differences
9780170452922
Discussion
1 Analyse how the numbers of bones in each area of your specimens compares with those of the
generalised pentadactyl limb.
2 Other than bone numbers, explain what other differences you find in the limb structures
compared with the generalised pentadactyl limb.
3 Suggest and explain reasons for the differences noted for each particular animal.
4 Suggest what advantages these differences might offer to the species concerned.
5 Identify the basic similarities in the different limbs and explain why these might be found in so
many different species, even though they may occupy a variety of different habitats.
Discussion
Write a summary of your analysis. What is your conclusion?
Taking it further
Use the Internet to examine the limb structures of other animals to see how they compare with the
ones you have examined in this activity. Are you able to see how closely animals are related to one
another by their similarities?
8.2 Hominid skull analysis

Aim
NOITAGITSEVNI
In this investigation, you will analyse various hominid/primate skulls. This is an excellent opportunity
to explore various anatomical adaptations that have diverged in hominids over the course of their
evolution.
Time requirement
45 minutes
Materials
• Pan troglodytes (chimpanzee) (Modern)
• Gorilla gorilla (gorilla) (Modern)
• Homo sapiens (human) (Modern)
• Homo neanderthalensis (Neanderthal human) (120 000–30 000 years ago)
• Homo erectus (upright human) (2.0 mya)
• Australopithecus boisei (2.3–1.2 mya)
• Australopithecus afarensis (‘Lucy’) (4.0 mya)
• Tape measure (in millimetres)
Risks
Skulls may have sharp edges. Handle with care and do not run fingers over skull teeth.
Procedure – Examining the braincase

1 Examine the frontal bone (forehead) of each of the skulls and determine whether they appear
more vertical or flat. Ensure the eye sockets are oriented forward while doing this.
9780170452922
2 Examine above the orbital and determine whether a supraorbital (brow ridge) is present. If so, see
whether the brow ridge is continuous or divided in the middle.
3 Measure the width of the braincase at the widest point. Make all measurements in millimetres.
4 Look for evidence of a sagittal crest running lengthwise along the midline of the top of the skull.
Identify whether it is prominent, present or absent.
5 Measure the distance between the front teeth and the front ridge of the foramen magnum.
6 Examine behind the ear of the skull and determine whether the mastoid process is fairly flat or
noticeably protruding.
7 Draw up a copy of Table 8.5 and record the results of your observations in it.
Procedure – Examining the facial structure
1 Position the skull so that it is facing you. Examine the nasal bones. Identify whether they are flat
or protruding.
2 Measure the maximum breadth (width) of the nasal opening.
3 Measure the maximum height of the nasal opening.
4 Starting at the outside of the upper back molars, measure the width of the maxilla (the upper jaw).
5 The bizygomatic breadth is the width of the face from the widest part of one zygomatic arch
(cheek bone) to the widest part of the other zygomatic arch. Measure this distance.
Procedure – Examining the dentition (teeth)
1 Examine the dental arcade (the shape made by the rows of teeth in the upper jaw). Observe the
teeth towards the back and identify whether the teeth on each side of the jaw are parallel or
diverging.
2 Reposition the skull so that you are viewing it from the side. Examine the incisors and identify
whether they are vertical or angled forward.
3 Measure the width of the incisors on the left side of the jaw and then measure that of the incisors
on the right side of the jaw. Add the width of all incisors together to get the combined width.
4 Examine the maxilla (upper jaw) and mandible (lower jaw) together. Identify whether the canine
teeth project above or below the chewing surfaces of the other teeth.
5 See if you can identify the canine diastema (gap on the medial side of the canine – i.e. on the side
nearer the middle of the body).
6 Measure from the back of the last molar to the front of the first premolar on the left side of the
jaw. This will give you a measurement for the chewing surface of the teeth.
Results
TABLE 8.5 Examining the braincase
SAGITTAL FORAMEN
SPECIMEN FOREHEAD BROW RIDGE BRAINCASE MASTOID
CREST MAGNUM
9780170452922
TABLE 8.6 Examining the facial structure
NASAL NASAL OPENING NASAL OPENING MAXILLA BIZYGOMATIC

SPECIMEN
BONES WIDTH HEIGHT WIDTH BREADTH
TABLE 8.7 Examining the dentition (teeth)
DENTAL INCISORS INCISORS CHEWING

SPECIMEN CANINE DIASTEMA
ARCADE ANGLE WIDTH SURFACE
Based on the data you have collected, draw a sketch of one characteristic (e.g. presence of brow ridge)
for each specimen, with the sketches arranged in order from great apes to modern humans, so that
you can see any trends over evolutionary time.
Discussion
1 The canine teeth have drastically reduced in size from great apes to modern humans. Explain why
this might be.
2 Explain why the face has become progressively flatter over the evolution of hominids.
3 Describe how the position of the foramen magnum relates to body posture and locomotion.
4 Certain areas of the braincase enlarged before others in our evolution. Describe how the various
areas have enlarged over the period of our evolution.
5 What traits differentiate modern apes and modern humans?
6 Using your measurements and the facial features you observed as evidence, are modern humans
or modern apes more closely related to extinct hominids?
7 Imagine you found the remains of a skull that only contained the mandible. Would that be enough
evidence to determine whether it belonged to a modern human, an early hominid, or an ape?
Explain your answer.
9780170452922
• Life has existed on Earth for approximately • Comparative genomics and comparative Chapter 8
Activity sheet
3.5 billion years and has changed over time. biochemistry are possible due to
Some changes in species are rapid and bioinformatics, which is the computer
occur after a period of stasis (punctuated analysis of large volumes of biological data.
equilibrium). Most changes take place over • Evolutionary relationships between groups
long periods of time (gradualism). can be represented using phylogenetic
• Darwin’s theory of evolution by natural trees. Analysis of phylogenetic trees gives
selection replaced Lamarck’s theory of us insight into how closely related species
transmutation of species. are.
• Evidence for evolution comes from five main • The fossil record provides evidence of
areas of study: biogeography, comparative extinct organisms. That change has occurred
genomics, the fossil record, comparative in species and in groups of species over long
embryology and comparative anatomy. periods of time is evidenced by fossils, as
• The positions of landmasses are in constant well as by the progression of simple to more
change. Geologic and fossil evidence tell complex organisms in the fossil record.
us that 200 mya a single supercontinent – • Comparative dating is used to determine the
Pangaea – existed, which later separated into relative age of a rock or fossil. Absolute (or
smaller landmasses. chronometric) dating provides the actual
• Biogeography is the study of the distribution (approximate) age of a fossil or rock.
of organisms and ecosystems across the • Comparative anatomy is used to establish
world and through geologic time. evolutionary relationships on the basis
• Different organisms share molecular and of structural similarities and differences,
structural homologies. The DNA present including the comparative study of
in all organisms indicates that modern embryos.
life descended from a single population of • Evolution can be classified as convergent
organisms. or divergent. Analogous structures provide
• Comparative genomics provides evidence some evidence for convergent evolution,
for the theory of evolution and helps us map and homologous structures provide some
the degree of species relatedness. evidence for divergent evolution.
CHAPTER 8 GLOSSARY
Absolute dating The process of determining the challenges or new opportunities; it is a type of
age of rocks and the fossils they contain on the divergent evolution
basis of the physical or chemical properties of
Analogous structure Features of organisms
materials in the rock that have the same function but not the same
Adaptation An evolved structural, structure
physiological or behavioural characteristic of an
Ancestor A species from which other species
organism that increases its chances of survival
have evolved
and reproduction in a particular environment
Biogeography The study of the distributions of
Adaptive radiation The process by which
a species rapidly diversifies into many taxa living things over a geographical area and how
those distributions have changed over geologic
with differing adaptations; it can be triggered
time
by many factors, such as the emergence of
reproductive barriers within a population, Bioinformatics The digital storage, retrieval,
changes in the availability of resources, new organisation and analysis of a large volume of
9780170452922
biological data; bioinformatics has dramatically different from the common ancestor and from
increased the size, accuracy and scope of data one another, giving rise to new species
sets, such as those needed for comparative DNA–DNA hybridisation A method used to
genomics analyse relatedness; similarities in the base-
Clade A group of organisms that includes all pairing of DNA strands are analysed to show
the descendants of a common ancestor and the evolutionary links between organisms
ancestor itself; for example, birds, dinosaurs, Embryology The study of the anatomy of
crocodiles and their common ancestor form a embryos and how they develop over time until
clade the adult stage
Common ancestor An ancestor that is shared Eon A major division of geologic time that is
by different species itself divided into eras
Comparative anatomy The study of the Epoch A division of geologic time (periods)
similarities and differences in structure between that is marked by one or more significant events
different organisms; a larger number of similar
Era A division of geologic time (a subdivision
features indicates a more recent common
of eons) that is itself divided into periods
ancestor
Evolution The process of cumulative, gradual,
Comparative biochemistry Analysis of the
inheritable change in a population of organisms
similarities and differences in the cellular
that occurs over many generations and a
chemistry of different species; it particularly
relatively long time
includes the study of proteins (especially
enzymes) and the DNA that encodes them; the Fossil Preserved remains or traces of an
results enable evolutionary biologists to obtain a organism
measure of the relatedness between species Genomics The study of the genome – how
genes interact with one another and the
Comparative dating The process of determining
the age of rocks and their contained fossils environment, and the resultant proteins
relative to one another, allowing an estimation produced; knowledge of an organism’s entire
of ‘oldest to youngest’, without assigning an DNA sequence
actual age in years Gradualism A theoretical model of evolution
that proposes there has been a steady, slow
Comparative genomics A field of biological
research in which scientists use a variety of divergence of lineages, irrespective of gaps in
tools to compare the genome sequences of the fossil record
different species; the more similar in sequence Homologous structure Feature that has the
the genes and genomes of two species are, the same general structure but different functions in
more closely related those species are different organisms
Conserved Refers to DNA or protein sequences Homology The existence of shared ancestry
that have been preserved by natural selection between a pair of structures or between genes
and are still the same or very similar in different Isotope Atoms of an element that have the
species same number of protons but different numbers
Continental drift The relative movement of of neutrons, and therefore different relative
Earth’s continental landmasses, which appear to atomic masses
drift over Earth’s mantle Molecular homology The identification of
Convergent evolution A process whereby shared biomolecular elements – generally genes
unrelated organisms evolve similar adaptations – used to test the closeness of relationships
in response to a similarity in their environments between organisms; it can demonstrate common
ancestry
Divergent evolution A process whereby related
species evolve new traits over time spent living Molecular phylogeny The study of evolutionary
in different habitats, becoming increasingly relationships using comparative genomics
9780170452922
Morphological Structural isotopes present in a rock or fossil to obtain an

Mutation rate The number of changes per gene absolute date for its age
copy in a population over a period of time Relatedness A measure of the evolutionary
mya Millions of years ago distance between two species; they are more
related if they have a recent common ancestor
Niche An organism’s habitat, way of life, or the
and less related if they have a less recent
way it functions in its environment
common ancestor
Palaeontology The study of life in the past,
based on fossil remains Speciation The evolution of one or more new
species from an ancestral species
Period A division of an era of geological time
that is itself divided into epochs Species A group of similar organisms capable
of breeding and whose offspring are also fertile
Phylogeny Evolutionary relationships that
exist between species, often expressed in a tree- Stratum (plural strata) The layers of rock in
like diagram an area (profile); strata occur in order, with the
oldest layers at the bottom
Principle of superposition The principle that
states that the oldest rock layer is found in the Taxon (plural taxa) A named group of
deepest position, and each consecutive layer organisms, such as beetles or reptiles
above it is relatively younger; it indicates the Theory A collection of models and concepts
relative ages of the rock layers and the fossils that explains specific systems or phenomena;
within them; this principle is fundamental to scientific theories allow predictions to be made
our interpretation of Earth’s history and hence are falsifiable
Punctuated equilibrium A theory of evolution Vestigial structures Biological structures
that proposes new organisms evolve quickly that have lost most, if not all, of their original
after a long period of no change, rather than function in the course of evolution; in ancestral
evolving by gradual change organisms the structures served a purpose, but
Radiometric dating Uses the known rates in their descendants the structures become
of decay of naturally occurring radioactive atrophied or rudimentary

Remembering
1 List the categories of evidence for evolution.
2 Describe Lamarck’s theory of transmutation of species.
3 Define:
a gradualism
b punctuated equilibrium
c biogeography
d vestigial structures
e homologous structures
f comparative genomics.
4 The fossil record is a vital source of evidence in the modern evolutionary synthesis, but it is
patchy and incomplete. Outline the reasons for this patchy record.
9780170452922
Understanding
5 The thylacine (marsupial) and the American gray wolf (placental) evolved independently
of each other in widely separated biogeographic locations, but both animals had a similar
appearance and occupied similar ecological niches. The similarities between the two organisms
are most likely a result of which evolutionary pattern?
6 Birds and bats both have wings, whereas mice and crocodiles don’t. Explain whether this
means that birds and bats are more closely related to one another than they are to mice and
crocodiles.
7 Forty per cent of the world’s species of fruit flies are found on the islands of the Hawaiian
archipelago.
a Propose a reason why the Hawaiian archipelago might provide a suitable habitat for so
many different species of fruit flies.
b Explain how adaptive radiation may have been involved in the evolution of Hawaiian fruit
flies.
8 The sugar glider and the flying squirrel have a similar appearance. Both have a flap of skin
between the forelimbs and hind limbs that enables them to glide from branch to branch. The
flying squirrel is a placental mammal found in the Northern Hemisphere, and the sugar glider is
a marsupial found in Australia.
a Name the process that has resulted in these species having similar features.
b Name and describe the evolutionary pattern that accounts for the similarity of these two
species.
c Suggest how these two animals – one a placental and one a marsupial – would differ in
other ways.
Applying
9 Embryological studies show bird embryos develop a fourth finger and a fifth toe that vanish as
the foetus develops. This vestigial developmental structure is evidence for common descent.
a Explain what this evidence explicitly says about the characteristics of the ancestors of
birds.
b Explain whether you would expect a complete fossil skeleton of a common ancestor
showing this characteristic to have been found.
Analysing
10 New Zealand has no large native land mammals, but has been home to some highly specialised
bird species. Many of these birds have lost the ability to fly: for example, the five species of
Kiwi, which have developed some distinctive features. These features include mammal-like
characteristics, such as a keen sense of smell, bone marrow (which makes bones heavy and
unsuitable for flight) and a pair of functional ovaries in females (most birds have only one
functional ovary), all of which are highly unusual for birds.
a Using the information above, give examples of:
i divergent evolution
ii convergent evolution
iii analogous structures.
b Would molecular homology studies show that the five species are more closely related to
other birds or to mammals?
9780170452922
Evaluating
11 The hoatzin (Opisthocomus hoazin) is a remarkable bird from South America. It has only one
known fossil ancestor, a 10-million-year-old skull fragment found in Colombia. The age of the
fossil demonstrates that hoatzins were endemic to South America, because the fossil pre-dates
the land bridge between North and South America by 8 million years.
Genetic analysis of the living hoatzin shows it is unique, perhaps because of its extensive
history of geographic isolation, and it has its own suborder. Chicks of the hoatzin show
a characteristic shown in no other living bird: a pair of claws on their wings. A similar
characteristic is seen on the bird-like dinosaur Archaeopteryx, which had three wing claws.
From this data, give an example of each of the following types of evolutionary evidence.
a palaeontology (the fossil record)
b biogeography
c morphology
d genetics
12 The 1861 discovery of the Jurassic-age fossil skeleton of the feathered dinosaurian bird ancestor
Archaeopteryx from Germany was a key moment in the development of Darwinian theory.
The discovery of the pigeon-sized animal was brought to the attention of Charles Darwin, who
commented that ‘hardly any recent discovery shows more forcibly than this how little we as yet
know of the former inhabitants of the world’ (The Origin of Species).
The skeleton of Archaeopteryx clearly shows that it had claws on its forelimbs, well-developed
feathers on its wings (allowing for weak, gliding flight), teeth and a long, bony tail.
a Define transitional form.
b Discuss the limitations of the evidence for the evolutionary relationships between dinosaurs,
Archaeopteryx and birds. Which type of evidence can be used and which types cannot?
Creating
Use the following genetic and morphological data to answer questions 13–15.
Genetic characters
Sequence of portion of chloroplast DNA
Japanese black pine (Pinus thunbergii) T A A T A A A GG AGG - - - - - - GA C T T A TG TC A C
Bhutan white pine (Pinus bhutanica) T A A T A A A GG AGGG A - - - - - - CT T A TG T CGC
Chiapas pine (Pinus chiapensis) T A A T A A A GGA GGG AC T T A GA C T T A TGT C A C
Eastern white pine (Pinus strobus) T A A T A A A GGA GGG AC T T A GA C T T A TGT C A C
Lacebark pine (Pinus bungeana) T A A T A A A GGA GGG AC - TG A - C T T A TGT C A C
Red pine (Pinus resinosa) T A A T A A AGGA GGGA - - - - - - C T T A TGT C A C
Single-leaf pinyon (Pinus monophylla) T A A T A A A G G A G GG A - - - - - - C T T A T G T C A C
Morphological characters
ygolotnoelaP fo muesuM ainrofilaC fo ytisrevinU
Number of Sheath around Number Seed wing

vascular needle bundle of (0 = absent,
bundles per (1 = straight, needles 1 = detachable,
needle 2 = curling back) per bundle 2 =permanent)
Japanese black pine 2 1 2 2
Bhutan white pine 1 2 5 1
Chiapas pine 1 2 5 1
Eastern white pine 1 2 5 1
Lacebark pine 1 2 3 2
Red pine 2 1 2 2
Single-leaf pinyon 1 2 1 0
FIGURE 8.29 Genetic sequences
13 Construct a phylogenetic tree for the seven pine species, based solely on the morphological
data.
9780170452922
14 Analyse the genetic sequences for the seven pine species and determine which two are the most
closely related species.
15 Create an argument summarising whether you think comparative genomics or comparative
anatomy (looking at morphological characters) provides more reliable evidence for relatedness,
and why.

1 The early evolution and diversification of 3 The first organisms on Earth were:
eukaryotes required increasing amounts A eukaryotic and aerobic
of which of the following gases in the B prokaryotic and aerobic
atmosphere? C eukaryotic and anaerobic
A oxygen D prokaryotic and anaerobic.
B carbon dioxide [Q4 2018 SCSA]
C hydrogen
Questions 4 and 5 relate to the information
D nitrogen
below.
[Q17 2019 SCSA]
The following phylogenetic tree shows the
2 Which of the following is evidence for the
relationships among the major groups of plants
process of evolution?
and the points in their evolution at which
A The fossil record has many gaps.
particular characteristics arose. The time frame
B Earth is about 4.5 billion years old.
is in millions of years ago (mya).
C All species share a genetic code.
D Interspecific hybrids are usually sterile.
[Q24 2019 SCSA]
Land plants
Vascular plants
Seed plants
Gymnosperms Angiosperms
Cycads
Ferns
~400 mya Ginkgo Conifers
Lycopods
~410 mya Horsetails
~375 mya
~120 mya
Carpel
Flowers
Hornworts
Mosses ~300 mya
Liverworts Seeds
Woody tissue
Algae Xylem and phloem

(seaweeds)
~420 mya
Cuticle
~1.5 billion years ago
9780170452922
4 The phylogenetic tree indicates that: 6 Describe the main features of the forefeet
A seeds evolved after flowers of the various types of horses that have
B woody tissue evolved after xylem and appeared over the past 50 million years.
phloem (4 marks)
C cycads have woody tissue and flowers [Q32c 2018 SCSA]
D cuticle is present in ferns but not in
7 Explain how biologists know about the
mosses.
evolution of the forefeet in horses over the
[Q14 2018 SCSA]
past 50 million years. (4 marks)
5 The phylogenetic tree also indicates that: [Q32d 2018 SCSA]
A angiosperms evolved from mosses and
8 A biologist constructed a phylogenetic tree
ferns
showing the evolutionary relationships
B gymnosperms evolved from
among the Australian species of dung
angiosperms
beetle. Explain how a phylogenetic tree can
C liverworts, hornworts and mosses
represent the evolutionary relationships
evolved from a single related group of
between different species. (4 marks)
plants
D cycads, ginkgos and conifers evolved [Q31e 2019 SCSA]
from a single related group of plants. 9 Indicate the order in which the following
[Q15 2018 SCSA] life forms first evolved: eukaryotic cells,
prokaryotic cells, land plants and marine
The following diagram shows the evolution of
animals. (4 marks)
height and forefeet in modern horses and their
First (oldest):
extinct ancestors over the past 50 million years.
Second:
The digits (‘fingers’) of the forefeet are labelled
Third:
2 to 5. Use the information to answer questions
Fourth:
6 and 7.
[Q34a 2017 SCSA]
Recent rock 2 4 10 Explain how fossils, comparative anatomy,

Pleistocene rock comparative embryology and comparative
(dates from
1 million years ago) genomics can each provide evidence for the
1.6 m Modern horse (Equus) 3 theory of evolution. (10 marks)
[Q37b 2017 SCSA]
Late Miocene rock 2 4
(dates from
8 million years ago)
3
1.25 m Pliohippus
Middle Miocene rock

(dates from
15 million years ago) 4
2
3
1 m Merychippus
5
Late Eocene rock
(dates from
2 4
3
0.6 m Mesohippus
Early Eocene rock

(dates from
5
2 4
3
0.4 m Hyracotherium
9780170452922
292
9
MECHANISMS OF CHAPTER 9 CONTENT
EVOLUTION AND By the end of this chapter, you will have covered the
following material.
SPECIATION STARTER QUESTIONS

1 What do you think the term ‘survival of the fittest’ means?
2 Dogs and cats have a common ancestor, but have evolved
very differently. Why have big cats evolved (such as the
Siberian tiger) but not big dogs?
3 What are the mechanisms for evolution? If they are absent,
can evolution occur?
» mutation is the ultimate source of genetic variation as it
introduces new alleles into a population
» natural selection occurs when selection pressures in the
environment confer a selective advantage on a specific
phenotype to enhance its survival and reproduction; this
results in changes in allele frequency in the gene pool of a
population
» in addition to environmental selection pressures, sexual
selection, mutation, gene flow and genetic drift can
contribute to changes in allele frequency in a population
gene pool
» speciation and macro-evolutionary changes result from an
accumulation of micro-evolutionary changes over time
» selective breeding (artificial selection) through the intentional
reproduction of individuals with desirable characteristics
results in changes in allele frequencies in the gene pools over
time
» differing selection pressures between geographically isolated
populations may lead to allopatric speciation
» populations with reduced genetic diversity face increased risk
of extinction
9780170452922
CHAPTER 9 | Mechanisms of evolution and speciation 293
9.1 EVOLUTION AND ITS MECHANISMS

In the previous chapter, evolution was defined as a process that results in cumulative, inheritable
changes in a population, spread over many generations. The theory of evolution states that all
organisms have developed from previous organisms and that all living things have a common
Mechanisms of
ancestor in some initial form of primitive life. It also states that all organisms are fundamentally similar evolution and natural
because their basic chemistry was inherited from this very first organism. The evidence supporting the selection
theory is significant, but unable to support all changes, including the initial change of the inanimate Watch this
introductory video
to the animate, and therefore evolution remains a theory. Since the 1930s and 1940s, the concept on the mechanisms
of evolution has ‘evolved’ to include genetics, and it is now understood to be due to change in of evolution. The
the frequency of alleles within a gene pool. This understanding is the modern synthesis theory of mechanisms described
explain how changes
evolution. If the basis of evolution is change, the next question is, what mechanisms bring about this occur in a population.
change? The Hardy–Weinberg equilibrium principle says that allele frequencies in a population will
remain constant in the absence of the four factors (mechanisms) that could change them. Those
mechanisms are mutation , natural selection , genetic drift , and migration (enabling gene flow ).
9.2 A MECHANISM FOR EVOLUTION: MUTATION

Mutation is a source of new alleles in a population’s gene pool. A mutation is a permanent change in
the DNA sequence of a gene. A mutation can change one allele into another, and the net effect is a
change in the frequency of an existing allele. The change in allele frequency resulting from mutations
is small, so its effect on evolution is insignificant unless it provides a beneficial trait with respect DNA mutation
simulation
to a particular selection pressure in the environment. A selection pressure is an abiotic or biotic A reminder of what a
environmental factor that enhances the survival and reproduction of those individuals in a population mutation is and how
who possess a beneficial trait, and reduces the survival and reproduction of those individuals without different mutations can
affect a protein. The
that trait. It can contribute to changes in allele frequencies in a population gene pool and therefore protein product affects
also drive natural selection. When individuals in a population possess certain alleles or traits that are a phenotype (‘trait’).
Mutation is a method of
better suited to survive selective pressures, reproduce and pass on the advantageous alleles. This is introducing a new allele,
known as ‘survival of the fittest’. which means a new
A mutation may produce an allele that is selected against, selected for, or selectively neutral. protein, which means
potentially a new trait.
Harmful mutations are removed from the population by selection and will generally only be found
in very low frequencies equal to the mutation rate. Beneficial mutations will spread through the
population over generations, through selection. That initial spread is slow, and is directly related to
a population’s reproductive rate. Whether or not a mutation is beneficial or harmful is determined
by whether it helps an organism survive to sexual maturity and reproduce. It should be noted that
if a mutation is beneficial, and selected for by the environment, it is the ultimate source of genetic
variation in all populations. New alleles enter a gene pool, changing the frequency of alleles at
the time of the mutation and after each new generation. Therefore, mutation is a mechanism for
evolution.
The peppered moth, Biston betularia, is widespread in Britain (Figure 9.1, page 294). Historically,
the standard moth form, typica, was white, liberally speckled with black. During the 1800s, British
cities and the countryside were transformed by the Industrial Revolution. Hundreds of coal-powered
factories produced large quantities of airborne soot and other pollutants. By 1895, 95% of moths Evolution of the
peppered moth
in industrial regions of Britain, such as Manchester, were black (form carbonaria). A well-known Explore the evolutionary
lepidopterist (person who studies moths and butterflies), J. W. Tutt, proposed an evolutionary link story of the peppered
between the Industrial Revolution and the moth population. Dark pigmentation was part of the moth.
natural, inheritable variation of the B. betularia population, but very rare. Blackening of tree trunks by
9780170452922
soot presented a new environmental pressure for the moth population. The dark-coloured moths
were better able to evade bird predation than the common white speckled form. Over time, black
moths came to dominate the population.
Since 1950, when clean air legislation was passed in Britain, the situation has been reversing; once
again dark-coloured moths are suffering greater predation on the naturally white tree trunks, and
their presence in the population is less common. Both dark and white forms continue to exist in the
population.
a
a b
b
rekceH knarF/otohP kcotS ymalA

ybraeN/otohP kcotS ymalA
FIGURE 9.1 The peppered moth, Biston betularia, has a a white speckled typica form and b a dark carbonaria form.
Variation in populations
Variations in populations can be very small, but they are the basis of evolution. As in the
peppered moth example, individuals in any population express a range of different phenotypes. A
population is a group of individuals of the same species that live in the same geographic area and
interbreed to produce fertile offspring. Members of a population have variation in their genotypes
that causes variation in their phenotypes. Variation therefore is based on differences in DNA
sequences, which give rise to different forms of genes (alleles), which in turn result in different
phenotypes.
Evolution relies on genetic variation that is inheritable: it can be passed to the next generation
and under certain circumstances may give an individual an advantage in survival and reproduction,
compared with the rest of the population. In the case of the peppered moth, a mutation in the
genotype produced a dark-coloured form in this population. This dark phenotype conferred a survival
advantage in the changed environment. In a different environment, the same genotypic variation may
give a disadvantage or have no effect at all. Either way, genetic mutation introduces new alleles and,
therefore, additional variation into populations.
Gene pools
Genes are the means of transmitting phenotypes from one generation to another. Many genes can
exist in different forms as alleles, and the characteristics of individuals are determined by the alleles
they inherit. It is this variation in alleles carried by different individuals that leads to most of the
variation in a population. The total collection of alleles within a population is referred to as the gene
pool (see Figure 9.2).
9780170452922
BB Bb
Bb
BB bb
Bb
Bb bb
bb
Bb
Bb
BB
FIGURE 9.2 The sum of all the alleles found in a population is called the gene pool.
Key concept
Genetic mutations introduce new alleles into populations and are the ultimate source of
variation. The sum total of all alleles present in a population is called the gene pool.
Linking evolution, ecology and health
YCARETIL CIFITNEICS
An understanding of evolution and ecology is essential when responding to threats to human
health. For example, the Ebola virus, which has killed more than 11 000 people, has evolved
quickly and is thought to have transferred from bat populations to human populations. Every
transmission of the Ebola virus to a new host represents an opportunity for natural selection
and therefore for evolution of the virus. Some strains have longer chains of transmission, with
more mutations, enabling viruses to discover more fit phenotypes. Phylogenetic analyses
revealed the great extent of evolutionary change that occurred early in the 2014 epidemic in
West Africa, with 73 non-synonymous substitution mutations being found among 78 infected
individuals just from Sierra Leone.
In 2018, an international body formed, known as the International Society for Evolution,
Medicine, and Public Health (ISEMPH). The mission of ISEMPH is ‘to foster communication
among scientists, students, clinicians and public health professionals who want to use
evolutionary insights to improve medical research and practice, and to use studies of human
health and disease to advance evolutionary biology’.
The Tasmanian devil facial tumour disease is another example of ecology and evolution
interacting to play a significant role in the health of a population. Tasmanian devils have been
subject to this infectious and fatal cancer, and the species is under threat of extinction. However,
it has been reported that some Tasmanian devils have developed resistance to the disease.
‘These gene variants would have been around before, but there was no evolutionary
advantage to them being at high frequency,’ says Professor Katherine Belov of the University
of Sydney. ‘Since the arrival of this new disease, the animals without these variants would have
been dying, leading to an increase in the frequency of these protective variants.’
Adapted from Charles L. Nunn, Susan C. Alberts, Craig R. McClain, Steven R. Meshnick, Todd J. Vision, Brian M. Wiegmann,
Allen G. Rodrigo, ‘Linking Evolution, Ecology, and Health’, TriCEM, BioScience, Vol.65, Iss. 8. August 2015, pp 748–749.
Questions
1 Describe an ecological aspect of the Ebola disease.
2 Describe a health aspect of the Ebola disease.
3 Describe an evolutionary aspect of the Ebola disease.
4 Argue that an understanding of all three aspects is crucial in the management of the
disease.
5 Explain how evolution is helping the Tasmanian devil.
9780170452922
Question set 9.2

REMEMBERING
1 Define and give an example of each of the following:
a mutation
b variation
c population.
UNDERSTANDING
2 Compare and contrast the types of variation in a population that results from mutation
and crossing over.
3 ‘Mutations are the ultimate source of variation.’ Explain the different ways in which sexual
reproduction and mutation contribute to variation.
4 Explain why there are still examples of the white and dark form of B. betularia moths, even
after clean air legislation has been passed.
9.3 A MECHANISM FOR EVOLUTION:

Natural selection
NATURAL SELECTION
Reinforce your
understanding of In 1868, two publications were released simultaneously through the Royal Society in London.
natural selection These papers were by Charles Darwin and Alfred Russel Wallace. They outlined the authors’ ideas
by watching these on the evolution of life, what they referred to as descent with modification. This term highlights
videos.
the important idea that all life that exists today has descended from shared ancestors. The shared
characteristics observed in organisms led them to conclude that all organisms descended from an
ancestor that lived in the past.
The mechanism proposed by Darwin and Wallace for how this happened is the process of natural
selection, which can be used to explain many features observed in living things found in the world
today. Through this mechanism, favourable traits are selected for and inherited, and become more
common in subsequent generations. The process of certain traits gradually becoming more common
over generations is known as accumulation.
2 Overproduction 3 Selection
Every species tends to Individuals are exposed to a new
produce more individuals selection pressure which selects
than can survive to maturity. some individuals over others to
survive longer and reproduce.
1 Variation 4 Adaptation
The individuals of a Individuals that survive and reproduce
population have many have traits that become more common
characteristics that differ. in the population, the advantageous
allele accumulating over generations.
FIGURE 9.3 The theory of evolution by natural selection
9780170452922
Natural selection occurs when selection pressures in the environment confer an advantage
on a specific phenotype and enhance its survival and reproduction; this results in changes in allele
frequencies in the gene pool of a population. Through this process, individuals that have certain
inherited traits are more likely to survive and reproduce at higher rates than other individuals. This
can cause changes in a population’s allele frequencies and therefore is a mechanism for evolution.
Alleles are expressed in phenotypes, also known as traits. If a population possesses variation in
a trait (different alleles for a gene), the population may experience natural selection. An inherited
trait that allows an individual to survive and reproduce is called an adaptation. Depending on
the environmental conditions, a phenotype may confer an advantage or a disadvantage to the
individual, relative to individuals with other phenotypes in the population. If it is an advantage,
then that individual will be more likely to survive and have offspring than individuals with the
other phenotypes, and this will mean that the allele producing the phenotype will have greater
representation in the next generation. If conditions remain the same, the offspring that are carrying
the same allele will also benefit. Over time, the allele will increase in frequency in the population.
Natural selection only acts on the population’s inheritable traits, selecting for beneficial alleles
and thus increasing their frequency in the population, while selecting against deleterious alleles and
thereby decreasing their frequency. Scientists call this process adaptive evolution.
TABLE 9.1 The principles of natural selection
PRINCIPLE VISUAL AID

1 Variation
Individuals in a population differ from
one another; that is, individuals within
populations show variation. Variation is due
to mutation in alleles and meiosis/sexual
tteZ aroD/moc.kcotsrettuhS
reproduction processes. These processes
include crossing over, independent
assortment, random fertilisation, and
random mating.
FIGURE 9.4 Variation in the dog population

2 Overproduction
There are more individuals produced in
a population than the environment can
support. Environmental resources are
limited. Not all individuals can survive to
reproduce.
Seahorse gives birth

to 2000 babies
Watch this male
seahorse give birth
to thousands of baby
seahorses. There are
enirreP guoD/otohP kcotS ymalA
many, but only 5 in

1000 will survive.
FIGURE 9.5 Male seahorse ‘giving birth’ to many offspring. Not all will survive.
9780170452922
PRINCIPLE VISUAL AID

3 Competition and survival of the fittest
a
Environmental selection pressures
such as food availability, predators and
some diseases favour those with more
advantageous traits or alleles. This may
lead to competition between individuals
in a population, and those with the
advantageous trait may outcompete those
nosI sirhC/moc.kcotsrettuhS
without the advantageous trait. This is an
example of ‘survival of the fittest’. Those
individuals who are more ‘fit’ are better
suited to the environment in which the
population lives.
b
Survival of the
Tasmanian devil
Those who develop
sttaW evaD /devreser sthgir llA .epacsuA

the trait of immunity
against the
transmissible devil
facial tumour disease
will be more likely to
survive, reproduce
and pass on their
advantageous allele.
FIGURE 9.6 Tasmanian devil: a with advantageous trait (fit); b without advantageous
trait (not fit)
4 Higher reproductive rate
Individuals with the inheritable advantageous trait are more likely to survive, reproduce and have a higher reproductive
rate than those who do not possess the allele.
5 Heritability One of the thorny devils’ selection pressures is predation by wild birds and goannas.
Advantageous alleles are passed to Advantageous traits they pass on to offspring are camouflaged colouration and large
offspring spines that serve as protection.
ztiwgreB ewU/moc.kcotsrettuhS
FIGURE 9.7 Thorny devil offspring showing advantageous traits of brown and gold
colouration and large spines
6 Allele frequencies change over generations
Over consecutive generations, the frequency of the advantageous alleles or traits increases. The frequency of the disadvantageous traits
decreases. Over many generations (and usually a relatively long time), an advantageous allele can become fixed; that is, its frequency can
become 100%. In contrast, the disadvantageous allele can become extinct (its frequency can become almost 0%).
9780170452922
The driving force for adaptive evolutionary change is natural selection. Table 9.2 presents a case
study for a hypothesis about long necks in giraffes being the result of natural selection using the
principles of natural selection. How did giraffes develop such a long neck? If there was an inadequate
supply of food, was this the selective force?
TABLE 9.2 The hypothesis that long necks in giraffes are the result of natural selection
PRINCIPLE APPLICATION TO GIRAFFES

1 Variation There was variation for short- and long-necked
giraffes due to mutation and sexual reproduction
processes.
2 Overproduction More giraffes are produced than the
environmental resources can sustain. There are
not enough leaves to feed a whole population,
and the last leaves to be eaten are up high.
3 Competition and The individuals in the giraffe population compete
survival of the fittest for the leaves high in the tree. Only those with
the advantageous tall allele or trait can reach and
consume enough food.
4 Higher reproductive The individuals who possess the advantageous
rate allele can survive and reproduce and have a
higher reproductive rate than those who do not
possess the advantageous allele.
5 Heritability The giraffes with the higher reproductive rate are
3otohpdliw/moc.kcotsrettuhS
more likely to pass their inheritable, advantageous
allele on to offspring.
6 Change in allele The next generation of giraffes have a higher
frequencies over frequency of advantageous (tall) alleles and a
generations lower frequency of disadvantageous (short)
alleles. Over many generations, the tall allele
FIGURE 9.8 The allele to produce a long-necked
accumulates until the allele becomes fixed and
phenotype suited the environmental pressures.
the disadvantageous short allele becomes extinct.
Key concept
Natural selection occurs when selection pressures in the environment confer an advantage on
a specific phenotype to enhance its survival and reproduction; this results in changes in allele
frequencies in the gene pool of a population. These advantageous traits are passed on to future
generations and accumulate over time, resulting in a change in the gene pool of the population.
Artificial selection: animal and plant breeding

Darwin drew comparisons with breeding programs for domestic animals, including dogs and pigeons.
The processes for breeding different strains of dogs and different varieties of pigeons were quite
well understood (Darwin was an experienced pigeon breeder). Parental stock with certain desirable
traits were selected and mated, and it was understood that these traits were often passed on to the
offspring. Over time the new traits could be established in the populations. This process is called
artificial selection (selective breeding), and it relies upon human intervention to determine which
traits are selected for.
Artificial selection is the intentional breeding of individuals with desirable traits, resulting in changes in
allele frequencies in gene pools over time. The traits are beneficial to humans. The breeding for particular
traits results in changes in allele frequencies over generations, and therefore this is a mechanism for
evolution. Specific allele frequencies will decrease, and variation will also decrease, as humans breed for
specific desirable traits. Artificial breeding has also been applied to sheep and cattle.
9780170452922
Sheep were very generic (had few breeds) and had random traits until about 300 years ago.
Selective breeding has been practised since then to select for the best quality and quantity of meat,
quality of wool, and size of the sheep. Sheep with the best characteristics were allowed to mate and
produce offspring who would also have the favourable traits. Many different varieties of sheep have
now been reared, all with traits that benefit humans.
Cattle, which currently have around 800 different breeds, have changed considerably from
their wild ancestor, the auroch, which is now extinct. Cows have been bred for meat quality, or
the quantity and quality of milk they produced. Jersey cows have been bred for both quantity and
quality of milk. This type of selective breeding can pose problems for cows. Cows with large udders
can be in discomfort due to the weight of the udder when it is full of milk.
The Belgian Blue is a breed of cattle that has been bred for the meat industry through artificial
selection. The Belgian Blue’s unusual physique comes from a naturally occurring ‘double muscling’
mutation. The mutation occurs in the myostatin gene (M), which codes for the protein myostatin
(‘myo’ = muscle, ‘statin’ = stop). Due to the mutation, muscle development is not regulated, resulting
in huge muscles.
a
eelessI cirE/moc.kcotsrettuhS
sknaborue/moc.kcotSi
FIGURE 9.9 a A ‘normal’ cow; b a Belgian Blue cow
Artificial breeding has also been applied to many fruits and vegetables, such as corn, bananas
and watermelons. Farmers and breeders use the practice of selection to cause major changes in the
features of their crops and animals over the course of decades. The changes in allele frequencies
cause evolution. The process is called artificial selection because people (instead of nature) select
which organisms get to reproduce.
The teosinte plant, still found in South America, is the origin of today’s corn plants. Native
Americans practised selective breeding (artificially fertilising, inbreeding and crossbreeding teosinte)
to create a higher yielding and tastier food source. The early corn plants had one cob per plant, on
which there were at the most 4–5 kernels, and they were covered in an outer husk. Today’s corn
has exposed kernels and is significantly larger than the earlier varieties, with more cobs per plant.
Plant breeding has been practised for thousands of years. It is practised worldwide by individuals
such as gardeners and farmers, and by professional plant breeders and researchers. It is conducted
over many generations. International development agencies believe that breeding new crops is
important for ensuring food security by developing new varieties that are higher-yielding, resistant to
pests and diseases, drought-resistant or regionally adapted to different environments and growing
conditions.
One major technique of plant breeding is selection, the process of selectively propagating plants
with desirable characteristics and eliminating or ‘culling’ those with less desirable characteristics.
Another technique is the deliberate interbreeding (crossing) of closely or distantly related
individuals to produce new crop varieties (hybrids) with desirable properties. Plants are crossbred to
introduce traits or alleles from one variety or line into a new genetic background.
9780170452922
Traits that breeders have tried to incorporate into crop plants include:
• improved quality, such as increased nutrition, improved flavour, seedlessness or greater beauty
• increased yield
• increased tolerance of environmental pressures (salinity, extreme temperature, drought)
• resistance to viruses, fungi and bacteria
• increased tolerance to insect pests
• increased tolerance to herbicides
• longer storage period.
Artificial selection is similar to natural selection in that advantageous traits are passed on and
allele frequencies change and may accumulate over generations. The major difference between
artificial selection and natural selection is that humans choose traits that are advantageous to
humans, whereas in natural selection, an environmental selection pressure selects a trait, and that trait
is beneficial for the survival of the organism.
Artificial selection
Learn more about
artificial selection
here.
Selective breeding
Investigate selective
Wild banana Modern banana
breeding further and
The first bananas may have been cultivated Today’s tastier bananas are hybrids of two
compare selective
7000 years ago in what is now Papua New wild banana varieties, Musa acuminana and
Guinea, and were stocky and hard, with Musa balbisiana.
breeding with
large, tough seeds.
genetic engineering.
Wild carrot Modern carrot

The first carrots were likely cultivated Carrots today are large, bright orange,
around the 10th century in Asia Minor and and tasty.
were either white or purple, with thin,
forked roots and a strong flavour.
Wild corn Modern corn

North American sweet corn was bred from The corn we eat now is 1000 times bigger
the barely edible teosinte plant. Natural corn and much easier to grow and peel. The
was first domesticated around 7000 BC and majority of the development took place
was thought to have been as dry as a raw after the 15th century, when European
potato. colonialists started farming it.
FIGURE 9.10 Selective breeding of wild foods led to modern versions.
9780170452922
Wild
mustard plant
Cauliflower Broccoli Cabbage Brussels Kale Kohlrabi Strain

sprouts
Flower buds Flower buds Terminal Lateral Leaves Stem Modified

and stem leaf bud leaf buds trait
FIGURE 9.11 The wild mustard plant has evolved into different forms through selective breeding.
The similarities and differences of natural selection and selective breeding can be summarised in
a Venn diagram.
Natural selection Selective breeding
Traits
Occurs naturally inherited from Humans select
without human parents desired traits that
interference benefit humans
Results in change in
Increases species’ allele frequencies in a May not enhance
chance for survival species survival of a species
Example: Galápagos Change occurs over Examples: dogs,

finches many generations crops, cattle
FIGURE 9.12 Venn diagram of the similarities and differences between natural selection and selective breeding
Table 9.3 compares the advantages of natural selection and artificial selection.
TABLE 9.3 Advantages of natural and artificial selection
NATURAL SELECTION ARTIFICIAL SELECTION

Slower growth rate and therefore has time to adapt to changes in the Usually a faster growth rate
environment, such as poor soil quality
Higher genetic variation – less susceptible to changes in the Increased nutritional value, larger yield,
environment. (Artificial selection usually breeds for one trait, which pest resistance, drought resistance,
reduces variation, i.e. there is less chance of suitable alleles existing disease resistance
and more chance of extinction.)
9780170452922
Sexual selection
Sexual selection is selection by male and female individuals of a population for an inherited trait that
assists in copulation or in the winning of a mate. This type of natural selection is always linked to
mating behaviour in animals. In this form of selection individuals with certain inherited characteristics
or behaviours are more likely than others to obtain mates and pass on their genes.
Sexual selection can produce quite spectacular effects, such as the enormous antlers of a moose,
or the long, showy tail of a male peacock. Over many generations, the frequency of the advantageous
allele increases. Therefore, this process is a mechanism for evolution. It can lead to the fixation of
advantageous alleles and the extinction of disadvantageous alleles. Although sexual selection is a
type of natural selection, the advantageous trait does not necessarily assist the individual to survive its
environmental selection pressure, it only helps it to win a mate.
Special characteristics such as the large tails of peacocks and lyrebirds, or the antlers of moose,
are actually quite costly to the animal that is carrying them, and do not directly give them any extra
survival advantage. In many cases, these attributes can be a threat to their survival. Loud and elaborate
courtship displays attract predators as well as mates, and growing new antlers every year costs
energy. So, what is the evolutionary advantage? One theory suggests that the females are selecting
for a very obvious characteristic that correlates with other beneficial alleles. There have been some
experiments carried out that suggest that this might be the case.
Sexual selection can also produce a phenomenon called sexual dimorphism. This term applies to
species in which males and females have different appearances or size. Males and females of certain
species are often quite different from one another in ways additional to their reproductive organs.
Males are often larger, for example, and display many elaborate colours and adornments, like the
peacock’s tail, whereas females tend to be smaller and duller in decoration. Morphological difference
such as this is termed dimorphism (‘di’ means ‘two’): the two sexes of the same species exhibit two
different forms.
Some examples of sexual selection can be surprising. For example, the Soay (Ovis aries) is a
primitive breed of sheep that lives on the rocky islands off the coast of Scotland. It is well known for
its agility on cliffs and for the large horns carried by many males. Large horn size appears to be a
sexually selected characteristic and provides males with a significant advantage in securing mates.
Variation in this trait appears to be controlled by a single gene. One allele (Ho+) is linked to large horns
and the other allele (Hop ) to smaller horns.
lliGcM divaD/otohP kcotS ymalA
FIGURE 9.13 Soay rams, showing their large horns
9780170452922
Biologists have often hypothesised that sexual selection helps females somehow choose
males who possess genes that confer a high level of biological fitness. But in the case of the Soay,
they found that males with large horns actually have lower fitness overall. Rams with small horns
Songs of the lyrebird
have a better chance of surviving the harsh winters, and rams that are heterozygous, carrying
Explore with David
Attenborough the one of each allele, are most successful overall in terms of survival and reproduction. This sexual
repertoire of one bird. selection ensures that the Hop allele survives in the population, even though it renders the rams
less sexually fit.
ABC Catalyst
Watch the video on
sexual selection (starts The multimedia display of the
at the 12-minute mark
and proceeds for lyrebird
8 minutes). The male lyrebird may not have the most
Noisiest mating call spectacular tail in the world, so you might think
A male white bellbird it would not be attractive to females. But the
screams a mating bird’s song display is a different story. The lyrebird
call. The birds further
enhance their courtship is one of the most accomplished mimics in the
DJRgiarC/moc.kcotSi
by extending a black animal kingdom. The males sing complex songs,
wattle, which grows
from their jaws. Watch mimicking animal and bird sounds, and even
it here. mechanical sounds, such as chainsaws. The
males with a greater repertoire achieve better
Mating dances reproductive success. FIGURE 9.14 The male lyrebird displaying its tail
National Geographic
peacock spider mating
dances Key concept
Bird of paradise mating Sexual selection is a form of selection in which individuals with certain inherited
dance characteristics or behaviours are more likely than others to obtain mates and pass on their
National Geographic
male bird of paradise genes. The traits do not usually provide a benefit for survival.
mating dances
Sexual selection
Read more about sexual
Question set 9.3
selection here. REMEMBERING
1 Outline the meaning of the following and give an example of each.
a natural selection
b sexual selection
c artificial selection.
UNDERSTANDING
2 Describe how natural selection contributes to evolutionary change.
3 Identify the role of variation in evolutionary change.
4 All breeds of dogs originated from the wolf. Over time they have been bred for particular
traits pleasing to humans, including friendliness. The cons of this breeding include back
pain for dachshunds and breathing problems in pugs. Name the type of selection involved
in dog breeding and discuss whether variation has increased or decreased in dogs.
5 In 2018, a man caught a sexually transmitted disease called gonorrhoea. He took
antibiotics, but it was the first case of the infection that could not be cured with
the first choice of antibiotics. The main antibiotic treatment – a combination
of azithromycin and ceftriaxone – failed to treat the disease. The World Health
Organization confirmed that this was a world first. The disease is caused by the
bacterium called Neisseria gonorrhoeae, and the infection is spread by unprotected sex.
Of those infected, about one in 10 heterosexual men and more than three-quarters of
women and gay men have no easily recognisable symptoms. Apply the principles of
natural selection to explain why the usual course of antibiotics did not work.
9780170452922
6 Male widowbirds have extremely long tails. Females prefer the longer tail when selecting a
mate. Females have no outstandingly attractive features: they are inconspicuously mottled
brown and have short tails. Suggest a reasonable explanation for the evolution of long tail
feathers in male widowbirds.
9.4 A MECHANISM FOR EVOLUTION:

GENETIC DRIFT
For variation to occur in phenotypes, more than one allele of a gene must exist. If there are multiple
alleles, they can be affected by the random processes that occur in sexually reproducing organisms.
Every reproductive event involves chance. This results in random changes in allele frequencies over
generations. These random changes from generation to generation are known as genetic drift.
Genetic drift is a mechanism of evolution in which allele frequencies of a population change over
generations due to chance. Genetic drift occurs in all populations, but its effects are strongest in small
populations.
There is usually a loss of genetic variation over generations. The smaller the population, the faster
the fixation of alleles and the extinction of other alleles can occur. This means the process allows
alleles in smaller populations to be eliminated faster than alleles in larger populations. Genetic drift
is an important element of the evolutionary process. It occurs when a random, non-representative
sample from a population produces the next generation. Thus, over time the proportion of an allele
can ‘drift’ up or down. It is important to note that this is not due to any advantage or disadvantage
associated with the allele (this is not a type of selection).
Each of us inherited half our alleles from our mother and half from our father. Which half of
their alleles our respective parents passed on to us was a matter of chance. In addition to random
fertilisation, each gamete has a randomly selected set of chromosomes due to random assortment
of chromosomes during meiosis. In large populations, this randomness in inheritance of alleles is not
noticeable overall. This is because the proportion of alleles that are affected is low. But if a population
is small, there is a chance that some alleles present in a parental group will not be passed on at all.
The same small number of alleles affected in a small population will be representative of a much
higher proportion. These alleles may quickly be permanently lost from the gene pool. Alleles may be
easy to lose, and they are virtually impossible to replace.
Genetic drift can be defined as the process of random changes in allele proportions within a
population from one generation to the next.
Two extreme cases of genetic drift are:
• the bottleneck effect
• the founder efect. SWAT!
Genetic drift can occur in a

small population or when a large
population is suddenly reduced due
to a catastrophic event. This can give
rise to a bottleneck effect. When a
small group of individuals migrates
Ratio 5:5 Ratio 5:1 Ratio 5:1
and establishes a population in a
new location, the founder effect may Reproduction
occur.
These effects are discussed in FIGURE 9.15 Genetic drift describes changes in allele frequency and
more detail below. proportions due to a chance event.
9780170452922
Bottleneck effect
Sometimes a catastrophic event or a period of adverse conditions drastically reduces the size of
a population. In this scenario, certain alleles may be lost through chance. If some portion of the
population survives the catastrophe, the original population gene pool cannot be recovered. The
expanded population can only
carry the alleles that existed in the
population that survived the event.
Therefore, the gene pool will now
carry an indication of the bottleneck
that occurred long after the population
has recovered. The bottleneck effect
occurs when there is a disaster of
some sort that reduces a population
to a small handful, which rarely
represents the full genetic makeup Parent population Bottleneck Surviving Next generation
(original allele (drastic individuals (change
of the initial population. This leaves frequencies and reduction in in allele
smaller variation among the surviving allele population) frequencies
proportions)
individuals.
The bottleneck effect is an extreme FIGURE 9.16 The bottleneck effect reduces genetic diversity
case of genetic drift as a result of in the population due to changes in the environment.
natural events or catastrophes.
Cheetahs are an endangered species
that have survived a drastic genetic
bottleneck. Facing a declining population,
the surviving parents mated with their own
offspring, and the resulting generations
were left with strikingly low variation in
alleles. One common allele is a mutated
allele with negative effects on fertility.
rublaHBelaD/otohpkcotSi
Typically, a male cheetah’s sperm count is
low, and 70% of the sperm are abnormal.
Other common alleles result in lowered
resistance to disease. Infections that
are seldom life-threatening to other cat
species can be lethal in cheetahs. There FIGURE 9.17 Cheetahs survived a severe bottleneck that
are only around 10 000 cheetahs left in increased the frequency of some unfavourable alleles.
the world today.

A catastrophic decrease in population size can result in a loss of some alleles from the gene pool.
This is the bottleneck effect. Deleterious genes can be preserved by chance.
Northern elephant seals have reduced genetic variation, most likely due to being hunted. Hunting
reduced their population size to as few as 20 individuals at the end of the 19th century. Since then,
their population has rebounded to over 30 000, but their genes still carry the evidence of their
bottleneck. They have much less variation than a population of southern elephant seals that were not
hunted.
The founder effect

The founder effect is a particular example of genetic drift. A few individuals who move to a
new area and become isolated from a larger population might not carry all the alleles that were
present in the original population. This means that the isolated population has less genetic
9780170452922
diversity than the original population, and deleterious recessive alleles may have a higher chance
of coming together than they did in the original population. The founder effect happens when
there is a dramatic decrease in genetic diversity caused by the development of small colonies
of individuals, sourced from the original population, that remain isolated from other colonies.
Only a small subset of the genetic diversity of the source population is likely to be included in the
new population, and the relative frequencies of these alleles may be very different from what they
were before.
The founder effect is an extreme case of genetic drift in a small population that migrates away
from a large parent population, carrying with it an unrepresentative set of alleles.
This effect has been observed Descendants
in human populations when small
groups of particular religious or Sample of original population
ethnic backgrounds have settled
somewhere new and mixed very
Founding
little with other populations. Around
population A
200 people originally formed (a misrepresentative
proportion of alleles)
the Amish community of North
America, and at least one of them
harboured a recessive allele for
Ellis–van Creveld syndrome. This
syndrome, symptoms of which Founding
population B
include dwarfism, polydactyly (extra (a misrepresentative
proportion of alleles)
toes or fingers) and sometimes a
hole in the heart, has been common FIGURE 9.18 The founder effect reduces genetic diversity in a
among Amish people of this region new population due to the reduced number and diversity of the
ever since. founding individuals.
Key concept
Genetic drift is a mechanism of evolution in which allele frequencies of a population change
over generations due to chance. Genetic drift occurs in all populations, but its effects are
strongest in small populations. There is usually a loss of genetic variation over generations. The
founder effect and bottlenecks are extreme examples of genetic drift.
Question set 9.4

1 Define: 3 Distinguish between a gene and an allele.
a founder effect 4 Outline why variations have to be
b genetic drift. inheritable for them to be relevant to
2 Recall an example of a bottleneck effect. evolutionary change.
9.5 A MECHANISM FOR EVOLUTION: GENE FLOW

Gene flow is the transfer of alleles, and it results from the migration of individuals from one population to
another. This can be due to immigration (individuals joining a population) or emigration (individuals leaving
a population). Populations, in a biological sense, are defined by their reproductive and genetic isolation.
Few populations are completely isolated from others, and generally some migration takes place both into
and out of a population. Gene flow may occur if the migrants breed. For example, immigrants may add
new alleles to the gene pool and emigrants may completely remove some alleles or significantly change
9780170452922
their frequency. Many plants, for example, send their seeds far and wide, by wind or in the guts of animals;
these seeds may introduce alleles common in the source population to another population in which
they are rare. Gene flow is another mechanism for evolution, because the migration of individuals from
population to population results in changes in the allele frequencies in populations.
aa
AA
AA
AA
aa
aa
aa
aa AA
FIGURE 9.19 Gene flow is the transfer of alleles that results from the migration of individuals between
populations.
Humans are polymorphic for a range of blood groups, including the ABO blood group. Indigenous
Australians have some alleles that are present at frequencies different from those of other populations
in the world. They have largely been isolated for the last 50 000 years, except for some gene flow from
Asia and New Guinea in the northern regions of Australia. Most Indigenous Australians do not possess
the IB allele of the ABO blood group that results in either B or AB type blood. The IB allele occurs at
a frequency of up to 10% in European populations and up to 20% in Asian populations. The overall
frequency of the IB allele is increasing within the Indigenous Australian population due to the migration
of people from Asia and Europe into Australia and the genetic flow between these populations.
Key concept
Gene flow is a mechanism for evolution due to migration. When an individual leaves one
population and joins another population, it brings along its genetic information. When that
individual breeds, its alleles are added to the new population.
Question set 9.5

REMEMBERING
1 Outline the meaning of ‘gene flow’.
2 Differentiate between immigration and emigration.
UNDERSTANDING
3 Describe the mechanisms that can lead to changes in the gene pool of a population.
4 Outline how gene flow can affect allele frequency.
9780170452922
9.6 THE BIGGER PICTURE OF EVOLUTION

The idea of adaptive evolution through natural selection is one of the most important biological
concepts. Although Darwin and Wallace did not have a good understanding of the underlying causes
of inheritance, they did realise that variable traits must be inheritable. Subsequent understanding
of the inheritance of traits, initially through the work of Mendel, fitted perfectly with their theories
to produce a combined theory referred to as the modern synthesis. The modern synthesis of
evolutionary theory, sometimes referred to as neo-Darwinism, is one of the greatest refinements of a
major theory to occur in biology.
Tree of Life
The Tree of Life project is a collaborative effort of biologists from around the world. It provides up-to-
date information about biodiversity, the characteristics of different organisms and their evolutionary
history (phylogeny).
The Tree of Life
Investigate the
characteristics and
Micro-evolution evolution of various
organisms.
The significant outcome of natural selection pressure is a change in the frequencies of various
alleles within a population, a process called micro-evolution, which is change within a species.
Micro-evolution refers to any small-scale change in the gene pool of a population. Changes in
allele frequencies occur in a population over generations due to the mechanisms of mutation,
natural selection, selective breeding, genetic drift and gene flow. The idea of micro-evolution puts
the spotlight of evolutionary theory firmly on the genetic makeup of populations. We now see a
population as a large pool of alleles that can change over time for a variety of reasons. Regardless of
how this change is occurring, if the gene pool is changing over time, then evolution is occurring. This
means genotype and phenotype frequencies are changing slightly over generations.
Macro-evolution
Major evolutionary changes above the species level are sometimes referred to as macro-evolution.
Speciation and macro-evolutionary changes result from an accumulation of micro-evolutionary
changes over many generations and over a very long time. Small-scale changes occur over one
generation, but when there is a very long time scale (3.5 billion years of life on Earth), the micro-
evolutionary changes accumulate into large changes. Large changes in a gene pool can be significant
enough to lead to the production of a new species. This is known as speciation, as occurred in the
Galápagos’ finches over many generations and considerable time (see next section).
Macro-evolution includes the largest transformations in evolution. Examples are the changes that
led to the evolution of mammals and of angiosperms (flowering plants). Macro-evolutionary patterns
are generally what we see when we look at the large-scale history of life. Speciation is the link
between micro-evolution and macro-evolution. Macro-evolution is the result of a series of speciation
events.
Key concept
Micro-evolution is any change in the allele frequencies in a gene pool of a population over time.
It occurs within species. Speciation is the production of a new species. Macro-evolution is the
result of a series of speciation events.
9780170452922
Question set 9.6

1 Define: 3 Construct a table summarising the
a micro-evolution different processes that can contribute to
b macro-evolution. micro-evolution.
2 Describe the link between
micro-evolution and macro-evolution.
9.7 SPECIATION
Speciation: an A species is a group of organisms that can interbreed to produce viable, fertile offspring and cannot
illustrated introduction
Watch the video breed with individuals of another species to produce fertile offspring. This is the biological species
on speciation as an concept – a genetically isolated group with its own gene pool. The morphological species concept
introduction defines a species by its structural features. Individuals of the same species are morphologically similar.
Speciation is the formation of a new species. It is the process of one species splitting into two or
more species.
The Galápagos Islands lie 1000 km west of Ecuador (South America) in the Pacific Ocean. When
Darwin visited them in 1835, during his famous voyage on HMSBeagle, he realised that these islands
were geologically quite young. They were teeming with life, but the animals and plants on the islands
were of recent origin. Many of these appeared to be related to similar species on the South American
mainland, but were also clearly different from them. One of the most famous groups of animals on
the Galápagos Islands are the 15 or so species of giant tortoise, whose closest living relative, the
Chaco tortoise, is found in mainland Argentina. Darwin wondered how they had got to the islands,
and how they had changed into new species. He hypothesised that the tortoises on the islands
originally came from the mainland population, but had changed over time to become better suited to
the environment of the Galápagos.
a b
ojoR leirbaG/yrarbiL erutciP erutaN

atnaffeL ociR/emitsmaerD
FIGURE 9.20 a The famous Galápagos tortoises are similar to b the much smaller Chaco tortoise (Geochelone chilensis), found in
South America.
Scientists have hypothesised that there may be more than 8 million different species on Earth, but
this is difficult to estimate accurately, because only around 1.2 million species have been identified
and classified so far. Macro-evolution is a set of processes that attempts to explain how new species
have evolved in such large numbers.
There are three broad processes that work together towards macro-evolution.
1 Natural selection favours phenotypes that make the population better adapted to its environment.
Populations change over time as their gene pools accumulate small changes in response to
natural selection. This is micro-evolution.
9780170452922
2 Eventually a population accumulates so many changes that a new species can be identified. This
process can lead to speciation, the multiplication of species.
3 Sometimes a rapid series of speciation events leads to the development of a whole collection of new
species, or even genera, families, or higher classification groups. This is referred to as macro-evolution.
Sometimes, the only evidence that a species existed is in the fossil record. When dealing with
fossils only, the morphological species concept can be applied. This concept identifies different
species based on their physical and physiological characteristics, but when used on the fossil record
is limited to what can be observed. For example, red and grey kangaroos are two of Australia’s most
recognised marsupials. Kangaroos are quite well represented in the fossil record. Twenty-five mya,
the ancestors of modern kangaroos lived in rainforests and fed on fruit. Kangaroos of today are
connected to these distant ancestors through an unbroken line of descent.
Key concept
The biological species model defines a species as a reproductively isolated group of
organisms. Species can also be identified through consistent differences in morphological
and physiological traits, as well as genetic differences.
Kangaroo fossil? 9.1

A fossil recently discovered in north-western Queensland
NOITACILPPA
has shed light on the evolution of the kangaroo. Read New fossil discovery confirms
the weblink to find out more about this fossil and the evolution of kangaroo
information it provides for our understanding of kangaroo Study more about the evolution of the
evolution. kangaroo by reading this resource.
Mechanisms of speciation
Speciation occurs when a single population becomes two separate populations that are unable to
interbreed due to changes that produce physical, biological or behavioural barriers. This separation,
termed reproductive isolation, results in the gene pool of the original species being divided.
Selection pressures act on the separated populations to cause micro-evolution, which can begin to
change them in different ways. The accumulation of different phenotypes that match the different
environments following reproductive isolation is known as adaptive radiation. Over time the allele
frequencies of the separated populations may become so different that the individuals are no longer
able to interbreed even if they are reunited, and we come to regard them as two distinct species. This
is divergent evolution: one species has separated (diverged) into two separate species.
For example, small species such as frogs can cover long distances if enough time is available.
Thus, during a period of hundreds of thousands of years, frogs can ‘pond hop’ hundreds of kilometres,
which means that they can colonise new habitats and exploit new breeding sites. It seems that
Victorian frogs colonised Tasmania in this way during the succession of recent ice ages. They did not
evolve into new species until the subpopulations became isolated, in this case by the rising sea waters
of an interglacial period.
Reproductive isolating mechanisms

Isolating mechanisms separate two groups and prevent them from producing fertile, viable
offspring – that is, offspring that survive and can themselves reproduce. These mechanisms can
operate before reproduction has occurred or after reproduction. Genetic isolation (in which
populations become so genetically different that they can no longer interbreed) can occur before
or after physical isolation. In either case, once isolation has occurred, the two groups can acquire
different phenotypes, as natural selection works on the members of the two groups so they become
adapted to their new, different environments (Figure 9.22, page 312).
9780170452922
a b
enylC yesneD/devreser sthgir llA .epacsuA
//:sptth( 0.3 YB CC yebmoW nhoJ/ORISC

)/0.3/yb/sesnecil/gro.snommocevitaerc
FIGURE 9.21 Two Victorian frogs, a Geocrinia victoriana and b Pseudophryne semimarmorata, breed in the same
habitat at the same time, but are prevented from interbreeding by alternating their calls so it is easier for females
to distinguish them (a pre-reproductive isolating mechanism). If they do mate, their tadpoles do not develop (a
post-reproductive isolating mechanism).
Pre-reproductive isolating mechanisms (pre-zygotic)

Some isolating biological or ecological mechanisms prevent organisms from being able to interact to
reproduce. Pre-reproductive isolating mechanisms include the following:
• temporal (time) mechanisms: individuals breed during
different seasons of the year or times of the day
• behavioural mechanisms: individuals have different Daughter
species A
courtship patterns
• morphological mechanisms: individuals have different ecnatsid citeneG
reproductive structures, i.e. genitalia of different size, Isolating
0
shape or location, so that mating is physically impossible. mechanism
The effectiveness of a geographic barrier as an isolating Interbreeding

mechanism depends on the size and mobility of the population Daughter
individuals concerned. For example, small organisms may be species B
easily transported across ocean barriers by being carried by
other animals; parts of plants, such as seeds and stems, can Increasing
Time
float; small rodents can cling to floating vegetation carried
by tides; and winds may carry insects over bodies of water. FIGURE 9.22 An isolating mechanism can
Insects, in particular, can have very precise timing prevent two subgroups of a species from
systems that determine when mating occurs. Periodical breeding, until they are so genetically
cicadas have one of the longest insect life cycles known. diverse that they form two new species.
6111relevart/otohpkcotSi
FIGURE 9.23 Magicicada, a periodical cicada endemic to the northern United States
9780170452922
In North America there are several species of periodical cicadas (genus Magicicada), some that hatch
out every 17 years and others that hatch every 13 years. Research has suggested the unusually lengthy
life cycles may act to prevent different populations interbreeding and producing hybrid offspring.
Another example of a pre-reproductive isolating mechanism can be seen in frogs. The mating
calls of frogs may sound very similar to us, but to other frogs they sound vastly different. Frogs usually
reproduce only with members of their own species, so their call acts as a pre-reproductive isolating
mechanism. In many cases, frogs have undergone speciation because their mating calls ensure that
they mate only with frogs with the same call. If populations become isolated, and the call changes
slightly, that can be enough to reproductively isolate the populations (even if they are reconnected) and
prevent gene flow between them till they are genetically different enough not to be able to interbreed
successfully.
Post-reproductive isolating mechanisms (post-zygotic)

If a frog does accidentally mate with a frog from another species, they will not produce fertile, viable
offspring because the parents’ chromosomes cannot line up successfully during meiosis, and no
zygotes are formed.
Methods such as this are called post-reproductive isolating mechanisms. They do not prevent
mating from occurring but they do prevent young from being produced. These genetic post-
reproductive isolating mechanisms include the following:
• gamete mortality: the gametes do not survive
• zygote mortality: the zygote forms but does not survive
• hybrid sterility: adult offspring are formed but are infertile because they are unable to produce
viable gametes, usually because of having received a different number or type of chromosomes
from each species.
In general, hybrid sterility acts as a post-reproductive isolating mechanism in animals but not
in plants. Many plants can interbreed; for example, polyploidy (multiple sets of chromosomes) is
common in eucalypts. Species of coffee plants with 22, 44, 66 and 88 chromosomes are known; this
suggests there was an ancestral plant with a haploid number of 11 and a diploid number of 22.
The key to the formation of new species involves reproductive isolation, leading to a disruption of
the flow of genes, combined with selection pressures.
Allopatric speciation
In allopatric speciation (from the ancient Greek ‘allos’ = other and ‘patra’ = homeland), gene flow is
disrupted when populations become physically separated through geographical isolation. The populations
diverge. This may be because of different selection pressures acting on the two populations, or it may
be due to other random processes such as genetic drift (see page 305). The isolation may happen on
a very small scale, such as when a river or stream changes course and subdivides a population of small
animals that can’t cross it. On a somewhat larger scale, deserts may expand, cutting off populations that
cannot live under desert conditions. Allopatric speciation is the most common form of speciation. It is
distinguished from reproductive isolation mechanisms because it is not part of the species’ biology. The
divergence of populations into new species is known as divergent evolution.
Physical barriers that can separate a subpopulation from its original population species can
include:
• water, for terrestrial organisms
• land, for aquatic organisms
• mountains.
New physical barriers can arise due, among other things, to:
• continental drift
• rising sea levels
• climate change.
9780170452922
Islands are home to many examples of allopatric speciation. On the Galápagos Islands, Darwin
noticed a flightless cormorant. This species most likely originated from a small population of ancestral
flying species that reached the islands from the South American mainland. The two populations
would have been physically isolated by the 1000 km of ocean between the islands and the South
American mainland. There would have been no gene flow between the two populations. The islands
were totally free from predators. The reduced predation changed the selection pressures acting on
this cormorant population. There were still selection pressures for efficient movement underwater,
but there was less pressure for efficient flight. This led to a reduction in the size of the wings in the
cormorant population, to a morphology that was well suited to movement under water but which no
longer allowed flight.
The flightless cormorant (Phalacrocorax harrisi) of the Galápagos Islands diverged from flighted
cormorants on the mainland through allopatric speciation. P. harrisi is most closely related to
cormorants such as the neotropic cormorant (P. brasilianus), which is widespread throughout tropical
regions of South and North America (Figure 9.24). Phylogenetic studies have only recently identified
the mainland species (all flighted) to which the Galápagos cormorant is most closely related.
P. harrisi: on the
Galapagos Islands
Galápagos
Islands
South America
)mottob( refahcS niveK/segamI ytteG ;)pot( akceluzS anytsyrK/APLF

Ancestral flighted
cormorant on South
American mainlaind P. brasilianus : still on
South American mainlaind
FIGURE 9.24 Phalacrocorax harrisi and P. brasilianus demonstrate allopatric speciation.
The more recent arrival of feral dogs and cats to the islands has once again led to a change
in selection pressures on this animal. There have been dramatic reductions in the cormorant
population, which is not well adapted to the new predation pressures because it cannot fly.
It is now recognised as an endangered species.
Key concept
Most speciation seems to occur as a result of populations becoming physically separated
through geographical isolation, leading to disruption of the gene flow. This process is called
allopatric speciation.
9780170452922
TABLE 9.4 The process of allopatric speciation
STEPS VISUAL AID

1 Subpopulations A parent population of a single species is distributed over a
broad range, resulting in subpopulations.
A parent population divides into two or more
subpopulations.
2 Isolation by a physical barrier

A physical barrier such as a mountain range, river or
desert separates and isolates the subpopulations.
3 No gene flow
Due to the physical barrier, the two subpopulations
are genetically isolated. There is no migration
between the two subpopulations.
4 Different selection pressures

The different environments apply different
A physical barrier such as a higher sea level separates two populations
selection pressures. The two subpopulations evolve and prevents gene flow. Populations adapt to differing environments on
independently from each other. opposite sides of the barrier (natural selection). Genetic drift causes
different random changes in both subpopulations.
5 Natural selection
For each subpopulation, different advantageous
alleles are selected for the survival of the fittest,
resulting in different allele frequencies over
generations.
6 Genetic drift
Genetic drift occurs independently in the
subpopulations, causing different alleles to be
passed to offspring randomly.
7 Two different species

Small micro-evolutionary genetic differences
over generations accumulate to become large
Two new species. If the barrier is removed, the populations may recolonise
differences, until the two groups become two the intervening area and mingle, but do not interbreed.
different species, no longer able to interbreed to
produce viable, fertile offspring. They are then
reproductively isolated.
Range of overlap
FIGURE 9.25 The process of allopatric speciation
9780170452922
Sympatric speciation
Allopatric speciation seems to have been the main mechanism producing new species throughout
evolutionary history. But sometimes species diverge without any obvious physical or geographical
isolation. Sympatric speciation refers to the evolution of two or more new species from a single
population within the same place.
How can new species arise without physical separation? It might be that groups within a single
population feed on different things, or choose mates based on different characteristics. They may
also choose to mate at different times. Genetic separation may occur due to the various pre-zygotic
and post-zygotic processes introduced on pages 312 and 313, respectively. There are not as many
clear examples of this type of speciation, but a few are quite striking, as in the case of Magicicada
(Figure 9.23, page 312).
Question set 9.7

REMEMBERING 4 Explain ‘allopatric speciation’ and provide
1 Describe the different types of selection an example.
that can lead to speciation. 5 What factors can act as geographic
2 Describe the mechanisms that can lead to barriers?
the isolation of populations. UNDERSTANDING
3 Explain how isolation of populations can 6 What effects can isolating mechanisms
lead to micro-evolutionary changes. have on a population?
9.8 EXTINCTION OF SPECIES

The fossil record shows that nearly all the species that ever lived are now extinct. In most cases, they
represented the end of an evolutionary lineage and left no descendants. Although extinction occurs
quite regularly, there have been periods when the rate of extinction has been very high. These are
referred to as mass extinctions.
The most dramatic mass extinction event, often called the ‘Great Dying’ appears to have occurred
at the end of the Permian period 250 mya. This appears to have coincided with one of the most
extensive periods of volcanic activity Earth has ever seen. In fact, some scientists believe that this event
went close to wiping life out completely. One of the few survivors of this catastrophe, however, was the
ancestor of the dinosaurs, one of the most successful vertebrate groups ever to have evolved.
Australian bushfires push threatened species

towards extinction
Over 1 billion animals died during the 2019/2020 Australian bushfire season. During this devastating
season, bushfires burned with significantly higher intensity compared with previous seasons due to
high temperatures and drought. Endangered species, including the long-footed potoroo, Kangaroo
Island’s glossy black-cockatoo and Batemans Bay’s spring midge orchid were pushed towards
extinction. For some species, their entire distribution area was burned. In addition to the immediate
The Australian mortalities from the fire, there would be ongoing mortalities after the fire from starvation, lack of
Academy of Science shelter, and attacks from predators such as foxes and cats, which are attracted to fire-affected areas
press release to hunt. Large parts of Kangaroo Island are designated as conservation areas to protect animals such
Watch this video
to further your as sea lions, penguins, kangaroos, koalas, bees, Kangaroo Island dunnarts and various birds, including
understanding of the glossy black-cockatoos. Many members of these species were lost to the fire. The devastating wildfires
effects of the 2019/2020
bushfire season in undid decades of careful conservation work on Kangaroo Island and have threatened to wipe out
Australia some of the island’s unique fauna altogether.
9780170452922
An ecologist at the Australian National University, Professor Sarah Legge, argued that the driver of
so much land being burned at once with such intensity was climate change. The extended drought
and high temperatures experienced over much of Australia are unprecedented.
Animals able to escape fires survive, and those who can’t (particularly slow-moving, land-dwelling
animals) perish. This will impact on the evolution of species in Australia. Regeneration and evolution
by natural selection is slow; extinction can be fast. This
means biodiversity is lost.
The National Aeronautics and Space Administration
(NASA) estimated that thousands of koalas have died, possibly
tens of thousands, just on Kangaroo Island alone. Koala
populations that survive the fires are likely to be cut off from
one another, lowering their genetic diversity and threatening
their long-term survival. Sudden reductions in population
size can cause genetic bottlenecks that lead to inbreeding,
which can reduce reproductive fitness and make extinction
more probable. To help the surviving koala populations, many
yhpargotohP kcolloP nayR

volunteers will be needed for tree planting and to help with
emergency care and conservation work.
The Australian Academy of Science recommends that
in order to reduce the worst impacts of climate change, we
need ensure global warming does not exceed 1.5°C above
the long-term average. The underlying reasons for these FIGURE 9.26 This joey was rescued and
unprecedented bushfires need to be addressed to enable the treated for burns after the Stirling Ranges
long-term survival of koalas, and other animals and plants. bushfires of 2019/2020.
Key concept
Extinctions have occurred naturally over geologic time. The recent Australian bushfires devastated Animals killed in
populations of native animals, pushing many already endangered species closer to extinction. bushfires
Click on the video series
and watch ‘At least a
Preventing extinction by preserving genetic diversity billion animals killed in
bushfires’.
Populations with reduced diversity face increased risk of extinction, so conservation projects usually
focus on maintaining genetic diversity. When large-scale extinctions occur, not all species are lost.
Some seem to be more at risk than others. Rapid extinction events can lead to greater loss of large
organisms than of small ones. A large distribution area is generally a big advantage, because it may
allow some pockets of habitat to survive. Large population size can also be some protection, because
the population is likely to have a more diverse gene pool and thus a greater variety of alleles and
phenotype options as the pressures from natural selection change.
Question set 9.8

REMEMBERING
1 Define extinction.
2 Define mass extinction. When was the largest mass
extinction event on Earth?
smailliW eeraM asiL/segamI ytteG
UNDERSTANDING
3 Why do many scientists believe the 2019/2020 Australian
bushfires were the result of climate change?
4 Why does the Australian Academy of Science recommend
that an increase in global warming must be limited to FIGURE 9.27 A rescued koala injured in the 2019/2020
less than 1.5°C? bushfire on Kangaroo Island, South Australia
9780170452922
WA conservation, extinction and evolution

YCARETIL CIFITNEICS Over the past 100 years, more mammals have become extinct in Australia than anywhere else
in the world. In WA, since European colonisation:
• 12 mammal species have become extinct
• 7 mammal species have disappeared from the mainland, but remain on a few offshore
islands
• more than 30 mammal species have declined significantly or are threatened with extinction.
Western Shield is the flagship
wildlife recovery program of the
nretseW - snoitcarttA
dna noitavresnoC
Government of WA’s Department
,ytisrevidoiB fo
tnemtrapeD
of Biodiversity, Conservation and
ailartsuA
Attractions, and the Parks and
Wildlife Service. It was launched FIGURE 9.28 WA’s Western Shield recovery program
in 1996 and is now one of the
biggest wildlife conservation programs ever undertaken in Australia. The aim of the project is
to recover native animal populations in the wild, through control of foxes and feral cats, and by
reintroducing native animals to their former habitats.
Western Shield aims to return the balance of native animals in selected areas of WA’s
environment to levels comparable with pre-European colonisation. It has a particular focus on
threatened species.
Western Shield suggests viewing the 53-minute video ‘Before it’s too late: Australia’s Mini
Marsupials’. It tells of the impact of European colonists on the endemic species and on the
Indigenous peoples, and shows people being trained to become wildlife managers.
Australia’s mini The most famous species to have become extinct is the Tasmanian tiger. The video warns
marsupials
Learn about the impact that the woylie, numbat and honey possum are also close to extinction.
of European colonialists. Woylies are an example of a species unable to adapt to the drastic changes in their
environment. The most significant changes to their environment include the introduction
of species such as feral cats, and habitat loss due to land clearing and climate change. Woylie
populations have declined from 225 000 to around 10 000–20 000 in the last 15 years. They
once inhabited more than 60% of mainland Australia, ranging through WA, the Northern
Territory, South Australia, Victoria and New South Wales. Now, they can only be found in small
pockets in WA and on offshore islands in South Australia.
Murdoch University led a study on the genetic diversity loss of woylies, which was
published in 2015. They found, when compared with ancient DNA, that woylies had lost a
significant amount of genetic diversity, and recommended assisted migration (and thus
assisted gene flow) to increase their reproductive fitness.
Honey possums are the only marsupial in
the world that feeds solely on nectar and pollen.
A deadly plant disease known as phytophthora is
partly responsible for the decline in honey possum
numbers. Phytophthora kills the trees on which
the possum feeds.
yrarbiL erutciP erutaN/otohP kcotS ymalA
Honey possums play a significant pollinating

role in their ecosystem. In recent years, too-
frequent fires have clearly disrupted their
population growth and genetic diversity. Don
Bradshaw, a retired Professor of the University of
Western Australia, campaigned for the protection
and conservation of the honey possum and other FIGURE 9.29 Honey possums are threatened by
endangered species. habitat loss.
9780170452922
Honey possums are only found in south-western Australia. They have a very limited diet –
the sweet nectar from plants such as banksias and bottlebrushes. One adaption they have
developed is a long snout to reach the nectar, and newborn baby honey possums weigh only
about 5 mg.
The spread of the disease phytophthora, caused by Phytophthora cinnamomi (dieback),
throughout southern WA has severely impacted Banksia ilicifolia trees, which are the honey
possums’ primary food source, and the impact has been greater in burnt areas than in unburnt
areas. Professor Bradshaw conducted a study on honey possum recovery after two fires.
Analysis of catch-per-unit-effort and population density of honey possums over the whole 29-
year period of the study showed that numbers had not declined in the long-unburnt southern
area of the study site, despite the spread of dieback and loss of banksia trees. Recovery numbers
were less encouraging in the burnt areas. Given predictions of increasing fire frequencies
due to climate change and the increased use of prescribed burning to protect human life and
property, it is imperative that areas harbouring honey possums be protected from too-frequent
fire if this iconic species is to persist. It is close to extinction.
Department of Biodiversity, Conservation and Attractions - Western Australia
Questions
1 Name a new factor that entered the environment of the woylie with European colonisation.
2 Describe how feral cats and foxes have introduced additional natural selection within
populations of small and medium-sized mammals endemic to WA.
3 Honey possums are an endangered species. Why should we care that they are close to
extinction?
Too little, too late for the Leadbeater’s possum? CASE

STUDY
Professor David Lindenmayer is one of species is currently experiencing a genetic
Australia’s leading landscape ecologists bottleneck and is threatened with extinction.
and conservation biologists. Based at the Professor Lindenmayer has been studying the
Australian National University in Canberra, Leadbeater’s possum for more than 30 years,
his research specialises in areas such as in an attempt to develop an appropriate
forest ecology and management, and habitat conservation plan.
fragmentation. He is the leading expert on Population modelling analysis has
the Leadbeater’s possum. In an interview on predicted that Leadbeater’s possum
the ABC radio program PM in August 2013, populations of below 50 are unviable,
he described how his research suggests whereas a population greater than
future strategies for the conservation of the 200 could survive 100 years. He used
Leadbeater’s possum. metapopulation analysis to assess the
In the 1950s, the Leadbeater’s possum was effect of habitat patch size, connectivity
known only from a few specimens collected between patches, fire and logging on the
in the early 1900s. It was declared extinct, species’ survival. Sustainable populations
but a small population was rediscovered need patches of more than 50 hectares
in 1961. The isolated population grew of mountain ash forest that is older than
to 7500 individuals in the 1980s. Then, 120 years, with 6–12 tree hollows per
bushfire in 2009 nearly wiped out all of 3 hectares. As mountain ash trees take
their habitat and numbers. Down to less decades to regenerate after fire or logging,
than an estimated 1000 individuals, this a 10-year study trialled the provision of
9780170452922
nest boxes in Leadbeater habitat. Unfortunately, the artificial hollows were not used.
In addition, the research has shown that logging significantly degrades habitat for
Leadbeater’s possum and renders it unsuitable for 150 to 200 years. The science is now
30 years in the making and it’s very strong. The path forward is clear. If we don’t log
strategically, Leadbeater’s possum is going to go extinct.
Questions
1 Outline the main habitat features essential for the survival of the Leadbeater’s possum’s
remaining population.
2 Apply your understanding of selection pressures and describe those that are likely to be
acting on the Leadbeater’s possum.
3 Fossil evidence shows the historical distribution of the Leadbeater’s possum included
an area in New South Wales. Suggest how this species may have evolved and how its
distribution may have become so limited and fragmented.
orerreF luaP-naeJ/devreser sthgiR llA .epacsuA

senoJ-notyalC leahciM /sotohP xafriaF
FIGURE 9.31 Leadbeater’s possum (Gymnobelideus

leadbeateri) is a small possum currently restricted to
FIGURE 9.30 Professor David Lindenmayer in a the small remaining pockets of old-growth mountain
Victorian mountain ash forest. A possum hole is ash forests in the Central Highlands of Victoria. It is an
shown in the trunk of the tree (yellow arrow). endangered species.
9780170452922
Natural selection with brine shrimp 9.1
NOITAGITSEVNI
Background
Natural selection was proposed by Charles Darwin to explain how new species evolve. All types of
living things have small differences between the individuals in the species. If one of those differences
allows the individual to live longer, they will likely have more offspring. As that trait is passed on, the
population starts to look more like the successful individual. Over time, the species changes.
Aim
To explore how hatching viability of Artemia sp. is impacted by different saline level environments.
Time requirement
45 minutes
Materials
• Brine shrimp eggs (cysts)
• 4 Petri dishes
• 0.5%, 1.0% and 2.0% solutions of salt water
• 1 fine brush
• 4 microscope slides
• 4 strips of double-sided tape
• 1 stereo microscope
• 1 permanent marker
• Distilled water
• 1 graduated cylinder
• Light bank or source of light
Risks
Brine shrimp may cause an allergic reaction in some Ensure appropriate personal protective equipment is
people. used at all times and be mindful of any known allergies.
Procedure – Preparing eggs for hatching (day 1)

1 Using a permanent marker, label 4 Petri dishes: 0%, 0.5%, 1.0%, 2.0%.
2 Form your hypothesis (e.g. the cysts will have the greatest hatching viability in the solution,
because brine shrimp thrive in high saline environments).
3 Using a graduated cylinder, measure 30 mL of each saline solution and pour it into the
appropriately labelled Petri dish.
4 Collect 4 microscope slides. Measure and cut a 1.5 cm strip of double-sided tape and gently adhere
it to a microscope slide. Repeat this step for the remaining microscope slides.
5 Lightly touch the fine brush to the side of the container of brine shrimp eggs. Collect
approximately 20–30 eggs on the brush. Do not collect too many eggs as you will be required to
count each one.
6 To adhere the eggs to the double-sided tape, lightly press the brush onto the tape on the
microscope slide. Repeat this step for the remaining 3 microscope slides.
9780170452922
7 Using a microscope, count the number of eggs on the first slide. Copy Table 9.5 and use it to
record your information.
8 Once the eggs have been counted, place this slide into the 0% salt solution Petri dish. Place the
slide with the tape side facing up.
9 Count the eggs on each slide and place them in the respective salt solution. Record the egg count
in Table 9.5.
10 Place the Petri dishes under a light bank and allow them to rest at room temperature for 24 hours.
Procedure – Data collection (days 2 & 3)
11 Using a stereo microscope, examine the contents of each Petri dish.
12 By this stage, you should see some brine shrimp have hatched and are swimming in the salt
solution. Record this information in Table 9.5.
13 Calculate the hatching viability of each dish at 48 hours by dividing the number of shrimp
swimming by the initial number of eggs in the Petri dish. Repeat this process for all 4 Petri dishes
and record the results in Table 9.5. Copy Table 9.6, round up your calculations to the nearest
hundredth, and add your information to the class data in Table 9.6.
14 Calculate the mean. Round your answers to the nearest hundredth and add them to Table 9.6.
Results
TABLE 9.5 Group data for hatching viability of brine shrimp in varying levels of salinity
% NaCl 0 HOURS 24 HOURS 48 HOURS

NO. OF NO. OF NO. NO. NO. OF NO. NO. HATCHING
EGGS EGGS DEAD OR SWIMMING EGGS DEAD OR SWIMMING VIABILITY (%)
PARTIALLY PARTIALLY
HATCHED HATCHED
0%
0.5%
1%
2%
TABLE 9.6 Class data for hatching viability of brine shrimp in varying levels of salinity
GROUP SALINITY
2% 1% 0.5% 0%
1
2
3
4
5
6
7
8
Mean hatching viability
Draw a graph of your results, ensuring you include all labels and units.
9780170452922
Discussion
1 Describe two conditions that were controlled in this experiment.
2 Which Petri dish had the highest hatching viability? Which had the lowest? Suggest possible
reasons for these results.
3 Was your hypothesis correct? Why or why not?
4 Based on your individual and class data, is there enough evidence to conclude that environments
of different salinities affect the hatching viability of brine shrimp?
Taking it further
What other conditions may impact the hatching viability of brine shrimp? Design an experiment to
investigate another environmental factor that may impact hatching viability.
9780170452922
WS
CHAPTER 9 SUMMARY
Chapter 9
Activity sheet • The main mechanisms of evolution are • The founder effect is observed when a new
mutation, natural selection, genetic drift, population is established by a small number
and gene flow (through migration). of individuals, leading to a population with
• New alleles arise through mutations, which limited genetic diversity.
are a key source of variation within a • Gene flow is the movement of genes
population. between different populations.
• Natural selection acts on variation in the • A gradual change in the gene pool of a
phenotype of a population. This variation is population is called micro-evolution.
inheritable. • Speciation and macro-evolutionary changes
• The modern theory of evolution takes into result from an accumulation of micro-
account all that we now understand of how evolutionary changes over time.
our traits are inherited and is called the
• Migration is the movement of individuals
modern synthesis.
of a population into or out of a region.
• A population is a group of individuals Migration can result in gene flow.
of the same species that live in the same
• The formation of new species often involves
geographic area and interbreed, producing
reproductive isolation combined with
fertile offspring. The sum total of all alleles
selection pressures, leading to a disruption
present in a population is called the gene
of the flow of genes.
pool.
• The splitting of a single species into
• Selective breeding (artificial selection) is
multiple new species usually involves
the selection of animals and plants with
physical or geographical isolation. This is
desirable characteristics for breeding,
allopatric speciation.
resulting in changes in allele frequencies in
• Speciation always involves significant
gene pools over time.
changes in the gene pool.
• Sexual selection occurs when individuals
• Major climatic and geological changes have
with certain inherited characteristics are
led to the evolution of multiple new species
more successful than other individuals in
from a single group, a process referred to as
finding mates.
adaptive radiation.
• The bottleneck effect refers to genetic drift
that occurs when there is a significant • Severe changes in climate and other
reduction in population size, resulting in physical conditions have sometimes led to
the extinction of many species, an event
genetic diversity that is non-representative
of the original population’s allele referred to as a mass extinction.
proportions. This can lead to a decrease in • Populations with reduced genetic diversity
the gene pool of a species. face increased risk of extinction.
CHAPTER 9 GLOSSARY
Accumulation The process of alleles or with differing adaptations; it can be triggered
traits gradually becoming more common over by many factors, such as the emergence of
generations reproductive barriers within a population,
changes in the availability of resources, new
Adaptive evolution Changes in a population
of organisms that make that population better challenges or new opportunities; it is a type of
adapted to its environment over time divergent evolution
Adaptive radiation The process by which Allopatric speciation Speciation that occurs
a species rapidly diversifies into many taxa due to physical or geographic isolation
9780170452922
Artificial selection (selective breeding) The Hybrid offspring Offspring from parents of two
intentional breeding or reproduction by humans different species
of individuals with desirable traits, resulting in Inheritable Capable of being passed on to the
changes in allele frequencies in gene pools over next generation
time; the traits are beneficial to humans
Isolating mechanism A mechanism that
Biological fitness The capacity of an individual prevents organisms from mating or producing
to survive and produce viable, fertile offspring viable offspring
Biological species concept A definition
Macro-evolution The evolution of new groups
of species based on whether members can of organisms comprising many related species
interbreed to produce fertile offspring
through multiple speciation events; includes
Bottleneck effect A random reduction in adaptive radiations
the size of a population, which can lead to
Mass extinction Extinction of many species
a reduction in the gene pool because of the
over a relatively short (geological) period of time
misrepresented allele proportions; it can occur
when a catastrophic event or a period of adverse Micro-evolution Change in the gene pool below
conditions drastically reduces the size of a species level; any small-scale change in the gene
population pool of a population
Descent with modification Darwin’s Modern synthesis The theory of evolution

terminology for the way life today has incorporating our current understanding of how
descended and evolved from common ancestors traits are inherited
that were generally different from their modern Morphological species concept Definition of
descendants a species using measurable anatomical criteria
Divergent evolution A process whereby related and characteristics
species evolve new traits over time after living Mutation A permanent change in the DNA
in different habitats, becoming increasingly sequence of a gene; a source of new alleles
different from their common ancestor and from in a population’s gene pool; the process of
one another, giving rise to new species generating a mutation
Evolution The process of cumulative, gradual, Natural selection Occurs when selection
heritable change in a population of organisms pressures in the environment confer a selective
that occurs over many generations and a advantage on a specific phenotype that
relatively long time enhances its survival and reproduction. It is a
Founder effect A random reduction in a process in which individuals that have certain
population that occurs when a few individuals inherited traits are more likely to survive
become isolated from a larger population and and reproduce at higher rates than other
form a new population that does not carry all individuals because of those traits. It can cause
the alleles that were present in the original changes in a population’s allele frequencies
population (gene pool) and therefore is a mechanism for
evolution
Gene flow The transfer of alleles that results
from emigration, immigration and migration of Population A group of individuals of the
individuals between populations same species that live in the same area and
Gene pool A collection of all the alleles for interbreed, producing fertile offspring
all the genes in the reproducing members of Post-reproductive isolating mechanism A
a population at a given time; it is the genetic mechanism that prevents fertilisation occurring
reservoir from which a population can obtain its or an embryo developing into viable offspring if
traits fertilisation does occur
Genetic drift A change in the gene pool of Pre-reproductive isolating mechanism A
a population as a result of chance; it usually mechanism that prevents organisms from being
occurs more noticeably in small populations able to interact to reproduce
9780170452922
Reproductive isolation When a single of breeding and exchanging genes with one
population becomes two separate populations another and whose offspring are capable of
that are unable to interbreed due to physical, doing the same
biological or behavioural barriers Sympatric speciation Speciation that occurs
Selection pressure A factor that influences without physical or geographic isolation
the survival of an individual within a population Theory of evolution States that all organisms
Sexual dimorphism Different morphologies have developed from previous organisms and
(often in shape or size) between males and that all living things have a common ancestor in
females of a species some initial form of primitive life. It also states
Sexual selection A selection process that that all organisms are fundamentally similar
occurs between males or between females in a because their basic chemistry was inherited
population for an inherited trait that assists in from this very first organism.
copulation or the winning of a mate Variable trait A trait that varies in the
Speciation The evolution of one or more new population due to differences in alleles carried
species from an ancestral species. A population by different individuals
is considered a new species when it can no Variation The diversity of genetic and
longer interbreed with the ancestral species. phenotypic traits within and between
Species A group of similar organisms capable populations

Remembering
1 Define:
a gene pool
b allele frequency
c genetic drift.
2 Draw a diagram to illustrate the founder effect.
Understanding
3 Explain the term ‘bottleneck’ and what effect a bottleneck may have had on the human gene
pool.
4 Draw a diagram to summarise the ways natural selection has occurred among the peppered
moth of Great Britain, as described in this chapter.
5 Provide an example of how an understanding of changing gene pools is important in
understanding evolutionary change.
Applying
6 Apply the definition of micro-evolution to a discussion of whether modern humans are still
evolving.
7 Herbert Spencer used the phrase ‘survival of the fittest’ to describe Darwin’s concept of natural
selection. Outline the ways in which this term could be misleading.
8 In the 2019/2020 bushfire season, many areas of Australian bush were burnt, leaving fragments
of habitat. A group of greater gliders (Figure 9.32) were cut off from the main remnant of their
population due to lost habitat and they could no longer mate with them.
a Assuming there was a sufficient gene pool in the subpopulation for them to survive,
describe how this could lead to speciation.
b Would this be allopatric speciation? Explain.
9780170452922
Analysing
9 Construct a genetic drift diagram that illustrates
how a trait can become extinct over a few
generations.
10 Identify the key difference between Darwin’s
original conception of adaptive evolution through
natural selection and what is referred to as the
‘modern synthesis of the theory of evolution’.
11 Explain why processes such as genetic drift,
the founder effect and sexual selection are not
regarded as examples of adaptive evolution.
dtL ytP lanoitanretnI epacsuA/otohP kcotS ymalA

12 When a mutation occurs in a large population, it
has very little effect on the population as a whole.
Even so, mutations are vital to the process of
evolutionary change. Explain why.
13 Over the last 30 years, many new pre-human
fossils have been found, but scientists often find
it difficult to agree on whether or not they should
be classified as new species. Account for this
difficulty in terms of our current understanding of FIGURE 9.32 A greater glider
the species concept.
14 To establish the extent of relatedness between species, several techniques have proved to be
useful. One of these measures the difference between the DNA of various species. When the
DNA of the orangutan, gorilla, chimpanzee and humans were compared, it was found that less
than 1% of the total DNA of these species differed. A rapidly evolving region of the genome
was analysed. This region had less than 3.5% variation, as shown in Table 9.7.
TABLE 9.7 Percentage divergence of nucleotide sequences in a rapidly evolving section of nuclear DNA in four
primate species
COMPARED WITH DNA FROM …
HUMAN CHIMPANZEE GORILLA ORANGUTAN
HUMAN – 1.56 1.69 3.30

... MORF AND
CHIMPANZEE 1.56 – 1.82 3.42

GORILLA 1.69 1.82 – 3.39
ORANGUTAN 3.30 3.42 3.39 –
a From the DNA data comparison, which primate(s) seem to be most closely related to
humans?
b Of the non-human primates, which seem to be most closely related to one another from
this data?
c From the data, which pair of primates do you think shared the most recent common
ancestor?
d Based on the data, construct a possible phylogenetic tree.
Evaluating
15 The long-billed black-cockatoo (Calyptorhynchusbaudinii) is found in the south-west of WA.
It lives in the tall jarrah–karri forests and eats the seed capsules of eucalypts. Very similar
birds, known as short-billed black-cockatoos, live in the inner wheat belt around Geraldton and
9780170452922
generally avoid forests. They eat pine seeds as well as hakea and banksia seeds. Initially the
short-billed black-cockatoos were classified as a subspecies. Following further investigation,
over time, the subspecies was reclassified as Calyptorhynchus latirostris, a separate species. Bill
length is described as an adaptation to the different environments that the birds occupy.
a What is meant by the term adaptation?
b What is meant by the term subspecies?
c Using the concepts you have learned in this chapter, outline the steps that might have taken
place for the two subspecies to become two separate species.
Creating
16 Design a diagram that clearly summarises the various mechanisms leading to evolutionary
change. Your table or diagram should indicate which of these changes lead to populations
becoming better adapted to a change in their environment.

1 Select the correct statement. 4 Which of the following situations is most
A Natural selection can result in the likely to lead to allopatric speciation?
evolution of new species, but artificial A Members of a fruit fly population breed
selection cannot. on different species of trees.
B Artificial selection can result in the B Members of a spider population
evolution of new species, but natural are separated by a housing
selection cannot. development.
C Both natural and artificial selection can C Members of a fish population migrate to
result in the evolution of new species. a new area to breed.
D Neither natural nor artificial selection D Members of a plant population
can result in the evolution of new tolerate different quantities of heavy
species. metals.
[Q6 2019 SCSA] [Q9 2018 SCSA]
2 Genetic differences between populations are

5 The males of some species of beetle
reduced by:
have much larger horns than the females.
A gene flow
These horns decrease the chances of
B mutation
the males surviving, but increase their
C sexual selection
chances of finding mates. The large horns
D genetic drift.
of the male beetles are likely to have
[Q26 2019 SCSA] evolved via:
3 A population of humpback whales was A natural selection, in which the
hunted almost to extinction before hunting males compete with one another
was stopped. Since then, the population has for mates
been increasing. The genetic diversity of the B natural selection, in which the
population will: females compete with one another
A not have been affected by the changes in for mates
population size C sexual selection, in which the
B not recover as quickly as the population males compete with one another
size for mates
C have returned to pre-hunting levels as D sexual selection, in which the
soon as the hunting stopped females compete with one another
D be decreasing as the population size for mates.
increases. [Q27 2018 SCSA]
9780170452922
6 The woolly mammoth was a large mammal

Recent rock 2 4
that became extinct approximately
Pleistocene rock
4000 years ago. Reduced genetic diversity (dates from
associated with a small population size 1 million years ago)
contributed to the extinction of this species. 1.6 m Modern horse (Equus) 3
The extinction was probably due to:

A artificial selection Late Miocene rock 2 4
B natural selection (dates from
C mutation
D genetic drift. 1.25 m Pliohippus
3
[Q3 2017 SCSA]
7 Dung beetles are a type of insect and feed Middle Miocene rock
(dates from
on animal faeces. A recent survey identified 15 million years ago) 4
2
over 500 species of dung beetle that are 3
1 m Merychippus
native to Australia.
a Define a species. (2 marks) 5
b Explain how new species of dung beetle Late Eocene rock
(dates from
could evolve by allopatric speciation. 35 million years ago)
4
(5 marks) 2
3
c Most species of dung beetle are 0.6 m Mesohippus
small and experience genetic drift.

Describe how genetic drift affects Early Eocene rock
the genetic composition of populations. (dates from
5
(3 marks) 2 4
3
d One species of dung beetle has males 0.4 m Hyracotherium
with larger horns than the females. The
larger horns make movement and eating Is the evolution of horse forefeet an example
more difficult. Explain how the larger of micro-evolution or macro-evolution?
horns in the males of this species could Explain your answer. (4 marks)
have evolved. (5 marks) [Q32e 2018 SCSA]
[Q31a–d 2019 SCSA] 9 Explain how speciation and

8 The following diagram shows the evolution macroevolutionary changes result from
of height and forefeet in modern horses an accumulation of micro-evolutionary
changes over time. (10 marks)
and their extinct ancestors over the past
50 million years. The digits (‘fingers’) of the [Q36b 2019 SCSA]
forefeet are labelled 2 to 5. 10 Describe how micro-evolution could result

in the development of salt tolerance in a
species of plant. (10 marks)
[Q37a 2019 SCSA]
11 Discuss how genetic drift and gene flow

change allele frequencies in the gene pool
of a population. (10 marks)
[Q36b 2018 SCSA]
12 Describe the process of allopatric

speciation. (10 marks)
[Q37a 2017 SCSA]
9780170452922
330
UNIT 4
SURVIVING IN
A CHANGING
ENVIRONMENT
ecrefiotsaebon/moc.kcotsrettuhS
9780170452922
331
10
HOMEOSTASIS AND CHAPTER 10 CONTENT
THERMOREGULATION By the end of this chapter, you will have covered the
following material.
STARTER QUESTIONS
1 Homeostasis is required in order to maintain certain
internal factors within a tolerance range. Can you
identify the parts of an animal’s body that can detect
changes in the internal and external environments?
2 Can you list factors inside a mammal’s body that
require maintenance within a set range for that
mammal to survive?
3 What processes occur inside your body to assist
in maintaining your body temperature at 37°C
when you move from an inside air-conditioned
temperature of 25°C to an outside temperature of
40°C?
» homeostasis is the process by which the body
maintains a relatively constant internal environment;
it involves a stimulus–response model in which
change in external or internal environmental
conditions is detected and appropriate responses
occur via negative feedback
» changes in an organism’s metabolic activity, in
addition to structural features and changes in
physiological processes and behaviour, enable the
organism to maintain its internal environment within
tolerance limits (temperature, nitrogenous waste,
water, salts, and gases)
» thermoregulatory mechanisms include structural
features, behavioural responses and physiological
mechanisms to control heat exchange and metabolic
activity; animals can be endothermic or ectothermic

» conduct investigations, including using models
of homeostasis and disease transmission, safely,
competently and methodically for valid and reliable
collection of data

9780170452922
10.1 HOMEOSTASIS
Homeostasis is defined as the processes involved in maintaining a constant internal environment,
within tolerance limits, despite changes in the internal and external environment. Homeostatic
regulation occurs in two stages. Stage one is the detection of a change from the stable state, known
as the stimulus (plural stimuli). Stage two is the response to the stimulus, which can be described as
counteracting the change. Therefore, to understand homeostatic regulation, a stimulus–response
model can be used. The purpose of homeostatic regulation is to maintain internal factors around a set
normal value. When the factors deviate away from the value, homeostatic adaptations will attempt to
bring the factor back to the normal value.
Living organisms carry out a series of chemical reactions in order to continue living. A linked
series of reactions is known as a biochemical pathway. The sum total of these chemical reactions
is called metabolism. The metabolic reactions are controlled by enzymes. Without enzymes, the
Homeostasis Part 1
Watch this video for chemical reactions would proceed too slowly to keep the organism alive. Enzymes are reusable,
an introduction to biological catalysts that lower the activation energy of chemical reactions, enabling them to proceed
homeostasis. faster. They are proteins that are sensitive to factors such as temperature and pH. Enzymes have
Homeostasis Part 2 certain tolerance limits within which they can avoid denaturation and function effectively. When an
Learn more about enzyme is denatured, it changes shape and becomes useless. Protein shape is influenced by salinity,
homeostasis.
pH, temperature and other environmental factors. Homeostatic processes maintain all those factors
within ranges favourable for the operation of enzymes.
Homeostatic regulation is required in all organisms in order to maintain the correct
environment for metabolic reactions. It is a necessity for survival. Just as there are a huge variety
of organisms in our world, there are huge variations in the level of homeostatic regulation
required by different organisms. Some organisms regulate many internal factors in widely varying
environments, while others do little more than contain their internal chemicals as well as they can
in fairly constant environments. Homeostasis (steady state) means the environment inside living
organisms stays the same, regardless of external environmental changes. Organisms have evolved to
be able to achieve this when the changes are not too extreme. When the changes are extreme, the
internal environment of an organism may be driven outside tolerance limits, causing illness or death.
For example, on a mountain top, the human body can produce extra red blood cells to keep the
level of oxygen in the body from getting too low, even though the level of oxygen outside is lower
than at sea level. However, at a certain point there’s just not enough oxygen outside and the body
cannot cope.
This chapter explores the stimulus–response model of homeostasis, negative feedback, and
the structural features, behavioural adaptations and physiological processes that help organisms
to maintain a relatively constant internal state – a state of homeostasis – and survive in their
environments.
Detecting the stimulus

Signals may come from the external environment, from other parts of the organism or from
within the cells. Stimuli may be physical (e.g. light, heat, pressure) or chemical (e.g. hormones,
neurotransmitters). There are millions of external and internal receptors that allow an organism
to respond to stimuli. The five main types of receptors are: chemoreceptors, mechanoreceptors,
photoreceptors, thermoreceptors and pain receptors.
Internal receptors receive signals from within the body about the internal environment.
Examples of internal signals are an increase in carbon dioxide concentration or low pH levels. The
interstitial fluid (the fluid that bathes the cells) and the blood plasma are the medium of the internal
environment. Cells exchange substances with the interstitial fluid across membranes (Figure 10.1).
9780170452922
CHAPTER 10 | Homeostasis and thermoregulation 333
Blood travels to
cells via arteries,
arterioles and
capillaries. Interoreceptors within
the cells detect high levels
of carbon dioxide in the
cytosol.
The blood travelling away via

the veins and venules carries
excess carbon dioxide, which
is removed from the blood
plasma at the alveoli.
Carbon dioxide is removed from the cells to the interstitial fluid.
FIGURE 10.1 The exchange of carbon dioxide between blood plasma and interstitial fluid
The external receptors of organisms detect changes in their external environment, interpret
these signals and coordinate a response for survival or development. External receptors can work as
individual receptors or together as a group. They can be distributed evenly over the body (e.g. pain
receptors), located in specialised areas (e.g. taste buds) or concentrated in organs (e.g. the eye).
TABLE 10.1 Some examples of receptors
TYPE OF RECEPTOR STIMULI LOCATION IN ANIMALS

Chemoreceptor (Internal receptor) Aorta, carotid arteries
Detects oxygen and ion levels
Osmoreceptor (Internal receptor) Hypothalamus
Detects changes in osmotic
pressure in blood (changes in solute
concentration in the blood)
Photoreceptor (External receptor) Eyes; light-sensitive cells on the body
Detects light surface of some invertebrates
Thermoreceptor (External receptor) Skin
Detects external temperature
variations
(Internal receptor) Hypothalamus
Detects internal temperature
variations
Homeostasis has its limitations CASE

STUDY
In 1988, Mark Dorrity went on an 8 km run where it could not flow freely in some parts
in extreme heat in New South Wales. During of the body. Every organ in his body was
the run, his body overheated to 42.8°C and he affected, he became delirious, brain damage
neglected to drink water to stay hydrated. As occurred, his lungs barely functioned and his
a result, Mark’s body could not regulate his heart stopped. Within an hour, he collapsed
temperature and water balance. His muscles into a 3-month coma, during which he was
generated more heat than could be lost from on dialysis and had one leg amputated due to
his body, and Mark suffered a rare condition gangrene.
known as rhabdomyolysis. His thigh muscles Under normal conditions, Mark’s body
liquefied and released toxic proteins into his systems would have worked together to
blood, causing kidney failure. Dehydration enable him to function comfortably, but
resulted in thickening of the blood to a point in the extreme environmental conditions
9780170452922
his body’s ability to maintain heat balance responses to the heat. The conditions in his
became impaired. His judgement overrode the internal environment became intolerable. He
warning signs, and his coordinating systems is fortunate to have survived the experience.
were unable to regulate his physiological
Body overheated to
Brain damaged
42.8°C
Lungs damaged
Heart stopped beating, Kidney failure due to

then restarted at dying muscles releasing
a very high rate toxic proteins into
bloodstream
Leg amputated
at buttocks, due
to gangrene Buttocks and hamstring
muscles liquefied
All organs affected

Rhabdomyolysis
Thigh muscles (muscle fatigue)
overheated, liquefied brought on by heat
and ceased operating exhaustion and
dehydration
Blood thickened to
honey-like consistency
FIGURE 10.2 Extreme environmental conditions affect homeostasis with life-threatening consequences.
Coordinating a response
In complex animals, there are two systems (the nervous system and the endocrine system) that are
responsible for monitoring changes, transmitting messages and coordinating responses. The nervous
system is fast acting and the endocrine system is relatively slow acting.
The nervous system

The nervous system comprises the central nervous system (CNS) and the peripheral nervous system
(PNS). The brain and the spinal cord form the CNS. These two structures receive sensory information
from receptors, interpret and process the sensory information, and if a response is needed they
coordinate the response. Sensory and motor neurons make up the PNS, which is responsible for
transmitting information to and from the CNS.
Nerve impulses travel along defined pathways. They follow the sensory neurons from the
source of stimulation, via the PNS to the CNS. Interconnecting neurons located in the CNS relay the
electrical impulses from the sensory neurons to the appropriate motor neurons. From the CNS, motor
neurons relay signals via the PNS to the effectors along different pathways. Effectors are the muscles
or glands that respond to the stimuli.
Neurons are the basic units of the nervous system. Their structure is directly related to their
function. They have extensions called fibres, along which nerve impulses travel. A bundle of nerve
fibres comprises a nerve, and each nerve is wrapped in a tube of connective tissue.
Nerve fibres contain a tubular extension of the cell body, called an axon. The axon is enclosed
in fatty material, functioning as insulation, called the myelin sheath. The myelin sheath is essential
for proper nervous system function as it assists in the transmission of electrical impulses, speeding
up transmission along the length of the nerve and preventing the message from crossing over to
adjacent neurons.
9780170452922
a b Central nervous system
Cerebrum
Brain
Cerebellum
Thoracic nerves Spinal cord

Cervical nerves supplying
supplying trunk and arms
neck, shoulders
and arms
Sensory nerves Motor nerves
Lumbar
nerves
supplying Peripheral nervous system
legs and
lower back
Spinal
Sacral nerves cord
supplying legs
and genitals
Coccygeal nerves
supplying vestigial
tail
FIGURE 10.3 a Overview of the nervous system; b main divisions of the nervous system
Sensory neurons (in the PNS) transmit messages from the receptor organs to special regions of
the brain (in the CNS) via the spinal cord. When one of the regions of the brain receives a message
about a detected change, it coordinates any response necessary to counteract the change and
sends messages to the effector organs (via the motor neurons in the spinal cord and then the motor
neurons in the PNS).
Afferent and efferent are directional words. Messages sent in an afferent direction travel from the
receptor cells to the CNS along (afferent) sensory neurons. Messages sent in an efferent direction
travel from the CNS to the effector along (efferent) motor neurons.
9780170452922
Nerve endings in spinal cord
Dendrites
Nucleus Dendrites
Axon
Cell body
Cell body Cell body
The axon
of the
Axon interneuron
is branched.
Nerve
impulses Myelin
Myelin sheath
sheath
Nerve impulses
Motor Axon
end-plate terminals
Sense organ
(touch receptor) Muscle
fibre Interconnecting neuron
Sensory neuron Motor neuron (interneuron)
FIGURE 10.4 The generalised structure of sensory, motor and interconnecting neurons. All classes of neurons
can have a variety of shapes.
The endocrine system

Not all changes in an organism’s internal and external environment require an immediate response.
The hypothalamus and Some responses take time and are under the control of hormones produced by the endocrine system.
thermoregulation Hormones are chemical substances, such as proteins, steroids, fatty acids and amino acids.
View this tutorial and In vertebrates they are secreted by ductless glands directly into the bloodstream. They target and
animation to reinforce
your knowledge about activate particular cells and organs, causing a response (Table 10.2). Only the cells in the body that
the hypothalamus. have receptors for a particular hormone will respond to that hormone.
TABLE 10.2 Examples of vertebrate endocrine glands, the hormones they secrete, and their function
ENDOCRINE GLAND HORMONE SECRETED TARGET TISSUE/ORGAN FUNCTION RELATED TO

HOMEOSTASIS
Posterior pituitary Antidiuretic hormone Kidney Stimulates reabsorption of water
Thyroid Thyroxine Nearly all tissues Increases metabolic rate, and
as a result increases oxygen
consumption and production
of heat
A target tissue may be a long way from the gland that secretes the hormone (Figure 10.5). For
example, antidiuretic hormone (ADH) is secreted by the pituitary gland in the brain but exerts its
effects on the kidneys. It stimulates the reabsorption of water, helping maintain an appropriate water
balance in the body.
The coordination of activities associated with the endocrine system is largely carried out by
the pituitary gland. It is known as the master gland because it produces many hormones that affect
hormone production by other endocrine glands. However, just above the pituitary gland is the
hypothalamus, which controls the functioning of the pituitary gland in regard to water balance. The
hypothalamus detects and coordinates many homeostatic factors.
9780170452922
Hypothalamus Homeostasis: body

temperature
Watch this animation
Pituitary gland to learn about the
(produces antidiuretic hormone) function of the
hypothalamus in
temperature regulation.
Thyroid
(produces thyroxine) Parathyroid glands
FIGURE 10.5 Location of some of the endocrine organs in the human body
Hormones and hormone-like substances occur in other organisms and they are essential to the
regulation of a variety of activities. Female ring doves coo during courtship to stimulate the release
of the hormones that result in egg development. In plants, a light-sensitive hormone called auxin is
responsible for plant growth towards light (phototropism) to maximise their photosynthetic ability.
Key concept
Homeostasis involves a stimulus–response method for maintaining a constant internal
environment. The nervous system and the endocrine system are involved in detecting stimuli
and transmitting a response. Sensory neurons in the PNS carry a message to the CNS, and
motor neurons in the PNS transmit the message to effectors (i.e. muscles and glands). In
the endocrine system, the hypothalamus detects changes and coordinates the response of
hormones, many of which are produced by the pituitary gland.
Question set 10.1

REMEMBERING 5 Explain why it is important for an
1 Describe the difference between a organism to be able to detect changes
stimulus and a response. in its external environment. Give an
2 Draw and complete a table that example.
summarises the different kinds of neurons. 6 Clarify the difference between an internal
Use the headings: Type of neuron, Simple receptor and an external receptor. Name
labelled diagram, Function. an example of each.
3 Identify the systems of the body that are APPLYING
largely responsible for monitoring and 7 Explain why it is important for the
coordinating response mechanisms. hypothalamus to detect changes in
UNDERSTANDING temperature and osmotic pressure (water
4 Define homeostasis and outline its balance in the blood) in mammals.
purpose.
9780170452922
10.2 NEGATIVE FEEDBACK: THE MECHANISM FOR

MAINTAINING HOMEOSTASIS
The external environment can vary greatly in terms of temperature, water availability, nutrients,
oxygen and carbon dioxide. The fluctuations in these factors, and others, can cause internal factors
to deviate away from their optimal values. Organisms have narrow ranges within which they need
Homeostasis and
feedback mechanisms to keep their internal temperature and fluid concentrations. Complex organisms have strategies and
Watch these videos homeostatic mechanisms to keep internal conditions relatively stable. This enables the necessary
to reinforce your
understanding of biochemical processes to be maintained.
homeostasis and Signals from receptors are sent to a coordinating centre (modulator). The coordinating centre
compare negative and interprets the signals and coordinates a specific response. A response that leads to homeostasis is
positive feedback.
one that counteracts (gives negative feedback about) the stimulus. Less common are responses that
reinforce (give positive feedback about) the deviation from the optimal state. These processes are
referred to as feedback mechanisms. A feedback mechanism is triggered when a stimulus is detected
by a receptor. The information about the stimulus is then processed, and a message is conveyed to an
effector, which carries out a physiological response to the stimulus.
In analysing how cells and organisms respond to signals, it is useful to apply a stimulus–response
model. This model represents the feedback mechanisms. In animals, the main body organs that
respond to signals are glands or muscles. Since the receptor organs are different from the effector
organs, communication between cells to coordinate a response is essential.
Feedback mechanisms are physiological processes that respond to small disturbances to keep
internal conditions and concentrations of substances within narrow limits for optimal function.
Negative feedback
A homeostatic process that responds by changing the direction of a stimulus is a negative feedback
loop. The initial stimulus is deviation of a factor away from normal. A negative feedback loop will
always reduce the stimulus. Many animals are regulators and employ negative feedback loops to
maintain their internal environment. For example, a platypus will regulate its body temperature in the
water to counteract changes in the external environment.
For the platypus to maintain its body temperature, certain mechanisms need to be used to return
the body temperature to normal. Negative feedback is extremely important in homeostasis, because
the response always works to restore the internal environment to a constant set of conditions.
Negative feedback is a mechanism that stabilises internal conditions.
Negative feedback can be modelled using a flow diagram. To understand the flow diagram, the
following terminology is helpful.
TABLE 10.3 Parts of a negative feedback model and the roles they play
PART WHAT IT IS AND WHAT IT DOES

Stimulus A change in one of the internal or external environmental factors that is detected by a receptor. The
change involves a deviation away from the normal or optimal value.
Receptor The cell or tissue that detects the stimulus (change in the environment). The receptor may be internal
or external.
Coordinating centre (modulator, The structure that receives messages from receptors (via sensory neurons), coordinates a response,
usually the hypothalamus) then sends an instruction to an effector via motor neurons.
Effector A muscle or gland that receives the message from the control centre and carries out the response.
Response The action of the effector that counteracts the stimulus (i.e. the change made by the effector).
Negative feedback A message that counteracts the stimulus; it returns the value back to its normal or optimal value.
9780170452922
Homeostasis and feedback

Figure 10.6 provides a generalised overview of homeostasis and feedback mechanisms. The model is Homeostasis
represented as a cycle, but in reality, the mechanism is only cyclic if a stimulus continuously occurs Reinforce your
after negative feedback.
knowledge about
homeostasis by
watching this video.
STIMULUS
Deviation from
optimal or normal
value
NEGATIVE RECEPTOR
FEEDBACK Cells or tissue that
The factor returns detect(s) the stimulus and
to optimal or normal send(s) a message to the
value coordinating centre
COORDINATING CENTRE
RESPONSE
(MODULATOR)
The action of the
Receives a message from the
effector that
receptor, coordinates a
counteracts the
response and sends a
stimulus
message to the effector
EFFECTOR
A muscle or gland that
receives a message
from the control centre
and carries out a
response
FIGURE 10.6 A generalised negative feedback loop
This negative feedback model (loop) is an example of a specific factor that can increase or
decrease in its deviation away from normal, but is regulated using negative feedback mechanisms.
Positive feedback
If a response reinforces the original stimulus, the mechanism is referred to as positive feedback.
This process increases the output of the system, further enhancing the deviation from the optimal
or normal value. Positive feedback is rare but necessary during some developmental processes. For
example, the development of frogs and toads is controlled by the hormone thyroxine. Just before
the tadpole changes (metamorphoses) into an adult frog, negative feedback is changed into positive
feedback. The concentration of thyroxine rises and it triggers metamorphosis. Other examples include
blood clotting (platelets releasing clotting factors, which cause more platelets to aggregate at the site
of injury) and lactation (the feeding child stimulating breast-milk production, which causes further
production that continues until the baby stops feeding).
In terms of homeostasis, positive feedback can be harmful. When human body temperature rises
during a fever, a new and higher set point for temperature can be established, and the person may
suffer from heatstroke. If the resetting of the set point continues upwards, cell function is impaired.
9780170452922
Effector: smooth muscle relaxes

causing blood vessels in skin to
dilate. Capillaries become filled
with warm blood. Heat transfers
and radiates from skin.
Body temperature
An increase in heat decreases; blood temperature
above normal activates decreases. The hypothalamus
heat-loss centre in the heat-loss centre shuts down.
hypothalamus.
Modulator coordinates
a response.
Blood warmer Effector: Sweat glands activated –

than set point perspiration helps cool the body by
in hypothalamus evaporative cooling.
Imb
ala
nce
Homeostasis = normal body temperature
(sti
mu
lus
)
Blood cooler than
set point in
Effector: smooth muscle contract, causing hypothalamus
Body temperature blood vessels in skin to contract. Blood in
increases; blood temperature capillaries diverted to deeper tissues.
rises. The hypothalamus Minimises heat loss from skin.
heat-promoting centre
shuts down.
A decrease in heat below

normal activates heat-
promoting centre in
hypothalamus. Modulator
Effector: Skeletal muscles
coordinates a response.
rapidly contract and relax when
more heat required. (Shivering begins.)
FIGURE 10.7 Negative feedback loop for an increase or decrease in body temperature in mammals
Key concept
Skin structure and Feedback mechanisms are triggered by a receptor detecting a stimulus. The information
function is processed by a modulator, and a message is transmitted to an effector to carry out the
Learn more about skin
structure and function
response. Feedback can be positive (reinforce the stimulus) or negative (reduce the stimulus).
Negative feedback is the main mechanism for maintaining homeostasis.
9780170452922
Question set 10.2

REMEMBERING 4 Clarify how positive and negative
1 Outline the stimulus–response model. feedback differ. Suggest why positive
2 Define: feedback is generally not associated with
a stimulus homeostasis.
b receptor APPLYING
c effector 5 Draw a stimulus–response model that
d response. demonstrates how temperature levels are
UNDERSTANDING maintained in the body.
3 Using an example, explain negative feedback.
10.3 TOLERANCE LIMITS

Each organism has set ranges within which they can tolerate the temperature, water balance and
different levels of organic and inorganic materials. These are known as tolerance ranges (Figure 10.8).
Organisms can survive change in a factor if it remains within their tolerance range. If a factor goes
outside of the tolerance range, it may be fatal for the organism.
Tolerance range
Zone of Zone of Optimal range Zone of Zone of

intolerance physiological physiological intolerance
stress stress
smsinagro fo rebmuN
Unavailable Marginal Preferred niche Marginal Unavailable

niche niche niche niche
Examples of abiotic factors

Too acidic pH Too alkaline
Too cold Temperature Too hot
FIGURE 10.8 The optimal range for an abiotic factor is the range within which an organism functions best.
Organisms can also function in the zone of physiological stress, but not in the zone of intolerance.
For example, dissolved oxygen in the ocean allows many aquatic animals to survive. Fish, crabs,
oysters and other aquatic animals need sufficient levels of dissolved oxygen in the water. The amount
of dissolved oxygen in an estuary’s water is the major factor that determines the type and abundance
of organisms that can live there. When levels of oxygen are within the tolerance range but outside the
optimal range this is known as the zone of physiological stress. Marine life such as crabs and fish can
survive in zones of physiological stress, but they will be lethargic because their respiration rate will
be lower. Oxygen levels below the tolerance range will not be high enough for a lot of marine life to
survive; this is the zone of intolerance. When air and water temperatures increase or there are high
9780170452922
levels of decomposition of algal blooms, this can lead to oxygen depletion. Many animals and plants
cannot survive when the dissolved oxygen falls to such low levels.
Homeostatic regulation seeks to maintain levels within the optimal ranges. The optimal range
is the set of values for a factor that enables an organism to function best, in its healthiest state, with
optimal growth and reproduction. The optimal range falls within the tolerance range. If oxygen levels
in an estuary are within the optimal range, fish, crabs and other marine life can potentially respire at
their maximum rates possible, leading to high metabolic, growth and reproductive rates.
Key concept
An organism’s tolerance range is the range of external environmental conditions within which
it can survive and maintain homeostasis. The tolerance range includes the optimal (preferred)
range and the zone of physiological stress (less preferred). Outside this range (in the zone of
intolerance) many animals and plants cannot survive.
Effects of moving outside tolerance limits

Any deviation outside the tolerance limits can affect the functioning of cells and the health of the
organism. There are many potential effects for cells and living organisms when major factors deviate
from the tolerance range.
If homeostasis fails and the level of pH, for example, becomes too high, an organism can fall
into a state of physiological stress, affecting its function. Internal factors that have a tolerance limit
include temperature, nitrogenous waste, water, salts, and gases. These factors need to be regulated
to stay within their tolerance ranges to enable cells to live, reproduce and function.
Temperature
A small increase in temperature can cause an increase in enzyme (protein) activity. This increases the
metabolic rate, because enzymes are biological catalysts. However, a significant increase (to 40–50°C
in mammals) can cause enzymes to denature, leading to critically slow cell metabolism. Cells can
Homeostasis: blood
sugar and temperature die. When human body temperature reaches 37.7–39.2°C, cognitive skills start to decline. The
Recall the effect of person experiences heat stress, heat exhaustion, and finally heat stroke (if temperature increases to
temperature on enzyme 39.2–39.6°C). At high temperatures, cell membranes become too fluid, allowing some unwanted
activity and therefore on
metabolic activity rate. substances into cells, or wanted substances out of cells. In plants, photosynthesis can slow down
significantly when enzymes denature. This affects plant growth and productivity.
A decrease in temperature below the optimal range can lead to a decrease in enzyme activity,
which results in a decrease in metabolic rate. The action of some other proteins may decrease as
well. For example, uptake of oxygen by the haemoglobin protein can be less effective, leaving animals
feeling sluggish. At low temperatures, cell membranes can become rigid (rather than fluid), slowing
the transport of substances across them.
When there is a decrease in temperature below the tolerance range, mammals can suffer
hypothermia and sometimes even lose limbs. Some animals may survive but cannot reproduce until
temperatures return to within their tolerance range.
Nitrogenous waste
Proteins and nucleic acids are required by organisms for survival. They both contain nitrogen. When
organisms break down proteins and nucleic acids, a highly toxic nitrogenous waste is formed, known
as ammonia. Most terrestrial animals convert this to urea, but urea still needs to be dissolved in water
and excreted because it is moderately toxic. (The nitrogenous waste that is least toxic is uric acid,
which requires very little water for its excretion but is made at an energy cost.) As nitrogenous wastes
increase in concentration, they become more toxic.
An increase in ammonia in the blood can lead to an increase in pH. Enzymes can only function
within a certain pH tolerance range, and they perform at their peak within an optimal pH range. When
9780170452922
the cellular pH is outside the optimal range, enzyme activity can decrease. When the cellular pH is
outside the tolerance range, the enzymes can denature, resulting in critically slow metabolism.
High levels of nitrogenous waste can also affect the water balance. Cells may lose water to dilute
the waste in an attempt to maintain pH homeostasis.
Water
Water is the universal solvent. It dissolves salts and minerals by breaking salts into ions. For example,
sodium chloride (NaCl) can be dissociated (dissolved and separated) into Na+ and Cl– ions. The ions are
then ready to partake in metabolic processes. Metabolic reactions occur in a solution composed mostly
of water. An increase in water content (and a decrease in ion concentration) leads to a decrease in the
collision rates of the reactants involved in the biochemical pathways, slowing metabolism. Too much
water results in an inability to regulate the concentration of solutes such as salts.
The movement of water across a semipermeable membrane from an area of high concentration
of water (low concentration of solute) to an area of low concentration of water (high concentration
of solute) is called osmosis. An increase in water content to above the tolerance range will lead to a
hypotonic (lower than normal solute concentration) solution surrounding the cells in the blood and
in the tissues. Water will then move into the cells down a concentration gradient in order to reach
equilibrium. If too much water enters the cells, animal cells can swell and burst (cell lysis), and plant
cells can swell. If cells swell, the resulting solute concentration can be too low, leading to a decrease
in collisions of reacting particles, slowing the rates of reactions. Thus, if the concentration inside cells
becomes too dilute, there are insufficient interactions between enzymes and substrates.
Too little water inside cells also results in an inability to regulate the concentration of solutes such as
salts. A hypertonic (higher than normal solute concentration) solution surrounding cells in the blood and
in the tissues may lead to water moving out of the cells by osmosis. This leads to dehydration. Cells can
shrink and plant cells can undergo plasmolysis. Plasmolysis is the term used when the cell membrane
of a plant cell has pulled away from the cell wall due to water moving out of the cell. In an environment
that has a water content below the tolerance range, ions are unable to move to their reaction sites at a
fast enough rate, slowing the metabolic rate. The cells are then unable to regulate the concentrations of
solutes (leading to an increase in osmotic pressure). Toxic waste cannot be excreted effectively, leading
to an increase in pH, which affects enzyme activity. In animals, blood plasma is 90% water. It transports
nutrients to cells and waste products away from cells. A decrease in water content can slow the rate of
transportation. When cells are surrounded by fluid of the same water concentration, the surrounding
solution is described as isotonic and there is no net movement of water.
Salts
Salts dissociate (dissolve and break apart) into ions. Ions such as sodium (Na+) and calcium (Ca+) are
required to be in concentrations within a fairly narrow range for normal activity of muscles, neurons
(nerve cells) and other body cells. If the salt concentration increases on the outside of cells, water
may be transported out of the cells by osmosis. This leads to cell shrinkage and dehydration. Salts are
needed at optimal levels in order to regulate water balance.
Calcium, for example, triggers muscles to contract. Low calcium levels in the blood can lead to
cramping in the legs and back. Low blood sodium levels affect water balance, blood pressure and the
nervous system. If the Na+ concentration drops too low outside cells, water moves into the cells, the
cells swell with too much water, and this can lead to weakness, fatigue and confusion.
Gases
Living cells need a continuous supply of oxygen in order to carry out respiration for energy production.
Carbon dioxide is a waste product of respiration. It readily dissolves in water, forming carbonic acid
–
(H2CO3), and then further dissociates to form hydrogen ions (H+) and bicarbonate ions (HCO3). High
levels of carbon dioxide can lead to a high concentration of H+ ions in solution, which lowers the
pH of the blood, making it more acidic. pH is a measure of how acidic or alkaline (basic) an aqueous
9780170452922
solution is. It is also a measure of the hydrogen ion concentration. Solutions with a pH of 7 are neutral.
If the pH is above 7 the solution is alkaline, and if the pH is below 7 the solution is acidic. In the case of
mammals, the blood pH lowers when the carbon dioxide level is high. The excess carbon dioxide needs
to be removed as quickly as possible, because this lowering of pH affects homeostasis and can reduce
enzyme activity rate or even denature enzymes. If the carbon dioxide level gets too low, it leads to a
lower ventilation (breathing) rate in animals and a lower rate of photosynthesis in plants.
It can also be toxic when oxygen increases above the tolerance range in animals. The gas can
diffuse straight into cells. A high level of oxygen can cause cell damage, nausea, dizziness and
breathing problems. If, on the other hand, the oxygen gets too low, this leads to a reduction in the
respiration rate and thus the rate of ATP (energy) production.
TABLE 10.4 Summary of potential effects on organisms when internal factors deviate away from their tolerance ranges
INTERNAL AN INCREASE A DECREASE VISUAL AID

FACTOR
Temperature 1 Enzymes (proteins) 1 Decrease in the
denature, leading to activity rate of
ytivitca emyzne gnisaercnI

critically slow cell enzymes, which
metabolism. results in a decrease
2 Cells can die. in metabolic rate.
3 Membranes such 2 The activity of some
Optimum
as cell membranes other proteins temperature
become too decreases.
fluid, allowing 3 Membranes such
0 10 20 30 40 50 60 70
some unwanted as cell membranes
Temperature (°C)
substances into or become rigid (instead
As temperature increases so does the rate of reaction.
wanted substances of fluid), slowing cell However, at high temperatures, some of the bonds that
out of cells. membrane transport hold the enzyme together break, changing the shape of the
active site so the enzyme becomes denatured.
4 Rate of of substances.
photosynthesis 4 Mammals can suffer FIGURE 10.9 Summary of potential effects of temperatures outside the
slows. hypothermia, may temperature tolerance range
lose limbs and cannot
reproduce.
Nitrogenous 1 As nitrogenous Not applicable Salivary
amylase
waste wastes build up,
they increase in Arginase
ytivitca emyznE
concentration and
Pepsin
become more toxic.
2 An increase in
ammonia (a base)
in the blood can
lead to an increase
1 2 3 4 5 6 7 8 9 10
in the pH of body
Acidic pH Basic
fluids.
Different enzymes work best at different pHs. If the
3 Enzyme activity can pH changes too far from this optimum, the bonds holding
decrease; enzymes the enzyme together weaken, changing the shape of the
active site so the enzyme becomes denatured.
will denature if the
pH gets too high. FIGURE 10.10 Summary of potential effects of pH outside the pH
4 High levels of tolerance range
nitrogenous waste
can affect water
balance. Cells may
lose water to dilute
the waste, affecting
water homeostasis.
9780170452922

FACTOR
Water 1 Too much 1 Too little water Plant cells
water results results in the inability Hypertonic Isotonic Hypotonic
in the inability to regulate salt
to regulate salt and other solute
and other solute concentrations.
concentrations. 2 A hypertonic solution H2O
H2O H2O H2O H2O
2 An increase in water can surround the
concentration leads cells, leading to
to a decrease in the movement of water
collision rates of out of the cells by
Plasmolysed Flaccid Turgid
reactants involved osmosis.
in biochemical 3 Dehydration – cells
pathways, slowing can shrink, and plant Red blood cells (animal cells)
metabolism. cells can undergo Hypertonic Isotonic Hypotonic
3 An increase in water plasmolysis.
above the tolerance 4 Ions are unable
range leads to a to move to their
hypotonic solution. reaction sites fast
Animal cells can enough; metabolic
swell and burst (cell rates slow down.
lysis); plant cells 5 Toxic waste cannot
can swell. be excreted
4 Solute effectively, leading
concentrations can to increased pH, H2O
H2O H2O H2O
be too low, leading which affects enzyme
to a decrease activity.
in collisions of 6 Blood plasma is 90% FIGURE 10.11 The effects of hypertonic, isotonic and hypotonic
reactant particles, water in animals. A solutions on plant cells and red blood cells (animal cells)
slowing the rate decrease in water
of reactions, as content can slow the
in the case of rate of transportation
excess water of nutrients and
concentration. wastes.
9780170452922

FACTOR
Salts 1 Salt ions such as 1 Low Ca+ levels can
Na and Ca are
+ +
lead to muscle
required within cramping in the legs
fairly narrow limits and back.
for normal activity 2 Low blood Na+ levels
of muscles, neurons affect water balance,
and other body blood pressure and
cells. the nervous system.
2 As salt 3 If the Na+
concentration concentration outside
increases, water cells is lower than
Resting potential
may be transported inside, water moves
Outside of cell
out of the cells by into cells. Cells can
osmosis. This leads swell with too much Na+ K+
to cell shrinkage water. Swollen red (high concentration) (low concentration)
and dehydration. blood cells can + + + + + + + + + +
3 High levels of lose their oxygen-

Na+ disenables carrying efficiency. – – – – – – – – – –
regulation of salt This can lead to + Na +

K
concentrations and weakness, fatigue and
(high concentration) (low concentration)
therefore water confusion. – – – – – – – – – –
balance.
4 Higher than normal
+ + + + + + + + + +
levels of potassium
(K ) can impair
+
Action potential
the function of Outside of cell
skeletal muscles, Na+
K+
the nervous system (low concentration) (high concentration)
and the heart. High
+ + + +– – – – + + + + + +
levels can cause
excitation of muscle
and nerve cells and – – – –+ + + + – – – – – –
+ +
cause muscle cells Na Na K+
to lose the ability to (low concentration) (high concentration) (high concentration)
relax. – – – –+ + + + – – – – – –
+ + + +– – – – + + + + + +
FIGURE 10.12 Salts are needed at optimal levels for the normal activity
of neurons.
What if you drink

saltwater?
How does drinking salt
water affect our cells?
9780170452922

FACTOR
Gases 1 High levels of CO2 1 A reduction in O2
can lead to a high leads to a reduction
concentration of in the respiration rate
H+ ions in solution, and the rate of ATP
which lowers pH. (energy) production.
2 Lowering of pH 2 Low CO2 leads to
affects homeostasis lowered ventilation
redimsoK kyrtaP/moc.kcotsrettuhS
and can reduce (breathing) rate in
enzyme activity animals and a lower
rate or denature photosynthesis rate in
enzymes. plants.
3 When the O2 level
increases above the
tolerance range in
animals, this can FIGURE 10.13 Low blood oxygen levels can cause French bulldogs to
be toxic. It can develop blue gums (due to their short nose and narrow nostrils).
cause cell damage,
nausea, dizziness
and breathing
problems.
Adaptations maintain an organism’s internal environment

within tolerance limits
Adaptations are features and strategies that help organisms survive in a particular environment,
including by maintaining their internal environment within tolerance limits. The three main types of
adaptations are physiological processes, structural features and behavioural adaptations. Physiological
adaptations are related to how an organism, system, organ, tissue or cell functions. Structural
adaptations are related to an organism’s shape, specialised features and size. Behavioural adaptations
relate to how the organism acts.
Metabolism is the sum of the chemical reactions that occur within an organism to maintain
life. The majority of these reactions require the catalytic help of enzymes. The various enzymes
function best at particular pH levels, solute concentrations and temperatures. Metabolic activity
is not only responsible for the breakdown or synthesis of molecules; it also creates internal body
heat. An increase in metabolic activity increases internal temperature as a result of the energy
released in the reactions, and a decrease in metabolic rate decreases the internal temperature.
However, there are other factors that alter temperature and pH levels. For example, concentration
of carbon dioxide in the internal environment can alter pH levels. If carbon dioxide concentrations
increase as a result of exercise, pH levels decrease. Decreasing the pH causes lower enzyme
functionality. In turn, metabolic activity is reduced, resulting in less heat energy being produced.
The body must maintain pH levels to ensure the supply of nutrients to cells is met and the internal
temperature remains constant.
Physiological processes
Physiological processes are the functional processes performed by organisms. Cells, tissues and
organs perform functions to help maintain homeostasis. Physiological processes maintain a balanced
internal environment through monitoring and adjusting as conditions change. The physiological
processes involve the three main parts of a negative feedback system – receptor, control centre and
effector.
9780170452922
As muscles contract and release more rapidly, the demand for oxygen and glucose increases.
These two reactants are substrates for cellular respiration and supply cells with energy. Carbon
dioxide is a by-product of this catabolic reaction, along with heat. As activity increases, the carbon
dioxide levels and internal temperature rise. Physiological mechanisms are in place to minimise these
changes. One way to reduce carbon dioxide concentration is by increasing the breathing rate. This
mechanism passes more blood through the lungs, releasing the carbon dioxide into the external
environment. The blood is also oxygenated faster, which maintains cellular respiration throughout the
activity.
The changed internal temperature is detected by thermoreceptors in the hypothalamus, which
signals to the sweat glands to become active, removing excess body heat.
Structure and behaviour

Structural features and behaviour also play a part in maintaining an organism’s internal environment
within tolerance limits. Structural features are physical features that usually have a function. They include
cell structure and the size and shape of an organism. Structural adaptations are special biological
structures that assist in homeostasis; for example, the thick insulating fur that keeps a bear warm; the
thin, flat leaves of a tree that maximise sunlight capture by chloroplasts; and the vast capillary network
over the alveoli that creates a large surface area for carbon dioxide and oxygen exchange to work
efficiently.
The behaviour of an organism can also help maintain its internal environment. Such behaviour is
usually an action performed in response to a stimulus. Burrowing in mud helps desert-dwelling frogs
avoid desiccating (drying out). The moist, delicate skin of a frog can dry out easily, preventing it from
achieving adequate gas exchange and leading to death. Much of WA is classified as desert, and to live
in those areas the water content of frogs must stay within their tolerance range. The desert spadefoot’s
behaviour of burrowing underground during the dry months prevents exposure to the sun while it waits
safely for rainfall. In humans, the removal of clothing or moving into the shade are behaviours seen when
an individual notices an increased body temperature. In addition, exercise pace will slow, slowing the
breathing rate and the removal of carbon dioxide. These actions change the metabolic rate and the heat
energy produced.
dtL ytP lanoitanretnI epacsuA/segamI ytteG
gnitnaL snarF tniM /kcotsotofegA
FIGURE 10.14 The desert spadefoot has moist, FIGURE 10.15 A desert spadefoot emerges from its
delicate skin but lives in the desert. burrow underground.
Key concept
Homeostatic adaptations that work to maintain tolerance limits can be physiological,
structural or behavioural.
9780170452922
Question set 10.3

1 Describe the effect of each of the 3 Differentiate between tolerance range and
following on cells when they rise above optimal range.
the optimal range: 4 Explain the difference between cellular
a temperature respiration and metabolic activity.
b concentration of nitrogenous wastes APPLYING
c oxygen
d water 5 Explain why metabolic rate can drop
e salt. significantly when temperatures become
2 What are the by-products of cellular significantly higher than the limit of the
respiration? tolerance range.
10.4 THERMOREGULATION
Thermoregulatory mechanisms also include structural features, behavioural responses and
physiological adaptations to control heat exchange and metabolic activity. Animals and plants must
control heat exchange and metabolic activity in order to survive. Life is found over a broad range of
temperatures in the biosphere of Earth, which can vary from –75°C to above 50°C. However, most
individual species can only survive within a relatively narrow range of temperature, and many cannot
exist in habitats that have greatly varying temperatures. Their structural, behavioural and physiological
adaptations help them to maintain their temperature within this narrow range. Within their tolerance
range, each species has an optimal temperature range at which it functions best. Thermoregulation is
critical for survival, because most biochemical and physiological processes are temperature sensitive.
For every 10°C increase in temperature, most enzyme-mediated reaction rates decrease by 50–65%.
Some mechanisms that plants use to control heat exchange and metabolic activity are listed in
Table 10.5.
TABLE 10.5 Features that help plants control heat exchange
COLD CLIMATES HOT CLIMATES
HbmG slanoisseforP egamI/otohP kcotS ymalA

esneciL tohsotohP/nolavA/otohP kcotS ymalA
FIGURE 10.16 The Australian snow gum (Eucalyptus pauciflora) FIGURE 10.17 The pink spike hakea (Hakea coriaceae)
Its thick, leathery, waxy leaves reduce heat loss by providing Its narrow, vertical leaves minimise the amount of direct sunlight
insulation against the cold climate. hitting them and thus minimise heat absorption during hot desert
days.
(The leaves also increase the hakea’s resistance to cold
temperatures and frosts, which deserts can experience at night.)
9780170452922
Different animals have different optimal internal temperatures. These are the temperatures at
which their enzymes work efficiently. In mammals, if internal temperatures rise much above the set
point, the enzymes denature, metabolic processes fail and the individual suffers from hyperthermia.
Conversely, if body temperatures fall, enzyme function slows significantly and the individual suffers
from hypothermia. Organisms use a variety of thermoregulatory processes to maintain homeostatic
internal body temperatures.
Types of thermoregulation in animals: ectothermy and

endothermy
Heat for thermoregulation can either come from metabolism or from the external environment.
Animals that use metabolic processes to generate their own heat to maintain their internal
temperature within the tolerance range are called endotherms. They have a range of adaptations
Ectotherms and
endotherms that serve as mechanisms for controlling heat gain or loss. Animals such as birds and mammals can
Watch this video to find generally maintain a stable internal temperature independent of external temperature fluctuations.
out about Australian In a cold environment, an endotherm generates enough heat to keep its body within its tolerance
endotherms and
ectotherms. range and at temperatures significantly higher than its surroundings. In a hot environment, such as
in the Australian desert during the day, endothermic vertebrates use special mechanisms to keep
cool. In addition to birds and mammals, there are some reptiles, fish and insects that are mainly
endothermic.
In contrast, amphibians, some reptiles and fish, and most invertebrates cannot maintain a
stable internal environment. An animal whose body temperature is determined by the external
environment is called an ectotherm. Ectotherms rely on external sources for gaining heat. To gain
heat, ectotherms may obtain heat from the sun or from objects in their surroundings. This means their
body temperature fluctuates with the external environment. Ectotherms have adaptations that help
in controlling heat gain or loss to regulate temperature, but these are structural or behavioural rather
than physiological.
Endotherms and ectotherms use a variety of adaptations to regulate internal temperature.
Some endothermic moths and beetles can raise their body temperature for short periods by
vigorous flapping of their wings, generating heat by muscular activity. These and many other
animals (such as mammals, birds and fast-swimming fish like yellowfin tuna) retain the heat
generated by metabolic activity within their
bodies. Further examples of endotherms
are kookaburras, penguins, emus, koalas,
wombats and humans. Ectothermic animals
include desert lizards, tropical marine
invertebrates (e.g. blood lobster, sea apple,
cleaner shrimp), the desert pupfish, snakes,
lizards, frogs, the majority of fish, and many
yzzE eoZ/moc.kcotsrettuhS
invertebrates (e.g. spiders, starfish, snails).

Scientists avoid using the terms ‘warm-
blooded’ and ‘cold-blooded’ because
they are misleading. For example, if an
ectothermic lizard is basking in the sun, its
body temperature may be ‘warmer’ than FIGURE 10.18 Crocodiles are ectothermic. Behaviours
an endothermic seal that is using faster such as mouth-gaping and moving in and out of the
metabolism to warm up. water help them thermoregulate.
9780170452922
TABLE 10.6 Comparing the costs and benefits of endothermic and ectothermic thermoregulation
ENDOTHERMS ECTOTHERMS
Cost To maintain a stable internal temperature, they Body temperature is dependent on the external
may have a higher metabolic rate. environment.
They need to spend more energy to maintain a These animals are limited to living in
higher metabolic rate. environments with less extreme temperatures.
This results in higher food requirements and They cannot tolerate very high or very low
more time spent finding food. external temperatures.
Benefit Body temperature is independent of external Their heat source is mainly the environment, so
temperature. there are lower energy requirements for these
This enables endotherms to live in more extreme animals.
environments. Therefore, they need to consume less food.
They can be active at night (when some They can spend less time hunting for food.
ectotherms are not) or more often during the day They can tolerate larger fluctuations in their
and in cold weather. internal body temperature compared with
Being more active may reduce the chance of endotherms.
predation.
Key concept
Animals can be described as endothermic or ectothermic. Endotherms are able to generate
their own heat to maintain their internal temperature. Ectotherms cannot maintain their own
internal temperature and rely on external sources for gaining and losing heat.
Question set 10.4

1 List three endotherms and three 4 Create a debate to argue whether
ectotherms. endotherms or ectotherms are better
2 Recall three main groups of equipped for survival.
thermoregulatory mechanisms.
UNDERSTANDING
3 Explain the differences between
endotherms and ectotherms, and name
examples of each.
10.5 ADAPTATIONS FOR THERMOREGULATION

Knowing animals have a tolerance range of temperatures within which they can survive is important.
A horse’s optimal range for temperature, for example, is 5°C to 25°C. They can survive outside
this, within the limits of their tolerance range. However, although they have several adaptations
for regulating their body temperature, including sweat glands, most horses do not cope with a lot
of exercise in temperatures hotter than about 25°C. To understand how organisms regulate their
temperature, it is necessary to understand how heat is transferred. Put simply, if an organism is too
hot, it must lose heat. If an organism is too cold, it must gain heat.
Heat transfer
Heat transfer depends on the temperature gradient between the internal and external environments.
When there is a balance between heat gain and heat loss, the organism is said to be in heat balance,
9780170452922
which is the purpose of thermoregulation. Organisms manage thermoregulation through the

interaction of their physiological, structural and behavioural mechanisms.
The mechanisms of heat loss and heat gain are the same: conduction, convection, evaporation
and radiation.
Conduction is the transfer of heat energy from a hotter object to a cooler object by direct
contact. Convection transfers heat when hot air or liquid rises and is replaced by cooler air or water.
Convection currents of air remove heat energy from the surface of an organism as they pass over it.
Evaporation (in relation to organisms) occurs when a liquid (water or sweat) turns to vapour, cooling
the skin. Heat is transferred from the surface of the skin to the water molecules as they evaporate.
As the vapour moves off the skin and into the surroundings, the vapour containing the transferred
energy carries the heat energy away from the organism. When heat is transferred from an object by
infrared waves, it is called radiation. Radiation is the emission of electromagnetic heat waves. Heat
radiates from the sun and from dry skin in the same manner. The adaptations, or mechanisms, for
heat release (when an organism’s internal temperature is elevated above the optimal range) or heat
conservation or generation (when an organism’s internal temperature falls below the optimal range)
help organisms regulate their internal body temperature. The four mechanisms of heat loss and heat
gain are illustrated in Figure 10.19.
a Sun b
Heat energy losses

Environment colder than body
Heat energy gains
Environment warmer than body
Convection Evaporation
of air
Sky
Radiation
36°C 36°C
Convection
(wind) Reflection
60°C 20°C
Conduction Conduction and
Conduction from ground to ground radiation to ground
FIGURE 10.19 Heat transfer for a lizard a during the day and b temperature loss at night
Thermoregulation in plants
It is not only animals that can regulate their body temperature. There are some plants that regulate
their body temperature. The lotus, Nelumbo nucifera, found in the Northern Territory, is able to
warm up and regulate its temperature. A bud starts heating up until it reaches approximately 32°C.
Its petals start to open, then its temperature will remain constant for 2–4 days, despite fluctuating
external temperatures. Just as would happen in a mammal, in the cool of night the plant increases its
metabolic heat production, and in the heat of the day evaporative cooling comes into play.
Key concept
Thermoregulation is essential for an organism’s survival. Heat energy can be lost or gained in
the following four ways: conduction, convection, evaporation and radiation.
Thermoregulation in hot environments

For animals living in hot environments, the problem is how to reduce heat gain and increase heat loss.
Heat is gained via solar radiation and reflection, ground radiation and conduction, wind currents, and
metabolic processes. Both endothermic and ectothermic animals have structural, behavioural and
physiological adaptations that allow them to survive in hot environments.
9780170452922
Structural features
Structural features such as dolphin flukes and elephant ears can help cool endotherms when needed.
Each half of a dolphin’s tail is known as a fluke. When the dolphin is hot, there is increased blood
circulation in the tail. The flukes contain many blood vessels just under the skin and so are said to be
highly vascularised. They are also very thin, so have a high surface-area-to-volume ratio. The heat
energy travels via the blood from the core
of the body to the tail, where it is released
to the cool water by conduction from the
blood vessels.
In lieu of sweat glands, elephants, Key adaptation –
the largest of Earth’s terrestrial animals, cooling ears
rely on other physical and behavioural Read about how
elephants have
adaptations to keep their massive bodies adaptations to keep cool
from overheating. When their surroundings
lekniwkcilb/otohP kcotS ymalA

are hot, elephants increase the blood supply
to their ears and flap them around to lose
body heat. The efficiency of this mechanism
is enhanced by the high surface-area-to-
volume ratio of their large flat ears. They can
achieve a high rate of heat transfer from the FIGURE 10.20 African elephants have large flat ears that
veins to the surroundings via radiation. can be flapped to cool them down (transfer heat out of
The red kangaroo has exposed areas of the body by radiation).
skin on its forelegs to increase evaporative
cooling of the blood from this area.
Ectotherms have some structural
features that can be used in hot weather. The
frilled-neck lizard skin colour can be adjusted
to keep its internal temperature within the
tolerance range. When desert temperatures
hsinroC ttaM /moc.kcotsrettuhS
rise, their colour becomes lighter, which
reflects the heat and keeps the lizard cooler.
In hot climates, fur can insulate animals
from radiant heat or hot air around them. For
example, the hair on the top of the camel’s
hump reflects heat. FIGURE 10.21 Frilled-neck lizard of northern Australia
Behavioural responses
To reduce heat gain, dingoes, birds and rock wallabies normally shelter from high temperatures
and reduce their activity, only emerging to feed in the relative cool of dusk and dawn. Avoiding
strong sunlight, such as by resting in the shade, reduces heat gain via radiation from the sun and via
conduction from hot objects such as rocks.
A number of species of wallabies and kangaroos lick their wrists where the blood vessels form a
dense network close to the surface. Even though this means loss of precious water, the evaporation
has a cooling effect. The water on the surface of the skin draws heat energy from the body for the
change of state from liquid water to vapour. The vapour diffuses into the surrounding air. This is called
evaporative cooling.
Other animals such as pigs and hippopotamuses roll in the mud to cool themselves down. As the
water in the mud evaporates from their skin, it carries away heat in the same way that sweat does in
humans.
9780170452922
a b
gniK nomiS/yrarbiL erutciP erutaN

c
orerreF luaP-naeJ/devreser sthgir llA .epacsuA
eiruoF sirhC/moc.kcotsrettuhS
FIGURE 10.22 The behaviour of a red kangaroos and b dingoes helps them thermoregulate in the heat of Australia.
c The burrow is a refuge for meerkats because it stays within a narrower temperature range than the air outside, and
it is suited to their tolerance range.
Crocodiles are ectotherms that shelter in cool vegetation lining river banks or submerge
themselves in the water. They also open their mouths, enabling evaporation from internal surfaces.
During cool seasons, they bask in the sunshine to get hot enough to digest their meals.
Echidnas are excellent diggers. Their backward-facing hind legs are unique physical features
that push the dirt out of the way. In the burrow, echidnas are protected from harsh weather
and can reduce heat gain from the sun’s radiation. The cool burrow also enables heat loss via
conduction.
Meerkats use burrows for thermoregulation. During the day, when the temperature becomes
too hot to continue foraging, they return to the burrow for the shade and cool that it offers. The
burrow also assists them at night, when outside temperatures fall below the optimal range, because
the temperature in the burrow does not drop as low as the temperature on the surface.
When the daytime heat gets to be too much, elephants enjoy submerging their bodies in water,
as well as showering, which entails sucking water in with their versatile, muscular trunks and then
spraying themselves. In addition to helping elephants rid their thick skin of parasites, bathing is
also an effective way for these enormous animals to reduce their body temperature. Heat from
their bodies is transferred to the cooler water via conduction. Thanks to their moisture-retaining
wrinkled skin, the cooling effect of a bath or shower continues even after the elephant has left the
water.
9780170452922
Physiological adaptations
Many endotherms, such as the red kangaroo, have a number of physiological adaptations for losing
heat. When the temperature in the surroundings increases, several physiological responses occur.
Nerve impulses stimulate the muscles of certain blood vessel walls to relax, causing the arterioles to
dilate (vasodilation). This means the blood vessels close to the surface of the skin widen, which allows
an increase in blood flow close to the skin’s surface, and heat to escape from the blood through the
skin via radiation and convection. Vasodilation is a mechanism for cooling the body and counteracts
any increase in internal body temperature above the optimal range. A negative feedback model can
be drawn to represent the mechanism at work (Figure 10.23).
STIMULUS
Increase in external
environmental
temperature above
optimal range
NEGATIVE RECEPTOR
FEEDBACK Thermoreceptor cells in the
Internal temperature returns skin detect the change in
to normal or optimal value. external temperature and
The mechanism counteracts send a message to the
the stimulus. control centre.
RESPONSE COORDINATING CENTRE

Vasodilation – extra (MODULATOR)
blood flow in the vessels The hypothalamus receives a
close to the surface of message from the receptor,
the skin – enables heat coordinates a response, and sends
loss via radiation. a message to the effector.
EFFECTOR
Smooth muscle cells
within the wall of the
blood vessels relax,
widening the arterioles.
FIGURE 10.23 Negative feedback loop for a physiological response to increased external environmental
temperature
Organisms also use sweating in the heat – their sweat glands open to release water and salt onto
the skin, which evaporates and cools the skin. The evaporated water carries away the heat energy
from the body and lowers the internal temperature. This is evaporative cooling. Horses and primates
(e.g. humans and monkeys) have large numbers of sweat glands. Other mammals such as kangaroos,
pigs, hippopotamuses, dogs and cats do not have many sweat glands and need to employ other
mechanisms for temperature control. Many animals, such as dogs, pant to keep cool. Panting expels
hot air and brings in cooler air, which then helps moisture in the mouth to evaporate quickly, reducing
body temperature.
Another response used by endotherms is a decrease in the metabolic rate, which reduces the
amount of heat generated within the body. Finally, the muscles attached to hair follicles can be relaxed
to flatten the hairs and decrease the layer of air acting as an insulator. This is known as pilorelaxation.
9780170452922
Solar radiation
Sweating
Radiation and
convection
Conduction
Internal
convection
Muscle
contraction
Metabolism
Breathing
Ground radiation
Solar reflection
FIGURE 10.24 Heat gains and losses in horses
CASE
STUDY
Bilby burrows – important for thermoregulation and hugely
important to the ecology of the surrounding habitat
One of Australia’s most iconic marsupials regions in WA, Queensland and the Northern
is the greater bilby (Macrotis lagotis). Its Territory.
Fun facts about bilbies
signature long ears and soft grey fur make Currently, the greater bilby’s conservation
Watch this footage of the bilby highly recognisable. The greater status is rated as vulnerable to extinction.
bilbies. Their burrows bilby once occupied around 80% of Australia’s Several conservation strategies have saved the
are vital for temperature terrestrial arid environment. After decades species from the same peril as the lesser bilby,
regulation.
of habitat loss and predation by introduced presumed extinct. However, Stuart Dawson,
species such as cats and foxes, bilbies are a bilby researcher at Murdoch University,
now only found in a small number of desert suggests conservation strategies need to
nosirroM geR/devreser sthgir llA .epacsuA
FIGURE 10.25 A bilby emerging from its burrow
9780170452922
be strengthened to match the important of other animals (mammals, birds and reptiles)
role that bilbies play in its ecosystem. The entering and exiting the burrows.
bilby’s deep, twisting type burrows serve as a The inference was made that the Bilby conservation
breeding program
thermoregulatory sanctuary for over 40 other animals were using the burrows to A successful
species, such as reptiles. When an animal is stay cool. Bilbies provide an important conservation program
absorbing too much heat, it can enter the ecosystem service, because their burrows is happening at
Currumbin Wildlife
burrow to avoid some of the heat gain that provide a facility for thermoregulation. If Sanctuary.
would occur outside. bilby population numbers decrease, the University of
Bilbies build their burrow-shelters to prediction is that there will be a negative Melbourne
reduce heat gain from the radiating sun and impact on other animal species that rely on See how scientists from
to increase heat loss by conduction directly to the cool burrows. Melbourne University
have teamed up with
the cool rock inside the burrow. Temperatures
in their outback habitat in WA regularly reach Questions Indigenous rangers
to protect the greater
40°C. Bilbies have other thermoregulatory 1 Describe the role of a bilby burrow in bilby.
mechanisms that act in conjunction with their thermoregulation.
burrowing, such as their ear structure. Bilbies 2 Describe the role of a bilby burrow in the
have long, thin, highly vascularised ears that ecology of a habitat.
help radiate excess heat. 3 Explain how the bilby’s ears can help its
Scientists have observed bilby burrows by thermoregulation.
using cameras with motion sensors. A study 4 Stuart Dawson would like more funding,
conducted in northern WA collected footage research and conservation for bilbies.
over a period of 3 years and recorded hundreds Construct an argument for his cause.
Thermoregulation in cold environments

For animals living in low-temperature environments, the problem is how to reduce heat loss and
increase heat conservation. Both endothermic and ectothermic animals have developed structural
features, behavioural responses and physiological adaptations to survive in cold environments.
Black polar bears 10.1

The fur of polar bears looks white, but it NOITACILPPA
is actually colourless; when photographed
with film sensitive to ultraviolet light,
polar bears appear black. Each strand of
hair has a hollow shaft that scatters and
afiargotoF ed uaN aL/moc.kcotsrettuhS
reflects visible light, much like ice and

snow does. The hollow shaft inspired
the hypothesis that the hair acts like an
optic fibre, conducting ultraviolet light to
the black skin beneath. Experimentation
proved this long-standing idea to be
wrong; it is now thought that the keratin FIGURE 10.26 A polar bear’s fur is a thermoregulator.
of the hair absorbs ultraviolet light and
that it does not reach the skin.
Structural features
The feathers of mutton-birds and the fur of polar bears aid thermoregulation by trapping an
insulating layer of air close to the skin. Insulation reduces the heat flow between an animal’s body
and its environment. Insulation is found on the surface, in thick fur and feathers, and beneath the
surface of the skin, in thick layers of fat (blubber) formed by adipose tissue. Most land mammals and
9780170452922
birds respond to a decrease in external temperature by raising their fur or feathers. This is called
piloerection, and the process is a physiological mechanism made possible by the structural feature
of the thick layer of fur. This traps a thick layer of air, which creates effective insulation, reducing
Homeostasis: blood
sugar and temperature heat loss to the cooler environment. A polar bear generates heat via metabolic processes to keep
Complete this its internal body temperature stable. Instead of losing this heat to the surroundings via radiation and
interactive to observe
the changes in conduction, it remains warm because it is so well insulated by its thick
Artery Vein
skin structure and fur that heat loss is practically nil. The emperor penguin is well insulated
function at different by several layers of scale-like feathers, and it takes a strong wind to
temperatures. 30°C 29°C
ruffle them. Although they don’t have feathers under their feet, emperor
penguins are able to stand on ice for long periods (Figure 10.27). For
details of an adaptation that allows this, see Figure 10.28. 25°C 24°C
20°C 19°C
15°C 14°C
10°C 9°C
GCV/sibroC/sivaD miT/segamI ytteG

FIGURE 10.28 A model of
FIGURE 10.27 Emperor penguins have physiological and behavioural adaptations to enable heat exchange in the foot of
them to survive in the freezing Antarctic temperatures. an emperor penguin
Variation throughout the year in fur thickness of animals such as French bulldogs and horses is
another adaptation that can assist with thermoregulation in challenging environmental conditions.
When temperatures cool, frilled-neck lizards turn darker. Dark colours increase heat absorption
from the sun via radiation.
Aquatic birds and mammals can be subjected to very cold environments. Heat loss via conduction
from the extremities to the aquatic environment is a problem. Fortunately, they have a very effective
system of keeping their extremities warm – countercurrent heat exchange. Countercurrent heat
exchange is the exchange of heat between two fluids flowing in opposite directions in vessels that are
in close proximity (located close enough for interaction). Heat in the blood travelling in the arteries to
the foot or fin warms the blood returning to the body in the adjacent veins. The outgoing blood to the
extremity is cooled in the process, but not enough to affect cellular activities. Since the temperature
gradient between the extremity and the surroundings is reduced, heat loss is minimised (Figure 10.28).
A temperature gradient is produced when two objects in close proximity have different temperatures.
The difference in heat energy between the two objects causes heat to travel in one direction, from the
hotter object to the cooler object. The countercurrent strategy traps heat in the body core, reducing
heat loss in the extremities. Extremities are limbs (arms or legs) that extend away from the core of the
body. They contain the outermost regions of an animal’s circulatory system and include the hands
and feet. They are relatively susceptible to heat loss due to their high surface-area-to-volume ratio.
To understand countercurrent heat exchange, it is necessary to apply your knowledge of the
circulatory system. Arteries carry warm blood away from the heart at the core of the body to the
extremities. Veins carry cooler blood back to the core from the extremities. Arteries and veins are
located adjacent to each other, close enough for heat to be transferred by conduction and radiation.
In addition, arteries and veins carry blood that flows in opposite directions, which means there is
always a high temperature gradient between them. The ‘counter’ flow of the blood leads to heat
9780170452922
being exchanged all the way along the length of the exchanger (adjacent artery and vein), increasing
the efficiency of the system to a higher rate than if the blood was flowing in the same direction. The
result is maximum heat transfer and minimum heat loss to the environment. This structural adaptation
can also be found in the flipper of a dolphin.
The shape and size of an organism can help to maintain homeostasis and internal temperature.
Large, round animals have a lower surface-area-to-volume ratio than small, thin animals. Adaptations
that reduce the surface-area-to-volume ratio reduce heat loss, because there is less surface area
per unit volume for heat to transfer through. For example, some bird species in Tasmania tend to
be larger than their counterparts on the warmer mainland. The larger size means less surface area
is exposed per unit volume, resulting in reduced heat transfer via convection or radiation to the air.
Having comparatively small extremities such as ears and legs can reduce the rate of heat loss. The
ears and limbs of Arctic foxes are more rounded and smaller than those of their relatives elsewhere
(Figure 10.29).
a b c
kaidruB rymydoloV/moc.kcotsrettuhS
refahcS niveK/yrarbiL erutciP erutaN

54enaLekiM/kcotsknihT
FIGURE 10.29 Ear shape and size differ between a the Arctic fox and its relatives, b the red fox and c the gray fox.
The Australian alpine grasshopper adult male will change the colour of its body surface to help
regulate its body temperature in different seasons. At temperatures above 25°C the colour is a bright,
greenish blue to reduce heat gain by radiation, and at temperatures below 15°C it is a dull, black
colour to increase heat gain from the sun’s radiation.
Behavioural responses
Animals can reduce heat loss by minimising the amount of surface area exposed to the surroundings.
For example, by huddling together, penguins reduce the group’s overall surface-area-to-volume
ratio. (They move around within the huddle to prevent any individual from being exposed to the harsh
environment for an extended period of time.) Animals can also maximise their heat gain through their Frogs and geckos
Investigate WA frogs’
behaviour. The freshwater crocodile will choose to bask in the sun when it is cold, to gain heat from and geckos’ behaviour
the sun via radiation. Additionally, if it is lying on a hot rock, heat will be absorbed by the body via and the adaptations
conduction from the rock. When the blue-tongue lizard basks in the sun on a hot rock, it will lie flat to they have developed
by watching this video
expose more of its body’s surface area to the sun and to the rock, maximising the rate of heat transfer on the WA museum
via radiation from the sun and conduction from the hot rock. website.
Physiological adaptations
Nerve impulses can stimulate the smooth muscle of blood vessel walls to contract, causing the
arterioles to constrict (vasoconstriction). This makes the blood vessels close to the surface of the
skin narrow (decrease in diameter), which results in a decrease in blood flow close to the skin’s
surface and reduces the amount of heat escaping from the blood through the skin via radiation and
convection. Vasoconstriction is a mechanism for reducing heat loss and it counteracts any decrease
in internal body temperature below the optimal range. A negative feedback model can be drawn to
represent the mechanism at work (Figure 10.30). Vasoconstriction reduces blood flow in peripheral
blood vessels, forcing blood towards the core and the vital organs found there, conserving heat.
9780170452922
STIMULUS
Decrease in external
environmental temperature
below optimal range
NEGATIVE RECEPTOR
FEEDBACK Thermoreceptor cells in the
Internal temperature returns skin detect the change in
to normal or optimal value. external temperature and
The mechanism counteracts send a message to the
the stimulus. coordinating centre.
COORDINATING CENTRE
RESPONSE (MODULATOR)
Vasoconstriction – reduced The hypothalamus receives a
blood flow in the vessels message from the receptor,
close to the surface of the coordinates a response and
skin – reduces heat loss via sends a message to the
radiation. effector.
EFFECTOR
Smooth muscle cells within
the walls of the blood vessels
contract, reducing the
diameter of the arterioles.
FIGURE 10.30 Negative feedback model for a physiological response to a decrease in external temperature
Metabolic heat production can be used to regulate body temperature. Many animals, especially
mammals, use metabolic waste heat as a heat source. When muscles are contracted, most of the
energy from the ATP used in muscle actions is wasted energy that translates into heat. Endotherms
can vary heat production to suit varying external temperatures.
Shivering is a reflex action activated in many mammals during extremely cold conditions. The
high rate of contraction and relaxation of muscles generates heat that can be used to regulate the
internal body temperature during the cold period.
Sometimes behaviours and physical features are inadequate for stabilising temperature. At a
particular external temperature set point, the metabolic rate of an animal begins to rise, increasing
heat output. The external temperature at which the metabolic rate begins to rise is the lower critical
temperature, which varies according to species (Figure 10.31). The increase in metabolic activity
requires a supply of energy, which for some animals proves difficult if food is scarce.
Upper critical
temperature
etar cilobateM
Lower critical
temperature
Basal
metabolic
rate
10 20 30 40
Environmental temperature (°C)
FIGURE 10.31 The effect of environmental temperature on the metabolic rate of a generalised mammal
9780170452922
In very cold conditions, the increase in metabolic rate may be insufficient to maintain body
temperature within tolerance limits. A major adaptation that enables animals to save energy, when
food is scarce and temperatures are very cold (or very hot), is torpor. Torpor is a physiological state of
decreased metabolic rate and physical activity.
Many Australian birds and small mammals exhibit a daily torpor. For example, some native bats
are active at night for feeding and go into a state of torpor during the day. Torpor reduces energy and
water costs for the animal. Another animal that exhibits torpor is the hummingbird, whose internal
body temperature can drop significantly during torpor, reducing energy expenditure on metabolic
heat production. Other animals in very cold conditions may hibernate, spending a longer period in
torpor. During hibernation, the metabolic rate falls to a level that just sustains life; the set point is
lowered considerably – an excellent mechanism for conserving energy (Figure 10.32). The upper
critical temperature is the external temperature at which the body’s cooling mechanisms fail.
120 Onset of hibernation Onset of arousal

Steady hibernation
)C°( erutarepmet ydoB

100 40
fo egatnecrep( etar cilobateM
Body temperature 30
)etar cilobatem lasab
80 20
10
60 0
40
Metabolic rate
20
7
0
0 6 12 18 0 6 12
Weeks
Hours Time Hours
FIGURE 10.32 Metabolic rate and body temperature of a ground squirrel before, during and after hibernation
Another kind of seasonal dormancy is aestivation (long-term torpor). This describes what some
animals do in very dry conditions, but not necessarily in summer. The garden snail retreats into its
shell and seals itself off; some earthworms coil into balls wrapped in mucus that dries out. Lungfish
burrow in mud that hardens, and there they remain until the next rainy season, some months later.
TABLE 10.7 Physiological responses to low and high temperatures
EFFECTOR RESPONSE TO LOW TEMPERATURES RESPONSE TO HIGH TEMPERATURES

Smooth Smooth muscles contract, causing vasoconstriction. Muscles relax, causing vasodilation.
muscles in Less blood is carried from the core to the skin surface. More blood is carried from the core to the skin surface.
arterioles in the The extremities can turn blue (in lighter skin colours), and The skin appears red and flushed and feels warm.
skin the skin feels cold. Heat is lost from the skin’s surface by convection and
Less warm blood to the skin surface helps to reduce heat radiation.
loss to the cool external environment.
Skeletal muscle A reflex action involving the rapid contraction and Sweat glands secrete sweat onto the skin’s surface, from
for shivering relaxation of skeletal muscles. which it evaporates. Heat is absorbed from the skin surface
Sweat glands This generates heat to increase the body temperature. for a change of state from liquid to gas as the sweat
for sweating evaporates (evaporative cooling).
Muscles Muscles attached to hair follicles contract, raising the hairs Muscles attached to the hair follicles relax, lowering
attached to hair and trapping an insulating layer of still, warm air next to the skin hairs and allowing air to circulate over the skin;
follicles the skin. This is not very effective in humans, just causing this encourages cooling by convection and evaporation
‘goosebumps’ (piloerection) (pilorelaxation).
9780170452922
Key concept
Animals and plants have developed adaptations in order to survive in different temperatures.
In hot temperatures, thermoregulatory adaptations aim to increase heat loss and reduce heat
gain. In cold environments, they aim to reduce heat loss and increase heat gain. The adaptions
involved can be behavioural, structural or physiological.
Which animals are best equipped for changes in their

YCARETIL CIFITNEICS
environment?
A large number of species currently face extinction. Scientists assert that climate change
is a major factor producing this trend. Climate change refers to a significant change in the
global climate, as observed in the average and variability of such features as temperature and
precipitation, which lasts for a long time, typically decades or longer. Increases in average
global temperature as a result of climate change are linked to sea level rises and increasingly
extreme weather conditions. These changes are impacting biotic and abiotic factors that enable
organisms to survive. Some species are predicted to be more at risk from these changes than
others.
Cockroaches are a group of
organisms that have an outstanding
track record for surviving extreme
conditions. They have already survived
TALUOJUOP ENITSIRHC-ENNA/segamI ytteG

mass extinction events. Their ability to
hold their breath, reproduce fast, eat
anything, burrow and tolerate pathogens
make them an outstanding competitor
The animals that will for the award of least-threatened species
survive climate change
Read this resource of climate change.
to explore concepts Mechanisms for homeostasis have
surrounding
homeostasis and climate
evolved as adaptations. Adaptations
change. can be structural, behavioural and FIGURE 10.33 Cockroaches have survived every mass
physiological. Just how much capacity extinction event in history thus far.
species have for adaptation is not known.

The effects of climate change and higher temperatures have been observed in our animals in
Australia. The effects include coral reef destruction, increased bushfire intensity, marine turtles
producing more female than male offspring, and yellow-footed rock wallabies facing starvation
from extended drought.
A small (5°C) temperature increase due to climate change would result in drought of such
a duration that animals like the rock wallaby would not do well. There would be less food, less
habitat, more competition and fewer rock wallabies.
Humans are also temperature sensitive. Slight variations from the optimal internal body
temperature of 37°C cause significant effects, as seen in Table 10.8.
9780170452922
TABLE 10.8 Responses to increased body temperature
BODY TEMPERATURE (°C) MEDICAL SYMPTOMS

37.7–38.2 Decrease in cognitive skills begins
Heat stress
Manual skilfulness decreases
38.2–39.2 Increase in judgement error
Decrease in tracking skills
Potential heat exhaustion
39.2–39.6 Functional limit of physical tasks is reached
Likely heat exhaustion
Potential heat stroke
>39.6 Probable heat stroke
Questions
1 From the data in Table 10.8, list some symptoms experienced by humans when internal
body temperature exceeds normal by 2°C.
2 Using your knowledge of enzymes explain some of the symptoms.
3 Name an animal that can survive extreme changes in environmental conditions.
4 Explain why your named animal has a higher chance of survival than the rock wallaby.
Question set 10.5

REMEMBERING
1 Draw a diagram of an Australian reptile and illustrate each of the following methods of
heat transfer used when the reptile is experiencing a cold day and employing behaviours
that help increase body temperature:
a conduction
b convection
c radiation.
2 Copy and complete Table 10.9 to compare a mammal’s physiological responses to hot and
cold temperatures.
TABLE 10.9 Simple stimulus–response mechanisms involved in thermoregulation
STIMULUS PHYSIOLOGICAL RESPONSE EFFECT

Increase in More heat lost through radiation
temperature Hairs flatten on skin, trapping less air
Decrease in Constriction of blood vessels on the skin
temperature Less heat loss through conduction
Shivering
3 Explain how heat balance is achieved.

UNDERSTANDING
4 What is vasodilation? Explain how it helps to maintain internal temperature.
5 Explain the difference between hibernation and torpor.
6 Explain how the shape of an organism can aid thermoregulation.
7 Explain how countercurrent heat exchange can help to maintain internal temperature.
CREATING
8 Construct a negative feedback model to demonstrate thermoregulation in mammals
experiencing cold weather through the mechanism of shivering.
9780170452922
CHAPTER 10 ACTIVITY
10.1 Water balance in animals
Aim
YTIVITCA
To study water regulation in Paramecium and humans

What to do
Read the following information and answer the set of questions.
A culture of Paramecium was placed on a thin layer of petroleum jelly on a microscope slide.
A coverslip was added and the cells were observed.
The anterior and posterior contractile vacuoles were located, and the time between
contractions of the Paramecium culture was noted. The Paramecium culture was exposed to differing
concentrations of sucrose from 0 to 50 mmol L- . The relationship between the time between
1contractions and the concentration of sucrose in the surrounding solution was displayed in a graph
(Figure 10.34).
snoitcartnoc neewteb emit egarevA
0 50
Sucrose concentration in surroundings (mmol L-1)
FIGURE 10.34 The relationship between the time between vacuole contractions and the concentration of sucrose
in the surrounding solution
Analysis of results
1 When a Paramecium lives in its normal freshwater environment, it is subjected to a continuous
influx of water. Explain why.
2 Describe what happens to the time between vacuole contractions as the concentration of the
surrounding sucrose solution increases.
3 How would the rate of water expulsion from Paramecium change as the osmotic pressure of the
surroundings increased (solutes became more concentrated)?
4 How could you tell when Paramecium was in an isotonic solution?
5 Using information from the experiment, explain how the contractile vacuoles in Paramecium
enable the cell to maintain a steady internal solute concentration.
6 Would this process of osmoregulation continue if the energy supply of the cell was cut off?
Explain.
9780170452922
• Homeostasis is the maintenance of a functions best; outside this range is the zone Chapter 10
relatively stable internal environment of physiological stress, within which it can Activity sheet
within a small tolerance range, despite survive. Outside that range, in the zone of
changes in the external environment. intolerance, it cannot survive.
• Multicellular organisms contain receptors • Adaptations allow organisms to maintain
that are highly specialised for receiving homeostasis within their tolerance limits.
signals from the external and internal They include physiological processes,
environments. structural adaptations and behavioural
• The nervous system provides a fast response functions.
to stimuli transmitted via sensory neurons • The main factors regulated within
in the PNS to the CNS and back via motor the tolerance limits are temperature,
neurons in the PNS to effectors (muscles nitrogenous waste, water, salts and gases.
and glands). • Thermoregulation is essential for
• The endocrine system provides a relatively preventing hyperthermia and hypothermia.
slower, long-lasting response involving the Vertebrates have physiological
release of hormones. It is mainly controlled mechanisms, structural features and
by the pituitary gland. behavioural strategies that aid the
• The nervous and endocrine systems react to regulation of core body temperature.
changes in stimuli and respond to them (the • Organisms can be classified as endotherms
stimulus–response model). or ectotherms.
• Negative feedback counteracts a change in • Heat energy can be transferred in four ways:
a stimulus to maintain internal pH, water conduction, convection, evaporation and
and solute concentrations within narrow radiation.
limits. • Mechanisms for thermoregulation in a hot
• Positive feedback reinforces a change in environment include sweating, vasodilation,
a stimulus and is seen in developmental panting, large round body shape, and
processes. Positive feedback can be harmful increased breathing rate for further
to homeostasis. evaporative cooling.
• Organisms must keep inorganic and organic • Mechanisms for thermoregulation in a cold
materials, pressure and temperature within environment include shivering, adjusting
narrow limits for survival. These limits are to a higher metabolic rate, vasoconstriction,
known as tolerance limits. Each organism countercurrent heat exchange, torpor and
has an optimal range within which it piloerection.
CHAPTER 10 GLOSSARY
Adaptation An evolved structural, Axon The extension from a neuron cell body
physiological or behavioural characteristic of an along which an electrical impulse can travel
organism that increases its chances of survival towards a target cell
and reproduction in a particular environment Behavioural adaptation An adaptation that relates
Aestivation Long-term torpor; dormancy that to how an organism acts in response to a stimulus
occurs in some animals during periods of Catabolic reaction A chemical (metabolic)
drought; reduced metabolic rate reaction whereby bonds in molecules are
Ammonia The direct product of the breakdown broken, releasing energy
of protein or nucleic acids; it is extremely toxic Chemoreceptor A sensory cell or organ that
and highly soluble in water detects chemical stimuli
9780170452922
Close proximity Located close enough for Evaporation The process in which liquid water
interaction changes to water vapour through heating
Conduction The transfer of heat energy from a Evaporative cooling A mechanism of heat
relatively hot object to a relatively cool object by transfer from an organism to its surroundings.
direct contact Water on the surface of the skin draws heat
Convection The transfer of heat by means of energy from the body for the change of state from
rising currents of warm air or water liquid water to vapour. The vapour diffuses into
the surrounding air, taking heat away from the
Coordinating centre (modulator) A tissue or
body and cooling the body down
organ that receives messages from receptors (via
sensory neurons) and coordinates a response, Extremities The ends of limbs (arms or legs)
then sends the information to an effector via that extend away from the core of the body;
motor neurons; usually the hypothalamus extremities contain the outermost points of an
animal’s circulatory system and can include feet
Countercurrent heat exchange The exchange
of heat between two fluids flowing in opposite and hands
directions in vessels that are in close proximity Feedback mechanism A mechanism in which
Ectotherm An animal whose body temperature the output or response affects the input or
is determined by the external environment. stimulus
Ectotherms rely on structures and behaviours Hibernate A period of dormancy over a long
for thermoregulation. Ectotherms may obtain period of cold conditions
heat from the sun or from objects in their
Homeostasis The processes involved in
surroundings, which means their body maintaining a constant internal environment,
temperature fluctuates with that of the external within tolerance limits, despite changes in the
environment internal and external environment
Effector A muscle or gland that receives a
Hyperthermia A state in which an organism’s
message from the control centre that a change
internal temperature rises above the upper
in a stimulus has occurred, then carries out a
tolerance limit
response
Hypertonic At a higher concentration than
Endocrine system The bodily system responsible
another solution. When a cell is surrounded by
for the production and secretion of hormones,
a hypertonic solution, water moves out of the
which are released into the bloodstream to act on
cell via osmosis to dilute the surroundings, so
specific target cells and organs
the cell shrinks
Endotherm An animal that uses metabolic
processes to generate its own heat to maintain Hypothalamus A small region of the brain that
plays a major role in detecting and coordinating
its internal temperature within the tolerance
the response to a change in e.g. temperature or
range. Endotherms also have a range of
water content in the blood
adaptations that serve as mechanisms for
controlling heat gain or loss. Within tolerance Hypothermia A state in which an organism’s
limits, animals such as birds and mammals internal temperature drops below the lower
can maintain a stable internal temperature tolerance limit
independent of external temperature Hypotonic At a lower concentration than
fluctuations another solution. When a cell is surrounded
Enzyme A reusable, biological catalyst that by a hypotonic solution, water moves into the
lowers the activation energy of chemical cell via osmosis to dilute the cell, so the cell
reactions, making them proceed faster; it is swells. (Animal cells, which have no cell wall,
a protein that is sensitive to factors such as sometimes burst.)
temperature and pH Insulation Any structure that reduces the
Estuary A transitional region in which fresh heat flow between an animal’s body and its
water from a river meets salt water from the sea environment, including thick fur or feathers,
9780170452922
and beneath the surface of the skin, thick layers Panting A method of cooling through
of fat (blubber) formed by adipose tissue evaporation of water from internal body surfaces
via exhalation
Interconnecting neuron Located in the central
nervous system, a nerve cell that transfers pH A measure of how acidic or alkaline (basic)
signals from sensory neurons to motor neurons an aqueous solution is. It is a measure of the
hydrogen ion concentration. Solutions with
Interstitial fluid The fluid that lies in the spaces
between cells; also known as tissue fluid a pH of 7 are neutral. If the pH is above 7, the
solution is alkaline; if the pH is below 7 the
Isotonic At the same concentration as another
solution is acidic.
solution. If a cell and its surrounding solution
are isotonic, there is no net movement of water Photoreceptor A sensory cell or organ that
between them and the cell maintains a constant detects light signals
volume Phototropism A plant’s hormonal response to
Mechanoreceptor A sensory cell or organ that light, whereby auxin accumulates on the darker
responds to mechanical stimuli side of the plant to stimulate cell elongation,
bending the plant towards the light to increase
Metabolism The sum of all the chemical
its ability to photosynthesise
reactions occurring within an organism to
maintain life; it includes reactions enabling Physiological process A functional process
an organism’s growth, homeostasis and that is performed by organisms to maintain
reproduction life
Motor neuron A nerve that transmits impulses Physiological stress Stress caused when an
from the central nervous system to an effector organism experiences conditions outside its
optimal range
Myelin sheath The fatty layer surrounding
and insulating the axons of many neurons; it Piloerection A physiological mechanism
increases the speed at which electrical impulses made possible by the structural feature of
travel along the nerve cell a layer of fur; the muscles attached to hair
follicles contract, so that the hairs stand
Negative feedback When a change in a
variable (stimulus) occurs, it is a response that up, trapping a layer of air that can provide
counteracts the change and returns the variable insulation, reducing heat loss to a cooler
back to its normal (optimal) value external environment
Nervous system The network of nerve cells and Pilorelaxation A physiological mechanism
fibres that transmits nerve impulses to provide involving muscles attached to hair follicles
communication between parts of the body relaxing to flatten hairs and decrease the layer
of air acting as an insulator. This enables more
Nitrogenous waste The nitrogen-containing
heat loss and cools the body
metabolic waste products of the breakdown of
proteins and nucleic acids. Initially, ammonia Pituitary gland Coordinates the endocrine
(which is highly toxic) is formed. Many animals system activities; it is the master endocrine
convert ammonia into a less toxic form – either gland because it produces hormones that affect
urea or uric acid the production of other hormones
Optimal range The narrower range, within Plasmolysis The state of a plant cell in which
an organism’s tolerance range for a particular the cell membrane has pulled away from the
factor, at which the organism functions best cell wall due to water moving out of the cell
Osmotic pressure The force of pressure that Positive feedback When a change in a variable
results when there is a difference in solute (stimulus) occurs, it is a response that amplifies
concentration across a membrane (further increases) the change
Pain receptor A sensory cell or organ that Radiation The transfer of heat from a hot object
detects pain signals by infrared waves
9780170452922
Receptor A cell or tissue that detects a Sweating A process in which sweat glands
stimulus (change in the environment); the open to release water and salt onto the skin; the
receptor may be internal or external sweat then evaporates and cools the skin
Response The action of the effector that Temperature gradient Produced when two
counteracts or amplifies the stimulus; the objects in close proximity have different
change made by the effector temperatures due to different amounts of heat
energy; this causes heat to travel from the hotter
Sensory neuron A nerve that transmits nerve
object to the colder object
impulses from a receptor towards the central
nervous system Thermoreceptor A sensory cell or organ that
detects heat or cold
Set point The optimal value for an internal
variable such as temperature or Ca 2+ Tolerance range The range of a factor within
concentration which an organism can function and reproduce;
if factors go outside of this range, it may be fatal
Shivering A reflex action activated in many for the organism
mammals during extreme cold conditions,
Torpor A physiological state of decreased
in which a high rate of contraction and
metabolic rate and physical activity
relaxation of muscles generates heat that
can be used to regulate the internal body Urea A nitrogenous waste formed from the
temperature breakdown of proteins and nucleic acids
(nitrogen-containing compounds); it is a less
Solvent A substance in which another
toxic form than ammonia, but the conversion
substance (known as a solute) dissolves
from ammonia to urea requires energy; it is
Stimulus (plural stimuli) A change in one of moderately soluble in water
the internal or external environmental factors;
Uric acid A nitrogenous waste formed from
it can be detected by a receptor and involves a the breakdown of proteins and nucleic acids
deviation from the normal or optimal value (nitrogen-containing compounds); it is the least
Stimulus–response model The two stages of toxic form, but the conversion from ammonia
homeostatic regulation. The stimulus (stage one) to uric acid requires a large amount of energy;
is the detection of a change from the stable state; it is in the form of a semi-solid paste and is
stage two is the response to the stimulus, which insoluble in water
can be described as counteracting the change Vasoconstriction A physiological mechanism
(negative feedback) or amplifying the change in which blood vessels contract to reduce blood
(positive feedback). A stimulus–response model flow and therefore heat loss from the surface of
can be used for homeostasis the body
Structural features Physical features that Vasodilation Dilation (widening) of blood
usually have a function; they include cellular vessels, particularly arterioles
structure and the size and shape of an organism
Zone of intolerance The zone that is outside the
Substrate A substance on which an organism tolerance range for survival
acts Zone of physiological stress The zone that
Surface-area-to-volume ratio The ratio of the is outside the optimal range, but inside the
surface area of a structure or organism to its tolerance range; it is not optimal, but within it
internal volume survival is possible
9780170452922

Remembering
1 Define homeostasis.
2 Using an example, explain the principle of positive feedback.
Understanding
3 Explain why some ectotherms bask in the sun.
4 When a cold reptile lies on a warm rock, it spreads its whole body out. Explain the purpose of
this behaviour.
5 Draw a table to summarise examples of the structural, physiological and behavioural
adaptations a mammal can use to regulate temperature.
6 Referring to Figure 10.29 (page 359), account for the differences shown in the size and shape of
the ears of different species of fox.
7 Kangaroos do not sweat when they rest. Instead, they breathe at a higher rate. Explain how
breathing may assist in lowering a kangaroo’s body temperature.
Applying
8 Homeostasis maintains the constant internal environment necessary for survival. One factor it
regulates is blood calcium concentration. Name another salt that is under homeostatic control
and explain why it must be regulated.
9 What strategies do animals employ if they are unable to meet their energy needs?
10 Name an animal that lives in conditions of either extreme cold or extreme heat. Draw a concept
map to summarise the structural, physiological and behavioural
adaptations it has available to regulate its temperature. Artery Vein
11 Explain the significance of receptors failing.
30°C 29°C
Analysing
12 Figure 10.35 shows a mechanism known as countercurrent heat 25°C 24°C
exchange. Copy and annotate the diagram to show the principles
of countercurrent heat exchange. 20°C 19°C
13 Figure 10.36 shows the relationship between the environmental
temperature and the metabolic rate of various animals. The basal 15°C 14°C
metabolic rate for each animal is given a value of 100%. Any
increase in metabolic rate is in relation to this value. 10°C 9°C
a At what external temperature does the metabolic rate of the

Eskimo dog pup begin to increase?
b At what external temperature does the metabolic rate of the
sloth begin to increase?
c The gradients of the lines of the graph indicate the rate of the
increase in metabolic rate. Which animal, the ground squirrel
or the polar bear cub, shows the greater rate of increase in
metabolic rate? FIGURE 10.35 Model
d Analyse the information in the figure and compare species of countercurrent heat
living in arctic conditions with species living in tropical exchange in the foot of an
conditions. emperor penguin
9780170452922
Arctic Tropical
400
M
m iN
ar
m
na thg
Lem
om aR
uH
ye noo tolS
Pola min W ea Co os
kn cc
Gro ati Juet
r be und g sel
h
300 ar p squ ng
up
etar cilobateM
)desidradnats(
irre le
l ra
t
200 Eskim
o dog
pup
White fo
x
Basal 100
metabolic
rate Observed Extrapolated
0
–60 –50 –40 –30 –20 –10 0 10 20 30 40
Lowest temperature on Earth Environmental temperature (°C) Human body temperature
FIGURE 10.36 The relationship between environmental temperature and metabolic rate
Evaluating
14 The removal of waste products from the interstitial fluid is essential in maintaining optimal
metabolic function. Explain this statement.
Creating
15 Design a new species of ectotherm suited to living in a hot environment. Describe its structural
and behavioural adaptations for thermoregulation.

1 Penguins have an inner layer of soft feathers 4 A terrestrial bird will lose most water by:
that trap air close to the body. This reduces A breathing
heat loss due to: B feeding
A conduction C sweating
B convection D urinating.
C evaporation [Q8 2018 SCSA]
D radiation. Question 5 relates to the information below.
[Q14 2019 SCSA]
A biologist measured the internal temperatures
2 Penguins also have a thick layer of fat. This
of six healthy grasshoppers from the same
reduces heat loss due to:
species in their natural environment. The
A conduction
measurements were 32.8, 37.8, 35.0, 37.0, 33.0
B convection
and 36.7 °C. The environmental temperature at
C evaporation
the time was 36°C.
D radiation.
5 The median body temperature of the
[Q15 2019 SCSA]
grasshoppers in °C was:
3 A behavioural adaptation that some animals A 35.0
use to regulate their body temperature in a B 35.4
hot environment is: C 35.9
A panting D 36.0.
B burrowing [Q11 2018 SCSA]
C vasodilation
D vasoconstriction.
[Q18 2019 SCSA]
9780170452922
6 A lizard lying on a rock that is warmer than 9 Rabbits have the ability to control the
the body of the lizard will: amount of blood flow to their ears. Explain
A lose heat to the rock by convection how this can help them to thermoregulate.
B lose heat to the rock by conduction (4 marks)
C gain heat from the rock by convection [Q35d 2017 SCSA]
D gain heat from the rock by conduction.
10 Compare the methods that endotherms and
[Q20 2018 SCSA]
ectotherms use to regulate their internal
7 a Outline the role of the effector in body temperature and discuss the costs
homeostasis. (2 marks) and benefits of endothermy to individuals.
b Outline the role of the receptor in (10 marks)
homeostasis. (2 marks) [Q38 2019 SCSA]
c State the defining feature of a negative 11 The Arctic fox (Figure 10.29a, page 359)
feedback loop. (1 mark) lives in the Arctic tundra, which is one of
[Q33a 2019 SCSA] the coldest environments on Earth. Discuss
8 A stimulus–response model consists of one structural feature and one physiological
several parts, which are represented by process that enables mammals living in
the boxes in the diagram below. The part cold environments to maintain a constant
represented by box (v) has been labelled. core body temperature. Identify clearly in
Complete the diagram by placing the correct your answer which is the structural feature
labels for the different parts of the model in and which is the physiological process. (10
boxes (i) to (iv). (4 marks) marks)
[Q31a 2018 SCSA]. [Q38a 2018 SCSA]
(i)
12 Describe in general terms how an organism
maintains its internal environment within
its tolerance limits. (10 marks)
[Q38 2017 SCSA]
(ii)
(iii)
(iv)
(v)
Response
FIGURE 10.37 Negative feedback model
9780170452922
372
11
REGULATION OF CHAPTER 11 CONTENT
WATER, SALTS following material.
AND GASES STARTER QUESTIONS

1 Can you explain the difference between urea and urine?
2 Why do some mammals have longer loops of Henle than
other mammals?
3 How does a cactus survive in the desert?
» the type of nitrogenous waste produced by different
vertebrate groups can be related to the availability of water in
the environment
» animals have a variety of behavioural, physiological and
structural adaptations to maintain water and salt balance in
terrestrial and aquatic environments
» to maintain water balance and allow for gas exchange,
xerophytes and halophytes have a variety of structural and
physiological adaptations
9780170452922
CHAPTER 11 | Regulation of water, salts and gases 373
11.1 WATER: ESSENTIAL TO LIFE

Water is the universal solvent and is essential to life. A solvent is a substance in which another
substance (known as a solute) dissolves. Most salts and minerals in organisms are dissolved and
broken into ions by water. Organisms therefore contain an aqueous solution of ions, such as sodium
and chlorine ions, ready for metabolic processes.
Metabolic reactions occur in a solution composed mainly of water. When the water content is
too high or too low, metabolic reactions slow down, because the reactants travel too slowly to their
reaction sites. Blood plasma, which transports metabolic products, is approximately 90% water. Blood
not only supplies nutrients to cells, but also transports waste products away from cells for removal
from the organism. Typically, the main waste products that require removal are carbon dioxide, via the
lungs, and nitrogenous compounds, via the kidneys.
Water balance requires continual homeostatic control, or osmoregulation. Osmoregulation is the
active regulation of the organism’s water content; that is, it maintains the fluid balance (water gain and
loss) and the concentration of electrolytes (ionic solutes, or salts in solution) and other solutes so the
fluids don’t become too diluted or too concentrated. If the supply of water does not replace what is
being lost, the relative concentrations of solutes and water in tissue fluids become difficult to regulate.
Physiological functions are then affected. A loss in blood volume results in a blood pressure drop,
toxic wastes not being excreted effectively and enzyme function being affected. Severe dehydration
can lead to death. In plants, loss of water can mean collapse of shoot systems and interference with
cellular functioning. Concentrations of water and solutes need to be kept within narrow tolerance
limits. In animals, ions such as sodium and calcium need to be maintained at concentrations that
permit the normal activity of muscles and neurons.
Water is constantly lost through evaporation (especially through evaporative cooling mechanisms
such as sweating, panting and rapid breathing) and urination. Water can be replaced by drinking
and eating; however, homeostatic mechanisms are also employed by many animals to regulate
their water content. Changes in the water level in the blood are detected by receptor cells in the
hypothalamus (called osmoreceptors). The hypothalamus is a small region of the brain that plays
a major role in detecting changes in the blood. In addition to detecting changes, the hypothalamus
acts as a coordinating centre (modulator), receiving information and coordinating a response. The
hypothalamus alters the kidney membrane permeability to adjust the concentration of the urine,
allowing wastes in the form of solutes to be excreted while conserving water.
A cell into which water has diffused so that the walls are stretched and the cell is fairly rigid
is described as turgid. Water can move into and out of cells and organisms via osmosis. Osmosis
is the passive diffusion of water across a membrane in response to a concentration gradient
(osmotic pressure) caused by an imbalance of molecules on either side of the membrane. The
concentration of a cell’s watery surroundings relative to that of the cellular contents can be:
1 isotonic: when the surroundings are of equal concentration to the cellular contents and there
is no net movement of water. Water may move in and out via diffusion, but the total input and
output is equal, which is known as zero net movement. The cell maintains a constant shape, since
the water volume is constant. This is the optimal state.
2 hypertonic: when the surroundings are more concentrated than the environment. When
solutions separated by a semipermeable barrier are of different concentrations, water will move
across the barrier via osmosis in order to equalise the concentrations. Thus, in the case of
hypertonic solutions, water moves out of the cell in order to dilute the outside concentration,
bringing it closer to the cellular concentration. Since water is leaving the cell, the cell loses
turgidity and shrivels up.
3 hypotonic: when the surroundings are less concentrated than the cellular contents. This causes
water to move into the cell via osmosis, making the cell contents less concentrated and making
the surroundings more concentrated. As a result, the cell volume increases and the cell swells up,
possibly bursting if too much water enters.
9780170452922
Key concept
Osmoregulation refers to the gain and loss of water and the concentration of solutes. Osmosis is the
passive movement of water across a membrane. Solutions can be isotonic (of equal concentration,
water movement is equal or net zero), hypertonic (more concentrated outside the membrane, water
moves out) or hypotonic (less concentrated outside the membrane, water moves in).
The kidneys
Kidneys are essential organs involved in maintaining a constant internal environment. They play an
important role in osmoregulation. Their osmoregulatory function includes:
1 removal of nitrogenous wastes
Formation of urine
This website contains an 2 regulation of water concentration in the blood
animated tutorial and 3 maintaining ion levels in the blood.
quiz summarising the
structures and function The cortex and medulla make up two of the main layers in a kidney and are composed of
of the kidney. individual filtering units known as nephrons, which filter the blood in order to regulate chemical
concentrations and produce urine. At one end of each nephron, in the cortex (outer layer) of the
kidney, are cup-shaped structures called Bowman’s capsules. Each one surrounds a group of
capillaries called a glomerulus. Blood travels from the renal arteries into the glomerulus of each
nephron. At the glomerulus, plasma is forced out through the walls of the glomerulus, then in
through the outer layers of the Bowman’s capsule to its interior, being filtered in the process. After
entering the capsule, the filtered fluid (filtrate) flows along the proximal convoluted tubule to the
loop of Henle, and then to the distal convoluted tubule and the collecting ducts, finally flowing into
the ureter. Each of the various components of the nephrons are selectively permeable to different
molecules, and enable the complex regulation of water and ion concentrations in the body. Renal
arteries carry blood to the kidney and renal veins carry blood away from the kidney. The glomerulus
is the site in the nephron where fluid and solutes are filtered out of the blood to form a glomerular
filtrate. The process is called filtration. The proximal and distal tubules, the loop of Henle, and
the collecting ducts are sites for the reabsorption of water and ions. Reabsorption is the process
of water, ions and other substances in the filtrate being absorbed back into the blood. Together,
filtration and reabsorption in the mammalian nephron regulate body fluid concentrations.
Proximal Distal
tubule tubule
Glomerulus
Renal
Renal
artery
pelvis
Collecting duct
Renal
vein Renal Bowman’s
artery capsule
Ureter
Renal
medulla Renal
Renal vein
cortex
Loop of Henle
To ureter
FIGURE 11.1 Structures of the human kidney and nephron substances that are reabsorbed (blue represents
water; grey represents salts and other substances)
9780170452922
Question set 11.1

REMEMBERING 5 a Explain the difference between solute
1 Why is water essential to life? and solvent.
2 Name and describe the three types of b Why might water be known as the
solution that may surround a cell. universal solvent?
3 State three main functions of the kidney. APPLYING
UNDERSTANDING 6 Draw a diagram of a nephron and label
4 Differentiate between filtration and the main parts.
reabsorption in nephrons.
11.2 NITROGENOUS WASTES

Excretion is the removal of nitrogenous wastes. In mammals, the nitrogenous waste urea is removed Nitrogenous wastes
To further your
as part of the urine. The elimination of nitrogenous wastes (formed from the breakdown of protein knowledge and
molecules and nucleic acids) is essential. One such nitrogenous waste is ammonia, which is extremely understanding of
nitrogenous wastes,
toxic. A build-up of ammonia in cells can affect their pH, making them more basic, which can
visit this website.
denature enzymes and compromise their function. This, in turn, can reduce metabolic activity. The
toxicity can be lessened if the ammonia can be diluted in water, but that depends on the availability of
water. Various organisms have different ways of coping with this waste product. Some animals excrete
ammonia directly, while many others expend energy to convert ammonia to a less toxic form, urea or
uric acid , before excretion.
Proteins Nucleic acids
Amino acids Nitrogenous bases
—NH2
Amino groups
Most aquatic animals, Mammals, most adult amphibians, Birds, insects, many
including many fishes and sharks, some bony fish; reptiles, land snails;
juvenile amphibians; need to conserve water need to conserve water
can afford to lose water
O
H
NH2 C
N
HN C
O C C O
NH2 C C
N
NH3 C N
H
H
Ammonia Urea Uric acid
(most toxic) (less toxic) (least toxic)
FIGURE 11.2 Three types of nitrogenous wastes and where they occur, which relates to water availability in the
organism’s environment
9780170452922
Freshwater fish produce abundant amounts of dilute urine containing ammonia. It is excreted
quickly and continuously. On the other hand, marine fish and terrestrial (land) mammals must quickly
convert the ammonia to a less toxic substance, urea. It is then released as concentrated urine,
reducing water loss from the body. Other organisms, such as reptiles and birds, produce uric acid,
which is the least toxic form of nitrogenous waste and contains very little water.
Natural selection has resulted in organisms that excrete the type and amount of nitrogenous
waste that works best for the availability of water in the environment in which they evolved. Evidence
of this is seen in turtles. Terrestrial turtles excrete mainly uric acid, in contrast to aquatic turtles, which
excrete both urea and ammonia. In many frog species, the tadpoles excrete nitrogenous waste as
ammonia, whereas the adult frogs excrete urea. This is because tadpoles live in water and are able to
dilute the highly toxic ammonia. A high volume of water output is essential in order to prevent death
from ammonia toxicity in the tadpoles. Adult frogs live on land and are usually able to access smaller
amounts of water than tadpoles. With less available water, adult frogs excrete urea. This has the added
benefit of saving the frog water, but it takes energy to convert ammonia to urea.
This is not observed in aquatic mammals. Even though whales and dolphins live in an
environment with copious amounts of water for diluting ammonia, they evolved from terrestrial
mammals, and features such as urinary systems were inherited from their ancestors. Consequently,
whales and dolphins excrete urea in their urine.
TABLE 11.1 Comparison of nitrogenous wastes in various vertebrate groups
NITROGENOUS VERTEBRATE SOLUBILITY AND ENVIRONMENTAL TOXICITY ENERGY COSTS

WASTE GROUPS WATER REQUIREMENT
Ammonia Fish Ammonia is highly soluble. In some Very high None to low
Juvenile amphibians invertebrates it can dissolve in water and Requires dilution with (breakdown of proteins
pass directly through body surfaces. water and nucleic acids
Aquatic reptiles
An environment high in water directly produces
Highly soluble
is required, such as in aquatic ammonia)
environments, to dilute the ammonia.
Urea Mammals Moderate water solubility Very low (100 000 times High (ammonia is
Most adult Terrestrial environments with a low less toxic than ammonia) converted to urea in the
amphibians water content and marine environments Can be stored in high liver)
Marine bony fish can be inhabited. concentrations safely

Much less water is lost
through urea excretion
than through diluted
ammonia excretion.
Uric acid Birds Does not dissolve in water (insoluble) Relatively non-toxic Highest (more ATP
Terrestrial reptiles Terrestrial (little water is required for the is required than in
excretion of uric acid as a semi-solid converting ammonia
paste) to urea)
Key concept
Excretion removes nitrogenous waste products from animals in different concentrations,
depending on where the animals live. Aquatic animals continuously excrete dilute urine
containing ammonia. In animals that need to conserve water, ammonia is converted to a less
toxic form (urea or uric acid) for storage, and the nitrogenous waste is more concentrated to
reduce water loss.
9780170452922
Question set 11.2

1 State the type of food and the substances 3 Compare the energy costs of excreting the
that are broken down into nitrogenous three different types of nitrogenous wastes.
wastes.
2 What are the three types of nitrogenous APPLYING
waste excreted by organisms? Explain 4 Explain why different groups of animals
why it is essential to remove this waste. have different nitrogenous waste products.
11.3 KIDNEYS MAINTAIN WATER BALANCE

Maintenance of water balance in mammals is controlled by antidiuretic hormone (ADH). As the name
suggests (‘diuresis’ means excessive urination), ADH reduces urine output. ADH is produced by the
hypothalamus and is stored in the pituitary gland. It reduces urine output by acting on the collecting
ducts of the kidney. The main functions of the collecting ducts are reabsorption of water and carrying
urine to the ureter. ADH increases reabsorption of water in the collecting ducts.
When the blood water content falls below its optimal range, osmoreceptors in the hypothalamus
detect an increase in blood solutes (created by the low water content in the blood) and it causes
ADH to be released by the posterior lobe of the pituitary gland. The ADH is secreted into the blood
for transport to the kidneys. ADH increases the permeability of the collecting duct of the kidney,
increasing water reabsorption. As water concentration increases in the blood plasma, negative
feedback decreases the release of ADH.
Osmoregulation is used to keep the bodily fluid from being too diluted or too concentrated.
When the bodily fluid is too concentrated, there are high levels of solutes and a low water content.
This leads to high osmotic pressure and the risk of cells losing too much water via osmosis. When the
bodily fluid is too dilute, there are relatively low levels of solutes and high water content. When this
level exceeds the tolerance range, cells are at risk of absorbing too much water, which can result in
them lysing (bursting) in the case of animal cells.
Freshwater fish Terrestrial Spinifex hopping

Copious dilute urine mammal mouse
containing Concentrated urine Extremely concentrated
ammonia containing urea urine containing urea
Dilute urine Concentrated urine
FIGURE 11.3 Urine concentration varies between animals, depending on their environment.
9780170452922
Proximal tubule Distal tubule

NaCl nutrients H2O
H2O NaCl
Cortex
Thick segment
Descending
of ascending
limb of loop
limb
of Henle
Filtrate NaCl
H2O (water) Outer H2O NaCl
Salts (NaCl etc.) medulla
Urea
Thin Collecting
Glucose
segment of duct
Amino acids
ascending
Some drugs
limb Urea
NaCl H2O
Active transport
Passive transport Inner
medulla
FIGURE 11.4 Water is conserved in the mammalian kidney by reabsorption in the descending portion of the
loop of Henle. The longer the loop of Henle, the more water is reabsorbed and the more concentrated
the urine.
Negative feedback loop for water balance

As a response to an increase in solute concentration in the blood (less water in the blood), the
hypothalamus signals the urge to drink and also sends a nerve signal to the pituitary gland, instructing
it to release stored ADH into the blood, which mainly targets cells in the collecting ducts in the kidney
nephrons. This hormone increases the permeability of the collecting duct walls (opening the water
channels) to allow water to flow back into the bloodstream (reabsorption). This increases the water
content of the blood and reduces water loss through urine. The resulting low volume of urine is
highly concentrated.
The reverse can occur when the water content of the blood is above the tolerance range. The
hypothalamus detects this deviation from normal (the stimulus) and coordinates a response. It sends
a message to the pituitary gland to release less ADH, reducing the permeability of the collecting
duct, which in turn reduces the amount of water reabsorbed back into the blood. The resulting large
volume of urine is highly dilute.
When water levels in the blood are returning to the optimal range, the amount of ADH released
and the urge to drink are reduced by negative feedback.
Key concept
The hypothalamus detects low water content in the blood and signals the pituitary gland to
release ADH. Increased ADH increases water reabsorption by the kidneys, which decreases
water loss by urination.
9780170452922
STIMULUS
Decrease in the blood water
content below optimal range
NEGATIVE RECEPTOR
FEEDBACK Osmoreceptor cells in the
The blood water content hypothalamus detect the
returns to the normal or change in the blood water
optimal value. The response content and send a message
counteracts the stimulus. to the coordinating centre.
COORDINATING CENTRE
RESPONSE (MODULATOR)
An increase in the blood The hypothalamus receives a
water content, a lower volume message from the receptor,
of urine and a higher urine coordinates a response and
concentration sends a message to the
effector. (The thirst centre is
also activated.)
EFFECTOR
The pituitary gland releases
ADH, which travels through
the blood to the kidney
nephrons, increasing the Negative feedback for
permeability of the collecting water content
duct wall, which increases
water reabsorption.
Read and use the
interactive tool to learn
about ADH and control
FIGURE 11.5 Negative feedback loop for low water volume (low hydration) of water balance.
Question set 11.3

1 State the full term represented by the 3 Explain how reabsorption of water can be
acronym ADH. controlled in a mammal.
2 State the relationship between the
length of the loop of Henle in the APPLYING
nephron and the urine concentration 4 Draw a negative feedback loop for an
that is demonstrated by Figure 11.3 increase in the water content of the blood
(page 377). above the optimal range.
11.4 ADAPTATIONS FOR WATER BALANCE

Organisms have various mechanisms for maintaining water balance. Some regulate their solute
concentration to be either higher or lower than that of their external environment; these organisms
are called osmoregulators. Others allow their solute concentration to be equal to the concentration
of the external environment; these organisms are called osmoconformers.
Osmoregulators
Structural features, as well as behavioural and physiological responses, aid in thermoregulation. In
hot environments, dingoes pant, losing water vapour from the tongue, the air passages and the lining
of the mouth. Other animals have high densities of sweat pores in certain areas, which are exposed
9780170452922
as the body temperature rises. These are effective cooling adaptations, but also involve water loss by
evaporation. Fortunately, a physiological thirst response is experienced as the concentration of blood
solutes increases, and animals respond by drinking water. Thermoregulation and osmoregulation
are intricately bound to each other, and for many terrestrial organisms, a water supply is not always
available. Animals living in dry areas have a range of structural, physiological and behavioural
adaptations for maintaining their water balance.
Structural features to maintain water balance

The threat of dehydration is a major issue in Australian terrestrial animals. Structural adaptations
that reduce water loss are essential. A waterproof or impermeable outer layer (integument) can
reduce water loss. For example, the scales of reptiles, the hair of mammals, the feathers of birds
and the upper part of the epidermis contain keratin, a protein that hardens and waterproofs
the body surface. The waterproof surface acts as a barrier, preventing water loss via osmosis or
evaporation.
a b
refieK yhtaC/kcotsknihT
neeuqcmsj/kcotsknihT
FIGURE 11.6 The scales of reptiles and feathers of birds contain keratin, and this reduces water loss.
Physiological processes to maintain water balance

Many reptiles and birds reabsorb water from their cloaca, the cavity into which their rectum and
ureter open. Excreting nitrogenous waste as uric acid is effective in saving water. Many terrestrial
vertebrates, such as the Australian desert frog, Chiroleptes, slow down the production of urine by
reducing the rate of glomerular filtration. The frog, swelling up like a ball, retains urine in its bladder
for use in the dry season. The Australian desert hopping mouse, Notomys alexis, can concentrate its
urine more than any other known rodent (see Figure 11.7). Water is conserved when it is reabsorbed
in the descending portion of the loop of Henle. The longer the loop of Henle, the more concentrated
the urine and the more water saved. The desert hopping mouse has a very long loop of Henle to
maximise water conservation, and both the desert hopping mouse and the kangaroo mouse are able
to conserve water by producing a low volume of highly concentrated urine.
Some desert mammals do not need to drink water. They extract enough water from the food they
consume, such as plants that store water. Some animals can use water stored in fats or carbohydrates,
or use the water that is generated from the metabolism of fats or carbohydrates.
9780170452922
Camels are renowned for their ability to

go for several weeks without drinking water.
Camels can produce water by metabolising the
fat in their hump; however, that source of water
is not enough to compensate for the water
nosniktA eihtaK/devreser sthgir llA .epacsuA

lost by evaporation. The camel’s body fluids
become increasingly concentrated. The camel
can survive, however, because its tissues are
extremely tolerant of this condition.
Marine vertebrates have body fluids that
tend to be hypotonic to their surroundings;
that is, their body fluids are of a lower
concentration compared with the medium
FIGURE 11.7 The desert hopping mouse, Notomys alexis,
in which they live. Water is lost via osmosis
conserves water due to its very long loop of Henle.
from the gill surfaces. Therefore, marine
fish drink copious amounts of seawater. The
problem this creates is the additional salt intake. Marine vertebrates are able to solve this problem by
the active removal of salts by special chloride-secreting cells in their gills. In addition, a slow filtration
rate and the excretion of concentrated nitrogenous waste help them reduce water loss. Some marine
animals, such as sharks and rays, tolerate high levels of urea in their body tissues, thereby reducing
their water loss. In this way, the internal solute concentration of their tissues becomes slightly higher,
or hypertonic, compared with the surrounding water. The water that consequently moves in due to
osmosis is easily removed by the kidneys.
Freshwater vertebrates have a concentration of ions in their tissues that is higher than that of
the surrounding water. They have a high rate of kidney filtration and produce copious amounts
of dilute urine. Freshwater fish must actively absorb salts from their external environment in order
to maintain their high ion concentration levels. Some fish, such as salmon, migrate between fresh
water and seawater. They can change their osmoregulation mechanisms to suit the different
environmental problems.
a b
Gain of water Excretion Osmotic water Uptake of Uptake of salt Osmotic water
and salt ions of salt ions loss through gills water and some ions by gills gain through
from food from gills and other parts of ions in food gills and other
body surface parts of body
surface
Gain of water Excretion of salt ions Excretion of large Key

and salt ions and small amounts of amounts of water in
Water
from drinking water in scanty urine dilute urine from kidneys
seawater from kidneys Salt
FIGURE 11.8 Solving the problem of water balance in a marine bony fish and b freshwater bony fish
9780170452922
TABLE 11.2 Problems and adaptations of freshwater and marine bony fish
FACTOR MARINE BONY FISH FRESHWATER BONY FISH

Problems Loses too much water via osmosis across the Gains too much water via osmosis across
skin. Gains too many salts by drinking seawater the skin and when eating food containing
and eating food. water. Loses too many salts via diffusion and
in urine.
Adaptations 1. Constantly drinks seawater 1. Does not drink water. (Fish swim with their
for water 2. Eats food containing water mouth open so that water passes by their
balance 3. High level of reabsorption in kidneys gills for gas exchange, but they do not
4. Excretes a low volume of highly swallow.)
concentrated urine 2. Low level of reabsorption in kidneys
3. Excretes high volumes of dilute urine
Adaptations 1. Excretes highly concentrated urine, ridding 1. Gains salts when eating food
for salt the body of excess salts 2. Active uptake of salts from seawater across
balance 2. Active transport of salts from salt-secreting gills
cells in gills to the seawater
Behaviours for retaining water: aestivation and burrowing

Desert frogs have adaptations ranging from the production of highly concentrated urine to
burrowing in the desert sands for several months at a time. For example, the water-holding frog,
Litoria platycephala, fills its bladder and pockets under the skin with water and tucks itself into a
water-conserving cocoon created from mucus and sloughed skin. The frog’s metabolic rate slows,
enabling it to enter aestivation in this cocoon under the ground. Water is a product of some metabolic
processes, so slowing down the metabolic
rate can reduce water loss. The frog can
survive in this way for many months.
Other desert animals spend a large
proportion of time in burrows. Burrows have
lower temperatures and higher humidity than
the open air, so water loss is reduced. The
burrow also traps exhaled water vapour, so
there is a lower concentration gradient of
nosniktA eihtaK/devreser sthgir llA .epacsuA

water vapour between the air and the animal
when it is in the burrow, which leads to less
evaporation and less water loss. The desert
hopping mouse, Notomys alexis, has a bushy
end to its tail, which it wraps around its face,
trapping the moisture from the air it breathes
out. This interesting behavioural adaptation
reduces water loss by saturating the air FIGURE 11.9 A water-holding frog, Litoria platycephala,
between its face and the bushy tail. breaking from its cocoon after rain
Osmoconformers
eloC nodnarB/yrarbiL erutciP erutaN
Most marine invertebrates, such as cnidarians

and molluscs, are osmoconformers. Their
interstitial fluid concentration fluctuates to
match that of the external environment. An
organism whose body fluids are of the same
concentration as the surrounding water is
referred to as isotonic. Cartilaginous fish FIGURE 11.10 Rays are osmoconformers.
9780170452922
such as sharks and rays are also osmoconformers. They are able to concentrate urea in their bodies
to maintain a high solute concentration, thus matching the ocean’s high concentration of solutes.
Some fish, such as sturgeon, have the capacity to conform to salt water and fresh water and can live
in water with variable salinity, such as in estuaries.
Key concept
Animals can be described as osmoregulators or osmoconformers. Osmoregulators regulate their
internal osmotic concentration to be less than or higher than their environment. Osmoconformers
conform to the osmotic concentration of their environment; that is, their internal osmotic
concentration matches that of their environment. Osmoconformers are isotonic.
Osmoregulation and communication

Animals are multicellular organisms that use a variety of chemical and electrical signals within a
communication network, coordinating the way individual cells support the organism as a whole. The
communication network involves two systems: the nervous system and the endocrine system. Rather
than being two separate systems, they are integrally related and follow the same principles of cell-to-
cell communication. In both systems, signalling molecules are produced and released by particular
cells, to signal to other cells. Other cells respond to these signalling molecules and effect a change in
cell functioning.
The endocrine and nervous systems are inextricably linked through the hypothalamus and pituitary
gland. The hypothalamus, which is made up of nervous tissue, is located in the brain and is connected
to the pituitary gland via both nerves and blood. An example of the interplay between the endocrine
and the nervous systems is seen in the regulation of the concentration of water in the blood plasma.
Osmoreceptors, sensory neurons that detect the water content of the blood, are located in the
hypothalamus. If the water content of the blood is low, the osmoreceptors send a nerve signal to the
pituitary gland to release stored ADH into the bloodstream, through which it travels to the kidneys. In
the kidneys, ADH makes a change in cell behaviour, increasing the reabsorption of water.
Salt balance
Salts are needed for the proper functioning of muscles, nerves and bones. The salts are usually
dissolved in water. Animals need to regulate the salt lost in sweating, which is an essential process
for cooling the body. Salts can be replaced through the diet, and they can also be reabsorbed via the
nephrons. Excess salts need to be excreted via the excretory system. Animals such as the albatross have
evolved a way to drink seawater, which is too salty for most birds and land animals. To get rid of excess
salt from the water and food they ingest, albatrosses have salt glands just behind their eye sockets. The
glands excrete a highly concentrated salt solution that drains out through the tip of the beak.
Question set 11.4

REMEMBERING environments in terms of water and salt
1 Describe the difference between an balance.
osmoconformer and an osmoregulator. 4 What is one benefit of being an
2 Create a table summarising the osmoconformer rather than an
adaptations osmoregulators use to osmoregulator?
maintain water balance. 5 Explain why excretion is important in
order to achieve water and salt (osmotic)
UNDERSTANDING balance.
3 Contrast the problems marine and
freshwater fish have in their different
9780170452922
Water balance in different organisms

YCARETIL CIFITNEICS All organisms need to regulate water and salts. Different organisms exhibit different types of
osmoregulation, but they all involve a stimulus and a response.
Fish respond based on whether they live in a freshwater or marine environment.
Freshwater fish are hypertonic to their surroundings. The concentration of salts is higher
in their blood compared with that in the surrounding water. Controlling intake of food and
water, excreting high volumes of dilute urine, and actively absorbing salts into cells work
together to regulate water and salt concentration in freshwater fish. Marine fish are hypotonic
to their surroundings. The concentration of salts is lower in their blood compared with in the
surrounding water. A combination of controlled intake of food and water, excretion of low
volumes of concentrated urine and active secretion of salts from cells contributes to water and
salt regulation in marine fish.
Bacteria are tiny unicellular organisms. They use an active transport mechanism to absorb
salts when they are hypotonic to their surroundings.
Animals Single cells
Must conserve water Make minor adjustments to water and solutes
Salt pumps
adjust solutes.
Plasma membrane has
solute pumps
Salt and adjusts sugars and
Water and solutes
water proteins in cell to control
are obtained in food.
water movement.
Water diffuses Water and
in and out solutes are lost
across gills. in urine
Must absorb solutes and dispose of water
Water diffuses in Pumps in plasma membrane

through the gills. accumulate solutes.
Water and some
solutes enter
Fresh
in food. Water diffuses in.
water
Solutes diffuse out.

Kidneys produce Eukaryote vacuoles
Gills pump in solutes. dilute urine. physically carry
water out.
Must absorb solutes and conserve water
Much water is Water evaporates

lost in exhaled air. from the skin.
Land
Water and minerals enter the Urine and faeces represent

animal when it eats and drinks. an important loss of both
water and minerals.
Key
Water Water
Solutes Solutes
Relatively large Relatively small
movement movement
FIGURE 11.11 Water is gained and lost differently by organisms in water and on land.
9780170452922
Water content Water content

of the blood of the blood
low high
Too much salt Too much

or sweating water drunk
Brain produces Water content Brain produces

more ADH of the blood normal less ADH
High volume of water Low volume of water

reabsorbed by kidney reabsorbed by kidney
Urine output Urine output

low high
(small volume of (large volume of

concentrated urine) dilute urine)
FIGURE 11.12 Negative feedback loops for high and low water content in blood
Plants have very specialised mechanisms for water and salt regulation. For example, they
use stomata (singular stoma) and their accompanying guard cells (on the lower side of their
leaves) to regulate water loss. The stomata can open and close in response to the concentration
of the solutes in their guard cells.
Most mammals have a highly developed excretory system to help regulate water and salts.
They use their nervous and hormonal communication systems to regulate urine output volume
and concentration. Some mammals, like koalas, rarely drink water. Instead they can extract
water from the food they eat (eucalyptus leaves). During very dry times, droughts and bushfires,
they will be seen drinking water.
Questions
1 List the types of animals that need to conserve water.
2 List the types of animals that need to dispose of water.
3 Compare the mechanisms for water and salt regulation of a fish with those of a human.
4 Write a sequential summary of the negative feedback loops that operate when a human’s
water content is too high or too low.
11.5 WATER TRANSPORT IN PLANTS

An understanding of basic plant structure and function is required in order to understand how a
plant regulates water and salt. You may recall that roots, stems and leaves are areas that all require
water and salts to be within a tolerance range. Water is gained through the root hairs and lost mainly
through the stomata in the leaves.
Transport and transpiration lead to water loss

Roots have fine root hairs attached to them that have an extremely high surface-area-to-volume
ratio. They can achieve high rates of osmosis and diffusion, as well as active transport of various
substances. Water and dissolved substances, such as salts, are transported up the stem. Inside the
9780170452922
stem of a vascular plant are the transport tissues, xylem and phloem. The xylem carries water and the
phloem carries the products of photosynthesis, such as glucose. The stem is attached to leaves. The
leaves consist of layers of specialised tissue and are the site where the majority of water loss occurs in
a plant (through transpiration).
Water transport and water loss happen simultaneously in vascular plants. Water is pulled from
the roots through the xylem to the leaves due to the set of forces known as the transpiration
pull. These forces include the forces of cohesion and adhesion. Cohesion is the attractive force
that occurs between water molecules. As water evaporates from the leaves, columns of water are
drawn up through the xylem vessels. Adhesion is the attractive force operating between water
molecules and the inner walls of the xylem vessels.
The combined forces of cohesion and adhesion create capillary action. Capillary action is
defined as the movement of water within the spaces of a porous material due to the forces of
adhesion and cohesion. As water continues to move up the column and is drawn from the root
hairs (by the xylem and the water molecules it contains), this sets up a concentration gradient
between the inside and outside of the root hairs, enabling water to move in by osmosis. In
addition, active transport of salt ions into the roots can cause osmotic water movement into the
root hairs, balancing the salt concentration inside and outside the root hairs. This movement of
water into the root hairs causes root pressure, a force that pushes the water upwards.
Together, the forces of cohesion, adhesion and root pressure produce a continuous flow of
water from the roots to the leaves via the xylem. This continuous flow of water is known as the
transpiration stream.
The strongest force, the cohesive force, causes a pull force in the xylem, because water at the top
of the column, at the leaf, evaporates due to a process called transpiration (Figure 11.13). Transpiration
is the evaporative loss of water (in the form of water vapour) from plants, usually through small pores
called stomata found on the surface of a plant, mostly on the underside of leaves. The evaporation
and diffusion out of the stomata occurs because of the concentration gradient of water vapour
between the inside and outside of the leaf. Water vapour moves down the concentration gradient,
from an area of high water content to an area of relatively low water content. The transport of water
through the plant results in water loss.
vog.ASU SGSU :ecruoS
FIGURE 11.13 Evidence of transpiration is shown in the results of this experiment. A plastic bag was wrapped
around some leaves on a plant. Water vapour from transpiring leaves can be seen on the plastic bag.
9780170452922
The importance of transpiration

1 Transpiration supplies photosynthesis with the water it needs.
2 The evaporation of water from the mesophyll cells (Figure 11.14) in the leaves that accompanies
transpiration requires energy and therefore cools the leaves in the same way that sweating cools
the skin of some mammals. Heat energy is drawn out of the plant, into the water, then out into
the external environment.
3 The transpiration stream is also necessary for distributing mineral salts throughout the plant.
Stomata have guard cells that open or close the stomata, depending on environmental
conditions, giving the plant some control over water loss. In most plants, light (in combination
with other factors, such as sufficient carbon dioxide concentration and sufficient humidity)
stimulates opening of the stomata. Using active transport, potassium ions (K+) are purposely
moved into guard cells. This creates a concentration gradient. The guard cells then take up water
by osmosis and become turgid. Because their inner walls are rigid, they are pulled apart, opening
the pore. In darkness, water is lost, the guard cells become flaccid, and their inner walls move
together, closing the pore.
Cuticle
Upper
epidermis
Palisade
mesophyll
Xylem
Vascular
bundle
Phloem
Spongy
mesophyll
CO2 O2 Transpiration quiz
Try this transpiration
Lower quiz to find out whether
epidermis you have learned
enough facts.
Stoma Guard cells
FIGURE 11.14 Leaf cross-section. The stomata release oxygen and take up carbon dioxide but also lose water.
A stoma opens when the guard cells are turgid A stoma closes when the guard cells are
due to absorbing water via osmosis flaccid due to losing water via osmosis
(usually during the day). (usually during the night).
Guard cell Guard cell
Thin outer wall Thin outer wall
Thick inner wall Thick inner wall
Nucleus Nucleus
Chloroplast Chloroplast
Stoma open Stoma closed
FIGURE 11.15 Comparison of an open stoma and a closed stoma
9780170452922
TABLE 11.3 Factors that can increase the rate of transpiration in plants
Light An increase in sunlight leads to an increase in transpiration due to warming the leaf and
stimulating the opening of the stomata (active transport of ions into the guard cells can
cause water to be absorbed via osmosis because of a concentration gradient in the ions
in solution); once the stomata are open, transpiration can start.
Humidity A decrease in humidity leads to a higher water vapour concentration gradient between
the air at the surface of the leaf and the air outside the leaf. This increases diffusion of
water vapour out of the leaf and evaporation from the leaf surface, which leads to an
increase in water loss from the plant (transpiration).
Wind An increase in wind leads to an increase in the rate of evaporation, which leads to an
increase in the rate of transpiration, because humid air near the stomata is being carried
away, increasing the water vapour concentration gradient between the air at the surface
of the leaf and the air outside the leaf.
Temperature An increase in temperature (due to heat energy being received from the sun) increases
the evaporation rate from the surface of the leaf, because of an increase in the
water vapour concentration gradient between the air at the surface of the leaf and
the air outside the leaf. This leads to an increased rate of water loss from the plant
(transpiration rate).
Key concept
The mechanisms of osmoregulation in plants are transport and transpiration. Transport
describes the movement of water and minerals in the xylem up the stem to the leaves, and
solutes in the phloem. Transpiration stream describes the pull of water from the roots to the
leaves due to cohesion, adhesion and root pressure. Transpiration is the loss of water from the
leaves.
CASE While a PhD research student at the surviving in the salt lakes of inland Australia.
STUDY University of Western Australia in 2016, The environment is described as highly
Louis Moir-Barnetson conducted a study on stressful due to the high salinity, extremely
different halophyte (salt-tolerant) species arid conditions and flash floods. The study
was conducted because little is known about
the ecology and physiology of the salt lake
plants. Their adaptations are key to their
survival in this extreme environment, and
their survival is vital for the ecology of the
salt lake. Halophytes seem to have abilities
ailartsuA nretseW fo ytisrevinU eleihT .R.K
ailartsuA nretseW fo ytisrevinU eleihT .R.K
FIGURE 11.16 Highly specialised plants can survive in extreme conditions; for example, the halophyte
Tecticornia medusa (samphire) is able to tolerate the highly saline, extremely arid conditions of inland salt
lakes.
9780170452922
that other plants (and animals) do not. The succulent tissues. When salt is moved into a
ability to filter salt from salt water is of vacuole, its toxic effects are removed from
particular interest to scientists, because it is the rest of the cytoplasm. Importantly, the
predicted that fresh water will become less limiting effects of salt in the cytoplasm
common in the future. disappear and nutrient uptake increases.
Louis also conducted a comparison Samphires accumulate salt in the older parts
study of three different halophytes and of the stem, which then fall off, removing the
found that in altered, increasingly saline salt from the plant.
conditions, shoot and root growth remained
the same, but that when subjected to low Questions
saline conditions, one suffered more stress 1 Explain why studies of halophytes may
than the other two. Samphire was one of benefit humans in the future.
two species that he described as superior 2 Predict some of the impacts that
competitors. removing halophytes from the salt lakes
Common mechanisms of halophytes for of inland Australia would have on the
surviving in environments where there are ecology there.
high concentrations of salt are accumulation 3 Describe the halophyte samphire and
and storage of salt in either vacuoles or state some of its unique adaptations.
Question set 11.5

1 State the relationship between the 3 Differentiate between the terms
following factors and the transpiration ‘transpiration’ and ‘transpiration pull’.
rate: 4 Explain why transpiration cannot
a high light intensity continue without evaporation.
b low temperature CREATING
c high wind 5 Create a poster showing a cross-section of
d low humidity. a leaf and the position of stomata on the
2 Describe the role of the guard cells in leaves. Include plant parts and processes
regulating water loss in a plant. you learned about in this section.
11.6 SPECIALIST PLANT ADAPTATIONS FOR

REGULATION OF WATER, SALTS AND GASES
To maintain water balance and allow for gas exchange, xerophytes (plants tolerant of an arid
environment) and halophytes (plants tolerant of salt) have a variety of adaptations. Adaptations
fall into the categories of structural (physical) or physiological (functional processes). Another
way to classify plant adaptations relates to the part of the plant involved: e.g. leaf, stomata or
root adaptations. When learning about adaptations, it is helpful to be able to describe how the
adaptation assists in reducing water loss or salt loss or gain, while maintaining adequate gas
exchange.
Gas exchange occurs through stomata, but only when they are open. They are usually open
during the day, when sunlight is being used in the process of photosynthesis. Stomatal opening
and closing depends on changes in the turgor of the guard cells. Turgor is a force that results
from the water pressure inside plant cells and it is maintained by osmosis. When water flows into
9780170452922
the guard cells by osmosis, their turgor increases and they expand. Due to the relatively inelastic
inner walls of guard cells, they bend and draw away from each other, so the pore opens. If the
guard cells lose water, the opposite happens and the pore closes. The guard cells lower their
water potential to draw in water from the surrounding epidermal cells by actively accumulating
potassium (K+) ions. This requires energy in the form of ATP, which is supplied by the chloroplasts
in the guard cells.
Plants require oxygen for respiration and carbon dioxide for photosynthesis. Respiration
occurs throughout the day and night, providing the plant with a supply of energy. Photosynthesis
can only occur during sunlight hours, so it stops at night. During the day, photosynthesis can
occur 10 or even 20 times faster than respiration (depending on the light intensity), and the
stomata must stay open so that the plant has enough carbon dioxide, most of which diffuses in
from the atmosphere. Simultaneously, oxygen, a product of photosynthesis, diffuses out through
the stomata. The rate at which oxygen is produced in photosynthesis is much higher than the
rate it is needed in respiration. This explains why oxygen is released, even though oxygen is
needed for respiration. How can plants that live in dry environments regulate water balance when
they need to open their stomata for gas exchange (which also allows evaporative loss of water
via transpiration)? Xerophytes have developed specialised features to solve this dilemma.
Carbon dioxide enters, while water and

oxygen exit
CO2 Water & O2 Sunlight
Cuticle
Upper
epidermis
Palisade
mesophyll
Spongy
mesophyll
Lower
epidermis CO2 enters
Guard cell
O2 exits
Stoma
FIGURE 11.17 Gas exchange in plants occurs through the stomata.
Xerophytes
Xerophytes live at the dry extreme of the moisture continuum. Deserts, but also aerial rainforest
niches and frozen arctic tundra, experience conditions in which evaporation exceeds precipitation for
all or part of the growing season. Xerophytes specialise in water conservation, allowing them to thrive
in these conditions. Xerophytes are plants adapted to live in arid environments. They have developed
specialised features that minimise water loss, while allowing for gas exchange. An environment is
classified as arid if it has a severe lack of available water that hinders the growth of most plant and
animal life. ‘Xero’ is the Greek word for dry; hence the term xerophyte. Xerophytes may live in very hot
places, such as the desert, where water is limited, or in areas of frozen land with no flowing water.
The problem with living in an arid environment is that water moves passively along a
concentration gradient out of the plant and into the dry environment. The rate of water loss by
evaporation due to transpiration is very high. It is high because there is a relatively high concentration
gradient between the inside and outside of the leaf. Water vapour evaporates and diffuses more
9780170452922
quickly in an arid environment compared with in a non-arid environment. Plant cells can become
flaccid, and plants can wilt, dry out and die when their water content falls below the plant’s tolerance
range. Water is a requirement for photosynthesis, it is a medium for metabolic processes (chemical
reactions), it is required for evaporative cooling, and it is needed for soil nutrients to dissolve into and
be absorbed by a plant.
Xerophytes have a range of structural and physiological adaptations that enable them to survive in
an arid environment:
• Reduction in leaf surface area. Leaves may be reduced to spines, or be long and narrow, reducing
the area for transpiration, and there may be a reduced number of stomata. In addition, the smaller
leaf surface area means less exposure to the drying effects of the wind, reducing evaporation and
reducing water loss. For example, some cacti have developed their leaves into thin spines without
stomata to inhibit water loss, while the porcupine (spinifex) grass has rolled leaves that create
pockets of very humid air
• Sunken stomata, which prevent water loss by increasing the relative humidity near each stoma,
decreasing the concentration gradient and reducing evaporation and diffusion. This creates a
micro-climate
• Deep roots to reach water sources underground, such as the water table, which increase water
uptake, preventing dehydration of the plant
• Rolled leaves, with the stomata inside and the inner surface covered in hairs. The rolled leaf and
hairs both serve to trap moist air, thus reducing the concentration gradient of the water vapour,
the diffusion rate of water vapour out of the leaf, the evaporation rate and the transpiration rate,
creating a humid micro-climate and reducing water loss
• Thick, waxy leaf cuticle that is impermeable to water, preventing evaporation and water loss.
The cuticle is also shiny and can reflect light, reducing the amount of light absorbed that could
transform into heat and increase the transpiration rate. The reduction in light absorption leads to
a reduction in the stimuli that open the stomata, further reducing water loss
• Stomata opening at night (reverse stomatal rhythm). This assists in reducing water loss,
because the stomata are closed during the hottest part of the day, reducing transpiration
and evaporation. Carbon dioxide uptake is then at night, and it is stored for use in
photosynthesis, which occurs in the daytime
• Shallow, spreading roots to collect the occasional rainfall, and to increase water uptake and
reduce the risk of dehydration of the plant.
• Storage of water in succulent tissues. Plants store water in fleshy stems or leaves (instead of it
being transpired out of the plant) for use during dry periods. This reduces water loss during hot,
dry periods.
These structural and physiological adaptations can be further classified into the following
categories: adaptations to increase water gain (spreading shallow roots or long tap-roots that
reach the water table), adaptations that limit water loss (leaf, stomatal, metabolic adaptation) and
adaptations for water storage.
Halophytes
Halophytes are plants that live in environments of high soil salinity, that is, soil with a high salt
concentration – places such as salt marshes and the mud flats of estuaries. The amount of salt-
affected land is increasing around Australia, and scientists study salt-tolerant plants to help in
agriculture, bioremediation and conservation.
9780170452922
Water does not move into a plant if the plant’s solute concentration is lower than the
concentration outside. Water will move out of the plant, via osmosis, passively along a concentration
gradient. Halophytes lose water, because the high salt concentration in the surrounding soils will
draw water from plant tissue via osmosis. The effects of living in an environment with high salinity are
multilayered. Plant growth can be reduced, germination can be hindered, and plants can struggle with
a water deficit as water is drawn out of them, which slows the rate of photosynthesis and productivity;
high levels of salt ions can also lead to toxicity and cell death. Because the salt concentration in the
soil exceeds that in the root hairs, unless the plant is specially adapted the water moves from the root
hairs into the soil by osmosis until the two solutions
are isotonic. Plants can become dehydrated if they
do not possess suitable adaptations.
In order to combat the effects of osmosis and
reduce water loss, halophytes are salt accumulators
and/or salt excluders. Salt accumulators gather
and store excess salt in their salt glands or in their
central vacuoles. Salt excluders remove salt by
ultrafiltration through cell membranes and the
endodermis. These complex plants are able to
accumulate and compartmentalise ions, enabling
them to continue to accumulate essential nutrients
in the presence of high sodium concentrations, and
limiting the entry of salt ions into the transpiration
tnahcraM haraS/otohP kcotS ymalA

stream, and hence protecting their ability to carry
out transpiration. Some examples of halophyte
adaptations follow.
• Filtration at the roots to regulate the amount
of salt entering the plant. Root cells that are
impermeable to salt prevent salt from entering
the plant. FIGURE 11.18 Salt glands on a quinoa flower
snobbiG boB/yrarbiL otohP ecneicS
FIGURE 11.19 The desert holly saltbush accumulates salt in its leaves, which can be dropped in order for the
plant to survive.
9780170452922
• Vacuoles in root cells store salt, which increases the salt concentration of the roots so it is greater
than that in the soil. This allows water movement into the roots. Storing salt in vacuoles, rather
than in the cytoplasm, stops it from interfering with cell functioning.
• Accumulation of salt in older leaves, salt bladders (modified epidermal hairs) or bark, which can
later be discarded. This reduces the amount of salt in the plant.
• Secretion of salt by special salt glands on leaves, stems and roots. This also reduces the amount
of salt in the plant.
• Succulence, the development of water storage structures in the leaves and other parts of the
plant, dilutes the salt content of the cells (as well as giving the plant a water source in drier
periods).
Examples of halophytes are mangrove grass and mangrove trees (Figure 11.20). Mangroves
are characterised by their aerial root systems, called pneumatophores, which aid in respiration.
The muddy, oxygen-poor soils that characterise mangrove areas do not hold enough oxygen for
these trees to effectively respire. Pneumatophores help the mangrove plant gain enough oxygen
for respiration. They are most common in the Kimberley and Pilbara regions, Exmouth, and Shark
Bay. There are also some small and isolated communities at the Abrolhos Islands in the state’s
mid-west and in the Leschenault Inlet, Bunbury, in the south-west. The diversity of mangroves
diminishes markedly from north to south, and only one species is found at Shark Bay and further
south.
Salt glands in the surface
layers of leaves secrete salt
(salt excretors).
Salt may accumulate

in older leaves before
Oxygen diffuses they fall.
through the spongy
tissue of the
pneumatophore to
the rest of the plant.
Water level at high tide

Pneumatophores
(breathing roots) Prop roots descend
rise from the from the trunk to
cable roots. provide additional
support.
Cable roots radiate from the Specialised root membranes

trunk. Fine feeding-roots in some mangroves prevent salt
grow off these radial roots from entering their roots (salt excluders).
and create a stable platform.
FIGURE 11.20 Mangroves have evolved methods of dealing with concentrations of salt that would kill or inhibit the
growth of most other plants.
9780170452922
TABLE 11.4 Structural and physiological adaptations of xerophytes and halophytes
XEROPHYTES
TYPE OF ADAPTATION HOW IT WORKS EXAMPLE
ADAPTATION
Structural Thick, waxy cuticle Impermeable to water, preventing
evaporation and water loss. Stops
/gro.snommocevitaerc//:sptth( 0.2 YB CC eleihT niveK/aidemikiW

uncontrolled evaporation through
leaf cells.
)ne.deed/0.2/yb/sesnecil
FIGURE 11.21 The Australian succulent Gunniopsis
quadrifida (Sturts pigface)
Small leaf surface Fewer stomata, leading to reduced Conifer needles, cactus spines
area water loss. Less surface area for
evaporation. Smaller surface area of
leaf is exposed to the drying effects
of the wind, reducing evaporation
and reducing water loss.
Sunken stomata Stomata in sunken pits within
Rolled leaves with rolled leaves prevent water loss
stomata on the by increasing the relative humidity
inside in the vicinity of each stoma,
decreasing the concentration
gradient and reducing evaporation
and diffusion. Creates a micro-
climate. /gro.snommocevitaerc//:sptth( 0.2 YB CC eleihT niveK/aidemikiW
Physiological Stomata opening This assists in reducing water loss

at night (reverse because the stomata are closed
stomatal rhythm) during the hottest part of the day,
reducing water loss by transpiration/
evaporation (CO2 uptake occurs at
night and it is then stored for use in
photosynthesis during the day).
)ne.deed/0.2/yb/sesnecil
FIGURE 11.22 Porcupine grass, also known as ’spinifex’ or

hummock grass (Triodia sp.), WA
Storage of water in Plants store water in cells in fleshy Gunniopsis quadrifida (shown above in Figure 11.21)
succulent tissues stems or leaves instead of transpiring
it out of plant, for use during dry
periods; reduced water loss during
hot dry periods.
9780170452922
HALOPHYTES
TYPE OF ADAPTATION HOW IT WORKS EXAMPLE
ADAPTATION
Structural Aerial root Aid in respiration. The muddy,
systems called oxygen-poor soils that characterise
pneumatophores these areas do not hold enough
oxygen for these trees to
effectively respire. Oxygen diffuses
into the spongy tissue of the
pneumatophores. They grow
otomisas/moc.kcotsrettuhS
upwards out of the water or mud to
reach the air.
Filtration structures Prevent salt from entering
in roots their roots. Mangroves have an
ultrafiltration system that can filter
approximately 90% of sodium ions FIGURE 11.23 Mangroves
from the surrounding salt water.
The three layers of the filtration
system surrounding the roots trap
sodium ions but allow water to
pass through as it is pulled into the
xylem.
Salt glands Salt is directed to plant surfaces,
where salt glands secrete salt to
reduce the salt content in the plant
Physiological Concentrates Stores salt in the vacuoles of the
and stores salts in fleshy stem segments or ‘beads’,
vacuoles which can have salt concentrations
of 30–45%. The salt in the beads
becomes highly concentrated, and
they shrivel, die then drop off. This
allows the rest of the plant to remain
healthy.w
otomisas/moc.kcotsrettuhS
FIGURE 11.24 Samphire: an Australian succulent

Accumulates salts Salt is directed to older leaves or bark,
in leaves or bark where it accumulates. The leaves
or bark eventually die and drop off,
removing the salt from the plant.
Key concept
Plants have structural and physiological adaptations to help them survive in different
environments. Xerophytes are plants that can tolerate extremely dry environments.
Halophytes are plants that can tolerate high soil salinity.
9780170452922
Question set 11.6

REMEMBERING
1 Describe the structural adaptations of these plants:
a xerophyte
b halophyte.
2 Describe the effects of an arid and highly saline environment on water balance for plants.
3 Copy and label Figure 11.25.
1
3
8
10
9
4
CO2 O2
6 7
FIGURE 11.25 Cross-section of a leaf
UNDERSTANDING
4 Draw a table to summarise two structural adaptations of xerophytes for reducing water
loss and two structural features of halophytes for salt regulation.
CREATING
5 Draw a diagram of a mangrove tree and add notes explaining the various structural and
physiological features it has for water, salt, oxygen and carbon dioxide regulation.
11.1 The problem of osmosis

Simple unicellular organisms, such as Amoeba, solve the problem of water gain from osmosis by
NOITACILPPA
accumulating the excess water in little bubbles in their cytoplasm. These contractile vacuoles
swell to bursting point, and the surplus water is expelled from the cell surface as the vesicular
membrane suddenly contracts.
11.2 Bioengineered kidney makes urine

Scientists can strip cells out of donated organs, such as kidneys, leaving a scaffold. The scaffold
NOITACILPPA
can then be populated with stem cells under conditions mimicking those in the body. The end
result is a functioning bioengineered kidney that can be transplanted into the stem cell donor.
9780170452922
How are animals adapted to withstand cold or heat? 11.1
NOITAGITSEVNI
Background
Mammalian body temperatures vary little. What are some of the adaptations that help mammals
maintain a fairly constant body temperature and keep warm in cold climates?
Aim
To model and investigate heat loss from an exposed surface
Materials
• 4 test tubes
• 4 thermometers
• 4 beakers
• Funnel
• Measuring cylinders
• Cotton wool (or some other insulating material)
• Cardboard cylinder (such as from a toilet roll)
• Timer
• Fan
• Spray bottle of warm water
Risks
Hot water can burn. Use a funnel and fill test tubes carefully.
Procedure – Part A: Effect of insulation on heat loss

1 Take three test tubes, label them ‘A’, ‘B’ and ‘C’, and place each one into a separate beaker.
2 Surround test tube A with cotton wool or some other insulating material.
3 Place test tube B in a cardboard cylinder and wrap the outside of the cylinder with the same
amount of insulating material as you used for tube A (so that there is a layer of air between the
test tube and the insulation).
4 Cover the top of the cardboard cylinder so the air is trapped.
5 Test tube C has no insulating material around it.
A B C
FIGURE 11.26 Experimental set-up to investigate the effect of insulation on heat loss
9780170452922
6 Fill each of the three test tubes with 20 mL water at 80°C.

7 Insert a thermometer in each test tube and record the three temperatures as soon as possible
after the water is added. In a table, record the three temperatures every minute for 10 minutes.
8 Graph your results.
Procedure – Part B: Effect of moisture on heat loss
1 Take four test tubes that have been wrapped in cotton wool and place each one in a separate
beaker. Label them ‘1’, ‘2’, ‘3’ and ‘4’.
2 Spray the outside of test tubes 1 and 3 with warm water.
3 Place test tubes 1 and 2 in front of a fan, and test tubes 3 and 4 in an area without air movement.
4 Fill each of the four test tubes with 20 mL water at 80°C.
5 Insert a thermometer in each test tube and record the four temperatures as soon as possible after
the water is added. In a table, record the four temperatures every minute for 10 minutes.
6 Graph your results.
12 3 4
FIGURE 11.27 Effect of moisture on heat loss
Results
Observations are to be recorded in tables and then graphed.
Analysis of results
1 Which test tube in Part A was the most effective at reducing heat loss? Suggest what makes this
set-up most effective at reducing heat loss.
2 Which test tube in Part B was the most effective at increasing heat loss?
Discussion
1 What structural feature of mammals is the cotton wool simulating?
2 How can an insulating layer of air be achieved in mammals?
3 How can the results from test tube B be used to explain the observation that a cat looks larger on
colder days?
4 Based on the results, suggest why an individual feels cooler on a hot windy day compared with on
a hot still day.
9780170452922
5 Using the observations collected in this experiment, explain why panting in dogs is an effective
way of losing body heat.
6 Why are animals like frogs at greater risk of perishing on a hot windy day? Use the experimental
results to support your answer.
Taking it further
1 Which part of the experiment modelled the role of perspiration in maintaining body temperature?
2 Were any experimental controls used in Part A and Part B of this experiment? If so, explain what
these were and discuss their importance.
3 Draw a diagram of a negative feedback model, using the examples of thermoregulation
investigated in this experiment. Are all components of a feedback model completely demonstrated
in this experimental set-up? Explain your answer.
4 When the body temperature in mammals starts to drop, a number of things happen. Describe
some of these physiological and behavioural responses. Are any of these responses being modelled
in this experimental set-up? Explain.
5 When the body temperature in mammals starts to increase, different physiological and
behavioural responses occur. Describe these responses. Are any of these responses being
modelled in this experimental set-up? Explain.
Extension
1 Devise a procedure for testing the effects of shivering on heat regulation. Use a procedure similar
to the one in this experiment.
2 Explain why a person shivers during a fever, even though their body temperature is above 37°C.
3 Why would a small mammal shiver more than a large mammal on a cold day?
4 A small mammal was found to eat more than its body weight in food in a 24-hour period. A larger
mammal ate less than its body weight in food in the same time period. Explain why.
9780170452922
WS
CHAPTER 11 SUMMARY
Chapter 11 • Water is essential to life and is known as the • Kidneys play a major role in osmoregulation
Activity sheet
universal solvent. It plays a major role in the and in vertebrates have adaptations for the
dissociation (dissolving and separation) of removal of nitrogenous waste.
salts into their ions for metabolic activity. • Nephrons filter the blood by filtration
• When a solution outside a cell is compared and reabsorption. The Bowman’s capsule
with one inside, it can be isotonic (equal surrounds the glomerulus, which is
concentration, equal water movement), the site of filtration. The proximal and
hypertonic (more concentrated outside the distal tubules, the loop of Henle, and
membrane, water moves out) or hypotonic the collecting ducts are the sites of
(more concentrated inside the membrane, reabsorption.
water moves in).
• The hypothalamus and pituitary gland
• Organisms can have a number of structural regulate reabsorption by increasing
features or behavioural and physiological or decreasing the production of
responses that enable them to maintain ADH. Increased ADH increases water
water balance (osmoregulation). reabsorption, which decreases water loss
• There are three types of nitrogenous waste: through urination.
ammonia, urea and uric acid.
• Animals have a variety of behavioural,
• The type of nitrogenous waste produced by
physiological and structural adaptations for
animals is related to the amount of water in
osmoregulation or osmoconformation.
their environment. However, all mammals
excrete urea (even aquatic mammals such as • To maintain water balance and allow for
whales), due to shared evolutionary history. gas exchange, some plants have developed
specialised structural and physiological
• Ammonia is highly soluble in water and is
adaptations.
highly toxic.
• Urea is moderately soluble in water. It is • Xerophytes are plants that are adapted to
moderately toxic, but much less toxic than survive in arid environments.
ammonia. • Halophytes are plants that are adapted
• Uric acid is insoluble in water and almost to survive in environments with high
non-toxic. salinity.
CHAPTER 11 GLOSSARY
Adhesion The attractive force between water Bowman’s capsule A cup-shaped structure
molecules and the inner walls of a vessel found at one end of each nephron, in the cortex
(e.g. the xylem vessels) of the kidney; it surrounds a group of capillaries
Ammonia The direct product of the breakdown called a glomerulus
of protein or nucleic acids; it is extremely toxic Capillary action The movement of water within
and highly soluble in water the spaces of a porous material or a narrow tube
Antidiuretic hormone (ADH) A hormone that due to the forces of adhesion and cohesion
regulates the level of water reabsorption in the Cohesion The attractive force between water
collecting duct of a kidney’s nephron molecules
Arid Describes an environment characterised Coordinating centre (modulator) A tissue or
by a severe lack of available water that hinders organ that receives messages from receptors
the growth of most plant and animal life (via sensory neurons) and coordinates a
9780170452922
response, then sends the information to an by a hypotonic solution, water moves into
effector via motor neurons; it is usually the the cell via osmosis to dilute the cell, so the
hypothalamus cell swells. (Animal cells, which have no cell
wall, sometimes burst.)
Estuary A transitional region in which fresh
water from a river meets salt water from the sea Isotonic At the same concentration as another
Excretion The removal of nitrogenous waste; solution. If a cell and its surrounding solution
in mammals, the nitrogenous waste urea is are isotonic, there is no net movement of water
removed in a mixture known as urine between them and the cell maintains a constant
volume
Filtrate The mixture that is filtered out of the
blood and enters the capsule; it flows along the Metabolism The sum of all the chemical
proximal tubule to the loop of Henle and then to reactions occurring within an organism to
the distal tubule and the collecting ducts, from maintain life; it includes reactions enabling
where it flows into the ureter an organism’s growth, homeostasis and
reproduction
Filtration A process that starts in the
glomerulus, where fluid and solutes are filtered Modulator (See coordinating centre)
out of the blood to form a glomerular filtrate Nephron The basic structural and functional
Glomerulus A group of capillaries surrounded unit of the kidney that filters the blood in order
by a Bowman’s capsule within a nephron; blood to regulate chemical concentrations, produce
is filtered from the glomerulus and through the urine and eliminate nitrogenous waste
surrounding Bowman’s capsule Nitrogenous waste The nitrogen-containing
Guard cells A pair of cells that surround a metabolic waste products of the breakdown of
stoma, which opens or closes depending on proteins and nucleic acids. Initially, ammonia
environmental conditions, giving the plant some (which is highly toxic) is formed. Many animals
control over water loss. When they are turgid convert ammonia into a less toxic form – either
the stomata open, and when they are flaccid the urea or uric acid
stomata close Osmoconformer An organism in which the
Halophyte A plant adapted to live in internal solute concentration changes with
environments with high soil salinity (i.e. a high the concentration of solutes in the external
salt concentration), such as salt marshes and the environment
mud flats of estuaries Osmoreceptor A receptor cell that detects
Hormone A chemical messenger secreted changes in blood water content (osmotic
directly into the bloodstream, other body fluids, pressure)
or adjacent tissues, where it moves to its target Osmoregulation The active regulation of an
cells organism’s water content; it maintains the
Hypertonic At a higher concentration than fluid balance (water gain and loss) and the
another solution. When a cell is surrounded by concentration of electrolytes (salts in solution)
a hypertonic solution, water moves out of the to keep internal fluids from becoming too
cell via osmosis to dilute the surroundings, so diluted or too concentrated
the cell shrinks Osmoregulator An organism that has
Hypothalamus A small region of the brain that specialised mechanisms for regulating
plays a major role in detecting and coordinating internal water and solute concentrations,
the response to a change in e.g. temperature or despite concentration changes in the external
water content in the blood environment
Hypotonic At a lower concentration than Osmosis The passive diffusion of water across
another solution. When a cell is surrounded a membrane in response to a concentration
9780170452922
gradient (osmotic pressure) caused by an the concentration gradient, from an area of

imbalance of molecules on either side of the high water content to an area of low water
membrane content. The transport of water through the
Phloem A type of vascular tissue (tubes) plant results in water loss.
within which sugars and other dissolved organic Transpiration pull The set of forces that pull
substances are transported in a vascular plant water from the roots to the leaves, including
cohesion and adhesion; as water evaporates
Reabsorption The process of substances in
the filtrate being absorbed back into the blood; from the leaves, columns of water are drawn up
control of reabsorption enables the regulation of through the xylem vessels
water and ions Transpiration stream The continuous flow of
water from the roots to the leaves via xylem
Root pressure A force pushing on the water in
the xylem, resulting from the active transport vessels due to the forces of cohesion, adhesion
of salt ions into the root hairs, which causes and root pressure
osmosis to occur and water to move from the Turgid Describes a cell into which water has
soil into the root hairs; root pressure is one of diffused, so that the walls are stretched and the
the forces involved in the transpiration stream cell is fairly rigid
Salt bladder A modified epidermal hair (found Turgor A measure of the force that results
in some halophytes) that accumulates salt; it can from the water pressure inside plant cells; it is
be discarded to reduce the amount of salt in the maintained by osmosis
plant Urea A nitrogenous waste formed from the
Solute A substance, such as a salt, that is breakdown of proteins and nucleic acids
dissolved in a solvent (nitrogen-containing compounds); it is less toxic
than ammonia and moderately soluble in water
Solvent A substance in which another
substance (known as a solute) dissolves Uric acid A nitrogenous waste formed from
the breakdown of proteins and nucleic acids
Stomata (singular stoma) Small pores, usually
(nitrogen-containing compounds); it is the least
found on the underside of leaves, through
toxic and insoluble in water
which gases are exchanged in plants
Vascular plant A plant with a transport system
Transpiration The evaporative loss of water
consisting of xylem and phloem
(in the form of water vapour) from plants,
usually through small pores called stomata Xerophyte A plant that has adapted to live in
(singular: stoma) found on the surface of a arid environments; it has developed specialised
plant, mostly on the underside of leaves. The features that minimise water loss, while
evaporation and diffusion out of the stoma maintaining gas exchange
occurs because of the concentration gradient Xylem A form of vascular tissue that contains
in the water vapour between the inside and tubes, within which water is transported from
outside of the leaf. Water vapour moves down roots to leaves in a vascular plant

Remembering
1 Name the effector in a negative feedback loop when there is an increase in the water content of
the blood.
2 List three gases that are involved in gas exchange through stomata.
3 Identify the hormone that can change the permeability of the walls of the collecting ducts in
kidney nephrons.
4 Tupong fish, small crustaceans and phytoplankton live in estuaries. Explain, in general terms,
the mechanisms you would expect each organism to have for maintaining water balance.
9780170452922
5 State a mechanism that mammals use when responding to a decrease in the water content of
blood.
6 Draw and annotate a diagram to show the operation of a sunken stoma in a xerophyte plant.
Understanding
7 Explain what would happen to the water balance of a marine fish if it were placed in fresh
water.
8 Name an animal that lives in the Australian desert, and describe one physiological adaptation it
uses for water balance.
9 Figure 11.28 shows three different nephron structures, with varying loop of Henle length.
Justifying your choice, indicate which of these nephrons would be found in:
a a terrestrial mammal
b a freshwater fish
c a reptile.
FIGURE 11.28 Loops of Henle from different organisms
10 Name the parts of the nephron, based on the described functions.

5. ___________________
(selectively secretes and absorbs
different ions to maintain blood
pH and electrolyte balance)
1. ________
(filters small
solutes from
the blood) 6. ______
(reabsorbs
solutes and
water from
the filtrate)
3. ________
(pores in the
membranes 2.________
allow water to (reabsorbs
pass from the ions, water
filtrate into the and nutrients;
interstitial fluid removes
toxins
4. ________ and adjusts
(reabsorbs filtrate pH)
Na+ and Cl– from
the filtrate into
the bodily fluid)
FIGURE 11.29 Nephron structures and their functions
9780170452922
Applying
11 Define metabolic activity and discuss how the ability to slow metabolic rate can assist some
animals in maintaining water balance in an arid environment.
Analysing
12 Table 11.5 shows the filtrate volume in the various parts of a nephron.
TABLE 11.5 Changes in filtrate volume along a nephron
LOCATION IN NEPHRON VOLUME OF FLUID (LITRES)

PER DAY
Bowman’s capsule 180
End of proximal tubule 54
End of loop of Henle 18
End of collecting duct (final urine) 1.5
If the measurement in the Bowman’s capsule was assumed to be 100% of the filtrate, calculate
the percentage of the filtrate that is retained as the final urine.
13 Outline the reason why the volume of filtrate becomes less as it flows through the nephron (see
Table 11.5).
Evaluating
14 Some scientists have shown an interest in incorporating halophyte adaptations in future crops.
Apply your knowledge of these adaptations to decide whether it is worth funding research into
this area.
Creating
15 Draw three diagrams showing the three types of solutions (hypertonic, hypotonic and isotonic)
surrounding red blood cells (animal cells). Show the direction of water movement for each cell.
Reflecting
16 Recall the different adaptations employed by plants and animals for water balance. Decide
whether plants or animals have a better set of adaptations and what the criteria would be
for your decision? Would you prefer to be a plant or an animal living in an arid or saline
environment? Explain your answer.

1 When the cells from a plant root are placed 2 Select the correct statement.
in solution, they lose water to the solution. A All mammals excrete nitrogenous waste
Relative to the cells, the solution is: in the form of urine.
A hypertonic B All mammals excrete nitrogenous
B hypotonic waste in the form of urea.
C isotonic C Aquatic mammals excrete
D osmotic. ammonia and land mammals
[Q3 2019 SCSA] excrete urine.
9780170452922
D Desert mammals excrete uric acid 6 List four structures seen in the cross-section
and other mammals excrete urea. of a xerophyte’s leaf that would assist the
[Q9 2019 SCSA] plant to conserve water. (4 marks)
[Q33c 2019 SCSA]
3 Freshwater bony fish mainly:
A gain salts by active transport through 7 The root systems of xerophytes often
the skin include spreading roots just beneath the soil
B gain salts by active transport through surface. Outline two advantages of these
the gills surface roots for xerophytes. (4 marks)
C lose salts by osmosis through the skin [Q33d 2019 SCSA]
D lose salts by osmosis through the gills.
8 Vertebrates produce three main types of
[Q25 2019 SCSA]
nitrogenous waste.
4 A biologist conducted an experiment to test [Q31b, c, d, e 2018 SCSA]
the ability of four species of small mammal
a Copy and complete the table to indicate
to produce concentrated urine during
the type of nitrogenous waste excreted
periods of water shortage. The biologist
by each animal. (4 marks)
measured the concentration of salt in the
urine and blood in dehydrated individuals
ANIMAL TYPE OF NITROGENOUS WASTE
of each species. The results were expressed
Desert rat
as the ratio of the concentration of salt
Bony fish
in the urine to the concentration of salt
Insect-eating
in the blood (U:B ratio) and are given in
bird
Table 11.6.
River dolphin
TABLE 11.6 Ability of small mammal species to

b Which type of nitrogenous waste is the
concentrate urine during water shortage
most toxic? (1 mark)
SPECIES U:B RATIO c List the main types of nitrogenous
A 8:1 waste in order from the one that takes
B 9.5:1 the least amount of energy to produce
C 10:1 to the one that takes the most energy.
(3 marks)
D 16:1
d Describe the circumstances in which it
From the results, which species is most is an advantage to an animal to excrete
likely to inhabit a dry environment? uric acid. (4 marks)
A A e Marine bony fish excrete only a
B B small volume of urine. Explain why.
C C (4 marks)
D D 9 Discuss how a xerophyte minimises water
[Q29 2018 SCSA] loss while maintaining gas exchange.
(10 marks)
5 A marine fish regulates its water and
[Q39b 2018 SCSA]
salt balance. Is this an example of
homeostasis? Give reasons for your
answer. (3 marks)
[Q33b 2019 SCSA]
9780170452922
406
12
INFECTIOUS CHAPTER 12 CONTENT
DISEASES material.
STARTER QUESTIONS
1 What is a pathogen? What effect do pathogens have on
organisms?
2 Are all pathogens the same?
3 What structural features of pathogens cause virulence?
» infectious disease differs from other disease in that it is
caused by invasion by a pathogen and can be transmitted
from one host to another
» zoonoses, such as influenza, can be transmitted between
vertebrate species
» the major groups of organisms that cause disease are
bacteria, fungi, protists and viruses; each group can be
distinguished by its structural characteristics
» diseases caused by these major pathogen groups include
– tuberculosis, tetanus, crown gall of plants
– chytridiomycosis (amphibian chytrid fungus disease)
– malaria, Phytophthora dieback (jarrah dieback)*
– influenza, Ross River virus, viral diseases of honeybees,
Australian bat lyssavirus
*The Phylum Oomycota containing Phytophthora dieback
has been removed from the Fungi Kingdom and placed in the
Protista Kingdom
9780170452922
CHAPTER 12 | Infectious diseases 407
12.1 WHAT IS AN INFECTIOUS DISEASE?

A disease is any condition that interferes with how an organism, or any part of it, functions. Diseases
are described as infectious (communicable) if they are caused by an invasion by a pathogen and
can be transmitted from one host to another. A host is an organism infected with a pathogen. An
infection is occurring if a pathogen has entered a host, has established itself and is replicating.
Unwanted signs and symptoms usually result from damage to the tissues and organs of the host. A
micro-organism is not a pathogen (i.e. not pathogenic) unless it causes disease.
Humans have attempted to identify, prevent and manage infectious diseases for centuries.
To identify the specific cause of an infectious disease, scientists have (and still apply) a series of
postulates that were developed by Robert Koch in 1884.
Koch’s postulates can be summarised into four steps.
1 The potential pathogen must always be present when the disease occurs.
2 The organism can be isolated from the host and grown in pure culture.
3 When organisms from the pure culture are inoculated into a healthy, susceptible host and the
disease develops, this is further evidence for a specific cause.
4 The organism can then be re-isolated, grown in pure culture and compared with the organism
first injected for confirmation.
Although Koch’s postulates are
limited because he only investigated
bacterial pathogens, and some
harmless bacteria may acquire extra
virulence factors that make them
yrubnekcarB nhoJ rD/yrarbiL otohP ecneicS

pathogenic, his work provides the basis
for identifying the specific cause of an
infectious disease.
A pathogen is an infectious
agent that causes disease. There are
several different types of pathogens,
but the four most common pathogen
groups are viruses, bacteria, fungi and
FIGURE 12.1 Short-duration flash photograph of a sneeze,
protists. This chapters describes 10
showing the number of droplets expelled. Each droplet may
infectious diseases that are caused by
contain thousands of bacterial or viral pathogens.
these four types of pathogens.
Table 12.1 lists the 10 infectious diseases that are listed in the Biology ATAR Syllabus [SCSA].
Viral pathogens cause influenza, honeybee diseases, Australian bat lyssavirus and Ross River virus.
Bacterial pathogens cause tuberculosis (TB), tetanus and crown gall of plants. A fungal pathogen
causes chytridiomycosis (amphibian chytrid fungus disease). Protists are the disease-causing agents
of malaria and phytophthora dieback (jarrah dieback). You will learn more about these ten pathogens
and the diseases they cause in this chapter, as well as their life cycles (chapter 13) and management
strategies (chapter 14).
TABLE 12.1 Ten infectious diseases and the types of pathogens that cause them
VIRAL BACTERIAL FUNGAL PROTIST

• influenza • tuberculosis (TB) • chytridiomycosis • malaria
• Ross River virus disease • tetanus (amphibian chytrid fungus • phytophthora dieback
• viral diseases of honeybees • crown gall of disease) (jarrah dieback)
• Australian bat lyssavirus plants
9780170452922
Transmission is the passing of an infectious disease from an infected host to another individual.
Pathogens have a variety of adaptations that enable transmission from host to host in a number of
ways. Infectious diseases, such as TB, are caused by an agent that can be passed from an infected
host to a susceptible (future) host. Diseases that are easily transmitted by close contact with an
infected organism or their secretions (body fluids) are called contagious. A disease can be infectious
but not contagious, as is tetanus.
Zoonotic diseases are infectious diseases that can be transmitted from one vertebrate group
to another. Humans, for example, can be infected with avian (bird) or swine (pig) influenza viruses.
Transmission is primarily through direct contact with infected animals. Direct contact with an infected
host’s saliva, mucus, faeces, blood or urine may happen when handling birds or by being bitten or
scratched. Transmission may also happen through close contact, such as being near an infected bird
when they shake their feathers. The virus may become airborne and be inhaled. Indirect contact may
occur when a susceptible host comes into contact with areas where infected animals live or roam,
where surfaces or objects have been contaminated. Examples of contaminated materials include
chicken coops, pet food dishes and soil.
Due to globalisation, outbreaks of diseases in Hong Kong in 1997 [avian influenza A(H5N1)
virus] and in China in 2003 [severe acute respiratory syndrome coronavirus (SARS-CoV-1)] resulted
in influenza viruses spreading from Asia to Europe and Africa. The COVID-19 pandemic was first
identified in China in 2019 and quickly spread around the world. The virus responsible, SARS-
CoV-2, is a new zoonotic RNA virus. The COVID-19 pandemic is discussed in more detail in
Chapter 14. Zoonotic influenza infection in humans may cause fever, cough or rapid progression
to severe pneumonia. Prevention of zoonotic diseases is recommended and can involve simple
physical strategies such as washing your hands with antimicrobial handwash to remove or kill the
pathogens. The dynamics of zoonotic disease transmission are deeply embedded in the ecology
and evolutionary biology of their hosts. A zoonosis comprises interaction between at least three
Australian bat
lyssavirus species: one pathogen and two host species (an animal species acting as the reservoir of the
Read how Australian infection, and humans).
bat lyssavrius can be Other zoonotic diseases explored in this course are the Australian bat lyssavirus and Ross River
transmitted by bites and
scratches from infected virus disease. Transmission of Ross River virus disease involves a vector (vectors are discussed in
bats. Chapter 11).
Key concept
Infectious diseases are caused by a pathogen and can be passed from one organism to another.
Infectious diseases can be caused by viruses, bacteria, fungi and protists.
Protecting human and animal health – a WHO discussion

YCARETIL CIFITNEICS
There has been a rise in emerging infectious diseases, particularly zoonotic diseases such as
influenza. Factors that are affecting the spread of zoonotic diseases include changes in the
environment, habitat destruction and global movement. The World Health Organization (WHO)
predicted in 2019, prior to the emergence of COVID-19, that the next human pandemic was
likely to be zoonotic.
Questions
1 In what way can changes in the environment or climate affect the spread of infectious
disease?
2 In what way can habitat destruction affect the spread of infectious disease?
3 In what way can an increase in global movement of people and wildlife affect the spread of
infectious disease?
4 Construct an inference about why zoonotic diseases are emerging faster than they did in
previous decades.
9780170452922
Question set 12.1a

1 Define: 3 If a new infectious disease emerged and
a infectious disease you were a scientist investigating the
b pathogen cause, describe the steps you would take
c contagious. to find out the cause.
2 List the four main groups of organisms 4 Explain why influenza is classified as a
that can cause infectious disease. zoonotic disease.
Understanding infectious disease

Most micro-organisms are not pathogens. The fact that a micro-organism is pathogenic is due to
special characteristics of the organism. These include the ability to stick to or invade a particular
cell type, produce toxins, and cope with or avoid the host immune system. Pathogens differ in their
disease-causing capacity or pathogenicity. The intensity of the effect of the pathogen is called its
virulence. The virulence of a micro-organism is a measure of the severity of the disease it causes.
Virulence factors help a pathogen invade a host, cause disease and evade host defences.
Individuals vary in their susceptibility to a pathogen; some have greater resistance than others.
For example, if a cold is spreading through family and friends, every person does not necessarily
become ill. Almost certainly, every person in contact with the sufferer will have contact with the cold
virus, but not everyone will develop cold symptoms. An individual’s ability to avoid being affected
by a pathogen depends on a number of factors, such as their age, state of health and their natural
resistance to that particular pathogen. Transmission of infectious diseases, including zoonotic diseases,
depends on three factors: the infectious agent, a susceptible host and a mode of transmission.
Symptoms are the effects the pathogen has on the body of the host. For example, an annoying
cough and sore throat may be early signs of a TB infection. Diseases usually have characteristic
symptoms, and a knowledge of symptoms is useful to doctors trying to diagnose the cause of a
disease without actually isolating the pathogen itself.
For many pathogens, symptoms of the disease do not appear immediately upon infection. The
time between infection and the onset of symptoms is known as the incubation period. This time lag
(Figure 12.2) may occur for a number of reasons. For example, the pathogen may have to divide many
times to reach numbers sufficient to cause disease, or it may take time to reach the target tissues
that are susceptible to that particular pathogen. Toxins produced by bacteria as waste products of
metabolic activity may take time to accumulate to a level that affects the host. Diseases are often
contagious before the onset of symptoms. This means that the pathogen can be passed on before
the person even knows they have it. This incubation period may be an adaptation of the pathogen,
allowing it to be transmitted before the host is incapacitated by symptoms.
Infection
Incubation period Symptoms of disease Recovery
smotpmys fo ecnaraeppA
Time
FIGURE 12.2 The phases of an infection and appearance of symptoms over time
9780170452922
Key concept
Transmission of infectious diseases depends on three factors: the infectious agent, the
susceptibility of the host and the mode of transmission.
Question set 12.1b

1 Define: 3 Describe how doctors use symptoms to
a susceptibility help diagnose and treat their patients.
b incubation period. 4 Discuss the differences between
2 List three virulence factors that determine pathogenicity and virulence.
the pathogenicity of an organism.
12.2 NON-CELLULAR PATHOGENS

Viruses are non-cellular pathogens. Viruses consist of one or more strands of nucleic acid (RNA
or DNA) inside a protein coat. They maintain this structure during the inert phase of their life cycle,
that is, when they are not inside a host. Viruses are not made out of cells and therefore are non-
living. They possess no metabolic machinery for processes such as cellular respiration. They cannot
be classified as prokaryotes or eukaryotes. Instead of cellular features such as ribosomes and
mitochondria, they have some nucleic acid and a protective coat. The shape of viruses varies greatly,
but most viruses are relatively tiny compared with other pathogens. They are usually only viewed by
electronic microscope.
Viruses
It is a common misconception that you can catch a cold if you go out on cold, wet days. The
common cold is caused by a virus, not by becoming cold. When a virus infects an organism, it
injects its nucleic acid into a host cell. Once inside, the viral nucleic acid takes over the host cell
and directs it to make multiple copies of the viral protein coat and nucleic acid. These are then
assembled into new viruses and are released when the host cell undergoes lysis, or splits open
(during the ‘lytic phase’). This releases many more viral particles, which can infect other cells within
the host. Exposure to cold and wet conditions might lower a person’s resistance to the virus, but it
is not the cause of the disease. All viruses cause some type of disease, because they rely totally on
host cells for their reproduction. A virus is often referred to as an obligate parasite because it cannot
function outside the host cell. This means that, unlike bacteria, viruses cannot be grown and studied
outside live cells. This trait poses limitations on viral research.
Virtually every type of organism on Earth is susceptible to viral infection. Viruses are significant
pathogens of many plants, sometimes resulting in the loss of crops such as potato and apples. Even
bacteria have their own group of viral pathogens, known as bacteriophages (such as in Figure 12.4,
page 411).
Structural features of viruses and virus replication

A virus is a non-cellular agent composed of a protein coat (capsid) and nucleic acid (Figure 12.3),
either DNA or RNA, but never both. The infectious agent is microscopic, relatively small compared
with all other pathogens and is usually measured at 30–300 nanometres in length.
9780170452922
Phospholipid
envelope
(derived from
host cell)
Viral proteins
embedded
in envelope
ecneicS fo eyE/yrarbiL otohP ecneicS

Viral nucleic
acid
Core proteins
FIGURE 12.4 A coloured transmission electron micrograph

of viruses (blue) attacking a bacterial cell of Escherichia coli
30–300 nm diameter
(orange). Small blue tails of DNA are seen being injected
FIGURE 12.3 A virus consists of a nucleic acid core surrounded by a into the bacterium.
protein coat.
Nucleus
Influenza virus
Epithelial cell
1 Attachment 2 Entry of virus 3 Viral DNA/RNA enters the

nucleic acid (DNA/RNA) into nucleus of the eukaryotic
the host cell host cell
5 New viral DNA/RNA and 4 Viral DNA/RNA directs the

The life cycle of a virus
proteins assemble at the host cell to replicate it and Watch the video and
host’s cell membrane. make copies of viral draw an annotated
proteins via translation. diagram representing
each stage of the life
FIGURE 12.5 Steps in viral replication in a eukaryotic host cycle.
Each virus is usually limited to infecting a specific host cell or organism. For example, an
adenovirus specifically infects epithelial cells in the upper respiratory tract, causing the common
cold. This is because the virus is able to recognise and bind to receptors that are expressed only
on respiratory tract epithelial cell surfaces. All viruses require host cells to replicate, and therefore
all viruses are pathogenic. The host will experience symptoms when a virus is replicating inside the
host’s cells.
9780170452922
1 Virus particle binds to

the wall of host cell
and viral DNA enters
the cell’s cytoplasm.
5 Host cell undergoes lysis 2 Viral DNA directs host

and dies. Infectious virus cell machinery to
particles are released. produce viral proteins
and copies of viral DNA.
4 Tail fibres and other 3 Viral proteins are assembled

components are added to coats. into coats; DNA is packaged
inside.
FIGURE 12.6 Viruses reproducing inside a bacterial (prokaryotic) cell. New viruses are produced within the infected bacterium.
lisarkaruy/moc.kcotsrettuhS
FIGURE 12.7 This person is suffering a rash and joint pain, symptoms of Ross River virus disease. The primary
replication of the virus occurs in skeletal muscle cells before the virus enters the blood. The virus also replicates
in the mosquito vector.
Key concept
The structural features of viruses include that they:
• are non-cellular, not living • reproduce using host cells
• have no membrane-bound organelles • have a protective protein coat called a capsid
• have nucleic acid (DNA or RNA) • are microscopic, 30–300 nanometres.
9780170452922
TABLE 12.2 Diseases caused by viruses
NAME OF VIRUS DISEASE SYMPTOMS INCUBATION PERIOD
Type A or B influenza virus Influenza The virus attacks the respiratory system. Average of 1–4 days
Sudden onset of high fever, cough,
muscle aches and pains, sore throat,
runny nose. These symptoms usually
last for up to 2 weeks.
Ross River virus Ross River virus disease Rash on limbs or trunk for 5–10 days; 1–3 weeks
painful and swollen joints, usually lasting
for months; fever and headache.
There are many different Viral diseases of honeybees CBPV: trembling wings and body, failure Varies
honeybee viruses (e.g. [e.g. chronic bee paralysis to fly, loss of hair
chronic bee paralysis virus virus (CBPV) and deformed DWV: wing deformity but can be
and deformed wing virus) wing virus (DWV)] asymptomatic
Australian bat lyssavirus Australian bat lyssavirus The virus attacks the nervous system: 20 days to 27 months. Only
(ABL) paralysis, delirium, convulsions/muscle three people in Australia have
spasms, death (if treatment is too late) been infected and confirmed to
have died from ABL.
Question set 12.2

REMEMBERING 6 Viruses can be made of DNA or RNA.
1 List four diseases that are caused by Explain the difference between DNA and
viruses and four symptoms associated RNA.
with each disease. 7 Viruses infect only specific host cells.
2 Define obligate parasite. Explain how this specificity comes about.
3 Recall the six steps a virus undertakes to APPLYING
replicate itself in a eukaryotic cell. 8 The Australian bat lyssavirus (ABL) and
UNDERSTANDING influenza pathogens attack different
4 All viruses are pathogens. Justify this human systems. Explain how this relates
statement. to the type of symptoms experienced by
5 Describe a unique structural feature of the hosts.
a virus that distinguishes it from other
cellular agents.
12.3 CELLULAR PATHOGENS

All living organisms are made of cells and are characterised by the ability to grow, reproduce and
respond to stimuli. In this section, we are not considering the vast majority of organisms on Earth;
instead we are focusing on those few living organisms that cause disease: the pathogens. Cellular
pathogens may be prokaryotic or eukaryotic.
Bacteria
Bacteria are prokaryotic. Bacteria are the most abundant and diverse group of organisms. Only a
relatively small number of bacteria cause disease. There are billions of bacteria living on our skin and
in our bodies that are not pathogenic and are often beneficial. Bacterium is the singular term for
bacteria.
9780170452922
Bacteria: structural features and reproduction

Typically bacteria are unicellular, microscopic, 1–10 µm (micrometres) in length and 0.20–2 µm in
diameter. Like all cells, bacteria have a plasma membrane that encloses the cytoplasm (Figure 12.8).
As they are prokaryotes, they have no membrane-bound organelles (such as mitochondria) or
a nucleus. However, bacteria do possess ribosomes and a single circular strand of DNA, known
as a chromosome. In addition to the DNA found in the chromosome, bacteria contain plasmids.
A plasmid is a small loop of DNA. Plasmids are able to be transferred out of bacteria without affecting
the functioning of the bacteria. Some plasmids contain genes that act as advantageous alleles
for the bacteria, as is the case for Agrobacterium tumefaciens, a bacteria that causes crown gall
in plants. Most bacteria have a cell wall outside their plasma membrane, made of peptidoglycan
(a protein–carbohydrate compound).
Plasma
Pilus Plasmid Cell wall Cytoplasm membrane Plasmid
Bacterial
flagellum
Capsule DNA Ribosome
FIGURE 12.8 Generalised structure of a bacterium
Some bacteria possess a flagellum, which helps them to move about. Another adaptation found
only in some species is a slimy bacterial capsule, which may be used to help the bacteria stick to
surfaces, such as teeth or mucous membranes. The capsule is a thick, well-organised layer sitting
outside the cell wall. It usually increases the virulence of a species, as it makes it harder for the body’s
immune system or antibiotics to attack the inner bacterium.
Many bacteria are capable of forming tough, dormant structures called endospores (or just
spores), which are resistant to extreme temperatures, chemicals and drying out. This adaptation helps
bacteria resist unfavourable
conditions and facilitates
dispersal to new hosts.
Some bacteria reproduce
by binary fission (Figure 12.9),
in which one cell splits into two
identical daughter cells. Binary
IRNC/yrarbiL otohP ecneicS
fission begins when the DNA of

the bacterium doubles in quantity
then divides into two (replicates).
The bacterial cell then elongates
and splits into two daughter cells,
each with DNA that is identical to FIGURE 12.9 Transmission electron micrograph of E. coli dividing into
that of the parent cell. two cells by binary fission
9780170452922
Others reproduce by budding off spores. These asexual forms of reproduction allow bacteria to
reproduce very rapidly in favourable conditions. Some species can reproduce every 20 minutes. For
such a species, one bacterium could give rise to a colony of 4.7 × 1021 individuals in just 24 hours.
(That is 4 700 000 000 000 000 000 000 bacteria in a single colony!) Mycobacterium tuberculosis,
however, has a much slower reproductive rate, taking 12 hours to divide.
Classification and identification of bacteria is related to their structure

To study bacteria in detail, it is necessary to view them under a powerful electron microscope.
However, useful information can still be obtained by staining and using a light microscope. This
reveals a variety of different shapes of bacteria. Bacteria can be classified according to their shape,
namely:
• spherical, known as coccus (plural cocci) (Figure 12.10a)
• rod-shaped, known as bacillus (plural bacilli) (Figure 12.10b)
• spiral (plural spirilla) (Figure 12.10c)
• vibrio, rather like a comma.
a b
htlaeH ,tteswoD A/yrarbiL otohP ecneicS

ycnegA noitcetorP
c
FIGURE 12.10 a Transmission electron micrograph of a cocci-shaped bacterium, Streptococcus pneumoniae

(magnification × 30 000); b a rod-shaped bacterium, Bacillus anthracis, which causes anthrax in sheep and cattle
(magnification × 10 500); and c a spiral-shaped bacterium, Leptospira (magnification × 4400)
It is difficult to distinguish between the different strains of each shape. A pathogenic bacillus may
look no different from a bacillus involved in cheese production. There is, however, one feature that
can be a useful tool for classifying them. Many strains of bacteria have differences in the structure and
composition of their cell walls, causing them to respond differently to stains and dyes, in particular,
the Gram stain (Figure 12.11, page 416).
9780170452922

FIGURE 12.11 Gram-positive bacteria stain purple and Gram-negative bacteria stain pink (magnification × 1000).
Since most bacteria are able to exist as free-

living organisms, it is possible to grow colonies of
them. This is done by inoculating a small number of
a particular strain into a medium containing all their
nutrient needs. This medium may be a liquid broth
or a solid gel called agar (Figure 12.12). When one
bacterium is inoculated onto a plate, it divides many
times to form a visible colony. The appearance
of these colonies can differ in colour, texture
oidutS CC/yrarbiL otohP ecneicS

and shape, depending on the particular strain. An
advantage of growing colonies on a solid medium is
that individual strains can be isolated and grown in
pure culture.
FIGURE 12.12 Haemolytic bacterial pathogens

infect blood cells, so they must be grown on
agar plates that contain blood.
Key concept
The structural features of bacteria include that they:
• are unicellular, prokaryotes
• have no membrane-bound organelles
• have circular DNA and plasmids
• may have flagella for movement
• reproduce via binary fission or budding off spores (endospores)
• are microscopic, 1–10 micrometres in length
• can be spherical, rod-shaped, spiral or vibrio
• vary in their ability to be stained (e.g. Gram stain).
9780170452922
How bacteria cause disease

Once inside a host, bacteria divide rapidly. Some bacteria damage host tissues directly, while others
produce powerful toxins (often their own metabolic wastes) that disrupt the functioning of cells
nearby or even further away. For example, toxins produced by the tetanus bacteria, Clostridium tetani,
affect the nervous system of the infected human host. The pathogen is a spore-forming anaerobic
bacterium. This means that outside of a host, the pathogen is in spore form and can survive in adverse
conditions. As an anaerobic bacterium, the bacterial spores will only germinate and undergo asexual
reproduction (binary fission) in the absence of oxygen, as in a deep puncture wound in human tissue.
However, it is the toxins produced by the pathogen upon entry that travel along neurons and spread
into the nervous system, inhibiting certain messages from being passed along the neurons and
causing motor neurones to be hyperactive. This leads to severe, unopposed muscle spasms in the
infected human host.
Bacteria are relatively large compared with viruses. Viruses are small enough to be taken up
by host cells via receptor-mediated endocytosis. Instead of endocytosis, some bacteria can enter
host cells via phagocytosis. This is a process performed by specialist white blood cells such as
macrophages. Macrophages normally ingest then destroy foreign microbes.
TABLE 12.3 Bacterial diseases and their symptoms
NAME OF BACTERIA DISEASE SYMPTOMS INCUBATION PERIOD
Clostridium tetani Tetanus Sustained, severe muscle contractions 3–21 days

due to blocking of nerve impulses by
tetanus toxin
Mycobacterium Tuberculosis A cough that persists, coughing up of 3–9 weeks from infection to development of a
tuberculosis (TB) sputum or blood, fever/night sweats, significant tuberculin. TB can stay dormant in the
steady loss of weight, fatigue. body for months or years. While TB is dormant, the
These symptoms are observed in sufferers host shows no symptoms. This is called ‘latent TB’.
of active TB disease. The host is not infectious while it is latent.
Agrobacterium Crown gall Galls form on stems, roots, trunks or 8 weeks until galls become visible
tumefaciens of plants branches, which can lead to stunted
growth and wilting (because the gall
formation interferes with water and food
transport).
Initially, galls form on the ‘crown’ of the
plant, which refers to where the main
roots join the stem, just above soil level.
nilttaC legiN/otohP kcotS ymalA
FIGURE 12.13 Close-up of a plant affected by

crown gall
9780170452922
The disease TB is caused by the bacterium Mycobacterium tuberculosis. TB has affected the
human race for thousands of years and remains one of the leading causes of mortality throughout
the world. When a pathogen enters the respiratory system of a human host, macrophages in the
lung’s alveoli normally ingest and destroy the foreign microbes. Interestingly, some bacteria, such as
Mycobacterium tuberculosis, have acquired the ability to survive, replicate and evade macrophages.
The pathogen contains virulence factors that may increase the severity of the disease, especially if the
host is susceptible (such as someone with a weak immune system). Instead of destroying the bacteria,
the phagocyte provides a location where it can multiply through binary fission. While the bacteria is
multiplying, and destroying host cells, the disease is categorised as active and symptoms develop.
Like the tetanus pathogen, the bacterium Agrobacterium tumefaciens enters its host through
a wound. Unlike the tetanus pathogen, the host of Agrobacterium tumefaciens is a plant . This
bacterium causes crown gall, a disease that involves the induced growth of tumour-like galls around
the stem of plants. When the pathogen enters a wound, it inserts a gene from its plasmid into the
genome of the host cell, causing rapid cell growth and the formation of galls. The galls are malformed
Binary fission
Play the animation to growth that becomes a barrier in the infected host plant’s transport system for water and nutrients,
review binary fission. causing the plant to wilt and have stunted growth.
Question set 12.3a

REMEMBERING cytokinesis occurs and the cell pinches
1 State three ways in which a bacterial in two; two identical daughter cells form,
pathogen can harm its host. each possessing a plasma membrane and
2 Define binary fission, and draw and a cell wall.
annotate the following stages: replication UNDERSTANDING
begins at the ‘origin of replication’, a 3 Describe the advantages of bacteria:
region of DNA on the chromosome and a having a capsule
also on the plasmid; the two copies of b forming endospores/spores.
the chromosome attach to the plasma 4 Describe the methods by which different
membrane and there are now two strains of bacteria can be classified or
copies of the plasmid; the cell elongates; identified.
a septum/cleavage furrow forms;
Fungi
The fungal world includes large organisms, such as mushrooms and toadstools, as well as minute
forms that were only revealed with the invention of the microscope. These microscopic fungi include
unicellular yeasts and moulds. They are plant-like organisms with cell walls, but their cell walls are not
made of cellulose and the cells do not contain chlorophyll.
Structural features of fungi and fungi reproduction

Fungi are eukaryotes whose cells have membrane-bound organelles, including a membrane-
bound nucleus. Fungal cells possess cell walls made of chitin, rather than cellulose. Most fungi
do not have flagella. A flagellum is a long tail that, through whip-like motion, propels the spore
form of fungi through water (a spore with a flagellum is called a zoospore). Chytrid fungi do
have flagella and are therefore motile and able to move towards favourable conditions using
the whip-like motion of the tail. Single-celled fungi are generally larger than bacteria. Most fungi
grow multicellular filaments, structures that play an important role in how they obtain food.
Filaments are long and thin, which gives them a high surface area for absorption. The network of
tiny filaments that forms is called hyphae (singular hypha). Hyphae have strong tubular cell walls
(made of chitin) surrounding the cell membrane of each cell. Hyphae grow to form an interwoven
9780170452922
mass known as a mycelium. This makes up the body of the fungus. A mycelium can infiltrate the
tissues of the host on which it feeds. Most fungi produce spores, either through sexual or asexual
reproduction. The mature mycelium forms sporangia (singular sporangium), which release spores.
When the spores make contact with a new, moist food source, they may germinate to form a new
mycelium.
a b Septum Cell wall c Proteins
Glucans
Nucleus Chitin
10 µm
FIGURE 12.14 Basic structural features of fungi: a optical microscope image of a mycelium film showing a
branched network of microfilaments (hyphae); b schematic representation of a hypha composed of cells
separated by cross walls (septa), all enclosed within a cell wall; c schematic representation of the cell wall, a layer
of chitin that surrounds the cell membrane
Key concept
The structural features of fungi include that they:
• are eukaryotic cell structure with membrane-bound organelles/nucleus
• have a cell wall made of chitin
• are unicellular or multicellular
• can be microscopic or macroscopic
• can be made up of filaments (hyphae)
• can have a body consisting of a mass of hyphae, known as the mycelium.
Some fungi are pathogenic, causing disease in a wide range of organisms, including plants and
animals. As is the case with bacteria, not all fungi cause disease.
Most fungal diseases in animals are external, where they irritate and inflame the skin. A common
example in frogs is chytridiomycosis (amphibian chytrid fungus disease). As a fungus grow on the skin,
it produces spores. Spores are very long lived, an adaptation that improves transmission rates – they
can remain alive for years, germinating when conditions are suitable.
TABLE 12.4 The fungal disease chytridiomycosis and its symptoms
DISEASE FUNGUS SYMPTOMS INCUBATION PERIOD
Chytridiomycosis Batrachochytrium Skin gets thickened and hardens. Respiration 2–10 weeks. Death
dendrobatidis becomes difficult because significant gas follows the onset
exchange usually occurs across moist skin of symptoms within
under normal conditions. The amphibian approximately 2–3
can become lethargic. Hind legs extend, and days.
the amphibian becomes sluggish and has no
appetite. These symptoms can lead to death.
9780170452922
nailartsuA ’seirtsudnI kcotseviL ORISC ,ttayH xelA rD :ecruoS

Ribosomes
b
//:sptth( 0.3 YB CC .)LHAA( yrotarobaL htlaeH laminA

Released
zoospore Nucleus
)/0.3/yb/sesnecil/gro.snommocevitaerc
Flagella
Discharge
tube
Zoosporangia
Developing
c zoospores
dleeB-netiuB/otohP kcotS ymalA
Rhyzoids
FIGURE 12.15 a Micrograph of the fungus pathogen Batrachochytrium dendrobatidis zoospores (×1400). b Diagram of the pathogen in
its zoosporangia form with zoospores developing inside. c Amphibian displaying signs of chytridiomycosis (amphibian chytrid fungus
disease), the disease caused by the pathogen.
CASE
STUDY
History and ecology of chytridiomycosis
Batrachochytrium dendrobatidis live in water Susceptibility can vary. In some
or soil. They produce spores that are motile in populations, mortality is 100%. The Australian
water, which means they can swim through Government has funded an abatement
water. Individual amphibians contract the project, addressing the impacts of chytrid
disease when their skin comes into contact fungus. The two main goals are:
with water containing spores that have 1 to prevent the spread of the fungus into
travelled from infected amphibians. areas in Australia that are disease free
The chytrid fungus enters the surface 2 to decrease the impact of the pathogen on
layers of the frog’s skin, causing damage populations currently infected.
to the outer keratin layer. When frogs are Questions
disease free, the skin has many functions,
Chytridiomycosis including gas exchange and regulation 1 Explain how susceptibility and mortality
Explore of osmosis and salts. As the skin hardens rates are related.
chytriodiomycosis by
reading through this and thickens, these functions are hindered, 2 Explain why the rate of gas exchange
resource. along with homeostasis of water, salts and decreases as the disease worsens. Describe
gases. the effect on frog cellular respiration.
Protists
Protists are a diverse and mostly unicellular group of eukaryotic organisms. Of the 65 000 known
species of protists, less than 24 species cause diseases in humans, but these few infect hundreds of
millions of people each year. To date, we still do not have effective preventatives against many of
them, and the treatment drugs we have are limited in their effectiveness. Some protists resemble
animal cells, some resemble plant cells, and some resemble fungal cells. A variety of specific, unique
features set them apart.
9780170452922
Structural features of protists and protist reproduction

Protists can be very small, smaller than prokaryotes. Their size can vary from 2 µm to 1000 µm
What is malaria?
(1 mm). They all have a membrane-bound nucleus and many are free-living. They can reproduce Read this interesting
both sexually and asexually. The mode of reproduction can depend on the environmental conditions introduction to malaria.
present. Protists are extremely diverse structurally, and their evolutionary history is complex. The
The Malaria Challenge
paragraphs below describe examples of just two of the many groups of protists. Play the Malaria
Species in the genus Plasmodium belong to a Protista group resembling animals. They have no Challenge to learn about
Plasmodium.
chlorophyll or cell walls. Animal-like protists are sometimes referred to as protozoa. Plasmodium
is classified into the parasitic group called Sporozoa (Apicomplexa). These parasitic protists spread Malaria Lifecycle Part 1:
Human Host
through their host in the form of tiny infectious cells called sporozoites. Apicomplexans were given Watch the 4-minute
this name because at one end, the apex, the sporozoite cell contains specialised organelles for video found here on
penetrating host cells. They have no means of locomotion. malaria.
Species in the genus Phytophthora belong to a group of Protista resembling plants. They
have a cellulose-based cell wall. Phytophthora is classified into a group called stramenopiles
because they have a distinguishable flagellum (plural flagella). A flagellum is a long, thin, thread-like
organelle projecting from a cell. Phytophthora have a set of flagella (one hairy and one smooth) for
locomotion, and they have an extensive network of filaments that allow for nutrient uptake. They are
further classified as oomycetes (water moulds) because of their fungus-like network of filaments.
Phytophthora cinnamomi parasitise terrestrial plants by attacking their root systems. Infected plants
can be seriously affected, and P. cinnamomi is devastating jarrah forests in WA and Tasmania. The
hyphae can penetrate the external surface of a plant and extend into its phloem, depriving it of valuable
nutrients and reducing crop yield. Part of the pathogen’s life cycle includes the production and release
of large quantities of spores that effectively transmit these pathogens to new hosts. A spore is a
reproductive cell that forms without fertilisation occurring. After germination, the spore can produce Phytophthora dieback
Read about
a mycelium, which is the new organism. Phytophthora spores are flagellated and therefore can be phytophthora dieback
referred to as zoospores. Zoospores are only found in some protists and chytrid fungi. and its impact in WA.
TABLE 12.5 Two protist diseases and their symptoms
DISEASE PROTIST SYMPTOMS INCUBATION PERIOD
Malaria Plasmodium Fever, headache, chills (shaking), sweating and 10–15 days
falciparum is the vomiting.
most deadly. If left untreated and a host is susceptible,
Five species of complications can develop, such as anaemia
Plasmodium (because red blood cells burst) and liver failure. The
cause malaria. complications can cause death.
Phytophthora Phytophthora Areas of the plant appear rotten and may have lesions Depends on susceptibility of plant
dieback cinnamomi (where the pathogen has consumed the cell’s sugars). (affected by age and species). Incubation
(jarrah Wilting occurs, root systems die (dieback), and plant can range from weeks to months. Once
dieback) death follows (usually quickly and completely, not one wilting starts, death follows quickly.
branch at a time).
More than one million Australians visit Bali every year. A protist of interest, Giardia lamblia
(Figure 12.16, page 422), is a relatively common parasite that infects travellers to Bali. This flagellated
protist can cause mild intestinal upsets, such as diarrhoea, but may also have more severe effects in
the young or the elderly. It is often found in the bodies of cattle or wild animals and usually leaves Protists and fungi
their bodies (in the form of a cyst) through the faeces. People become infected if they drink water that View this video on
contains these cysts. In Australia, this has not usually been a problem, because our sewage system is protists and fungi
to reinforce your
well isolated from our drinking water. However, it is a major problem in many developing countries, knowledge of their
where travellers are advised never to drink water that is not bottled or boiled. structures.
9780170452922
/0.4/yb/sesnecil/gro.snommocevitaerc//:ptth ecneciL
0.4 YB-CC .dtL erutaN regnirpS ,stropeR cfiitneicS
FIGURE 12.16 Scanning electron micrograph of Giardia lamblia (yellow) in the human small intestine. This
flagellated protist contaminates drinking water, causing intestinal upsets.
Key concept
The structural features of protists include that they:
• are relatively small 2–1000 μm
• are eukaryotes, with a membrane-bound nucleus
• are mostly unicellular
• can reproduce sexually and/or asexually
• can exist in different forms during their life cycle, depending on their classification (for
example, spores or zoospores, filaments, hyphae and mycelia)
• can be plant-like, animal-like or fungi-like in their structural or reproductive features.
12.1 Fungi have cell walls. Phytophthora cinnamomi was originally classified as a fungus. It has a cell
wall. It has a life cycle and reproduces in a similar way to a fungus. The pathogen grows fine
NOITACILPPA
filaments, called hyphae. Similarly to a fungus, it produces spores.

Can you explain why it is currently classified as a protist instead of a fungus?
(Hint: Phytophthora cell walls are made of cellulose. Its similarity to fungi is considered to
be a case of convergent evolution.)
Question set 12.3b

1 Recall the structural features eukaryotic 5 Discuss the relationship between type of
pathogens have in common. pathogen and type of symptoms.
2 Name and describe a plant disease caused 6 Distinguish between the features of a
by a protist agent. fungal pathogen and a bacterial pathogen.
3 Describe the symptoms caused by 7 Describe the difference between malaria
Plasmodium falciparum. and Plasmodium .
4 Distinguish between the structural
features of fungi and protists.
9780170452922

What does a million look like? 12.1
You will need
YTIVITCA
• Small quantity of rice
• A balance
What to do
1 Weigh out 1 g of rice.
2 Count the grains.
3 Calculate the mass of rice that would provide one million grains.
Were you surprised by what a million looks like?
Fomites and pathogens 12.1

Some bacteria can survive for days or even weeks on surfaces such as handrails, chopping boards and
NOITAGITSEVNI
bathroom sinks. In this investigation, you will test the degree of contamination of four different fomites,
by swabbing the objects and counting the number of bacterial colonies that grow on agar plates.
Aim
To compare the degree of contamination of four different fomites
Materials
Class requires:
• Incubator set to 25°C
Each group requires:
• 4 nutrient agar plates
• Marking pen
• Unopened box of sterile cotton swabs
• Sticky tape
• Disinfectant solution
Risks
Dispose of plates appropriately.
Disinfectants may damage clothes and cause skin irritation. Wear gloves and lab coats.
Procedure
Note: to minimise contamination, wipe the bench down with bleach or alcohol before you start.
1 Choose four objects, such as a doorknob, chopping board or coin, that you think may be covered
with bacteria. Write a hypothesis to predict the degree of contamination of your four different
fomites.
2 Sample one of your objects by rubbing a sterile swab tip across its surface.
9780170452922
3 Open the lid of the agar plate and, starting at the top, gently drag the swab in a zig-zag motion
down and across the agar, taking care not to gouge the surface.
4 Replace the lid quickly, seal the plate with sticky tape and label it with your group’s name and the
name of the object.
5 Repeat steps 2 to 4 using your other fomites.
6 Place plates in an incubator at 25°C for 24–48 hours.
7 Ensure the bench is wiped down with bleach or alcohol and wash your hands thoroughly.
8 Devise a way of scoring the amount of bacterial growth on each plate (e.g. no coverage, partial
coverage, complete coverage etc.).
9 The next day, do not open the plates. Use your scoring system to record the amount of bacterial
growth on each of the plates.
10 Dispose of your plates as instructed by your teacher, ensure the bench is wiped down with bleach
or alcohol, and wash your hands thoroughly.
Results
1 Record your results for each fomite in a suitable table.
Analysis of results
1 Which fomite grew more colonies? Why do you think this was the case?
2 Describe the pattern observed in the size and number of colonies in the streaking on each plate.
Discussion
1 Was there a control in this experiment? Explain why this is, or is not, important.
2 List four factors that you would need to control to make this a fair (valid) test.
3 Identify any possible limitations in the data by considering the sample size and measurement
errors.
4 Write a conclusion, ensuring that you refer back to your hypothesis.
Thinking deeper
It is clear that inanimate objects and the hospital environment can become contaminated with
dangerous pathogens, and that these organisms can persist for long periods of time if not eradicated.
Fomites
Many Gram-negative species, such as Escherichia coli, can survive on inanimate surfaces for months.
More information Mycobacteria, including Mycobacterium, also survive for many months on surfaces. A few others, such
about fomites can as Haemophilus influenzae and Vibrio cholerae, however, persist only for days. Explain how fomites can
be found here. be directly linked to patient infection.
In which areas and on which equipment would you expect most contamination to occur, and how
could you mitigate the spread of pathogens?
12.2 Investigate the effectiveness of different anti-microbials on pathogen

growth
NOITAGITSEVNI
Design your own similar investigation into the effectiveness of three different antiseptics/antibiotics/
antimicrobials such as Dettol, honey, tea-tree oil.
Use four Petri dishes. One acts as a control without an antimicrobial.
9780170452922
CHAPTER 12 SUMMARY
WS
Chapter 12
• Disease is any condition that interferes with contaminated food or water, or disease- Activity sheet
the proper functioning of an organism. specific vectors.
• Infectious diseases are caused by any agent • Specific diseases are characterised by
that can be transmitted from one organism their virulence, incubation period and
to another. recognisable symptoms.
• Pathogens are disease-causing agents. • People differ in their susceptibility to
Cellular pathogens include bacteria, fungi, various diseases.
protists, endoparasites and ectoparasites. • Viruses and certain parasites are host
Viruses and prions are non-cellular specific. Zoonoses can be transmitted
infectious agents that are always pathogenic. between vertebrate species.
• Pathogens have adaptations to ease their • Pathogens have adaptations to facilitate
entry into cells of vectors, intermediate their transmission between hosts.
hosts and the final host. Examples of such adaptations include
• Transmission of disease occurs through long-lasting resistant spores (or similar,
various means, including direct contact, which enable them to remain dormant
close contact and indirect contact. outside a host), use of a vector, and ability
Contact can be with body fluids, the air, to exist in water.
CHAPTER 12 GLOSSARY
Bacteria Microscopic unicellular organisms that Endospore A tough, dormant structure formed
do not have a nuclear membrane or membrane- by many species of bacteria to help them resist
bound organelles – they are prokaryotic unfavourable conditions and disperse to new
Bacterial capsule A slimy layer surrounding hosts
the cell wall of some species of bacteria Filament A thread-like series of tubular
Bacteriophage A virus that invades bacteria cells connected end to end; each cell is
surrounded by a cell wall; each filament is
Binary fission The division of a cell into
a hypha, and multiple filaments are called
two cells without mitosis; a prokaryotic cell
hyphae; a mass of interwoven filaments is
undergoes binary fission to form two identical
called a mycelium
daughter cells; a form of asexual reproduction
Flagellum A whip-like tail, which provides
Body fluid Any liquid that comes from inside
a zoospore and some other motile single cells
the body
with locomotion
Capsid The protective protein coat of a virus
Fungi A diverse kingdom of spore-producing,
Chitin The polysaccharide that is the main eukaryotic organisms; they have a cell wall
component of fungal cell walls and the made of chitin; they do not possess chloroplasts;
exoskeletons of insects and other arthropods they have a complex cell cycle, in which
Communicable Able to be communicated spores can develop into hyphae then grow into
(transmitted) from one organism to another a mycelium; they can be unicellular, but are
Contagious Able to be transferred by direct mostly multicellular
contact Gall A brown, roughened lump of
Endocytosis A process by which material can undifferentiated tissue on the crown of a plant
pass into a cell: the cell membrane folds inwards (where the roots meet the stem on a small plant,
to form a small sac around the incoming material or where a branch meets the trunk of a tree); it
or may extend outwards for larger particles (in looks tumour-like
which case it is termed phagocytosis)
9780170452922
Germinate Grow and develop from a spore Pathogen A disease-causing agent

into hyphae and a new mycelium (in the case of Pathogenicity The capacity of a pathogen to
fungi); from a seed into the first root and shoot cause disease in a host
(in the case of plants)
Peptidoglycan A protein–carbohydrate
Host An organism that is infected by a compound that forms the cell wall of bacteria
pathogen
Phagocytosis The process of engulfing and
Hyphae (singular hypha) A network or branch destroying a microbe
of tiny filaments; a hypha is one of the filament
threads Plasmid A small, circular piece of DNA,
found in bacteria, that is able to replicate
Incubation period The time between infection independently of the cell’s chromosomes;
and the onset of symptoms engineered plasmids can carry antibiotic-
Infection The invasion of host by a pathogen, resistance markers
where it establishes itself and replicates
Prokaryote A single-celled organism that lacks
Infectious (communicable) Caused by an membrane-bound organelles such as a nucleus
invading pathogen and able to be transmitted
Protist An organism in the Kingdom Protista
from one organism to another
that is eukaryotic but may have plant-, animal-
Infectious agent A disease-causing agent that or fungus-like features; a protist is usually
can be transmitted from one organism to another unicellular and relatively tiny
Lysis The process of a cell bursting (verb: to Receptor In cell biology, a site on a cell
lyse) membrane that receives a signal, or the site on
Lytic phase Part of the life cycle of a virus in a host cell where a virus may attach prior to
which viral components are replicated and endocytosis
packaged to form new viruses that lyse the host Reservoir An organism (such as a wallaby)
cell or habitat (such as soil) in which a pathogen
Macrophage A white blood cell that can can reside, and sometimes replicate, prior
perform phagocytosis on microbes such as to entering a susceptible host; a reservoir is
pathogens, by engulfing them (endocytosis) and somewhere in which the pathogen does not go
destroying them with the use of enzymes extinct
Micro-organism A microscopic organism; for Resistance When an infectious agent or toxin
example, bacteria is acting on a host, resistance is the ability to
Motile Able to move spontaneously without withstand any adverse effects; it describes the
external force extent to which an organism is or is not affected
by an agent such as a pathogen or chemical toxin
Mycelium An interwoven mass of hyphae; it
forms the body of a fungus Sporangia (singular sporangium) A spore case
in which asexual spores are formed
Nucleic acid The molecule (DNA or RNA) that
forms the genetic code in an organism Spore A reproductive cell that forms without
fertilisation. Spores can produce a mycelium
Obligate parasite An organism that can only
survive in another organism; it is ‘obliged’ to after germination
live in another organism Sporozoite The tiny, infectious cell form of
a parasite (such as Plasmodium); it is often
Outbreak A sudden, unexpected increase in
the prevalence of a particular disease above the the infective agent that enters the host; it is a
baseline level for that population; it could be relatively immature form of a pathogen
a single case of a contagious disease in a small Susceptibility The likelihood of developing a
community disease; if the susceptibility of an organism is
Parasite An organism that lives on or in its high, its ability to resist the disease is low
host for all or part of its life, causing harm to Symptom A subjective experience felt by a
and gaining nutrition from the host patient, such as nausea and pain
9780170452922
Toxin A waste product of bacteria and other Virulence A measure of the ability of a
microbes that is poisonous to a host pathogen to cause severe disease within its host
Transmission Transport of a pathogen from Virus A non-cellular pathogenic agent,
an infected host or a reservoir to a susceptible containing either DNA or RNA, that can only
host reproduce inside a living host cell
Unicellular Single-celled Zoonotic disease A disease that animals
Vector In reference to diseases, a vector is an pass to humans; an infection that is naturally
agent that transmits pathogens from one host to transmitted between other vertebrate animals
another; in genetics, it refers to a vehicle used to and humans
transfer DNA sequences from one organism to Zoospore A spore with a flagellum; it is one of
another several forms of a fungal or protistan organism

Remembering
1 Recall four symptoms of:
a influenza
b Ross River virus disease
c Australian bat lyssavirus.
2 Name one honeybee disease caused by a virus and describe two to three symptoms.
3 Identify two adaptations that aid the entry and transmission of fungal pathogens into a new
host.
4 State two important differences between a bacterium and a virus. Give two examples of
diseases that are caused by each of these pathogens.
5 Recall four symptoms of:
a tuberculosis
b tetanus
c crown gall of plants.
6 State two diseases caused by each of the following pathogens: fungi and protists.
7 Describe the feature that helps classify Phytophthora as a protist and not a fungi.
Understanding
8 Explain why classifying protists is challenging.
9 Which human systems are infected by the tuberculosis and malaria pathogens?
10 Explain why the symptoms of tuberculosis and malaria are so different, based on your answer
to Question 9.
11 Draw an annotated diagram of the process by which bacteria reproduce.
Applying
12 Differentiate between pathogenicity and virulence, and include examples of organisms that
demonstrate these features.
13 Define endocytosis and describe how it is applied in virus replication and in macrophage
phagocytosis of tuberculosis bacteria.
9780170452922
Analysing and creating

14 Name two structural characteristics or reproductive strategies characteristic of each of the four
pathogen types listed below. Which of these are unique to the pathogen type? Create a Venn
diagram showing the similarities and differences in structure between two of the types of
pathogens.
a virus
b bacteria
c fungi
d protist
15 Figure 12.17 shows the number of cattle infected with the pathogen causing BSE (bovine
spongiform encephalopathy; also known as mad cow disease) in Britain for the years 1985–95.
Since 1992, feedstuff containing sheep offal has been banned.
40 000
30 000
elttac ESB fo rebmuN
20 000
10 000
0
1985 1990 1995
Year
FIGURE 12.17 Number of cattle infected with BSE from 1985 to 1995
a Describe the trend in numbers of BSE-infected cattle in Britain from 1985 to 1995.
b Suggest a reason for the decline in the incidence of BSE since 1992.
c The infectious agent that causes BSE can infect humans, causing Creutzfeldt–Jakob disease.
Does this make Creutzfeldt–Jakob disease zoonotic? Explain your answer.
16 Consider the stages in the replication of a virus. Imagine you are a chemist trying to find
antiviral medicines. Describe two points at which a virus would be susceptible to antiviral
chemical therapies.
9780170452922

1 Which of the following human diseases is B a bacterium that enters the plant
transmitted by a vector? through wounds in the roots or stem
A influenza C a virus that enters the plant through
B tuberculosis stomata in the leaves
C tetanus D a virus that enters the plant through
D malaria wounds in the roots or stem.
[Q5 2017 SCSA] [Q24 2018 SCSA]
2 Chytridiomycosis is a: 6 Malaria and tuberculosis are infectious

A fungal disease of plants diseases of humans. Malaria is caused by a
B fungal disease of amphibians protist. Describe the main structural features
C bacterial disease of plants of protists. (4 marks)
D bacterial disease of amphibians. [Q35a 2018 SCSA]
[Q5 2018 SCSA]
7 There are four main groups of organisms
3 Which of the following statements about that cause infectious disease. Protists
fungal and bacterial cells is most accurate? are one of these groups. Name the three
A Neither fungal cells nor bacterial cells other groups and describe their structural
have cell walls. characteristics. (10 marks)
B Fungal cells have cell walls but bacterial [Q38a 2016 SCSA]
cells do not.
8 State how infectious disease differ from
C Fungal cells do not have cell walls but
other types of disease. (2 marks)
bacterial cells do.
D Both fungal and bacterial cells have cell [Q34a 2016 SCSA]
walls. 9 State the type of organism that causes the

[Q6 2018 SCSA] following diseases and the type of organism
affected by the disease. An example is
4 In order to be regarded as infectious, a
tuberculosis. Tuberculosis is caused by a
disease must be:
bacterium and affects humans. (6 marks)
A caused by a pathogen
a crown gall
B caused by a mutation
b chytridiomycosis
C able to infect humans
c phytophthora dieback
D able to infect animals.
[Q34b 2016 SCSA]
[Q13 2018 SCSA]
10 Name and describe the process by which a
5 Crown gall disease in plants is caused by:
bacterial cell reproduces. (4 marks)
A a bacterium that enters the plant
through stomata in the leaves [Q31a 2016 SCSA]
9780170452922
430
13
SPREAD OF CHAPTER 13 CONTENT
PATHOGENS material.
STARTER QUESTIONS
1 Can you give examples of the different ways pathogens can
spread from host to host?
2 Why are some pathogens spread more easily and transmitted
further and faster than others?
3 How are some infectious diseases transmitted by
mosquitoes?
» the life cycle of a pathogen and its associated diseases,
including the method of invading the host, the impact on
the host, and the mode of transmission (direct or indirect),
determines its success for survival
» the spread of a specific disease involves a range of
interrelated factors, including
– growth of the pathogen population
– density of the host population
– mode of transmission
» transmission and spread of disease are facilitated by regional
and global movement of organisms
» the distribution of mosquito-borne diseases may be affected
by global climatic changes
» many pathogens evolve rapidly in a changing environment

» susceptibility of urban areas to epidemics and pandemics of
infectious disease can be due to population density, variation
in living conditions and healthcare provisions
9780170452922
CHAPTER 13 | Spread of pathogens 431
13.1 THE LIFE CYCLE OF A PATHOGEN

As for all organisms, pathogens strive to survive and reproduce, but pathogens usually do so at the
expense of a host. The host provides an environment that assists in the survival of the pathogen. In
order to best survive and reproduce, pathogens need to:
• invade the host (have a portal of entry)
• exploit a nutrient-rich area of the host
• avoid host defence mechanisms
• replicate
• exit (have a portal of exit) and transmit to new hosts (mode of transmission).
This is known as a pathogen’s life cycle. Some pathogens have developed elaborate life cycles
that enable them to survive, reproduce and spread. Pathogens spread by being transmitted from an
infected host (or reservoir) to a susceptible host. The infected host may travel and thus transport a
disease, which further increases spread. Understanding the infectious cycle is critical for identifying
suitable strategies for controlling a pathogen.
Infected host
reservoir
Site for
Susceptible host replication of
infectious agent
Portal of entry Portal of exit
Some infectious
Mode of diseases have
transmission another
possible reservoir
FIGURE 13.1 Generic life cycle of a pathogen
There are different ways pathogens can enter a host. The susceptible host has various portals
of entry through which the micro-organism can enter. Portals of entry can be mucous membranes,
which are surface membranes that are moistened with slimy, sticky and viscous mucus. Mucous
membranes are found in the human respiratory, gastrointestinal and reproductive tracts. They are
lined with epithelial cells that secrete mucus. Other portals of entry are skin, wounds, eyes and ears.
The outer layer of tissue in a plant or a human is known as the epidermis. It usually provides a
physical barrier to pathogens. As long as it remains unbroken, the tough waterproof skin is an effective
barrier against invaders; however, the external openings of the respiratory, digestive, excretory and
reproductive systems provide ideal entry points into any organism. If the skin is wounded, a pathogen
can penetrate the barrier using the wound as a portal of entry. Examples of pathogens that enter
through wounds include the bacteria Agrobacterium tumefaciens, which causes the formation of a
gall in the crown areas of plants, and Clostridium tetani, which causes tetanus in humans.
Many pathogens enter the host via the same portal that they exit: for example, the pathogen
Mycobacterium tuberculosis, which causes the disease tuberculosis (TB). This bacteria enters and
exits through the respiratory system. The infected host may cough, and the susceptible host may
inhale the airborne droplets containing the pathogen.
9780170452922
TABLE 13.1 Portals of entry and exit
PORTALS OF ENTRY PORTALS OF EXIT

Skin (bite, blood feed, penetration) Bite/blood feed/saliva
Mucous membranes Digestion (elimination)
Wounds in epidermal layers of animals and plants Respiratory system (coughing, sneezing)
Eyes and ears Blood contact
Respiratory system (nose/throat/lungs) Reproductive system (e.g. some honeybee viruses
Reproductive system passing from queen bee to worker bees)
After entry, many pathogens attach to host cells. Some pathogens then multiply in between host
cells or within body fluids, while others, such as viruses and some bacteria, enter the host cells and
replicate there.
The impact on the host can include mild to severe symptoms or signs. Many of these are listed in
chapter 12. Tissue structure and function is usually affected. Tissue damage or abnormal function may
be due to the replication of the pathogen, or toxins produced by the pathogen, and death is a possible
outcome. Symptoms are usually subjective and include the feelings or experiences of a patient, such
as nausea and pain. In contrast, signs of disease are usually objective and measurable and can be
directly observed. Elevated body temperature and breathing rate are considered vital signs of disease.
Key concept
The pathogen life cycle is dependent on having portals of entry and exit to and from a susceptible
host, the ability to replicate, and modes of transmission.
Question set 13.1

1 List the general steps in the life cycle of a 4 Differentiate between signs and
pathogen. symptoms of a disease.
2 List three openings in the skin that can 5 Explain why a wound can be a portal of
allow the entry of pathogens. entry.
3 Describe mucous membranes and recall
where they are found in humans.
13.2 MODES OF TRANSMISSION

The life cycle of a pathogen requires a mode of transmission. Without a mode of transmission, the
pathogen will die when the host dies. Transmission is how the pathogen is transferred from the host
and/or a reservoir to a susceptible host, which can involve developmental stages occurring in the
environment or in vectors. Vectors are living or non-living things that transport pathogens from the
infected host to a susceptible host. Mosquito vectors transport pathogens through blood feeds. Bat
vectors transport pathogens through bites and scratches. The different modes of transmission are
commonly classified as direct or indirect. Direct transmission is the transfer of a pathogen from an
infected host, or other reservoir, to a susceptible host by direct contact or close contact. Indirect
transmission is the transfer of a pathogen from a reservoir to a host through vectors (inanimate vehicles
or living intermediaries) or suspended air particles. Indirect transmission may require one or more steps.
Pathogens rely on the hosts they infect for nutrients or a site for replication. A reservoir is an organism
or habitat (such as soil) in which a pathogen can reside, and sometimes replicate, prior to entering a
susceptible host. Some pathogens have a definitive host (a single host), within which the adult phase of
the pathogen produces gametes, and which also acts as a reservoir, whereas other pathogens require a
host and a separate reservoir (an intermediate host, such as another species of animal).
9780170452922
Direct transmission
Direct contact
Direct contact involves the transmitting of a pathogen through physical touch between the infected
host and a susceptible host via skin or body fluids. Body fluids are any liquids that come from inside
the body, including sweat, tears, vomit, nasal secretions, blood, saliva, sexual fluids and urine.
Close contact
Pathogens can be transmitted via airborne droplets when there is close proximity (usually within
1.5 metres) between infected and susceptible host, particularly by sneezing, singing or coughing.
When an individual coughs or sneezes, small droplets of mucus that may contain pathogens are
ejected, and these can be inhaled by someone close by. A cough, a sneeze or singing can release
millions of microbes into the air in droplets of mucus or saliva that are so small they can remain
airborne for extended periods of time. If a droplet lands on the mucous membranes of a person’s
mouth, nose or eyes, they may catch the disease. Sometimes talking, singing or just breathing out
is enough to allow pathogens to leave the host and become airborne in aerosols. Transmission
by airborne droplets through close proximity is classified as direct, because transmission is by
direct spray over a short distance (before the droplets fall to the ground) from an infected host’s
respiratory system into a susceptible host’s respiratory system. TB and influenza can be spread in
this way.
From a reservoir
Transmission can occur from a reservoir directly to a susceptible host. A reservoir is a living or
non-living site in which a pathogen normally resides and possibly replicates. The pathogen may be
dormant in this site. An example of a non-living reservoir is soil (the reservoir of tetanus bacteria).
In zoonotic diseases, animals act as reservoirs of human disease and transmit the infectious agent to
humans through direct or indirect contact. In some cases, such as ABL, the disease also affects the animal;
in others the animal is asymptomatic. The first step requires the pathogen to exit the body of its current
host. It must then gain transport to a suitable new host, enter their body, establish itself in their tissues and
finally ensure it is once again passed to a new host.
Indirect transmission
Living vectors
A living vector is usually a vertebrate or an arthropod that transmits a pathogen from an infected
host to a susceptible host. Bats and mosquitoes can be vectors. Vectors may be infected, such as
the Anopheles mosquito that transmits Plasmodium. This means the pathogen reproduces inside the
vector. Some vectors are carriers and are not said to be infected, because the pathogen does not
reproduce inside the vector. A vector may also enable a pathogen to penetrate the outer defences
of the potential host in a way that would not be possible unassisted. The varroa mite is a vector for
several bee diseases. It can be infected or be a carrier.
Airborne droplets
Pathogens can be transmitted inside airborne droplets (aerosols) that are sneezed or coughed into the
air and are suspended in air currents for a period of time before being inhaled or landing on a surface
such as a table or tissue (a fomite). Transmission is indirect because it does not occur until later, when
a susceptible host touches the fomite or inhales droplets, or it occurs over a longer distance. These
tiny particles can travel considerable distances in air currents. Crowded indoor environments may
promote the chances of airborne transmission, which explains the increase in respiratory infections
during winter months.
9780170452922
Soil, water, food and fomites

Non-living objects can carry a disease-causing agent from one host to another during the life cycle of
a pathogen. Fomites are surfaces or objects that can carry an infectious agent. Examples include car
tyres, clothing, eating utensils and mobile phones. Some diseases can also survive in soil and water
until they find a suitable host. Crown gall and phytophthora dieback are two examples of diseases that
can be spread by non-living objects.
Transmission due to physical touch between an infected host and
a susceptible host via skin or body fluids
Direct
contact Australian bat lyssavirus (ABL) via infected bat
Influenza, COVID-19
Transmission of pathogen in airborne droplets between an

infected host and a susceptible host, such as sneezing/coughing
Close
Direct within 1.5 metres or due to close proximity
contact
Transmission from an inanimate reservoir/fomite to a susceptible

host. A reservoir could be soil, as for tetanus bacteria.
Reservoir
(other) Tetanus
Influenza, COVID-19 (fomite)
MODES OF A living thing that transmits a pathogen from an infected

TRANSMISSION host to a susceptible host.
Tetanus via dog-bite saliva

Vector
Honeybee viruses via varroa mite
Ross River virus disease by mosquitos
Malaria by mosquitos
Pathogens can be transmitted inside airborne droplets (aerosols)

that are sneezed or coughed into air and are suspended for a
period of time before being inhaled. They may land on surfaces
Airborne
and be transferred by a fomite.
Indirect droplets
Air/Fomites
TB
An inanimate object acts as an intermediary between the portal of

exit from the reservoir and the portal of entry to the host. For
example, car tyres and human shoes can carry pathogens from a
contaminated area to an area containing susceptible hosts.
Soilborne/ Pathogens can swim or be carried through water or wet soil from
waterborne/ an infected host to a susceptible host.
vehicle
Crown gall can enter via a wound
Chytridiomycosis
Phytophthora dieback
FIGURE 13.2 Examples of diseases and their modes of transmission
Key concept
Transmission of a pathogen can be direct or indirect. Direct transmission requires direct or close
contact between an infected host or reservoir and a susceptible host. Indirect transmission is when
vectors, fomites or airborne, soilborne or waterborne transmission transfers a pathogen from an
infected host or reservoir to a susceptible host.
9780170452922
Is food a vehicle for disease? 13.1

The growing trend towards consuming take-away meals makes food poisoning an increasingly
NOITACILPPA
important problem in the developed world. Food should be eaten immediately after purchase
or kept hot enough to kill bacteria. If it is to be stored, the food must be cooled very quickly to
prevent the growth of bacteria that could cause food poisoning.
Questions
1 What steps do food manufacturers take to reduce the chances of food poisoning being
caused by their food?
2 Use the weblink or other resources to find out the names of the pathogens that most
commonly cause food poisoning from eating: Foods that cause food
poisoning
a poultry Read this resource to
b beef explore the different
c vegetables. types of contaminated
food.
Question set 13.2

1 Recall the names and descriptions of three 4 Explain the difference between direct and
direct modes of transmission. indirect transmission.
2 Recall the names and descriptions of three 5 Explain the difference between direct
indirect modes of transmission. transmission of airborne droplets
3 Define reservoir and describe three and indirect transmission of airborne
different types of reservoirs. droplets.
13.3 PATHOGEN LIFE CYCLES FOR SOME

SIGNIFICANT DISEASES
In this chapter, the life cycles for each of the following 10 diseases will be investigated:
• influenza, Ross River virus disease, viral diseases of honeybees, ABL (caused by viruses)
• TB, tetanus, crown gall of plants (caused by bacteria)
• chytridiomycosis (amphibian chytrid fungus disease) (caused by fungi)
• malaria, phytophthora dieback (jarrah dieback) (caused by a protist).
The pathogens are discussed in order from smallest to largest, based on the general relative size
of the various types of pathogen: virus, bacteria, fungi, protist. Each life cycle requires a portal of
entry, site for replication (sexual or asexual if non-viral), portal of exit, possible reservoir (other than
human reservoir), and mode(s) of transmission.
Recall that viruses are not living and undergo replication instead of reproduction. In contrast,
bacteria, fungi and protists undergo either sexual or asexual reproduction during their life cycles.
Life cycle of pathogenic viruses

Influenza
The infectious agents that cause influenza are the influenza A, B or C viruses. These single-stranded
RNA viruses are usually transmitted from a respiratory tract, through the air inside airborne droplets,
when an infected host coughs or sneezes. Viruses, found in the airborne droplets or spray, are inhaled
and then enter the respiratory tract. Viruses will attach to epithelial cells along the respiratory tract
if those cells contain suitable virus receptor cells. The virus will undergo viral replication inside the
epithelial cells. Refer to Chapter 12 for the steps of viral replication.
9780170452922
After the release of new viruses from the epithelial cells, a cough or sneeze may send a spray of
airborne droplets into the air. The droplets may be inhaled by someone in close proximity or (if small
enough) become an aerosol and drift with air currents beyond the 1–2 metres, to be inhaled at a later
time or land on a surface, making it a fomite. Therefore, transmission, although usually direct via close
contact, can be indirect via airborne droplets or fomites.
Deaths caused by influenza or influenza-related illnesses were around 80 in WA during 2019,
which is a significant increase compared with the number in the previous year. The symptoms of
influenza can overlap with those of other illnesses common in winter. Symptoms that are more
common with influenza and which can help distinguish the flu from ordinary colds and coughs
include:
• fever
• severe fatigue
• general aches and pains
• cough
• vomiting and diarrhoea (in children).
Droplet b
a Influenza virus
Influenza virus structure
Nucleic acid
Portal of entry (RNA)
Lipid envelope
Aerosol Capsid
Portal of exit
Fomite
Shared spaces
Influenza virus replication
Distance
FIGURE 13.3 Influenza life cycle: a influenza virus portal of entry, modes of transmission, and portal of exit; b virus replicating inside
epithelial cells in respiratory tract
Ross River virus disease (epidemic polyarthritis)

The infectious agent that causes Ross River virus disease is Ross River virus. The disease involves
a rash and painful swollen joints, and it is sometimes misdiagnosed as arthritis (see Figure 12.7,
page 412). Like the influenza virus, it is a single-stranded RNA virus. The virus is an alphavirus and
is endemic in Australia, always present in some populations or regions. The virus is transmitted
indirectly by female mosquito vectors, usually from marsupial reservoirs such as wallabies or
kangaroos, to humans via blood feeds. Outbreaks in Australia have coincided with an increase in
rainfall and flooding, which increases the potential breeding sites for the mosquito vectors. The
disease is endemic in the south-west of WA, where outbreaks have been recorded, for example,
in 2017. The distribution of the specific species of mosquitoes that can carry the virus largely
determines where outbreaks occur. The major species of mosquitoes that can transmit the virus are
Aedes vigilax and A. camptorhynchus near saltmarshes and coastal areas, and Culex annulirostris
Mosquitoes elsewhere.
Female mosquito blood The portal of entry is via the skin and involves a female mosquito taking a blood feed. A blood
feeds and the structure
and function of the feed is the method used by female mosquitoes to ingest blood. They insert their proboscis, a tube-like
mosquito’s proboscis mouthpiece, into the skin and blood vessel of a host species to feed on blood. During the bite, the
9780170452922
mosquito’s saliva is transferred to the potential host via one of the tubes in the proboscis, numbing
the area and preventing the blood from clotting. Blood is sucked up from the potential host through
another tube in the proboscis and into the gut of the mosquito. It’s not until after the mosquito
withdraws its proboscis that the site may become itchy. The saliva exiting the mosquito and the blood
being ingested by the mosquito may both potentially carry pathogens. Female mosquitoes feed on
humans when they are carrying eggs and need protein. Mosquitoes choose their targets through a
combination of smell, heat and visual cues, and continue feeding until their abdomens are full. Female
mosquitoes live for approximately 1 month and feed, on average, every two to three nights.
The main hosts are marsupials, but the mosquito transmits the virus from marsupials to humans.
The virus does not usually transmit from human to human, and therefore the disease is infectious
but not contagious. When a female mosquito vector takes a blood feed from a marsupial reservoir
such as a western grey kangaroo, it pierces the skin and a blood vessel in order to suck blood. If the
marsupial is a natural reservoir for the Ross River virus, the virus can be transmitted to the mosquito
via the blood. If it is one of the correct species of mosquito, the virus finds receptors on mosquito
epithelial cells to attach to in order to replicate. The viruses then move to the salivary glands, allowing
for further transmission. The female mosquito vector may take another blood feed, this time from
a susceptible human. As in the previous blood feed, the proboscis breaks the skin barrier and blood
vessel wall. Saliva is injected into the site through one tube, and protein-containing blood is sucked
up from the human host into the gut of the mosquito. In contrast to the previous blood feed, the
virus is transmitted to the human host via the saliva. Again, the viruses will find receptors on cells
to attach to. This time, however, they are muscle cells. After primary replication in the infected
human skeletal muscle cells, the virus enters the blood and symptoms begin. It takes 3–9 days after
transmission for symptoms of Ross River virus disease to appear. This period of time is known as the
incubation period.
Mosquito takes
blood feed
containing viruses
from marsupials.
Mosquito
The virus can circulate
around marsupials via
various mosquito
vectors
Marsupial reservoir Virus replicates
inside mosquito
Virus travels to
salivary glands
of mosquito
The same female
mosquito vector
takes another
blood feed, this
time on a human
host and injects
saliva containing
viruses into the
Mosquito vector human host
bloodstream.
Primary replication
Susceptible occurs in the skeletal
human host muscles of the
human host.
Human–mosquito–
human/marsupial
transmission is unlikely
but possible.
FIGURE 13.4 Life cycle of Ross River virus
9780170452922
Viral diseases of honeybees

There are many infectious agents that cause honeybee diseases, including 24 known honeybee
viruses. Common diseases are sacbrood, black queen bee virus, chronic bee paralysis virus and
Honeybee viruses deformed wing virus. Viruses may cause diseases that are asymptomatic, or they can be highly
Explore honeybee virulent and kill the hive. This significantly reduces the rate of pollination in the areas where the
diseases further by bees had previously resided, including the pollination of crops, which in turn affects human
reading this resource.
populations. Two of the common diseases found in honeybees are sacbrood and deformed wing
Sacbrood virus virus disease.
Learn more about the
honeybee virus found in Sacbrood disease
WA: sacbrood virus.
Sacbrood disease is caused by the sacbrood virus, which
.0202 yaM dessecca )gro.demrofnieeb.www( dnalyraM fo ytisrevinU ,pihsrentraP demrofnI eeB/redynS boR
has infected bees internationally and was detected in WA
in 1979. This disease mostly affects worker larvae, but
can also infect adult honeybees. Infected larvae die just
before pupation. The virus’s mode of transmission may
be foodborne: the virus can be carried by vector nurse
bees when contaminated food is fed to the brood of
larvae. The virus replicates inside the larval cells, causing
the larvae to display unusual behaviour. The larvae turn
onto their backs and lie stretched out with their heads
lifted. After the larvae die, they turn light- to dark-brown,
and an observer of the hive will see an unusual pattern
of discoloured cappings. After the larvae dry out, they
turn from brown to black and become brittle. Millions
of viruses surround the dead larvae. When humans
clean out dead larvae, they can cause the viruses to be
disturbed and transported to other worker bees.
Deformed wing virus

FIGURE 13.5 Honeybee larvae affected by
Deformed wing virus (DWV) disease is caused by the
sacbrood virus
deformed wing virus, which is usually transmitted
indirectly by the varroa mite. The varroa mite is a Deformed wing
significant pest in bee colonies all over the world.
Fortunately, it has not successfully passed through the
biosecurity in Australia.
Bee health
aliasP eppilihP/yrarbiL otohP ecneicS
One mode of transmission for DWV is thought to
Read more about the
impact of the varroa be via an attached parasitic varroa mite called Varroa
mite on honeybees by destructor. The theory proposes that the parasitic mite
reading this resource.
feeds on bee blood and at the same time transmits the
virus. However, the virus has been detected in bees
during life stages not normally associated with the
varroa mite, so other modes of transmission are likely
FIGURE 13.6 Newly emerged worker
in addition to transmission through the vector, such as honeybee showing deformed wing virus
vertical transmission from queen bee to offspring. The (DWV) disease. A healthy winter bee can
impact on honeybees can be asymptomatic or severe live for several months, but mites carrying
(in the form of deformed wings). Asymptomatic refers DWV have compromised this bee’s health,
to the state of being infected but not experiencing any meaning it will probably not live more than a
signs or symptoms. few days at most.
9780170452922
Australian bat lyssavirus

Australian bat lyssavirus causes the disease known as ABL. The virus was discovered in 1966. It is
closely related to the rabies virus, but the rabies virus is not found in Australia. ABL infects Australian
flying foxes (fruit bats) and microbats. The disease can be transmitted from bats to humans, to horses
and to other bats. The disease affects the nervous system in humans, and can cause fatal encephalitis
(inflammation of the brain).
a b
serutciP s’nffiuP/otohP kcotS ymalA

ailartsuA ORISC thgirypoC ©
c
d
ecruoS ecneicS/CLL ,sesirpretnE trA gniviL/yrarbiL otohP ecneicS
FIGURE 13.7 a A transmission electron micrograph showing colourised bullet-shaped ABL particles; b the bat
host reservoir; c normal human brain; and d human brain with encephalitis
9780170452922
Bats infected with the virus may show symptoms such as paralysis, weakness, tremors and
seizures. The bats are a reservoir host for the disease. Some bats may be infected but asymptomatic,
so all bats may be considered to be potential vectors. The virus multiplies within the bat and may
travel to its salivary glands. The mode of transmission to humans or horses is direct contact with an
infected bat host via a bite or scratch or other break in the skin, or via the mucous membranes. The
virus replicates locally in the new host and then slowly travels through the sensory and motor nerves
to the central nervous system (CNS), where it causes encephalitis. It then spreads to salivary glands
and other organs via the peripheral nerves. Once the virus replicates within the salivary glands, the
host becomes capable of infecting other animals or humans. The disease is not contagious between
humans, but it is zoonotic.
The incubation period can be 10 days to over a year. This is followed by a course of symptoms
in three phases. The first phase involves a slight fever, headache, nausea and sensitivity to light and
wind. The person may feel sensations around the portal of entry, such as tingling, cold, itchiness,
burning and pain. In most cases, the second phase of symptoms and signs, known as the excitatory
phase, may be experienced as anxiety and unusual eye movements, and the eyes may become
insensitive to touch. Facial muscles may weaken, and heart rate and respiratory rate may intensify,
and these are followed by incontinence and constipation. This may precede the third phase,
encephalitis, which leads to paralysis and coma. The prognosis (likely outcome) of the untreated
disease is death. If promptly treated, however, the disease can sometimes be avoided. There have
been no confirmed cases of ABL in WA, but there have been three cases of the disease elsewhere in
Australia. All were fatal.
ABL
transmission
Infected Virus replicates and

Bat bites
reservoir travels to brain via
human
bat host nervous system
FIGURE 13.8 Life cycle of Australian bat lyssavirus
Life cycle of pathogenic bacteria

Tuberculosis
TB is caused by the infectious agent Mycobacterium tuberculosis. It is not common in Australia, but is
very common in many developing countries. The tubercle-producing, rod-shaped bacterium mainly
affects the lungs of the respiratory system. A tubercle is a small, round structure made of cells that is
produced as a result of the infection. The disease spreads quickly when the density of the human host
population is high and their immune system strength is low. In many socio-economically deprived
areas, people often share limited space in housing and hospitals. Transmission is fast because
susceptible hosts are always in close proximity. Much of the shared space is dusty, so both direct and
indirect modes of transmission are possible.
When a person with TB coughs, tubercle bacilli are transported in fine droplets from the infected
human host’s lungs into the air, from where they can be inhaled by a susceptible person. Direct
transmission occurs when a person is standing only 1–2 metres away from the infected person and
inhales the airborne droplets. The TB bacteria rapidly move through that person’s mouth, throat,
trachea and bronchi, and deep into the lungs.
9780170452922
1 Droplet nuclei
a b containing tubercle
bacilli are inhaled
and travel to the alveoli.
Bronchiole
Tubercle
bacilli
Alveoli
2 Tubercle bacilli multiply in the

alveoli.
c
enizamaC ttocS/otohP kcotS ymalA
4 Granuloma shell breaks down 3 Immune cells form a barrier shell

and the tubercle bacilli escape around the tubercle bacilli, called
and rapidly multiply, forming a granuloma.
more tubercles.
FIGURE 13.9 a Direct mode of transmission of TB via airborne droplets or particles; b the life cycle in and impact on the host;
c Mycobacterium tuberculosis
Indirect transmission can also occur when an infected person coughs, sending droplets into the
air, because the bacilli may land on a dusty surface. When the dust is disturbed and flies in the wind, it
can carry the bacteria into the air and be inhaled.
When the bacteria enter the lungs, they are transported into the alveoli. In the alveoli, they
multiply asexually by binary fission. Within 2–8 weeks, they are encountered by white blood cells
(phagocytes such as macrophages). These are large cells that engulf invading pathogens by
phagocytosis. The bacteria are able to evade the usual enzymes that destroy pathogens, because
they survive inside macrophages, protected by the waxy mycolic acid in the bacterial cell walls. This
strategy is known as a virulence factor. Instead of destroying the pathogen, the macrophage forms
a barrier shell. It doesn’t break the bacteria down, but does contain it and keep it under a degree of
control. Eventually, the alveoli develop small, round lesions in the area of the infection, now named
a tubercle. In this state, the host has latent TB. The bacteria remain dormant and symptoms are not
experienced by the host. The host is not considered contagious, because they do not have the TB
disease and the pathogen cannot spread to other people.
However, when macrophages can no longer contain the bacteria, the pathogens burst out and
begin to rapidly multiply asexually, again. The infection has now become active, and the host is
contagious and will experience symptoms. The pathogen may enter the bloodstream via capillaries
and spread to other areas of the body, such as the lymph nodes or a bone.
The World Health Organization (WHO) recorded 1.5 million deaths due to tuberculosis in 2018.
Tuberculosis deaths have been recorded for centuries. Nearly one-third of the world’s population
currently has latent TB. There are many factors that contribute to its persistence. One factor is that the
main symptom is a cough, which is the main symptom of several other conditions. For TB, the cough
has to be prolonged (2–3 weeks) to lead to testing. During that period, the person can continue to
spread it, thinking they just have a cold or something minor.
9780170452922
It’s ‘time to #EndTB’

YCARETIL CIFITNEICS It’s ‘time to #EndTB’, says UN on World Tuberculosis Day.
A woman in Pakistan with TB went undiagnosed for 5 years because she could not afford
the $2 transportation cost from her village to the closest hospital. TB is the world’s deadliest
infectious disease. WHO has announced that every day close to 30 000 people fall ill to TB, and
that nearly 4500 people lose their lives to the disease. World Tuberculosis Day is on 24 March
for the important reason of raising public awareness of the TB pandemic. It falls on the date
when the bacterium that caused TB was first discovered. TB was first identified as a disease in
1882. It is preventable, treatable and curable. Why did 1.6 million people die from the disease in
2018, nearly 136 years after it was discovered?
Adapted from UN News, ‘It’s ‘time to #EndTB’ says UN on World Tuberculosis Day’, March 2019
Questions
1 Discuss the following factors in relation to TB and how they have made it one of the
world’s most infectious disease killers. Use your knowledge from the chapter as well as the
scientific literacy item.
a host factors
b pathogen factors
c modes of transmission
2 Determine the name of the doctor who discovered the TB bacterium.
(Hint: it was the same doctor who developed a set of postulates to determine the specific
cause of an infectious disease.)
3 Write out the doctor’s postulates and how they would have been applied to finding out the
specific cause of tuberculosis.
Tetanus
The disease tetanus is caused by the infectious agent Clostridium tetani. C. tetani is an obligate
anaerobic Gram-positive bacillus. Entry into a susceptible host involves contact with the spore
form of the bacterium, universally present in soil, typically via a deep wound. The spores are also
found in animal intestines and faeces. The bacterial spores will not germinate in a superficial wound
because they are anaerobic bacteria and will only germinate and multiply in hypoxic (low oxygen)
conditions. Wounds that penetrate deeply into skin and soft tissues provide the hypoxic conditions
required for germination of the spore and a portal of entry. After entry via a wound, the pathogen
will start to multiply via binary fission and increase in numbers. During this process, toxins are
released from the cells, transported through the bloodstream, and taken up and transported by
nerve cells (neurons). The disease is caused not by the bacteria itself, but by the potent toxins that
the bacteria produces during its growth. One major toxin is a neurotoxin called tetanospasmin,
which affects the nervous system of its infected host. Once inside neurons, tetanus toxin cannot
be neutralised by anti-toxin. The toxin blocks the release of inhibitory neurotransmitters (chemical
messengers) in the central nervous system. This leaves excitatory nerve impulses unopposed,
resulting in uncontrolled muscle spasms in skeletal muscles. Symptoms include lockjaw, which
is the uncontrolled tightening of the jaw and the inability to open the mouth or swallow, and
violent painful muscle spasms. The muscles of the body adopt an agonising posture known as
opisthotonos: the extensor muscles of the back arch backwards and lock, and the arms flex to
the chest with fists clenched. This can lead to other complications, such as loss of respiratory
mechanisms, diaphragm dysfunction, airway obstruction and fractures associated with severe
muscle spasm. The disease is infectious, but not contagious.
9780170452922
1 Soil reservoir
• Soil particles containing bacterial spores can be found on
rusty nails and on dog’s teeth.
2 Mode of transmission
• Entry portal is via a deep wound in the skin involving
direct contact with the soil reservoir (such as by stepping
on a nail or being bitten by a dog).
3 Reproduction
• Inside the deep, hypoxic wound, bacterial spores
germinate, grow and multiply asexually via binary
fission.
4 Production of toxin
• During the growth of the bacteria, neurotoxins are
produced (e.g. tetanospasmin), which travel inside
neurons from the peripheral nervous system (PNS) to
inhibitory interneurons in the central nervous system
(CNS).
e
5 Impact on host
• The toxin blocks inhibitory neurotransmitters and nerves
fire continuously, producing rigidity, unopposed muscle
contraction and spasm, including lockjaw (muscles
contract and can’t relax). This can affect breathing and lead
to death.
• Infectious but not contagious
• The pathogen does not normally transmit from human
to human.
FIGURE 13.10 Life cycle of tetanus: a tetanus bacteria spores live in soil; b foot puncture wound; c inside the
deep, hypoxic wound, bacterial spores germinate, grow and multiply asexually via binary fission; d toxins spread
from the wound through the nerves and the blood to the central nervous system and the face; e ‘lockjaw’ (now
called trismus) may occur, intense painful spasms of the jaw muscles
Crown gall
Crown gall disease of plants is caused by the infectious agent Agrobacterium tumefaciens. Bacteria
can be transmitted from one host to another directly (via infected plant root to susceptible plant
root contact) or indirectly [via grafting tools, car tyres, infested soil reservoirs, or movement of
infested soil (such as by work boots or rain)]. Like the tetanus bacterium, A. tumefaciens requires a
wound as a portal of entry. Unlike tetanus, the wound does not have to be deep.
9780170452922
The disease can spread through

susceptible crops such as stone fruits
and roses. Farmers and gardeners have 1 Bacterial spores released from infected
experienced financial loss from crown gall, plant galls
particularly in nurseries where the plants

are dug for sale. The disease can be found
throughout Australia and has been a minor
disease in roses and stone fruits in WA. 2 Direct/indirect modes of transmission
The bacterium that causes crown gall – spores are transmitted by contact or
by vehicle into wounded roots in a
lives in the soil that surrounds the roots susceptible plant – the portal of entry
of plants. This bacterium can live in the is through a wound.
soil as a decomposer for years without
infecting a living host. When a plant is
injured (either by mechanical transmission,
insect feeding, or naturally) the damaged 3 Bacterium attaches to a wounded
cells release compounds into the soil, plant cell and multiplies.
attracting the bacterium to the wound site.
Once inside the plant root, the bacterium
replicates rapidly via binary fission, forming
a tumour-like gall (a large cluster of
undifferentiated cells that looks like a brown 4 Bacterium transfers a plasmid into
sphere) by integrating some of its DNA, plant cells. Plasmid contains genes
for uncontrolled cell growth.
which is contained in a circular plasmid,
into the host’s DNA. A plasmid is a small
DNA molecule that is separate from the
chromosomal DNA and can replicate on its
own. Once the bacterial genomic material
5 Plant cell genome transforms and
is incorporated into the host’s genome, the starts to divide, rapidly forming galls.
normal plant cells are altered and genes for
uncontrolled cell division are expressed.
They multiply and form the gall structure.
Galls form on the crown of the plant
and on the roots. The crown of a small
6 Galls grow around the crown of the
plant is where the stem joins the roots.
plant and stunted plant growth results.
In trees, crowns are the sites where
branches join the trunk. The galls can
interrupt normal transport of water and
nutrients. Consequently, a symptom that
can be observed, in addition to the galls,
is stunted growth. Galls can also form on 7 Spores can be released to continue
the cycle.
the main stem above soil level, or on the
branches. Old galls are dark and can grow
to 30 centimetres. If the plant is suffering
from moisture stress in addition to crown gall FIGURE 13.11 Life cycle of crown gall disease
disease, then it is at risk of dying.
Only the strains of bacteria that contain these tumour-inducing plasmids (Ti plasmid) can cause
disease. Some strains of A. tumefaciens lack the specific plasmid and remain in the soil without
causing disease. When the outside tumour cells shed into the soil, replicated bacteria can live in the
soil and be carried off by water to infect neighbouring plants.
9780170452922
Life cycle of pathogenic fungi

Chytridiomycosis
The disease chytridiomycosis is caused
by the fungus Batrachochytrium
dendrobatidis. The chytrid fungus typically
lives in water or soil and usually reproduces
1 Zoospores are produced and released
asexually only. Their zoospores have a
from a mature zoosporangium (thallus)
single posterior flagellum, a whip-like discharge tube.
tail, which provides the zoospore with
locomotion (makes it motile and able to
swim through the water).
The disease has been detected in
all states of Australia and is affecting
amphibians worldwide. In WA, the main 2 Zoospores swim a short distance or are
area affected is the cooler south-west, carried by water currents.
possibly because the fungus is temperature

sensitive. The disease causes amphibians to
die, and at times mortality in a population
is 100 per cent. The Global Amphibian
Assessment of 2004 reported that one-
third of the world’s amphibian species are 3 Zoospores encounter a new susceptible
threatened. host and attach to and penetrate a skin
cell. This is the portal of entry.
Occasionally, transmission is direct
via skin-to-skin contact; however,
indirect transmission is more common.
Indirect transmission is waterborne.
Zoospores are released by infected frogs
via a zoosporangium (thallus), then 4 The cells invade the skin, absorbing
swim through the water and attach to, nutrients. A new zoosporangium
develops via asexual reproduction.
and penetrate, the skin of a susceptible
amphibian. Amphibians such as frogs are
highly reliant on their skin for processes
such as oxygen and carbon dioxide
exchange (respiration), water absorption,
pathogen defence and electrolyte
transportation. Therefore, the impact on 5 The zoosporangium matures and
zoospores are produced.
the frog is extensive. As the pathogen
invades the skin, the outer keratin layers
are damaged, disrupting respiration, salt
regulation and osmoregulation (water
balance). The skin thickens and hardens.
As respiration, water and electrolytes
6 Chytridiomycosis damages the frog's
decrease, so does the activity level of skin causing reduced respiration and
the frogs. Signs of the disease include osmoregulation, leading to death.
lethargy, extension of the hind legs away
from the body, and abnormal behaviour
such as sitting in the sun instead of the
shade. FIGURE 13.12 Life cycle of chytridiomycosis
9780170452922
Note: chytrids lack hyphae, the typical filaments that are common in most fungal life cycles.
Instead, they grow a roughly spherical, smooth-walled zoosporangium or thallus. Inside the thallus,
asexual reproduction occurs, producing new zoospores. The thallus contains a plug that is removed
once the thallus matures, releasing the zoospores into water.
The reasons why this fungus has spread so widely and so quickly could include (i) virulence of
the pathogen (whether it has increased or evolved recently), (ii) the environment (whether there
are more suitable environmental conditions for the growth and survival of the fungus in its
reservoirs) and (iii) the host (whether there is reduced resistance to infection in frog populations).
All these possibilities could potentially be caused by other factors, such as environmental changes
or as yet undetected co-infections. Host, pathogen, environment and modes of transmission are
interrelated.
Life cycle of pathogenic protists

Malaria
Malaria is caused by unicellular protists from the Plasmodium genus. Plasmodium falciparum
is the most lethal, but there are six Plasmodium species that can cause malaria. Plasmodium
species belong to a Protistan group resembling animal cells. The animal-type protists are referred
to as protozoa. The infectious agents are transmitted indirectly to a host by the bite of a female
Anopheles mosquito vector. The mosquito is the vector that completes the life cycle of the
Plasmodium pathogen. The parasite requires both the mosquito and the human host. Sexual
reproduction occurs in the female mosquito gut, which is why the mosquito is known as the
definitive host. Asexual reproduction takes place in the liver and red blood cells of the human host,
who is known as the intermediate host.
Australia was certified as malaria free in 1981 by WHO. However, hundreds of cases are
recorded each year as people return from visiting other countries. Fortunately, the Anopheles
mosquito vector does not occur naturally in Australia. In 2016, there were an estimated 216 million
malaria cases in the world. Malaria kills one child every 2 minutes globally. WHO has a target of
eliminating malaria by 2030. This goal is in serious danger of not being achieved, because the
number of infected cases has surged in the last few years in some of Australia’s poorer neighbours,
such as Papua New Guinea.
When the mosquito penetrates the skin with its proboscis, it searches and pierces a blood vessel
to access blood. Through one tube of the proboscis, saliva containing Plasmodium sporozoites (a
relatively immature form of Plasmodium), is injected into the host, and blood is sucked up through
a separate tube. The portal of entry is the same as the portal of exit, but one mosquito injects the
pathogen in its saliva, and a different mosquito takes up the Plasmodium parasite within its blood
feed. The injected sporozoite parasites travel through the bloodstream to the liver (Figure 13.13).
After invading liver cells, the sporozoites divide repeatedly, by asexual reproduction, then develop
and release thousands of merozoites. Merozoites are a relatively mature form of the Plasmodium
pathogen. The merozoites leave the liver and enter the bloodstream, where they infect red blood cells
within which they reproduce asexually again. The merozoites burst out and invade other red blood
cells. Some of the merozoites break away from the red blood cell cycle and instead, form male and
female gametocytes (underdeveloped male and female sex cells). The female Anopheles mosquito
may bite an infected human, usually at dusk, ingesting the gametocytes as it takes the blood feed.
Inside the mosquito gut, the gametocytes mature into male and female gametes and fuse to form
zygotes, which is known as sexual reproduction. The zygotes penetrate and burrow through the
wall of the mosquito stomach and form cysts. Sporozoites form within the cysts and migrate to the
salivary glands of the mosquito, ready to infect a new host.
9780170452922
a 1 Zygotes of the malarial parasite Plasmodium develop

into sporozoites in the gut of the female Anopheles 3 Sporozoites reproduce
mosquito then migrate into her salivary gland. asexually in liver cells.
Sporozoite
2 Mosquito blood feed;

sporozoites enter human
bloodstream and
move to the liver.
4 Merozoites (resulting
7 Bloo d i s sucke d fro m a n infecte d human
from asexual
by a female mosquito. Gametocytes travel
reproduction of
to the mosquito’s gut where they mature
sporozoites) move into
into gametes and fuse to form zygotes
the bloodstream and
(sexual reproduction).
6 Some merozoites from there enter red
can form male and blood cells where they
reproduc e asexually. 5 Merozoites
female gametocytes.
released from
These are released
red blood cells
into the bloodstream.
can infect and
multiply in
other red
blood cells.
Male gametocyte in
blood cell
b 2 Sporozoites enter the

bloodstream of another host. 3 Sporozoites reach the liver
and asexually reproduce and
specialise, releasing merozoites
into the blood.
Infection
1 Sporozoites form from

the zygotes and travel 4 Merozoites enter red blood
to the mosquito's cells, where they multiply up
salivary glands. until they are released.
Liver
7 Haploid gametocytes enter

another mosquito and produce
gametes. Pairs of gametes fuse
inside the mosquito gut to make
zygotes. 5 Released merozoites infect
6 Some merozoites other red blood cells
develop into (asexual cycle).
gametocytes.
FIGURE 13.13 Life cycle of Plasmodia showing a its various forms and where they occur and b details of its asexual reproduction within
the human liver and red blood cells
When infected red blood cells rupture in the process known as lysis, they release merozoites and
their metabolic wastes into the bloodstream. This toxic release induces malarial headaches, chills and a
burning fever. These symptoms eventually subside, but can recur when more cells are lysed, releasing
Malaria life cycle
more merozoites. Ongoing rupturing of red blood cells leads to anaemia (lack of red blood cells), Watch the video, then
which lowers the amount of oxygen that is transported to cells. If left untreated, the host may develop draw your own life cycle
of Plasmodia.
enlargement of the liver and spleen or, in the case of cerebral malaria, brain injury. This leads to death in
severe cases.
9780170452922
Phytophthora dieback (jarrah dieback)

Phytophthora (pronounced fy-TOFF-thora) dieback is a disease caused by the water mould protist
Phytophthora cinnamomi. It is a plant pathogen that affects plants in Australia such as jarrah, banksia
and grass trees by attacking their root system. In WA, more than 40% of native plants are susceptible to
the disease, particularly in the state’s south-west.
a b
.snommocevitaerc//:sptth( .esneciL 0.3 noitubirttA snommoC
etatS dna etutitsnI cinhcetyloP ainigriV ,hsuB htebazilE
evitaerC a rednu desneciL .gro.doowguB ,ytisrevinU
yrarbiL otohP ecneicS/otohP kcotS ymalA

)/0.3/yb/sesnecil/gro
FIGURE 13.14 aPhytophthora hyphae; b injecting phosphite to manage the spread of Phytophthora in WA
Healthy plant Diseased plant
Read more about the
biology and ecology of
here.
Phytophthora
reproduction
Zoospores are produced
asexually inside Zoospores are attracted
Mycelium grows in and
sporangia; resilient to and penetrate the
on an infected root.
chlamydospores roots of a host plant.
are also produced
asexually; zoospores are Soil particle
occasionally produced
Zoospore
for reproduction in
soil and plant tissue,
Zoospores are
but read about why
released into the soil.
reproduction is rare in
Australia.
Spore sacs and

Chlamydospores chlamydospores
germinate in better grow on mycelium
conditions, releasing
zoospores. Sporangia
Spore sac
Chlamydospore
germinating in
better conditions
Chlamydospores await
favourable conditions.
FIGURE 13.15 Life cycle of Phytophthora
9780170452922
Areas in WA that are currently experiencing spread of Phytophthora include Two People’s Bay Nature
Reserve and metropolitan Perth bushland areas such as Lightning Swamp Bushland. After infecting a plant
such as a jarrah tree, it grows in the roots and rapidly kills it. It does not require a wound for a portal of entry,
as does crown gall, although it can use such a portal. Like fungi, Phytophthora cinnamomi has threadlike
hyphae and produces spores, but unlike fungi its cell walls are cellulose-based rather than chitin-based.
The usual portal of entry is via root tips. Zoospores swim through the soil water and attach to the
root tip cells of susceptible host plants. After attachment, the zoospores grow long, thin microscopic
filaments of cells. Bundles of a few filaments form the mycelial threads known as hyphae that
grow on the surface of infected roots, absorbing nutrients. They then produce sporangia, which
release zoospores. Once the zoospores have swum to and infected a plant, they produce long-lived
chlamydospores (which can survive unfavourable conditions), sexual oospores and further sporangia.
When the soil is dry, Phytophthora cinnamomi can remain dormant in the chlamydospore form
for long periods, until it rains again and conditions are favourable.
The mode of transmission is usually indirect via vehicles such as cars and shoes carrying
contaminated soil. The disease is soilborne and can spread faster when it rains. Transmission can be
direct from infected to susceptible plants by root-to-root contact. Impact on the plant is swift after
transmission. P. cinnamomi attacks the roots, causing root rot. The growth of the protist reduces the
ability of the plant to absorb water and nutrients. Dieback is progressive and death may follow.
Phytophthora dieback: why is the disease such a massive problem CASE

STUDY
in Western Australia?
Root rot is a term describing one of the has stated that the disease affects more than
impacts Phytophthora cinnamomi has on plants. 40% of the native plant species and half of the
It affects over 200 threatened native plants endangered ones in the south-west of WA.
and is considered a highly problematic invasive Biodiversity in WA is declining because of this
species. The Australian Government developed disease.
a threat abatement plan for the disease in 2017. The pathogen is able to be transmitted
The Department of Parks and Wildlife in WA via zoospores that are attracted to roots
Mount Magnet
Laverton
400 mm
Leonora
Geraldton
Moora Kalgoorlie
Southern Cross
Lancelin
Northam
Merredin
PERTH
Norseman
600 mm
Narrogin
Bunbury Ravensthorpe
Kojonup
Esperance
0 200 km
Augusta
Albany
Confirmed Phytophthora species
High
Plant endemism (Hopper and Gioia, 2004)
Low
Annual rainfall 600 mm SW of 600 mm line
FIGURE 13.16 Map showing the association between Phytophthora cinnamomi distribution and higher
rainfall areas with endemic (native) plants
9780170452922
in the soil, and they actively swim towards contaminated grafting tools, car tyres and
susceptible root tips through wet soil from a human footwear, all of which can transport
infected site. They do not require a wound. The contaminated soil to new places. In addition
entry portal is the finer tips of roots in plants. to indirect transmission, the disease can
The pathogen germinates and grows a cyst spread via direct root-to-root contact between
before growing thread-like structures known infected and susceptible plants.
as hyphae. In the hyphae form, the protist can There is no known cure for the disease
grow into the root cells to absorb nutrients. phytophthora dieback .
Phytophthora cinnamomi’s life cycle is not
limited to one mode of transmission. The Questions
pathogen can survive in dry, unfavourable 1 How is Phytophthora cinnamomi
soil conditions as chlamydospores until transmitted from host to host?
conditions become favourable (warm and 2 How does Phytophthora cinnamomi
moist). Chlamydospores may undergo sexual reproduce?
reproduction or germinate to form sporangia 3 Why are outbreaks of Phytophthora
to propagate more zoospores. Other indirect cinnamomi so difficult to contain and
modes of transmission are vehicles, such as control?
Question set 13.3

REMEMBERING
1 Copy and complete this summary table for the 10 diseases covered in this section and their
life cycles.
DISEASE PATHOGEN PATHOGEN MODE/S OF LIFE CYCLE SPECIFICATIONS
TYPE NAME TRANSMISSION
[portal of entry, site(s) of
(most common replication (sexual/asexual
to least common) reproduction), reservoir(s), portal
of exit]
UNDERSTANDING
2 Explain why ABL’s rate of spread may be lower or higher than the other kinds of viral
diseases mentioned (influenza, viral diseases of the honey bee and Ross River virus
disease).
3 Draw a life cycle summary for a chosen bacterial disease.
4 Draw the life cycle for chytridiomycosis.
5 Draw a life cycle for one of the protistan diseases.
13.4 FACTORS THAT AFFECT THE SPREAD OF

A DISEASE
Control of any disease is related to thresholds. A threshold is a certain magnitude that must be
exceeded before a result can be produced. Certain parameters or host/pathogen/vector population
sizes must be exceeded for a specific infectious disease to spread. For example, a disease may be
unable to spread if the population is below a critical size. Since 1967, at least 39 new pathogens have
been identified, including the human immunodeficiency virus (HIV), Ebola virus, SARS-CoV-1 and
SARS-CoV-2. Other centuries-old threats, such as pandemic influenza, malaria and tuberculosis,
continue to pose a threat to health through a combination of mutation, rising resistance to
9780170452922
antimicrobial medicines, globalisation, urbanisation, climate change and poor health systems.
Climate-sensitive vector-borne diseases are likely to be emerging due to climate changes and
environmental changes, such as increased irrigation.
Spread is the transmission of a pathogen to susceptible hosts over a wider area and into new
populations. The rate of spread of a specific disease is affected by a range of interrelated factors
(factors that depend on and have an effect on one another), including growth of the pathogen
population, density of the host population and modes of transmission. All play a vital part in spread
and all three factors need to reach particular thresholds or spread will be limited. Successful
replication in host cells, high-density living, and airborne droplet and fomite transmission have meant
that the rate of spread of COVID-19 has been relatively fast.
Growth of the pathogen population

An increase in the growth of a pathogen population can lead to an increase in the spread of a disease.
Greater abundance of a pathogen means the risk of transmission is higher. Some pathogens, such as
viruses, have a very high rate of replication, which increases their chance of spread. However, spread
relies on all three interrelated factors, so if there are limited hosts or reservoirs, then the pathogen will
not survive. A reservoir is where a pathogen resides and survives. Some pathogens reside and survive
in a host, but other pathogens require a vector or reservoir other than the host they infect. Scientists
are monitoring the increase in Australian bat lyssavirus because the pathogen causes a fatal disease in
humans. The virus was first identified in 1996 and has been found in four kinds of flying foxes (fruit bats)
and one species of insect-eating microbat. It is spread to humans by the saliva of infected bats when the
saliva comes into contact with mucous membranes or broken skin, or through bat bites or scratches.
Infection is fatal, but the infection rate in humans is low. One reason for this is, unlike mosquito vectors,
bats do not use humans as a primary source of food. They consume insects or fruits. In addition, the
mode of transmission is direct contact. Humans usually only come into contact with a flying fox when
one is injured. Therefore, the mode of transmission is a limiting factor for this pathogen. Regardless of
the growth of the pathogen population, without a more effective mode of transmission, the spread of
ABL in humans is limited. However, some scientists are concerned that this zoonotic disease will emerge
as an epidemic due to rapid environmental change and the way that is affecting bats.
Density of the host population

An increase in the density of a population can lead to an increase in the spread of a disease. The human
population has increased to more than seven billion. This increase, coupled with urbanisation, has led
to much higher density living. Urbanisation is the movement of people from rural areas to towns and
cities. A higher population density means more people are in a particular area at the same time. This
means that for any given pathogen present in the community, more infected individuals will come into
contact with susceptible individuals. This is a significant problem in relation to pathogens that transmit
via direct contact. Many animal vector populations are affected by habitat loss. The animal vectors
themselves may be living in higher density populations due to limited habitat space, and humans are
encroaching on what was natural habitat for living space and agriculture.
However, spread is dependent not just on the density of the host population, but also on the
pathogen population growth. If there are limited pathogens, then spread will not increase. The mode
of transmission can also affect spread, and an increase in either the pathogen population or the
host density will have negligible impact on the spread of a pathogen if it cannot be transmitted. For
density-dependent pathogens, there is theoretically a level of density below which transmission is
inefficient and the pathogen cannot persist. For density-independent pathogens, transmission may be
relatively unaffected by host density and relatively more affected by vector density. The spread of TB
was discussed earlier in this chapter. The mode of transmission of TB can be direct, by close proximity
via airborne droplets containing the pathogen. Therefore, in areas of the world where there is
urbanisation and high-density living, the rate of spread is expected to be high. It is particularly high in
9780170452922
areas that contain high levels of the pathogen population and low level of healthcare, which together
allow the transmission to be very effective. In poor countries, TB spreads quickly and easily because
all three interrelated factors exceed their threshold. In higher socio-economic areas of the world,
healthcare is more accessible, disenabling the modes of transmission and decreasing the pathogen
population through medication and prevention measures. A high density of the host population by
itself is not the sole determiner of the spread of an infectious disease.
Mode of transmission
Pathogens have one or more unique transmission modes specific to them. Some infectious agents are
easily transmitted (that is, they are very contagious), whereas others are not easily transmitted. Some of
those that are easily transmitted are not very likely to cause disease (that is, they are not very virulent).
The most worrisome infectious agents are those that are both very contagious and very virulent.
Some pathogens have multiple modes of transmission. One mode of transmission can switch
to another depending on the environmental conditions. Phytophthora is an example of a disease
that can follow two different pathways depending on the
environmental conditions. When conditions are ideal,
zoospores are produced that may swim to another susceptible
plant. When conditions are not ideal, for example during dry Growth of
pathogen
periods, resilient chlamydospores may be produced that can population
survive for long periods of time. When conditions improve,
zoospores develop and complete the transmission.
Pathogens may be transmitted through direct and/or
indirect contact. When pathogens can be transmitted via Density
Mode of
of the host
several modes of transmission, this increases their chance of transmission
population
spreading. However, the pathogen still relies on a threshold
number of pathogens being present and a certain level of host
population density to successfully spread. If there are multiple
modes of transmission but few hosts or pathogens, then there FIGURE 13.17 Interrelated factors
is a limiting factor and spread will be limited. influencing the spread of pathogens
Globalisation
For most of human history, continental populations have been relatively isolated from one another.
Only relatively recently has there been extensive contact between the humans, plants and animals of
different continents. Initially, new infectious diseases could spread only as fast and far as people could
walk. Then they started spreading as fast and far as horses could gallop and ships could sail. Globalisation
is a modern phenomenon and it is having a big impact on the spread of disease. Globalisation is the
process by which the world is becoming increasingly interconnected as a result of massively increased
trade, economic, travel and cultural exchange. The efficiency, speed and reach of modern transport puts
people at risk from the emergence of new strains of familiar diseases, and from completely new diseases.
In addition, the growth of global economic activity, tourism and human migration is leading to ever more
cases of the movement of both disease vectors and the diseases they carry.
Disease can quickly spread to new areas if infected hosts travel into different regions or areas of
the globe. Tourism and trade such as in poultry and fruit can facilitate the transmission and spread
of diseases. Transmission involves the transport of a pathogen from reservoir to susceptible host,
and spread involves transmission into wider areas and new populations. Transmission and spread of
disease can be due to war, refugees seeking safety, and legal and illegal trade in wildlife. Pathogens
can be transported in the traveller or on objects being transported. In our increasingly interconnected
world, new diseases are emerging at an unprecedented rate, and they have the ability to cross borders
and spread rapidly, as has been the case with COVID-19.
9780170452922
Measles is a highly contagious viral disease spread by tiny airborne droplets when infected people
sneeze or cough. It had virtually been eliminated from WA for approximately 20 years by vaccination
and isolation of cases. Outbreaks, however, have occurred when an infected international tourist
has visited the state or via a returning WA traveller who has been infected. The incubation period is
7–21 days. Therefore, someone can be unaware they are contagious. Australians currently rely on
herd immunity to keep the minority of unvaccinated, vulnerable individuals protected and to prevent
spread. A fly-in, fly-out worker infected with the virus was diagnosed on the 12 October 2019, 10 days
after flying into Christmas Creek mine site in the Pilbara. The worker was then promptly quarantined.
However, in addition to the workers at the mine site, workers at the airport and people on the plane
had been exposed to the infection.
African swine fever (ASF) virus is endemic to sub-Saharan Africa. A disease is said to be endemic
when it is always present in the region. ASF is caused by a DNA-type virus, and there is no vaccine
or cure. It can spread directly through live or dead pigs and their body fluids. It can also be spread
indirectly through animal feed that contains pork infected with ASF, or via fomites such as transport
storage surfaces, shoes and clothes. The virus has high environmental resistance; that is, it can survive
in extreme, dry temperatures.
No outbreaks in domestic pigs

>5 outbreaks
>25 outbreaks
>100 outbreaks
1646 outbreaks (in Romania)
FIGURE 13.18 Number of outbreaks of African swine fever, September 2019 – March 2020
The recent spread of ASF has been the

biggest animal disease outbreak in history. It
has killed more than a quarter of the world’s
pigs. This has occurred due to the movement
of pigs and pig products across borders,
exacerbated by the fact that farmers in South-
ANAYAYSTAV NANAM/segamI ytteG
East Asia were hesitant to report the disease

for fear of stocks being culled and loss of
livelihood, with no offers of compensation
being given to them. The outbreak was first
reported in north-eastern China in August
2018, following which the highly contagious,
often fatal pig disease quickly swept through FIGURE 13.19 Processing a pig killed by African swine fever
9780170452922
the country, causing the death or culling of more than 1 million pigs. The epidemic then expanded
across borders to become a pandemic. An epidemic is a sudden increase in the prevalence of a
particular disease that spreads rapidly through a region or nation after an outbreak. A pandemic is the
rapid spread of a particular disease throughout the world, crossing international borders. By October
2019, ASF had jumped borders to Vietnam, Cambodia, Mongolia, Hong Kong, North Korea, South
Korea, Lao, Myanmar, The Philippines, Timor-Leste and parts of Europe.
Mosquito-borne diseases and climate change

The distributions of mosquito-borne diseases, such as malaria and Ross River virus disease, are
being affected by global climatic changes. Distribution refers to the area of occurrence of an
infectious disease, including the patterns of spread in geographical areas. The distribution of a
disease may not be consistent or uniform, but instead concentrated in particular areas. Global
climate change, as we are experiencing, encompasses increases in global average air and ocean
Increased Decreased
Middle atmosphere temperature Net decrease in glacier volumes
Increased
Water vapour
Decreased
Extent of
sea-ice
Decreased
Polar ice sheets Increased
Air temperature
Increased over land
Increased Sea level
Air temperature
over ocean
Increased
Sea surface
temperature
Increased
Ocean heat content
FIGURE 13.20 Changes in the global climate system
9780170452922
temperatures, rising global sea levels, long-term sustained widespread reduction of snow and ice
cover, and changes in atmospheric and ocean circulation and regional weather patterns, which
influence seasonal rainfall conditions (Figure 13.20).
Projecting future
Climate change has led to an increase in more severe weather events, including heat waves and climate change
storms, and these are expected to become more common. The causes of climate change are complex, Read the information,
watch the video and
but one root cause is the following series of events. The gases released during the burning of fossil describe the link
fuels and agriculture are predominantly greenhouse gases, such as carbon dioxide, methane and water between greenhouse
vapour. These atmospheric gases trap solar energy that otherwise would radiate out of the atmosphere, gases and global
warming. Describe
retaining heat in our atmosphere. Increased levels of these gases in our atmosphere has resulted in a how this has affected
rise in average global temperatures. The higher temperatures are causing the climate to change. This Australia.
affects the weather. Some geographic areas will have more rainfall, and some will have more drought.
Models have been used to project future climate change, but scientists cannot know for certain 13.2
the quantities and sources of greenhouse gas emissions. Apply your knowledge of the scientific
NOITACILPPA
method (such as observation, hypotheses and variables) to describe how scientists use past
knowledge to project future changes.
The distribution of mosquito-borne diseases is likely to increase as a result of climate change,

because warmer temperatures and extra water bodies will increase the activity of mosquitoes and the
number of breeding grounds where mosquitoes can reproduce. An increase in the incidence of the
mosquito vector leads to an increase in transmission.
For example, malaria is transferred by the female Anopheles mosquito vector. Mosquitoes will
carry malaria with them when they spread to new areas, increasing the distribution of the pathogen,
which may increase transmission rates. In addition, malarial activity varies seasonally in the areas in
which it is endemic. The link between malaria and extreme climatic events has long been studied.
In India early last century, for example, the river-irrigated Punjab region experienced periodic
malaria epidemics. Excessive monsoon rainfall and high humidity were identified early on as a major
influence, because they enhanced the breeding and survival of mosquitoes.
Antibiotic resistance
Evolution is the cumulative, gradual, inheritable change in a population over generations and usually
a very long time. The pathogens investigated in this text are all microscopic, but bacteria and viruses
stand out as being the smallest. Small and unicellular, bacteria have one enormous advantage
over larger, multicellular organisms, and that is their reproductive rate. Bacteria can reproduce
asexually within minutes by binary fission. If a mutation or alteration causes a tiny change that gives
the bacterium just a tiny advantage, then it can spread rapidly due to the high reproductive rate.
Environmental factors impose a selective force on populations, including pathogen populations. The
environment is changing at a faster rate than at earlier times in history. Factors such as average air
temperature and habitat loss are driving forces behind a more rapid evolution of pathogens.
Antibiotics are medications that destroy or slow down the growth of bacteria. They are also
known as antibacterials because they only act on bacteria. Antibiotics have been misused over time,
and this has led to the evolution of bacteria with resistance to antibiotics. When antibiotics were
first synthesised, they killed most bacteria and were used to treat many affected people and pets. All
bacteria in a population died, including any resistant strains of the bacterium. Either through mutation
or gene transfer, a bacterium can, however, gain a gene that provides resistance against the antibiotic.
When the antibiotic is taken again for an infection, all but the resistant bacteria die. The resistant
bacteria survive and reproduce and pass their resistance gene on to offspring. This problem has been
exacerbated by patients not taking a complete course of antibiotics. When they are only taken for
9780170452922
the first few days, the weaker bacteria are killed, leaving behind more resistant bacteria. After many
generations, a new population of resistant bacteria have evolved. This is a form of natural selection.
The selective pressure of an antibiotic is selecting for the antibiotic-resistant strain of bacteria to
survive, reproduce and pass on the advantageous trait.
As new antibiotics have been synthesised, the environment for bacteria has changed, and the
changes have killed many bacteria. The selection pressure has sped up the evolution of bacterial strains.
The environment is changing quickly for many pathogens, due to climate change and use of medications.
This added pressure is forcing pathogen evolution to speed up, which enables an increase in spread.
CASE
STUDY
Horizontal gene transfer and natural selection
Bacteria are able to respond to selective other than from parent to offspring.
pressures and adapt to new environments Mutations usually cause small-scale changes,
by acquiring new genetic traits as a result whereas horizontal gene transfer can cause
of mutation and horizontal gene transfer. much larger changes to a bacterium’s set
Mutation is a modification of a gene and its of traits. Some genes have transferred the
function. Horizontal gene transfer is the code for a trait that makes the bacteria
acquisition of new genes between organisms resistant to a certain antibiotic. Bacteria
Release
of DNA
Antibiotic-
Donor cell resistance gene Recipient cell
1 Bacterial transformation
Release
of phage
Phage-infected donor cell Recipient cell

2 Bacterial transduction
Transposon Plasmid
Donor cell Recipient cell

3 Bacterial conjugation
FIGURE 13.21 Three ways in which bacteria acquire DNA horizontally. In this example, the bacteria are
acquiring genes that make them resistant to antibiotics.
9780170452922
can become resistant to an antibiotic, and Questions:

over time they may acquire genes that make 1 Describe three methods by which bacteria
them resistant to multiple antibiotics, such can rapidly acquire entire genes that
as has occurred in the bacteria that cause make them resistant to antibiotics?
TB. Resistance can build slowly through 2 Explain how the principles of natural
mutation over many generations, or much selection apply to the evolution of
faster through horizontal gene transfer (see antibiotic-resistant bacteria.
Figure 13.21).
Host susceptibility
Susceptibility of urban areas to epidemics and pandemics of infectious disease can be related to high
population density, poor living conditions and lack of adequate healthcare provision. The United Nations
(UN) predicts that the world’s urban population will almost double from 3.3 billion in 2007 to 6.3 billion
in 2050. More than 50% of the world’s population currently live in urban areas, and this percentage keeps
increasing. The reasons for migration from rural to urban areas are many, but it is common that people
migrate in the hope of a better job or a better lifestyle. Most of the increase in urbanisation is occurring
in developing countries, where sanitation and hygiene are relatively poor. In many cities, this has resulted
in very high human densities and all of the issues associated with overcrowding. The following explore
three of the main reasons why urban areas are more susceptible to infectious disease.
High population density

Urbanisation is the increase in the proportion of people living in cities. A larger number of people are
living within the same limited space. With higher density living, there can be a higher contact rate
between infected and uninfected individuals for any given pathogen, which means infections can
spread faster. There is also an increase in interactions between animals, humans and ecosystems.
An outbreak in a rural setting may be controlled quickly and easily, compared with an outbreak in
an urban setting, simply because of the absence of susceptible hosts, particularly if the mode of
transmission is via direct contact or close contact. Therefore, an epidemic is more likely to occur
in an urban setting. An epidemic involves many individuals in a particular area being infected by
an infectious disease. Rapid increases in population density can overwhelm vaccination programs,
decrease herd immunity, and render a population more susceptible to outbreaks.
An example of a disease that can spread directly via close contact is influenza. Severe acute
respiratory syndrome (SARS) was a major pandemic. It demonstrated the interrelatedness of urbanisation
and globalisation. The first person infected with the disease lived outside a city in China. A doctor who had
treated SARS patients in a hospital in that area travelled to Hong Kong and infected seven other people in
a hotel there. The newly infected hosts spread the virus around the world. Therefore, the SARS pandemic
started outside a city, but spread through a city, then through several other major cities, due to the ease
with which a pathogen can spread through an area dense with human hosts.
Poor living conditions

Poor living conditions can lead to the spread of infectious disease, especially airborne diseases such
as TB, and vector-borne diseases such as malaria. In developing countries, there is less access to
clean, treated water. Sanitation facilities are inadequate. Consequently, urban slums usually have high
levels of faecal matter in the water consumed by households. Waterborne diseases spread rapidly in
such conditions. If electricity is affordable and reliable, then many microbes can be killed using heat
treatment, but in many cities, and especially for the homeless, access to electricity cannot be relied
on. Inadequate nutrition leads to weaker immune systems, increasing susceptibility to many infectious
diseases. Diarrhoeal diseases are often caused by the poor sanitation associated with poverty. Though
many diarrhoeal diseases are easily and cheaply treatable through oral rehydration, these diseases still
claim over 1.5 million lives each year.
9780170452922
Extensive animal keeping, backyard farming, and mixed production systems have also been
associated with disease risks. The outbreaks of highly pathogenic avian influenza in South-East Asia
have been demonstrated to be related to rice production, duck population density, and human
population density. In addition to the traditional backyard poultry–keeping in urban areas, there
are increasing trends of keeping small flocks of poultry in middle- and high-income urban areas in
many countries. In both cases, awareness of the importance of biosecurity measures is often limited.
Transmission of diseases from bird to human can occur via direct contact, as humans handle birds often
when they keep them.
Opportunities for hygiene practice are limited in developing areas. With overcrowding
exacerbating the situation, disease transmission can be very fast when people are not able to wash
their hands, buy antimicrobial handwash or take medication to reduce symptoms that increase the
chance of spread, such as a runny nose.
Lack of adequate healthcare provisions

Healthcare provisions include medicine, vaccines, bandages and other medical supplies. Healthcare
services and facilities such as hospitals and health professionals are also considered to be provisions.
Poor healthcare increases susceptibility to infectious disease. Poor access to medications, particularly
preventative medication such as vaccination, leaves many people vulnerable to infectious diseases.
Fewer individuals are able to be immunised against specific diseases. This means there is more risk
of a disease spreading and a higher proportion of susceptible individuals. This is known as low herd
immunity. As more people become infected and fewer people are able to access medication such
as antivirals and antibiotics, little can be done to slow the spread. As more hosts become infected,
pathogen numbers increase, causing populations to have a very high risk of an epidemic or pandemic.
The capacity to pay for healthcare is determined by socio-economic level. Quality healthcare is
not affordable for many people living in urban settings in developing countries. Vulnerable people,
such as the very young, elderly, sick or unimmunised, are particularly at risk. Diseases associated with
poverty are a relatively high proportion of the diseases spreading in developing countries. Examples
are malaria, which can largely be prevented with barriers and medication, and TB, which can to some
extent be prevented by improving nutrition.
Key concept
Factors that affect the spread of disease include the pathogen population size, the density of the
host population, the mode of transmission, globalisation, and host susceptibility. For diseases that
are spread by bacteria, antibiotic resistance is also a cause for concern.
Question set 13.4

REMEMBERING 6 Describe a series of events that climate
1 List the three interrelated factors that change could trigger in a named
affect the spread of pathogens. mosquito-borne disease you have studied.
2 Describe globalisation. 7 Explain how some bacteria have
3 State a definition for climate change. developed resistance to antibiotics.
UNDERSTANDING CREATING
4 ABL is fatal but has caused a low number 8 Create an infographic to illustrate how
of human deaths. Discuss the three the following factors cause urban areas
interrelated factors that affect its spread to be susceptible to epidemics and
and explain why the spread among pandemics of infectious disease:
humans has so far been low. a high population density
5 Relate globalisation to an increase in the b poor living conditions
spread of a named infectious disease. c lack of adequate healthcare provisions.
9780170452922
Infectious disease transmission: simulation of 13.1

an epidemic
NOITAGITSEVNI
Background
An infectious disease is caused by a pathogen that is passed from one host to another. Spread can
occur in a variety of ways, such as through direct contact with an infected individual, indirect contact
via surfaces or objects touched by an infected individual, or airborne droplets that result from
infected individuals sneezing, coughing or laughing. The ease of transmission of disease through
airborne droplets depends on how close the infected individual and potential host are to one another,
as the larger droplets disperse and settle quickly. The common cold and influenza are typically
transmitted through droplets in the air.
Local health departments, WHO and Centres for Disease Control (CDCs) are responsible for
monitoring infectious disease outbreaks. One of their responsibilities is to identify the source of
outbreaks by tracking the routes of transmission. Over the past 100 years, these organisations have
fought the spread of disease by contact tracing, sanitation improvement, vaccine development and
other lines of research. Many of the infectious diseases that have historically been responsible for
devastating epidemics have now been reduced or even eradicated.
Aim
To simulate a real-case scenario of infectious disease transmission and to identify patient zero
Time requirement
45 minutes
Materials
1 screw cap vial with solution (containing either 7 mL 0.001 mol L- hydrochloric acid, HCI or 7 mL 1
1mol L-1 sodium hydroxide,
• 15 mL phenol red indicator in a vial
NaOH) • 1 index card
• 1 plastic pipette • PPE: lab coats, safety glasses, disposable
• Four 96-well plates (for shared use) gloves
• 1 permanent marker
Risks
Sodium hydroxide can cause severe skin burns and eye Ensure appropriate personal protective equipment is
damage. worn at all times.
Disposable gloves may pose an allergy risk. Use a type of glove that removes allergy risk and is
suitable for the chemicals being used.
Procedure
1 Collect 1 index card, 1 plastic pipette and 1 screw-cap vial containing solution. The solution in the
vial represents bodily fluid. Your vial will be labelled with a number.
2 There are four 96-well plates labelled ‘0’, ‘1’, ‘2’ and ‘3’. Locate your individual well on the class
plates. This will be labelled with the number corresponding to the number on your vial.
9780170452922
3 Using a plastic pipette, remove some of the fluid from your vial and transfer 5 drops into your well
on Well Plate 0.
4 Select a partner for your first exchange. Record their name and vial number on your index card.
5 Using your plastic pipette, transfer 5 drops from your vial to your partners’ vial. Return any liquid
remaining in your pipette to your vial. Replace the vial cap and mix the solution by inverting it
several times.
6 Using a plastic pipette, transfer 5 drops of the fluid in your vial into your well on Well Plate 1.
7 Repeat steps 4–6 for the second and third exchanges, depositing the fluid in your vial into your
wells on Plates 2 and 3, respectively. Select a different partner for each round and complete each
step before proceeding to the next exchange.
8 After all exchanges have been made, your teacher will add 1 drop of phenol red; an indicator
solution that will determine whether your vial has become ‘infected’. Vials that turn red or pink
are ‘positive for the pathogen’ (infected), whereas vials that turn yellow are negative; i.e. they did
not become infected.
Negative Positive
(not infected) (infected)
9 Report whether your vial tested positive. If so, share the names of the partners you exchanged
fluids with.
10 Based on your individual results and the data from your classmates, try to identify which vial the
infection spread from. Your teacher will add a drop of phenol red to each of the wells in the well
plates. By observing which samples indicate a positive result in each round of transfers, you may
be able to trace the spread of inspection to the original source.
11 Copy and complete Table 13.2 to identify the source of the infection. Once you have listed the
positive vials and who they had exchanged fluid with, circle the numbers of the partners whose
vials tested positive.
Results
TABLE 13.2 Positive vials and exchange partners
POSITIVE VIAL NUMBERS 1ST EXCHANGE PARTNER 2ND EXCHANGE PARTNER 3RD EXCHANGE PARTNER
NUMBER NUMBER NUMBER
9780170452922
1 Who was patient zero?

2 After the three rounds of exchanges, how many vials tested positive? Calculate what percentage
of your class this represents.
3 Graph the number of students who were infected after each round.
Analysis of results
1 If the class were divided into three groups of 10 at the start of this procedure and were allowed to
exchange only within their group, what would the transmission of the disease have looked like?
2 Did you know which vials were infected during the procedure?
3 Do you believe an individual who does not show any signs of a disease is capable of transmitting
the disease to others?
4 What is the importance of identifying patient zero in epidemics?
5 How does this simulation differ from the spread of disease in the real world, such as the spread of
COVID-19? Explain.
6 List the appropriate measures that individuals should take to limit the spread of diseases.
Taking it further
Research past infectious disease epidemics. Include information about:
• origins of the disease
• how the disease is transmitted
• typical incubation period
• signs and symptoms of the disease
• impact (i.e. death toll, cultural shifts, social effects)
• historical context
• vaccines and treatments
• preventative measures taken before, during and after.
9780170452922
WS
CHAPTER 13 SUMMARY
Chapter 13 • To survive, pathogens require an effective • Climate change is causing a rise in average
Activity sheet
life cycle. The pathogen needs a portal of air temperature and extreme weather
entry, to exploit nutrients, to avoid host events, including floods. Mosquitoes are
defence mechanisms, to replicate, a portal of more active in warmer temperatures. As
exit and a mode of transmission. previously cold areas become warmer,
• Transmission can be direct or indirect. mosquitoes will spread further, along
• Direct transmission is the transfer of a with the pathogens they carry. Mosquitoes
pathogen from a current infected host, or exploit the extra bodies of water bodies left
other reservoir, to a susceptible future host after floods and rains as breeding grounds,
by direct contact or droplet spread. increasing the area in which they can
• Indirect transmission is the transfer of breed and the number of offspring they can
a pathogen from a reservoir to a host produce.
through non-living vectors (vehicles or • Environmental factors contribute to the
inanimate objects), living vectors (living selective forces on populations, including
intermediaries) or suspended air particles. pathogen populations. The environment
• Pathogens have adaptations that facilitate is changing at a faster rate due to climate
their transmission by various mechanisms, change. Factors such as increased average
including through direct contact, by contact air temperature and habitat loss are driving
with bodily fluids, through the air and via forces behind rapid evolution of pathogens.
contaminated food, through water or by • Urbanisation is the increased trend
disease-specific vectors. for humans to live in cities, and it is
• The spread of a disease can be influenced associated with much higher density living
by three interrelated factors: the host and at times overcrowding. It can also
population density, the population of the be the cause of poorer living conditions,
pathogen and the mode of transmission. especially for vulnerable people living
All three factors need to reach a certain in the lower socio-economic areas of the
threshold for spread to be possible. world. These two factors, combined with
• Globalisation is the process by which limited healthcare provisions, result in
the world is becoming increasingly higher susceptibility to epidemics and
interconnected. Trade of goods and services, pandemics. When an outbreak occurs, it
and tourism facilitate regional and global can quickly spread if people are in close
movement of pathogens. Therefore, disease contact, water is unclean and sanitation is
is spreading globally at a much higher rate poor, and medicine and vaccinations are
than prior to globalisation. inaccessible.
TABLE 13.3 Ten diseases and their life cycles
DISEASE PATHOGEN PATHOGEN MODE OF LIFE CYCLE SPECIFICATIONS

TYPE NAME TRANSMISSION [portal of entry, site of replication
(most common to (sexual/asexual reproduction),
least common) reservoir, portal of exit]
Influenza RNA virus Influenza A, B Direct, close contact Entry and exit via respiratory system
or C via airborne droplets Replication inside epithelial cells in
when infected person the respiratory tract; human host
coughs reservoir
Indirect via fomites
9780170452922

Ross River virus RNA virus Ross River virus Indirect via female Entry via skin (blood feed)
disease (epidemic mosquito vector Replication in epithelial cells of
polyarthritis) e.g. Aedes vigilax mosquito vector and muscle cells of
the infected human host before
entering the bloodstream and then
multiplying there; the reservoir is
marsupials (e.g. wallabies)
Entry and exit via two different
blood feeds; exit not likely from
human host; pathogen circulates
through marsupials such as the
western grey kangaroo
Viral diseases of Virus Deformed wing Indirect via the vector Entry and exit via skin (blood feeds
honeybees, such virus varroa mite from varroa mite vectors)
as deformed wing Direct via vertical Replication in bee
virus disease transmission from bee
to offspring
Australian bat RNA virus Australian bat Direct contact with an Entry via site of bite or other break
lyssavirus lyssavirus infected bat’s bodily in skin
fluids, through a bite or Replication in bat reservoir and
scratch infected human host before
travelling along nerves to CNS
Exit not likely from human host;
pathogen circulates through bats
Tuberculosis Bacterium Mycobacterium Direct, close contact Entry via respiratory system
tuberculosis via airborne droplets Replication in alveolar
inhaled into respiratory macrophages in lungs
system Exit via respiratory system through
Indirect if the droplets a cough or sneeze
land on a dusty fomite,
become disturbed and
are then inhaled
Tetanus Bacterium Clostridium tetani Direct contact Entry via deep wound; replication
between soil reservoir in tissue in a deep wound in
and deep puncture the absence of oxygen; the
wound neurotoxins travel up neurons,
blocking the release of inhibitory
neurotransmitters in the CNS
Crown gall Bacterium Agrobacterium Indirect soilborne Entry via a wound on a susceptible
tumefaciens spores via a root plant root
wound, or via a vehicle Replication in plant roots; bacteria
such as grafting or transfer some plasmid DNA into
other gardening tools the plant cell genome; the inserted
Direct contact via DNA codes for uncontrolled plant
infected root to wound growth; plant cells grow and divide
on susceptible plant and form galls
root Exit is via galls, through spores that
drop into the soil or onto vehicles
for further spread
9780170452922

Chytridiomycosis Fungus Batrachochytrium Indirect via soilborne/ Entry via skin penetration (invades
dendrobatidis waterborne swimming outer layer of skin/epithelium)
zoospores Replication via asexual
Direct contact via reproduction inside the thallus
infected amphibian (zoosporangium)
skin to susceptible Exit is via zoospores going from the
amphibian skin thallus in the skin of an amphibian
into the water
Malaria Protist Plasmodium Indirect via female Entry via skin: blood feed by
falciparum Anopheles mosquito mosquito vector
vector blood feeds Replication: sexual reproduction
between male and female gametes
in the mosquito (definitive host) gut;
asexual reproduction of sporozoites
in liver cells; asexual reproduction
of merozoites in red blood cells (the
human is the intermediate host)
Exit via skin: blood feed by
mosquito vector
Phytophthora Protist Phytophthora Indirect via swimming Entry via root tips; the mycelia
cinnamomi soilborne zoospores threads grow on the surface
Indirect via vehicles and then invade the cells to gain
such as car tyres and nutrients and moisture for growth
walking boots and reproduction
Direct contact Replication is on and in root
between infected and cells, and is usually asexual; a few
susceptible roots cells form a filament, filaments
Waterborne: form mycelia threads, and a mass
zoospores can be of threads can develop into a
carried by water and sporangium
swim short distances Exit from sporangia in the form of
to susceptible hosts zoospores; if conditions are poor,
chlamydospores are produced
instead (the resilient forms of the
organism ); the soil is a reservoir
CHAPTER 13 GLOSSARY
Airborne droplet A tiny particle of liquid Antibiotic An antimicrobial chemical that
suspended in the air as part of an aerosol inhibits or destroys bacteria
(solution in air) that is sneezed or coughed into
air; a droplet can be suspended in an air current Asymptomatic Infected but not experiencing
any signs or symptoms
for a period of time before being inhaled or
landing on a surface such as a table Blood feed The method used by female
Anaerobic bacteria Bacteria that will only mosquitoes to ingest blood: they insert their
germinate and multiply in hypoxic (low oxygen) proboscis, a tube-like mouthpiece, into the
conditions skin and blood vessel of a host to feed on
9780170452922
blood; during the bite, the mosquito’s saliva is Epidemic An increase in the occurrence of a
transferred to the host; the saliva exiting the specific disease above the baseline level for a
mosquito, or the blood being ingested by the particular population; it tends to refer to larger,
mosquito, may potentially carry pathogens more serious events than an outbreak
Climate change The current climate change Evolution The process of cumulative, gradual,
occurring on Earth encompasses increasing inheritable change in a population of organisms
global average air and ocean temperatures, that occurs over many generations and a
rising global sea levels, long-term sustained relatively long time
widespread reduction in snow and ice cover, Fever Increased body temperature
and changes in atmospheric circulation, ocean
Flagellum A whip-like tail, which provides
circulation and regional weather patterns,
a zoospore and some other motile single cells
which in turn influence seasonal rainfall
with locomotion
conditions. The current change is thought to
be mostly due to human activity, primarily the Fomite A surface or non-living object carrying
an infectious agent
burning of fossil fuels. Already, there has been a
40% increase in heat-trapping carbon dioxide in Gall A brown, roughened lump of
the atmosphere undifferentiated tissue on the crown of a plant
(where the roots meet the stem on a small plant,
Close contact Close proximity (usually within
or where a branch meets the trunk of a tree); it
1.5 metres) between infected and susceptible
looks tumour-like
hosts; it allows the immediate transmission of
some pathogens by airborne droplets such as are Gametocyte An underdeveloped male or
produced by sneezing or coughing female sex cell; the form of Plasmodium that
is ingested by mosquito vectors during a blood
Crown On a shrub or small plant, the site
feed on an infected human
where the stem and roots meet; on trees, the site
where a branch meets the trunk Globalisation The process by which the world
is becoming increasingly interconnected as a
Defence mechanism A mechanism that can
result of massively increased trade, economic,
prevent entry into or persistence of a pathogen
travel and cultural exchange
within a host; it can be a physical barrier such
as skin, or a non-specific cellular process such Healthcare provision The provision of
as phagocytosis medicine, vaccines, bandages and other medical
supplies, healthcare services and facilities such
Definitive host The host in which a pathogen
as hospitals and healthcare professionals
replicates sexually; for example, in the case of
malaria, sexual reproduction of Plasmodium Impact on the host The signs and symptoms
occurs in the gut of the female mosquito of an infectious disease, and its effect on
tissue structure and function; tissue damage or
Direct contact The transmitting of a pathogen
abnormal function may be due to the replication
through physical touch between infected host
of the pathogen or to toxins produced by the
and susceptible host via skin or body fluids
pathogen; death is a possible impact in some
Direct transmission The transfer of a pathogen cases
from an infected host, or other reservoir, to a
Indirect transmission The transfer of a pathogen
susceptible host by direct contact or via droplets
from a reservoir to a host through vehicles
Distribution The location, arrangement or (inanimate objects), living vectors (living
frequency of occurrence of an infectious intermediaries) or suspended air particles;
disease; it describes the patterns of occurrence indirect transmission may require one or more
in geographical areas, such as ‘uniform’ or steps
‘random’
Intermediate host The host in which a
Encephalitis Inflammation of the brain pathogen replicates asexually; in malaria, this
Endemic A disease that is always present in a occurs in the liver and red blood cells of a
population or region human
9780170452922
Interrelated factors Factors that affect or are Portal of entry The site where a pathogen
affected by one another can enter a susceptible host; includes mucous
Keratin A strong, stable structural protein membranes lining the respiratory tract or the
found in skin, hair, horn and nails gastrointestinal tract, or a break in the skin of an
animal or the bark of a plant
Life cycle The cycle a pathogen goes through
to survive and reproduce; it includes invasion Portal of exit Many pathogens exit the host in
of the host, exploiting a nutrient-rich area of the same way that they enter; other portals of
the host, avoiding host defence mechanisms, exit include excretion from the digestive system
replicating, exiting, and transmitting to new or via the reproductive system
hosts Reservoir An organism (such as a wallaby)
Lysis The process of a cell bursting (verb: to lyse) or habitat (such as soil) in which a pathogen
can reside, and sometimes replicate, prior
Macrophage A white blood cell that can
perform phagocytosis on microbes such as to entering a susceptible host; a reservoir is
somewhere in which the pathogen does not go
pathogens, by engulfing them (see endocytosis
in Chapter 12) and destroying them with the use extinct
of enzymes Sign An objective and measurable experience
Merozoite A relatively mature form of of a pathogen host that is directly observable:
the Plasmodium pathogen; it is the form elevated body temperature, breathing rate, pulse
that develops in the liver of a human host, rate and/or blood pressure are important ‘vital’
exits the liver, and invades red blood cells, signs of disease
spreading among them until some develop into Sporozoite The tiny infectious cell form of
gametocytes a parasite (such as Plasmodium); it is often
Mucous membrane A mucus-secreting the infective agent that enters the host; it is a
membrane that lines the respiratory, digestive, relatively immature form of a pathogen
excretory and reproductive tracts (note the Spread To transmit a pathogen to susceptible
different spelling of the mucous membrane and hosts over a wider area and into new
the mucus it secretes) populations
Mycelial thread Also known as a hypha, a Susceptible host An organism that is
mycelial thread grows on the surface of infected vulnerable to developing infection when
roots, absorbing nutrients; it is highly branched invaded by germs; very young children,
and can be observed by the naked eye, growing older people, people who are ill or who are
on rotten plant roots receiving particular medicines that reduce
Outbreak A sudden, unexpected increase in their immunity, people with long-term health
the prevalence of a particular disease above the conditions like diabetes, and those who
baseline level for that population; it could be are physically weak due to, for instance,
a single case of a contagious disease in a small malnutrition or dehydration can be particularly
community susceptible
Pandemic A disease that has spread rapidly Symptom A subjective experience felt by a
throughout the world; an epidemic that has patient, such as nausea or pain
crossed international borders Threshold A certain level that must be
Phagocyte A cell that is capable of exceeded for a result to be produced (the
phagocytosis; it can be a macrophage or a spread of a pathogen is reduced unless the host
neutrophil population reaches the threshold value)
Phagocytosis The process of engulfing and Transmission Transport of a pathogen from
destroying a microbe an infected host or a reservoir to a susceptible
host
Population density The number of organisms of
the same species living in a particular area at a Tubercle A small, round structure made of
specified time cells that is produced as a result of an infection
9780170452922
Urbanisation The increase in the proportion of Zoosporangium (thallus) A roughly spherical,

people moving from rural areas to live in towns smooth-walled growth; inside the thallus,
and cities asexual reproduction occurs, producing new
Vector In reference to diseases, an agent that zoospores; the thallus contains a plug that is
transmits pathogens from one host to another; removed once the thallus matures, releasing the
in genetics, a vehicle used to transfer DNA zoospores into water
sequences from one organism to another Zoospore A spore with a flagellum; one of
Zoonotic disease A disease that animals pass to several forms of a fungal or protistan organism
humans; an infection that is naturally transmitted
between vertebrate animals and humans

Remembering
1 For a pathogen, state the purpose of a host.
2 Describe the generic life cycle of a pathogen.
3 List three interrelated factors that can affect the rate of spread of a pathogen.
Understanding
4 Summarise the life cycle of the pathogen that causes chytridiomycosis.
5 Describe the site/s and form/s of the parasite Plasmodium during;
a sexual reproduction
b asexual reproduction.
6 Name two diseases with more than one mode of transmission and describe the modes.
Applying
7 Discuss the possible impacts of global climate change on the distribution of mosquito-borne
diseases.
8 Describe two major differences between the pathogen that causes malaria and the pathogen that
causes Ross River virus disease.
9 Provide a rationale for spending money on biosecurity to prevent the varroa mite from entering
Australia.
10 Differentiate between an epidemic and a pandemic.
11 Explain why tuberculosis spreads easily in urban areas of poor countries.
Analysing
12 Compare crown gall and tetanus, using the following terms:
a pathogen type
b pathogen forms
c aerobic
d spores.
9780170452922
Evaluating
13 Given the increase in antibiotic resistance in recent years, discuss whether we should restrict
the use of antibiotics to only those people with a life-threatening illness.
14 Consider your knowledge of infectious disease and evaluate urbanisation, listing two
advantages (pros) and two disadvantages (cons) for humans.
Creating
15 Design an experiment to test the effectiveness of a new antibiotic on a specific bacterium.

1 A pandemic is most likely to arise from a 5 Many strains of bacteria that cause diseases
new influenza virus strain that: in humans are evolving resistance to
A spreads easily among humans antibiotics. Explain how a disease-causing
B causes a high mortality rate in humans strain of bacterium can evolve resistance
C cannot replicate in humans to an antibiotic used to treat the associated
D has the same protein coat as an existing disease. (4 marks)
strain. [Q34e 2016 SCSA]
[Q16 2018 SCSA]
6 Describe how malaria is transmitted from
2 A pathogen that infected plants has cells an infected person to an uninfected person.
with a true nucleus, mitochondria and a cell (4 marks)
wall made of chitin and is therefore a: [Q35b 2018 SCSA]
A bacterium
7 Malaria is distributed mainly near the
B fungus
equator, where it is warm and has relatively
C protist
high rainfall. Unlike malaria, tuberculosis
D virus.
occurs throughout the world. Explain
[Q17 2017 SCSA]
why tuberculosis is much more widely
3 In the course of an influenza epidemic, the distributed than malaria. (5 marks)
number of susceptible hosts will: [Q35e 2018 SCSA]
A stay the same
8 Discuss how population density can
B increase
influence the susceptibility of an urban area
C decrease
to an influenza epidemic. (5 marks)
D fluctuate.
[Q38 2018 SCSA]
[Q29 2017 SCSA]
9 Discuss how the provision of healthcare can
4 An outbreak of a serious new strain of
influence the susceptibility of an urban area
influenza occurs on a cruise ship at sea. The
to an influenza epidemic. (5 marks)
best method of preventing the influenza
from spreading to populations on land is to: [Q38 2018 SCSA]
A keep all people on the ship until 10 Discuss how phytophthora dieback disease
everyone has recovered spreads and the management strategies that
B send crew members ashore to obtain can be used to control the spread of this
antiviral medication disease. (10 marks)
C disinfect all eating and recreational [Q39 2018 SCSA]
areas on the ship
D bring in medical personal to vaccinate
people on the ship.
[Q8 2016 SCSA]
9780170452922
469
14
PATHOGEN CHAPTER 14 CONTENT
MANAGEMENT material.
STARTER QUESTIONS
STRATEGIES 1 Recall one or two diseases you have studied in Chapters 12
and 13. Can you give examples of how Western Australia
attempts to control the spread of those infectious diseases
locally and across the state?
2 Can you describe how Australian authorities have kept many
infectious diseases outside our national borders?
3 Of the pathogens that you have studied so far, which is the
most difficult to manage in terms of controlling spread, and
can you explain why?
» management strategies are used to control the spread of
infectious diseases, including
– quarantine
– immunisation – herd immunity
– disruption of pathogen life cycle
– medications – antibiotics and antivirals
– physical preventative measures

» contemporary models can project the spread of disease
and simulate the effects of possible interventions.
Supercomputing has enabled models to predict the
relationships between epidemic frequency and location,
and factors such as population size, environmental change,
persistence and antibiotic resistance
» international cooperation and communication are needed
to evaluate the risk of the spread of disease, including the
emergence of new viral diseases
» quarantine measures protect Australia’s agriculture industry
and environment against the influx of disease-carrying
materials and organisms in the face of increasing global trade
and travel
9780170452922
14.1 WHY DO WE NEED PATHOGEN MANAGEMENT

STRATEGIES?
Growth in the number of emerging diseases, speed of transmission, and distribution of familiar
diseases has increased rapidly in the last few decades. Due to a boom in low-cost international flights,
outbreaks of disease that could previously have been contained within small areas or communities
can now spread quickly and become global incidents. Throughout history, some diseases have
not been eradicated, but have remained resistant to medical treatment. Some have persisted after
hundreds of years of infecting our societies.
Emerging diseases fall into one of the following three categories:
• diseases that have recently appeared in a population
• diseases that have occurred previously but until recently have affected only small numbers in
isolated places
• diseases that have occurred previously but only recently have been associated with a newly
identified pathogen.
Examples of emerging diseases are COVID-19, ebola, AIDS, and the re-emerging diseases malaria
Emerging infectious
diseases and tuberculosis (TB). Understanding the factors that contribute to the spread of disease within a
Investigate several population, and globally, is important in managing disease outbreaks. Management of spread relies on
emerging infectious communication and collaboration between countries, organisations and communities. Interventions
diseases at this website.
can then be designed to target factors that prevent further spread of disease. Understanding the life
cycle of a pathogen can help scientists work out how to prevent and control the spread of the disease
it causes. Factors that can be targeted are:
• the mechanism of transmission
• environmental factors (such as climate)
• characteristics of the infected population (such as levels of immunisation).
Disease management is a coordinated response involving prevention, control and treatment, and
is a response that is specific for each infectious disease.
Prevention and early detection are by far the most effective strategies, because most emerging
diseases are caused by viruses for which we currently have no vaccines. Prevention includes the
prevention of the transmission of a disease, of the onset of disease signs and symptoms, and of
the impact of the disease on the environment or society. It involves a range of simple to complex
measures, such as washing hands, making health services accessible, and utilising predictive
computer modelling. Practices that prevent the spread of disease include hygiene practices,
quarantine, vaccination, public health campaigns, use of pesticides, and genetic engineering.
Control measures are a set of strategies that reduce the incidence and duration of a disease.
Management strategies may help control the spread of a disease, which may result in localised
elimination of that disease, and may ultimately lead to its global and permanent eradication. They
involve meticulous preparation for and rapid responses to outbreaks at community, state, national and
global levels. Australia has strict border control and quarantine strategies for the purpose of limiting an
outbreak. When an outbreak occurs, response teams plan and carry out strategies that aim to minimise
spread of a disease. The World Health Organization (WHO) has response teams with strategies aimed at:
• prevention (once the outbreak has happened)*
• anticipation
• early detection
• containment
• control
• eradication.
*Control of a disease also involves preventative measures, but these strategies are being applied after an outbreak.
9780170452922
CHAPTER 14 | Pathogen management strategies 471
Treatment involves providing healthcare, such as medication and vaccination, at the right time
and cost. Antimicrobial medications are crucial for managing certain diseases, but many medicines
get distributed according to a community’s ability to afford them. Following treatment, if the host no
longer has the pathogen present, or signs or symptoms of disease, then they are said to be cured.
Some epidemics have well-established control measures, yet they remain a threat for many
individuals for a variety of reasons. Influenza remains a threat because the pathogen rapidly changes
strain. TB bacteria have evolved to become resistant to antibiotics. Many people can’t afford the
testing needed to diagnose a disease, or its treatment. For many diseases, eradication awaits financial
help, especially to increase health provisions.
TB
1000000000
TB
DEATHS
Smallpox
Malaria
Plague
Influenza
Cholera
AIDS
FIGURE 14.1 Some infectious diseases have not been eradicated, even after hundreds of years of infection.
FIGURE 14.2 A person infected with smallpox. Vaccination efforts meant that the disease was declared to have
been eliminated in 1980.
Epidemiology is the study of the occurrence of disease in populations. Epidemiologists are

professionals who work to prevent or minimise the impact of diseases in the population. Their work
may include such activities as identifying outbreaks, determining the effectiveness of a vaccine, and
9780170452922
calculating the cost effectiveness of various means of controlling disease transmission. Occasionally,
epidemiologists act as detectives, tracking down the cause of an emerging disease, determining its
reservoir and mode of transmission, and helping organise healthcare workers to bring the disease
under control. Epidemiologists aim to describe patterns of disease, identify causes of disease, and
provide data for management of a disease. They analyse data gathered about notifiable diseases.
Notifiable diseases are communicable diseases that, if diagnosed, are required to be reported to
a state government healthcare working group. In Australia, the Communicable Diseases Network
Australia team have agreed on a list of communicable diseases that require reporting by the public.
Data on notifiable diseases are analysed under the Commonwealth’s National Notifiable Diseases
Surveillance System. If outbreaks occur that put communities at risk, control measures will be
executed. Information can then be sent to international bodies such as WHO for global surveillance
and management. International cooperation and communication are needed to evaluate the risk of
the spread of an infectious disease, including emerging diseases.
In 2018, 27 980 notifiable infectious diseases were reported in Perth. Diseases of concern that
are on the rise include sexually transmitted infections, measles, influenza and varicella. In addition,
although the benchmark for fully immunised 1-year-olds is 95 per cent for achieving community
protection, fewer than this number were immunised that year (93.7%). This is a cause of concern for
epidemiologists, health professionals and government officials and the wider community who wish to
minimise outbreaks of infectious diseases.
Key concept
Epidemiologists develop management strategies which focus on the prevention, control and
treatment of disease, in order to minimise the spread of outbreaks.
Question set 14.1

REMEMBERING 4 How does understanding the life cycle of
1 What are the three different categories of a pathogen help to prevent and control
emerging diseases? disease?
2 Recall the terms that best describe the UNDERSTANDING
following: 5 Explain why an international team
a the study of the occurrence of a is required for managing infectious
disease in populations diseases. Why can’t Australia manage
b a coordinated response involving diseases effectively without international
prevention, control and treatment communication and cooperation?
c a disease, usually viral, that has
recently appeared in a population.
3 List the criteria for someone to be
identified as ‘cured’ of an infectious
disease.
14.2 STRATEGIES THAT CONTROL THE SPREAD

OF PATHOGENS
Management strategies should be utilised before and during an outbreak, depending on the
pathogen: quarantine, immunisation, disruption of pathogen life cycles, medications (antibiotics and
antivirals) and physical preventative measures. There is not just one method for disease management.
We will explore generic management strategies, and also specific advice for specific diseases.
9780170452922
Quarantine
Quarantine is a period of isolation undertaken by potentially infected individuals to prevent the
spread of a contagious disease. Organisms suspected of carrying a disease are isolated from local,
susceptible populations until at least the incubation period is finished, and clinical signs and symptoms
have passed and/or test results are negative. Australia has strict quarantine laws that prohibit the entry
of items that may carry an infectious animal or plant disease. When products are potential carriers of
pathogens, biosecurity officers enforce a compulsory period of isolation of the products. Biosecurity
is a set of strategies that support the prevention of, response to and recovery from diseases that
affect our economy, environment and health. Biosecurity in Australia has maintained a disease-free
status for many of the world’s diseases. Our geographic isolation plays a major role in maintaining this
status, but globalisation has diminished the geographical advantage. With nearly 60 000 kilometres of
coastline offering a variety of pathways for exotic pests and diseases, the Department of Agriculture
screens, inspects and clears the millions of people, mail parcels, baggage, ships, animals, plants and
cargo containers entering Australia every year using X-ray machines, surveillance and detector dogs.
Quarantine is a practice used by our biosecurity officers to stop goods and individuals who have been
exposed to infectious diseases from carrying that disease into healthy, susceptible populations. It is
used to counter the threat of spreading disease via the movement of infected individuals.
If harmful diseases enter Australia, they can cause huge financial losses for many industries,
especially agriculture. It is also costly to attempt to bring a disease under control once it has entered.
The cost of quarantine is much less than the cost to industry that accompanies an outbreak. Northern
Australia has implemented extreme quarantine rules because of its proximity to the South-East Asia
and Pacific region. The Northern Australia Quarantine Strategy is implemented by the Australian
Quarantine and Inspection Service (AQIS) to monitor the comprehensive quarantine regulations for
the coastline from Cairns to Broome, including the Torres Strait.
Quarantine was first used during the 14th century to stop the spread of the bubonic plague. Ships
arriving into Venetian ports had to anchor just outside the port for 40 days before passengers could
disembark. The modern term ‘quarantine’ derives from the Italian word quaranta meaning ‘forty’.
Captains of planes and ships carrying passengers collaborate with biosecurity officers because they
are required to report passengers displaying symptoms of certain infections. In exceptional circumstances,
intensified quarantine measures may be implemented at airports to try to prevent the spread of disease by
air travel. For example, in 2009 during the H1N1 influenza (swine flu) pandemic, thermal imaging cameras
were used at airports to try to detect people with a fever who might have the disease.
On 12 March 2020, COVID-19 was declared a pandemic by WHO. From 28 March 2020,
passengers arriving in Australia from overseas were subject to the Australian Government’s mandatory
quarantine period of 14 days. Passengers were provided with suitable accommodation, usually a hotel,
to stay in during this period. Those in quarantine had to remain in the allocated accommodation until
they were medically cleared to enter the Australian community.
Goods brought into Australia on passenger planes and commercial shipments are also inspected
for high-risk items, such as meat or plant products. These products can then be stopped from
entering the country. Australia has particularly strict quarantine laws because of the potentially
devastating impact of imported pathogens on our unique flora and fauna. As an island, protecting our
borders from imported pathogens and pests is easier than in many other parts of the world.
To protect Australia’s agriculture industry and environment against the influx of disease-carrying
materials and organisms, the following measures are undertaken:
1 inspection of all material brought into Australia; confiscation of suspect items
2 materials and organisms, particularly plants, that display the impact of an infectious disease are
destroyed or kept in quarantine stations
3 monitoring for vectors entering Australia, such as the varroa mite; use of biotechnology to
reliably identify species.
4 Northern Australia on high alert for infectious disease, due to its close proximity to South-East Asia.
5 Any items such as tools are treated before movement between regions.
9780170452922
WA has remained relatively free of pests and diseases that would adversely affect our agricultural
industries and environment. In March 2020, Queensland fruit fly, a serious pest of many fruits was
detected in Perth. Larvae develop within the fruit, feeding from it and ruining the harvest. When the
Queensland fruit fly
For updates on the adults emerge, females penetrate fruit to lay their eggs. The wound this makes allows fruit-rotting
Queensland fruit fly bacteria to enter. A quarantine area has been set up, along with a baiting and trapping program,
epidemic, refer to this to manage the outbreak. WA farmers rely on quarantine to keep their crops disease-free, enabling
website.
them to export their crops to worldwide markets. The Department of Agriculture and Food, through
Quarantine WA, enforces strict biosecurity legislation on imports. They inspect the following potential
carriers:
• new or used machinery that is used in association with agriculture, animals, mining or earth
moving
• animals or animal products
• bees, honey and other hive products
• animal feed of plant origin other than processed or manufactured feed for dogs, cats and fish
(including hay, straw, fodder, seed and other grain used for animal feed)
• plants or plant products, including flowers, cuttings, bulbs, fruit and vegetables (excluding canned
or cooked plant products)
• seeds
• absorbent pet litter derived from plant material
• soil
• plant-growing media and landscaping material such as potting mix, wood-chips and mulch
• cargo containers
• containers used for, or in connection with, agricultural products
• containers used to transport animals (other than dogs and cats)
• containers of live fish, including all contents and the fish
• vessels and vehicles.
Quarantine in action: Department of Biodiversity, Conservation

YCARETIL CIFITNEICS
and Attractions
Myrtle rust: WA and South Australia have so far successfully prevented the entry and spread of a plant
dodging the fungus disease – myrtle rust – even though the disease has spread through all other states and
bullet? territories. Learn about it through the weblink.
Read about the
disease in this 1 Explain the potential impact on our environment if it did spread to WA.
article. 2 What role does quarantine play in preventing the disease from entering our state?
Question set 14.2a

REMEMBERING 2 List five potential carriers of disease
1 Recall the term for the following: inspected by biosecurity officers in
a a set of strategies that support Australia.
the prevention of, response to and UNDERSTANDING
recovery from diseases that affect our 3 Explain why the northern half of Australia
economy, environment and health conducts more biosecurity surveillance
b a period of isolation to prevent the and quarantine than the southern half?
spread of a contagious disease.
9780170452922
Immunisation and herd immunity

Immunisation is the act of protecting someone from disease by the use of a vaccine, and also
describes the process of developing resistance to a specific disease. A vaccine stimulates active
immunity, which is the production of specific antibodies in a susceptible host during its response to
a specific pathogen, and it promotes the formation of memory cells. A serum-type vaccine can be
used, but this leads to passive immunity and no formation of antibodies or memory cells. Antibodies
are special proteins produced by white blood cells. They react with and help make pathogens
harmless. Antibodies are also known as immunoglobulins, and they are produced by specialist white
blood cells called B cells. Vaccination is the administration of a vaccine into the bloodstream to
cause immunity, usually by injection. Immunisation is what happens in your body after you have a
vaccination. The vaccine stimulates your immune system so that it can recognise the disease and
protect you from future infection (i.e. you become immune to the infection).
Vaccines help develop immunity by inducing a response to the part of a pathogen called an
antigen. During infection, antigens, which exist on the surface of pathogen, trigger a response. A
vaccine also triggers the response (production of antibodies), without the presence of the pathogen in
its typical form. The pathogen may be dead or attenuated; therefore, the immune response is initiated
without developing the disease. Minor symptoms may be experienced instead of the full effects of a
disease, but most importantly, the host develops a supply of specialist ‘memory’ cells that the body
can use as a defence if infected with the same pathogen.
Vaccines consist of a dead, weakened or inactive form of a pathogen. For example, the vaccine
may be a pathogen that has had DNA or RNA removed, preventing the replication of the pathogen
but still supplying the antigen required for an immune response by the recipient. Vaccines contain
antigen components from an infected organism. If the antigen components stimulate an immune
response (but not disease), they can protect against subsequent infection by that organism.
ACTIVE IMMUNITY PASSIVE IMMUNITY
Natural Artificial Natural Artificial
Infection Vaccination Maternal antibodies Monoclonal antibodies
FIGURE 14.3 Examples of active and passive immunity
What is herd immunity?

When a high enough proportion of a population, the threshold proportion, is immune to an infectious
disease, the fraction who are not immune are to a large degree protected from transmission. This is
known as herd immunity. Herd immunity can stop a disease from spreading, and it prevents outbreaks.
When a high threshold percentage of the population is vaccinated, it is difficult for infectious diseases
that are contagious to spread, because there are not many people who can be infected. For example,
if someone with measles is surrounded by people who are vaccinated against measles, the disease
9780170452922
cannot easily be passed on to anyone, and it will quickly disappear again. This is because there will too
few susceptible hosts for the pathogen to be transmitted to. The lack of susceptible hosts provides
protection to the vulnerable people in a community, such as people with a compromised immune
system, new-born babies and the elderly. If a certain threshold of people have been immunised, then
the few who have not have a very low chance of becoming infected. This is an effective management
strategy for preventing epidemics.
Herd immunity does not protect against all vaccine-preventable diseases. The best example
of this is tetanus, which is infectious but not contagious. The bacteria are transmitted from the
environment (soil), not from other people who have the disease. No matter how many people around
you are vaccinated against tetanus, it will not protect you from tetanus.
Principles of herd immunity

1 A critical (high enough) proportion of the host population becomes immune to a specific disease.
2 Immunity is usually by an artificial vaccine (or can be gained naturally by recovery from disease)
causing the formation of specific antibodies and memory cells against a specific pathogen.
3 This limits the spread of the disease, because there are too few susceptible people to sustain the
spread. The pathogen cannot reproduce at a high enough rate to sustain its population.
4 Infected hosts carrying the pathogen are more likely to come into contact with immune
individuals, reducing the possibility of transmission and reducing the risk for susceptible people.
5 The higher the proportion of immune individuals, the greater the protection.
6 It protects people who cannot be vaccinated, such as people with an anaphylactic reaction to
a vaccine ingredient (which is rare), and pregnant women or those undergoing a treatment that
suppresses their immune system (in the case of vaccines containing live viruses).
7 The proportion of the population who need to be immune to create herd immunity depends on
the virulence of the pathogen.
Figure 14.4 demonstrates why herd immunity occurs when the proportion of a population who are
immune to a disease reaches a high enough level. Infected individuals (orange) are only able to spread
the disease when they come into contact with susceptible individuals (black). When there are enough
immune individuals (blue), the chance of an infected individual coming into contact with a susceptible
individual is so low that the disease cannot spread. For herd immunity to prevent the spread of disease,
a high proportion of the population needs to be immune. The exact proportion depends on the
virulence and infectivity of a particular disease. Some individuals have health conditions that mean they
cannot be immunised, and they have to rely on herd immunity for protection from infection.
Population with Population without

herd immunity herd immunity
Infected
individual
Immune
individual
Susceptible
individual
FIGURE 14.4 Principles of herd immunity
9780170452922
There are concerns about vaccines. Side effects can be experienced by the recipient. However,
significant harmful side effects are rare.
In Australia, children are routinely vaccinated against a large number of infectious diseases, including
hepatitis B, pertussis, measles, tetanus and poliomyelitis. Groups that are at high risk of infection, such
as people with complex health issues or chronic illnesses, may need additional vaccinations. As new
vaccines are developed, there are immunisation programs against an increasing number of diseases,
with evident benefits to health. Figure 14.5 shows the rates of infection of Haemophilus influenzae and
meningococcal C after the introduction of vaccines against these pathogens.
10 Haemophilus influenzae
vaccination program
introduced
8 Meningococcal (Australia)
setar noitacfiiton noitcefnI
)slaudividni 000 001 rep(
Meningococcal C Meningococcal C Meningococcal (Victoria)

6 vaccine available vaccination program
Haemophilus influenzae
introduced
type B (Australia)
metsyS ecnallievruS sesaesiD elbafiitoN lanoitaN

Haemophilus influenzae
airotciV ,htlaeH fo tnemtrapeD dna )SSDNN(

4 type B (Victoria)
0
1991 1996 2001 2006 2011
Year
FIGURE 14.5 Rates of Haemophilus influenzae type B and meningococcal infection since the introduction of
vaccines against these diseases
Herd immunity 14.1

Read the information and watch the video in the weblink to find out more about herd
NOITACILPPA
immunity. Herd immunity
1 How does vaccination help you? Explore the
principles of
2 How does vaccination help others? herd immunity
3 Describe the principles of herd immunity. and watch the
4 Why does vaccination not help with tetanus? video.
Key concept
Quarantine and immunisation strategies aim to reduce the spread of infectious disease by isolating
potential carriers away from the population (quarantine) and reducing the number of infections of a
population (immunisation and herd immunity).
Question set 14.2b
REMEMBERING 4 Copy and complete the flow diagram
1 Define: in Figure 14.6 (page 478) to describe,
a immunisation in detail, the sequence of events a
b vaccination community experiences in order to gain
c antibodies. herd immunity. One of the steps has been
2 Outline the principles of herd immunity. completed for you as an example.
UNDERSTANDING
3 Apply the principles of herd immunity to
the control of influenza in Australia.
9780170452922
Vaccination
(or natural immunity)
There is a percentage of people

Critical/threshold that needs to be immune for
proportion immune a population to have herd immunity
(e.g. for measles it is approx. 90%).
Specific antibodies
and memory cells
Too low a number of

susceptible hosts for
the pathogen to
persist
Herd immunity/
protection for the
vulnerable
FIGURE 14.6 The sequence of events a community experiences in order to gain herd immunity
Disruption of a pathogen life cycle

Understanding the life cycle of a pathogen can help scientists work out how to prevent and control
the spread of the disease it causes. The life cycle of each pathogen is unique, but it generally
involves a reservoir, a portal of exit from an infected host, a mode of transmission, a portal of entry,
replication and a susceptible host. Many of these factors can be targeted in order to break the cycle
and reduce the survival of the pathogen. Some factors that are targeted include the mechanism of
transmission, mechanism for entry, replication stages, persistence in a reservoir, portal of exit and
immunity in host.
Replication is the process of producing new pathogens from old pathogens. Viruses replicate by
taking control of host cell replication enzymes. Bacteria replicate by binary fission, a form of asexual
reproduction. Fungi and protists may reproduce via sexual or asexual reproduction.
Persistence refers either to the ability of a pathogen to survive for long periods in reservoirs, or
how long the pathogen remains viable outside the host.
If pathogen populations stop transmitting, infecting, replicating, persisting, or gaining nutrients, or
can’t survive against the immune system of hosts, then the disease may stop spreading. When one of
three interrelated factors influencing the spread of disease is missing, spread stops. This can lead to
elimination or even eradication of a disease. The three factors needed for disease spread are:
1 a susceptible host in sufficient density
2 growth of a virulent pathogen population
3 transmission.
Epidemiologists have been studying the life cycle of Plasmodium for decades with the intention
of targeting a stage in the life cycle as a measure of control. Complex analysis of the biology of the
organism’s life cycle is crucial to meeting the aim of stopping its spread.
9780170452922
Plasmodium causes the disease malaria. This protistan pathogen requires two types of hosts in its
life cycle; one of them, the female Anopheles mosquito, also transmits the pathogen from infected
to uninfected hosts. The mosquito gut is where Plasmodium reproduces sexually. Thus, there are
two essential hosts involved in the life cycle: the intermediate host (the human), and the mosquito
vector that also plays the role of definitive host (the host within which the adult form of the parasite
produces gametes).
Kill asexual Prevent development

forms within mosquito
Plasmodium
(the agent)
Chloroquine + primaquine Kill sexual forms
Early diagnosis
and treatment
Prevent breeding
Reduce stagnant water
Prevent sporozoite Kill larvae
from entering liver
Possible Vaccine Prevent entry
Close doors/windows
Deny blood meal Prevent biting Mosquito

Protect from Kill adult mosquitoes (the vector)
mosquito bites Nets,
repellents
Human
(the host)
FIGURE 14.7 Control strategies at the various stages of the life cycle of Plasmodium
Mosquitoes are a vector for the transmission of Plasmodium. They have been targeted as
a control measure. However, adult mosquitoes are highly active and have shown resistance to
insecticides, making population control difficult. It is therefore important to target their larvae. The
pathogen has also shown resistance to the anti-malarial drugs. Each control target is promising,
but it also has issues. Targeting the human host through early diagnosis and the use of medication
has potential, but poverty, low access to health provisions, and poor education have prevented this
approach from breaking the cycle. Killing both the asexual and sexual forms of the parasite has been
made possible, but drug resistance has evolved. Killing the mosquito vector with insecticide has
been effective in large areas of the world, but insecticide resistance has evolved. Lastly, prevention of
transmission via blood feeds through using barriers to infection (such as bed nets, clothing, closed
windows and insect repellent) has reduced the rate, but not all people are diligent or educated about
the effectiveness of these simple measures.
9780170452922
If all humans could somehow be protected from infections for a few months at a time (e.g.
through vaccination), the malaria parasite would eventually die out, because all malaria-carrying
mosquitoes naturally have a short life span. However, this vector-transmitted disease is not currently
eradicable because so far we have no consistently effective eradication measures.
Travellers to areas where malaria is endemic, and vulnerable individuals living within those areas
(e.g. pregnant women, patients with complex health issues, patients with organ failure), should be
started on chemoprophylaxis (preventative treatment with drugs) against malaria, before travel in the
case of travellers. The chemoprophylaxis involves taking antimalarial drugs every day (or weekly in the
case of some antimalarial drugs), so as to suppress malaria.
)8177/secruoser/on.adirg.www//:sptth( suinelhA oguH/ladnerA-DIRG/PENU

Stopping mosquito-
borne disease Key
This interactive Current distribution
investigates the life Possible extended distribution by 2050
cycle of mosquito (suitable climate)
vectors with the aim of Current distribution, but unsuitable
stopping the spread of a climate by 2050
disease.
FIGURE 14.8 Map showing the predicted changes in distribution by 2050 of Plasmodium falciparum malaria,
based on modelling data
In 2002, scientists succeeded in sequencing the P. falciparum genome, which has allowed
researchers to better understand ways to target it. For around three decades, scientists have been making
progress with a number of vaccines. The vaccine that was trialled in Malawi, Ghana and Kenya is the RTS,S
Malaria vaccine trial
Read about a new vaccine, for children up to 2 years of age. Children are the chosen recipients of the vaccine trial because
Australian vaccine in malaria claims the life of one child every 2 minutes. The goal of the vaccine is to induce high levels of
clinical trials.
antibodies to both block the sporozoites from entering the liver cells (part of the pathogen’s life cycle) and
to tag specific infected cells for destruction. However, this vaccine’s effectiveness is currently below 50%.
Scientists are aiming to increase its effectiveness to above 50%.
Key concept
By understanding the life cycle of pathogens, scientists hope to eliminate and eradicate disease by
targeting the persistence, methods of replication and modes of transmission of the pathogens.
9780170452922
Question set 14.2c

REMEMBERING a Describe how the new vaccine
1 Describe the generic life cycle of a impacts the life cycle of Plasmodium.
pathogen. b Draw and label the life cycle of
2 Draw and annotate a diagram showing another pathogen and indicate where
the life cycle of a Plasmodium pathogen in the life cycle a control measure
and indicate which parts have been could be put into place to stop the
targeted as control measures. spread. Explain the reasons for your
choice.
UNDERSTANDING
3 Explain why the new vaccine for malaria
is being trialled on children.
Medications
Medications used to treat infectious diseases come in the form of antimicrobial agents. The type of
antimicrobial depends on the type of organism that is causing the infection: whether the organism is a
bacterium, virus, fungus or protist. Antibiotics are medications that treat bacterial infections, antivirals
treat viral infections, and antifungals treat fungal infections. There are also some antiprotozoal drugs
(such as antimalarials) that treat protistan infections.
Antibiotics
Antibiotics are antimicrobial chemicals that inhibit or destroy bacteria. They target structures or
processes only present in bacteria. They are used as a treatment for an infectious disease and can lead
to a cure. This results in a decrease in the spread of the disease from the infected host.
Bacteria are prokaryotes, so it has been relatively easy to find and develop antibacterial drugs
that have minimal side effects on many other organisms, because eukaryotes have a very different
structure. Antibiotic drugs target structural features and metabolic characteristics of prokaryotes
that are significantly different from those in eukaryotic cells. Drugs used to treat bacterial diseases
can be grouped into categories based on their modes of action. Table 14.1 provides examples of
specific antibiotics and their mode of action on bacteria. Without antibiotics, a simple wound or
straightforward surgery, such as the removal of an appendix, can become life threatening. Pneumonia
would return to being the mass killer it once was.
TABLE 14.1 Mode of action of some antibiotics
EXAMPLES OF ANTIBIOTICS ACTION ON BACTERIA

Streptomycin Disrupts protein synthesis
Penicillin Disrupts cell wall growth in bacteria
Clotrimazole Disrupts cell membrane permeability
Antibiotics that are classified as penicillins and cephalosporins all interfere with the synthesis of
the peptidoglycan layer in prokaryotic cell walls. Because eukaryotes have neither the peptidoglycan
components nor the enzymes that synthesise them, these drugs do not affect the host cells. A second
class of drugs (including chloramphenicol, the tetracyclines, and erythromycin) binds to prokaryotic
ribosomes and inhibits protein synthesis. Prokaryotic ribosomes are structurally different from
eukaryotic ribosomes, so these drugs have minimal effect on eukaryotic cells. Nevertheless, some of
them may be toxic to some human tissues when they are used in high doses or for prolonged periods
of time. Rifampicin is one of the antibiotics frequently used for treating TB. This drug inhibits prokaryotic
RNA synthesis.
9780170452922
Inhibition of cell
wall synthesis
Inhibition of nucleic Disruption of cell
acid synthesis membrane function
Inhibition of Blocking pathways and
protein synthesis inhibiting metabolism
Cell wall
Cell
DNA membrane
Folic acid
Ribosome
FIGURE 14.9 Modes of antibiotic action
Antibiotics have been overused and misused. Misuse occurs when antibiotics have been
prescribed and the full course has not been taken. Other times, patients have been prescribed
antibiotics as a preventative measure instead of a treatment or they have been prescribed too early,
Superbugs that resist
antibiotics can evolve in preventing immune systems from building naturally acquired immunity (these are examples of
11 days overuse). Resistant bacteria have rapidly evolved. Antibiotics act as a selection agent in the evolution
View this video to see
graphic images about of bacteria, because they give a survival advantage to those bacterial populations with the favourable
the misuse of antibiotics characteristic of antibiotic resistance. Bacteria that are resistant to antibiotics survive and quickly
and an investigation of reproduce, passing on the resistance gene. Over many replications, entire bacterial populations can
antibiotic resistance in a
giant Petri dish. become resistant to antibiotics as the resistance gene becomes fixed.
Antibiotics that treat TB have become ineffective over time. The Bacillus thuringiensis (Bt) bacteria
evolved resistance because infected people did not take the complete dose (due to being forgetful
or ignorant). Now, a cocktail of antibiotics needs to be taken over a minimum of 6 months for the
medication to be effective.
Antivirals
Antivirals are antimicrobial chemicals that inhibit the ability of viruses to replicate. This type of
medication only works on viruses, disrupting the life cycle of the virus. If fewer viruses are made,
the duration of the disease will be shorter and the spread of the disease will be reduced. Unlike
other antimicrobials, they do not deactivate or destroy the microbe. Antivirals treat viral infections
by minimising symptoms and infectivity, and shorten the duration of the illness. However, most viral
infections will be resolved by natural immune responses.
Most illnesses due to viruses are treated symptomatically until the host’s immune system controls
and eliminates the pathogen (or the host dies). Antiviral drugs that are used typically target virus-
specific enzymes involved in viral nucleic acid synthesis.
Most of the antiviral drugs now available are designed to help combat HIV, herpes viruses (best known
for causing cold sores and genital herpes, but actually the cause of a wide range of other diseases, such as
chicken pox), the hepatitis B and C viruses (which can cause liver cancer), and influenza A and B viruses.
Designing safe and effective antiviral drugs is difficult, because viruses use the host’s cells to replicate.
This makes it difficult to find targets for the drug that will interfere with the virus without harming the host
9780170452922
organism’s cells. Moreover, the major difficulty in developing vaccines and antiviral drugs is related to viral
variation. New strains develop rapidly, making previous vaccines obsolete.
Various points in the life cycle of a virus (see Figure 14.10) can be targets for antivirals. Examples of
antivirals acting on the various target points include antivirals that:
1 inhibit binding or attachment (known as ‘entry blocking’ drugs)
2 inhibit entry or penetration by blocking protein channels in the host cell membrane
3 inhibit transcription of the virus by blocking transcription factors to viral DNA
4 prevent the release of the newly assembled viruses from the cell membrane (these have been
used to treat a wide range of influenza strains).
Infectious
virus
Envelope
receptor
binding
Fusion
and entry Transcription Assembly
Budding
Maturation
Reverse Integration Viral Translation

transcription genomic RNA
Virus
Viral RNA
Host cell DNA

Complementary copy of the viral RNA, in the form of DNA
FIGURE 14.10 Life cycle of an RNA virus
Influenza is generally caused by infection with either influenza A or influenza B. Every year
there are one or two types of each of influenza A and influenza B viruses circulating. Influenza can
be treated by antivirals, for example oseltamivir. WHO recommends vaccination as the primary
management against infection and spread. However, after infection, if there is moderate to severe
illness, antivirals are recommended by Australian health authorities, but they must be issued as soon
as possible after onset of symptoms. Currently, there is no significant evidence of resistance to
antivirals in recently circulating strains of influenza A or B.
Question set 14.2d

1 Copy this table and list two differences 3 Explain why certain structures on a
between antibiotics and antivirals. bacterium have been chosen as targets
ANTIBIOTICS ANTIVIRALS for the action of antibiotics. Give two
Difference 1
examples of these.
Difference 2
4 Explain why new vaccines are made yearly
for influenza.
2 State a reason why it is relatively easy
to develop antibacterial drugs that have
minimal side effects on humans.
9780170452922
Physical preventative measures

Prior to the mid-19th century, the transmission of infection was not well understood. In hospitals,
surgeons did not wash their hands, and rates of death from post-operative infection were extremely
high. In fact, the contamination of a surgeon’s clothes with bodily fluids was considered a sign of
experience. A British surgeon, Joseph Lister, had read of Louis Pasteur’s theory that micro-organisms
cause disease, and he hypothesised that preventing their entry may stop disease. Lister experimented
with the use of carbolic acid to clean wounds and instruments, as well as for handwashing, as a way
of maintaining low levels of micro-organisms and preventing infection. These strategies proved
successful in lowering post-operative infection rates, and Lister’s practices gained favour with other
surgeons. Today, regular handwashing and the use of sterile equipment are considered key elements
in effective healthcare. The mouthwash product Listerine® is named after Joseph Lister.
Handwashing is one of several physical preventative measures useful against the spread of disease.
Handwashing
Regular handwashing can prevent individuals from contracting infections, particularly those that
are spread by faecal–oral or direct contact routes. On a global scale, handwashing can significantly
reduce the mortality from certain infections, such as diarrhoeal illnesses.
Handwashing is most effective if warm water and soap or antiseptic handwash is used. An
antiseptic handwash contains an antimicrobial substance that inactivates micro-organisms or inhibits
their growth. For example, it might contain 60–95 per cent alcohol, which can destroy the cell wall
and membrane of bacterial cells and the envelope of viruses (including SARS-CoV-2). Handwashing
should include rubbing both sides of hands and in between fingers, finishing with a thorough rinse
and dry. This should be done before preparing or eating food and definitely after sneezing, coughing,
gardening, toilet duties or looking after sick people. Under certain circumstances (especially after
being exposed to an infected host of a disease that spreads via contact or fomites), a shower and
washing of clothes is recommended. Washing removes or kills pathogens, which prevents the
spread of disease. Diseases spread by faecal–oral or direct contact routes are often avoided through
handwashing. If hands are contaminated with an infectious agent, they can easily contaminate food,
and the agent can then enter a host via the gastrointestinal tract.
Use filtered clean water and food

Water should be treated before being supplied. In many areas of the world, water is unclean and
carries waterborne diseases. Pathogens can be carried long distances in water, further increasing
the spread of infectious diseases. Sometimes food such as salad ingredients are washed in untreated
water, which means infectious agents can be transferred into salads and consumed. Other pathogens
are foodborne because the food they occupy is undercooked or out of date when consumed.
Sanitation
Sanitation is the safe disposal of human excreta (faeces and urine). Unfortunately, 2.6 billion people
in the world lack adequate sanitation, which leads to the spread of (mainly diarrhoeal) diseases. Many
governments build sanitation infrastructure for their communities, but they can only do so if they have
the funding. Excrement, especially in urban areas, requires safe removal, transport and treatment. This
measure can prevent the oral entry of many infectious diseases, slowing the spread significantly.
Sneeze and cough into elbow

To prevent the spread of infectious disease, the elbow can act as a barrier to any airborne droplets
that exit an infected host during a cough or sneeze. SARS-CoV-2, influenza and TB can be transmitted
by coughs and sneezes. To avoid transmission, an elbow is used to capture the pathogen. If the hand
is used instead of an elbow, the hand is likely to become a fomite or vehicle, and thereby provide an
alternative mode of transmission.
9780170452922
Barriers
Barriers to prevent the transmission of disease and therefore the spread include mosquito nets,
kitchen gloves and surgical masks. Mosquito nets have been made more effective when sprayed
with insecticide. Protection against mosquito-borne diseases such as malaria can last for months,
but susceptible hosts need to be diligent in their use of the nets. Infected hosts of Mycobacterium
tuberculosis can wear a surgical mask. The mask can stop exhaled droplets from being generated
or projected. Healthcare workers can wear specialist masks that are designed to protect them from
inhaling droplet nuclei, helping protect these individuals from becoming infected with M. tuberculosis
when in close contact with a person with infectious TB. Masks have been an important management
tool in reducing the spread of SARS-CoV-2.
Handwashing saves lives 14.2

Each year, almost 200 000 hospital-acquired infections occur in Australian hospitals. In 1840s
NOITACILPPA
Vienna, Dr Ignaz Semmelweis proved that the unhygienic practices of his medical staff caused
septic infections and death in 13% of women after childbirth. Almost two centuries later,
hospital staff worldwide are still being told to wash their hands to reduce disease transmission
between patients. Handwashing campaigns in Australia have raised hand hygiene compliance
in hospitals from less than 50% to more than 75% in recent years.
Questions
1 In which industries do you think it is essential to wash your hands regularly?
2 In public bathrooms, you are often given the choice to dry your hands using a jet dryer or
paper towel. Which do you think is more hygienic?
3 How do instant hand sanitizers kill ‘99.99% of germs without water’?
Key concept
Medications (e.g. antibiotic and antiviral) and physical preventative measures (e.g. handwashing,
filtered water, sanitation, sneezing into your elbow and barriers) help to prevent and control the
spread of disease.
Management strategies for 10 diseases
TABLE 14.2 Management strategies for 10 diseases
DISEASE BIOLOGICAL ISSUES RELATED TO MANAGEMENT STRATEGIES OF PREVENTION AND CONTROL

Influenza Viruses rapidly develop new strains, making the 1 Yearly vaccination – immunisation for yourself and protection
previous year’s vaccinations obsolete. for vulnerable people around you.
Epidemics are seasonal, usually occurring during 2 Monitoring and sharing of data (including the virus strain) with
winter. state, national and global bodies such as WHO.
Transmission is rapid in crowded areas of high host 3 Handwashing and fomite washing with disinfectant to kill
density. microbes; coughing into elbow or a tissue.
Seasonal influenza is hard to differentiate from 4 Isolation such as staying home from work or school to
other respiratory diseases. disable the mode of transmission – close contact via airborne
droplets; limiting contact with others.
5 Early treatment with antiviral medication may reduce
complications and deaths.
9780170452922

Ross River virus A mosquito-borne disease that passes between 1 Seek a blood test for a proper diagnosis (it can be
animals and mosquitoes. misdiagnosed as arthritis).
There is no vaccine or cure; the disease is usually 2 Personal protection such as long sleeves, bed nets, and
not fatal but causes discomfort and pain. insect repellent, to deter mosquitoes from blood feeds. A
Viruses are active in WA. In the northern mosquito control program such as spraying with insecticide
and southern parts of WA, the risk of vector or removing breeding grounds.
transmission is higher after rainy seasons that leave 3 Notify the Department of Health so that they can issue public
behind mosquito breeding habitats. warnings in the areas in which mosquito vectors are active.
4 Medical treatment can reduce joint pain and swelling. Rest.
5 Prevention is best, which involves minimising the risk of being
bitten by a mosquito vector. Screen all doors and windows
of houses, cover up and apply insect repellent (DEET),
particularly at dawn and dusk, when mosquitoes are most
active.
Viral diseases of There are 24 different honeybee diseases caused by 1 Regularly inspect bee hives for signs of disease. Inspect and
honeybees viruses. Many contribute to bee deaths. quarantine imported bees and bee products.
Deformed wing virus (DWV) represents a major 2 Using DNA sequencing, reverse transcription (RT)-PCR
threat worldwide and is transmitted by the varroa and Southern hybridisation, scientists can detect DWV and
mite vector. It is not currently a threat in Australia. sacbrood.
Sacbrood is a threat in Australia. The sacbrood 3 Pest management, but this may mean culling the hive.
virus infects bee larvae after they consume 4 Pre-treatment with pest control such as Apiguard® to kill the
contaminated water, pollen or nectar. vector mite, Varroa destructor, or for drone brood culling.
(The drone is the male honeybee that produces sperm.) There
is no treatment after infection for this viral bee disease.
5 For sacbrood virus, the colony’s queen bee should be
replaced with one supplied by a reputable breeder
(re-queening).
Australian bat The vaccine is unique in being successful prior to 1 Vaccinate prior to exposure, especially if travelling to infected
lyssavirus (ABL) exposure, but also in between entry of pathogen areas. The vaccine is used as both prevention and treatment.
disease and onset of symptoms. 2 Educate the public that fast treatment is required.
After the onset of symptoms, mortality is usually 3 Wash the wound with disinfectant. If not washed immediate-
100%. ly, there is no effective treatment or cure once symptoms are
The virus is in the same family as rabies. established.
Less than 1% of bats may be infected. Sick or 4 Do not touch bats. If they are injured, contact the Department
injured bats are more likely to be infected and more of Biodiversity, Conservation and Attractions (WA). Only
likely to be handled. Risk of spread is low, but the experienced, vaccinated people should handle bats and it
risk of infection being fatal is high. should be done while wearing puncture-resistant gloves.
Habitat loss acts as pressure on populations, which
can influence density and cause a higher rate of
transmission between bats.
9780170452922

TB Easily spreads globally because it can be spread by 1 Respiratory protective equipment: patients can wear a
infected people when they travel. surgical mask that stops exhaled droplets from being
M. tuberculosis is transmitted only through air generated; healthcare workers can wear specialist masks that
containing microdroplets of TB organisms. It is not are designed to protect them from inhaling droplet nuclei.
transmitted by touching surfaces such as bed linen, 2 Infected people can be isolated, particularly in hospitals, in
toilet seats, shaking hands etc. respiratory isolation rooms, so that air from the room does
Depending on the environment, tubercle bacilli can not circulate into other rooms.
remain suspended in the air for prolonged periods, 3 Cough into tissues.
and air currents can carry them throughout a room 4 Educate and counsel family members about minimising the
or building. risk of transmission.
Multidrug- and extreme multidrug-resistant 5 Chest X-rays or sputum tests for diagnosis of active TB. Free
bacteria have evolved. X-rays are performed in the Western Australian Tuberculosis
Hosts with active and latent TB are advised to be Control Program, at the Anita Clayton Centre in Perth.
treated to avoid transmission. This is because hosts 6 Treated with a mix of antibiotics for a minimum of 6 months,
with latent TB can develop contagious active TB but this is only effective if it is taken without interruption;
at an unpredictable time. Usually, it is not until reducing the development of resistance. In WA, anti-TB
infected hosts experience a prolonged cough medication is free of charge, unlike in many areas of the world.
(2–3 weeks) that they get tested. The disease may 7 Government healthcare workers have infection control
have spread. About one-third of the world have TB, guidelines for prompt detection of infectious patients,
many without knowing it. airborne precautions and treatment.
Tetanus Is infectious but not contagious. 1 Vaccinate with a modified toxin to stimulate immunity.
Spores of Clostridium tetani are found everywhere 2 Three booster vaccinations should be administered during
in the environment and therefore cannot be adolescence. Immunisation is then stimulated to last
eradicated. throughout much of adulthood. Boosters are required, how-
The neurotoxin causes the infected host harm, but ever, because memory cells decline over time.
not the bacteria. 3 Wash and disinfect puncture wounds. See a doctor at once.
1 2 4 7 9 15
6 months
Birth Long-term
protection
Primary series 1st booster achieved but
2nd booster 3rd booster a booster
(3 doses) 12–23 months
4–7 years 9–15 years recommended
Before 6 months (2nd year of life)
at age 50
≥3-year protection ≥5-year protection ≥10-year protection
FIGURE 14.11 Tetanus vaccination for long-term protection
9780170452922

Crown gall Invasion of spores requires a root wound. Spores 1 For nursery plantings, do not use soil in which crown gall
are transported via rain and runoff. Inside vascular infection of plants has occurred. Soil used in the nursery
tissue, bacteria reproduce via binary fission. should be treated to eradicate crown gall bacteria.
Bacteria transfer a plasmid gene into the host 2 Eliminate any plants with galls or suspicious swellings at the
cell genome so the host plant cells will perform graft union or near the soil level. Dig up the plant and soil
uncontrolled cell division to form galls. immediately around the roots and dispose of it carefully, such
There is no cure. as by burning.
It commonly affects roses and fruit trees. 3 Treat pruning, budding and grafting tools with a disinfectant.
4 Wash down tyres and boots before leaving a contaminated
area to prevent spread.
5 Careful surgery to remove galls from trees. After surgically
removing the gall, apply heat to dry and sterilise the area
around the gall. Monitoring regrowth is required every few
months. This is a costly and labour-intensive strategy.
6 Re-direct runoff, especially during rainy seasons, because
spores can spread in water.
Chytridiomycosis The fungus is temperature sensitive. 1 Control efforts should be aimed at protecting uninfected areas.
(amphibian Chytridiomycosis has been found in all Australian 2 Detect new outbreaks in currently uninfected populations
chytrid fungus states and in the Australian Capital Territory, but or locations of unknown disease status. Establish restricted
disease) not in the Northern Territory. Currently, it appears areas and control areas for which quarantines and movement
to be confined to the relatively cool, wet areas restrictions are applied. Identify infected and non-infected
of Australia. Australian upland frog populations areas.
have suffered the greatest number of declines 3 Identify and prioritise Australian frog species at risk of extinction.
and extinctions, leading to the suggestion that Species-specific research is needed due to different ecological
environmental stress, perhaps from climate change requirements, as well as captive insurance colonies to avoid
or increased exposure to ultraviolet radiation, may extinctions; this means maintaining at-risk species in captivity to
be reducing resistance to infection. be reintroduced at a later date.
Vaccines have been tested on amphibians, but no 4 Monitor impacts on frogs, especially populations who recover
significant differences in mortality or virulence have naturally. Analyse the different strains of the fungus for
been observed. different virulence factors and for mapping their locations.
5 Implement hygiene protocols common across all states of
Australia: protocols for bushwalking, fishing, four-wheel
driving and bike-riding. Disinfecting vehicles can prevent the
spread into uninfected areas.
6 Develop a central information storage site at which
government, stakeholders and researchers can upload and
access data.
7 There is no cure.
9780170452922

Malaria Breeding sites can form, due to rainfall or flooding, 1 Use chemical insecticides to kill mosquito vectors and their
in unpredictable areas. It is hard to eliminate the larvae.
sites as quickly as they form. The distribution of 2 Eliminate stagnant (still) water to remove breeding sites of
breeding sites enables the distribution of the vector, mosquito vectors and reduce vector populations.
which in turn influences the distribution of the 3 Avoid being outdoors when mosquitoes are most active, that
disease. is, at dawn and dusk; use bed nets at night and protective
Conversely, the spread is subject to the distribution clothes during the day as barriers to stop transmission, or
of specific species of mosquito vectors (near the repellents to deter the mosquito from taking a blood feed;
equator, where there are warm temperatures and install insecticide-coated mosquito nets and screens on
regular rainfall). windows and doors.
Strains of Anopheles mosquitoes have evolved 4 If proven safe, introduce a biological control such as
resistance to insecticides and anti-malarial drugs. mosquito fish to feed on mosquito larvae, but evidence for
Malaria, a protozoan disease, was successfully the effectiveness of this is limited.
treated for many years with chloroquine. In recent 5 Take anti-malaria drugs to reduce the number of people
decades, Plasmodium species that are resistant infected with malaria, reducing the spread. There is no
to this drug have appeared and spread to areas vaccine currently available in Australia, although new vaccines
where malaria is a common threat. In those are in development.
areas, a combination of the drugs sulfonamide
and pyrimethamine is frequently used to treat the
disease.
Phytophthora Spores do not need a wound for entry. They 1 Quarantine strategies consist of restricting access to infected
germinate upon contact with moist, nutritious areas to limit the transport of spores out of the area and into
media, then hyphae emerge from the spore. The uninfected areas, especially during rainy seasons, because
hyphae penetrate epidermal cells on the roots. The contaminated soil or mud can more easily be picked up by
invasion can spread to vascular tissue, absorbing vehicles such as boots.
nutrients and blocking plant host transport of water 2 Application of phosphite, a biodegradable fungicide, increases
and nutrients. resistance to infection. Plants can be injected and protected
After symptoms appear, death follows rapidly. for up to 5 years. The phosphite is supplied agronomically,
either by injection or by foliar spray, but when trees are
sprayed, the length of protection is reduced to 2 years. It is
safe, inexpensive and has low toxicity to animals. However,
decreasing sensitivity of Phytophthora to phosphite has
been documented. In orchards in both South Africa and
Australia, the use of phosphorous acid sprays has led to
decreased sensitivity to phosphite. This may mean effective
injections will require higher doses. In 2019, the Western
Australian Government advised that spraying should be used
in conjunction with the ‘Pegg Wheel’ management strategy for
managing phytophthora dieback in avocados (named after its
designer, Ken Pegg) (Figure 14.12, page 490).
3 Sterilise or wash down grafting tools, clothing, footwear,
equipment and cars before and after use to prevent carrying
pathogen spores from infected area to uninfected area; do
not carry plants from infected areas into susceptible areas to
reduce the risk of spread.
4 Destroy all infected trees to reduce the risk of spread because
there is no cure.
5 Schedule work in infected areas during dry seasons because
the pathogen spreads more easily in wet and muddy
conditions. Redirect runoff during rainy seasons to prevent
the spread in disease-free areas.
9780170452922
Organic Site selection

amendments
• Deep, well-drained soil
• Mulch, compost and is best
other carbon-rich
• Avoid seasonal wet area,
materials prevent
soaks and springs
root rot
• Plant trees in mounds
Inorganic nutrition Rootstock

• Use leaf and soil analysis selection
to fine-tune • Velvick and Dusa are
• Manipulate nitrogen resistant to root rot
application to balance • Reed and Zutano have
fruit and leaf load poor tolerance
• Use calcium as mild
fungicide
Chemical control
• Use metalaxyl when
Irrigation
planting trees
management
• Older trees require up
• Small, frequent irrigation is
to six sprays per year of
better than heavy irrigation
potassium phosphate
• Use root testing to
fine-tune practices
• Inject directly into
badly affected
trees
FIGURE 14.12 The Pegg Wheel Management Strategy for managing phytophthora dieback, particularly used for
avocado trees
CASE
STUDY
Managing the spread of disease: coronavirus disease (COVID-19)
WHO monitors, communicates and Knowledge of the biology and ecology of the
coordinates health initiatives. They include pathogen and its disease was essential for
over 7000 representatives from a diverse effective management planning.
array of nations, working collaboratively with Professor John Mackenzie is an Australian
global partners such as the UN, research who is working with WHO as a consultant
institutions and medical professionals. on COVID-19. He was a Professor of Tropical
On 31 December 2019, COVID-19 was first Infectious Diseases at Curtin University,
reported to them from Wuhan, China. It was WA, and has spent much of his career
a disease that could cause pneumonia and, in analysing global aspects of infectious disease
some cases, death. Spread of the disease was management (surveillance and response),
swift. Within 3 months, on 11 March 2020, particularly of emerging zoonotic diseases
WHO classified the disease as a pandemic. such as avian influenza, Australian bat
WHO collected and analysed data from its lyssavirus and Ross River virus disease.
global partners and publicly communicated
information about the spread via its Structure and source of the virus
‘COVID-19 situation dashboard’. The virus responsible for COVID-19, SARS-
WHO’s pandemic management strategies CoV-2, is a novel (new) zoonotic RNA virus.
included helping countries obtain supplies From phylogenetic tree analyses of the
of personal protective equipment (PPE) and available full genome sequences, bats appear to
providing guidelines. The goal was to equip be the reservoir of the SARS-CoV-2 virus, with
all governments and health workers to a potential intermediate host(s). Information
manage cases and reduce the spread. on animals that were in the marketplace in
9780170452922
Huanan, the place thought to be the origin The virus can persist for a few hours and
of the disease, has been recorded, along up to a few days depending on factors such
with the post-market destinations, in case as temperature and humidity. Due to the
those animals might be a source of further, ease with which this pathogen spreads and
potentially zoonotic, outbreaks. persists, organisations such as WHO and
Signs, symptoms, disease governments require management plans that
are suited to this specific, highly contagious
progression and severity disease. As we do not currently have any
Disease presentation can range from therapeutic medicine or vaccine for the new
no symptoms (asymptomatic) to severe coronavirus, much of the management is
pneumonia and death. Typical signs and undertaken by public health authorities.
symptoms include (in order of highest to
lowest incidence): fever, dry cough, sore Management plans
throat, fatigue, sputum production, shortness 1 Management of cases: Health workers
of breath, headache, muscle aches, chills, require a plan for assessing cases as mild,
nausea or vomiting, nasal congestion and moderate or severe, and treating them
diarrhoea. The mean incubation period (time accordingly. Respiratory support may
period between exposure to the virus and be necessary. Establishing fever clinics,
observable symptoms) is 5–6 days, with a increasing emergency wards, and even
range of 1–14 days. Most people infected opening new temporary hospitals are
with the SARS-CoV-2 virus have mild disease likely to be required. Assistance may be
and recover, but 13.8% have severe disease. needed for at-risk people. Special plans
Approximately 80% of humans infected with for palliative care, pregnant women
the SARS-CoV-2 virus have mild symptoms, and ethical considerations are needed.
especially children and young adults, and Decisions about medical care need to be
recover, but around 20% have severe disease. based on the premise that every person
Individuals at the highest risk for severe is equal, rather than on discriminatory
disease and death include people aged over 60 factors such as age or sex.
and those with underlying conditions, such as 2 Testing and contact tracing: need to be
cardiovascular disease. efficient to reduce spread. The PCR test
Transmission routes uses a method called reverse-transcrip-
tion polymerase chain reaction. If the
SARS-CoV-2 is transmitted via droplets and virus is present in a sample, copies are
fomites during close unprotected direct produced of the virus’ genetic code, which
contact between an infected host and a is in the form of RNA, and the results can
susceptible host. Airborne spread may be be returned the same day. If a patient’s
possible for COVID-19, but it has not been test result is positive, they need to be
observed to any great extent to date. Human- quarantined. In Australia, positive cases
to-human transmission is largely occurring in are reported to the Department of Health
families. SARS-CoV-2 is transmitted directly and Human Services.
via airborne droplets and fomites during 3 Stopping or slowing transmission via
close contact (within around 1.5 m between education and physical preventative
an infected host and a susceptible host). measures: these measures include social
When an infected host coughs or sneezes, distancing, quarantine, isolation, stopping
droplets containing the virus may be inhaled mass gatherings such as sporting events,
by a susceptible host. Indirect transmission closing schools and universities, and
can occur when a susceptible host touches (where possible) having people work at
a contaminated surface, called a fomite, home. Frequent handwashing, regular
and then touches their eyes, ears or mouth. disinfecting of potential fomites, wearing a
This is because many droplets fall on nearby mask and always covering mouth and nose
surfaces and objects, such as tables or phones. when sneezing or coughing are important.
9780170452922
4 Border biosecurity: National border the vaccine development need to include this
security involves travel restrictions, mutation factor in their planning.
international air arrival passenger caps The virus was grown in labs around the
Coronavirus outbreak: and two weeks’ quarantine on arrival at world, including the Peter Doherty Institute
How the COVID-19 a designated facility. During a pandemic, for Infection and Immunity in Melbourne, to
vaccine is being made
Watch the video and flights are limited, and only applicants study it and to have samples ready for vaccine
read the content to find who are approved for exemption may testing. Animal models at the CSIRO centre,
out about the stages
involved in creating a
travel. In WA, strict state border security also in Melbourne, have been used for testing
vaccine. has been enforced during the pandemic. potential vaccines. Ferrets were chosen as an
People have not been allowed to enter WA animal model because they are susceptible to
without a special exemption, and eligible the SARS-CoV-2 virus and develop symptoms
people have been subject to mandatory, similar to humans. After a vaccine is found to
self-funded quarantine. be safe and effective in animal trials, human
5 Vaccine research: Vaccine research trials are to be conducted.
is being carried out by a number of Currently there are three types of virus
universities, health research institutes vaccines: subunits (that contain parts of a
and companies around the world. An virus), live attenuated vaccines (that contain
important vaccine research group is a weakened form of a virus) and inactivated
based at the University of Queensland. viruses (that contain ‘dead’ viruses that
They are being funded by international cannot replicate). Scientists at the University
agencies to develop a vaccine to SARS- of Queensland are applying a new vaccine
CoV-2. They have developed and patented technology developed in Norway that uses
new ‘molecular clamp’ technology, which features of the proteins found on the surface
it is hoped will make it possible to rapidly of the virus.
develop an effective vaccine. Once a The coronavirus invades a human host cell
vaccine is created, it will need to be to replicate, using ‘spike’ proteins found on the
quickly scaled up and distributed. virus’ outer surface, which are coiled up like
tiny springs. The structure of the spike proteins
enables the outer virus coat or ‘envelope’ to
merge with the cell cytoplasmic membrane,
allowing the virus core containing the viral RNA
genome (along with protective proteins and
evihcrA otohP naciremA /otohP kcotS ymalA
enzymes) to enter the cell cytoplasm.

Our immune system responds by
recognising the antigens (spike proteins) of
Emerging respiratory the virus and making specific antibodies to
viruses
Find out more about
kill it. The new molecular clamp technology
methods of detection, at the University of Queensland is being used
prevention, response for developing a vaccine based on the spike
and control for viruses
such as SARS-CoV-2.
FIGURE 14.13 An electron micrograph of proteins. The function of the molecular clamp
SARS-CoV-2, the virus that causes COVID-19
is to fix the protein spike in its characteristic
Vaccine development coiled shape, so that the host’s antibodies can
recognise it.
In the initial steps of developing a vaccine It has been determined that the virus is
Vaccine development for COVID-19, the genome of the virus was mutating. Scientists are now trying to discover
Here’s why a vaccine sequenced and the structure of the virus
can take more than 18 whether it is like the flu virus, which mutates
months to be developed. studied. The genome is 29 878 base pairs quickly and therefore needs a new vaccine every
long. It was sequenced several times to year to account for the mutational changes, or
monitor whether the virus was mutating and whether it is like the mumps, so that only one
evolving, which it was. Scientists involved in vaccine will be required.
9780170452922
Questions
1 List the major facets of a management
plan for a disease such as COVID-19.
2 Describe how social distancing slows
transmission.
nothguaNcM ttocS/sotohP xafriaF

3 Describe some physical preventative
strategies you can use to prevent infection.
4 Explain why a vaccine has been difficult to
create.
FIGURE 14.14 Professor George Lovrecz and
Mylinh La investigating a potential COVID-19
vaccine in Melbourne’s CSIRO facility.
This mite be the bees’ worst enemy
YCARETIL CIFITNEICS
Bees, those small insects that collect nectar and pollen and make honey and wax, are in
precipitous decline: populations in the US and Britain, for example, have halved over the past
25 years.
Their biggest threat is from the evil-sounding Varroa destructor, an oval-shaped, reddish-brown
mite that sucks the blood from bees and transmits virulent diseases, such as deformed-wing
virus. The pinhead-sized bloodsuckers have decimated bee populations worldwide, including in
neighbouring New Zealand and Papua New Guinea, but have not arrived yet in Australia.
‘If they enter this country, the mites will completely wipe out our wild honeybees, which
means crop growers will lose their largest and free source of pollination, worth more than
$1 billion a year,’ says bee pathologist Denis Anderson of CSIRO Ecosystem Sciences in Canberra.
The mites will also reduce the number of managed honeybee colonies, he explains. ‘This
means keepers will pay more for scarce paid pollination services – costs that [will] flow through
to consumers.’ In addition, most of Australia’s horticultural and agricultural crops, worth
billions of dollars, rely on bees for pollination.
Australia’s national port surveillance program, although currently inadequate to deal with
the threat, is being strengthened. Surveillance for honeybees and bee pests and parasites that
are exotic to Australia forms part of the National Sentinel Hive Program, which is coordinated
by Plant Health Australia.
The program, established in 2000, has been growing steadily, Dr Anderson says. ‘It operates
on the premise that most of the important exotic pests and parasites will enter Australia on live
honeybees from another country – particularly through bee swarms arriving on vessels at our
sea ports,’ he explains. ‘If a swarm was carrying exotic parasites, such as the Varroa mite, those
parasites would spread to colonies near the port, and then on to colonies further away.’
The National Sentinel Hive Program places special hives at sea ports around Australia and
monitors them every 2 months for signs of exotic pests and parasites that may have arrived in
a bee swarm from overseas.
The program’s success depends on how many hives are at each port and the number of
ports targeted. ‘The more of each, the higher the chance of success,’ he says. ‘At present, only a
few hives are based at a few strategic ports – just three hives cover Melbourne and Geelong, for
example – and there are not enough funds to expand the current program.’
This is why the state government has set up Bee Force, a pilot project to improve Victoria’s
capacity to detect incursions of exotic bee pests. Now being trialled in Melbourne and Geelong,
the project involves local amateur beekeepers who run sentinel hives.
9780170452922
ab
REKORBegami /otohP kcotS ymalA
suhC rogI /moc.kcotsrettuhS

FIGURE 14.15 The varroa mite: a the mite is small, shiny and reddish-brown; b extreme close-up of the
mite on beehive cells containing bee eggs and larvae
‘This encourages community involvement and expands the number of sentinel hives that
can be used for surveillance, thus keeping costs to manageable levels,’ Dr Anderson says. ‘If the
trial Bee Force program proves successful, it could be extended to other port areas.’
Victoria’s Department of Environment and Primary Industries has trained a honeybee
quarantine response team of 90 beekeepers, including hobby and commercial beekeepers, who
may be called on to assist in an emergency.
The early detection of the Varroa mite, combined with effective surveillance, it is argued,
may increase the chance of eradicating the parasite once it enters the country. This has never
been achieved before.
‘Since it switched host (from the Asian honeybee to European honeybee), the mite has
spread throughout the world,’ Dr Anderson says. ‘Let’s ensure we do everything possible to
keep the parasite out of Australia for as long as we possibly can.’
Spinks, P. (2012) ‘This mite be the bees’ worst enemy’, The Age online, 26 June. The use of this work has been licensed by
Copyright Agency except as permitted by the Copyright Act, you must not re-use this work without the permission of the
copyright owner or Copyright Agency.
Questions
1 List at least three industries that could be affected were the varroa mite to spread into
Australia.
2 Australia is now the only country in the world with a honey industry that is free of the
varroa mite. Spread to New Zealand and Hawaii only occurred relatively recently.
a What characteristic of these three countries allowed them to remain mite-free for so long?
b Explain how strategies to prevent the introduction of Varroa destructor into Australia
utilise this characteristic.
3 Brainstorm some other strategies that could be used to prevent the introduction of Varroa
destructor into Australia.
Question set 14.2e

REMEMBERING than TB or tetanus, but one you studied
1 Describe two different types of physical during this course.
barrier that prevent the spread of disease. 4 Evaluate two measures you chose for
2 Describe two methods of removing or Question 3, describing at least one benefit
killing pathogens. and one issue.
UNDERSTANDING APPLYING
3 Apply your new knowledge of physical 5 Construct a mind map of the 10 diseases
preventative measures to a disease other in Table 14.2, including their issues and
unique management strategies.
9780170452922
14.3 MONITORING DISEASE ACTIVITY

In order to define and control disease outbreaks, public health authorities need to know when and
Notifiable diseases in
Australia
where particular infections are occurring. In Australia, the number of cases of a particular disease Visit the Department
is monitored by health authorities in each state. On a global level, the monitoring of diseases is of Health’s website to
view the current list of
conducted by WHO, the organisation that coordinates global responses to outbreaks that pose notifiable diseases in
widespread threats. Australia.
National surveillance
A widely used method of monitoring disease activity is through the notification of public authorities
when individuals are diagnosed. In Australia, the list of notifiable diseases contains a diverse mix of
more than 70 conditions, including chickenpox, syphilis, rabies and influenza. A doctor who diagnoses
one of these conditions must report the case to the relevant state health authority. Outbreaks or cases
of unusual diseases can then be investigated.
There is a number of limitations to data collected in this way. Not all patients who are infected
with a disease will seek healthcare, and of those who do, not all will receive a diagnosis. Infections
can also be under-reported, and this may be more of a problem in certain populations or with certain
diseases. Together, this means that reported data are likely to be lower than the actual number of
cases. There can also be delays between the onset of symptoms, diagnosis and reporting, which can
limit the ability of public health authorities to respond quickly to epidemics.
In recent years, researchers have been exploring alternative ways of conducting disease
surveillance. The widespread use of the Internet and social media provides a novel data source
from which information about the frequency of different diseases can be extracted. Data from
Facebook, Twitter and mobile phones have been used to monitor disease activity. Google
has developed a program that tracks how frequently people use the search engine to look up
influenza-like illnesses. Figure 14.16 compares data obtained by this method with traditional
reporting data. You can see that the spikes in Google search activity correspond with the peak
influenza season.
3000
Influenza-related
2400
Google search activity
Influenza cases
1800
B ro A azneuflni fo )detset yrotarobal(
1200 Australia
sesac demrfinoc fo rebmuN
600
15 000
April 2009: beginning of influenza
A(H1N1)pdm09 ‘swine flu’ pandemic Google Flu Trends
Visit Google Flu Trends
10 000 for up-to-date data
on influenza-related
US
searches.
5000
0
80
60
90
01
70
80 J
60
90
01
21
11
31
70
11
21
31
lu
na
na
na
na
lu
lu
lu
lu
na
na
na
na
lu
lu
lu
J
J
J
J
J
J
FIGURE 14.16 Patterns of influenza infection and Google search activity related to flu-like illness in Australia and
the US
9780170452922
These digital disease surveillance mechanisms have the advantage of providing information to
public health authorities in real time. However, the quality of the data is limited by the effectiveness
of the algorithms in determining whether or not a tweet or search is actually about an illness.
Furthermore, high Internet activity about an illness does not always correspond to high disease
activity, as it can be skewed by other events, such as the illness of a celebrity.
Due to its limitations, digital disease surveillance is not likely to replace traditional reporting methods.
It does, however, provide epidemiologists with an additional tool that complements these methods.
Managing an outbreak
Epidemiologists take a number of steps to investigate a new disease outbreak (Figure 14.17). Similar
steps apply whether the outbreak is a small, localised occurrence or a pandemic. When an outbreak
is suspected, the first step is to confirm that the reported cases do, in fact, meet the definition of an
outbreak. This involves confirming the number and diagnosis of known cases and comparing this with
background levels of the disease.
Once this has been done, investigators can formulate a case definition, indicating which cases
are considered to be part of the outbreak. Case definitions include not only the type of illness but
also the place and time. Such definitions can change and be refined as
the investigation progresses and investigators understand more about Confirm outbreak
the disease. The next few steps (finding cases, gathering information and
developing hypotheses) are easiest if the mechanism of transmission of a
Formulate case
disease is already known. When the mechanism is not known, investigators definition
have to consider a wider range of potential cases and disease sources.
Investigators, then, need to find people affected by the outbreak. Not
all of those who are ill will have sought medical care, or been reported Find cases
to investigators. As such, disease surveillance (or passive case finding)

generally does not locate all individuals affected. Investigators in disease Trace contact
outbreaks perform active case finding, in which they try to track down
infected individuals. An important component of this is contact tracing,
Identify index case
whereby people who may have infected, or been infected by, known
cases are tracked down. The type of contacts sought will vary with
the mechanism of transmission. For example, if the disease is sexually Gather and analyse
information
transmitted, only sexual contacts of the infected individual will be
contacted by investigators. On the other hand, for an airborne disease
such as TB, investigators will contact all people who have been in close Develop hypotheses
proximity with the case. In some cases, investigators may focus on people
who have been exposed to the same potential sources, even if they didn’t
Test hypotheses
have direct contact with an infected individual. In the measles example in
the weblink, it was concluded that the infection of at least 20 people could
be traced back to one man who visited Perth from New Zealand, based on Implement control
measures
Tackling the WA efforts made to contact people with symptoms who might have met him.
measles outbreak As part of the case findings, investigators may be able to identify the index
Read the article to find case, or the case that started the outbreak. In the Perth measles outbreak,
out how quickly and FIGURE 14.17 The steps
easily an infectious it appears that the visiting New Zealander was a super-spreader who was
involved in investigating
disease can spread. identified as patient zero. a disease outbreak.
Investigators will then gather information from cases. Initially, this will Communicating findings
involve in-depth interviews to explore any potential sources of infection. and implementing
These interviews will include asking about usual activities, sick contacts, control measures usually
recent meals and travel. The aim of these interviews is to generate a happen throughout the
hypothesis about how the outbreak is spreading. investigation.
9780170452922
Solving the outbreak

Once a hypothesis has been generated, the investigators can search for evidence to support or
refute that hypothesis. This evidence might include further interviewing of cases, site inspections, and
environmental sampling (such as testing water or food for pathogens). In some cases, sufficient data
may have already been collected, and testing the hypothesis involves analysing that data.
An outbreak investigation is an important aspect of controlling a disease outbreak. The investigation
involves a series of steps that aim to determine what has caused the outbreak. The final steps of an
outbreak investigation are to implement measures to control the spread and to communicate the
findings. In practice, both of these steps may take place while other steps are being undertaken.
Predicting the spread of disease

Mathematical models that can predict the spread of disease are important tools in the control of
outbreaks. Such models can be used to explore the likely effects of newly emerging pathogens and
changes in environmental conditions. They can also be used to design models and predict the chance
that a disease will invade particular countries, the expected number of cases within a particular time
frame and the effects of potential public health interventions. Contemporary models project how
the disease will progress and simulate the effects of possible interventions. Such models are used to
inform public health interventions, such as mass vaccination programs.
Supercomputing has increased processing capacity, and data storage has enabled models to
increase in their complexity, with new variables being examined and new relationships found, such
as the relationships between epidemic frequency and location, and factors such as population size,
environmental change, persistence and antibiotic resistance.
In order to make these predictions, mathematical models include several assumptions about the
way that different variables behave. The accuracy of these models is dependent on these assumptions
being met. You have already seen how a large number of factors can impact on disease transmission.
In order for a model to have good predictive ability, the design of the model needs to reflect this
complexity. The use of mathematical models to predict disease spread involves close collaboration
between mathematicians and biologists.
For this information to be of value, the model must be a sufficiently accurate representation
of reality in order to provide useful outputs. All models have a trade-off between complexity and
accuracy, so it is important to assess which approach is most appropriate for each individual
situation. How reliable the predictions are depends on how robust the data are, how quickly
they are accessed and how accurate the assumptions are. If the results of a prediction are not
reproducible, then their reliability is questionable. Predictions about emerging diseases have less
Data modelling
underpins public safety
reliability due to the lack of data. Watch the video and
read about the findings
of the model here.
Educating for public safety
A disease modelling expert at the University of Western Australia has modelled a potential outbreak of
COVID-19 in Perth and warned that community education for a future outbreak should be a priority
to help people cope with lock-down and social-distancing measures. The modelling has also shown
how to effectively wind back social distancing without causing another outbreak. The study indicated
that in this example 14 weeks of social distancing was required to significantly reduce the chance of an
outbreak reoccurring.
Key concept
Monitoring of pathogens and the outbreak of disease occurs at the national and international level
in order to effectively manage, predict spread and implement disease control measures.
9780170452922
Probably, SARS-CoV-2
Wuhan, Hubei Province
China, December 2019
Marburg haemorrhagic fever MERS-CoV SARS-CoV-1

Marburg and Frankfurt, Germany, (Middle East Respiratory Syndrome Guangdong Province,
and Belgrade, Serbia, 1967 Coronavirus) Saudi Arabia, April 2012 China, November 2002
Number of viruses shared

by bats and humans
Nipah
16 Ebola Kampung Sungai
Nzara, Sudan Nipah, Malaysia,
12
and Yambuku, 1998
8 Congo in
1976; Guinea
4 in December
2013 HeV
1
(Hendra virus
infection) Hendra,
Queensland,
Australia, 1994
Sources: World Health Organization (WHO),Centers for Disease Control and Prevention.
FIGURE 14.18 Map indicating the locations of bat-to-human transmission of zoonotic diseases. This data can be used to predict possible
locations of future emerging zoonotic disease.
Question set 14.3

1 Outline the steps in performing an 3 Explain how mathematical modelling can
outbreak investigation. aid epidemiologists in controlling disease
2 Explain what a notifiable disease is, giving spread.
an example.
9780170452922
CHAPTER 14 ACTIVITIES AND INVESTIGATIONS

Modelling disease spread 14.1
Models are tools employed by epidemiologists to predict the impact of different factors on disease
YTIVITCA
spread. The disease lab simulator allows you to modify various disease characteristics (infectivity,
mortality rate and duration of infection), population density and vaccination status, and observe their
impact on the spread of disease.
Aim
To explore the impact of several variables on disease transmission.
What to do Disease lab
1 Access the weblink and perform your own investigation. (The first page of the the weblink Use the
interactive lab
provides a link to the simulator and outlines how to use it.) Write up your investigation using the simulator to
standard scientific report format, from Aim to Conclusion (refer to Chapter 1, if you are unsure investigate the
how to write up your report). spread of disease.
2 Using what you have learned in this activity, discuss how the risk of pandemics spreading to
Australia is different now compared with 100 years ago, and identify the pathogens, hosts and
environmental factors that contribute to this risk.
Outbreak management in Australia 14.2

Background
YTIVITCA
Honeybees are vital for pollination of our crops and flowers in Australia. Globally, honeybees are
suffering from various infectious diseases, many of which are caused by viruses. Fortunately, several
of these pathogens have been prevented from entering Australia due to our geographically isolated
location and strict biosecurity. Read page 438 to find out about the epidemiology and pathology
involved in the deformed wing virus (DWV) disease. Epidemiologists look for typical clinical signs of
DWV: shrunken, crumpled wings, decreased body size, and discolouration. However, adult honeybees
with high levels of the virus may not show clinical signs. Finding the source of the disease would be Honeybee report
difficult. Find out about
a major threat
Aim to Australia’s
honeybee and
To learn about the control of disease outbreaks in Australia through the examination of a recent case crop pollination
industries.
You will need
• A computer with Internet access
• A large sheet of poster paper
• Markers and pens
What to do
1 Perform an Internet search about the DWV disease and its outbreak, aiming to find the following
information:
• characteristics of the disease (for example, the type of pathogen, symptoms, mortality,
incubation period and mode of transmission)
• size and impact of the outbreak
• outcomes of the epidemiological investigation (for example, was a source found?)
• control measures used by public health authorities.
9780170452922
2 Summarise the information on the poster paper. You could use a flow chart or timeline to show
how events unfolded.
3 Using your poster, explain to a classmate what you have found.
4 What sources of information did you choose to use? Explain why you chose these sources and how
you know that they are reliable.
1 Outline the process of investigating an outbreak, using your case as an example.
2 Explain, using your case as an example, how the mode of transmission of a disease can direct an
outbreak investigation.
3 If an outbreak of DWV disease occurred in Australia, what steps do you think epidemiologists
would take to ensure it was correctly identified, the source found and spread controlled?
14.1 The efficacy of alcohol-based antisepsis

Background
NOITAGITSEVNI
Alcohol-based hand rubs are widely used in hospitals as an alternative to frequent handwashing with
soap and water. To use the hand rub, you simply squirt a small amount into the palm of your hand and
rub your hands together so that the liquid covers your hands. The alcohol rapidly evaporates, leaving
your hands dry. In this experiment, you will compare the efficacy of alcohol-based hand rubs with that
of traditional handwashing.
Aim
To determine whether alcohol-based hand rubs or handwashing with soap and water is more effective
How to handrub?
How to
in reducing bacterial load on hands
handwash?
WHO guidelines
Materials
for handwashing • Alcohol-based hand rub
and using • Liquid soap (not antibacterial handwash)
alcohol-based
hand rubs • Sink with water
• Paper towel
• Sterile agar plates (two per student)
• Clear tape or Parafilm
• Hand Hygiene Australia or WHO guidelines for proper handwashing and use of hand rub
Agar plates may culture dangerous bacteria. Take care not to open agar plates once they have been
incubated. Autoclave used plates for safe disposal.
Liquid soap or alcohol-based hand rub may be irritating If you know you cannot use one of these products,
to people with sensitive skin. inform your teacher or arrange to use the alternative
one.
Procedure
1 You will conduct this experiment in pairs. One person will use an alcohol-based hand rub and the
other will use soap and water to wash their hands. Form a hypothesis before beginning.
2 Label your agar plates on the underside with your name, the date and your treatment. Label one
plate ‘before washing’ and the other ‘after washing’.
9780170452922
3 Remove the lid from the plate labelled ‘before washing’ and press the palm of one hand down
firmly on the agar, covering as much of the plate as possible. Replace the lid.
4 Following the guidelines, wash your hands using either the alcohol-based hand rub or soap and
water.
5 Without touching anything, repeat step 3 using the opposite hand on the plate labelled ‘after
washing’.
6 Place the plates upside down (agar layer on top), seal with clear tape or Parafilm and incubate at
25°C for 24 hours.
Results
1 Count the number of colonies on each agar plate before and after handwashing. Record your
results in a table similar to Table 14.3. Combine all class data to increase sample size.
TABLE 14.3 Results of experiment comparing alcohol-based hand rub with soap and water
ALCOHOL-BASED HAND RUB SOAP AND WATER
NUMBER OF NUMBER OF PERCENTAGE NUMBER OF NUMBER OF PERCENTAGE

PAIR COLONIES COLONIES REDUCTION COLONIES COLONIES REDUCTION
BEFORE AFTER IN NUMBER BEFORE AFTER IN NUMBER
WASHING WASHING OF COLONIES WASHING WASHING OF COLONIES
MEAN
SD
Analysis of results
1 Calculate the percentage reduction in number of colonies for each treatment.
2 Calculate the mean percentage reduction in number of colonies for each treatment.
Discussion
1 Compare the mean percentage reductions for the two treatments. Is there any difference? Do
your results support your hypothesis?
2 Identify some potential sources of error in this experimental design.
3 Explain why you have calculated the percentage reduction in number of colonies, rather than
comparing the number of colonies remaining for each treatment.
4 Do you think that it would be better to use the same hand or the opposite hand for the control
plate? Justify your response.
5 In hospitals, it is not just the ability of the treatment to reduce the number of bacteria on hands
that influences the transmission of infection. Make a list of other factors that might influence
whether alcohol-based hand rubs or soap and water are more effective in reducing nosocomial
(hospital) infections.
6 Design an experiment to test these two treatments in the hospital environment. Ensure that you
list appropriate control(s) and what outcomes you will measure.
9780170452922
14.2 Investigating antibiotic resistance

Background
NOITAGITSEVNI
Antibiotics are molecules that are produced by bacteria and fungi as a defence against other
microbes. Penicillin was a revolutionary discovery for the human race in the 20th century. Penicillin,
along with other antibiotic discoveries, suddenly provided us with a weapon against an invisible
enemy. Antibiotics have been harnessed by scientists and medical professionals for treating disease
and saving lives. Since that first discovery of antibiotics, they have been developed for use against
the broad range of pathogenic microbes. Unfortunately, this weapon has become dulled in the past
decade, because overuse has led to antibiotic resistance. Antibiotic resistance occurs when bacteria
evolve to become resistant to the antibiotics that have been used to fight them. As a result, antibiotic
medicines are not able to kill certain bacteria as effectively, and medical professionals have been
forced to find alternative solutions. Not all antibiotics work against all bacteria, and knowing which
bacteria are susceptible is essential to finding the best treatment for disease.
Aim
Investigate antibiotic effectiveness against common bacterial strains
Time requirement
45 minutes
Materials
• Escherichia coli broth culture • Permanent marker
• Staphylococcus epidermidis broth culture • Ethanol or bleach
• 4 nutrient agar plates • Bunsen burner
• 2 sterile pipettes • Forceps
• 2 disposable spreaders • Contaminated waste bag
• 2 Mastring antibiotics discs • Sterile forceps
• Measuring ruler or callipers • Incubator
• Adhesive tape • PPE: lab coats, safety glasses, disposable gloves
Risks
While lab strains are usually harmless, bacteria may cause Wear lab coats, safety glasses and gloves; wash hands
disease, so assume them to be pathogenic. thoroughly at end of activity.
Decontaminate benches before and after activity. Flood
spills with bleach.
Micro-organisms will grow on the Do not open plates once they are securely taped.
agar plates. Dispose of plates appropriately after autoclaving.
Disposable gloves may pose an allergy risk Use a type of glove with no allergy risk and is suitable for
the chemicals being used.
Procedure
1 To use an aseptic technique, wipe your bench down with ethanol (or bleach) and keep your work
near the Bunsen burner to take advantage of the updraft the flame will create to waft potential
contaminants away from your materials.
9780170452922
2 Label the bottom of your four agar plates with your name and the
date. Label two plates ‘E. coli ‘ and two plates ‘S. epidermidis‘. Label
one plate of each type of bacteria with ‘E‘ for experiment and label E. coli
E
S. epidermidis
E
the other ‘C‘ for control.
3 Using a sterile plastic pipette, transfer a drop of the E. coli bacterial
broth onto the surface of the agar on your two E. coli plates.
4 Working in close proximity to the Bunsen burner, use the spreader E. coli S. epidermidis
to spread the bacterial broth over the plates evenly. If you are using C C
a glass spreader, pass it through the flame of the Bunsen burner

before each use.
5 Replace the lid on the plate immediately to avoid contamination.
6 Repeat steps 3–5 for S. epidermidis using a new sterile plastic pipette and spreader.
7 The next step is to apply the Mastring to each of the experiment plates. Wait 10–15 minutes
before applying the Mastring to ensure the bacteria has a chance to grow.
8 To apply the Mastring, flame your forceps and allow them time to cool before picking them up.
Place the Mastring in the middle of your plate and push (very gently) with the forceps to help it
stay in place. Each lobe of the Mastring is impregnated with a different antibiotic; use the code on
the packet to differentiate them.
T AP
The symbols indicate antibiotics as follows:

AP Ampicillin (apricot)
S Streptomycin (yellow)
ST C
C Chloramphenicol (pink)
ST Sulphatriad (mauve)
PG Penicillin (green)
T Tetracycline (blue)
S PG
9 Repeat steps 7 and 8 for the other experiment plate, flaming the forceps between each application.
10 Seal all four plates with sticky tape and incubate for 24 hours at 37°C, upside down so that the
agar is at the top.
11 Wipe your bench down with ethanol and clean your hands
thoroughly. E. coli experiment S. epidermidis experiment
12 Dispose of all materials safely in a contaminated-waste
bag.
13 The next day, observe for the presence or absence of
growth near the disc, and measure the diameter of any
zones of inhibition. Record your results and contribute to
the class data pool. E. coli control S. epidermidis control
Results
1 Draw a diagram of what you see on each plate. Include
labels.
9780170452922
2 Copy and complete the table below with the results of your experiment.
DIAMETER OF ZONE OF INHIBITION (mm)
ANTIBIOTIC
Escherichia coli Staphylococcus epidermidis
Ampicillin
Chloramphenicol
Streptomycin
Sulphatriad
Penicillin
Tetracycline
3 Calculate the class average diameter of the zone of inhibition for each antibiotic. Copy and
complete the table below with the results of your experiment.
AVERAGE DIAMETER OF THE ZONE OF INHIBITION (mm)
ANTIBIOTIC
Escherichia coli Staphylococcus epidermidis
Ampicillin
Chloramphenicol
Streptomycin
Sulphatriad
Penicillin
Tetracycline
Discussion
1 Explain the function of the control plate in the experiment. How could a control plate be helpful in
the event there was no growth on the experiment plate?
2 What were four variables that you kept constant in this experiment? How did you control them?
3 Why is it important to pool data from the class results to find the average zone of inhibition for
each antibiotic?
4 What is a zone of inhibition? How were zones of inhibition created in your experiment?
5 Which antibiotic had the greatest zone of inhibition? Explain why this might be.
6 Did your individual results differ from the class results? If so, suggest possible reasons.
7 Which antibiotic would be most suitable for treating an infection by Staphylococcus epidermidis?
8 Which antibiotic would you use if you were unsure of the pathogen in an infection? Explain your
answer.
9 Did your results show any signs of antibiotic resistance?
10 Discuss the impacts that antibiotic resistance has on medical treatment?
11 Why have antibiotics become a less effective treatment for infection in recent years?
Taking it further
Test the efficacy of natural antibiotics on similar bacteria.
9780170452922
• Infectious diseases are spreading more the spread of disease as well as to Chapter 14
Activity sheet
rapidly because of globalisation, travel simulate possible outcomes of specific
and trade. Without rapid management by interventions, such as social restrictions.
governments and communities, infectious Modelling has improved enormously
diseases can cause unprecedented harm to with supercomputing, which processes
people, economics and the environment. higher volumes of data faster while
• Management strategies are a coordinated simultaneously performing incredibly
response involving prevention, control complex calculations. Data involving the
and treatment. Specific infectious diseases complexities of disease factors such as
require specific management plans. population size, environmental change,
• Quarantine, immunisation, disruption of pathogen persistence and antibiotic
a pathogen life cycle, medications and resistance can be used as parameters and
physical preventative measures are examples processed to simulate spread and predict
of measures that can be introduced to the rate and distribution of new cases
prevent the spread of infection. emerging.
• To predict the spread of disease, mathematical • Medications such as antibiotics, which
models are used. Mathematicians and inhibit or destroy bacteria, and antivirals,
biologists work closely to include the which inhibit the replication of viruses,
complex factors to maximise the reliability of are effective for some diseases but have
the model. Such models are used to inform limitations due to specificity and drug
public health interventions, such as mass resistance.
vaccination programs and a safe time to cease • Handwashing, specialised masks and
self-isolation. sneezing into elbows are examples of
• Immunisation is an important tool in physical preventative measures used to
preventing the spread of disease to control the spread of disease.
individuals and throughout a population • Management of an outbreak of a disease,
(through herd immunity). especially an emerging disease, requires
• Quarantine is an isolation measure used an investigation to discover the causative
to prevent the spread of disease into factors.
healthy populations. In Australia, the focus • Systems for monitoring the spread of
of quarantine policy has changed over disease are needed so that public health
time from human diseases to plant and interventions can be well targeted. The
animal pathogens that threaten our unique most common form of disease monitoring
wildlife. involves the reporting of notifiable
• Mathematical models are used to predict diseases.
CHAPTER 14 GLOSSARY
Antibiotic An antimicrobial chemical that Antimicrobial agent A medication used to treat
inhibits or destroys bacteria infectious diseases
Antibody A special protein that is produced Antiviral An antimicrobial chemical that

by white blood cells and reacts with and inhibits the ability of viruses to replicate
helps make pathogens harmless; antibodies Biosecurity A set of strategies that support the
are also known as immunoglobulins and are prevention of, response to and recovery from
produced by specialist white blood cells called diseases that affect our economy, environment
B cells and health
9780170452922
Carrier In reference to infectious diseases, a Host An organism that is infected by a pathogen

carrier is an organism that has the infection and
Immunisation The act of protecting someone
is capable of passing it on to others but may or from disease by the use of a vaccine; the process
may not show symptoms.
of developing resistance to a specific disease
Case An individual who is infected with an
Index case The patient zero (initial patient)
infectious disease
in the population of an epidemiological
Case definition A definition that includes a investigation
particular disease, time and place, and is used
to help identify individuals affected by a disease Infectivity The ability of a pathogen to spread
outbreak from one host to another potential host
Contact tracing A process for identifying Intermediate host The host in which a pathogen
potential cases; recent contacts of an infected replicates asexually; in malaria, this occurs in
individual are contacted and screened for the the liver and red blood cells of a human
infection Management strategy A coordinated response
Control measure A strategy that reduces the to an infectious disease involving prevention,
incidence and duration of a disease; it involves control and treatment; specific infectious
meticulous preparation and rapid response to diseases require specific management plans
outbreaks at community, state, national and Mortality The impact of a disease within a
global levels population, measured by the number of deaths
Definitive host The host in which a pathogen caused by that disease
replicates sexually; in the case of malaria, Notifiable disease A disease that, if diagnosed,
sexual reproduction of Plasmodium occurs in is required to be reported to public health
the gut of the female mosquito authorities
Emerging disease A disease that has recently Outbreak A sudden, unexpected increase in
appeared in a population, has occurred the prevalence of a particular disease above the
previously but affected only small numbers in baseline level for that population; it could be
isolated places, or has occurred previously but a single case of a contagious disease in a small
only recently been recognised as being due to a community
newly identified pathogen
Pandemic A disease that has spread rapidly
Endemic A disease that is always present in a throughout the world; an epidemic that has
population or region crossed international borders
Epidemic An increase in the occurrence of a
Patient zero The index case (initial patient) in the
specific disease above the baseline level for a
population of an epidemiological investigation
particular population; it tends to refer to larger,
more serious events than an outbreak Persistence Refers to the ability of a pathogen
to survive for long periods of time in reservoirs,
Epidemiologist A scientist who studies the
or to how long the pathogen remains viable
causes and effects of diseases at a population
outside the host
level, and who works to prevent or minimise the
impact of diseases on the population Prevention Preventing transmission of a
disease, onset of disease signs and symptoms,
Epidemiology The study of the occurrence of
and impact on the environment or society
disease in populations
Quarantine A period of isolation serving to
Fomite A surface or non-living object carrying
prevent the spread of a contagious disease;
an infectious agent
suspected cases are isolated from local,
Herd immunity The phenomenon that once a susceptible populations until at least the
particular proportion of a population is immune incubation period is finished, clinical signs and
to a disease, susceptible individuals are also symptoms have passed and a scientist confirms
better protected from the specific disease the suspected pathogen is no longer present
9780170452922
Replication In reference to diseases, the usually by injection; immunisation is what

process of producing new pathogens from old happens in your body after you have had the
pathogens vaccination
Sign An objective and measurable experience Vaccine A treatment containing a dead or
of a pathogen host that is directly observable: weakened/inactive form of a pathogen that
elevated body temperature, breathing rate, pulse stimulates a specific immune response; vaccines
rate and/or blood pressure are important ‘vital’ contain antigen components harvested from an
signs of disease infected organism and stimulate the production
Symptom A subjective experience felt by a of antibodies
patient, such as nausea or pain Vector In reference to diseases, an agent that
Treatment Health provisions such as transmits pathogens from one host to another;
medication and vaccination that treat or prevent in genetics, a vehicle used to transfer DNA
disease sequences from one organism to another
Vaccination The administration of a vaccine Virulence The ability of a pathogen to cause
to the bloodstream to cause immunity, severe disease within its host

Remembering
1 List five general management strategies used to control the spread of disease.
2 State the role of an epidemiologist in managing the spread of disease.
3 Describe the impact of increased travel and trade on disease transmission in the context of:
a island-based wildlife
b emerging human viruses.
4 Using an example, describe herd immunity.
5 Outline how hand hygiene can help prevent the transmission of disease.
Understanding
6 Explain why herd immunity cannot be an effective management strategy against tetanus.
7 Some people are unable to receive vaccinations because of a medical condition. Explain why
the vaccination of healthy individuals is important for those who cannot receive vaccinations.
8 Explain why it is important to collect data about disease rates, even when levels are fairly stable.
9 Research a recent outbreak of an emerging/re-emerging disease (such as SARS or swine fever)
and describe the management strategies used to control the spread. Include what was done and
who did it (WHO, UN, government or community).
Applying
10 TB is caused by a bacterium that can lie latent in the body for many years. When it reactivates,
it can cause serious infections of any part of the body, but most commonly the lung. When
diagnosed, patients with reactivated TB are treated for 2 weeks in hospital isolation before
continuing treatment at home. All visitors must wear masks to enter the isolation unit.
a Explain why patients are initially treated in isolation.
b Is this a type of quarantine? Explain why or why not.
c Public health authorities will contact and test other people in the household of somebody
diagnosed with TB. Name this process.
9780170452922
11 Malaria is a disease that is a significant cause of mortality worldwide.

a Summarise the life cycle of the malaria parasite, Plasmodium.
b Explain how this life cycle affects the distribution of this disease.
There are several conditions caused by abnormal alleles of the gene that codes for haemoglobin.
One of these abnormal alleles, the sickle cell allele (h), causes red blood cells produced to
have abnormal shapes. For patients who are homozygous (hh) for this allele, these abnormally
shaped red blood cells cause a serious disease known as sickle cell anaemia. However,
heterozygotes, who also have one normal allele (Hh), are usually unaffected. Heterozygotes are
also more resistant to infection with malaria than are people with two normal alleles (HH).
c In areas where malaria is common, which genotype would provide an individual with the
biggest selective advantage: HH, Hh or hh? Justify your response.
d Sickle cell anaemia is much more common in parts of the world near the equator. Linking
this to your knowledge of evolution, explain why this is the case.
12 Influenza is a viral infection that is most common in winter. It is spread from person to person
by airborne droplets produced when sneezing or coughing. The rapid evolution of the virus
means that individuals who have been exposed to one strain may not have immunity against
other strains.
a Suggest some disease, population and environmental characteristics that may explain why
influenza is most common in winter.
b Explain how handwashing can be used to prevent the spread of influenza.
c Explain why herd immunity is not able to provide complete protection against influenza.
Analysing
13 Draw a table that compares disease surveillance and predictive modelling (including the type
of information and when each technique is useful).
Evaluating
14 Evaluate the current management strategies used to control Ross River virus disease.
Creating
15 Create a Venn diagram to summarise the management strategies used in controlling the spread
of phytophthora and crown gall diseases.

1 A pandemic is most likely to arise from a Step B The virus binds to the host cell.
new influenza virus strain that Step C The virus injects its nucleic acid into
A spreads easily among humans the host cell.
B causes a high mortality rate in humans Step D The host cell releases viral particles.
C cannot replicate in humans Step E The host cell produces viral nucleic
D has the same protein coat as an existing acids and proteins.
strain. Which of the following lists these steps in
[Q16 2018 SCSA] the order in which they occur in the life
cycle of the virus?
2 The following is a list of the main steps
A B→C→E→A→D
in the life cycle of a virus, listed in no
B A→E→C→D→B
particular order.
C C→B→A→D→E
Step A Viral proteins and nucleic acids are
D D→C→E→B→A
assembled in the host cell.
[Q23 2017 SCSA]
9780170452922
3 Tuberculosis will spread most rapidly 5 Outline two distinctly different methods of
through a host population when the density controlling the spread of malaria. (4 marks)
of the host population is [Q35c 2018 SCSA]
A high and herd immunity is low.
6 Discuss management strategies that can be
B high and herd immunity is high.
used to control the spread of phytophthora
C low and herd immunity is low.
dieback disease. (6 marks)
D low and herd immunity is high.
[Q39 2018 SCSA]
[Q2 2016 SCSA]
7 A group of biologists developed a model
4 Select a true statement about TB.
for predicting the spread of influenza in
A TB cannot be prevented.
human populations. As a part of this, they
B People with latent TB can transmit the
collected data on the number of individuals
disease.
per household in two locations, shown in
C TB can usually be treated with a
Figure 14.19.
6-month course of antimicrobial drugs.
D Multidrug-resistant tuberculosis is Compare the number of people per
caused by bacteria that does not respond household in the two locations. Use data
to the standard course of medication from Figure 14.19 to support your answer.
and requires a course of antiviral drugs. (4 marks)
[Q8 2016 SCSA] [Q32a 2017 SCSA]
Location 1 Location 2
80 120
100
60
80
40 60
40
20
20
0 0
1 2 3 4 5 6+ 1 2 3 4 5 6+
Number of people per household Number of people per household
FIGURE 14.19 Number of people per household
8 Explain why data on the number of 10 White spot disease is a highly contagious
people per household are relevant to the viral disease that affects prawns. It is
development of a model for predicting the found in parts of Asia, America, Africa
spread of influenza in human populations. and the Middle East, but generally not in
(4 marks) Australia. A recent outbreak has, however,
[Q32b 2017 SCSA] occurred in several prawn farms on a river
in Queensland. Explain two measures that
9 Can influenza be treated with antibiotics?
could be taken to reduce the risk of white
Explain why or why not. (4 marks)
spot spreading from the affected farms to
[Q32c 2017 SCSA] other parts of Australia. (4 marks)
[Q32e 2017 SCSA]
9780170452922
510
INDEX
5’ to 3’ (direction of synthe- Ti plasmid 96, 218 gas balance 343–4, 347 Australian bushfires push
sis of nucleotide strand) use in biotechnology 96, nitrogenous wastes 342–3, threatened species towards
57, 61, 62, 67, 68, 173 218, 219, 221 344, 375–6 extinction 316–17
AIDS 470 salt balance 343, 346, 383 Australian Code for the Care
A airborne droplets 431, 433, thermoregulation 342, 344, and Use of Animals for
abiotic factors, optimal range 434, 484 350–1, 353–63, 397–9 Scientific Purposes 7, 8
for 341 albatross 383 water balance 343, 345, Australian Quarantine and
ABO blood group system alcohol-based antisepsis, 364, 373–4, 377–83, Inspection Service (AQIS)
codominance 148 efficacy of 500–1 384–5 473
genotypes and phenotypes allele frequencies in a gene annealing 174, 175, 196 Australian Sheep Breeding
137–8 pool of a population over PCR 178, 179, 180 Values 151
in Indigenous Australians time 309 Anopheles mosquito 433, Australia’s fossil record 277
308 allele frequencies in a popu- 446, 455, 479, 489 autoclave 7
absolute dating 264, 267–8 lation 293, 297 ant-eating mammals 278 autosomal dominant patterns
accumulation 296 change over generations anteaters 278 of inheritance 153, 156
accuracy 9, 14 298, 299, 305–7, 308, 311 antibiotic resistance 455–7, autosomal gene, inheritance
active immunity 475 alleles 29, 87, 88, 107, 125 471, 482 of single 130–3
adaptations 249, 296, 332 advantageous 298 investigation 502–4 autosomal inheritance 152
physiological, for homeo- inheritance of a single antibiotics 455, 456, autosomal recessive patterns
stasis 347–8 autosomal gene 130–3 481–2 of inheritance 152, 156
structural and behavioural, introduction of new modes of action 481–2 autosomal trait 16
for homeostasis 348 alleles into a population anticodon 66, 71, 72 autosomal trisomy 104
for thermoregulation through mutation 293–5 antidiuretic hormone (ADH) autosomes 29, 43
351–63 ‘tall’ and ‘short’ pheno- 336, 377, 378, 383 avoidable measurement
to maintain an organism’s types 129–30 antimalarial drugs 480 error 14
tolerance limits 347–8 allopatric speciation 313–15 antimicrobials, effectiveness axons 334
adaptive evolution 297–9, process of 315 on pathogens 424
309 alphaviruses 436 anti-parallel strands 62 B
adaptive radiation 270, 271, amino acid sequence of hae- antisense strand 66 bacillus 415
276, 311 moglobin, in humans and antivirals 482–3 bacteria 30, 44, 407, 414–18
of marsupials 276, 277 other primates 260 modes of action 483 antibiotic modes of action
adenine 53, 56, 57, 58, 66 amino acid table 74 apoptosis 44, 74, 91, 95 on 481–2
adhesion 386 amino acids 63, 74 AquAdvantage Salmon® antibiotic resistance
adult stem cells 239 and mRNA codons 74 220, 224 455–6, 482
advantageous traits, passed protein synthesis 65, 70, aquatic birds and mammals classification according to
on to offspring 298 71, 72, 73 nitrogenous waste 376 shape 415
adverse conditions, crops ammonia 342, 375, 376, 377 thermoregulation 358 classification based on
tolerance of 221–2 amphibian chytrid fungus Archaeopteryx 264 composition of cell
aestivation 361, 382 disease 418, 419–20, 434, arid environment plants, walls 415–16
afferent neurons 335 445–6, 488 adaptations for regulation diseases caused by 417–18
African swine fever (ASF) amplifying DNA 175 of water, salts and gases Gram Stain 415–16
230 using PCR 178–80 389, 390–1, 394 and horizontal gene trans-
outbreaks and spread anaerobic bacteria 417, 442 arteries 358 fer 96
453–4 analogous structures 272–4, artificial selection 151, 169, how they cause disease
agarose gel 180 278 299–302 417–18
agricultural industries and anaphase 34, 35 vs natural selection 302 isolation 416
environment, quarantine anaphase I 40, 41 asexual reproduction 26 pathogenic, life cycle
protection 473–4 anaphase II 40, 41 asymptomatic 433 440–4
agriculture 216 anatomy, comparative 270–4, Atlantic salmon, faster reproduction 414–15
DNA identification tech- 278 growth rate 220, 224 structural features 414
nologies in 216–18 ancestor 249 Atlas of Living Australia viral replication in 412
recombinant DNA technol- aneuploidy 103–4 (ALA) 248 bacterial capsule 414
ogy in 218–24 animal breeding 299–300 atmospheric oxygen 252 bacterial transformation 196,
Agrobacterium tumefaciens animal cells Australian bat lyssavirus 200–4
197 cytokinesis 35–6 408, 413, 433, 439–40 bacterial vectors 197, 219
as cause of crown gall dis- water balance 345, 373 life cycle 440 bacteriophages 410
ease of plants 218, 414, animal ethics 7–8 management, prevention baleen whales, evolution
417, 418, 431, 443–4 animals and control 486 274–5
entry through wounds 431, climate change survival transmission 434, 439, bananas, selective breeding
443 362–3 440, 461 301
9780170452922
INDEX 511
bands on the gel 181 Bowman’s capsule 374 cephalosporins 481 codons 64–5, 70, 71
bar graphs 12 brain 334, 335 chain-termination sequenc- cohesion 386
barley, salt-tolerant 222 branch (phylogenetic tree) ing 186–7 cold climates, plant’s heat
base-pair substitution 93 257 Chargaff, Erwin 53 exchange control 349
bat-to-human transmission breeding behaviour 87 cheetahs 306 cold environments, thermo-
locations of zoonotic dis- brine shrimp, natural selec- chemical mutagens 96 regulation in (animals) 357
eases 498 tion 321–3 chemoreceptors 332, 333 behavioural responses 359
Batrachochytrium dendro- 5-bromouracil 96 chiasma 108 physiological adaptations
batidis 419–20 brood parasitism and fam- chitin 418 359–61
bats, as vectors 433, 440, 451 ily size in black swans chlamydospores 449, 450 structural features 357–9
Bee Force 493–4 199–200 chloride ions 343, 346 common ancestor 249, 254,
bees see honeybees Bt (Bacillus thuringiensis) chloroplasts, DNA in 55 257–60, 270–1, 274, 276,
behaviour adaptations, and gene 197 chordate embryos, similari- 278
homeostasis 348 budding 415 ties 270 common cold 411, 412, 436
behavioural responses burrowing 348, 357, 382 chromatids 33, 39, 108 common marsupial ancestor
to thermoregulation in burrowing bettong (Bettongia chromatin 27, 29, 33, 90 276
cold environments 359 lesueur ) 192 chromosomal mutations communicable diseases 407,
to thermoregulation in hot bushfires 101–7 472
environments 353–5 and climate change 317, devil facial tumour disease Communicable Diseases Net-
beneficial mutations 99, 293 319 45–6, 103 work Australia team 472
beta-carotene (β-carotene) impact on threatened chromosome non-disjunc- communicating your results
221 species 316–17 tion, effect on gametes 15–17
bilbies, thermoregulation 101, 103 comparative anatomy
356–7 C chromosome number, varia- analogous structures
binary fission 38, 414, 441 calcium ions 343 tions in 101–4 272–4, 278
biochemistry, comparative camels 381 chromosome structure, varia- homologous structures
259–60 cancer 91, 95 tions in 105–6 270–2
biodegradation 231 canola, GM 223, 232 chromosomes 54 comparative biochemistry
bioengineered kidney 396 capillary action 386 crossing over 39 and protein conservation
bioengineering 218 capsid 410 of eukaryotes 27–9, 33–5, 259–60
biogeography 225 captive breeding programs, 39–42 comparative dating 266–7
bioinformatics 256–9 biotechnology use 227–9 karyotype 27–8, 101 comparative embryology 269
biological agents, causing carbon dating 267–8 numbers of 43 comparative genomics 188,
mutations 45–6, 96–7 carbon dioxide of prokaryotes 29–30, 38, 254–9
biological fitness 304 exchange between blood 42 made possible with bioin-
biological materials, safe use plasma and interstitial chytridiomycosis (chytrid formatics 256–9
and disposal 7 fluid 332–3 fungus disease) of frogs and mutation rate 259
biological species concept 310 levels, tolerance range 343, 418, 419–20, 434, 445–6 and phylogenetic trees
bioremediation 231 344, 347 history and ecology 420 256–9
biosecurity officers 473 and pH levels 347 life cycle 445 competition 298
biotechnology 169 reducing levels 348 management, prevention complementary base pairs
DNA tools used in 170–4 carbon-14, half-life 267–8 and control 488 53, 57
emerging technologies carriers transmission 445 during transcription 66
237–9 of pathogens 473, 474 cicadas 312–13 complete dominance 149
environmental effects 235 of recessive alleles 152 circular DNA 54, 55 concentration gradient 387
for monitoring endangered carrots, selective breeding clades 254, 257 conclusions (investigations)
species 226–7 301 cleavage 35 14
traditional 169–70 case definition 496 cleavage furrow 35 conduction 352
use in agriculture 216–24 catabolic reaction 348 climate change 221, 317, 319 conservation, importance of
use in captive breeding cattle breeding 301 and animal survival 361–2 225–6
programs 227–9 cell body 334 and mosquito-borne dis- conservation biology 224
use in environmental con- cell cycle 31–2 eases 454–5 conservation breeding
servation 224–32 cell death 44 climate variations 252, 277 programs, biotechnology
use in quarantine 229–30 cell division 26, 31–42 cloning 237–8 use 227–9
see also transgenic organ- cell division errors 94–5 cloning vectors 97 conservation planning
isms cell plate 35 close contact 432, 433, 434 225–6
bird-like dinosaurs 264 cell walls (bacteria) 414, 415 Clostridium tetani 417, 431, contagious diseases 408
bivalent 39 cellular machinery 64 442, 487 continental drift 250
blunt ends 170, 171, 172 cellular pathogens 413–22 coccus 415 continuity of life 26–30
body fluids 408, 432 central nervous system cockroaches 362 continuous variables 6
body temperature see tem- (CNS) 334, 335 coding DNA 63–5 continuous variation 146,
perature centrioles 33 coding strand 66 147
bottleneck effect 305, 306, centromere 27 codominance 148–9, 150 student height 159
317, 319 centrosomes 31, 33 codon table 74 control group 5
9780170452922
512 INDEX
control measures (disease) 470, 471 data recording 10–11 structure and functioning 58–9
controlled variables 5 dating methods (rocks and fossils) 264, structure enables DNA replication 59,
convection 352 266–8 60–3
convergent evolution 258, 278–9 daughter cells 31, 33, 35, 39 DNA code (genes) 65, 67, 69, 70
coordinating centre (modulator) 338, daughter DNA strands 61 DNA–DNA hybridisation 255
339, 373 definitive host 432, 479 DNA fingerprinting 229, 241
coordinating a response (homeostasis) deformed wing virus (DWV) disease of DNA helicase 61, 62
332, 334–7 bees 438, 486, 499–500 DNA identification technologies in agri-
endocrine system role 334, 336–7 dehydration 333, 343 culture 216–18
nervous system role 334–6 deleterious mutations 99 DNA ladder 175, 181–2
coral polyps spawning 110 deletion mutations 94, 98 DNA ligase 61, 62, 170, 172–3, 196
cormorants 314 deletions (chromosomal mutation) 105 DNA microarray technology 184–5
corn denaturation (PCR) 178, 179, 180 DNA polymerase 61, 62, 170
drought-tolerant 222 deoxyribose sugar 56–7 DNA profiling 178, 193–4, 216, 227
selective breeding 300, 301 dependent variables 4 for paternity testing 194
coronavirus disease see COVID-19 descent with modification 296 process involved 193
cotton, GM 219–20, 232 desert animals, burrowing 382 DNA replication 59, 60–3
cough and sneeze into elbow 484 desert hopping mouse (Notomys alexis), enzymes involved 62
countercurrent heat exchange 358–9 water conservation 380, 381, 382 showing leading and lagging
COVID-19 408, 470, 490–3 detecting the stimulus (homeostasis) strands 63
management plans 391–2 332–4 steps involved 62
mandatory quarantine of overseas devil facial tumour disease 45–6, 103, DNA replication errors 93–4
passengers 473 228 DNA sequencing 169, 186–92, 196, 255
modelling, and educating for public dideoxynucleotide sequencing 186–7 for mapping of species’ genomes
safety 497 differentiation 29 190–1
rate of spread 451, 452 digital disease surveillance 495–6 next-generation sequencing (NGS)
signs, symptoms, disease progression dihybrid crosses 138–41 186, 188–9
and severity 491 explanation of ratios 143–4 Sanger sequencing 186–7
structure and source of virus 490–1 solving 141–3 to study ecosystem biodiversity 188–9
transmission routes 434, 491 diploid cells 43, 87 DNA techniques and vocabulary
vaccine development 3, 4, 492 diploid number 29, 33 174–85
Crick, Francis 53, 54 direct contact 432, 433, 434 DNA technologies see biotechnology
critical thinking 132 direct transmission 432, 433, 434 DNA viruses 410, 411
crocodiles, thermoregulation 354, 359 from a reservoir 433 docosahexaenoic acid (DHA) 223
crops discontinuous variation 138, 147 dominance inheritance patterns 148
GM 218–23, 232–3 discrete variable 6 codominance 148–9, 150
herbicide-resistant 218–19, 235 discussion 13–14, 16 complete dominance 149
tolerance of adverse environmental disease management 472–95 incomplete dominance 148, 150
conditions 221–2 disease monitoring 495–8 in terms of genotype and phenotype
see also wheat breeding educating for public safety 497 150
crossing over 39, 108 managing an outbreak 496 dominant allele 124, 125, 126, 128, 129
unequal 94 national surveillance 495–6 dominant mutations 92
crown gall disease of plants 407, 417, predicting the spread of disease 497 dominant phenotype 130
431, 434, 443–4 solving the outbreak 497 double-strand breaks (DNA) 95, 96, 105
life cycle 444 disease-resistant crops 219–20 Down syndrome 104
management, prevention and disease spread, factors affecting 450–8 Drosophila melanogaster (fruit fly) 134
control 488 disease surveillance 495–6 comparative genomics with
transmission 443, 444 divergent evolution 275, 276–7, 311, 313 humans 188
CSIRO AAHL biocontainment laboratory DNA (deoxyribonucleic acid) 26 genetic mapping 191
(AAHL) 230 in chloroplasts 55 monohybrid cross for wing length 135
cutting DNA 170, 171–2 coding and non-coding DNA 60, test cross for wing length 134–6
cyanobacteria 252–3 63–5 drought-tolerant GM corn 222
cytokinesis 31 coding region 69 Duchenne muscular dystrophy 154
in eukaryotic cells 35–6 discovery 53, 54 duplications (chromosomal
cytokinesis I 40, 41 double-helical structure 53, 57, 58, 59 mutation) 106
cytokinesis II 40, 41 drawing and labelling 57–8
cytosine 53, 56, 57, 58, 66 in eukaryotic cells 27, 29, 54 E
extraction 78–9 Earth
D in mitochondria 55, 56 continental drift 250
Darwin, Charles 310, 314 mutagen effects 95–7 geologic timeline 250, 251–2
theory of evolution by natural selec- nucleotides 26, 53, 56–7 life and times of 248, 250–2
tion 249–50, 296 in prokaryotic cells 29, 30, 38, 54 species extinction due to changes in
data analysis 10–13 promoter region 69 climate, sea level and atmospheric
data points 11, 12, 13 structural properties 56–9 oxygen 252–3
9780170452922
INDEX 513
eastern barred bandicoot (Parameles meiosis 39–42 fertilisation 26, 43–4, 102
gunnii), speciation and conservation mitosis 33–5, 36 filaments 418
240–1 structural similarities and differences filtered clean water 484
Ebola disease 470 to prokaryotic cells 30, 54 filtrate 374
evolution, ecology and health 295 transcription in 66–9 filtration 374
echidnas 278, 354 translation in 70–3 first filial generation (F1 ) 127, 128, 130
ecosystem biodiversity, next-generation viral replication in 411 fish
sequencing to study 188–9 see also fungi nitrogenous waste 376
ectotherms, temperature regulation evaporation 352 osmoregulation 381, 382, 384
350–1, 353–62 evaporative cooling 352, 353 flagellum (flagella) 414, 418, 421
eDNA (environmental DNA) evidence for theory of evolution 250, flamingos 255
NGS to analyse 188–9 253–75 flowering plants, structure 110
to monitor platypus 227 biogeography 253 fomites 433, 434, 484
educating for public safety (infectious comparative anatomy and embryology and pathogens 423–4
diseases) 497 269–75 food poisoning 435
effectors 334, 338 comparative biochemistry and protein foodborne pathogens 484
efferent neurons 335 conservation 259–60 foot and mouth disease (FMD) 230
elephants, cooling ears 353 comparative genomics 254–9 footprints (early humans) 263
Ellis–van Creveld syndrome 307 fossil record 262–8 forelimb of vertebrates, adaptive radia-
elongation (translation) 70 evolution 249 tion 271
embryo splitting 237 adaptive 297–9, 309 fossil record 252, 262–8, 311
embryology, comparative 269 and atmospheric oxygen levels 252–3 Australia 277
embryonic stem cells 238–9 of bacterial strains and antibiotic gradualism 266
emerging diseases 470 resistance 455–6 punctuated equilibrium 266
emigrations 226 bigger picture of 309 transitional forms and the pace of
emperor penguin, thermoregulation 358 convergent 258, 278–9 evolution 264–6
Encyclopedia of DNA Elements (EN- divergent 275, 276–7, 311, 313 fossilisation 262–3
CODE) project 60 evidence for theory of 250, 253–75 fossils 262
endangered species monitoring 224, macro-evolution 309, 310–11 dating methods 264, 266–8
226–7 mechanisms for 293–308 looking at 280
endocrine system 334, 337–8 micro-evolution 309, 310 principle of superposition 263–4
endocytosis 417 theory of evolution by natural selec- process of fossilisation 262–3
endospores 414 tion 249–50, 296 founder effect 305, 306–7
endotherms, temperature regulation see also speciation frameshift mutations 98, 100
350–1, 353–62 evolutionary thought, history of 249 Franklin, Rosalind 53
environmental conservation excretion 342, 375–6 freshwater bony fish, water balance 381,
biotechnology use 224–32 exons 67, 69 382, 384
recombinant DNA use 231 exotic bee pests 434, 438, 493 frogs
environmental factors 88–91 extension 174 behavioural adaptations 348
and genotype 86 PCR 178, 179, 180 chytridiomycosis (chytrid fungus dis-
influencing phenotype 87, 88–91 external environmental factors, influenc- ease) 418, 419–20, 434, 445–6, 488
and variation 88–91 ing phenotype 89–90 isolating mechanisms 311, 312
enzymes 61, 65, 74, 347 external receptors 333 nitrogenous waste 376
temperature and pH effects 332, 344 extinction of species 316–20 water balance maintenance 380, 382
eons 250 Australian bushfires push threatened fruit fly see Drosophila melanogaster
epidemic polyarthritis see Ross River species towards extinction 316–17 fungi 407, 418
virus disease Leadbeater’s possum 319–20 diseases caused by 419–20
epidemics 451, 454, 471 preventing by preserving genetic pathogenic, life cycle 445–6
simulation 459–61 diversity 317 structural features and reproduction
epidemiologists 471–2 WA conservation, extinction and 418–19
epidemiology 471 evolution 318–19
epidermis 431 extrapolation 11, 12, 13 G
epigenetics, affect on phenotype 90 extremities (aquatic birds and mam- Galápagos cormorant 314
epigenome 110 mals), countercurrent heat exchange Galápagos tortoise 310
epochs 250 358–9 gametes 26, 39, 43
eras 250 chromosome non-disjunction effects
ethical issues F 101, 103
embryonic stem cells 239 F1 generation 127, 128, 130 crossing over effects 108
transgenic organisms 232–6 F2 generation 127, 128, 130 independent assortment and random
ethidium bromide 181 feedback mechanisms (homeostasis) assortment effects 108–9
eukaryotic cells 338–40 mutation effects 92
chromosomes 27–9, 33–5 negative feedback 338–40, 347, 355, random fertilisation 109
cytokinesis 35–6 360, 378–9 gametocytes 446
DNA in 27, 29, 54, 55 positive feedback 338, 339 gas balance, in animals 343–4, 347
9780170452922
514 INDEX
gas exchange, in plants 389–90 today 129–33 halophytes

Gastornis (terror bird) 273 vocabulary 125–6 adaptations for regulation of water,
gel electrophoresis 169 genome sequences 63–5, 75–6, 191, salts and gases 388–9, 391–3, 395
summary of main steps 182–3 254–6 structural and physiological adapta-
for visualising DNA 180–3 genomes 37, 64, 89, 176, 190, 254 tions 392–3, 395
gene cloning 195 genomics 60, 254 handwashing 484
gene expression 184, 196 comparative 188, 254–9 efficacy of alcohol-based antisepsis
and epigenetics 90 genotype ratios 129, 130, 133, 136, 138 500–1
observed in phenotype 197 genotypes 87, 125 haploid (n) 101
gene flow different types of dominance relation- haploid cells 40, 41, 43, 108
from crop species to weed species 233 ship 150 haploid number 29
as mechanism for evolution 307–8 for Duchenne muscular dystrophy 154 Hardy–Weinberg equilibrium principle
gene guns 197 for human blood groups 137–8 293
gene mapping 190, 191, 196 influencing phenotype 88 harmful mutations 293
gene mutations 92 predicting from test cross 134–7 healthcare provisions, lack of, and
gene pools 224–5, 293, 294–5 predicting using Punnett squares 131, spread of disease 458
assessing for breeding programs 224–5 132–3 heat exchange, control in plants 349
and conservation planning 225–6 genotypic variation 87 heat transfer 351–2
diversity 228 geologic timeline 250, 251–2 hepatitis B and C, antiviral treatment
and micro-evolution 309 germline cells 29 482
gene probes 184–5 mutations in 91, 92, 94 herbicide-resistant crops 218–19, 235
gene sequences, conservation in differ- Giardia lamblia 421–2 herbicide-resistant weeds 233–4
ent organisms 254 giraffes, long necks in 299 herbicides 218
genes 28, 58, 63–4, 65 globalisation, and spread of disease herd immunity 453, 458, 475–6
phenotypic expression 86–8 452–4 principles 476–7
genetic admixing 192 glomerulus 374 sequence of events a community ex-
genetic bottlenecks 305, 306, 317, 319 Glossopteris seed ferns 253 periences in order to gain 478
genetic code 60, 64–5, 74–5, 98 glyphosate 219, 233 heredity 26, 60, 86
activity 77–8 GM barley, salt-tolerant 222 principles of 124–5
genetic diversity 87, 228 GM canola 223, 232, 234 heritability 298
koalas 231 GM cotton 219–20, 232 herpes viruses, antiviral treatment 482
loss of 318 GM crops 218–23, 232–3 heterosomes 29
preserving 317 gene flow into non-GM crops 233 heterozygous alleles 126
reduction in GM crops 235 reduction of genetic diversity 235 heterozygous barley seed, inheritance
Tasmanian devil 228–9 GM salmon 220 in 160–1
genetic drift GM soybeans 219 hibernation 361
bottleneck effect 305, 306, 317, 319 GM wheat, salt-tolerant 222 histograms 13
founder effect 305, 306–7 Golden Rice 221 histone proteins 27
as mechanism for evolution 305–7 Gondwana 253 HIV, antiviral treatment 482
genetic engineering 171 Gouldian finch homeostasis 332–48
genetic information 26 monitoring 226, 227 adaptations to maintain an organism’s
genetic mapping 190, 191, 196 variation in 86–7 internal environment within toler-
genetic markers 190, 192 gradualism 266 ance limits 347
genetic relatedeness 254–5 Gram stain 415–16 feedback mechanisms 338–40, 347
genetic variation 86, 293, 294 graphs limitations 333–4
burrowing bettong 192 drawing in biological science 11–13 osmoregulation 373–4
and genetic drift 305–7 rules for 10–11 and physiological processes 347–8
through chromosome mutations greater bilby (Macrotis lagotis) 356–7 stimulus–response model 332–7, 338
101–7 grebes 255 structural and behavioural adapta-
through sexual reproduction 107–10 green sea turtles, temperature affects sex tions 348
genetically engineered animals 220, 224 phenotype 89 tolerance limits 341–7
genetically modified organisms (GMOs) greenhouse gas emissions 455 homeostatic regulation 332
195–8, 218–24 guanine 53, 56, 57, 58, 66 hominid skull analysis 282–4
ethical issues 232–6 guard cells 385, 387, 389–90 homologous chromosomes 28, 33, 43,
genetics guinea pigs fur colour, test cross 136–7 87, 88, 94, 126
dihybrid cross 138–44 combinations of alleles 131
dominance inheritance patterns H and independent assortment 107,
148–50 haemoglobin, amino acid sequence, in 108–9, 143–4
inheritance principles 124–9 humans and other primates 260 segregation of alleles 131
modes of inheritance 152–7 Haemophilus influenzae, rate of infection homologous structures 270–2, 281–2
monohybrid cross 130–3 after introduction of the vaccine 477 and adaptive radiation 270, 271,
multiple alleles for one gene 137–8 hairline, widow’s peak 124, 125 276–7
polygenic inheritance 146–7 half-life of elements used in radiometric pentadactyl limb 271, 281–2
test cross 134–7 dating 267–8 vestigial 272
9780170452922
INDEX 515
homology 254 infected host reservoir 431 intermediate host 479

homozygous alleles 125, 126 infections 407 internal environmental factors, influenc-
honey possums 318–19 phases of 409 ing phenotype 90
honeybee viral diseases 413, 438 infectious agents 407 internal receptors 332
management, prevention and control infectious diseases interphase 31, 33, 41
486, 499–500 disruption of a pathogen life cycle interpolation 12, 13
transmission 434, 438 478–80 inter-quartile range 10
honeybees, and Varroa mite 434, 438, factors affecting spread 450–8 interrelated factors in spread of patho-
493–4 general life cycle 431–2 gen 451, 452
horizontal gene transfer 96–7, 456–7 immunisation and herd immunity interstitial fluid, exchange of carbon
hormones 90, 336, 337 475–8 dioxide with blood plasma 332–3
in water balance 377, 378 Koch’s postulates 407 intraspecific variation 87
horses medications 481–3 introduction (reports) 15
evolution 264–6 monitoring 495–8 introns 64, 67, 69, 255
heat gains and losses 356 outbreaks 408, 436 inversions (chromosomal mutation) 106
host population density, and spread of physical preventive measures 484–5 investigations 2
disease 451–2, 457 quarantine to prevent spread 473–4 communicating your results 15–17
host susceptibility, and spread of disease specific disease management strate- conclusions 14
457–8 gies 485–94 discussion 13–14
hosts 407, 411 strategies that control spread of generic steps 2–3
defence mechanisms 431 472–94 hypothesis 4–5
for pathogens 431, 432 transmission 408, 409–10, 431–5 planning 5–8
hot climates, plant’s heat exchange simulation of an epidemic 459–61 procedure 8–9
control 349 understanding 409–10 researching and refining your ques-
hot environments, thermoregulation in what are they? 407–9 tion 3–4
(animals) 352 see also pathogens results: recording the data 9–10
behavioural responses 353–5 infectivity of a disease 476 isolating mechanisms 311
physiological adaptations 355–7, 361 influenza post-reproductive (post-zygotic) 313
structural features 353 antiviral treatment 482, 483 pre-reproductive (pre-zygotic) 312–13
human blood groups life cycle 435–6 isotonic solution 343, 345, 373
genotypes and phenotypes 137–8 management, prevention and control isotopes 267
Indigenous Australians 308 485
humans, response to increased body patterns of infection and influenza-re- J
temperature 361–2 lated Google search activity 495 jarrah dieback 421, 448–50, 489–90
humidity, and transpiration 388 persistence 471
Huntington’s disease 184 symptoms 436 K
hybrid offspring 313 transmission 434 Kangaroo Island bushfires, faunal losses
hybrid sterility 313 influenza viruses 316, 317
hydrangeas, flower colour 89 structure 436 kangaroos 311, 353
hyperthermia 350 Type A, B or C 413, 435 karyotype 27–8, 37, 101, 104
hypertonic solution 343, 345, 373 vaccination against 483 keratin 75, 420, 445
hyphae (hypha) 418–19, 449 zoonotic 408 keratinocytes 44
hypothalamus 333, 336, 338, 339, 348 inheritance 124 Khapra beetle 229
and osmoregulation 373, 377, 378, autosomal dominant 153, 156 kidneys
383 autosomal recessive 152, 156 role in osmoregulation 374, 377–9
hypothermia 342 dihybrid cross 138–44 structure 374
hypothesis 2, 4–5 dominance inheritance patterns water reabsorption 378
hypotonic solution 343, 373, 381 148–50 kitchen gloves 485
in heterozygous barley seed 160–1 koalas
I modes of 152–7 common ancestor 276
immigrations 226 monohybrid cross 130–3, 135 deaths from bushfires 317
immunisation/immunisation programs multiple alleles for one gene 137–8 genetic diversity 231
475, 477 polygenic 146–7 genome 75–6
impressions (fossils) 263 sex-linked 153–7 Koch’s postulates 407
inbreeding 225, 226, 228, 229, 231 single autosomal gene 130–3
inbreeding depression 227 test cross 134–7 L
incomplete dominance 148, 150 inheritance principles lagging strand 61, 62, 63
incubation period 409 Mendel’s pea experiments 125, 126–7, Lamarck’s theory of transmutation of
independent assortment 41 129–30 species 249
and homologous chromosomes 107, Punnett squares 126, 128–9, 131, Lamda DNA, restriction digestion en-
108–9, 143–4 132–3 zymes effect on 204–6
independent variables 5 initiation (translation) 70 lanes on a gel 181
index case 496 insertion mutations 94, 98 Law of Independent Assortment 108
indirect transmission 432, 433–4 interconnecting neurons 334, 336 Law of Random Segregation 109
9780170452922
516 INDEX
Leadbeater’s possum 319–20 mutation 293–5 monitoring endangered species

leading strand 61, 62, 63 natural selection 296–304 224, 226–7
leaves mechanisms of speciation 311–13 monohybrid cross
cross-section 387 post-reproductive isolating genotype ratio 133
homologous structures 270–1, 272 mechanisms (post-zygotic) 313 inheritance of a single autosomal gene
legless lizards 257, 258 pre-reproductive isolating 130–3, 135
life cycle of pathogens 431–2 mechanisms (pre-zygotic) 312–13 phenotype ratio 130, 133
disruption 478–80 reproductive isolating mechanisms 311 segregation of chromosomes 132
general life cycle 431–2 mechanoreceptors 332 solving 132–3
pathogenic bacteria 440–4 median 10 monoploidy (1n) 101–2
pathogenic fungi 445–6 medications against infectious diseases monosomy 103–4
pathogenic protists 446–50 455, 456, 481–3 morphological species concept 310, 311
pathogenic viruses 435–40 meerkats 354 mosquito-borne diseases 433, 434,
RNA viruses 483 meiosis 26, 31, 94 436–7, 446, 479
ligation 196 comparison with mitosis 42 and climate change 454–5
light, and transpiration 388 in eukaryotic cells 39–42 mosquito nets 485
line graphs 12 and independent assortment 107, motor neurons 334, 335, 336
linear DNA 55 108–9, 143–4 mRNA (messenger RNA) 64, 65, 66, 71
linkage mapping 190, 191 inputs and outputs 43 synthesis 68
linked genes 151 and monohybrid cross 130 mRNA codons 64–6, 68, 70, 74
living things change and diversify mutations during 94 mRNA nucleotides 70
248–9 phases 39, 40–1 mRNA splicing 67
living vectors 433 meiosis I 40, 41 mucous membranes 431
lizards, thermoregulation 352, 353, 359 meiosis II 40, 42 multimedia presentations 17
locus 29 membrane-bound organelles 27, 66 multiple alleles for one gene 137–8
logbook 3 Mendel, Gregor, pea experiments 60, 124 mutagens 91, 93, 95–7
loop of Henle 378, 380 applying today’s knowledge to biological agents 45–6, 96–7
lyrebirds 304 129–30, 131 chemical 96
lysis 410, 447 dihybrid cross 138–40 physical 95–6, 111–13
plant characteristics studied 125 mutant phenotype 92
M Punnet square results applied to 128–9 mutation rate 93, 259, 293
macro-evolution 309 pure-breeding crosses and conclu- mutation studies 93–4
processes working towards 310–11 sions 126–8 mutations
macrophages 417, 441 meningococcal C, rate of infection after causes of cell division errors 94
malaria 421, 446–7, 470, 479 introduction of the vaccine 477 DNA replication errors 93–4
chemoprophylaxis 480 merozoites 446 mutagens 95–7
management, prevention and control metabolic rate, and environmental tem- causing variation 87, 91–107, 293–5
489 perature (mammals) 360–1 chromosomal 101–7
transmission 434, 446, 447, 454, 455 metabolism 332, 347 effect on survival 99–100
vaccine 480 metaphase 34, 35 and genetic variation 101–7
mammals metaphase I 40 in germline cells 91, 92
nitrogenous waste 376 independent assortment 41, 108, 143 as mechanism for evolution 293–5
water balance 380, 384, 385 metaphase II 40 and phenotype 87, 88
management strategies (disease) 470 microarrays 184–5 point 97–9, 100, 107
mangroves 393 micro-evolution 309, 310 in somatic cells 91
marine bony fish, water balance 381, micro-organisms 407, 409 mya (millions of years ago) 250
382, 384 micropipettes 177 mycelial threads 449
marine life, oxygen levels 341–2 migrations 226, 308 mycelium 419
marker-assisted breeding 216 million, what it looks like 423 Mycobacterium tuberculosis 417, 418,
marking DNA 173–4 mineralisation 262 431, 440–2, 485, 487
marsupial genomes 37 missense mutations 98, 99, 100 myelin sheath 334
marsupial moles 276 mitochondrial DNA 55, 56 myrtle rust 474
marsupials mitosis 26, 31
adaptive radiation 276, 277 comparison with meiosis 42 N
as reservoir for Ross River virus 437 in eukaryotic cells 33–5, 36 National Notifiable Diseases
mass extinctions 316, 362 mutations 94 Surveillance System 472
maternal chromosomes 29, 39, 41 phases of 34–5 National Sentinel Hive Program 493
mature mRNA 67, 69 modelling disease spread 497, 499 national surveillance of diseases 495–6
mean 10 models 2 natural selection 225
measles outbreaks 453, 496 modulator 338, 339, 373 and adaptive evolution 297–9
measurement error 14 molecular homologies 254, 257 with brine shrimp 321–3
mechanisms for evolution 293–308 molecular phylogeny 257 and horizontal gene transfer 456–7
gene flow 307–8 molecular size markers 175, 181–2 impact on allele frequency 297, 298, 299
genetic drift 305–7 monitoring disease activity 495–8 as mechanism for evolution 296–304
9780170452922
INDEX 517
principles of 297–9 nucleolus 34 pathogen management strategies, rea-

sexual selection 303–4 nucleotide-pair insertion or deletion 100 sons for 470–2
theory of evolution by 249–50, 296 nucleotide-pair substitution 100 pathogen population, growth of, and
vs selective breeding 302 nucleotides 26, 53, 56–7 spread of disease 451
see also artificial selection 5’ to 3’ (direction of synthesis) 57, 61, pathogenic bacteria, life cycle 440–4
natural theology 249 62, 67, 68, 173 pathogenic fungi, life cycle 445–6
negative feedback 338–9, 347 coding DNA 64–5 pathogenic protists, life cycle 446–50
for body temperature regulation in nucleus 27, 54 pathogenic viruses, life cycle 435–40
mammals 340 numbats 278 pathogenicity 409
flow diagram 339 pathogens 407, 409
for high and low water content in O cellular 413–22
blood 385 obligate parasites 410 effectiveness of anti-microbials on 424
for physiological response to de- Okazaki fragments 61, 62 factors affecting spread 450–8
creased external environmental omega-3 oils, long-chain, in grains 223 and fomites 423–4, 433, 434
temperature 360 opalised fossils 263 hosts for 431, 432
for physiological response to in- optimal range 341, 342 impact on the host 432
creased external environmental oral presentations 17 and individual susceptibility or resis-
temperature 355 organelles 27, 66 tance to 409
for water balance 378, 379 osmoconformers 379 life cycles 431–2, 435–50
neo-Darwinism 309 water balance 379, 382–3 disruption 478–80
nephrons 374 osmoreceptors 333, 373 non-cellular 410–13
nerve fibres 334 osmoregulation 373, 374 portals of entry and exit 431, 432
nerve impulses 334 adaptations for 379–85 strategies that control spread of
nervous system 334–6 and communication 383 472–94
neurons 334–5 in different organisms 384–5 transmission 408, 409–10, 431–5
and optimal salt levels 345 kidneys role 374, 377–9 types of 407
structure 336 in plants 385–8 see also bacteria; fungi; protists;
neutral mutations 99 see also water balance viruses
next-generation sequencing (NGS) 186, osmoregulators 379–80 patient zero 496
188–9 behaviours for retaining water: aesti- PCR (polymerase chain reaction) 169
steps involved 188 vation and burrowing 382 for amplifying DNA 178–80
to study ecosystem biodiversity 188–9 physiological processes to maintain biotechnology applications 229, 230
nitrogenous bases water balance 380–2 steps involved 178–9, 180
DNA 26, 53, 56, 57, 58, 66 structural features to maintain water pea plants
physical mutagen effects 95 balance 380 alleles for tallness and shortness
RNA 65, 66 osmosis 343, 345, 373, 374, 387, 396 129–30
nitrogenous wastes osmotic pressure 333 and Mendel’s experiments 124, 125,
removal of 342, 374, 375–6 outbreaks of disease 408, 436, 470 126–8
tolerance range 342–3, 344 managing 499–500 monohybrid cross 130, 131
types of and where they occur 375–6 solving 497 pedigree symbols 152
in vertebrate groups 376 steps involved in investigating 496 pedigrees
node (phylogenetic tree) 257 outcrossing 233 for autosomal dominant patterns 153,
non-cellular pathogens 410–13 outliers 12 156
non-coding DNA 60, 64, 65 overproduction 296, 297 for autosomal recessive patterns 152,
non-coding strand 66 oxygen levels 156
non-homologous chromosomes 144 for marine life 341–2 key to determine likely mode of inher-
non-sister chromatids 39, 94 tolerance range 344, 347 itance 156
non-template strand 66 for X-linked dominant pattern 156
nonsense mutations 98, 99, 100 P for X-linked recessive pattern 154–5,
Northern Australia Quarantine pain receptors 332 156
Strategy 473 palaeontology 262 penguins, thermoregulation 358, 359
northern elephant seals 306 pandemics 408, 442, 454, 457, 473, penicillins 481
northern quolls, monitoring 227 490–3 pentadactyl limb, homologous structures
notifiable diseases 472 pangolins 278 271, 281–2
monitoring activity 495–8 panting 355 peppered moth (Biston betularia)
Notofagus (southern beech trees) 253 parasitic protists 421–2 293–4
nuclear membrane 54 parent cells 31, 39 peptide bonds 66
nuclear pores 65, 70 parent DNA strand 61 peptidoglycan 414, 481
nuclear radiation 95 parental generation (P) 127 periods 250
nuclear transfer 237–8 parthenogenesis 102 peripheral nervous system (PNS) 334,
nucleic acids 65 partial dominance 148 335
in viruses 410, 411 passive immunity 475 persistence (of a pathogen) 478
see also DNA; RNA paternal chromosomes 29, 39, 41 pesticide-resistant species, rapid evolu-
nucleoid 29, 54 paternity testing 194 tion of 233–4
9780170452922
518 INDEX
pH 332, 343–4 Phytophthora dieback 318, 319, 421, practice exam questions 51, 84, 121–2,
factors altering 347 434, 448–9 166–7, 213–14, 245–6, 290–1, 328–9,
levels, carbon dioxide effects 347 management, prevention and control 370–1, 429, 468, 508–10
tolerance range 342–3, 344, 347 489–90 pre-mRNA 67, 69
phagocytes 441 as massive problem in WA 448, 449–50 pre-reproductive isolating mechanisms
phagocytosis 417 piloerection 358, 361 (pre-zygotic) 312–13
phenotype ratios 129, 136, 138 pilorelaxation 355, 361 prevention of disease 470
dihybrid cross 140–1, 143 pituitary gland 336 primary data 5
monohybrid cross 130, 133 plagiarism 3 primary structure (proteins) 73
phenotypes 86, 87 planning (investigations) 5–8 primers 62, 170, 173–4, 179
different types of dominance plant breeding 300–2 procedure 8–9, 15
relationship 150 plant cells programmed cell death 44, 74, 91
for Duchenne muscular cytokinesis 35 prokaryotic cells
dystrophy 154 water balance 343, 345 binary fission 38
environmental factors influencing plants chromosomes 29–30, 38, 42
88–91 control of heat exchange 349 differences from eukaryotic cells 30
epigenetics affect on 90 gas exchange 389–90 DNA in 29, 30, 38, 54
and expression of alleles 125, 126 specialist, adaptations for regulation structural similarities and differences
for human blood groups 137–8 of water, salts and gases 388–95 to eukaryotic cells 54
influenced by genotype 87, 88 thermoregulation 349, 352 transcription and translation 66
known, predicting the genotype transport and transpiration leading to viral replication in 412
through a test cross 134–7 water loss 385–8 see also bacteria; protists
mechanisms influencing 87, 88 water transport 385–9 promoter 67
of pea plants (Mendel’s experiments) plasmid DNA 196, 197 prophase 34, 35
125, 126–7 plasmid vectors 197 prophase I 40, 41
and polygenic inheritance 146–7 plasmids 29, 66, 96, 169, 176, 195, prophase II 40, 42
predicting using Punnett squares 196, 414 protein conservation and comparative
131, 132–3 Plasmodium 421, 433, 446 biochemistry 259–60
sex-linked inheritance 153–7 life cycle 446–7, 478 protein synthesis 64, 65–9, 74
phenotypic expression of genes control strategies 478–9, 480, 489 materials required 65
86–8 Plasmodium falciparum 421, 446 transcription and translation in
phenotypic variation 86, 87–8 map showing the predicted changes prokaryotes 66
phloem 386 in distribution by 2050 480 transcription in eukaryotes
phosphate group 56 plasmolysis 343 66–9
phosphodiester bonds 56, 59 platypus translation in eukaryotes 70–3
photoreceptors 332, 333 monitoring 227 proteins 54, 70, 74–7
phototropism 337 in opalised fossil 263 structure 73
phylogenetic trees 256–9 pneumatophores 393 protists 407, 420
drawing 258–9 point mutations 93, 97–9, 100, 107 diseases caused by 421–2
relationships between parts 257 polar bears, thermoregulation 357, 358 pathogenic, life cycle 446–50
vocabulary 257 pollutants, bioremediation 231 structural features and
phylogeny 250 polygenes 146 reproduction 421
physical mapping 190 polygenic inheritance 146–7 protozoa 421
physical mutagens 95–6, 111–13 polymerase chain reaction see PCR public health, and genetically
physical preventive measures against polypeptides 58, 66, 70, 72–3 engineered foods 236
diseases 484–5 polyploidy 102, 313 punctuated equilibrium 266
physiological adaptations poor living conditions, and spread of Punnett squares 126
of halophytes 392–3, 395 disease 457–8 constructing 128–9
to thermoregulation in cold population density, and spread of dihybrid cross 140, 141
environments 359–61 disease 451–2, 457 monohybrid cross 131, 132–3
to thermoregulation in hot population dynamics 226 multiple alleles for one gene 137
environments 355–7, 361 populations, variation in 294 sex-linked inheritance 154
of xerophytes 391, 394 pork industry, DNA identification tech- pure-breeding 126–7
physiological processes nologies use 217 monohybrid cross 130–3
and homeostasis 347–8 pork products, ASF virus fragments in
to maintain water balance 230 Q
( osmoregulators) 380–2 portal of entry (for pathogen) 431, 432 qualitative measurements 6
physiological stress 342 portal of exit (for pathogen) 431, 432 quantitative measurements 5
Phytophthora 421 positive feedback 338, 339 quarantine 470, 473–4
life cycle 448 harmfulness of 339 biotechnology use 224, 229–30
Phytophthora cinnamomi 421, 422, post-reproductive isolating mechanisms Quarantine WA, biosecurity inspection
448, 449 (post-zygotic) 313 services 474
transmission 449, 450 posters 17 quaternary structure (proteins) 73
9780170452922
INDEX 519
R RNA nucleotide code 65 shivering 360, 361

RNA polymerase 66, 67, 68 short tandem repeats (STRs) 177, 193, 216
radiation 352
RNA primase 62 shorthorn cattle coat colour, codomi-
radiometric dating 267–8
RNA viruses 410, 411, 435, 436, 490 nance 149
random assortment 108, 109
life cycle 483 signs of disease 407, 409, 432, 470
random fertilisation 109
root (phylogenetic tree) 257 silent mutation 98, 100
reabsorption 374, 378
root pressure 386 single nucleotide polymorphisms
receptors 332–3, 338, 411
roots (plants) 385, 386 (SNPs) 98
recessive allele 92, 125, 126, 128, 129
Ross River virus disease 408, 412, 413 single-stranded breaks (DNA) 96
recessive mutations 92
life cycle 436–7 sister chromatids 33
recessive trait 130
management, prevention and skin, as barrier to pathogens 431
recognition sites 170
control 486 smallpox 471
recombinant chromosomes 108
outbreaks in Australia 436 snakes 257, 258
recombinant DNA technology 169,
transmission 434, 436–7, 454 snapdragons flower colour, incomplete
195–8
Roundup Ready crops 219, 233–4 dominance 148
in agriculture 218–24
rRNA (ribosomal RNA) 70 sneeze and cough into elbow 484
in environmental conservation 231
rust resistance, in wheat 216, 217, 219 Soay rams, sexual selection 303–4
recombinant plasmid 196
sodium ions 343, 346
recombining DNA 172–3 S soilborne transmission 434, 449
red blood cells, water content tolerance
sacbrood disease 438, 486 solute 373
345
safe use and disposal of biological solvent 343, 373
references 16
materials 7 somatic cells 28
refinement alternatives (animals) 7
salt balance, in animals 343, 346, 383 mutation effects 91
relative dating 266–7
salt bladders 393 soybeans, Roundup Ready tolerance 219
reliability 13
salt-tolerant plants, adaptations for specialist plants, adaptations for regula-
reliable data 13
regulation of water, salts and gases tion of water, salts and gases 388–95
replacement alternatives (animals) 7
388–9, 391–3, 395 speciation 276, 309–15
replication fork 61, 62
salt-tolerant wheat and barley 222 allopatric 313–15
report writing 15–16
salts, regulation in plants 385 mechanisms of 311–13
reproductive behaviour 226
Sanger sequencing method 186–7 sympatric 316
reproductive isolation 311, 313
sanitation 484 species 87, 248, 257
reproductive rate, higher 299
SARS-CoV-2 virus see COVID-19 species extinction 316–20
research question
scientific method 2–14 due to changes in climate, sea level
hypothesis 4–5
sea level changes 252 and atmospheric oxygen 252–3
researching and refining 3–4
second filial generation (F2 ) 127, spinal cord 334, 335
reservoirs 431, 451
128, 130 spindle fibres 33
direct transmission from 433, 434
secondary data 5 spirilla 415
resistance to a pathogen 409
secondary structure (proteins) 73 spontaneous mutations 91, 93
response 338
selection pressures 293, 296, 298 sporangia (sporangium) 419, 449
coordinating a (homeostasis) 332,
selective breeding 151, 169, 299–302 spores (bacteria) 414, 415, 417, 442, 443
334–7
vs natural selection 302 spores (fungi) 419, 445, 446
restriction digestion enzymes, effect on
semi-conservative replication 60 spores (protists) 421, 450
Lamda DNA 204–6
sense strand 66 sporozoites 421, 446
restriction endonucleases 171
sensory neurons 334, 335, 336 spread of a disease
restriction enzymes 169, 170, 171–2,
sentience 8 factors affecting 450–8, 478
176, 196
set point (for temperature) 339 predicting using models 497, 499
producing blunt ends and sticky ends
severe acute respiratory syndrome strategies that control 472–95
172
(SARS) 457 start codon (AUG) 65, 70, 71
and restriction sites 171
sex cells 39, 43 stem cell research 238–9
restriction fragments 171
mutations in 92 sticky ends 170, 171, 172
restriction sites 171
sex chromosomes 29, 43–4, 126, 153 stimulus 338
results
monosomy in 103–4 stimulus–response model of homeosta-
analysing the data 10–13, 16
trisomy in 104 sis 332, 338
communicating 15–17
sex-linked 126 coordinating the response 332, 334–7
discussion of 13–15, 16
sex-linked inheritance 153–7 detecting the stimulus 332–4
interpreting the 14
Punnett squares to predict 154 stomata (stoma) 385, 387
recording the data 9–10
sex-linked trait 16 STOP codon 65, 70
ribose sugar 57
sexual dimorphism 303 stratum (strata) 264
ribosomes 64, 66, 70, 71, 481
sexual reproduction 26, 43 strawberry DNA extraction 78–9
rice, transgenic 220–1
increasing variation 87, 107–10 structural adaptations
risk assessment 6–7
and phenotype 87, 88 of halophytes 392–3, 395
RNA (ribonucleic acid) 57
sexual selection 303–4 and homeostasis 348
nitrogenous bases 65, 66
sheep breeding 151, 300 of xerophytes 391, 394
9780170452922
520 INDEX
structural features theories 2 transmission of pathogens 408, 409–10,

for thermoregulation in cold theory of evolution 293 431–5
environments 357–9 by natural selection 249–50, 296 direct transmission 432, 433, 434
for thermoregulation in hot evidence for 250, 253–75 indirect transmission 432, 433–4
environments 353 thermal cyclers 178, 179 modes of transmission 432–5
to maintain water balance thermoreceptors 332, 333, 348 and spread 452
( osmoregulators) 380 thermoregulation 340, 348, 349–50 transpiration 385–8
substitution mutations 93, 97–8, adaptations for 351–63 factors increasing rate of 388
99, 100 in animals 350–1, 353–63, 397–9 importance of 387–8
substrates 343, 348 in cold environments 357–62 transpiration pull 386
sugar–phosphate backbone 58, 59 in hot environments 352–7 transpiration stream 386
sulfur mustard 96 in mammals 340, 348 treatment (for disease) 470, 471
superb fairy-wren (Malurus cyaneus) in plants 349, 352 Tree of Life project 309
194 thorny devil 298 1,2,3-trichloropropane (TCP) 231
superweeds 233, 234, 236 thresholds for disease spread 450 triplets 64–5, 68, 70
surface-area-to-volume ratio 353, 359 thymine 53, 56, 57, 58, 65, 66 trisomy 103, 104
surgical masks 485 Ti plasmid 96, 218 tRNA (transfer RNA) 65, 66, 70, 71–2
survival of the fittest 298 tip (phylogenetic tree) 257 tubercle 440
susceptibility to a pathogen 409 tolerance limits/ranges 341–8 tuberculosis (TB) 407, 417, 418, 431,
susceptible host 431 adaptations maintain an organism’s 440–2, 470
sweat glands 340, 348, 355, 361 internal environment within 347–8 antibiotic treatment 482
sweating 355, 361 effects of moving outside 342–7 deaths 441, 442
sympatric speciation 316 torpor 361 life cycle 441
symptoms of disease 407, 409, 432, 470 tortoises 310 management, prevention and
synapsis 39 toxins 417, 442 control 487
synonymous mutations 98 traits 26, 58, 86, 124, 249 persistence 471
systematic error 14 accumulation of 296 spread 451–2, 485
advantageous 298 transmission 434, 440–1
T transcription 64, 65 turgidity (cells) 373, 387
taq polymerase 178, 179, 180 in eukaryotes 66–9 turgor 387, 389–90
Tasmanian devil (Sarcophilus harrisii) point mutation effects 100 Turner syndrome 103–4
228, 298 process of 70–3 turtles, nitrogenous waste 376
breeding program 228–9 in prokaryotes 66
common ancestor 276 transformation 218 U
devil facial tumour disease 45–6, of bacteria and gene expression 196 ultraviolet light (UV light) 95
103, 228 transgenic organisms 195–8, 218–24 effect on Saccharomyces cerevisiae
genetic diversity 228–9 arguments for and against 235–6 111–13
insurance population on Maria effects on non-target organisms 233 unbound circular DNA 54, 55
Island 229 emergence of superweeds 234 unicellular organisms 414, 420
taxon (taxa) 254, 257 engineered for resistance 218–20 uracil 65, 66
telophase 34, 35 ethical issues 232–6 urbanisation, and spread of disease
telophase I 40, 41 for faster growth rate 220 451–2, 457
telophase II 40, 42 for greater product quality and yield urea 342, 375, 376, 377
temperature 220–1 uric acid 342, 375, 376
humans responses to increased tem- and more rapid evolution of urine concentration, variation between
perature 333–4, 362–3 pesticide-resistant species 233–4 animals and their environment 377
regulation see thermoregulation reduction of genetic diversity in GM
tolerance range 333–4, 342, 344 crop plants 235 V
and transpiration in plants 388 techniques used to create 196–7 vaccination 470, 475
temperature gradient 352 tolerance to adverse environmental vaccines 470, 475, 480
template strand (DNA) 59, 66, 67 conditions 221–2 COVID-19 3, 4, 492
termination (translation) 70 transgenic animals 220, 224 influenza 483
terror bird (Gastornis) 273 transitional forms and the pace of validity 13
tertiary structure (proteins) 73 evolution 264–6 variable nucleotide tandem repeats
test cross 126, 134–7 Archaeopteryx 264 (VNTRs) 193
fur colour in guinea pigs 136–7 horse 264–6 variable traits 309
wing length in fruit flies 135–6 translation 64, 66 variables 4, 5, 6
tetanus 407, 417, 431, 442–3 in eukaryotes 70–3 variation 86, 88
life cycle 442, 443 point mutation effects 100 in different species 88
management, prevention and in prokaryotes 66 environmental factor effects 88–91, 97
control 487 translocations (chromosomal genetic 86, 101–7, 228
transmission 434, 443 mutation) 106 in Gouldian finch 86–7
9780170452922

Biology WA ATAR Units 3 & 4 Student Book With 1 X 26 Month NelsonNetBook Access Code

Uploaded by

Copyright:

Available Formats

Biology WA ATAR Units 3 & 4 Student Book With 1 X 26 Month NelsonNetBook Access Code

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Biology WA ATAR Units 3 & 4 Student Book With 1 X 26 Month NelsonNetBook Access Code

Uploaded by

Copyright:

Available Formats

nehs xaM/segamI ytteG

Mya Skirving Copyright Notice

National Library of Australia Cataloguing-in-Publication Data

Cengage Learning Australia

South Melbourne, Victoria Australia 3205

Cengage Learning New Zealand

For learning solutions, visit cengage.com.au

Printed in Singapore by 1010 Printing International Limited.

Author and reviewer team vi Chapter summary 80

Acknowledgements vii Chapter glossary 80

Using Biology WA ATAR vii Chapter review questions 83

Practice exam questions 84

UNIT 3 4 VARIATION AND MUTATION 85

4.2 Environmental factors 88

1.3 Communicating your results 15 4.5 Causes of mutations: mutagens 95

Chapter summary 18 4.6 Types of mutations 97

Chapter glossary 18 4.7 Sexual reproduction increases

Activity 45 5.1 Genetics introduction 124

Chapter summary 47 5.2 Genetics today 129

Chapter glossary 47 5.3 The test cross 134

Practice exam questions 51 5.5 The dihybrid cross 138

5.6 Polygenic inheritance 146

3.1 The discovery of DNA 53 5.8 Modes of inheritance 152

3.3 DNA structure enables DNA replication 60 Chapter summary 162

3.4 Coding and non-coding DNA 63 Chapter glossary 162

3.5 Protein synthesis 65 Chapter review questions 164

3.6 Proteins 74 Practice exam questions 166

8.5 Evidence for the theory of evolution:

Chapter glossary 207 9 MECHANISMS OF EVOLUTION AND

9.2 A mechanism for evolution: mutation 293

7 BIOTECHNOLOGY IN AGRICULTURE 9.3 A mechanism for evolution:

9.4 A mechanism for evolution:

7.3 DNA technologies 9.7 Speciation 310

Chapter review questions 244

Practice exam questions 245 UNIT 4

10.3 Tolerance limits 341 Chapter summary 425

10.4 Thermoregulation 349 Chapter glossary 425

10.5 Adaptations for thermoregulation 351 Chapter review questions 427

Activity 364 Practice exam questions 429

Chapter summary 365

Practice exam questions 370 13.2 Modes of transmission 432

13.3 Pathogen life cycles for some

11.1 Water: essential to life 373 Investigation 459

11.2 Nitrogenous wastes 375 Chapter summary 462

11.3 Kidneys maintain water balance 377 Chapter glossary 464

11.5 Water transport in plants 385 Practice exam questions 468

11.6 Specialist plant adaptations for

Investigation 397 14.1 Why do we need pathogen

Chapter summary 400 management strategies? 470

Chapter glossary 400 14.2 Strategies that control the

12 INFECTIOUS DISEASES 406 Chapter summary 505

Chapter glossary 505

Activity and investigations 423 Index 510

FOREWORD BY LYN BEAZLEY

Lyn Beazley AO, FAA, FTSE

AUTHOR AND REVIEWER TEAM

USING BIOLOGY WA ATAR

Each chapter begins with a chapter opening page

that will be covered in the chapter. This gives