United States Patent (19) 11 Patent Number: 4,683,195

Mullis et al. (45) Date of Patent: Jul. 28, 1987

54 PROCESS FOR AMPLIFYING, DETECTING, plex and Evidence for Two SB Beta-chain Genes",
AND/OR-CLONING NUCLEIC ACID Proc. Natl. Acad. Sci. USA 81: 3934 (1984).
SEQUENCES Boss et al., "Cloning and Sequence Analysis of the
Human Major Histocompatibility Complex Gene DC
75) Inventors: Kary B. Mullis, Kensington; Henry 3beta", Proc. Nat. Acad. Sci. USA 81: 5199 (1984).
A. Erlich, Oakland; Norman Okada et al, "Gene Organization of DC and DX Subre
Arnheim, Woodland Hills; Glenn T. gions of the Human Major Histocompatibility Com
Horn, Emeryville; Randall K. Saiki,
Richmond; Stephen J. Scharf, plex", Proc. Natl. Acad. Sci. USA 82: 3410 (1985).
Berkeley, all of Calif. Salser, "Cloning cDNA sequences: A general Tech
nique for Propagating Eukaryotic Gene Sequences in
73 Assignee: Cetus Corporation, Emeryville, Calif. Bacterial Cells", in Genetic Engineering, 1978, Char
* Notice: The portion of the term of this patent rabarty (ed.), CRC Press, Inc. Boca Raton, Fla., pp.
subsequent to Jul. 28, 2004 has been 53-81.
disclaimed. Gaubatz et al, "Strategies for Constructing Comple
21 Appl. No.: 828,144 mentary DNA for Cloning", J. Theor. Biol. 95: 679
(1982).
22 Filed: Feb. 7, 1986 Rossi et al., J. Biol. Chem., 257, 9226-9229 (1982).
Related U.S. Application Data Primary Examiner-James Martinell
Attorney, Agent, or Firm-Janet E. Hasak; Albert P.
60 Continuation-in-part of Ser. No. 824,044, Jan. 30, 1986, Halluin
abandoned, which is a division of Ser. No. 791,308,
Oct. 25, 1985, which is a continuation-in-part of Ser. 57 ABSTRACT
No. 716,975, Mar. 28, 1985, abandoned. The present invention is directed to a process for ampli
51 Int. Cl." ........................ C12Q 1/68; C12P 19/34; fying and detecting any target nucleic acid sequence
C12N 1/00; C12N 15/00; G01N 33/48; G01N contained in a nucleic acid or mixture thereof. The
33/00; G01N 33/566; G01N 33/564; CO7H process comprises treating separate complementary
21/02; CO7H 21/04 strands of the nucleic acid with a molar excess of two
52 U.S. C. .......................................... 435/6; 435/91; oligonucleotide primers, extending the primers to form
435/172.3; 435/317; 436/63; 436/94; 436/501; complementary primer extension products which act as
436/508; 536/27; 536/28; 536/29; 935/17; templates for synthesizing the desired nucleic acid se
935/18; 935/76, 935/77; 935/78 quence, and detecting the sequence so amplified. The
58 Field of Search ...................... 435/91, 172.3, 317, steps of the reaction may be carried out stepwise or
435/6; 536/27, 28, 29; 935/17, 18, 78, 77, 76; simultaneously and can be repeated as often as desired.
436/63, 94, 501, 508
In addition, a specific nucleic acid sequence may be
56) References Cited cloned into a vector by using primers to amplify the
U.S. PATENT DOCUMENTS. sequence, which contain restriction sites on their non
4,395,486 7/1983 Wilson et al. ........................... 435/6 complementary ends, and a nucleic acid fragment may
be prepared from an existing shorter fragment using the
OTHER PUBLICATIONS amplification process.
Gorski et al, "Molecular organization of the HLA-SB
Region of the Human Major Histocompatibility Com 26 Claims, 12 Drawing Figures
U.S. Patent Jul. 28, 1987 Sheet 1 of 12 4,683,195

FIG.
Double-Stranded 94-bp Sequence

TTTGC TTCTGACACA ACTGTGTTCA CTAGCAACCT -o-

AAACG AAGACTGGT TGACACAAGT GATCGTTGGA

NCOI Hinf MSt II

V V V
CAAACAGACA CCATGGTGCA CCTGACTCCT GAGGAGAAGT -p
GTTTGTCTGT GGTACCACGT GGACTGAGGA ccTCTCA
All elic base
pair DNA
polymorphism

CTGCCGTTAC TGCCCTGTG
GACGGCAATG ACGGGACAC
U.S. Patent Jul. 28, 1987 Sheet 2 of 12 4,683,195

188
181
saf 4.

78
62

45

FIG.2
U.S. Patent Jul. 28, 1987 Sheet 3 of 12 4,683,195

141 Nep

78

62

48
45

FIG.3
U.S. Patent Jul. 28, 1987 Sheet 4 of 12 4,683,195

SETOW

1op.0&3s%o 11§395§)

0
U.S. Patent Jul. 28, 1987 Sheet 7 of 12 4,683,195

78

62

48
45

FIG.5
U.S. Patent Jul. 28, 1987 Sheet 8 of 12 4,683,195

FIG.6

BA CATGGTGCACCTGACCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAA
GTACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCCGTTCCACT

BS CATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAA
GTACCACGTGGACTGAGGACACCTCTTCAGACGGCAATGACGGGACACCCCGTTCCACTT

* Marks the mutation (A to T) in the sickle cell gene which disrupts

the Dode I Site
U.S. Patent Jul. 28, 1987 Sheet 9 of 12 4,683,195

GACTCCTGAG
-CTGAGGACTC

denature
anneal to probe

*-GACTCCTGAG-probe
CTGAGGACTC

digest with Dde I

(8-mer) *-GACTCC TGAG

CTGAGGACT C

digest with Hinf I

*-GACTCC
TGAG
CTGAGGACT C

is label FG.7
U.S. Patent Jul. 28, 1987 Sheet 10 of 12 4,683,195

GACTCCTGTGall
CTGAGGACAC-8s
denature
anneal to probe

A
*-GACTCCTG G-probe
CTGAGGAC C
A

digest with Dde I

A
*-GACTCCTG G
CTGAGGAC C
A

digest with HinfI

A
(3-mer) *-G ACTCCTG G
-CTGA GGAC C
it is label FIG.8 A
U.S. Patent Jul. 28, 1987 Sheet 11 of 12 4,683,195

A B C D

8-MER

3-MER

FIG.9
U.S. Patent Jul. 28, 1987 Sheet 12 Of R2 4,683,195

(O
 4,683, 195 2
laborious and time-consuming, require expensive equip
PROCESS FOR AMPLIFYING, DETECTING, ment and reagents, and have a low overall efficiency.
AND/OR-CLONING NUCLEIC ACID SEQUENCES The low overall efficiency may be caused by the ineffi
ciencies of the synthesis of the oligonucleotides and of
BACKGROUND OF THE INVENTION 5 the joining reactions. In the synthesis of a long nucleic
This application is a continuation-in-part application acid, or even in the synthesis of a large amount of a
of copending U.S. Ser. No. 824,044 filed Jan. 30, 1986, shorter nucleic acid, many oligonucleotides would need
now abandoned, which is a divisional application of to be synthesized and many joining reactions would be
copending U.S. Ser. No. 791,308 filed Oct. 25, 1985, required. Consequently, these methods would not be
10 practical for synthesizing large amounts of any desired
which is a continuation-in-part application of copending
U.S. application Ser. No. 716,975 filed Mar. 28, 1985, nucleic acid.
now abandoned. Methods also exist for producing nucleic acids in
FIELD OF THE INVENTION
large amounts from small amounts of the initial existing
nucleic acid. These methods involve the cloning of a
The present invention relates to a process for ampli nucleic acid in the appropriate host system, where the
fying existing nucleic acid sequences if they are present desired nucleic acid is inserted into an appropriate vec
in a test sample and detecting them if present by using a tor which is used to transform the host. When the host
probe. More specifically, it relates to a process for pro is cultured the vector is replicated, and hence more
ducing any particular nucleic acid sequence from a 20 copies of the desired nucleic acid are produced. For a
given sequence of DNA or RNA in amounts which are brief description of subcloning nucleic acid fragments,
large compared to the amount initially present so as to see Maniatis, T., et al., Molecular Cloning. A Laboratory
facilitate detection of the sequences. The DNA or RNA Manual, Cold Spring Harbor Laboratory, pp. 390-401
may be single- or double-stranded, and may be a rela (1982). See also the techniques described in U.S. Pat.
tively pure species or a component of a mixture of nu Nos. 4,416,988 and 4,403,036.
cleic acids. The process of the invention utilizes a repet A third method for synthesizing nucleic acids, de
itive reaction to accomplish the amplification of the scribed in U.S. Pat. No. 4,293,652, is a hybrid of the
desired nucleic acid sequence. above-described organic synthesis and molecular clon
DESCRIPTION OF RELATED DISCLOSURES ing methods. In this process, the appropriate number of
For diagnostic applications in particular, the target 30 oligonucleotides to make up the desired nucleic acid
nucleic acid sequence may be only a small portion of the sequence is organically synthesized and inserted sequen
DNA or RNA in question, so that it may be difficult to tially into a vector which is amplified by growth prior
detect its presence using nonisotopically labeled or to each succeeding insertion.
end-labeled oligonucleotide probes. Much effort is The present invention bears some similarity to the
being expended in increasing the sensitivity of the probe 35 molecular cloning method; however, it does not involve
detection systems, but little research has been con the propagation of any organism and thereby avoids the
ducted on amplifying the target sequence so that it is possible hazards or inconvenience which this entails.
present in quantities sufficient to be readily detectable The present invention also does not require synthesis of
using currently available methods. nucleic acid sequences unrelated to the desired se
Several methods have been described in the literature 40 quence, and thereby the present invention obviates the
for the synthesis of nucleic acids de novo or from an need for extensive purification of the product from a
existing sequence. These methods are capable of pro complicated biological mixture.
ducing large amounts of a given nucleic acid of com SUMMARY OF THE INVENTION
pletely specified sequence.
One known method for synthesizing nucleic acids de 45 The present invention resides in a process for ampli
novo involves the organic synthesis of a nucleic acid fying one or more specific nucleic acid sequences pres
from nucleoside derivatives. This synthesis may be per ent in a nucleic acid or mixture thereof using primers
formed in solution or on a solid support. One type of and agents for polymerization and then detecting the
organic synthesis is the phosphotriester method, which amplified sequence. The extension product of one
has been utilized to prepare gene fragments or short 50 primer when hybridized to the other becomes a tem
genes. In the phosphotriester method, oligonucleotides plate for the production of the desired specific nucleic
are prepared which can then be joined together to form acid sequence, and vice versa, and the process is re
longer nucleic acids. For a description of this method, peated as often as is necessary to produce the desired
see Narang, S.A., et al., Meth. Enzymol, 68,90 (1979) amount of the sequence. This method is expected to be
and U.S. Pat. No. 4,356,270. The patent describes the 55 more efficient than the methods described above for
synthesis and cloning of the somatostatin gene. producing large amounts of nucleic acid from a target
A second type of organic synthesis is the phosphodi sequence and to produce such nucleic acid in a compar
ester method, which has been utilized to prepare a atively short period of time. The present method is
tRNA gene. See Brown, E. L., et al., Meth. Enzymol, especially useful for amplifying rare species of nucleic
68, 109 (1979) for a description of this method. As in the 60 acid present in a mixture of nucleic acids for effective
phosphotriester method, the phosphodiester method
involves synthesis of oligonucleotides which are subse detection of such species.
quently joined together to form the desired nucleic More specifically, the present invention provides a
acid. process for detecting the presence or absence of at least
Although the above processes for de novo synthesis 65 one specific nucleic acid sequence in a sample contain
may be utilized to synthesize long strands of nucleic ing a nucleic acid or mixture of nucleic acids, or distin
acid, they are not very practical to use for the synthesis guishing between two different forms of sequences in
of large amounts of a nucleic acid. Both processes are said sample, wherein the sample is suspected of contain
 4,683,195
3 4
ing said sequence or sequences, which process com thesized from one primer, when it is separated from its
prises: complement, can serve as a template for synthesis of the
(a) treating the sample with one oligonucleotide extension product of the other primer, and wherein said
primer for each strand of each different specific se primer or primers each contain a restriction site on its 5'
quence suspected of being present in the sample, under 5 end which is the same as or different from the restric
hybridizing conditions such that for each strand of each tion site(s) on the other primer(s);
different sequence to be detected an extension product (b) separating the primer extension products from the
of each primer is synthesized which is complementary templates on which they were synthesized to produce
to each nucleic acid strand, wherein said primer or single-stranded molecules;
primers are selected so as to be substantially comple- 10 (c) treating the single-stranded molecules generated
mentary to each strand of each specific sequence such from step (b) with oligonucleotide primers such that a
that the extension product synthesized from one primer, primer extension product is synthesized using each of
when it is separated from its complement, can serve as
a template for synthesis of the extension product of the the single strands produced in step (b) as a template,
wherein depending on the particular sequence being
other primer; 15 amplified, steps (a) and (c) are carried out in the pres
(b) treating the sample under denaturing conditions to
separate the primer extension products from their tem ence of from 0 up to an effective amount of dimethyl
plates if the sequence or sequences to be detected are sulfoxide or at a temperature of up to about 45 C.;
(d) adding to the product of step (c) a restriction
present;
(c) treating the sample with oligonucleotides primers 20 enzyme for each of said restriction sites to obtain
such that a primer extension product is synthesized cleaved products in a restriction digest; and
using each of the single strands produced in step (b) as (e) ligating the cleaved product(s) into one or more
a template, resulting in amplification of the specific cloning vectors.
nucleic acid sequence or sequences if present; In yet another embodiment, the invention herein
(d) adding to the product of step (c) a labeled probe 25 relates to a process for synthesizing a nucleic acid frag
capable of hybridizing to said sequence being detected ment from an existing nucleic acid fragment having
or a mutation thereof; and fewer nucleotides than the fragment being synthesized
(e) determining whether said hybridization has oc and two oligonucleotide primers, wherein the nucleic
curred. acid being synthesized is comprised of a left segment, a
The steps (a)-(c) may be conducted sequentially or 30 core segment and a right segment, and wherein the core
simultaneously. In addition, steps (b) and (c) may be segment represents at least substantially the nucleotide
repeated until the desired level of sequence amplifica sequence of said existing nucleic acid fragment, and the
tion is obtained. right and left segments represent the sequence nucleo
In other embodiments the invention relates to diag tide present in the 5' ends of the two primers, the 3' ends
nostic kits for the detection of at least one specific nu- 35 of which are complementary or substantially comple
cleic acid sequence in a sample containing one or more mentary to the 3' ends of the single strands produced by
nucleic acids at least one of which nucleic acid is sus separating the strands of said existing nucleic acid frag
pected of containing said sequence, which kit com ment, which process comprises:
prises, in packaged form, a multicontainer unit having (a) treating the strands of said existing fragment with
(a) one container for each oligonucleotide primer for 40 two oligonucleotide primers under condition such that
each strand of each different sequence to be detected, an extension product of each primer is synthesized
which primer or primers are substantially complemen which is complementary to each nucleic acid strand,
tary to each strand of each specific nucleic acid se wherein said primers are selected so as to be substan
quence such that an extension product synthesized from tially complementary to the 3' end of each strand of said
one primer, when it is separated from its complement, 45 existing fragment such that the extension product syn
can serve as a template for the synthesis of the extension thesized from one primer, when it is separated from its
product of the other primer; complement, can serve as a template for synthesis of the
(b) a container containing an agent for polymeriza extension product of the other primer, and wherein
tion;
(c) a container for each of four different nucleoside 50 tides which contains,
each primer
are not
at its 5' end, a sequence of nucleo
complementary to said existing
triphosphates;
(d) a container containing a probe capable of detect fragment and which correspond to the two ends of the
nucleic acid fragment being synthesized;
ing the presence of said sequence in said sample; and (b) separating the primer extension products from the
(e) a container containing means for detecting hy templates on which they were synthesized to produce
brids of said probe and said sequence. 55
In yet another embodiment, the invention relates to a single-stranded
(c) treating
molecules;
the single-stranded molecules generated
process for cloning into a vector a specific nucleic acid
sequence contained in a nucleic acid or a mixture of from step (b) with the primers of step (a) under condi
nucleic acids, which process comprises: tions such that a primer extension product is synthesized
(a) treating the nucleic acid(s) with one oligonucleo- 60 using each of the single strands produced in step (b) as
tide primer for each strand of each different specific a template so as to produce two intermediate double
sequence being amplified, under conditions such that stranded nucleic acid molecules, into each of which has
for each strand of each different sequence being ampli been incorporated the nucleotide sequence present in
fied an extension product of each primer is synthesized the 5' end of one of the oligonucleotide primers, and
which is complementary to each nucleic acid strand, 65 two full-length double-stranded nucleic acid molecules,
wherein said primer or primers are selected so as to be into each of which has been incorporated the nucleotide
substantially complementary to each strand of each sequence present in the 5' ends of both of the oligonu
specific sequence such that the extension product syn cleotide primers;
 4,683,195 6
5
(d) repeating steps (b) and (c) for a sufficient number FIG. 7 illustrates the results of sequential digestion of
of times to produce the full-length double-stranded normal (3-globin using a 40-mer probe and Dde fol
molecule in an effective amount; lowed by Hinf restriction enzymes.
(e) treating the strands of the product of step (d) with FIG. 8 illustrates the results of sequential digestion of
two primers so as to lengthen the product of step (d) on 5 sickle (3-globin using the same 40-mer probe as in FIG.
both ends; and 7 and Ddel followed by Hinf restriction enzymes.
(f) repeating steps (a)-(d) using the product of step (d) FIG. 9 illustrates a photograph of an ethidium bro
as the core fragment and two oligonucleotide primers mide-stained polyacrylamide gel demonstrating the use
which are complementary or substantially complemen of the same 40-mer probe as in FIG. 7 to specifically
tary to the 3' ends of the single strands produced by O characterize the beta-globin alleles present in samples of
separating the strands of the product of step (d). whole human DNA which have been subjected to am
The core fragment may be obtained by the steps plification, hybridization with the probe, and sequential
comprising: digestion with Ddel and Hinfl.
(a) reacting two oligonucleotides, each of which con FIG. 10 illustrates a photograph of a 6% NuSieve
tain at their 3' ends a nucleotide sequence which is 15 agarose gel visualized using ethidium bromide and UV
complementary to the other oligonucleotide at its 3' light. This photograph demonstrates amplification of a
end, and which are non-complementary to each other at sub-fragment of a 1 10-bp amplification product which
their 5' ends, with an agent for polymerization and four sub-fragment is an inner nested set within the 10-bp
nucleoside triphosphates under conditions such that an fragment.
extension product of each oligonucleotide is synthe 20 DETAILED DESCRIPTION OF THE
sized which is complementary to each nucleic acid PREFERRED EMBODIMENTS
strand;
(b) separating the extension products from the tem The term "oligonucleotide" as used herein in refer
plates on which they were synthesized to produce sin ring to primers, probes, oligomer fragments to be de
gle-stranded molecules; and tected, oligomer controls and unlabeled blocking oligo
25
(c) treating the single-stranded molecules generated mers is defined as a molecule comprised of two or more
from step (b) with the oligonucleotides of step (a) under deoxyribonucleotides or ribonucleotides, preferably
conditions such that a primer extension product is syn more than three. Its exact size will depend on many
thesized using each of the single strands produced in factors, which in turn depend on the ultimate function
step (b) as a template, resulting in amplification of the 30 or use of the oligonucleotide.
core fragment. The term "primer' as used herein refers to an oligo
nucleotide whether occurring naturally as in a purified
BRIEF DESCRIPTION OF THE DRAWINGS restriction digest or produced synthetically, which is
FIG. 1 illustrates a 94 base pair length sequence of capable of acting as a point of initiation of synthesis
human (3-globin desired to be amplified. The single base 35 when placed under conditions in which synthesis of a
pair change which is associated with sickle cell anemia primer extension product which is complementary to a
is depicted beneath the 94-mer. nucleic acid strand is induced, i.e., in the presence of
FIG. 2 illustrates a photograph of an ethidium bro nucleotides and an agent for polymerization such as
mide-stained polyacrylamide gel demonstrating amplifi DNA polymerase and at a suitable temperature and pH.
cation of the 94-mer contained in human wild-type The primer is preferably single stranded for maximum
DNA and in a plasmid containing a 1.9 kb BamHI frag efficiency in amplification, but may alternatively be
ment of the normal g-globin gene (pBR328:HbA). double stranded. If double stranded, the primer is first
FIG. 3 illustrates a photograph of an ethidium bro treated to separate its strands before being used to pre
mide-stained polyacrylamide gel demonstrating amplifi pare extension products. Preferably, the primer is an
cation of any of the specific target 94-mer sequence 45 oligodeoxyribonucleotide. The primer must be suffi
present in pBR328:HbA, a plasmid containing a 1.9 kb ciently long to prime the synthesis of extension products
BamHI fragment of the sickle cell allele of 3-globin in the presence of the agent for polymerization. The
(pBR328:HbS), pBR328:HbA where the sequence to be exact lengths of the primers will depend on many fac
amplified is cleaved with MstII, and pBR328:HbS tors, including temperature and source of primer. For
where the sequence to be amplified has been treated but 50 example, depending on the complexity of the target
not cleaved with Mst. sequence, the oligonucleotide primer typically contains
FIG. 4 illustrates in detail the steps and products of 15-25 or more nucleotides, although it may contain
the polymerase chain reaction for amplification of the fewer nucleotides. Short primer molecules generally
desired 94-mer sequence of human g-globin for three require cooler temperatures to form sufficiently stable
cycles using two oligonucleotides primers. 55 hybrid complexes with template.
FIG. 5 represents a photograph of an ethidium bro The primers herein are selected to be "substantially'
mide-stained polyacrylamide gel demonstrating amplifi complementary to the different strands of each specific
cation after four cycles of a 240-mer sequence in sequence to be amplified. This means that the primers
pBR328:HbA, where the aliquots are digested with must be sufficiently complementary to hybridize with
NcoI (Lane 3), MstI (Lane 4) or Hinf (Lane 5). Lane 60 their respective strands. Therefore, the primer sequence
1 is the molecular weight standard and Lane 2 contains need not reflect the exact sequence of the template. For
example, a non-complementary nucleotide fragment
the intact 240-bp product.
FIG. 6 illustrates the sequence of the normal (34) and may be attached to the 5' end of the primer, with the
sickle cell (3S) 6-globin genes in the region of the DdeI remainder of the primer sequence being complementary
to the strand. Alternatively, non-complementary bases
and Hinf restriction sites, where the single lines for 64 65 or
mark the position of the DdeI site (CTGAG) and the longer sequences can be interspersed into the primer,
double bars for g4 and 6Smark the position of the HinfI provided that the primer sequence has sufficient com
site (GACTC). plementarity with the sequence of the strand to be am
 4,683,195
7 8
plified to hybridize therewith and thereby form a tem RNA from any source, including bacteria, yeast, vi
plate for synthesis of the extension product of the other ruses, and higher organisms such as plants or animals.
primer. DNA or RNA may be extracted from blood, tissue
As used herein, the terms "restriction endonucleases' material such as chorionic villi or amniotic cells by a
and "restriction enzymes' refer to bacterial enzymes variety of techniques such as that described by Maniatis
each of which cut double-stranded DNA at or near a et al., Molecular Cloning. A Laboratory Manual, (New
specific nucleotide sequence. York: Cold Spring Harbor Laboratory, 1982), pp
As used herein, the term "DNA polymorphism' re 280-281.
fers to the condition in which two or more different Any specific nucleic acid sequence can be produced
nucleotide sequences coexist in the same interbreeding O by the present process. It is only necessary that a suffi
population in a DNA sequence. cient number of bases at both ends of the sequence be
The term "restriction fragment length polymor known in sufficient detail so that two oligonucleotide
phism" ("RFLP") refers to the differences in DNA primers can be prepared which will hybridize to differ
nucleotide sequences that are randomly distributed ent strands of the desired sequence and at relative posi
throughout the entire human genome and that produce 15 tions along the sequence such that an extension product
different restriction endonuclease patterns. synthesized from one primer, when it is separated from
The present invention is directed to a process for its template (complement), can serve as a template for
amplifying any one or more desired specific nucleic extension of the other primer into a nucleic acid of
acid sequences suspected of being in a nucleic acid. defined length. The greater the knowledge about the
Because large amounts of a specific sequence may be 20 bases at both ends of the sequence, the greater can be
produced by this process, the present invention may be the specificity of the primers for the target nucleic acid
used for improving the efficiency of cloning DNA or sequence, and thus the greater the efficiency of the
messenger RNA and for amplifying a target sequence to process. It will be understood that the word primer as
facilitate detection thereof. used hereinafter may refer to more than one primer,
In general, the present process involves a chain reac 25 particularly in the case where there is some ambiguity in
tion for producing, in exponential quantities relative to the information regarding the terminal sequence(s) of
the number of reaction steps involved, at least one spe the fragment to be amplified. For instance, in the case
cific nucleic acid sequence given (a) that the ends of the where a nucleic acid sequence is inferred from protein
required sequence are known in sufficient detail that sequence information a collection of primers containing
oligonucleotides can be synthesized which will hybrid 30 sequences representing all possible codon variations
ize to them, and (b) that a small amount of the sequence based on degeneracy of the genetic code will be used
is available to initiate the chain reaction. The product of for each strand. One primer from this collection will be
the chain reaction will be a discrete nucleic acid duplex homologous with the end of the desired sequence to be
with termini corresponding to the ends of the specific amplified.
primers employed. 35 The oligonucleotide primers may be prepared using
Any source of nucleic acid, in purified or nonpurified any suitable method, such as, for example, the phospho
form, can be utilized as the starting nucleic acid or triester and phosphodiester methods described above,
acids, provided it is suspected of containing the specific or automated embodiments thereof. In one such auto
nucleic acid sequence desired. Thus, the process may mated embodiment diethylphosphoramidites are used as
employ, for example, DNA or RNA, including messen 40 starting materials and may be synthesized as described
ger RNA, which DNA or RNA may be single stranded by Beaucage et al., Tetrahedron Letters (1981),
or double stranded. In addition, a DNA-RNA hybrid 22:1859-1862. One method for synthesizing oligonucle
which contains one strand of each may be utilized. A otides on a modified solid support is described in U.S.
mixture of any of these nucleic acids may also be em Pat. No. 4,458,066. It is also possible to use a primer
ployed, or the nucleic acids produced from a previous 45 which has been isolated from a biological source (such
amplification reaction herein using the same or different as a restriction endonuclease digest).
primers may be so utilized. The specific nucleic acid The specific nucleic acid sequence is produced by
sequence to be amplified may be only a fraction of a using the nucleic acid containing that sequence as a
larger molecule or can be present initially as a discrete template. If the nucleic acid contains two strands, it is
molecule, so that the specific sequence constitutes the 50 necessary to separate the strands of the nucleic acid
entire nucleic acid. It is not necessary that the sequence before it can be used as the template, either as a separate
to be amplified be present initially in a pure form; it may step or simultaneously with the synthesis of the primer
be a minor fraction of a complex mixture, such as a extension products. This strand separation can be ac
portion of the g-globin gene contained in whole human complished by any suitable denaturing method includ
DNA or a portion of nucleic acid sequence due to a 55 ing physical, chemical or enzymatic means. One physi
particular microorganism which organism might consti cal method of separating the strands of the nucleic acid
tute only a very minor fraction of a particular biological involves heating the nucleic acid until it is completely
sample. The starting nucleic acid may contain more (>99%) denatured. Typical heat denaturation may
than one desired specific nucleic acid sequence which involve temperature ranging from about 80 to 105 C.
may be the same or different. Therefore, the present 60 for times ranging from about 1 to 10 minutes. Strand
process is useful not only for producing large amounts separation may also be induced by an enzyme from the
of one specific nucleic acid sequence, but also for ampli class of enzymes known as helicases or the enzyme
fying simultaneously more than one different specific RecA, which has helicase activity and in the presence
nucleic acid sequence located on the same or different of riboATP is known to denature DNA. The reaction
nucleic acid molecules. t 65 conditions suitable for separating the strands of nucleic
The nucleic acid or acids may be obtained from any acids with helicases are described by Cold Spring Har
source, for example, from plasmids such as pBR322, bor Symposia on Ouantitative Biology, Vol. XLIII
from cloned DNA or RNA, or from natural DNA or "DNA: Replication and Recombination” (New York:
 4,683, 195 10
9
Cold Spring Harbor Laboratory, 1978), B. Kuhn et al., 35-40 C. For certain applications, where the sequen
"DNA Helicases", pp. 63-67, and techniques for using ces to be amplified are over 110 base pair fragments,
RecA are reviewed in C. Radding, Ann. Rev. Genetics, such as the HLA DQ-a or -(3 genes, an effective amount
16:405-37 (1982). (e.g., 10% by volume) of DMSO is added to the amplifi
If the original nucleic acid containing the sequence to 5 cation mixture, and the reaction is carried at 35-40 C.,
be amplified is single stranded, its complement is syn to obtain detectable results or to enable cloning.
thesized by adding one or two oligonucleotide primers The agent for polymerization may be any compound
thereto. If an appropriate single primer is added, a or system which will function to accomplish the synthe
primer extension product is synthesized in the presence sis of primer extension products, including enzymes.
of the primer, an agent for polymerization and the four 10 Suitable enzymes for this purpose include, for example,
nucleotides described below. The product will be par E. coli DNA polymerase I, Klenow fragment of E. coli
tially complementary to the single-stranded nucleic acid DNA polymerase I, T4 DNA polymerase, other avail
and will hybridize with the nucleic acid strand to form able DNA polymerases, reverse transcriptase, and other
a duplex of unequal length strands that may then be enzymes, including heatstable enzymes, which will fa
separated into single strands as described above to pro- 15 cilitate combination of the nucleotides in the proper
duce two single separated complementary strands. Al manner to form the primer extension products which
ternatively, two appropriate primers may be added to are complementary to each nucleic acid strand. Gener
the single-stranded nucleic acid and the reaction carried ally, the synthesis will be initiated at the 3' end of each
Out. primer and proceed in the 5' direction along the tem
If the original nucleic acid constitutes the sequence to 20 plate strand, until synthesis terminates, producing mole
be amplified, the primer extension product(s) produced cules of different lengths. There may be agents, how
will be completely complementary to the strands of the ever, which initiate synthesis at the 5' end and proceed
original nucleic acid and will hybridize therewith to in the other direction, using the same process as de
form a duplex of equal length strands to be separated scribed above.
into single-stranded molecules. 25 The newly synthesized strand and its complementary
When the complementary strands of the nucleic acid nucleic acid strand form a double-stranded molecule
or acids are separated, whether the nucleic acid was which is used in the succeeding steps of the process. In
originally double or single stranded, the strands are the next step, the strands of the double-stranded mole
ready to be used as a template for the synthesis of addi cule are separated using any of the procedures de
tional nucleic acid strands. This synthesis can be per 30 scribed above to provide single-stranded molecules.
formed using any suitable method. Generally it occurs New nucleic acid is synthesized on the single
in a buffered aqueous solution, preferably at a pH of stranded molecules. Additional inducing agent, nucleo
7-9, most preferably about 8. Preferably, a molar excess tides and primers may be added if necessary for the
(for cloned nucleic acid, usually about 1000:1 primer:- reaction to proceed under the conditions prescribed
template, and for genomic nucleic acid, usually about 35 above. Again, the synthesis will be initiated at one end
100: 1 primer:template) of the two oligonucleotide prim of the oligonucleotide primers and will proceed along
ers is added to the buffer containing the separated tem the single strands of the template to produce additional
plate strands. It is understood, however, that the nucleic acid. After this step, half of the extension prod
amount of complementary strand may not be known if uct will consist of the specific nucleic acid sequence
the process herein is used for diagnostic applications, so 40 bounded by the two primers.
that the amount of primer relative to the amount of The steps of strand separation and extension product
complementary strand cannot be determined with cer synthesis can be repeated as often as needed to produce
tainty. As a practical matter, however, the amount of the desired quantity of the specific nucleic acid se
primer added will generally be in molar excess over the quence. As will be described in further detail below, the
amount of complementary strand (template) when the 45 amount of the specific nucleic acid sequence produced
sequence to be amplified is contained in a mixture of will accumulate in an exponential fashion.
complicated long-chain nucleic acid strands. A large When it is desired to produce more than one specific
molar excess is preferred to improve the efficiency of nucleic acid sequence from the first nucleic acid or
the process. mixture of nucleic acids, the appropriate number of
The deoxyribonucleoside triphosphates dATP, 50 different oligonucleotide primers are utilized. For ex
dCTP, dGTP and TTP are also added to the synthesis ample, if two different specific nucleic acid sequences
mixture in adequate amounts and the resulting solution are to be produced, four primers are utilized. Two of
is heated to about 90-100° C. for from about 1 to 10 the primers are specific for one of the specific nucleic
minutes, preferably from 1 to 4 minutes. After this heat acid sequences and the other two primers are specific
ing period the solution is allowed to cool to from 55 for the second specific nucleic acid sequence. In this
20-40 C., which is preferable for the primer hybridiza manner, each of the two different specific sequences can
tion. To the cooled mixture is added an agent for poly be produced exponentially by the present process.
merization, and the reaction is allowed to occur under The present invention can be peformed in a step-wise
conditions known in the art. This synthesis reaction fashion where after each step new reagents are added,
may occur at from room temperature up to a tempera 60 or simultaneously, where all reagents are added at the
ture above which the agent for polymerization no initial step, or partially step-wise and partially simulta
longer functions efficiently. Thus, for example, if DNA neous, where fresh reagent is added after a given num
polymerase is used as the agent for polymerization, the ber of steps. If a method of strand separation, such as
temperature is generally no greater than about 45° C. heat, is employed which will inactivate the agent for
Preferably an amount of dimethylsulfoxide (DMSO) is 65 polymerization, as in the case of a heat-labile enzyme,
present which is effective in detection of the signal or then it is necessary to replenish the agent for polymeri
the temperature is 35-40 C. Most preferably, 5-10% zation after every strand separation step. The simulta
by volume DMSO is present and the temperature is neous method may be utilized when a number of puri
 4,683, 195
11 12
fied components, including an enzymatic means such as the desired sequence S comprised of complementary
helicase, is used for the strand separation step. In the strands St) and S) is utilized as the nucleic acid.
simultaneous procedure, the reaction mixture may con During the first and each subsequent reaction cycle
tain, in addition to the nucleic acid strand(s) containing extension of each oligonucleotide primer on the original
the desired sequence, the strand-separating enzyme template will produce one new ssDNA molecule prod
(e.g., helicase), an appropriate energy source for the uct of indefinite length which terminates with only one
strand-separating enzyme, such as raTP, the four nu of the primers. These products, hereafter referred to as
cleotides, the oligonucleotide primers in molar excess, "long products," will accumulate in a linear fashion;
and the inducing agent, e.g., Klenow fragment of E. coli that is, the amount present after any number of cycles
DNA polymerase I. If heat is used for denaturation in a O will be proportional to the number of cycles.
simultaneous process, a heat-stable inducing agent such The long products thus produced will act as tem
as a thermostable polymerase may be employed which plates for one or the other of the oligonucleotide prim
will operate at an elevated temperature, preferably ers during subsequent cycles and will produce mole
65°-90° C. depending on the inducing agent, at which cules of the desired sequence (S+) or S). These mole
temperature the nucleic acid will consist of single and 15 cules will also function as templates for one or the other
double strands in equilibrium. For smaller lengths of of the oligonucleotide primers, producing further St
nucleic acid, lower temperatures of about 50° C. may be and ST), and thus a chain reaction can be sustained
employed. The upper temperature will depend on the which will result in the accumulation of S) at an expo
temperature at which the enzyme will degrade or the nential rate relative to the number of cycles.
temperature above which an insufficient level of primer 20 By-products formed by oligonucleotide hybridiza
hybridization will occur. Such a heat-stable enzyme is tions other than those intended are not self-catalytic
described, e.g., by A. S. Kaledin et al., Biokhimiya, 45, (except in rare instances) and thus accumulate at a linear
644-651 (1980). Each step of the process will occur Tate.
sequentially notwithstanding the initial presence of all The specific sequence to be amplified, S, can be
the reagents. Additional materials may be added as 25 depicted diagrammatically as:
necessary. After the appropriate length of time has
passed to produce the desired amount of the specific St 5' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCC 3'
nucleic acid sequence, the reaction may be halted by S-) 5’ TTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5'
inactivating the enzymes in any known manner or sepa
rating the components of the reaction. 30
The appropriate oligonucleotide primers would be: .
The process of the present invention may be con
ducted continuously. In one embodiment of an auto Primer i: GGGGGGGGGG
mated process, the reaction may be cycled through a Primer 2: AAAAAAAAAA
denaturing region, a reagent addition region, and a
reaction region. In another embodiment, the enzyme 35
so that if DNA containing S
used for the synthesis of primer extension products can
. . . zzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz . . .
... ZzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz...

be immobilized in a column. The other reaction compo is separated into single strands and its single strands are
nents can be continuously circulated by a pump through hybridized to Primers 1 and 2, the following extension
the column and a heating coil in series; thus the nucleic reactions can be catalyzed by DNA polymerase in the
acids produced can be repeatedly denatured without 45 presence of the four deoxyribonucleoside triphosphates:
inactivating the enzyme.
3' 5
extends<-GGGGGGGGGG Primer 1
... zzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz . . .
original template strand
original template strand
. . .zzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGZZZZZZZZZZZZZZZZ . . .
Primer 2AAAAAAAAAA-G extends
5' 3'

The present invention is demonstrated diagrammati On denaturation of the two duplexes formed, the prod
lucts are:
cally below where double-stranded DNA containing
3.
. . .zzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGG
newly synthesized long product 1

. . .zzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz . . .
original template strand
 4,683, 195 14
13
-continued
2ZZZZZZZZZZZZZZZTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGZZZZZZZZZZZZZZZZ. . . .
original template strand
s
AAAAAAAAAAXXXXXXXXXX CCCCCCCCCCzzzzzzzzzzzzzzzy... . .
newly synthesized long product 3

If these four strands are allowed to rehybridize with human genomic DNA, preferably the number of cycles
Primers 1 and 2 in the next cycle, agent for polymeriza- 0 is from about 10-30.
tion will catalyze the following reactions: The amount of original nucleic acid remains constant

Primer 2 5' AAAAAAAAAA -Gextends to here

3' ... zzzzzzzzzzzzzzzzzzTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5'
newly synthesized long product 1

extends<- GGGGGGGGGG 5' Primer

5' . . .zzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzz ... 3"
original template strandt
Primer 2 5' AAAAAAAAAA-G extends
3' ... zzzzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGzzzzzzzzzz... 5
original template strand

extends to here <-GGGGGGGGGG 5' Primer 1

5' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz ... 3"
newly synthesized long product 2
If the strands of the above four duplexes are separated, in the entire process, because it it not replicated. The
the following strands are found: amount of the long products increases linearly because
5' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCC 3'
newly synthesized St
3' ... zzzzzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5'
first cycle synthesized long product 1
3' ... zzzzzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5'
newly synthesized long product 1
5' . . . ZzzzzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzz ... 3
original template strand
5' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz ... 3
newly synthesized long product 2
3' ... zzzzzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz... 5
original template strand
3' TTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5'
newly synthesized S
5' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz ... 3
first cycle synthesized long product 2
they are produced only from the original nucleic acid.
It is seen that each strand which terminates with the The amount of the specific sequence increases exponen
oligonucleotide sequence of one primer and the comple tially. Thus, the specific sequence will become the pre
mentary sequence of the other is the specific nucleic dominant species. This is illustrated in the following
acid sequence S that is desired to be produced. 60 table, which indicates the relative amounts of the spe
The steps of this process can be repeated indefinitely, cies theoretically present aftern cycles, assuming 100%
being limited only by the amount of Primers 1 and 2, the efficiency at each cycle:
agent for polymerization and nucleotides present. For
detection, the number of cycles used is that required to Number of Double Strands
produce a detectable signal, an amount which will de 65 After 0 to n Cycles
pend, e.g., on the nature of the sample. For example, if Long Specific
the sample is pure or diluted, fewer cycles may be re Cycle Number Template Products Sequence S.
quired than if it is a complex mixture. If the sample is O 1
 4,683, 195
16
-continued quence will not interfere with the ability of the primer
Number of Double Strands
to hybridize to the original target sequence and to initi
After () () in Cycles ate polymerization. After the first amplification cycle
Long Specific the primer is copied, becomes the target, and matches
Cycle Number Template Products Sequence ES 5 exactly with new primers. After the amplification pro
O cess, the products are cleaved with the appropriate
2 l restriction enzymes, optionally separated from inhibi
3. l 3. 4. tors of ligation such as the nucleotide triphosphates and
5 l 5
() O ()3 salts by passing over a desalting column or molecular
15 15 32,752 O weight chromatography column, and inserted by liga
2O 20 048.555
(2 - 1 - 1)
tion into a cloning vector such as bacteriophage M13.
The gene may then be sequenced and/or expressed
using well known techniques.
When a single-stranded nucleic acid is utilized as the 5
The second method for preparing the primers in
template, only one long product is formed per cycle. volves taking the 3' end of the primers from the target
The method herein may be utilized to clone a particu sequence and adding the desired restriction site(s) to the
lar nucleic acid sequence for insertion into a suitable 5' end of the primer. For the above example, a HindIII
expression vector. The vector may then be used to site could be added to make the sequence "cgaagctt
transform an appropriate host organism to produce the CAGTATCCGA ... ', where lower case letters are as
gene product of the sequence by standard method of described above. The added bases would not contribute
recombinant DNA technology. to the hybridization in the first cycle of amplification,
Normally, such cloning would either involve direct but would match in subsequent cycles. The final ampli
ligation into a vector or the addition of oligonucleotide fied products are then cut with restriction enzyme(s)
linkers followed by restriction enzyme cleavage. Both and cloned and expressed as described above. The gene
of these methods involve, however, the inefficient 25
being amplified may be, for example, human beta-hemo
blunt-end ligation reaction. Also, neither technique globin or the human HLA DQ, DR or DP-a and (3
would control for the orientation or multiplicity of genes.
insertion of the amplified product into the cloning vec In addition, the process herein can be used for in vitro
tor.
The amplification process herein may yield a mixture mutagenesis. The oligodeoxyribonucleotide primers
of nucleic acids, resulting from the original template need not be exactly complementary to the DNA se
nucleic acid, the expected target amplified products, quence which is being amplified. It is only necessary
and various background non-target products. The am that they be able to hybridize to the sequence suffi
plified product can also be a mixture if the original ciently well to be extended by the polymerase enzyme
template DNA contains multiple target sequences, such 35 or by whatever other inducing agent is employed. The
as in a heterozygous diploid genome or when there is a product of a polymerase chain reaction wherein the
family of related genes. primers employed are not exactly complementary to the
The primers herein may be modified to assist the original template will contain the sequence of the
rapid and specific cloning of the mixture of DNAs pro primer rather than the template, thereby introducing as
duced by the amplification reaction. In such modifica 40 in vitro mutation. In further cycles this mutation will be
tion the same or different restriction sites are incorpo amplified with an undiminished efficiency because no
rated at the 5' ends of the primers to result in restriction further mispaired primings are required. The mutant
sites at the two ends of the amplified product. When cut thus produced may be inserted into an appropriate vec
with the appropriate enzymes, the amplified product tor by standard molecular biological techniques and
can then be easily inserted into plasmid or viral vectors 45 might confer mutant properties on this vector such as
and cloned. This cloning allows the analysis or expres the potential for production of an altered protein.
sion of individual amplified products, not a mixture. The process of making an altered DNA sequence as
Although the same restriction site can be used for described above could be repeated on the altered DNA
both primers, the use of different sites allows the inser using different primers so as to induce further sequence
tion of the product into the vector with a specific orien SO changes. In this way a series of mutated sequences
tation and suppresses multiple insertions as well as inser could gradually be produced wherein each new addi
tions arising from amplifications based on only one of tion to the series could differ from the last in a minor
the two primers. The specific orientation is useful when way, but from the original DNA source sequence in an
cioning into single-strand sequencing vectors, when increasingly major way. In this manner changes could
single-strand hybridization probes are used, or when the 55 be made ultimately which were not feasible in a single
cloned product is being expressed. step due to the inability of a very seriously mismatched
One method to prepare the primers is to choose a primer to function.
primer sequence which differs minimally from the tar In addition, the primer can contain as part of its se
get sequence. Regions in which each of the primers is to quence a non-complementary sequence provided that a
be located are screened for homology to restriction sites 60 sufficient amount of the primer contains a sequence
appropriate to the desired vector. For example, the which is complementary to the strand to be amplified.
target sequence "CAGTATCCGA...' differs by only For example, a nucleotide sequence which is not com
one base from one containing a BamHI site. A primer plementary to the template sequence (such as, e.g., a
sequence is chosen to match the target exactly at its 3' promoter, linker, coding sequence, etc.) may be at
end, and to contain the altered sequence and restriction 65 tached at the 5' end of one or both of the primers, and
site near its 5' end (for example, "CAGgATCCGA. . . thereby appended to the product of the amplification
', where the lower case letter symbolizes a mismatch process. After the extension primer is added, sufficient
with the target sequence). This minimally altered se cycles are run to achieve the desired amount of new
 4,683,195 18
17
template containing the non-complementary nucleotide Therefore, mutants of the original nucleic acid may be
insert. This allows production of large quantities of the made by using primers which are substantially comple
combined fragments in a relatively short period of time mentary at their 3' ends to the 3' ends of the single
(e.g., two hours or less) using a simple technique. strands of the original shorter nucleic acid.
Moreover, the process herein may be used to synthe If restriction site linkers are incorporated into the
size a nucleic acid fragment from an existing nucleic primers, then the amplified double-stranded products
acid fragment which is shorter than its product (called can be digested with the appropriate restriction en
the core segment) using certain primers the 3' ends of zymes and ligated directly into an M13 vector for rapid
which are complementary to or substantially comple cloning and sequencing. The M3 plaques containing
mentary to the 3' ends of the single strands produced by 10 the specific amplified target sequences can be identified
separating the strands of the original shorter nucleic by hybridizing plaque lift filters with a probe specific
acid fragments, and the 5' ends of which primers con for the target sequence.
tain sequence information to be appended to the core The method herein may also be used to enable detec
segment. This process comprises: tion and/or characterization of specific nucleic acid
(a) treating the strands of said existing fragment with 5 sequences associated with infectious diseases, genetic
two oligonucleotide primers under conditions such that disorders or cellular disorders such as cancer, e.g., on
an extension product of each primer is synthesized cogenes. Amplification is useful when the amount of
which is complementary to each nucleic acid strand, nucleic acid available for analysis is very small, as, for
wherein said primers are selected so as to be substan example, in the prenatal diagnosis of sickle cell anemia
tially complementary to the 3' end of each strand of said 20 using DNA obtained from fetal cells. Amplification is
existing fragment such that the extension product syn particularly useful if such an analysis is to be done on a
thesized from one primer, when it is separated from its small sample using non-radioactive detection tech
complement, can serve as a template for synthesis of the niques which may be inherently insensitive, or where
extension product of the other primer, and wherein radioactive techniques are being employed but where
each primer contains, at its 5' end, a sequence of nucleo 25 rapid detection is desirble.
tides which are not complementary to said existing For purposes of this invention genetic diseases may
fragment and which correspond to the two ends of the include specific deletions and/or mutations in genomic
nucleic acid fragment being synthesized; DNA from any organism, such as, e.g., sickle cell ane
(b) separating the primer extension products from the mia, cystic fibrosis, a-thalassemia, A-thalassemia, and
templates on which they were synthesized to produce 30 the like. Sickle cell anemia can be readily detected via
single-stranded molecules; oligomer restriction analysis or a RFLP-like analysis
(c) treating the single-stranded molecules generated following amplification of the appropriate DNA se
from step (b) with the primers of step (a) under condi quence by the present method. a-Thalassemia can be
tions such that a primer extension product is synthesized detected by the absence of a sequence, and 6-thalas
using each of the single strands produced in step (b) as 35 semia can be detected by the presence of a polymorphic
a template so as to produce two intermediate double restriction site closely linked to a mutation which causes
stranded nucleic acid molecules, into each of which has the disease.
been incorporated the nucleotide sequence present in All of these genetic diseases may be detected by am
the 5' end of one of the oligonucleotide primers, and plifying the appropriate sequence and analyzing it by
two full-length double-stranded nucleic acid molecules, 40 Southern blots without using radioactive probes. In
into each of which has been incorporated the nucleotide such a process, for example, a small sample of DNA
sequence present in the 5' ends of both of the oligonu from, e.g., amniotic fluid containing a very low level of
cleotide primers; the desired sequence is amplified, cut with a restriction
(d) repeating steps (b) and (c) for a sufficient number enzyme, and analyzed via a Southern blotting tech
of times to produce the full-length double-stranded 45 nique. The use of non-radioactive probes is facilitated
molecule in an effective amount; by the high level of the amplified signal.
(e) treating the strands of the product of step (d) with In another embodiment a small sample of DNA may
two primers so as to lengthen the product of step (d) on be amplified to a convenient level and then a further
both ends; and cycle of extension reactions performed wherein nucleo
(f) repeating steps (a)-(d) using the product of step (d) 50 tide derivatives which are readily detectable (such as
as the core fragment and two oligonucleotide primers 32P-labeled or biotin labeled nucleoside triphosphates)
which are complementary or substantially complemen are incorporated directly into the final DNA product,
tary to the 3' ends of the single strands produced by which may be analyzed by restriction and electropho
separating the strands of the product of step (d). retic separation or any other appropriate method. An
Steps (b) and (c) are repeated as often as necessary, 55 example of this technique in a model system is demon
usually at least 5 times, to produce the required amount strated in FIG. 5.
of the full-length double-stranded product to synthesize In a further embodiment, demonstrated in a model
the final product (i.e., the effective amount). In addi system in FIG. 3, the nucleic acid may be exposed to a
tion, the core segment may be obtained as the product particular restriction endonuclease prior to amplifica
of a previous amplification cycle. The product pro 60 tion. Since a sequence which has been cut cannot be
duced in step (d) may be purified before a new cycle of amplified, the appearance of an amplified fragment,
extension and amplification, or used directly by employ despite prior restriction of the DNA sample, implies the
ing the reaction mixture containing the product. absence of a site for the endonuclease within the ampli
If the 3' ends of the primers are not exactly comple fied sequence. The presence or absence of an amplified
mentary to the 3' ends of the single strands of the origi 65 sequence can be detected by an appropriate method.
nal shorter nucleic acid, the core fragment of the prod A practical application of this technique can be illus
uct will not be exactly the same as the sequence infor trated by its use in facilitating the detection of sickle cell
mation resident in the original shorter nucleic acid. anemia via the oligomer restriction technique described
 4,683,195
19 20
herein and in copending U.S. application Ser. No. and sensitivity required to make the Falkow and Ward
716,982 filed Mar. 27, 1985. Sickle cell anemia is a he procedures useful in a routine clinical setting.
moglobin disease which is caused by a single base pair In addition, the probe may be a biotinylated probe in
change in the sixth codon of the f3-globin gene. FIG. 6 which the biotin is attached to a spacer arm of the for
illustrates the sequences of normal and sickle cell S mula:
globin genes in the region of their polymorphism,
where the single bars mark the location of a Ddel site
present only in the normal gene and where the double
bars mark the location of a Hinf site which is non
polymorphic and thus present in both the normal and 10
sickle cell alleles. FIG. 7 illustrates the process of oligo where Y is O, NH or N-CHO, X is a number from 1 to
mer restriction of normal 6-globin DNA using a probe 4, and y is a number from 2 to 4. The spacer arm is in
spanning both restriction sites and labeled where the turn attached to a psoralen moiety of the formula:
asterisk appears. (The probe is preferably labeled at the 15
end which is fewer base pairs from the restriction site CH
than the other end of the probe.) The DNA, amplified
as provided herein, is denatured and annealed to the
labeled probe. The amplification may be carried out at
elevated temperatures (35-40 C.) in the presence of
dimethylsulfoxide to minimize formation of secondary
structure. The enzyme Dde cleaves the DNA at the
reformed DdeI site and generates a labeled octamer. The psoralen moiety intercalates into and crosslinks a
Under the conditions used in the test the octamer is "gapped circle" probe as described by Courage-Tebbe
short enough to dissociate from the duplex. The subse 25 et al., Biochim. Biophys. Acta, 697 (1982) 1-5, wherein
quent addition of the enzyme Hinf has no effect on the the single-stranded hybridization region of the gapped
now single-stranded octamer. FIG. 8 illustrates the circle spans the region contained in the primers. The
same process applied to the sickle cell allele of £3-globin details of this biotinylation and dot blot procedure are
DNA. The enzyme Dde cannot cleave the duplex described more fully in commonly assigned copending
formed by the amplified DNA and the labeled probe 30 U.S. application Ser. Nos. 683,263 filed Dec. 18, 1984
because of the A-A base pair mismatch. The enzyme and 791,332 filed Oct. 25, 1985, the disclosures of which
HinfI, however, does restrict the hybrid and a labeled are incorporated herein by reference.
trimer is produced. In practice the method can diagnose The amplification process can also be utilized to pro
the DNA of an individual as being either homozygous duce sufficient quantities of DNA from a single copy
for the wild type, homozygous for the sickle type or a 35 human gene such that detection by a simple non-specific
heterozygous carrier of the sickle cell trait, since a spe DNA stain such as ethidium bromide can be employed
cific signal is associated with the presence of eithrallele. so as to make a DNA diagnosis directly.
Use of this above-described method to amplify the per In addition to detecting infectious diseases and patho
tinent sequence allows for a rapid analysis of a single logical abnormalities in the genome of organisms, the
copy gene using a probe with only a single 32P label. 40 process herein can also be used to detect DNA poly
Various infectious diseases can be diagnosed by the morphism which may not be associated with any patho
presence in clinical samples of specific DNA sequences logical state.
characteristic of the causative microorganism. These The following examples are offered by way of illus
include bacteria, such as Salmonella, Chlamydia, and tration and are not intended to limit the invention in any
Neisseria; viruses, such as the hepatitis viruses; and 45 manner. In these examples all percentages are by weight
parasites, such as the Plasmodium responsible for ma if for solids and by volume if for liquids, and all temper
laria. U.S. Pat. No. 4,358,535 issued to Falkow describes atures are in degrees Celsius unless otherwise noted.
the use of specific DNA hybridization probes for the
diagnosis of infectious diseases. A problem inherent in EXAMPLE
the Falkow procedure is that a relatively small number 50 A 25 base pair sequence having the nucleotide se
of pathogenic organisms may be present in a clinical quence
sample from an infected patient and the DNA extracted 5' CCTCGGCACCGTCACCCTGGATGCT 3'
from these may constitute only a very small fraction of 3' GGAGCCGTGGCAGTGGGACCTACGA 5'
the total DNA in the sample. Specific amplification of contained on a 47 base pair FokI restriction fragment of
suspected sequences prior to immobilization and hy 55 pBR322 obtainable from ATCC was prepared as fol
bridization detection of the DNA samples could greatly lows. A FokI digest of pBR322 containing the 47-bp
improve the sensitivity and specificity of these proce fragment was produced by digesting pBR322 with FokI
dures. in accordance with the conditions suggested by the
Routine clinical use of DNA probes for the diagnosis supplier, New England Biolabs Inc. The primers which
of infectious diseases would be simplified considerably 60 were utilized were 5' d(CCTCGGCACCG) 3' and 5'
if non-radioactively labeled probes could be employed d(AGCATCCAGGGTG) 3', and were prepared using
as described in EP No. 63,879 to Ward. In this proce conventional techniques. The following ingredients
dure biotin-containing DNA probes are detected by were added to 33 ul of buffer which consisted of 25 mM
chromogenic enzymes linked to avidin or biotin-specific potassium phosphate, 10 mM magnesium chloride and
antibodies. This type of detection is convenient, but 65 100 mM sodium chloride at pH 7.5: 2433 pmoles of each
relatively insensitive. The combination of specific DNA of the primers described above, 2.4 pmoles of the FokI
amplification by the present method and the use of digest of pBR322, 12 nmoles of dATP, 22 nmoles of
stably labeled probes could provide the convenience dCTP, 19 nmoles of dGTP and 10 nmoles of TTP.
 4,683,195 22
21
The mixture was heated to 85 C. for five minutes and rated to dryness at room temperature in a vacuum cen
allowed to cool to ambient temperature. Five units of trifuge.
the Klenow fragment of E. coli DNA polymerase I Characterization of Oligodeoxyribonucleotides: Test
were added and the temperature was maintained for 15 aliquots of the purified oligonucleotides were 32P la
minutes. After that time, the mixture was again heated beled with polynucleotide kinase and y-2P-ATP. The
to 85 C. for five minutes and allowed to cool. Five labeled compounds were examined by autoradiography
units of the Klenow fragment were again added and the of 14-20% polyacrylamide gels after electrophoresis for
reaction was carried out for 15 minutes. The heating, 45 minutes at 50 volts/cm. This procedure verifies the
cooling and synthesis steps were repeated eleven more molecular weight. Base composition was determined by
times. O digestion of the oligodeoxyribonucleotide to nucleo
After the final repetition, a 5ul aliquot was removed sides by use of venom diesterase and bacterial alkaline
from the reaction mixture. This was heated to 85 C. for phosphatase and subsequent separation and quantitation
three minutes and allowed to cool to ambient tempera of the derived nucleosides using a reverse phase HPLC
ture. 12.5 pmoles of a-P32-deoxycytidine triphosphate column and a 10% acetonitrile, 1% ammonium acetate
and 5 units of Klenow fragment were added and the 15 mobile phase.
reaction was allowed to proceed for 15 minutes. The II. Source of DNA
labeled products were examined by polyacrylamide gel
electrophoresis. The FokI digest was labeled in a similar A. Extraction of Whole Human Wild-Type DNA
fashion and served as a control and molecular weight Human geonomic DNA homozygous for normal
markers. The only heavily labeled band visible after the 20
A-globin was extracted from the cell line Molta (ob
13 cycles was the intended 25 base pair sequence. tained from Human Genetic Mutant Cell Repository
EXAMPLE 2 and identified as GM2219c) using the technique de
The desired sequence to be amplified was a 94 base scribed by Stetler et al., Proc. Nat. Acad. Sci. USA
pair sequence contained within the human beta-globin 25 (1982), 79:5966-5970.
gene and spanning the Mstill site involved in sickle cell B. Construction of Cloned Globin Genes
anemia. The sequence has the nucleotide sequence A 1.9 kb BamHI fragment of the normal (3-globin
shown in FIG. 1. gene was isolated from the cosmid pFC11 and inserted
I. Synthesis of Primers 30 into the BamHI site of pBR328 (Soberon, et al., Gene
The following two oligodeoxyribonucleotide primers (1980) 9:287-305). This fragment, which encompasses
were prepared by the method described below: the region that hybridizes to the synthetic 40-mer probe,
5' CACAGGGCAGTAACG 3' Primer A includes the first and second exons, first intron, and 5'
and
flanking sequences of the gene (Lawn et al., Cell (1978),
5 TTTGCTTCTGACACA 3' Primer B 35 15:1157–1174). This clone was designated pbR328:HbA
Automated Synthesis Procedures: The diethylphos and deposited under ATCC No. 39,698 on May 25,
phoramidites, synthesized according to Beaucage and 1984.
Caruthers (Tetrahedron Letters (1981) 22:1859-1862), The corresponding 1.9 kb BamHI fragment of the
were sequentially condensed to a nucleotide derivatized sickle cell allele of 6-globin was isolated from the cos
controlled pore glass support using a Biosearch SAM-1. 40 mid pFC12 and cloned as described above. This clone
The procedure included detritylation with trichloroace was designated pBR328:HbS and deposited under
tic acid in dichlorimethane, condensation using benzotri ATCC No. 39,699 on May 25, 1984.
azole as activating proton donor, and capping with Each recombinant plasmid was transformed into and
acetic anhydride and dimethylaminopyridine in tetrahy propagated in E. coli MM294 (ATCC No. 39,607).
drofuran and pyridine. Cycle time was approximately 45 C. Digestion of Cloned Globin Genes with MstI
30 minutes. Yields at each step were essentially quanti A total of 100 ug each of pBR328:HbA and
tative and were determined by collection and spectro pBR328:HbS were individually digested with 20 units
scopic examination of the dimethoxytrityl alcohol re of MstII (New England Biolabs) for 16 hours at 37° C.
leased during detritylation.
Oligodeoxyribonucleotide Deprotection and Purifi 50 in 200 ul of 150 mMNaCl, 12 mM Tris HCl (pH 7.5), 12
cation Procedures: The solid support was removed mM MgCl2, 1 mM dithiothreitol (DTT), and 100 ug/ml
from the column and exposed to 1 ml concentrated bovine serum albumin (BSA). The products are desig
ammonium hydroxide at room temperature for four nated pBR328:HbA/MstII and pBR328:HbS/MstII,
hours in a closed tube. The support was then removed respectively.
by filtration and the solution containing the partially 55 III. Polymerase Chain Reaction
protected oligodeoxyribonucleotide was brought to 55
C. for five hours. Ammonia was removed and the resi To 100 ul of buffer consisting of 60 mM sodium ace
due was applied to a preparative polyacrylamide gel. tate, 30 mM Tris acetate and 10 mM magnesium acetate
Electrophoresis was carried out at 30 volts/cm for 90 at pH 8.0 was added 2 ul of a solution containing 100
minutes after which the band containing the product 60 picomoles of Primer A (of the sequence d(CACAGG
was identified by UV shadowing of a fluorescent plate. GCACTAACG)). 100 picomoles of Primer B (of the
The band was excised and eluted with 1 ml distilled sequence d(TTTGCTTCTGACACA)) and 1000 pico
water overnight at 4°C. This solution was applied to an moles each of dATP, dCTP, dGTP and TTP. In addi
Altech RP18 column and eluted with a 7-13% gradient tion, one of the following sources of DNA described
of acetonitrile in 1% ammonium acetate buffer at pH 65 above was added:
6.0. The elution was monitored by UV absorbance at 10 ug whole human wild-type DNA (Reaction I)
260 nm and the appropriate fraction collected, quanti 0.1 picomole pBR328:HbA (Reaction II)
tated by UV absorbance in a fixed volume and evapo 0.1 picomole pBR328:HbS (Reaction III)
 4,683,195
23 24
0.1 picomole pBR328:HbA/MstII (Reaction IV) the 94-mer band does not appear in Lane 4. In contrast,
0.1 picomole pBR328:HbS/MstII (Reaction V) the 94-mer sequence in pBR328:HbS does not cut when
No target DNA (Reaction VI) the plasmid is digested with Mstill and thus is available
Each resulting solution was heated to 100° C. for four for amplification as shown in Lane 5.
minutes and allowed to cool to room temperature for 5 FIG. 4 illustrates the chain reaction for three cycles
two minutes, whereupon 1 Jul containing four units of in amplifying the 94-bp sequence. PC01 and PCO2 are
Klenow fragment of E. coli DNA polymerase was Primers A and B. The numbers on the right indicate the
added. Each reaction was allowed to proceed for 10 cycles, whereas the numbers on the left indicate the
minutes, after which the cycle of adding the primers, cycle number in which a particular molecule was pro
nucleotides and DNA, heating, cooling, adding poly O duced.
merase, and reacting was repeated nineteen times for EXAMPLE 3
Reaction I and four times for Reactions II-VI.
Four microliter aliquots of Reactions I and II re This example illustrates amplification of a 110 bp
moved before the first cycle and after the last cycle of sequence spanning the allelic MistII site in the human
each reaction were applied to a 12% polyacrylamide 15 hemoglobin gene.
gel 0.089M in Tris-borate buffer at pH 8.3 and 2.5 mM A total of 1.0 microgram whole human DNA, 100
in EDTA. The gel was electrophoresed at 25 volts/cm picomoles d(ACACAACTGTGTTCACTAGC) and
for four hours, transferred to a nylon membrane serving 100 picomoles d(CAACTTCATCCACGTTCACC),
as solid phase support and probed with a 5'-32P-labeled the primers having been prepared by the technique of
40 pb synthetic fragment, prepared by standared tech 20 Example 2, were dissolved in 100 ul of a solution which
niques, of the sequence WaS:
5'd(TCCTGAGGAGAAGTCTGCCGT 1.5 mM in each of the four deoxyribonucleoside tri
TACTGCCCTGTGGGGCAAG)3' phosphates
in 30% formamide, 3X SSPE, 5XDenhardt's, 5% so 30 mM in Tris acetate buffer at pH 7.9
dium dodecyl sulfate at pH 7.4. FIG. 2 is an autoradio 25 60 mM in sodium acetate
graph of the probed nylon membrane for Reactions I 10 mM in magnesium acetate
and II. Lane 1 is 0.1 picomole of a 58-bp synthetic frag 0.25 mM in dithiothreitol
ment control one strand of which is complementary to The solution was heated to 100° C. for one minute
the above probe. Lane 2 is 4 ul of Reaction I prior to the and brought rapidly to 25° C. for one minute, after
first amplification cycle. Lane 3 is 4 ul of Reaction I 30 which was added 2.5 units Klenow fragment of DNA
after the 20th amplification cycle. Lane 4 is 4 ul of polymerase. The polymerase reaction was allowed to
Reaction II after five amplification cycles. Lane 5 is a proceed for two minutes at 25°C., after which the cycle
molecular weight standard consisting of a FokI (New of heating, cooling, adding Klenow, and reacting was
England Biolabs) digest of pBR322 (New England Bi repeated as often as desired.
olabs) labeled with alpha-32P-dNTPs and polymerase. 35 With 70% efficiency at each cycle, 15 cycles resulted
Lane 3 shows that after twenty cycles the reaction in the synthesis of 1.4 femtomoles of the desired 110 bp
mixture I contained a large amount of the specific se fragment of the g-globin gene.
quence of the proper molecular weight and no other EXAMPLE 4
detectable products. Reaction mixture II after five cy
cles also contained this product, as well as the starting 40 This example illustrates amplification of a 240 bp
nucleic acid and other products, as shown by Lane 4. sequence spanning the allelic MstI site in the human
To 5.0 ul aliquots of Reactions II-VI after the fourth hemoglobin gene. This sequence contains Nicol, Hinf
cycle were added 5 pmoles of each primer described and Mst restriction sites.
above. The solutions were heated to 100° C. for four To 100 ul of a mixture of 60 mM sodium acetate, 30
minutes and allowed to equilibrate to room tempera 45 mM Tris acetate and 10 mM magnesium acetate at pH
ture. Three pmoles each of alpha-32P-dATP, alpha-32P 8.0 containing 0.1 pmole pBR328:HbA was added 2 ul
dCTP, alpha-32P-dGTP and alpha-32P-TTP and four of Solution A containing:
units of Klenow fragment were added. The reaction, in 100 pmoles d(GGTTGGCCAATCTACTC
a final volume of 10 ul and at the salt concentrations CCAGG) primer 8
given above, was allowed to proceed for 10 minutes. 50 100 pmoles d(TAACCTTGATAC
The polymerase activity was terminated by heating for CAACCTGCCC) primer
20 minutes at 60° C. Four ul aliquots of Reactions II-VI 1000 pmoles each of dATP, dCTP, dGTP and TTP
were loaded onto a 12% polyacrylamide gel 0.089M in The two primers were prepared by the technique
Tris-borate buffer at pH 8.3 and 2.5 mM in EDTA. The described in Example 2. The solution was heated to
gel was electrophoresed at 25 volts/cm for four hours 55 100 C. for four minutes and allowed to cool in ambient
after which autoradiography was performed. air for two minutes, after which was added 1 pull contain
FIG. 3 is an autoradiograph of the electrophoresis. ing four units Klenow fragment of E. coli DNA poly
Lane 1 is a molecular weight standard, Lane 2 is Reac merase. The reaction was allowed to proceed for 10
tion II, Lane 3 is Reaction III, Lane 4 is Reaction IV minutes after which the cycle of solution A addition,
and Lane 5 is Reaction V. Another lane for Reaction VI 60 heating, cooling, adding polymerase, and reacting was
with no DNA as control had no images in any of the repeated three times. To a 5.0 ul aliquot of the reactions
lanes. It can be seen from the figure that the 94-bp frag was added 5 picomoles of each oligonucleotide primer
ment predicted from the target DNA was present only described above. The solution was heated to 100° C. for
where intact g-globin DNA sequences were available four minutes and allowed to come to ambient tempera
for amplification, i.e., pHR328:HbA (Lane 2), 65 ture, after which 3 picomoles each of the alpha-32P
pBR328:HbS (Lane 3) and pbR328:HbS(MstII (Lane labeled deoxyribonucleoside triphosphates and 4 units
5). MstI digestion cuts pHR328:HbA in the 94-mer Klenow fragment were added. The reaction, in a final
sequence rendering it incapable of being amplified, and volume of 10 ul and at the salt concentrations given
 4,683,195 26
25
above, was allowed to proceed for 10 minutes. The SC-1, deposited with ATCC on Mar. 19, 1985, is an
polymerase activity was terminated by heating for 20 EBV-transformed B cell line homozygous for the sickle
minutes at 60° C. Two ul aliquots were digested with cell allele. GM2064 (Human Mutant Cell Repository,
Nicol, MstI, or Hinfl and loaded onto a 12% polyacryl GM2064) was originally isolated from an individual
amide gel 0.089M in Tris-borate at pH 8.3 and 2.5 mM homozygous for hereditary persistence of fetal hemo
in EDTA. The gel was electrophoresed at 25 volts/cm globin (HPFH) and contains no beta- or delta-globin
for four hours and autoradiography was performed. gene sequences. All cell lines were maintained in
FIG. 5 illustrates the autoradiograph of the electropho RPMI-1640 with 10% fetal calf serum.
resis, where Lane 1 is the molecular weight standard, Isolation of Human Genomic DNA from Clinical Blood
Lane 2 is without digestion with enzyme (240 bp intact), 10
Samples
Lane 3 is digestion with Ncol (131 and 109 bp), Lane 4
is digestion with MstII (149 and 91 bp), and Lane 5 is A clinical blood sample designated CH 12 from a
digestion with Hinf (144 and 96 bp). The autoradio known sickle cell carrier (AS) was obtained from Dr.
graph is consistent with the amplification of the 240 bp Bertram Lubin of Children's Hospital in Oakland, Calif.
Sequence. 15 Genomic DNA was prepared from the buffy coat frac
tion, which is composed primarily of peripheral blood
EXAMPLE 5 lymphocytes, using a modification of the procedure
This example illustrates use of the process herein to described by Nunberg et al., Proc. Nat. Acad. Sci. USA,
detect sickle cell anemia by sequential digestion. 75, 5553-5556 (1978).
The cells were resuspended in 5 ml Tris-EDTA-NaCl
Synthesis and Phosphorylation of (TEN) buffer (10 mM Tris buffer pH 8, 1 mM EDTA,
Oligodeoxyribonucleotides 10 mM NaCl) and adjusted to 0.2 mg/ml proteinase K,
A labeled DNA probe, RS06, of the sequence: 0.5% SDS, and incubated overnight at 37° C. Sodium
5 *CTGACTCCTGAGGAGAAGTCTGCCGT perchlorate was then added to 0.7M and the lysate
TACTGCCCTGTGGG 3' 25 gently shaken for 1-2 hours at room temperature. The
where * indicates the label, and an unlabeled blocking lysate was extracted with 30 ml phenol/chloroform
oligomer, RS10, of the sequence: (1:1), then with 30 ml chloroform, and followed by
3' GACAGAGGTCACCTCTTCAGACG ethanol precipitation of the nucleic acids. The pellet
GCAATGACGGGACACCC 5' was resuspended in 2 ml of TE buffer and RNase A
which has three base pair mismatches with RS06 were 30 added to 0.005 mg/ml. After digestion for one hour at
synthesized according to the procedures provided in 37 C., the DNA was extracted once each with equal
Example 20I). The probe RS06 was labeled by contact volumes of phenol, phenol/chloroform, and chloro
ing five pmole thereof with 4 units of T4 polynucleotide form, and ethanol precipitated. The DNA was resus
kinase (New England Biolabs) and 50 pmole y-32P-ATP pended in 0.5 nm.
(New England Nuclear, about 7200 Ci/mmole) in a 40 35
Polymerase Chain Reaction to Amplify Selectively
ul reaction volume containing 70 mM Tris buffer (pH £8-Globin Sequences
7.6), 10 mM MgCl2, 1.5 mM spermine, and 2.5 mM
dithioth reitol for 90 minutes at 37° C. The total volume Two micrograms of genomic DNA was amplified in
was then adjusted to 100 pull with 25 mM EDTA and an initial 100 ul reaction volume containing 10 mM Tris
purified according to the procedure of Maniatis et al., 40 buffer (pH 7.5), 50 mM. NaCl, 10 mM MgCl2, 150 pmole
Molecular Cloning. A Laboratory Manual (New York: of Primer A of the sequence d(CACAGGGCAC
Cold Spring Harbor Laboratory, 1982), pp. 464-465 TAACG), and 150 pmole of Primer B of the sequence
over a 1 ml Bio Gel P-4 spin dialysis column from Bio d(CTTTGCTTCTGACACA) and overlayed with
Rad equilibrated with Tris-EDTA (TE) buffer (10 mM about 100 ul mineral oil to prevent evaporation.
Tris buffer, 0.1 mM EDTA, pH 8.0). The labeled probe 45 Each DNA sample underwent 15 cycles of amplifica
was further purified by electrophoresis on a 18% poly tion where one cycle is composed of three steps:
acrylamide gel (19:1 acrylamide:BIS, Bio-Rad) in Tris (1) Denature in a heat block set at 95 C. for two
boric acid-EDTA (TBE) buffer (89 mM Tris, 89 mM minutes.
boric acid, 2.5 mM EDTA, pH 8.3) for 500 vhr. After (2) Transfer immediately to a heat block set at 30° C.
localization by autoradiography, the portion of the gel 50 for two minutes to allow primers and genomic DNA to
containing the labeled probe was excised, crushed and anneal.
eluted into 0.2 ml TE buffer overnight at 4" C. TCA (3) Add 2 ul of a solution containing 5 units of the
precipitation of the reaction product indicated that the Klenow frgment of E. coli DNA polymerase I (New
specific activity was 4.9 Ci/mmole and the final concen England Biolabs), 1 nmole each of dATP, dCTP, dGTP
tration was 20 pmole/ml. 55 and TTP, in a buffer composed of 10 mM Tris (pH 7.5),
The labeled RS10 blocking oligomer was used at a 50 mM. NaCl, 10 mM MgCl2, and 4 mM dithiothreitol.
concentration of 200 pmole/ml. This extension reaction was allowed to proceed for 10
minutes at 30° C.
Isolation of Human Genomic DNA from Cell Lines After the final cycle, the reaction was terminated by
High molecular weight genomic DNA was isolated 60 heating at 95 C. for two minutes. The mineral oil was
from the lymphoid cell lines Molta, SC-1 and GM2064 extracted with 0.2 ml of chloroform and discarded. The
using essentially the method of Stetler et al., Proc. Natl. final reaction volume was 130 ul.
Acad. Sci. USA (1982), 79, 5966-5970 (for Molta) and Hybridization/Digestion of Amplified Genomic DNA
Maniatis et al., Molecular Cloning. A Laboratory Manual with Probes and DdeI/Hinf
(New York: Cold Spring Harbor Laboratory, 1982), pp. 65
280-281. Forty-five microliters of the amplified genomic DNA
Molta (Human Mutant Cell Repository, GM2219C) was ethanol precipitated and resuspended in an equal
is a T cell line homozygous for normal g-globin, and volume of TE buffer. Ten microliters (containing the
 4,683, 195
27 28
pre-amplification equivalent of 154 ng of genomic EXAMPLE 7
DNA) was dispensed into a 1.5 ml Microfuge tube and
20 ul of TE buffer to a final volume of 30 ul. The sam A. A total of 100 fmoles pBR328 containing a 1.9 kb
ple was overlayed with mineral oil and denatured at 95 insert from the human beta-globin A allele, 50 nmoles
C. for 10 minutes. Ten microliters of 0.6M NaCl con- 5 each alpha-32P-dNTP at 500 Ci/mole, and 1 nmole of
taining 0.02 pmole of labeled RS06 probe was added to each of the primers used in Example 3 were dissolved in
the tube, mixed gently, and immediately transferred to a a solution containing 100 ul 30 mM Tris-acetate at pH
56° C. heat block for one hour. Four microliters of 7.9, 60 mM sodium acetate, 100 mM dithioth reitol, and
unlabeled RS10 blocking oligomer (0.8 pmole) was 10 mM magnesium acetate. This solution was brought
added and the hybridization continued for an additional 10 to 100° C. for two minutes and cooled to 25 C. for one
10 minutes at the same temperature. Five microliters of minute. A total of 1 ul containing 4.5 units Klenow
60 mM MgCl2/0.1% BSA and 1 ul of Ddel (10 units, fregment of E. coli DNA polymerase I and 0.09 units
New England Biolabs) were added and the reannealed inorganic pyrophosphatase was added to prevent the
DNA was digested for 30 minutes at 56°C. One microli possible build-up of pyrophosphate in the reaction mix
ter of Hinf (10 units, New England Biolabs) was then 15 ture, and the reaction was allowed to proceed for two
added and incubated for another 30 minutes. The reac minutes at 25 C., after which the cycle of heating,
tion was stopped by the addition of 4 ul 75 mM EDTA cooling, adding enzyme, and reacting was repeated nine
and 6 ul tracking dye to a final volume of 61 ul. times. Ten-ul aliquots were removed and added to lull
The mineral oil was extracted with 0.2 ml chloro 600 mM EDTA after each synthesis cycle. Each was
form, and 18 ul of the reaction mixture (45 ng genomic 20 analyzed on a 14% polyacrylamide gel in 90 mM Tris
DNA) was loaded onto a 30% polyacrylamide mini-gel borate and 2.5 mM EDTA at pH 8.3 and 24 volts/cm
(19:1, Bio-Rad) in a Hoeffer SE200 apparatus. The gel for 2.5 hours. The completed gel was soaked for 20
was electrophoresed at approximately 300 volts for one minutes in the same buffer with the addition of 0.5
hour until the bromophenol blue dye front migrated to ug/ml ethidium bromide, washed with the original
3.0 cm off-origin. The top 1.5 cm of the gel was re- 25 buffer, and photographed in UV light using a red filter.
moved and the remaining gel was exposed for four days The 110-bp fragment produced was excised from the
with one intensification screen at -70° C. gel under ultraviolet light and the incorporated 32P
Discussion of Photograph (FIG.9) counted by Cerenkov radiation. An attempt to fit the
data to an equation of the form: pmoles/10 ul=0.01
Each lane contains 45 ng of amplified genomic DNA. 30 (1+y)N-yN-1), where N represents the number of
Lane A contains Molta DNA; Lane B, CH12; Lane C, cycles and y the fractional yield per cycle, was optimal
SC-1; and Lane D, GM2064. Molta represents the geno with y = 0.619. This indicates that a significant amplifi
type of a normal individual with two copies of the 64 cation is occurring.
gene per cell (AA), CH 12 is a clinical sample from a B. The above experiment was repeated except that
sickle cell carrier with one g4 and one g5 gene per cell 35 100 nmoles of each dNTP was added to a 100 ul reac
(AS), and SC-1 represents the genotype of a sickle cell tion, no radiolabel was employed, and aliquots were not
individual with two copies of the £5 gene per cell (SS), removed at each cycle. After 10 cycles the reaction was
GM2064, which contains no beta- or delta-globin se terminated by boiling for two minutes and rehybridiza
quences, is present as a negative control. tion was performed at 57 C. for one hour. The se
As seen in the photograph, the Ddel-cleaved, g4- 40 quence of the 110-bp product was confirmed by subject
specific octamer is present only in those DNA's con ing 8 ul aliquots to restriction analysis by addition of 1
taining the 64 gene (Lanes A and B), and the Hinfl ul bovine serum albumin (25 mg/ml) and i ul of the
cleaved, 6S-specific trimer is present only in those appropriate restriction enzyme (Hinfl, MnlI, MstiI,
DNA's containing the GS gene (Lanes B and C). The NcoI) and by reaction at 37° C. for 15 hours. PAGE
presence of both trimer and octamer (Lane B) is diag- 45 was performed as described above.
nostic for a sickle cell carrier and is distinguishable from EXAMPLE 8
a normal individual (Lane A) with only octamer and a
sickle cell afflicted individual (Lane C) with only tri This example illustrates the use of different primers to
e. amplify various fragments of pBR328 and 322.
As a comparison, repeating the experiment described 50 A. The experiment described in Example 7A was
above using non-amplified genomic, DNA revealed repeated except using the following primers:
that the amplification increased the sensitivity of detec d(TTTGCTTCTGACACAACTGTGTTCAC
tion by at least 1000 fold. TAGC) and d(GCCTCACCACCAACTTCATC
EXAMPLE 6
CACGTTCACC) to produce a 130-bp fragment of
55 pBR328.
This example illustrates direct detection of a totally B. The experiment described in Example 7A was
unpurified single copy gene in which human DNA on repeated except using the following primers:
gels without the need for a labeled probe. d(GGTTGGCCAATCTACTCCCAGG) and
Using the technique described in Example 3, a 110-bp d(TGGTCTCCTTAAACCTGTCTTG) to produce a
fragment from a sequence in the first exon of the beta- 60 262-bp fragment of pBR328. The reaction time was 20
globin gene was amplified from 10 micrograms of minutes per cycle.
whole human DNA after 20 cycles. This 110-bp frag The experiment described in Example 8B was re
ment produced after 20 cycles was easily visualized on peated except that 100 fmoles of an Mst digest of
gels stained with ethidium bromide. pBR328 containing a 1.9 kb insert from the human beta
The sequence was not amplified when it was first cut 65 globin Sallele was used as initial template. This plasmid
with the restriction enzyme Dde unless, as in the beta was cleaved several times by MstI but not inside the
globin Sallele, the sequence does not contain the re sequence to be amplified. In addition, the primers em
striction site recognized by the enzyme. ployed were as follows:
 4,683,195 30
29
d(GGTTGGCCAATCTACTCCCAGG) and pBR322 and represent the T7 promoter described
d(TAACCTTGATACCAACCTGCCC) above. The promoter has been inserted adjacent to a
to produce a 240-bp fragment. 1000-bp fragment from pBR322.
D. The experiment described in Example 7B was The results indicate that a primer which is not a per
repeated except that 100 fmoles of an NruI digest of fect match to the template sequence but which is none
pBR322 was used as template, 200 nmoles of each theless able to hybridize sufficiently to be enzymatically
dNTP were used in the 100 ul reaction, and the primers extended produces a long product whwich contains the
Were: sequence of the primer rather than the corresponding
d(TAGGCGTATCACGAGGCCCT) and sequence of the original template. The long product
d(CTTCCCCATCGGTGATGTCG) O serves as a template for the second primer to introduce
to produce a 500-bp fragment from pBR322. Reaction an in vitro mutation. In further cycles this mutation is
times were 20 minutes per cycle at 37° C. Final rehy amplified with an undiminished efficiency, because no
bridization was 15 hours at 57 C. Electrophoresis was further mispaired primings are required. In this case, a
on a 4% agarose gel. primer which carries a non-complementary extension
EXAMPLE 9
5 on its 5' end was used to insert a new sequence in the
product adjacent to the template sequence being cop
This example illustrates the invention process ied.
wherein an in vitro mutation is introduced into the EXAMPLE 10
amplified segment.
A. A total of 100 fmoles of pBR322 linearized with 20 This example illustrates employing nested sets of
NruI, 1 nmole each of the primers: primers to decrease the background in the amplification
d(CGCATTAAAGCTTATCGATG) and of single copy genes.
d(TAGGCGTATCACGAGGCCCT) Whole human DNA homozygous for the wild-type
designed to produce a 75-bp fragment, 100 nmole each f3-globin allele was subjected to twenty cycles of ampli
dNTP, in 100 ul 40 mM Tris at pH 8, 20 mM in MgCl2, 25 fication as follows: A total of 10 ug DNA, 200 pico
5 mM in dithiothreitol, and 5 mg/ml bovine serum albu moles each of the primers:
min were combined. The mixture was brought to 100 d(ACACAACTGTGTTCACTAGC) and
C. for one minute, cooled for 0.5 minutes in a water bath d(CAACTTCATCCACGTTCACC)
at 23° C., whereupon 4.5 units Klenow fragment and and 100 nanomoles each dNTP in 100 ul of 30 mM
0.09 units inorganic pyrophosphatase were added, and a 30 Tris-acetate pH 7.9, 60 mm sodium acetate, 10 mM
reaction was allowed to proceed for three minutes. The dithiothreitol, and 10 mM magnesium acetate were
cycle of heating, cooling, adding enzymes, and reacting heated to 100° C. for one minute, cooled to 25 C. for
was repeated nine times. The tenth reaction cycle was one minute, and treated with 2 units Klenow fragment
terminated by freezing and an 8-ul aliquot of the reac for two minutes. The cycle of heating, cooling and
tion mixture was applied to a 4% agarose gel visualized 35 adding Klenow as repeated 19 times. A ten-ul aliquot
with ethidium bromide. was removed from the reaction mixture and subjected
B. The experiment described in Example 9A was to a further ten cycles of amplification using each of the
repeated except that the oligonucleotide primers em primers:
ployed were: d(CAGACACCATGGTGCACCTGACTCCTG)
d(CGCATTAAAGCTTATCGATG) and 40 and
d(AATTAATACGACTCACTATAGG d(CCCCACAGGGCAGTAACG
GAGATAGGCGTATCACGAGGCCCT). GCAGACTTCTCC),
Thse primers are designed to produce a 101-bp frag which amplify a 58-bp fragment contained within the
ment, 26 nucleotides of which (in the second listed 110-bp fragment produced above. This final ten cycles
primer) are not present in pBR322. These nucleotides 45 of amplification was accomplished by diluting the 10-ul
represent the sequence of the T7 promoter, which was aliquot into 90 ul of the fresh Tris-acetate buffer de
appended to the 75-bp sequence from pBR322 by using scribed above containing 100 nanomoles each dNTP
the primer with 20 complementary bases and a 26-base and 200 pmoles of each primer. Reaction conditions
5' extension. The procedure required less than two were as above. After ten cycles a 10-ul aliquot (corre
hours and produced two picomoles of the relatively 50 sponding to 100 nanograms of the original DNA) was
pure 101-bp fragment from 100 fmoles of pBR322. applied to a 6% NuSieve (FMC Corp.) agarose gel and
The T7 promoter can be used to initiate RNA tran visualized using ethidium bromide.
scription. T7 polymerase may be added to the 101-bp . FIG. 10 illustrates this gel illuminated with UV light
fragment to produce single-stranded RNA. and photographed through a red filter as is known in the
C. The experiment described in Example 8D was 55 art. Lane 1 is molecular weight markers. Lane 2 is an
repeated except that the olignonucleotide primers em aliquot of the reaction described above. Lane 3 is an
ployed were as follows: aliquot of a reaction identical to that described above,
d(TAGGCGTATCACGAGGCCCT) and except that the original wild-type DNA was cleaved
d(CCAGCAAGACGTAGCCCAGC) with DdeI prior to amplification. Lane 4 is an aliquot of
to produce a 1000-bp fragment from pBR322. 60 a reaction identical to that described above, except that
D. The experiment described in Example 9C was human DNA homozygous for the sickle betaglobin
repeated except that the oligonucleotide primers em allele was treated with Dde prior to amplification (the
ployed were as follows: sickle allele does not contain a Dde site in the fragment
d(TAGGCGTATCACGAGGCCCT) and being amplified here). Lane 5 is an aliquot of a reaction
d(AATTAATACGACTCACTATAGG 65 identical to that described above, except that salmon
GAGATAGGCGTATCACGAGGCCCT) sperm DNA was substituted for human DNA. Lane 6 is
so as to produce a 1026-bp fragment, 26 nucleotides of an aliquot of a reaction identical to that described
which (in the second listed primer) are not present in above, except that the aliquot was treated with Dde
 4,683, 195
31 32
after amplification (Ddel should convert the 58-bp
wild-type product into 27- and 31-bp fragments). Lane 7
is an aliquot of the Lane 4 material treated with Ddel
after amplification (the 58-bp sickle product contains no 5
Ddel site). where Y is O, NH or N-CHO, x is a number from 1 to
Detection of a 58-bp fragment representative of a 4, and y is a number from 2 to 4, as described in U.S.
Pat. Nos. 4,582,789 issued Apr. 15, 1986 and 4,617,261
single-copy gene from one microgram of human DNA issued Oct. 14, 1986, the disclosures of which are incor
using only ethidium bromide staining of an agarose gel O porated herein by reference. Detection of the biotinyl
requires an amplification of about 500,000-fold. This groups on the probe may be accomplished using a strep
was accomplished by using the two nested sets of oligo tavidin-acid phosphatase complex commercially obtain
able from Enzo Biochemical using the detection proce
nucleotide primers herein. The first set amplifies the dures suggested by the manufacturer in its brochure.
1 10-bp fragment and the inner nested set amplifies a 15 The hybridized probe is seen as a spot of precipitated
sub-fragment of this product up to the level of conve stain due to the binding of the detection complex, and
nient detection shown in FIG. 10. This procedure of the subsequent reaction catalyzed by acid phosphatase,
using primers amplifying a smaller sequence contained which produces a precipitable dye.
within the sequence being amplified in the previous EXAMPLE 12
amplification process and contained in the extension In this example, the process of Example 7 was basi
products of the other primers allows one to distinguish cally used to amplify a 119 base pair fragment on the
the wild-type from the sickle allele at the betaglobin human (3-hemoglobin gene using the primers:
5'-CTTCTGcagcAACTGTGTTCACTAGC-3'
locus without resorting to either radioisotropic or non 25 (GH18)
radioisotopic probe hybridization methodology such as 5'-CACaAgCTTCATCCACGTTCACC-3 (GH19)
that of Conner et al., Proc. Natl. Acad. Sci. USA, 80:278 where lower case letters denote mismatches from wild
(1983) and Leary et al., Proc. Natl. Acad. Sci. USA, type sequence to create restriction enzyme sites. The
full scheme is shown in Table I. Table I illustrates a
80:4045 (1983). diagram of the primers GH18 and GH19 which are used
EXAMPLE 11 for cloning and sequencing a 1 19-base pair fragment of
the human 6-globin gene and which are designed to
The present process is expected to be useful in detect contain internal restriction sites. The start codon ATG
ing, in a patient DNA sample, a specific sequence asso is underlined. GH18 is a 26-base oligonucleotide com
ciated with an infectious disease such as, e.g., Chlamy 35 plementary to the negative strand and contains an inter
dia using a biotinylated hybridization probe spanning nal PstI site. GH19 is a 23-base oligonucleotide comple
mentary to the plus strand and contains an internal
the desired amplified sequence and using the process HindIII recognition sequence. Arrows indicate the di
described in U.S. Pat. No. 4,358,535, supra. The bi rection of extension by DNA polymerase I. The boxed
otinylated hybridization probe may be prepared by 40 sequences indicate the restriction enzyme recognition
intercalation and irradiation of a partially double sequences of each primer. These primers were selected
stranded DNA with a 4'-methylene substituted 4,5'-8-
by first screening the regions of the gene for homology
to the Pst and HindIII restriction sites of bacteriophage
trimethylpsoralen attached to biotin via a spacer arm of M13. The primers were then prepared as described in
the formula: 45 previous examples.

50

55

60

65
 4,683,195
35
Amplification and Cloning TABLE II-continued
Blic N. A-Globin
After twenty cycles of amplification of microgram N. Plaques inserts Inserts' inscris
of human genomic DNA isolated from the cell line OAL 58 132 2)( 5
Molt 4 as described in Example 2, 1/14th of the reaction %, if plau's containing implified squices which contain f3-globin inscri
product was hybridized to the labeled 6-globin specific 5A2 . () 2.4%
oligonucleotide probe, RS06, of the sequence 5'- %( tainlaques which contain f3-globin inscri 15496 . . . .
CTGACTCCTGAGGAGAAGTCTGCCGT % of total plaques which contain anali?icci sequences i. 1206/496 - 100 ().8%
*Clear plaques which cle not hybridize to prinner C04
TACTGCCCTGTGGG-3 using the methods de **Cicir plaques which hybridize to primer PC 4
scribed above for oligomer restriction. Following solu 10
tion hybridization, the reaction mixture was treated
with Dde under restriction digestion conditions as Restriction Enzyme and Southern Blot Analysis
described above, to produce an 8-base pair oligonucleo DNAs from phage DNA minipreparation of three
tide. The amount of this 8-base pair product is propor p3-globin positive and two 6-globin negative (but PC04
tional to the amount of amplified product produced. 15
primer positive) plaques were analyzed by restriction
The digestion products were resolved on a 30% poly enzyme analysis. MstII digestion of DNA from M13
acrylamide gel and visualized by autoradiography. clones containing the amplified (3-globin fragment
Analysis of the autoradiogram revealed that the am should generate a characteristic 283 base-pair fragment.
plification was comparable in efficiency to that of am Following Mst I digestion, the three (3-globin positive
plification with primers PCO3 (5'- clones all produced the predicted 283 base pair frag
ACACAACTGTGTTCACTAGC-3) and PC04 (5'- ment, while the two clones which were positive only
CCACTTGCACCTACTTCAAC-3), which are com with the primer produced larger fragments.
plementary to the negative and positive strands, respec The gel from this analysis was transferred to a MSI
tively, of the wild-type 3-globin. nylon filter and hybridized with a radiolabeled nick
The amplified product was ethanol precipitated to 25
translated (3-globin probe prepared by standard nick
desalt and concentrate the sample, redissolved in a re translation methods as described by Rigby et al., J. Mol.
striction buffer of 10 mM Tris pH 8, 10 mM MgCl2, 1 Biol. (1977), 113:237-51. The only bands which hybrid
mM DTT, 100 mM NaCl2, and simultaneously digested ized to the g-globin probe were the three (3-globin
with PstI and HindIII. After digestion the sample was positive clones. The two other clones had inserts which
desalted with a Centricon 10 concentrator and ligated did not hybridize to the 6-globin probe.
overnight at 12" C. with 0.3 micrograms of the Pst/-
HindIII digested vector M13mp10w, which is publicly Sequence Analysis
available from Boehringer-Mannheim. Ten (3-globin positive clones which were shown by
The entire ligation mixture was transformed into E. 35 restriction enzyme analysis to contain the 3-globin in
coli strain JM103, which is publicly available from BRL sert were sequenced using the M13-dideoxy sequencing
in Bethesda, MD. The procedure followed by preparing method. Of the ten clones, nine were identical to the
the transformed strain is described in Messing, J. (1981) g-globin wild-type sequence. The other clone was iden
Third Cleveland Symposium on Macromolecules. Recom tical to the a-globin gene which had been shown to be
binant DNA, ed. A. Walton, Elsevier, Amsterdam, 40 amplified to only a small degree by the 6-globin prim
143-153. S.
The transformation mixture was plated onto x-gal In conclusion, the modified linker primers were
media for screening via plaque hybridization with nylon nearly as efficient as the unmodified primers in amplify
filters. The filters were probed with a 3-globin-specific ing the B-globin sequence. The primers were able to
oligonucleotide probe RS24 of the sequence 5'- facilitate insertion of amplified DNA into cloning vec
CCCACAGGGCAGTAACGGCAGACTTCTCCT 45 tors. Due to the amplification of other segments of the
CAGGAGTCAG-3' to determine the number of 3 genome, only 1% of the clones contained hemoglobin
globin inserts. The filters were then reprobed with the Sequences.
primer PC04 to determine the total number of inserts. Nine of the ten clones were found to be identical to
Plating and Screening 50 the published 6-globin sequence, showing that the tech
Table II summarizes the plating and plaque hybridi nique amplifies genomic DNA with high fidelity. One
zation data. The filters were probed with the primer clone was found to be identical with the published
PC04 to determine the percentage of inserts resulting a-globin sequence, confirming that the primers are spe
from amplification and cloning; 1206 clear plaques cific for the g-globin gene despite their having signifi
(90% of total number of clear plaques) hybridized to the 55 cant sequence homology with 8-globin.
primer. Fifteen plaques hybridized to the g-globin spe When cloning was carried out with a 267 base pair
cific probe RS24. The percentage of 6-globin positive fragment of the S-globin gene, cloning was effective
plaques among the amplified primer-positive plaques is only when dimethylsulfoxide was present (10% by vol
approximately 1%. ume at 37° C) in the amplification procedure.
60 Restriction site-modified primers were also used to
TABLE amplify and clone and partially sequence the human
Blue No 3-Giobin N-ras oncogene and to clone 240-base pair segments of
Plate No. Plaques Inserts' inserts' Inserts the HLA DQ-a and DQ-3 genes. All of these amplifica
28 25 246 1 tions were carried out in the presence of 10% by vol
2
3
29 18
26
222
180
2
O
65 ume dimethylsulfoxide at 37 C. The primers for ampli
4 24 20 192 5 fying HLA DQ-a and DQ-g genes were much more
5 22 27 185 5 specific for their intended targets than were the g
6 39 21 8. 3 globin and DR-6 primers, which, rather than giving a
 4,683, 195 38
37
discrete band on an ethidium bromide stained agarose GACAAGCCTGTAGCCCATGTTGTAG
gel, produced only a smear. In addition, the HLA DQ-o. CAAACCATC-3'
primers produced up to 20% of clones, with amplified (TN14) 5'-GCTCGGATCCTTACAGGGCAAT
inserts which contained the desired HLA target frag GACTCCAAAGTAGACCTGC
ment, whereas 1% of the S-globin clones contained the 5 CCAGACTCGGCAAAGT
target sequence. The HLA DQ-a and DQ-9 gene clon CGAGATACTTGGGCAGA-3'
ing was only effective when the DMSO was present OVERALL PROCEDURE
and the temperature was elevated.
Ten cycles of the protocol indicated below were
EXAMPLE 13 ro" carried out using primers TN 10 and TN11, which
This example illustrates the use of the process herein interact as shown in the diagram below, step (a).
to prepare the TNF gene of 494 base pairs starting from II. A total of 2 ul of the reaction mixture from Part I
two oligonucleotides of 74 base pairs each. above was added to the primers LL09 and LL 12. The
protocol described below was carried out for 15 cy
PRIMERS 15 cles, so that the primers would interact with the prod
The primers employed were prepared by the method uct of Part I as shown in the diagram below, step (b).
described in Example 2 and are identified below, each III. A total of 2 ul of the reaction mixture from Part II
being 74 mers. above was added to the primers TN08 and TN13.
(TN10) 5'-CCTCGTCTACTCCCAGGTCCTCTT The protocol described below was carried out for 15
CAAGGGCCAAGGCTGCCCCGAC- 20 cycles, so that the primers would interact with the
TATGTGCTCCTCACCCACACCGTCAGCC product of Part II as shown in the diagram below,
3' step (c).
(TN11) 5'-GGCAGGGGCTCTTGACG- IV. A total of 2 ul of the reaction mixture from Part III
GCAGAGAGGAGGTTCACCTTCTCCTG above was added to the primers LL07 and LL14. The
GTAGGAGATGGCGAAGCGGCT- 25 protocol described below was carried out for 15 cy
GACGGTGTGG-3' cles, so that the primers would interact with the prod
(LL09) 5'-CCTGGCCAATGGCATGGATCT uct of Part III as shown in the diagram below, step
GAAAGATAACCAGCTGGTGGTGCCAG (d).
CAGATGGCCTGTACCTCGTCTACTCCC-3' PROTOCOL
(LL12) 5'-CTCCCTGATAGATGGGCTCATAC- 30
CAGGGCTTGAGCT- Each reaction contained 100 ul of:
CAGCCCCCTCTGGGGTGTCCTTCGG 2 mM of each of dATP, dCTP, dGTP and TTP
GCAGGGGCTCTTG-3' 3 uM of each of the primers used at that step
(TN08) 5'-TGTAGCAAACCATCAAGTTGAG 1Xpolymerase buffer, (30 mM Tris-acetate, 60 mM
GAGCAGCTCGAGTGGCTGAGC- 35 Na-acetate, 10 mM Mg-acetate, 2.5 mM dithio
CAGCGGGCCAATGCCCTCCTGG threitol)
CCAATGGCA-3' Each cycle constituted:
(TN13) 5'-GATACTTGGGCAGATTGACCT (1) 1 min. in boiling water
CAGCGCTGAGTTGGTCACCCTTCT (2) 1 min. cooling at room temperature
CCAGCTGGAAGACCCCTCCCT- 40 (3) add 1 ul (5 units) of the Klenow fragment of DNA
GATAGATG-3' polymerase
(LL07) 5'-CCTTAAGCTTATGCTCAGAT (4) allow the polymerization reaction to proceed for 2
CATCTTCTCAAAACTCGAGT min. For the next cycle start again at step 1.

DIAGRAM

5' TN10--Ge.
<--5' TN11

-Gexxxxxxx product from

xxxxxxxxxx <- Part
(b)
L' LL09-Ge.
xxxxxxxxxx<- 5' TN11
--

5' TN10-GexXxxxxxxxx
 4,683,195
39 40
-continued
OAGRAM

5' LL09-G xxxxxx xxxxxxxx xxxxxxx

xxx xxxxxxxxxxxxxxxxxe-H-5' LL
intermediate state --
5' TN 10-Sexxxxxxxxxxxx xxxxx xxxx
xxxxxxxxxx xxxxxxxxx<-5' Ll2
only the sequence between 5' of LL09 and 5' LL 12
will be full length. The strands that contain
TN 10 and TNll have non-growing 5' ends. Thus . . .

5' LL09- G> xxxxxxxxxxxx xxxxxxxxxxx xxxxxxxx

xxxxxxxxxxxxxxxxxxxxxxxxxxxxx < 5' LL12
This is the product of Part II
(c)
5' TN08-Ge.
xxxxxxxxxxxxxxxxxxxxxxxxxxxx < 5' LL12
--
5' LL09 XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
e-5' TN13
- intermediate schema as (b)
5 TN08- G xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx xxxxxx (SH- 5 TN13
This is the product from Part II
(d)
5' LL07-Ge.
xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx<-5' TN13
--
5' TN08-G xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
- intermediate schema as (b) and (c)

5' LL07- G-xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx< 5 TN14
(TNF gene)

Deposit of Materials sion products are produced which can subsequently act
The cell line SC-1 (CTCC #0082) was deposited on as templates for further primer extension reactions. The
Mar. 19, 1985 with the American Type Culture Collec process is especially useful in detecting nucleic acid
tion (ATCC), 12301 Parklawn Drive, Rockville, Md. sequences which are initially present in only very small
20852 USA, with ATCC Accession No. CRLiF8756. 45 amounts. Also, the amplification process can be used for
The deposit of SC-1 was made pursuant to a contract molecular cloning.
between the ATCC and the assignee of this patent ap Other modifications of the above described embodi
plication, Cetus Corporation. The contract with ATCC ments of the invention which are obvious to those of
provides for permanent availability of the progeny of skill in the area of molecular biology and related disci
this cell line to the public on the issuance of the U.S. 50 plines are intended to be within the scope of the follow
patent describing and identifying the deposit or the ing claims.
publications or upon the laying open to the public of What is claimed is:
any U.S. or foreign patent application, whichever 1. A process for detecting the presence or absence of
comes first, and for availability of the progency of this at least one specific nuclei acid sequence in a sample
cell line to one determined by the U.S. Commissioner of 55 containing a nucleic acid or mixture of nucleic acids, or
Patents and Trademarks to be entitled thereto accord distinguishing between two different sequences in said
ing to 35 CFRS122 and the Commissioner's rules pursu sample, wherein the sample is suspected of containing
ant thereto (including 37 CFR Sl. 14 with particular said sequence or sequences, which process comprises:
reference to 886 OG 638). The assignee of the present (a) treating the sample with one oligonucleotide
application has agreed that if the cell line on deposit 60 primer for each strand of each different specific
should die or be lost or destroyed when cultivated sequence, under hybridizing conditions such that
under suitable conditions, it will be promptly replaced for each strand of each different sequence to which
on notification with a viable culture of the same cell an oligonucleotide primer is hybridized an exten
line. sion product of each primer is synthesized which is
In summary, the present invention is seen to provide 65 complementary to each nucleic acid strand,
a process for detecting sequences in nucleic acids by wherein said primer or primers are selected so as to
first amplifying one or more specific nucleic acid se be sufficiently complementary to each strand of
quences using a chain reaction in which primer exten each specific sequence to hybridize therewith such
 4,683,195 42
41
that the extension product synthesized from one 16. A process for detecting the presence or absence of
primer, when it is separated from its complement, a nucleic acid sequence containing a polymorphic re
can serve as a template for synthesis of the exten striction site specific for sickle cell anemia which se
sion product of the other primer; quence is suspected of being contained in a sample,
(b) treating the sample under denaturing conditions to 5 which process comprises:
separate the primer extension products from their (a) treating the sample, together or separately, with
templates if the sequence or sequences to be de an oligodeoxyribonucleotide primer for each
tected are present; strand, four different nucleoside triphosphates, and
(c) treating the sample with olignonucleotide primers an agent for polymerization under hybridizing con
such that a primer extension product is synthesized O ditions, such that for each strand of the nucleic acid
using each of the single strands produced in step (b) sequence an extension product of each primer is
as a template, resulting in amplification of the spe synthesized which is sufficiently complementary to
cific nucleic acid sequence or sequences if present; each strand of the nucleic acid sequence being
(d) adding to the product of step (c) a labeled oligo detected to hybridize therewith and contains the
nucleotide probe for each sequence being detected 15 region of the g-globin gene known potentially to
capable of hybridizing to said sequence or a muta contain the mutation that causes sickle cell anemia,
tion thereof; and wherein said primers are selected such that the
(e) determining whether said hybridization has oc extension product synthesized from one primer,
curred. when it is separated from its complement, can serve
2. The process of claim 1, wherein steps (b) and (c) 20 as a template for synthesis of the extension product
are repeated at least once. of the other primer;
3. The process of claim 1, wherein steps (a) and (c) (b) treating the sample under denaturing conditions to
are accomplished by treatment with four different nu separate the primer extension products from the
cleoside triphosphates and an agent for polymerization, templates on which they are synthesized if the
which are added together with or separately from the 25 sequence to be detected is present;
primer(s). (c) treating the product of step (b) with oligodeox
4. The process of claim 1, wherein said nucleic acid is yribonucleotide primers, four different nucleoside
double stranded and its strands are separated by dena triphosphates, and an agent polymerization such
turing before or during step (a). that a primer extension product is synthesized
5. The process of claim 1, wherein said nucleic acid is 30 using each of the single strands produced in step (b)
single stranded. as a template, resulting in amplification of the se
6. The process of claim 4, wherein said nucleic acid is quence to be detected if present;
DNA and said primers are oligodeoxyribonucleotides. (d) hybridizing said primer extension products of step
7. The process of claim 4, wherein said nucleic acid is (c) with a labeled oligodeoxyribonucleotide probe
RNA and said primers are oligodeoxyribonucleotides. 35 complementary to a normal 6-globin gene;
8. The process of claim 5, wherein said nucleic acid is (e) digesting the hybridized mixture from step (d)
DNA and said primers are oligodeoxyribonucleotides. with a restriction enzyme for the restriction site
9. The process of claim 5, wherein said nucleic acid is specific for sickle cell anemia; and
RNA and said primers are oligodeoxyribonucleotides. (f) detecting whether the digest contains a restriction
10. The process of claim 1, wherein each primer em fragment correlated with the presence of sickle cell
ployed contains a restriction site on its 5' end which is anemia.
the same as or different from a restriction site on an 17. The process of claim 16, wherein in step (d) the
other primer, and after step (c) and before step (d) the probe spans Dde and Hinf restriction sites, in step (e)
product of step (c) is cleaved with a restriction enzyme the restriction enzyme is Dde, and after step (e) and
specific for each of said restriction sites and the cleaved 45 before step (f) the mixture is digested with restriction
products are separated from the uncleaved products enzyme Hinf.
and used in step (d). 18. The process of claim 16, wherein in steps (d)-(f)
11. The process of claim 1, wherein the specific nu are present a positive control which contains a nucleic
cleic acid sequence contains at least one specific dele acid with the polymorphic restriction site specific for
tion or mutation that causes a genetic disease. 50 sickle cell anemia and a negative control which does not
12. The process of claim 11, wherein the genetic contain such nucleic acid.
disease is sickle cell anemia. 19. A process for synthesizing a nucleic acid fragment
13. The process of claim 11, wherein after step (c) and from an existing nucleic acid fragment having fewer
before step (d) the treated sample is cut with a restric nucleotides than the fragment being synthesized and
tion enzyme and electrophoresed and step (e) is accom 55 two oligonucleotide primers, wherein the nucleic acid
plished by Southern blot analysis. being synthesized is comprised of a left segment, a core
14. The process of claim 1, wherein the specific nu segment and a right segment, and wherein the core
cleic acid sequence is contained in a pathogenic organ segment is sufficiently complementary to the nucleotide
ism or is contained in an oncogene. sequence of said existing nucleic acid fragment to hy
15. The process of claim 1, wherein steps (a) and (c) 60 bridize therewith, and the right and left segments repre
are accomplished using an enzyme selected from the sent the nucleotide sequence present in the 5' ends of the
group consisting of E. coli DNA polymerase I, Klenow two primers, the 3' ends of which are complementary
fragment of E. coli DNA polymerase I, T4DNA poly to, or sufficiently complementary to hybridize with, the
merase, reverse transcriptase wherein the template is 3' ends of the single strands produced by separating the
RNA or DNA and the extension product is DNA, and 65 strands of said existing nucleic acid fragment, which
an enzyme that after being exposed to a temperature of process comprises:
about 65°-90° C. forms said extension products at the (a) treating the strands of said existing fragment with
temperature of reaction during steps (a) and (c). two oligonucleotide primers under conditions such
 4,683, 195
43 44
that an extension product of each primer is synthe gonucleotide is synthesized which is complemen
sized which is complementary to each nucleic acid tary to each nucleic acid strand;
strand, wherein said primers are selected so as to be (b) separating the extension products from the tem
sufficiently complementary to the 3' end of each plates on which they were synthesized to produce
strand of said existing fragment to hybridize there 5 single-stranded molecules; and
with, such that the extension product synthesized (c) treating the single-stranded molecules generated
from one primer, when it is separated from its com from step (b) with the oligonucleotides of step (a)
plement, can serve as a template for synthesis of the under conditions such that a primer extension
extension product of the other primer, and wherein product is synthesized using each of the single
each primer contains, at its 5' end, a sequence of O strands produced in step (b) as a template, resulting
nucleotides which are not complementary to said in amplification of the core fragment.
existing fragment and which correspond to the two 23. The process of claim 19, wherein the product of
ends of the nucleic acid fragment being synthe step (d) is purified before step (e).
sized;
24. The process of claim 19, wherein the product of
15 step (d) is not purified before step (e).
(b) separating the primer extension products from the 25. The process of claim 19, wherein steps (a) and (c)
templates on which they were synthesized to pro are accomplished by treatment with four different nu
duce single-stranded molecules; cleoside triphosphates and an agent for polymerization,
(c) treating the single-stranded molecules generared which are added together with or separately from the
from step (b) with the primers of step (a) under primers.
conditions such that a primer extension product is 26. A process for cloning into bacteriophage M13 a
synthesized using each of the single strands pro polymorphic genetic sequence on the human HLA DQ,
duced in step (b) as a template so as to produce two DR or DP Class Iia and G genes, which process com
intermediate double-stranded nucleic acid mole prises:
cules, into each of which has been incorporated the 25 (a) treating a genetic sequence of human HLA DQ,
nucleotide sequence present in the 5' end of one of DR, or DP Class II or and 3 genes with one oligo
the oligonucleotide primers, and two full-length nucleotide primer for each strand of said sequence,
double-stranded nucleic acid molecules, into each under conditions such that for each strand an ex
of which has been incorporated the nucleotide tension product of each primer is synthesized
sequence present in the 5' ends of both of the oligo 30 which is complementary to each nucleic acid
nucleotide primers; strand, wherein said primers are selected so as to be
(d) repeating steps (b) and (c) for a sufficient number sufficiently complementary to each strand to hy
of times to produce the full-length double-stranded bridize therewith such that the extension product
molecule in an effective amount; synthesized from one primer, when it is separated
(e) treating the strands of the product of step (d) with 35 from its complement, can serve as a template for
two primers so as to lengthen the product of step synthesis of the extension product of the other
(d) on both ends; and primer, and wherein each of said primers contains
a restriction site on its 5' end which is different
(f) repeating steps (a)-(d) using the product of step (d) from the restriction site on the other primer;
as the core fragment and two oligonucleotide prim 40 (b) separating the primer extension products from the
ers which are complementary to, or sufficiently templates on which they were synthesized to pro
complementary to hybridize with, the 3' ends of duce single-stranded molecules;
the single strands produced by separating the (c) treating the single-stranded molecules generated
strands of the product of step (d). from step (b) with oligonucleotide primers such
20. The process of claim 19, wherein steps (b) and (c) 45 that a primer extension product is synthesized
are repeated at least five times. using each of the single strands produced in step (b)
21. The process of claim 20, wherein the core seg as a template, wherein steps (a) and (c) are carried
ment used is the product of step (f). out in the presence of an effective amount of di
22. The process of claim 19, wherein the core frag methylsulfoxide to amplify sufficiently the amount
ment used is obtained by the steps comprising: 50 of sequence produced and at a temperature of
(a) reacting two oligonucleotides, each of which con 35-40 C.;
tain at their 3' ends a nucleotide sequence which is (d) adding to the product of step (c) a restriction
complementary to the other oligonucleotide at its enzyme for each of said restriction sites to obtain
3' end, and which are non-complementary to each cleaved products in a restriction digest; and
other at their 5' ends, with an agent for polymeriza 55 (e) ligating the cleaved products into said bacterio
tion and four nucleoside triphosphates under con phage M13 with2k a specific
k x:
orientation.
k
ditions such that an extension product of each oli

60

65
 UNITED STATES PATENT AND TRADEMARK OFFICE
CERTIFICATE OF CORRECTION

PATENT NO. : 4,683,195 Page 1 of 1

DATED : July 28, 1987
INVENTOR(S) : Mullis et al.

It is certified that error appears in the above-identified patent and that said Letters Patent is
hereby corrected as shown below:

Title page,
After Notice, please replace "The portion of the term of this patent Subsequent
to Jul. 28, 2004 has been disclaimed." with -- This patent is subject to a terminal
disclaimer. --

Signed and Sealed this

First Day of July, 2003

JAMES E ROGAN
Director of the United States Patent and Trademark Office