Hindawi

Oxidative Medicine and Cellular Longevity

Volume 2022, Article ID 9304383, 21 pages
https://doi.org/10.1155/2022/9304383

Research Article
High Level of Uric Acid Promotes Atherosclerosis by Targeting
NRF2-Mediated Autophagy Dysfunction and Ferroptosis

Wei Yu ,1 Weidong Liu,1 De Xie,1 Qiang Wang,1 Chenxi Xu,1 Hairong Zhao,1 Jiaming Lv,1
Furong He,1 Bingyang Chen,1 Tetsuya Yamamoto,2 Hidenori Koyama,2
and Jidong Cheng 1,2,3
1
Department of Internal Medicine, Xiang’an Hospital of Xiamen University, School of Medicine, Xiamen University, Xiamen,
Fujian, China
2
Department of Diabetes, Endocrinology and Clinical Immunology, Hyogo College of Medicine, Nishinomiya, Hyogo, Japan
3
Xiamen Key Laboratory of Translational Medicine for Nucleic Acid Metabolism and Regulation, Xiamen, Fujian, China

Correspondence should be addressed to Jidong Cheng; [email protected]

Wei Yu and Weidong Liu contributed equally to this work.

Received 19 January 2022; Revised 22 March 2022; Accepted 29 March 2022; Published 18 April 2022

Academic Editor: Fuqiang Liu

Copyright © 2022 Wei Yu et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Atherosclerotic vascular disease (ASVD) is the leading cause of death worldwide. Hyperuricemia is the fourth risk factor for
atherosclerosis after hypertension, diabetes, and hyperlipidemia. The mechanism of hyperuricemia affecting the occurrence and
development of atherosclerosis has not been fully elucidated. Mononuclear macrophages play critical roles in all stages of
atherosclerosis. Studies have confirmed that both hyperuricemia and ferroptosis promote atherosclerosis, but whether high
level of uric acid (HUA) promotes atherosclerosis by regulating ferroptosis in macrophages remains unclear. We found that
HUA significantly promoted the development of atherosclerotic plaque and downregulated the protein level of the NRF2/
SLC7A11/GPX4 signaling pathway in ApoE−/− mice. Next, we evaluated the effect of HUA and ferroptosis inhibitor
ferrostatin-1 (Fer-1) treatment on the formation of macrophage-derived foam cells. HUA promoted the formation of foam
cells, decreased cell viability, and increased iron accumulation and lipid peroxidation in macrophages treated with oxidized
low-density lipoprotein (oxLDL); these effects were reversed by Fer-1 treatment. Mechanistically, HUA significantly inhibited
autophagy and the protein level of the NRF2/SLC7A11/GPX4 signaling pathway. Fer-1 activated autophagy and upregulated
the level of ferroptosis-associated proteins. Moreover, an NRF2 inducer (tertbutyl hydroquinone (TBHQ)) and autophagy
activator (rapamycin (RAPA)) could reverse the inhibitory effect of HUA on foam cell survival. Our results suggest that HUA-
induced ferroptosis of macrophages is involved in the formation of atherosclerotic plaques. More importantly, enhancing
autophagy and inhibiting ferroptosis by activating NRF2 may alleviate HUA-induced atherosclerosis. These findings might
contribute to a deeper understanding of the role of HUA in the pathogenesis of atherosclerosis and provide a therapeutic
target for ASVD associated with hyperuricemia.

1. Introduction mortality [3–6]. For each 1 mg/dl increase in serum uric acid
(sUA) level, the risk of death from atherosclerotic vascular
Hyperuricemia is a metabolic disorder syndrome caused by disease (ASVD) is increased by 48% in men and 126% in
purine nucleotide metabolism disorder. The overall preva- women [7]. However, the molecular mechanisms of high
lence of hyperuricemia in China is 13.3%, and it has become level of uric acid (HUA) affecting the occurrence and devel-
a common metabolic disease after diabetes [1, 2]. Hyperuri- opment of ASVD are far from being clarified.
cemia is not only an independent risk factor for cardiovascu- Ferroptosis is a newly discovered nonapoptotic-regulated
lar disease but also an independent predictor of all-cause cell death characterized by iron accumulation and lipid
2 Oxidative Medicine and Cellular Longevity

peroxidation [8–10]. The ferroptosis of macrophage-derived AC026) antibodies and C11-BODIPY (Cat# RM02821) were
foam cells plays a crucial role in the formation and develop- from ABclonal (Wuhan, China). Phorbol 12-myristate 13-
ment of atherosclerotic plaques [11–14]. Glutathione peroxi- acetate (PMA) (Cat# 16561-29-8), UA (Cat# 69-93-2), and
dase 4 (GPX4) is considered one of the most important RAPA (Cat# 53123-88-9) were from Sigma (USA). Fer-1
antioxidant enzymes because of its unique ability to reduce (Cat# HY-100579) and TBHQ (Cat# HY-100489) were from
phospholipid hydroperoxide activity [15, 16]. Inactivation of MCE (USA). Human oxLDL (Cat# YB-002) was from
GPX4 in mice and cells led to excessive lipid peroxidation, Yiyuan Biotechnologies (Guangzhou, China).
thus triggering ferroptotic cell death [14, 15, 17]. In contrast,
GPX4 overexpression removed oxidative lipid modifications 2.2. Animals and Treatment. ApoE−/− mice (C57BL/6J
and inhibited plaque formation in ApoE−/− mice [18]. background) were purchased and fed in the Laboratory
Ferrostatin-1 (Fer-1), a selective inhibitor of erastin-induced Animal Center of Xiamen University (Fujian, China).
ferroptosis, could inhibit atherosclerosis progression in vivo Eight-week-old male ApoE−/− mice were randomly divided
[13]. However, whether HUA can promote the occurrence into three groups: standard laboratory diet (SLD) group
and development of atherosclerosis by regulating ferroptosis (fed a standard laboratory diet for 16 weeks, n = 6), high
in macrophage-derived foam cells remains unclear. fat diet (HFD) group (fed a fat-rich Western diet (provided
Nuclear factor erythroid 2-related factor 2 (NFE2L2/ 37% kcal in fat, Cat# HD012a, Botai, Beijing) for 16 weeks, n
NRF2) is a key regulator of antioxidant responses because = 6), and HUA and high fat diet (HUA+HFD) group (fed a
many of its downstream target genes are involved in pre- fat-rich Western diet for 16 weeks and intraperitoneally injected
venting or correcting redox imbalance in cells [19, 20]. with hypoxanthine (100 mg/kg) and oteracil potassium
NRF2 also plays an essential role in many key metabolic (150 mg/kg) once every two days for the last 3 weeks, n = 6).
pathways, including iron/heme metabolism, proteostasis, All experimental procedures and animal housing in this
carbohydrate and lipid metabolism, and apoptosis [21–26]. study were designed and conducted in accordance with the
Thus, NRF2 has emerged as a major regulator of lipid perox- approval of the Institutional Animal Care and Use Commit-
idation and ferroptosis. GPX4 and the cysteine/glutamate tee of Xiamen University, China (Animal Ethics No.
transporter system xC-/xCT/SLC7A11 are important down- XMULAC20200122).
stream regulatory targets of NRF2 [9, 26, 27]. Recent studies
have indicated that NRF2 is involved in regulating some 2.3. Serum Biochemical Profile Detection. Biochemical kits
genes related to macrophage autophagy, such as p62 and were used to detect sUA (Cat# C102) and lipid profiles,
Atg5 [28–32]. Treating ApoE−/− mice with tertbutyl hydro- including total cholesterol (TC) (Cat# A111), triglycerides
quinone (TBHQ), an NRF2 inducer, had a protective effect (TG) (Cat# A110), and high-density lipoprotein-cholesterol
on atherosclerosis [33]. The molecular mechanisms are by (HDL-C) and low-density lipoprotein-cholesterol (LDL-C)
upregulating antioxidant and anti-inflammatory effects and (Cat# A112 and A113, respectively), following the manufac-
by enhancing the autophagic flux of macrophages in plaque turer’s instructions. The supernatant of the mice blood sam-
[33]. Therefore, ferroptosis is considered an autophagic cell ples was centrifuged and determined by using a microplate
death process, with NRF2-mediated autophagy playing a reader (Thermo, USA). All Biochemical kits were from Nan-
crucial role [34, 35]. Recent study confirmed that HUA jing Jiancheng Bioengineering Institute (Nanjing, China).
inhibits NRF2 signaling and promotes the production of 2.4. Cell Cultures and Treatment. THP-1 cells and
excessive reactive oxygen species (ROS) in chicken embryo RAW264.7 cells were obtained from the American Type Cell
cardiomyocytes [36]. Therefore, we speculated that NRF2- Collection and grown in RPMI-1640 and DMEM medium
mediated ferroptosis may contribute to the occurrence and (Gibco, Shanghai) containing 10% fetal bovine serum
development of hyperuricemia-associated ASVD. (Gibco, Shanghai). RAW264.7 cells were incubated with
In this study, we determined the effects and underlying DMEM, and THP-1 cells were primed with 160 nM PMA
mechanisms of HUA on the transition of macrophage phe- for 24 h, then exposed to oxLDL (100 μg/ml), or coincubated
notypes and the formation of atherosclerosis in ApoE−/− with UA (15 mg/dl) and oxLDL for another 24 h. In experi-
mice and macrophages treated with oxidized low-density ments involving inhibitors or activators, the cells were pre-
lipoprotein (oxLDL). HUA impaired mitochondrial func- treated with Fer-1 (2 μM), TBHQ (10 μM), or RAPA
tion, inhibited NRF2 signaling and autophagy, increased fer- (10 μM) for 0.5 h, and then, oxLDL and/or UA was added
roptosis, and thus promoted the formation of atherosclerotic for another 24 h.
plaques; all effects were reversed by treatment with Fer-1.
2.5. Oil Red O Staining. To observe atherosclerotic plaque
2. Materials and Methods formation in vivo and the fat accumulation in vitro, the cells
were exposed to various treatments, and frozen serial cross-
2.1. Antibodies and Chemicals. Rabbit anti-NRF2 (Cat# sections of aortic tissue were stained with Oil red O (Cat#
ab62352), Alexa Fluor 488 anti-rabbit secondary antibody C0158S, Beyotime, China) [37]. ImageJ was used to analyze
(Cat# ab150077), and iron assay kit (Cat# ab83366) were atherosclerotic lesion area in 3 cross-sections/mouse (n = 5).
from Abcam (UK). Anti-LC3B (Cat# 2775) and anti-p62
(Cat# 39749) antibodies were from CST (USA). GPX4 2.6. Immunohistochemical Staining. To assess the infiltration
(Cat# A1933), SLC7A11 (Cat# A15604), CD68 (Cat# of macrophages in the atherosclerotic lesion area of the
A13286), GAPDH (Cat# AC002), and β-actin (Cat# aortic sinus, 3 cross-sections/mouse (n = 3) underwent
Oxidative Medicine and Cellular Longevity 3

Table 1: qPCR primer sequences.

Gene Species Sense/antisense Sequence (5 ′ -3 ′ )

CD36 Human Sense TTGATGTGCAAAATCCACAGG
Antisense TGTGTTGTCCTCAGCGTCCT
ABCA1 Human Sense ACCCACCCTATGAACAACATGA
Antisense GAGTCGGGTAACGGAAACAGG
ABCG1 Human Sense ATTCAGGGACCTTTCCTATTCGG
Antisense CTCACCACTATTGAACTTCCCG
NFE2L2 Human Sense TCAGCGACGGAAAGAGTATGA
Antisense CCACTGGTTTCTGACTGGATGT
SLC7A11 Human Sense TCTCCAAAGGAGGTTACCTGC
Antisense AGACTCCCCTCAGTAAAGTGAC
GPX4 Human Sense GAGGCAAGACCGAAGTAAACTAC
Antisense CCGAACTGGTTACACGGGAA
CD36 Mouse Sense ATGGGCTGTGATCGGAACTG
Antisense GTCTTCCCAATAAGCATGTCTCC
ABCA1 Mouse Sense GCTTGTTGGCCTCAGTTAAGG
Antisense GTAGCTCAGGCGTACAGAGAT
ABCG1 Mouse Sense CTTTCCTACTCTGTACCCGAGG
Antisense CGGGGCATTCCATTGATAAGG
NFE2L2 Mouse Sense TCTTGGAGTAAGTCGAGAAGTGT
Antisense GTTGAAACTGAGCGAAAAAGGC
SLC7A11 Mouse Sense GGCACCGTCATCGGATCAG
Antisense CTCCACAGGCAGACCAGAAAA
GPX4 Mouse Sense GCCTGGATAAGTACAGGGGTT
Antisense CATGCAGATCGACTAGCTGAG
β-Actin Human Sense AGCGAGCATCCCCCAAAGTT
Antisense GGGCACGAAGGCTCATCATT
β-Actin Mouse Sense GCAGGAGTACGATGAGTCCG
Antisense GGGTGTAAAACGCAGCTCAG

Table 2: Body weight and serum biochemical profiles of ApoE−/− mice.

Parameters SLD (n = 6) HFD (n = 6) HUA+HFD (n = 6)

Body weight (g) 27:22 ± 1:03 29:17 ± 1:52∗ 27:0 ± 0:95+
sUA (μmol/l) 247:3 ± 35:43 490:20 ± 106:00∗∗ 1066:00 ± 180:90+++
TG (mmol/l) 1:20 ± 0:51 3:22 ± 0:19∗∗∗ 3:39 ± 0:52
∗∗∗
TC (mmol/l) 5:79 ± 1:41 43:09 ± 1:08 43:21 ± 2:21
HDL-C (mmol/l) 3:36 ± 0:42 2:74 ± 0:82 5:05 ± 1:13+
∗∗∗
LDL-C (mmol/l) 1:11 ± 0:41 18:13 ± 1:67 13:94 ± 1:64+
Data are means ± SD. HDL-C: high-density lipoprotein-cholesterol; HFD: high fat diet; HUA+HFD: high level of uric acid and high fat diet; LDL-C: low-
density lipoprotein-cholesterol; SLD: standard laboratory diet; sUA: serum uric acid; TC: total cholesterol; TG: triglycerides. ∗ P < 0:05, ∗∗ P < 0:01, and ∗∗∗
P < 0:001 compared to SLD; +P < 0:05 and +++P <0.001 compared to HFD.

immunohistochemical staining with anti-CD68 antibody bation overnight at 4°C. After a wash the next day, the cells
(1 : 100 dilution) [37]. ImageJ software was used for data were incubated with Alexa Fluor 488 anti-rabbit secondary
analyses. antibody (1 : 1000 dilution) at room temperature and out
of light for 1 h and then incubated with DAPI (4 ′ ,6 ′ -diam-
2.7. Immunofluorescence Microscopy. Frozen sections of aor- idino-2-phenylindole) in 1% goat serum for 5 min at room
tic tissue (3 cross-sections/mouse, n = 3) were fixed, perme- temperature. The cells were imaged by laser scanning confo-
abilized, and blocked, and the primary antibodies (NRF2, cal microscopy (FV1000 MPE-B, Olympus, Tokyo, Japan).
SLC7A11, and GPX4, 1 : 100 dilution) were added for incu- ImageJ software was used for data analyses.
4 Oxidative Medicine and Cellular Longevity

SLD HFD HUA+HFD

Oil-red O staining

100 𝜇m

(a)
500 ⁎⁎⁎

Aortic root lesion area

400

(×103 𝜇m2)
300
⁎⁎⁎
200

100

0 SLD

HFD

HUA+HFD
(b)
SLD HFD HUA+HFD
IHC staining (CD68)

50 𝜇m

(c)
⁎
3
Relative macrophage
content in plaques

⁎
2

0
SLD

HFD

HUA+HFD

(d)

Figure 1: HUA promotes atherosclerosis development in ApoE mice. Eight-week-old male ApoE−/− mice were randomly divided into
−/−

three groups (SLD, HFD, and HUA+HFD); when the mice reached age 22 weeks (after 14 weeks with various treatment), aortas were
dissected. (a) Oil red O staining of frozen aortic root sections from the 3 groups. (b) Quantification of the aortic root lesion areas
(×103μm2). Data are means ± SD, 3 cross-sections/mouse, n = 5. (c) Macrophage infiltration in the aortic root sections examined by IHC
staining with an anti-CD68 antibody and (d) quantification. Data are means ± SD, 3 cross-sections/mouse, n = 3. HFD: high fat diet;
HUA: high level of uric acid; HUA+HFD: high level of uric acid and high fat diet group; IHC: immunohistochemical; SLD: standard
laboratory diet. ∗ P < 0:05 and ∗∗∗ P < 0:001.
Oxidative Medicine and Cellular Longevity 5

HFD HUA+HFD HFD HUA+HFD

SLC7A11
NRF2

DAPI
DAPI

Merge
Merge

100 𝜇m 100 𝜇m

(a) (b)
HFD HUA+HFD NRF2
20 ⁎⁎⁎
Fluorescence intensity

15
GPX4

10

0
HFD

HUA+HFD
DAPI
Merge

100 𝜇m

(c) (d)

Figure 2: Continued.
6 Oxidative Medicine and Cellular Longevity

SLC7A11 GPX4
⁎⁎ 25 ⁎⁎⁎
15

Fluorescence intensity
Fluorescence intensity
20
10 15
10
5
5

0 0

HFD

HUA+HFD
HFD

HUA+HFD
(e) (f)

Figure 2: HUA inhibits the protein level of the NRF2/SLC7A11/GPX4 signaling pathway in atherosclerotic plaque from HFD-treated
ApoE−/− mice. The protein level of the NRF2/SLC7A11/GPX4 signaling pathway was assessed by immunofluorescence staining. (a–c)
Representative immunostaining of NRF2, SLC7A11, and GPX4 in aortic atherosclerotic lesions in HUA+HFD versus HFD group. (d–f)
Quantification of the mean fluorescence intensity for NRF2, SLC7A11, and GPX4. Data are means ± SD, 3 cross-sections/mouse, n = 3.
HFD: high fat diet; HUA: high level of uric acid; HUA+HFD: high level of uric acid and high fat diet group. ∗∗ P < 0:01 and ∗∗∗ P < 0:001.

2.8. Cell Viability Assay. Cell viability was evaluated by using to the method provided by the assay kit. The absorbance
the cell counting kit-8 (CCK-8) (Cat# K1018, APExBIO, was measured at 410 nm on a microplate reader.
USA) according to the manufacturer’s instructions. Briefly,
the cells were seeded into 96-well plates at a density of 5 × 2.13. Transmission Electron Microscopy (TEM). After treat-
103 cells per well and incubated for 24 h before being sub- ment, cell specimens were fixed with 2.5% glutaraldehyde
jected to various treatments. Following that, 10 μl of CCK8 and sliced into ultrathin slices. The slices were then stained
solution was added to each well and cultivated for 2 hours. with uranyl acetate and lead citrate. Finally, put the slice
The absorbance at 450 nm was measured by a microplate under the TEM (HT-7800; Hitachi, Tokyo) and investigate
reader (Multiskan Skyhigh, Thermo, USA). the cell ultrastructure.

2.9. Malondialdehyde (MDA) Assay. Relative MDA concen- 2.14. Measurement of Mitochondrial Membrane Potential
tration in cell lysates was assessed with a lipid peroxidation (MMP). MMP was measured by using the JC-1 staining
assay kit (Cat# A003-1) purchased from Nanjing Jiancheng assay kit (Cat# C2006, Beyotime, China) according to the
Bioengineering Institute (China) according to the manufac- manufacturer’s instructions. Briefly, the cells were incubated
turer’s instructions. Briefly, after adding TBA to cell lysates, with JC-1 fluorescent probe for 20 minutes in the dark at
the absorbance was recorded at 532 nm using a microplate 37°C. After washing with PBS, cell images were detected
reader to calculate the MDA level. using a fluorescent microscope (IX83, Olympus Co., Japan).
The average fluorescence intensity (AFI) was quantified by
2.10. Iron Assay. Intracellular ferrous iron (Fe2+) level was using ImageJ.
determined by using an iron assay kit (Abcam, Cat#
ab83366) according to the manufacturer’s instructions. The 2.15. RNA Extraction, cDNA Synthesis, and qPCR Analysis.
cells were lysed on ice, and supernatants were collected Total RNA was isolated with the RNeasy Mini Kit (Cat#
and coincubated with 5 μl Iron Reducer solution at 37°C B511311, Sangon Biotech, Shanghai), and 2 μg of total
for 30 min. Then, 100 μl Iron Probe was added and incu- RNA was used for cDNA synthesis with the PrimeScript
bated in darkness at 37°C for 1 h. The absorbance was mea- RT-PCR Kit (Cat# KR106, TIANGEN, Beijing). Quantitative
sured at 593 nm with a microplate reader. PCR involved using the Hieff qPCR SYBR Green Master Mix
(Cat# 11201, Yeason, Shanghai). Samples were obtained and
2.11. Lipid ROS Assay. Lipid ROS level was detected by flow analyzed on the CFX96 Touch Quantitative PCR (qPCR)
cytometry (FCM) with BODIPY-C11 dye. In brief, the cells Detection System (Bio-Rad, USA). Gene levels were normal-
were treated as indicated; then, 50 μM C11-BODIPY ized to β-actin level. The primer sequences are in Table 1.
(ABclonal, Cat# RM02821) was added and incubated for
1 h. Lipid ROS generation was analyzed by FCM according 2.16. Immunoblotting. The cells were trypsinized and
to the manufacturer’s instructions. washed twice with ice-cold PBS and then lysed in radioim-
munoprecipitation lysis buffer (Cat# EA0002, Sparkjade Bio-
2.12. Glutathione (GSH) Assay. The relative GSH level in cell technology, China) with protease and phosphatase
lysates was analyzed by using a GSH assay kit (Cat# A006-2, inhibitors. Cell lysates were resolved by 13% SDS-PAGE
Nanjing Jiancheng Bioengineering Institute) according to and transferred to polyvinylidene difluoride (PVDF) mem-
the manufacturer’s instructions. RAW264.7 and THP-1 cells branes (Millipore, Billerica, MA, USA), which were incu-
were seeded at 5 × 105 cells in 6-well plates. After 24 h of bated with the indicated primary antibodies (1 : 1000
treatment with different methods, the supernatant of cell dilution) at 4°C overnight and then HRP-conjugated sec-
lysates was taken and GSH level was determined according ondary antibodies (1 : 2000 dilution) for 1 h at room
Oxidative Medicine and Cellular Longevity 7

THP-1
Oil-red O staining Control oxLDL UA+oxLDL Fer-1+UA+oxLDL

25 𝜇m

(a)
RAW264.7
Control oxLDL UA+oxLDL Fer-1+UA+oxLDL
Oil-red O staining

25 𝜇m

(b)
THP-1 RAW264.7
⁎⁎⁎ ⁎⁎⁎ ⁎⁎⁎ ⁎⁎⁎
20 30
(𝜇g/mg protein)
Total cholesterol

(𝜇g/mg protein)
Total cholestero

15
20
10 ⁎⁎⁎ ⁎⁎⁎
5 10

0 0
oxLDL – + + + oxLDL – + + +
UA – – + + UA – – + +
Fer-1 – – – + Fer-1 – – – +
(c) (d)

Figure 3: HUA promotes macrophage-derived foam cell formation in THP-1 and RAW264.7 cells. THP-1 and RAW264.7 cells were treated
with oxLDL (100 μg/ml) or coincubated with UA (15 mg/dl) and with or without Fer-1 (2 μM) for 24 h. (a and b) Oil red O staining to
evaluate the effect of HUA and Fer-1 on the formation of foam cells. (c and d) Quantification of the lipid accumulation in THP-1 and
RAW264.7 cells. Data are means ± SD, n = 3. Fer-1: ferrostatin-1; HUA: high level of uric acid; oxLDL: oxidized low-density lipoprotein;
UA: uric acid. ∗∗∗ P < 0:001.

temperature. The protein bands were imaged by using the serum lipid profile, and atherosclerotic lesion formation
Enhanced Chemiluminescence Kit (Cat# 34580, Thermo, were assessed after 16 weeks of various treatment. As com-
USA), and detection involved using Azure Biosystems pared with HFD mice, HUA+HFD mice showed slightly
C300 (USA). The band intensities were quantified by using decreased body weight, but a 2.17-fold increase in sUA level
ImageJ. (Table 2). HUA+HFD mice showed elevated HLD-C level,
with decreased LDL-C level (Table 2). Oil red O staining of
2.17. Statistical Analysis. Data are presented as means ± SD. the aortic sinus showed a significant increase in lipid accumu-
Unpaired Student’s t test was used to compare two groups lation in HUA+HFD versus HFD mice (Figure 1(a)). Plaque
and one-way ANOVA to compare multiple groups. All data lesion area in the aortic sinus was 2.67-fold greater in
were analyzed by using GraphPad Prism 8.0 (GraphPad HUA+HFD than HFD mice (Figure 1(b)). These results sug-
Software, Inc.). P < 0:05 was considered statistically gest that HUA may play a critical role in the aggravation of
significant. atherosclerosis. Likewise, immunohistochemical results
showed that macrophage infiltration in the atherosclerotic
3. Results lesion area of the aortic sinus was significantly higher in
HUA+HFD than HFD mice (Figures 1(c) and 1(d)).
3.1. HUA Promotes the Development of Atherosclerosis in
ApoE−/− Mice. To explore the pathophysiological roles of 3.2. HUA Inhibits the Protein Level of the NRF2/SLC7A11/
HUA in atherosclerosis, ApoE−/− mice were given SLD, GPX4 Signaling Pathway in Macrophages in Atherosclerotic
HFD, or HUA+HFD treatment. sUA levels, body weight, Plaques. Ferroptosis of macrophage-derived foam cells plays
8 Oxidative Medicine and Cellular Longevity

THP-1 THP-1
120 ⁎⁎ ⁎⁎⁎
⁎⁎⁎ 1.6

Cell viability (% of control)

100 1.4 ⁎⁎

Fe2+ (fold of control)

80 ⁎⁎⁎ ⁎⁎⁎ 1.2
1.0
60 0.8
40 0.6
0.4
20
0.2
0 0.0
oxLDL – + + + oxLDL – + + +
UA – – + + UA – – + +
Fer-1 – – – + Fer-1 – – – +

(a) (b)
THP-1 THP-1
5 1.2 ⁎⁎⁎
⁎⁎⁎ ⁎⁎⁎ ⁎⁎
MDA (fold of control)

1.0

GSH (fold of control)

4
⁎⁎⁎ ⁎⁎
0.8
3
0.6
2
0.4
1 0.2
0 0.0
oxLDL – + + + oxLDL – + + +
UA – – + + UA – – + +
Fer-1 – – – + Fer-1 – – – +
(c) (d)
RAW264.7 RAW264.7
⁎⁎⁎ ⁎⁎⁎
120 ⁎⁎ 1.6
Cell viability (% of control)

100 1.4
⁎⁎ ⁎⁎ ⁎⁎
Fe2+ (fold of control)

1.2
80
1.0
60 0.8
40 0.6
0.4
20
0.2
0 0.0
oxLDL – + + + oxLDL – + + +
UA – – + + UA – – + +
Fer-1 – – – + Fer-1 – – – +
(e) (f)

Figure 4: Continued.
Oxidative Medicine and Cellular Longevity 9

RAW264.7 GSH of RAW264.7

10 ⁎⁎⁎ ⁎⁎⁎ 10 ⁎⁎⁎ ⁎⁎⁎

MDA (fold of control)

MDA (fold of control)

8 8

6 ⁎⁎⁎ 6 ⁎⁎⁎

4 4

2 2

0 0
oxLDL – + + + oxLDL – + + +
UA – – + + UA – – + +
Fer-1 – – – + Fer-1 – – – +

(g) (h)
THP-1

Control: All events oxLDL: All events UA+oxLDL: All events Fer-1+UA+oxLDL: All events
C11-BODIPY staining coupled with FCM

Control oxLDL UA+oxLDL Fer-1+UA+oxLDL

200

200 200 200

Count

Count
P1 (12.68%) P1 (55.98%)
Count

P1 (2.02%) P1 (13.38%)

Count
100
100 100 100

0 0 0 0
2 3 4 5 6 2 3 4 5 6 2 3 4 5 6 2 3 4 5 6
10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10
Log green fluorescence 530/15 Log green fluorescence 530/15 Log green fluorescence 530/15 Log green fluorescence 530/15

(i)
RAW264.7

Control: All events oxLDL: All events UA+oxLDL: All events Fer-1+UA+oxLDL: All events
C11-BODIPY staining coupled with FCM

400 Control oxLDL UA+oxLDL Fer-1+UA+oxLDL

300 300 300

P1 (0.66%) 200 P1 (43.72%) 200 P1 (59.33%) 200 P1 (36.62%)

Count

Count

Count

Count

200

100 100 100

0 0 0 0
2 3 4 5 6 2 3 4 5 6 2 3 4 5 6 2 3 4 5 6
10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10
Log green fluorescence 530/15 Log green fluorescence 530/15 Log green fluorescence 530/15 Log green fluorescence 530/15

(j)
THP-1 RAW264.7
80 80
⁎⁎⁎ ⁎⁎⁎ ⁎⁎⁎ ⁎⁎⁎
60
Lipid ROS (%)

60
Lipid ROS (%)

⁎⁎⁎
40 40

20 ⁎⁎ 20

0 0
oxLDL – + + + oxLDL – + + +
UA – – + + UA – – + +
Fer-1 – – – + Fer-1 – – – +
(k) (l)

Figure 4: HUA-induced ferroptosis is a key regulatory promoting foam cell formation. THP-1 and RAW264.7 cells were treated with
oxLDL (100 μg/ml) or coincubated with UA (15 mg/dl) with or without Fer-1 (2 μM) for 24 h. (a and e) Cell viability was assayed by
using a CCK-8 kit. (b and f) The accumulation of Fe2+ was measured by an iron detection assay. (c and g) Lipid formation was
measured by MDA assay. (d and h) Relative GSH level was detected by using an assay kit. (i and j) C11-BODIPY staining coupled with
FCM was used to assess lipid ROS levels. (k and l) Quantification of lipid ROS levels. Data are means ± SD, n = 3 − 7. FCM: flow
cytometry; Fer-1: ferrostatin-1; GSH: glutathione; HUA: high level of uric acid; MDA: malondialdehyde; oxLDL: oxidized low-density
lipoprotein; ROS: reactive oxygen species; UA: uric acid. ∗∗ P < 0:01 and ∗∗∗ P < 0:001.
10 Oxidative Medicine and Cellular Longevity

THP-1
Control oxLDL UA+oxLDL
Transmission electron microscopy

20 𝜇m

(a)
RAW264.7

Control oxLDL UA+oxLDL

Transmission electron microscopy

20 𝜇m

(b)
THP-1 RAW264.7
JC-1 aggregates JC-1 monomers Merge JC-1 aggregates JC-1 monomers Merge
Control

Control
Mitochondrial membrane potential

Mitochondrial membrane potential

oxLDL

oxLDL
UA+oxLDL

UA+oxLDL
Fer-1+UA+oxLDL

Fer-1+UA+oxLDL

50 𝜇m 50 𝜇m

(c) (d)

Figure 5: Continued.
Oxidative Medicine and Cellular Longevity 11

RAW264.7
20 THP-1 20 ⁎⁎⁎
⁎⁎
15 ⁎⁎⁎ ⁎ ⁎
⁎⁎ 15 ⁎⁎⁎ ⁎
⁎⁎⁎ ⁎ ⁎⁎⁎ ⁎⁎
10 10

JC-1 AFI
JC-1 AFI

5 5
5 5
4 4
3 ⁎⁎ ⁎⁎ ⁎⁎
⁎⁎⁎ ⁎⁎⁎
⁎⁎ 3
2 2
1 1
0 0
Red Green Red/Green Red Green Red/Green

Control UA+oxLDL Control UA+oxLDL

oxLDL Fer-1+UA+oxLDL oxLDL Fer-1+UA+oxLDL

(e) (f)

Figure 5: Mitochondrial damage contributes to HUA-induced ferroptosis in foam cells. THP-1 and RAW264.7 cells were treated with
oxLDL (100 μg/ml) or coincubated with UA (15 mg/dl) with or without Fer-1 (2 μM) for 24 h. (a and b) TEM images of macrophages
treated with oxLDL or coincubated with UA. Arrows indicate mitochondria. (c and d) A JC-1 staining kit was used to assess MMP level
in THP-1 and RAW264.7 cells. (e and f) Quantification of MMP level. Data are means ± SD, n = 3. AFI: average fluorescence intensity;
Fer-1: ferrostatin-1; HUA: high level of uric acid; MMP: mitochondrial membrane potential; oxLDL: oxidized low-density lipoprotein;
TEM: transmission electron microscopy; UA: uric acid. ∗ P < 0:05, ∗∗ P < 0:01, and ∗∗∗ P < 0:001.

a crucial role in the formation and development of athero- (Figures 4(a)–4(l)). Intriguingly, Fer-1 also reversed HUA-
sclerotic plaques [11, 12, 38–41]. The NRF2/SLC7A11/ enhanced foam cell formation (Figures 3(a) and 3(b)) and
GPX4 signaling pathway is one of the most important reversed the increased lipid accumulation (Figures 3(c) and
defense systems for ferroptosis [21, 23, 26, 27, 42–45]. To 3(d)). Therefore, HUA specifically regulates oxLDL-
this end, we used immunofluorescence staining to detect induced ferroptosis in macrophages and promotes foam cell
the protein level of the NRF2/SLC7A11/GPX4 signaling formation by ferroptosis.
pathway in aortic plaque. HUA significantly inhibited the
protein level of the signaling pathway (Figures 2(a)–2(f)), 3.5. Mitochondrial Damage Contributes to HUA-Induced
which suggests that NRF2-mediated ferroptosis is involved Ferroptosis in Foam Cells. In addition to iron overload and
in the progression of hyperuricemia-associated ASVD. lipid peroxidation, mitochondrial changes are another major
feature of ferroptosis. Accordingly, we observed mitochon-
3.3. HUA Promotes Macrophage-Derived Foam Cell drial ultrastructural changes in THP-1 and RAW264.7 cells
Formation in THP-1 and RAW264.7 Cells. Macrophage- treated with oxLDL or coincubated with UA for 24 h. TEM
derived foam cell formation is a crucial step in the pathogen- results showed that mitochondria were generally smaller
esis of atherosclerosis [46]. We evaluated the effect of HUA and mitochondrial cristae were reduced in the UA-treated
on the formation of macrophage-derived foam cells. THP-1 group (Figures 5(a) and 5(b)). These changes in mitochon-
and RAW264.7 cells were exposed to oxLDL (100 μg/ml) or drial structure may lead to mitochondrial dysfunction. To
coincubated with UA (15 mg/dl) and oxLDL for 24 h. Oil red further confirm the effect of UA on mitochondrial func-
O staining revealed that HUA enhanced foam cell formation tion in foam cells, we examined the MMP by JC-1 stain-
(Figures 3(a) and 3(b)) and increased lipid accumulation ing. The red average fluorescence intensity (AFI) and
(Figures 3(c) and 3(d)). Thus, HUA promoted foam cell for- red/green fluorescence ratio were significantly reduced
mation in THP-1 and RAW264.7 cells. after UA treatment (Figures 5(c)–5(f)), so the MMP was
reduced in foam cells. However, green AFI was not signif-
3.4. HUA-Induced Ferroptosis Is a Key Regulatory Factor icantly increased as expected. These phenomena were par-
Promoting Foam Cell Formation. Ferroptosis has been asso- tially alleviated by Fer-1 treatment (Figures 5(c)–5(f)).
ciated with various tissue and organ diseases, including neu- These data indicate that HUA induced mitochondrial dys-
rodegenerative diseases, acute kidney injury, myocardial function, which contributed to inducing ferroptosis in
ischemia–reperfusion injury, and ASVD [11, 26, 38, 39, macrophage-derived foam cells.
41]. To gain insights into the potential mechanisms by
which HUA promotes foam cell formation, we assessed the 3.6. NRF2-Mediated Autophagy Dysfunction and Ferroptosis
ferroptosis of foam cells treated with UA (15 mg/dl). HUA Are Involved in Foam Cell Formation Induced by HUA.
treatment promoted oxLDL-induced cell death in THP-1 GPX4 and SLC7A11 are central regulators of ferroptosis as
and RAW264.7 cells (Figures 4(a) and 4(e)), along with well as downstream target genes of NRF2 [21, 22, 27, 44].
increased ferroptotic events including iron accumulation To investigate whether the NRF2/SLC7A11/GPX4 signaling
(Figures 4(b) and 4(f)), MDA production (Figures 4(c) and pathway was regulated by HUA in foam cells, we detected
4(g)), GSH depletion (Figures 4(d) and 4(h)), and lipid the expression of the pathway by qPCR and western blot
ROS production (Figures 4(i)–4(l)). In contrast, pretreat- analysis. HUA decreased the protein level of the NRF2/
ment with Fer-1 increased cell viability in oxLDL-treated SLC7A11/GPX4 signaling pathway in macrophage-derived
macrophages owing to reduced ferroptotic events foam cells (Figures 6(c)–6(f)), which was further confirmed
12 Oxidative Medicine and Cellular Longevity

THP-1
⁎⁎ ⁎⁎ ⁎⁎⁎ ⁎⁎⁎
2.5 ⁎⁎⁎ ⁎⁎⁎

Relative mRNA expression

2.0

(fold of control)
⁎⁎ ⁎⁎⁎
1.5 ns ⁎⁎
ns ⁎⁎⁎
1.0

0.5

0.0
CD36 ABCA1 ABCG1 NFE2L2 SLC7A11 GPX4

Lipid metabolism Ferroptosis

Control
oxLDL
UA+oxLDL
(a)
RAW264.7
4 ⁎⁎ ⁎
Relative mRNA expression

3
(fold of control)

⁎⁎ ⁎⁎ ⁎ ⁎⁎
2 ⁎ ⁎⁎⁎
ns ⁎⁎⁎ ns ⁎⁎⁎
1

0
CD36 ABCA1 ABCG1 NFE2L2 SLC7A11 GPX4

Lipid metabolism Ferroptosis

Control
oxLDL
UA+oxLDL
(b)
THP-1 RAW264.7
NRF2 100 kDa NRF2 100 kDa

SLC7A11 55 kDa SLC7A11 55 kDa

GPX4 22 kDa GPX4 22 kDa

p62 62 kDa p62 62 kDa

I 17 kDa
LC3B I 17 kDa
II 15 kDa LC3B 15 kDa
II
GAPDH 37 kDa GAPDH 37 kDa

Control oxLDL UA+oxLDL Control oxLDL UA+oxLDL

(c) (d)

Figure 6: Continued.
Oxidative Medicine and Cellular Longevity 13

THP-1
1.5

Relative mRNA expression

ns ns ⁎ ⁎ ns ⁎
⁎⁎⁎ ⁎⁎⁎

(fold of control)
1.0 ⁎⁎
⁎⁎

0.5

0.0
NRF2 SLC7A11 GPX4 p62 LC3B (II/I)

Control
oxLDL
UA+oxLDL
(e)
RAW264.7
2.0
Relative mRNA expression

⁎ ⁎⁎⁎
1.5 ns ns ⁎⁎
ns
(fold of control)

⁎⁎⁎ ⁎⁎⁎ ⁎⁎⁎

1.0 ⁎⁎

0.5

0.0
NRF2 SLC7A11 GPX4 p62 LC3B (II/I)

Control
oxLDL
UA+oxLDL
(f)

Figure 6: NRF2-mediated autophagy dysfunction and ferroptosis are involved in foam cell formation induced by HUA. THP-1 and
RAW264.7 cells were treated with oxLDL (100 μg/ml) or coincubated with UA (15 mg/dl) for 24 h. (a and b) qPCR was used to detect
the transcription of lipid metabolism-related genes (CD36, ABCA1, and ABCG1) and ferroptosis-related genes (NFE2L2, SLC7A11, and
GPX4) in macrophage-derived foam cells. (c and d) Representative western blot images of the protein level of the NRF2/SLC7A11/GPX4
signaling pathway and autophagy-related proteins (LC3B and p62). (e and f) Quantification of NRF2, SLC7A11, GPX4, LC3B, and p62
protein levels. Data are means ± SD, n = 3. ABCA1: ATP-binding cassette transporter A1; ABCG1: ATP-binding cassette transporter G1;
HUA: high level of uric acid; oxLDL: oxidized low-density lipoprotein; qPCR: quantitative PCR. ns indicates no significance. ∗ P < 0:05,
∗∗
P < 0:01, and ∗∗∗ P < 0:001.

by qPCR results (Figures 6(a) and 6(b)). In addition, qPCR ing pathway was decreased by HUA and restored by Fer-1
results showed that HUA inhibited the transcription of lipid treatment (Figures 7(a)–7(d)). Consistently, Fer-1 restored
metabolism-related genes such as CD36, ATP-binding cas- the protein level of the autophagy-related proteins LC3B
sette transporter A1 (ABCA1), and ATP-binding cassette and p62 (Figures 7(a)–7(d)). These results support that
transporter G1 (ABCG1) (Figures 6(a) and 6(b)). Notably, HUA promotes atherosclerosis by modulating NRF2-
HUA also suppressed the protein level of LC3B and p62, mediated autophagy dysfunction and ferroptosis.
which are markers of autophagic status (Figures 6(c)–6(f)).
Collectively, these data suggest that NRF2-mediated autoph- 3.8. NRF2 Inducer (TBHQ) and Autophagy Activator
agy dysfunction and ferroptosis may be involved in foam cell (RAPA) Could Reverse the Inhibitory Effect of HUA on
formation associated with HUA. Foam Cell Survival. To further study the role of NRF2 or
autophagy in HUA-induced ferroptosis, we used TBHQ
3.7. Ferroptosis Inhibitor (Fer-1) Reverses HUA-Induced and RAPA to activate NRF2 and autophagy in foam cells,
Foam Cell Formation by Regulating NRF2-Mediated respectively. TBHQ significantly enhanced the protein level
Autophagy Dysfunction and Ferroptosis. To confirm the role of NRF2, along with SLC7A11 and GPX4 (Figures 8(a) and
and molecular mechanism of ferroptosis involved in HUA- 8(b) and 8(d) and 8(e)) and reversed the inhibitory effect
induced foam cell formation, we used the specific inhibitor of HUA on foam cell survival (Figures 8(c) and 8(f)). Simi-
of ferroptosis, Fer-1. As shown in Figures 3 and 4, Fer-1 larly, pretreatment with RAPA significantly activated
treatment reversed HUA-induced foam cell formation and autophagy, as evidenced by increased protein levels of
inhibited HUA-induced ferroptosis in foam cells. In addi- LC3B and p62 (Figures 8(a) and 8(b) and 8(d) and 8(e)),
tion, the protein level of the NRF2/SLC7A11/GPX4 signal- and reversed the HUA-induced ferroptosis (Figures 8(c)
14 Oxidative Medicine and Cellular Longevity

THP-1
NRF2 100 kDa

SLC7A11 55 kDa

GPX4 22 kDa

p62 62 kDa

I 17 kDa
LC3B 15 kDa
II

GAPDH 37 kDa
oxLDL – + + +
UA – – + +
Fer-1 – – – +
(a)
THP-1
2.0
⁎⁎⁎
Relative protein expression

1.5 ns ⁎⁎⁎ ns ⁎⁎ ⁎ ⁎⁎ ⁎ ⁎⁎⁎ ns

(fold of control)

⁎
⁎⁎⁎ ⁎⁎⁎ ⁎⁎
1.0
⁎⁎

0.5

0.0
NRF2 SLC7A11 GPX4 p62 LC3B (II/I)

Control UA+oxLDL
oxLDL Fer-1+UA+oxLDL
(b)
RAW264.7
NRF2 100 kDa

SLC7A11 55 kDa

GPX4 22 kDa

p62 62 kDa

I 17 kDa
LC3B
II 15 kDa

GAPDH 37 kDa
oxLDL – + + +
UA – – + +
Fer-1 – – – +
(c)

Figure 7: Continued.
Oxidative Medicine and Cellular Longevity 15

RAW264.7
2.0

Relative protein expression

ns ⁎⁎⁎ ns ⁎⁎⁎ ⁎ ⁎⁎⁎ ⁎⁎⁎ ns ⁎⁎⁎ ⁎⁎
1.5

(fold of control)
⁎⁎⁎ ⁎⁎⁎ ⁎⁎⁎ ⁎⁎ ⁎⁎
1.0

0.5

0.0
NRF2 SLC7A11 GPX4 p62 LC3B (II/I)

Control UA+oxLDL
oxLDL Fer-1+UA+oxLDL
(d)

Figure 7: A ferroptosis inhibitor (Fer-1) reverses HUA-induced foam cell formation by targeting NRF2-mediated autophagy dysfunction
and ferroptosis. THP-1 and RAW264.7 cells were treated with oxLDL (100 μg/ml) or coincubated with UA (15 mg/dl) with or without
Fer-1 (2 μM) for 24 h. Western blot assay was used to detect the protein level of the NRF2/SLC7A11/GPX4 signaling pathway and
autophagy-related proteins (LC3B and p62). (a and c) Representative western blot images of NRF2, SLC7A11, GPX4, LC3B, and p62. (b
and d) Quantification of NRF2, SLC7A11, GPX4, LC3B, and p62 protein levels. Data are means ± SD, n = 3: Fer-1: ferrostatin-1; HUA:
high level of uric acid; oxLDL: oxidized low-density lipoprotein; UA: uric acid. ns indicates no significance. ∗ P < 0:05, ∗∗ P < 0:01, and ∗∗∗
P < 0:001.

and 8(f)). In sum, all these results further support that HUA rosis [53, 56]. However, the molecular mechanisms by which
promotes atherosclerosis by targeting NRF2-mediated HUA promotes atherosclerosis are far from clear. Therefore,
autophagy dysfunction and ferroptosis. the current treatment of hyperuricemia-associated ASVD is
limited, and there is an urgent need to discover new mecha-
4. Discussion nisms and provide new therapeutic targets.
Ferroptosis is a newly discovered type of regulated cell
Collectively, in this study, we found that HUA impaired death mainly mediated by iron-dependent lipid peroxidation
mitochondrial function, decreased cell viability and GSH and has contributed to many pathological processes includ-
level, and increased lipid ROS levels and iron accumulation ing ASVD, cancer development, neurodegenerative disease,
in macrophage-derived foam cells, which were all reversed and acute kidney injury [11, 26, 38, 39]. Accumulating evi-
by Fer-1 treatment. Also, HUA inhibited the autophagy of dence suggests that HUA can promote oxidative activity
foam cells and the protein level of the NRF2/SLC7A11/ and increase the production of ROS [37, 57]. Therefore, we
GPX4 signaling pathway, which were also reversed by Fer- speculated that HUA may promote the progression of ath-
1. HUA promoted the formation of atherosclerotic plaque erosclerosis by regulating ferroptosis in foam cells. In this
and foam cells in ApoE−/− mice and macrophages, respec- study, we found that HUA promotes the formation of ath-
tively. In addition, NRF2-mediated autophagy dysfunction erosclerotic plaque and foam cells in ApoE−/− mice and mac-
and ferroptosis may be involved in the occurrence and pro- rophages, respectively. HUA decreased cell viability and
gression of hyperuricemia-associated ASVD (Figure 9). GSH level and increased lipid ROS levels and iron accumu-
ASVD has become one of the leading causes of death lation in foam cells, which were all reversed by Fer-1 treat-
worldwide [47, 48]. An increasing number of epidemiologi- ment. Immunofluorescence results and western blot
cal and clinical studies have shown hyperuricemia strongly analysis also confirmed that HUA inhibited the protein level
associated with the occurrence and progression of many of GPX4 and SLC7A11, which are critical key factors in the
metabolic diseases, including atherosclerosis, hypertension, processing of ferroptosis in ApoE−/− mice and macrophage-
diabetes, and chronic kidney disease [3, 49–54]. The preva- derived foam cells. Thus, HUA can promote atherosclerosis
lence of hyperuricemia is increasing and in younger people by regulating ferroptosis in vivo and in vitro.
worldwide. About 177 million people have hyperuricemia Recent studies have shown that ferroptosis is an autoph-
in China, nearly 60% of whom are aged 18 to 35 years agic cell death process [34, 58, 59]. Autophagy plays a key
[55]. Thus, hyperuricemia has become the fourth largest risk role in regulating ferroptosis because of its ability to regulate
factor for atherosclerosis after hypertension, diabetes melli- cellular iron homeostasis and cellular ROS generation [35,
tus, and hyperlipidemia. ASVD associated with hyperurice- 60]. Dysfunction of autophagy in macrophages contributes
mia increases the global healthcare burden. to atherosclerosis. Impaired autophagy-lysosomal degrada-
Elevated sUA level may impair endothelial dysfunction tion system leads to lipid accumulation, facilitating athero-
by inflammation and oxidative stress, thus forming unstable sclerotic plaque, while enhancing autophagy mitigates
lipid plaques in arteries and eventually leading to atheroscle- atherosclerosis development [61–66]. Consistently, we
16 Oxidative Medicine and Cellular Longevity

THP-1 THP-1
8
NRF2 100 kDa

Relative protein expression

SLC7A11 55 kDa 6 ⁎⁎⁎

(fold of control)
GPX4 22 kDa ⁎⁎⁎ ⁎⁎⁎ ⁎⁎⁎
⁎⁎⁎
4 ⁎⁎⁎ ⁎⁎⁎
p62 62 kDa ⁎⁎⁎
⁎⁎⁎
I 17 kDa 2 ns
LC3B
II 15 kDa
𝛽-actin 0
NRF2 SLC7A11 GPX4 p62 LC3B (II/I)
oxLDL + + +
UA + + + UA+oxLDL
TBHQ – + – TBHQ+UA+oxLDL
RAPA – – + RAPA+UA+oxLDL
(a) (b)
THP-1 RAW264.7
120
⁎⁎⁎ NRF2 100 kDa
Cell viability (% of control)

100 ⁎⁎
SLC7A11 55 kDa
80 ⁎⁎⁎ ⁎⁎⁎
GPX4 22 kDa
60
p62 62 kDa
40
I 17 kDa
20 LC3B
II 15 kDa
0 𝛽-actin 42 kDa
oxLDL – + + + + oxLDL + + +
UA – – + + + UA + + +
TBHQ – – – + – TBHQ – + –
RAPA – – – – + RAPA – – +
(c) (d)
RAW264.7 RAW264.7
5 120 ⁎⁎ ⁎⁎
⁎⁎ ⁎⁎⁎
Cell viability (% of control)
Relative protein expression

⁎⁎ 100
4
⁎ ⁎⁎⁎ ⁎⁎⁎ ⁎⁎⁎ ⁎⁎⁎
(fold of control)

⁎⁎⁎ 80
3
⁎⁎ ⁎⁎ 60
2
ns 40
1
20
0 0
NRF2 SLC7A11 GPX4 p62 LC3B (II/I)
oxLDL – + + + +
UA+oxLDL UA – – + + +
TBHQ+UA+oxLDL TBHQ – – – + –
RAPA+UA+oxLDL RAPA – – – – +
(e) (f)

Figure 8: NRF2 inducer (TBHQ) and autophagy activator (RAPA) could reverse the inhibitory effect of HUA on foam cell survival. THP-1
and RAW264.7 cells were pretreated with TBHQ (10 μM) or RAPA (10 μM) for 0.5 h before coincubation with oxLDL (100 g/ml) and UA
(15 mg/dl) for another 24 h. Western blot was used to detect the protein level of NRF2, LC3B, and p62. A CCK-8 kit was used to assay the
cell viability of foam cells. (a and d) Representative western blot images of NRF2, SLC7A11, GPX4, LC3B, and p62. (b and e) Quantification
of NRF2, SLC7A11, GPX4, LC3B, and p62 protein levels. (c and f) The cell viability of foam cells. Data are means ± SD, n = 3 − 5. HUA: high
level of uric acid; oxLDL: oxidized low-density lipoprotein; RAPA: rapamycin; TBHQ, tertbutyl hydroquinone. ns indicates no significance.
∗
P < 0:05, ∗∗ P < 0:01, and ∗∗∗ P < 0:001.
Oxidative Medicine and Cellular Longevity 17

ApoE–/– mice Macrophage

oxLDL
Uric acid
Glu Cys2

OAT SLC3A2
SLC7A11 –
System xC

HFD NRF2 Glu Cys

Glu
Gly
Mitochondrial GSH
Vessel dysfunction
GPX4
LC3B
p62
LC3B
p62 LC3B
Lipid ROS Fe2+

Hypoxanthine
+
Oteracil potassium
Lysosomal
degradation
Ferroptosis

HFD

Membrane destabilization
Smooth Endothelium
muscle cell
Foam cell of
Foam cell of
macrophage
smooth muscle
origin
origin
Foam cell T cell

Figure 9: Schematic illustration of HUA promoting atherosclerosis by triggering ferroptosis in macrophage-derived foam cells. HUA
induces mitochondrial dysfunction and inhibits NRF2 signaling, which may in turn impair macrophage autophagy and increase foam
cell ferroptosis, thereby accelerating atherosclerosis. GPX4: glutathione peroxidase; GSH: glutathione; HFD: high fat diet; HUA: high
level of uric acid; NRF2: nuclear factor erythroid 2-related factor 2; OAT: organic anion transporter; oxLDL: oxidized low-density
lipoprotein; ROS: reactive oxygen species; UA: uric acid.

found that HUA suppressed the protein levels of LC3B and homeostasis by regulating cellular antioxidants [19, 20]. In
p62, which are markers of autophagic status, in addition to the NRF2 signaling pathway, autophagy is
macrophage-derived foam cells. That is, HUA impaired another major intracellular defense system to combat oxida-
autophagy and increased the lipid accumulation in macro- tive damage and maintain homeostasis in mammals [69].
phages. Interestingly, Fer-1 treatment restored the HUA- p62 is an ubiquitin-binding autophagy receptor protein that
inhibited protein levels of LC3B and p62. Additionally, an can connect to the NRF2 pathway and autophagy [32].
autophagy activator (RAPA) could reverse the inhibitory Increasing evidence has emerged for the important role of
effect of HUA on foam cell survival. This result was consis- NRF2 in regulating ferroptosis [21]. Certain ferroptosis acti-
tent with a previous report showing that autophagy directly vators (erastin and sorafenib) can induce an interaction
regulates SLC7A11, thereby maintaining tumor cell growth between p62 and KEAP1, thus activating NRF2 and the
and proliferation [60]. In addition to SLC7A11, selective expression of antiferroptosis genes [70]. NRF2 transcription
autophagy also regulates ferroptosis by degrading GPX4 regulates several ferroptosis-related genes, including iron
[67, 68]. Therefore, autophagy-dependent ferroptosis plays metabolism genes (HMOX1, FTH1, and FPN) [42, 71–74],
an important role in tumorigenesis and development. The a GSH synthesis- and release-related gene (SLC7A11) [22,
role of autophagy in ferroptosis was inconsistent with our 74, 75], and antioxidant genes (GPX4, NQO1 (NAD (P) H
current study, in which we showed that HUA inhibited mac- quinone dehydrogenase 1), TXNRD1, etc.) that enhance
rophage autophagy and increased ferroptosis, thereby pro- resistance to ferroptosis [70, 76, 77]. Thus, NRF2 plays a
moting the formation of foam cells. The role of selective central role in the transcriptional regulation of ferroptosis.
autophagy (activation or inhibition) in ferroptosis might be We found that HUA impaired mitochondrial function and
tissue- or cell-specific. Although the role of autophagy dys- inhibited the protein level of NRF2 in foam cells, as well as
function in ferroptosis needs further investigation, however, downstream SLC7A11 and GPX4. Fer-1 could alleviate the
our data clearly indicate that HUA promotes foam cell for- mitochondrial damage and reverse the HUA-reduced pro-
mation by impairing macrophage autophagy and increasing tein level of the NRF2/SLC7A11/GPX4 signaling pathway.
ferroptosis. Furthermore, an NRF2 inducer (TBHQ) could reverse the
NRF2 is considered a master antioxidant regulator, play- inhibitory effect of HUA on foam cell survival. This result
ing a crucial role in maintaining redox and metabolic was consistent with a previous study [33] showing that
18 Oxidative Medicine and Cellular Longevity

NRF2 activation by TBHQ suppressed diabetes-driven ath- Data Availability

erosclerosis in vivo. Thus, HUA may promote atherosclero-
sis by modulating NRF2-mediated autophagy dysfunction The data used to support the findings of this study are avail-
and ferroptosis. able from the corresponding author upon request.

5. Conclusion Conflicts of Interest

In conclusion, our results show that HUA inhibits NRF2 and The authors declare that they have no conflict of interest.
increases ferroptosis, thereby promoting the formation of
atherosclerotic plaques in ApoE−/− mice. In addition, HUA Authors’ Contributions
impaired mitochondrial function and autophagy, decreased
cell viability and GSH level, and increased lipid ROS levels J Cheng, W Yu, and W Liu designed this study. W Yu and W
and iron accumulation in macrophage-derived foam cells Liu conducted the study. W Yu, W Liu, D Xie, H Zhao, Q
in vitro. Furthermore, Fer-1 could reverse the protein level Wang, and F He collected the data. W Yu, W Liu, C Xu, B
of the NRF2/SLC7A11/GPX4 signaling pathway and Chen, and J Cheng analyzed the data. W Yu, W Liu, and J
autophagy inhibited by HUA, thus decreasing ferroptosis Cheng drafted the manuscript. J Cheng, H Koyama and T
and inhibiting the formation of foam cells. These findings Yamamoto revised the manuscript content. All authors
indicate that HUA promotes atherosclerosis by targeting approved the final version of the manuscript. J Cheng takes
NRF2-mediated autophagy dysfunction and ferroptosis. responsibility for the integrity of the data. Wei Yu and Wei-
Additionally, the inhibition of ferroptosis or activation of dong Liu contributed equally to this work.
NRF2 could alleviate the progression of hyperuricemia-
associated ASVD. Certain ferroptosis inhibitors or NRF2 Acknowledgments
activators may be potential targets for AVSD treatment.
The experiments were mainly carried out in the Central Lab-
Nevertheless, further study is needed to confirm whether
oratory, Xiang’an Hospital of Xiamen University. This work
UA-lowering treatment can inhibit the progression of ath-
was supported by grants from the Natural Science Founda-
erosclerosis by regulating ferroptosis.
tion of Fujian Province (2020J01018) and the Gout Research
Foundation (Japan, 2019).
Abbreviations
ABCA1: ATP-binding cassette transporter A1 References
ABCG1: ATP-binding cassette transporter G1
AFI: Average fluorescence intensity [1] Chinese Society of Endocrinology and Chinese Medical Asso-
ciation, “Guideline for the diagnosis and management of
ASVD: Atherosclerotic vascular disease
hyperuricemia and gout in China (2019),” Chinese Journal of
CCK-8: Cell counting kit-8 Endocrinology And Metabolism, vol. 36, no. 1, pp. 1–13, 2020.
DAPI: 4 ′ ,6-diamidino-2-phenylindole [2] R. Liu, C. Han, D. Wu et al., “Prevalence of hyperuricemia and
FCM: Flow cytometry gout in mainland China from 2000 to 2014: a systematic
Fer-1: Ferrostatin-1 review and meta-analysis,” BioMed Research International,
GPX4: Glutathione peroxidase vol. 2015, Article ID 762820, 2015.
GSH: Glutathione [3] W. Yu and J. D. Cheng, “Uric acid and cardiovascular disease:
HDL-C: High-density lipoprotein-cholesterol an update from molecular mechanism to clinical perspective,”
HFD: High fat diet Frontiers in Pharmacology, vol. 11, 2020.
HUA: High level of uric acid [4] R. Wang, Y. Song, Y. Yan, and Z. Ding, “Elevated serum uric
HUA + HFD: High level of uric acid and high fat diet acid and risk of cardiovascular or all-cause mortality in people
LDL-C: Low-density lipoprotein-cholesterol with suspected or definite coronary artery disease: a meta-
MDA: Malondialdehyde analysis,” Atherosclerosis, vol. 254, pp. 193–199, 2016.
MMP: Mitochondrial membrane potential [5] T. G. von Lueder, N. Girerd, D. Atar et al., “Serum uric acid is
NFE2L2/NRF2: Nuclear factor erythroid 2-related factor 2 associated with mortality and heart failure hospitalizations in
oxLDL: Oxidized low-density lipoprotein patients with complicated myocardial infarction: findings
PMA: Phorbol 12-myristate 13-acetate from the High-Risk Myocardial Infarction Database Initia-
tive,” European Journal of Heart Failure, vol. 17, no. 11,
PVDF: Polyvinylidene difluoride
pp. 1144–1151, 2015.
qPCR: Quantitative PCR
[6] Y. Cang, S. Xu, J. Zhang et al., “Serum uric acid revealed a U-
RAPA: Rapamycin shaped relationship with all-cause mortality and cardiovascu-
ROS: Reactive oxygen species lar mortality in high atherosclerosis risk patients: the ASSURE
SLD: Standard laboratory diet study,” Frontiers in Cardiovascular Medicine, vol. 8, article
sUA: Serum uric acid 641513, 2021.
TBHQ: Tertbutyl hydroquinone [7] M. Li, X. Hu, Y. Fan et al., “Hyperuricemia and the risk for cor-
TC: Total cholesterol onary heart disease morbidity and mortality a systematic
TEM: Transmission electron microscopy review and dose-response meta-analysis,” Scientific Reports,
TG: Triglycerides. vol. 6, no. 1, article 19520, 2016.
Oxidative Medicine and Cellular Longevity 19

[8] D. Tang, X. Chen, R. Kang, and G. Kroemer, “Ferroptosis: [26] A. Ajoolabady, H. Aslkhodapasandhokmabad, P. Libby et al.,
molecular mechanisms and health implications,” Cell “Ferritinophagy and ferroptosis in the management of meta-
Research, vol. 31, no. 2, pp. 107–125, 2021. bolic diseases,” Trends in Endocrinology and Metabolism,
[9] J. Zheng and M. Conrad, “The metabolic underpinnings of fer- vol. 32, no. 7, pp. 444–462, 2021.
roptosis,” Cell Metabolism, vol. 32, no. 6, pp. 920–937, 2020. [27] Y. Yuan, Y. Zhai, J. Chen, X. Xu, and H. Wang, “Kaempferol
[10] S. J. Dixon, K. M. Lemberg, M. R. Lamprecht et al., “Ferropto- ameliorates oxygen-glucose deprivation/reoxygenation-
sis: an iron-dependent form of nonapoptotic cell death,” Cell, induced neuronal ferroptosis by activating Nrf2/SLC7A11/
vol. 149, no. 5, pp. 1060–1072, 2012. GPX4 Axis,” Biomolecules, vol. 11, no. 7, p. 923, 2021.
[11] S. Ouyang, J. You, C. Zhi et al., “Ferroptosis: the potential value [28] J. Liu, C. Wang, J. Li et al., “Autophagy blockage promotes the
target in atherosclerosis,” Cell Death & Disease, vol. 12, no. 8, pyroptosis of ox-LDL-treated macrophages by modulating the
p. 782, 2021. p 62/Nrf2/ARE axis,” Journal of Physiology and Biochemistry,
[12] W. Martinet, I. Coornaert, P. Puylaert, and G. R. Y. De Meyer, vol. 77, no. 3, pp. 419–429, 2021.
“Macrophage death as a pharmacological target in atheroscle- [29] M. M. Vazquez, M. V. Gutierrez, S. R. Salvatore et al., “Nitro-oleic
rosis,” Frontiers in Pharmacology, vol. 10, p. 306, 2019. acid, a ligand of CD36, reduces cholesterol accumulation by mod-
[13] T. Bai, M. Li, Y. Liu, Z. Qiao, and Z. Wang, “Inhibition of fer- ulating oxidized-LDL uptake and cholesterol efflux in RAW264.7
roptosis alleviates atherosclerosis through attenuating lipid macrophages,” Redox Biology, vol. 36, article 101591, 2020.
peroxidation and endothelial dysfunction in mouse aortic [30] V. Mylka, J. Deckers, D. Ratman et al., “The autophagy recep-
endothelial cell,” Free Radical Biology & Medicine, vol. 160, tor SQSTM1/p62 mediates anti-inflammatory actions of the
pp. 92–102, 2020. selective NR3C1/glucocorticoid receptor modulator com-
[14] Y. Zhou, H. Zhou, L. Hua et al., “Verification of ferroptosis and pound A (CpdA) in macrophages,” Autophagy, vol. 14,
pyroptosis and identification of PTGS2 as the hub gene in no. 12, pp. 2049–2064, 2018.
human coronary artery atherosclerosis,” Free Radical Biology [31] J. Mildenberger, I. Johansson, I. Sergin et al., “N-3 PUFAs
& Medicine, vol. 171, pp. 55–68, 2021. induce inflammatory tolerance by formation of KEAP1-
[15] K. Bersuker, J. M. Hendricks, Z. Li et al., “The CoQ oxidore- containing SQSTM1/p62-bodies and activation of NFE2L2,”
ductase FSP1 acts parallel to GPX4 to inhibit ferroptosis,” Autophagy, vol. 13, no. 10, pp. 1664–1678, 2017.
Nature, vol. 575, no. 7784, pp. 688–692, 2019. [32] T. Jiang, B. Harder, M. Rojo de la Vega, P. K. Wong,
[16] T. Tadokoro, M. Ikeda, T. Ide et al., “Mitochondria-dependent E. Chapman, and D. D. Zhang, “p62 links autophagy and
ferroptosis plays a pivotal role in doxorubicin cardiotoxicity,” Nrf2 signaling,” Free Radical Biology & Medicine, vol. 88, no. -
JCI Insight, vol. 5, no. 9, 2020. Part B, pp. 199–204, 2015.
[17] T. J. Park, J. H. Park, G. S. Lee et al., “Quantitative proteomic [33] I. Lazaro, L. Lopez-Sanz, S. Bernal et al., “Nrf2 activation pro-
analyses reveal that GPX4 downregulation during myocardial vides atheroprotection in diabetic mice through concerted
infarction contributes to ferroptosis in cardiomyocytes,” Cell upregulation of antioxidant, anti-inflammatory, and autophagy
Death & Disease, vol. 10, no. 11, p. 835, 2019. mechanisms,” Frontiers in Pharmacology, vol. 9, p. 819, 2018.
[18] Z. Guo, Q. Ran, L. J. Roberts 2nd et al., “Suppression of athero- [34] M. Gao, P. Monian, Q. Pan, W. Zhang, J. Xiang, and X. Jiang,
genesis by overexpression of glutathione peroxidase-4 in apo- “Ferroptosis is an autophagic cell death process,” Cell
lipoprotein E-deficient mice,” Free Radical Biology & Research, vol. 26, no. 9, pp. 1021–1032, 2016.
Medicine, vol. 44, no. 3, pp. 343–352, 2008. [35] W. Hou, Y. Xie, X. Song et al., “Autophagy promotes ferropto-
[19] R. Li, Z. Jia, and H. Zhu, “Regulation of Nrf 2 signaling,” Reac- sis by degradation of ferritin,” Autophagy, vol. 12, no. 8,
tive Oxygen Species (Apex), vol. 8, no. 24, pp. 312–322, 2019. pp. 1425–1428, 2016.
[20] C. Tonelli, I. I. C. Chio, and D. A. Tuveson, “Transcriptional [36] X. Sun, H. Jiao, J. Zhao, X. Wang, and H. Lin, “Unexpected
regulation by Nrf2,” Antioxidants & Redox Signaling, vol. 29, effect of urate on hydrogen peroxide-induced oxidative dam-
no. 17, pp. 1727–1745, 2018. age in embryonic chicken cardiac cells,” Free Radical Research,
[21] M. Dodson, R. Castro-Portuguez, and D. D. Zhang, “NRF2 vol. 51, no. 7-8, pp. 693–707, 2017.
plays a critical role in mitigating lipid peroxidation and ferrop- [37] D. Xie, H. Zhao, J. Lu et al., “High uric acid induces liver fat
tosis,” Redox Biology, vol. 23, article 101107, 2019. accumulation via ROS/JNK/AP-1 signaling,” American Jour-
[22] Z. Fan, A. K. Wirth, D. Chen et al., “Nrf2-Keap1 pathway pro- nal of Physiology. Endocrinology and Metabolism, vol. 320,
motes cell proliferation and diminishes ferroptosis,” Oncogene, no. 6, pp. e1032–e1043, 2021.
vol. 6, no. 8, p. e371, 2017. [38] Y. Yu, Y. Yan, F. Niu et al., “Ferroptosis: a cell death connect-
[23] Z. Lv, F. Wang, X. Zhang, X. Zhang, J. Zhang, and R. Liu, “Eto- ing oxidative stress, inflammation and cardiovascular dis-
midate attenuates the ferroptosis in myocardial ischemia/ eases,” Cell Death Discovery, vol. 7, no. 1, p. 193, 2021.
reperfusion rat model via Nrf2/HO-1 pathway,” Shock, [39] Y. Le, Z. Zhang, C. Wang, and D. Lu, “Ferroptotic cell death:
vol. 56, no. 3, pp. 440–449, 2021. new regulatory mechanisms for metabolic diseases,” Endo-
[24] L. He, Y. Y. Liu, K. Wang et al., “Tanshinone IIA protects crine, Metabolic & Immune Disorders Drug Targets, vol. 21,
human coronary artery endothelial cells from ferroptosis by no. 5, pp. 785–800, 2021.
activating the NRF2 pathway,” Biochemical and Biophysical [40] H. Hu, Y. Chen, L. Jing, C. Zhai, and L. Shen, “The link
Research Communications, vol. 575, pp. 1–7, 2021. between ferroptosis and cardiovascular diseases: a novel target
[25] F. Guohua, Z. Tieyuan, M. Xinping, and X. Juan, “Melatonin for treatment,” Frontiers in Cardiovascular Medicine, vol. 8,
protects against PM2.5-induced lung injury by inhibiting fer- article 710963, 2021.
roptosis of lung epithelial cells in a Nrf2-dependent manner,” [41] X. Chen, X. Li, X. Xu et al., “Ferroptosis and cardiovascular
Ecotoxicology and Environmental Safety, vol. 223, article disease: role of free radical-induced lipid peroxidation,” Free
112588, 2021. Radical Research, vol. 55, no. 4, pp. 405–415, 2021.
20 Oxidative Medicine and Cellular Longevity

[42] X. Fang, H. Wang, D. Han et al., “Ferroptosis as a target for [57] Y. Hu, H. Zhao, J. Lu et al., “High uric acid promotes dysfunc-
protection against cardiomyopathy,” Proceedings of the tion in pancreatic β cells by blocking IRS2/AKT signalling,”
National Academy of Sciences of the United States of America, Molecular and Cellular Endocrinology, vol. 520, article
vol. 116, no. 7, pp. 2672–2680, 2019. 111070, 2021.
[43] A. Anandhan, M. Dodson, C. J. Schmidlin, P. Liu, and D. D. [58] Y. Qin, Y. Qiao, D. Wang, C. Tang, and G. Yan, “Ferritino-
Zhang, “Breakdown of an ironclad defense system: the critical phagy and ferroptosis in cardiovascular disease: mechanisms
role of NRF2 in mediating ferroptosis,” Cell Chemical Biology, and potential applications,” Biomedicine & Pharmacotherapy,
vol. 27, no. 4, pp. 436–447, 2020. vol. 141, article 111872, 2021.
[44] Z. Qiang, H. Dong, Y. Xia, D. Chai, R. Hu, and H. Jiang, “Nrf2 [59] H. Y. Chen, Z. Z. Xiao, X. Ling, R. N. Xu, P. Zhu, and S. Y.
and STAT3 alleviates ferroptosis-mediated IIR-ALI by regulat- Zheng, “ELAVL1 is transcriptionally activated by FOXC1
ing SLC7A11,” Oxidative Medicine and Cellular Longevity, and promotes ferroptosis in myocardial ischemia/reperfusion
vol. 2020, p. 16, 2020. injury by regulating autophagy,” Molecular Medicine, vol. 27,
[45] W. Q. Ma, X. J. Sun, Y. Zhu, and N. F. Liu, “Metformin atten- no. 1, p. 14, 2021.
uates hyperlipidaemia-associated vascular calcification [60] S. Mukhopadhyay, D. E. Biancur, S. J. Parker et al., “Autoph-
through anti-ferroptotic effects,” Free Radical Biology & Med- agy is required for proper cysteine homeostasis in pancreatic
icine, vol. 165, pp. 229–242, 2021. cancer through regulation of SLC7A11,” Proceedings of the
[46] X. Liao, J. C. Sluimer, Y. Wang et al., “Macrophage autophagy National Academy of Sciences of the United States of America,
plays a protective role in advanced atherosclerosis,” Cell vol. 118, no. 6, 2021.
Metabolism, vol. 15, no. 4, pp. 545–553, 2012. [61] T. Wang, L. Zhang, J. Hu et al., “Mst1 participates in the ath-
[47] G. R. Grandhi, R. Mszar, F. Vahidy et al., “Sociodemographic erosclerosis progression through macrophage autophagy inhi-
disparities in influenza vaccination among adults with athero- bition and macrophage apoptosis enhancement,” Journal of
sclerotic cardiovascular disease in the United States,” JAMA Molecular and Cellular Cardiology, vol. 98, pp. 108–116, 2016.
Cardiology, vol. 6, no. 1, pp. 87–91, 2021. [62] I. Sergin, T. D. Evans, X. Zhang et al., “Exploiting macrophage
[48] A. Bermon, A. F. Uribe, P. F. Perez-Rivero et al., “Efficacy and autophagy-lysosomal biogenesis as a therapy for atherosclero-
safety of text messages targeting adherence to cardiovascular sis,” Nature Communications, vol. 8, no. 1, article 15750, 2017.
medications in secondary prevention: TXT2HEART Colom- [63] J. He, G. Zhang, Q. Pang et al., “SIRT6 reduces macrophage
bia randomized controlled trial,” JMIR mHealth and uHealth, foam cell formation by inducing autophagy and cholesterol
vol. 9, no. 7, article e25548, 2021. efflux under ox-LDL condition,” The FEBS Journal, vol. 284,
[49] M. Kuwabara, K. Niwa, I. Hisatome et al., “Asymptomatic no. 9, pp. 1324–1337, 2017.
hyperuricemia without comorbidities predicts cardiometa- [64] S. Fang, X. Wan, X. Zou et al., “Arsenic trioxide induces mac-
bolic diseases: five-year Japanese cohort study,” Hypertension, rophage autophagy and atheroprotection by regulating ROS-
vol. 69, no. 6, pp. 1036–1044, 2017. dependent TFEB nuclear translocation and AKT/mTOR path-
[50] M. Kuwabara, R. Kuwabara, I. Hisatome et al., ““Metabolically way,” Cell Death & Disease, vol. 12, no. 1, p. 88, 2021.
healthy” obesity and hyperuricemia increase risk for hyperten- [65] S. Kumar, R. Nanduri, E. Bhagyaraj et al., “Vitamin D3-VDR-
sion and diabetes: 5-year Japanese cohort study,” Obesity, PTPN6 axis mediated autophagy contributes to the inhibition
vol. 25, no. 11, pp. 1997–2008, 2017. of macrophage foam cell formation,” Autophagy, vol. 17, no. 9,
[51] M. Kuwabara, I. Hisatome, K. Niwa et al., “Uric acid is a strong pp. 2273–2289, 2021.
risk marker for developing hypertension from prehyperten- [66] H. Tao, P. G. Yancey, J. L. Blakemore et al., “Macrophage SR-
sion: a 5-year Japanese cohort study,” Hypertension, vol. 71, BI modulates autophagy via VPS34 complex and PPARα tran-
no. 1, pp. 78–86, 2018. scription of Tfeb in atherosclerosis,” The Journal of Clinical
[52] M. Kuwabara, C. Borghi, A. F. G. Cicero et al., “Elevated serum Investigation, vol. 131, no. 7, 2021.
uric acid increases risks for developing high LDL cholesterol [67] X. Chen, C. Yu, R. Kang, G. Kroemer, and D. Tang, “Cellular
and hypertriglyceridemia: a five-year cohort study in Japan,” degradation systems in ferroptosis,” Cell Death and Differenti-
International Journal of Cardiology, vol. 261, pp. 183–188, 2018. ation, vol. 28, no. 4, pp. 1135–1148, 2021.
[53] T. Maruhashi, I. Hisatome, Y. Kihara, and Y. Higashi, “Hyper- [68] Y. Sun, Y. Zheng, C. Wang, and Y. Liu, “Glutathione depletion
uricemia and endothelial function: from molecular back- induces ferroptosis, autophagy, and premature cell senescence
ground to clinical perspectives,” Atherosclerosis, vol. 278, in retinal pigment epithelial cells,” Cell Death & Disease, vol. 9,
pp. 226–231, 2018. no. 7, p. 753, 2018.
[54] F. Liu, S. Hui, T. H. Hidru et al., “The prevalence, distribution, [69] G. Filomeni, D. De Zio, and F. Cecconi, “Oxidative stress and
and extent of subclinical atherosclerosis and its relation with autophagy: the clash between damage and metabolic needs,”
serum uric acid in hypertension population,” Frontiers in Car- Cell Death and Differentiation, vol. 22, no. 3, pp. 377–388, 2015.
diovascular Medicine, vol. 8, article 638992, 2021. [70] X. Sun, Z. Ou, R. Chen et al., “Activation of the p62-Keap1-
[55] Y. Hao, H. Li, Y. Cao et al., “Uricase and horseradish peroxi- NRF2 pathway protects against ferroptosis in hepatocellular
dase hybrid CaHPO4 nanoflower integrated with transcutane- carcinoma cells,” Hepatology, vol. 63, no. 1, pp. 173–184, 2016.
ous patches for treatment of hyperuricemia,” Journal of [71] X. Chen, J. Li, R. Kang, D. J. Klionsky, and D. Tang, “Ferrop-
Biomedical Nanotechnology, vol. 15, no. 5, pp. 951–965, 2019. tosis: machinery and regulation,” Autophagy, vol. 17,
[56] Y. Kimura, T. Yanagida, A. Onda, D. Tsukui, M. Hosoyamada, pp. 2054–2081, 2020.
and H. Kono, “Soluble uric acid promotes atherosclerosis via [72] D. Shin, E. H. Kim, J. Lee, and J. L. Roh, “Nrf2 inhibition
AMPK (AMP-activated protein kinase)-mediated inflamma- reverses resistance to GPX4 inhibitor-induced ferroptosis in
tion,” Arteriosclerosis, Thrombosis, and Vascular Biology, head and neck cancer,” Free Radical Biology & Medicine,
vol. 40, no. 3, pp. 570–582, 2020. vol. 129, pp. 454–462, 2018.
Oxidative Medicine and Cellular Longevity 21

[73] J. L. Roh, E. H. Kim, H. Jang, and D. Shin, “Nrf2 inhibition

reverses the resistance of cisplatin-resistant head and neck
cancer cells to artesunate-induced ferroptosis,” Redox Biology,
vol. 11, pp. 254–262, 2017.
[74] L. C. Chang, S. K. Chiang, S. E. Chen, Y. L. Yu, R. H. Chou, and
W. C. Chang, “Heme oxygenase-1 mediates BAY 11-7085
induced ferroptosis,” Cancer Letters, vol. 416, pp. 124–137,
2018.
[75] D. Chen, O. Tavana, B. Chu et al., “NRF2 is a major target of
ARF in p 53-independent tumor suppression,” Molecular Cell,
vol. 68, no. 1, pp. 224–232 e4, 2017.
[76] Q. Wang, C. Bin, Q. Xue et al., “GSTZ1 sensitizes hepatocellu-
lar carcinoma cells to sorafenib-induced ferroptosis via inhibi-
tion of NRF2/GPX4 axis,” Cell Death & Disease, vol. 12, no. 5,
p. 426, 2021.
[77] O. E. Chepikova, D. Malin, E. Strekalova, E. V. Lukasheva,
A. A. Zamyatnin Jr., and V. L. Cryns, “Lysine oxidase exposes
a dependency on the thioredoxin antioxidant pathway in
triple-negative breast cancer cells,” Breast Cancer Research
and Treatment, vol. 183, no. 3, pp. 549–564, 2020.