42

Singh et al.
BMC Plant Biology (2020) 20:220

https://doi.org/10.1186/s12870-020-02400-9
RESEARCH ARTICLE Open Access
Diversity of nitrogen-fixing rhizobacteria

associated with sugarcane: a
comprehensive study of plant-microbe
interactions for growth enhancement in
Saccharum spp.
Rajesh Kumar Singh1,2,3†, Pratiksha Singh1,2,3†, Hai-Bi Li1,2, Qi-Qi Song1,2, Dao-Jun Guo1,2,3, Manoj K. Solanki4,
Krishan K. Verma1,3, Mukesh K. Malviya1,3, Xiu-Peng Song1,2, Prakash Lakshmanan1,3,5, Li-Tao Yang2,3 and
Yang-Rui Li1,2*
Abstract
Background: Nitrogen is an essential element for sugarcane growth and development and is generally applied in
the form of urea often much more than at recommended rates, causing serious soil degradation, particularly soil
acidification, as well as groundwater and air pollution. In spite of the importance of nitrogen for plant growth,
fewer reports are available to understand the application and biological role of N2 fixing bacteria to improve N2
nutrition in the sugarcane plant.
(Continued on next page)
* Correspondence: [email protected]; [email protected]

†
Rajesh Kumar Singh and Pratiksha Singh contributed equally to this work.
1
Key Laboratory of Sugarcane Biotechnology and Genetic Improvement
(Guangxi), Ministry of Agriculture, Sugarcane Research Center, Chinese
Academy of Agricultural Sciences, Guangxi Key Laboratory of Sugarcane
Genetic Improvement, Sugarcane Research Institute, Guangxi Academy of
Agricultural Sciences, Nanning 530007, Guangxi, China
2
College of Agriculture, State Key Laboratory of Conservation and Utilization
of Subtropical Agro-bio resources, Guangxi University, Nanning 530005,
China
Full list of author information is available at the end of the article
© The Author(s). 2020 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,
which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if
changes were made. The images or other third party material in this article are included in the article's Creative Commons
licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons
licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain
permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the
data made available in this article, unless otherwise stated in a credit line to the data.
Singh et al. BMC Plant Biology (2020) 20:220 Page 2 of 21
(Continued from previous page)

Results: In this study, a total of 350 different bacterial strains were isolated from rhizospheric soil samples of the
sugarcane plants. Out of these, 22 isolates were selected based on plant growth promotion traits, biocontrol, and
nitrogenase activity. The presence and activity of the nifH gene and the ability of nitrogen-fixation proved that all
22 selected strains have the ability to fix nitrogen. These strains were used to perform 16S rRNA and rpoB genes for
their identification. The resulted amplicons were sequenced and phylogenetic analysis was constructed. Among the
screened strains for nitrogen fixation, CY5 (Bacillus megaterium) and CA1 (Bacillus mycoides) were the most
prominent. These two strains were examined for functional diversity using Biolog phenotyping, which confirmed
the consumption of diverse carbon and nitrogen sources and tolerance to low pH and osmotic stress. The
inoculated bacterial strains colonized the sugarcane rhizosphere successfully and were mostly located in root and
leaf. The expression of the nifH gene in both sugarcane varieties (GT11 and GXB9) inoculated with CY5 and CA1
was confirmed. The gene expression studies showed enhanced expression of genes of various enzymes such as
catalase, phenylalanine-ammonia-lyase, superoxide dismutase, chitinase and glucanase in bacterial-inoculated
sugarcane plants.
Conclusion: The results showed that a substantial number of Bacillus isolates have N-fixation and biocontrol
property against two sugarcane pathogens Sporisorium scitamineum and Ceratocystis paradoxa. The increased
activity of genes controlling free radical metabolism may at least in part accounts for the increased tolerance to
pathogens. Nitrogen-fixation was confirmed in sugarcane inoculated with B. megaterium and B. mycoides strains
using N-balance and 15N2 isotope dilution in different plant parts of sugarcane. This is the first report of Bacillus
mycoides as a nitrogen-fixing rhizobacterium in sugarcane.
Keywords: Genetic diversity, GFP, Microbe-plant interactions, Nitrogen-fixing bacteria, PGPR, 15N2 isotope, qRT-PCR,
Sugarcane
Background agriculture to mitigate soil degradation and climate

Sugarcane (Saccharum officinarum L.) is the world’s lar- change [6].
gest sugar crop and globally the second largest source of The need for reducing chemical N fertilizer depend-
biofuel [1, 2]. It is also an increasingly important source ency prompted research on sustainable alternative nitro-
of raw materials for animal feed, paper production, and gen sources for crop production [7]. Soil micro-
many biomass-based products [3]. China ranks the organisms and plant microbial endophytes including rhi-
third-largest sugarcane growing country, producing zobacteria have been reported to promote plant growth,
about ten million tons of sugar annually [2]. Yet, it is suppress pathogens and in some instances improve abi-
now the largest sugar importer in the world due to in- otic stress tolerance [8, 9]. More specifically, plant
creasing local consumption. Given this commercial real- growth-promoting rhizobacteria (PGPR) with nitrogen-
ity, there is a strong impetus to increase sugarcane fixing ability are reported to be a valuable source of ni-
production area and crop productivity in China. Sugar- trogen for sustainable crop production as well as to
cane is a fast-growing high-biomass crop and its nutrient maintain soil fertility [3]. Several groups of soil and root-
and water requirements are relatively large. There is a associated nitrogen-fixing microorganisms such as Azo-
huge variation for nitrogen (N) fertilizer application for tobacter vinelandii [10], Azospirillum brasilense, Azospir-
sugarcane production between countries, ranging from illum zeae, and Pseudomonas stutzeri [11], Acetobacter
as little as 60 kg N ha− 1 in some regions of Brazil to as diazotrophicus [12], Achromobacter insolitus [13], Bacil-
high as 755 kg N ha− 1 in some parts of China [4]. In lus megaterium [14], Bacillus rhizosphaerae [15], Bur-
China, the excessive application of N fertilizer in sugar- kholderia tropica [16], Burkholderia xenovorans [17],
cane crop, spurred by the low cost of fertilizer and as an Burkholderia silvatlantica [18], and Burkholderia cabal-
insurance strategy to achieve high cane yield, is causing leronis [19], Bradyrhizobium. japonicum and B. elkanii,
considerable soil degradation as well as air and ground- [20], Delftia tsuruhatensis [21], Enterobacter sacchari
water pollution [5]. Further, the high use of N fertilizer [22], Gluconacetobacter diazotrophicus [23], Gluconace-
adversely affects sugar quality and dramatically alters soil tobacter diazotrophicus [24], Stenotrophomonas malto-
biota, which often results in a substantial decline in philia [25], Pseudomonas koreensis, and P. entomophila
beneficial microflora associated with N mineralization [7] have been found to colonize different crops and
and supply. Compounding these issues is the regulatory stimulate plant growth either directly or indirectly. Their
pressure felt across agriculture, including the sugarcane activity, however, is influenced by crop species, soil type
industry, to reduce greenhouse gas emission from and soil condition [26]. Therefore, it is important to
isolate, identify, and culture PGPRs associated with sug- plant-microbe interaction has been studied and the re-
arcane that functions optimally in different soil types sults are presented here.
and climatic conditions to promote crop growth and
yield. Results
The nitrogen-fixing Bacillus species have the potential Isolation and characterization of rhizosphere bacteria
to use as a microbial bio-fertilizer and biocontrol in agri- with PGP ability
culture sectors [27]. Therefore, in this study, we focused A total of 350 bacterial isolates were obtained from the
on the bacteria belonging to nitrogen-fixing Bacillus sugarcane rhizosphere. Out of these, 102 isolates were
species. Bacillus spp. occur in very different soil types selected with different PGP traits, and nitrogenase activ-
and they can be cultured. They have a complex cell wall ity and were tested in vitro for antagonistic activity
and, stress-resistant endospore they produce antibiotics against sugarcane pathogens. Following this screening,
and extracellular lytic enzymes, and tolerate adverse en- 22 of them were selected for further studies (Fig. 1a-b).
vironmental conditions for extended periods [28, 29]. All the isolated sugarcane rhizosphere bacteria were
Several Bacillus species such as Bacillus tequilensis, B. primarily screened to analyze their biocontrol property
megaterium, B. cereus [30, 31], B. amyloliquefaciens, B. against the pathogens Sporisorium scitamineum and Cer-
aryabhattai, B. safensis, B. aerophilus, B. subtilis [31, atocystis paradoxa. A total of 18 such isolates with bio-
32], B. rhizosphaerae [15], B. pumilus [31], B. fluminen- control property were selected. The data in Table 1,
sis [33] and B. indica [34] have been isolated from sugar- indicated that about 40 (9) and 60% (13) of the isolates
cane. These micro-organisms promote plant growth were antagonistic to S. scitamineum and C. paradoxa re-
directly via nitrogen fixation, phosphate solubilization spectively. All the selected isolates were screened for
and production of phytohormones, and indirectly their capacity to solubilize phosphate using Pikovskaya’s
through the production of antibiotics, hydrolytic en- plates. The results showed that 82% (18) of tested iso-
zymes and siderophores [3, 34–37]. lates produced a halo zone, indicating their capacity to
Many Bacillus species fix N2 and the occurrence of N2 produce organic acids to solubilize the tri-calcium phos-
fixing bacteria in sugarcane was first reported by Dober- phate in the media. Among the 22 bacterial isolates
einer and Ruschel [38], which was confirmed by later tested, 45.5% (10) were able to produce an orange halo
studies [23, 39, 40]. Based on nitrogenase activity, Xie zone on the chrome azurol S agar medium indicating
et al. [41] showed that Bacillus brevis, B. cereus, B. circu- siderophores production. Further, about 60% (13) of the
lans, B. firmus, B. licheniformis, B. megaterium, B. pumi- isolates produced ammonia and 18% (4) produced
lus, and B. subtilis associated with rice have the capacity hydrogen cyanide (HCN) (Table 1).
to fix nitrogen. Recently, Paenibacillus odorifer, P. gra- Phosphate and siderophore activity of the bacterial iso-
minis, P. peoriae, and P. brasilensis have been described lates 3 mm or greater clear zone of inhibitions on suit-
as nitrogen fixers in other plants [42–44], with the pres- able medium after 3–5 days of incubation at 30 ± 2 °C.
ence of nifH gene established in, P. graminis and P. Antifungal activity by dual culture plate measured as a
odorifer [43, 45]. zone of inhibition after 3–5 days of incubation at 26 ±
Microbial colonization is an important aspect of suc- 2 °C.
cessful plant-microorganism interactions [46]. In many The ability to synthesize Indole-3-acetic acid (IAA) is
instances, artificially inoculated PGPRs failed to colonize an important feature of PGPR isolates. The data in
target hosts grown in the soil. The reason for poor Table 2, shows that the isolates had a very diverse cap-
colonization by externally supplied PGPRs, especially acity to synthesize IAA. These variations ranged from
when plants are grown in soil, is not known, and this 11.42 ± 0.49 to 44.88 ± 0.19 μ g mL− 1 in a medium with-
currently limits the application of PGPRs in many com- out tryptophan but the addition of tryptophan resulted
mercial crops, including sugarcane [47]. Hence, the ob- in 29.65 ± 0.61 to 316.84 ± 2.5 μ g mL− 1. The isolates
jectives of this study are (i) to isolate nitrogen-fixing CoY8 and CY5 showed the lowest and highest IAA pro-
microorganisms from the rhizosphere of Chinese sugar- duction, respectively in the absence of tryptophan. How-
cane germplasm and characterize them for nitrogen fix- ever, in the presence of tryptophan, the lowest and
ation, plant growth promotion and biocontrol of highest production of IAA was observed in isolates CA8
sugarcane pathogens, and (ii) to understand how the and AY8, respectively. The level of nitrogenase activities
host and the growing environment control the varied greatly amongst the twenty-two bacterial isolates
colonization process. Using several experimental tools tested. The nitrogen-fixing ability among the isolates
and strategies relevant to rhizosphere and microbiome ranged from 2.40 ± 0.24 to 26.59 ± 2.0 n moL C2H4 mg
association studies, such as the expression of the nifH protein h− 1. Isolate AN11 showed the highest and CY10
gene, 15N2 tracer studies, confocal microscopy, and N2- recorded the lowest activity using an acetylene reduction
fixation-associated metabolic changes, this important assay. 1-aminocyclopropane-1-carboxylate (ACC)
Fig. 1 a Assortment of nitrogen-fixing micro-organisms from the rhizosphere of sugarcane plants in a different medium, b A dendrogram was
constructed on the basis of functional characterization of different PGP traits for all selected isolates
deaminase activity was determined as the ability to use The results displayed that all the isolates belonged to the
ACC as the sole N2 source. Of the 22 isolates, 10 Bacillus genus (Table 3). Based on the similarity value
(45.5%) were able to grow normally on the DF medium ≥97% score, we separated the Bacillus into 13 different
supplemented with 3 m moL L− 1 of ACC after 36–48 h species including 3 belongs to B. species, 1 to B. licheni-
incubation at 30 ± 2 °C. Subsequently, the color of bac- formis, 3 to B. pumilus, 2 to B. safensis, 1 to Firmicutes
teria appeared dark in the DF medium with ACC. On bacterium, 1 to B. luciferensis, 1 to Paenibacillus lautus,
the basis of the above results, 10 of the isolates were se- 2 to B. cereus, 2 to B. subtilis, 3 to B. thuringiensis, 1 to
lected for further quantitative tests and found varying B. megaterium, 1 to B. aryabhattai, and 1 to B. mycoides.
levels of ACC deaminase amongst them (Table 2). The In addition, we found that some isolates belonged to the
highest activity was found in the CY5 (75.63 ± 3.35) with same species, as determined by the 16S rRNA gene se-
CA8 registering the lowest level (16.47 ± 0.42), and all quences. Another primer set of rpoB gene was also used
these selected strains showed the amplification approxi- for the amplification of partial sequences of the genes.
mately 755 bp of acdS gene (Additional file 1: Fig. S1). As shown in Table 3, the rpoB gene sequence homology
analysis failed to discriminate against the isolates
Molecular characterization of bacterial isolates CoA10, AY6, and CY11.
In the present study, the 16S and rpoB rRNA gene amp-
lification was done. The amplified fragment was used for Phylogenetic structure of 16S rRNA and rpoB genes
16S rRNA gene partial sequencing and basic local align- The individual analysis for a phylogenetic tree for the
ment search tool (BLAST) analysis for judging the se- evolutionary relationship was done. The 16S rRNA and
quence similarity with the national center for rpoB gene partial sequences of the isolated strains were
biotechnology information (NCBI) GenBank database. compared with the reference strains of the NCBI
Table 1 In vitro characterization of rhizospheric bacteria on the basis of plant growth promotion attributes exhibited by selected
isolates
Culture Phosphate Siderophore Ammonia HCN ACC Antifungal activity
Code deaminase
Sporisorium scitamineum Ceratocystis paradoxa
CoY3 + – +++ – – + +
CoY7 + – ++ – + ++ –
CoY8 – – ++ + – – ++
CoA1 + – ++ – – – +
CoA10 +++ – – – – ++ –
AY6 ++ +++ – ++ + ++ –
AY7 +++ ++ – – + – +++
AY8 – ++ ++ – – – –
AN8 +++ +++ – ++ + – +
AN11 ++ +++ – – – – +++
AN12 ++ +++ – – – – ++
BN5 ++ – – – – – –
CY5 ++ ++ ++ – + ++ ++
CY9 ++ – ++ – – ++ –
CY10 ++ – ++ – + ++ –
CY11 – – ++ – + + +
CA1 ++ +++ ++ +++ + ++ +
CA6 ++ – +++ – – – +
CA8 – +++ – – + – –
CN13 ++ – ++ – – – –
CN14 ++ – ++ – + – +
N1 ++ ++ – – – – ++
(+) = low activity; (++) = moderate activity; (+++) = strong activity; (−) = no activity
GenBank public database. In 16S rRNA genes two major NCBI GenBank and their accession numbers are from
and two minor groups were formed based on the NJ KY652155 to KY652160.
method with 1000 bootstrap sampling (Fig. 2a). Pseudo-
monas putida was used as the reference to separate Ba- Characterization of genomic fingerprinting
cillus strains. However, in the case of the rpoB gene A genomic fingerprint was examined by A1R-based re-
three major and two minor groups were formed (Fig. petitive extragenic palindromic (BOX) and enterobacte-
2b). rial repetitive intergenic consensus (ERIC) PCR using
the purified DNA of selected isolates from the sugarcane
Amplification of the nifH gene rhizosphere. Many polymorphic bands were observed
To investigate the nifH gene for all the selected isolates, approximately ranging between 100 bp and about 5 kb.
the genomic DNA extracted and used to detect the PCR The genomic DNA fingerprints generated from all the
products with an accurate band size of about 360 bp. Re- isolates were clearly distinguished from each other.
sults showed that six strains were positive for nifH gene High-quality fingerprint profiles were visualized on agar-
amplification (Additional file 2: Fig. S2). The positive ose gels with each primer set (Fig. 3). The BOX and
isolates were used to establish nifH clone libraries and ERIC-PCR fingerprints results were very complicated
ten clones were selected from each isolate for sequen- with several polymorphic bands with different intensity.
cing. All the sequenced clones were found to be similar A total of 174 bands ranging from 50 bp to 5 kb were
to the nifH gene by the BlastN search program from the generated from all the 22 selected Bacillus strains
NCBI GenBank database. These isolates were similar to through BOX PCR. The isolate B9 and B14 showed the
B. cereus (AY8), B. subtilis (AN8), B. cereus (BN5), B. maximum 11 bands, after this B1, B4, and B7 showed a
megaterium (CY5), B. pumilus (CY10), and B. pumilus similar number of bands (10), while a minimum of 4
(CA6). The nifH sequences identified were submitted to bands was detected in B2, and B4 isolates (Fig. 3a;
Table 2 In vitro screening of the bacterial isolates for IAA production, ARA, and ACC deaminase activity
Culture IAA (μ g mL− 1) ARA ACC
Code (n moL C2H4 (nmol α-
A-Tryptophan P-Tryptophan
mg protein ketobutyrate
h− 1 ) mg− 1 h− 1)
CoY3 11.61 ± 0.49l 36.35 ± 0.10nm 10.04 ± 1.65h –
h k
CoY7 15.70 ± 0.34 44.82 ± 0.61 16.65 ± 1.25fg 34.72 ± 5.33d
CoY8 11.42 ± 0.49l 49.26 ± 0.69j 17.65 ± 0.27ef –
CoA1 17.12 ± 0.33 fg
42.14 ± 0.21l
5.53 ± 0.56i –
CoA10 12.56 ± 0.25 kl
51.84 ± 0.10ij
16.74 ± 0.18 fg
–
AY6 14.10 ± 0.34ij 49.20 ± 0.34j 21.38 ± 2.42cd 19.60 ± 0.89e
AY7 26.25 ± 0.51d 53.84 ± 0.27i 21.59 ± 3.65cd 39.80 ± 1.10c
AY8 17.27 ± 0.20 fg
316.84 ± 2.5b
25.89 ± 2.08 ab
–
e c ab
AN8 19.13 ± 0.51 290.57 ± 2.62 24.73 ± 0.61 17.42 ± 0.55e
AN11 39.92 ± 2.95 b
104.62 ± 0.51 h
26.59 ± 2.05 a
–
AN12 17.37 ± 0.61 f
112.27 ± 1.28 g
19.70 ± 0.67 de
–
BN5 15.41 ± 0.11h 271.06 ± 2.45d 23.62 ± 1.15bc –
a mn bc
CY5 44.88 ± 0.19 35.01 ± 0.30 23.87 ± 2.55 75.63 ± 3.35a
CY9 14.03 ± 0.30 ij
49.33 ± 0.63j
25.87 ± 1.72 ab
–
hi n j
CY10 14.98 ± 0.26 33.84 ± 0.11 2.40 ± 0.24 32.92 ± 4.23d
a e fg
CY11 43.77 ± 0.23 175.73 ± 0.91 16.12 ± 0.94 41.57 ± 3.91c
CA1 16.14 ± 0.10gh 130.96 ± 1.81f 15.94 ± 2.11fg 49.61 ± 1.15b
CA6 13.28 ± 0.25 jk
37.10 ± 0.41m
14.23 ± 1.07 g
–
f o fg
CA8 17.42 ± 0.18 29.65 ± 0.61 15.08 ± 1.17 16.47 ± 0.42e
c mn fg
CN13 28.28 ± 0.47 36.12 ± 1.93 16.87 ± 0.92 21.05 ± 1.04e
CN14 13.90 ± 0.19ij 37.56 ± 0.30m 16.92 ± 1.71fg –
N1 18.64 ± 0.15 e
339.07 ± 5.56 a
17.69 ± 0.76ef –
SEM 0.39 0.89 0.86 1.62
CD (P = 0.05) 1.12 2.55 2.44 4.87
CV (%) 3.40 1.50 8.30 7.60
A-Tryptophan absence of tryptophan, P-Tryptophan presence of tryptophan.
Means followed by the same letter within a row are not significantly different (p ≤ 0.05) according to Duncan’s Multiple Range Test (DMRT). SEM standard error of
the difference between means, CD critical difference, CV coefficient of variation
Additional file 3: Fig. S3). For ERIC-PCR the faint bands fourteen isolates. In the ERIC-PCR, all the twenty-two
were frequently observed and approximately 50 bp to 5 isolates showed two major clusters, containing one and
kb of 146 bands were identified. The maximum number twenty-one isolates, respectively. The twenty-one isolates
of bands was observed in three strains i.e., B1, B2, and were divided into two sub-groups, which contained 3
B9 (10), whereas the minimum bands were found in B13 and 17 isolates, and all were grouped into different clus-
(3) (Fig. 3c; Additional file 3: Fig. S4). ters (Fig. 3d).
BOX-PCR fingerprints showed more genotypic diver-
sity for all selected Bacillus spp. as compared to ERIC Biolog phenotypic profiling of CY5 and CA1
fingerprints, and a dendrogram was created of finger- The substrate utilization patterns for the selected strains
print bands to generate their relatedness (Fig. 3). The (CY5 and CA1) were established for metabolic potential
data were examined by Jaccard similarity coefficients with numerous groupings such as carbon (C), and nitro-
and the neighbor-joining method based on UPGMA. gen (N) sources, tolerance of osmotic stress and meta-
Two major clusters, one comprising two isolates and the bolic activity over a wide range of pH (3.5–10). The
other comprising twenty isolates were found in dendro- physiological, biochemical, and chemical sensitivity of
gram created through BOX PCR fingerprints (Fig. 3b). the isolates was performed by the Biolog system based
These eighteen isolates were further divided into two on substrate use. The results showed that the strain CA1
sub-groups, one contained 6 isolates and the other had utilized more carbon sources as compared to CY5 i.e.
Table 3 Identification of selected bacterial strains isolated from sugarcane-based on 16S rRNA and rpoB gene sequence
Isolates Identified by two genes: A (16S rRNA) and B (rpoB) % identitya No. of Nucleotidesb Accessions Numberc
A B A B A B A B
CoY3 Bacillus spp. Bacillus spp. 98 97 1452 779 KY652111 KY652133
CoY7 Bacillus licheniformis Bacillus licheniformis 98 96 1396 547 KY652112 KY652134
CoY8 Bacillus pumilus Bacillus pumilus 99 99 1447 1166 KY652113 KY652135
CoA1 Bacillus safensis Bacillus safensis 99 99 1447 1178 KY652114 KY652136
CoA10 Firmicutes bacterium Bacillus cereus 98 98 1490 1080 KY652115 KY652137
AY6 Bacillus luciferensis Bacillus amyloliquifensis 98 96 1497 581 KY652116 KY652138
AY7 Paenibacillus lautus Paenibacillus lautus 97 96 1389 352 KY652117 KY652139
AY8 Bacillus cereus Bacillus cereus 99 99 1414 1104 KY652118 KY652140
AN8 Bacillus subtilis Bacillus subtilis 99 99 1462 1149 KY652119 KY652141
AN11 Bacillus thuringiensis Bacillus thuringiensis 98 96 1474 778 KY652120 KY652142
AN12 Bacillus subtilis Bacillus subtilis 99 97 1458 1094 KY652121 KY652143
BN5 Bacillus cereus Bacillus cereus 98 96 1392 840 KY652122 KY652144
CY5 Bacillus megaterium Bacillus megaterium 98 97 1403 690 KY652123 KY652145
CY9 Bacillus safensis Bacillus safensis 99 98 1354 1164 KY652124 KY652146
CY10 Bacillus pumilus Bacillus pumilus 99 98 1375 1165 KY652125 KY652147
CY11 Bacillus aryabhattai Bacillus altitudinis 99 98 1455 1139 KY652126 KY652148
CA1 Bacillus mycoides Bacillus mycoides 98 96 1413 781 KY652127 KY652149
CA6 Bacillus pumilus Bacillus pumilus 99 98 1459 1155 KY652128 KY652150
CA8 Bacillus thuringiensis Bacillus thuringiensis 99 98 1461 1211 KY652129 KY652151
CN13 Bacillus spp. Bacillus spp. 97 97 1457 800 KY652130 KY652152
CN14 Bacillus spp. Bacillus spp. 98 98 1518 775 KY652131 KY652153
N1 Bacillus thuringiensis Bacillus thuringiensis 98 96 1411 694 KY652132 KY652154
a
The percentage identity with the 16S rDNA/ rpoB gene sequence of the closest phylogenetic relative
b
The number of 16S rDNA/ rpoB gene nucleotides used for the alignment
c
NCBI GenBank accession number of 16S rDNA/ rpoB gene
sugars (74.07%), carboxylic acids (66.67%), hexose acids activity, both isolates could grow in the pH range from 3.5
(88.89%), and amino acids (100.00%), and the highest to 10. The diversity measures can be used to evaluate the
chemical sensitivity (86.97%) (Additional file 4: Table diversity of resources used by micro-organisms indicating
S1). Along with, reducing sugar, sodium chloride, amino their tolerance to a wide range of environments. The diver-
acid, lactic acid, and hexose-PO4 were used. In both sity parameters defined on the basis of data obtained
tested strains, 79 (82.29%) of CA1 and 61 (63.54%) of through Biolog analysis are presented in Table 4.
CY5 compounds were utilized (Fig. 4). A PCA was performed by using PM3B, PM9, and
Different nitrogen sources support the growth of CY5 PM10 for a qualitative analysis of the metabolic diversity
and CA1, indicating that these isolates metabolize com- of both isolates based on the PC score values obtained.
pounds such as ammonia, nitrite, nitrate, urea, biuret, l- Based on the relationships between different substrates,
alanine, glycine, hydroxylamine methylamine, ethylamine, metabolites and strain utilization, the grouping was per-
ethanolamine, adenine, cytosine, thymine, uracil, and uric formed for each individual component. And, for these
acid, and they might tolerate nearly 95 different forms of ni- studies, a separate evaluation was performed for nitrogen
trogen and some related chemicals even at high concentra- source, osmolytes, and pH. The results obtained from
tions. The tolerance levels of isolates CY5 and CA1 to nitrogen source (Fig. 5) clarified the metabolic variability
different concentrations of NaCl (1–10%), potassium chlor- of 53.52 and 46.48% according to the first and second
ide (3–6%), sodium sulfate (2–5%), ethylene glycol (5–20%), PC values, respectively. A figure for PCA scatters plot of
sodium formate (1–6%), urea (2–7%), sodium lactate (1– osmolytes (Os) showed the first component of PC ana-
12%), sodium phosphate pH 7 (20–200 mM), sodium lysis accounted for 50.74% of the total variance and the
benzoate pH 5.2 (20–200 mM), ammonium sulfate pH 8 second 49.26%. Whereas, in the case of pH, 53.95 and
(10–100 mM), sodium nitrate (10–100 mM) and sodium 46.06% of the variance were observed in PC1 and PC2,
nitrite (10–100 mM) were high. In the case of metabolic respectively (Fig. 5a-c).
Fig. 2 a-b Phylogenetic tree based on the partial 16S rRNA and rpoB gene sequences of twenty-two potent plant-growth-promoting and
nitrogen-fixing Bacillus strains screened from sugarcane. Evolutionary distances were calculated using the UPGMA method. Based on bootstrap
analysis of 1000 replications are indicated as percent confidence values for particular branching. Scale bar represents the number of changes per
base position and Pseudomonas putida was used as an outgroup
Fig. 3 Genotypic fingerprinting of the screened bacterial isolates from the sugarcane rhizosphere obtained by using genomic DNA. Banding
patterns for BOX and ERIC-PCR are shown in a and c. White space represents the joining of two gels. The dendrogram (b and d) was obtained
from the similarity coefficient and clustering was done by using the UPGMA algorithm with the NTSYS software program. Strain Codes: B1. CoY3,
B2. CoY7, B3. CoY8, B4. CoA1, B5. CoA10, B6. AY6, B7. AY7, B8. AY8, B9. AN8, B10. AN11, B11. AN12, B12. BN5, B13. CY5, B14. CY9, B15. CY10, B16.
CY11, B17. CA1, B18. CA6, B19. CA8, B20. CN13, B21. CN14 and B22. N1. M, molecular size marker from 100 bp–5 kb (Takara)
Fig. 4 Pattern of phenotypic profiles in CY5 and CA1 isolates in the presence of different carbon substrate utilization using BIOLOG Phenotype
Micro-Array™ plates GNIII
Colonization pattern of GFP-tagged CY5 and CA1 on the sugarcane stem, the transverse sections of roots and
sugarcane in the mesophyll cells of the leaves intercellular bacterial
Two isolates selected from the sugarcane rhizosphere, B. colonization of single or multiple species of bacteria
megaterium (CY5), and B. mycoides (CA1), were used could be seen in the inoculated plant (Fig. 6d-i). In the
for localization studies using Confocal Laser Scanning leaves, the GFP-tagged isolate was for colonization in
Microscopy (CLSM). This technique helped to study roots, mostly root hair zones were overshadowed by the
plant-microorganism interactions of selected isolates. In green fluorescence produced from xylem vessels, endo-
this study, both CY5 and CA1 conferred protection dermal junction sites, and cell walls. The CLSM images
against sugarcane pathogens (S. scitamineum, and C. of root, leaf, and stem showed similar colonization pat-
paradoxa) produced different PGP traits and showed ni- terns and abundance of both CY5 and CA1.
trogenase activity in medium (Tables 1 & 2). The data in
Fig. 6 showed bacterial cells occupying internal plant tis- nifH gene expression determined by qRT-PCR in pots
sue. These isolates after 72 h of incubation with GFP under the greenhouse
pPROBEpTetr-TT showed higher fluorescence, and the The expression of a nifH gene by the selected diazotroph
increased bacterial cell density could be easily detected bacterial isolates in sugarcane varieties GT11 and GXB9
under CLSM. The control plants without inoculated iso- was monitored by qRT-PCR (Fig. 7). The results from
lates showed no fluorescent cells (Fig. 6a-c). However, in the leaf tissue of inoculated GXB9 plants showed the
Table 4 Substrate richness diversity parameters calculated for nitrogen, osmolytes and pH through Biolog for selected strains CY5
(Bacillus megaterium) and CA1 (Bacillus mycoides)
Diversity Diversity indices measurement through different Biolog Micro-Plates
parameters
CY5 CA1
Nitrogen (PM3B) Osmolytes (PM9) pH (PM10) Nitrogen (PM3B) Osmolytes (PM9) pH (PM10)
Dominance_D 0.02512 0.01533 0.01131 0.01551 0.01489 0.01183
Simpson_1-D 0.9749 0.9847 0.9887 0.9845 0.9851 0.9882
Shannon_H 4.176 4.247 4.497 4.319 4.297 4.467
Evenness_e^H/S 0.6783 0.7279 9.35E-01 7.82E-01 7.66E-01 0.9073
Brillouin 0.6053 2.635 2.85 0.8634 2.099 2.291
Menhinick 21.48 11.63 9.399 11.91 8.721 8.018
Margalef 53.02 23.4 21.27 29.89 21.5 20.63
Equitability_J 0.915 0.9304 0.9852 0.9462 0.9415 0.9787
Fisher_alpha 0.0 0.0 585.2 0.0 213.9 127.2
Berger-Parker 0.05006 0.01467 0.009586 0.0154 0.01651 0.01395
Fig. 5 Graphs of principle component analysis results for Bacillus megaterium (CY5) and Bacillus mycoides (CA1) strains on the basis of BIOLOG(R)
micro-plates profile i.e., a nitrogen, b pH, and c osmolytes obtained under the different treatments of phenotypic attributes
15
highest expression of a nifH gene on day 60 post- Percent of N2 and N content in sugarcane
inoculated in both CY5 and CA1 (Fig. 7a), whereas the The concentration of N content in plant tissues such as
expression level was higher in GXB9 inoculated with leaf, root, and stem was significantly increased with the
CA1 on day 120 (Fig. 7b). In these studies, nifH gene ex- inoculation of selected isolates (CY5 and CA1) in both
pression was positively detected following the inocula- sugarcane varieties (GT11 and GXB9) as compared with
tion of both bacterial isolates in both sugarcane varieties the control (uninoculated). For GT11, the maximum in-
at different time intervals. crease in total N concentration was observed in root
samples for plants inoculated with both isolates com-
pared with the control (Fig. 9a). Whereas for GXB9,
Genes expression analysis of CAT, PAL, SOD, CHI, and compared with the control, CY5 inoculation results in
GLU more N concentration than that with CA1 in all samples
The differential gene expression of catalase (CAT), (Fig. 9b).
phenylalanine ammonia-lyase (PAL), superoxide dismut- To estimate the proportion of N in sugarcane plant
ase (SOD), chitinase (CHI) and glucanase (GLU) in leaf parts derived from the atmosphere, the plant growth
tissues at different stages of sugarcane growth was stud- medium was equally tagged with ten mg of H4SO4 per
ied by qRT-PCR (Fig. 8). The data showed a significant kilogram of soil. Our results showed that strain CY5
change in the expression level of all selected five genes fixed more N in root and stem tissues whereas, less N in
in both sugarcane varieties after CA1 and CY5 inocula- leaf tissues of GT11 variety as compared to CA1 strain.
tion. The expression level of CAT increased significantly However, in the case of GXB9 variety, CA1 fixed more
and equally in both GT11 and GXB9 on days 30 and 60 N in all plant parts (leaf, stem, and root) than strain CY5
after planting. The activity of CAT in GT11 increased (Fig. 9c-d). Consequently, the availability of N in inocu-
gradually until day 60, whereas a similar trend was ob- lated plants allowed improved growth and development
served in CA1-inoculated GXB9 until day 30 following in soil-grown plants.
planting (Fig. 8a). The PAL expression level showed a
significant increase in GT11 on day 60, whereas in Discussion
GXB9 the increase was observed only on day 30. There An important objective of research on rhizosphere mi-
was no significant change in the level of PAL expression crobes that fix nitrogen is to extend biological nitrogen
in GT11 at 30 days and GXB9 at 60 days (Fig. 8b). SOD fixation as a significant source of nitrogen for non-
expression was gradually increased up to 60 days in leguminous crops. It is important to identify a nitrogen-
GT11 for both CY5 and CA1 inoculated strains, fixing micro-organism in a major agricultural crop like
whereas, decreased from 30 to 60 days in GXB9 for both sugarcane. In addition, BNF microorganisms reduce the
inoculated strains (Fig. 8c). cost of sugarcane production [5]. In Brazil sugarcane is
The expression of CHI in GT11 was increased cultivated with a very low amount of N inputs suggest-
throughout 60 days after planting, while its activity in- ing the occurrence of BNF [25]. In this work, the evi-
creased for the first 30 days in GXB9 (Fig. 8d). For GT11 dence of BNF in B. megaterium (CY5), and B. mycoides
and GXB9, the GLU expression increased continuously (CA1) is well established. Ambrosini et al. [48] previ-
until day 60, except in CY5-inoculated GXB9 (Fig. 8e). ously studied Bacillus mycoides B38 V, which produces
various PGP traits and biocontrol activity against
Fig. 6 Fluorescence (GFP) micrographs of sugarcane plant colonized by GFP-tagged Bacillus megaterium (CY5) and Bacillus mycoides (CA1) leaf,
stem, and the root of micropropagated plantlets of sugarcane variety GT11. Confocal laser scanning microscopic images present bacterial in
green and red dots of auto-fluorescence in everywhere of plant parts respectively. (A-C) Control sugarcane plant parts and (D-I) Sugarcane plant
parts inoculated with GFP tagged bacterial strains at 500–530 nm. On the surface of roots, junction area, around the whole root, stem, and leaf.
Bacterial cells are indicated with blue arrowheads in single or clustered of bacteria. D-F represent CY5, and G-I represents CA1 strain with
bar 50 μm
Sclerotinia scleratiorum isolated from sunflower. Here, based phylogenetic analysis. All the 22 strains isolated in
we confirmed that Bacillus mycoides is the nitrogen- the present study were selected on the basis of PGP, ni-
fixing as well as plant growth-promoting bacteria in sug- trogenase, biocontrol of pathogens, etc. The strains Ba-
arcane. Members of some Bacillus spp. showed PGP cillus megaterium (CY5) and Bacillus mycoides (CA1)
traits and N-fixing ability, directly affects the plant were the most promising. Therefore, the antagonistic ef-
growth and development [49, 50]. ficacy test can be used as a regular test for screening bio-
Soil micro-organisms are essential for biogeochemical control agents and shows a cumulative result of all
cycles, colonizing the plant root, improving soil fertility mechanisms for biocontrol [7, 29]. Nitrogen-fixing bac-
and plant health and increasing crop production [51, terial genera especially Bacillus, Pseudomonas, and En-
52]. In this specific study, we focused on Bacillus genus terobacter, are known to solubilize phosphate
isolated from the sugarcane rhizosphere and character- compounds present in the soil. Among the 22 bacterial
ized them for PGP traits, in vitro antifungal activities as isolates, 18 (81.8%) isolates displayed to phosphate
well as nitrogen-fixing activity. A total of 22 Bacillus iso- solubilization property by forming clear zones in the
lates were identified following16S rRNA and rpoB gene- plates [7, 30]. Another PGP trait of Bacillus species was
Fig. 7 Analysis of inoculated potent strains Bacillus megaterium (CY5) and Bacillus mycoides (CA1) on the nifH expression patterns in two
sugarcane varieties (GT11 and GXB9) at 60 and 120 days through qRT-PCR. Data were normalized to the GAPDH expression level. All the data
points are the means ± SE (n = 3)
the activity of siderophore, and it has been recom- deaminase activity, with CY5 and CA1 recording the
mended that siderophores are involved in plant protec- highest activity. The bacterial strains producing IAA
tion [53, 54]. The qualitative test results showed 59.1 might increase root growth and help develop lateral
and 18.2% of Bacillus strains had ammonium and HCN roots which would increase nutrient uptake from the
production ability. Also, all selected screened strains rhizosphere [62]. We found that all the Bacillus strains
played an important role in biocontrol of S. scitamineum were able to produce IAA in the range from 35.01 to
and C. paradoxa pathogens. 130.96 μg mL− 1. Also, all the selected strains showed ni-
Smut, caused by S. scitamineum is a major disease of trogenase activity and they were confirmed as nitrogen-
sugarcane [55], which causes significant yield loss of sug- fixing bacteria, similar to what was observed previously
arcane production in Guangxi, China. The average smut in. Bacillus mycoides B38 V, and Bacillus megaterium
infection rate is over 10% and might reach over 50% in [30, 48].
some regions in China [55]. Pineapple disease is another In this study, we have also examined a molecular
common disease in all sugarcane growing regions in method for examining the nitrogen-fixing genes in all
China, caused by C. paradoxa. Therefore, preventing the selected strains. For the amplification of the nifH
these diseases, by non-chemical means is now a research gene, several primers were used based on its nucleotide
priority in China. Bacillus strains produced ammonia sequences, yet the nifH gene was amplified in only six
when grown in nitrogen sources and ammonia accumu- strains. It has been reported that the amplification of the
lating strains supply nitrogen to the host plant and sup- nifH gene is useful for confirming the potential strains
port plant biomass production [56]. showing nitrogen fixation [63]. The lack of nifH gene
The method to examine the quantitative amount of amplification does not imply that the isolates are not
PGPR associated with sugarcane is culture-dependent. A capable of BNF since the nucleotide sequences of the
number of bacterial strains expressing ACC deaminase nifH gene in some Bacillus species may be significantly
have been isolated in laboratory conditions worldwide different from others [64]. Genomic diversity of Bacillus
and reported their PGPR activity [57, 58]. Many PGPR strains in this study showed considerable similarity to
bacteria stimulate plant growth through the activity of those reported earlier [7]. Genetic diversity studies of
ACC deaminase by reducing plant ethylene levels. Nasci- bacterial species isolated from sugarcane using PCR-
mento et al. [59] reported that the ACC deaminase based methods are limited. Versalovic et al. [65] de-
shows various roles in microorganism’s developmental scribed a method of bacterial fingerprinting to examine
processes along with plant growth promotion abilities the strain-specific banding patterns for PCR amplifica-
and also proposed the ACC deaminase belongs to an ex- tion of repetitive DNA elements presented in entire bac-
tensive group of pyridoxal phosphate-dependent en- terial genomes. The dendrogram obtained from the
zymes based on protein sequence and phylogenetic cluster analysis of BOX and ERIC-PCR fingerprints pro-
analysis. And, the best ACC-utilizing bacterial isolates vided a complete classification of the species exhibiting
are from the genus Burkholderia and Pseudomonas iso- biological nitrogen fixation.
lated from sugarcane [60, 61]. Quantitatively, only ten Out of all the screened strains, two strains (CY5 and
(45.45%) studied strains showed significant ACC CA1) were characterized using BIOLOG(R) phenotype
Fig. 8 qRT-PCR analysis of differentially expressed genes in leaf tissue of sugarcane varieties GT11 and GXB9 during selected nitrogen-fixing
strains inoculation. (A) Catalase (SuCAT), (B) Phenylalanine ammonia-lyase (SuPAL), (C) Superoxide dismutase (SuSOD), (D) Chitinase (ScCHI), and (E)
Glucanase (ScGluD1). Data were normalized to the GAPDH expression level. All data points are the mean ± SE (n = 3)
microarray assays, localization studies using GFP To examine the effect of bacterial strains on sugarcane
marker, nifH gene expression using qRT-PCR and 15N2 colonization capability CY5 and CA1 were genetically
isotope dilution assay in sugarcane plants inoculated tagged with GFP and the amount of colonization was
with CY5 and CA1. The pattern of metabolic profiling observed by using CLSM. The uninoculated plants after
of CY5 and CA1 showed that they use a variety of meta- 72 h of incubation showed no fluorescent bacterial col-
bolic substrates (Fig. 4). Wielbo et al. [66] proposed that ony, whereas, in the plants inoculated with the isolates,
strains with wide metabolite tolerance were more effect- it was observed that bacterial cell density had increased,
ive players in host plant nodulation. In this study, the and fluorescent cells were detected and all over the plant
strain CA1 was more metabolically diverse than CY5, organs, including roots, stems, and leaves. Both strains
suggested that CA1 might be more effective in terms of colonized the sugarcane after inoculated independently.
plant growth and development. The metabolic properties Fluorescence due to the GFP-tagged bacterial
of an organism might play a role in survival to establish colonization was detected in all the sugarcane plant
successful host assemblage and to promote plant growth parts. Similarly, in the sugarcane plant, fluorescent cells
and establishment [67]. of GFP tagging can be observed on sugarcane roots and
Fig. 9 Effect of inoculation of strains Bacillus megaterium (CY5) and Bacillus mycoides (CA1) on percent 15N and N parameters for dry biomass of
two sugarcane varieties (GT11 and GXB9). The columns represent the mean of the data for each treatment and bars represent the standard error
leaves but the micro-organisms and their pattern of are the PR proteins, extensively distributed in higher
colonization were different [7, 68]. plant roots, stems, and flowers [76–87], and the expres-
We determined the amount of nifH gene expression sion of these proteins has been controlled mostly during
for selected strains in sugarcane by qRT-PCR. The nifH stress conditions such as pathogen infection [78]. The
gene expression through mRNA of diazotrophs indicated expression of beta-1,3-glucanase and chitinase genes has
the level of biological N2 fixation activity, and our results been reported in various physiological and developmen-
showed both CY5 and CA1 strains, as well as control, tal processes of plants [79], like seed and pollen germin-
expressed nitrogen fixation activity in both sugarcane ation [80], flower development and fruit ripening [81].
15
varieties at different levels. The qRT-PCR method is N2 isotope dilution and N balance trials with differ-
highly sensitive and specific [69] and suitable for the de- ent cultivars of sugarcane specify their ability to obtain
tection of mRNA transcriptions of micro-organisms at substantial quantities of nitrogen from atmospheric N2
low densities in different plant tissues or experimental through biological nitrogen-fixing micro-organisms [82].
samples. The expression profile of important plant de- In this study, our results of 15N2 isotope dilution method
velopment and defense-related enzymes, specifically and N2 assimilation experiments proposed a similar role
CAT, PAL, SOD, CHI and GLU was compared by RT- of biological nitrogen fixation by micro-organisms in
qPCR technique in both sugarcane plants at 30 and 60 sugarcane plants.
days of post-inoculation with CY5 and CA1 strains.
Similar to the earlier reports a positive response of anti- Conclusions
oxidant enzymes (CAT, SOD, and PAL) at different de- In summary, the present study indicates the occurrence
velopmental stages in sugarcane against smut disease of various strains of Bacillus genus as plant-growth pro-
resistance was observed [70]. The expression of several moting and nitrogen-fixing bacteria in the sugarcane
catalase genes is regulated in response to numerous en- rhizosphere. The use of effective nitrogen-fixing micro-
vironmental oxidative stimuli in sugarcane [71] and dif- organisms is an opportunity for improving crop produc-
ferent developmental stages in maize [72, 73]. tion in addition to maintaining soil structure and fertil-
Additionally, the positive response of SOD and PAL sup- ity. And, all those isolated bacteria showed various PGP
ports the contention that Bacillus species such as CY5 traits, nitrogenase activity, and disease resistance in re-
and CA1 help sugarcane tolerate various oxidative sponse to different pathogens. Both strains, B. megater-
stresses [74, 75]. Plant beta-1,3-glucanase and chitinases ium (CY5), and B. mycoides (CA1) may play an
important role in sugarcane crop protection, adaptation actively growing culture in the PDA plate and it was
to environmental stresses and provision of nutrients. placed at the center of the PDA: NA plates. The bacter-
ial isolates were grown in nutrient broth at a concentra-
Methods tion of 106 cell mL− 1 and they were streaked on the
Descriptions of the study site, and soil physico-chemical plate approximately 3 cm from the center where patho-
analysis gen disk is located [29, 85]. The cultures were then incu-
The aim of soil testing is to determine the nutrient of bated at 28 ± 2 °C for five days or till the fungal mycelia
the study site. The study site is located in an experimen- were fully grown in the control plate. Pathogen without
tal field of Guangxi University, Nanning, China at lati- bacterial strain was used as a control. The antifungal ac-
tude 22°49′1.21″ N, longitude 108°21′59.55″ E and an tivity was assessed by determining the growth inhibition
elevation between 70 and 500 m above sea-level. It has a against the test pathogen. The Percentage of inhibition
warm, humid subtropical climate with an annual average was calculated according to Singh et al. [29]. The isolates
temperature of 21.7 °C (21–33 °C), and rainfall varied be- showing ≥50% inhibition of mycelial growth was consid-
tween 1000 mm to 2800. Soil samples were randomly ered as promising biocontrol agents.
collected from the sugarcane field in April 2015 and The plant growth promotion potential of all the se-
stored at 4 °C. The crushed soil samples were analyzed lected isolates was assessed by standard procedures that
for physical and chemical properties. The electrical con- measure phosphate solubilization [52] and the produc-
ductivity (EC) of rhizosphere soil ranged from 0.00871 tion of siderophore [86], HCN, [87] and ammonia pro-
to 0.0111 Sm− 1, and it depends on the amount of mois- duction [88]. IAA production by the isolates was
ture and the size, and texture of soil particles. The water estimated spectrophotometrically following the method
content was varied from 5.13 to 6.18%, and the pH described by Glickmann and Dessaux [89].
ranged from 6.0 to 6.70. The amount nitrogen, phos-
phorus, and potassium in the test soil were 0.60, 0.46 1-Aminocyclopropane-1-carboxylate deaminase assay
and 14.26 g Kg− 1 respectively. The level of other macro All isolates were screened for ACC deaminase activity by
and micronutrients in the sugarcane rhizosphere are using nitrogen-free Dworkin and Foster (DF) medium
presented in Additional file 5 (Table S2). [90]. Medium without ACC was used as a negative con-
trol, whereas two positive controls, i.e. medium with am-
Isolation of nitrogen-fixing bacteria monium sulfate [(NH4)2SO4] (0.2% w/v) and those with
Five, six months old healthy cultivated sugarcane plants ACC (3 mM) were also used, and the cultures were incu-
were randomly collected from our experimental field of bated at 30 ± 2 °C for 3–5 days. The strains grown on
Sugarcane Research Institute, Guangxi Academy of Agri- ACC plates were further selected and acdS gene amplifi-
cultural Sciences, Nanning, China. No permissions were cation was observed with degenerate primers and the
required for the collection of sugarcane plant samples in conditions were followed by Li et al. [91]. The ACC de-
this study. Root-adhered soil was collected and mixed aminase activity was quantified according to Honma and
well and then stored at 4 °C for further analysis. Root Shimomura [92].
debris was removed by sieving the soil through a 2 mm
mesh. Ten grams of soil sample was suspended in 90 mL Acetylene reduction assay
of saline water and agitated in an orbital shaker set at Each bacterial isolate was examined for nitrogen-fixing
100 rpm and 30 ± 2 °C for 30 min. Different bacterial ability through the acetylene reduction assay (ARA)
species present in the soil suspension were isolated as method [93]. All isolates were inoculated in a 25 mL
described earlier [29]. Nitrogen-fixing bacteria were iso- flask comprising 10 mL JNFb (Additional file 6) medium
lated by using five different media JNFb medium, LGI and incubated for 3 days at 30 ± 2 °C. Inside air from the
Medium [83, 84], Ashbey medium (Hi-Media), Yeast tubes is replaced with 5 mL of acetylene through a syr-
Mannitol Agar (Hi-Media), and Nutrient Agar (Hi- inge and the tubes were incubated for 24 h at 30 ± 2 °C
Media) (Additional file 6: Table S3). The colonies of dis- [7]. The column (DB-1701, Agilent, Santa Clara, USA)
similar morphotypes appeared in the culture were puri- temperature was set at 80 °C, whereas flame ionization
fied and stored for further studies. detector and injector temperature were 110 °C, with car-
rier gas nitrogen at a flow rate of 35 mL min− 1. A gas
Identification of isolates with antifungal and plant growth sample from the tube (0.5 mL) was inserted into the
promotion properties GC-17A gas chromatograph (Shimadzu, Kyoto, Japan)
All isolates were tested for their in vitro antifungal activ- and the peak heights were measured and to compute
ity by dual culture method on PDA: NA (1:1) agar plates ethylene production in samples. The total protein con-
with two sugarcane pathogens S. scitamineum, and C. centration of each sample tube was estimated by the
paradoxa. A disk of 5 mm diameter was cut from an protein assay kit (Solarbio, Life Sciences, Beijing).
DNA extraction and partial sequencing of 16S rRNA and rpoB gene sequences with essential reference sequences
rpoB genes were sourced from the NCBI GenBank database. The
A pure culture of bacteria was grown in Luria-Bertani multiple sequences were aligned by ClustalW [100] and
broth for 24–36 h on a rotary incubator maintained at the BlastN search program was performed to compare the
32 ± 2 °C and 150 rpm. DNA was extracted from 1.5 mL sequences. The 16S rRNA and rpoB genes were subjected
of pure culture using a DNA isolation kit (CWBIO, to phylogenetic analysis using molecular evolutionary gen-
Beijing-China) according to the manufacturer’s instruc- etics analysis (MEGA) software (version 7.0) [101], and
tions. The quantity and integrity of the extracted DNA the unweighted pair group method with arithmetic mean
were determined by electrophoresis (0.8%) and by spec- (UPGMA) in a Kimura two-parameter model [102]. The
trophotometry, using Nanophotometer (Pearl, Implen- bootstrap analysis was carried out by the Felsenstein
3780). method using 1000 pseudoreplication [103].
To amplify the 16S rRNA and rpoB gene, primer pairs
PA-F and PH-R for the 16S rRNA gene [96 and rpoB-F Amplification, cloning, and sequencing of the nifH gene
and rpoB-R for rpoB gene [94] were used (Table 5). The Using total DNA as a template, the nifH gene was ampli-
polymerase chain reaction (PCR) was performed for16S fied by polymerase chain reaction (PCR) using primers
rRNA gene with a heated lid included in the initial de- PolF and PolR ([97]; Table 5). The PCR was performed
naturation at 95 °C for 5 min, 30 cycles of denaturation as described earlier [7]. The PCR product was gel ex-
at 95 °C for 1 min, annealing at 55 °C for 1 min, exten- tracted, purified and cloned (pMD® 18-TVector) follow-
sion at 72 °C for 1 min and rpoB gene 95 °C for 3 min, ing the manufacturer’s (TaKaRa, Japan) instructions.
35 cycles at 95 °C for 20 s, 55 °C for 30 s, and 72 °C for The recombinant colonies grown on Luria-Bertani agar
1.5 min extension and final extension for both genes at plates containing 50 μg mL− 1 ampicillin were identified
72 °C for 5 min. All amplified products were purified by by colony PCR. The cloned PCR products were se-
PCR purification kit (BioFlux) and sequenced (Sangon quenced (Sangon Biotech, Shanghai, China) to establish
Biotech, Shanghai, China). the nifH gene identity.
Phylogenetic analysis Genetic characterization of isolates by BOX and ERIC-PCR

To verify the identities of the bacterial isolates and deter- To determine the genetic diversity of selected isolates,
mine their evolutionary relationships, the 16S rRNA and total DNA isolated were fingerprinted by BOX-PCR and
Table 5 PCR primers used for species identification, molecular characterization, and gene expression
Target Gene Primer Nucleotide Sequence (5′ ------- → 3′) Product Size (bp) Reference
Name
16S PA-F AGAGTTTGATCCTGGCTCAG 1300–1500 [95]
PH-R AAGGAGGTGATCCAGCCGCA
rpoB RPO-F ATCGAAACGCCTGAAGGTCCAAACAT > 1100 [94]
RPO-R ACACCCTTGTTACCGTGACGACC
BOX BOX A1R CTACGGCAAGGCGACGCTGACG 50–5000 [96]
ERIC ERIC-1 ATGTAAGCTCCTGGGGATTCAC 50–5000
ERIC-2 AAGTAAGTGACTGGGGTGAGCG
RTq-PCR Primers
NifH Pol-F TGCGAYCC-SAARGCBGACTC RTq-PCR [97]
Pol-R ATSGCCATCATYTCRCCGGA
Glyceraldehyde 3-phosphate dehydrogenase GAPDH-1 CTCTGCCCCAAGCAAAGATG RTq-PCR [98]
GAPDH-2 TGTTGTGCAGCTAGCATTG
SuPAL PAL-F CTCGAGGAGAACATCAAGAC RTq-PCR [74]
PAL-R GTGATGAGCTCCTTCTCG
SuCAT CAT-F CTTGTCTGGAGCACATACACTTGGA RTq-PCR [72]
CAT-R TTCTCCGCATAGACCTTGAACTTTG
SuSOD SOD-F TTTGTCCAAGAGGGAGATGG RTq-PCR [75]
SOD-R CTTCTCCAGCGGTGACATTT
ScChi ScChi-QF ACGGCTACGGCGACAACA RTq-PCR [71]
ScChi-QR GTCCGCTGACCAGATGAAGAG
ScGluD1 D-QF TGCTACTTCTTATCCACCCTCTG RTq-PCR [99]
D-QR CGTTGACATAGAAAGGTGAGCC
ERIC-PCR [29] using the primers and the conditions used as a control, following the growth chamber condi-
listed in Table 5, and Additional file 7 (Table S4), re- tion of Li et al. [7].
spectively. The amplified bands were separated by gel
electrophoresis (1.5% agarose) and the gels were imaged Confocal laser scanning microscopy
by the BIORAD gel documentation system. After 96 h of bacterial inoculation, inoculated and un-
inoculated sugarcane plantlets were removed from the
Phenotype microarray assays culture vessel and washed two to three times with auto-
Among all the screened isolates CY5 and CA1 were the claved distilled water. The root, stem, and leaf were cut
most potent N-fixing strains on the basis of PGPs as well into small parts (50 to 150 μm) and then mounted them
as nitrogenase activity. Thus, both were selected for fur- on the bridge slide with 10% (v/v) glycerol. All plant sec-
ther experiments. Phenotype microarray was conducted tions were detected with a CLSM (Leica DMI 6000,
using Biolog microplates, a tetrazolium-based growth Leica Microsystems, Mannheim, Germany).
assay developed by Biolog Incorporated (Biolog, Inc.,
Hayward, CA). The potential strains CY5 and CA1 were Evaluation of isolates in the greenhouse experiment
assayed on microplates GENIII, PM3B, PM9 and PM10, The experiment was conducted in a greenhouse with
testing for different substrates such as several carbon two sugarcane verities GT11 and GXB9, at Guangxi Uni-
and nitrogen sources, and tolerance to different osmotic versity, Nanning, Guangxi, China. The plantlets of these
and pH stresses [104]. The inoculum of microplates was varieties were provided by Sugarcane Research Institute,
prepared as described [7]. All the microplates were incu- Guangxi Academy of Agricultural Sciences, Nanning,
bated for 72 h at 30 ± 2 °C for tetrazolium color develop- China. Forty healthy sugarcane plantlets of each sugar-
ment. After incubation, the readings were obtained cane variety were divided into two groups i.e., 20–20.
using an automated BIOLOG(R) Micro-Station Reader These selected plantlets were 30–40 days old, then
according to the manufacturer’s instructions. The micro- washed with running tap water to remove all soil parti-
bial growth was evaluated using optical density measure- cles attached to the surface of the plants. All sugarcane
ments at 590 nm after 72 h incubation. plantlets were immersed in bacterial spore suspension
set at 106 spores mL− 1 for 1 h. After, these treatments,
plantlets were transferred into plastic pots (30 cm in
Genetic transformation of strains with green fluorescent diameter, 40 cm in-depth, two plants per pot) with 15 kg
protein soil and sand mixture (3:1 w/w). The plantlets without
Plasmid transformation spore suspension treatment were used as the control for
The pPROBE-pTetr-TT plasmid containing the green both varieties. After inoculation, the plantlets were
fluorescent protein (GFP) gene and tetracycline resist- grown in the pots under controlled conditions (30 ±
ance gene (provided by State Key Laboratory of Subtrop- 2 °C, > 80% relative humidity and 16/8 h light/dark
ical Bioresources Conservation and Utilization, Guangxi cycle). Leaf, stem and root samples from both varieties
University, Nanning, China) was transferred to Bacillus were sampled at consecutive time intervals (30–120
strains (CY5 and CA1) by biparental mating using days). Collected samples were immediately stored at −
Escherichia coli strain TG1 as the donor and DH5α/ 80 °C until they were used for investigations.
pRK2013 as the helper [105]. Transformants were se-
lected using kanamycin (100 μg mL− 1) and ampicillin RNA extraction and cDNA synthesis
(100 μg mL− 1) resistance and green fluorescence. RNA was extracted using Trizol reagent (Tiangen,
China) and purified using a RNeasy Plant Mini Kit (Qia-
Colonization of sugarcane plantlets by GFP-tagged gen). The first-strand cDNA from DNase-treated RNA
pPROBE-pTetr-TT CY5 and CA1 bacteria was synthesized using Prime-Script™ RT Reagent Kit
Plantlets of micro-propagated cultivated sugarcane var- (TaKaRa, China) according to the manufacturer’s
iety GT11 were obtained from Sugarcane Research Insti- instructions.
tute, Guangxi Academy of Agriculture Sciences,
Nanning, China, and plantlets were inoculated with Ba- Real-time PCR quantification of CY5 and CA1
cillus strains and GFP /pPROBEpTetr-TT tagged Bacil- The expression of nifH, CAT, PAL, SOD, CHI and GLU
lus strains according to Oliveira et al. [105]. Five genes in leaf tissues of sugarcane during plant-
different plantlets were shifted in a glass container com- microorganism interaction was analyzed under a green-
prising 50 mL of liquid MS medium [106]. After two- house condition after inoculation of selected strains
three days, plantlets were shifted in bacterial suspension (CY5 and CA1) in GT11 and GXB9 sugarcane varieties.
approximately 2.0 × 105 mL− 1 cell count in autoclaved Both sugarcane varieties were provided by Sugarcane Re-
bottles and plantlets without bacterial suspension were search Institute, Guangxi Academy of Agricultural
Sciences, Nanning, China. The relative expression of all (DMRT). Standard errors were calculated for all mean
genes was measured by calculating the difference in the values of three replicates and variations were measured
expression level of the inoculated sample and the control significant at the p ≤ 0.05 level by student’s t-test. All
at 60 and 120 days with glyceraldehyde-3-phosphate de- plant growth-promoting rhizobacteria tests were con-
hydrogenase (GAPDH) as the reference gene. ducted in triplicate, and the results were expressed as
Real-time quantitative PCR (RT-qPCR) was conducted mean values. All the experiments including Biolog, mi-
with SYBR Premix Ex Tap™II (TaKaRa, Japan) and the crobial colonization, and RT-PCR were performed in du-
reaction was completed in RT-PCR System (Bio-Rad, plicate and the results were assessed for consistency.
USA). The total reaction volume was 20 μL, the compos- OrigiPro 9.1 (2013) software was used for the principal
ition of the reaction mixtures and conditions were component analysis (PCA).
followed by Niu et al. [98]. The list of primers used is
presented in Table 5. The specificity of the reaction was
confirmed by melting curve analysis at the end of the Supplementary information
amplification and 2−△△Ct method was used for quantifi- Supplementary information accompanies this paper at https://doi.org/10.
1186/s12870-020-02400-9.
cation of relative gene expression [107]. Each RT-qPCR
experiment was conducted in triplicate. Additional files 1: Figure S1. acds gene amplification in nitrogen-fixing
bacteria and approximately 755 bp fragments to be amplified. M is a mo-
15 lecular size marker (100 to 2000 bp), PC is positive control (Pseudomonas
Plant tissue analysis for N2 and %N by isotope dilution
entomophila), and NC is negative control (sterile water).
assay
Additional files 2: Figure S2. PCR amplification with genomic DNA of
The nitrogen content of the dried plant tissues (root, nitrogen-fixing bacteria. The nifH gene fragment is amplified at 360 bp. M
leaf, and stem) was determined by the Institute of Gen- is a molecular size marker (100 to 2000 bp), Klebsiella verticola as a posi-
etics and Physiology, Hebei Academy of Agriculture and tive control (PC), and sterile water is negative control (NC).
Forestry Sciences, China. Atom % 15N2 was determined Additional files 3: Figure S3. BOX fingerprinting of the screened
bacterial isolates from sugarcane. Strain Codes: B1. CoY3, B2. CoY7, B3.
by K05 automatic Kjeldahl nitrogen determination ap- CoY8, B4. CoA1, B5. CoA10, B6. AY6, B7. AY7, B8. AY8, B9. AN8, B10. AN11,
paratus (Shanghai Sonnen automated analysis instru- B11. AN12, B12. BN5, B13. CY5, B14. CY9, B15. CY10, B16. CY11, B17. CA1,
ment co. Ltd.), and elementary analysis isotope ratio B18. CA6, B19. CA8, B20. CN13, B21. CN14 and B22. N1. M, molecular size
marker from 100 bp- 5 kb (Takara). Figure S4. ERIC-PCR fingerprinting of
mass spectrometers (Thermo Fisher DeltaV Advantage selected bacteria from sugarcane. Strain Codes: B1. CoY3, B2. CoY7, B3.
IRMS). The 15N2 isotope dilution assay was used to CoY8, B4. CoA1, B5. CoA10, B6. AY6, B7. AY7, B8. AY8, B9. AN8, B10. AN11,
quantify the nitrogen fixed by CY5 and CA1, in the sug- B11. AN12, B12. BN5, B13. CY5, B14. CY9, B15. CY10, B16. CY11, B17. CA1,
B18. CA6, B19. CA8, B20. CN13, B21. CN14 and B22. N1. Without labelled
arcane varieties GT11 and GXB9. 15N2 isotope dilution gel lanes are not used in this study.
assay of GT11 and GXB9 plants under the greenhouse Additional files 4: Table S1. The number of substrates utilized by
condition was done as described by Lin et al. [108]. individual strains for Bacillus megaterium (CY5) and Bacillus mycoides
The method involves testing of an N2-fixing crop grown (CA1).
in a substrate with homogenous 15N2 enrichment ammo- Additional files 5: Table S2. Analysis of physical, chemical properties
and trace elements structure in the soil of sugarcane plant.
nium sulfate (10 mg kg− 1 of soil). Pots were filled with 15
Additional files 6: Table S3. The media used in this study for isolation
kg of soil mixed with 15N2-labeled ammonium sulfate. of N2 fixing bacteria from sugarcane.
Three plants of similar sizes and inoculated with CY5 and Additional files 7: Table S4. Composition and conditions of PCR
CA1 strains were transplanted in each pot. There were amplification used for genetic fingerprinting analysis.
five replicates per treatment. Six months after planting,
the plants were harvested and washed to remove the at-
tached soil. Root, leaf, and stem were separated and dried Abbreviations
at 65 °C for 48 h and ground to make a fine powder, then ACC: 1-aminocyclopropane-1-carboxylate; ANOVA: Analysis of variance;
ARA: Acetylene reduction assay; BLAST: Basic local alignment search tool;
sieved using a 0.5 mm mesh. The percentage of fixed N2 BOX: A1R-based repetitive extragenic palindromic; CAT: Catalase;
derived from the air (Ndfa) in the plant was determined CHI: Chitinase; DMRT: Duncan’s multiple range test; EC: Electrical
according to the following equation [108]. conductivity; ERIC: Enterobacterial repetitive intergenic consensus;
GFP: Green fluorescent protein; GLU: Glucanase; HCN: Hydrogen cyanide;
IAA: Indole acetic acid; MEGA: Molecular evolutionary genetics analysis;
N: Nitrogen; (NH4)2SO4: Ammonium sulfate; NCBI: National center for
%Ndfa ¼ 100 ð1− atom% 15 N2 excess from treatment biotechnology information; PGPR: Plant growth-promoting rhizobacteria;
PAL: Phenylalanine ammonia-lyase; PCA: Principal component analysis;
= atom% 15 N2 excess from control g PCR: Polymerase chain reaction; qRT-PCR: Quantitative Real-Time polymerase
chain reaction; SOD: Superoxide dismutase; UPGMA: Unweighted pair group
method with arithmetic mean
Statistical data analysis
The data were analyzed using analysis of variance Acknowledgements
(ANOVA) followed by Duncan’s multiple range test Not applicable.
Authors’ contributions 8. Glick BR. Plant growth-promoting bacteria, mechanisms and applications.
Conceptualization, RKS, PS, LY, and YL. Methodology, RKS, HL, PS. Software Scientifica (Cairo). 2012;963401. https://doi.org/10.6064/2012/963401.
analysis, RKS. Validation, QS, and DG. Formal analysis, MKS, KKV, MKM. The 9. Paungfoo-Lonhienne C, Lonhienne TGA, Yeoh YK, Webb RI, Lakshmanan P,
investigation, LY, YL. Formal analysis, XS. Writing-original draft preparation, Chan CX, Lim PE, Ragan MA, Schmidt S, Hugenholtz P. A new species of
RKS, PS. Writing-review and editing, LY, YL, and PL. All authors read, edited Burkholderia isolated from sugarcane roots promotes plant growth. Microb
and approved the final manuscript. Biotechnol. 2014;7(2):142–54.
10. Sahoo RK, Ansari MW, Dangar TK, Mohanty S, Tuteja N. Phenotypic and
Funding molecular characterisation of efficient nitrogen-fixing Azotobacter strains
This research was funded by the National Natural Science Foundation of from rice fields for crop improvement. Protoplasma. 2014;251:511–23.
China (31471449, 31171504, 31101122), Guangxi Special Funds for Bagui 11. Venieraki A, Dimou M, Pergalis P, Kefalogianni I, Chatzipavlidis I, Katinakis P.
Scholars and Distinguished Experts (2013–3), Guangxi Special Fund for The genetic diversity of culturable nitrogen-fixing bacteria in the
Scientific Base and Talent (GKAD17195100). Fund for Guangxi Innovation rhizosphere of wheat. Microb Eco. 2011;61:277–85.
Teams of Modern Agriculture Technology (GJNYTXGXCXTD-03-01) and Fund 12. Boddey RM, de Oliveira OC, Urquiaga S, Reis VM, Olivares FL, Baldani VLD,
of Guangxi Academy of Agricultural Sciences (2015YT02 and GNKB2017028). DoÈbereiner J. Biological nitrogen fixation associated with sugar cane and
The funding bodies were not involved in the design of the study, analysis, rice: contributions and prospects for improvement. Plant Soil. 1995;174:195–
and interpretation of data in the manuscript. 209.
13. Silveira APD, Sala VMR, Cardoso EJBN, Labanca EG, Cipriano MAP. Nitrogen
Availability of data and materials metabolism and growth of wheat plant under diazotrophic endophytic
All data produced or evaluated through this study will be easily accessible bacteria inoculation. Appl Soil Ecol. 2016;107:313–9.
with request to corresponding authors for reasonable request. 14. Liu X, Zhao H, Chen S. Coloniation of maize and rice plants by strain Bacillus
megaterium C4. Cur Microbiol. 2006;52:186–90.
Ethics approval and consent to participate 15. Munusamy M, Selvaraj P, Lee J-S, Lee K-C, Kuppusamy H. Bacillus
This research article does not contain any ethical and consent approval. rhizosphaerae sp. nov., an novel diazotrophic bacterium isolated from
sugarcane rhizosphere soil. Antonie van Leeuwenhoek. 2011;100:437–44.
Consent for publication 16. Reis VM, P., los Santos E-d, Tenorio-Salgado S, Vogel J, Stoffels M, Guyon S,
Not applicable. Mavingui P, Baldani VLD, Schmid M, Baldani JL, Balandreau J, Hartmann A,
CaballeroMellado J. Burkholderia tropica sp. nov., a novel nitrogen fixing,
Competing interests plant-associated bacterium. Int J Syst Evol Microbiol. 2004;54:2155–62.
The authors declare that they have no competing interests. 17. Goris J, De Vos P, Caballero-Mellado J, Park J, Falsen E, Quensen JF, Tiedje
JM, Vandamme P. Classification of the PCB- and biphenyl-degrading strain
Author details LB400 and relatives as Burkholderia xenovorans sp. nov. Int J Syst Evol
1
Key Laboratory of Sugarcane Biotechnology and Genetic Improvement Microbiol. 2004;54:1677–81.
(Guangxi), Ministry of Agriculture, Sugarcane Research Center, Chinese 18. Perin L, Martinez-Aguilar L, Paredes-Valdez G, Baldani JI, Estrada-de los
Academy of Agricultural Sciences, Guangxi Key Laboratory of Sugarcane Santos P, Reis VM, Caballero-Mellado J. Burkholderia silvatlantica sp. nov., a
Genetic Improvement, Sugarcane Research Institute, Guangxi Academy of diazotrophic bacterium associated with sugarcane and maize. Int J Syst Evol
Agricultural Sciences, Nanning 530007, Guangxi, China. 2College of Microbiol. 2006;56:1931–7.
Agriculture, State Key Laboratory of Conservation and Utilization of 19. Martínez-Aguilar L, Salazar-Salazar C, Méndez RD, Caballero-Mellado J, Hirsch
Subtropical Agro-bio resources, Guangxi University, Nanning 530005, China. AM, Vásquez-Murrieta MS, Estrada-de los Santos P. Burkholderia caballeronis
3
Guangxi Key Laboratory of Crop Genetic Improvement and Biotechnology, sp. nov., a nitrogen fixing species isolated from tomato (Lycopersicon
Nanning 530007, Guangxi, China. 4Department of Food Quality and Safety, esculentum) with the ability to effectively nodulate Phaseolus vulgaris.
Institute for Post-harvest and Food Sciences, The Volcani Center, Agricultural Antonie Van Leeuwenhoek. 2013;104(6):1063–71.
Research Organization, 7528809 Rishon LeZion, Israel. 5Queensland Alliance 20. Salvagiotti F, Cassman KG, Specht JE, Walters DT, Weiss A, Doberman A.
for Agriculture and Food Innovation, The University of Queensland, St Lucia, Nitrogen uptake, fixation, and response to fertilizer N in soybeans: a review.
QLD 4072, Australia. Field Crops Res. 2008;108:1–13.
21. Han J, Sun L, Dong X, Cai Z, Sun X, Yang H, Wang Y, Song W.
Received: 30 August 2019 Accepted: 21 April 2020 Characterization of a novel plant growth-promoting bacteria strain Delftia
tsuruhatensis HR4 both as a diazotroph and a potential biocontrol agent
against various plant pathogens. Syst Appl Microbiol. 2005;28(1):66–76.
References 22. Zhu B, Qing Z, Lin L, Hu C, Shen P, Yang L, Qianli A, Guanlin X, Yangrui L.
1. Dwight T, Lakshmanan P, Songstad DD. “Biofuels” Global impact on Enterobacter sacchari sp. nov., a nitrogen-fixing bacterium associated with
renewable energy, production agriculture and technological advancement, sugarcane (Saccharum officinarum L.). Int J Syst Evol Microbiol. 2013;63:
Springer, USA; 2011. p. 357. 2577–82.
2. FAO. Top Sugarcane Production: Food and Agriculture Organization of the 23. Boddey RM, Urquiaga S, Alves Burno JR, Reis V. Endophytic nitrogen fixation
United Nations. Rome: FAO; 2018. in sugarcane: present knowledge and future applications. Plant Soil. 2003;
3. Singh RK, Singh P, Li HB, Yang LT, Li YR. “Soil–Plant–Microbe Interactions” 252:139–49.
Use of nitrogen-fixing bacteria for plant growth and development in 24. Vargas L, Santa-Brígida AB, Mota-Filho JP, de Carvalho TG, Rojas CA,
sugarcane. In: Singh DP, et al., editors. “Plant-Microbe Interactions in Agro- Vaneechoutte D, Van Bel M, Farrinelli L, Ferreira PCG, Vandepoele K, Hemerly
Ecological Perspectives”. Singapore Pte Ltd. Springer Nature; 2017. https:// AS. Drought tolerance conferred to sugarcane by association with
doi.org/10.1007/978-981-10-5813-4-3. Gluconacetobacter diazotrophicus: a transcriptomic view of hormone
4. Robinson N, Brackin R, Vinall K, Soper F, Holst J, Gamage H, Paungfoo- pathways. PLoS One. 2014;9:e114744.
Lonhienne C, Rennenberg H, Lakshmanan P, Schmidt S. Nitrate paradigm 25. Yong-Xiu X, Chun-Yan W, Yao M, Yang L-T, Si-Liang H, Yang-Rui L. Nitrogen-
does not hold up for sugarcane. PLoS One. 2011;6(4):e19045. fixing and plant growth-promoting ability of two endophytic bacterial
5. Li RY, Yang LT. Sugarcane agriculture and sugar industry in China. Sugar strains isolated from sugarcane stalks. Sugar Tech. 2015;18(4):373–9.
Tech. 2015;17:1–8. 26. Ehrmann J, Ritz K. Plant: soil interactions in temperate multi-cropping
6. Lal R. Climate change and soil degradation mitigation by sustainable production systems. Plant Soil. 2014;376:1–29.
management of soils and other natural resources. Agric Res. 2012;1(3):199– 27. Hong Y, Ma Y, Wu L, Maki M, Qin W, Chen S. Characterization and analysis
212. of nifH genes from Paenibacillus sabinae T27. Microbiol Res. 2012;167:596–
7. Li HB, Singh RK, Singh P, Song QQ, Xing YX, Yang LT, Li YR. Genetic diversity 60.
of nitrogen-fixing and plant growth promoting Pseudomonas species 28. Ankit K, Anil P, Johri BN. Bacillus as PGPR in crop ecosystem. In: Maheshwari
isolated from sugarcane rhizosphere. Front Microbiol. 2017. https://doi.org/ DK, editor. Bacteria in Agrobiology: crop ecosystems, Springer-Verlag Berlin
10.3389/fmicb.2017.01268. Heidelberg; 2011. p. 37–59.
29. Singh RK, Kumar DP, Solanki MK, Singh P, Srivastava S, Srivastva AK, Kumar S, 53. Radzki W, Gutierrez MFJ, Algar E, Lucas GJA, Garcia VA, Ramos SB. Bacterial
Kashayp PL, Singhal PK, Arora DK. Multifarious plant growth promoting siderophores efficiently provide iron to iron-starved tomato plants in
characteristics of chickpea rhizosphere associated bacilli help to suppress hydroponics culture. Anton V Leeuwen. 2013;104:321–30.
soil-borne pathogens. Plant Growth Regul. 2013;73:91–101. 54. Jaber M, Harald K, Omer E, Konrad M. The central role of microbial activity
30. Solanki MK, Wang Z, Wang FY, Li CN, Lan TJ, Singh RK, Singh P, Yang LT, for iron acquisition in maize and sunflower. Biol Fertil Soil. 2002;30:433–9.
Yang RL. Intercropping in sugarcane cultivation influenced the soil 55. Que YX, Xu LP, Lin JW, Chen RK, Grisham MP. Molecular variation of
properties and enhanced the diversity of vital diazotrophic bacteria. Sugar Sporisorium scitamineum in mainland China revealed by RAPD and SRAP
Tech. 2016. https://doi.org/10.1007/s12355-016-0445-y. markers. Plant Dis. 2012;96:1519–25..
31. Velazquez E, Rojas M, Lorite MJ, Rivas R, Zurdo-Pineiro JL, Heydrich M, 56. Marques APGC, Pires C, Moreira H, Rangel AOSS, Castro PML. Assessment of
Bedmar EJ. Genetic diversity of endophytic bacteria which could be find in the plant growth promotion abilities of six bacterial isolates using Zea mays
the apoplastic sap of the medullary parenchyma of the stem of healthy as indicator plant. Soil Biol Biochem. 2010;42:1229–35.
sugarcane plants. J Basic Microbiol. 2008;48:118–24. 57. Belimov AA, Safronova VI, Mimura T. Response of spring rape (Brassica
32. Kruasuwan W, Thamchaipenet A. Diversity of culturable plant growth- napus L. var. Oleifera) to inoculation with plant growth promoting
promoting bacterial endophytes associated with sugarcane roots and their rhizobacteria containing 1-aminocyclopropane-1-carboxylate deaminase
effect of growth by co-inoculation of diazotrophs and actinomycetes. J Plant depends on nutrient status of the plant. Can J Microbiol. 2002;48:189–99.
Growth Regul. 2016;35(4):1074–87. 58. Glick BR, Penrose DM, Li J. A model for the lowering of plant ethylene
33. Dobereiner J. Nitrogen fixing bacteria of the genus Beijerinckia Drex. In the concentration by plant growth-promoting bacteria. J Theor Biol. 1998;190:63–8.
rhizosphere of sugarcane. Plant Soil. 1961;15:211–6. 59. Nascimento FX, Rossi MJ, Soares CRFS, McConkey BJ, Glick BR. New insights
34. Costa PBD, Granada CE, Ambrosini A, Moreira F, de Souza R, dos Passos JFM, into 1-Aminocyclopropane-1-carboxylate (ACC) Deaminase phylogeny,
Arruda L, Passaglia LMP. A model to explain plant growth promotion traits: Evolution and Ecological Significance. PLoS ONE. 2014;9(6):e99168.
a multivariate analysis of 2211 bacterial isolates. PLoS One. 2014;9:e116020. 60. Blaha D, Prigent-Combaret C, Mirza MS, MoenneLoccoz Y. Phylogeny of the
35. Govindasamy V, Senthilkumar M, Magheshwaran V, Kumar U, Bose P, 1-aminocyclopropane-1-carboxylic acid deaminase encoding gene acdS in
Sharma V, Annapurna K. Bacillus and Paenibacillus spp.: potential PGPR for phytobeneficial and pathogenic Proteobacteria and relation with strain
sustainable agriculture. In: Maheshwari DK, editor. Plant growth and health biogeography. FEMS Microbiol Ecol. 2006;56:455–70.
promoting Bacteria. Berlin Heidelberg: Springer; 2011. p. 333–64. 61. Onofre-Lemus J, Hernandez-Lucas I, Girard L, Caballero-Mellado J. ACC (1-
36. Parke JL, Gurian-Sherman D. Diversity of the Burkholderia cepacia complex aminocyclopropane-1- carboxylate) deaminase activity, a widespread trait in
and implications for risk assessment of biological control strains. Annu Rev Burkholderia species, and its growth-promoting effect on tomato plants.
Phytopathol. 2001;39:225–58. Appl Environ Microbiol. 2009;75:6581–90.
37. Suárez-Moreno Z, Caballero-Mellado J, Coutinho B, Mendonça-Previato L, 62. Idris SE, Iglesias DJ, Talon M, Borriss R. Tryptophan-dependent production of
James E, Venturi V. Common features of environmental and potentially indole-3-acetic acid (IAA) affects level of plant growth promotion by Bacillus
beneficial plant-associated Burkholderia. Microb Ecol. 2012;63:249–66. amyloliquefaciens FZB42. Mol Plant-Microbe Interact. 2007;20:619–26.
38. Dobereiner J, Ruschel AP. A new species of Beijerinckia (in Portuguese, with 63. Zehr JP, Capone DG. Problems and promises of assaying the genetic
abstract in English). Rev Biol. 1958;1:261–72. potential for nitrogen fixation in the marine environment. Microb Ecol.
39. Dobereiner J. Biological nitrogen fixation in the tropics, social and 1996;32:263–81.
economic contributions. Soil Biol Biochem. 1997;29:771–4. 64. Zehr JP, Jenkins BD, Short SM, Steward GF. Nitrogenase gene diversity and
40. Baldani JI, Reis VM, Baldani VLD, Dobereiner J. A brief story of nitrogen microbial community structure, a cross-system comparison. Environ
fixation in sugarcane reasons for success in Brazil. Funct Plant Biol. 2002;29: Microbiol. 2003;5:539–54.
417–23. 65. Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in
41. Xie GH, Su BL, Cui ZJ. Isolation and identification of N2-fixing strains of eubacteria and application to fingerprinting of bacterial genomes. Nucleic
Bacillus in rice rhizosphere of the Yangtze River valley. Acta Microbiol Sin. Acids Res. 1991;19:6823–31.
1998;38:480–3. 66. Wielbo J, Marek-Kozaczuk M, Kubik-Komar A, Skorupska A. Increased
42. Elo S, Suominen I, Kampfer P, Juhanoja J, Salkinoja-Salonen M, Haahtela K. metabolic potential of Rhizobium spp. is associated with bacterial
Paenibacillus borealis sp. nov.; a nitrogen fixing species isolated from spruce competitiveness. Can J Microbiol. 2007;53:957–67.
forest humus in Finland. Int J Syst Evol Microbiol. 2001;51:535–45. 67. Mazur A, Stasiak G, Wielbo J, Koper P, Kubik-Komar A, Skorupska A.
43. Berge O, Guinebretiere MH, Achouak W, Normand P, Heulin T. Paenibacillus Phenotype profiling of Rhizobium leguminosarum bv. Trifolii clover nodule
graminis sp. nov. and Paenibacillus odorifer sp. nov.; isolated from plant isolates reveal their both versatile and specialized metabolic capabilities.
roots, soil and food. Int J Syst Evol Microbiol. 2002;52:607–16. Arch Microbiol. 2013;195:255–67.
44. Von der Weid I, Duarte GF, van Elsas JD. Paenibacillus brasilensis sp. nov.; a 68. Lin L, Guo W, Xing Y, Zhang X, Li Z, Hu C, Song L, Li YR, An Q. The
novel nitrogen-fixing species isolated from the maize rhizosphere in Brazil. actinobacterium Microbacterium sp. 16SH accepts pBBR1-based pPROBE vectors,
Int J Syst Evol Microbiol. 2002;52:2147–53. forms biofilms, invades roots, and fixes N2 associated with micropropagated
45. Achouak W, Normand P, Heulin T. Comparative phylogeny of rrs and nifH sugarcane plants. Appl Microbiol Biotechnol. 2012;93:1185–95.
genes in the Bacillaceae. Int J Syst Bacteriol. 1999;49:961–7. 69. Noda S, Ohkuma M, Usami R, Horikoshi K, Kudo T. Culture-independent
46. Lugtenberg BJJ, Dekkers L, Bloemberg GV. Molecular determinants of characterization of a gene responsible for nitrogen fixation in the symbiotic
rhizosphere colonization by Pseudomonas. Annu Rev Phytopathol. 2001;39: microbial community in the gut of the termite Neotermes koshunensis. Appl
461–90. Environ Microbiol. 1999;65:4935–42.
47. Compant S, Clement C, Sessitsch A. Plant growth-promoting bacteria in the 70. Singh P, Song QQ, Singh RK, Li HB, Solanki MK, Malviya MK, Verma KK, Yang
rhizo- and endosphere of plants, their role, colonization, mechanisms LT, Li YR. Proteomic analysis of the resistance mechanisms in sugarcane
involved and prospects for utilization. Soil Biol Biochem. 2010;42:669–78. during Sporisorium scitamineum infection. Int J Mol Sci. 2019;20:569. https://
48. Ambrosini A, Sant’Anna FH, de Souza R, Tadra-Sfeir M, Faoro H, Alvarenga doi.org/10.3390/ijms20030569.
SM, Pedrosa FO, Souza EM, Passaglia LMP. Genome sequence of Bacillus 71. Su Y, Guo J, Ling H, Chen S, Wang S, Xu L, Allan AC, Que Y. Isolation of a
mycoides B38V, a growth-promoting bacterium of sunflower. Genome novel peroxisomal catalase gene from sugarcane, which is responsive to
Announc. 2015;3:e00245-15. biotic and abiotic stresses. PLoS One. 2014;9(1):e84426.
49. Ogut M. Fatih Er, Kandemir N. phosphate solubilisation potential of soil 72. Chen HJ, Wu SD, Huang GJ, Shen CY, Afiyanti M, Li WJ, Lin YH. Expression
Acinetobacter strains. Biol Fertil Soils. 2010;46:707–15. of a cloned sweet potato catalase SPCAT1 alleviates ethephon-mediated
50. Dobbelaere S, Vanderleyden J, YaacovOkon Y. Plant growth-promoting leaf senescence and H2O2 elevation. J Plant Physiol. 2012;169:86–97.
effects of diazotrophs in the rhizosphere. Crit Rev Plant Sci. 2003;22:147–9. 73. Williamson JD, Scandalios JG. Differential response of maize catalases and
51. Rifat H, Safdar A, Ummay A, Rabia K, Iftikhar A. Soil beneficial bacteria and their role superoxide dismutases to the photoactivated fungal toxin cercosporin. The
in plant growth promotion, a review. Ann Microbiol. 2010;60:579–98. Plant J. 1992;2:351–8.
52. Pikovskaya RI. Mobilization of phosphorus in soil in connection with the 74. Song XP, Huang X, Mo FL, Tian DD, Yang LT, Li YR, Chen BS. Cloning and
vital activity of some of the microbial species. Microbiologiya. 1948;17: expression analysis of sugarcane phenylalanin ammonia-lyase (PAL) gene.
362–70. Sci Agric Sin. 2013;46:2856–68.
75. Jain R, Chandra A, Venugopalan VK, Solomon S. Physiological changes and 98. Niu JQ, Wang AQ, Huang JL, Yang LT, Li YR. Isolation, characterization and
expression of SOD and P5CS genes in response to water deficit in promoter analysis of cell wall invertase gene SOCIN1 from sugarcane
sugarcane. Sugar Tech. 2015;17:276–82. (Saccharum spp.). Sugar Tech. 2015;17:65–76.
76. Leubner-Metzger G. Functions and regulation of plant b-1,3-glucanases (PR- 99. Su YC, Xu LP, Xue BT, Wu QB, Guo JL, Wu LG, Que YX. Molecular cloning
2). J Cyst Fibros. 2012;11:49–76. 840 and characterization of two pathogenesis related ß-1,3-glucanase genes
77. Libantová J, Kämäräinen T, Moravčíková J, Matušíková I, Salaj J. Detection of ScGluA1 and ScGluD1841 from sugarcane infected by Sporisorium
chitinolytic enzymes with different substrate specificity in tissues of intact scitamineum. Plant Cell Rep. 2013;32:1503–19.
sundew (Drosera rotundifolia L.). Mol Biol Rep. 2009;36:851–6. 100. Saitou N, Nei M. The neighbor-joining method, a new method for
78. Singh P, Song QQ, Singh RK, Li HB, Solanki MK, Yang LT, Li YR. Physiological reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–25.
and molecular analysis of sugarcane (varieties- F134 and NCo310) during 101. Kumar S, Stecher G, Tamura K. MEGA7, molecular evolutionary genetics
Sporisorium scitamineum interaction. Sugar Tech. 2018. https://doi.org/10. analysis version 7.0 for bigger datasets. Mol Bio Evol. 2016;33:1870–4.
1007/s12355-018-0671-6. 102. PHA S, Sokal RR. Numerical Taxonomy. The principles and practice of
79. Porat R, Vinokur V, Holland D, Gregory McCollum T, Droby S. Isolation of a numerical classification. San Francisco: Freeman; 1973. p. 573.
citrus chitinase cDNA and characterization of its expression in response to 103. Felsenstein J. Confidence limits on phylogenies, an approach using the
elicitation of fruit pathogen resistance. J Plant Physiol. 2001;158:1585–90. bootstrap. Evolution. 1985;39:783–91.
80. Wan LL, Zha WJ, Cheng XY, Liu C, Lv L, Liu CX, Wang Z, Du B, Chen R, Zhu 104. Bochner BR. Global phenotypic characterization of bacteria. FEMS Microbiol
L, He G. A rice b-1, 3-glucanasegene Osg1 is required for callose Rev. 2009;33:191–205.
degradation in pollen development. Planta. 2011;233:309–23. 105. Oliveira ALM, Urquiaga S, Dobereiner J, Baldani JI. The effect of inoculating
81. Tao Y, Xie B, Yang Z, Chen Z, Chen B, Deng Y, Jiang Y, van Peer AF. endophytic N2-fixing bacteria on micropropagated sugarcane plants. Plant
Identification and expression analysis of a new glycoside hydrolase family Soil. 2002;242:205–15.
55 exo-b-1, 3-glucanase-encoding gene in Volvariella volvacea suggests a 106. Reis VM, Olivares FL, de Oliveira ALM, dos Reis Jr FB, Baldani JI, Dobereiner J.
role in fruiting body development. Gene. 2013;527:154–60. Technical approaches to inoculate micro-propagated sugarcane plants with
82. Urquiaga S, Cruz K, Boddey R. Contribution of nitrogen fixation to Acetobacter diazotrophicus. Plant Soil. 1999;206:205–11.
sugarcane, nitrogen-15 and nitrogen balance estimates. Soil Sci Soc Am J. 107. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
1992;56:105–14. real-time quantitative PCR and the 2−△△Ct method. Methods. 2001;25:402–8.
83. Baldani VLD, Baldani JI, Olivares FL, Döbereiner J. Identification and ecology 108. Lin L, Li Z, Hu C, Zhang X, Chang S, Yang LT, Yang RL, An Q. Plant growth-
of Herbaspirillum seopedicae and the closely related Pseudomonas promoting nitrogen-fixing enterobacteria are in association with sugarcane
rubrisubalbicans. Symbiosis. 1992;19:65–73. plants growing in Guangxi, China. Microbes Environ. 2012b;4:391–8..
84. Baldani JI. Ocorrência e caracterização de Azospirillum amazonense em
comparação com outras espécies deste gênero, em raízes de milho, sorgo e Publisher’s Note
arroz. Federal Rural University of Rio de Janeiro, Seropédica, 1984; MSc Springer Nature remains neutral with regard to jurisdictional claims in
Thesis. published maps and institutional affiliations.
85. Singh RK, Kumar DP, Solanki MK, Singh P, Srivastava S, Srivastva AK, Kumar S,
Kashayp PL, Saxena AK, Singhal PK, Arora DK. Optimization of media
components for chitinase production by chickpea rhizosphere associated
Lysinibacillus fusiformis B-CM18. J Basic Microbiol. 2012;52:1–10.
86. Schwyn B, Neilands JB. Universal chemical assay for the detection and
determination of siderophores. Anal Biochem. 1987;160:47–56.
87. Lorck H. Production of hydrocyanic acid by bacteria. Physiol Plant. 1948;1:
142–6.
88. Dey R, Pal KK, Bhatt DM, Chauhan SM. Growth promotion and yield
enhancement of peanut (Arachis hypogaea L) by application of plant
growth promoting rhizobacteria. Microbiol Res. 2004;159:371–94.
89. Glickmann E, Dessaux Y. A critical examination of the specificity of the
Salkowski reagent for indolic compounds produced by phytopathogenic
bacteria. Appl Environ Microbiol. 1995;61:793–6.
90. Jacobson CB, Pasternak JJ, Glick BR. Partial purification and characterization
of 1-aminocyclopropane-1-carboxylate deaminase from the plant growth
promoting rhizobacterium Pseudomonas putida GR12-2. Can J Microbiol.
1994;40:1019–25.
91. Zhengyi L, Siping C, Shuting Y, Mingyue C, Lin L, Yuanyuan L, Shuying L,
Qianli A. Differentiation of 1-aminocyclopropane-1-carboxylate (ACC)
deaminase from its homologs is the key for identifying bacteria containing
ACC deaminase. FEMS Microbiol Ecol. 2015;91:fiv112. https://doi.org/10.
1093/femsec/fiv112.
92. Honma M, Shimomura T. Metabolism of 1-aminocyclopropane-1- carboxylic
acid. Agric Biol Chem. 1978;42:1825–31.
93. Hardy RF, Holsten RD, Jackson EK, Burn R. The acetylene-ethylene assay for
N2 fixation, laboratory and field evaluation. Plant Physiol. 1968;43:1185–207.
94. Ki JS, Zhang W, Qian PY. Discovery of marine Bacillus species by 16S rRNA
and rpoB comparisons and their usefulness for species identification. J
Microbiol Methods. 2009;77:48–57.
95. Edwards U, Rogall TH, Blocker H, Emde M, Bottger EC. Isolation and direct
complete nucleotide determination of entire genes. Characterization of a
gene coding for 16S ribosomal RNA. Nucleic Acids Res. 1989;17:7843–53.
96. Versalovic J, Schneider M, de-Bruijn FJ, Lupski JR. Genomic fingerprinting of
Bacteria using repetitive sequence-based polymerase chain reaction.
Methods Mol Cell Biol. 1994;5:25–40.
97. Poly F, Monrozier LJ, Bally R. Improvement in the RFLP procedure for
studying the diversity of nifH genes in communities of nitrogen fixers in
soil. Res Microbiol. 2001;152:95–103.

42

Uploaded by

42

Uploaded by

Singh et al.

BMC Plant Biology (2020) 20:220

RESEARCH ARTICLE Open Access

Diversity of nitrogen-fixing rhizobacteria

* Correspondence: [email protected]; [email protected]

(Continued from previous page)

Background agriculture to mitigate soil degradation and climate

Phylogenetic analysis Genetic characterization of isolates by BOX and ERIC-PCR

You might also like