Fruits 784014 Lisianthus

See discussions, stats, and author profiles for this publication at: https://www.researchgate.
net/publication/377744742
Investigation of Fusarium root rot of lisianthus (Eustoma grandiﬂorum) in

Okinawa, Japan, caused by Fusarium nirenbergiae
Article in Fruits · January 2024

DOI: 10.17660/th2023/014
CITATIONS READS
0 17
4 authors, including:
Takashi Hanagasaki Atsushi Ajitomi

Okinawa Agricultural Research Center 25 PUBLICATIONS 87 CITATIONS
25 PUBLICATIONS 52 CITATIONS
SEE PROFILE
SEE PROFILE
Tomohiko Kiyuna
TechnoSuruga Laboratory Co., Ltd.
30 PUBLICATIONS 241 CITATIONS
SEE PROFILE
All content following this page was uploaded by Takashi Hanagasaki on 29 February 2024.
The user has requested enhancement of the downloaded file.

Fruits 78(4) | ISSN 0248-1294 print, 1625-967X online | https://doi.org/10.17660/th2023/014 | © ISHS 2023
Original article
Investigation of Fusarium root rot of lisianthus

(Eustoma grandiflorum) in Okinawa, Japan, caused by
Fusarium nirenbergiae
T. Hanagasaki1,a, A. Ajitomi1, E. Miwa2 and T. Kiyuna2
1
Okinawa Agricultural Research Center, Japan
2
TechnoSuruga Laboratory Co. Ltd., Japan
Summary Significance of this study

Introduction – Lisianthus (Eustoma grandiflorum) What is already known on this subject?
has become one of the major flowering plants in Ok- • Fusarium root rot, an extremely problematic disease
inawa, the southernmost prefecture of Japan. Simul- of lisianthus, was first found to be caused by Fusarium
taneously, many types of lisianthus diseases related oxysporum in each of the regions in Hokkaido
to damping-off symptoms also increased dramati- Prefecture, Japan around 1986.
cally. Objective and methods – To create a strategy for
preventing the disease, disease symptoms and patho- What are the new findings?
genic organisms of primary problematic disease with • The pathogens of Fusarium root rot (Tachigare-byo)
seasonal variation in the emergence were investigat- were identified as Fusarium nirenbergiae based on
ed. Results and discussion – The symptoms were diag- multigene sequences analyses. The diseased plants
nosed as Fusarium root rot (Tachigare-byo) and the spread over the greenhouse from November to March.
pathogens were identified as Fusarium nirenbergiae Furthermore, the ratio of farms where Fusarium root
based on multigene sequences analyses. Indeed, our rot occurred against the total number of farms was
isolates, R2-28 and R2-29, are clustered separately 56.3% in Okinawa Main Island.
from the other F. oxysporum strains isolated from li-
sianthus in Italy but R2-29 and the other F. nirenber- What is the expected impact on horticulture?
giae strain (MAFF 712464) isolated in Japan formed • It will be useful information about preventing
a monophyletic lineage. The diseased plants spread Fusarium root rot (Tachigare-byo) of lisianthus
over the greenhouse from November to March. Fur- cultivated in subtropical regions, such as Okinawa.
thermore, they increased to 2.3% of the total number
in the case that no fungicide was sprayed, but there
was almost no diseased lisianthus plant in the case
that reductive disinfection of soil was conducted us- over, various symptoms appearing in production sites are
ing ethanol, and fungicides were sprayed periodically associated with damping-off, which can accordingly reflect
after planting. Furthermore, the ratio of farms where various pathogenic organisms. Hence, detailed examination
Fusarium root rot occurred against the total number should be conducted to identify lisianthus diseases related to
of farms was 56.3% in Okinawa Main Island. Conclu- damping-off diseases to create a strategy for preventing these
sion – The pathogens of Fusarium root rot were iden- diseases. Recently, we identified strains showing diseases
tified as Fusarium nirenbergiae based on multigene similar to Fusarium root rot in greenhouses of farmers in
sequences analyses. Reductive disinfestation of soil Okinawa Main Island. Fusarium root rot, an extremely prob-
and spraying fungicides periodically within every lematic disease of lisianthus, was first found to be caused by
two weeks was effective in preventing diseases, such Fusarium oxysporum in each of the regions in Hokkaido Pre-
as Fusarium root rot but not doing them in another fecture, Japan around 1986 (Iwata, 1991). Consequently, the
greenhouse caused several Fusarium root rot. disease was spread all over Japan, such as Fukuoka prefec-
ture (Yasunaga et al., 2020). In the first place, Fusarium root
Keywords rot is a serious lisianthus disease globally (Zhou et al., 2019).
Tachigare-byo, Fusarium nirenbergiae, sporodochia, PCR In this study, disease symptoms and pathogenic organisms of
detection, phylogenetic analysis Fusarium root rot, with seasonal variation in the emergence
of these diseases in Okinawa Main Island, were investigated.
Materials and methods

Introduction
In Okinawa, the southernmost prefecture of Japan, lisian- Lisianthus sample
thus (Eustoma grandiflorum) has become one of the major Lisianthus strains were planted in four rows on a furrow
flowering plants. Simultaneously, many types of lisianthus and resulted in about 1,000 strains on one furrow in green-
diseases have appeared dramatically in recent years. More- house C of the farmer in Nago city (Figure 1). ‘Luca Gold’,
‘Marissa Blue’, ‘Laviage’, ‘M20-1’, and ‘Julius Snow’ were
a
Corresponding author: [email protected]. planted in each furrow from left to right in the greenhouse
Fruits - A publication of ISHS - www.ishs.org. - DOI: 10.17660/th2023/01 4 1

Hanagasaki et al. | Fusarium root rot of lisianthus (Eustoma grandiflorum) caused by Fusarium nirenbergiae
Figure 1. Map of Okinawa, indicating where the greenhouses were located.
FIGURE 1. Map of Okinawa, indicating where the greenhouses were located.
Figure 2. Symptoms of Fusarium root rot and white sporodochia on lisianthus plant. (a), (b), and (c): The variety ‘Monroe’
was diseased with Fusarium root rot from Yaese town on January 14, 2021. (b) and (c): Vessel turned brown. (d): Sporodochia
formed on ‘Celeb Pink Dia’ from Nago city on November 27, 2020. (e): Crescent shape of the sporodochia was observed
through a microscope.
FIGURE 2. Symptoms of Fusarium root rot and white sporodochia on lisianthus plant. (a), (b), and (c): The variety
‘Monroe’ was diseased with Fusarium root rot from Yaese town on January 14, 2021. (b) and (c): Vessel turned
brown. (d): Sprodochia formed on ‘Celeb Pink Dia’ from Nago city on November 27, 2020. (e): Crescent shape of
the sporodochia was observed through a microscope.
2 International Journal of Tropical and Subtropical Horticulture 9
on September 7, 2020 and subsequently ‘Julius Snow’, ‘Moa- trose agar; Difco Laboratories) plate. To confirm the appear-
na Light Pink’, ‘TU-948’, ‘Celeb Christal’, and ‘Celeb Pink Dia’ ance of fungi, the PDA plate was incubated at 25 °C for a week
were planted in each furrow from left to right on September until the hyphae spread covering the plate almost entirely.
14, 2020. All plants of all varieties were investigated every
other week and the plants that had looked Fusarium root rot- PCR detection
like were sampled on each investigation day. Fungal genomic DNA was extracted by DNeasy Plant Mini
Lisianthus strains were planted in four rows on a furrow Kit following the manufacturer’s protocols (QIAGEN). The re-
on September 19th, 2020, and resulted in about 1,200 strains action mixture consisted of 12.5 µL Sapphire Amp Fast PCR
on one furrow in greenhouse D of the farmer in Yaese town Master Mix, 1 µL CLOX1 (10 pmol µL-1; 5�-CAGCAAAGCATCA-
(Figure 1). ‘Voyage Midori’ was planted in five furrows on the GACCACTATAACTC-3�) and CLOX2 (10 pmol µL-1; 5�-CTT-
left side of the greenhouse except ‘Mascar Green’ planted in GTCAGTAACTGGACGTTGGTACT-3�) primers (Mulè et al.,
two rows on the left side on the third furrow (Figure 2a). In 2004), 1 µL fungal genomic DNA template (about 30 ng), and
the same way, ‘Monroe’ was planted in five furrows on the 9.5 µL sterile distilled water. Amplification was performed
middle side of the greenhouse except ‘Voyage Midori’ plant- using the following cycling conditions: primary denaturation
ed in two rows on the left side on the second furrow from for two min at 94 °C, followed by 30 cycles of 30 s at 94 °C,
left. Also, ‘Reina White’ was planted in five furrows on the 30 s at 62 °C, and 60 s at 72 °C; and a final extension step for
right side of the greenhouse except ‘Celeb Queen’ planted five min at 72 °C (Mulè et al., 2004).
in two rows on the right side on the third furrow. All plants
of all varieties every other week were investigated and the Sequencing and phylogenetic analysis
plants that had Fusarium root rot-like were sampled on each Genomic DNA from fungal mycelium grown on potato
investigation day. Besides, lisianthus plants that exhibited dextrose agar (PDA, Becton Dickinson, U.S.A.) was extracted
Fusarium root rot-like symptoms from each of the regions via physical disruption using beads (Nippon Gene Co., Ltd.).
in the Okinawa Main Island were sampled from a total of 32 Five loci, i.e., nuclear ribosomal internal transcribed spacer
farmers from various regions: seven from Nakijin village, one (ITS) regions, which include ITS1, 5.8S, and ITS2, partial
from Motobu town, and seven from Nago city in the north- translation elongation factor (tef1), partial calmodulin (CaM),
ern area; one each from Okinawa city (the same as above) partial RNA polymerase second largest subunit (rpb2), and
and Uruma city in the middle area; and six from Yaese town, partial β-tubulin (TUB2) gene regions were amplified and
three from Nanjo city, and six from Itoman city in the south- sequenced, respectively. The primers used in this study are
ern area. listed (Table 1). Only R2-28, three loci, i.e., ITS, tef1, and CaM,
were amplified and sequenced. Polymerase chain reactions
Fungal isolation (PCRs) were performed with BIOTAQ DNA Polymerase (Bio-
Small pieces of infected stems were cut from the edge line, U.K.) for ITS, tef1, CaM, rpb2 and TUB2. Amplification
of significant lesions using a sterile blade. The pieces were was performed with the following cycling conditions: prima-
soaked in 70% ethanol for 30 s and 1.0% hypochlorous acid ry denaturation for 5 min at 94 °C; 40 cycles of 30 s at 94 °C,
for 60 s, then soaked twice in sterile distilled water for a few 40 cycles of 30 s at 52 °C, and 40 cycles of 30 s at 72 °C; and
seconds. After the pieces were dried on sterile paper, they a final extension step for 7 min at 72 °C. The sequences were
were placed on an agar plate. The plates were incubated at assembled with ChromasPro 2.1.10 (Technelysium Pty, Ltd.,
25 °C and examined whether or not hyphal grew from the South Brisbane QLD, Australia). Multiple alignments were
pieces 3–4 d later. When hyphal grew from the piece, the hy- performed with CLUSTALW (Thompson et al., 1994), and the
phal tip was cut with agar and moved to a PDA (potato dex- final alignments were manually introduced. Ambiguous posi-
Table 1. PCR Primers information of PCR ampliﬁcation of the seven loci.

Locus Primers Sequence of Primer (5’→3’) Direction References
ITS ITS5 GGAAGTAAAAGTCGTAACAAG Forward White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC Reverse
NL4 a GGTCCGTGTTTCAAGACGG Reverse O’Donnell (1993)
tef1 EF1 ATGGGTAAGGARGACAAGAC Forward O’Donnell et al. (1998b)
EF2 GGARGTACCAGTSATCATGTT Reverse
CaM CL1 GARTWCAAGGAGGCCTTCTC Forward O’Donnell et al. (2000)
CL2A TTTTTGCATCATGAGTTGGAC Reverse
CAL-228f a GAGTTCAAGGAGGCCTTCTCCC Forward Carbone and Kohn (1999)
CAL-2Rd a TGRTCNGCCTCDCGGATCATCTC Reverse Quaedvlieg et al. (2011)
rpb2 RPB2-5f2 GGGGWGAYCAGAAGAAGGC Forward Reeb et al. (2004)
fRPB2-7cr CCCATRGCTTGYTTRCCCAT Reverse Liu et al. (1999)
fRPB2-7cf ATGGGYAARCAAGCYATGGG Forward
RPB2-11ar GCRTGGATCTTRTCRTCSACC Reverse
TUB2 Bt2a GGTAACCAAATCGGTGCTGCTTTC Forward Glass and Donaldson (1995)
Bt2b ACCCTCAGTGTAGTGACCCTTGGC Reverse
TUB-2Fd a GTBCACCTYCARACCGGYCARTG Forward Aveskamp et al. (2009)
TUB4RD a CCRGAYTGRCCRAARACRAAGTTGTC Reverse
a
Used only for sequencing reactions.

tions and alignment gaps were excluded from the analysis. of FOSC (Figure 4), and our isolates, R2-28 and R2-29, are
The neighbor-joining (Saitou and Nei, 1987) phylogenetic clustered separately from the other strains from lisianthus in
tree with the Kimura two-parameter model (Kimura, 1980) Italy but R2-29 and the other strain (MAFF 712464) isolated
was constructed using the MEGA v. 7.0 (Kumar et al., 2016). from lisianthus in Japan formed a monophyletic lineage. Our
A bootstrap test with 1,000 iterations was used to assess the isolates, R2-28 and R2-29, and F. nirenbergiae formed a clus-
reliability of the branches (Felsenstein, 1985). The positions ter with bootstrap support (55%) (Figure 4). Furthermore,
with gaps and the regions of uncertain nucleotide alignment The CaM sequence-based NJ phylogeny showed that our iso-
were excluded from the phylogenetic analyses. Neighbor- lates, R2-28 and R2-29, and F. nirenbergiae formed a mono-
joining trees were constructed on the basis of each gene or phyletic lineage with a moderate bootstrap support (66%)
concatenated sequence. (data not shown). The bootstrapped NJ phylogeny inferred
from tef1, rpb2, TUB2 and CaM genes of R2-29 and Fusarium
Results and discussion nirenbergiae demonstrated a cluster in the FOSC clade with
bootstrap support (80%) (Figure 5). Therefore, R2-28 and
Diagnosis of Fusarium root rot R2-29 was identified as Fusarium nirenbergiae based on mul-
Symptoms of Fusarium root rot appeared in greenhouse tigene sequences analyses.
C in Nago city and greenhouse D in Yaese town. Diseased li-
sianthus plants indicated that its vessel turned brown. Their The occurrence of Fusarium root rot in the greenhouses
leaves got discolored brown from the stem side. Moreover, Lisianthus plants diseased with Fusarium root rot spread
the entire plant was wilting. There are cases in which the over greenhouse D in Yaese town, regardless of which vari-
sporodochia of white or cream color was formed on the low- ety it was (Figure 6a). Furthermore, the diseased plants ap-
est part of the stem (Figure 2d). The shape of sporodochia peared at the middle growth stage to the late growth stage,
was crescent (Figure 2e). The mycelia of the isolates from the which started from November to March (Figure 6b). Plants
infected part of plants were white on a PDA plate and colored diseased with Fusarium root rot at the early growth stage
PDA plate purple, blue, or green. F. oxysporum specific prim- was not seen, but some plants seemed damaged by fertilizer
ers, CLOX1/2 amplified a single PCR product of the expected spoilage. The diseased plants increased at the late growth
size (about 600 bp) from all tested F. oxysporum isolates, stage on the left and middle side but did not increase at the
R2-28 in Nago city and R2-29 in Yaese town but not from stage on the right side. Eventually, the accumulated number
an F. avenaceum isolate causing Fusarium stem rot (Figure of diseased plants in greenhouse D was 410, which was 2.3%
3). It was reported that F. oxysporum caused Fusarium root of the total number in greenhouse D. However, in greenhouse
rot in Japan (Matsuo, 1980) and whose symptoms were the C in Nago city, plants diseased with Fusarium wilt were rarely
same as those in this study (Matsuo, 1980; The Phytopatho- found. There was just one plant of ‘Celeb Pink Dia’ at the mid-
logical Society of Japan, 2022). Therefore, these symptoms dle growth stage on November 27, 2020, and two plants of
were diagnosed as Fusarium root rot (Tachigare-byo). ‘Celeb Christal’ on December 11th and 26th, 2020, which was
only 0.03% of the total number in greenhouse C. Besides, as
Phylogenetic analysis of F. oxysporum isolates, R2-28, for the occurrence rate in the investigated farms, Fusarium
R2-29 root rot occurred in 56.3% of the 32 farms in each of the re-
One base change in the sequences of three respec- gions in Okinawa Main Island (Figure 7).
tive loci, ITS, tef1, and CaM, was observed between R2-28
(MAFF247609) and R2-29 (MAFF247610). The ITS sequence- General discussion
based NJ phylogeny showed that our isolates, R2-28 and Fusarium oxysporum is a ubiquitous soil fungus as sap-
R2-29, and Fusarium oxysporum, including six strains from rophyte, and pathogenic fungus (plant, animal, and human)
Eustoma grandiflorum (lisianthus) referred from Phan and with a wide plant host range, and many formae speciales/
Vo unpublished data in GenBank, and related FOSC species races based on host specificity (Edel-Hermann and Lecomte,
formed a cluster with a moderate bootstrap support (98%) 2019; Leslie and Summerell, 2006). However, molecular
(Supplemental Information, Figure S1). The bootstrapped NJ phylogenetic analyses of F. oxysporum have demonstrated
phylogeny inferred from tef1 gene demonstrated divergence multiple independent origins of formae speciales in this
of our isolates, R2-28 and R2-29, and Fusarium nirenbergiae, complex, indicating that this is not a reliable taxonomic cat-
including 28 strains isolated from Eustoma grandiflorum (li- egory, as common host specificity is often the result of con-
sianthus) referred from Bertoldo et al. (2015), in the clade vergent evolution. Several F. oxysporum formae speciales are
Figure 3. Isolated strain grown on PDA plates and PCR detection using CLOX1/2 primers.
FIGURE 3. Isolated strain grown on PDA plates and PCR detection using CLOX1/2 primers.
4 International Journal of Tropical and Subtropical Horticulture
Fusarium curvatum CBS 238.94T (MH484984)

Fusarium oxysporum f. sp. eustomae Fuslis49-09 (KJ361595) ex Eustoma grandiflorum
Fusarium oxysporum f. sp. eustomae Fuslis52-09A (KJ361598) ex Eustoma grandiflorum
Fusarium veterinarium CBS 109898T (MH484990)
Fusarium contaminatum CBS 114899T (MH484992)
Fusarium pharetrum CPC 30824T (MH485043)
Fusarium nirenbergiae CBS 130301 (MH485017)
Fusarium nirenbergiae CBS 130300 (MH485016)
Fusarium nirenbergiae CBS 149.25 (MH484956)
Fusarium nirenbergiae CBS 840.88T (MH484978)
R2-29
Fusarium nirenbergiae MAFF712464 ex Eustoma
Fusarium nirenbergiae CBS 744.79 (MH484973)
R2-28
Fusarium vanleeuwenii JW 10008T (MZ921896)
97
Fusarium libertatis CPC 28465T (MH485035)
Fusarium oxysporum CBS 144134ET (MH485044)
Fusarium languescens CBS 645.78T (MH484971)
Fusarium sangayamense InaCC F960T (LS479732)
87 Fusarium tardichlamydosporum InaCC F958T (LS479729)
Fusarium hoodiae CBS 132474T (MH485020)
Fusarium kalimantanense InaCC F917T (LS479690)
Fusarium duoseptatum InaCC F916T (LS479688)
Fusarium cugenangense InaCC F984T (LS479757)
Fusarium gossypinum CBS 116613T (MH485000)
Fusarium carminascens CPC 25800T (MH485028)
Fusarium glycines CPC 25808T (MH485033)
Fusarium hexaseptatum InaCC F866T (LS479805)
Fusarium grosmichelii InaCC F833T (LS479744)
Fusarium elaeidis CBS 217.49T (MH484961)
Fusarium fabacearum CPC 25802T (MH485030)
Fusarium inflexum NRRL 20433T (AF008479)
Fusarium callistephi CBS 187.53T (MH484966)
90
95 Fusarium phialophorum InaCC F971T (LS479741)
94 Fusarium odoratissimum InaCC F822T (LS479828)
76 Fusarium tardicrescens CBS 102024T (LS479665)
Fusarium triseptatum CBS 258.50T (MH484964)
Fusarium foetens CBS 110286T (MT011001)
Fusarium fujikuroi CBS 221.76ET (AB725605)
Fusarium udum CBS 177.31 (MH484957)
0.0050
Figure 4. Neighbor-Joining (NJ) phylogeny inferred from tef1 sequences of R2-28, R2-29, MAFF 712464, and 28 strains
from lisianthus (Eustoma grandiflorum), and species of Fusarium oxysporum species complex. Numbers on the nodes are NJ
Bootstrap values above 70%. Ex-type and ex-epitype strains are indicated with T and ET, respectively.

Figure 5. Neighbor-Joining (NJ) phylogeny inferred from combined tef1, rpb2, TUB2, and CaM sequences of R2-29 and species
of Fusarium oxysporum species complex. Numbers on the nodes are NJ Bootstrap values above 70%. Ex-type and ex-epitype
strains are indicated with T and ET, respectively.
FIGURE 5. Neighbor-Joining (NJ) phylogeny inferred from combined tef1, rpb2, TUB2, and CaM sequences of R2-29
knownand to
species of Fusarium
be able oxysporum
to infect and cause disease
speciesincomplex.
more than
Numbers is recorded as plant-pathogen
on the nodes for Root
are NJ Bootstrap valuesrot of lisianthus
above 70%. in
oneEx-type
plant hosts (Leslie and
and ex-epitype Summerell,
strains with T andetET, respectively.
2006; Lombard
are indicated Japan. On the other hand, MAFF strains, deposited as F. ox-
al., 2019). F. oxysporum is also known as a species complex ysporum or Fusarium sp. (FOSC), are recently reidentified
(Fusarium oxysporum species complex; FOSC) consisting as F. nirenbergiae (https://www.gene.affrc.go.jp/databas-
numerous cryptic species. Recently, Lombard et al. (2019) es-micro_search.php), including one strain, MAFF 712464
had taxonomically re-organized FOSC based on multi-locus from lisianthus in Fukuoka prefecture. The sequence of tef1
phylogenetic analayses and morphological characteristics, between MAFF 712464 and R2-28 showed one base differ-
and designated an epitype for F. oxysporum and described ence and one gap, and one gap between MAFF 712464 and
15 cryptic taxa as new species. In this study, our isolates R2-29, respectively. As a result, R2-28 is clustered separately
(R2-28 and R2-29) were identified as Fusarium nirenbergiae, from MAFF 712464 in the tef1 sequence-based NJ phylogeny
which were described as a new species in the subclade in (Figure 4). Furthermore, there are some F. oxysporum strains
Clade VIII of Lombard et al. (2019). F. nirenbergiae included ex E. grandiflorum preserved in NARO Genebank, and these
a strain previously identified as F. oxysporum, which was strains could not be included in molecular phylogenetic
shown to be distributed in a variety of plant hosts and to analyses, because sequence data of these strains are not re-
consist of several formae speciales (Lombard et al., 2019). leased in public. Some F. oxysporum strains stored at NARO
This species was reported from various plants host and sub- Genebank may have possibly contained F. nirenbergiae. Con-
strates, e.g., Secale (U.S.A., The Netherlands, South Africa), sidering this, PCR result in this study was the same as one
Musa (unknown), Passiflora (Brazil, Italy), Chrysanthemum from F. oxysporum (Figure 3). Therefore, additional phyloge-
(U.S.A.), Bouvardia (Italy), Dianthus (The Netherlands), Ag- netic analyses of F. nirenbergiae, causing Fusarium root rot,
athosma (South Africa), Tulip (U.S.A.), amputated human toe are warranted in the future owing to differences in the ITS
(U.S.A.), and human leg ulcer (U.S.A.) (Lombard et al., 2019; region sequences of the pathogens isolated in each area
Aiello et al., 2021). In the Database of Plant Diseases in Ja- in Okinawa Main Island. Actually, Fusarium root rot is also
pan (https://www.gene.affrc.go.jp/databases-micro_pl_dis- caused by Fusarium solani (The Phytopathological Society of
eases.php) and Common Names of Plant Diseases in Japan Japan, 2022) but the symptoms is a little different from Root
(The Phytopathological Society of Japan, 2022), F. oxysporum and stem rot by Fusarium solani (Xiao et al., 2018). In fact,
13

235 (a)
(b)
200 200 200
Fusarium root rot Fusarium root rot Fusarium root rot
150 150 150
100 100 100
50 50 50
MascalGreen Monroe ReinaWhite

0 0 0
19-Sep 29-Oct 8-Dec 17-Jan 26-Feb 19-Sep 29-Oct 8-Dec 17-Jan 26-Feb 19-Sep 29-Oct 8-Dec 17-Jan 26-Feb
Figure 6. The occurrence of Fusarium root rot.
Table Figure
240 6. The occurrence
2. The fungicides of Fusarium
applying for lisianthus root
strains in rot. D.
greenhouse
The fungicide name Compound Registration for lisianthus Application interval
Fantagista grain wettable powder Pyribencarb Gray mold Every 10 to 14 days since planted until
Leaf spot shipment by spraying each pesticide
Daconil 1000 Chlorothalonil Powdery mildew alternately
Leaf spot

Figure 7. Map of Okinawa, in-

dicating the ratio of Fusarium
root rot occurred in each of the
regions.
Figureroot
Fusarium 7. Map
rot byofFusarium
Okinawa, indicating
solani theOkinawa
occurred in ratio of Fusarium
rot occurred root rot occurred
continually (2.3% ofinthe
each
totalof the in green-
number)
(data not shown). The survey of the disease caused by Fusa- house D. On the right side, the plants diseased with Fusarium
regions.
rium solani is needed for further study. root rot at the late stage did not increase so much. A reason
There were few diseased plants with Fusarium root rot is that the right side is dry compared to the left and middle
(0.03% of the total number) in the other farmer of green- sides. Fusarium root rot is a serious lisianthus disease glob-
house C. In fact, reductive disinfection of soil was conducted ally (Zhou et al., 2019). Especially, the disease incidence was
using ethanol and rice bran before planting. Here, that treat- 5%–30% in Korea (Hahm, 2001), located next to Japan. In
245 General discussion
ment almost certainly inhibited the disease because Fusari- Okinawa, the disease incidence from 2020–2021 was 56.3%.
um root rot is known as soil-borne disease. Additionally, the Only Orthocide wettable powder 80 is registered as a spray-
Fusarium
farmer oxysporum
alternately is afungicides
sprayed the ubiquitous
suchsoil fungus as saprophyte,
as Fantagista and for
ing type pesticide pathogenic fungus
Fusarium root rot in(plant,
Japan. Accordingly,
grain wettable powder and Daconil 1000 every 10–14 d (Ta- investigating the effect of this pesticide on the pathogens of
bleanimal, and
2). It must human)
have with
cured leaf a and
spot wide plant host
prevented range, andFusarium
this disease many formae
root rot speciales
isolated in /Okinawa
races based
shouldon be conducted
even though leaf spot occurred on ‘Celeb Christal’ and ‘Celeb in the next study.
host
Pink Dia’specificity (Edel-Hermann
in the part of and Lecomte,
greenhouse C. Simultaneously, 2019; Leslie
these and Summerell
In conclusion, 2006). However,
reductive disinfestation of soil and spray-
fungicides could have prevented Fusarium root rot as well. ing fungicides periodically every within two weeks was effec-
molecularthere
Additionally, phylogenetic
were no otheranalyses
diseasesof leaf spots have
F. oxysporum
except tive in demonstrated multiple
preventing diseases, such asindependent
Fusarium root rot but not
that occurred partly in greenhouse C. As a result, conduct- doing them in another greenhouse caused several Fusarium
ing reductive disinfection of soil before planting and spray- root rot. To pick suitable fungicides and spray them at an ap-
ing two types of fungicides alternately every 10–14 d may propriate interval is the key to preventing Fusarium root rot.
be a good example to prevent lisianthus diseases. However, Further study is needed to search the effective methods to
the farmer of greenhouse D did not conduct soil disinfection prevent these diseases, such as choosing fungicides and soil
and did not spray any fungicides, although insecticides were disinfestation for inhibiting pathogens.
sprayed almost every week. This must be why Fusarium root

Conclusions Hahm, Y.I. (2001). Occurrence of Fusarium wilt on Lisianthus

The pathogens of Fusarium root rot (Tachigare-byo) of (Eustoma grandiflorum) caused by Fusarium oxysporum f. sp.
lisianthus were identified as Fusarium nirenbergiae based eustomae [1998]. Korean J. Plant Pathol. 14, 188–190.
on multigene sequences analyses. Our isolates, R2-28 and Iwata, Y. (1991). The wilt symptom of lisianthus by Fusarium roseum
R2-29, are clustered separately from the other F. oxyspo- and Fusarium oxysporum. Jap. J. Phytopathol. 57(1), 123.
rum strains isolated from lisianthus in Italy but R2-29 and
Kimura, M. (1980). A simple method for estimating evolutionary
the other F. nirenbergiae strain (MAFF 712464) isolated in
rates of base substitutions through comparative studies of nucleotide
Japan formed a monophyletic lineage. The diseased plants sequences. J. Molec. Evol. 16, 111–120. https://doi.org/10.1007/
spread over the greenhouse from November to March. The BF01731581. PMID: 7463489.
ratio of farms where Fusarium root rot occurred against the
total number of farms was 56.3% in Okinawa Main Island. Kumar, S., Stecher, G., and Tamura, K. (2016). MEGA7: Molecular
Reductive disinfestation of soil and spraying fungicides peri- evolutionary genetics analysis version 7.0. for bigger datasets.
Molec. Biol. Evol. 33, 1870–1874. https://doi.org/10.1093/molbev/
odically every within two weeks was effective in preventing
msw054. Epub 2016 Mar 22.
diseases, such as Fusarium root rot but not doing them in
another greenhouse caused several Fusarium root rot. Leslie, J.F., and Summerell, B.A. (2006). The Fusarium
Laboratory Manual. (Oxford, U.K.: Blackwell Publ.). https://doi.
Date availability statement org/10.1002/9780470278376.
The sequence is available from the Bioinformation and Liu, Y.J., Whelen, S., and Hall, B.D. (1999). Phylogenetic relationships
DDBJ Center database DDBJ at www.ddbj.nig.ac.jp with ac- among ascomycetes: Evidence from an RNA polymerse II subunit.
cession numbers LC789093 (ITS), LC789094 (tef1), and Molec. Biol. Evol. 16, 1799–1808. https://doi.org/10.1093/
LC789092 (CaM) for R2-28 and LC789097 (ITS), LC789099 oxfordjournals.molbev.a026092.
(tef1), LC789098 (rpb2), LC789095 (TUB2), and LC789096 Lombard, L., Sandoval-Denis, M., Lamprech, S.C., and Crous, P.W.
(CaM) for R2-29. (2019). Epitypification of Fusarium oxysporum – Clearing the
taxonomic chaos. Persoonia 43, 1–47. https://doi.org/10.3767/
Acknowledgments persoonia.2019.43.01
We would like to thank all the farmers for cooperation
Matsuo, T. (1980). Fusarium Disease of Crops. (Nat. Rural Education
with our investigation. And we are grateful to Mr. Nobori-
Assoc.), 472 pp.
kawa, senior staff, for his support with the investigation. We
appreciate technical support of DNA sequence by Dr. Tarora. Mulè, G., Susca, A., Stea, G., and Moretti, A. (2004). Specific detection
We also would like to thank Mr. Takushi and Dr. Kawano for of the toxigenic species Fusarium proliferatum and F. oxysporum
technical advice. from asparagus plants using primers based on calmodulin gene
sequences. FEMS Microbiol. Lett. 230, 235–240 https://doi.
org/10.1016/S0378-1097(03)00926-1.
Conflicts of interest/Competing interests
Not applicable. O’Donnell, K. (1993). Fusarium and its near relatives. In The Fungal
Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal
References Systematics, D.R. Reynolds, and J. Taylor, eds. (Wallingford, U.K.: CAB
Intl.), p. 225–233.
Aiello, D., Fiorenza, A., Leonardi, G.R., Vitale, A., and Polizzi, G. (2021).
Fusarium nirenbergiae (Fusarium oxysporum species complex) O’Donnell, K., Kistler, H.C., Cgelnik, E., and Ploetz, R.C. (1998).
causing the wilting of Passion Fruit in Italy. Plants 10(10), 2011. Multiple evolutionary origins of the fungus causing Panama disease
https://doi.org/10.3390/plants10102011. of banana: Concordant evidence from nuclear and mitochondrial
gene genealogies. Proc. Natl. Acad. Sci. U.S.A. 95, 2044–2049.
Aveskamp, M.M., Verkley, G.J., De Gruyter, J., Murace, M.A., Perelló,
A., Woudenberg, J.H., Groenewald, J.Z., and Crous, P.W. (2009). DNA O’Donnell, K., Nirenberg, H.I., Aoki, T., and Cgelnik, E. (2000).
phylogeny reveals polyphyly of Phoma section Peyronellaea and A multigene phylogeny of the Gibberella fujikuroi species
multiple taxonomic novelties. Mycologia 101, 363–382. https://doi. complex: Detection of additional phylogenetically distinct species.
org/10.3852/08-199. Mycoscience 41, 61–78. https://doi.org/10.1007/BF02464387.
Bertoldo, C., Gilardi, G., Spadaro, D., Gullino M.L., and Garibaldi, A. Quaedvlieg, W., Kema, G.H., Groenewald, J.Z., Verkley, G.J., Seifbarghi,
(2015). Genetic diversity and virulence of Italian strains of Fusarium S., Razavi, M., Mirzadi Gohari, A., Mehrabi, R., and Crous, P.W. (2011).
oxysporum isolated from Eustoma grandiflorum. Eur. J. Plant Pathol. Zymoseptoria gen. nov.: A new genus to accommodate Septoria-like
141, 83–97. https://doi.org/10.1007/s10658-014-0526-2. species occurring on graminicolous hosts. Persoonia 26, 57–69.
Carbone, I., and Kohn, L.M. (1999). A method for designing primer https://doi.org/10.3767/003158511X571841.
sets for speciation studies in filamentous ascomycetes. Mycologia Reeb, V., Lutzoni, F., and Roux, C. (2004). Contribution of RPB2
91, 553–556. https://doi.org/110.1080/00275514.1999.12061051. to multilocus phylogenetic studies of the euascomycetes
Edel-Hermann, V., and Lecomte, C. (2019). Current status of (Pezizomycotina, Fungi) with special emphasis on the lichen-forming
Fusarium oxysporum formae speciales and races. Phytopathology Acarosporaceae and evolution of polyspory. Molec. Phylogenet. Evol.
109, 512–530. https://doi.org/10.1094/PHYTO-08-18-0320-RVW. 32, 1036–1060. https://doi.org/10.1016/j.ympev.2004.04.012.
Felsenstein, J. (1985). Confidence limits on phylogenies: An Saitou, N., and Nei, M. (1987). The neighbor-joining method: A new
approach using the bootstrap. Evolution 39, 783–791. https://doi. method for reconstructing phylogenetic trees. Molec. Biol. Evol.
org/10.1111/j.1558-5646.1985.tb00420.x. 4, 406–425, https://doi.org/10.1093/oxfordjournals.molbev.
a040454.
Glass, N.L., and Donaldson, G.C. (1995). Development of primer sets
designed for use with the PCR to amplify conserved genes from The Phytopathological Society of Japan (2022). Common Names
filamentous ascomycetes. Appl. Environm. Microbiol. 61(4), 1323– of Plant Diseases in Japan (2022.8 edn.). (Tokyo, Japan: The
1330. https://doi.org/10.1128/aem.61.4.1323-1330.1995. Phytopathological Society of Japan).
Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W:

Improving the sensitivity of progressive multiple sequence alignment

through sequence weighting, positions-specific gap penalties and Fusarium root rot and distribution of the disease. Kyusyu Plant Prot.
weight matrix choice. Nucleic Acids Res. 22, 4673–4680. https://doi. Res. 66, 33–39.
org/10.1093/nar/22.22.4673.
Zhou, X., Li, C., Liu, L., Zhao, J., Zhang, J., Cai, Z., and Huang, X.
White, T.J., Bruns, T., Lee, S., and Taylor, J. (1990). Amplification and (2019). Control of Fusarium wilt of lisianthus by reassembling
direct sequencing of fungal ribosomal RNA genes for phylogenetics. the microbial community in infested soil through reductive soil
In PCR Protocols: A Guide to Methods and Applications, M.A. Innis, disinfestation. Microbiol. Res. 220. 1–11, https://doi.org/1 0.1016/j.
D.H. Gelfand, J.J. Sninsky, and T.J. White, eds. (San Diego, U.S.A.: micres.2018.12.001.
Academic Press), p. 315–322.
Xiao, R.F., Wang, J., Ruan, C., Pan, Z., Zhu, Y.J., and Liu, B. (2018). Root Received: Jun. 3, 2023
and stem rot on lisianthus (Eustoma grandiflorum) in China caused Accepted: Aug. 16, 2023
by Fusarium solani. Canadian J. Plant Pathol. 40, 455–460.
Yasunaga, T., Setoyama, S., Kondo, T., Kawazoe, K., Kawabe, M.,
Sato, M., and Onozaki, T. (2020). Identification of the pathogen of
SUPPLEMENTAL INFORMATION
Supplemental Information
Supplemental Information – Figure S1. Neighbor-Joining (NJ) phylogeny inferred from ITS sequences of R2-28, R2-29,
and species of Fusarium oxysporum species complex. Numbers on the nodes are NJ Bootstrap values above 70%. Ex-type and
SUPPLEMENTAL
ex-epitype strainsINFORMATION
are indicated–with
FIGURE
T S1.ET, Neighbor-Joining
and respectively. (NJ) phylogeny inferred from ITS sequences of R2-28,
R2-29, and species of Fusarium oxysporum species complex. Numbers on the nodes are NJ Bootstrap values above
70%. Ex-type and ex-epitype strains are indicated with T and ET, respectively.
View publication stats

Fruits 784014 Lisianthus

Uploaded by

Copyright:

Available Formats

Fruits 784014 Lisianthus

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Fruits 784014 Lisianthus

Uploaded by

Copyright:

Available Formats

See discussions, stats, and author profiles for this publication at: https://www.researchgate.

Investigation of Fusarium root rot of lisianthus (Eustoma grandiﬂorum) in

Article in Fruits · January 2024

Takashi Hanagasaki Atsushi Ajitomi

The user has requested enhancement of the downloaded file.

Investigation of Fusarium root rot of lisianthus

Summary Significance of this study

Materials and methods

Fruits - A publication of ISHS - www.ishs.org. - DOI: 10.17660/th2023/01 4 1

Figure 1. Map of Okinawa, indicating where the greenhouses were located.

FIGURE 1. Map of Okinawa, indicating where the greenhouses were located.

Table 1. PCR Primers information of PCR ampliﬁcation of the seven loci.

Fruits - A publication of ISHS - www.ishs.org. - DOI: 10.17660/th2023/01 4 3

Fusarium curvatum CBS 238.94T (MH484984)

Fruits - A publication of ISHS - www.ishs.org. - DOI: 10.17660/th2023/01 4 5

6 International Journal of Tropical and Subtropical Horticulture

150 150 150

100 100 100

MascalGreen Monroe ReinaWhite

Figure 6. The occurrence of Fusarium root rot.

Fruits - A publication of ISHS - www.ishs.org. - DOI: 10.17660/th2023/01 4 7

Figure 7. Map of Okinawa, in-

8 International Journal of Tropical and Subtropical Horticulture

Conclusions Hahm, Y.I. (2001). Occurrence of Fusarium wilt on Lisianthus

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W:

Fruits - A publication of ISHS - www.ishs.org. - DOI: 10.17660/th2023/01 4 9

10 International Journal of Tropical and Subtropical Horticulture

View publication stats

You might also like