American J of Botany - 2007 - Whitten - Molecular Phylogenetics of Maxillaria and Related Genera Orchidaceae Cymbidieae

American Journal of Botany 94(11): 1860–1889. 2007.
MOLECULAR PHYLOGENETICS OF MAXILLARIA AND RELATED

GENERA (ORCHIDACEAE: CYMBIDIEAE) BASED ON COMBINED
MOLECULAR DATA SETS1
W. MARK WHITTEN,2,3 MARIO A. BLANCO,4,5 NORRIS H. WILLIAMS,3 SAMANTHA KOEHLER,6

GERMÁN CARNEVALI,7 RODRIGO B. SINGER,8 LORENA ENDARA,4 AND KURT M. NEUBIG4
3
Florida Museum of Natural History, University of Florida, P.O. Box 117800, Gainesville, Florida 32611-7800 USA;
4
Department of Botany, 220 Bartram Hall, University of Florida, Gainesville, Florida 32611-8526 USA; 5Jardı́n Botánico
Lankester, Universidad de Costa Rica, Apdo. 1031–7050, Cartago, Costa Rica; 6Departamento de Genética, Escola Superior de
Agricultura ‘‘Luiz de Queiróz,’’ Caixa Postal 83, Piracicaba, SP, Brazil, 13400-970; 7Centro de Investigación Cientı́fica de
Yucatán (CICY), Calle 43 No. 130, Col. Chuburná de Hidalgo, 97200 Mérida, Yucatán, México; and 8Departamento de Botânica,
Instituto de Biociências, Universidade Federal do Rio Grande do Sul, CEP 91501-970, Porto Alegre, RS, Brazil
The orchid genus Maxillaria is one of the largest and most common of neotropical orchid genera, but its current generic
boundaries and relationships have long been regarded as artificial. Phylogenetic relationships within subtribe Maxillariinae sensu
Dressler (1993) with emphasis on Maxillaria s.l. were inferred using parsimony analyses of individual and combined DNA
sequence data. We analyzed a combined matrix of nrITS DNA, the plastid matK gene and flanking trnK intron, and the plastid
atpB-rbcL intergenic spacer for 619 individuals representing ca. 354 species. The plastid rpoC1 gene (ca. 2600 bp) was sequenced
for 84 selected species and combined in a more limited analysis with the other data sets to provide greater resolution. In a well-
resolved, supported consensus, most clades were present in more than one individual analysis. All the currently recognized minor
genera of ‘‘core’’ Maxillariinae (Anthosiphon, Chrysocycnis, Cryptocentrum, Cyrtidiorchis, Mormolyca, Pityphyllum, and
Trigonidium) are embedded within a polyphyletic Maxillaria s.l. Our results support the recognition of a more restricted
Maxillaria, of some previously published segregate genera (Brasiliorchis, Camaridium, Christensonella, Heterotaxis,
Ornithidium, Sauvetrea), and of several novel clades at the generic level. These revised monophyletic generic concepts should
minimize further nomenclatural changes, encourage monographic studies, and facilitate more focused analyses of character
evolution within Maxillariinae.
Key words: atpB-rbcL spacer; matK; Maxillaria; Maxillariinae; molecular phylogenetics; nrITS; Orchidaceae; rpoC1.
Botanists have long been fascinated by large, hyperdiverse Bulbophyllum Thouars, Epidendrum L., Pleurothallis R. Br.,
genera and the evolutionary forces that create them. Govaerts and Dendrobium Sw. What causes explosive speciation, and
(2001) lists over 50 seed plant genera that contain more than how can such radiations be explained by ecological adaptations,
physiological/morphological innovations, or accelerated rates of
500 species. Orchidaceae are one of the largest plant families
morphological/molecular change? As presently circumscribed,
and include several megagenera (1000þ spp.) including Maxillaria (ca. 580 spp.; Kew Monocot Checklist; Govaerts,
2005) ranks seventh in number of species for orchid genera
1
Manuscript received 9 February 2007; revision accepted 17 August 2007. (Cribb and Govaerts, 2005) and probably ranks among the 50
The authors thank the herbaria of the Pontificia Universidad Católica de largest angiosperm genera (Frodin, 2004). Maxillariinae is one
Quito (QCA), the Universidad de Panamá (PMA), the Universidad de Costa
of the most conspicuous and diverse subtribes of neotropical
Rica (USJ), the Ministerio del Ambiente of Ecuador, and the Autoridad
Nacional del Ambiente of Panama for facilitating our research and issuing Orchidaceae. The species are common, floristically important
permits. They are especially grateful to the Portilla family and their staff at elements in humid neotropical forests and widespread from
Ecuagenera Ltd. (Ecuador); to A. Maduro and his staff at Finca Dracula southern Florida (USA) to northern Argentina, with centers of
(Panama); to researchers and staff at Jardı́n Botánico Lankester (Costa Rica), diversity in southern Central America, along the Andes, and in
Marie Selby Botanical Gardens (Sarasota, FL, USA), and the Atlanta southeastern Brazil. Floristic, biogeographic, and evolutionary
Botanical Garden (Atlanta, GA, USA); and to H. Phillips and A. Phillips studies of such large genera are hampered by the large number
(Encinitas, California, USA) for generous access to their orchid collections. L. of species, the difficulty of defining manageable monophyletic
Jost (Ecuador) and G. Gerlach (Botanischer Garten München-Nymphenburg,
Germany) kindly contributed specimens. J. Atwood, C. Dodson, and R. units, and often by the paucity of morphological and molecular
Dressler helped to initiate this project and provided access to specimens, characters that distinguish species. In this study, we use
taxonomic advice, and field assistance. E. Christenson provided valuable combined molecular data sets to test the monophyly of the large
discussions and nomenclatural advice. K. Perkins (FLAS) provided genus Maxillaria. Does Maxillaria consist of one megagenus,
invaluable assistance in specimen and image databasing. DNA sequencing or is its present circumscription artifactual, the result of orchid
was performed by the ICBR core facility at University of Florida. E. taxonomists’ overemphasis on homoplasious vegetative and
Christenson and two anonymous reviewers provided many suggestions that pollination-related floral traits? Can Maxillaria be subdivided
improved this manuscript. Funding was provided by U.S. National Science
Foundation grant No. DEB-0234064 to N.H.W. and W.M.W., a Furniss
into more manageable clades defined by strong molecular
Foundation graduate student fellowship from the American Orchid Society to support and putative morphological synapomorphies?
M.A.B., Kew Latin American Research Fellowships to M.A.B., a FAPESP In the most recent subtribal classifications of Orchidaceae
postdoctoral grant 01/08958-1 to R.B.S., and a grant from CICY to G.C. (Dressler, 1993; Chase et al., 2003), the neotropical subtribe
2
Author for correspondence (e-mail: [email protected]) Maxillariinae Benth. was broadened to include genera formerly
1860
15372197, 2007, 11, Downloaded from https://bsapubs.onlinelibrary.wiley.com/doi/10.3732/ajb.94.11.1860 by Cochrane Peru, Wiley Online Library on [01/08/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
November 2007] W HITTEN ET AL .—M OLECULAR PHYLOGENETICS OF M AXILLARIINAE 1861
placed in Bifrenariinae Dressler and Lycastinae Schltr. sensu (producing rhizomatous, rambling plants). Plants of Cyrti-
Dressler (1981). Genera now included in Maxillariinae are: diorchis and some species in the Camaridium and Ornithidium
Anguloa Ruiz & Pav., Ida A. Ryan & Oakeley, Lycaste Lindl., clades (see Discussion) have dimorphic growth; the sympodial
Neomoorea Rolfe, Xylobium Lindl. (all previously Lycastinae); juveniles bear pseudobulbs, whereas the mature shoots that
Bifrenaria Lindl. (including Adipe Raf., Cydoniorchis Senghas, bear flowers are monopodial. Leaves can be produced
and Stenocoryne Lindl.; Koehler and do Amaral, 2004), throughout the stem or only from the terminal part of each
Guanchezia G.A. Romero & Carnevali, Horvatia Garay, sympodium. The number of apical leaves per pseudobulb
Hylaeorchis Carnevali & G.A. Romero, Rudolfiella Hoehne, ranges from one to five, and bracts subtending the pseudobulbs
Scuticaria Lindl., Teuscheria Garay (all previously Bifrenari- may be large and foliaceous or scarious.
inae); Anthosiphon Schltr., Brasiliorchis R. Singer, S. Koehler In contrast to vegetative structure, floral morphology in core
& Carnevali, Cryptocentrum Benth., Chrysocycnis Linden & Maxillariinae is relatively uniform compared to other groups in
Rchb.f., Cyrtidiorchis Rauschert, Maxillaria Ruiz & Pavón, Cymbidieae (e.g., Oncidiinae, Stanhopeinae). Conspicuous
Mormolyca Fenzl, Pityphyllum Schltr., and Trigonidium Lindl. fiber bundles may be present or absent in sepals and petals
Orchid classifications of recent decades (Dressler, 1981, 1993; (readily evident when sepals are torn; Fig. 10R). Most species
Senghas, 1993, 1994; Szlachetko, 1995) have all recognized do not offer any floral reward and seem to be food-deceptive.
these genera as a closely related, monophyletic or paraphyletic The widespread (possibly pleisiomorphic) occurrence of
(Szlachetko, 1995) group; the classification of Dressler (1993) scutellar pollinarium attachment to pollinating bees results in
is most congruent with current molecular data. Maxillariinae a stereotypic floral morphology that has hampered attempts at
are members of a neotropical clade that includes Coeliopsidi- generic and subgeneric classification. Apparent floral rewards
nae, Oncidiinae, Stanhopeinae, and Zygopetalinae; these five in some clades include nectar, triterpenoid resins, and
subtribes are each strongly monophyletic and are sister to pseudopollen (van der Pijl and Dodson, 1966; Davies et al.,
Eriopsidiinae, but relationships among them are still poorly 2000, 2003a, b, 2005; Singer, 2003; Flach et al., 2004; Singer
resolved (Whitten et al., 2000; M. Whitten, unpublished data). and Koehler, 2004; Stpiczynska et al., 2004; Singer et al.,
Wider phylogenetic analyses of epidendroid orchids (Freuden- 2006). Radiations to novel pollination syndromes (e.g.,
stein et al., 2004; van den Berg et al., 2005) showed that putative moth pollination in Cryptocentrum; pseudocopulation
Coeliopsidinae, Maxillariinae, Oncidiinae, Stanhopeinae, and in Mormolyca, Trigonidium, Chrysocycnis, and Cyrtidiorchis;
Zygopetalinae form a clade within a grade that includes hummingbird pollination in some Camaridium and Ornithi-
members of Cyrtopodiinae and Cymbidieae (sensu Dressler, dium) are associated with numerous floral apomorphies that
1993); consequently, Chase et al. (2003) lumped tribe resulted in segregation of these clades at the generic level by
Maxillarieae into a broader tribe Cymbidieae. previous workers. Pseudocopulation may have evolved at least
As presently circumscribed, subtribe Maxillariinae s.l. four times within Maxillariinae, and resin rewards may have
includes species with diverse vegetative morphology, but their several independent origins. Floral rewards and pollination
flowers usually have a prominent column foot (a ventral syndromes will be discussed in subsequent papers.
extension of the base of the column to which the labellum is Fruits of Maxillariinae are always capsules that dehisce
attached) and pollinaria with a viscidium, four pollinia in two along six longitudinal seams, resulting in six separate valves:
superposed pairs, and often a prominent stipe. Generic three ‘‘placentiferous’’ ones alternating with three ‘‘sterile’’
relationships within Maxillariinae were partially clarified by ones (Blanco et al., 2006). In some taxa, these valves separate
Whitten et al. (2000); phylogenetic relationships within the apically and become reflexed; in most taxa, the valves remain
Lycaste alliance sensu Dressler (1993) were analyzed by Ryan united both distally and proximally, with seeds dispersing
et al. (2000), and within the Bifrenaria alliance by Koehler et through lateral openings. These two types of fruit dehiscence
al. (2002). The remaining large clade of species (corresponding (apical vs. lateral) and the presence/absence of perianth fiber
to Maxillariinae sensu Dressler [1993], hereafter referred to as bundles correlate with major clades (see Discussion).
core Maxillariinae) currently consists of eight genera (Antho- Reported chromosome numbers for core Maxillariinae are
siphon, Chrysocycnis, Cryptocentrum, Cyrtidiorchis, Maxil- 2n ¼ 28, 30, 32, 34, 36, 38, 40, and 42 with 40 being the most
laria, Mormolyca, Pityphyllum, and Trigonidium) with about common number for 68 species sampled (Blumenschein, 1960;
609 species, currently recognized by the World Checklist of Blumenschein and Paker, 1963; Tanaka, 1966; Carnevali,
Orchidaceae (Govaerts et al., 2005). Dressler (1981), Senghas 1991; Félix and Guerra, 2000). The lowest counts of 2n ¼ 28
(1994) and Szlachetko (1995) included Scuticaria in core and 30 are from Cryptocentrum (Carnevali, 1991). Diploids
Maxillariinae, but molecular data place it in the Bifrenaria and tetraploids of M. mosenii have 2n ¼ 38 and 76, respectively
alliance (Whitten et al., 2000; Koehler et al., 2002). (S. Koehler, unpublished data). Blumenschein and Paker
Core Maxillariinae are characterized by the presence of (1963) reported triploids in three species. At present,
conduplicate leaves (sometimes modified as terete, subterete, chromosome counts are too few for meaningful taxonomic
or ensiform, but never plicate), single-flowered inflorescences correlations, and reported counts often vary within species.
(sometimes produced in fascicles), four pollinia with or without Most chromosome counts lack corresponding herbarium
a stipe attached to an often lunate viscidium, and usually a vouchers (allowing the corroboration of their identity), which
prominent column foot that is typically persistent in the fruit. further diminishes their scientific value.
Vegetative structure varies greatly among species groups. Taxonomists have long recognized that generic delimitations
Stems can be monopodial (forming long canes with apparently within core Maxillariinae are unsatisfactory (Dressler, 1981;
indeterminate growth) or more frequently sympodial. In the Carnevali, 1991; Senghas, 1993, 1994, 2000; Whitten et al.,
latter case, each growth unit can either be terminated by a 2000; Christenson, 2002a, b; Szlachetko et al., 2006;
heteroblastic (single internode) pseudobulb or be relatively Szlachetko and Śmiszek, 2007). Several segregate genera have
uniform in thickness. The rhizome segments between growth been created during the last 150 yr, but most recent taxonomic
units can be very short (producing cespitose plants) or long and floristic treatments favor a broad generic concept of
1862 A MERICAN J OURNAL OF B OTANY [Vol. 94
Figs. 1–7. Single, randomly selected most parsimonious cladogram from a combined analysis of nrITS, matKþtrnK, and atpB-rbcL spacer sequence
data for Maxillariinae. Values above branches are Fitch lengths; values below branches are bootstrap percentages 50%. Black circles indicate nodes that
collapse in the strict consensus of shortest trees. Lettered clades correspond to those mentioned in Results/Discussion. Names in boldface indicate the type
species of genera or sections. Species names are prefaced with collector initial and collection number (Appendix 1). Collector abbreviations are: A ¼
Atwood & Whitten; B ¼ Blanco; D ¼ Dressler & Atwood; GG ¼ Gerlach; H ¼ Hirtz; J ¼ Jost; SK ¼ Koehler; FP ¼ Pupulin; W ¼ Whitten.
Maxillaria while suspecting the polyphyly of the genus (e.g., Prieto. In the first volume of their later Systema Vegetabilium
Atwood and Mora de Retana, 1999; Govaerts et al., 2005). A Florae Peruvianae et Chilensis, Ruiz and Pavón (1798) listed
comprehensive monograph of Maxillaria has never been 16 species in Maxillaria (13 of these are now relegated to other
attempted, and given the present circumscription of the genus, genera and subtribes; Garay, 1997b). Maxillaria platypetala
developing such a monograph would represent a gigantic effort Ruiz & Pav. is currently regarded as the valid lectotype (Brieger
(Christenson, 2002a, b; Monro, 2006). and Hunt, 1969; Garay, 1997a, b; McIllmurray and Oakeley,
The circumscription of Maxillaria, the largest genus in the 2001). The large number of species described in the last two
subtribe, has plagued taxonomists since its origin. It was centuries, the conservative floral morphology, and the diverse
established by Ruiz and Pavón (1794) with a short description vegetative habits among species have resulted in great
of the genus and an engraving of a flower and capsule by Félix confusion in the circumscription and taxonomy of Maxillaria
Fig. 2.
and closely related genera (Carnevali, 1991; Dressler, 1993; been segregated from Maxillaria (Szlachetko et al., 2006;
Christenson, 2002a, b). Generic names currently regarded as Singer et al., 2007; Szlachetko and Śmiszek, 2007).
synonyms of Maxillaria (Govaerts et al., 2005) include There have been several recent attempts to produce a generic
Camaridium Lindl., Dicrypta Lindl., Heterotaxis Lindl., and infrageneric classification of Maxillaria and relatives, all
Marsupiaria Hoehne, Menadena Raf., Neo-urbania Fawc. & without the benefit of a phylogenetic framework and with
Rendle, Ornithidium Salisb., Pentulops Raf., Pseudomaxillaria conflicting results. Using pollinarium characters and chromo-
Hoehne, Psittacoglossum La Llave & Lex., Sepalosaccus some numbers, Carnevali (1991) divided Maxillaria into two
Schltr., and Siagonanthus Poepp. & Endl. Recently, Heterotaxis major groups, four alliances, 47 suballiances, and more than 10
has been resurrected (Barros, 2002; Ojeda et al., 2005), and five series. Senghas (2000) created a classification based on growth
more genera (Adamanthus Szlach., Brasiliorchis R. Singer, S. habit, floral characters, and leaf texture, recognizing 12 groups
Koehler & Carnevali, Christensonella Szlach., Mytnik, Górniak and giving generic status to Marsupiaria, Ornithidium, and
& Śmiszek, Laricorchis Szlach., and Sauvetrea Szlach.) have Sepalosaccus. Christenson (2002a, b) provided an overview of
Fig. 3.
vegetative and floral variation within Maxillaria and presented MATERIALS AND METHODS
a partial infrageneric classification with 19 sections.
Dathe and Dietrich (2006) analyzed nrITS sequences and Specimens were field collected or were obtained from various botanical
gardens, private collections, and commercial vendors (Appendix 1).
morphology for 30 species of core Maxillariinae. They Nomenclature largely follows the World Checklist of Orchidaceae (Govaerts
concluded that Maxillaria is grossly polyphyletic, that most et al., 2005), except where we disagree on certain species circumscriptions.
morphological characters examined were homoplasious, and The sister group of Maxillariinae is still unclear. A 215-accession, combined
that the current classification is based on groupings that are matK/ITS cladistic analysis of neotropical Cymbidieae (M. Whitten,
somewhat useful for identification purposes but are not unpublished data) strongly supports a clade consisting of Maxillariinae
(including Bifrenariinae and Lycastinae), Stanhopeinae, Coeliopsidinae,
monophyletic. They also stated that greater taxon sampling Zygopetalinae, and Oncidiinae, but relationships among subtribes are not
was needed before core Maxillariinae could be reclassified. well supported. Consequently, Eriopsis (Eriopsidiinae) was used as an
The objective of this study was to use combined molecular outgroup. Sampling included 604 specimens of ingroup core Maxillariinae,
data sets and extensive taxon sampling to reevaluate generic representing approximately 354 species plus 13 placeholder individuals
boundaries and to define well-supported clades within core (representing 12 species) of Bifrenariinae and Lycastinae (both sensu
Dressler [1981]). Representatives of all genera (including almost all type
Maxillariinae. This clade constitutes a large fraction of species) were sampled. A few specimens could not be unequivocally
neotropical Orchidaceae, which in turn are a major component identified to species, reflecting either alpha-taxonomic problems or
of neotropical floristic diversity. The monographic revision of undescribed species. Whenever possible, these are identified with a species
large genera such as Maxillaria is hampered by the difficulty of modifier ‘‘aff.’’ or ‘‘cf.’’ and the probable name of the species or that of its
defining manageable monophyletic subdivisions (Monro, putative closest relative, respectively. Apparently undescribed species are
indicated with the abbreviation ‘‘sp. nov.’’ after the genus. Digital
2006). The identification of such clades in this study should photographs of most sampled plants are being placed in a database with
facilitate more intensive taxonomic, morphological, molecular, voucher data at FLAS (http://www.flmnh.ufl.edu/natsci/herbarium/cat/
and biogeographic studies, and analyses of character evolution. catsearch.htm). The alpha-taxonomy of Maxillaria s.l. is still incomplete,
Fig. 4.
and several new species are discovered each year, especially in the Peruvian 26SE of Sun et al. (1994) and a PCR program consisting of an initial 10 min
Andes (E. Christenson, BRIT, personal communication). Nevertheless, we bake at 998C, followed by individual addition of 0.5 unit of Taq polymerase; 30
are confident that our taxon sampling of ca. 354 species includes cycles of 948C denaturation for 45 s, 608C annealing for 45 s, and 728C
representatives of all major morphological groups of core Maxillariinae extension for 1 min; and a final extension of 728C for 3 min. To minimize the
and that the resulting cladograms adequately reflect relationships among effects of secondary structure during nrITS amplification, 7 lL of 5 M betaine
them. were added to the PCR mix. The matKþtrnK intron region was usually
amplified as a single piece, using the primers 19F (Goldman et al., 2001) and
DNA extraction, amplification, and sequencing—DNA was extracted trnK2R (Johnson and Soltis, 1994); primers 308F (TATCAGAAGGTTTTG-
mostly from fresh leaves, flowers, and silica-gel-dried leaves and flowers, using SA) and 1100F (CATTTCTAATAAATACTCTGAC) were used as additional
a modified version of the 23 CTAB procedure of Doyle and Doyle (1987) with internal sequencing primers. Some species were amplified using the primers
exclusion of beta-mercaptoethanol and inclusion of five units of proteinase K to 56F (ACTTCCTCTATCCGCTACTCCTT) and 1520R (CGGATAATGTC-
improve yield and quality of DNA. Nearly all material was extracted from fresh CAAATACCAAATA) that yielded a shorter but nearly complete portion of
or silica-dried tissue; extractions from herbarium specimens were rarely matK. PCR conditions consisted of a hot start with 2 min of initial denaturation
successful. Precipitated DNA pellets were resuspended in 200 lL of Tris- at 948C; followed by 33 cycles of 948C denaturation for 45 s, 608C annealing
EDTA (TE) buffer and then cleaned using Qiaquick columns (Qiagen, for 45 s, and 728C extension for 2 min 45 s; and a final extension at 728C for 3
Valencia, California, USA) with 2–3 washes with Buffer PE to remove potent min. The plastid trnL-F region has been widely used in orchid phylogenetics,
PCR inhibitors present in many samples. but in preliminary surveys within Maxillariinae, many species yielded several-
All amplifications used Sigma Jumpstart Taq polymerase and reagents banded PCR products suggestive of multiple copies and possible pseudogenes.
(Sigma-Aldrich, St. Louis, Missouri, USA) in 25-lL reactions with 2.5 mM We therefore abandoned use of this region and substituted the atpB-rbcL spacer
MgCl2. Amplification and sequencing of nrITS utilized the primers 17SE and region. The atpB-rbcL intergenic spacer was amplified with the primers
[Vol. 94
B OTANY
OF
A MERICAN J OURNAL
Fig. 5.
1866
Fig. 6.
(designed by MW) Max F (CTAGGTTTTGTTCTTCAAGTGTAG) and Max cycles of 948C denaturation for 45 s, 608C annealing for 45 s, and 728C for 2
R (GTCAATTTGTAATCTTTAACACCAGC). PCR conditions consisted of min; and a final extension at 728C for 3 min. Although the RNA polymerase
an initial 10 min bake at 998C followed by individual addition of Taq beta subunit 1 (rpoC1) intron has been used in a few phylogenetic analyses of
polymerase hot start with 2 min of initial denaturation at 948C; followed by 33 angiosperms (e.g., Plunkett et al., 2004), we are unaware of any studies using
data. Heuristic searches consisted of 1000 random taxon addition replicates of

subtree-pruning-regrafting (SPR) and ‘‘keeping multiple trees’’ (MULTREES)
with the number of trees limited to 10 per replicate to minimize extensive
swapping on islands with many suboptimal trees. The resulting trees were then
used as starting trees for tree-bisection-reconnection swapping (TBR, because
this algorithm is sometimes able to reach shorter trees than SPR) with an upper
limit of 10 000 trees. Searches for shortest trees were also performed using
parsimony ratchet as implemented in the program PAUPRat (Sikes and Lewis,
2001). Internal support was evaluated using 1000 bootstrap replicates using
heuristic searches with random taxon-addition and the SPR algorithm; five trees
were saved per replicate. Individual shortest trees, strict consensus trees, and
bootstrap (BS) consensus trees were examined visually to assess congruence
among data sets. Bootstrap support is categorized as weak (50–75%), moderate
(76–90%), and strong (91–100%). Because of the large size of the data set, the
incongruence length difference (ILD; Farris et al., 1995) and Bayesian and
maximum likelihood analyses were not performed.
Two accessions were identified as natural hybrids based on their conflicting
placements in shortest nrITS vs. plastid trees and on their intermediate
morphology: Blanco 2986 [putative M. porrecta Lindl. 3 M. exaltata
(Kraenzl.) C. Schweinf.] and Blanco 1661 [putative M. strumata (Endres &
Rchb.f) Ames & Correll 3 M. pseudoneglecta J.T. Atwood]. Both were
excluded from the combined analyses. No other cases of hard incongruence
between data sets were detected. Data sets were analyzed individually and as a
combined ITS/matK/atpB-rbcL matrix. A smaller combined four-region matrix
(88 selected species) included rpoC1 data.
RESULTS
General features of the DNA regions and tree statistics from

separate and combined analyses are presented in Table 1. The
number of species for each matrix is not equal because of
amplification or sequencing failures in various species.
Because of space limitations, trees from individual analyses
are not presented.
Analysis of nrITS—Although nrITS is the shortest of the

four regions utilized (833 aligned base pairs), it provided the
greatest percentage of potentially parsimony-informative
characters and the most resolution and the greatest number of
Fig. 7. clades with BS support 70% (N ¼ 180; Table 1). All of the
major clades found in the combined analyses (see Discussion)
the nearly complete gene (2818 bp in Phalaenopsis chloroplast genome, are monophyletic with BS 50% in the nrITS analysis except
GenBank AY916449). Based on the Phalaenopsis sequence and related for Trigonidium, which forms three clades in the unresolved
monocots, we designed primers to amplify a ca. 2600-bp portion of rpoC1 from spine of the bootstrap consensus.
Maxillarieae. Amplimers were 1F (ATGAATCAGAATTTCTATTCTATG)
and 2604R (TCCACCGAAGCCACAAAGGACTAT). Internal sequencing Analysis of matK þ trnK—For matK, eight species
primers used were 560F (AGGAGGAACATGAAGCTCAG), 700R
(TGTGAAATTCTTGAGTAGTCTAC), 1887F (ACTCTGCTTGG-
repeatedly gave messy sequences, suggesting multiple copies
TAAACGGGTCGAT), 1910R (ATCGACCCGTTTACCAAGCAGAGT), or pseudogenes; other species sequenced cleanly but contained
and 1137F (TTGAGCCGGATGAGAGGAAACCTT). This region was indels not in multiples of three, producing reading frameshifts.
amplified and sequenced for 84 selected species. For some species, the region For this reason, we suspect that matK may be a pseudogene in
was amplified in two overlapping pieces using the primer combinations 1F at least some Maxillariinae. Anthosiphon roseans repeatedly
þ1910R and 1137F þ 2604R. Amplification protocols were identical to those produced messy sequences from several accessions. Because
used for matK. Purification of PCR products was performed with Microclean
(Gel Co., San Francisco, California, USA) following the manufacturer’s
this monotypic genus is of special taxonomic interest, we
protocols. PCR products were sequenced in both directions, using the BigDye cloned the matK PCR products and sequenced five of the
Terminator reagents on an ABI 377 or 3130 automated sequencer following longest clones. The five clones contained various numbers of
manufacturer’s protocols (Applied Biosystems, Foster City, California, USA). indels, resulting in products ranging from ca. 1200 to 1850 bp.
Electropherograms were edited and assembled using the program Sequencher The longest (apparently intact) copy was selected for inclusion
4.6 (Genecodes Inc., Ann Arbor, Michigan, USA), and the resulting sequences in the matrix.
were aligned manually using the program Se-Al (Rambaut, 1996) following the
guidelines of Kelchner (2000). All sequences were deposited in GenBank (see
Although the matK þ trnK region yielded slightly more
Appendix 1), and aligned matrices were deposited in TreeBase. potentially parsimony-informative characters than nrITS and
with slightly higher CI and similar RI values, the BS consensus
Data analysis—Analyses were performed using PAUP* version 4.0b10 is less resolved and has 50% fewer clades with support 70%
(Swofford, 2003) with Fitch parsimony (unordered characters with equal (Table 1). Nevertheless, the supported clades are congruent
weights; Fitch, 1971), ACCTRAN optimization, and gaps treated as missing with those found in the nrITS analysis.
Fig. 8. Bootstrap consensus from a combined analysis of nrITS, matKþtrnK, atpB-rbcL spacer, and rpoC1 sequence data for Maxillariinae. Values
above branches are bootstrap percentages 50%. Lettered clades correspond to those mentioned in Results/Discussion.
Analysis of atpB-rbcL intergenic spacer—The atpB-rbcL ranging from 449-1090 bp among species sampled, with many
intergenic spacer proved difficult to sequence cleanly in some large indels, repeats, and some probable stem–loop regions.
species because of multiple homopolymer A/T regions that These features make this region very challenging to align. The
caused stutter; consequently, the matrix includes only 580 total length of the aligned matrix was 2031 bp, but we judged
individuals. The length of this region also varies greatly, almost half of it (1087 bp) to be unalignable; these regions
Fig. 9. Representatives of major clades of core Maxillariinae; letters correspond to clades in Figs. 1, 2, and 8. (A) Maxillaria cymbidioides Dodson, J.T.
Atwood & Carnevali, Whitten 1869 (inset: flower with labellum deflexed, showing callus); (B) Heterotaxis sessilis (Sw.) F. Barros [¼ Maxillaria crassifolia
(Lindl.) Rchb.f.], Whitten 2455 (inset: labellum showing callus); (C) Maxillaria sophronitis (Rchb.f.) Garay, Whitten 2930 (inset: flower in frontal view);
(D) Pityphyllum laricinum (Kraenzl.) Schltr., Whitten 1653; (E) Brasiliorchis phoenicanthera (Barb. Rodr.) R. Singer, S. Koehler & Carnevali, Whitten 2304;
were excluded from the analyses. This spacer region might be 3187). For the remaining 84 samples, the aligned matrix is
fully alignable within genera and species groups, but it turned 2843 bp with 387 bp of exon 1, 787 bp of intron, and 1319 bp
out to be a less than optimal choice for subtribal level analyses. of exon 2. The intron ranged in length from 729 to 769 bp. The
Nevertheless, the included aligned regions (944 bp) provided matrix was easily aligned and contained few indels, ranging
useful levels of variation congruent with the other data sets. from 1 to 76 bp, mostly in the intron. Although branch lengths
The BS analysis yielded only 77 clades with BS support 70% are short and BS support is low in the rpoC1 analysis, the
and CI and RI values lower than for either the nrITS or matK shortest trees (not shown) recovered the same clades and tree
analyses. structure as the combined four-region analysis (Fig. 8).
Analysis of combined nrITS/matK/atpB-rbcL—Figures 1– Analysis of combined rpoC1/nrITS/matK/atpB-rbcL—The

7 present one randomly chosen most parsimonous tree from the addition of data from the relatively conserved rpoC1 gene in
combined three-region analysis. Values above branches are the limited 88-accession analysis results in increased resolution
Fitch branch lengths; values below the line are BS percentages and support in the spine of the tree and in higher BS for most
50%. Nodes that collapse in the strict consensus of all most clades (Fig. 8). Clades A, B, and C (M. nasuta clade,
parsimonious trees are marked with a black circle. Bifrenari- Heterotaxis, and Ornithidium) still receive low to moderate BS,
inae sensu Dressler (1993) (Bifrenaria-Hylaeorchis) is highly but the three are united in a basal clade with 100% BS.
supported (99% BS) and is basal to Lycastinae sensu Dresser Pityphyllum (clade D) is successively sister to the remaining
(88% BS; Neomoorea-Xylobium), which is sister to core taxa; clades E–Q all receive BS greater than 90%. The M.
Maxillariinae (BS 99%). The spine of the tree within core bicallosa clade (F) is moderately supported as sister to
Maxillariinae is poorly supported, but numerous clades (clades Cryptocentrum þ Anthosiphon (clade G). Clades H–L form a
A–Q) often corresponding to recognized generic or subgeneric polytomy weakly sister to clades M–Q. Trigonidium is
taxa received weak to strong BS support. The currently supported as monophyletic but with only 90% BS. Both
recognized minor genera of core Maxillariinae (Anthosiphon, Camaridium (clade P) and Maxillaria s.s. (clade Q) are
Chrysocycnis, Cyrtidiorchis, Mormolyca, Pityphyllum, and strongly supported and together contain the majority of species
Trigonidium) and the recent segregate genera (Adamanthus, in the subtribe.
Brasiliorchis, Christensonella, Laricorchis, and Sauvetrea) are
embedded within a polyphyletic Maxillaria s.l. with moderate
to high BS support. DISCUSSION
Nonmonophyly of species—For species that include several In the strict consensus of all shortest trees of all analyses, the
samples per species, the individuals do not always form clades currently recognized minor genera of core Maxillariinae
in the representative shortest tree (Figs. 1–7). Lineage sorting (Anthosiphon, Chrysocycnis, Cyrtidiorchis, Mormolyca, Pity-
and introgression are possible explanations for such paraphyly, phyllum, and Trigonidium; Govaerts et al., 2005) and the five
but in cases where branch lengths and support are substantial recent segregate genera (Adamanthus, Brasiliorchis, Christen-
(e.g., Christensonella, clade L; M. acutifolia Lindl., clade J), sonella, Laricorchis, and Sauvetrea) are embedded within a
this probably reflects poor alpha-taxonomy and unrecognized polyphyletic Maxillaria with moderate to high BS. In the
cryptic species. In other cases [e.g., M. sigmoidea (C. following paragraphs, we discuss the morphological character-
Schweinf.) Ames & Correll/M. lutheri J.T. Atwood, clade P; istics of well-supported clades that we feel warrant generic
M. flava Ames, F. T. Hubb. & C. Schweinf./M. microphyton recognition. Some of these clades correspond to currently
Schltr., clade P], we suspect a combination of short branch recognized or recently described genera; others represent novel
lengths and uncertain morphological species boundaries, plus segregates that are in the process of formal taxonomic
possible ambiguous determination of specimens. For morpho- circumscription. In the heading for each clade, two BS values
logically unambiguous species, the multiple samples nearly are given; the first is that from the large three-region analysis,
always formed clades, often revealing geographic structure. and the second is from the smaller four-region analysis. For
simplicity throughout the discussion, figures, and appendix, we
Analysis of rpoC1—The rpoC1 gene is the least variable of generally use the traditional species names in Maxillaria for
the regions utilized. The primers we used amplified about 85% those groups that are currently regarded as part of Maxillaria
of the gene (portions of the 5 0 and 3 0 ends were lacking, but an s.l. For each clade, we note the type of fruit dehiscence (apical
intron was included). The sequenced region ranged from 2365 vs. lateral) and the presence or absence of conspicuous perianth
to 2474 bp. Because of the length and consequent cost per fibers (Fig. 10R).
individual, this gene was sequenced for only 88 accessions
selected from all major clades revealed in the combined matK/ Clade descriptions—
ITS/atpB-rbcL analysis. Three species produced messy rpoC1
sequences and are represented by missing data in the combined Clades AþBþC—(100/100% BS) Fig. 1
four-region analysis: Cyrtidiorchis alata (Lindl.) Rauschert This highly supported clade includes three morphologically
(Whitten 2932 and Gerlach 944005), Maxillaria calantha distinctive subclades (the M. nasuta Rchb.f. clade, Heterotaxis,
Schltr. (Whitten 2550), and M. chicana Dodson (Whitten and Ornithidium) that receive moderate BS support; two of
(F) Maxillaria bicallosa (Rchb.f.) Garay, Whitten 3339 (inset: flower in lateral view); (G) Cryptocentrum latifolium Schltr. flower showing labellar spur,
Whitten 2733 [inset: plant habit of C. peruvianum (Cogn.) C. Schweinf., Whitten 2322]; (H) Cyrtidiorchis frontinoensis (Garay) Rauschert, Gerlach 94–4005
(inset: column and pubescent labellum); (I) Maxillaria aff. alpestris Lindl., Whitten 3113 (inset: flower, lateral view).
Fig. 10. Representatives of major clades of core Maxillariinae; letters correspond to clades in Figs. 2–8. (J) Maxillaria richii Dodson, Whitten 1975 (inset:
flower, lateral view); (K) Maxillaria longipetiolata Ames & C. Schweinf., Whitten 2360 (inset: flower with labellum deflexed); (L) Maxillaria acicularis
Herb. ex Lindl., Whitten 1994 (inset: SEM of root showing annular thickenings of velamen; scale bar ¼ 100 lm); (M) Maxillaria scorpioidea Kraenzl.,
Whitten 3335 (inset: labellum showing resinous secretion); (N) Maxillaria procurrens Lindl., Whitten 2438 (inset: flower showing shiny, dry callus); (O)
Trigonidium egertonianum Bateman in Lindl., Whitten 3341 (inset: flower in frontal view showing shiny blue petal apices); (P) Maxillaria paleata (Rchb.f.)
TABLE 1. Features of DNA data sets used in this study in relation to one of the most parsimonious trees from each analysis (percentages calculated relative
to aligned length).
No. of No. of potentially Fitch tree No. of No. of nodes
No. of variable parsimony- length shortest 70% bootstrap Transition/
DNA region species Aligned length (bases) sites informative sites (steps) trees (ingroup) CI RI transversion ratio
matKþtrnK 611 1852 795 476 2228 10 000þ 86 0.46 0.84 0.68 (571/841)
nrITS 1&2 619 833 525 416 2691 10 000þ 180 0.34 0.88 1.86 (1049/563)
18S 619 70 21 7 39 — — 0.64 0.07 2.00 (8/4)
ITS1 619 260 197 167 1169 — — 0.31 0.87 1.77 (462/260)
5.8S 619 164 39 28 112 — — 0.43 0.93 3.60 (54/15)
ITS2 619 277 227 193 1263 — — 0.34 0.90 1.96 (421/215)
26S 619 62 41 21 108 — — 0.53 0.87 1.57 (44/28)
atpB-rbcL Spacer 580 944 (1087 excluded) 465 380 2579 10 000þ 77 0.32 0.77 0.34 (682/1973)
Combined matK, ITS, atpB-rbcL 611 3629 1890 1267 7959 184 285 0.35 0.83 0.78 (2793/3579)
rpoC1 84 2843 350 149 565 10 000þ — 0.69 0.76 1.09 (176/162)
Exons 84 1704 170 63 245 — — 0.74 0.84 1.29 (55/51)
Intron 84 787 180 86 326 — — 0.50 0.67 0.83 (80/96)
Combined matK, ITS, atpB-rbcL, rpoC1 88 6127 1374 654 3178 216 — 0.56 0.66 0.93 (1289/1379)
these subclades have previously been recognized as genera. A distributed from southern Florida (USA) and the Greater
detailed morphological and molecular analysis of this clade Antilles to Brazil, with most of the species occurring in
was performed by Ojeda (2003) and Ojeda et al. (2003) with southern Central America and northern South America (Ojeda
recircumscription and addition of new species and combina- et al., 2005). Several inflorescences are produced sequentially
tions (Ojeda et al., 2005). Pseudobulbs are unifoliate. from each leaf axil. Morphological cladistic analyses by Ojeda
Pseudobulbless species with pseudomonopodial growth (pre- et al. (2003) of Heterotaxis, Ornithidium, and the M. nasuta
sumably neotenic) also occur. The flowers in all three Rchb.f. clade revealed three morphological synapomorphies
subclades provide some kind of floral reward: trichomes, for Heterotaxis: (1) the floral pedicel is wider than the other
resin-like secretions, or nectar. A putative synapomorphy for internodes of the peduncle; (2) the junction of the column and
this clade is a greatly reduced column foot. the pedicel is slanted at an angle of 458; and (3) the sepals and
petals have a subapical mucron. The flowers are yellow to
Clade A—(84/79% BS); Maxillaria nasuta clade, Figs. 1, 9; orange-red, with the labellum in some species being mostly
3 spp. purple (or rarely pinkish) and with calli varying in size and
Vegetatively, the three species in this clade (M. nasuta, M. texture; in most species the labellum is yellow or orange with
cymbidioides Dodson, J.T. Atwood & Carnevali, M. probosci- purple or reddish spots or blotches. The labellum typically
dea Rchb.f.) are similar to Heterotaxis (see next section) but bears a linear pad of easily detached, glandular trichomes that
have pseudobulbs with smooth, varnished surfaces rather than secrete an unidentified reward (Singer et al., 2006); these
the minutely wrinkled, roughened surfaces of pseudobulbs of trichomes are collected by meliponine bees. The fruits
Heterotaxis and Ornithidium. Additional putative synapomor- invariably have lateral dehiscence.
phies (within clade AþBþC) include relatively long inflores- The distinctly fleshy flowers usually possess fiber bundles in
cences (ca. twice the length of pseudobulbs), fibrous sepals and the sepals and petals, a character shared with the M. nasuta
petals, and papillae on the dorsal surface of the column. The clade (A) but absent in Ornithidium (clade C). Heterotaxis is
labellar callus is ligulate and shiny and secretes an abundant characterized by short rhizomes and laterally compressed,
reddish, sticky substance (probably resin) but lacks the raised oblong, minutely wrinkled, unifoliate pseudobulbs subtended
pad of glandular trichomes present in Heterotaxis (Clade B). by various leaf-bearing sheaths. Exceptions are Maxillaria
The fruits have lateral dehiscence; perianth fibers are present. equitans Schltr. and M. valenzuelana (A. Rich.) Nash that
Maxillaria nasuta is widely distributed in Central and South exhibit pseuomonopodial growth without pseudobulbs. Based
America south to Bolivia; the other two species are restricted to on these characters, Hoehne (1947) created the genus
Ecuador, Colombia, and Venezuela. Marsupiaria for these two species. Brieger and Illg (1972)
included M. nasuta and M. proboscidea (as synonyms of each
Clade B—(76/74% BS) Heterotaxis Lindl., Figs. 1, 9; 11þ other) in the Heterotaxis group, but these two species form
spp.; including Dicrypta Lindl., Marsupiaria Hoehne, Pentu- their own separate clade along with M. cymbidioides (see clade
lops Raf., Maxillaria subgen. Heterotaxis (Lindl.) Brieger, M. A). Brieger and Illg excluded M. equitans and M. valenzuelana
sect. Heterotaxis (Lindl.) Brieger, M. sect. Iridifoliae Pfitz. from this group. The generic concept Pentulops Raf. (based on
Type: Heterotaxis crassifolia Lindl. [¼ Heterotaxis sessilis M. discolor) is also embedded within the Heterotaxis clade.
(Sw.) F. Barros] Barros (2002) reinstated Heterotaxis, a decision supported and
Heterotaxis comprises about 11, primarily epiphytic species amplified by Ojeda et al. (2005), but the World Checklist of
Ames & Correll, Whitten 2561 (inset: flower, frontal view); (Q) Maxillaria irrorata Rchb.f., Whitten 2571 (inset: flower, frontal view). (R) Sepals of various
species of Maxillaria, torn to show presence/absence of fiber bundles. The top two (M. gentryi Dodson and M. ochroleuca Lodd. ex Lindl.) have fiber
bundles and belong in Maxillaria s.s. (clade Q). The third and fourth (M. ctenostachya Rchb.f. and M. imbricata Barb.Rodr.) lack fiber bundles and belong in
Camaridium (clade P). The fifth (M. rufescens) also lacks fiber bundles and belongs in Mormolyca (clade J).
Orchidaceae (Govaerts et al., 2005) still includes Heterotaxis as small, white or yellow/orange, and lack a column foot. The
a synonym of Maxillaria. pollinarium consists of four small clavate pollinia attached to a
delicate discoid or narrowly triangular visicidum. The tiny,
Clade C—(57/77% BS) Ornithidium Salisb., Figs. 1, 9; 35þ narrow flowers of most species and the viscidium shape
spp.; including Laricorchis Szlach., Neo-urbania Fawc. & suggest attachment of pollinaria to the proboscis of small
Rendle, Siagonanthus Poepp. & Endl., Maxillaria sect. insects (rather than attachment to the scutellum), but no
Ornithidium (Salisb.) Christenson, M. sect. Reflexae Christen- pollination records exist. The genus was recently broadened to
son, M. sect. Siagonanthus (Poepp. & Endl.) Christenson. include Maxillaria huancabambae (Kraenzl.) C. Schweinf. and
Type: Ornithidium coccineum (Jacq.) Salisb. ex R. Br. M. saragurensis Dodson (Whitten et al., 2006) on the basis of
Species in this clade are widely distributed throughout the our analyses. Pityphyllum hauncabambae (Kraenzl.) Whitten is
neotropics. Plants are characterized by the presence of either distinctive because of its broad conduplicate leaves and
elongate rhizomes between erect to pendent growths with or globose, bright-yellow flowers, but it also possesses a scarious
without pseudobulbs, or erect, leafy, monopodial canes. The tunica with small ligules. The bright-yellow flowers of this
flowers are fleshy, often globose, tan, green, orange, yellow, species are similar to those of many species of Ornithidium
red, pink, or mauve, lack perianth fibers, and usually produce (clade C) and suggest hummingbird pollination. We are
nectar at the base of the labellum. Most brightly colored uncertain whether flowers of this genus secrete nectar. Fruit
species are probably hummingbird-pollinated; those with more dehiscence is apical; perianth fibers are absent.
open, greenish flowers are probably bee- or wasp-pollinated.
Maxillaria haemathodes (Ruiz & Pav.) Garay is remarkable for Clade E—(100/100% BS) Brasiliorchis R. Singer, S.
having deep royal blue flowers. Braga (1977) documented Koehler & Carnevali, Figs. 2, 9; 13 spp.; Maxillaria sect.
pollination of M. pendens Pabst by nectar-collecting wasps Repentes Pfitz. Type: B. picta (Hooker) R. Singer, S. Koehler
with attachment of the disclike viscidia to their compound & Carnevali
eyes. Most species of this clade are endemic to the Atlantic rain
The surface of the pseudobulbs and stems of most species forest biome in southeastern Brazil; a few species reach
have a characteristic shiny, minutely cracked texture reminis- northeastern Argentina [B. chrysantha (Barb. Rodr.) R. Singer,
cent of old varnish and are usually olive-green in life. Roots are S. Koehler & Carnevali, B. picta]. This group is easily
usually orangish to brown. Some species [e.g., M. multicaulis diagnosed by the sulcate to ridged bifoliate pseudobulbs; the
(Poepp. & Endl.) C. Schweinf., M. pendens Pabst, M. rigida campanulate, rewardless flowers; and pollinaria normally
Barb. Rodr., M. miniata (Lindl.) L.O. Williams] typically devoid of stipes. Most species have tightly aggregated
produce cespitose juvenile plants that produce elongate pseudobulbs, but in a few species (B. chrysantha, B. margin-
rhizome segments as adults (Christenson, 2002a). This juvenile ata) they are separated by a conspicuous rhizome covered by
character, often missing in herbarium specimens, usually scarious bracts. The pseudobulbs are not (or are only mildly)
requires observation of populations in the field and may be laterally flattened. The flowers are showy and long-lasting (10
more common within the clade. In contrast to the fruits of the d or more), fragrant, and devoid of secretions or multicellular
previous two clades, the fruits of Ornithidium have apical trichomes. The pollinarium lacks a tegular stipe in most species
dehiscence; perianth fibers are absent. and has a soft, hyaline, semilunar viscidium that readily
Maxillaria multicaulis (Poepp. & Endl.) C. Schweinf. and collapses after pollinarium removal (Singer and Koehler,
M. coccinea (Jacq.) L.O. Williams, the respective types of 2004). The flowers of most species combine cream or
Siagonanthus and Ornithidium, are sister species in the yellowish color with purplish dots or spotting, often more
combined analysis. The generic types of Neo-urbania [Max- intense on the external surface of the sepals. The flowers of the
illaria adendrobium (Rchb.f.) Dressler] and Laricorchis diminutive B. barbosae (Loefgr.) R. Singer, S. Koehler &
[Maxillaria aggregata (Kunth) Lindl.] are firmly nested within Carnevali and B. schunkiana (Campacci & Kautsky) R. Singer,
the Ornithidium clade. Christenson (2002a, b) included S. Koehler & Carnevali are exceptional within the genus in
Pleuranthium as a generic synonym of Maxillaria s.l. (with displaying a dark, shining labellum, similar to those of the
M. adendrobium cited as the type), but this genus is typified by Christensonella clade (Pabst and Dungs, 1975). Fruit dehis-
Epidendrum dendrobii Rchb.f., a true Epidendrum (Hágsater, cence is apical; perianth fibers are absent. Singer et al. (2007)
2005). include a more detailed characterization of the genus.
Clade D—(59/98% BS) Pityphyllum Schltr., Figs. 1, 9; 7 Clade F—(97/93% BS) Maxillaria bicallosa clade, Figs. 2,
spp. Lectotype (designated by Sweet, 1972: 205): Pityphyllum 9; 3 spp.; M. sect. Polyphyllae Christenson
antioquiense Schltr. This highly supported and easily recognized clade consists
All species of Pityphyllum occur in the Andes from of only two described species, M. bicallosa (Rchb.f.) Garay
Venezuela to Peru; these inconspicuous epiphytes with and M. chartacifolia Ames & C.Schweinf., both from Costa
diminutive flowers are rarely collected. Most Pityphyllum Rica to Peru, and possibly one undescribed species from
species produce small, bushy, pendent plants with needle-like Colombia [E. Christenson (Botanical Research Institute of
or very narrow conduplicate leaves often clustered at the apex Texas ) and G. Carnevali, personal communication]. Plants of
of the pseudobulb with a characteristic brown, scarious tunica this clade possess congested rhizomes bearing fan-shaped
(a leaf sheath fused to the pseudobulb and lacking a blade) shoots with five to many (10–20) leaves, devoid of
tightly covering the ovoid to fusiform pseudobulb (Sweet, pseudobulbs. The leaves are relatively long, narrow, thin, and
1972; Whitten et al., 2006). In most species, the leaf sheaths sessile. The flowers emerge from between the leaf bases and
(including the tunicae) each have a pair of ligules at the apex are pale yellow or spotted to uniformly dark maroon. The
(Whitten et al., 2006); in P. saragurensis (Dodson) Whitten, labellum is dark maroon, entire or obscurely three-lobed, and
these ligules form prominent recurved hooks. Flowers are bears a small linear callus. In M. chartacifolia, the callus is
surrounded by a pad of dense, felt-like, swollen multicellular Maxillaria strumata (Endres & Rchb.f) Ames & Correll
trichomes that are easily dislodged. These trichomes may (syn. Sepalosaccus humilis Schltr.) also has a spurlike structure
represent a floral reward similar to pseudopollen, but their formed by connate sepals, but the claw of the labellum is free
composition is unknown. The flowers usually have a fetid, from the column foot and lacks a labellar spur. Dressler (1961)
cheese-like and/or fecal odor, suggesting dung-fly pollination. concluded on the basis of morphology that this species is most
Fruits are elongate and narrow, with lateral dehiscence; closely related to M. neglecta (Schltr.) L.O. Williams (a
perianth fibers are absent. member of Camaridium, clade P); our molecular data confirm
Dressler’s hypothesis. Brieger (1977) advocated the union of
Clade G—(98/84% BS) Cryptocentrum Benth., Figs. 2, 9; the four genera with a sepaline spur (Anthosiphon, Cryptocen-
18þ spp.; including Anthosiphon Schltr., and Pittierella Schltr. trum, Sepalosaccus, and Pseuodomaxillaria Hoehne) into a
Type: Cryptocentrum jamesonii Benth. [¼ C. lehmannii ‘‘generic series Cryptocentra,’’ but our results do not support
(Rchb.f.) Garay] that classification.
Cryptocentrum has been consistently recognized at the
generic level because of its unique autapomorphies within Clade H—(65/100% BS) Cyrtidiorchis Rauschert, Figs. 2, 9;
Maxillariinae (Carnevali Fernandez-Concha, 1996). Plants are 5 spp.; Cyrtidium Schltr., non Vainio. Lectotype (designated by
either monopodial (with distichous or polystichous phyllotaxy, Ortiz, 1995: 70): Cyrtidiorchis rhomboglossa (F. Lehm. &
depending on the species) or sympodial. Leaves are condupli- Kraenzl.) Rauschert.
cate to subterete; inflorescences are elongate with long This small Andean genus ranges from Venezuela to Peru.
peduncles. The flowers are green to tan, star-shaped, Plants bear basal ovoid 1–2 foliate pseudobulbs and long leafy
nocturnally fragrant, with a spur formed by the backward canes. Garay (1969) reports that plants in the field appear to
projecting bases of the lateral sepals and column foot that have continuously growing (monopodial) stems, but these can
encloses a labellar spur, which is adaxially fused to the sepaline be traced back to rhizomes with pseudobulbs. The transition
spur. The fruits apically dehisce; perianth fibers are absent. from sympodial juvenile plants with pseudobulbs to adults with
Species of Cryptocentrum are distributed from Costa Rica to erect, monopodial shoots also occurs in a number of species in
Peru. the Camaridium and Ornithidium clades. The inflorescences
Garay (1962) created a separate subtribe for this genus are supra-axillary, emerging immediately below the insertion of
(Cryptocentrinae) because of its unusal morphology, but the next distal leaf, but opposite its axil. Supra-axillary
Dressler (1961) and Carnevali (2001) reviewed the morphol- inflorescences are rare in Orchidaceae but may also occur in
ogy of the genus and noted that most features are also found in Chrysocycnis (clade J); more detailed observations are needed.
various species of Maxillariinae. Within Maxillariinae, the Flowers are resupinate with flat, open perianth parts, a strongly
presence of a long nectariferous spur and nocturnally fragrant arched column without a foot, and a vaguely insectlike label-
flowers in Cryptocentrum are apomorphies probably associated lum that is obscurely three-lobed and covered with patches of
with moth pollination. Some of the smaller species (e.g., C. pilose trichomes. No observations of pollination have been
standleyi Ames) have features of twig epiphytism, an extreme published, but Dodson (1993) hypothesized that the flowers are
adaptation rare in Maxillariinae but more common in sexually deceptive. The fruits have lateral dehiscence; perianth
Oncidiinae (e.g., Stellilabium, Tolumnia; Chase et al., 2005). fibers are absent based on the few specimens examined.
The Cryptocentrum clade has long branches relative to other The genus was first established in 1924 by Schlechter as
Maxillariinae (Fig. 2), with accelerated rates of sequence Cyrtidium, an illegitimate homonym of the fungus genus
divergence. Long branches also occur in Oncidiinae twig Cyrtidium Vainio. Rauschert (1982) coined the new name
epiphytes, suggesting a correlation between adaptations to a Cyrtidiorchis to remedy the situation. Garay (1969) provided a
stressful, rapid life cycle, accelerated divergence rates, and synopsis of the genus (as Cyrtidium). We did not sample C.
reduction in chromosome number (Chase et al., 2005). rhomboglossa (the generic lectotype), but all the species of
Morphological cladistic analyses (Carnevali Fernandez-Con- Cyrtidiorchis have the same unusual vegetative modifications,
cha, 1996) indicate at least two origins of twig epiphytism from and we are confident that they constitute a monophyletic group.
branch epiphytes within the genus. Schlechter created the Cyrtidiorchis is strongly supported (100% BS) as sister to
genus Pittierella in 1906 based on P. calcarata Schltr., a Sauvetrea (clade I), although the vegetative and floral
species that clearly belongs in Cryptocentrum. Schlechter morphology is very different in both groups. The trigonous
himself transferred P. calcarata to Cryptocentrum in 1914, and ovary is a putative synapomorphy shared by these two clades.
our molecular data confirm this generic placement (Fig. 2).
Anthosiphon roseans from Panama and Colombia was Clade I—(100/100% BS) Sauvetrea Szlach., Figs. 2, 9; ca.
described by Schlechter in 1920, who correctly concluded that 10 spp.; Maxillaria sect. Trigonae Christenson. Type:
it was closely related to Cryptocentrum. It differs from most Sauvetrea alpestris (Lindl.) Szlach.
species of Cryptocentrum by the presence of pseudobulbs, a Most species in this predominately Andean clade possess
shorter spur, erect (not spreading) white to pinkish perianth elongate rhizomes with short, acutely triangular, two-ranked,
parts, a shorter peduncle, and diurnal fragrance production. We strongly keeled papery bracts exposing the green internodes.
are uncertain whether the spur produces nectar. Some authors The unifoliate, ancipitous pseudobulbs are subtended by
have challenged the close relationship of Anthosiphon and similar acute papery bracts; plants of some species (e.g., M.
Cryptocentum (Dodson, 1993), but our molecular and koehleri Schltr., M. laevilabris Lindl.) are cespitose. The
morphological data strongly support sister status of these two inflorescences are produced from the base of immature
genera, and we favor the lumping of Anthosiphon with pseudobulbs; the scapes are covered with usually overlapping,
Cryptocentrum to avoid the recognition of a monotypic genus two-ranked, strongly keeled bracts. Flowers are usually
based mostly on flower color. Hawkes (1953) transferred the yellowish-green to tan with sepals not spreading widely and
sole species to Cryptocentrum as C. roseans (Schltr.) Hawkes. petals subparallel to the column. The three-lobed labellum
bears a ligulate callus with a sulcate depression along its from white, pink, yellow, and orange to brownish-purple, and
length; no obvious reward is present. In most species, the ovary floral fragrance composition also varies substantially among
and fruit are strongly trigonous, but ovaries are terete in M. species (Flach et al., 2004). The labellum usually bears a linear
koehleri and M. laevilabris. Maxillaria chicana Dodson is pad of densely packed trichomes that produces an unidentified
distinctive for its diminutive, cespitose plants with terete viscous secretion.
leaves, but the inflorescence is clothed with keeled bracts and Plants of Chrysocycnis (two or three Andean species; Sweet,
the fruit is apparently trigonous (Dodson, 1994). Fruit 1971) have elongate, erect rhizome segments between the
dehiscence in this clade is apical; perianth fibers are absent. pseudobulbs, and their leaves tend to be widely elliptic with
As circumscribed by Szlachetko and Śmiszek (2007), prominent cross veins. The flowers have a strongly arcuate
Sauvetrea is polyphyletic. These authors included Maxillaria column (similar to that of Cyrtidiorchis), lack a well-
acuminata Lindl. in Sauvetrea, but this species is morpholog- developed column foot, and the insect-like labellum is
ically different and appears firmly nested in a separate clade markedly three-lobed (Sweet, 1971). The pollinators and
(M) in our analyses. Among the species that we did not sample fragrance composition of Chrysocycnis are unknown, but the
but that Szlachetko and Śmiszek included in Sauvetrea, we flowers are thought to be sexually deceptive because of their
believe (based on their general morphology) that Maxillaria similarity to those of Cyrtidiorchis and Mormolyca (Dodson,
grandimentum C. Schweinf. actually belongs in Maxillaria s.s. 1993). Atwood and Mora de Retana (1999) suggested that
(clade Q) and M. planicola C. Schweinf. (¼ Camaridium Maxillaria tigrina C.Schweinf. is a member of Chrysocycnis,
latifolium Schltr.) in Camaridium (clade P). but according to our data this species is well nested in
Camaridium (see clade P).
Clade J—(65/100% BS) Mormolyca Fenzl, Figs. 2, 10; 30þ A putative synapomorphy for this clade is the inflorescence
spp.; including Chrysocycnis Linden & Rchb.f., Cyrtoglottis production from the rhizome. In most Maxillariinae with
Schltr., Maxillaria sect. Rufescens Christenson. Type: Mormo- sympodial growth, inflorescences are produced from the most
lyca lineolata Fenzl [¼ M. ringens (Lindl.) Gentil]. current growth, either simultaneously with the emergence of a
This clade includes a paraphyletic grade of Mormolyca new shoot or from the sheathing bracts at the base of a recently
species (with sexually deceptive flowers) sister to a clade matured pseudobulb. In species of Chrysocycnis and the
composed of members of the Maxillaria rufescens Lindl. Maxillaria rufescens alliance, inflorescences are produced from
alliance (M. section Rufescens, with a diversity of floral the rhizome between the second-, third-, and fourth-oldest
fragrances, but probably not sexually deceptive), with pseudobulbs rather than from the terminal growth. In
Chrysocycnis (putatively sexually deceptive) nested within. Mormolyca, inflorescences are produced from the rhizome
Atwood and Mora de Retana (1999) had already suggested a
between the terminal mature pseudobulb and the emerging
close relationship between Mormolyca and the Maxillaria
vegetative shoot. These inflorescences are produced from the
rufescens alliance based on vegetative morphology. Holtzmeier
axils of rhizome bracts and therefore are not supra-axillary. In
et al. (1998) also detected a close relationship between
Mormolyca ringens and species of the Maxillaria rufescens the few species of this clade we observed, fruit dehiscence is
alliance, based on an analysis of anatomical characters with a apical. Perianth fiber bundles are absent.
rather limited taxon sampling. Species in this clade range from
southern Mexico and the Caribbean islands to Bolivia. Clade K—(100/100% BS) Maxillaria desvauxiana clade,
The six or seven species of Mormolyca vary in plant size, Figs. 3, 10; 4 spp.
pseudobulb shape, and number of leaves per pseudobulb, but This clade consists of four currently described, morpholog-
all bear flat, open flowers that lack a column foot (Garay and ically similar species: M. desvauxiana Rchb.f., M. auyante-
Wirth, 1959). The vaguely insect-like labellum bears a puiensis Foldats, M. foldatsiana Carnevali & I. Ramı́rez, and
complex pattern of pilosity, reminiscent of labella in the M. longipetiolata Ames & C. Schweinf. (Carnevali and
Mediterranean orchid genus Ophrys L., which also has Ramı́rez, 1989). The superficially similar Maxillaria neophylla
pseudocopulatory pollination. Under cultivation in Brazil Rchb.f., previously hypothesized to belong in this group
(outside its native range), the flowers of Mormolyca ringens (Carnevali and Ramı́rez, 1989), is firmly nested in Maxillaria
are pollinated by sexually excited drones of Nannotrigona s.s. (clade Q, Fig. 6). The four species occur in the Guyana-
testaceicornis and Scaptotrigona sp. (Apidae: Meliponini) that northern Amazonas region, where two of them are endemic.
attempt to copulate with the labellum (Singer et al., 2004). The Two species extend to the eastern slopes of the Andes and one
floral fragrance composition is complex, with large amounts of (M. longipetiolata) into southern Central America. Two species
n-hexyl hexanoate and n-nonanal (Flach et al., 2004), and are usually terrestrial on white sands (M. auyantepuiensis and
remarkably matches the pheromones of virgin queens of M. foldatsiana). The plants have congested, ovoid, mildly
Scaptotrigona (Flach et al., 2006). The genus Cyrtoglottis laterally compressed pseudobulbs subtended by several charta-
Schltr., based on C. gracilipes Schltr., was merged with ceous, fibrous, nonfoliaceous bracts. The single apical leaf has
Mormolyca by Garay and Wirth (1959) due to their overall a distinct, usually long petiole and an oblong, apically acute
similarity. Their close relationship is confirmed by our results. blade. The peduncles are very short, and the flowers are
Species of the Maxillaria rufescens alliance are vegetatively clustered tightly among the pseudobulbs, often barely exceed-
similar to Mormolyca ringens, with cespitose, unifoliate ing their height (a potential synapomorphy for the clade). The
pseudobulbs subtended by papery bracts and sessile, acute fleshy flowers are dull maroon with broadly triangular perianth
leaves (Carnevali Fernandez-Concha et al., 2001), but the parts. The labellum is three-lobed with rounded lateral lobes.
inflorescences are much shorter. The flowers are morpholog- The flowers lack any obvious reward, and the labellum callus is
ically similar among species, with a three-lobed labellum with shiny and warty or verrucose, suggesting possible nectar, oil, or
acute lateral lobes, an arcuate column with a broad apex, and resin deceit. The mode of fruit dehiscence is unknown; perianth
similar pollinaria. Flower color varies among species, ranging fibers are present.
Clade L—(98/100% BS) Christensonella Szlach., Mytnik, clade (clade J), although it is unclear whether this represents a
Górniak & Śmiszek, Figs. 3, 10; 11þ spp.; Maxillaria sect. synapomorphy because these clades are not sister in the
Urceolatae Christenson. Type: Christensonella nardoides shortest trees (but without strong BS). Flowers are often
(Kraenzl.) Szlach., Mytnik, Górniak & Śmiszek. greenish, not opening widely, with rigid, fibrous, acuminate to
This group of species, traditionally known as the Maxillaria aristate sepals and petals. The column apex is usually
madida Lindl. alliance, was recently elevated to generic rank as conspicuously ciliate. The pollinarium is narrowly linear and
Christensonella by Szlachetko et al. (2006), although a few oblong, with a prominent stipe whose margins curl inward
species still require to be formally transferred (in Fig. 3, we use upon removal from the column. The labellum is simple or
the names in Maxillaria for all of them). This group comprises obscurely three-lobed with a linear callus bearing a resinous/
about 11 species with a dwarf (1–30 cm tall) sympodial growth lipoidal secretion or waxy white crystals. Fruits have lateral
habit. These plants generally grow as epiphytes in moist and dehiscence; perianth fibers are present. Species in this clade
seasonally dry forests of the Amazonian region and on rocky occur from Mexico to Bolivia.
outcrops in southeastern Brazil, where most species are Davies et al. (2003a) studied the histochemistry of labellar
endemic. Christensonella uncata (Lindl.) Szlach., Mytnick, secretions and the ultrastructure of secretory tissues of
Górniak & Śmiszek is widely distributed from southern Maxillaria acuminata Lindl., M. cerifera Barb.Rodr., and M.
Mexico to Bolivia and has substantial vegetative variation. notylioglossa Rchb.f. They reported that the secretions were
Plants in this group are characterized by their roots with ‘‘lipoidal’’ and included aromatic amino acids and starch. Flach
alternating thickenings and constrictions of their velamen, in an et al. (2004) used GC–MS and NMR analyses to identify the
accordion-like fashion. The rhizome is rigid, very short to major secretions of M. cerifera and M. scorpioidea Kraenzl. (as
rarely elongate (e.g., C. uncata), and is usually covered in M. friedrichsthalii Rchb.f.) as triterpenoid resins. These resins
scarious, imbricate bracts. The pseudobulbs are usually are likely collected by female bees for nest construction, as is
aggregate, erect, subtended by several papery sheaths at the the case for floral resins produced by other plant genera
base, and bear 1–2, rarely 3–4, leaves at the apex. The number, (Armbruster, 1984).
shape, and size of leaves constitute the most important Embedded in this clade is the vegetatively anomalous
diagnostic character to distinguish the species, except for M. Maxillaria witsenioides Schltr., which has long (to 0.8 m),
neowiedii Rchb.f. and C. subulata (Lindl.) Szlach., Mytnick, pendent, monopodial stems and glaucous, ensiform, equitant
Górniak & Śmiszek, which have extremely polymorphic leaves. The yellow-green flowers emerge on short penduncles
leaves. Other important characters traditionally used to delimit from the leaf axils. The labellum bears a linear callus with a
species include plant size, flower fragrance, length of the resinous secretion. Because of its pendent habit and equitant,
ovary-pedicel relative to the adjacent pseudobulb, and shape of glaucous leaves, it was hypothesized (Carnevali, 1991;
the petals. The leaves are always sessile, erect to twisted, flat or Christenson, 2002a, b) to be a close relative of M. valenzuelana
conduplicate, and coriaceous to fleshy or rarely thin. In most [¼ Heterotaxis valenzuelana (A. Rich.) I. Ojeda & Carnevali],
species, the midlobe bears a conspicuous shiny purple to dark and it was included in Marsupiaria or in Maxillaria sect.
red spot covered by numerous trichomes and papillae, with no Iridifoliae. The molecular data refute this placement and
obvious reward. The callus is always glabrous and extends indicate that the similarities between M. witsenioides and H.
from the labellum base up to its median region, along the valenzuelana represent vegetative convergences. Maxillaria
midvein, as a low, thick ridge. The pollinarium bears two pairs witsenioides is certainly a species with a very modified growth
of laterally flattened, superposed, ovate to round pollinia, a habit within the M. acuminata clade.
small tegular stipe, and an arcuate viscidium. The stipe is
unusually long in M. pacholskii Christenson and C. uncata. Clade N—(77/100% BS) Maxillaria variabilis clade, Figs.
Fruit dehiscence in this group is apical; the fruits of C. 4, 10; ca. 50 spp., including M. sect. Ebulbes Pfitz., and M.
nardoides extrude endocarpic trichomes along with the seeds, a sect. Erectae Pfitz. sensu Christenson (2002a).
unique mode of seed presentation among orchids (Blanco et al., Most members of this clade have conspicuous rhizomes with
2006). Perianth fibers appear to be present in at least the larger moderately spaced, ovoid, unifoliate, bilaterally compressed
species. Currently accepted species concepts within this clade pseudobulbs. These are subtended by scarious bracts, and in
are unsatisfactory, as evidenced by the nonmonophyly of many some species foliaceous bracts with persistent sheaths clothe
species in the cladogram (Fig. 3). A taxonomic revision and the stem. Roots are smooth and white to brown. Leaves are
more detailed phylogenetic analyses of this clade based on light green, tough, and flexible, varying in width from 2–3 mm
combined molecular data sets and morphology will be (M. sanguinea Rolfe) to several cm [M. elatior (Rchb.f)
published separately (S. Koehler, unpublished manuscript). Rchb.f.]. Flowers are produced from the basal bracts of
emerging or recently matured growths; only one flower is
Clade M—(77/100% BS) Maxillaria acuminata clade, Figs. produced from each leaf axil (no sequential bud development).
4, 10; 12þ spp. Flowers are campanulate with broadly triangular sepals; the
Plants of this clade are cespitose to straggly epiphytes with labellum is unlobed or obscurely three-lobed and bears a
oblong, 2–4 foliate, shiny pseudobulbs that are laterally smooth, ligulate, glossy callus. The clinandrium and anther cap
flattened with several conspicuous vertical ribs. The rhizomes are smooth to minutely papillose. In some species, the glossy
are covered by overlapping, scarious brown bracts that callus produces no obvious secretion but the flowers produce
transition into articulated foliaceous bracts subtending the variously fruity fragrances (e.g., M. sanguinea, M. tenuifolia
pseudobulbs. Inflorescences are produced simultaneously with Lindl., M. variabilis Bateman ex Lindl.). Maxillaria elatior
the emergence of new growths, but in most species they arise produces an abundant resin-like secretion on the callus,
from bract axils between the second- and third-oldest labellum base, and base of column, and the flowers have a
pseudobulbs rather than at the base of the most recently terpenoid fragrance. Species in this clade are widely distributed
matured pseudobulb. This trait is shared with the Mormolyca throughout the neotropics. Fruits of species in this clade have
lateral dehiscence; perianth fibers are absent in most species Clade P—(100/100% BS) Camaridium Lindl., Figs. 5, 10;
but weakly present in larger-flowered species (e.g., M. 80þ spp.; including Adamanthus Szlach., Pseudomaxillaria
variabilis). Hoehne, Psittacoglossum La Llave & Lex., Sepalosaccus
There are two highly supported subclades in this group (Fig. Schltr., Maxillaria sect. Camaridium (Lindl.) Christenson, M.
4): the M. diuturna/M. arbuscula subclade and the M. sect. Cucullatae Christenson, and M. sect. Pseudomaxillaria
variabilis/M. elatior subclade. However, there are no clearly (Hoehne) Christenson. Type: Camaridium ochroleucum Lindl.
defined morphological differences between them. Lindley’s (1824) original concept of Camaridium, based
Species of the Maxillaria linearifolia/M. cassapensis Rchb.f. upon Camaridium ochroleucum Lindl. (¼ Maxillaria camaridii
group (M. section Ebulbes Pfitz., the ‘‘M. graminifolia Rchb.f.), emphasized floral characters that distinguished it from
suballiance’’ reviewed by Atwood, 2003) have long, erect or Ornithidium. He stated (plate 844) that Camaridium is
pendent, sparsely branched, monopodial stems; their placement ‘‘principally distinguished from Ornithidium by not having
in a clade of predominately sympodial, pseudobulbous plants the base of the labellum united with the base of the columna,
has not been hypothesized before. However, they also share the nor a connivent perianthium, nor a fleshy discus to the
single, nonsequential inflorescence per leaf axil, and some labellum, and especially characterized by its small labellum
closely related species (e.g., M. arbuscula) appear to have and expanded perianthium.’’ The clade recognized here as
monopodial mature shoots. A relationship of this ‘‘suballiance’’ Camaridium is more florally diverse than Lindley’s original
with M. dendrobioides (Schltr.) L.O. Williams and relatives (in concept, and many species [e.g., M. neglecta (Schltr.) L.O.
Camaridium, clade P) had been hypothesized by Atwood Williams, M. parviflora (Poepp. & Endl.) Garay, M. schlech-
(2003) on the basis of their superficial vegetative similarity. teriana J.T. Atwood] have been repeatedly transferred between
Szlachetko and Śmiszek (2007) also held a similar view when Camaridium and Ornithidium, possibly reflecting homoplas-
they created the genus Adamanthus Szlach., comprising mostly ious floral traits associated with pollination by nectar-foraging
species of Maxillaria section Ebulbes. However, these authors bees or hummingbirds (e.g., saccate and rigid labellums,
designated Camaridium dendrobioides Schltr. as the type and abundant nectar, and yellow/orange colors).
ignored the synonymy already worked out by Atwood (2003) Plants may be cespitose or scraggly epiphytes with widely
for their generic transfers (further discussed under Camari- spaced, unifoliate pseudobulbs or may form erect, monopodial,
dium, see the following section on clade P). leafy canes. In some species (e.g., M. scalariformis J.T.
Atwood, M. inaudita Rchb.f.), juvenile plants are sympodial
Clade O—(59/90% BS) Trigonidium Figs. 4, 10; 7 spp., and bear cespitose pseudobulbs, but the adult plants produce
type: Trigonidium obtusum Lindl. long, monopodial, leafy shoots. Inflorescences are usually
This florally distinctive genus ranges from Mexico to produced from leafy new growths rather than from the base of
Bolivia. Some authors estimate up to 13 species in the genus, mature pseudobulbs or mature canes. The floral bract is
but a recent study indicates that there are only seven (M. generally longer than the ovary. Floral morphology (especially
Blanco, unpublished manuscript). The monophyly of Trigoni- labellum and callus shape) is variable, but many species lack a
dium is only moderately supported by molecular data, although prominent column foot. The labellum is often much shorter
several clades within the genus (which correspond to different than the sepals and petals; the perianth segments lack fibers and
vegetative habits) receive high BS. Species vary in the often have a minutely papillose epidermis that appears
pseudobulb shape, the number of apical leaves, and the length sparkling in direct sunlight. In some putatively hummingbird-
of the rhizomes, but the floral structure is very uniform pollinated species [e.g., M. lutheri J.T. Atwood, M. sigmoidea
throughout the genus. Pseudobulbs are cespitose to widely (C. Schweinf.) Ames & Correll], the labellum base is saccate
spaced on frequently branching rhizomes; ovoid, pyriform, or and rigidly attached to the reduced column foot. Many species
oblong; laterally compressed; slightly ridged; one-, two-, or up secrete abundant nectar at the labellum base, whereas others are
to five-foliate; subtended by several imbricate bracts. Leaves apparently rewardless; no resin or pseudopollen production has
are thin to coriaceous, sublinear to oblanceolate, subsessile or been observed in this clade. Maxillaria imbricata Barb. Rodr.
basally attenuate, and acute. Inflorescences originate from the produces abundant nectar on the abaxial surfaces of the
base of developing or mature pseudobulbs (depending on the labellum, sepals, and petals and produces a foul, aminoid odor.
species). Flowers are erect, funnel-shaped, and trigonous, with Pollinarium morphology varies within this clade, possibly
the floral cavity facing upward. Sepals are similar to each reflecting radiations to different classes of pollinators and sites
other, often basally clawed, yellow to tan or cream with purple of pollinarium attachment. As noted by Carnevali (1991), many
or reddish veins, reflexed at midpoint, basally forming a cup putatively hummingbird-pollinated species (e.g., M. scalar-
that encloses the petals, labellum, and column, with sepal iformis, M. sigmoidea) produce relatively tiny pollinaria with
apices spread flat or reflexed. The petals are much smaller than cream or white pollinia and a broad, hyaline viscidium; these
the sepals, lanceolate, asymmetric, with characteristic shiny smaller pollinia are likely an adaptation to avoid removal by
thickened pads (often bluish) at the tips. The labellum is much grooming of the bird’s beak (Dressler, 1971). Fruit dehiscence
shorter than the sepals. The column is erect, straight, wingless, appears to be always apical; perianth fibers are absent.
and lacking a prominent column foot. The stipe is absent or Traditionally, plants with pseudobulbs separated on long
transversely semilunate, with a semilunate viscidium. Fruit rhizomes were considered a trademark of the genus Camari-
dehiscence is lateral; perianth fibers are absent. dium. Therefore, many species in other clades (especially
Pseudocopulatory pollination has been documented in T. Ornithidium, Maxillaria s.s., and the M. variabilis clades) with
obtusum. The flowers are pollinated through sexual mimicry by this habit were at some point treated as part of Camaridium.
males of Plebeia droryana (Apidae: Meliponini), which This vegetative habit clearly evolved repeatedly within core
attempt copulation with the petals or lateral sepals and slip Maxillariinae and has little systematic value at the generic
into the floral cavity (Singer, 2002). level. Camaridium is best distinguished by the combination of
apical fruit dehiscence, absence of fibers in floral segments, synapomorphy for this subclade. The type of the genus
and a floral bract that often exceeds the ovary. Psittacoglossum La Llave & Lexarza is part of this subclade.
The recently described genus Adamanthus Szlach. (Szla- As traditionally recognized, the M. cucullata alliance is not
chetko and Śmiszek, 2007) is grossly polyphyletic. It is monophyletic (M. meleagris Lindl. and M. obscura Lind. &
typified by Camaridium dendrobioides Schltr. (a true Camari- Rchb.f. appear firmly nested among other members of
dium), but most of the other species are members of Maxillaria Camaridium), and we prefer to consider Psittacoglossum as
section Ebulbes Pfitz. (discussed in section Clade N). part of Camaridium.
Adamanthus nitidulus (Rchb.f.) Szlach., not sampled by us,
most likely belongs in the Camaridium clade; A. pittieri Clade Q—(58/100% BS) Maxillaria s.s., Figs. 6, 7; 250þ
(Ames) Szlach. [Maxillaria pittieri (Ames) L.O. Williams] is spp.; including M. subgen. Aggregatae (Pfitz.) Brieger, M. sect.
clearly an Ornithidium (see section Clade C), and A. exaltatus Amazonicae Christenson, M. sect. Aggregatae Pfitz., M. sect.
(Kraenzl.) Szlach. [¼ Maxillaria exaltata (Kraenzl.) C. Arachnites Christenson, M. sect. Axilliflorae Lindl., M. sect.
Schweinf.] is firmly nested in Maxillaria s.s. (see section Maxillaria Ruiz & Pav. (sensu Christenson, 2002a, b), M. sect.
Clade Q). Szlachetko and Śmiszek (2007) used the feminine Multiflorae Christenson, Dendrobium sect. Maxillaria (Ruiz &
gender for most of their new combinations even when they Pav.) Pers., and Menadena Raf.; lectotype (designated by
must be masculine; we use the correct gender here (McNeill et Brieger and Hunt, 1979: 602; Garay, 1997a): Maxillaria
al., 2006: articles 62.1 and 62.2.c). platypetala Ruiz & Pav.
The genus Pseudomaxillaria Hoehne was originally erected This large clade includes many species with large, showy
to accommodate Maxillaria parviflora (Poepp. & Endl.) Garay, flowers, but also others with small plants and flowers (e.g., M.
and later Brieger (1977) added most of its close relatives. This acostae Schltr.). Because of the large number of species in this
small species alliance is most diverse in Central America and clade and their morphological diversity, unambiguous diag-
was reviewed by Atwood (1993). It is also nested within nostic synapomorphies are difficult to identify. Plants of most
Camaridium. species are cespitose with ovoid, unifoliate pseudobulbs and
Maxillaria strumata (Endres & Rchb.f) Ames & Correll is often one to several pairs of large foliaceous bracts that may
unusual within Camaridium because of its small, cespitose equal the terminal leaf in size, although M. grobyoides Garay &
plants and partially connate lateral sepals enclosing a Dunst. and M. steyermarkii Foldats (not sampled, but
subsaccate labellum (Brieger, 1977). The pollinarium has a tentatively included here) are bifoliate. The inflorescences
discoid viscidium and a prominent stipe. This species was usually emerge at the base of recently matured pseudobulbs,
segregated as Sepalosaccus humilis Schltr. [¼ S. strumatum and the floral bract is often shorter than the ovary (contrasting
(Endres & Rchb.f.) Garay], but the molecular data show it is with the longer floral bract of Camaridium). The flowers
deeply embedded within Camaridium. Maxillaria strumata and usually have a prominent column foot, and many species have
M. brevilabia Ames & Correll are sister to the Pseudomaxil- a fringed or ciliate clinandrium margin. The flowers possess
laria alliance, and all of them have subsaccate labella enclosed very tough perianth fibers. The anther cap is frequently crested
by the inflated bases of the lateral sepals. It is notable that M. or ornamented with trichomes. The labellum is usually three-
strumata and M. pseudoneglecta (also in the Pseudomaxillaria lobed, with the lateral lobes rounded and much smaller than the
alliance) hybridize in nature (see Materials and Methods, Data midlobe. The labellum often bears trichomes (sparse to dense,
analysis). depending on species), and the callus is usually linear or
Atwood and Mora de Retana (1999) suggested that M. rectangular, sometimes broadly triangular. The pollinaria
vittariifolia L.O. Williams might deserve generic status usually have a hard, brownish, horseshoe-shaped viscidium,
because of its diminutive, cespitose plants and filiform lack a well-developed tegula (stipe), and have spheroidal to
peduncles and that M. tigrina C. Schweinf. might belong in clavate pollinia. No species in this clade are known to produce
Chrysocycnis because of its superficial similarity to members a nectar or resin reward; they appear to be deceit pollinated or
of that genus (part of Mormolyca, see section Clade J). produce pseudopollen. In the M. platypetala alliance (M.
However, our data show both of these species nested within longissima Lindl. to M. striata Rolfe, Fig. 7), flowers are
Camaridium. usually large and showy, and the labellum always bears a dense
Sister to the rest of Camaridium is a clade composed of indument of loose, deciduous moniliform trichomes (pseu-
members of the Maxillaria cucullata Lindl. alliance (M. sect. dopollen). In all known cases, the fruits have lateral
Cucullatae). This taxonomically difficult group of about 10 dehiscence.
species is almost restricted to Mexico and Central America. Another character found in many species of this clade,
The plants have cespitose pseudobulbs with nonfoliaceous especially in the M. platypetala alliance, is a narrow projection
subtending bracts. Inflorescences bear relatively large, inflated, from the pseudobulb apex that elevates the leaf abscission
green sheathing bracts, and the floral bract is cucullate and layer. When the leaf abscises, this projection persists on the
usually exceeds the length of the ovary. The flowers are yellow pseudobulb and can vary in length from a few millimeters to
to purple, sometimes with lines of purple spots. The usually several centimeters, depending on the species. A similar
dark maroon labellum is three-lobed with rounded lateral lobes structure occurs in other orchids such as Coelia (Laeliinae),
and an ovate midlobe, with an oblong or trapezoid callus Koellensteina Rchb.f., and Otostylis Schltr. (Zygopetalinae).
thickened distally; its surface is usually verrucose, although We adopt the term ‘‘phyllopodium’’ for this structure, in
Davies and Turner (2004) reported an absence of papillae on analogy to the phyllopodium of many species in the fern genera
the labellar surface in this group. The perianth parts are Elaphoglossum and Oleandra (Lellinger, 2002). In species
generally fleshier and thicker than in other species of the with reduced pseudobulbs concealed by the foliaceous
Camaridium clade. There is a thickened, transverse ridge at the sheathing bracts (e.g., M. angustissima Ames, F. T. Hubb., &
base of the column, just above the attachment of the labellum; C.Schweinf., M. breviscapa Poepp. & Endl., M. silvana
its function is unknown, but this ridge is a putative Campacci), a prominent phyllopodium is still present on the
apex of the pseudobulbs. The orchid phyllopodium probably and nomenclatural transfers will be made in separate
represents the leaf sheath, which is extremely reduced in the publications.
pseudobulb apical leaves of most other orchids. A substantial number of unsampled species are known only
Maxillaria exaltata (Kraenzl.) C. Schweinf. and M. from one or few herbarium specimens or from incomplete
meridensis Lindl. have erect canes with the pseudobulbs descriptions with destroyed types; assignment of these species
reduced to swollen nodes or absent. Perhaps the most to particular clades will be problematic on the basis of
vegetatively atypical species in this clade is M. lueri Dodson morphology alone. Increased sampling for molecular studies
with pendent growths, greatly reduced pseudobulbs concealed (especially for species from Bolivia, Peru, Colombia, and
in the leaf sheaths, and long (up to 1 m), linear leaves. Venezuela) will be needed to clarify relationships within most
Most internal clades within Maxillaria s.s. lack strong BS of the clades. Clearly, the repeated loss of pseudobulbs, the
support because of short branch lengths, but it is clear that most evolution of monopodial stems, convergence in growth habit,
of the sections defined by Christenson (2002a, b) are and the simple floral plan has created taxonomic confusion
polyphyletic. An exception is M. section Multiflorae Chris- within core Maxillariinae. The danger of erecting genera based
tenson, which is morphologically distinctive (ancipitous, upon a few, homoplasious morphological characters and/or
ridged pseudobulbs; leaves and foliaceous bracts abruptly incomplete molecular sampling is demonstrated by the recently
narrowed above the abcission layer; and long, straight sepals described Adamanthus, Laricorchis, and Sauvetrea (Szlachetko
and petals). Long, narrow, pendulous sepals and petals, a and Śmiszek, 2007). More subtle morphological or anatomical
defining feature of M. section Arachnites Christenson, characters (e.g., presence/absence of fibers in sepals, fruit
apparently have been gained and lost several times in dehiscence) may prove phylogenetically informative, but more
Maxillaria and might represent an evolutionarily labile feature detailed morphological analyses are needed. Although these
related to attraction of certain pollinators. molecular data have greatly clarified relationships within the
subtribe, we must echo Lindley’s (1843, p. 16) comment:
Taxonomic implications—The combined three- and four- ‘‘With regard to the species that belong to true Maxillaria, now
region analyses demonstrate that Maxillaria as presently that it has been weeded of these species, I must take another
defined in the World Checklist of Orchidaceae (Govaerts et opportunity of examining them.’’
al., 2005) is polyphyletic and that all minor genera of core
Maxillariinae are embedded within Maxillaria s.l. Although the LITERATURE CITED
spine of the tree is incompletely resolved with strong BS ARMBRUSTER, W. S. 1984. The role of resin in angiosperm pollination:
support, the bootstrap consensus (Fig. 8) does provide strong ecological and chemical considerations. American Journal of Botany
support for many clades that traditionally have been recognized 71: 1149–1160.
as genera (e.g., Cryptocentrum, Cyrtidiorchis, Pityphyllum, ATWOOD, J. T. 1993. A revision of the Maxillaria neglecta complex
Trigonidium), that correspond to recent generic segregates (Orchidaceae) in Mesoamerica. Lindleyana 8: 25–31.
(e.g., Brasiliorchis, Christensonella, Sauvetrea), or that have ATWOOD, J. T. 2003. Review of the Maxillaria graminifolia (Kunth)
Rchb.f. (Orchidaceae) suballiance. Selbyana 24: 144–164, errata 223.
been recognized at generic level by previous workers (e.g., ATWOOD, J. T., AND D. E. MORA DE RETANA. 1999. Flora Costaricensis
Ornithidium, Camaridium). The cladograms also include family #39 Orchidaceae: tribe Maxillarieae: subtribes Maxillariinae
several strongly supported clades that represent novel assem- and Oncidiinae. Fieldiana, Botany new series 40: 1–182.
blages of species whose relationships have not been previously BARROS, F. 2002. Notas taxonômicas para espécies brasileiras dos gêneros
hypothesized. Epidendrum e Heterotaxis (Orchidaceae). Hoehnea 29: 109–113.
The polyphyly of Maxillaria s.l. (¼ core Maxillariinae) BLANCO, M. A., M. W. WHITTEN, N. H. WILLIAMS, AND S. KOEHLER. 2006.
presents two alternatives: (1) lump all species into one Capillitial extrusion from fruits of Maxillaria nardoides (Orchid-
extremely large and variable genus with a subgeneric aceae: Maxillariinae). Orchids 75: 685–691.
BLUMENSCHEIN, A. 1960. Número de cromossomas de algumas espécies de
classification that reflects phylogenetic relationships; or (2) orquideas. Publicação Cientifica do Instituto de Genética, Piracica-
divide Maxillaria s.l. into well-supported clades and create ba, São Paulo 1: 45–50.
several new genera, together with redefined generic concepts of BLUMENSCHEIN, A., AND I. U. PAKER. 1963. Número de cromossomas nas
some existing minor genera. Both approaches would necessi- Maxillariinae (Orchidaceae). Ciência e Cultura; Orgao da Sociedade
tate numerous nomenclatural transfers, but the existing generic Brasileira para o Progresso da Ciência 15: 255.
classification is clearly misleading. As currently circumscribed, BRAGA, P. 1977. Aspectos biologicos das Orchidaceae da Amazônia
Maxillaria is not defined by a uniform set of character states; it Central. Acta Amazonica 7: 1–89.
is a true ‘‘catch-all’’ taxon. BRIEGER, F. G. 1977. On the Maxillariinae (Orchidaceae) with sepaline
spur. Botanische Jahrbücher für Systematik, Pflanzengeschichte und
We favor the division of Maxillaria s.l. into smaller genera Pflanzengeographie 97: 548–574.
(clades A–Q) that are more easily defined by morphological as BRIEGER, F. G., AND P. F. HUNT. 1969. Hormidium, Maxillaria, and
well as molecular synapomorphies. A single mega-genus might Scaphyglottis. Taxon 18: 601–603.
require fewer nomenclatural transfers (although many would BRIEGER, F. G., AND R. D. ILLG. 1972. O grupo Heterotaxis do gênero
still be necessary), but it would be morphologically undiag- Maxillaria Ruiz & Pavón (Orchidaceae). Anais da Sociedade
nosable. We feel that recognition of the previously discussed Botânica do Brasil, 238 Congresso Nacional de Botânica, 93–99.
clades as genera will produce a more predictive classification Universidade Federal de Pernambuco, Recife, Brazil.
and will be more useful for field identification and floristic CARNEVALI, G. 1991. The cytology and the pollinaria in the Maxillariinae
(Orchidaceae). Master’s thesis, University of Missouri, St. Louis,
treatments. They will also facilitate more restricted analyses Missouri, USA.
using more advanced phylogenetic methods and incorporating CARNEVALI, G. 2001. A synoptical view of the classification of
morphological characters. The majority of species will remain Cryptocentrum (Orchidaceae), new taxa, and a key to the genus.
in Maxillaria s.s. (clade Q), thus keeping the necessary Harvard Papers in Botany 5: 467–486.
nomenclatural transfers to a minimum. Generic descriptions CARNEVALI, G., AND I. RAMÍREZ. 1989. New or noteworthy orchids for the
Venezuelan flora. VII. Additions in Maxillaria from the Venezuelan Brazilian Maxillariinae orchids: floral rewards and fragrance. Journal
Guayana. Annals of the Missouri Botanical Garden 76: 374–380. of Chemical Ecology 30: 1045–1056.
CARNEVALI FERNANDEZ-CONCHA, G. 1996. Systematics, phylogeny and twig FLACH, A., A. J. MARSAIOLI, R. B. SINGER, M. D. E. AMARAL, C. MENEZES,
epiphytism in Cryptocentrum (Orchidaceae). Ph.D. dissertation, W. E. KERR, L. G. BATISTA-PEREIRA, AND A. G. CORREA. 2006.
University of Missouri, St. Louis, Missouri, USA. Pollination by sexual mimicry in Mormolyca ringens: a floral
CARNEVALI FERNANDEZ-CONCHA, G., J. L. T. MUÑOZ, AND M. GOMEZ-JUAREZ. chemistry that remarkably matches the pheromones of virgin queens
2001. A synopsis of the Maxillaria rufescens complex in Mexico, of Scaptotrigona sp. Journal of Chemical Ecology 32: 59–70.
Central America, and the Greater Antilles. Brittonia 53: 454–465. FREUDENSTEIN, J. V., C. VAN DEN BERG, D. H. GOLDMAN, P. J. KORES, M.
CHASE, M. W., J. V. FREUDENSTEIN, AND K. M. CAMERON. 2003. DNA data MOLVRAY, AND M. W. CHASE. 2004. An expanded plastid DNA
and Orchidaceae systematics: a new phylogenetic classification. In K. phylogeny of Orchidaceae and analysis of jackknife branch support
W. Dixon, S. P. Kell, R. L. Barrett, and P. J. Cribb [eds.], Orchid strategy. American Journal of Botany 91: 149–157.
conservation, 69–89. Natural History Publications, Kota Kinabalu, FRODIN, D. G. 2004. History and concepts of big plant genera. Taxon 53:
Sabah, Malaysia. 753–776.
CHASE, M. W., L. HANSON, V. A. ALBERT, W. M. WHITTEN, AND N. H. GARAY, L. A. 1962. Studies in American orchids. V. Caldasia 8: 517–521.
WILLIAMS. 2005. Life history evolution and genome size in subtribe GARAY, L. A. 1969. Sinopsis del género Cyrtidium Schltr. Orquideologı́a
Oncidiinae (Orchidaceae). Annals of Botany 95: 191–199. 4: 3–13.
CHRISTENSON, E. A. 2002a. Maxillaria, an overview. In J. Clark, W. Elliott, GARAY, L. A. 1997a. De nominibus orchidacearum incunabulorum.
G. Tingley, and J. Biro [eds.], Proceedings of the 16th World Orchid Harvard Papers in Botany 2: 47–54.
Conference, 1999, Vancouver, British Columbia, Canada, 279–290. GARAY, L. A. 1997b. The identity of the type drawings of Maxillaria Ruiz
Vancouver Orchid Society, Richmond, British Columbia, Canada. & Pavón. Maxillarieae 1: 3–5.
CHRISTENSON, E. A. 2002b. Vue d’ensemble du genre Maxillaria. GARAY, L. A., AND M. WIRTH. 1959. On the genera Mormolyca Fenzl and
Richardiana 2: 41–65. Cyrtoglottis Schltr. Canadian Journal of Botany 37: 479–490.
CRIBB, P., AND R. GOVAERTS. 2005. Just how many orchids are there? In A. GOLDMAN, D. H., J. V. FREUDENSTEIN, P. J. KORES, M. MOLVRAY, D. C.
Raynal-Roques and A. Roguenant [eds.], Proceedings of the 18th JARRELL, W. M. WHITTEN, K. M. CAMERON, R. K. JANSEN, AND M. W.
World Orchid Conference, 161–172. Naturalia Publications, Turriers, CHASE. 2001. Phylogenetics of Arethuseae (Orchidaceae) based on
France. plastid matK and rbcL sequences. Systematic Botany 26: 670–695.
DATHE, S., AND H. D IETRICH. 2006. Comparative molecular and GOVAERTS, R. 2001. How many species of seed plants are there? Taxon 50:
morphological studies in selected Maxillariinae orchids. Willdenowia 1085–1090.
36: 89–102. GOVAERTS, R., M. A. CAMPACCI, D. HOLLAND BAPTISTA, P. CRIBB, A.
DAVIES, K. L., M. STPICZYNSKA, AND A. GREGG. 2005. Nectar-secreting GEORGE, K. KREUZ, AND J. J. WOOD. 2005. World checklist of
floral stomata in Maxillaria anceps Ames & C.Schweinf. (Orchid- Orchidaceae. Board of Trustees of the Royal Botanic Gardens, Kew,
aceae). Annals of Botany 96: 217–227. UK. Website, http://www.kew.org/wcsp/monocots/ [accessed 10
DAVIES, K. L., AND M. P. TURNER. 2004. Morphology of floral papillae in January 2007].
Maxillaria Ruiz & Pav. (Orchidaceae). Annals of Botany 93: 75–86. HÁGSATER, E. 2005. Epidendrum. In A. M. Pridgeon, P. J. Cribb, and M.
DAVIES, K. L., M. P. TURNER, AND A. GREGG. 2003a. Lipoidal labellar W. Chase [eds.], Genera Orchidacearum, vol. 4 Epidendroideae (part
secretions in Maxillaria Ruiz & Pav. (Orchidaceae). Annals of Botany one), 236–251. Oxford University Press, New York, New York,
91: 439–446. USA.
DAVIES, K. L., M. P. TURNER, AND A. GREGG. 2003b. Atypical HAWKES, A. D. 1953. A new section of Cryptocentrum Benth. Orchid
pseudopollen-forming hairs in Maxillaria (Orchidaceae). Botanical Journal 2: 379.
Journal of the Linnean Society 143: 151–158. HOEHNE, F. 1947. Reajustamento de algunas especies de Maxillarieas do
DAVIES, K. L., C. WINTERS, AND M. P. TURNER. 2000. Pseudopollen: its Brasil, com criação de dois novos genêros para elas. Arquivos de
structure and development in Maxillaria (Orchidaceae). Annals of Botânica do Estado de São Paulo 2: 65–74.
Botany 85: 887–895. HOLTZMEIER, M. A., W. L. STERN, AND W. S. JUDD. 1998. Comparative
DODSON, C. H. 1993. Native Ecuadorian orchids, vol. 1. Editorial Colina, anatomy and systematics of Senghas’s cushion species of Maxillaria
Medellı́n, Colombia. (Orchidaceae). Botanical Journal of the Linnean Society 127: 43–82.
DODSON, C. H. 1994. New orchid species and combinations from Ecuador. JOHNSON, L. A., AND D. E. SOLTIS. 1994. matK DNA sequences and
3. Orquideologı́a 19: 51–96. phylogenetic reconstruction in Saxifragaceae s.st. Systematic Botany
DOYLE, J. J., AND J. L. DOYLE. 1987. A rapid DNA isolation procedure for 19: 143–156.
small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11– KELCHNER, S. A. 2000. The evolution of non-coding chloroplast DNA and
15. its application in plant systematics. Annals of the Missouri Botanical
DRESSLER, R. L. 1961. The systematic position of Cryptocentrum Garden 87: 482–498.
(Orchidaceae). Brittonia 13: 266–270. KOEHLER, S., AND M. D. E. DO AMARAL. 2004. A taxonomic study of the
DRESSLER, R. L. 1971. Dark pollinia in hummingbird-pollinated orchids, or South American genus Bifrenaria Lindl. (Orchidaceae). Brittonia 56:
do hummingbirds suffer from strabismus? American Naturalist 105: 314–345.
80–83. KOEHLER, S., N. H. WILLIAMS, W. M. WHITTEN, AND M. D. E. DO AMARAL.
DRESSLER, R. L. 1981. The orchids: natural history and classification. 2002. Phylogeny of the Bifrenaria (Orchidaceae) complex based on
Harvard University Press, Cambridge, Massachusetts, USA. morphology and sequence data from nuclear rDNA internal
DRESSLER, R. L. 1993. Phylogeny and classification of the orchid family. transcribed spacers (ITS) and chloroplast trnL-trnF region. Interna-
Dioscorides Press, Portland, Oregon, USA. tional Journal of Plant Sciences 163: 1055–1066.
FARRIS, J. S., M. KÄLLERSJÖ, A. G. KLUGE, AND C. BULT. 1995. Constructing LELLINGER, D. B. 2002. A modern multilingual glossary for taxonomic
a significance test for incongruence. Systematic Biology 44: 570–572. pteridology. Pteridologia 3: 1–263.
FÉLIX, L. P., AND M. GUERRA. 2000. Cytogenetics and cytotaxonomy of LINDLEY, J. 1824. Camaridium ochroleucum. Botanical Register 10 t. 844.
some Brazilian species of Cymbidioid orchids. Genetics and LINDLEY, J. 1843. Maxillaria. Botanical Register 29: Misc. 10–16.
Molecular Biology 23: 957–978. MCILLMURRAY, M., AND H. F. OAKELEY. 2001. Maxillaria platypetala, the
FITCH, W. M. 1971. Toward defining the course of evolution—minimum type for the genus. Orchid Review 109: 49–51.
change for a specific tree topology. Systematic Zoology 20: 406–416. MCNEILL, J., F. R. BARRIE, H. M. BURDET, V. DEMOULIN, D. L.
FLACH, A., R. C. DONDON, R. B. SINGER, S. KOEHLER, M. D. E. AMARAL, HAWKSWORTH, K. MARHOLD, D. H. NICOLSON, J. PRADO, P. C. SILVA,
AND A. J. MARSAIOLI. 2004. The chemistry of pollination in selected J. E. SKOG, W. J. WIERSEMA, AND N. J. TURLAND. 2006. International
code of botanical nomenclature (Vienna code). Regnum Vegetabile SINGER, R. B. 2003. Orchid pollination: recent developments from Brazil.
146. Lankesteriana 7: 111–114.
MONRO, A. K. 2006. Revision of species-rich genera: a phylogenetic SINGER, R. B., A. FLACH, S. KOEHLER, A. J. MARSAIOLI, AND M. D. E.
framework for the strategic revision of Pilea (Urticaceae) based on AMARAL. 2004. Sexual mimicry in Mormolyca ringens (Lindl.) Schltr.
cpDNA, nrDNA, and morphology. American Journal of Botany 93: (Orchidaceae: Maxillariinae). Annals of Botany 93: 755–762.
426–441. SINGER, R. B., AND S. KOEHLER. 2004. Pollinarium morphology and floral
OJEDA, I. 2003. Filogenia del complejo Heterotaxis Lindl. (Orchidaceae): rewards in Brazilian Maxillariinae (Orchidaceae). Annals of Botany
evolución de la arquitectura vegetativa y de los sı́ndromes de 93: 39–51.
polinización. Master’s thesis, Centro de Investigación Cientı́fica de SINGER, R. B., S. KOEHLER, AND G. CARNEVALI. 2007. Brasiliorchis: a new
Yucatán, Mérida, Yucatán, México. genus for the Maxillaria picta alliance (Orchidaceae, Maxillariinae).
OJEDA, I., G. CARNEVALI, N. H. WILLIAMS, AND M. W. WHITTEN. 2003. Novon 17: 91–99.
Phylogeny of the Heterotaxis Lindley complex (Maxillariinae): SINGER, R. B., A. J. MARSAIOLI, A. FLACH, AND M. GOMES-REIS. 2006. The
evolution of the vegetative architecture and pollination syndromes. ecology and chemistry of pollination in Brazilian orchids: recent
Lankesteriana 7: 45–47. advances. In J. A. Teixeira da Silva [ed.], Floriculture, ornamental
OJEDA, I., G. CARNEVALI FERNANDEZ-CONCHA, AND G. A. ROMERO. 2005. and plant biotechnology: advances and topical issues, vol. IV, 570–
New species and combinations in Heterotaxis Lindley (Orchidaceae: 583. Global Science Books, Isleworth, Middlesex, UK.
Maxillariinae). Novon 15: 572–582. STPICZYNSKA, M., K. L. DAVIES, AND A. GREGG. 2004. Nectary structure and
ORTIZ, P. 1995. Orquı́deas de Colombia, 2nd ed. Indo-American Press, nectar secretion in Maxillaria coccinea (Jacq.) L.O. Williams ex
Bogotá, Colombia. Hodge (Orchidaceae). Annals of Botany 93: 87–95.
PABST, G. F. J., AND F. DUNGS. 1975. Orchidaceae Brasilienses. Brücke- SUN, Y., D. Z. SKINNER, G. H. LIANG, AND S. H. HULBERT. 1994.
Verlag Schmersow, Hildesheim, Germany. Phylogenetic analysis of Sorghum and related taxa using internal
PLUNKETT, G. M., G. T. CHANDLER, P. P. LOWRY, S. M. PINNEY, AND T. S. transcribed spacers of nuclear ribosomal DNA. Theoretical and
SPRENKLE. 2004. Recent advances in understanding Apiales and a Applied Genetics 89: 26–32.
revised classification. South African Journal of Botany 70: 371–381. SWEET, H. 1971. Orquı́deas andinas poco conocidas. V. Chrysocycnis
Linden & Rchb.f. Orquideologı́a 6: 3–10.
RAMBAUT, A. 1996. Se-Al: sequence alignment editor, Ver. 2.0a11.
SWEET, H. 1972. Orquı́deas andinas poco conocidas. VI. Pityphyllum
Website http://tree.bio.ed.ac.uk/software/seal/ [accessed August
Schltr. Orquideologı́a 7: 203–214.
2007].
SWOFFORD, D. L. 2003. PAUP*: phylogenetic analysis using parsimony
RAUSCHERT, S. 1982. Nomina nova generica et combinationes novae
(*and other methods), version 4.0b10. Sinauer, Sunderland, Massa-
Spermatophytorum et Pteridophytorum. Taxon 31: 554–563.
chusetts, USA.
RUIZ, H., AND J. PAVÓN. 1794. Prodromus flora Peruviana et Chilensis 116, SZLACHETKO, D. L. 1995. Systema orchidalium. Fragmenta Floristica et
t. 25. Imprenta de Sancha, Madrid, Spain. Geobotanica Supplementum 3: 1–152.
RUIZ, H., AND J. PAVÓN. 1798. Maxillaria. Systema vegetabilium florae SZLACHETKO, D. L., J. MYTNIK-EJSMONT, M. GÓRNIAK, AND M. ŚMISZEK.
Peruvianae et Chilensis 1: 219–226. 2006. Genera et species orchidalium. 15. Maxillarieae. Polish
RYAN, A., M. W. WHITTEN, M. A. T. JOHNSON, AND M. W. CHASE. 2000. A Botanical Journal 15: 57–59.
phylogenetic assessment of Lycaste and Anguloa (Orchidaceae: SZLACHETKO, D. L., AND M. ŚMISZEK. 2007. Nouveaux genres dans le
Maxillarieae). Lindleyana 15: 33–45. complex Maxillaria (Orchidaceae). Richardiana 7: 26–32.
SENGHAS, K. 1993. Subtribus Maxillariinae. In F. G. Brieger, R. Maatsch, TANAKA, R. 1966. Chromosome counts of orchids in Japan III. Japan
and K. Senghas [eds.], Rudolf Schlechter, Die Orchideen, Band I/B. Orchid Society Bulletin 12: 2–4.
Lieferung 28, 1727–1776. Paul Parey, Berlin and Hamburg, VAN DEN BERG, C., D. H. GOLDMAN, J. V. FREUDENSTEIN, A. M. PRIDGEON, K.
Germany. M. CAMERON, AND M. W. CHASE. 2005. An overview of the
SENGHAS, K. 1994. Subtribus Maxillariinae. In F. G. Brieger, R. Maatsch, phylogenetic relationships within Epidendroideae inferred from
and K. Senghas [eds.], Rudolf Schlechter, Die Orchideen, Band I/B. multiple DNA regions and recircumscription of Epidendreae and
Lieferung 29, 1777–1803. Paul Parey, Berlin and Hamburg, Arethuseae (Orchidaceae). American Journal of Botany 92: 613–624.
Germany. VAN DER PIJL, L., AND C. H. DODSON. 1966. Orchid flowers: their pollination
SENGHAS, K. 2000. Maxillaria, un genre chaotique. Richardiana 2: 29–38. and evolution. University of Miami Press, Coral Gables, Florida,
SIKES, D. S., AND P. O. LEWIS. 2001. PAUPRat: PAUP implementation of USA.
the parsimony ratchet. Distributed by the authors. Website http:// WHITTEN , M. W., M. A. BLANCO, AND N. H. W ILLIAMS. 2006.
www.ucalgary.ca/;dsikes/software2.htm. Department of Ecology Recircumscription of Pityphyllum (Maxillariinae: Orchidaceae).
and Evolutionary Biology, University of Connecticut, Storrs, Orchids 75: 452–456.
Connecticut, USA [accessed August 2007]. WHITTEN, W. M., N. H. WILLIAMS, AND M. W. CHASE. 2000. Subtribal and
SINGER, R. B. 2002. The pollination mechanism in Trigonidium obtusum generic relationship of Maxillarieae (Orchidaceae) with emphasis on
Lindl (Orchidaceae: Maxillariinae): sexual mimicry and trap-flowers. Stanhopeinae: combined molecular evidence. American Journal of
Annals of Botany 89: 157–163. Botany 87: 1842–1856.
APPENDIX 1. Voucher information and GenBank accession numbers for taxa used in this study. A dash indicates that the DNA region was not sampled.
Herbarium acronyms: ESA ¼ Universidade de São Paulo, São Paulo, Brazil; FLAS ¼ University of Florida, Gainesville, FL, USA; M ¼ Botanische
Staatssammlung München, München, Germany; PMA ¼ Universidad de Panamá, Panamá; QCA ¼ Pontificia Universidad Católica del Ecuador, Quito,
Ecuador; QCNE¼ Museo Ecuatoriano de Ciencias Naturales, Quito, Ecuador; SEL ¼ Marie Selby Botanical Gardens, Sarasota, FL, USA; SP ¼Instituto
de Botânica, São Paulo, Brazil; UEC ¼ Universidade Estadual de Campinas, Brazil; USJ ¼ Universidad de Costa Rica, San José, Costa Rica.
Taxon—GenBank accessions: nrITS, matKþtrnK, atpB-rbcL spacer, rpoC1, Collector and number, Source, Herbarium.
Anthosiphon roseans Schltr.—DQ210416, DQ210903, DQ209701, 2411, Ecuador, cult. FLAS. C. standleyi Ames—DQ210309,
DQ872598, Whitten 2554, Panama, FLAS. DQ210808, DQ209597, —, Holst 8764, Costa Rica, SEL. C.
Bifrenaria inodora Lindl.—DQ210217, DQ210744, —, —, Whitten standleyi—DQ210322, DQ210821, DQ209610, —, Whitten 2323,
93189, Brazil, cult., FLAS. B. tetragona (Lindl.) Schltr.—AF239335, Ecuador, FLAS. C. standleyi —DQ210364, DQ210858, DQ209651,
DQ210751, DQ209533, DQ872528, Whitten 93156, Brazil, cult., —, Whitten 2407, Ecuador, cult., FLAS. Cryptocentrum sp.—
FLAS. B. tyrianthina (Loudon) Rchb.f—DQ210235, DQ210752, —, DQ210323, DQ210822, DQ209611, —, Whitten 2324, Ecuador,
—, Whitten 3008, Brazil, cult., FLAS. FLAS.
Brasiliorchis barbosae (Loefgr.) R.Singer, S.Koehler & Carnevali— Cyrtidiorchis alata (Ruiz & Pav.) Rauschert—DQ210087, DQ210627,
DQ210150, DQ210682, DQ209460, —, Koehler 0140, Brazil, UEC. DQ209399, —, Gerlach 1994–4005, Colombia, M. C. alata—
B. chrysantha (Barb.Rodr.) R.Singer, S.Koehler & Carnevali— DQ210569, DQ211044, DQ209849, —, Whitten 2932, Ecuador,
DQ210113, DQ210644, DQ209424, —, Koehler 0029, Brazil, cult., cult., FLAS. C. frontinoensis (Garay) Rauschert—DQ210248,
UEC. B. gracilis (Lodd.) R.Singer, S.Koehler & Carnevali— DQ210763, DQ209542, —, Whitten 2993, Colombia, cult., FLAS.
DQ210108, DQ210639, DQ209420, —, Koehler 0017, Brazil, cult., Eriopsis biloba Lindl.—DQ210374, DQ210866, DQ209661, —, Whitten
UEC. B. gracilis—DQ210154, DQ210686, DQ209464, —, Koehler 2439, Ecuador, cult., FLAS. E. biloba—DQ461788, DQ461806,
0147, Brazil, UEC. B. gracilis—DQ210312, DQ210811, DQ209600, DQ461770, DQ872521, Whitten 3153, Ecuador, QCA.
DQ872539, Whitten 2303, Brazil, cult., FLAS. B. kautskyi (Pabst) R. Heterotaxis brasiliensis (Brieger & Illg) F. Barros—DQ210155,
Singer, S.Koehler & Carnevali—DQ210115, DQ210646, DQ209426, DQ210687, DQ209465, —, Koehler 0150, Brazil, UEC. H. discolor
—, Koehler 0035, Brazil, UEC. B. marginata (Lindl.) R.Singer, S. (Lodd. ex Lindl.) Ojeda & Carnevali—DQ210232, DQ210748,
Koehler & Carnevali—DQ210156, DQ210688—, —, Koehler 0152, DQ209531, —, Atwood & Whitten 5063, Suriname, SEL. H.
Brazil, UEC. B. phoenicanthera (Barb.Rodr.) R.Singer, S.Koehler & discolor—DQ210052, DQ209899, DQ209367, —, Blanco 2098,
Carnevali—DQ210173, DQ210703, DQ209480, —, Koehler 0274, Costa Rica, cult., USJ. H. discolor —DQ210181, DQ210711,
Brazil, ESA. B. phoenicanthera—DQ210313, DQ210812, DQ209488, —, Koehler 0311, Brazil, ESA. H. discolor —
DQ209601, —, Whitten 2304, Brazil, cult., FLAS. B. picta (Hook.) DQ210333, DQ209953, DQ209620, —, Whitten 2350, Ecuador,
R.Singer, S.Koehler & Carnevali—DQ210084, DQ210624, FLAS. H. equitans (Schltr.) Ojeda & Carnevali—DQ210151,
DQ209396, —, Gerlach 1984–3140, cult., M. B. picta—DQ210190, DQ210683, DQ209461, —, Koehler 0141, Brazil, UEC. H.
DQ210720, DQ209497, —, Koehler 0337, Brazil, UEC. B. picta— equitans—DQ210389, DQ210877, —, DQ872595, Whitten 2483,
DQ210522, DQ211002, DQ209804, —, Whitten 2755, Brazil, cult., Ecuador, cult., FLAS. H. fritzii Ojeda & Carnevali—DQ210497,
FLAS. B. porphyrostele (Rchb.f.) R.Singer, S.Koehler & Carnevali— DQ209969, DQ209781, —, Whitten 2672, Colombia, cult., FLAS. H.
DQ210159, DQ210691, DQ209467, —, Koehler 0159, Brazil, UEC. maleolens (Schltr.) Ojeda & Carnevali—DQ209978, DQ209856,
B. porphyrostele—DQ210294, DQ210793, DQ209584, —, Whitten DQ209295, —, Atwood & Whitten 5055, Honduras, SEL. H.
1972, Brazil, FLAS. B. schunkiana (Campacci & Kautsky) R.Singer, maleolens—DQ210525, DQ209972, DQ209807, —, Whitten 2764,
S.Koehler & Carnevali—DQ210300, DQ210799, DQ209589, cult., FLAS. H. santanae (Carnevali & I.Ramirez) Ojeda &
DQ872537, Whitten 1992, Brazil, cult., FLAS. B. ubatubana Carnevali—DQ210526, DQ209973, DQ209808, DQ872582, Whitten
(Hoehne) R.Singer, S.Koehler & Carnevali—DQ210158, 2765, Ecuador, cult., FLAS. H. sessilis (Sw.) F. Barros—DQ209986,
DQ210690—, —, Koehler 0155, Brazil, UEC. B. ubatubana— DQ209862, DQ209303, —, Atwood & Whitten 5065, Jamaica, SEL.
DQ210205, DQ210735, DQ209512, —, Koehler 0373, Brazil, ESA. H. sessilis—DQ210410, DQ210897, DQ209695, DQ872555, Whitten
B. aff. ubatubana—DQ210016, DQ210588, DQ209330, —, Atwood 2544, cult., FLAS. H. superflua (Rchb.f.) F. Barros—DQ210157,
& Whitten 5099, Brazil, cult., SEL. DQ210689, DQ209466, —, Koehler 0153, Brazil, UEC. H.
Chrysocycnis schlimii Linden & Rchb.f.—DQ210088, DQ210628, superflua—DQ210175, DQ210705, DQ209482, —, Koehler 0279,
DQ209400, —, Gerlach 1992–763, Colombia, cult., M. C. Brazil, ESA. H. superflua—DQ461800, DQ461818, DQ461782, —,
schlimii—DQ210350, DQ210847, DQ209637, DQ872547, Whitten Whitten 3197, Ecuador, cult., QCA. H. valenzuelana (A. Rich.) Ojeda
2386, Ecuador, cult., FLAS. & Carnevali—DQ210170, DQ210700, DQ209477, —, Koehler 0263,
Cryptocentrum calcaratum (Schltr.) Schltr.—DQ210487, DQ210970, Brazil, ESA. H. valenzuelana—DQ210172, DQ210702, DQ209479,
DQ209771, —, Whitten 2651, Panama, FLAS. C. inaequisepalum C. —, Koehler 0270, Brazil, ESA. H. valenzuelana—DQ210466,
Schweinf.—DQ210257, DQ210769, DQ209551, —, Whitten 1567, DQ210950, DQ209749, —, Whitten 2620, Panama, FLAS. H.
Ecuador, FLAS. C. inaequisepalum—DQ210324, DQ210823, valenzuelana—DQ210231, DQ209934, DQ209530, —, Whitten
DQ209612, —, Whitten 2325, Ecuador, FLAS. C. 3000, Panama, cult., FLAS. H. villosa (Barb.Rodr.) F. Barros—
inaequisepalum—DQ210407, DQ210894, DQ209692, —, Whitten DQ210202, DQ210732, DQ209509, —, Koehler 0367, Brazil, ESA.
2535, Ecuador, FLAS. C. inaequisepalum—DQ210501, DQ210982, H. villosa—DQ210387, DQ209963, DQ209673, —, Whitten 2481,
DQ209784, —, Whitten 2700, Ecuador, FLAS. C. latifolium Schltr.— Ecuador, cult., FLAS. H. violaceopunctata (Rchb.f.) F. Barros—
DQ209999, DQ210578, DQ209315, —, Atwood & Whitten 5081, cult., DQ210146, DQ210678, DQ209457, —, Koehler 0129, Brazil, cult.,
SEL. C. latifolium—DQ210332, DQ210831, DQ209619, —, Whitten UEC. H. violaceopunctata—DQ210308, DQ210807, DQ209596,
2349, Ecuador, FLAS. C. latifolium—DQ210511, DQ210992, DQ872538, Whitten 2294, Brazil, cult., FLAS.
DQ209794, —, Whitten 2733, Ecuador, FLAS. C. lehmannii (Rchb. Hylaeorchis petiolaris (Schltr.) Carnevali & G. A. Romero—DQ210545,
f.) Garay—DQ210365, DQ210859, DQ209652, —, Whitten 2408, DQ211020, DQ209827, —, Whitten 3073, Ecuador, cult., QCA.
Ecuador, FLAS. C. peruvianum (Cogn.) C.Schweinf.—DQ210279, Maxillaria acervata Rchb.f.—DQ210064, DQ210607, DQ209379, —,
DQ210786, DQ209572—Whitten 1796, Ecuador, cult., FLAS. C. Blanco 2302, Costa Rica, cult., USJ. M. aciantha Rchb.f.—
peruvianum —DQ210321, DQ210820, DQ209609, DQ872599, DQ210011, DQ209876, DQ209326, —, Atwood & Whitten 5094,
Whitten 2322, Ecuador, FLAS. C. pseudobulbosum C.Schweinf.— Belize, SEL. M. aciantha—DQ210296, DQ210795, DQ209585, —,
DQ210280, —, —, —, Whitten 1999, Ecuador, FLAS. C. Whitten 1978, Belize, FLAS. M. acicularis Herb. ex Lindl.—
pseudobulbosum—DQ210367, DQ210861, DQ209654, —, Whitten DQ210142, DQ210673, DQ209452, —, Koehler 0115, Brazil, SP.
M. acicularis—DQ210161, DQ210693, DQ209469, —, Koehler arbuscula—DQ210555, DQ211030, DQ209836, —, Whitten 2902,

0237, Brazil, UEC. M. acicularis —DQ210196, DQ210726, Ecuador, cult., FLAS. M. aff. arbuscula—DQ210401, DQ210888,
DQ209503, —, Koehler 0352, Brazil, cult., UEC. M. acicularis — DQ209686, —, Whitten 2500, Ecuador, cult., FLAS. M. attenuata
DQ210204, DQ210734, DQ209511, —, Koehler 0371, Brazil, ESA. Ames & C.Schweinf.—DQ210239, DQ209936, DQ209537, —,
M. acicularis —DQ210301, DQ210800—, —, Whitten 1994, Brazil, Atwood s.n., Panama, SEL 1974-0030-113A, SEL. M. atwoodiana
cult., FLAS. M. acostae Schltr.—DQ210034, DQ210603, DQ209348, Pupulin—DQ210055, DQ209902, DQ209370, —, Blanco 2104, Costa
—, Blanco 0938, Costa Rica, USJ. M. acostae—DQ210067, Rica, cult., USJ. M. augustae-victoriae F.Lehm. & Kraenzl.—
DQ210610, DQ209381, —, Blanco 2826, Panama, FLAS. M. DQ210027, DQ210599, DQ209341, —, Dressler & Atwood 6266,
acostae— —, DQ210965, DQ209766, DQ872566, Whitten 2644, Ecuador, cult., FLAS. M. augustae-victoriae—DQ210551,
Panama, cult., FLAS. M. acostae—DQ210532, DQ211008, DQ211026, DQ209832, DQ872588, Whitten 2893, Ecuador, cult.,
DQ209814, —, Whitten 2786, Panama, cult., FLAS. M. acuminata FLAS. M. auyantepuiensis Foldats—DQ210331, DQ210830,
Lindl.—DQ210408, DQ210895, DQ209693, —, Whitten 2536, DQ209618, DQ872543, Whitten 2347, Ecuador, FLAS. M.
Ecuador, FLAS. M. acuminata—DQ210447, DQ210932, auyantepuiensis—DQ210336, DQ210834, DQ209622, —, Whitten
DQ209731, —, Whitten 2597, Panama, cult., FLAS. M. 2360, Ecuador, cult., FLAS. M. cf. bennettii Christenson—
acuminata—DQ210500, DQ210981, DQ209783, DQ872573, DQ210352, DQ210849, DQ209639, —, Whitten 2388, Ecuador,
Whitten 2698, Ecuador, FLAS. M. acutifolia Lindl.—DQ210337, cult., FLAS. M. bicallosa (Rchb.f.) Garay—DQ210233, DQ210749,
DQ210835, DQ209623, —, Whitten 2361, Ecuador, cult., FLAS. M. DQ209532, —, Atwood & Whitten 5058, cult., SEL. M. bicallosa—
cf. acutifolia—DQ210330, DQ210829, DQ209617, —, Whitten 2338, DQ210277, DQ209946—, —, Whitten 1677, Ecuador, cult., FLAS. M.
Ecuador, FLAS. M. adendrobium (Rchb.f.) Dressler—DQ210214, bicallosa—DQ210386, DQ209962, DQ209672, —, Whitten 2480,
DQ210741, DQ209519, —, Dressler 4231, Panama, FLAS. M. Ecuador, cult., FLAS. M. bicallosa—DQ210478, DQ210960,
adendrobium—DQ210467, —, DQ209750, —, Whitten 2621, DQ209761, DQ872596, Whitten 2636, Panama, FLAS. M.
Panama, FLAS. M. adolphi (Schltr.) Ames & C.Schweinf.— bicallosa—DQ210517, DQ210998, DQ209800, —, Whitten 2748,
DQ210066, DQ210609, DQ209380, —, Blanco 2539, Costa Rica, Ecuador, cult., FLAS. M. biolleyi (Schltr.) L.O.Williams—DQ210050,
USJ. M. aequiloba Schltr.—DQ210273, DQ210784, DQ209567, —, DQ209897, DQ209365, —, Blanco 2092, Costa Rica, cult., USJ. M.
Whitten 1668, Ecuador, cult., FLAS. M. aequiloba—DQ210564, biolleyi—DQ210019, DQ210591, DQ209333, —, Dressler & Atwood
DQ211039, DQ209844, —, Whitten 2918, Ecuador, cult., FLAS. M. 6241, Panama, PMA. M. bolivarensis C.Schweinf.—DQ210341,
cf. aggregata (Kunth) Lindl.—DQ210393, DQ210880, DQ209678, DQ210838, DQ209627, —, Whitten 2365, Ecuador, cult., FLAS. M.
DQ872552, Whitten 2488, Ecuador, cult., FLAS. M. cf. aggregata— brachybulbon Schltr.—DQ210262, DQ210773, DQ209556,
DQ461793, DQ461811, DQ461775, —, Whitten 3180, Ecuador, QCA. DQ872533, Whitten 1583, Ecuador, FLAS. M. bracteata (Schltr.)
M. cf. aggregata—DQ461797, DQ461815, DQ461779, —, Whitten Ames & Correll—DQ209988, DQ209864, DQ209305, —, Atwood &
3189, Ecuador, cult., QCA. M. cf. aggregata—DQ461799, Whitten 5068, Costa Rica, cult., SEL. M. bracteata—DQ210180,
DQ461817, DQ461781, —, Whitten 3195, Ecuador, cult., QCA. M. DQ210710, DQ209487, —, Koehler 0305, Brazil, cult., ESA. M.
cf. alba (Hook.) Lindl.—DQ210000, DQ209873, DQ209316, —, bracteata—DQ210305, DQ210804, DQ209593, —, Whitten 2198,
Atwood & Whitten 5082, cult., SEL. M. alba—DQ209984, Costa Rica, FLAS. M. bradei Schltr. ex Hoehne—DQ210149,
DQ210575, DQ209301, —, Atwood & Whitten 5062, Costa Rica, DQ210681, DQ209459, —, Koehler 0138, Brazil, UEC. M.
SEL. M. alba—DQ210171, DQ210701, DQ209478, —, Koehler bradeorum (Schltr.) L.O.Williams—DQ210443, DQ210928,
0266, Brazil, UEC. M. alba—DQ210315, DQ210814, DQ209603, —, DQ209727, —, Whitten 2590, Panama, cult., FLAS. M.
Whitten 2306, Jamaica, cult., FLAS. M. allenii L.O.Williams— bradeorum—DQ210481, DQ210963, DQ209764, DQ872565,
DQ210068, DQ210611, DQ209382, —, Blanco 2836, Panama, FLAS. Whitten 2639, Panama, FLAS. M. bradeorum—DQ210506,
M. alpestris Lindl.—DQ210414, DQ210901, DQ209699, —, Whitten DQ210987, DQ209789, —, Whitten 2716, Ecuador, FLAS. M.
2551, Ecuador, cult., FLAS. M. alticola C.Schweinf.—DQ210399, brevilabia Ames & Correll—DQ210046, DQ209893, DQ209361,
DQ210886, DQ209684, —, Whitten 2498, Ecuador, cult., FLAS. M. —, Blanco 1717, Costa Rica, USJ. M. brevilabia—DQ210456,
alticola—DQ210535, DQ211010, DQ209817, DQ872584, Whitten DQ210940, DQ209740, —, Whitten 2606, Panama, cult., FLAS. M.
2800, Ecuador, cult., FLAS. M. amparoana Schtr.—DQ210005, breviscapa Poepp. & Endl. cf.—DQ210544, DQ211019, DQ209826,
DQ210583, DQ209321, —, Atwood & Whitten 5087, cult., SEL. M. —, Whitten 2873, Ecuador, cult., FLAS. M. buchtienii Schltr.—
ampliflora C.Schweinf.—DQ210069, DQ210612, DQ209383, —, DQ210572, DQ211047, DQ209852, DQ872592, Whitten 2940, Peru,
Blanco 2845, Panama, FLAS. M. ampliflora—DQ210425, cult., FLAS. M. camaridii Rchb.f.—DQ210086, DQ210626,
DQ210912, DQ209710, —, Whitten 2566, Panama, cult., FLAS. M. DQ209398, DQ872583, Gerlach 2003–3648, Brazil, M. M.
ampliflora—DQ210458, DQ210942, DQ209742, —, Whitten 2608, camaridii—DQ210193, DQ210723, DQ209500, —, Koehler 0347,
Panama, FLAS. M. cf. anatomorum Rchb.f.—DQ210483, Brazil, cult., UEC. M. campanulata C.Schweinf.—DQ210044,
DQ210966, DQ209767, —, Whitten 2645, Colombia, cult., FLAS. DQ209891, DQ209359, —, Blanco 1679, Costa Rica, USJ. M.
M. anceps Ames & C.Schweinf.—DQ210518, DQ209971, canarensis J.T.Atwood—DQ210372, DQ209959, DQ209659,
DQ209801, —, Whitten 2750, Nicaragua, cult., FLAS. M. DQ872549, Whitten 2437, Ecuador, cult., FLAS. M. candida G.
angustisegmenta Ames & C.Schweinf.—DQ210012, DQ209877, Lodd. ex Lindl.—DQ210189, DQ210719, DQ209496, —, Koehler
DQ209327, —, Atwood & Whitten 5095, Costa Rica, cult., SEL. M. 0335, Venezuela, ESA. M. carinulata Rchb.f.—DQ210263,
angustisegmenta—DQ210429, DQ210916—, —, Whitten 2570, DQ210774, DQ209557, —, Whitten 1591, Ecuador, FLAS. M.
Panama, FLAS. M. angustissima Ames, F.T.Hubb. & C. carolii Christenson—DQ210573, DQ211048, DQ209853, —,
Schweinf.—DQ210054, DQ209901, DQ209369, —, Blanco 2103, Whitten 2948, Colombia, cult., FLAS. M. cassapensis Rchb.f.—
Costa Rica, USJ. M. angustissima—DQ210479, DQ210961, DQ210256, DQ210768, DQ209550, —, Whitten 1562, Ecuador,
DQ209762, —, Whitten 2637, Panama, FLAS. M. angustissima— FLAS. M. cedralensis J.T.Atwood & Mora-Ret.—DQ210097,
DQ210512, DQ210993, DQ209795, DQ872575, Whitten 2735, DQ209916, DQ209409, —, Mora & Warner s.n., Costa Rica, cult.,
Panama, FLAS. M. arachnitiflora Ames & C.Schweinf.— USJ. M. cerifera Barb.Rodr.—DQ210117, DQ210648, DQ209428, —,
DQ210063, DQ209909, DQ209378, —, Blanco 2262, Costa Rica, Koehler 0058, Brazil, UEC. M. cerifera—DQ210307, DQ210806,
cult., USJ. M. arachnitiflora— —, DQ210758—, —, Matthews s.n., DQ209595, —, Whitten 2292, Brazil, cult., FLAS. M. chacoensis
Costa Rica, SEL. M. arbuscula (Lindl.) Rchb.f.—DQ210357, Dodson—DQ210278, DQ210785, DQ209571, —, Whitten 1693,
DQ210853, DQ209644, —, Whitten 2395, Ecuador, cult., FLAS. M. Ecuador, cult., FLAS. M. chartacifolia Ames & C.Schweinf.—
arbuscula—DQ210404, DQ210891, DQ209689, —, Whitten 2508, DQ209981, DQ209859, DQ209298, —, Atwood & Whitten 5059,
Ecuador, cult., FLAS. M. arbuscula—DQ210538, DQ211013, Ecuador, cult., SEL. M. chartacifolia—DQ210265, DQ209942,
DQ209820, DQ872585, Whitten 2810, Ecuador, cult., FLAS. M. DQ209559, —, Whitten 1597, Ecuador, FLAS. M. chartacifolia—
DQ210520, DQ211000, DQ209803, DQ872581, Whitten 2752, cult., DQ209809, —, Whitten 2777, Panama, cult., FLAS. M. dillonii D.E.
FLAS. M. chicana Dodson —DQ461795, DQ461813, DQ461777, —, Benn. & Christenson—DQ210434, DQ209965, DQ209718, —,
Whitten 3187, Ecuador, cult., QCA. M. chionantha J.T.Atwood— Whitten 2575, cult., FLAS. M. dillonii—DQ210546, DQ211021,
DQ210008, DQ210585, DQ209323, —, Atwood & Whitten 5091, DQ209828, DQ872586, Whitten 2878, Peru, cult., FLAS. M. cf.
Panama, SEL. M. chionantha—DQ210293, DQ210792—, —, disticha (Lindl.) C.Schweinf.—DQ461791, DQ461809, DQ461773,
Whitten 1968, Panama, FLAS. M. chionantha—DQ210396, —, Whitten 3165, Ecuador, QCA. M. diuturna Ames & C.
DQ210883, DQ209681, —, Whitten 2493, Ecuador, cult., FLAS. M. Schweinf.—DQ210033, DQ209882, DQ209347, —, Blanco 0620,
chionantha—DQ210476, DQ210958, DQ209759, —, Whitten 2634, Costa Rica, cult., USJ. M. diuturna—DQ210022, DQ210594,
Panama, FLAS. M. chionantha—DQ210486, DQ210969, DQ209770, DQ209336, —, Dressler & Atwood 6251, Panama, PMA. M.
DQ872568, Whitten 2649, Panama, FLAS. M. coccinea (Jacq.) L.O. diuturna—DQ210314, DQ210813, DQ209602, —, Whitten 2305,
Williams ex Hodge—DQ210009, DQ209875, DQ209324, —, Atwood Colombia, cult., FLAS. M. diuturna—DQ210473, DQ210955,
& Whitten 5092, Puerto Rico, cult., SEL. M. colemanii Carnevali & DQ209756, —, Whitten 2631, Panama, FLAS. M. diuturna—
Fritz—DQ209989, DQ209865, DQ209306, —, Atwood & Whitten DQ210530, DQ209975, DQ209812, —, Whitten 2780, Panama, cult.,
5069, Venezuela, SEL. M. concavilabia Ames & Correll— FLAS. M. divaricata (Barb.Rodr.) Cogn.—DQ210378, DQ210869,
DQ210445, DQ210930, DQ209729, —, Whitten 2595, Panama, DQ209664, —, Whitten 2450, Ecuador, cult., FLAS. M. dressleriana
FLAS. M. conduplicata (Ames & C.Schweinf.) L.O. Williams— Carnevali & J.T.Atwood—DQ209980, DQ209858, DQ209297, —,
DQ209991, DQ210577, DQ209308, —, Atwood & Whitten 5071, Atwood & Whitten 5057, Costa Rica, cult., SEL. M. eburnea Lindl.—
Costa Rica, SEL. M. conduplicata—DQ210041, DQ209889, DQ210454, DQ210938, DQ209738, —, Whitten 2604, Ecuador, cult.,
DQ209356, —, Blanco 1660, Costa Rica, USJ. M. confusa Ames & FLAS. M. echiniphyta Barb.Rodr.—DQ210197, DQ210727,
C.Schweinf.—DQ210001, DQ210579, DQ209317, —, Atwood & DQ209504, —, Koehler 0353, Brazil, UEC. M. echiniphyta Barb.
Whitten 5083, Costa Rica, SEL. M. confusa—DQ210343, DQ210840, Rodr.—DQ210246, DQ210762, DQ209540, —, Whitten 2990, Brazil,
DQ209629, —, Whitten 2367, Ecuador, cult., FLAS. M. confusa— cult., FLAS. M. echiniphyta—DQ210250, DQ210765, DQ209544, —,
DQ210513, DQ210994, DQ209796, DQ872576, Whitten 2736, Whitten 1056, Brazil, cult., FLAS. M. ecuadorensis Schltr.—
Panama, cult., FLAS. M. cf. confusa—DQ210480, DQ210962, DQ210259, DQ210771, DQ209553, —, Whitten 1572, Ecuador,
DQ209763, —, Whitten 2638, Panama, Bocas del Toro, Fortuna FLAS. M. ecuadorensis—DQ210508, DQ210989, DQ209791,
Dam site to Chiriquı́ Grande, FLAS. M. consanguinea Klotzsch— DQ872574, Whitten 2724, Ecuador, FLAS. M. elatior (Rchb.f.)
DQ210188, DQ210718, DQ209495, —, Koehler 0333, Brazil, ESA. Rchb.f.—DQ210298, DQ210797, DQ209587, DQ872536, Whitten
M. costaricensis Schltr.—DQ210036, DQ209884, DQ209350, —, 1986, cult., FLAS. M. elegantula Rolfe—DQ210024, DQ210596,
Blanco 1475, Costa Rica, cult., USJ. M. costaricensis Schltr.— DQ209338, —, Dressler & Atwood 6262, Ecuador, cult., PMA. M.
DQ210288, DQ210788, DQ209579, —, Whitten 1910, Panama, elegantula—DQ210025, DQ210597, DQ209339, —, Dressler &
FLAS. M. crocea Lindl.—DQ210103, DQ210634, DQ209415, —, Atwood 6264, Ecuador, cult., PMA. M. elegantula—DQ210435,
Koehler 0005, Brazil, UEC. M. crocea—DQ210311, DQ210810, DQ210921, DQ209719, —, Whitten 2576, Ecuador, cult., FLAS. M.
DQ209599, —, Whitten 2299, Brazil, cult., FLAS. M. cryptobulbon elegantula—DQ210437, DQ210923, DQ209721, —, Whitten 2578,
Carnevali & J.T.Atwood—DQ209982, DQ209860, DQ209299, —, Ecuador, cult., FLAS. M. elegantula—DQ210543, DQ211018,
Atwood & Whitten 5060, Ecuador, cult., SEL. M. cryptobulbon— DQ209825, DQ872558, Whitten 2872, Ecuador, cult., FLAS. M.
DQ210397, DQ210884, DQ209682, —, Whitten 2494, Ecuador, cult., encyclioides J.T.Atwood & Dodson—DQ209983, DQ209861,
FLAS. M. ctenostachya Rchb.f.—DQ210098, DQ209917, DQ209300, —, Atwood & Whitten 5061, Ecuador, SEL. M. endresii
DQ209410, —, Morales 1639, Costa Rica, USJ. M. ctenostachya— Rchb.f.—DQ210010, DQ210586, DQ209325, —, Atwood & Whitten
DQ210412, DQ210899, DQ209697, —, Whitten 2549, Panama, cult., 5093, Costa Rica, SEL. M. exaltata (Kraenzl.) C.Schweinf.—
FLAS. M. ctenostachya—DQ210484, DQ210967, DQ209768, DQ210029, DQ210601, DQ209343, —, Dressler & Atwood 6277,
DQ872567, Whitten 2647, Panama, FLAS. M. cucullata Lindl.— Panama, FLAS. M. exaltata—DQ210251, DQ209938, DQ209545, —,
DQ210237, DQ210753, DQ209535, —, Atwood & Whitten 5066, Whitten 1506, Ecuador, FLAS. M. exaltata—DQ210319, DQ210818,
Venezuela, cult., SEL. M. cucullata—DQ209997, DQ209871, DQ209607, DQ872541, Whitten 2317, Ecuador, FLAS. M. exaltata—
DQ209313, —, Atwood & Whitten 5079, cult., SEL. M. cucullata— DQ210320, DQ210819, DQ209608, —, Whitten 2318, Ecuador,
DQ210178, DQ210708, DQ209485, DQ872602, Koehler 0298, Costa FLAS. M. cf. exaltata—DQ210325, DQ210824, DQ209613, —,
Rica, cult., ESA. M. cucullata—DQ210411, DQ210898, DQ209696, Whitten 2332, Ecuador, FLAS. M. cf. exaltata—DQ210326,
—, Whitten 2546, cult., FLAS. M. curvicolumna M.A. Blanco & DQ210825, DQ209614, —, Whitten 2333, Ecuador, FLAS. M.
Neubig—DQ210474, DQ210956, DQ209757, —, Whitten 2632, exaltata 3 M. porrecta—DQ210080, DQ210623, DQ209393, —,
Panama, FLAS. M. cymbidioides Dodson J.T.Atwood & Blanco 2986, Panama, FLAS. M. falcata Ames & Correll—
Carnevali—DQ209987, DQ209863, DQ209304, —, Atwood & DQ210079, DQ210622, DQ209392, —, Blanco 2975, Panama, cult.,
Whitten 5067, Ecuador, SEL. M. dalessandroi Dodson—DQ210366, FLAS. M. ferdinandiana Barb.Rodr.—DQ210129, DQ210660,
DQ210860, DQ209653, —, Whitten 2409, Ecuador, cult., FLAS. M. DQ209440, —, Koehler 0089, Brazil, SP. M. ferdinandiana—
cf. dalessandroi—DQ210549, DQ211024—, —, Whitten 2889, Peru, DQ210139, DQ210670, DQ209449, DQ872523, Koehler 0109,
cult., FLAS. M. dendrobioides (Schltr.) L.O. Williams—DQ210020, Brazil, SP M. ferdinandiana—DQ210286, DQ209951, DQ209577,
DQ210592, DQ209334, —, Dressler & Atwood 6243, Panama, PMA. —, Whitten 1872, Brazil, cult., FLAS. M. flava Ames, F.T.Hubb. & C.
M. dendrobioides—DQ210449, DQ210934, DQ209733, —, Whitten Schweinf.—DQ210242, DQ210757—, —, Dressler 5441, Panama,
2599, Panama, cult., FLAS. M. dendrobioides—DQ210469, FLAS. M. flava—DQ210438, DQ210924, DQ209722, —, Whitten
DQ210952, DQ209752, DQ872561, Whitten 2627, Panama, FLAS. 2579, Panama, cult., FLAS. M. flava—DQ210460, DQ210944,
M. dendrobioides—DQ210491, DQ210974, DQ209775, —, Whitten DQ209744, —, Whitten 2611, Panama, cult., FLAS. M. flava—
2655, Panama, FLAS. M. densa Lindl.—DQ209992, DQ209867, DQ210468, DQ210951, DQ209751, —, Whitten 2624, Panama,
DQ209309, —, Atwood & Whitten 5072, Mexico, cult., SEL. M. FLAS. M. fletcheriana Rolfe—DQ210209, DQ210739—, —,
densa—DQ210091, DQ210629, DQ209403, —, Higgins 1017, Whitten 88028, Ecuador, FLAS. M. fractiflexa Rchb.f.—DQ210074,
Mexico, FLAS. M. densa—DQ210290, DQ210790, DQ209581, —, DQ210617, DQ209387, —, Blanco 2956, Ecuador, cult., FLAS. M.
Whitten 1964, cult., FLAS. M. densifolia (Poepp. & Endl.) Rchb.f.— friedrichsthalii Rchb.f.—DQ210145, DQ210676, DQ209455, —,
DQ210253, DQ210767, DQ209547, —, Whitten 1554, Ecuador, Koehler 0125, Brazil, UEC. M. friedrichsthalii—DQ210210,
FLAS. M. desvauxiana Rchb.f.—DQ210206, DQ210736, DQ209923, DQ209516, —, Whitten 1977, French Guiana, cult.,
DQ209513, —, Koehler 1585, Brazil, ESA. M. dichotoma (Schltr.) FLAS. M. cf. friedrichsthalii—DQ210224, DQ209929—, —, Whitten
L.O. Williams—DQ210441, DQ210926, DQ209725, —, Whitten 1977, French Guiana, cult., FLAS. M. fulgens (Rchb.f.) L.O.
2584, Panama, FLAS. M. dichotoma—DQ210527, DQ211005, Williams—DQ210225, DQ209930, DQ209525, —, Dressler 5452,
Panama, FLAS. M. fulgens—DQ210472, DQ209968, DQ209755, DQ210679, DQ209458, —, Koehler 0132, Brazil, UEC. M. jostii
DQ872563, Whitten 2630, Panama, FLAS. M. galantha J.T.Atwood & Dodson—DQ210092, DQ210630, DQ209404, —, Jost 3133, Ecuador,
Carnevali—DQ210574, DQ211049, DQ209854, —, Whitten 2951, QCA. M. jucunda F.Lehm. & Kraenzl.—DQ210440, DQ210925,
Panama, FLAS. M. gentryi Dodson—DQ210347, DQ210845, DQ209724, —, Whitten 2581, Ecuador, cult., FLAS. M. jucunda—
DQ209634, —, Whitten 2379, Ecuador, cult., FLAS. M. gentryi— DQ210455, DQ210939, DQ209739, —, Whitten 2605, Ecuador, cult.,
DQ210400, DQ210887, DQ209685, —, Whitten 2499, Ecuador, cult., FLAS. M. juergensii Schltr.—DQ210120, DQ210651, DQ209431, —,
FLAS. M. gentryi—DQ210492, DQ210975, DQ209776, DQ872572, Koehler 0069, Brazil, SP. M. juergensii—DQ210124, DQ210655,
Whitten 2656, Panama, FLAS. M. gigantea (Lindl.) Dodson— DQ209435, —, Koehler 0079, Brazil, cult., SP. M. juergensii—
DQ210260, DQ209941, DQ209554, —, Whitten 1579, Ecuador, DQ210140, DQ210671, DQ209450, —, Koehler 0111, Brazil, cult.,
FLAS. M. gigantea—DQ210318, DQ210817, DQ209606, SP. M. klugii C.Schweinf.—DQ210354, DQ209955, DQ209641, —,
DQ872540, Whitten 2316, Ecuador, FLAS. M. gigantea— Whitten 2390, Ecuador, cult., FLAS. M. klugii—DQ210395,
DQ210359, DQ209956, DQ209646, —, Whitten 2398, Ecuador, DQ210882, DQ209680, —, Whitten 2492, Ecuador, cult., FLAS. M.
cult., FLAS. M. gomeziana J.T.Atwood—DQ210297, DQ210796, klugii—DQ210533, DQ209976, DQ209815, —, Whitten 2787,
DQ209586, —, Atwood s.n., SEL. M. gomeziana—DQ210228, Ecuador, cult., FLAS. M. laevilabris Lindl.—DQ210334,
DQ209932, DQ209527, —, Whitten 1985, Costa Rica, FLAS. M. cf. DQ210832, DQ209621, DQ872544, Whitten 2358, Ecuador, cult.,
grandiflora (Kunth) Lindl.—DQ210026, DQ210598, DQ209340, —, FLAS. M. cf. laevilabris—DQ210345, DQ210842, DQ209631, —,
Dressler & Atwood 6265, Ecuador, cult., PMA. M. grayi Dodson— Whitten 2372, Ecuador, cult., FLAS. M. lankesteri Ames—
DQ210547, DQ211022, DQ209829, DQ872587, Whitten 2879, Peru, DQ210554, DQ211029, DQ209835, —, Whitten 2901, Costa Rica,
cult., FLAS. M. grisebachiana Nir & Dod—DQ210542, DQ211017, cult., FLAS. M. lankesteri—DQ210243, DQ210759—, —, Whitten
DQ209824, —, Whitten 2841, Cuba, cult., FLAS. M. guadalupensis 2885, Costa Rica, cult., FLAS. M. lawrenceana (Rolfe) Garay &
Cogn.—DQ210504, DQ210985, DQ209787, —, Whitten 2714, Dunst.—DQ210451, DQ210936, DQ209735, —, Whitten 2601,
Ecuador, FLAS. M. guadalupensis—DQ210264, DQ210775, Colombia, cult., FLAS. M. lehmannii Rchb.f.—DQ210268,
DQ209558, DQ872535, Whitten 1593, Ecuador, FLAS. M. DQ210778, DQ209562, —, Whitten 1641, Ecuador, cult., FLAS. M.
guadalupensis—DQ210502, DQ210983, DQ209785, —, Whitten lepidota Lindl.—DQ210562, DQ211037, DQ209842, —, Whitten
2704, Ecuador, FLAS. M. gualaquizensis Dodson—DQ461796, 2914, Ecuador, cult., FLAS. M. aff. lepidota— —, DQ210783,
DQ461814, DQ461778, —, Whitten 3188, Ecuador, cult., QCA. M. DQ209566, —, Whitten 1665, Ecuador, cult., FLAS. M. aff.
guareimensis Rchb.f.—DQ210565, DQ211040, DQ209845, —, lepidota—DQ210351, DQ210848, DQ209638, —, Whitten 2387,
Whitten 2920, Ecuador, cult., FLAS. M. haberi J.T.Atwood— Ecuador, cult., FLAS. M. cf. lepidota—DQ210363, DQ210857,
DQ210032, DQ209881, DQ209346, —, Blanco 0496, Costa Rica, DQ209650, —, Whitten 2406, Ecuador, cult., FLAS. M. leucaimata
USJ. M. hedwigiae Hamer & Dodson—DQ209994, DQ209869, Barb.Rodr.—DQ210107, DQ210638, DQ209419, —, Koehler 0015,
DQ209311, —, Atwood & Whitten 5074, Costa Rica, cult., SEL. M. Brazil, UEC. M. linearifolia Ames & C.Schweinf.—DQ210096,
hedwigiae—DQ210182, DQ210712, DQ209489, —, Koehler 0314, DQ209915, DQ209408, —, Mora 001–92, Costa Rica, cult., USJ. M.
Guatemala, cult., ESA. M. hedwigiae—DQ210213—, —, —, Whitten loefgrenii (Cogn.) Pabst—DQ210194, DQ210724, DQ209501, —,
1961, Costa Rica, FLAS. M. hennisiana Schltr.—DQ210013, Koehler 0349, Brazil, UEC. M. longibracteata (Lindl.) Rchb.f.—
DQ209878—, —, Atwood & Whitten 5096, Ecuador, cult., SEL. M. DQ210353, DQ210850, DQ209640, —, Whitten 2389, Ecuador, cult.,
hennisiana—DQ210431, DQ210918, DQ209715, DQ872557, FLAS. M. longicaulis Schltr.—DQ210510, DQ210991, DQ209793,
Whitten 2572, Ecuador, cult., FLAS. M. hennisiana—DQ210529, —, Whitten 2726, Ecuador, FLAS M. longicolumna J.T.Atwood—
DQ209974, DQ209811, —, Whitten 2779, Panama, cult., FLAS. M. DQ210495, DQ210978, DQ209779, —, Whitten 2667, Panama,
hennisiana—DQ210536, DQ211011, DQ209818, —, Whitten 2808, FLAS. M. longiloba (Ames & C.Schweinf.) J.T.Atwood—
Ecuador, cult., FLAS. M. hennisiana—DQ210537, DQ211012, DQ210432, DQ210919, DQ209716, —, Whitten 2573, cult., FLAS.
DQ209819, —, Whitten 2809, Ecuador, cult., FLAS. M. M. longipes Lindl. —DQ210077, DQ210620, DQ209390, —, Blanco
heterophylla var. acicularifolia Hoehne—DQ210132, DQ210663, 2965, Ecuador, cult., FLAS. M. longipes—DQ210413, DQ210900,
DQ209443, —, Koehler 0095, Brazil, SP. M. heterophylla var. DQ209698, —, Whitten 2550, Ecuador, cult., FLAS. M. longipes—
acicularifolia—DQ210208, DQ210738, DQ209515, —, Koehler DQ210433, DQ210920, DQ209717, —, Whitten 2574, Ecuador, cult.,
1706, Brazil, SP. M. heterophylla var. intermedia Hoehne— FLAS. M. longipes—DQ210519, DQ210999, DQ209802, DQ872580,
DQ210162, —, DQ209470, —, Koehler 0240, Brazil, cult., UEC. Whitten 2751, Ecuador, cult., FLAS. M. longipetiolata Ames & C.
M. heterophylla var. magnifolia Hoehne—DQ210165, DQ210695, Schweinf.—DQ210229, DQ210747, DQ209528, DQ872529, Atwood
DQ209473, —, Koehler 0245, Brazil, UEC. M. heterophylla var. & Whitten 5075, Costa Rica, SEL. M. longipetiolata—DQ210236,
pygmaea Hoehne—DQ210141, DQ210672, DQ209451, —, Koehler DQ209935, DQ209534, —, Whitten 1974, Costa Rica, FLAS. M.
0113, Brazil, SP. M. heterophylla var. pygmaea—DQ210174, longissima Lindl.—DQ210269, DQ210779, DQ209563, —, Whitten
DQ210704, DQ209481, —, Koehler 0278, Brazil, ESA. M. 1642, Ecuador, cult., FLAS. M. longissima—DQ210360, DQ210855,
heterophylla var. pygmaea—DQ210176, DQ210706, DQ209483, DQ209647, —, Whitten 2399, Ecuador, cult., FLAS. M. longissima—
—, Koehler 0292, Brazil, ESA. M. hillsii Dodson cf. —DQ210073, DQ210515, DQ210996, DQ209798, DQ872578, Whitten 2745,
DQ210616, DQ209386, —, Blanco 2954, Ecuador, cult., FLAS. M. Ecuador, cult., FLAS. M. cf. loretoensis C.Schweinf.—DQ210361,
horichii Senghas—DQ210452, DQ210937, DQ209736, DQ872559, DQ210856, DQ209648, —, Whitten 2400, Ecuador, cult., QCA. M.
Whitten 2602, Panama, cult., FLAS. M. horichii—DQ210462, lueri Dodson—DQ210003, DQ210581, DQ209319, —, Atwood &
DQ210946, DQ209745, —, Whitten 2615, Panama, FLAS. M. cf. Whitten 5085, cult., SEL. M. lueri—DQ210303, DQ210802,
horichii—DQ210002, DQ210580, DQ209318, —, Atwood & Whitten DQ209591, —, Whitten 2051, Costa Rica, FLAS. M. lueri—
5084, Costa Rica, cult., SEL. M. houtteana Rchb.f.—DQ210559, DQ210471, DQ210954, DQ209754, DQ872562, Whitten 2629,
DQ211034, DQ209839, —, Whitten 2910, Mexico, cult., FLAS. M. Panama, FLAS. M. lutheri J.T.Atwood—DQ210422, DQ210909,
huebschii Rchb.f.—DQ210570, DQ211045, DQ209850, —, Whitten DQ209707, —, Whitten 2563, Panama, FLAS. M. lutheri—
2935, Ecuador, cult., FLAS. M. imbricata Barb.Rodr.—DQ210329, DQ210426, DQ210913, DQ209711, —, Whitten 2567, Panama, cult.,
DQ210828, DQ209616, DQ872542, Whitten 2337, Ecuador, FLAS. FLAS. M. lutheri—DQ210428, DQ210915, DQ209713, —, Whitten
M. imbricata—DQ210111, DQ210642, DQ209422, —, Koehler 2569, Panama, Chiriquı́, cult., FLAS. M. madida Lindl.—DQ210119,
0025, Brazil, UEC. M. inaudita Rchb.f.—DQ209977, DQ209855, DQ210650, DQ209430, —, Koehler 0065, Brazil, SP. M. madida—
DQ209294, —, Atwood & Whitten 5054, Panama, SEL. M. inaudita— DQ210125, DQ210656, DQ209436, —, Koehler 0081, Brazil, SP M.
DQ210524, DQ211004, DQ209806, —, Whitten 2763, Panama, madida—DQ210138, DQ210669, DQ209448, —, Koehler 0107,
FLAS. M. irrorata Rchb.f—DQ210430, DQ210917, DQ209714, —, Brazil, SP. M. madida—DQ210284, DQ209949, DQ209576, —,
Whitten 2571, Ecuador, cult., FLAS. M. johannis Pabst—DQ210147, Whitten 1868, Brazil, cult., FLAS. M. cf. madida—DQ210498,
DQ210980, DQ209782, —, Whitten 2673, Ecuador, cult., FLAS. M. Koehler 0033, Brazil, UEC. M. notylioglossa—DQ210167,
mapiriensis (Kraenzl.) L.O. Williams—DQ210571, DQ211046, DQ210697, —, DQ872601, Koehler 0255, Brazil, UEC. M. cf.
DQ209851, —, Whitten 2936, Ecuador, cult., FLAS. M. nubigena (Rchb.f.) C.Schweinf.—DQ210507, DQ210988,
marmoliana Dodson—DQ210349, DQ209954, DQ209636, —, DQ209790, —, Whitten 2718, Ecuador, FLAS. M. cf. nubigena—
Whitten 2381, Ecuador, cult., FLAS. M. meleagris Lindl.— DQ461789, DQ461807, DQ461771, —, Whitten 3160, Ecuador, QCA.
DQ210038, DQ209886, DQ209353, —, Blanco 1604, Guatemala, M. aff. nutans Lindl.—DQ210561, DQ211036, DQ209841, —,
cult., FLAS. M. meleagris—DQ210539, DQ211014, DQ209821, —, Whitten 2912, Ecuador, cult., FLAS. M. obscura Linden & Rchb.
Whitten 2816, Guatemala, cult., FLAS. M. meridensis Lindl.— f.—DQ210048, DQ209895, DQ209363, —, Blanco 1827, Costa Rica,
DQ210037, DQ209885, DQ209351, —, Blanco 1562, Costa Rica, cult., USJ. M. ochroleuca Lodd. ex Lindl.—DQ210105, DQ210636,
cult., USJ. M. meridensis—DQ210258, DQ210770, DQ209552, —, DQ209417, —, Koehler 0011, Brazil, UEC. M. ochroleuca—
Whitten 1568, Ecuador, FLAS. M. meridensis—DQ210270, DQ210346, DQ210844, DQ209633, DQ872546, Whitten 2378,
DQ210780—, —, Whitten 1647, Ecuador, cult., FLAS. M. Ecuador, cult., FLAS. M. oreocharis Schltr.—DQ210004,
meridensis—DQ210379, DQ210870, DQ209665, DQ872550, DQ210582, DQ209320, —, Atwood & Whitten 5086, Costa Rica,
Whitten 2451, Ecuador, cult., FLAS. M. meridensis—DQ210427, SEL. M. oreocharis—DQ210444, DQ210929, DQ209728, —,
DQ210914, DQ209712, —, Whitten 2568, Panama, cult., FLAS. M. Whitten 2594, Panama, FLAS. M. oreocharis—DQ210465,
mexicana J.T.Atwood—DQ210299, DQ210798, DQ209588, —, DQ210949, DQ209748, —, Whitten 2619, Panama, FLAS. M.
Whitten 1989, cult., FLAS. M. microphyton Schltr.—DQ210316, oreocharis—DQ210488, DQ210971, DQ209772, DQ872569,
DQ210815, DQ209604, —, Whitten 2307, Costa Rica, cult., FLAS. M. Whitten 2652, Panama, FLAS. M. pacholskii Christenson—
microphyton—DQ210442, DQ210927, DQ209726, —, Whitten 2586, DQ210355, DQ210851, DQ209642, DQ872600, Whitten 2393,
Panama, cult., FLAS. M. microphyton—DQ210493, DQ210976, Ecuador, cult., FLAS. M. pacholskii—DQ210382, DQ210873,
DQ209777, —, Whitten 2659, Panama, FLAS. M. cf. DQ209668, —, Whitten 2464, Ecuador, cult., FLAS. M.
microphyton—DQ210017, DQ210589, DQ209331, —, Dressler & pacholskii—DQ210402, DQ210889, DQ209687, —, Whitten 2501,
Atwood 6238, Panama, PMA. M. miniata (Lindl.) L.O. Williams— Ecuador, cult., FLAS. M. pachyacron Schltr.—DQ210059,
DQ210062, DQ209908, DQ209377, —, Blanco 2261, Venezuela, cult., DQ209906, DQ209374, —, Blanco 2235, Costa Rica, USJ. M.
USJ. M. minor (Schltr.) L.O.Williams—DQ210448, DQ210933, pachyacron—DQ210021, DQ210593, DQ209335, —, Dressler &
DQ209732, —, Whitten 2598, Panama, cult., FLAS. M. minor— Atwood 6249, Panama, PMA. M. pachyacron—DQ210489,
DQ210457, DQ210941, DQ209741, —, Whitten 2607, Panama, cult., DQ210972, DQ209773, DQ872570, Whitten 2653, Panama, cult.,
FLAS. M. minor—DQ210470, DQ210953, DQ209753, —, Whitten FLAS. M. pachyphylla Schltr. ex Hoehne—DQ210015, DQ209879,
2628, Panama, FLAS. M. minuta Cogn.—DQ210133, DQ210664, DQ209329, —, Atwood & Whitten 5098, Brazil, cult., SEL. M.
DQ209444, —, Koehler 0097, Brazil, cult., SP M. minuta— pachyphylla—DQ210137, DQ210668, —, DQ872522, Koehler 0105,
DQ210166, DQ210696, DQ209474, —, Koehler 0253, Brazil, UEC. Brazil, SP. M. pachyphylla—DQ210203, DQ210733, DQ209510, —,
M. modesta Schltr.—DQ210195, DQ210725, DQ209502, —, Koehler Koehler 0369, Brazil, cult., ESA. M. pachyphylla—DQ210285,
0351, Brazil, UEC. M. molitor Rchb.f.—DQ210369, DQ210863, DQ209950—, —, Whitten 1868, Brazil, cult., FLAS. M. paleata
DQ209656, —, Whitten 2424, Ecuador, cult., FLAS. M. molitor— (Rchb.f.) Ames & Correll—DQ210420, DQ210907, DQ209705,
DQ210370, DQ210864, DQ209657, —, Whitten 2425, Ecuador, cult., DQ872556, Whitten 2561, Panama, FLAS. M. paleata (Rchb.f.)
FLAS. M. moralesii Carnevali & J.T.Atwood—DQ210051, Ames & Correll—DQ210421, DQ210908, DQ209706, —, Whitten
DQ209898, DQ209366, —, Blanco 2097, Costa Rica, USJ. M. 2562, Panama, FLAS. M. paleata—DQ210424, DQ210911,
moralesii—DQ210295, DQ210794—, —, Whitten 1976, Costa Rica, DQ209709, —, Whitten 2565, Panama, cult., FLAS. M. pardalina
FLAS. M. mosenii var. echinochila Hoehne—DQ210128, Garay—DQ210065, DQ210608—, —, Blanco 2524, Ecuador, FLAS.
DQ210659, DQ209439, —, Koehler 0087, Brazil, SP. M. mosenii M. parkeri Hook.—DQ210144, DQ210675, DQ209454, —, Koehler
var. echinochila—DQ210177, DQ210707, DQ209484, —, Koehler 0119, Brazil, UEC. M. parviflora (Poepp. & Endl.) Garay—
0294, Brazil, ESA. M. mosenii var. hatschbachii Hoehne— DQ209990, DQ209866, DQ209307, DQ872530, Atwood & Whitten
DQ210121, DQ210652, DQ209432, —, Koehler 0071, Brazil, UEC. 5070, Costa Rica, SEL. M. parviflora—DQ210112, DQ210643,
M. mosenii var. hatschbachii—DQ210126, DQ210657, DQ209437, DQ209423, —, Koehler 0027, Brazil, UEC. M. parviflora—
—, Koehler 0083, Brazil, SP. M. multicaulis (Poepp. & Endl.) C. DQ210302, DQ210801, DQ209590, —, Whitten 2019, Haiti, FLAS.
Schweinf.—DQ210557, DQ211032, —, DQ872589, Whitten 2905, M. parviflora—DQ210541, DQ211016, DQ209823, —, Whitten
Ecuador, cult., FLAS. M. multiflora Barb.Rodr.—DQ210186, 2822, Jamaica, cult., FLAS. M. patens Schltr.—DQ210261,
DQ210716, DQ209493, —, Koehler 0325, Brazil, ESA. M. DQ210772, DQ209555, —, Whitten 1580, Ecuador, FLAS. M.
murilliana Hoehne—DQ210548, DQ211023, DQ209830, —, patens Schltr.—DQ210505, DQ210986, DQ209788, —, Whitten
Whitten 2883, Brazil, cult., FLAS. M. nardoides Kraenzl.— 2715, Ecuador, FLAS. M. patens—DQ210528, DQ211006,
DQ210335, DQ210833—, —, Whitten 2359, Ecuador, cult., FLAS. DQ209810, —, Whitten 2778, Panama, cult., FLAS. M. aff.
M. nardoides—DQ210403, DQ210890, DQ209688, DQ872554, patens—DQ210509, DQ210990, DQ209792, —, Whitten 2725,
Whitten 2502, Ecuador, cult. Ecuagenera, FLAS. M. nasuta Rchb. Ecuador, FLAS. M. pauciflora Barb.Rodr.—DQ210093, DQ210631,
f.—DQ210169, DQ210699, DQ209476, —, Koehler 0261, Brazil, DQ209405, —, Jost 5002, Ecuador, QCA. M. pauciflora—
ESA. M. nasuta—DQ210241, DQ210756, DQ209539, DQ872532, DQ210344, DQ210841, DQ209630, —, Whitten 2368, Ecuador,
Whitten 1869, Ecuador, FLAS. M. neglecta (Schltr.) L.O. Williams— FLAS. M. pauciflora—DQ210390, DQ209964, DQ209675, —,
DQ210045, DQ209892, DQ209360, —, Blanco 1680, Costa Rica, Whitten 2484, Ecuador, cult., FLAS. M. pendens Pabst—, —,
USJ. M. cf. neglecta —DQ210383, DQ210874, DQ209669, —, DQ210677, DQ209456, —, Koehler 0128, Brazil, cult., UEC. M.
Whitten 2466, Ecuador, cult., FLAS. M. neophylla Rchb.f.— pendula (Poepp. & Endl.) C.Schweinf.—DQ210405, DQ210892,
DQ210550, DQ211025, DQ209831, —, Whitten 2891, Ecuador, DQ209690, —, Whitten 2513, Ecuador, cult., FLAS. M. perryae
cult., FLAS. M. neowiedii Rchb.f.—DQ210122, DQ210653, Dodson—DQ210006, DQ210584—, —, Atwood & Whitten 5088,
DQ209433, —, Koehler 0073, Brazil, SP M. neowiedii— Ecuador, SEL. M. perryae—DQ461786, DQ461804, DQ461768, —,
DQ210130, DQ210661, DQ209441, —, Koehler 0091, Brazi, SP. Jost 8101, Ecuador, QCA. M. perryae—DQ210275, DQ209944,
M. neowiedii—DQ210163, DQ209922, DQ209471, —, Koehler DQ209569, —, Whitten 1672, Ecuador, cult., FLAS. M. aff. perryae—
0241, Brazil, UEC. M. nicaraguensis (Hamer & Garay) J.T. DQ461801, DQ461819, DQ461783, —, Whitten 3200, Ecuador, cult.,
Atwood— —, DQ210604, DQ209352, —, Blanco 1582, Costa Rica, QCA. M. pittieri (Ames) L.O. Williams—DQ210060, DQ209907,
USJ. M. niesseniae Christenson—DQ210560, DQ211035, DQ209375, —, Blanco 2237, Costa Rica, USJ. M. pittieri—
DQ209840, —, Whitten 2911, Colombia, cult., FLAS. M. DQ210439, DQ209966, DQ209723, —, Whitten 2580, Panama,
notylioglossa Rchb.f.—DQ210114, DQ210645, DQ209425, —, FLAS. M. platypetala Ruiz & Pav.—DQ210558, DQ211033,
DQ209838, —, Whitten 2909, Peru, cult., FLAS. M. plebeja Rchb.f.— Ecuador, FLAS. M. rufescens Lindl.—DQ209993, DQ209868,
DQ210127, DQ210658, DQ209438, —, Koehler 0085, Brazil, SP. M. DQ209310, —, Atwood & Whitten 5073, cult., SEL. M. rufescens—
plebeja—DQ210207, DQ210737, DQ209514, —, Koehler 1653, DQ210191, DQ210721, DQ209498, —, Koehler 0339, Brazil, UEC.
Brazil, SP. M. plebeja—DQ210281, DQ209947, DQ209573, —, M. rufescens—DQ210521, DQ211001—, —, Whitten 2754, cult.,
Whitten 1834, Brazil, cult., FLAS. M. ponerantha Rchb.f.— FLAS. M. cf. rufescens—DQ210168, DQ210698, DQ209475, —,
DQ210339, DQ210837, DQ209625, —, Whitten 2363, Ecuador, Koehler 0258, Brazil, UEC. M. cf. rufescens—DQ210274,
cult., FLAS. M. ponerantha—DQ210417, DQ210904, DQ209702, DQ209943, DQ209568, —, Whitten 1669, Ecuador, cult., FLAS. M.
—, Whitten 2555, Panama, FLAS. M. ponerantha—DQ210490, rupestris Barb.Rodr.—DQ210106, DQ210637, DQ209418, —,
DQ210973, DQ209774, DQ872571, Whitten 2654, Panama, cult., Koehler 0013, Brazil, UEC. M. rupestris—DQ210118, DQ210649,
FLAS. M. aff. ponerantha—DQ210418, DQ210905, DQ209703, —, DQ209429, —, Koehler 0063, Brazil, UEC. M. sanantonioensis
Whitten 2558, Panama, cult., FLAS. M. porrecta Lindl.—DQ209985, Christenson—DQ210415, DQ210902, DQ209700, —, Whitten 2552,
DQ210576, DQ209302, —, Atwood & Whitten 5064, Ecuador, cult., Colombia, cult., FLAS. M. sanderiana Rchb.f. ex Sander—
SEL. M. porrecta—DQ210031, DQ209880, DQ209345, —, Blanco DQ210368, DQ210862, DQ209655, —, Whitten 2422, Ecuador,
0337, Costa Rica, cult., USJ. M. porrecta—DQ210100, DQ209919, cult., FLAS. M. sanderiana—DQ210271, DQ210781, DQ209564,
DQ209412, —, Pupulin 0978, Costa Rica, USJ. M. porrecta— —, Whitten 1652, Ecuador, cult., FLAS. M. sanderiana—DQ210453,
DQ210291, DQ210791, DQ209582, —, Whitten 1966, Costa Rica, DQ209967, DQ209737, —, Whitten 2603, Ecuador, cult., FLAS. M.
cult., FLAS. M. porrecta—DQ210292, —, DQ209583, —, Whitten sanguinea Rolfe—DQ210081, DQ209910, DQ209394, —, Blanco
1967, Ecuador, FLAS. M. porrecta—DQ210464, DQ210948, s.n., Costa Rica, cult., USJ. M. scalariformis J.T.Atwood—
DQ209747, DQ872560, Whitten 2617, Panama, FLAS. M. DQ210023, DQ210595, DQ209337, —, Dressler & Atwood 6252,
porrecta—DQ210568, DQ211043, DQ209848, —, Whitten 2931, Panama, PMA. M. scalariformis—DQ210419, DQ210906,
Venezuela, cult., FLAS. M. proboscidea Rchb.f.—DQ209979, DQ209704, —, Whitten 2559, Panama, FLAS. M. scalariformis—
DQ209857, DQ209296, DQ872531, Atwood & Whitten 5056, DQ210475, DQ210957, DQ209758, DQ872564, Whitten 2633,
Venezuela, cult., SEL. M. procurrens Lindl.—DQ210272, Panama, FLAS. M. schlechteriana (C.Schweinf.) J.T.Atwood—
DQ210782, DQ209565, —, Whitten 1657, Ecuador, cult., FLAS. M. DQ210043, DQ209890, DQ209358, —, Blanco 1662, Costa Rica,
procurrens—DQ210358, DQ210854, DQ209645, DQ872548, USJ. M. schlechteriana—DQ210304, DQ210803, DQ209592, —,
Whitten 2397, Ecuador, cult., FLAS. M. procurrens—DQ210373, Whitten 2157, Costa Rica, FLAS. M. scorpioidea Kraenzl.—
DQ210865, DQ209660, —, Whitten 2438, Ecuador, cult., FLAS. M. DQ210058, DQ209905, DQ209373, —, Blanco 2143, Costa Rica,
procurrens—DQ210380, DQ210871, DQ209666, —, Whitten 2452, cult., USJ. M. cf. scorpoidea— —, DQ210843, DQ209632, —,
Ecuador, cult., FLAS. M. pseudoneglecta J.T.Atwood—DQ210007, Whitten 2373, Ecuador, cult., FLAS. M. serrulata Ames & Correll—
DQ209874, DQ209322, —, Atwood & Whitten 5089, Costa Rica, cult., DQ210082, DQ209911, DQ209395, —, Blanco s.n., Costa Rica, USJ.
SEL. M. pseudoneglecta—DQ210222, DQ209927, DQ209523, —, M. setigera Lindl.—DQ210230, DQ209933, DQ209529, —, Atwood
Whitten 2626, Panama, FLAS. M. pseudoreichenheimiana Dodson— s.n., cult., SEL. M. setigera—DQ210143, DQ210674, DQ209453, —,
DQ209996—, —, —, Atwood & Whitten 5078, Ecuador, cult., SEL. Koehler 0117, Brazil, cult., UEC. M. sigmoidea (C.Schweinf.) Ames
M. pseudoreichenheimiana—DQ210328, DQ210827—, —, Whitten & Correll—DQ210057, DQ209904, DQ209372, —, Blanco 2141,
2335, Ecuador, FLAS. M. pulla Linden & Rchb.f.—DQ210381, Costa Rica, cult., USJ. M. sigmoidea—DQ210072, DQ210615,
DQ210872, DQ209667, DQ872551, Whitten 2459, Ecuador, cult., DQ209385, —, Blanco 2915, Panama, FLAS. M. sigmoidea—
FLAS. M. pumila Hook.—DQ210131, DQ210662, DQ209442, —, DQ210018, DQ210590, DQ209332, —, Dressler & Atwood 6240,
Koehler 0094, Brazil, cult., SP. M. pumila—DQ210135, DQ210666, Panama, FLAS. M. silvana Campacci—DQ210516, DQ210997,
DQ209446, —, Koehler 0101, Brazil, SP. M. pumila—DQ210164, DQ209799, DQ872579, Whitten 2747, Ecuador, FLAS. M. cf.
DQ210694, DQ209472, —, Koehler 0243, Brazil, UEC. M. pumila— silvana —DQ210391, DQ210878, DQ209676, —, Whitten 2485,
DQ210198, DQ210728, DQ209505, —, Koehler 0355, Brazil, UEC. Ecuador, cult., FLAS. M. sophronitis (Rchb.f.) Garay—DQ210310,
M. pumila—DQ210083, DQ209912—, —, Pupulin s.n., Costa Rica, DQ210809, DQ209598, DQ872593, Whitten 2296, Venezuela, cult.,
cult., USJ. M. punctostriata Rchb.f.—DQ210056, DQ209903, FLAS. M. sophronitis—DQ210461, DQ210945—, —, Whitten 2613,
DQ209371, —, Blanco 2107, Costa Rica, cult., USJ. M. Venezuela, cult., FLAS. M. speciosa Rchb.f.—DQ210075,
punctostriata—DQ210409, DQ210896, DQ209694, —, Whitten DQ210618, DQ209388, —, Blanco 2957, Colombia, cult., FLAS.
2543, Ecuador, cult., FLAS. M. ramonensis Schltr.—DQ210099, M. splendens Poepp. & Endl.—DQ210152, DQ210684, DQ209462,
DQ209918, DQ209411, —, Mora s.n., Costa Rica, cult., USJ. M. —, Koehler 0144, Brazil, cult., UEC. M. splendens—DQ210289,
reichenheimiana Endres & Rchb.f.—DQ210053, DQ209900, DQ210789, DQ209580, —, Whitten 1962, Suriname, cult. FLAS. M.
DQ209368, —, Blanco 2102, Costa Rica, cult., USJ. M. cf. splendens—DQ210388, DQ210876, DQ209674, —, Whitten 2482,
reichenheimiana—DQ210463, DQ210947, DQ209746, —, Whitten Ecuador, cult., FLAS. M. squamata Barb.Rodr. —DQ461798,
2616, Panama, FLAS. M. reichenheimiana—DQ210503, DQ210984, DQ461816, DQ461780, —, Whitten 3193, Ecuador, cult., QCA. M.
DQ209786, —, Whitten 2713, Ecuador, FLAS. M. repens L.O. striata Rolfe—DQ210267, DQ210777, DQ209561, —, Whitten 1639,
Williams—DQ210070, DQ210613, DQ209384, —, Blanco 2911, Ecuador, cult., FLAS. M. strumata (Endres & Rchb.f.) Ames &
Panama, FLAS. M. richii Dodson—DQ209995, DQ209870, Correll—DQ210179, DQ210709, DQ209486, —, Koehler 0302, Costa
DQ209312, —, Atwood & Whitten 5077, Ecuador, cult., SEL. M. Rica, cult., ESA. M. strumata—DQ210245, DQ210761—, —,
richii—DQ210338, DQ210836, DQ209624, DQ872545, Whitten Whitten 3021, Guatemala, cult., FLAS. M. strumata 3 M.
2362, Ecuador, cult., FLAS. M. cf. richii—DQ461784, DQ461802, pseudoneglecta—DQ210042, DQ210605, DQ209357, —, Blanco
DQ461766, —, Blanco 3108, cult., FLAS. M. rigida Barb.Rodr.— 1661, Costa Rica, USJ. M. suarezorum Dodson—DQ210523,
DQ210104, DQ210635, DQ209416, —, Koehler 0007, Brazil, cult., DQ211003, DQ209805, —, Whitten 2758, Ecuador, cult., FLAS. M.
UEC. M. rigida—DQ210116, DQ210647, DQ209427, —, Koehler suarezorum—DQ210553, DQ211028, DQ209834, DQ872605,
0053, Brazil, UEC. M. ringens Rchb.f.—DQ210047, DQ209894, Whitten 2895, Ecuador, cult., FLAS. M. synsepala J.T.Atwood—
DQ209362, —, Blanco 1727, Costa Rica, USJ. M. robusta Barb. DQ210076, DQ210619, DQ209389, —, Blanco 2962, Panama, FLAS.
Rodr.—DQ210192, DQ210722, DQ209499, —, Koehler 0343, Brazil, M. tenuibulba Christenson—DQ210552, DQ211027, DQ209833, —,
UEC. M. rodrigueziana J.T.Atwood & Mora-Ret.—DQ210061, Whitten 2894, Colombia, cult., FLAS. M. tenuifolia Lindl.—
DQ210606, DQ209376, —, Blanco 2258, Costa Rica, USJ. M. DQ210282, DQ210787, DQ209574, —, Whitten 1843, cult., FLAS.
rotundilabia C.Schweinf.—DQ210406, DQ210893, DQ209691, —, M. tigrina C.Schweinf.—DQ210085, DQ210625, DQ209397, —,
Whitten 2516, Ecuador, FLAS. M. rotundilabia—DQ461792, Gerlach 2001–2204, Panama, cult., M. M. tigrina—DQ210244,
DQ461810, DQ461774, —, Whitten 3173, Ecuador, QCA. M. rubioi DQ210760—, —, Whitten 2991, Panama, cult., FLAS. M. tonduzii
Dodson—DQ210327, DQ210826, DQ209615, —, Whitten 2334, (Schltr.) Ames & Correll—DQ210028, DQ210600, DQ209342, —,
Dressler & Atwood 6276, Panama, PMA. M. trilobata Ames & DQ209837, —, Whitten 2904, Ecuador, cult., FLAS. Maxillaria sp.—
Correll—DQ210030, DQ210602, DQ209344, —, Dressler & Atwood DQ461794, DQ461812, DQ461776, —, Whitten 3186, Ecuador, cult.,
6278, Panama, PMA. M. trilobata—DQ210101, DQ209920, QCA. Maxillaria sp.—DQ461785, DQ461803, DQ461767, —, Jost
DQ209413, —, Pupulin 2000, Costa Rica, cult., USJ. M. triloris E. 7921, Ecuador, QCA.
Morren—DQ210039, DQ209887, DQ209354, —, Blanco 1640, Mormolyca gracilipes (Schltr.) Garay & Wirth—DQ210090, DQ209914,
Colombia, cult., USJ. M. triloris—DQ210078, DQ210621, DQ209402, —, Hirtz 8088, Ecuador, cult., QCNE. M. peruviana C.
DQ209391, —, Blanco 2967, Colombia, cult., FLAS. M. triloris— Schweinf.—DQ210398, DQ210885, DQ209683, DQ872553, Whitten
DQ210255, DQ209940, DQ209549, —, Whitten 1558, Ecuador, 2497, Ecuador, cult., FLAS. M. polyphylla Garay & Wirth—
FLAS. M. triloris—DQ210563, DQ211038, DQ209843, DQ872590, DQ210534, DQ211009, DQ209816, —, Whitten 2789, Ecuador,
Whitten 2917, Colombia, cult., FLAS. M. triloris—DQ210567, cult., FLAS. M. ringens (Lindl.) Gentil—DQ210148, DQ210680—,
DQ211042, DQ209847, —, Whitten 2928, Colombia, cult., FLAS. —, Koehler 0134, Brazil, cult., UEC. M. ringens—DQ210219,
M. cf. triloris—DQ210342, DQ210839, DQ209628, —, Whitten 2366, DQ209925, —, DQ872524, Whitten 2871, Mexico, cult. SEL. M.
Ecuador, cult., FLAS. M. tubercularis J.T.Atwood—DQ210446, schweinfurthiana Garay & Wirth—DQ210234, DQ210750—, —,
DQ210931, DQ209730, —, Whitten 2596, Panama, FLAS. M. aff. Whitten 97085, Peru, cult., FLAS. M. schweinfurthiana—DQ210249,
tubercularis—DQ210540, DQ211015, DQ209822, —, Whitten 2817, DQ210764, DQ209543, —, Whitten 3109, Ecuador, cult., QCA.
Panama, cult., FLAS. M. turkeliae Christenson—DQ210276, Neomoorea wallisii (Rchb.f.) Schltr.—DQ210216, DQ210743,
DQ209945, DQ209570, —, Whitten 1675, Ecuador, cult., FLAS. M. DQ209520, —, Whitten 3010, Panama, cult., FLAS.
tutae J.T.Atwood—DQ210071, DQ210614—, —, Blanco 2913, Pityphyllum antioquiense Schltr.—DQ210371, DQ209958, DQ209658,
Panama, FLAS. M. umbratilis L.O. Williams—DQ210040, —, Whitten 2436, Ecuador, cult., FLAS. P. antioquiense—DQ210384,
DQ209888, DQ209355, —, Blanco 1642, Costa Rica, USJ. M. DQ209961, DQ209670, DQ872594, Whitten 2473, Ecuador, cult.,
umbratilis—DQ210049, DQ209896, DQ209364, —, Blanco 1835, FLAS. P. huancabambae (Kraenzl.) Whitten—DQ210362,
Costa Rica, USJ. M. umbratilis—DQ210450, DQ210935, DQ209734, DQ209957, DQ209649, —, Whitten 2402, Ecuador, cult., FLAS. P.
—, Whitten 2600, Panama, cult., FLAS. M. umbratilis—DQ210482, pinoides Sweet—DQ210089, DQ209913, DQ209401, —, Whitten
DQ210964, DQ209765, —, Whitten 2643, Panama, FLAS. M. cf. 2401, Ecuador, cult., FLAS. P. pinoides—DQ210375, DQ209960,
umbratilis—DQ210485, DQ210968, DQ209769, —, Whitten 2648, DQ209662, —, Whitten 2440, Ecuador, cult., FLAS. P. saragurense
Panama, cult., FLAS. M. uncata Lindl.—DQ210123, DQ210654, (Dodson) Whitten—DQ461787, DQ461805, DQ461769, DQ872597,
DQ209434, —, Koehler 0075, Brazil, cult., SP. M. uncata— Whitten 3084, Ecuador, cult., QCA.
DQ210199, DQ210729, DQ209506, —, Koehler 0359, Brazil, UEC. Rudolfiella floribunda (C.Schweinf.) Hoehne—DQ210394, DQ210881,
M. uncata—DQ210356, DQ210852, DQ209643, —, Whitten 2394, DQ209679, —, Whitten 2489, Ecuador, cult., FLAS.
Ecuador, cult., FLAS. M. uncata—DQ210459, DQ210943, Scuticaria salesiana Dressler—DQ210385, DQ210875, DQ209671, —,
DQ209743, —, Whitten 2609, Panama, cult., FLAS. M. cf.
Whitten 2478, Ecuador, cult., FLAS.
uncata—DQ210496, DQ210979, DQ209780, —, Whitten 2670,
Trigonidium acuminatum Bateman in Lindl.—DQ210109, DQ210640—,
Ecuador, cult., FLAS. M. aff. uncata—DQ210223, DQ209928,
—, Koehler 0021, Brazil, cult., UEC. T. acuminatum—DQ210153,
DQ209524, —, Atwood & Whitten 5076, Ecuador, cult., SEL. M.
DQ210685, DQ209463, —, Koehler 0145, Brazil, cult., UEC. T.
vaginalis Rchb.f.—DQ210306, DQ210805, DQ209594, —, Whitten
acuminatum—DQ210201, DQ210731, DQ209508, DQ872604,
2259, Costa Rica, cult., FLAS. M. aff. vaginalis—DQ210436,
Koehler 0363, Brazil, ESA. T. acuminatum—DQ210376,
DQ210922, DQ209720, —, Whitten 2577, Panama, Chiriquı́, cult.,
DQ210867—, —, Whitten 2442, Ecuador, cult., FLAS. T.
FLAS. M. variabilis Bateman ex Lindl.—DQ209998, DQ209872,
DQ209314, —, Atwood & Whitten 5080, Nicaragua, cult. SEL. M. egertonianum Bateman in Lindl.—DQ210184, DQ210714,
variabilis—DQ210035, DQ209883, DQ209349, —, Blanco 1076, DQ209491, DQ872527, Koehler 0317, Costa Rica, cult., ESA. T.
Costa Rica, cult., USJ. M. variabilis—DQ210187, DQ210717, egertonianum—DQ210200, DQ210730, DQ209507, DQ872603,
DQ209494, —, Koehler 0327, Mexico, cult., ESA. M. cf. Koehler 0361, Brazil, cult., UEC. T. egertonianum—DQ210211,
variabilis—DQ210514, DQ210995, DQ209797, DQ872577, Whitten DQ210740, DQ209517, —, Whitten 2993, cult., FLAS. T. insigne
2737, Panama, cult., FLAS. M. vernicosa Barb.Rodr.—DQ210134, Rchb.f. in Benth. & Hook.f.—DQ210266, DQ210776, DQ209560, —,
DQ210665, DQ209445, —, Koehler 0099, Brazil, SP. M. vernicosa— Whitten 1599, Ecuador, FLAS. T. insigne—DQ210423, DQ210910,
DQ210136, DQ210667, DQ209447, —, Koehler 0103, Brazil, SP. M. DQ209708, —, Whitten 2564, cult., FLAS. T. insigne—DQ210494,
vernicosa—DQ210287, DQ209952, DQ209578, —, Whitten 1871, DQ210977, DQ209778, —, Whitten 2660, Ecuador, cult., FLAS. T.
Brazil, cult., FLAS. M. vittariifolia L.O. Williams—DQ210102, insigne—DQ210566, DQ211041, DQ209846, DQ872591, Whitten
DQ209921, DQ209414, —, Pupulin 2193, Costa Rica, USJ. M. 2926, Ecuador, cult., FLAS. T. obtusum Lindl.—DQ210110,
vittariifolia—DQ210283, DQ209948, DQ209575, —, Whitten 1867, DQ210641, DQ209421, —, Koehler 0023, Brazil, UEC. T.
Costa Rica, cult., FLAS. M. wercklei (Schltr.) L.O. Williams— obtusum—DQ210220, DQ210746, DQ209521, DQ872525, Whitten
DQ210477, DQ210959, DQ209760, —, Whitten 2635, Panama, 2997, cult., FLAS. T. riopalenquense Dodson—DQ210014,
FLAS. M. cf. wercklei—DQ210377, DQ210868, DQ209663, —, DQ210587, DQ209328, —, Atwood & Whitten 5097, Ecuador, cult.,
Whitten 2443, Ecuador, cult., FLAS. M. whittenii Dodson— SEL. T. riopalenquense—DQ210252, DQ210766, DQ209546, —,
DQ210340, —, DQ209626, —, Whitten 2364, Ecuador, cult., FLAS. Whitten 1534, Ecuador, FLAS. Trigonidium sp. nov.—DQ210183,
M. witsenioides Schltr.—DQ210247, DQ209937, DQ209541, —, DQ210713, DQ209490, DQ872526, Koehler 0315, Brazil, UEC.
Whitten 1600, Ecuador, FLAS. M. woytkowskii C.Schweinf.— Trigonidium sp. nov.—DQ210185, DQ210715, DQ209492, —,
DQ210531, DQ211007, DQ209813, —, Whitten 2782, Bolivia, cult., Koehler 0319, Brazil, ESA.
FLAS. M. yanganensis Dodson—DQ461790, DQ461808, Xylobium leontoglossum (Rchb.f.) Rolfe—DQ210499, DQ209970—, —,
DQ461772, —, Whitten 3161, Ecuador, QCA. Maxillaria sp.— Whitten 2683, Ecuador, FLAS. X. leontoglossum—DQ210254,
DQ210094, DQ210632, DQ209406, —, Jost 6100, Ecuador, QCA. DQ209939, DQ209548, DQ872534, Whitten 1557, Ecuador, FLAS.
Maxillaria sp.—DQ210095, DQ210633, DQ209407, —, Jost 6406, X. pallidiflorum (Hook.) G. Nicholson—AF239338, AF239434—, —,
Ecuador, QCA. Maxillaria sp.—DQ210317, DQ210816, DQ209605, Whitten 1876, Ecuador, FLAS. X. subpulchrum Dressler—DQ210218,
—, Whitten 2310, Peru, cult., FLAS. Maxillaria sp.—DQ210348, DQ210745—, —, Whitten 94013, Peru, cult., FLAS. X. zarumense
DQ210846, DQ209635, —, Whitten 2380, Ecuador, cult., FLAS. Dodson—AF239339, AF239435, DQ209578, —, Whitten 1881,
Maxillaria sp.—DQ210392, DQ210879, DQ209677, —, Whitten Ecuador, FLAS. Xylobium sp.—DQ210160, DQ210692, DQ209468,
2486, Ecuador, cult., FLAS. Maxillaria sp.—DQ210556, DQ211031, —, Koehler 0166, Brazil, cult., UEC.

American J of Botany - 2007 - Whitten - Molecular Phylogenetics of Maxillaria and Related Genera Orchidaceae Cymbidieae

Uploaded by

Copyright:

Available Formats

American J of Botany - 2007 - Whitten - Molecular Phylogenetics of Maxillaria and Related Genera Orchidaceae Cymbidieae

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

American J of Botany - 2007 - Whitten - Molecular Phylogenetics of Maxillaria and Related Genera Orchidaceae Cymbidieae

Uploaded by

Copyright:

Available Formats

American Journal of Botany 94(11): 1860–1889. 2007.

MOLECULAR PHYLOGENETICS OF MAXILLARIA AND RELATED

W. MARK WHITTEN,2,3 MARIO A. BLANCO,4,5 NORRIS H. WILLIAMS,3 SAMANTHA KOEHLER,6

data. Heuristic searches consisted of 1000 random taxon addition replicates of

General features of the DNA regions and tree statistics from

Analysis of nrITS—Although nrITS is the shortest of the

Analysis of combined nrITS/matK/atpB-rbcL—Figures 1– Analysis of combined rpoC1/nrITS/matK/atpB-rbcL—The

M. acicularis—DQ210161, DQ210693, DQ209469, —, Koehler arbuscula—DQ210555, DQ211030, DQ209836, —, Whitten 2902,

You might also like