Microbiological Research: Saira Ali, Sohail Hameed, Muhammad Shahid, Mazhar Iqbal, George Lazarovits, Asma Imran

Microbiological Research 232 (2020) 126389
Contents lists available at ScienceDirect
Microbiological Research
journal homepage: www.elsevier.com/locate/micres
Functional characterization of potential PGPR exhibiting broad-spectrum T

antifungal activity
Saira Alia,b, Sohail Hameeda,c, Muhammad Shahida,d, Mazhar Iqbala, George Lazarovitse,
Asma Imrana,*
a
National Institute for Biotechnology and Genetic Engineering (NIBGE), P.O.Box 577, Jhang Road, Faisalabad, Pakistan
b
Pakistan Institute of Engineering and Applied Sciences (PIEAS), Islamabad, Pakistan
c
Department of Biosciences, University of Wah Research Lab. Complex, University of Wah, Wah Cantt, Pakistan
d
Department of Bioinformatics and Biotechnology, Government College University Faisalabad, Allama Iqbal Road, Faisalabad, Pakistan
e
A&L Biologicals, Agroecology Research Service Centre, 2136 Jet Stream Road, London ON, N5V 3P5, Canada
A R T I C LE I N FO A B S T R A C T
Keywords: This study describes the biocontrol potential of rhizobacteria against a range of fungal phytopathogens. Out of
Biocontrol 227 bacteria isolated from the rhizosphere of maize, rice, wheat, potato, sunflower and soybean crops cultivated
Plant growth-promoting rhizobacteria (PGPR) in different agro-ecological regions of Pakistan, 48 exhibited > 60 % antifungal activity against Fusarium oxy-
Phytopathogenic fungi sporum, Fusarium moniliforme, Rhizoctonia solani, Colletotrichum gloeosporioides, Colletotrichum falcatum,
Pseudomonas
Aspergillus niger, and Aspergillus flavus. The rhizobacteria inhibiting > 65 % pathogen growth were selected for
Bacillus
Antibiotics
detailed molecular and in planta studies most of which were identified as Pseudomonas and Bacillus species based
on 16S rRNA gene sequence analysis. Antifungal metabolites produced by these rhizobacteria analyzed through
LCMS were identified as antibiotics (iturin, surfactins, fengycin, DAPG, Phenazine, etc.), cell wall degrading
enzymes (protease, chitinase, and cellulase), plant growth promotion enzymes and hormones (indole-3-acetic
acid, ACC-deaminase, phosphates, nitrogen fixation), N-acyl-homoserine lactones and siderophores. The growth
room experiment validated the potential of these bacteria as biofertilizer and biopesticide agents. Of all, P.
aeruginosa strain FB2 and B. subtilis strain RMB5 showed significantly higher potential as antagonistic plant-
beneficial bacteria effective against a range of fungal phytopathogens. Both these bacteria can be used to develop
a dual-purpose bacterial inoculum as biopesticide and biofertilizer. Rest of the antagonistic PGPR may be
exploited for disease control in less-infested soils.
1. Introduction around the world and are encountered by several phytopathogens

causing significant economic losses and food shortage at a local, na-
The performance of global agriculture and associated food systems tional and global scale. If the situation is not controlled, the world will
is drastically decreasing due to the infestation of pests and pathogens (P see high yield losses shortly leading to a severe shortage of food espe-
&Ps). This is because P&Ps are an integral part of man-made agroeco- cially in food-deficit regions with a fast-growing population.
systems, continuously co-evolving and becoming more resilient due to A proximate, practicable and sustainable strategy against phyto-
climate change (Savary et al., 2019). Classical management practices of pathogens is to replace the chemical control with the biocontrol.
P&Ps include increased host plant resistance and the use of chemical Biocontrol is the application of microbial antagonists (biocontrol
pesticides. These strategies although partially effective; result in disease agents; BCAs) to suppress plant diseases (Pal and Gardener, 2006),
instability, outbreaks, pollution, and degradation of overall agroeco- weeds (Flores-Vargas and O’Hara, 2006) and insects (Péchy-Tarr et al.,
systems. Additional reasons for increased phytopathogens infestation 2008; O’ Brien, 2017). Compared to the agrochemicals, the molecules of
are the wide diversity and broad host range of pathogens, easy dispersal biological origin are easily biodegradable (Lugtenberg and Kamilova,
with the wind, farm machinery, and water, drastic changes in climate 2009). Moreover, the action of BCA is more transient and localized to
and large-scale genetically-uniform intensive monoculture crops (Pan the rhizosphere. The use of BCA guarantees increased efficacy, a heal-
et al., 2010). Wheat, rice, maize, and potato are major crops grown thier environment, safety of the user and consumer, cost-effectiveness,
⁎
Corresponding author.
E-mail addresses: [email protected], [email protected] (A. Imran).
https://doi.org/10.1016/j.micres.2019.126389
Received 31 July 2019; Received in revised form 21 October 2019; Accepted 29 November 2019
Available online 30 November 2019
0944-5013/ Crown Copyright © 2019 Published by Elsevier GmbH. All rights reserved.
S. Ali, et al. Microbiological Research 232 (2020) 126389
reduces the risk of the build-up of resistance in the pathogen and im- 72°59 E; elevation 184 m; annual rainfall 300 mm; dry semi-arid),
provements in overall crop health and yield (Urja and Saraf, 2014). Multan (30°12 N, 71°26 E; elevation 122 m; annual rainfall 119.7 mm;
The mode of action of BCAs is diverse either direct or indirect in- arid) and Peshawar (34 °N, 71°34 E; elevation 306 m; annual rainfall
duction of plant defence responses (Gupta et al., 2015). Numerous BCA 400 mm; dry sub-humid).
produces secondary metabolites such as volatile compounds (hydrogen
peroxide), cell wall degrading enzymes(chitinase, glucanases, pro- 2.2. Sample collection and isolation of bacteria
teases)and antibiotics on or near the plant surface (Haas and Defago,
2005). Most of these compounds are as effective as chemical pesticides. Rhizosphere samples were collected from healthy patches of the
In particular Trichoderma, Pseudomonas and Bacillus species are well disease infected fields of wheat, corn, rice, potato, sunflower, and
reported for the production of secondary metabolites that play a sig- cotton. Roots were washed in the saline solution (0.85 %) by agitation
nificant role in the control of plant pathogens (Jayaprakashvel and to remove the adhered soil and microbes. One mL of the suspension
Mathivanan, 2011). Antibiosis is the most widely accepted biocontrol obtained was used to prepare serial dilutions (Somasegaran and Hoben,
mechanisms (Tanya and Filion, 2017). Six classes of antibiotic com- 1994). The dilutions 10−3 to 10-7 were selected for bacterial isolation.
pounds namely phenazines, phloroglucinols, pyoluteorin, pyrrolnitrin, An aliquot of 100 μL from each of the dilutions was spread on Luria-
cyclic lipopeptides (diffusible compounds) and hydrogen cyanide Bertani (LB) agar plates. The plates were incubated at 28 ± 2 °C for 24
(HCN; volatile compound) are better correlated with the biocontrol of h. All morphologically different colonies were picked and purified on
root diseases (Haas and Defago, 2005; Beneduzi and Ambrosini, LB agar plates by repeated sub-culturing.
Passaglia, 2012). Two antibiotics namely biosurfactants and lipopep-
tide have gained attention due to their biocontrol potential against 2.3. Dual culture assay for the screening of biocontrol rhizobacteria
wide-spectrum phytopathogens including bacteria, fungi, oomycetes,
protozoa, nematodes and plants (Al-Ajlani et al., 2007; de Bruijn et al., Bacterial isolates were tested for in vitro antagonistic activity against
2007; Raaijmakers et al., 2010). Bacillus produces twelve major anti- the 10 fungal phytopathogens listed in (Table 1) by dual-culture assay
biotics including bacillomicin, mycobacillin, fungistatin, iturin, fen- as described by Sakthivel and Gnanamanickam (1987). A fungal disc
gycin, plipastatin, surfactin, bacilysin, etc. (Stien, 2005; Al-Ajlani et al., (≈5 mm2) was placed in the centre of a potato dextrose agar (PDA)
2007) whereas Pseudomonas spp. produce only six antibiotics plate. Bacterial isolates were streaked 3 cm away from the agar plug.
(Shanmugaiah et al., 2010). Plates inoculated with the fungal discs and sterile water were used as
Another important feature of the bacteria is the direct growth plant control. The plates were incubated at 28 ± 2 °C for 5–7 days. Results
promotion phenomenon. The bacteria known as plant growth-pro- were expressed as the percentage inhibition of the growth of the fungal
moting rhizobacteria (PGPR) live in close vicinity to the plants (endo- mat in the presence and absence of bacterial isolates by using the
sphere or rhizosphere) and play a key role in the transformation of equation (Montealegre et al., 2003):
many organic and inorganic compounds making them available for Inhibition (%) = [(1- (Fungal growth / Control growth)] × 100
plant growth such as nitrogen, phosphorus, potassium, iron, and zinc
Olanrewaju et al., 2017). Furthermore, these PGPR exert beneficial 2.4. Biocontrol potential of extracellular metabolites
effects on plant growth and yield by the production of plant growth
regulating substances, such as indole-3-acetic acid (IAA), gibberellic This test was performed to examine the antifungal activity of ex-
acid, cytokinin and 1-aminocyclopropane-1-carboxylate (ACC) deami- tracellular metabolites of rhizobacteria against pathogenic fungi.
nase (Glick, 2014). The ACC-deaminase producing PGPR facilitate plant Nutrient broth (15 mL) was inoculated with a pure bacterial colony and
growth by decreasing plant ethylene levels and reducing stress caused incubated on a shaker (200 rpm) at 28 ± 2 °C for 5 days. Cells were
by biotic (such as phytopathogenic bacteria/fungi) and abiotic factors removed by centrifugation at 4,000 × g for 15 min at 4 °C. The cell-free
(such as heavy metals, salt, and drought) (Glick et al., 2007; Shahid supernatant was collected through centrifugation and filtered asepti-
et al., 2012). cally through 0.45 μm pore-size membrane filters. Petri plates were
Biofertilization, phytostimulation and biological control are diverse filled with 15 ml of PDA media at 45 °C and filtered bacterial super-
traits of heterogeneous PGPR and can be exploited to develop for- natant (5 % v/v) was added in each plate. After solidification, a fungal
mulations to control pathogens, increase yield and food production by disc (5 mm2) was placed on each of the PDA-supernatant plates. The
using fewer resources and less reliance on the chemical fertilizers and plates were incubated for 3–5 days at 28 ± 2 °C and examined for an-
pesticides (Bhattacharyya and Jha, 2012). Because of the broad-host- tifungal after every 24 h.The results were expressed as the presence or
range of P&Ps, changing climates, high prices of agrochemicals, and absence of growth antifungal activity.
ecological crises, we hypothesize that devising multi-purpose bio-
formulations will be a more practical strategy for integrated pest and 2.5. Assays for biocontrol potential and plant growth-promoting traits
nutrient management. This study aimed to identify potential rhizo-
bacterial strains exhibiting plant growth promotion as well as biocon- 2.5.1. Production of lytic enzymes
trol potential against a broad spectrum of phytopathogenic fungi. The The production of proteolytic enzymes was assessed by inoculating
future objective is to develop a dual-purpose inoculum exhibiting bio- a pure colony of each of the bacteria on skim milk agar plates (Abo-Aba
fertilizer and biopesticide potential for commercial use in integrated- et al., 2006). Cellulase activity was examined on carboxymethyl cel-
nutrient management and sustainable agriculture. lulose (CMC)-agar plates (Ghose, 1987) and chitinase activity were
assessed by growing bacteria on chitin agar plates (Shimahara and
2. Materials and methods Takiguchi, 1988). Plates were incubated at 28 ± 2 °C for 5 days. The
formation of a clear zone around a bacterial colony was considered as a
2.1. Details of agro-ecological sites for sample collection positive result for the respective enzyme activity.
Plant and soil samples were collected from six different agro-eco- 2.5.2. Hydrogen cyanide production
logical sites of Pakistan. The sampling locations were Naran (34°77 N, Hydrogen cyanide (HCN) production by antagonistic strains was
73°52 E; elevation 2500 m; annual rainfall 87.1 mm; wet sub-humid), assessed according to the method of Lork (1948). Petri plates were filled
Abbottabad (34°09 N, 73°13 E, elevation 1260 m; annual rainfall 261 with 15 mL of molten LB agar amended with glycine 4.4 g L−1 and then
mm; humid-subtropical), Rawalakot (33°51 N, 73°45 E; elevation 1638 a pure bacterial colony (n = 3) was streaked onto the LB media after
m; annual rainfall 1300 mm; humid subtropical), Faisalabad (30°31 N, solidification. A sterile filter paper (Whatman No.1) soaked in an
2
Table 1
In vitro antagonistic potential of rhizobacteria against the ten fungal phytopathogens.
No. Isolate Crop/ Location % Inhibition = [(1- (fungal growth / Control growth) × 100]
F.o F.m R.s C.g C.f A.n A.f A.a P.i P.u
1 LB1 Potato/ Naran 80 78 79 78 80 72 70 75 85 83

2 MS6 Sunflower/ Multan 79 77 80 76 78 70 70 70 80 80
3 NS1 Maize/ Naran 75 70 75 77 80 70 70 70 83 81
4 NS2 Maize/ Naran 69 67 76 79 80 70 70 73 82 75
5 NS4 Maize/ Naran 78 66 75 77 80 70 68 70 82 81
6 NS6 Maize/ Naran 78 67 71 70 80 70 68 70 84 84
7 WCMa Wheat/Multan 63 65 60 55 45 40 50 55 70 68
8 WCM5.4b Wheat/ Multan 63 61 59 57 53 50 45 54 69 68
9 WMR 3.1 Wheat/Rawalakot 59 55 54 59 50 55 56 60 69 71
10 RWK 2.3b Wheat/Rawalakot 64 62 61 64 60 51 55 60 70 70
11 RWK 3.7 b Wheat/Rawalakot 60 59 58 61 59 56 50 55 65 67
12 RWK 3.1 Wheat/Rawalakot 57 55 56 58 55 53 47 49 60 65
13 RWK 3.7c Wheat/ Rawalakot 54 53 53 52 50 53 50 51 55 60
14 RWK 1.2a Wheat/ Rawalakot 61 61 58 59 55 58 65 60 69 68
15 RWK 2.4a Wheat/ Rawalakot 60 62 65 64 50 45 50 54 65 67
16 RWK 3.2 Wheat/ Rawalakot 59 57 56 57 50 59 52 40 59 60
19 WMR 6.4b Wheat/ Rawalakot 58 57 56 56 54 56 53 52 66 67
20 WMR 1.1 Wheat/ Multan 56 57 56 55 53 52 50 47 59 60
22 WMR 4.1 Wheat/ Multan 60 60 59 58 57 56 55 53 60 65
23 RMB1 Maize/ Rawalakot 60 63 61 57 60 55 53 54 65 66
37 PS5 Wheat/ Abbottabad 58 55 56 56 53 55 50 51 53 55
38 W1 Wheat/ Abbottabad 47 46 46 47 44 43 42 43 55 57
42 1A Wheat/ Abbottabad 49 46 46 47 40 49 40 50 50 49
43 1B Wheat/ Abbottabad 57 57 56 59 53 55 50 51 53 55
44 1D Wheat/ Abbottabad 60 59 55 59 56 53 55 50 51 53
45 FB1 Rice/ Faisalabad 78 77 78 77 80 70 76 80 86 84
F.o: Fusarium oxysporum; F.m.: Fusarium solani; R.s: Rhizoctonia solani; C.g: Colletotrichum gloeosporioides; C.f: Colletotrichum falcatum; A.n: Aspergillus niger; A.f:
Aspergillus flavus; A.a: Alternaria alternata; P.i: Pythium irregulare; P. : Pythium ultimum.
alkaline picrate solution (2.5 g L-1 picric acid, 12.5 get-1 Na2CO3; pH 2.5.4. Diffusible and volatile antibiotics
13) was pasted in the lids of the Petri plates containing bacterial cul- To assess the production of diffusible antibiotics the pure rhizo-
tures. The Petri plates were then sealed with parafilm and incubated at bacterial suspensions (20 μL, 1 × 107cfu mL−1) were inoculated in the
28 ± 2 °C for 3 days. A change in the color of the filter paper from centre of PDA plates, covered with sterile cellophane membranes and
yellow to orange-red, brown or reddish-brown confirmed the weak, incubated for 36 h at 28 ± 2 °C.The membranes were removed and
moderate, or strongly cyanogenic potential, respectively. each of the plates was inoculated in the middle with a 5-mm2 disk of a
phtopathogenic fungus. The plates were further incubated for 72 h at
28 ± 2 °C and observed for the growth of the fungus.
2.5.3. Siderophore production Volatile antibiotics were detected by adding bacterial suspension (1
Siderophore production by biocontrol bacteria was determined by % [v/v], 1 × 107cfu mL−1) to petri dishes containing luke warm PDA
the method described by Schwyne and Neilands (1987). Briefly, the (∼ 50 °C). The plates were allowed to solidify and a disk of a phto-
pure bacterial colonies were spotted on the Petri plates containing pathogenic fungus (5 mm2) was placed at the centre of another petri
chrome azurol S media (Sigma) and incubated at 28 ± 2 °C for 3 days. plate containing PDA. The two plates were placed face to face, avoiding
The siderophore production by biocontrol rhizobacteria was confirmed physical contact between the pathogen and the bacterial suspensions,
by the formation of a purple zone (catechol type siderophore) or an sealed tightly with parafilm to prevent loss of volatiles formed and
orange zone (hydroxamate-type siderophore) around the bacterial co- incubated at 28 ± 2 °C for 3 days. The growth of the fungus was ob-
lonies. served and compared to control plates containing autoclaved distilled
3
water in place of bacterial inoculum.
45.67 ± 4.09
5.65 ± 0.25
0.12 ± 0.01
0.45 ± 0.01
Rawalakot
JQ425165
B. subtilis
Round
2.5.5. Production of Indole-3-acetic acid (IAA)
RMB5
maize
The production of IAA was assessed using the colorimetric method
+
+
+
+
+
0
–
–
–
described by (Gordon and Weber, 1952). Bacteria were grown for 7
40.48 ± 1.0
6.83 ± 0.38
0.14 ± 0.01
0.30 ± 0.03
days in LB broth supplemented with 100 mg L–1 of tryptophan as the
693 ± 3.55
HQ834863
B. subtilis
IAA precursor. Cells were removed by centrifugation and the pH of the

Round
Naran
maize
NS6
supernatant was adjusted to 2.8 by using 1 M HCl. Indole acetic acid
+
+
+
+
–
–
–
45.27 ± 3.67 was extracted twice from the supernatant by adding an equal volume of
668.7 ± 7.78
7.94 ± 0.21 ethyl acetate. The extract was air-dried and dissolved in methanol.
0.14 ± 0.03
HQ834864
B. subtilis
Production of IAA was confirmed and quantified through high-perfor-

Round
Naran
maize
mance liquid chromatography (HPLC) (Perkin Elmer, USA) equipped

NS4
+
+
+
+
with Turbochrom software. Separation was done using C-18 reverse-
0
–
–
–
phase column (Microsorb-MV 100 C18; particle size 5 μm; L x ID 250 ×
40.66 ± 6.85
606.8 ± 6.51
6.33 ± 0.41
0.12 ± 0.03
0.22 ± 0.01
4.6 mm). The mobile phase was prepared by mixing 1 % acetic acid in
JN714126
B. subtilis
methanol (70:30 v/v). The flow rate was adjusted to 0.5 mL min−1. IAA
Round
Naran
maize
NS2
production was quantified by comparing the retention time and peak

+
+
+
+
+
–
–
–
area of 1000 ppm synthetic IAA standard.
50.34 ± 5.05
0.11 ± 0.03
0.25 ± 0.01
349 ± 3.32
5.89 ± 0.3
JN714125
B. subtilis
2.5.6. Phosphate solubilization

Round
Naran
maize
For qualitative analysis of phosphatase activity by antagonistic

Detail of morphological, physiological, plant growth promoting and biocontrol potentials of selected rhizobacteria isolated from different locations.
NS1
+
+
+
bacteria, an aliquot of 10 μL from each of the freshly grown bacteria

–
–
–
was spotted on Petri plates prepared with Pikoviskayas’agar media

P = Phosphate solubilization; IAA = Production of indole-3-acetic acid, ARA = Acetylene reduction assay; ACC = ACC-deaminase activity.
40.95 ± 3.51
HQ6587671
0.31 ± 0.01
0.77 ± 0.01
277 ± 4.35
8.31 ± 0.7
(Sigma). The plates were incubated at 28 ± 2 °C for 5 days and ex-

Rawalakot
Small rod
P. stutzeri
amined for the formation of a clear zone around the bacterial colony.
RMB6
maize
The Phosphomolybdate blue color method was used to quantify the

+
+
+
+
+
+
–
–
–
total solubilized phosphate produced by bacteria (Murphy and Riley,

Brownish green
1962). A freshly grown bacterial colony of each rhizobacterium was

P. aeuroginosa
50.58 ± 5.11
0.34 ± 0.01
157.8 ± 9.8
inoculated in a 50 mL sterile falcon tube (n = 3) containing 15 mL of

HQ658762
8.95 ± 0.5
Faisalabad
Pikovskaya’s broth supplemented with tri-calcium phosphate. The tubes

Rod
FB5
were incubated at 28 °C for 7 days in an incubator shaker at 120 rpm.

rice
+
+
+
+
+
0
Cells were removed by centrifugation at 8000 rpm for 10 min and the
P. aeuroginosa
amount of phosphorous in the supernatant was measured by a UV–vis

40.57 ± 2.76
6.87 ± 0.45
0.65 ± 0.03
0.69 ± 0.02
HQ658764
Faisalabad
spectrophotometer (Camspec M350) at 882 nm. The amount of solu-

Yellow
bilized phosphorous was calculated by comparing it with the standard

Rod
FB3
rice
curve of phosphorous dissolved in deionized water.

+
+
+
+
+
+
+
0
–
P. aeuroginosa
60.59 ± 4.86
2.5.7. Nitrogen fixation (NF)

Bluish-green
6.80 ± 0.15
0.35 ± 0.01
HQ658762
Faisalabad
Nitrogenase activity of the 12 antagonist strains was examined by

acetylene reduction assay (ARA) (Okon et al., 1977). A pure bacterial
Rod
FB2
rice
+
+
+
+
+
+
colony was inoculated in 10 mL McCartney vial (n = 3) containing

0
semisolid nitrogen-free malate medium (NFM, 5 mL) and the vials were
Brownish green
P. aeuroginosa
50.84 ± 2.50
119.6 ± 5.55
incubated at 28 ± 2 °C for 48 h. Then, the metal caps were replaced by

7.20 ± 0.11
0.32 ± 0.01
HQ834862
Faisalabad
rubber ones under the sterile conditions, acetylene gas (10 % v/v) was
injected through the rubber stoppers and vials were re-incubated for 16
Rod
FB1
rice
+
+
+
+
+
+
h. The amount of ethylene produced in the vials was measured as de-

0
scribed by Hardy et al. (1977). Briefly, a 100 μLof gas was sucked
521.6 ± 5.92
1.41 ± 0.09
70.21 ± 7.1
0.31 ± 0.04
0.85 ± 0.02
through syringe from each vial and infused in a gas chromatograph

HQ658765
sunflower
P. putida
(Thermoquest; Porapak N column 6′x1/8′', 80–100 mesh; H2 carrier gas

Multan
Yellow
MS6
and flame ionization detector FID). A standard curve of ethylene was

Rod
+
+
+
+
–
–
–
used to calculate the amount of ethylene produced by each bacterium.

Yellowish green
P. fluorescence
50.17 ± 2.32
8.83 ± 0.42
0.28 ± 0.04
0.82 ± 0.01
2.5.8. Quorum sensing activity (QS)

HQ658766
Freshly grown culture of the biosensor strain

Potato
Naran
Chromobacteriumviolaceum (CV026) was spread on the LB plates and a

Rod
LB1
+
+
+
+
0
–
–
pure colony of each of the rhizobacterium was spotted onto the LB agar
plate (n = 3). The plates were incubated for 3 days at 28 ± 2 °C and
Pigmentation on LB/KB medium
Plant Growth Promoting Traits
then observed for the appearance of a violet hues. The presence of

GenBank accession number
ACC-Deaminase O.D(570nm)
purple-colored pigment production indicates the presence of QS-posi-

P solubilization(μg/ml)
tive bacteria.
Diffusable antibiotics
ARA (ηmol/h/vial)
Antagonistic Traits
Volatile antibiotics
Biofilm O.D(570nm)
2.5.9. ACC-deaminase activity

Strain Identity
Isolation Site
IAA (μg/ml)
Siderophore
The ability of rhizobacteria to use 1-aminocyclopropane-1-car-

Host Plant
Cell shape
Chitinase
Cellulase
Protease
Isolates
boxylic acid (ACC) as a sole nitrogen source was assessed in 5 mL DF

Table 2
HCN
AHL
salt minimal medium (Penrose and Glick, 2003) containing 3 μL of 0.5

M ACC. The pure cultures were grown for 24 h with constant shaking at
4
160 x g and at 28 ± 2 °C to. The presence of ACC-deaminase activity
76.79 ± 0.007
RMB6 μg/mL
14.4 ± 0.017
9.02 ± 0.005
was indicated by the turbidity or the growth of rhizobacteria in the
respective media.
0
2.5.10. Formation of biofilm
Biofilm formation was assessed by micro-titter plate assay essen-
188.99 ± 0.017
15.42 ± 0.011
tially as described by Fujishige et al. (2006). Bacterial colonies were
5.97 ± 0.006
22.88 ± 0.01
MS6 μg/mL
inoculated in LB broth and incubated at 28 ± 2 °C for 24 h. Cells were

washed with sterile distilled water (SDW) and resuspended at an OD570
nm of 0.2 in SDW. An aliquot (150 μL) of bacterial cell suspension was
added to individual wells in a 96-well PVC plate (Fisher, USA) along-
with non-inoculated broth as control. Plates were sealed and incubated
218.69 ± 0.025
26.39 ± 0.026
at 28 ± 2 °C for 24 h. After removal of the medium wells were washed,

7.36 ± 0.001
9.36 ± 0.017
LB1 μg/mL
dried and stained with 150 μL of 0.001 % crystal violet dye for 15 min.
The dye was removed and wells were washed with sterile water. The
retained stain was solubilized in 150 μL of 95 % ethanol and the
amount of retained dye was quantified by measuring the absorbance at
570 nm on a universal microplate reader (BIO-TEK Instruments).
448.96 ± 0.051
30.62 ± 0.039
63.75 ± 0.007
7.12 ± 0.01
FB5 μg/mL
2.6. Characterization of antifungal metabolites through mass spectroscopy
Two different methods were adopted for the isolation of metabo-

lites.
14.22 ± 0.013
91.47 ± 0.015
11.47 ± 0.035
9.22 ± 0.005
2.6.1. Extraction of metabolites from Pseudomonas spp

FB3 μg/mL
A pure colony of each strain was inoculated to 250 mL of King’s B

broth in 500 mL Erlenmeyer flasks and incubated at 28 ± 2 °C for 72 h
Detection and quantification of antifungal metabolites produced by different biocontrol agents through liquid chromatography.
in an incubator shaker at 200 rpm. The cells were removed by cen-

trifugation (8000 g for 15 min) and the pH of the supernatant was
1130.48 ± 0.011
adjusted to 3.0 by adding 1 M HCl. An equal volume of ethyl acetate

31.22 ± 0.025
44.27 ± 0.003
17.57 ± 0.035
was added to the supernatant, mixed by shaking for 30 min at 120 rpm.
FB2 μg/mL
The supernatant was poured in the extraction funnel and was left to
stand for 6 h to separate the two layers. The ethyl acetate layer was
collected in a clean 500 mL Erlenmeyer flask. The extraction step was
repeated to extract the remaining metabolites. The extracted metabo-
643.82 ± 0.056
lites were freeze-dried. The dried compounds were dissolved in 5 mL of

28.21 ± 0.005
18.7 ± 0.051
7.06 ± 0.015
50 % methanol. The extract was purified by passing through a 0.45-μm

FB1 μg/mL
syringe filter, freeze-dried and re-dissolved in 1 mL methanol. The li-

2,4-DAPG = 2,4 Diacetyl phloroglucinol; DIH2O = Deionized water; ACN = Acetonitrile.
popeptide extract was stored at -20 °C.
2.6.2. Extraction of lipopeptides from Bacillus spp

nm
nm
nm
nm
Bacilluslipopeptides were extracted as described by Ali et al., (2014)

UV (ʎ)
270
254
280
403
Briefly, a pure bacterial colony from each strain was inoculated to 250
mL Lauria Bertani (LB) broth in 500 mL Erlenmeyer glass flask and
allowed to grow in an incubator shaker at 28 ± 2 °C for 7 days. Cells
Solvent B (25 min)
were removed by centrifugation (8000 g at 4 °C for 10 min). The su-

pernatant was collected in a clean flask and the lipopeptides were
ACN
ACN
ACN
ACN
precipitated by adding 6 N HCl to get the final pH of 2.0 and kept at 4 °C

for 2 h. The precipitates were recovered by centrifugation (8000 g at 4
%
%
%
%
80
60
60
10
°C for 20 min) and dissolved in 75 % methanol. The extract was purified

by passing through a 0.45 μm syringe filter, freeze-dried and re-dis-
solved in 1 mL methanol. The lipopeptide extract was stored at -20 °C.
Solvent A (3 min)
2.6.3. Characterization of biocontrol metabolites through a mass

spectrometer
DIH2O
DIH2O
DIH2O
DIH2O
The purified metabolites from Pseudomonas and Bacillus were ana-

lyzed on a mass spectrometer, LTQ XL Linear Ion Trap Mass
Spectrometer (Thermo Scientific, USA) equipped with an ESI source.
(mL/min)
Flow rate
The samples were injected through a syringe pump with a flow rate of 5
μL/min. The ESI source parameters (probe position, gas flow, capillary
0.35
0.35
0.35
1.00
temperature, tube lens voltage, the voltage of ion optics), MS para-

meters and the probe position were set manually to the point where the
Compounds
Pyoverdine
maximum intensity value of the ion signal was achieved. Sheath and
2,4- DAPG
Pyocyanin
Phenazine
auxiliary gas flow rates were adjusted to get the stable spray. Mass
Table 3
spectra were recorded in the range of m/z 50–2000 at both the scan
modes to study the behaviour of biocontrol related antibiotics.
5
Metabolites extracted from a commercially available biocontrol strain 250 mL of LB broth and incubated on a shaker (200 rpm) at 28 °C. Cells
P.aureofaciens Q2-87 were included in the analysis as a positive control. were harvested (1 ⋅ 10−7CFU) and re-suspended in 250 mL of saline
The available synthetic standards of 2,4-DAPG, 1-hydroxy phenazine, (0.85 %). There were three control treatments in this experiment
pyoverdine, pyocyanin and pyochelin obtained from Sigma Aldrich, namely commercial chemical pesticide, phosphonate, (Phosphonate:
Canada were used to optimize the conditions for the detection of 1:200 v/v in water); an organic fertilizer (OF) and distilled water (DW).
compounds and to quantify the compound. Firstly, sterile plastic bags were filled with 250 g of the soil and
inoculated with 50 mL of inoculum. Then, the plastic bags were placed
2.7. Quantification of biocontrol metabolites through HPLC in the dark at room temperature to allow the bacteria to colonize in the
soil. After two days, 30 g of soil from each bag was added to each of the
Purified metabolites from Pseudomonas and Bacillus strains were coffee cups, twenty surface sterile seeds of arugula were sprinkled on
quantified on High-Performance Liquid Chromatograph (HPLC). The the surface and overlaid another 20 g of soil. Then, the cups were
HPLC system used in this study was Waters 600 F, USA, equipped with covered with lids and set up in a completely randomized design in a
an LCD pump controller, Dual ʎ absorbance detector (Waters 2487), growth room (16 h light; 8 h dark; 23 / 19 °C day/ night temperature).
Waters In-line Degasser AF. The column used in this analysis was the Next, the lids were removed at the emergence of seedlings and plants
YMC-Pack Pro C18 column (250 mm × 4.6 mm, 5 μm particle sizes, were monitored regularly and watered as required. The plants were
AS12S05- 2546WT, No. 0425034894 (W), USA). Different mobile monitored regularly, harvested after 14 days and data was collected for
phases were used in this study to elute various compounds through the the plant growth and survival from each of the treatments.
column (Table 3). For each of the metabolites flow rate, UV absorbance
and mobile phase composition was optimized by using commercial
standards (Sigma Aldrich, Canada) to allow for appropriate separation 2.10. Assessment of antagonists for their commercial value
of respective compounds from any impurities. The standard curves were
drawn by running different concentrations of standards (0, 10, 20, 30, The assessment system established by Zhang et al. (2011) was used
40, 50, 60, 70, 80, 90 and 100 ppm). The temperature of the column to rate the potential of the 12 selected bacteria as biocontrol and plant
compartment was set at 25 °C with an injection volume of 10 μL. Each growth-promoting agents. Briefly, three categories were made using a
of the samples was analyzed in three replicates and the process was point-based system: Category Aoffered points for invitro antagonistic
repeated under the same conditions for comparing results. activity against fungal pathogens based on the percent inhibition zones
(1 point for < 70 %, 2 points for < 80 % and 3 points for ≥ 80 %). The
category B assigned one point for the presence of each of a biocontrol
2.8. Identification of rhizobacteria and analysis of their genes for antifungal
trait (proteases, cellulases, chitinases, HCN, and siderophore) whereas,
metabolites
the category C assigned one point for exhibiting a plant growth pro-
motion trait (phosphate solubilization, production of IAA, Nitrogenase
The rhizobacterial strains were identified through the sequence
activity, ACCD and the production of AHLs). For every biocontrol
analysis of a 16S rRNA amplified through a colony PCR using universal
strain, the obtained points were summed up and its commercial value
primers (Table 4) and conditions described by Shahid et al., (2012). The
was assessed.
amplified products of 16S rRNA PCR were purified by using a Pure-
LinkTM Quick Gel Extraction Kit (Invitrogen) and then sequenced by
Eurofins (Germany). The gene sequences were deposited in the Gen-
2.11. Statistical analysis
Bank database and the accession numbers were obtained. For the am-
plification of genes of antibiotics from the rhizobacteria, a colony PCR
Statistical analyses were conducted on lab and growth room data for
was performed for the three antibiotics namely 2,4-DAPG, surfactin,
all treatments. For the basic statistical analysis of data such as means,
and fengycin to confirm the biosynthesis of these antibiotics. The
standard deviation, bar graphs, and standard curves MS Excel 2016 was
conditions of PCR and the primers used are listed in Table 4.
used. Before conducting ANOVA, the normality of distribution and
homogeneity of variance were checked with Shapiro and Bartlett tests,
2.9. Plant inoculation studies of potential biocontrol agents respectively. One-way analysis of variance (ANOVA) was used to de-
termine any significant differences between the means of four treat-
To evaluate the biocontrol potential of selected antagonistic bac- ments with means and mult-compview packages in R 3.6.0 (R-Studio
teria rapidly, a model system was developed with properties such as Team., 2019) with p = 0.05. For visualization of paired comparison,
cost-effectiveness, easy to handle and the short-term plant species. the post hoc testing was performed using a function of Tukey’s HSD test.
Hence, instead of pots, the cardboard coffee cups (10 ounces) were Correlation coefficients were calculated among biocontrol and PGP
used. The seeds (100 % viability) of a Pythium susceptible variety of efficacy of antagonists with their in vitro assessed biocontrol and PGP
arugula (Eruca vesicaria var. Roquette) were obtained from seeds col- potentials.
lection facility at A & L Biologicals Laboratories, Canada and a naturally
Pythium-infested muck soil was used. Bacterial inoculum from each of
the 12 strains was prepared by inoculating a fresh bacterial colony into
Table 4
Detail of primers and PCR conditions used for the amplification of different genes from biocontrol agents.
Antibiotics/ Gene/ Size Primers Primer sequence (5′-3′) PCR profile (40 cycles each) References
16S rRNA; 1.5 Kb fD1 AGAGTTTGATCCTGGCTCAG Denaturing: 95 °C, 2 min. Annealing: 55 °C, 30 sec Weisberg et al.,1991.
rD1 AAGGAGGTGATCCAGC Extension: 72 °C, 5 min.
2,4-diacetylphloroglucinol; phlD; 470 bp B2BF ACCCACCGCAGCATCGTTTATGAGC Denaturing: 94 °C,1 min; Annealing: 60 °C, 1 min; Gardener et al. 2001.
BPR2 GAGCGCAATGTTGATTGAAGGTCTC Extension: 72 °C, 1 min
Surfactin; sfp; 675 bp Sfp-f ATGAAGATTTACGGAATTT Denaturing: 94 °C, 1 min; Annealing at 46 °C,1 min; Hsieh et al., 2004.
Sfp-r TTATAAAAGCTCTTCGTACG Extension: 72 °C,1 min.
Fengycin; fend; 964 bp FEND1f TTT GGC AGC AGG AGA AGT TT Denaturing: 94 °C,1 min; Annealing: 52 °C,1 min; Ramarathnam et al.,
FEND1r GCT GTC CGT TCT GCT TTT TC Extension: 72 °C,1.5 min 2007.
6
Fig. 1. Dual culture plate assay for the screening of rhizobacteria against phytopathogenic fungus Pythium ultimatum. Pure rhizobacterial strains were streaked on
PDA plates against P. ultimatum. Inhibition of fungal growth as compared to control plates represents the biocontrol potential of rhizobacteria.
3. Results regions and crops of Pakistan (Table 1). Out of these 112 were from the
humid areas (Abottabad, Naran, and AJ&K), 70 from a dry to semi-arid
3.1. Bacterial isolation, screening for antifungal activity and identification (Faisalabad) and 35 from an arid region (Multan). From a crop per-
spective, 30 rhizobacteria were from sunflower, 20 from soybean, 127
There were 227 rhizobacteria isolated and purified from various from maize, 20 from wheat, 10 from potato and 20 from wheat
7
Fig. 2. Plate assay for antifungal potential of extracellular metabolites produced by biocontrol agents against P. ultimatum. Cell-free supernatant mixed with PDA
were poured in plates. Inhibition of fungal growth as compared to control plates represents the biocontrol potential of extracellular metabolites.
(Table 1). These isolates were evaluated for antifungal activity using a Azad Kashmir showed strong antagonistic potential, 20 % from Multan,
dual culture plate assay (Fig. 1). Forty-eight rhizobacteria showed in 13 % from Faisalabad and 10 % from Naran. Twelve isolates showing
vitro antagonistic activity against 10 selected fungal pathogens. From a more than 70 % of the mycelial growth inhibition were selected for
regional perspective, 30 % of rhizobacteria isolated obtained from the further biocontrol studies (Table 2). The cell-free supernatant of all the
8
Fig. 3. Plates assays for screening of biocontrol traits of antagonistic rhizobacteria. A; Protease enzyme production on skim milk agar plate indicated by development
of halo zone around bacterial colony. B; Production of HCN indicated by the change in filter paper colour from yellow to orange/brown. C; Production of siderophore
indicated by the change in the colour of media from blue to orange due to removal of iron from CAS/HDTMA-Fe+3.
12 strains showed inhibition of fungal growth on PDA plates (Fig. 2). 3.4. Mass spectrometric analysis of antifungal metabolites
Results of 16S rRNA sequence analyses showed that seven isolates be-
longed to different species of genus Pseudomonas while five were 3.4.1. Antifungal metabolites of Pseudomonas spp
identified as Bacillus subtilis strains (Table 2). The detail of strain The mass spectrometric analysis (ESI-MS/MS) of purified bacterial
identification and accession numbers are mentioned in Table 2 while metabolites from Pseudomonas (FB1, FB2, FB3, FB5, LB1, MS6, and
nucleotide sequence datais available in the GenBank. RMB6) were compared to positive control P.aureofaciens Q2-87. The
metabolites were scanned at the positive and negative ion mode in the
mass range of m/z 0-1500. A wide range of metabolites was detected at
3.2. Assay for biocontrol traits both modes. About eight different compounds with known antifungal
and/or antibiotics activity were identified from the mass chromato-
All the rhizobacteria showed a positive activity for the presence of grams of Pseudomonas strains namely AHLs (quorum sensing mole-
enzymes protease and cellulase by forming halo zones on their re- cules), 2,4-Diacetylphloroglucinol (2,4-DAPG), phenazines, pyochelin,
spective media (Fig. 3A) while there was no chitinase activity observed rhamnolipids, pyoverdines, and violacein (Fig. 5A).
by any of the biocontrol agents on chitin agar plates. Four Pseudomonas The compound 2,4-DAPG was detected in all the seven Pseudomonas
strains RMB6, FB1, FB2, and FB3 showed the production of hydrogen strains through direct infusion analysis in ESI-MS negative scan mode.
cyanide (Fig. 3B). All the 12 rhizobacteria showed the production of The chromatogram showed a peak of the deprotonated molecule
siderophores on CAS media by changing the color of media from blue to [M−H] − at m/z 209 which corresponds with the exact mass of 2,4-
orange (Fig. 3C).The detail of traits exhibited by these bacteria is DAPG = 210. The DAPG produced by these strains was quantified
summarized in Table 2. through the equation of linear regression obtained from HPLC chro-
matogram. The values ranged from 14.22–31.22 μg mL-1 where the
strain FB2 showed the highest concentration of all (Table 3).
3.3. Assays for plant growth-promoting traits Four derivatives of phenazines were identified in metabolites from
Pseudomonas strains (Fig. 5A) namely 1-hydroxyphenazine (m/z 197 [M
The biocontrol strains exhibited the production of IAA in the range +H]+), pyocyanin (5-methyl-1-hydroxyphenazinium betaine; m/z 211
of 1.41–8.95 μg mL−1 (Table 2). Pseudomonads spp. showed the highest [M+H] +), phenazine-1-carboxamide (m/z 224 [M+H]+) and phe-
IAA activity as compared to Bacillus subtilis strains. Amongst the Pseu- nazine-1-carboxylate (m/z 225 [M+H] +). The amount of pyocyanin
domonas strains, FB5 and LB1 produced the highest amount of IAA with and 1-hydroxy phenazine produced was quantified through HPLC and
the values of 8.95 μg mL−1 and 8.83 μg mL−1 respectively. All the the values ranged from 14.22 to 50.26 μg mL−1 with the strain FB2
bacteria solubilized inorganic phosphate by forming a halo zone on showed the highest concentration of all (Table 3).
Pikoviskaya agar. The amount of phosphorous solubilized by the bio- A widerange of AHL molecules was prominently detected in the
control agents ranged from 40.48–70.21 μg mL−1 (Table 2), where the metabolites of the Pseudomonas strains at positive scan mode in the
pseudomonads showed significantly high activity as compared to the mass range of m/z 200–400 (Fig. 5A). The structures of the selected
Bacillus spp. The P. putida strain MS6 exhibited the highest P-solubili- AHLs and HAQs (4-hydroxy-2-alkylquinolines) peaks were confirmed
zation ability with the value of 70.21 μg mL-1. The results of ARA in- by the MS/MS analysis of molecules. Six different derivatives of AHLs
dicated that 9 out of the 12 rhizobacteria showed the production of were detected namely 3OHC5-HSL, 3oxoC7-HSL, C9.1-HSL, C10-HSL,
ethylene, Bacillus subtilis strain NS4 showed significantly highest value 3oxoC10-HSL, 3oxoC12-HSL.
(668.70 ± 7.7 ηmol/h/vial) than the other strains. Six of the B. subtilis All pseudomonads showed the production of siderophores pyochelin
strains were identified as nitrogen fixers while only four out of the and pyoverdine in both positive and negative scan mode. The spectra
seven Pseudomonas strains namely P. putida MS6, P. aeuroginosa FB1, P. showed peaks of protonated [M+H]+ at m/z 325, sodiated molecule
aeuroginosa FB5 and P. stutzeri RMB6 possessed the nitrogen fixation [M + Na]+ at m/z 347 (Fig.5A). The pyoverdine derivatives were
ability. All of the selected 12 rhizobacteria showed the ability to pro- detected at both positive and negative scan modes howing protonated
duce AHLS which was indicated by the production of purple hues by the peaks in the mass range of m/z 900–1200 (Fig.5B). The spectra showed
biosensor strain C.violaceum CV026 (Fig. 4A). The ACC deaminase ac- peaks of protonated molecules [M+H]+ at m/z 1179.58 and 1191.54,
tivity was shown by 8 out of the 12 rhizobacteria (Table 2), which was and sodiated molecule [M + Na]+ at m/z 1206.58 (Fig.5B). The
indicated by the growth of bacteria in the growth medium amended amount of pyoverdine produced was quantified through HPLC and the
with ACC as a sole carbon source. Pseudomonas strains showed more values ranged from 7.06 to 17.57 μg mL−1 with the strain FB2 showed
growth as compared to the B. subtilis strains and the highest growth was the highest concentration of all (Table 3).
observed for Pseudomonas putida MS6 (O.D570nm = 0.85 ± 0.02; The mixture of mono- and di- rhamnolipids were identified by direct
Fig. 4B). All the selected biocontrol agents were tested for their ability infusion of the bacterial extracts into the mass spectrometer and their
to produce biofilm on the abiotic surface such as 96-well microtiter peaks were more apparent in the negative full scan mode. The mono-
plate. P. aeuroginosa FB3 showed significantly highest biofilm formation rhamnose-di-lipidic congeners with the protonated ion [M+H]+peaks
(O.D570nm = 0.65) as compared to the other strains (Table 2). were identified at: m/z 475, 503, 505, 533, 561 and 657. The di-
rhamnose-di-lipidic congeners with protonated ion [M+H]+peaks
9
Fig. 4. In vitro assay of plant growth promoting traits by antagonistic rhizobacteria. A; The QS activity indicated by violacein production with overlay of biosensor
strain CV026 indicating the presence of AHLs. B; ACC-deaminase activity indicated by the bacterial growth in medium supplemented with ACC as sole carbon source.
were identified at: m/z 595, 621, 651, 677, 701 and 803 (Fig. 5C). with the values of 65 mm and 64 mm, respectively (Fig. 9B). Similarly,
these two strains showed statistically significant increase in plant bio-
3.4.2. Antifungal metabolites of Bacillus subtilis spp mass of 58.20 mg and 55.50 mg, respectively (Fig. 9C) as compared to
The metabolites were scanned at both negative and positive ion scan all the other treatments.
mode in the range of m/z 50-2000. Two families of surfactants,namely
surfactin and fengycin, were detected in the extract from five B. Subtilis 3.7. Assessment of bacteria for commercial value as a biofertilizer and/or a
strains. biopesticide
The peaks of surfactants were apparent in the mass range of m/
z900-1600. The surfactins produced by the Bacillus strains were first The twelve bacterial strains were rated for their antagonistic, bio-
analyzed through ESI-MS direct infusion in positive full scan mode. The control and plant growth-promoting potentials (Table 5). The data il-
peaks of surfactin observed with strong signals at m/z 1030.83, 1044.75 lustrated that the biocontrol agent MS6 received the least of 30 out of
and 1058.75 corresponded to sodiated surfactin homologs ions [M + the total 42 points while the biocontrol strains FB2 and RMB5 achieved
Na]+and weak signals of [M+H]+ of these surfactin variants corre- the highest value of 37 points. The rating system was based on the in
sponded at m/z 995.67, 1008.83 and 1022.83 (Fig. 6A). vitro assessment of biocontrol ability and directly correlated with the
The ESI-MS direct infusion analysis revealed peaks of fengycins both performance of these strains in in planta growth room studies. Thus, FB2
at positive and negative ion full scan mode. The peaks detected at m/ and RMB5 were rated as the best strains with highest commercializa-
z:1464.75, 1478.67, 1491.83 and 1505.83 corresponded to protonated tion potential based on Zhang's rating system. Analysis of the re-
molecules, while the peaks detected at m/z: 1500.00 and 1527.75 lationship between in vitro antifungal activity of bacteria and their
corresponded to sodiated fengycin homologs (Fig. 6B) biocontrol potential (Table 2) shows a positive correlation (r =
0.8845).
3.5. Molecular analysis of antifungal metabolite genes
4. Discussion
Three different primer pairs were used to amplify the biosynthetic
genes of 2,4-DAPG, surfactin, and fengycin. In the case of 2,4-DAPG, the Rhizosphere bacteria are known to confer resistance/protection
primer pair B2BF/BPR2 amplified the 470 bp gene from all the 7 strains against many plant pathogens (Compant et al., 2010). Very few studies
of Pseudomonas (Fig. 7A). The fengycin primer pair FEND1f / FEND1r have reported the biocontrol agents having antagonistic potential
amplified 964 bp fen D biosynthetic gene from the RMB5, while no against multiple fungal pathogens alongwith plant growth promotion
amplification was observed from the other four B. subtilis strains ability. The present study was, therefore, designed to explore the po-
(Fig. 7B). In the case of surfactin the primer pair sfp-f/sfp-r amplified tential of rhizosphere bacteria to control broad-host range fungal pa-
675 bp sfp gene from all the six B. subtilis strains NS1, NS2, NS4, NS6 thogens with concurrent stimulatory effects on the plant growth and
and RMB5 (Fig. 7C). yield. A biocontrol agent having broad-spectrum antimicrobial activ-
ities is more promising under field condition as compared to the ones
3.6. Effect of bacteria on biocontrol and plant growth having antagonistic activity against only one or two pathogens (Ali
et al., 2014; Ahemad and Kibert, 2014; Sun et al., 2017; Zhang et al.,
Overall, the treatments inoculated with biocontrol agents showed a 2017).
statistically significant increase in disease control and plant growth as The samples were collected from the healthy soils with moderate
compared to the non-inoculated and control treatments (Fig.8). In the disease severity because those soil possess suppressive activity against
case of plant survival, phosphonate (P) and biocontrol agent FB2 phytopathogens due to the presence of antagonistic microbes (Schalter
showed the maximum disease control of 87 % each but the plants were et al., 2019). Out of the total 227 rhizobacteria isolated from different
weak and stunted in the pots treated with P as compared to the FB2 and regions and plants, 48 showed strong antagonistic activity against the
all the other bacterial treated soils (Fig. 9A). However, amongst the 10 selected fungi. Aspergillus, Fusarium, Verticillium, Phytophthora,
biocontrol agents, there was no statistically significant difference in the Colletotrichum, Pythium and Rhizoctonia spp. are reported as the most
survival rate. The Bacillus subtilis strains performed better than the devastating, widespread plant pathogens with a broad host range
Pseudomonas strains. The control treatments distilled water and organic (André et al., 2018). Screening of putative antagonists was carried out
fertilizers showed extremely low percentage survival of 38 % and 49 % using a dual-culture assay which rapidly screens antagonists among a
respectively (Fig.9A). The plants treated with biocontrol agents were large collection (Shi et al., 2014).The extracellular metabolites pro-
healthier as compared to the control treatments (Fig. 8). The strains FB2 duced by antagonistic strains also exhibited antifungal potential
and RMB5 showed a statistically significant increase in plant height (Fig. 1).
10
Fig. 5. The ESI-MS chromatograms of purified metabolites extracted from biocontrol agent Pseudomonas strains used in this study. A; Positive scan mode in mass
range of 200–400 amu indicating various antifungal metabolites such as 2,4-DAPG and Phenazines, QS signalling molecules such as Acylhomoserine lactones (AHLs)
and Pseudomonas Quinolones (PQs) and siderophore Pyochemin. B; Positive scan mode analysis representing different siderophores Pyoverdines. C; Negative scan
mode analysis in the range of 400–800 amu representing a range of Rhamnolipids.
Strain identification using 16S rRNA sequencing showed that most phytopathogens such as antibiosis, siderophore production
potent biocontrol agents (BCA) belong to two genera Pseudomonas (P. (Raaijmakers and Mazzola, 2012; Shen et al., 2013; Ali et al., 2014),
aeruginosa, P. fluorescens, P. putida, P. stutzeri) and Bacillus (mainly B. parasitism by catalytic enzymes production (such as chitinase, lipase
subtilis), which are well-known biocontrol agents effective against and protease; Friedrich et al., 2012) and by inducing systemic re-
broad range fungal phytopathogens including Pythium spp., Botrytis sistance in plants (Halfeld-Vieira et al., 2006). Furthermore, the an-
spp., Phytophthora spp., Fusarium spp. (Idris et al., 2007, 2008; Shi et al., tagonistic activity and efficacy of any BCA depend essentially upon the
2014; Sun et al., 2017). Both Pseudomonas and Bacillus have been ex- precise combination of different metabolites active against diverse pa-
clusively studied due to their importance in biological control and thogens.
agricultural practices (Gross and Loper, 2009; Malfanova et al., 2012; The present study demonstrates that all the selected Pseudomonas
Ali et al., 2014). strains showed the production of antifungal metabolite HCN, different
Polyphasic characterization of putative BCAs screened in this study lytic enzymes, antibiotics including 2,4-DAPG and four different types
showed the ability to produce a range of secondary metabolites in- of phenazines, which is another group of antibiotics (Fig. 5A). Synthesis
cluding HCN, cell wall degrading enzymes, ACC deaminase, diffusible of lytic enzymes and HCN have been shown by genera Pseudomonas and
or volatile antibiotics, and siderophore. It has already been recognized Bacillus (Kamei et al., 2014; Nandi et al., 2017). HCN also increases
that BCAs adopt several mechanisms to counter deleterious effects on phosphate availability for rhizobacteria and plant hosts (Rijavic and
11
Fig. 6. ESI-MS chromatograms of purified metabolites extracted from the biocontrol agent B. subtilis strain NS2 at positive ion mod. A; Peaks of surfactins [M+H]+
observed at m/z 995.67, 1008.83 and [M + Na]+ observed at 1030.83, 1044.75 and 1058.75. B; Peak of C-7 fengycin B [M+H]+ observed at m/z 1505.83 and [M
+ Na]+ observed at m/z 1527.75.
Lapanje, 2016). Thus, HCN production appears to act synergically with Root associated species of genus Pseudomonas produce various anti-
other methods of biocontrol employed by same bacteria. The lytic en- biotics like 2,4-diacetylphloroglucinol, AHLs, cyclic lipopeptides, phe-
zymes break the glycosidic linkages in the cell wall of phytopathogens nazines, pyoluteorin, pyochelin, pyoverdin, pyrrolnitrin, rhamnolipids
ultimately limiting their growth in the vicinity (Shaikh and Sayyed, and siderophores (Goswami et al., 2016). Rhizobacterial 2,4-DAPG has
2015; Jadhav et al., 2017). Antibiosis plays a key role in biocontrol. been reported as an essential tool against fungal pathogens (Weller
Fig. 7. Gel picture showing the amplification of genes for the biosynthesis of antifungal metabolites from the biocontrol strains used in this study: A; 470bp of PhlD
gene for the biosynthesis of 2,4-DAPG from Pseudomonas spp. strains, B; 964 bp of fenD gene for biosynthesis of Fengycin from B.subtilis strains C; 675 bp of sfp gene
for the biosynthesis of Surfactin from B.subtilis strains. L: 100bp ladder; B: blank.
12
Fig. 8. Plant growth and root health of Arugula plants grown in Pythium infested soil inoculated with various treatments namely distilled water (DW), organic
fertilizer (OF), phosphonate (P; chemical pesticide), P. aeruginosa FB2, B. subtilis RMB5 and B. subtilis NS4.
et al., 2002; Mavrodi et al., 2011; Schlatter et al., 2017), oomycetes metabolites extracted from rhizobacterial strains during these studies.
(particularly Pythium spp.), fungi (F.oxysporum, R.solani, Thiela- The AHLs are the most important signalling compounds produced by
biopsisbasicola etc.), bacteria (e.g. Pectobacteriumcarotovorum) and ne- Pseudomonads and many species of Bacillus (Yin et al., 2010). Rhizo-
matodes (e.g.Meloidogyne spp.) (Siddiqui and Shaukat, 2004; bacteria use AHLs and cyclic dipeptides to sense their population den-
McSpadden et al., 2005; Chandurkar et al., 2017). Phenazines are sity or quorum in the rhizosphere, to communicate with plants and to
known inhibitors of spore germination and alter the morphology of modulate growth and defence responses (Castro and Bucio, 2019). It
fungal hyphae of wide range of fungal pathogens (Chen et al., 2015). also plays a key role in regulating the production of antifungal com-
All pseudomonads and bacilli from the present study showed the pounds by microorganisms (Castro and Bucio, 2019) e.g., phenazine-1-
production of siderophores namely pyochelin and pyoverdines carboxamide (PCA) production by Pseudomonas and Bacillus spp. and
(Fig. 3–9). Siderophores are the key compounds produced by diverse biofilm formation (Maddula et al., 2006; Aloo et al., 2019).
group of antagonistic-PGPR such as Pseudomonas, Bacillus, Rhizobium, Plant growth-promoting features shown by these biocontrol agents
Azotobactor, Enterobacter,and Serratia (Tailor and Joshi, 2012;Yu et al., were the production of IAA, solubilization of inorganic phosphate, ni-
2011) and inhibit the proliferation of phytopathogens by sequestering trogen fixation, biofilm formation and utilization of ACC-deaminase.
Fe3+ in the rhizosphere, making it unavailable to pathogens (Martinez- These characteristics stimulate plant growth and reduce disease in-
Viveros et al., 2010).Studies have reported that the siderophores pro- cidence and severity. All of the 12 strains used in the current study
duced by biocontrol pseudomonads control the diseases caused by F. showed IAA production which increasesthe root surface area subse-
oxysporum, F. udum,A. niger, and Pythium spp. and stimulate the shoot quently improving nutrients and water uptake (Spaepen et al., 2007).
and root growth (Ali and Vidhale, 2013; Ahmed and Holmström, 2014; Indole acetic acid production is ubiquitous among members of genera
Sulochana et al., 2014; Trapet et al., 2016). Agrobacterium, Pseudomonas, Bacillus, Enterobacter, Rhizobium and Bra-
Another important class of secondary metabolites detected in all dyrhizobium (Ahmed and Holmström, 2014; Etesami et al., 2015). All
pseudomonads from the present study is the biosurfactantmore speci- the selected BCA screened during this study exhibited P-solubilization,
fically the rhamnolipids (Fig. 5C). There are five major categories of nine showed nitrogen fixation and ACC-deaminase potential.Both nu-
biosurfactants namely glycolipids, phospholipids and fatty acids, lipo- trient phosphorus (P) and nitrogen (N) are essential nutrients for the
peptides and lipoproteins, polymeric biosurfactants and particulate survival of microbes and plants. These abilities of biocontrol agents
biosurfactants. The glycolipid biosurfactants “rhamnolipids” are largely makes them more competitive against phytopathogens (Nico et al.,
focused for antifungal, antibacterial and antiviral (Shen et al., 2013) 2012; Lavakush et al., 2014; Marag et al., 2018). Bacteria that contain
activity, for aiding the absorption of fertilizers and nutrients through ACC-deaminase facilitate plant growth and development by decreasing
roots and as biopesticides (Sachdev and Cameotra, 2013). Rhamnoli- plant ethylene levels, increase plant tolerance to biotic and abiotic
pids are produced by various species of Pseudomonas (Abdel-Mawgoud stresses such as the phytopathogenic bacteria, hydrocarbons, heavy
et al., 2010) but a predominant feature of P. aeurogenisa. metals such as Ca2+ and Ni2+, salt, drought, water, and light etc. (Glick
Amongst Bacillus spp., the ‘surfactants’ fengycins, iturins and sur- et al., 2007).
factins were produced (m/z 900–1100). Numerous studies reported the Both Pseudomonas and Bacillus strains showed the ability to form a
production of surfactins from various biocontrol strains of Bacillus (Ji biofilm on an artificial surface which enablethem to colonize and this
et al., 2008; Li et al., 2013; Fan et al., 2017) which are of great im- close contact results in maximum benefit to the host plant. Studies have
portance due to their antifungal, antibacterial and antiviral property shown biofilm plays an important role in plant pathogenesis and ben-
(Gudina et al., 2015; Luo et al., 2015). Fengycin has strong antifungal eficial interactions in above-mentioned genera (Lugtenberg and
activity against the filamentous fungi as it interacts with sterol and Kamilova, 2009). It can provide a mechanism for organisms to establish
phospholipid molecules in membranes and thus change the structure and maintain themselves in a favourable environment, get benefit from
and permeability of the fungal cell membrane (Deleu et al., 2005; Tang nutrients secreted by the plants and influence them directly or in-
et al., 2014). Five B. subtilis strains namely RMB5, NS1, NS2 and NS4 directly by assuring a healthy root system, preserving rhizosphere
showed the production of fengycins (m/z 1400–1600) (Fig5-a). It has moisture, and modifying soil pH, leading to enhanced nutrient cycling
been reported that fengycin producing B. subtilis strain B-FS01 con- (Davey and O’Toole, 2000).
trolled S. scleritiorium and F. moniliforme infection in rape stem (Hu Plant inoculation results validated the innate biocontrol and bio-
et al., 2007). fertilizer potential of bacteria screened in this study. In planta evalua-
A range of AHL molecules (m/z 200–400) werealso detected in tion showed that arugula plants treated with P. aeruginosa FB2 and B.
13
Fig. 9. Bar charts representing means and standard deviation values of the effect of inoculation with different biocontrol agents (n = 3) on the A; percentage
survival, B; plant height (mm) and C; biomass of arugula plants. The letters indicate significant difference following one-way analysis of variance (ANOVA), and
Tukey’s test (p < 0.05).
subtilis strain RMB5 showed highest percentage survival, disease control showed a positive correlation (r = 0.8845). Similar findings have been
and biomass in Pythium-infested soil. The response of inoculation was reported earlier for suppression of Pythium damping-off and root rot of
comparable to commercially available chemical pesticide and sig- cucumber seedlings along-with 84 % increase in plant fresh weight by
nificantly higher than the DW and OF treatments. This response may be the application of two strains Pseudomonas spp. and B. subtilis (Khabbaz
attributed to multifarious potential of both BCA which controlled the and Abbasi, 2014) and pepper (Yu et al., 2011).
disease on one hand and facilitated plant growth on the other hand.
Disease control activity of these strains may be attributed to the higher 5. Conclusions
production of antifungal metabolites and the collective action of lytic
enzymes, AHL production and siderophores. Inoculation of FB2 and This study provides an insight into the diversity of biocontrol agents
RMB5 has resulted in 78 % and 77 % increase in the plant biomass. The with distinctive plant-growth-promoting traits present across the di-
in-vitro biocontrol activity showed a positive correlation between bac- verse agro-ecological areas of Pakistan. These biocontrol bacteria have
terial performance to control disease in vivo. In vitro PGPR activity shown root colonization properties, broad-spectrum antifungal activity
showed a positive correlation to plant growth promotion in growth and the ability to promote plant growth. The profiles of antifungal
room (biomass production r = 0.8932) and in vitro antifungal activity compounds included 2,4-DAPG, phenazine, pyochelin, rhamnolipids,
of these bacteria and their biocontrol potential in the growth room pyoverdines, surfactins and AHLs which varied among different
14
indicates activities of antifungal metabolites and cell wall degrading enzymes. 1 point represents antagonist showing any one of the proteases (Pr.), cellulase (Cel.), chitinase (chi), Volatile and diffusible antibiotics (V +
indicates activities of plant growth-promoting potential including solubilizing phosphate (P), production of IAA, production of Acyl homoserine lactone molecule (AHL), nitrogen fixation (ARA), and ACC-deaminase
Pseudomonas and Bacillus species. The production of more than one
Assessed commercial value
antibiotic by a biocontrol agent makes it a more valuable tool against
indicates sizes of inhibition zones of 12 bacterial antagonists towards 10 fungal pathogens 1 point represents 0–1 mm wide zone; 2 point represents 1–3 mm wide zone; 3point represents > 3 mm wide zone.
different phytopathogens. Moreover, the plant growth-promoting the
ability of these strains are also notable. The plant inoculation study
validated their innate biocontrol and biofertilizer potentials where in
Total = 42
vitro antifungal activity showed positive correlation with in vivo disease

suppression activity. On the whole, the strains FB2 and RMB5 were
found promising candidates for the development of a biofertilizer and a
37
37
35
36
35
35
30
32
33
33
33
30
biopesticide for field applications. Future studies will focus on the de-
velopment and formulation of inoculation in the field and biosafety
ACCD
analysis. Other strains FB3, FB5, NS1, NS2, NS6 will be evaluated in
1
1
1
1
0
1
1
1
1
1
1
0 greenhouse to see their response for disease suppression in less infested
soils.
PGP Potential (total points 5)c
ARA
1
1
0
1
0
0
1
1
1
1
1
Declaration of Competing Interest

AHL
The authors declare that the research was conducted in the absence
1
1
1
1
1
1
1
1
1
1
1
1
of any commercial or financial relationships that could be construed as

IAA
a potential conflict of interest.

1
1
1
1
1
1
1
1
1
1
1
1
Acknowledgements
D); hydrogen cyanide (HCN) and siderophore production (sid.); 1 represents that the strain possesses such trait while 0 point represents no ability.
1
1
P
1
1
1
1
1
1
1
1
1
1
Authors are thankful to the Higher Education Commission of

Pakistanfor providing funds for the research project under “5000 in-
HCN
digenous fellowship scheme”.

1
1
1
1
1
1
1
1
1
1
1
1
enzyme activity (ACC). 1 point represents isolates showing the said activity; 0 point represents isolates showing no these abilities.
References
V+D
1+1
1+0
1+1
1+1
1+1
1+1
1+0
1+1
1+0
1+0
1+0
1+0
Biocontrol Potential (total points 7)b
Abdel-Mawgoud, A.M., Hausmann, R., Le´pine, F., Muller, M.M., De´ziel, E., 2010.
Rhamnolipids: detection, analysis, biosynthesis, genetic regulation and bioengi-
Sid.
neering of production. In: Soberon‐Chavez, G. (Ed.), Biosurfactants Microbiology

1
1
1
1
1
1
1
1
1
1
1
1
Monographs. Springer-Verlag, Germany, pp. 13–55.

Ahemad, M., Kibert, M., 2014. Mechanisms and applications of plant growth promoting
Chi.
rhizobacteria: current perspective. J. King Saud. Univ. Sci. 26, 1–20.

0
1
0
0
0
0
0
0
0
0
0
0
Ahmed, E., Holmström, S.J., 2014. Siderophores in environmental research: roles and
applications. MicrobBiotechnol. 7, 196–208.
Cel.
Al-Ajlani, M.M., Sheikh, M.A., Ahmad, Z., Hasnain, S., 2007. Production of surfactin from
1
1
1
1
1
1
0
1
1
1
1
1
Bacillus subtilis MZ-7 grown on pharmamedia commercial medium. Microb. Cell Fact.
6, 17–24.
Ali, S., Hameed, S., Imran, A., Iqbal, M., Lazarovits, G., 2014. Genetic, physiological and
biochemical characterization of Bacillus subtilis strain RMB7 exhibiting plant growth
Pr.
promoting and broad-spectrum antifungal activities. Microb. Cell Fact. 13. https://
1
1
1
1
1
1
0
0
1
1
1
1
doi.org/10.1186/s12934-014-0144-x.
Ali, S.S., Vidhale, N.N., 2013. Bacterial siderophore and their application: a review. Int. J.
P.i
Curr. Microbiol. Appl. Sci. 12, 303–312.

3
3
3
3
3
3
3
3
3
3
3
3
Aloo, B.N., Makumba, B.A., Mbega, E.R., 2019. The potential of Bacillus rhizobacteria for
Assessed potentials of 12 antagonistic bacteria as biocontrol and PGPR agents.
sustainable crop production and environmental sustainability. Microbiol. Res. 219,

P.u
26–39.
3
3
3
3
3
3
3
3
3
3
3
3
André, C.V., Castroverde, C.D.M., He, S.Y., 2018. Plant pathogen warfare under changing
climate conditions. Curr. Biol. 28, 619–634.
A.a
Beneduzi, A., Ambrosini, Passaglia, L.M.P., 2012. Plant growth-promoting rhizobacteria

3
3
3
3
3
3
2
2
2
2
2
2
(PGPR): their potential as antagonists and biocontrol agents. Genet. Mol. Biol. 35,
Antagonism against 10 fungal pathogens (total points 30)a
1044–1051.
A.f
Bhattacharyya, P.N., Jha, D.K., 2012. Plant growth-promoting rhizobacteria (PGPR):

2
2
2
2
2
2
2
2
2
2
2
1
emergence in agriculture. World J. Microbiol. Biotechnol. 28, 1327–1350.

Castro, R.O., Bucio, J.L., 2019. Review: phytostimulation and root architectural responses
A. n
to quorum-sensing signals and related molecules from rhizobacteria. Plant Sci. 248,
2
2
2
2
2
2
2
2
2
2
2
2
135–142.
Chandurkar, P., Murab, T., Choudhary, A., Tripathi, N., Gujar, N., Saini, S., 2017. 2, 4-
Diacetylphloroglucinol (DAPG) a secondary metabolite of fluorescent pseudomonads
C.f
3
3
3
2
3
2
2
3
3
3
3
as a potential biocontrol agent for plant diseases. J. Sci. Res. A Sci. 3, 235–246.
Chen, Y., Shen, X., Peng, H., Hu, H., Wang, W., Zhang, X., 2015. Comparative genomic
analysis and phenazine production of Pseudomonas chlororaphis, a plant growth-
C.g
promoting rhizobacterium. Genom. Data 4, 33–42.

3
2
2
3
3
2
2
2
2
2
2
2
Compant, S., Clément, C., Sessitsch, A., 2010. Plant growth-promoting bacteria in the
rhizo- and endosphere of plants: their role, colonization, mechanisms involved and
R.s
prospects for utilization. Soil Biol. Biochem. 42, 669–678. https://doi.org/10.1016/j.

3
3
2
3
3
2
3
2
2
2
2
2
soilbio.2009.11.024.
Davey, M.E., O’toole, G.A., 2000. Microbial biofilms: from ecology to molecular genetics.
F.m
Microbiol. Mol. Biol. Rev. 64 (4), 847–867.

2
3
2
2
2
2
2
2
2
2
2
1
de Bruijn, I., de Kock, M.J.D., Yang, M., de Waard, P., van Beek, T.A., Raaijmakers, J.M.,
2007. Genome-based discovery, structure prediction and functional analysis of cyclic
F.o
lipopeptide antibiotics in Pseudomonas species. Mol. Microbiol. 63, 417–428.

3
2
2
2
2
3
2
2
2
2
2
2
Deleu, M., Paquot, M., Nylander, T., 2005. Fengycin interaction with lipid monolayers at
Table 5
Strains
the air-aqueous interface-implications for the effect of fengycin on biological mem-

RMB5
RMB6
MS6
NS1
NS2
NS6
NS4
FB2
branes. J. Colloid Interface Sci. 283, 358–365.

FB1
FB3
FB5
LB1
Etesami, H., Alikhani, H.A., Hosseini, H.M., 2015. Indole-3-acetic acid (IAA) production
b
a
15
trait, a useful screening to select endophytic and rhizosphere competent bacteria for spp. In: Maheshwari, D.K. (Ed.), Natural Protection of Wheat from Soil Borne
rice growth promoting agents. MethodsX. 2, 72–78. Pathogens, in: Bacteria in Agrobiology: Plant Nutrient Management. Springer-Berlin
Fan, H., Ru, J., Zhang, Y., Wang, Q., Yang, L., 2017. Fengycin produced by Bacillus subtilis Heidelberg, pp. 7–11.
9407 plays a major role in the biocontrol of apple ring rot disease. Microbiol. Res. McSpadden, B.B., Gardener, L., Gutierrez, J., Joshi, R., Edema, E., Lutton, E., 2005.
(Pavia) 199, 89–97. Distribution and biocontrol potential of phlD+ Pseudomonads in corn and soybean
Flores-Vargas, R.D., O’Hara, G.W., 2006. Isolation and characterization of rhizosphere fields. Phytopathol. 95, 715–724.
bacteria with potential for biological control of weeds in vineyards. J. Appl. Environ. Montealegre, J.R., Reyes, R., Pérez, L.M., Herrera, R., Silva, P., Besoain, X., 2003.
Microbiol. 100, 946–954. Selection of bioantagonistic bacteria to be used in biological control of Rhizoctonia
Friedrich, N., Hagedorn, M., Soldati-Favre, D., Soldati, T., 2012. Prison break: pathogens’ solani in tomato. Electron. J. Biotechnol. 6, 115–127.
strategies to egress from host cells. Microbiol. Mol. Biol. Rev. 76, 707–720. https:// Murphy, J., Riley, J.P., 1962. Modified solution method for determination of phosphate in
doi.org/10.1128/MMBR.00024-12. natural water. Anal. Chim. Acta 27, 31–36.
Fujishige, N.A., Kapadia, N.N., De Hoff, P.L., Hirsch, A.M., 2006. Investigations of Nandi, M., Selin, C., Brawerman, G., Fernando, W.G.D., de Kievit, T., 2017. Hydrogen
Rhizobium biofilm formation. FEMS Microbiol. Ecol. 56, 195–206. cyanide, which contributes to Pseudomonas chlororaphis strain PA23 biocontrol, is
Glick, B.R., Cheng, Z., Czarny, J., Duan, J., 2007. Promotion of plant growth by ACC upregulated in the presence of glycine. Biol. Control 108, 47–54. https://doi.org/10.
deaminase-producing soil bacteria. Eur. J. Plant Pathol. 119, 329–339. 1016/j.biocontrol.
Glick, B.R., 2014. Bacteria with ACC deaminase can promote plant growth and help to Nico, M., Ribaudo, C., Gori, J.I., Cantore, M.L., Curá, J.A., 2012. Uptake of phosphate and
feed the world. Microbiol. Res. (Pavia) 169, 30–39. promotion of vegetativegrowth in glucose-exudingrice plants (Oryza sativa) in-
Gordon, S.A., Weber, R.P., 1952. Colorimetric estimation of indole acetic acid. Plant oculated with plant growth-promoting bacteria. Agric. Ecosyst. Environ. Appl. Soil
Physiol. 26, 192–195. Ecol. 61, 190–195.
Goswami, D., Thakker, J.N., Dhandhukia, P.C., Tejada Moral, M., 2016. Portraying me- O’ Brien, P.A., 2017. Biological control of plant diseases. Aust Plant Pathol. 46, 293–304.
chanics of plant growth promoting rhizobacteria (PGPR): a review. Cogent Food https://doi.org/10.1007/s13313-017-0481-4.
Agric 2,1127500. Okon, Y., Albercht, S.L., Burris, R.H., 1977. Methods for growing Azospirillumlipoferum
Gross, H., Loper, J.E., 2009. Genomics of secondary metabolite production by and for counting it in pure culture and in association with plants. Appl. Environ.
Pseudomonas spp. Nat. Prod. Rep. 26, 1408–1446. Microbiol. 33, 85–88.
Gudina, E.J., Fernandes, E.C., Rodrigues, A.I., Teixeira, J.A., Rodrigues, L.R., 2015. Olanrewaju, O.S., Glick, B.R., Babalola, O.O., 2017. Mechanisms of action of plant growth
Biosurfactant produced by Bacillus subtilis using corn steep liquor as culture medium. promoting bacteria. World J. Microbiol. Biotechnol. 33 (11), 197. https://doi.org/10.
Front. Microbiol. 6. https://doi.org/10.3389/fmicb.2015.00059. 1007/s11274-017-2364-9.
Gupta, G., Parihar, S.S., Ahirwar, N.K., Snehi, S.K., Singh, V., 2015. Plant growth pro- Pal, K.K., Gardener, M.B., 2006. Biological control of plant pathogens. Plant Health Instr.
moting rhizobacteria (PGPR): current and future prospects for development of sus- https://doi.org/10.1094/PHI-A-2006-1117-02.
tainable agriculture. J. MicrobBiochem. Technol. 7, 96–102. Pan, Z., Li, X., Yang, B.X., Andrade, D., Xue, J., McKinney, N., 2010. Prediction of plant
Haas, D., Defago, G., 2005. Biological control of soil-borne pathogens by fluorescent diseases through modelling and monitoring airborne pathogen dispersal. In:
pseudomonads. Nat. Rev. Microbiol. 3, 307–319. Hemming, D. (Ed.), CAB Reviews: Perspectives in Agriculture, Veterinary Science.
Halfeld-Vieira, B.A., Vieira, J.R., Romeiro Jr., R.S., Silva, H.S.A., Mc, B.P., 2006. Nutrition and Natural Resources CABI, UK, pp. 191–202.
Induction of systemic resistance in tomato by autochthonus phylloplane resident Péchy-Tarr, M., Bruck, D.J., Maurhofer, M., Fisher, E., Vogne, C., 2008. Molecular ana-
Bacillus cereus. Pesq Agropec Bras. 41, 1247–1252. https://doi.org/10.1590/S0100- lysis of a novel gene cluster encoding an insect toxin in plant-associated strains of
204X2006000800006. Pseudomonas fluorescens. Environ. Microbiol. 10, 2368–2386.
Hardy, R.W.F., Burns, R.C., Holsten, R.D., 1973. Application of acetylene reduction assay Penrose, D.M., Glick, B.R., 2003. Methods for isolating and characterizing ACC deaminase
for measurement of nitrogen fixation. Soil Boil Biochem. 5, 47–81. containing plant growth promoting rhizobacteria. Physiol. Plantar. 118, 10–15.
Hu, L.B., Shi, Z.Q., Zhang, T., Yang, Z.M., 2007. Fengycin antibiotics isolated from B- R-Studio Team, 2019. R Studio: Integrated Development Environment for R (Version
FS01culture inhibit the growth of Fusarium moniliforme Sheldon ATCC38932. FEMS 3.6.0). R Studio, Inc., Boston, MA. http://www.rstudio.com/.
Microbiol. Lett. 272, 91–98. Raaijmakers, J.M., de Bruijn, I., Nybroe, O., Ongena, M., 2010. Natural functions of li-
Idris, A.H., Labuschagne, N., Korsten, L., 2007. Screening rhizobacteria for biological popeptides from Bacillus and Pseudomonas: more than surfactants and antibiotics.
control of Fusarium root and crown rot of sorghum in Ethiopia. Biol. Control 40, FEMS Microbiol. Rev. 34, 1037–1062.
97–106. Raaijmakers, J.M., Mazzola, M., 2012. Diversity and natural functions of antibiotics
Idris, A.H., Labuschagne, N., Korsten, L., 2008. Suppression of Pythium ultimum root rot of produced by beneficial and plant pathogenic bacteria. Annu. Rev. Phytopathol. 50,
sorghum by rhizobacterial isolates from Ethiopian and South Africa. Biol. Control 45, 403–424. https://doi.org/10.1146/annurev-phyto-081211-172908.
72–84. Sachdev, D.P., Cameotra, S.S., 2013. Biosurfactants in agriculture. Appl. Microbiol.
Jayaprakashvel, M., Mathivanan, N., 2011. Management of plant diseases by microbial Biotechnol. 97, 1005–1016.
metabolites. In: Harikesh, B.S., Chetan, K., Reddy, M.S., Estibaliz, S., Carlos, G.E. Sakthivel, N., Gnanamanickam, S.S., 1987. Toxicity of Pseudomonas fluorescens towards
(Eds.), Bacteria in Agrobiology: Plant Nutrient Management. Sringer-Verlag, Berlin, rice sheath rot pathogen Acrocylindriumoryzae. Curr. Sci. 5, 106–107.
pp. 237–265. Savary, S., Willocquet, L., Pethybridge, S.J., Esker, P., McRoberts, N., Nelson, A., 2019.
Ji, Z., Ling, Z., Zhang, Q., Xu, J., Chen, X., Tong, Y., 2008. Study on the inhibition of The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 3,
Bacillus licheniformis on Botryosphaeria berengeriana f sp. Piricola and Glomerella cin- 430–439.
gulate and biocontrol efficacy on postharvest apple diseases. J. Fruit Sci. 25, 209–214. Schlatter, D., Kinkel, L., Thomashow, L., Weller, D., Paulit, T., 2017. Disease suppressive
Kamei, A., Dolai, A.K., Kamei, A., 2014. Role of hydrogen cyanide secondary metabolite soils: new insights from the soil microbiome. Phytopahtol. 107, 1284–1297.
of plant growth promoting rhizobacteria as biopesticides of weeds. Glob. J. Sci. Front. Schwyne, B., Neilands, J.B., 1987. Universal chemical assay for the detection and de-
Res. A Phys. # Space Sci. 14 ISSN: 2249-4626 & Print ISSN: 0975-5896. termination of siderophores. Anal. Biochem. 160, 47–56.
Khabbaz, S., Abbasi, P.A., 2014. Isolation, characterization, and formulation of antag- Shahid, M., Hameed, S., Imran, A., Ali, S., van Elsas, J.D., 2012. Root Colonization and
onistic bacteria for the management of seedlings damping-off and root rot disease of growth promotion of sunflower (Helianthus annuus L.) by phosphate solubilizing
cucumber. Can. J. Microbiol. 60 (1), 25–33. Enterobacter sp. W. J. Microbiol. Biotechnol. 28 (8), 2749–2758. https://doi.org/10.
Lavakush, Y.J., Verma, J.P., Jaiswal, D.K., Kumar, A., 2014. Evaluation of PGPR and 1007/s11274-012-1086-2. Fs-11.
different concentration of phosphorus level on plant growth, yield and nutrient Shanmugaiah, V., Mathivanan, N., Varghese, B., 2010. Purification, crystal structure and
content of rice (Oryza sativa). Ecol. Eng. 62, 123–128. antimicrobial activity of phenazine-1-carboxamide produced by a growth-promoting
Li, Y., Han, L.R., Zhang, Y., Fu, X., Chen, X., Zhang, L., Mei, R., Wang, Q., 2013. Biological biocontrol bacterium, Pseudomonas aeruginosa MML2212. J. Appl. Microbiol. 108,
control of apple ring rot on fruit by Bacillus amyloliquefaciens 9001. Plant Pathol. J. 703–711.
(Faisalabad) 29, 168–173. Shen, X., Hu, H., Peng, H., Wang, W., Zhang, X., 2013. Comparative genomic analysis of
Lork, H., 1948. Production of hydrocyanic acid by bacteria. Physiol. Plant. 1, 142–146. four representative plant growth-promoting rhizobacteria in Pseudomonas. BMC
Lugtenberg, B., Kamilova, F., 2009. Plant-growth-promoting rhizobacteria. Ann. Rev. Genomics 14, 1471–2164.
Microbiol. 63, 541–556. Shi, C., Yan, P., Li, J., Wu, H., Li, Q., Guan, S., 2014. Biocontrol of Fusarium graminearum
Luo, C., Liu, X., Zhou, H., Wang, X., Chen, Z., 2015. Nonribosomal peptide synthase gene growth and deoxynivalenol production in wheat kernels with bacterial antagonists.
clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic Int. J. Environ. Res. Public Health 11, 1094–1105.
functions. Appl. Environ. Microbiol. 81, 422–431. Shimahara, K., Takiguchi, Y., 1988. Preparation of crustacean chitin. Method Enzymol.
Maddula, V.S.R.K., Zhang, Z., Pierson, E.A., Pierson-III, L.S., 2006. Quorum sensing and 161, 417–423.
phenazines are involved in biofilm formation by Pseudomonas chlororaphis (aur- Siddiqui, I.A., Shaukat, S.S., 2004. Systemic resistance in tomato induced by biocontrol
eofaciens) strain 30-84. Microb. Ecol. 52, 289–301. bacteria against the root-knot nematode, Meloidogyne javanicais independent of sal-
Malfanova, N., Franzil, L., Lugtenberg, B., Chebotar, V., Ongena, M., 2012. Cyclic lipo- icylic acid production. J. Phytopathol. 152, 48–54.
peptide profile of the plant-beneficial endophytic bacterium Bacillus subtilis HC8. Somasegaran, P., Hoben, H.J., 1994. Handbook for Rhizobia: Methods in Legume-
Arch. Microbiol. 194, 893–899. Rhizobium Technology. Springer, Berlin.
Marag, P.S., Suman, A., Gond, S., 2018. Prospecting endophytic bacterial colonization Spaepen, S., Vanderleyden, J., Remans, R., 2007. Indole-3-acetic acid in microbial and
and their potential plant growth promoting attributes in hybrid maize (Zea mays L.). microorganism plant signalling. FEMS Microbiol. Rev. 31, 425–448.
Int. J. Curr. Microbiol. Appl. Sci. 7, 1292–1304. Stien, T., 2005. Bacillus subtilis antibiotics: structures, syntheses and specific functions.
Martinez-Viveros, O., Jorquera, M., Crowley, D.E., Gajardo, G., Mora, M.L., 2010. Mol. Biol. (Mosk.) 56, 845–857.
Mechanisms and practical considerations involved in plant growth promotion by Sulochana, M.B., Jayachandra, S.Y., Kumar, S.K.A., Dayanand, A., 2014. Antifungal at-
rhizobacteria. J. Soil Sci. Plant Nut. 10, 293–319. tributes of siderophore produced by the Pseudomonas aeruginosa JAS-25. J. Basic
Mavrodi, D., Mavrodi, O., Parejko, J.A., Weller, M.D., Thomasho, L., 2011. The role of Microbiol. 54, 418–424.
2,4-diacetylphloroglucinol- and phenazine-1-carboxylic acid-producing Pseudomonas Sun, G.Z., Yao, T., Feng, C.J., Chen, L., Li, J.H., Wang, L.D., 2017. Identification and
16
biocontrol potential of antagonistic bacteria strains against Sclerotinia sclerotiorum (Eds.), Microbial Diversity and Biotechnology in Food Security. Springer- Verlag,
and their growth-promoting effects on Brassica napus. Biol. Control 104, 35–43. Berlin, pp. 293–305.
Tailor, J.A., Joshi, B.H., 2012. Characterization and optimization of siderophore pro- Weller, D.M., Raaijmakers, J.M., McSpadden Gardener, B.B., Thomashow, L.S., 2002.
duction from Pseudomonas fluorescens strain isolated from sugarcane rhizosphere. J. Microbial populations responsible for specific soil suppressiveness to plant patho-
Environ. Res. Dev. 6, 688–694. gens. Annu. Rev. Phytopathol. 40, 309–348.
Tang, Q., Bie, X., Lu, Z., Lv, F., Tao, Y., Qu, X., 2014. Effects of fengycin from Bacillus Yin, X.T., Xu, Y., Fan, S.S., Xu, L.N., Li, D.C., Liu, Z.H., 2010. Isolation and character-
subtilis fmbj on apoptosis and necrosis in Rhizopus stolonifera. J. Microbiol. 52, ization of AHL lactonase gene from Bacillus amyloliquefaciens. W J. Microbiol.
675–680. Technol. 26, 1361–1367.
Tanya, A., Filion, M., 2017. Biocontrol through antibiosis: exploring the role played by Yu, X., Ai, C., Xin, L., Zhou, G., 2011. The siderophore-producing bacterium, Bacillus
subinhibitory concentrations of antibiotics in soil and their impact on plant patho- subtilis CAS15, has a biocontrol effect on Fusarium wilt and promotes the growth of
gens. Can. J. Plant Pathol. 39, 267–274. pepper. Eur. J. Soil Biol. 47, 138–145.
Trapet, P., Avoscan, L., Klinguer, L., Pateyron, S., Citerne, S., Chervin, C., Mazurier, S., Zhang, X., Zhou, Y.Y., Li, Y., Fu, X.C., Wang, Q., 2017. Screening and characterization of
Lemanceau, P., Wendehenne, D., Besson-Bard, A., 2016. The Pseudomonas fluorescens endophytic Bacillus for biocontrol of grapevine downy mildew. Crop. Prot. 96,
siderophore pyoverdine weakens Arabidopsis thalianadefense in favour of growth in 173–175.
iron-deficient conditions. Plant Physiol. 171, 675–693. Zhang, Y., Xue, Q.Y., Xu, Q., Lu, S., Gu, C., Guo, J.H., 2011. A screening strategy of fungal
Urja, P., Saraf, M., 2014. In vitro evaluation of PGPR strains for their biocontrol potential biocontrol agents towards Verticillium wilt of cotton. Biol. Control 56, 209–216.
against fungal pathogens. In: Kharwar, R.N., Upadhyay, R.S., Dubey, N.K., Richa, R.
17

Microbiological Research: Saira Ali, Sohail Hameed, Muhammad Shahid, Mazhar Iqbal, George Lazarovits, Asma Imran

Uploaded by

Microbiological Research: Saira Ali, Sohail Hameed, Muhammad Shahid, Mazhar Iqbal, George Lazarovits, Asma Imran

Uploaded by

Microbiological Research 232 (2020) 126389

Contents lists available at ScienceDirect

Functional characterization of potential PGPR exhibiting broad-spectrum T

1. Introduction around the world and are encountered by several phytopathogens

1 LB1 Potato/ Naran 80 78 79 78 80 72 70 75 85 83

water in place of bacterial inoculum.

IAA precursor. Cells were removed by centrifugation and the pH of the

supernatant was adjusted to 2.8 by using 1 M HCl. Indole acetic acid

Production of IAA was conﬁrmed and quantiﬁed through high-perfor-

mance liquid chromatography (HPLC) (Perkin Elmer, USA) equipped

production was quantiﬁed by comparing the retention time and peak

2.5.6. Phosphate solubilization

For qualitative analysis of phosphatase activity by antagonistic

bacteria, an aliquot of 10 μL from each of the freshly grown bacteria

was spotted on Petri plates prepared with Pikoviskayas’agar media

(Sigma). The plates were incubated at 28 ± 2 °C for 5 days and ex-

The Phosphomolybdate blue color method was used to quantify the

total solubilized phosphate produced by bacteria (Murphy and Riley,

1962). A freshly grown bacterial colony of each rhizobacterium was

inoculated in a 50 mL sterile falcon tube (n = 3) containing 15 mL of

Pikovskaya’s broth supplemented with tri-calcium phosphate. The tubes

were incubated at 28 °C for 7 days in an incubator shaker at 120 rpm.

amount of phosphorous in the supernatant was measured by a UV–vis

spectrophotometer (Camspec M350) at 882 nm. The amount of solu-

bilized phosphorous was calculated by comparing it with the standard

curve of phosphorous dissolved in deionized water.

2.5.7. Nitrogen ﬁxation (NF)

Nitrogenase activity of the 12 antagonist strains was examined by

colony was inoculated in 10 mL McCartney vial (n = 3) containing

incubated at 28 ± 2 °C for 48 h. Then, the metal caps were replaced by

h. The amount of ethylene produced in the vials was measured as de-

through syringe from each vial and infused in a gas chromatograph

(Thermoquest; Porapak N column 6′x1/8′', 80–100 mesh; H2 carrier gas

and ﬂame ionization detector FID). A standard curve of ethylene was

used to calculate the amount of ethylene produced by each bacterium.

2.5.8. Quorum sensing activity (QS)

Freshly grown culture of the biosensor strain

Chromobacteriumviolaceum (CV026) was spread on the LB plates and a

then observed for the appearance of a violet hues. The presence of

purple-colored pigment production indicates the presence of QS-posi-

2.5.9. ACC-deaminase activity

The ability of rhizobacteria to use 1-aminocyclopropane-1-car-

boxylic acid (ACC) as a sole nitrogen source was assessed in 5 mL DF

salt minimal medium (Penrose and Glick, 2003) containing 3 μL of 0.5

160 x g and at 28 ± 2 °C to. The presence of ACC-deaminase activity

inoculated in LB broth and incubated at 28 ± 2 °C for 24 h. Cells were

at 28 ± 2 °C for 24 h. After removal of the medium wells were washed,

2.6. Characterization of antifungal metabolites through mass spectroscopy

Two diﬀerent methods were adopted for the isolation of metabo-

2.6.1. Extraction of metabolites from Pseudomonas spp

A pure colony of each strain was inoculated to 250 mL of King’s B

in an incubator shaker at 200 rpm. The cells were removed by cen-

adjusted to 3.0 by adding 1 M HCl. An equal volume of ethyl acetate

lites were freeze-dried. The dried compounds were dissolved in 5 mL of

50 % methanol. The extract was puriﬁed by passing through a 0.45-μm

syringe ﬁlter, freeze-dried and re-dissolved in 1 mL methanol. The li-

popeptide extract was stored at -20 °C.

2.6.2. Extraction of lipopeptides from Bacillus spp

Bacilluslipopeptides were extracted as described by Ali et al., (2014)

were removed by centrifugation (8000 g at 4 °C for 10 min). The su-

precipitated by adding 6 N HCl to get the ﬁnal pH of 2.0 and kept at 4 °C

°C for 20 min) and dissolved in 75 % methanol. The extract was puriﬁed

2.6.3. Characterization of biocontrol metabolites through a mass

The puriﬁed metabolites from Pseudomonas and Bacillus were ana-

temperature, tube lens voltage, the voltage of ion optics), MS para-

vitro antifungal activity showed positive correlation with in vivo disease

Declaration of Competing Interest

of any commercial or ﬁnancial relationships that could be construed as

a potential conﬂict of interest.

Authors are thankful to the Higher Education Commission of

digenous fellowship scheme”.

neering of production. In: Soberon‐Chavez, G. (Ed.), Biosurfactants Microbiology

Monographs. Springer-Verlag, Germany, pp. 13–55.

rhizobacteria: current perspective. J. King Saud. Univ. Sci. 26, 1–20.

Curr. Microbiol. Appl. Sci. 12, 303–312.

sustainable crop production and environmental sustainability. Microbiol. Res. 219,