Paper para clase y trabajo (2018) pdf

Article
NF-kB Restricts Inflammasome Activation via

Elimination of Damaged Mitochondria
Graphical Abstract Authors
Zhenyu Zhong, Atsushi Umemura, Elsa
Sanchez-Lopez, ..., Maria T. Diaz-Meco,
Jorge Moscat, Michael Karin
Correspondence
[email protected]
In Brief
NF-kB restrains its own inflammation-
promoting activity in macrophages by
promoting p62-mediated removal of
mitochondria that have been damaged
after macrophages encounter various
NLRP3-inflammasome activators.
Highlights
d NF-kB mediates LPS-induced p62/SQSTM1 expression in
macrophages
d NLRP3 agonists damage mitochondria and release

inflammasome activating signals
d Ubiquitinated damaged mitochondria are eliminated by p62-

dependent mitophagy
d p62 ablation prevents mitophagy and enhances NLRP3-

inflammasome activation
Zhong et al., 2016, Cell 164, 896–910

February 25, 2016 ª2016 Elsevier Inc.
http://dx.doi.org/10.1016/j.cell.2015.12.057
Article
NF-kB Restricts Inflammasome Activation

via Elimination of Damaged Mitochondria
Zhenyu Zhong,1,2,10 Atsushi Umemura,1,2,3,10 Elsa Sanchez-Lopez,1,2 Shuang Liang,4 Shabnam Shalapour,1,2
Jerry Wong,1,2 Feng He,1,2 Daniela Boassa,5 Guy Perkins,5 Syed Raza Ali,6 Matthew D. McGeough,6 Mark H. Ellisman,5
Ekihiro Seki,4,7 Asa B. Gustafsson,8 Hal M. Hoffman,6 Maria T. Diaz-Meco,9 Jorge Moscat,9 and Michael Karin1,2,*
1Laboratory of Gene Regulation and Signal Transduction, Department of Pharmacology
2Department of Pathology, School of Medicine
University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093, USA
3Department of Molecular Gastroenterology and Hepatology, Graduate School of Medical Science, Kyoto Prefectural University of Medicine,
465 Kajii-cho, Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan

4Division of Gastroenterology, Department of Medicine, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093, USA
5National Center for Microscopy and Imaging Research, Center for Research in Biological Systems, University of California San Diego,
9500 Gilman Drive, La Jolla, CA 92093, USA

6Department of Pediatrics, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093, USA
7Division of Gastroenterology, Department of Medicine, Cedars-Sinai Medical Center, Los Angeles, CA 90048, USA
8Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California San Diego, La Jolla, CA 92093, USA
9Sanford-Burnham Prebys Medical Discovery Institute, 10901 North Torrey Pines Road, La Jolla, CA 92037, USA
10Co-first author
*Correspondence: [email protected]
http://dx.doi.org/10.1016/j.cell.2015.12.057
SUMMARY (PAMPs) or damage-associated (DAMPs) molecular patterns,

macrophages initiate an acute but transient host response
Nuclear factor kB (NF-kB), a key activator of inflam- whose ultimate goal is clearance of foreign organisms and
mation, primes the NLRP3-inflammasome for activa- cellular debris and restoration of tissue integrity and function
tion by inducing pro-IL-1b and NLRP3 expression. (Kotas and Medzhitov, 2015; Meylan et al., 2006). Indeed, while
NF-kB, however, also prevents excessive inflamma- interfering with innate immunity, macrophage ablation also re-
tion and restrains NLRP3-inflammasome activation sults in excessive tissue damage (Brenner et al., 2013). Thus,
proper control of macrophage activation is pivotal to restoration
through a poorly defined mechanism. We now show
of tissue integrity and function.
that NF-kB exerts its anti-inflammatory activity by Macrophages sense PAMPs and DAMPs via Toll-like (TLRs)
inducing delayed accumulation of the autophagy re- and Nod-like (NLRs) receptors, which control inflammation
ceptor p62/SQSTM1. External NLRP3-activating stim- through transcriptional and post-transcriptional mechanisms,
uli trigger a form of mitochondrial (mt) damage that respectively (Meylan et al., 2006). Unlike TLRs, which directly
is caspase-1- and NLRP3-independent and causes recognize their agonists, most NLRs involved in inflammasome
release of direct NLRP3-inflammasome activators, activation and IL-1b/IL-18 production are not bona fide receptor
including mtDNA and mtROS. Damaged mitochondria proteins (Vance, 2015; von Moltke et al., 2013). For instance,
undergo Parkin-dependent ubiquitin conjugation and NLR family, pyrin domain containing 3 (NLRP3), which binds
are specifically recognized by p62, which induces the adaptor apoptosis-associated speck-like protein containing
their mitophagic clearance. Macrophage-specific a CARD domain (ASC) to induce pro-caspase-1 recruitment,
autoactivation, and pro-IL-1b processing, responds to highly
p62 ablation causes pronounced accumulation of
diverse stimuli, including ATP, bacterial toxins, micro-crystalline
damaged mitochondria and excessive IL-1b-depen- substances, lipid particles, bacteria, and viruses, none of which
dent inflammation, enhancing macrophage death. binds NLRP3 directly (Elliott and Sutterwala, 2015; Lamkanfi and
Therefore, the ‘‘NF-kB-p62-mitophagy’’ pathway is a Dixit, 2014). Some of these stimuli act via the purinergic receptor
macrophage-intrinsic regulatory loop through which P2X7 and others are thought to induce plasma membrane dam-
NF-kB restrains its own inflammation-promoting ac- age, but all of them promote NLRP3 association with ASC,
tivity and orchestrates a self-limiting host response inducing formation of the NLRP3-inflammasome complex
that maintains homeostasis and favors tissue repair. through indirect mechanisms that involve mitochondrial (mt) sig-
nals (Elliott and Sutterwala, 2015; Zhong et al., 2013). Inflamma-
some-activating signals include mtDNA, reactive oxygen spe-
INTRODUCTION cies (mtROS), or cytosolic presentation of cardiolipin, all of
which were proposed to serve as direct activators of the
Macrophages are sentinels that detect foreign invaders and NLRP3:ASC:pro-Caspase-1 complex. Essential for NLRP3-in-
sterile tissue damage. Upon encounter of pathogen-associated flammasome activation is transcription factor nuclear factor kB
896 Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc.
(NF-kB), which acts downstream of TLRs and other immune that activates NF-kB and primes macrophages for NLRP3-in-
receptors (Vallabhapurapu and Karin, 2009). While inducing flammasome activation. Expression of all five autophagy recep-
numerous inflammatory chemokines, cytokines, and cytokine tors was low in wild-type (WT) macrophages but LPS treatment
precursors, including pro-IL-1b, NF-kB also induces NLRP3 led to strong and selective p62 mRNA and protein induction (Fig-
and is therefore important for inflammasome priming and as- ures 1A and S1A). Notably, LPS-induced p62 continues to accu-
sembly (Schroder and Tschopp, 2010). Surprisingly, NF-kB mulate for at least 6 hr during the priming step and lags behind
also has anti-inflammatory functions, and its activity is needed NLRP3 and pro-IL-1b, whose accumulation was completed
for preventing premature and excessive NLRP3-inflammasome within the first 3 hr of priming (Figures 1A and S1B). However,
activation in macrophages as well as inhibition of neutrophil pro- similar to NLRP3 and pro-IL-1b, induction of p62 was NF-kB-
teases, that also process pro-IL-1b (Greten et al., 2007). Treat- dependent because IKKb inhibition by ML120b prevented it
ment of mice with potent IKKb inhibitors or myeloid-specific (Figure 1B).
IKKb ablation enhances IL-1b production and mortality in
response to LPS challenge and microbial infections (Greten Macrophage p62 Ablation Enhances IL-1b Production
et al., 2007). IKKb ablation or inhibition also results in neutrophilia We investigated whether p62 could mediate the inhibitory effect
(neutrophil accumulation), another dangerous condition causing of NF-kB on the NLRP3-inflammasome. We crossed p62F/F and
extensive tissue damage (Hsu et al., 2011). Enhanced inflamma- LysM-Cre mice to generate LysM-Cre/p62F/F mice (hereafter
tion and neutrophilia were observed in human subjects that were p62DMye), which lack p62 in mature myeloid cells, including mac-
given IKKb inhibitors, resulting in termination of clinical develop- rophages and neutrophils. Intraperitoneal (i.p.) LPS injection re-
ment programs focused on such compounds. The precise sulted in 35% mortality in WT mice, but close to 100% mortality
molecular mechanism underlying NF-kB-mediated inhibition of was seen in p62DMye mice (Figure 1C). Importantly, the effect of
NLRP3-inflammasome activation remains obscure. myeloid-specific p62 deletion on sepsis-induced mortality is
A recent study suggested that NF-kB promotes autophagy similar to that of IKKb ablation in the same compartment (Greten
(Criollo et al., 2010), a quality control process that negatively reg- et al., 2007). LPS-induced mortality is mediated by TNF and IL-
ulates NLRP3-inflammsome activation (Nakahira et al., 2011; 1b, but circulating TNF in LPS-injected p62DMye mice was barely
Saitoh et al., 2008; Zhou et al., 2011) through a yet-to-be defined higher than in WT mice (Figure 1D). By contrast, p62DMye mice
mechanism. Postulating that the anti-inflammatory effect of NF- exhibited a 2-fold increase in circulating IL-1b after LPS treat-
kB could be mediated through autophagy, we searched for NF- ment (Figure 1E). No strain-specific differences in basal TNF or
kB-regulated gene products involved in autophagy. We thus IL-1b were observed. Blocking IL-1 signaling with anakinra, an
examined expression of all five known autophagy receptors IL-1b receptor antagonist, prevented septic shock and improved
(Lazarou et al., 2015), namely: NBR1, NDP52, p62/SQSTM1, op- survival in both WT and p62DMye mice (Figure 1C), indicating a
tineurin (OPTN), and TAX1BP1, in LPS-primed macrophages central and critical role for IL-1b-IL-1R signaling in the pathogen-
and found that only p62 was upregulated upon NF-kB activation. esis of excessive inflammation.
p62, a highly conserved protein, is a multifunctional signaling Unlike TNF, whose synthesis and secretion are inflamma-
scaffold and adaptor that binds polyubiquitinated proteins some-independent, secretion of mature IL-1b by macrophages
and damaged organelles and targets them to autophagosomal requires inflammasome-dependent caspase-1 activation.
clearance via its ubiquitin association domain (UBA) and LC3 Indeed, stimulation of WT and p62DMye bone marrow-derived
binding motif (LIR), respectively (Komatsu et al., 2012). Upon macrophages (BMDM) with different NLRP3 inflammasome ac-
stimulation of primed macrophages with NLRP3 agonists, p62 tivators, including ATP, urea microcrystals (MSU), alum, silica
is recruited to damaged mitochondria that release signals microparticles, liposomes (DOTAP), and nigericin, led to 2- to
causing NLRP3-inflammasome activation. By eliminating such 3-fold higher IL-1b secretion by p62DMye macrophages than
signal-producing mitochondria, p62 prevents excessive inflam- p62F/F macrophages (Figures 1F and S1C), indicating that
masome activation, which, in addition to IL-1b release, triggers enhanced IL-1b secretion is retained ex vivo and likely to be
macrophage death (Miao et al., 2010), thereby compromising related to enhanced inflammasome activation. Importantly,
macrophage-mediated immunity, tissue repair and healing. small hairpin RNA (shRNA)-mediated p62 silencing in WT
Therefore, the ‘‘NF-kB-p62/SQSTM1-mitophagy’’ pathway pro- (C57Bl/6) immortalized BMDM (Hornung et al., 2008) led to a
vides an essential regulatory loop through which NF-kB orches- similar enhancement of pro-IL-1b processing and IL-1b secre-
trates a reparative inflammatory response and prevents exces- tion upon incubation with the inflammasome activators used
sive collateral damage. above (Figures 1G and S1D). Thus, the results are not unique
to knockout mice. Elevated IL-1b secretion was accompanied
RESULTS by enhanced caspase-1 activation in p62DMye BMDM (Figures
S1C and S1E). Fittingly, ATP-induced pyroptosis, an inflamma-
LPS Induces NF-kB-Dependent p62/SQSTM1 tory form of cell death mediated by caspase-1, was exacerbated
Expression in Macrophages in p62-deficient macrophages relative to WT counterparts (Fig-
We examined whether NF-kB attenuates NLRP3-inflammasome ure S1F). p62 ablation had no effect on NLRP3, ASC, or pro-
activation in macrophages by inducing genes whose products IL-1b expression after LPS treatment (Figure S1G) and did not
promote autophagy. We examined expression of five known affect TNF induction by LPS alone or together with NLRP3-in-
autophagy receptors (NBR1, NDP52, p62/SQSTM1, OPTN, flammasome activators (Figures 1H and S1H). BMDM from
and TAX1BP1) in the presence or absence of LPS, a TLR4 ligand global p62-KO mice also displayed elevated IL-1b secretion after
Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc. 897
Figure 1. p62, Induced on NF-kB Activation, Suppresses NLRP3-Inflammasome-Dependent IL-1b Production
(A) Immunoblot (IB) analysis of autophagy receptors in wild-type (p62F/F) and p62DMye BMDM stimulated with LPS (200 ng/ml).
(B) Wild-type BMDM were incubated with or without LPS in the absence or presence of IKKb inhibitor ML120b and expression of p62, pro-IL-1b, and NLRP3 was
IB-analyzed.
(C) Survival of p62F/F or p62DMye mice injected with intraperitoneal (i.p.) LPS (30 mg/kg) without or with anakinra (50 mg/kg), n = 11–13.
(D and E) Twelve-week-old p62F/F or p62DMye mice were i.p. injected with LPS and their sera collected 3 hr later and analyzed by ELISA for TNF (D) and IL-1b (E).
(F and H) Release of IL-1b (F) or TNF (H) from LPS-primed p62F/F or p62DMye BMDM that were stimulated with the indicated NLRP3 agonists. Data are averages ±
SD (n = 3).
(G) IB analysis of caspase-1 and pro-IL-1b processing in LPS-primed WT (W) or p62-deficient (K) iBMDM stimulated as indicated. Data are representative of three
independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001.
See also Figure S1.
stimulation with NLRP3 agonists (Figure S1I). Moreover, p62 agonists stimulate mitochondrial damage, which results in p62
ablation did not have a significant effect on AIM2- or NLRP1b-in- recruitment.
flammasome activities (Figures S1J and S1K), suggesting the ef-
fect is specific to the NLRP3-inflammasome. In p62-deficient Damaged Mitochondria Accumulate in p62-Deficient
macrophages, IKKb inhibition did not cause a further increase Macrophages
in caspase-1 activation (Figure S1L). Mitophagy mediates clearance of damaged mitochondria (Laz-
arou et al., 2015). To test more directly whether NLRP3-inflam-
Inflammasome Activators Recruit p62 to Mitochondria masome agonists trigger mitochondrial damage, we measured
Inflammasome activators were suggested to affect mitochon- mitochondrial membrane potential. All tested NLRP3 agonists
drial membrane integrity or enhance mtROS production (Elliott induced loss of mitochondrial membrane potential (DJm), and
and Sutterwala, 2015), and p62 can recognize damaged mito- this was exacerbated in p62-deficient macrophages (Figure 2D).
chondria and may promote their autophagic clearance (Geisler To confirm these findings, we used a fluorescence-based assay
et al., 2010), although this function of p62 has been disputed and flow cytometry to quantitate mitochondrial damage.
(Lazarou et al., 2015). We therefore examined whether inflamma- Consistent with the above results, inflammasome activators
some activators affect the subcellular distribution of p62 and/or induced appearance of damaged mitochondria and their effect
induce its mitochondrial translocation. In non-stimulated macro- was considerably enhanced in p62-deficient macrophages (Fig-
phages, p62 displayed diffuse cytoplasmic distribution, but ure 2E). Using electron microscopy (EM) we directly assessed
diverse NLRP3 inflammasome activators induced p62-contain- mitochondrial integrity and state in WT and p62DMye BMDM.
ing aggregates that were either colocalized with or adjacent to Whereas ATP, and to a lesser extent, DOTAP induced accumu-
mitochondria (Figures 2A and 2B). Cell fractionation confirmed lation of a few swollen mitochondria in WT cells, this effect was
these results. In LPS-primed macrophages, very little p62 co- strongly enhanced in p62DMye BMDM, which contained many
sedimented with mitochondria, but after incubation with ATP or highly damaged, electron-dense mitochondria (Figures 2F and
nigericin, much more p62 was present in the mitochondrial frac- 2G). Accumulation of damaged mitochondria in p62-deficient
tion, which now also contained lipidated LC3 (LC3II) and Parkin macrophages correlated with enhanced mtROS production
(Figure 2C). These results suggest that NLRP3-inflammasome and elevated mtDNA release (Figures S2A and S2B). These
(legend on next page)
results confirm that NLRP3 agonists induce mitochondrial dam- also defective in mitochondrial p62 recruitment (Figures 3B,
age, resulting in mtROS and mtDNA release. Unlike previous 3C, S3B, and S3C). We examined whether ectopically expressed
studies, in which p62 deficiency only affected the subcellular p62 is also recruited to mitochondria upon macrophage stimula-
distribution of mitochondria (Narendra et al., 2010; Okatsu tion. Whereas full-length WT p62 underwent mitochondrial
et al., 2010), p62 ablation results in substantial accumulation recruitment after stimulation with NLRP3 agonists, the UBA-defi-
of damaged mitochondria in macrophages stimulated with cient construct, p62(DUBA), did not (Figures 3D and S3D). Thus,
NLRP3 agonists. By promoting clearance of damaged mito- mitochondrial recruitment of p62 after exposure to NLRP3
chondria, p62 attenuates NLRP3-inflammasome activation. agonists requires Parkin-dependent decoration of damaged
It was suggested that NLRP3-inflammasome-dependent mitochondria with poly-Ub chains that are recognized by the
caspase-1 activation is responsible for mitochondrial damage p62 UBA domain.
(Yu et al., 2014), thus placing mitochondria downstream of
caspase-1. However, numerous other studies had reached the Parkin Restricts Buildup of Damaged Mitochondria
opposite conclusion and placed mitochondrial damage up- By decorating damaged mitochondria with poly-Ub chains, Par-
stream to caspase-1(Elliott and Sutterwala, 2015). We ad- kin targets them to mitophagic clearance (Eiyama and Okamoto,
dressed this controversy using Nlrp3 / , Asc / , and Casp1 / 2015). Accordingly, Parkin-deficient macrophages exhibited
macrophages, which are defective in inflammasome activation. enhanced accumulation of damaged mitochondria after treat-
Despite the defect, all types of inflammasome-deficient macro- ment with NLRP3 agonists (Figure 4A). The Parkin deficiency
phages exhibited mitochondrial damage comparable to WT, also enhanced Jm loss upon stimulation with NLRP3 agonists
when incubated with NLRP3-inflammasome agonists (Figures and augmented mtDNA release and mtROS production (Figures
S2C–S2E), confirming that mitochondrial damage is upstream 4B and S4A, and S4B). Although the Parkin deficiency did not
to and independent of caspase-1 activation. These results also affect NLRP3, ASC, pro-caspase-1, or pro-IL-1b expression
confirmed that NLRP3 is not the direct site of action of the inflam- (Figure S4C), it enhanced IL-1b release upon stimulation with in-
masome activators tested in these experiments. flammasome activators, without affecting TNF secretion (Figures
To validate these conclusions, we took advantage of a tamox- 4C and S4D). NLRP3 agonist-induced caspase-1 activation was
ifen-inducible Nlrp3 knockin mouse strain, that expresses a hu- also elevated in Parkin-deficient macrophages (Figures 4D and
man Muckle-Wells syndrome NLRP3(A350V) variant that is 4E). Thus, just like p62, Parkin limits accumulation of damaged
constitutively active toward caspase-1 (Brydges et al., 2013). mitochondria in macrophages stimulated with NLRP3 inflamma-
BMDM isolated from these mice released considerable amounts some activators and thereby attenuates caspase-1 activation
of IL-1b upon LPS priming, without the need for secondary stim- and IL-1b secretion.
ulation with NLRP3 agonists (Figure S2F). However, macro-
phages containing genetically activated NLRP3(A350V) did not ATG7 Is Needed for Clearance of p62-Bound
exhibit mitochondrial damage and enhanced mtROS production Mitochondria
after LPS stimulation (Figures S2G and S2H), supporting the To better understand the role of the autophagic machinery in
notion that mitochondrial damage induced by external NLRP3 clearing damaged mitochondria, we conducted additional imag-
agonists is caspase-1-independent. ing experiments. LC3 puncta, which indicate autophagosome
formation, colocalized with mitochondria, p62, and poly-Ub after
Parkin Is Required for p62 Mitochondrial Recruitment NLRP3 inflammasome activation (Figures 5A, 5B, S5A, and
p62 binds damaged mitochondria through its UBA domain (Ko- S5B). ATG7 deletion had no pronounced effect on NLRP3,
matsu et al., 2012). Macrophage treatment with NLRP3-inflam- ASC, pro-caspase-1, or pro-IL-1b in LPS-stimulated macro-
masome agonists induced formation of poly-ubiquitin (poly-Ub) phages (Figure S5C), although it enhanced accumulation of
aggregates, most of which colocalized with p62 puncta on damaged mitochondria after stimulation with NLRP3 agonists,
mitochondria (Figures 3A and S3A). Induction of mitochondrial increased mitochondrial depolarization, and augmented mtROS
poly-Ub is likely to depend on the E3 ligase Parkin (Lazarou production and mtDNA release (Figures 5C, 5D, S5D, and S5E).
et al., 2015). Indeed, no mitochondrial poly-Ub was detected in As expected, ATG7 deficiency enhanced p62 accumulation (Fig-
Park2 / (Park2 encodes Parkin) macrophages, which were ure S5C) and more p62 was recruited to mitochondria in
Figure 2. NLRP3 Agonists Promote Mitochondrial Damage and p62 Recruitment

(A and B) Intracellular distribution (A) of p62 and mitochondria (Tom20) in LPS-primed BMDM stimulated with NLRP3 agonists examined by confocal microscopy
(scale bars, 5 mm) and (B) quantitated by counting cells with p62 aggregation on mitochondria. Averages ± SD represent the ratio of cells with mitochondrial p62
aggregates to total cells in each field. (n = 6).
(C) Subcellular distribution of p62, LC3II, and Parkin before and after NLRP3-inflammasome activation. Data are representative of three independent
experiments.
(D) NLRP3 agonist-induced changes in mitochondrial membrane potential (Jm) in LPS-primed WT (shCtrl) or p62-deficient (shp62) iBMDM were measured by
TMRM fluorescence. Data are averages ± SD (n = 3).
(E) Flow cytometric analysis of mitochondrial status in macrophages challenged with NLRP3 agonists. Gates represent cells with damaged mitochondria.
(F and G) Electron micrographs of mitochondria in LPS-primed p62F/F or p62DMye BMDM after incubation with NLRP3 agonists. Shown are representative
examples of normal, partially damaged, and heavily damaged mitochondria. Scale bars, 500 nm. (G) Quantification of damaged mitochondria in (F). Results are
averages ± SEM (n = 8). *p < 0.05; **p < 0.01; ***p < 0.001.
See also Figure S2.
Figure 3. Mitochondrial p62 Recruitment Is Parkin-Dependent
(A) Intracellular distribution of p62, polyubiquitin (poly-Ub), and mitochondria (Mitotracker) in LPS-primed WT BMDM stimulated with NLRP3 agonists determined
by confocal microscopy. Scale bars, 5 mm.
(B) Mitochondrial poly-Ub decoration examined by confocal microscopy in LPS-primed Park2+/+ or Park2 / BMDM stimulated with NLRP3 agonists. Scale
bars, 5 mm.
(C) Mitochondrial recruitment of p62 in LPS-primed WT (shCtrl) or Parkin-deficient (shPark2) iBMDM stimulated with NLRP3 agonists. Scale bars, 5 mm.
(D) Subcellular distribution of human p62 in LPS-primed, NLRP3 agonist stimulated p62-deficient BMDMs transduced with human p62-full length or p62(DUBA)
constructs. Scale bars, 5 mm.
See also Figure S3.
stimulated cells (Figure 5E), but these damaged mitochondria vious study (Shi et al., 2012), ATG7 deletion had no significant
were not cleared (Figure 5C), leading to elevated caspase-1 ac- effect on AIM2-inflammasome activation (Figure S5J). This
tivity and IL-1b secretion (Figures 5F, 5G, S5F, and S5G) without discrepancy is likely due to the previous reliance on autophagy
affecting TNF release (Figures S5H and S5I). In contrast to a pre- inhibitors (Shi et al., 2012) that probably have off-target effects.
Figure 4. Parkin Limits Accumulation of Damaged Mitochondria after Inflammasome Activation
(A) Flow cytometry of mitochondrial status in WT (shCtrl) or Parkin-deficient (shPark2) iBMDM stimulated with NLRP3 agonists. Gates represent cells with
damaged mitochondria.
(B) NLRP3 agonist-induced changes in mitochondrial membrane potential (Jm) in LPS-primed WT (shCtrl) or p62-deficient (shp62) iBMDM measured by TMRM
fluorescence. Data are averages ± SD (n = 3).
(C) IL-1b release by LPS-primed Park2+/+ or Park2 / BMDM stimulated with NLRP3 agonists. Data are averages ± SD (n = 3).
(D) Caspase-1 activity in LPS-primed WT (shCtrl) or Parkin-deficient (shPark2) iBMDM stimulated with NLRP3 agonists. Results are averages ± SD (n = 3).
(E) IB analysis of cleaved caspase-1 and IL-1b secretion to cell culture supernatants (Sup) or tubulin in cell lysates (Lys) in LPS-primed Park2+/+ or Park2 / BMDM
stimulated with NLRP3 agonists. Data are representative of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001.
See also Figure S4.
(legend on next page)
Activation of the NLRP1b-inflammasome was also unaffected As our results suggest that the NF-kB-p62-mitophagy
by ATG7 ablation (Figure S5K). These results suggest that pathway acts upstream to caspase-1 and restricts its activation,
autophagy specifically inhibits activation of the NLRP3- we reasoned that genetic activation of NLRP3 in the absence of
inflammasome. any external NLRP3 agonists should lead to caspase-1 activa-
tion that cannot be inhibited by this pathway. Indeed, treatment
Eliminating Mitochondrial Signals Attenuates IL-1b of BMDM that expressed genetically activated NLRP3(A350V)
Release with ML120b, which blocks p62 induction, did not further
Damaged mitochondria release or display signals, such as enhance caspase-1 activity (Figure S6E). Similarly, knocking
mtROS, mtDNA, and cardiolipin, that promote NLRP3-inflamma- down of p62 had no effect on IL-1b secretion by LPS-treated
some activation (Elliott and Sutterwala, 2015). We reasoned that NLRP3(A350V) BMDM (Figure S6F) although it enhanced niger-
elimination of these signals may attenuate IL-1b release from icin-induced IL-1b release from WT BMDM (Figure S6G). These
p62-deficient macrophages. To test this hypothesis, we treated results indicate that the genetically activated NLRP3-inflamma-
WT or p62-deficient macrophages with low dose ethidium some is refractory to the NF-kB-p62-mitophagy negative regula-
bromide (EtBr), which depletes mtDNA and blocks mtROS pro- tory loop.
duction (Nakahira et al., 2011). Although not affecting TNF pro-
duction, EtBr treatment, which reduced mtDNA by 90%, atten- p62 Attenuates Sterile Inflammation and Fulminant
uated excessive IL-1b release by p62-deficient macrophages Hepatitis
stimulated with inflammasome activators and inhibited cas- To further examine the physiological function of p62, we used
pase-1 activation (Figures 6A–6D). EtBr treatment had no effect two mouse models of NLRP3-inflammasome-dependent inflam-
on expression of pro-IL-1b or inflammasome components (Fig- mation (Eisenbarth et al., 2008; Kim and Lee, 2013). We em-
ure 6E). Similar results were obtained by treating macrophages ployed alum-induced peritonitis, in which alum was i.p. injected
with chloramphenicol (Figures S6A and S6B), an antibiotic that into WT or p62DMye mice. More peritoneal IL-1b was induced in
targets mitochondrial protein synthesis, thus depleting mito- p62DMye mice, which exhibited elevated neutrophil and mono-
chondria-derived inflammasome-activating signals (Shimada cyte infiltration relative to WT counterparts (Figures 7A–7D).
et al., 2012). We also tested whether sequestering mtROS would Similar results were seen in global p62 KO mice (Figures S7A–
reverse the effect of p62 deficiency. Treatment of macrophages S7D), confirming that global p62 ablation has a similar pheno-
with the mitochondrial-specific antioxidant Mito-Q (Chernyak type to the macrophage-specific deletion in respect to control
et al., 2006) partially reduced NLRP3 agonist-induced mtROS of NLRP3-inflammasome activity. In a second model, we
production and release of IL-1b without affecting TNF release induced fulminant hepatitis with LPS plus D-galactosamine.
(Figures 6F–6H). These results collectively indicate that elimi- p62DMye mice displayed enhanced liver damage and elevated
nating mitochondria-derived signals attenuates IL-1b release in caspase-1 activation in liver macrophages relative to WT mice
p62DMye macrophages. (Figures 7E–7G). Notably, as p62 ablation in neutrophils did not
Although the p62-autophagy pathway was suggested to affect IL-1b secretion induced by NLRP3 agonists (Figure S7E),
attenuate inflammasome activation by targeting inflammasome the phenotypes seen in p62DMye mice are due to p62 deletion
components to autophagic degradation (Shi et al., 2012), we in macrophages.
did not observe significant elevation in amounts of inflamma- We generated Atg7DMye mice, which, similar to p62DMye mice,
some components in p62DMye or Atg7DMye macrophages relative exhibited enhanced IL-1b production and decreased survival
to WT cells after stimulation with ATP (Figures S6C and S6D). We after i.p. injection of LPS (Figures S7F–S7H). Thus, ATG7 also
reason that the ‘‘NLRP3-ASC-pro-caspase-1’’ complex cannot has a protective role in acute septic inflammation. Moreover,
be effectively degraded in lysosomes because inflammasome upon alum challenge, Atg7DMye mice displayed enhanced IL-1b
aggregates are highly resistant to lysosomal degradation and production and neutrophil/monocyte recruitment relative to WT
can be secreted out of the cell (Baroja-Mazo et al., 2014; Franklin mice (Figures S7I–S7L). Similarly, Atg7DMye mice exhibited
et al., 2014). Enhanced inflammasome secretion may account elevated caspase-1 activation in liver macrophages and
for the decrease in NLRP3 after a 2 hr stimulation of p62DMye enhanced liver damage relative to WT counterparts after LPS +
or Atg7DMye macrophages with LPS + ATP. D-galactosamine challenge (Figures S7M–S7O). These results
Figure 5. Autophagy Mediates Clearance of p62-Bound Mitochondria

(A and B) Intracellular distribution of LC3, p62, poly-Ub, and mitochondria in LPS-primed LC3-GFP BMDM stimulated with NLRP3 agonists examined by confocal
microscopy.
(C) Flow cytometric analysis of mitochondrial status in LPS-primed WT (shCtrl) or Atg7-deficient (shAtg7) iBMDM after NLRP3 agonist stimulation. Gates, cells
with damaged mitochondria.
(D) NLRP3 agonist-induced changes in mitochondrial membrane potential (Jm) in LPS-primed WT (shCtrl) or Atg7-deficient (shAtg7) iBMDM. Data are
averages ± SD (n = 3).
(E) Intracellular distribution of p62 and mitochondria in LPS-primed shCtrl or shAtg7 iBMDM stimulated with NLRP3 agonists.
(F) IB analysis of caspase-1 p20 and mature IL-1b in culture supernatants (Sup) and b-actin in cell lysates (Lys) of LPS-primed Atg7F/F (WT) and Atg7DMye (KO)
BMDM stimulated as indicated. Data are representative of three independent experiments.
(G) IL-1b secretion by above cells measured by ELISA. Results are averages ± SD (n = 3). **p < 0.01; ***p < 0.001.
See also Figure S5.
Figure 6. Elimination of Mitochondrial Signals Prevents Excessive IL-1b Production by p62-Deficient Macrophages
(A) Relative concentrations of mtDNA in p62F/F and p62DMye BMDM before and after 4 days of ethidium bromide (EtBr) treatment. Results are averages ± SD
(n = 3).
(B–D) TNF (B) IL-1b (C) release and caspase-1 activity (D) in p62F/F and p62DMye BMDM pre-treated with EtBr or not that were co-stimulated with LPS and different
NLRP3 agonists. Results are averages ± SD (n = 3).
(E) IB analysis of pro-IL-1b, NLRP3, ASC, and pro-caspase-1 in lysates of EtBr-pretreated WT BMDM before and after 4 hr of LPS stimulation. Data are
representative of three independent experiments.
(F) Relative mtROS amounts determined by MitoSOX staining of LPS-primed WT BMDM stimulated with NLRP3 agonists in the presence of dTPP or Mito-Q.
(G and H) Release of IL-1b (G) and TNF (H) from LPS-primed p62F/F and p62DMye BMDM that were treated with Mito-Q or vehicle (dTPP) before addition of NLRP3
agonists. Results are averages ± SD (n = 3).
See also Figure S6.
Figure 7. p62 Inhibits Inflammasome-Dependent Sterile Inflammation
(A) Peritoneal IL-1b in p62F/F or p62DMye mice 4 hr after i.p. injection of alum or PBS (n = 3–6).
(B–D) Alum-induced peritoneal infiltration of PEC (B), monocytes (CD11b+Ly6C+Ly6G ) (C), and neutrophils (CD11b+Ly6G+F4/80 ) (D) in p62F/F and p62DMye
mice 16 hr after alum or PBS injection.
(E) Representative liver appearance and histology of p62F/F or p62DMye mice i.p. injected with LPS plus D-galactosamine (D-gal).
(F) Serum ALT in above mice.
(G) Fluorescent staining of F4/80, active caspase-1, and DAPI in livers of p62F/F and p62DMye mice after LPS+ D-gal challenge. *p < 0.05; **p < 0.01; ***p < 0.001.
(H) Schematic representation of key findings. NF-kB induces expression of p62, which negatively regulates caspase-1 activation via mitophagic elimination of
mitochondria that release NLRP3-inflammasome activating signals.
See also Figure S7.
confirm that autophagy limits excessive inflammation by re- strate that the NF-kB-p62-mitophagy pathway represents a
straining NLRP3-inflammasome activation. key regulatory loop through which NF-kB orchestrates NLRP3-
inflammasome activation and cytokine release, thereby focusing
DISCUSSION macrophage-mediated immunity on eliminating infectious
agents while preventing long-lasting tissue inflammation and
This study identifies p62 as the missing link that allows NF-kB to damage due to excessive IL-1b secretion and inflammatory
inhibit NLRP3-inflammasome activation. Our results demon- macrophage death (Figure 7H). Moreover, our results reaffirm
the importance of mitochondrial damage in control of NLRP3- the effect of p62 on TRAF6 signaling, we directly investigated
inflammasome activation. the function of myeloid p62 in acute LPS-induced inflammation.
In addition to being the primary transcriptional activator of in- LPS from enteric bacteria, reaching the liver and pancreas
flammatory genes (Barnes and Karin, 1997), NF-kB is respon- through the portal circulation, is thought to play important roles
sible for keeping NLRP3-inflammasome activation and IL-1b in the pathogenesis of chronic hepatitis, liver fibrosis, liver can-
production in check (Greten et al., 2007). Although the mecha- cer, and pancreatitis (Henao-Mejia et al., 2012; Seki and
nistic basis for this unexpected IKKb/NF-kB function was Schwabe, 2015; Vonlaufen et al., 2007). To our surprise,
heretofore obscure, the findings have turned out to be clinically myeloid-specific p62 deletion strongly enhanced LPS-induced
relevant as excessive inflammation was observed in human vol- inflammation and mortality due to unrestrained inflammasome
unteers that were given highly specific and potent IKKb inhibi- activation, without an effect on pro-IL-1b or NLRP3-inflamma-
tors. Unfortunately, this precipitated the termination of further some component expression. Collectively, these findings rein-
clinical development of this group of NF-kB antagonists. In force the notion that p62 is a multifunctional protein with distinct
addition to excessive IL-1 production, myeloid-specific IKKb cell-type and context-specific roles.
ablation results in IL-1-dependent neutrophilia and tissue dam- Damaged mitochondria are recognized by the E3 ubiquitin
age (Hsu et al., 2011). By examining the ability of autophagy re- ligase Parkin, which decorates their outer membrane proteins
ceptors to link NF-kB signaling to inhibition of inflammasome with poly-Ub chains (Eiyama and Okamoto, 2015). p62 binds
activation, we found that only p62, but not other receptors, poly-Ub chains through its UBA domain and can direct protein
was upregulated upon IKKb/NF-kB activation. Furthermore, aggregates and organelles bearing such modifications to auto-
p62 induction was found to account for the inflammasome phagic clearance (Komatsu et al., 2012). However, the mitopha-
inhibitory function of NF-kB, as it promotes the mitophagic gic function of p62 has been questioned, because in certain cells
clearance of damaged mitochondria that emit NLRP3-inflam- it only modulated the subcellular distribution of mitochondria
masome activating signals (Figure 7H). These signals, which that were damaged by treatment with uncouplers of oxidative
are induced by a bewildering collection of unrelated stimuli, phosphorylation and its ablation had no effect on their autopha-
include mtROS, mtDNA, and cardiolipin (Elliott and Sutterwala, gic clearance (Lazarou et al., 2015; Narendra et al., 2010; Okatsu
2015). Yet, generation of these more direct NLRP3 activators et al., 2010). By contrast, our results clearly demonstrate that in
does not require NLRP3 itself, its association with ASC, or cas- macrophages, p62 is an essential mediator of mitophagic elimi-
pase-1 activation. Furthermore, in p62-deficient macrophages nation of mitochondria that were damaged by treatment with
IKKb inhibition no longer enhances caspase-1 activation. NLRP3 agonists. Since LPS-induced macrophage activation is
Notably, the kinetics of p62 accumulation in LPS-stimulated associated with a marked and selective increase in p62 expres-
macrophages lag behind those of NLRP3 and pro-IL-1b, further sion, it is plausible that only in cells that express much more p62
supporting the notion that p62 induction is only involved in elim- than other mitophagy receptors, p62 becomes the rate-limiting
ination of direct inflammasome activating signals and does mediator of mitophagy. Alternatively, mitochondrial uncouplers
not affect NLRP3-inflammasome assembly (Lu et al., 2014) or (e.g., CCCP), which are commonly used to study mitophagy,
expression of inflammasome components. As inflammasome may induce a different pattern of mitochondrial outer membrane
activation may be a digital, all-or-none, process (Liu et al., protein ubiquitination than the one induced by classical NLRP3
2014), the NF-kB-p62-mitophagy pathway may only control agonists. Such differences in the composition or distribution of
the number of macrophages in which the NLRP3-inflamma- ubiquitin chains may be sensed by specific autophagy recep-
some triggers caspase-1 activation. tors, such that only p62 recognizes mitochondria that have
p62 is a multifunctional protein that is expressed at low been damaged with NLRP3 agonists. Although production of
amounts by most healthy cells and tissues. Protein aggregates catalytically active caspase-1, induced by canonical NLRP3 ag-
containing p62, however, referred to as Mallory-Denk bodies onists (e.g., ATP), was proposed to enhance mitochondrial dam-
or hyaline granules, accumulate under stress, and are a charac- age (Yu et al., 2014), we found that NLRP3 agonists induced
teristic pathological feature of chronic liver inflammation and mitochondrial damage independently of NLRP3-inflammasome
cancer (Stumptner et al., 2007). p62-containing aggregates components, including caspase-1. Furthermore, mutational
also accumulate in chronic pancreatitis, which is attenuated activation of NLRP3 did not induce any detectable mitochondrial
upon p62 ablation in pancreatic epithelial cells (Li et al., 2013). damage, although it activated caspase-1. Thus, mitochondrial
Whole body p62 ablation also attenuates liver inflammation damage occurs upstream to NLRP3 and independently of it,
and damage caused by disruption of autophagy (Komatsu and its removal through mitophagy prevents NLRP3-dependent
et al., 2007), but it is not clear in which cells p62 exerts its primary inflammasome activation. Most likely, different experimental
pro-inflammatory effects. Disruption of autophagic protein conditions account for the difference between our results and
degradation results in accumulation of p62, which can activate those of Yu et al., and when macrophages are incubated with
NF-kB via its TRAF6 binding motif (Moscat and Diaz-Meco, suboptimal amounts of NLRP3 agonists, caspase-1 activation
2009). However, p62 may also inhibit TRAF6 signaling (Kim may be needed to enhance mitochondrial damage at later time
and Ozato, 2009) and promote caspase-3 activation and cell points. However, recent studies suggest that inflammasome-
death (Komatsu et al., 2012). Given the involvement of p62 in mediated caspase-1 activation is an all-or-none process, further
pancreatitis and liver inflammation, the likely pathogenic role of ruling out the operation of a caspase-1-dependent positive
macrophages in these diseases, which could be mediated feedback loop. Of note, little or no mitochondrial damage was
through either TNF or IL-1b, and the conflicting reports about observed in macrophages that express the constitutively active
NLRP3(A350V) protein, even though these cells secreted that encode components of the Parkin-dependent mitophagy
copious amounts of IL-1b. pathway were detected in patients with Parkinson disease (Pick-
p62 was originally identified as a protein kinase Cz binding pro- rell and Youle, 2015). Although Parkinsonism entails age-related
tein that promotes NF-kB activation through its TRAF binding degeneration of dopaminergic neurons, it is plausible that exces-
motif, thereby enhancing conventional inflammatory responses sive inflammasome-mediated IL-1b production by microglia may
mediated by IL-1 or TNF (Moscat and Diaz-Meco, 2009). Since exacerbate neuronal cell death and inflammation. Another age-
NF-kB stimulates p62 gene transcription, p62 can be part of a related disease linked to the NLRP3-inflammasome is macular
feed-forward loop that amplifies NF-kB-dependent inflamma- degeneration (Tarallo et al., 2012). In fact, many degenerative dis-
tion. However, our results indicate just the opposite—p62 is eases may be associated with accumulation of damaged and
responsible for preventing excessive inflammasome activation. defective mitochondria, which can be the major cause of parain-
Since unrestricted caspase-1 activation results in macrophage flammation (Medzhitov, 2008; Wallace, 2005). The aging process
death in addition to IL-1b and IL-18 release, the absence of itself is linked to elevated low-grade inflammation or parainflam-
proper safety loops, such as the one mediated by NF-kB and mation, characterized by constitutive production of low amounts
p62, can lead to macrophage loss and uncontrolled neutrophil of IL-1b, TNF, and IL-6 (Chung et al., 2009; Licastro et al., 2005).
accumulation. This highly dangerous condition has been de- We suggest that the NLRP3-inflammasome activation and insuf-
tected in mice lacking either IKKb (Hsu et al., 2011) or p62 in ficient mitophagy link accumulation of damaged mitochondria to
myeloid cells. However, it should be noted that the mere upregu- the para-inflammatory state discussed above. Normal, healthy
lation of p62 does not inhibit NLRP3 inflammasome activation; aging may be compromised and greatly enhanced by accumula-
ATG7-deficient macrophages accumulate large amounts of tion of somatically mutated mitochondria (Wallace, 2005), which
p62, but in the absence of the autophagic machinery p62 cannot are more likely to release mtROS and fragmented mtDNA that
restrain inflammasome activation. act as direct NLRP3-inflammasome activators. Enhanced caloric
While being responsive to various foreign toxins and irritants, intake may further accelerate this process through mTORC1-
the NLRP3-inflammasome is activated by DAMPs, such as dependent attenuation of autophagy.
ATP and uric acid, natural cellular constituents that are released
upon sterile tissue damage. Under such conditions, the antimi- EXPERIMENTAL PROCEDURES
crobial function of IL-1b may not be essential and the goal of
Please see the Supplemental Experimental Procedures for detailed experi-
the sterile inflammatory response is to stimulate regenerative
mental procedures.
processes. DAMPs and other NLRP3 agonists elicit mito-
chondrial damage and thereby trigger production of NLRP3- Mice
inflammasome-activating signals which are removed through LysM-Cre mice were from Jackson Laboratories and crossed with p62F/F and
p62-mediated mitophagy, whose major goal is to dampen Atg7F/F mice (Komatsu et al., 2005; Müller et al., 2013) to generate p62DMye
inflammation caused by tissue damage and initiate regeneration. and Atg7DMye mice, respectively. p62 / mice were previously described
Thus, NF-kB activation, which increases transcription of genes (Rodriguez et al., 2006). Nlrp3A350V/+CreT mice were as previously described
(Brydges et al., 2013).
encoding essential inflammatory mediators, also ensures that
the beneficial inflammatory response will not be excessive,
Cell Culture and Stimulation
thus avoiding chronic inflammatory disease and parainflamma- Primary bone marrow-derived macrophages (BMDM) were generated as
tion caused by cell and tissue stress (Medzhitov, 2008). Self- described (Hornung et al., 2008). For stimulation, BMDM were LPS-primed
limiting inflammation is also important for initiating regeneration, and then stimulated with NLRP3 agonists, AIM2 agonist poly(dA:dT), or
which restores integrity of epithelial barriers and thereby attenu- NLRP1b agonist B. anthracis. Macrophages with a constitutively active mutant
ates PAMP and DAMP availability (Taniguchi et al., 2015). NLRP3 were generated by treating BMDM from Nlrp3A350V/+CreT mice with
1 mM 4-hydroxytamoxifen.
Notably, Parkin-mediated mitophagy, in which p62 participates,
is utilized by all metazoan phagocytes, from fly to human, to Enzyme-Linked Immunosorbent Assay
eliminate ingested bacteria (Manzanillo et al., 2013). Thus, the Paired antibodies and standard recombinant mouse IL-1b (R&D Systems)
‘‘NF-kB-p62’’-dependent anti-inflammatory module described and TNF (eBioscience) were used to determine cytokines concentrations
above could be an evolutionary relic of the xenophagy pathway, according to manufacturer’s instructions.
which also limits PAMP availability. Mitochondria have likely
originated from prokaryotic intracellular parasites that have Measurement of Active Caspase-1 by FLICA Assay
The levels of active caspase-1 were quantified using a fluorescent probe
adapted to their eukaryotic hosts, which tolerate them as long
(FLICA FAM-YVAD-FMK, ImmunoChemistry Technologies) that specifically
as they do not pose danger or are altered in such a way that recognized active caspase-1. Fluorescence intensity was measured with a
makes them perceived as ‘‘non-self.’’ Failed xenophagy in- FilterMax F5 multimode plate reader (Molecular Devices).
creases microbial load, which is likely to be dealt with through
IL-1b/IL-18-promoted innate immune responses. Measurements of Mitochondrial Membrane Potential and ROS
Dysregulation of the NLRP3-inflammasome is frequently asso- Mitochondrial membrane potential (Jm) was measured using TMRM as previ-
ously described (Shimada et al., 2012). Mitochondrial ROS were measured
ciated with diverse inflammatory, metabolic, and malignant dis-
using MitoSOX (Life Technologies) following the manufacturer’s instructions.
eases, including gouty arthritis, Alzheimer’s disease, obesity,
type II diabetes, and colorectal cancer (Lamkanfi and Dixit, Immunofluorescent Staining and Confocal Microscopy
2012). Therefore, proper control of NLRP3-inflammasome activity BMDM were primed with LPS and then treated with NLRP3 agonists. Cells
is critical for preventing disease development. Mutations in genes were then fixed, permeabilized, and blocked. After incubating overnight with
primary antibodies, secondary fluorescent antibodies (Alexa-488, Alexa-594, Brenner, C., Galluzzi, L., Kepp, O., and Kroemer, G. (2013). Decoding cell
or Alexa-647, from Life Technologies or Jackson Laboratories) were added death signals in liver inflammation. J. Hepatol. 59, 583–594.
and DAPI was used for nuclear counterstaining. Samples were imaged through Brydges, S.D., Broderick, L., McGeough, M.D., Pena, C.A., Mueller, J.L., and
a SP5 confocal microscope (Leica). Hoffman, H.M. (2013). Divergence of IL-1, IL-18, and cell death in NLRP3 in-
flammasomopathies. J. Clin. Invest. 123, 4695–4705.
Statistics Chernyak, B.V., Izyumov, D.S., Lyamzaev, K.G., Pashkovskaya, A.A., Pletjush-
All data are shown as means ± SD or means ± SEM as indicated. Statistical kina, O.Y., Antonenko, Y.N., Sakharov, D.V., Wirtz, K.W., and Skulachev, V.P.
analysis was performed using a two-tailed Student’s t test or log-rank test. (2006). Production of reactive oxygen species in mitochondria of HeLa cells
For all tests, p values <0.05 were considered statistically significant. under oxidative stress. Biochim. Biophys. Acta 1757, 525–534.
Chung, H.Y., Cesari, M., Anton, S., Marzetti, E., Giovannini, S., Seo, A.Y.,
SUPPLEMENTAL INFORMATION Carter, C., Yu, B.P., and Leeuwenburgh, C. (2009). Molecular inflammation:
underpinnings of aging and age-related diseases. Ageing Res. Rev. 8, 18–30.
Supplemental Information includes Supplemental Experimental Procedures Criollo, A., Senovilla, L., Authier, H., Maiuri, M.C., Morselli, E., Vitale, I., Kepp,
and seven figures and can be found with this article online at http://dx.doi. O., Tasdemir, E., Galluzzi, L., Shen, S., et al. (2010). The IKK complex contrib-
org/10.1016/j.cell.2015.12.057. utes to the induction of autophagy. EMBO J. 29, 619–631.
Eisenbarth, S.C., Colegio, O.R., O’Connor, W., Sutterwala, F.S., and Flavell,
AUTHOR CONTRIBUTIONS R.A. (2008). Crucial role for the Nalp3 inflammasome in the immunostimulatory
properties of aluminium adjuvants. Nature 453, 1122–1126.
Z.Z. and M.K. conceived the project. Z.Z. designed the study and performed
Eiyama, A., and Okamoto, K. (2015). PINK1/Parkin-mediated mitophagy in
most of the experiments. A.U., S.L., E.S.-L., J.W., and F.H. performed immuno-
mammalian cells. Curr. Opin. Cell Biol. 33, 95–101.
blot analysis. Z.Z. and E.S.-L. performed confocal microscopy analysis. Z.Z.,
D.B., and G.P. performed EM analysis. Z.Z. and J.W. performed p62 reconsti- Elliott, E.I., and Sutterwala, F.S. (2015). Initiation and perpetuation of NLRP3
tution experiments. S.A. performed B. anthracis infection experiment. Z.Z. and inflammasome activation and assembly. Immunol. Rev. 265, 35–52.
S.L. conducted septic shock experiments. A.U. performed fulminant hepatitis Franklin, B.S., Bossaller, L., De Nardo, D., Ratter, J.M., Stutz, A., Engels, G.,
experiments. Z.Z. and S.S. did the peritonitis experiments. A.G. provided Brenker, C., Nordhoff, M., Mirandola, S.R., Al-Amoudi, A., et al. (2014). The
Park2 / bone marrow cells. E.S. provided Atg7DMye mice. M.H.E. provided adaptor ASC has extracellular and ‘prionoid’ activities that propagate inflam-
analytical tools and suggestions. M.M. and H.H. provided Nlrp3A350V/+CreT mation. Nat. Immunol. 15, 727–737.
mice and suggestions. M.T.D.-M. and J.M. provided p62F/F mice and p62 con-
Geisler, S., Holmström, K.M., Skujat, D., Fiesel, F.C., Rothfuss, O.C., Kahle,
structs. Z.Z. and M.K. wrote the manuscript with input from all authors. P.J., and Springer, W. (2010). PINK1/Parkin-mediated mitophagy is depen-
dent on VDAC1 and p62/SQSTM1. Nat. Cell Biol. 12, 119–131.
ACKNOWLEDGMENTS Greten, F.R., Arkan, M.C., Bollrath, J., Hsu, L.C., Goode, J., Miething, C., Gök-
tuna, S.I., Neuenhahn, M., Fierer, J., Paxian, S., et al. (2007). NF-kappaB is a
We thank M.K. lab members for helpful discussions and eBioscience, Cell negative regulator of IL-1beta secretion as revealed by genetic and pharmaco-
Signaling Technologies, Santa Cruz Technologies, and Life Technologies for logical inhibition of IKKbeta. Cell 130, 918–931.
gifts of antibodies and other reagents. Z.Z. was supported by Cancer
Henao-Mejia, J., Elinav, E., Jin, C., Hao, L., Mehal, W.Z., Strowig, T., Thaiss,
Research Institute (CRI) Irvington postdoctoral fellowship; A.U. was supported
C.A., Kau, A.L., Eisenbarth, S.C., Jurczak, M.J., et al. (2012). Inflammasome-
by JSPS KAKENHI (15H06547), Kanae Foundation for the Promotion of Med-
mediated dysbiosis regulates progression of NAFLD and obesity. Nature 482,
ical Science, and a Global Grant Scholarship from The Rotary Foundation;
179–185.
E.S.-L. was supported by Sara Borrell fellowship under ISCIII/MICINN pro-
gram; S.S. was supported by fellowships from CRI-Irvington and German Hornung, V., Bauernfeind, F., Halle, A., Samstad, E.O., Kono, H., Rock, K.L.,
Research Foundation (SH721/1-1); and J.W. was supported by a postdoctoral Fitzgerald, K.A., and Latz, E. (2008). Silica crystals and aluminum salts activate
fellowship from the Canadian Institutes of Health Research (MFE-135425). the NALP3 inflammasome through phagosomal destabilization. Nat. Immunol.
Research was supported by grants from the NIH (AI043477 and CA163798) 9, 847–856.
to M.K., (GM103412) to M.H.E. for support of the National Center for Hsu, L.C., Enzler, T., Seita, J., Timmer, A.M., Lee, C.Y., Lai, T.Y., Yu, G.Y., Lai,
Microscopy and Imaging Research, (AA020172 and DK085252) to E.S., L.C., Temkin, V., Sinzig, U., et al. (2011). IL-1b-driven neutrophilia preserves
(ES010337) to M.K. and E.S., (HL087023) to A.B.G., (AI52430) to H.M.H., antibacterial defense in the absence of the kinase IKKb. Nat. Immunol. 12,
(CA192642) to M.T.D.-M., (CA030199) to M.T.D-M. and J.M., (CA132847, 144–150.
CA172025) to J.M., Leukemia and Lymphoma Society SCOR (20132569) to
Kim, S.J., and Lee, S.M. (2013). NLRP3 inflammasome activation in D-galac-
Tom Kipps and M.K., and the Alliance for Lupus Research (257214) to M.K.,
tosamine and lipopolysaccharide-induced acute liver failure: role of heme oxy-
who is an American Cancer Research Professor and holds the Ben and Wanda
genase-1. Free Radic. Biol. Med. 65, 997–1004.
Hildyard Chair for Mitochondrial and Metabolic Diseases.
Kim, J.Y., and Ozato, K. (2009). The sequestosome 1/p62 attenuates cytokine
Received: June 2, 2015 gene expression in activated macrophages by inhibiting IFN regulatory factor 8
Revised: November 12, 2015 and TNF receptor-associated factor 6/NF-kappaB activity. J. Immunol. 182,
Accepted: December 29, 2015 2131–2140.
Published: February 25, 2016 Komatsu, M., Waguri, S., Ueno, T., Iwata, J., Murata, S., Tanida, I., Ezaki, J.,
Mizushima, N., Ohsumi, Y., Uchiyama, Y., et al. (2005). Impairment of starva-
REFERENCES tion-induced and constitutive autophagy in Atg7-deficient mice. J. Cell Biol.
169, 425–434.
Barnes, P.J., and Karin, M. (1997). Nuclear factor-kappaB: a pivotal transcrip- Komatsu, M., Waguri, S., Koike, M., Sou, Y.S., Ueno, T., Hara, T., Mizushima,
tion factor in chronic inflammatory diseases. N. Engl. J. Med. 336, 1066–1071. N., Iwata, J., Ezaki, J., Murata, S., et al. (2007). Homeostatic levels of p62 con-
Baroja-Mazo, A., Martı́n-Sánchez, F., Gomez, A.I., Martı́nez, C.M., Amores-In- trol cytoplasmic inclusion body formation in autophagy-deficient mice. Cell
iesta, J., Compan, V., Barberà-Cremades, M., Yagüe, J., Ruiz-Ortiz, E., Antón, 131, 1149–1163.
J., et al. (2014). The NLRP3 inflammasome is released as a particulate danger Komatsu, M., Kageyama, S., and Ichimura, Y. (2012). p62/SQSTM1/A170:
signal that amplifies the inflammatory response. Nat. Immunol. 15, 738–748. physiology and pathology. Pharmacol. Res. 66, 457–462.
Kotas, M.E., and Medzhitov, R. (2015). Homeostasis, inflammation, and dis- Rodriguez, A., Durán, A., Selloum, M., Champy, M.F., Diez-Guerra, F.J.,
ease susceptibility. Cell 160, 816–827. Flores, J.M., Serrano, M., Auwerx, J., Diaz-Meco, M.T., and Moscat, J.
Lamkanfi, M., and Dixit, V.M. (2012). Inflammasomes and their roles in health (2006). Mature-onset obesity and insulin resistance in mice deficient in the
and disease. Annu. Rev. Cell Dev. Biol. 28, 137–161. signaling adapter p62. Cell Metab. 3, 211–222.
Lamkanfi, M., and Dixit, V.M. (2014). Mechanisms and functions of inflamma- Saitoh, T., Fujita, N., Jang, M.H., Uematsu, S., Yang, B.G., Satoh, T., Omori, H.,
somes. Cell 157, 1013–1022. Noda, T., Yamamoto, N., Komatsu, M., et al. (2008). Loss of the autophagy
Lazarou, M., Sliter, D.A., Kane, L.A., Sarraf, S.A., Wang, C., Burman, J.L., Side- protein Atg16L1 enhances endotoxin-induced IL-1beta production. Nature
ris, D.P., Fogel, A.I., and Youle, R.J. (2015). The ubiquitin kinase PINK1 recruits 456, 264–268.
autophagy receptors to induce mitophagy. Nature 524, 309–314. Schroder, K., and Tschopp, J. (2010). The inflammasomes. Cell 140, 821–832.
Li, N., Wu, X., Holzer, R.G., Lee, J.H., Todoric, J., Park, E.J., Ogata, H., Gukov- Seki, E., and Schwabe, R.F. (2015). Hepatic inflammation and fibrosis: func-
skaya, A.S., Gukovsky, I., Pizzo, D.P., et al. (2013). Loss of acinar cell IKKa trig- tional links and key pathways. Hepatology 61, 1066–1079.
gers spontaneous pancreatitis in mice. J. Clin. Invest. 123, 2231–2243.
Shi, C.S., Shenderov, K., Huang, N.N., Kabat, J., Abu-Asab, M., Fitzgerald,
Licastro, F., Candore, G., Lio, D., Porcellini, E., Colonna-Romano, G., France- K.A., Sher, A., and Kehrl, J.H. (2012). Activation of autophagy by inflammatory
schi, C., and Caruso, C. (2005). Innate immunity and inflammation in ageing: a signals limits IL-1b production by targeting ubiquitinated inflammasomes for
key for understanding age-related diseases. Immun. Ageing 2, 8. destruction. Nat. Immunol. 13, 255–263.
Liu, T., Yamaguchi, Y., Shirasaki, Y., Shikada, K., Yamagishi, M., Hoshino, K.,
Shimada, K., Crother, T.R., Karlin, J., Dagvadorj, J., Chiba, N., Chen, S.,
Kaisho, T., Takemoto, K., Suzuki, T., Kuranaga, E., et al. (2014). Single-cell im-
Ramanujan, V.K., Wolf, A.J., Vergnes, L., Ojcius, D.M., et al. (2012). Oxidized
aging of caspase-1 dynamics reveals an all-or-none inflammasome signaling
mitochondrial DNA activates the NLRP3 inflammasome during apoptosis.
response. Cell Rep. 8, 974–982.
Immunity 36, 401–414.
Lu, A., Magupalli, V.G., Ruan, J., Yin, Q., Atianand, M.K., Vos, M.R., Schröder,
Stumptner, C., Fuchsbichler, A., Zatloukal, K., and Denk, H. (2007). In vitro
G.F., Fitzgerald, K.A., Wu, H., and Egelman, E.H. (2014). Unified polymeriza-
production of Mallory bodies and intracellular hyaline bodies: the central role
tion mechanism for the assembly of ASC-dependent inflammasomes. Cell
of sequestosome 1/p62. Hepatology 46, 851–860.
156, 1193–1206.
Manzanillo, P.S., Ayres, J.S., Watson, R.O., Collins, A.C., Souza, G., Rae, C.S., Taniguchi, K., Wu, L.W., Grivennikov, S.I., de Jong, P.R., Lian, I., Yu, F.X.,
Schneider, D.S., Nakamura, K., Shiloh, M.U., and Cox, J.S. (2013). The ubiq- Wang, K., Ho, S.B., Boland, B.S., Chang, J.T., et al. (2015). A gp130-Src-
uitin ligase parkin mediates resistance to intracellular pathogens. Nature YAP module links inflammation to epithelial regeneration. Nature 519, 57–62.
501, 512–516. Tarallo, V., Hirano, Y., Gelfand, B.D., Dridi, S., Kerur, N., Kim, Y., Cho, W.G.,
Medzhitov, R. (2008). Origin and physiological roles of inflammation. Nature Kaneko, H., Fowler, B.J., Bogdanovich, S., et al. (2012). DICER1 loss and
454, 428–435. Alu RNA induce age-related macular degeneration via the NLRP3 inflamma-
Meylan, E., Tschopp, J., and Karin, M. (2006). Intracellular pattern recognition some and MyD88. Cell 149, 847–859.
receptors in the host response. Nature 442, 39–44. Vallabhapurapu, S., and Karin, M. (2009). Regulation and function of NF-
Miao, E.A., Leaf, I.A., Treuting, P.M., Mao, D.P., Dors, M., Sarkar, A., Warren, kappaB transcription factors in the immune system. Annu. Rev. Immunol.
S.E., Wewers, M.D., and Aderem, A. (2010). Caspase-1-induced pyroptosis is 27, 693–733.
an innate immune effector mechanism against intracellular bacteria. Nat. Vance, R.E. (2015). The NAIP/NLRC4 inflammasomes. Curr. Opin. Immunol.
Immunol. 11, 1136–1142. 32, 84–89.
Moscat, J., and Diaz-Meco, M.T. (2009). p62 at the crossroads of autophagy, von Moltke, J., Ayres, J.S., Kofoed, E.M., Chavarrı́a-Smith, J., and Vance, R.E.
apoptosis, and cancer. Cell 137, 1001–1004. (2013). Recognition of bacteria by inflammasomes. Annu. Rev. Immunol. 31,
Müller, T.D., Lee, S.J., Jastroch, M., Kabra, D., Stemmer, K., Aichler, M., 73–106.
Abplanalp, B., Ananthakrishnan, G., Bhardwaj, N., Collins, S., et al. (2013).
Vonlaufen, A., Xu, Z., Daniel, B., Kumar, R.K., Pirola, R., Wilson, J., and Apte,
p62 links b-adrenergic input to mitochondrial function and thermogenesis.
M.V. (2007). Bacterial endotoxin: a trigger factor for alcoholic pancreatitis? Ev-
J. Clin. Invest. 123, 469–478.
idence from a novel, physiologically relevant animal model. Gastroenterology
Nakahira, K., Haspel, J.A., Rathinam, V.A., Lee, S.J., Dolinay, T., Lam, H.C., 133, 1293–1303.
Englert, J.A., Rabinovitch, M., Cernadas, M., Kim, H.P., et al. (2011). Auto-
Wallace, D.C. (2005). A mitochondrial paradigm of metabolic and degenerative
phagy proteins regulate innate immune responses by inhibiting the release
diseases, aging, and cancer: a dawn for evolutionary medicine. Annu. Rev.
of mitochondrial DNA mediated by the NALP3 inflammasome. Nat. Immunol.
Genet. 39, 359–407.
12, 222–230.
Narendra, D., Kane, L.A., Hauser, D.N., Fearnley, I.M., and Youle, R.J. (2010). Yu, J., Nagasu, H., Murakami, T., Hoang, H., Broderick, L., Hoffman, H.M., and
p62/SQSTM1 is required for Parkin-induced mitochondrial clustering but not Horng, T. (2014). Inflammasome activation leads to Caspase-1-dependent
mitophagy; VDAC1 is dispensable for both. Autophagy 6, 1090–1106. mitochondrial damage and block of mitophagy. Proc. Natl. Acad. Sci. USA
111, 15514–15519.
Okatsu, K., Saisho, K., Shimanuki, M., Nakada, K., Shitara, H., Sou, Y.S.,
Kimura, M., Sato, S., Hattori, N., Komatsu, M., et al. (2010). p62/SQSTM1 co- Zhong, Z., Zhai, Y., Liang, S., Mori, Y., Han, R., Sutterwala, F.S., and Qiao, L.
operates with Parkin for perinuclear clustering of depolarized mitochondria. (2013). TRPM2 links oxidative stress to NLRP3 inflammasome activation. Nat.
Genes Cells 15, 887–900. Commun. 4, 1611.
Pickrell, A.M., and Youle, R.J. (2015). The roles of PINK1, parkin, and mito- Zhou, R., Yazdi, A.S., Menu, P., and Tschopp, J. (2011). A role for mitochondria
chondrial fidelity in Parkinson’s disease. Neuron 85, 257–273. in NLRP3 inflammasome activation. Nature 469, 221–225.
Supplemental Figures
Figure S1. p62 Inhibits NLRP3 Inflammasome-Dependent IL-1b Production, Related to Figure 1
(A) Q-PCR quantitation of mRNA amounts of different autophagy receptors before and after LPS stimulation. Results are averages ± SD (n = 3).
(B) The induction kinetics of p62, pro-IL-1b and NLRP3 in LPS-stimulated BMDM determined by IB analysis.
(C) IB analysis of caspase-1 p20 and mature IL-1b in supernatants (Sup) and b-actin in lysates (Lys) of LPS-primed p62F/F (WT) and p62DMye (KO) BMDM
stimulated as indicated.
(D and H) Release of IL-1b (D) and TNF (H) from LPS-primed wild-type (shCtrl) or p62-deficient (shp62) immortalized BMDM (iBMDM) that were stimulated with
NLRP3 agonists. Results are averages ± SD (n = 3).
(E) Quantification of caspase-1 activity with a FAM-ZYVAD-FLICA probe in LPS-primed p62F/F and p62DMye BMDM stimulated with NLRP3 agonists.
(F) Analysis of macrophage viability by LDH release in response to stimulation with ATP after LPS priming.
(G) IB analysis of pro-IL-1b, NLRP3, ASC, and p62 in lysates of WT (p62F/F) and p62-deficient (p62DMye) BMDM before and after 4 hr of LPS stimulation.
(H) Release of TNF from LPS-primed shCtrl or shp62 iBMDM that were stimulated with NLRP3 agonists.
(I) Release of IL-1b from LPS-primed WT or p62 whole body-deficient (p62 / ) BMDM that were stimulated with NLRP3 agonists.
(J and K) Release of IL-1b from LPS-primed p62F/F or p62DMye BMDM that were stimulated with poly(dA:dT), ATP and nigericin (J) or infected with WT or lethal
toxin-deficient (DLT) B. anthracis (K). Results in H-K are averages ± SD (n = 3).
(L) Quantification of caspase-1 activity with a FAM-ZYVAD-FLICA probe in ML120b-pretreated (10 mM for 45 min) p62F/F and p62DMye BMDM followed by
stimulation with LPS+NLRP3 agonists. Results are averages ± SD (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001.
Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc. S1

Figure S2. p62 Deficiency Enhances Accumulation of Damaged Mitochondria in Macrophages Stimulated with NLRP3 Agonists, Related to
Figure 2
(A) Relative mtROS content measured by MitoSOX staining of LPS-primed WT and p62-deficient iBMDM stimulated with NLRP3 agonists.
(B) Relative concentrations of mtDNA in LPS-primed WT and p62-deficient iBMDM stimulated with NLRP3 agonists.
(C–E) NLRP3 agonist-induced changes in Jm in LPS-primed WT, NLRP3-KO (C), ASC-KO (D) or Caspase-1-KO (E) iBMDM were measured by TMRM
fluorescence.
(F) Release of IL-1b from Nlrp3A350V/+CreT BMDM that were pretreated with 4-hydroxytamoxifen for 24 hr followed by LPS treatment.
(G) NLRP3 agonist-induced changes in Jm in 4-hydroxytamoxifen pretreated NLRP3(A350V)-expressing BMDM stimulated with LPS.
(H) Relative mtROS content measured by MitoSOX staining of 4-hydroxytamoxifen pretreated NLRP3(A350V)-expressing BMDM stimulated with LPS. All results
are averages ± SD (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001.
S2 Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc.

Figure S3. Parkin and the p62 UBA Domain Are Required for p62 Mitochondrial Recruitment, Related to Figure 3
(A) Percentages of cells with mitochondrial co-localization of p62 and Poly-Ub. Data are from the experiments depicted in Figure 3A.
(B) Percentages of Park2+/+ and Park2 / BMDM that show Poly-Ub decoration of mitochondria. Data are from Figure 3B.
(C) Percentages of WT and Parkin-deficient iBMDM that show p62 decoration of mitochondria. Data are from Figure 3C.
(D) Percentages of full-length p62 or p62(DUBA) reconstituted p62DMye BMDM that show p62 aggregation on mitochondria after stimulation with LPS + NLRP3
agonist. Data are from Figure 3D. **p < 0.01; ***p < 0.001.

Figure S4. Parkin Prevents Accumulation of Damaged Mitochondria and Excessive Caspase-1 Activation, Related to Figure 4
(A) Relative cytosolic concentrations of mtDNA in WT and Parkin-deficient iBMDM stimulated with NLRP3 agonists.
(B) Relative mtROS amounts determined by MitoSOX staining of LPS-primed WT and Parkin-deficient iBMDM stimulated with NLRP3 agonists.
(C) IB analysis of pro-IL-1b, Parkin, NLRP3, ASC and pro-caspase-1 in lysates of Park2+/+ or Park2 / BMDMs before and after 4 hr of LPS stimulation.
(D) Release of TNF from LPS-primed Park2+/+ and Park2 / BMDM stimulated with NLRP3 agonists. Data in (A), (B) and (D) are averages ± SD (n = 3). *p < 0.05;
**p < 0.01; ***p < 0.001.

Figure S5. Autophagy Is Responsible for Clearance of p62-Bound Mitochondria, Related to Figure 5
(A) Percentages of macrophages with mitochondrial co-localization of LC3 and p62. Data are derived from experiments in Figure 5A.
(B) Percentages of macrophages with mitochondrial co-localization of LC3 and Poly-Ub. Data are derived from Figure 5B.
(C) IB analysis of pro-IL-1b, NLRP3, ASC, p62, and pro-caspase-1 in lysates of Atg7F/F and Atg7DMye BMDM before and after 4 hr of LPS stimulation.
(D) Relative mtROS amounts, determined by MitoSOX staining, in LPS-primed WT and Atg7-deficient iBMDM stimulated with NLRP3 agonists.
(E) Relative cytosolic mtDNA amounts in WT and Atg7-deficient iBMDM stimulated with NLRP3 agonists.
(F) Caspase-1 activity in LPS-primed shCtrl or shAtg7 iBMDM stimulated with NLRP3 agonists.
(G–I) Release of IL-1b (G) and TNF (H) from LPS-primed shCtrl or shAtg7 iBMDM stimulated with NLRP3 agonists. (I) TNF release by LPS-primed Atg7F/F and
Atg7DMye BMDM stimulated with NLRP3 agonists.
(J) Release of IL-1b from LPS-primed Atg7F/F or Atg7DMye BMDM that were stimulated with poly(dA:dT) or DOTAP.
(K) Release of IL-1b from Atg7F/F or Atg7DMye BMDM that were infected with WT or lethal toxin-deficient (DLT) B. anthracis. Data in (D)–(K) are averages ± SD
(n = 3). *p < 0.05; **p < 0.01; ***p < 0.001.

Figure S6. Depletion of Mitochondria, p62, or ATG7 Does Not Affect Expression of Pro-IL-1b or NLRP3-Inflammasome Components, and
Genetically Activated NLRP3 Is Refractory to IKKb Inhibition, Related to Figure 6
(A and B) Release of IL-1b (A) and TNF (B) from LPS-primed p62F/F and p62DMye BMDM that were stimulated with NLRP3 agonists in the presence of chlor-
amphenicol (200 mg/ml) pretreatment.
(C and D) IB analysis of pro-IL-1b, NLRP3, ASC, and pro-caspase-1 in lysates of unprimed, LPS-primed p62F/F and p62DMye (C) or Atg7F/F and Atg7DMye (D)
BMDM stimulated with or without ATP.
(E) Quantification of caspase-1 activity with the FAM-ZYVAD-FLICA probe in ML120b-pretreated (10 mM for 45 min) NLRP3-WT and NLRP3 mutant (NLRP3/
A350V) BMDM stimulated with LPS.
(F) Release of IL-1b by LPS-stimulated NLRP3-WT and NLRP3 mutant (NLRP3/A350V) BMDM whose p62 has been knocked down.
(G) Release of IL-1b by LPS-primed and nigericin-stimulated NLRP3-WT BMDM whose p62 has been knocked down. Data in panels (A), (B) and (E)-(G) are
averages ± SD (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001.

Figure S7. p62 Attenuates Inflammasome-Dependent IL-1b Production and Subsequent Inflammation, Related to Figure 7
(A) Peritoneal IL-1b in WT or p62 / mice at 4 hr after i.p. injection of alum or PBS. n = 3-4.
(B–D) Alum-induced peritoneal infiltration of PEC (B), neutrophils (CD11b+Ly6G+F4/80 ) (C) and monocytes (CD11b+Ly6C+Ly6G ) (D) in WT or p62 / mice 16 hr
after alum or PBS injection.
(E) Release of IL-1b from LPS-primed p62F/F and p62DMye neutrophils after stimulation of NLRP3 agonists. Results are averages ± SD (n = 3).
(F and G) 12-weeks old Atg7F/F and Atg7DMye mice were i.p. injected with LPS (30 mg/kg) and their sera were collected and analyzed for IL-1b (F) and TNF (G) by
ELISA 3 hr post injection. (n = 3-6).
(H) Survival of Atg7F/F and Atg7DMye mice i.p. injected with LPS (n = 10-11).
(I) Peritoneal IL-1b concentrations in Atg7F/F and Atg7DMye mice at 4 hr after i.p. injection of alum.
(J–L) Alum-induced infiltration of total PEC (J), neutrophils (CD11b+Ly6G+F4/80 ) (K) and monocytes (CD11b+Ly6C+Ly6G ) (L) into the peritoneal cavities of
Atg7F/F and Atg7DMye mice was determined 16 hr post alum injection. (n = 3-6).
(M) Serum concentrations of ALT in Atg7F/F or Atg7DMye mice after LPS plus D-gal challenge.
(N) Representative liver appearance and histology in Atg7F/F and Atg7DMye mice after i.p. injection of LPS plus D-gal.
(O) Fluorescent staining of F4/80, active caspase-1, and DAPI in livers of in Atg7F/F and Atg7DMye mice after LPS plus D-gal challenge. *p < 0.05; **p < 0.01;
***p < 0.001.

Cell, Volume 164
Supplemental Information
NF-kB Restricts Inﬂammasome Activation

via Elimination of Damaged Mitochondria
Zhenyu Zhong, Atsushi Umemura, Elsa Sanchez-Lopez, Shuang Liang, Shabnam
Shalapour, Jerry Wong, Feng He, Daniela Boassa, Guy Perkins, Syed Raza
Ali, Matthew D. McGeough, Mark H. Ellisman, Ekihiro Seki, Asa B. Gustafsson, Hal M.
Hoffman, Maria T. Diaz-Meco, Jorge Moscat, and Michael Karin
Mice
LysM-Cre mice were purchased from Jackson Laboratories and were crossed with p62F/F and Atg7F/F
mice (Komatsu et al., 2005; Muller et al., 2013) to generate p62∆Mye and Atg7∆Mye mice, respectively.
p62∆Mye and Atg7∆Mye mice and their wild-type littermates (p62F/F and Atg7F/F, respectively) were used in
all studies. Whole body p62-/- mice were previously described (Rodriguez et al., 2006). Nlrp3A350V/+CreT
mice were as previously described (Brydges et al., 2013). All mice were bred and maintained at
University of California San Diego (UCSD) and were treated in accordance with guidelines of the
Institutional Animal Care and Use Committee of UCSD.
Reagents
Silica and ATP were from Sigma-Aldrich. Ultrapure LPS (E. coli O111:B4) was from Invivogen.
Monosodium urate crystal (MSU) was from Enzo Life Science. Imject Alum and streptavidin-HRP were
from Pierce. MitoSOX and Mitotrackers were from Life Technologies. TMRM was from AnaSpec Inc.
(#CA94555). ML120b was from Tocris (#4899). The lactate dehydrogenase (LDH) assay kit was from
Roche. 1,2-Dioleoyl-3-trimethylammonium-propane (DOTAP) liposomes were made by Encapsula
NanoSciences as previously described (Zhong et al., 2013). Antibodies used for immunoblot analysis
were: anti-mouse IL-1β (#12426S, Cell Signaling Technologies), anti-mouse NLRP3 (#AG-20B-0014-
C100, Adipogen), anti-mouse ASC (#AG-25b-0006-C100, Adipogen), anti-mouse caspase-1 p20 (# AG-
20B-0042-C100), anti-mouse OPTN (#10837-1-AP, Proteintech), anti-mouse Tax1bp1 (#14424-A-AP,
Proteintech), anti-mouse Calcoco2/Ndp52 (#12229-1-AP, Proteintech), anti-mouse NBR1 (#9891S, Cell
Signaling Technologies), anti-mouse Parkin (#sc-30130, Santa Cruz Technologies), anti-VDAC (# 4661S,
Cell Signaling Techonologies), anti-p62 (#GP62-C, ProGen), anti-Atg7 (#8558, Cell Signaling
Technologies), anti-LC3 (#2775, Cell Signaling Technologies) and anti-tubulin (#T5168, Sigma-Aldrich).
Cell culture and stimulation
2
Primary bone marrow-derived macrophages (BMDM) were generated by culturing mouse bone marrow
cells in the presence of 20% vol/vol L929 conditional medium for 7 days as described (Hornung et al.,
2008). BMDM were seeded in 6-well, 24-well or 48-well plates overnight. On the 2nd day, after
pretreatment with ultrapure LPS (200 ng/ml) for 4 hrs, BMDM (1x106 cells/ml) were further stimulated
with ATP (4 mM) or Nigericin (10 μM) for 60 min unless otherwise indicated or DOTAP liposomes (100
μg/ml), alum (500 μg/ml), silica (600 μg/ml) and MSU (600 μg/ml) for 6 hrs. For AIM2 inflammasome
activation, macrophages were primed with LPS (200ng/ml) followed by transfection of poly(dA:dT) using
Lipofectamine 2000 (Life Technologies) according to the manufacture’s protocol. For NLRP1b
inflammasome activation, BMDM were infected with WT or lethal toxin deleted mutant (∆LT) B. anthracis
at MOI of 2. Culture supernatants were collected 6 hrs post infection and IL-1β release was measured by
ELISA. Macrophages with a constitutively active mutant NLRP3 (Nlrp3-A350V) were generated by
treating BMDM from Nlrp3A350V/+CreT mice with 1 μM 4-hydroxytamoxifen (Sigma-Aldrich) for 24 hrs.
Supernatants and cell lysates were collected for ELISA and immunoblot analyses. Immortalized murine
BMDM (iBMDM) from C57Bl/6 (WT) was generously provided by Dr. Katherine Fitzgerald. Knock down
of p62, Atg7, or Parkin was done in WT iBMDM using specific shRNAs (from Sigma shRNA Mission
library), and the sequences are as follows: shp62#1
(CCGGGAGGTTGACATTGATGTGGAACTCGAGTTCCACATCAATGTCAACCTCTTTTTG);shp62#2
(CCGGTAGTACAACTGCTAGTTATTTCTCGAGAAATAACTAGCAGTTGTACTATTTTTG); shAtg7#1 (5'-
CCGGCCAGCTCTGAACTCAATAATACTCGAGTATTATTGAGTTCAGAGCTGGTTTTTG-3'); shAtg7#2
(5'-CCGG-GCCTGGCATTTGATAAATGTACTCGAGTACATTTATCAAATGCCAGGCTTTTTG-3');
shPark2#1(5'-
CCGGCGGAGGATGTATGCACATGAACTCGAGTTCATGTGCATACATCCTCCGTTTTTG-3');
shPark2#2(5'-CCGGCGTGATCTGTTTGGACTGTTTCTCGAGAAACAGTCCAAACAGATCACGTTTTTG-
3'). Mouse neutrophils were isolated from bone marrows of p62F/F and p62∆Mye mice using EasySepTM
Mouse Neutrophil Enrichment Kit (Stem Cell Technologies), and stimulated the same way as BMDM
described above. Knocking down of p62 expression in NLRP3 mutant (Nlrp3-A350V) macrophages was
3
achieved by lentiviral infection of mutant BMDM at day 3 after differentiation. Cells were analyzed after
puromycin selection at day 7.
RNA isolation and real-time PCR
RNA was isolated from BMDM and was reverse transcribed, and real-time PCR was performed as
previous described(Zhong et al., 2013). Primer sequences are as follows. Optn-F: 5’-
AGAGGAGAGGATCCCTGTGG-3’; Optn-R: 5’-ATTTCCTGGGGTCTCACAAG-3’; Nbr1-F: 5’-
CCAGAAAATACAACCTGGGC-3’; Nbr1-R: 5’-TCCTCGTTCTCCTCATCCAG-3’; Tax1bp1-F: 5’-
CTACGCTGAGAGGCAGTGG-3’; Tax1bp1-R: 5’-GCAATTGGACTTCTTGAAAGG-3’; p62-F: 5’-
AGAATGTGGGGGAGAGTGTG-3’; p62-R: 5’-TCTGGGGTAGTGGGTGTCAG-3’; Ndp52-F: 5’-
GCCCCATACCTACCTTGCTG-3’; Ndp52-R: 5’-TCGAGGGATGAACTTTTCAGTG-3’; Hprt1-F: 5’-
CTGGTGAAAAGGACCTCTCG-3’; Hprt1-R: 5’-TGAAGTACTCATTATAGTCAAGGGCA-3’.
Enzyme-linked immunosorbent assay
Paired (capture and detection) antibodies and standard recombinant mouse IL-1β (from R&D Systems)
and TNF (from eBioscience) were used to determine cytokines concentrations in cell culture
supernatants and mouse sera according to manufacturer's instructions.
Measurement of active caspase-1 by FLICA assay
The levels of active caspase-1 were quantified using an inhibitor-based, fluorescent probe (FLICA™
FAM-YVAD-FMK, #98, ImmunoChemistry Technologies) that specifically recognized active caspase-1.
Briefly, macrophages were primed with LPS (100 ng/ml) followed by treatment with ATP or nigericin for
45 min or alum, silica, MSU or DOTAP liposomes for 5 hrs. Then the cells were washed twice with PBS
and loaded with 4 µM of FLICA™ FAM-YVAD-FMK for 40 min and washed twice with PBS.
Fluorescence intensity was determined using a FilterMax F5 multimode plate reader (Molecular Devices)
and the data were normalized to LPS-primed but NLRP3 agonist-untreated controls.
4
Immunoblot analysis
Cells were lysed in RIPA buffer (25 mM Tris-HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium
deoxycholate, 0.1% SDS) containing protease inhibitor cocktail (Roche, #11836153001) and
phosphatase inhibitor cocktail (Sigma-Aldrich, #P5726). Protein concentrations were quantified using
BCA Protein Assay Kit (Pierce, #23225). Equal amounts of protein were loaded into SDS-PAGE and
transferred onto nitrocellulose membranes. The membranes were then incubated with antibodies against
p62, NBR1, NDP52, OPTN, TAX1BP1, ATG7, Parkin, ASC, NLRP3, VDAC, α-Tubulin, caspase-1 and
IL-1β (as described above), followed by appropriate secondary HRP–conjugated antibodies, and then
developed with ECL.
Mitochondrial ROS detection
Mitochondrial ROS were measured using MitoSOX. Briefly, macrophages were first primed with LPS
(100 ng/ml) followed by treatment with ATP or nigericin for 30 min or alum, silica, MSU or DOTAP
liposomes for 3 hrs, after which the cells were washed twice with PBS and loaded with 4 µM of MitoSOX
for 20 min and washed twice with PBS. Fluorescence intensity was determined using a FilterMax F5
multimode plate reader (Molecular Devices), and the data were normalized to LPS-primed but NLRP3
agonist-untreated controls.
Measurement of mitochondrial membrane potential
Mitochondrial membrane potential (Ψm) was measured using TMRM. Briefly, macrophages were primed
with LPS (100 ng/ml) followed by treatment with ATP or nigericin for 30 min or alum, silica, MSU or
DOTAP liposomes for 3 hrs, after which the cells were washed twice with PBS and loaded with 200 nM
of TMRM for 30 min and washed twice with 50 nM TMRM. The cells were resuspended in PBS and
fluorescence intensity was measured with a FilterMax F5 multimode plate reader (Molecular Devices).
The data were normalized to LPS-primed but NLRP3 agonist-untreated controls.
5
Cellular fractionation and measurement of cytosolic mtDNA
Macrophages were first primed with LPS (100 ng/ml) followed by treatment with ATP or nigericin for 60
min or other NLRP3 agonists for 5 hrs. Cellular fractionation was then performed using a mitochondrial
isolation kit for culture cells (#89874, ThermoScientific) according to manufacturer's instructions.
Measurement of cytosolic mtDNA was as previously described (Nakahira et al., 2011) by using the
mitochondrial isolation kit above. DNA was isolated from 300 μl of the cytosolic fractions and
mitochondrial DNA encoding cytochrome c oxidase 1 was measured by quantitative real-time PCR with
same volume of the DNA solution. Nuclear DNA encoding 18S ribosomal RNA was used for
normalization. Primers’ sequences are as previously described (Nakahira et al., 2011).
Immunofluorescent staining and confocal microscopy
BMDM were seeded at 0.2 x 106 cells per well in 8 well glass slides, and rested overnight for proper
attachment. Then, the cells were primed with LPS (10 ng/ml) for 2 hrs, and treated with ATP or nigericin
for 30 min, or other NLRP3 agonists for 2 hrs. After the treatment, the cells were washed twice with
sterile PBS and fixed with 4% paraformaldehyde (PFA), permeabilized with 0.01% Triton X-100 and
blocked in 2% BSA and 1% donkey serum. The cells were then incubated overnight with primary
antibodies, including anti-p62 (#GP62-C, ProGen), anti-TOM20 (#sc-11415, Santa Cruz Technologies),
anti-poly-ubiquitin (#D071-3, MBL), anti-GFP (#ab13970, Abcam). For experiments that used mitotracker
instead of Tom20 antibody, cells were stained with mitotracker red (#M-7512, Life Technologies) prior to
PFA fixation. Secondary fluorescent antibodies (Alexa-488, -594 or -647, from Life Technologies or
Jackson Laboratories) were added for 1 hr and DAPI was used for nuclear counterstaining. Samples
were imaged through a SP5 confocal microscope (Leica) 24 hrs after mounting.
Electron microscopy
6
After LPS priming and NLRP3 agonist stimulation, macrophages were fixed in 2.5% glutaraldehyde in 0.1
M cacodylate buffer pH 7.4 pre-warmed up at 37°C for 5 minutes at room temperature followed by 1 hr
over ice. All solutions and steps from this point on were utilized and performed at 4°C. After fixation cells
were rinsed 5 times for 1 minute each in 0.1 M cacodylate buffer, then post-fixed in 2% OsO4 in 0.1 M
cacodylate buffer for 30 minutes. After 2 washes for 1 minute each in 0.1 M cacodylate buffer and 3
washes for 1 minute each in double-distilled water, cells were en bloc stained with 2% aqueous uranyl
acetate overnight at 4°C. After 5 rinses for 1 minute each in double-distilled water cells were dehydrated
in a cold graded ethanol series (20%, 50%, 70%, 90%, 100%) for 3 minutes each on ice, then rinsed
once in room temperature 100% ethanol, and embedded in Durcupan ACM resin (Electron Microscopy
Sciences). Sections were cut with a diamond knife at a thickness of 70-90 nm. The sections were
examined using a JEOL 1200 EX at 80 kV. Images were recorded on film at either 4000 x or 10,000 x
magnification. The film negatives were digitized using a FlexTight scanner at either 1000 or 1500 dpi. To
avoid bias, the entire population of mitochondria in each image (number of images = 10) was examined
to count the number of abnormal mitochondria. The percentage of abnormal mitochondria was
determined by dividing the number of abnormal mitochondria by the total number of mitochondria per
image. The mean, standard error of the mean (SEM) and Student’s t-test p values are reported.
p62 reconstitution in p62∆Mye macrophages
p62∆Mye macrophages were transduced with viral supernatants corresponding to the pMigR1-p62 and
pMigR1-p62∆UBA retroviral vectors obtained as previously described(Wooten et al., 2005). Viral
supernatants were filtered through a 0.45-μm-pore-size filter (Millipore) and supplemented with
Polybrene (8 μg/ml) before adding to cells. Four days after viral transduction, cells were analyzed for p62
and p62∆UBA localization by confocal microscopy after LPS priming followed by NLRP3 agonist
stimulation.
Depletion of mitochondria-derived NLRP3 inflammasome-activating signals
7
For mtDNA depletion, p62F/F and p62∆Mye BMDM were treated with 450 ng/ml of ethidium bromide (EtdBr)
for 4 days as previously described (Rongvaux et al., 2014). For inhibition of mitochondrial protein
synthesis, the above cells were treated with chloramphenicol (200 μg/ml) as previously described
(Shimada et al., 2012). Cells were then primed with LPS followed by stimulation with NLRP3 agonists.
After treatment, cells and culture supernatants were collected for measuring active caspase-1 by FLICA
assay and IL-1β and TNF by ELISA, respectively.
Septic shock model
Septic shock was induced by the intraperitoneally (i.p.) injecting 8-12 weeks old sex-matched p62∆Mye
and Atg7∆Mye mice or their wild-type littermates (p62F/F and Atg7F/F, respectively) with LPS (E. coli
O111:B4, Sigma-Aldrich) at 30 mg/kg body weight. Mouse survival was monitored every 6 hrs post
injection for a total of 72 hrs. In separate experiments, mice were treated with the same dose of LPS and
immune sera were collected 3 hrs post injection. Serum IL-1β and TNF were measured by ELISA.
Peritonitis model
Peritonitis was induced by i.p. injection of PBS or 300 μg alum (dissolved in 0.2 ml sterile PBS) into 8-12
weeks old sex-matched p62∆Mye and Atg7∆Mye mice and their wild-type littermates (p62F/F and Atg7F/F,
respectively). 15-18 hrs after injection, mice were euthanized and the peritoneal cavities were washed
with 6 ml cold sterile PBS. Total recruited peritoneal exudate cell (PEC), neutrophils (CD11b+Ly6G+
F4/80-) and monocytes (CD11b+Ly6C+Ly6G-) present in the peritoneal lavage fluid were quantified by
flow cytometry. For blocking of Fc-mediated interactions, mouse cells were pre-incubated with 0.5-1 μg
of purified anti-mouse CD16/CD32. Isolated cells were stained with labeled antibodies in PBS with 2%
FCS and 2 mM EDTA or cell staining buffer (Biolegend). Dead cells were excluded based on staining
with Live/Dead fixable dye (eBioscience). Antibodies specific for the following antigens were used:
CD45(hOKT4), CD11b(M1/70), CD11c(N418), MHCII(M5/114.15.2), Gr-1(1A8-l66g), Ly6C(HK1.4), and
8
Ly6G(1A8-Ly6g) (all from eBioscience). Cells were analyzed on a Beckman Coulter Cyan ADP flow
cytometer. Data were analyzed using FlowJo software (Treestar).
Fulminant hepatitis model
10-12 weeks old mice were i.p. administered with LPS (Sigma-Aldrich; 0.5 µg/mouse) and D-
galactosamine hydrochloride (D-Gal, from Sigma-Aldrich; 20 mg/mouse). D-Gal is an inhibitor of hepatic
RNA synthesis, and induces hepatic damage and macrophage infiltration. When given with a low dose of
LPS, D-Gal strongly sensitizes mice to produce apoptotic liver injury with severe hepatic congestion,
resulting in fulminant hepatitis. Mice were euthanized at 6 hrs after LPS/D-Gal injection, blood and liver
samples were then collected for pathological and immunological analyses. 6-10 mice per each group
were used for this experiment.
Statistics
All data are shown as means ± s.d. or means ± s.e.m. as indicated. Statistical analysis was performed
using a two-tailed Student’s t-test or log-rank test (for survival analysis). For all tests, P-values lower than
0.05 were considered statistically significant.
References
Brydges, S.D., Broderick, L., McGeough, M.D., Pena, C.A., Mueller, J.L., and Hoffman, H.M. (2013).
Divergence of IL-1, IL-18, and cell death in NLRP3 inflammasomopathies. The Journal of clinical
investigation 123, 4695-4705.
Hornung, V., Bauernfeind, F., Halle, A., Samstad, E.O., Kono, H., Rock, K.L., Fitzgerald, K.A., and Latz,
E. (2008). Silica crystals and aluminum salts activate the NALP3 inflammasome through phagosomal
destabilization. Nature immunology 9, 847-856.
Komatsu, M., Waguri, S., Ueno, T., Iwata, J., Murata, S., Tanida, I., Ezaki, J., Mizushima, N., Ohsumi, Y.,
Uchiyama, Y., et al. (2005). Impairment of starvation-induced and constitutive autophagy in Atg7-
deficient mice. The Journal of cell biology 169, 425-434.
Muller, T.D., Lee, S.J., Jastroch, M., Kabra, D., Stemmer, K., Aichler, M., Abplanalp, B., Ananthakrishnan,
G., Bhardwaj, N., Collins, S., et al. (2013). p62 links beta-adrenergic input to mitochondrial function and
thermogenesis. The Journal of clinical investigation 123, 469-478.
Nakahira, K., Haspel, J.A., Rathinam, V.A., Lee, S.J., Dolinay, T., Lam, H.C., Englert, J.A., Rabinovitch,
M., Cernadas, M., Kim, H.P., et al. (2011). Autophagy proteins regulate innate immune responses by
inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nature immunology
12, 222-230.
9
Rodriguez, A., Duran, A., Selloum, M., Champy, M.F., Diez-Guerra, F.J., Flores, J.M., Serrano, M.,
Auwerx, J., Diaz-Meco, M.T., and Moscat, J. (2006). Mature-onset obesity and insulin resistance in mice
deficient in the signaling adapter p62. Cell metabolism 3, 211-222.
Rongvaux, A., Jackson, R., Harman, C.C., Li, T., West, A.P., de Zoete, M.R., Wu, Y., Yordy, B., Lakhani,
S.A., Kuan, C.Y., et al. (2014). Apoptotic caspases prevent the induction of type I interferons by
mitochondrial DNA. Cell 159, 1563-1577.
Shimada, K., Crother, T.R., Karlin, J., Dagvadorj, J., Chiba, N., Chen, S., Ramanujan, V.K., Wolf, A.J.,
Vergnes, L., Ojcius, D.M., et al. (2012). Oxidized mitochondrial DNA activates the NLRP3 inflammasome
during apoptosis. Immunity 36, 401-414.
Wooten, M.W., Geetha, T., Seibenhener, M.L., Babu, J.R., Diaz-Meco, M.T., and Moscat, J. (2005). The
p62 scaffold regulates nerve growth factor-induced NF-kappaB activation by influencing TRAF6
polyubiquitination. The Journal of biological chemistry 280, 35625-35629.
Zhong, Z., Zhai, Y., Liang, S., Mori, Y., Han, R., Sutterwala, F.S., and Qiao, L. (2013). TRPM2 links
oxidative stress to NLRP3 inflammasome activation. Nature communications 4, 1611.
10

Paper para clase y trabajo (2018) pdf

Uploaded by

Copyright:

Available Formats

Paper para clase y trabajo (2018) pdf

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Paper para clase y trabajo (2018) pdf

Uploaded by

Copyright:

Available Formats

Article

NF-kB Restricts Inflammasome Activation via

d NLRP3 agonists damage mitochondria and release

d Ubiquitinated damaged mitochondria are eliminated by p62-

d p62 ablation prevents mitophagy and enhances NLRP3-

Zhong et al., 2016, Cell 164, 896–910

NF-kB Restricts Inflammasome Activation

465 Kajii-cho, Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto 602-8566, Japan

9500 Gilman Drive, La Jolla, CA 92093, USA

SUMMARY (PAMPs) or damage-associated (DAMPs) molecular patterns,

Figure 2. NLRP3 Agonists Promote Mitochondrial Damage and p62 Recruitment

Figure 5. Autophagy Mediates Clearance of p62-Bound Mitochondria

Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc. S1

S2 Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc.

Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc. S3

S4 Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc.

Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc. S5

S6 Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc.

Cell 164, 896–910, February 25, 2016 ª2016 Elsevier Inc. S7

NF-kB Restricts Inﬂammasome Activation

Institutional Animal Care and Use Committee of UCSD.

Roche. 1,2-Dioleoyl-3-trimethylammonium-propane (DOTAP) liposomes were made by Encapsula

20B-0042-C100), anti-mouse OPTN (#10837-1-AP, Proteintech), anti-mouse Tax1bp1 (#14424-A-AP,

Proteintech), anti-mouse Calcoco2/Ndp52 (#12229-1-AP, Proteintech), anti-mouse NBR1 (#9891S, Cell

Cell culture and stimulation

library), and the sequences are as follows: shp62#1

(CCGGTAGTACAACTGCTAGTTATTTCTCGAGAAATAACTAGCAGTTGTACTATTTTTG); shAtg7#1 (5'-

puromycin selection at day 7.

RNA isolation and real-time PCR

AGAGGAGAGGATCCCTGTGG-3’; Optn-R: 5’-ATTTCCTGGGGTCTCACAAG-3’; Nbr1-F: 5’-

CCAGAAAATACAACCTGGGC-3’; Nbr1-R: 5’-TCCTCGTTCTCCTCATCCAG-3’; Tax1bp1-F: 5’-

CTACGCTGAGAGGCAGTGG-3’; Tax1bp1-R: 5’-GCAATTGGACTTCTTGAAAGG-3’; p62-F: 5’-

AGAATGTGGGGGAGAGTGTG-3’; p62-R: 5’-TCTGGGGTAGTGGGTGTCAG-3’; Ndp52-F: 5’-

GCCCCATACCTACCTTGCTG-3’; Ndp52-R: 5’-TCGAGGGATGAACTTTTCAGTG-3’; Hprt1-F: 5’-

CTGGTGAAAAGGACCTCTCG-3’; Hprt1-R: 5’-TGAAGTACTCATTATAGTCAAGGGCA-3’.

Enzyme-linked immunosorbent assay

supernatants and mouse sera according to manufacturer's instructions.

Measurement of active caspase-1 by FLICA assay

FAM-YVAD-FMK, #98, ImmunoChemistry Technologies) that specifically recognized active caspase-1.

developed with ECL.

Mitochondrial ROS detection

Measurement of mitochondrial membrane potential

The data were normalized to LPS-primed but NLRP3 agonist-untreated controls.

normalization. Primers’ sequences are as previously described (Nakahira et al., 2011).

Immunofluorescent staining and confocal microscopy

p62 reconstitution in p62∆Mye macrophages

pMigR1-p62∆UBA retroviral vectors obtained as previously described(Wooten et al., 2005). Viral

Depletion of mitochondria-derived NLRP3 inflammasome-activating signals

assay and IL-1β and TNF by ELISA, respectively.

Septic shock model

CD45(hOKT4), CD11b(M1/70), CD11c(N418), MHCII(M5/114.15.2), Gr-1(1A8-l66g), Ly6C(HK1.4), and

cytometer. Data were analyzed using FlowJo software (Treestar).

Fulminant hepatitis model

galactosamine hydrochloride (D-Gal, from Sigma-Aldrich; 20 mg/mouse). D-Gal is an inhibitor of hepatic

were used for this experiment.

0.05 were considered statistically significant.

You might also like