need help to post week 1 discussion for inf 630 system analysis

Week 1 – Discussion 1No unread replies.No replies.Your initial discussion thread is due on
Day 3 (Thursday) and you have until Day 7 (Monday) to respond to your classmates. Your
grade will reflect both the quality of your initial post and the depth of your responses. Refer
to the Discussion Forum Grading Rubric under the Settings icon above for guidance on how
your discussion will be evaluated.Be sure to review the How to Increase Your Score:
Discussion Forum Expectations Announcement for more information about what I’m
expecting in your discussion forum replies. The What and Who of a Business Problem
(BP)Before beginning this exercise, read the lecture, read Chapter 3 in the text, and review
Chapters 1 and 2 in the BABOK® guide located in the Week 1 – Resources page. Using
Figure 3.7 on page 45 in the Robertson and Robertson text as a guide, identify the principal
stakeholders in the CWI scenario, and describe what their roles are in the BP. Be sure you
have captured the all the primary stakeholders in the BP. Identify the elements of a business
problem, then examine the relationship of the BP to the stakeholders you have identified.
Your initial post should be a minimum of 200 words.Guided Response: Evaluate your peer’s
identified stakeholders and their relationships to the BP. Respond to at least two of your
peers. Respond to at least two of your peers. Explain why you agree or disagree with their
explanations, then offer at least one additional possible stakeholder that your peer should
consider. Explain your reason for including this stakeholder. Your posts should be a
minimum of 100 words.
Need help to write a 4 pages research about diversity

Final Paper copy.docI have a research paper about diversity in classroom which need more
4 pages to be complete.In this 4 pages i need to be focused on two main things and you can
add more from you mind but tell me first .1- The students :the benefits of having students
from different cultures in one class – how that affects their performance and learning – how
can they learn from each other – how teachers can learn from them – …etc.2- The teachers
:how can they be prepared to teach in a diverse classroom – what challenges do they have –
the importance of learning multicultural education for the teachers – how can new and
future teacher learn from the old and experienced teachers – what is the teacher role in the
diverted classroom.Here is the professor instructions : Interview ANYONE about your topic
(could be a friend, but NOT someone in the class). Report what they said, but DO NOT just
“dump” what they said in this section. Instead, create a “story” that helps the reader to
understand what you learned, and use quotes from the person that you interviewed as
“evidence” of your analysis.For example: When Dr. Tod interviewed John here is what John
said: “Thanks Dr. Tod for explaining what critical Race theory is. Now that you have
explained it, I think l can understand why people of color are interested in it. I think it helps
make sense of the world by putting race at the forefront. I think it would have helped me
understand what happened to me at the University when a professor wouldn’t shake my
hand because he said he had a cold. But I noticed that he shook hands with a white student
he was talking to…” (these notes from John ARE NOT in your paper, you use them like you
see below)Now, here is how you can think about writing in the “What I learned” section
(use first person): Critical race theory (CRT) helps us understand the world from the
perspective of people of color. When I first got to University I had a professor who said that
she did not think that Black History Month was necessary any longer. At first I cringed when
l heard that, but with knowledge of CRT, l am able to understand the same way that John
did. John explained that “[when I attended] the University of Maryland a professor wouldn’t
shake my hand because he said he had a cold. But I noticed that he shook hands with a
white student he was talking to”. Incidents like these remind me of what Pitre et al. talk
about in their book called “xxxxx”. …..(in those quotation marks you are quoting Pitre).Be
conversational, but put in information that is actually useful to the reader. Create an EASILY
readable, but true “story”.I have a record of the interview and i wrote it but i did not finish
and i will write the rest within 24 hours. Also i will send you i copy of some pages from my
books and i need you to take some parts of it .Also you can use any acadimic article or
resources Books , videos , lectures…..etc
Need help to write a JUST one page summary about

Find one current event from this business journal ” http://www.bizjournals.com/ “Type
a ONE PAGE summary about the event.It must be typed Double space 12 font, Times New
Roman. *** SUMMARIES SHOULD INCLUDE:1. A brief summary of what the article is
about.2. Why the article appealed to you.3. How the article relates to the business field4. No
plagiarism and works cited needed too.
Need help to write a 6-8 pages long research

Write a 6-8 pages formal research paper. The outline is in attach here : Outline This should
be a FULL APA style research paper with 6-8 resources; at least 2 academic resources.Make
sure to follow everything in the outline (topic/ main points/ sub points)Do not make it too
academic, it is for graduated student level. However, keep it formal.
need help to write a psuedocode for each

Write a program to read three values, calculate their sum and their average and print the
results as: “The sum is “, sum “The average is “, average2. Write a program to read a value,
print its 3/4, 1/2, and 1/4. Declare four variables with appropriate names to store the
original value, three quarters of the values, half of the value and quarter of the value. 3.
Write a program that will read a radius of a sphere, send the radius to function by the name
sphereVolume to return the volume of the sphere (find the formula of the volume of sphere
in the WWW). Print the volume in the original program (main program where you have:
Start and Stop).4. Write a program that will read 5 sales. After finding their subtotals,
calculate the sale discount based on these criteria s:if the subtotal is >= 10000, the discount
is 15%else if the subtotal is >= 7500 and < 10000, the discount is 10%else if the subtotal is
>= 5000 and < 75000, the discount is 7%else if the subtotal is >= 2500 and < 5000, then
discount is 5%else the discount is 3%Print the dicousntedAmount, the TaxAmount based on
7.5% taxRate, and the total. 5. Write a program using for-loop to add values between 50 and
100 (Hint: you can initialize a variable to any value instead of one or zero)
Need help to write a short paragraph on “Who makes

Post a short paragraph about one or two of the products in your house. What did you find
out that really surprised you? Why was it surprising? Was there anything you found that
was actually locally owned or made in the United States that surprised you? I’d like to get a
diverse set of posts, so try to be creative, and try to have fun with this one.Some questions
you might think about:Where was your furniture made? Where did you buy it?We know, for
the most part, who makes iPhones and Kindle Fires and Androids, so don’t post about your
electronic gadgets.Where did you get the clothes you are wearing and who made
them?Think small as well—what about your shampoo? Your razor? Stationery items like
pens, paper, notebooks and so on.What about the food in your cupboard or refrigerator?
Could your organic fruit juice actually be a subsidiary of Coca-Cola? If it’s Odwalla, it sure is!
But if you’re drinking Nantucket Nectars, you’re supporting the Dr. Pepper Snapple Group.
Do you have any cereal in the house? You may be interested not only in what company
produces it, but where they get their grains. Are they purchasing from Monsanto? Where
did you get your groceries? Do you know who actually owns Trader Joe’s?Your initial post
should be 200-300 words.
need help to write an essay about that related to african study

hello , i need a help on writing 4 page essay about the american civil war . you will see the
detail on the instruction that’s include two question to choose . i would like choose the the
american civil war . there must be three sources to use , the two sources that you must use
are : 1. Kevin Shillington. History of Africa. 3rd Edition. New York: Palgrave Macmillan,
2012.2. Karenga Maulana. Introduction to Black Studies. 4th Edition. Los Angeles:
University of Sankore Press, 2010. you need to find a third sources . the instruction is on the
attachment . waiting to hear from you . thank’s
need help today eco question

What are the highest and lowest payments from the writer that the bookkeeper farmer
team will accept for the 6th day? Assume that the farmer can dispose of $7 from the writer
as she wishes, what range of payments will the beekeeper accept? Assuming that the
beekeeper gets that amount, what range of payments will the farmer accept? (Remember
that negative payments are also possible.) Answer the same question for the 5th day. 13.
Some fields have large enough quantities of both oil and natural gas that coordination must
be achieved for the production of both, rather than oil alone as in our examples. Will fields
with both oil and gas have greater difficulties in unitization than fields with oil or gas alone?
Explain.
Need help understanding this topic and writing this essay on Heideigger

In his essay “The Question Concerning Technology,” Heidegger claims that technology is
amode of revealing, with modern technology in particular revealing nature as standing-
reserve.Do information technologies like cell phones, social media, and the like, constitute a
new modeof revealing? First, give a brief presentation of Heidegger’s analysis of modern
technology. Then,either a) argue that information technology reveals nature in a way other
than as standing-reserveor b) argue that information technology reveals nature in the same
way as modern technologymore generally. 500 words, Use MLA or Chicago-Turabian
formatting and citation guidelines.
need help watching the movie roma on netlfix about 2 hours and answer these questions

Miren una estas pelÃ-culas y respondan a la siguientes preguntas (nedless to say, Google
Translate or Spanish Dic are forbidden and those who use it, will get a zero in this
assignment). 1. ¿Qué clase de pelÃ-cula es? (género de la pelÃ-cula)2. ¿Quiénes
son los protagonistas? ¿Quiénes son los personajes secundarios? Escribe todos los
nombres.3. ¿Cuál es la relación entre los personajes? ¿A qué clase social pertenecen?
¿A qué se dedican? (profession)4. ¿Dónde tiene lugar la pelÃ-cula? (location). Si hay
más de una ubicación, escrÃ-bela.5. ¿Qué fue lo que más te gustó de la pelÃ-cula?
¿Por qué?6. ¿Qué fue lo que menos te gustó de la pelÃ-cula? ¿Por qué?7. La
música: ¿cuál es la banda sonora? (original soundtrack) ¿Tiene un papel relevante la
música en ciertas partes de la pelÃ-cula?
need help week 11 business assignment

To complete this assignment:1. Read the following article titled “Making ethical
business decisions”, at CBIA News:
http://www.cbia.com/cbianews/2006/07/200607CS_MakeEthicalBizDecisions.htm2. Ans
wer all of the questions below in the space provided.3. Reflect on the information
presented in this week’s lesson and provide an insightful response to each question
writing no more than two paragraphs.EXAMPLE: After reading the article, in 100-150
words, summarize your findings regarding the importance of making sound ethical
decisions for business entities.Example answer: I learned that that as a manager, ethical
business practices are an integral part of running a business and hence ethical values
accompany business by default. I learned that without following certain ideals in business, I
cannot become successful. Success that is attained without a foundation of strong ethics is
bound to be short-lived. Needless to say, a business cannot continue to prosper without an
ethical base. I mean think about it, having a few business successes can be coincidences or
flukes but persistent business success can only be a result of a strong foundation of ethical
business practices. I am now aware that ethical business practices have become more
complicated because of the financial, global and diversified nature of many large
corporations and because of the complexity of our social, economic, global, natural, political,
legal obligations.Example a.: List at least one reference used to assist you in answering the
question? Recognizing that a reference could be a personal discussion with an
entrepreneur, magazine article, text book, etc without APA
formatting.http://www.cbia.com/cbianews/2006/07/200607CS_MakeEthicalBizDecisions.
htm 1. After reading the article, in 150-200 words, summarize your findings regarding the
importance of making sound ethical decisions for business entities. 1a. List at least one
reference used to assist you in answering the question? Recognizing that a reference could
be a personal discussion with an entrepreneur, magazine article, text book, etc without APA
formatting.
need help week 12 science assignment

Watch this movie: Home After watching the movie, coupled with what you have learned
over the last 12 weeks, state your honest account of the following:Summarize what topics
were most interesting to you. Summarize what topics were the least interesting to you.Will
any of your actions/behaviors change as a result of this class? If so, why or why
not?Requirements: Please make sure your summary: Is written in paragraph form. Is
double-spaced. Uses 12 point, Times New Roman font. Includes title & reference pages. Is at
least one full page of text to the body of your summary. Has one-inch margins on all sides.
need help week 7 business assignment

View the “Remember the Titans” video clip.Part 1: Each team member must choose one
stage of Team Development: Forming, Storming, Norming, Performing or Adjourning. As
you view the video, identify the team dynamics during your specific stage. Part 2: In your
group’s designated discussion forum, discuss the video as it relates to the stages of team
development and discuss your specific stage as it relates to team development as a
whole. Some questions to consider:1. What behaviors were demonstrated during my
chosen stage?2. How did the behaviors influence the next stage in the development of the
team?3. In the forming stage, how did the actions of the characters influence the
development in the next stage?3. In the adjourning stage, how did the previous stages
influence the outcome of the adjourning stage? Part 3: For the Team Project, compile and
submit a summary of the responses of all team members. Each team member must submit a
separate Team Project for grading purposes. Your submission must be 100-150 words
minimum. Part 4: Once the project is finished, please complete the anonymous peer-review
sheet and submit it to the Dropbox. List at least one reference used to assist you in
answering the question? Recognizing that a reference could be a personal discussion with
an entrepreneur, magazine article, text book, etc., without APA formatting. Peer Review
Scale/Evaluation Document.
need help week 7 discussion question

Discuss one alternative to gasoline for automobiles and explain how it works.Select an
automobile model – on the market now – that uses the alternative fuel source you described
above and give detailed information on the vehicle (including but not limited to who makes
it, how much it costs, the mileage it gets, etc.)Thinking about the auto model you chose
above, would you buy one of these – why or why not?Would you save gas (not money) if you
drove the model you chose to investigate? If not, why not? Please show your
calculations.What changes would make these vehicles more popular?Would you consider
using public transportation or riding a bicycle instead of driving your current vehicle for at
least some trips you make?
need help week 8 psychology assignment

This week we have explored theories of development from Piaget and Erikson and how we
continue through “stages― throughout our lifespan. As you reflect upon these
theories of development, please answer the following in essay format.Using a word
processor, complete the following:Choose the stage that has been the biggest challenge for
you, thus far.Explain what you have learned about a “future stage.― How will this
information benefit you as you reach that stage?Choose at least three specific goals you
have set for yourself as you continue through your lifespan and how you will achieve those
goals.How has this course helped you determine those goals?Your assignment should be
a minimum of one to two well-composed paragraphs. Each paragraph should include 5-7
insightful sentences.Use APA format in this document, following these guidelines:Your
paragraphs should be double-spacedTimes New Roman, 12pt fontMargins should be set at 1
inch on all sides.
need help will pay 40

Using the Critique Format as a guide, please read and submit a written summary for each
of the following six (6) articles no later than May 2, 2016. What
are common messages or themes contained in these articles? What
are conflicting messages or themes contained in these
articles? 2. Daniela Marinova Cultural Alienation in the Ageing Person Psychological
Thought, 2013, Vol. 6(2), 264-282 3. Robin P. Bonifas; Kelsey Simons; Barbara BielAging
and Place in Long-Term Care Settings: Influences on Social Relationships Journal of
Aging and Health 2014, Vol. 26(8) 1320-
1339 *Jah.sagepub.com@njcu 4. Gregg Esterbrook ‘What Happens When We All Live to
100?’ The Atlantic, October 2014 p.61-72 5. Ezekiel J. Emanuel ‘Why I Hope to Die At 75’.
The Atlantic October 2014 p.75-81 Cultural Alienation in the Ageing Person 6. Lesley
Stahl, Alive and Kickin’ 60 Minutes January 4, 2015 (Script) www.cbsnews.com/news/alive-
and-kickin’ Alive and Kickin’
need help wit this assignment

Students, please view the “Submit a Clickable Rubric Assignment” in the Student
Center.Instructors, training on how to grade is within the Instructor Center.Assignment 3:
Keys to Success in Multinational CompaniesDue Week 9 and worth 220 pointsIt is widely
known that Knowledge Management Systems are the key to success in multinational
companies. Imagine that you are a Vice President of a company that is ramping up to go
global.Please choose one (1) of the following industries for the purposes of this
assignment:JewelryFashion / ApparelChemicalsConsumer electronics, electronic
componentsMedical supplies or equipmentBins, totes, crates, material handlingFood
productsDrug productsChildren’s products, clothing, toys, etc.Note: You may create and
/ or assume all necessary assumptions needed for the completion of this assignment.You
have been tasked with designing a comprehensive best practices policy list geared towards
managing existing knowledge and any new knowledge as it becomes viable. The best
practices policy should include a compiled task list that will help your company to handle
not only the regular issues of conducting business within a foreign country, but also the
unexpected events (e.g., earthquakes, demonstrations, bomb threats, etc.), no matter the
country or countries into which you will be expanding. The policy list should also take any
unique challenges that your company may face into consideration.Write a six to eight (6-8)
page paper in which you:Design a comprehensive best practices policy list that includes
policies on the following:Sanitation (e.g., hand washing, toilet facilities, etc.)Eating and / or
drinking (e.g., at desks, on the company grounds, inside in the manufacturing area at
designated tables / areas, etc.)Conflict resolution (e.g., settling disputes, mediation and / or
arbitration with designated mediator on staff, etc.)In-house teams (e.g., minimum meeting
times, scribes, appointed leaders, etc.)Online team (e.g., 24-hour coverage on phone due to
time differences, etc.)Security (e.g., leaving doors open, locks, key return policy for
departing workers, etc.)Emergency evacuation proceduresDetermine the key benefits of
creating such policies. Provide a rationale for your response.Speculate on the major
ramifications if such policies are not created. Provide a rationale for your response.Predict
the significant ways in which the best practices policy that you created will contribute
towards the long-term sustainability of the company. Provide a rationale for your
response.Determine whether or not your best practices policy would provide a competitive
advantage over other international companies. Provide one (1) example of a company using
a best practices policy to support your response.Use at least three (3) quality academic
resources in this assignment. Note: Wikipedia and other similar websites do not qualify as
academic resources.Your assignment must follow these formatting requirements:Be typed,
double spaced, using Times New Roman font (size 12), with one-inch margins on all sides;
citations and references must follow APA or school-specific format. Check with your
professor for any additional instructions.Include a cover page containing the title of the
assignment, the student’s name, the professor’s name, the course title, and the date.
The cover page and the reference page are not included in the required assignment page
length.The specific course learning outcomes associated with this assignment are:Evaluate
strategic management and participation strategies in a global business.Use technology and
information resources to research issues in global management.Write clearly and concisely
about global management using proper writing mechanics.Click here to view the grading
rubric for this assignment.By submitting this paper, you agree: (1) that you are submitting
your paper to be used and stored as part of the SafeAssignâ„¢ services in accordance with
the Blackboard Privacy Policy; (2) that your institution may use your paper in accordance
with your institution’s policies; and (3) that your use of SafeAssign will be without recourse
against Blackboard Inc. and its affiliates. ASSIGNMENT SUBMISSIONCreate Submission in
BlackboardStart SubmissionAttach FilesSafeAssign accepts files in .doc, .docx, .docm, .ppt,
.pptx, .odt, .txt, .rtf, .pdf, and .html file formats only. Files of any other format will not be
checked through SafeAssign. ADD COMMENTS
need help with 2 assgiments

Due no later than Thursday 11:59 am (PST)Discussion 1:1a. Discuss how the articles by
Neims (2015) and Goldsmith (2011) on
plagiarism are alike and how they are different by explaining their
views on if and how plagiarism is a problem.1b. How does society at large need to change
their views of plagiarism?Do your best to cite your source(s) and reply to at least one other
student's post. - can you name the file a.b
eng130=================================================================
================================Due no later than Sunday 11:59 pm (PST) can you
name this file a.b eng130Discussion 2Review the paraphrasing tips from Gahan (2019) and
the video in the module background readings.2a. Discuss at least 2 key elements to keep in
mind when paraphrasing?2b. What is at risk when you paraphrase poorly?2c. Paraphrase
the statement below:"Earning a college degree is all about opening up opportunities in
life. It prepares you, both intellectually and socially, for your career
and your adult life. The benefits of a college education include career
opportunities like better paying and higher skilled jobs, but studies
have shown that it also leads to overall happiness and stability"
(Education Corner, 2016).
Need help with 2 questions

i went ahead and put the articles where to find the answers under the bold question. In the
article, "Hiring the 'perfect employee'," Katherine Woodford lays out a detailed process for
screening potential candidates. What are the steps in the process as she identifies it? What
has she left out of her process that may be important to a small business owner? Hiring
the 'perfect employee'Woodford, S Katherine. Grounds Maintenance38.7 (Jul 2003):
C14. Turn on hit highlighting for speaking browsers Abstract
(summary)TranslateAbstract Woodford discusses ways in making employee recruitment
easier. The first step is to write proper job descriptions for all employees on the payroll.
Second, draw a composite of the perfect employee. Consider the roles the employee will
take on. Qualities should include: abilities to identify and resolve problems quickly, good
communication skills, knowledge in customer service, and professionalism. Full
textTranslateFull text HeadnoteFollow these steps to make hiring employees easier.Staffing
in the green industry is a complex job. It's a balancing act requiring talent, business finesse
and a little bit of luck. Keeping full-time employees on the payroll year round can drain the
company's profits, yet the business cannot run without a full-time staff.In addition to full-
time employees, green industry businesses depend on seasonal workers for nine months
out of the year. This brings with it another set of hiring difficulties: 1) The pool of potential
employees is small 2) Knowing how many employees to hire because of the unreliability of
seasonal employees and the unpredictable volume of business and 3) Procrastination, then
rushing through the hiring process, only to have major regrets later.For these reasons and
more, business owners and managers deal with the question: How do I hire the 'perfect'
employee? With enough information, you can set up standards for the hiring process so that
you'll confidently breeze through like a professional and waiting to the last minute to hire a
mismatched employee will be a behavior of the past.PRE-INTERVIEWHiring the wrong
person may cost you more than you think. Customers judge your business by the
employees. The best-looking trucks, equipment and uniforms in the country won't offset
employees who aren't customer oriented - a situation that can cause your business never to
realize its full potential. If it's the right match, they'll accelerate the growth of your business,
but a wrong match could actually hurt the productivity of your staff.The first step is to write
proper job descriptions for all employees on the payroll. Then write job descriptions for the
slots you need to fill. Qualify a salary and benefits package for the job. Realize that when you
present an offer to the best applicant, it should be a competitive package. Talk to other
managers and small business owners in the community before deciding on a wage scale and
fringe benefits for the position. Evaluate the benefits package from both the employee and
employer's point of view.Second, draw a composite of the perfect employee. Consider the
roles the employee will take on. Qualities should include:* Abilities to identify and resolve
problems quickly* Good communication skills* Professionalism, presenting themselves well
to the customer* Knowledgeable in customer service* Work experience in sales and the
green industry* Ability to work unsupervised* Work well with others* Respect
management and their fellow employeesDetermine the specific level of experience you're
looking for, the least amount you'll settle for and be realistic. If the applicant is straight out
of school, don't expect a great deal of professionalism and adjust the questions to their level.
For example, ask for experiences from school and part-time jobs.Once you've defined the
'perfect employee', effectively prepare for the interview. Design an interview form with
standard questions, leaving room for observations made during the interview. As a
reminder, make a note of questions not to ask during the interview.Over the past three
decades, the government has passed numerous civil rights laws in an attempt to prevent
discrimination in the workplace. This legislation has a direct impact on the types of
questions allowed during an employment interview. Specifically, they prohibit questions
regarding race, national origin, religion, age, sex, marital status, ethnicity, citizenship, height
and weight and physical disability.Set a bottom line for minimum requirements in each
category. Some professionals suggest a score sheet to rank candidates with the
characteristics listed as Required, Preferred and Not Required. Filing the questionnaire and
score sheet with their application may come in handy later should a disgruntled, rejected
applicant file unwarranted charges of discrimination in hiring practices.The third step is to
customize a personnel package. Include an application for employment, the equal
opportunity employer statement and a statement that the application process does not
represent a contract of employment.Fourth, decide the most efficient way to find the top
candidate for the job. Classified ads are usually the first choice. To discourage unqualified
applicants, include:* Job title* Complete job description* Qualifications required* Salary
range and major benefits* How to apply and application deadline* Note if drug screening is
requiredDon't make the job sound better than it actually is. Be aware of the legalities of
your state regarding giving medical exams and drug screening tests.Other 'applicant pool'
options include employee and customer referrals, trade magazines, association publications
and temporary employment agencies. Generally, people don't take a chance on referring
someone unless they're completely sure of the candidate's ability to handle the position,
especially if it's their own place of employment, favorite landscape contractor or lawn
service.Inform the temporary employment agency that you're looking for a full-time
employee and give the specifics of the job. The agency will work to send a good match, with
the knowledge that performing this service guarantees them repeat business for future
temporary jobs.All applicants must complete an employment application. Add a statement
to the application that false information is grounds for termination. Have the applicant sign
the application. If applicants submitted resumes use them in conjunction with the
applications to screen candidates before interviewing, keeping in mind that resumes are
frequently 'pumped up.' When screening the candidates, look for length of time in each job
and gaps in the work history.THE INTERVIEWSet aside a time slot specifically for the
interview and give the applicant your undivided attention. Inform employees that you're
not to be disturbed unless it's an emergency. Don't take phone calls and leave email until
later. Keep in mind the applicant is a person, not a number and give them the respect you
would a customer.The time spent in an interview with a potential employee may be the
most important time you ever spend with them. To save time and to avoid the same
questions being repeated in multiple interviews, have two or three people sit in on a portion
of the interview to give everyone a chance to hear each candidate's answer to the same
question. This group could include a future fellow employee, a customer and their future
manager.A group evaluation of the same interview can be interesting as each one may pick
up different details. Conduct one interview by telephone to test the applicant's telephone
skills.First impressions are lasting impressions. Pay attention to the smallest detail. Did the
applicant show up on time for the interview? Were they early or did they rush in the door
two minutes before the appointment time? Were they dressed appropriately, have their hair
combed, face hair trimmed or shaved, chew gum, slouch, shoes tied? These silent factors
give out important information about the applicant.Save the small talk. It's very easy to
begin talking about yourself or your company and use up the slotted interview time. Focus
on asking your questions, then be a good listener. A good listen/talk ratio to shoot for is
80/20, talk 20 and listen 80 percent of the time.Explain the job description to the applicant
so they fully understand what the job entails. Include questions or problems that the
applicant should be able to handle daily on the job.POST INTERVIEWScreening an applicant
prior to employment can prevent a variety of problems, including workmen's compensation
claims.Create a standardized release form for background checks to hasten the hiring
process.Get written permission from the applicant to verify references and always check
their references.If the candidate is to handle money, get their permission in writing to run a
consumer credit check.If the applicant's responsibilities include driving a company vehicle,
get their permission to conduct a motor vehicle record check.Some employers run criminal
background checks. If you're inclined to do so, get permission in writing from the
applicant.Ask for permission to contact their current employer. If they request that you
don't, honor their request.HIRING YOUR NEW EMPLOYEEPool the information on the final
selection of candidates and meet with the interviewing team to discuss the interviews.
Compare observations and make a decision.Once you've chosen a candidate from the
applicants and background checks are complete, don't delay the hiring process. Keep in
mind that the candidate will be applying at other establishments. Notify the candidate by
phone with a tentative job offer, specifying job title, salary, start date and appointment for
drug screening. Make it clear the offer is pending a favorable drug screening. Follow the
phone call with a conditional letter of confirmation. Include a second copy with a stamped
envelope requesting the candidate to sign and return, verifying they understand the
offer.Once the screening test has cleared, schedule a time to sign employment paperwork.
Go over the employment agreement and the company Employee Handbook. Hand out
company uniforms and confirm a start date.Some professionals recommend a three to six
month probationary period in which either party can terminate employment at will for any
reason. This allows you and the applicant the opportunity to see if this is a good match
before confirming permanent full-time employment with a benefits package.Use these
procedures to hire both full-time and part-time employees. It appears lengthy and in the
beginning, it will be. However, once it's standardized, you'll ask yourself how you ever hired
capable employees in the past. The marvel will be the way your business runs as smooth as
a fine-tuned engine with the appropriate number of well-matched employees. Trends in
small business were discussed in the article, "The future of small business." What three
points discussed in the article will have the greatest affect on small business in the US
moving into the next five years as we work to pull out of the recession? Be sure to support
your response with additional research. 1 - THE FUTURE OF SMALL
BUSINESSAnonymous. Growth Strategies 1012 (Apr 2008): 1-2. Turn on hit highlighting for
speaking browsers Abstract (summary)TranslateAbstract Here's a summary of findings:
DEMOGRAPHIC TRENDS AND SMALL BUSINESS The Changing Face of Small Business
Entrepreneurs * Entrepreneurs will no longer come predominantly from the middle of the
age spectrum; people nearing retirement and their children just entering the job market
will become the most entrepreneurial generations ever. * Entrepreneurship will reflect an
upswing in the number of women. * Immigrant entrepreneurs will help drive a new wave of
globalization. On My Terms * Small businesses will use intelligent devices to gain customer
insight and improve delivery of goods and services. * Mobile devices will become central to
business management. * A new wave of analytical tools will increase small business
productivity and ease management burdens. Full TextTranslateFull text Tell me if this
sounds familiar:Small businesses are an important and growing driver of US economic
growth and dynamism. They employ over half of Americas private sector workers, produce
over half of America s non-farm private GDP, and create roughly 75% of new private sector
jobs . The next decade will see the growth of small business continue, and the social and
economic impacts of small business increase.It should sound familiar because it has been
true for at least a quarter century, and we have been writing about the phenomena over
that time. But it is still quite true: small businesses remain important and growing drivers of
the American economy, and will continue to be so into the future.The paragraph quoted
above is actually from the Intuit Future of Small Business Report, a research project
released last year in conjunction with the Institute for the Future. Here's a summary of
findings:DEMOGRAPHIC TRENDS AND SMALL BUSINESSThe Changing Face of Small
Business Entrepreneurs* Entrepreneurs will no longer come predominantly from the
middle of the age spectrum; people nearing retirement and their children just entering the
job market will become the most entrepreneurial generations ever.* Entrepreneurship will
reflect an upswing in the number of women.* Immigrant entrepreneurs will help drive a
new wave of globalization.The Rise of Personal Businesses* Contract workers and
accidental and social entrepreneurs will fuel a proliferation of personal businesses.The
Emergence of Entrepreneurial Education* Entrepreneurship will be a widely adopted
curriculum at educational, trade, and vocational institutions.TECHNOLOGY TRENDS AND
SMALL BUSINESSThe Connected World: Small Business Management On My Time. On My
Terms* Small businesses will use intelligent devices to gain customer insight and improve
delivery of goods and services.* Mobile devices will become central to business
management.* A new wave of analytical tools will increase small business productivity and
ease management burdens.Beyond Web 2.0: Technology Fuels Small Business Formation.
Operations, and Innovation* High-tech will no longer be a high hurdle as costs and
complexity fall.* Small business relationships will become increasingly virtual as online
social networks expand.* Virtual worlds will be widely adopted venues for reaching
customers and experimenting with new product ideas and business models.Small Business
Marketing: The Mindset Shifts from Push to Pull* A small business's online presence will be
the most important factor in customer acquisition.* Small businesses will increasingly
market themselves through the connected world of cars and cell phones.THE NEW
ARTISAN ECONOMYBarbell Economics: Brain Meets Brawn to Create Opportunities for
Small Business* Small businesses will be better positioned than large corporations to
provide customers with highly targeted, customized, and relevant products.* Outsourced
innovation from big businesses will increase opportunities for small business.Lightweight
Business Infrastructure: Barriers Down. Small Business Opportunities Up* Small businesses
will reclaim manufacturing, fueling small-scale and specialized production.* Plug-and-play
infrastructure will make small businesses more competitive and successful.* The shift to
variable cost structures for core business operations will reduce risk and increase
opportunities for small businesses.Borderless Business: Small Businesses Will Drive the
Next Wave of Globalization* Almost half of US small businesses will be involved in global
trade by 2018.* Social networks will fuel borderless commerce.* Globalization will increase
small business diversity and amplify economic value.For the complete report go to
http://www.intuit. com/futureofsmallbusiness
need help with 2 quick very basic and short few questions assignment for a philosophy class
– topics are logic/reasoning. 2 problem sets with questions and 2 modules for the set are
included as attach

need help with 2 quick very basic and short few questions assignment for a philosophy class
– topics are logic/reasoning. 2 problem sets with questions and 2 modules for the set are
included as attachment
need help with 20 questions on friday 4 31 at 11 am est there is a 4 hour deal line

Topics will include but not limited to ,Identifying the domain of a given functionSimplifying
algebraic expressions which involve factoring common factorspolynomial and rational
inequalitiesquotient for polynomial, rational, and square root functions.graph of a function
by shifting, reflecting, and/or stretching the known graph of a related function.6. Graphing a
piece-wise defined function.Expanding or condensing logarithmic expressionsSolving
exponential or logarithmic equations, especially base e. Checking for extraneous roots.Given
stated conditions, finding the constants in a general exponential function . This may involve
a word problem.Given the value of a trigonometric function, find the exact value of another
trigonometric function.A word problem involving solving a right triangle.Graphing a sine or
cosine function by finding the period, amplitude and shift. Graphing a tangent function by
finding the period and shift.Verify a trigonometric identity.Simplify a trigonometric
expression.Solve a trigonometric equation.Use the trigonometric addition formulas for sine
and cosine.Use the trigonometric double angle formulas for sine and cosine.Find the exact
value of an expression involving inverse trigonometric functions and trigonometric
functions.Use the Law of Sines and the Law of Cosines
need help with 25 introduction to statistics questions

18.2.7Identify the null and alternative hypotheses when given some claimabout a
population parameter.28.2.17Use P-values to state a final conclusion that addresses an
originalclaim.28.2.17Use critical values to state a final conclusion that addresses an
originalclaim.38.2.19Identify type I and type II errors that correspond to a given
claim.48.2.25Use sample data to conduct a formal hypothesis test of a claim abouta
population proportion.58.3.30Use sample data to conduct a formal hypothesis test of a
claim abouta population proportion.68.3.2Use sample data to conduct a formal hypothesis
test of a claim madeabout a population mean.78.3.9-TUse sample data to conduct a formal
hypothesis test of a claim madeabout a population mean.88.3.11Test claims about
population proportions.98.3.13-TTest claims about population proportions.108.3.17Test
claims about population proportions.118.3.23Test claims about population
proportions.128.4.25Test claims about population proportions.138.4.15-TTest claims about
population means with sigma unknown148.4.27-TTest claims about population means with
sigma unknown.158.45-TFind P-values using the Student t distributi
ELM-360 Need help with "Planning 5E Questioning Strategies" Assignment

This assignment states:- Using the '5E Lesson plan template" you wrote in Topic 3, the "5E
Questions Table" and Webb's DOK levels, draft two different questions for each of the 5Es
(total of 10 questions). Incorporate the following into your questions:- ensure each question
is aligned to the learning target of the lesson plan.- represent all four DOK levels in the table,
and at least half the questions need to be at a level 3 or 4.- questions should encourage
exploration, problem solving, and activating prior knowledge.Compose a 250-500 word
rationale of why the questions align with the "E" and meet the DOK levels for each
question.Submit the "5E Questions table" and the rationale as one submission.
need help with a 3 to 4 page paper

Assignment 2: Someone to Respect and AdmireThere are leaders in every field of study and
business around the world. Select a business leader you admire. Use your textbook, the
Argosy University online library resources, and the Internet to select a leader and then to
research the leader’s career.Write a paper on your selected leader. Include the following
in the paper:Give an overview of the organization and the leader.Explain how the person
demonstrates integrity or ethics, giving examples.Provide your own insight into the
organization or leader.What makes the person or organization stand out?If you were in that
person’s place or worked for the organization, would you make the same choices? Why or
why not?Write a three- to four-page paper in Word format. Apply APA standards for writing
style to your work. Also use APA to cite books, articles and websites used in your
research. Use the following file naming
convention:LastnameFirstInitial_M4_A2.doc.By Wednesday, August 5, 2015, deliver your
assignment to the M4: Assignment 2 Dropbox.Assignment 2 Grading CriteriaMaximum
PointsIdentify leader and leader’s role.4Summarize relevant and important information
about your selected leader and organization.20Explain how the leader demonstrates
integrity and ethics.20Explain personal perspective on the selected leader and
organization.20Support statements with reasons, examples, and research
information.20Wrote in a clear, concise, and organized manner; demonstrated ethical
scholarship in accurate representation and attribution of sources; displayed accurate
spelling, grammar, and punctuation.16Total:100
Need help with a 4 page paper APA format on Starting a Group.

Assignment 2: Starting a GroupGroup therapy represents a large portion of treatment

opportunities for clients battling substance use disorders. Groups are an important part of
treatment, allowing clients to feel as though they are not alone in facing a problem and that
other people have faced similar problems and overcome them successfully. This particular
assignment consists of two parts. For this assignment, assume that you have been working
as an individual counselor at a substance abuse treatment center for some time now. Your
supervisor has asked you to create a therapy group for a handful of the substance abuse
clients that you and the other counselors work with. In order to identify the appropriate
clients that can be placed in your group, your supervisor has asked you to prepare a report
outlining the important points of the group you are forming:Part IPrepare a 1–2-page
report detailing the following items in your group design:Goal(s) of groupGroup norms
(such as attendance requirements, privacy, confidentiality, relationships with group
members, etc.)Differences between therapy group and self-help groupsProcedure for
dealing with disruptive and/or resistant clientsForm(s) of power to be usedConsequences
for relapseProcedure for dealing with a member leaving the groupPart IIFor the next part of
this assignment, read this passage and address the questions that follow:As the group
leader, it is important to take time to look at some of the issues you may need to be aware of
in yourself throughout each of the four stages of group development. For example, the
second stage of group development includes an opportunity for clients to challenge or
critique you. The way you handle criticism is an issue you need to identify and be wary of
how you respond. Keeping this in mind, your supervisor has asked you to do the
following:Reflect on your potential issues for each of the four stages of group
development.Present at least two self-care strategies that you will be able to choose from in
order to address these issues as they arise in your career.Write a 3–4-page paper that
includes both parts of the assignment in Word format. Include a title page in APA format.
Use scholarly resources, including your textbook to support your ideas. Apply APA
standards to citation of sources. Use the following file naming convention:
LastnameFirstInitial_M2_A2.doc.Assignment 2 Grading CriteriaMaximum PointsDescribed
all of the required aspects of group design such as its goals, norms, differences,
etc.24Identified potential issues for each of the four stages of group development showing
understanding and analysis of the group dynamics as well as self-reflection.24Identified
appropriate self-care strategies to address potential issues that might arise.32Wrote in a
clear, concise, and organized manner; demonstrated ethical scholarship in accurate
representation and attribution of sources; displayed accurate spelling, grammar, and
punctuation.20Total:100
Need help with a 450 words final reflection

The reflection should be about 450 words. https://www.onetonline.org/link/details/11-

3121.00Kindly look through the link and find out my work values and interest. I also
attached the sample work and you could take that as reference. The first file is the
template.The second file is the sample and the last one is the reading material.
need help with a assignment 12

Research and develop a MS Word document of at least 2000 word that:1) Discusses the
Digital Divide in the in the U.S. and internationally.2) The paper must include the
background/history of the project. What are some of the causes of the divide? What efforts
are engaged to reduce the divide? What are things you can do personally?3) State whether
you believe that there is a “digital divide” and why.4) Write a one or two paragraph
conclusion stating what would you say to a decision maker to persuade them to support or
disregard the digital divide.APA format with references. Safe assign assignment.
need help with a case study 3 pages single spaced

I need help with a case study. All the instructions are attached below. Please do not use any
outside source other thn the articles and readings attached below.Stihl is a manufacturer of
chain saws and other similar power tools. It has been shunning big retail chains like Home
Depot and selling primarily through small retail shops. It has been doing well. Recently,
however, the growth and popularity of online market platforms such as the Amazon
Marketplace – where manufacturers can sell directly to consumers if they choose – has
created both opportunities and threats to manufacturers such as Stihl. Suppose that you
were a strategic consultant and Stihl hired you to evaluate whether it is worthwhile for Stihl
to use the Amazon Marketplace to sell its power tools. Your analysis and answers will be
considered by Stihl’s CEO as he develops company’s strategic planning for the next
five years. Based on information in the provided documents, please answer the following
three questions. What are pros and cons of Stihl using the Amazon Marketplace to sell its
tools? Based on your analysis, what would be your recommendation to Stihl on whether to
use the Amazon Marketplace? 3. Might any changes in situation – such as increasing
competition, change in product quality, or change in its customer base – lead you to reverse
your recommendation or call for a different approach? Enclosed are five documents.
Rothermeal, F. T. (2019). Business Strategy: Innovation, Entreneurship, and Platforms.
Strategic Management, 4th Edition. Dubuque, Iowa, McGraw-Hill Education 249-253. Stock,
K. (2014). Stihl Chain Saws Thrive Outside the Big Box. Bloomberg. Marketplace-Pulse
(2019). Marketplaces Year in Review 2018, Marketplace Pulse. Danziger, P. N. (2018).
Thinking of Selling on Amazon Marketplace? Here Are the Pros and Cons. Forbes. Greene, J.
(2019). Amazon Tests Pop-up Feature Touting Its Lower-Priced Products. Wall Street
Journal. The paper should thoroughly address each component above, be professionally
written and formatted, and be no more than three single-spaced pages. You instructor will
give you additional details on the submitting the assignment on Canvas.
Need help with a case study in business management. Current Performance: Pr

Need help with a case study in business management.

Current Performance: Provide an overview of the firm’s current and recent performance in
its competitive markets. This includes a general analysis of the company’s financial
performance and competitive position.
Mission and Objectives: Describe the firm’s mission and major objectives and analyze their
appropriateness and fit with the firm’s strategy.
Corporate Governance: Analyze the composition, strategic orientation, and direction of the
firm’s Board of Directors and analyze the composition, strategic orientation, and direction
of the firm’s top management team.
Need Help with a College Algebra Paper and Spreadsheet

Part 1: You will write a 1250 – 1500 word narrative describing the trip. This is a report,
written in GCU style. You will need a minimum of three scholarly resources (see the
resource list below for ideas) and needs to address the following areas: areas listed in
Mission Trip attachmentPart 2: A financial plan for your trip, which you will include in the
provided Excel spreadsheet. Your financial plan needs to include the following information:
Also listed on the mission trip attachment
need help with a discussion question 7

In section 2.1 you read about how we can model certain situations using linear equations. In
particular, example 8 shows how you can create an equation to predict sales of a
companyPick a company whose sales you want to model and predict. Look up their sales
information and pick 2 years of data. Using that information, create a linear equation that
can be used to predict the sales of the company. Once you have your equation, predict the
sales 2 years from now.Make sure you include in your post the links where you found the
relevant information. Clearly show your work. This includes naming the company, sharing
the ordered pairs, defining variables, finding the slope, determining the equation, and then
using that equation to predict.When replying to your classmates, consider the company that
they chose. How does the growth (or shrink) of the company compare with the company
you chose? Do you think that the equation will be accurate 5 years from now? Why or why
not?
need help with a flyer

CH 5 Early Childhood: Body and Mind Handout Assignment Due Tuesday

by 10pm Points 15 Submitting a file upload File Types pdf, jpeg, jpg, ai, and
psd Available Nov 9 at 1pm – Nov 15 at 10pm MAKE SURE TO MANAGE YOUR TIME
– THIS ASSIGNMENT MAY TAKE MORE TIME THAN USUAL.
need help with a history paper

Don't use plagiarized sources. Get Your Custom Assignment on need help with a
history paper Just from $13/Page
Order Essay I need help with an
apa format paper must have an abstract, reference page and a 4 page body. Work will be ran
under the plagiarism checker. I already have a topic in mine and a list of references however
you can use more if need.
need help with a marketing plan

I would like help with my marketing plan and making it look nice (I’m not very good with
powerpoint). I am attaching what I have done so far and the papers that I have written on
the topic so far.. It needs to be develped to include the below requirement I need a
powerpoint presentation and an outline for a presentation. Here’s the requirement from the
professor:A well written marketing plan upon which an organization can execute is the
concluding project for this course. Your marketing plan will be based on a real life, publicly
traded company. You will take on the role of CHIEF MARKETING OFFICER for this company.
In your new “job” you will conduct a SWOT analysis based on public information, develop a
list of ORIGINAL marketing recommendations, and selecting one recommendation, write an
implementation plan, including follow up metrics. You may consider a marketing plan on
any of the following topicsIntroduction of a new productIntroduction of a new
serviceExpanding an existing product to an entirely new buyer segmentExpanding an
existing product to an entirely new geographic marketThis is NOT a research paper that
documents the current marketing activities of your target firm.The assignment is to be
completed in POWERPOINT, as most organizations today use this format for marketing plan
communication with management. A template and rubric have been attached as a
resource.The presentation should include4 content slides (without cover page or ending
page). Slides must include at least 3 of the following: graphs, tables, photos, video, and
text.Company Summary and SWOTMarket Strategy RecommendationOne detailed element
of the marketing plan (e.g., if a new market segment – which one and why, how does
research support it? If a new product or service – discuss one of the 4 P’s… My new market
segment is organic foods (healthier choices)Financial projection
Need help with a discussion: My career is human resources. Do you have a field or career
you are interested in pursuing? Look for job roles or descriptions in that field and consider
how managerial ac

Need help with a discussion: My career is human resources.

Don't use plagiarized sources. Get Your Custom Assignment on Need help with a
discussion: My career is human resources. Do you have a field or career you are interested
in pursuing? Look for job roles or descriptions in that field and consider how managerial ac
Just from $13/Page
Order Essay Do you have a field or career you are interested in
pursuing? Look for job roles or descriptions in that field and consider how managerial
accounting principles and skills can be applied to them. In your initial post address the
following: Describe at least two potential positions related to managerial accounting that
you personally found to be interesting and explain why they were noteworthy to you.
Include a link to the job posting or job description. Compare these positions and job
descriptions to those that require a background in financial accounting. Are they similar or
different?
need help with a paper 5

For the next newsletter, you have been asked to write a 700- to 1,050-word article about
the spectrum of health care facilities. In your article:Analyze the spectrum of health care
facilities that exist in the U.S.Analyze the purpose and goals of each of the different types of
health care facilities in the U.S.Analyze how the different types of facilities work
together.Analyze who is responsible for the oversight of the facilities.Analyze the
similarities and differences of the health care facilities.Cite 3 peer-reviewed, scholarly, or
similar references to support your paper.Format your paper according to APA guidelines.
Need help with a Paper (1,000-1,250 word)

You are an intelligence analyst for the Department of Homeland Security assigned to the
Office of Intelligence and Analysis (DHS-OIA). You are currently working in the Special
Events Unit, and you are responsible for producing an intelligence assessment outlining
potential threats to the upcoming United Nations General Assembly (UNGA) meeting that is
to take place in New York City later this year. To successfully complete this assessment, you
must work closely with your federal partners in the U.S. intelligence community (horizontal
integration) as well as your partners within the state, local, and international communities
(vertical integration).Your supervisor has given you a list of intelligence requirements
pertaining to the upcoming event and has asked you to draft an intelligence collection plan
based on those requirements. The intelligence requirements are as follows:What
individuals or groups are planning terrorist acts directed at the UNGA meeting in New
York?What individuals, groups, or delegations attending the UNGA meeting in New York are
being targeted by domestic or international terrorists?What groups or individuals
associated with criminal or terrorist activities are active in the New York area of
operations?Which foreign intelligence service will attempt to use the UNGA meeting in New
York as an intelligence collection opportunity?Which delegations attending the UNGA
meeting in New York are being targeted by foreign intelligence services?For this
assignment, you must write an intelligence collection plan of 1,000–1,250 words detailing
how DHS-OIA will use horizontal and vertical integration to successfully address these
requirements and identify any potential intelligence gaps. In addition, you must discuss
each requirement individually and outline which sources and methods will be used against
that particular requirement and how you plan to address gaps if necessary. This assignment
will require additional outside research, and you should document your research
accordingly.Assignment GuidelinesAddress the following in an intelligence collection plan
of 1,000–1,250 words:How will the DHS-OIA use horizontal and vertical integration to
successfully address the above requirements? Identify any potential intelligence gaps.What
are 5 agencies involved in horizontal integration? Describe and summarize them.What roles
does each agency play throughout the overall intelligence cycle? Explain.How will the
agencies be used to address the above requirements? Explain.What types of local and state
agencies are involved in vertical integration? Describe and summarize them.What role does
each type of agency play throughout the overall intelligence cycle? Explain.How will the
agencies be used to address the above requirements? Explain.How can cooperation with
international agencies facilitate the processes of the Requirements phase? Explain.For each
of the 5 requirements listed in the assignment description, address the following:Which
sources and methods will be used against the particular requirement? Explain.If necessary,
how would you plan to address intelligence gaps? Explain.
Need help with a Project (Part 1)

I’m including the assignment instructions for Part 1 that Ineed for tomorrow 9/25/14 and
part 2 that i needed for the final project due in a week and half 10/4/14. Also I’m including
a Sample APA paper, RED information and Amenah’s Story Sample Outline. Also I’m
including Amenah’s Story. I’m including part 2 so you can have an idea of what is needed.
Very important you will need to be proficient in APA actual formatting and familiar with
RED.Read the instructions and let me know.
Need help with a Religion essay

MLA format1200 word minimumno plagerismminimum of four citations print or

electronic book electronic peer-reviewed journal article website with a .edu
address chose only one 1. How is a sacrament both a sign and a symbol? Use one
sacrament to illustrate. 2. How does Catholic theology understand the sacraments as
“means of grace―? 3. What is the conscience? How does “natural law― work
to inform our conscience?
need help with a report due date 1 30 20

Must show that you understand the issues presented at the beginning of each chapter. “I”
should be able to read your report and understand what issues Kimball’s is facing. This will
include You are not to copy and paste from the book. You can summarize the
information.Must address the questions in the “Kimball’s Revisited” and “New Perspectives”
section that are located at the end of each chapter. I do not want to hunt for your
recommendations or answers to questions. They should be well organized and clearly
marked with section headings.I want charts and/or visuals when appropriate.
Examples:There should be an organizational chart for chapter 1. I will want to see who the
people are in the organization and what role they play. (You will most likely have multiple
organizational charts as things change in the company).A table or embedded excel
worksheetA picture or specs of hardware, software (you can definitely copy and paste those
types of items from Internet)Links to additional information.Formatting should be uniform
throughout the document.It MUST look professional. Something that you would show your
employer or client.Chapter 2: Paragraph 6 & Paragraph 8. 2 paragraphs at leasts 250
wordsKimball’s Restaurant: Using Information Strategically – pg. 35-36Kimball’s Advice –
pg. 60Chapter 3: Paragraph 11 just one paragraph here.Kimball’s Restaurant: The New
Location – pg. 67Kimball’s Advice – pg. 100Summarize itTitle of the paragraphs How it
should be listed.Ch.2Paragraph 6Paragraph 8Ch.3Paragraph 11DUE DATE: 1/30/20 Also
the attachments will be posted after bid.
need help with a short report 3-5 pages long regarding Chemical Engineering topic

We can learn a lot by examining what went wrong in chemical/industrial accidents. The
assignment is to research your assigned accident from the list below and to prepare a three-
five page report (1.5 line space, 12 point font, Times New Roman, 1 inch margins). Your
report should provide the following information: a bit of background information on the
company involvedthe location of the accidentthe facts surrounding the accident (who, what,
where, when, why and how), Be very specific on the probable cause of the accident and
reasons for number of injuries/fatalities, ie. Reactions involved? Safety system failure?
Operator error? Engineering design flaws? Corrosion of materials?the effects of the accident
(human and financial)some pictures if you can find themfindings of whatever investigative
bodies reviewed the accidentwhat was learned from the accident (how can an event such as
this be prevented in the future?)What specific changes in design, control, operation, training
and/or regulation do you recommend based on your findings?
need help with a sociology paper and quick turnaround

Watch the video titled, “From school yard bullying to genocide: Barbara Coloroso at
TEDxCalgary― (19 min 5 s) located below. You may also view the video
at https://www.youtube.com/watch?v=zkG0nssouFg.Write a one to two (1-2) page essay in
which you:Identify the most important step in the student’s guide to research that you
would need in order to analyze bullying.Define the identified critical step of research in
your words.Explain how bullying relates to one (1) of the following topics:the agents of
socialization (i.e., family, teachers and school, peers),formal organizations (i.e., conformity
to groups),different types of deviance (i.e., everyday deviance, sexual deviance, or criminal
deviance).Provide a rationale for your response.Your assignment must follow these
formatting requirements:Be typed, double spaced, using Times New Roman font (size 12),
with one-inch margins on all sides. Check with your professor for any additional
instructions.To keep this essay short and manageable, your only sources for the essay
should be the TED video and the sections noted in your text. For this reason, APA citations
or references are not required for this assignment.Include a cover page containing the title
of the assignment, the student’s name, the professor’s name, the course title, and the
date. The cover page is not included in the required assignment page length.
need help with a two page paper titled team work

Cultural differences and personality differences can impact cooperation. Team building is
an important aspect of communication. Consider some aspects of culture and personality
that may impact how people work together.Research the importance of teamwork and the
impact of personal and cultural differences on team building using your textbook, the
Argosy University online library resources, and the Internet.Situation:After you helped your
company, Labolg, prepare for expansion into other countries, the chief operating officer
(COO) approaches you and tells you that she feels the differences among team members is
negatively affecting production. She asks if you have any ideas for productive ways to work
with the differences in their organization.Analyze the situation and prepare a
recommendation for the COO. State any assumptions you make about the nature of
differences in the team.Write a two- to three-page paper in Word format. Apply APA
standards for writing
need help with a weekly case study no plagarism

This assignment asks you to once more address your fantasy organization. Submissions
should be in APA format, with 12 point Times New Roman Font, 1― margins all around.
Avoid passive voice, avoid first person, and check both grammar and spelling prior to
submission. Students should include both a title page and a reference page in their
submission, and should use at least 3 academically credible sources. Submissions should be
double spaced and at least 2 ½ pages, not including title page, reference page, and
appendices. Wikipedia is not a credible reference; do not use it. Neither your textbook nor
Gardiner (1925) are included in the required 3 sources. Here’s what you should
do:Explain how communication occurs in your organization. (My organization is World
Wide Travels. Please see attachment for particulars for my country).This should include
upward, downward, and lateral communications. What is your organization’s official
policy on communication? What really occurs? How does the leadership at the top see the
importance of organizational communication, and why? What are the organizational
leader’s thoughts on inclusion of employees in decision making? Explain the leadership
philosophy of the organizational leader, and from where this philosophy developed. As an
appendix, include the following:an example of a downward communication explaining the
institution of merit-based pay for employees. an example of a downward communication
explaining the need for an immediate reduction in force. These should be professional
business memoranda, and should include your organization’s logo. Grammar, spelling,
and overall professionalism will be important, as your leader’s cognitive ability may be
inferred from the quality of the communication.
Need help with a paper.

Imagine that you have been recently promoted to serve as Chief Information Security
Officer (CISO) for a Fortune 500 organization. This organization has known brand products
across the world and expects top-secret methods for safeguarding proprietary information
on its recipes and product lines. The Board of Directors request that their information
security strategy be upgraded to allow greater opportunities of secure cloud collaboration
between suppliers and resellers of their products. Another concern they have is the recent
number of hacktivist attacks that have caused the network to fail across the enterprise.
Their concern extends to making sure that they have controlled methods for accessing
secured physical areas within their various regional facilities. For your new position, you
will be responsible for developing standards, methods, roles, and recommendations that
will set the new IT security path for the organization. The existing organization has limited
experience in supporting an enhanced level of IT security; therefore, you may need to
outsource certain security services. Additionally, you may create and / or assume all
necessary assumptions needed for the completion of this assignment. Write an eight to
twelve (8-12) page paper in which you provide the following deliverables:
Need help with Accounting

The revenue recognition principle and the matching principle are the basis of recording net
income under accrual basis accounting in contrast to cash basis accounting. Case IIPeterson
Law asks Executive Lawn to provide $100 of landscape maintenance. Executive Lawn
provides the service on April 10.Peterson pays for the lawn service the following month on
May 2.If Peterson Law uses accrual-basis accounting, for the scenario you select, on which
date would Peterson Law record the $100 expense ? Explain the reason for your answer.If
Peterson Law uses cash-basis accounting, for the scenario you select, on which date would
Peterson Law record the $100 expense? Explain the reason for your answer
need help with adding some paragraphs in a research paper which is already done this
assignment is a

The case study paper, approximately 3 to 5 pages in length (single-spaced). The paper must
discuss a case that is relevant to our study of computer ethics. Case topics can be chosen
from a list provided by the instructor, or suggested by the student and approved by the
instructor. You will describe the case in your own words and identify key ethical issues
raised by the case. Using a relevant professional code of ethics, you will explain what, if
anything, failed to conform to the Code. The goals of the paper are to summarize the case,
analyze it, and discuss your reaction to it including how similar problems may be prevented
in the future. This paper will be due at midnight on the last day of class.Further
Guidelines:12pt font, Times New Romans. Word Document(.doc) ONLY.1inch margins all
around for all pages.Make sure to use IEEE formatting if you are not familiar then you can
use another type of formatting but you have to let me know in advance which you are using.
Make sure to have at least 5 different references.You should have a SEPARATE Title PAGE
and REFERENCE PAGE( not included in the 3-5pages of actual content for your
paper).Example if you do max of 5 pages you should have a total of at least
7pages(depending on how many references you have and if it takes up more than 1 page
and the title page).You should have already picked your topics. If you do not remember if
you go the assignment for the case study paper you should see a list of the different topics. I
also made an announcement listing them a month or so ago.If any questions please let me
know. Please check the assignment section for due date of paper.
need help with algebra is someone available asap thanks

Must show all work.1. Jake and his father are building a rectangular tree house that is 5ft
tall, 4 ft wide and 4 ft. long. If the wood costs $2.50 per square foot, what is th least amount
Jake and his father can spent on the wood for the tree house?2. An above-ground circular
swiming pool has a radius of 15 feet and a height of 6 feet. What is the surface area of the
material that was used to construct the pool?3. The Lucky Stars Cereal Co. sells a box of
cereal that is 8 inches wide, 11 inches high and 3 inches deep. How many square inches of
cardboard are needed to make the box of cereal?4. The paper cone used to hold a sample of
ice cream at a local ice cream shop is 3 inches in diameter and 2 inches tall with a slant
height of 2.5 inches. How much paper is needed to create 100 sample cones?5. Toblerone
chocolate is packaged in a triangular prism as shown below. If there is no overlap, how
much stock card is used to make the packaging?
need help with an assignment 11

Read the following scenario:Data has been collected to identify specific cases of people who
are infected with a dangerous virus. Your organization has an interest in knowing where the
population is most affected in an effort to move resources to areas that need them.Create a
bar chart using Microsoft Excel® and the data provided in the Cases by City document to
identify the cities with the highest counts of cases.Note: This information will be used for
further analysis in future assignments.Write a 350- to 525-word report of your analysis of
the data. Include an answer to the following questions:What are the top five cities for
infected cases?How many infected cases does each of those cities have?What is the
prevalence rate per 100,000 people?What else can be deduced after evaluating the
chart?Include your bar chart in the report.Format your citations according to APA
guidelines.
need help with an assignment 12

– Why would we want to test & evaluate early on in the acquisition process?– What is the
primary purpose of T&E in an acquisition program?– What role does the Office of the
Secretary of Defense (OSD) fill in T&E?– What is the Program Manager (PM) role regarding
acquisition T&E? Additionally, what are some PM responsibilities?– Why is it so important
to have an Acquisition Program Baseline (APB) and baseline documentation?– What is the
primary difference between DT&E and OT&E?The paper must be in APA format and must
include any references that you use to develop your findings.Submission
Instructions:•Written communication: Written communication is free of errors that
detract from the overall message.•APA formatting: Resources and citations are formatted
according to APA (6th edition) style and formatting.•Length of paper: typed, double-
spaced pages with no less than 800 words.•Font and font size: Times New Roman, 12
point.
need help with an assignment 14

Select a company and learn about the company’s labor rate. Discuss labor rate(s) and how
that relates to the company you researched total company overhead. Keep in mind the
industry and how important is the labor workforce is to the organization. You can use the
course resources and the library to assist with writing the paper. Instructions:•Written
communication: Written communication is free of errors that detract from the overall
message.•APA formatting: Resources and citations are formatted according to APA (6th
edition) style and formatting.•Length of paper: typed, double-spaced pages with no less
than a three-page paper.•Font and font size: Times New Roman, 12 point.
need help with an assignment for system analysis

Future State Vision Use CaseUsing what you have learned from this week’s lecture, as well
as the lectures, materials, and activities in Weeks 1 and 2, develop a diagram that depicts
your vision of CWI’s enhanced use case to their business problem. You may use the same
modeling tool(s) as in last week’s business problem assignment, or you may use another
tool. Be aware that your use case may have more than a single branch. Then, write a three-
to four-page paper narrative that explains the strategy of the improvements and proposed
changes. Explain the future goals of your solution, and include discussion that describes
your future state diagram. Incorporate what you have learned about elicitation from your
group assignments as well as from your own assignments, and include at least two
references each from the text and the BABOK® guide located in your online classroom.
Include your diagram as an Appendix to your paper, and submit the paper to Waypoint for
grading.In your paper,Explain the strategy of the improvements and proposed
changes.Describe the processes depicted in your future state use case diagram.Explain the
future goals of your use case solution.Apply what you learned about elicitation to your
requirements gathering process.Attach your future state use case diagram as an Appendix
to your paper.The Future State Vision paperMust be three to four double-spaced pages in
length (not including title page, references page, or Appendix) and formatted according to
APA style as outlined in the Ashford Writing Center (Links to an external site.)Links to an
external site..Must include a separate title page with the following:Title of paperStudent’s
nameCourse name and numberInstructor’s nameDate submittedIn addition to two
additional scholarly or credible resources, use at least two citations each from the text and
the BABOK® guide located in your online classroom.The Scholarly, Peer Reviewed, and
Other Credible Sources (Links to an external site.)Links to an external site. table offers
additional guidance on appropriate source types. If you have questions about whether a
specific source is appropriate for this assignment, please contact your instructor. Your
instructor has the final say about the appropriateness of a specific source for a particular
assignment.Must document all sources in APA style as outlined in the Ashford Writing
Center.Must include a separate references page that is formatted according to APA style as
outlined in the Ashford Writing Center.
need help with an english assignment correct punctuation 4

They first met on July seventh, 1940. a. written correctly b. contains error in the use of
apostrophes, hyphens, abbreviations, numbers, or numerals My grandparents have been
married for fifty-one years. a. written correctly b. contains error in the use of
apostrophes, hyphens, abbreviations, numbers, or numerals These shoes must be
somebody elses. a. written correctly b. contains error in the use of apostrophes, hyphens,
abbreviations, numbers, or numeralsIn 1896 Fannie Farmer’s first cookbook, “Boston
Cooking-School Cook Book,” was published. a. sentence is written correctly b. contains
error in the use of dashes, parentheses, quotation marks, or italics
need help with an essay 7

I will be attaching any files that will be of assistance for this paper.One thing to note is that I
will be attaching 1 file where I started the introduction part of the paper, and would like for
you to add on to that and not change that beginning part.Here are the basic requirements:1)
Answer ALL questions on the Paper Grading Rubric (using the theory of justice and article
that you selected when you wrote your introduction)2) 4 – 5 pages3) 1 inch marginsThere
is an excel file attached that has the requirements, I went with deontology as the theory I
wanted to speak about. The PDF file attached has the article I used, and the paper I wrote
followed that. I need it to total up to 5 pages. If you have any other questions please
message me as soon as you can.Thank you in advance.
need help with an essay apa format

Research global climate change, global warming, and the Kyoto Protocol.Write a 700- to
1,050-word evaluation of international efforts to combat global climate change. Include the
following information in your evaluation:Introduce the concept of global climate
change.Contrast the costs and benefits of combating global climate change in the developing
world with the costs and benefits in the industrialized countries.Explain the economic
benefits of the Kyoto Protocol.Explain the economic costs of the Kyoto Protocol.Recommend
a policy to address global climate change.Defend your policy recommendation based on
economic projections and principles.Cite at least four references.Format your evaluation
consistent with APA guidelines.Submit your assignment.
Need help with an excel spreadsheet – Due TODAY

Please do not respond if you cannot complete today: I need help creating an excel spread
sheet, I am not sure where to start on this one. Thank youPLEASE NOTE – ALL RELEVANT
information is attached. I mainly need the help with the spreadsheet. Using the information
calculated in previous weeks’ activities (NOI, debt service, interest, depreciation, and taxes
(using an assumed 28% tax bracket) and ATCF) compute the before- tax IRR and NPV as
well as the after-tax IRR and NPV. Briefly discuss the impact of the following:1) A lower
interest rate on the loan2) A higher depreciation deduction3) A lower NOI (aka
higher expenses)4) A lower tax rateYou must submit an EXCEL spreadsheet to validate
your analysis. Show the different scenarios in different tabs of the spreadsheet. Ideally you
will create a “master” table with all of your variables and reference each of the variables in
your formulas. Property I am
using:http://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=6&ved=0CFsQ
FjAF&url=http%3A%2F%2Fcp.capitalpacific.com%2FProperties%2FBalentine-Plaza–
NewarkCA.pdf&ei=Qwb0UabMD6vriQLz8oHoCA&usg=AFQjCNEp_-
SB0ISu74lMOrJQaTEpcNuHYg&sig2=XrDBUjj7osxxn4rxqlzv4A&bvm=bv.49784469,d.cGE
Need help with analysis of a psychology research paper. Answer Questions 1-6 Name the
independent a

Need help with analysis of a psychology research paper. Answer Questions 1-6 Name the
independent and dependent variables used in the first experiment include all the levels of
each variable. (maximum 2 sentences 1 point) Are there any methodological f. Need help
with analysis of a psychology research paper. Answer Questions 1-6: Name the independent
and dependent variables used in the first experiment; include all the levels of each variable.
(maximum 2 sentences, 1 point) Are there any methodological flaws or limitations in the
experimental design? Explain. (Note that small sample size and lack of diversity of the
subjects are not sufficient limitations for this question, as how visual perception works is
not expected to vary significantly between individuals, and sample sizes of 3+ subjects are
common in psychophysical experiments). (maximum 3 sentences; 2 points) How did the
experimenters control for possible confounding variables? Explain. (maximum 3 sentences,
2 points) Explain the preconstancy and postconstancy views of perceptual grouping. How
are these two views related to whether perceptual grouping operates early or late in visual
processing? (maximum 5 sentences, 4 points) What did the authors find, and what are the
implications of those findings? Relate your answer to a sensation or perception topic that
you have learned about in this class. (maximum 5 sentences, 3 points) Design an
experiment that will look at perceptual grouping using another Gestalt principle of grouping
(e.g., proximity) or another type of constancy (e.g., size, shape) (maximum 1 page, 7 points
as detailed below) 1) What methods would you use? (e.g., describe your stimuli, your task,
etc.) Be clear and detailed in your description. (3 points) 2) What do you expect to find? (2
points) 3) What would be the implications of your findings? (try to talk about this with
regard to the article and sensation/perception in general) (2 points)
Don't use plagiarized sources. Get Your Custom Assignment on Need help with
analysis of a psychology research paper. Answer Questions 1-6 Name the independent a
Just from $13/Page
Order Essay Place this order or similar order and get an
amazing discount. USE Discount code “GET20” for 20% discount
Need help with analysis week LDR 531 management homework help

InstructionsAssignment FilesGradingPurpose of AssignmentThe purpose of this assignment

is to provide students with an opportunity to apply communications theories, research, and
conversation with class colleagues to actual business situations, through the development
of applicable strategies. Assignment Steps Read Case 2: Global Shared Services, McDonald’s
Corporation located in Mastering Leadership.Analyze in 1,050 to 1,225 words the
communications and group behavioral issues that might arise in an organization hiring
employees for their first job based on the discussion from your learning team. Include a
strategy to address these challenges.Format your assignment consistent with APA
guidelines.Click the Assignment Files tab to submit your
assignment.MaterialsCommunications Challenges and Strategies Grading GuideMastering
Leadership ch.7
– need help with this, as soon as possible. Thank youDescriptionSolution downloadThe
Questionneed.

– need help with this, as soon as possible. Thank youDescriptionSolution downloadThe

Questionneed help with this, as soon as possible. Thank youBUS070: Introduction to
Marketing II | AssignmentAssignment 2RInstructionsSave the file in your course folder, and
name it with Assignment, the assignment letter, the section number, andyour first initial
and last name. For example, Jessie Robinson’s assignment 1R for Section 1 would be
namedAssignment1RJRobinson.Type the answers to the assignment’s questions. Use
complete sentences unless the question says otherwise.You will have more than one day to
complete an assignment. At the end of each day, be sure to save yourprogress.Review
Lesson 4 of the Course Overview for instructions about turning in your
assignments.Assignment 2R: Customers, Inventory, and Safety(20 points)In Section 2, you
learned about customers, inventory, and safety. Now, you’ll apply what you learned.1.
Choose a well known company, and describe its brand promise. Describe at least three ways
that the companyuses to create that brand promise. (1-5 sentences. 3.0 points)2. Choose a
type of company you would like to work for or start up yourself, and then answer the
questions below.a. Describe the type of company and the product it would sell. TIP: This can
be the same or different fromthe company you described in Assignment 1R. (1-3 sentences.
1.0 points)b. Describe at least two categories you could group the company’s target
customers into, if the companywere using channel management. (1-2 sentences. 1.0
points)c.Describe at least two ways that the company might decide to treat those two
categories of customersdifferently, and explain why it might do that. (1-5 sentences. 4.0
points)d. Would the type of channel management described in questions 2b and 2c above be
likely to lead to unfairtreatment of some groups? Why or why not? How could you make
sure that didn’t happen? (1-5sentences. 4.0 points)3. Imagine that you are working at a
clothing or grocery store, and answer the questions below about inventoryand
merchandising for the store.? 2014 K12 Inc. All rights reserved.Copying or distributing
without K12?s written consent is prohibited.Page 1 of 2BUS070: Introduction to Marketing
II | Assignmenta. Describe at least two factors you could consider to help decide how much
inventory to keep in stock of aparticular item at the store. (1-4 sentences. 1.0 points)b. If
you were running the clothing or grocery store, which buying method would you prefer to
use? Why? (14 sentences. 1.0 points)c.If you were running the clothing or grocery store,
which inventory control method would you prefer to use?Describe at least one, and explain
why you would use it. (1-2 sentences. 1.0 points)d. Describe an example of two products
you could combine in a display in the store to show how they couldwork together. (1-2
sentences. 1.0 points)4. List at least six things you would check for if you were asked to
evaluate the workspace of an employee forergonomics. (1-6 sentences. 3.0 points)? 2014
K12 Inc. All rights reserved.Copying or distributing without K12?s written consent is
prohibited.Page 2 of 2
need help with assignment 133

You are a Human Resources (HR) program of one. Based on information learned in this
course, create a Human Resources plan of the steps needed to create a one-person HR
department. The design of the HR department must correspond to the various dimensions
of the organization. For example, if there are multiple customers, products, or locations,
then HR needs to support them all. In your paper:Provide a clear and concise summary of
the business (name, industry, number of people, etc.).Create a detailed plan by completing
the following:Develop a recruitment and selection plan.Design a training and development
plan.Design a compensation package for the people hired.Discuss legal issues the company
should consider (e.g., the U.S. Equal Employment Opportunity Commission).Develop a
performance appraisal system.Provide support from scholarly sources in regards to the
decisions made in the creation of the HR department.Writing the HR PlanThe HR PlanMust
be eight to ten pages in length (not including the title and reference pages) and must be
formatted according to APA style as outlined in the Ashford Writing Center. Any exhibits or
appendices are also not included in the paper length.Must include a title page with the
following:Title of paperStudent’s nameCourse name and numberInstructor’s
nameDate submittedMust begin with an introductory paragraph that has a succinct thesis
statement.Must address the topic of the paper with critical thought.Must end with a
conclusion that reaffirms your thesis.Must use at least five scholarly sources, three of which
must be from the Ashford University Library, in addition to the text.The Scholarly, Peer
Reviewed, and Other Credible Sources (Links to an external site.) table offers additional
guidance on appropriate source types. If you have questions about whether a specific
source is appropriate for this assignment, please contact your instructor. Your instructor
has the final say about the appropriateness of a specific source for a particular
assignment.Must document all sources in APA style as outlined in the Ashford Writing
Center.Must include a separate references page that is formatted according to APA style as
outlined in the Ashford Writing Center.
need help with assignment 142

For this assignment, you will take on the role of a mid-level organizational manager. In your
current job role, you have noticed that the organizational culture is contributing to some
unethical decision making by subordinates and peers. You feel strongly that leadership
must be not only made aware of the situation but also given appropriate solutions. To
communicate with the CEO and shareholders, you must create a memo. In the memo, you
will explain the issues, as well as offer appropriate solutions. For help in the format and
writing style of a memo use Good example of a persuasive memo. In your memo include:
Header: with To, From, Date, and Subject Introductory paragraph One to two paragraphs
outlining the issues. Three to six paragraphs describing solutions A closing paragraph that
summarizes the information.In the memo: Describe the issues of the current ethical culture
Describe which stakeholders are affected by the issues, such as employees, shareholders,
local community, society, etc. Formulate a plan to change the ethical culture Convince the
CEO and shareholders of the importance of the changesMemos are a business style of
writing rather than academic. You do not need to use in-text citations in the memo.
However, your work should be paraphrased rather than quoted. You must include a
reference page to demonstrate the use of any resources.
need help with assignment 50

Stock Valuation and Analysis Purpose of AssignmentThe purpose of this assignment is to

allow students the opportunity to research a Fortune 500 company stock using the popular
online research tool Yahoo Finance. The tool allows the student to review analyst reports
and other key financial information necessary to evaluate the stock value and make an
educated decision on whether to invest. Assignment Steps Resources: Yahoo Finance Select
a Fortune 500 Company from one of the following
industries:PharmaceuticalEnergyRetailAutomotiveComputer
HardwareManufacturingMiningAccess Yahoo Finance and enter the company name. Review
the financial information and statistics provided for the stock you selected and answer the
following:What is the ticker symbol of the company you chose?What is the Current Stock
Price?What is the Market Cap for the stock you chose?What is the Price to Earnings
Ratio?What is the Dividend and Yield?What is the Enterprise Value?What is the Beta?Was
there a Stock Split, and if so, when?What was the closing stock price for the last 5
days?What was the 52 Week High for this stock?What is the Book Value per Share?What
type of rating are analysts recommending (i.e. buy, hold, etc.)?What is the target price
analysts are predicting for this stock?What is the analyst’s average revenue estimate for
next year?What are some of the significant news items and press releases made by the
company over the last year? Explain in 700 words why you would or would not recommend
investing in this stock.Describe the relationship between the value of the stock and the price
to earnings ratio. What information does the Market Capitalization (Market Cap) and Beta
provide to the investor?
need help with assignment 99

PayrollA local small business has hired you to write a payroll calculation program. The
program only needs to calculate gross pay for an employee and display the results. Your
program will accept the employee’s name, hours worked, and the employee’s pay rate. The
program will need to calculate overtime as well. Overtime is defined as anything over 40
hours is paid at 1.5 times the regular pay. The program should print the employee’s name,
the gross pay amount, and only if there was overtime, print the overtime pay amount as
well. Finally, the program should repeat as necessary until the user enters a sentinel
value.For this project:You will submit your python code in either the original .py file, or
copied into a .txt file.A screenshot of your code having been executed (run). How to Take a
ScreenshotTips: Remember to keep track of input data types when comparing values.
input() formats the user’s data as a string, so comparing string data to a number without
quotes would produce an error.Do not worry about security, it is irrelevant here. Just focus
on the functionality discussed above.Remember to follow the guidelines of good program
design. Make sure to use meaningful variable names, include comments as needed, and
provide thoughtful output.Example output:C:\>python week2.pyABC Inc., Gross Pay
Calculator!Enter employee’s name or 0 to quit: NathanEnter hours worked: 35Enter
employee’s pay rate: 10.00Employee Name: NathanGross Pay: 350.0Enter next employee’s
name or 0 to quit: TobyEnter hours worked: 45Enter employee’s pay rate: 10Employee
Name: TobyGross Pay: 475.0(overtime pay: 75.0 )Enter next employee’s name or 0 to quit:
0Exiting program…Grading Criteria AssignmentsMaximum PointsProgram accomplishes
requested operations per instructions.40Demonstrates proper use of the decision structure
and program loops until user chooses to quit.40Meaning of the output is clear to the user
(i.e. instructions for input and labels for output data are provided), and prints the gross pay,
and only print the overtime is there is overtime.20
Need help with assignment by 8:30 p.m. Central Time 05/06/2015

6–8 slides with speaker notes of 200–250 words per slides (excluding Title and
Reference slides) Working with organizations to improve the interactions of members and
increase productivity through collaborative behavior is an essential role of the organization
development human resources specialist. You will need to pick an organization to use for
this project. The organization you choose may be your current employer, or alternatively,
an organization in which you volunteer or one about which you can easily find information
through the school library, the Internet, or other sources. Research and address the
elements of organizational effectiveness that will improve interactions in a presentation for
senior leaders: · Explain the concept of organizational effectiveness, as it relates to the
interactions of members. · Describe methods used to assess the behaviors and
attitudes of organizational members, and apply 1 model in an analysis of your
organization. · Analyze methods used to improve the behavior and attitudes of
organizational members. · Propose processes to build teams and manage their
different stages of development. · Evaluate methods of managing conflict and change
within the organization.
need help with assignment original work only

Outsourcing, especially to low labor-cost countries, has grown substantially. Be sure to

address the following in your paper:Analyze the trade-offs between inputs for the
productivity improvements.Analyze the advantages and disadvantages of global sourcing
versus producing in the U.S.Describe a product or service of a specific low-labor-cost
country as an example.Include a recommendation of a low-labor-cost country based on
inputs, trade-offs, and going global advantages.Your paper should be in paragraph form
(avoid the use of bullet points) and supported with the concepts outlined in your text and
additional scholarly sourcesSubmit your three- to four-page paper (not including the title
and reference pages). Your paper must be formatted according to APA style as outlined in
the Ashford Writing Center and must cite at least three scholarly sources in addition to the
textbook.
Need help with assignment

Purpose of Assignment This assignment has two cases. The first case is on expansion
strategy. Managers constantly have to make decisions under uncertainty. This assignment
gives students an opportunity to use the mean and standard deviation of probability
distributions to make a decision on expansion strategy. The second case is on determining
at which point a manager should re-order a printer so he or she doesn’t run out-of-stock.
The second case uses normal distribution. The first case demonstrates application of
statistics in finance and the second case demonstrates application of statistics in operations
management. Assignment Steps Resources: Microsoft Excel®, Bell Computer Company
Forecasts data set, Case Study Scenarios Write a 1,050-word report based on the Bell
Computer Company Forecasts data set and Case Study Scenarios. Include answers to the
following: Case 1: Bell Computer CompanyCompute the expected value for the profit
associated with the two expansion alternatives. Which decision is preferred for the
objective of maximizing the expected profit?Compute the variation for the profit associated
with the two expansion alternatives. Which decision is preferred for the objective of
minimizing the risk or uncertainty? Case 2: Kyle Bits and BytesWhat should be the re-order
point? How many HP laser printers should he have in stock when he re-orders from the
manufacturer?Format your assignment consistent with APA format.
Need help with biology article

I have quiz on the attached article. questions What is the impact factor of the journal where
this article is published?Who is the senior author of this paper?What is the overall objective
for this paper? What are the authors testing?Why did the authors do this research?How did
the authors test their objective?What materials and methods did researchers of this paper
use?(Include just a general idea of the procedures they followed)What was the control in
this experiment?What are the experimental groups that are compared to the controls?What
is the result? (only Fig 1)What conclusions did the researchers draw?What message can be
drawn from the result of this paper?When was published the article which documented for
the first time that measles virus (MV) infection causes immune suppression in
children?Thank you
need help with biology paper 1

Chapter 11 discusses the major practices that expose soil to erosion and how they can be
corrected. The three major practices are overgrazing, overcultivation, and
deforestation. The World Wildlife Foundation also discusses soil erosion and degradation in
this website: http://worldwildlife.org/threats/soil-erosion-and-degradationFor this week’s
individual work, write a 1-2 page paper (counting body text only, not title or reference
pages) in double spaced, one-inch margins on all sides. Respond to the following:What is
soil erosion?What are the negative impacts of soil erosion?Define overgrazing,
overcultivation, and deforestation. Include ideas on what people can do differently to
reduce the impact of these three practices on soil erosion.Provide examples of where this
happens both locally and regionally. Within the examples list the specific
consequences.Requirements: Please make sure all of your assignments:Are written in
paragraph form.Are double-spaced.Use 12 point, Times New Roman font.Include title &
reference pages.Include at least one full page of text to the body of your essay.Include one-
inch margins on all sides.Include a reference list at the end of your essay. That includes all
web sites, journals, articles, etc., you used.Please make sure you have not copied and pasted
any information directly from any source; that is considered plagiarism. There is no need to
copy, or quote, anyone for this assignment. It is to be a written summary reflecting your
own thoughts of your reading and research on this topic. However, you should include in
your reference list the source of your reading and research.
need help with book questions and chapter summaries

I need a summary for each chapter I will list below and also the case questions written and
answered for each chapter I will list below (case questions are found at the end of each
chapter). The book required to write the summaries and answer the questions is called ”
Supervision Today!” seventh edition by Stephen P. Robbins Chapter 2 half a page
summary, case 2-B questionsChapter 4 half a page summary, case 4-A questionsChapter
5 half a page summary. case 5-B questionsChapter 6 half a page summary, case 6-A
questionsChapter 7 half a page summary, case 7-A questionsChapter 8 half a page
summary, case 8-A questionChapter 9 half a page summary, Case 9-B questionsChapter
11 half a page summary, Case 11-B questionsChapter 12 half a page summary, Case 12-B
questionsChapter 14 half a page summary, Case 14-A questionsChapter 16 half a page
summary, Case 15-B questionsIf possible all in one file
need help with business decision making courses: 20 pages managerial report and 25 pages
of powerpoint

The course is about operation management, organization&HR management. The project is

Quantitative and Qualitative Decision Making project--part 2, since i have already
completed the part 1, you need to read the business running case as well as the previous
assignment part 1, and watch the video , then continue to structure and present your paper
as a managerial report. the attachments are sample of the managerial report, powerpoint
sample, part 1 that has been completed before, and the guide & grading rubric of part 2. Plz
read through the guide and strictly follow it.
need help with business ethics 1

You manage a large, high-end jewelry store with an international clientele in a country of
your choice (EU- or US-based). Your workforce of 150 is demographically diverse, and your
employees are trustworthy as a rule. However, you have experienced some unexplained
loss of inventory and suspect a couple of employees are stealing valuable pieces, removing
them from backroom storage safes and handing them off to another person somewhere in
the store who leaves with them or to a third person pretending to be a customer. To prevent
this, your assistant managers are urging you to place discreet cameras in the restrooms and
break rooms, where these exchanges are likely occurring. Some managers might be
concerned about using cameras at all due to privacy issues; others might want to use them
without notifying employees or putting up signs because they do not want to tip off the
suspects or deal with the negative reaction of the workforce (although that brings up
invasion of privacy issues). You are weighing the pros of catching the thieves against the
possible loss of other employees’ trust. Find a solution by going through the ethical
decision making process with Kidder‘s 9 steps! Keep legal restrictions in mind (EU and
US) Kidders 9 steps: 1. Recognize that there is a problem (is it a moral issue?): Drawing
distinctions between moral questions and those that merely involve manners and social
conventions. 2. Determine the actor(s): Who is (personally) responsible for addressing the
problem? Identify stakeholders and consider the benefits and harm to actors. 3. Gather the
relevant facts (details make a difference) 4. Test for right versus wrong issues (stench text,
frontpage test, mom test) 5. Test for right versus right values: Honesty vs. loyalty, individual
vs. community, justice vs. mercy, short-term vs. longterm 6. Apply the ethical standards and
perspectives (which normative ethical principles should be applied here? Utilitarianism,
Combination/Pluralism?) 7. Look for a third way. Maybe the dilemma can be solved in a
different way 8. Make the decision. Apply moral courage 9. Revisit and reflect on the
decision. Learn from your choices. What ethical issues were raised?
Need help with business plan paper…

Business Plan Paper Instructions – For a Bakery in Missouri As an entrepreneur, you want
to start a business. You know that the first step is to consider drafting a business plan
proposal to organize all of your ideas. For this assignment, you will submit a business plan
for your imaginary business. For research purposes, you can choose any state for the
location of your business. You are creating your business based on biblical principles, which
should be integrated throughout your plan. Your business plan must include the
following:1. Introduction of the proposed business;2. Description and explanation of
the type of business entity that is best for your business;3. Description of the specific
steps needed to be followed to successfully and legally start the business;4. A draft of a
valid contract with a vendor, supplier, customer, etc. that illustrates all elements of a
contract and takes into consideration some of the topics discussed in the contract
chapters;5. Description of possible ethical considerations for your business, including any
social responsibility plans or attitudes that your business will embrace;6. Description of a
possible disagreement that could be encountered among the partners, or investors and
shareholders, or other stakeholders in the business; and7. Illustration of the various
ways the disagreement could be resolved (referring back to the formal documents, such as
the articles of incorporation or the partnership agreement). This paper must be 1,500–
2,100 words, double-spaced, Times New Roman font or similar, structured in APA form.
Your analysis must be supported by at least 3 scholarly sources other than the Melvin
textbook. Sources must be cited in current APA format.
need help with case study 8

Case Study, Chapter 21, Health Care Reform: The Dismantling of the Affordable Care ActAs
we entered 2018, millions of Americans still relied on Affordable Care Act(ACA) subsidies,
health premiums were soaring, and provider choice was more limited than ever.There was,
however, momentum for reform. Health care was identified as the country’s leading
priority for Democrats (54%) and the second highest priority for Republicans (42%) at the
close of 2017. A group of registered nurses debate the issue of health care reform.1. The
nurses debate whether the country feels that health care reform is really necessary. Discuss
reasons why reform is needed and what that reform should address.2. What were the 10
essential benefits guaranteed by insurance plans in the ACA Health Care Marketplace? 3.
What are the successes of the ACA?4. What are the failures of the ACA?
Need help with Case study on dermatology key for case study ….

Need help with Case study on dermatology key for case study …. Need help with Case study
on dermatology key for case studyImage transcription textPo AaBbCcDc AaBbCcDo AaBbCc
T Normal 1 No Spac.. Heading 1 Paragraph Styles Use this key + Indicates manifestation
present I’ + + indicates a key manifestation Type of Dermatitis Irritant Allergic Atopic
General manifestations Pain Pruntus Xerosis Erythema Edema Appearance immediately
after exposure Delay of manifestation after exposure Vesicles Papules Crusting Fissuring
Well-demarcated lesions Lesions confined to one area Lesions affecting multiple areas O
a Place an Order We do custom work
100% original and plagiarism free .If you need help in any assignment just send us
requirements with time limit ,we will quote a price and after your confirmation ,we start
working on your assignment. An original work ready for submission provided to you
Name* First
Last
Email* Description**
Attachment

Drop files here or

CommentsThis field is for

validation purposes and should be left unchanged.
Δdocument.getElementById( "ak_js_1" ).setAttribute( "value", ( new Date() ).getTime() );
if(typeof gf_global == 'undefined') var gf_global = {"gf_currency_config":{"name":"U.S.
Dollar","symbol_left":"$","symbol_right":"","symbol_padding":"","thousand_separator":",","d
ecimal_separator":".","decimals":2},"base_url":"https:\/\/homeworklance.com\/wp-
content\/plugins\/gravityforms","number_formats":[],"spinnerUrl":"https:\/\/homeworkl
ance.com\/wp-
content\/plugins\/gravityforms\/images\/spinner.gif"};jQuery(document).bind('gform_po
st_render', function(event, formId, currentPage){if(formId == 1) {} }
);jQuery(document).bind('gform_post_conditional_logic', function(event, formId, fields,
isInit){} );
jQuery(document).ready(function(){jQuery(document).trigger('gform_post_render', [1, 1])
} );
need help with chemical formulas? Chemistry work details below:

DETERMINING CHEMICAL FORMULAS PROMPT:In this lesson, you learned about the
empirical formula and how it is related to molecular formulas. Now you will demonstrate
this knowledge by responding to the following prompt. Make sure you are showing all of
your work. A compound containing sodium, chlorine, and oxygen is 25.42% sodium by
mass. A 3.25 g sample gives 4.33 × 1022 atoms of oxygen. Explain the steps you need to take
to find the empirical formula with the given information, then find the empirical
formula."Make sure to show your work, and your answers should be provided with the
correct amount of significant figures." YOU WILL RECEIVE A SCORE REDUCTION IF THE
ABOVE REQUIREMENTS ARE NOT MET. CHEMICAL FORMULAS PRACTICE:1) Which of the
following compounds does not contain a polyatomic ion?sodium carbonatesodium
sulfatesodium sulfitesodium sulfide2) The correct formula for ammonium phosphate is
________.(NH4)3PO4(NH4)2PO4NH4PO4NH4(PO4)23) When writing the formula for a
compound that contains a polyatomic ion, ________.write the anion’s formula first use
superscripts to show the number of polyatomic ions present use parentheses if the number
of polyatomic ions is greater than 1always place the polyatomic ion in parentheses4) The
correct name for NH4OH is ________.ammonium carbonateammonium hydroxideammonium
acetateammonium nitrate5) Which of the following is the correct formula for iron (III)
sulfate?Fe3SO4Fe3(SO4)3Fe2(SO4)33FeSO46) The molecular formula for acetylene is
C2H2. The molecular formula for benzene is C6 H6+. The empirical formula for both is
________.CHC2H2C6H6(CH)27) Which of the following shows the percentage composition of
H2SO4?2.5% H, 39.1% S, 58.5% O2.1% H, 32.7% S, 65.2% O28.6% H, 14.3% S, 57.1%
O33.3% H, 16.7% S, 50% O8) Which of the following compounds has the highest percentage
of oxygen?CH4OC02H2ONa2CO39) The empirical formula for a compound that is 1.2% H,
42.0% Cl, and 56.8% O is ________.HClOHClO2HClO3HClO4
need help with civilization questions

1) Confucius: A) had little lasting impact on the conduct of government in China. B) felt that
some people were born evil and could not be changed. C) lived during the period of the
Warring States. D) was made a high ranking advisor to a Chinese leader.
Need help with computer science Why wont this javascript code execute

JavaScript Tutorial it looks logically and syntactically correct so im not sure what im
missing.
Need Help with creating a Proffesional Bio. I have the full directions added dow

Need Help with creating a Proffesional Bio. I have the full directions added down below in a
file as well as another file that has some information about me for the bio. Please message
me if you have any questions. Thank you!
need help with critical numbers

1.Find the critical numbers of the function. (Enter your answers as a comma-separated list.
If an answer does not exist, enter DNE.) g(t) = |4t − 7|2.Find the critical numbers of the
function. (Enter your answers as a comma-separated list. If an answer does not exist, enter
DNE.)h(t) = t3/4 − 6t1/43.Find the critical numbers of the function. (Enter your answers
as a comma-separated list. Use n to denote any arbitrary integer values. If an answer does
not exist, enter DNE.) f(θ) = 10 cos θ + 5 sin2θ 4.Find the critical numbers of the function.
(Enter your answers as a comma-separated list. If an answer does not exist, enter DNE.)
f(x) = x6e−8x
need help with current event essay middle america realm

Hi(this realm I need to write about consists of mexico, belize, guatemala, honduras, el
salvidor and nicaragua)Please write a summary that ties these 2 stories
together:http://abcnews.go.com/US/wireStory/judge-us-violates-agreement-detention-
immigrant-kids-32679960http://abcnews.go.com/US/wireStory/documents-deportation-
shelved-year-honduran-boy-32577012AND follows the instructions below.———————
——-Step 1. Search the Internet for a recently published news article that describes a recent
event that occurred in the Middle American realm and that you can relate to geography (i.e.,
physical, cultural, political, economic). Please Note: The event MUST have occurred during
the past 90 days; the news article also must have been published during the past 90
days. Step 2. Summarize the event (500 – 650 words), citing appropriate sources in APA
format. Include the cited sources in the references, also in APA format.**Analyze the short-
and long-term geographic importance of the event within the community, region, and
nation in which the event occurred.** **Analyze the geographic importance of the event on
one or more countries that are outside the realm in which the event occurred.****Describe
what the event reveals about culture, lifestyle, politics, economic conditions, and values
(personal, community, or national), etc., of the people in the region or country in which the
event occurred.**
need help with current event essay middle america

need in 1 daydon’t need a whole essay written, I would like help finding a topic with a
credible reference within the last 30 days. I would also like the tutor to write an outline of
what the paper should be broken down into—————————Step 1. Search the Internet
for a recently published news article that describes a recent event that occurred in the
Middle American realm and that you can relate to geography (i.e., physical, cultural,
political, economic). Please Note: The event MUST have occurred during the past 30 days;
the news article also must have been published during the past 30 days. Step 2. Summarize
the event (500 – 650 words), citing appropriate sources in APA format. Include the cited
sources in the references, also in APA format.Analyze the short- and long-term geographic
importance of the event within the community, region, and nation in which the event
occurred. Analyze the geographic importance of the event on one or more countries that are
outside the realm in which the event occurred. Describe what the event reveals about
culture, lifestyle, politics, economic conditions, and values (personal, community, or
national), etc., of the people in the region or country in which the event occurred.If your
instructor has posted a rubric for this assignment, be certain to consult it. Submissions
should demonstrate critical thinking and the ability to pull together information from a
variety of sources. A simple restatement of information from the textbook, news article,
blog, a general opinion, or only a summary of the news report will earn very few points.
need help with discussion 18

1) Read Section 1.6, A Moment in the Life of an HR Manager, from Chapter 1 of the course
text and watch Aligning HR With Business Strategy Featuring Wayne Cascio, PhD (Links to
an external site.)Links to an external site.. Do you believe frontline managers have an active
role in HR? Why or why not? Compare the functions and practices of human resource
managers with front-end managers and provide examples to support your point of view.
Your initial post must be a minimum of 250 words. Cite at least one scholarly source to
support your response.2) Economics is the study of how society chooses to allocate its
scarce productive resources (labor, capital, land, entrepreneurial talent).In a mixed
economy, elements of both central planning and market allocation of resources are used in
allocating productive resources. The United States economy is a mixed economy, with a bias
towards market allocation of resources. This means most resources are allocated in the
private sector by way of markets.Discuss whether you favor a larger or smaller role of
government in the economy. Refer to concepts found in the reading to support your
opinion.Reference: Chapter 2: Markets, Governments, and Nations: The Organization of
Economic Activity
need help with discussion 71

1) Gonzalez-Padron (2015) addressed several ethical issues that have arisen in the 21st
century. Choose a scholarly or credible article relating to a 21st century ethical issue. The
Scholarly, Peer Reviewed, and Other Credible Sources table offers additional guidance on
appropriate source types. If you have questions about whether a specific source is
appropriate for this assignment, please contact your instructor. Your instructor has the final
say about the appropriateness of a specific source for a particular assignment.Describe how
the ethical dilemma can affect both the organization and society.Evaluate changes could
have been made to prevent this ethical dilemma.Your response must be a minimum of 300
words.2) Before starting your discussion, read the Forbes article How to make an ethical
difference in your business (Links to an external site.). In the article, Zwilling (2013)
stated,Many people seem to have the sense that ethics are spiraling downward in business,
yet most business professionals and entrepreneurs I know don’t believe they can make a
difference. They don’t realize that if they don’t take an active role in the solution,
they really become part of the problem. (para. 1Review the five solutions to ethical
problems described by Zwilling. Select one of the five solutions. Put yourself into the role of
leader and evaluate how your chosen solution could be applied to an organizational ethical
dilemma.Your response must be a minimum of 300 words.
need help with discussion 73

1) Prior to beginning your discussion response, read The ethical trap (Links to an external
site.). Discuss an ethical dilemma that you are aware of in an organization. Describe how the
ethical dilemma was an ethical trap. Evaluate how the ethical dilemma and the ethical trap
could have been avoided.Your response must be a minimum of 300 words.2) Prior to
beginning your discussion response, read Managing for organizational integrity (Links to an
external site.). In the article, Paine (1994) described scenarios of various organizations.
Choose one of the ethics topics: integrity as a governing ethic, emphasizing core values,
building shared aspirations, or defining right action.Summarize the information shared in
the article for your chosen topic.Describe how the ethics topic could be incorporated into
your organization or an organization that you are familiar with.Your response must be a
minimum of 300 words.
need help with discussion 75

1) Read Consider: What’s in a Name of an Ethics Code? in Chapter 9, then answer these
following questions from the text:Describe how the title of a company’s ethics document
affects your attitude about the content?. Do you find one title more attractive than
another?Describe the message that the title “code of conduct― conveys?. Does it
reflect the purpose of the document to provide employee guidance on expected
conduct?Propose creative titles for ethics codes for a pharmaceutical company and a
restaurant. (Gonzalez-Padron, 2015).Identify two other company ethics documents and
share the titles of their ethics documents (consider your own organization or one that you
are familiar with for this question). Your response must be a minimum of 300 words. 2)
Medical Tourism has become a growing industry, especially in developing countries.
Research the topic of medical tourism, and find a scholarly or credible article for your topic.
Develop a code of conduct for medical tourism. Your code of conduct must
includeOrganizational valuesGuidelines for acceptable behaviorCompliance with
legislationExamples of prohibited actsYour response must be a minimum of 300 words.Use
at least one scholarly or credible source.The Scholarly, Peer Reviewed, and Other Credible
Sources table offers additional guidance on appropriate source types. If you have questions
about whether a specific source is appropriate for this assignment, please contact your
instructor. Your instructor has the final say about the appropriateness of a specific source
for a particular assignment.
need help with discussion 78

As the world continues to become more global because of technological advances, the risks
will increase. Choose one of the global risk areas: economic, environmental, geopolitical,
societal, or technological. Then choose a specific issue related to the global risk
area.Describe the ethical issue. Evaluate how the risk could best be mitigated.Your response
must be a minimum of 300 words.Use at least one scholarly or credible source.The
Scholarly, Peer Reviewed, and Other Credible Sources table offers additional guidance on
appropriate source types. If you have questions about whether a specific source is
appropriate for this assignment, please contact your instructor. Your instructor has the final
say about the appropriateness of a specific source for a particular assignment.A common
debate in ethics is universalism versus relativism of ethics and moral codes. A frequently
asked question is “Does a universal moral code exist regardless of an individual’s
culture?― As organizations are becoming increasingly global, and understanding of
universalism versus relativism of culture ethics is important.Compare and contrast
universalism and relativism.Evaluate how universalism and relativism affect global social
corporate responsibility.Your response must be a minimum of 300 words.Please use at least
one scholarly or credible source in your discussion.The Scholarly, Peer Reviewed, and Other
Credible Sources table offers additional guidance on appropriate source types. If you have
questions about whether a specific source is appropriate for this assignment, please contact
your instructor. Your instructor has the final say about the appropriateness of a specific
source for a particular assignment.
need help with discussion 8

1) Select a non-profit organization (e.g., American Red Cross, Salvation Army, etc.) and
assess the role of public relations in that non-profit organization. Compare and contrast at
least two characteristics between a for-profit organization and a non-profit organization.2)
Select an organization from the United States that conducts business in other countries and
assess the impact of global public relations on buyer behavior (hint: Coca-Cola, Disney,
McDonald’s, etc.)
Need help with discussion question 1 health and medicine homework help

Prior to engaging in this discussion, read Chapters 7 and 8 in your text as well as the articles
by Clark, et al. (2013) “California’s historic effort to reduce the stigma of mental
illness: The Mental Health Services Act” .and Cummins (2013) “Addressing public
stigma and disparities among persons with mental illness: The role of federal policy.― It
is highly recommended that you also watch a few of the videos on mental illness from the
TED playlist, “All kinds of minds― as these provide valuable insights into a variety of
disorders and the issues associated with them.For this discussion, refer to the information
in the SOC313 Family Document. Lucy Miller is a 20 year old who has recently been
diagnosed with bipolar disorder. She is working on the family farm. She would rather work
elsewhere because she does not get along well with her family. However, she has been fired
from four jobs in the past two years and this is her only option for work currently. Lucy
began experimenting casually with illegal drugs in high school after a particularly
challenging year, and found that they helped her mood swings. Unfortunately, she kept
getting them from friends and has now become addicted to drugs.Examine the potential
biological basis for Lucy’s psychological disorder. For example, what, if anything, in her
family history might point to this issue as being hereditary? Consider the biases that are
often held regarding mental illness. Is individual choice involved in mental illness? Discuss
your thoughts on how much is related to environment and genetics. Discuss how society
relates to mental illness when we know the person well versus when the person is a
stranger (e.g., a homeless individual or a panhandler on the street). How has society’s
behaviors contributed to the adverse long-term outcomes for people with mental illness?
need help with discussion question

Sultz and Young (2011) note that there is currently a strong movement within the U.S.
health care system to address “the seemingly unresolvable need to correct problems of
access and cost without compromising the quality of care” (pg. 1). After viewing the
required video Reinventing Healthcare-A Fred Friendly Seminar, discuss how one of the
cases presented during the seminar is an example of the tension between cost, access, and
quality. Highlight what you consider to be the biggest problem inherent in the system.Sultz
and Young (2011) describe the various stakeholders in the U.S. health care system. Choose
one of these stakeholders and describe their role, concerns, interests, as well as the
strengths and weaknesses of their influence in the system. In what ways has this group
contributed to rendering the current health care system as too complex and unmanageable?
Discuss what you think this group could do to improve the current health care system.
need help with discussion questions 36

1) Explain what types of marks for which a professional sports organization can seek legal
trademark protection. Why? Support your position with examples.2) Analyze the functions
of a trademark and the purpose of a copyright. Then, provide a sport-related example that
will emphasize the main differences between a copyright and a trademark.Resources,
Sharp, L. A., Moorman, A. M., & Claussen, C. L. (2014). Sports law: A managerial approach
(3rd ed.). Scottsdale, AZ: Holcomb Hathaway.
need help with discussion questions

1) Complete Problem 1 from the end of Chapter 2: You have just graduated from college and
are looking to buy your first car. Money is tight right now, so you are concerned with initial
cost as well as ongoing expenses. At the same time, you don’t want to drive a slow, ugly car
like your parents do. You have narrowed your choices down to two vehicles: a Honda
Enigma and a Bizzarini Booster. Based on the rankings in the table (found under Chapter 2,
Problem 1 in the textbook), calculate the value index for each car. Which car provides you
with the greatest value? Use formulas to calculate the answer to one decimal point2) From
Chapter 4, Section 4.2, Problem 2, read the current home equity loan process at Faircloth
Financial and map the current process. Identify any rework loops and delays in the process.
What causes these? What is the impact on cycle times? How might this affect customers’
willingness to do business with Faircloth? What changes might you recommend to redesign
this process with the needs of the customer in mind?
need help with discussions

1) Complete Problem 1 from the end of Chapter 2: You have just graduated from college and
are looking to buy your first car. Money is tight right now, so you are concerned with initial
cost as well as ongoing expenses. At the same time, you don’t want to drive a slow, ugly car
like your parents do. You have narrowed your choices down to two vehicles: a Honda
Enigma and a Bizzarini Booster. Based on the rankings in the table (found under Chapter 2,
Problem 1 in the textbook), calculate the value index for each car. Which car provides you
with the greatest value? Use formulas to calculate the answer to one decimal point2) From
Chapter 4, Section 4.2, Problem 2, read the current home equity loan process at Faircloth
Financial and map the current process. Identify any rework loops and delays in the process.
What causes these? What is the impact on cycle times? How might this affect customers’
willingness to do business with Faircloth? What changes might you recommend to redesign
this process with the needs of the customer in mind?
need help with doing a thesis paper

The title I want the paper to be about is, “Teaching Children with Special Health Care
Needs”. I need a Course Paper Thesis, Outline, & Annotated Bibliography and Course Paper
Rough Draft to be revise from the writing center. The instructions are listed before. The
Course Paper Thesis, Outline, & Annotated Bibliography is 4 pages and Course Paper Rough
Draft is 4+ pages.
Need help with drama essays.

Objectives:1. Apply elements of analyzing the message in a piece of drama.2. Create a thesis
statement to focus the paper.3. Apply elements of works cited formatting.4. Apply the
elements of characterization to a piece of drama.5. Create a characterization of one of the
main characters in a play.Develop three essays to respond to questions listed in the
assignment.Since drama is a visual medium, the reader must pay more attention to the
actions as well as the dialogue of the characters. Take the time to read the plays more
slowly, noting the author’s notes and asides that set the scenesand indicate the actors’
movements. Let the play unfold in your mind’s eye. Feel the emotion the actions
identify.WRITE: COMPLETE1. A character analysis of Mrs. Wright based on the guidance
offered on pp. 440-441 (I uploaded a pic of the guidance) and
in response to question #4 (question below). Use citations and back up
your opinions with evidence. Include drafts and a works cited page for the play. Include in-
text citations for material you quote from the play. http://www.one-act-
plays.com/dramas/trifles.htmlQuestion: We never see Mrs. Wright on stage. Nevertheless,
by the end of Trifles we know a great deal about her. Explain both what we know about her-
physical cal characteristics, habits, interests, personality, life before her marriage and after-
and how we know these things. 2.
After reading “Sure Thing” answer either question 1 or 3 on p. 461.
Include in-text citations for material you quote from the
play.http://blanckd.yolasite.com/resources/Sure%20Thing...Question
1.: Does Sure Thing have a plot? Does it follow the traditional formula
of a beginining, a middle, and an end? (The conventional advice to
playwrights is, "Get your guy up a tree, throw rocks at him, and get
him down.") Is there an ending, a resolution, or do you think the play
could go on and on? Please explain.3. After reading “Andre’s
Mother” answer #1 or #3 on p. 739. Include in-text citations for the
material you quote from the play.
http://sites.suffolk.edu/englishfaculty/files/2009...Question
1.: Andre's Mother doesn't speak in the play, but we learn something
about her through Cal's words, and something more through thedescription in the final
stage direction. In a paragraph, characterize Andre's Mother.***As for the in-text citations
just put the author last name no numbers, I will use my book for the number. The website's
I provide is just the plays word from word just like my book for my class.
need help with easy discussion questions

1) The website for the Association for Talent Development (www.td.org (Links to an
external site.)Links to an external site.) contains a wealth of information. Visit this website
and discuss 2-3 interesting things that you found there.(100+ words)2) Talent management
focuses on having the right individuals ready for the jobs when needed. Does talent
management play a role in recruitment and selection? If so, what role(s)?(100+ words)3)
Why is evaluating training an important part of strategic training?4) What training
techniques should be implemented to meet the needs of the varied learning styles and
maximize the learning potential of the participants?5) Do you think the issue of global dual-
career couples will increase or decrease in the next ten years? Why?
Need help with english assignment

fvPhase 3 Discussion BoardDeliverable Length:2 parts: See Assignment

DetailsDetails:Reminder: Initial Discussion Board posts due by Wednesday, responses due
by SundayStudents will be expected to post their first initial discussion board posting by
Wednesday of each week. Discussion posts will be graded and late submissions will be
assigned a late penalty in accordance with the late penalty policy found in the syllabus.
NOTE: All submission posting times are based on midnight Central Time.Students are
expected to post their responses to peers by Sunday. NOTE: All submission posting times
are based on midnight Central Time.Say it with care and clarity!Considering the context of
communication is essential when speaking with an employee.Recently, you were advised by
your manager that your employee used the company computer to post some messages to
her friends on a social networking site. This is clearly against the company’s policy,
which states that “no employee will use the company computer for personal activities.” You
schedule a meeting to speak with the employee about this violation of policy.Primary Task
Response: Within the Discussion Board area, write 400–600 words that respond to the
following questions with your thoughts, ideas, and comments. This will be the foundation
for future discussions by your classmates. Be substantive and clear, and use examples to
reinforce your ideas:What are some of the considerations that will apply to this situation
when relaying the bad-news message to the employee during the meeting? Discuss the
following:What type of communication channel would you propose (and why) to advise the
employee of the meeting?Should the content of the communication be direct or indirect, and
why?What type of evidence would you use to prove your point?How will you close the
meeting?
need help with environmental homework

Problem 1 a) The proton concentration of a solution is 0.0005 mole/l. What is the pH of this
solution? b) The hydroxide ion concentration of a solution is 0.0005 mole/l, what is the pH
of this solution? Problem 2 a) The pKa value for hypochlorous acid is 7.45, what is Ka value
for the same acid? b) The Ka value for acetic acid is 10-4.75, what is the pKa value for the
same acid? Problem 3 Examine dissociation of acetic acid (CH3COOH) and hydrochloric acid
(HCl) at pH 5 and 10. – – Calculate [Cl ]/[HCl] and [Ac ]/[HAc] Problem 4 a) What is the
oxidation states of sulfur in SO42- and HS- ? b) Balance the following redox reaction use the
half reactions (you have to develop the half reactions to get full credit) SO42- + H+ + CH2O
HS- + CO2 + H2O Problem5 SO42- + H+ + 2CH2O HS- + 2CO2 + 2H2O In above balanced
redox reaction, list the following: Oxidant: Reductant:
need help with essay 18

Case Study, Chapter 18, Academic Integrity in Nursing Education: Is it Declining?A group of
nursing students are in the middle of an exam when two students witness another student
pull out his phone and look up answers. Neither student informs the faculty member but
after the exam they discuss what they witnessed.1. Describe the most common forms of
cheating in the classroom and in the clinical area.2. What should the nursing students do in
regard to what they witnessed during the exam? Why is it important for them to do
anything?
Need help with finance Concept

1–2 pagesDetails:Weekly tasks or assignments (Individual or Group Projects) will be due

by Monday and late submissions will be assigned a late penalty in accordance with the late
penalty policy found in the syllabus. NOTE: All submission posting times are based on
midnight Central Time.Evaluate the following types of personal insurance: Health
insuranceCar insuranceHomeowners/renter’s insuranceLife insurance
Need help with finance home owrk

A person is considering buying the stock of two home health companies that are similar in
all respects except the proportion of earning paid out as dividends. Both companies are
expected to earn $6 per share in the coming year, but company D (for dividends) is
excepted to pay out the entire amount as dividends, why company G ( for growth ) is
expected to pay out only one third of its earning or $2 per share. The companies are equally
risky; their required rate of return is $15 percent. D’s constant growth rate is zero and
G’s is 8.33 percent. What are the intrinsic values of stocks D and G? Medical Corporation
of America (MCA) has a current stock price of $36 and its last dividends (Do) were $2.40. In
view of MCA‘s strong financial position, its required rate of return is 12 percent. If
MCA’s dividends are expected to grow at a constant rate in the future, what is the firm
expected stock price in five year? A broker offer to sell you shares of Bay Area Healthcare,
which just paid a dividend of $2 per share. the dividend is expected to grow at a constant
rate of 5 percent per year. the stocks required rate of return is 12 percent. a. what is the
expected dollar dividend over the next three years? b. what is the current value of the stock
and the expected stock price at the end of each of the next three years? c. what is the
expected dividend yield and capital gains yield for each of the next three years? d. what is
the expected total return for each of the next three years? e. how does the expected total
return compare with the required rate of return on the stock? does this make sense? explain
your answer. 4. Lucas Clinics last dividend (Do) was $1.50. its current equilibrium stock
price is $15.75 and its expected growth rate is a constant 5 percent. if the stockholders
required rate of return is 15 percent, what is the expected dividend yield and expected
capital gains yield for the coming year?
Need Help with Finance

P2.Find the future value of $10,000 invested now after five years if the annual rate is 8
percent. a. What would be the future value if the interest rate is a simple interest
rateb. What would be the future value if the interest rate is a compound interest rate? P3.
Determine the future values if $5,000 is invested in each of the following situations: a. 5
percent for ten yearsb. 7 percent for seven yearsc. 9 percent for four years P4.You are
planning to invest $2,500 today for three years at a nominal interest rate of 9 percent with
annual compounding. a. What would be the future value of your investment? b. Now
assume that inflation is expected to be 3 percent per year over the same three year
period. What would be the investment’s future value in terms of purchasing
power? c. What would be the investment’s future value in terms of purchasing
power if inflation occurs at a 9 percent annual rate?
need help with history homework

Create a journal entry of 700 to 1,050 words from the perspective of one of the following
1960s personas: · Student at the University of Mississippi when James Meredith tried
to enroll · Witness to the assassination of Malcolm X · Protestor at the Lincoln
Memorial who hears King give his “I Have a Dream― speech · A freedom rider
headed to New Orleans in 1960 · Store owner and witness to the Watts riots in LA
· African American participant in one of the Selma marches in 1965 · An African
American supporter and political organizer for Robert Kennedy in 1968 Consider the
social, economic, and political forces at work. For example, if you have chosen to be a
student at the University of Mississippi, describe the court cases that resulted in the
desegregation of the campus. Ensure that your journal entry aligns with fact and that all
facts are supported by proper citations. Format the text of your journal entry consistent
with APA guidelines.
need help with homework 14

Introduce your assignment with a discussion of probability distributions.What is a

probability distribution? What are the requirements for a probability distribution?How are
probability distributions helpful for the analysis of your chosen scenario?Using the
discrete/quantitative variable that you analyzed in Part 1, construct a probability
distribution for the data. Interpret your results in context of your chosen scenario. Calculate
the parameters of your probability distribution. Interpret your results in context of your
chosen scenario. MeanVarianceStandard DeviationUse the Range Rule of Thumb to identify
any unusual results. Interpret your results in context of your chosen scenario.
ConclusionRecap your ideas by summarizing the information presented.
Need Help With Homework

Assignment 3: Mobile Computing and Social Networking Due Week 7 and worth 75
points Mobile computing has dramatically changed how information is accessed and shared.
Wireless networking has been an enabler of mobile computing. One profession that mobile
computing has had a big impact on is health care management. Patients are now able to
monitor their vital signs such as blood pressure, glucose levels, etc. without having to
periodically visit a doctor’s office or hospital. There are devices such as the Withings Blood
Pressure Monitor that works with an iPhone, iPod Touch, or iPad to record, track, and graph
a patient’s blood pressure. There are other devices that can measure blood glucose levels,
oxygen levels, heart rate, etc. and use an iPhone to send the results to a clinical server.
Doctors and caregivers are then able to access the data on the clinical server. According to
the American College of Gastroenterology, social networking sites like Facebook, Twitter,
and YouTube are used as powerful platforms to deliver and receive health care information.
Patients and caregivers are increasingly going online to connect and share experiences with
others with similar medical issues or concerns Patients are able to take advantage of social
networks to do more than just share pictures and tweets. Write a four to five (4-5) page
paper in which you:Compare and contrast monitoring of patient vital signs using mobile
computing technology to in-patient visits to the doctor’s office or hospital.Analyze the
advantages and disadvantages of using mobile computing technology to monitor
patients.Assess the security concerns with regard to the transmission of personal medical
information over wireless networks.Assess the use of social networking for group support
for patients with similar medical concerns. Use at least three (3) quality resources in this
assignment. Note: Wikipedia and similar Websites do not qualify as quality resources.Your
assignment must follow these formatting requirements:Be typed, double spaced, using
Times New Roman font (size 12), with one-inch margins on all sides; citations and
references must follow APA or school-specific format. Check with your professor for any
additional instructions.Include a cover page containing the title of the assignment, the
student’s name, the professor’s name, the course title, and the date. The cover page and the
reference page are not included in the required assignment page length.The specific course
learning outcomes associated with this assignment are:Describe the use of network
management, Web, wireless, and mobility technologies.Outline the strategic implications of
information assurance and security in an information technology environment.Use
technology and information resources to research issues in information systems and
technology.Write clearly and concisely about topics related to information systems for
decision making using proper writing mechanics and technical style conventions.Grading
for this assignment will be based on answer quality, logic / organization of the paper, and
language and writing skills. Click here to view the grading rubric for this assignment.
need help with human resource assignment

you will prepare a general summary of their scenario as well as provide answers to the
questions provided at the end of the scenario.The response should be at least 750
wordsLEARNING TEAM 2 SCENARIOHR On-the-Job: Planning for New Employee
OrientationEffective new employee orientation requires planning and preparation. Both the
supervisor and the HR unit should be prepared to give each new employee the perception
that the new employee belongs and is important to the organization. “Buddy” mentors are
recommended to mentor new employees. An orientation checklist can help new employees
because all areas of potential concern are addressed by HR and the new employees’
immediate supervisor. All important information needs to covered and checklists can help
make sure that pertinent rules are explained. Employers should cover all of this new
information in a logical organized manner without information overload. In addition, a
follow- up should be completed to see how the employee is doing and if there are any
questions. Questions for Discussion:Why is new employee orientation so important?What
role could a checklist play in employee orientation?How could employers prevent
information overload of new employees?
NEED Help with HW

Hello I need help with HW in database class I HAVE to choose DATA for any company and
put them in SQL. HERE is WHAT TEACHER WANTS IT IN THE DATA. then we have to write
the 2 page paper about that describing. AFTER THAT YOU also have to MAKE
PRESENTATION should have around 5 to 6 slides. FOR all THIS I have instruction in bottom.
INSTRUCTIONS FOR DATABASE InstructionsTo help users evaluate your database vision
and its usability, you generally create prototype queries and views (reports) to illustrate
your specific design and its features. Create example queries and views (reports) in SQL;
employing some sample data, verify your ER model(s) will support those use cases, or
accomplishments, or activity, etc. demanded by your chosen area of application.Turns out
there were some questions that probably should have been asked in class. Designs
generated by Vertabelo include all relevant FOREIGN KEY constraints, and this can
sometimes create issues in SQLITE if you try to add a new record so you can input sample
data.The problem is that if you don't specify a default value for an INTEGER foreign key,
when SQLITE creates an new empty record, it will try to insert a key value of zero (0). If you
don't already have a record for key value zero (0), the attempt to create a new record using
the 'New Record' button will usually fail, particularly if NOT NULL is also specified for
integer foreign keys.The issue with text/string foreign keys is a bit different as sometimes
for a NOT NULL type text constraint, the default value is an empty string (i.e. blank) which is
sometimes different from a Null value, or nothingness.If you're having problems creating
data, and getting queries completed, then perhaps some of the problem is in the
CONSTRAINTS defining Primary and Foreign Keys, and the mechanism in SQLITE for
creating new records. INSTRUCTIONS FOR PAPER.As stated in the syllabus: "Students are
required to submit a paper describing a business situation that would benefit from a
database implementation to store and retrieve data. They must apply their knowledge of
relational databases to define the business constraints, design considerations and
implementation techniques."Your paper should be Consistent with the submitted topic and
the associated ER model; substitutions if necessary will require submitting revised topic/ER
model and obtaining necessary approval for the proposed topic change. MAKE
PRESENTATIONFINAL PRESENTATION SHOULD BE DESCRBING HOW DID WE GOT ALL
THIS NUMBERS AND HOW DID YOU MADE IT in STEPSPLEASE MAKE IT ACCURATEThank
you for your help.
Need help with homework: I have completed everything except the “variances” tab. it most
show the formulas in the excel worksheet.

Need help with homework: I have completed everything except the “variances” tab. it most
show the formulas in the excel worksheet.
Need help with internship assignment

Here are the questions I’ve to answer. Summarize your individualized results on
CareerBeam, Internship Predictor and top 5 Values on in-class assessment. Reflecting on the
results, how would you interpret them for yourself? Do you agree with the results, is there
an agreement or contradiction between the assessments?What do those results suggest to
you about your possible internship options?Write 2 paragraphs about the type of
organization and opportunities that would interest you.Summarize results and what you
took away from each assessment. What do the results from the assessment mean for your
decision-making right now. CareerBeam link to on https://www.wou.edu/slcdInternship
Predictor on http://www.internships.com/predictor . Don’t worry about the in-class
assesment in the first Question. Right what you got in the Careerbam, and I will provide you
deatails.
need help with java assignment 1

1. Write an application that inputs three numbers (integer) from a user. (40 pts) UPLOAD
Numbers.java a. display user inputs b. determine and display the number of negative inputs
c. determine and display the number of positive inputs d. determine and display the number
of zero inputs e. determine and display the number of even inputs f. determine and display
the number of odd inputs 2. Create a class called Customer that includes three private
instance variables – a first name (String), a last name (String), and a credit limit (double).
(30 pts) UPLOAD Customer.java a. Provide a constructor that initializes these three instance
variables. Validate credit limit; it must be greater than 0.0. b. Provide set and get methods
for each instance variable. Validate credit limit; it must be greater than 0.0. Write a test
application named CustomerTest that demonstrates class Customers’s capabilities. (30 pts)
UPLOAD CustomerTest.java a. Create two Customer objects. b. Display each customer’s first
name, last name, and credit limit. For doubles, display two integers after the decimal point.
c. Then, raise each customer’s credit limit by 20%. d. Display each customer’s first name,
last name, and credit limit again. For doubles, display two integers after the decimal point.
need help with legal memorandum 1 2 pages

Assignment DetailsJendall Kenner came into our office today to ask for representation on a
recent public intoxication charge. Jendall says that last month, a friend called him sometime
in the afternoon and invited him to a party that night at 128 Oakland Street. He knows now
that he mistakenly wrote the address as 182 Oakland Street. He admits that he was already
drinking before he caught a city bus to the party.When he arrived at 182 Oakland Street
around 6:00 p.m., he wasn’t surprised that the party had not yet begun. It was still early. He
didn’t see anyone at the house and the door was unlocked, so he went inside to wait for
other people to show up. While he waited, he helped himself to a few more beers from the
refrigerator, and he turned on the stereo to help “get the party started.” He suspects he then
must have passed out, because he woke up on the kitchen floor with a police officer
standing over him with a gun pointed at him.The arrest report says that the police arrived
at 8:43 p.m. after the homeowners arrived home and called to report an intruder. It also
states that the officer based the arrest on his observation that “Kenner had glassy,
bloodshot eyes and the strong smell of alcohol.” Jendall has only been charged under the
public intoxication statute located at Code of Virginia § 18.2-388.Jendall explains that he
feels really bad about the whole incident, but he isn’t a criminal. It was all just a big mistake
that he doesn’t want to ruin his life. He has asked that we represent him to try to get the
public intoxication charge dropped.Instructions: Please research Virginia law-
https://www.novadefenders.com/drunk-in-public.htmlDraft a legal memorandum to your
supervising attorney regarding this client’s matter. Research the public intoxication statute
indicated above and any case law related to this issue that you find helpful. Be sure to cite
your sources. Accurately identify the elements of public intoxication contained in the
statute. Compare the facts above with the elements of public intoxication to see if the client
has been charged correctly. Make a recommendation as to whether we should accept this
client’s case and what result we should expect if we take this case to trial.Required Criteria:
In addition to fulfilling the specifics of the Assignment, a successful paper must also meet
the following criteria:Length should be 1–2 pages, excluding cover page and references
page.Double-spaced and in a 12-point fontViewpoint and purpose should be clearly
established and sustainedAssignment should follow the conventions of Standard American
English (correct grammar, punctuation, etc.).Writing should be well ordered, logical, and
unified, as well as original and insightful.Your work should display superior content,
organization, style, and mechanics.Appropriate citation style should be followed.
Need help with Linux server assignment

For this, you are required set up a working server that will contain several applications. You
should use VMWare Player to host either a Linux server. These are the requirements for the
server:For a Linux Server:Remove any unnecessary applicationsSet up a print server
(CUPS), allow clients to connect, print to PDFCreate a script that backs up the printed
documents every 6 hoursWrite-up with the following information: For Linux: What
programs were removed, why, and how you removed themDetailed description of the
process of setting up and running each server (explain also the default configurations, if the
system will work as-is)Report and describe each script in detailReport and describe any
system you set up in detailList and describe any accounts, report the passwords for each
accountDescribe how to access any of your serversOnly the ones that apply
Need help with literature

Task Name:Phase 3 Individual ProjectDeliverable Length:1,000–1,500

wordsDetails:Weekly tasks or assignments (Individual or Group Projects) will be due by
Monday and late submissions will be assigned a late penalty in accordance with the late
penalty policy found in the syllabus. NOTE: All submission posting times are based on
midnight Central Time.Complete your reading of chapters 21–31 in To Kill a
Mockingbird. To begin preparing you for the next step toward your key assignment, write a
thought piece answering the following questions:Summarize the main messages of the book
as you see them, and discuss the message Harper Lee wanted readers to take away from
it. Speculate about her motivations for writing this particular book. What in her life
experience might have been the catalyst for this story?What is the climax of the story? In the
final section of the novel, which you just read, two seemingly separate threads of the plot
come back together: the trial of Tom Robinson and the mystery of Boo Radley. How do the
final events bring these two stories together and exemplify the title of the book?Make a
chart of the characters in the town, List those that represent justice, reason, empathy,
tolerance, and good (topped by Atticus Finch), those that represent evil and prejudice
(topped by Bob Ewell), and those who fall into the ambiguous category.Discuss the meaning
of the title phrase “it’s a sin to kill a mockingbird.” Who are the mockingbirds in the
book? What do you take this to mean for your life? Discuss the symbols and motifs Lee uses
as metaphors and powerful images throughout the book. Hint: Examples would be the mad
dog incident, or the items Boo Radley leaves for the children in the tree.Articulate the life
lessons that Scout gets through the events in the book. What is the role of her father, Atticus
Finch, as the moral center of the book? Many readers testify that this book made a real
difference in their lives. How did it affect you, and what will you take away with you as a
result of reading it? Comment on literature’s ability to mirror life and provide lessons and
self-knowledge. What is happening in today’s world that this book still speaks to?
Need help with Macroeconomics homework ?

1. Which of the following changes will result in a shift of the aggregate demand curve, and
which will result in a movement along the curve? If there is a shift, or a movement, be sure
to explain in which direction, and why (either up or down, or, right or left). 1 pt each a. The
Fed lowers interest rates. b. The price level in the economy falls. c. Wealth decreases. d. A
foreign trading partner’s national income increases. 2. With a two panel diagram –one
panel showing the aggregate expenditure diagram, and the other showing the AD curve –
show how a decrease consumption shifts the AD curve. 2 pts 3. What will happen to the
aggregate supply curve if the price of foreign oil decreases? Will it cause a movement along
the curve or a shift of the curve? Explain clearly. 2 pts 4. Is there any difference between the
aggregate demand curve and the demand curve for good x? Explain .
need help with media paper

Guidelines for Media Foundation Course ProjectProject OverviewOverview: This is an

individual project involving analyzing the media coverage given a global event and/or issue.
Your task is 1) to apply the media concepts and theories we have learned from class and 2)
produce a content analysis comparing and contrasting how different countries, political
parties, or media outlets report and approach an event/issue similarly and differently. It
could be an event (e.g., health/economy/politics crisis), an issue (e.g., poverty, education
injustice, sexism), or a news story (e.g., a celebrity’s scandal, affair, a sports game).
Length: 8-12 pages double spaced (not including references and appendices), 1-inch
marginsWriting style: APA (not following APA style will result in penalty) Grading: The
paper will be graded on the quality of your critical analysis, plus writing, organization,
grammar, spelling, and punctuation. Anti-plagiarism software will be used to help detect
plagiarism.Your paper should be organized into the following sections. Title page. This page
should indicate the title of your paperIntroduction. The first section of the paper is an
introduction that represents a concise statement of the problem under investigation (a
health issue, crisis, etc.). Prior to the problem statement, you are suggested to write a brief
introduction of the problem. Theoretical Foundation. This section involves a literature
review of agenda-setting and framing theoretical frameworks, as well as relevant research.
Implementation. This section involves articulating two key elements: (1) media
outlets/platforms you would like to compare, (2) time frame of the media coverage you
intend to investigate.Main findings. Discuss your main finding, and speculate the possible
behind reasons for the similarities and differences (e.g., political, economic, ideological, and
cultural factors, etc.)References or bibliography. Resources: APA formatting and style guide:
https://owl.purdue.edu/owl/research_and_citation/apa_style/apa_formatting_and_style_gu
ide/general_format.html
need help with z-scoring method work

1. A
community psychologist is interested in whether spending time in after-school
programs is predictive of the number of arrests as a young adult in a high-risk
neighborhood. After collecting records on 17 individuals over 8 years, the
psychologist compiles the information listed in the table below. Conduct a linear regression
to analyze the
research question.
The steps will be the same as the
ones you have been practicing in Part 1 of the assignment—the only difference
is that you are now responsible for creating the data file as well. Remember to
name and define your variables under the “Variable View,” then return to the
“Data View” to enter the data. (3 pts)
Table is shown
on the following page.

Hours Spent in After-School Programs

Number of Arrests After Age 17

3

41

68

29

12

121

0
54

19

134

106

67

25

73

38
4

110

31

2. Construct
a scatterplot of the relationship between the 2 variables. Plot the regression
line on this graph. (3 pts)
3. Is
time spent in after-school programs predictive of the number of arrests as a
young adult? Write a Results section in current APA style describing the
outcome. All homework “Results sections” must follow the example given in the
Course Content document “Writing Results of Statistical Tests in Current APA
Format” (Note: you do not have to refer to a figure). The statistical statement for a bivariate
linear regression must
include at least the equation of the line and the confidence interval for the
slope (the second row under Confidence Intervals in the output). (3 pts)
Part 3: Cumulative
Homework
1. To
investigate the relationship between hours spent studying and exam scores,
researchers measured the following. Is there a significant relationship between
hours spent studying and scores? Choose the correct test to analyze this
question, set up the SPSS file, and run the analysis. Follow the directions
under the table on the following page.

Hours Spent Studying

Exam Scores
 1
3
3
4
4
5
5
5
6
6
7
7
8

40
50
51
61
73
71
64
75
68
76
94
85
84

a)
Paste appropriate SPSS output. (3 pts)
b)
Paste appropriate SPSS graph. (3 pts)
c)
Write a Results section in current APA style describing
the outcome. All homework “Results sections” must follow the example given in
the Course Content document “Writing Results of Statistical Tests in Current APA
Format” (Note: you do not have to refer to a figure). (4 pts)
need help with mini paper

The Mini-Paper is a single-page composition on the assigned question.Mini-paper question:

Please discuss your understanding of the FBI’s National Incident-Based Reporting
System (NIBRS) Format:One full page, headed with the student’s name. (No cover
page.)Narrative must be double spaced, with1 inch margins, written in #12 font.All
supportive references must be cited in APA format with an in-text citation as well as a full
citation on a separate Resources page.No directly quoted (copy/paste) material may be
used in this project paper.Resources should be summarized or paraphrased with
appropriate in-text and Resource page citations.MUST FOLLOW RUBRICS For grading
criteria (Rubrics For grading criteria is attached) Absolutly No Plagerism
Need help with my assessment on Unstructured data management. I

Need help with my assessment on Unstructured data management. I need it by Tuesday

21st September, 4 pm (ACST). The assessment must be very well written and the
assessment manual need to be followed thoroughly. It is a 1500 words report. There can’t
be any plagiarism as it will be checked for plagiarism and I would need the plagiarism check
report. Please follow the assessment manual and word limits for each section carefully.
Referencing must be done properly with a bibliography at the end. Harvard style
referencing. Only those who can actually do it properly message me because if this goes well
I will take your help for more assessments.
need help with my assignment 18

Research the range of contemporary issues teenagers face today. In a 500-750-word paper,
choose one issue (besides teen pregnancy) and discuss its effect on adolescent behavior and
overall well-being. Include the following in your submission:Describe the contemporary
issue and explain what external stressors are associated with this issue.Outline assessment
strategies to screen for this issue and external stressors during an assessment for an
adolescent patient. Describe what additional assessment questions you would need to ask
and define the ethical parameters regarding what you can and cannot share with the parent
or guardian.Discuss support options for adolescents encountering external stressors.
Include specific support options for the contemporary issue you presented. Prepare this
assignment according to the guidelines found in the APA Style Guide, located in the Student
Success Center. An abstract is not required.
need help with my care plan, I will submit some

need help with my care plan, I will submit some patient’s information and the rest you can
make it up as stating by our professor. The care plan is about maternal and newborn. I will
upload a copy of the care plan that you can fill out and a copy of the rubric
Need help with my care planmy patient only had surgery of coronary atheroscleros

Need help with my care planmy patient only had surgery of coronary atherosclerosis of
native artery. That is his diagnosis……he is alert and orientated plus no bed alarms and the
bed is position low. I will post his other info when you pick me. I need it in 6 hrs. Please put
it on the sheet I’m giving you
need help with my exam asap

question 1 Of the seven varieties of critical methods, which are used in chapter six?
Specifically, what does the study in chapter six do that enacts the method or methods it
claims to use?question 2The tragic events described by this criticism occurred several years
ago. Update the study in chapter six by pointing to more recent events which the public
understood through personalization. Did the paradoxes occur in these more recent events
as well?question 3Of the seven varieties of critical methods, which are used in chapter
seven? Specifically, what does this study do that enacts the method or methods it claims to
use?question 4 Your reactions to the sixth chapter may depend on your ethnicity. Do your
reactions to chapter eight depend on your gender? Do they depend as much, or less, or
more? What does your answer tell us about how the reader approaches criticism, and what
the critic must do to anticipate the reader?question 5How much can you get out of a
criticism if you have not personally experienced the text that is being critiqued? You may or
may not have seen this film. But you are likely not to have experienced the public reactions
to the house fires described in Chapter 5. What does a criticism need to do to reach readers
who are unfamiliar with the text being studied?
Need help with my financial Concept

Phase 5 Individual ProjectDeliverable Length:2–3 pagesDetails:Weekly tasks or

assignments (Individual or Group Projects) will be due by Monday and late submissions will
be assigned a late penalty in accordance with the late penalty policy found in the syllabus.
NOTE: All submission posting times are based on midnight Central Time.Create a
comprehensive personal financial plan based upon current and future financial needs. This
plan must include the following:Life expectancy planningSurvivorship needsLifestyle
considerationsFinal disposition of assetsContingency allowancesThe plan should be
organized in the following manner:Current and future income needsDebt acquisition and
retirementAcquisition and disposal of personal assetsEmergency cash fundsInvestment
planRetirement planEstate planTax Plan
Need help with my financial management report (not the video

Need help with my financial management report (not the video part). I need it by Friday
10th September, evening (ACST).The assessment is of 2000 words and must be very well
written and the assessment brief must be followed religiously. I have provided the lecture
slides so that you know what concepts to write about. There can’t be any plagiarism as it
will be checked for plagiarism and I would need the plagiarism check report. Please follow
the assessment brief for word limits for each section and follow that. Reference must be
done correctly in Harvard style and a proper bibliography must be there at the end.Only
those who can actually do it properly message me.
Need help with my homework

Phase 3 Discussion BoardDeliverable Length:400–600 wordsDetails:Reminder: Initial

Discussion Board posts due by Wednesday, responses due by SundayStudents will be
expected to post their first initial discussion board posting by Wednesday of each week.
Discussion posts will be graded and late submissions will be assigned a late penalty in
accordance with the late penalty policy found in the syllabus. NOTE: All submission posting
times are based on midnight Central Time.Students are expected to post their responses to
peers by Sunday. NOTE: All submission posting times are based on midnight Central
Time.Primary Task Response: Within the Discussion Board area, write 400–600 words that
respond to the following questions with your thoughts, ideas, and comments. This will be
the foundation for future discussions by your classmates. Be substantive and clear, and use
examples to reinforce your ideas:Compare the value of homeownership to renting. Make
sure you include the following in your discussion:Advantages and disadvantages of home
ownershipAdvantages and disadvantages of renting Responses to Other Students: Respond
to at least 2 of your fellow classmates with at least a 100-word reply about their Primary
Task Response regarding items you found to be compelling and enlightening. To help you
with your discussion, please consider the following questions:What did you learn from your
classmate’s posting?What additional questions do you have after reading the posting?What
clarification do you need regarding the posting?What differences or similarities do you see
between your posting and other classmates’ postings?
Need help with my presentation

I need help edit my presentation and pamphlet. I have done with it but need some edits and
thoughts to be creative.I need mostly help with my presentation, I didn't finish it yet and
need help with it. ( the presentation should be 10 minutes and I need help which info from
my pamphlet should I include and I also need help writing notes (text) under each slide so
that i can read these notes while presenting)For my pamphlet I wrote the whole text
material but need only help arrange the layout to be more creative.I have attached all the
documentPlease note that i need the presentation within 3 hours but for the pamphlet you
have 7 hours and will extend the time if needed Thank you
Need help with my psychology homework need and essay

A L L writing assignments will be graded on the following criteria:1) Ability to follow

assignment directions2) Demonstrate college, academic-level writing skills, including, but
not limited to, alignment to assignment, grammar, spelling, and structure. No opinions are
allowed, each statement of fact and/or example MUST be substantiated with a credible
source. 3) Each writing assignment should not be less than 500 words. No one-word or one
sentence answers accepted. Everything is structured in paragraph format, no outlines, or
bullet points accepted. Questions should be answered as follows: Paragraph form
paraphrasing both the question and the answer in each response. Please open this folder to
view assignments. Be aware of due dates. No late assignments are accepted under any
circumstances. Early submission is allowed and
eencouraged•https://www.ted.com/talks/dan_gilbert_researches_happiness What is the
tendency to compare to the past WHO IS Daniel Bernoulli What are two kinds of errors do
people make when trying to decide what the right thing is to do? According to Dan Gilbert,
why in the world would anybody ever play the lottery? What were our brains evolved for?
Why are we so bad at using Bernoulli's gift? What is the only thing that will destroy us? By
and large people are enormously_______________? What do we do if a decision is far into the
future What is dynamic inconsistency?
Need help with my research paper

Why Senior Assisted Living (example, Brookdale Senior Living , Sunrise Senior Living, etc)
failed or didn't do well with growth in their business? Every points that you state and
analyze need strong evidences and examples from credible sources to support your
position. You need at least 5 credible sources. All quotes must be cited in APA format.
Graphs and Charts are not parts of paper (at least 1500 words or 3 single spaced for your
paper not including the Reference and Cover pages).So please include all the sources,
articles, webpage for the research paper in the last page. Thank you
Need help with my short assignment

4 My Proposed Price(s) [ Penalty = 0.00(0) ]Comment:100 word literature review on 9

journal articles EACH. These articles must relate to- child sedentary behaviour and screen
time usage (technology: tv, mobile phone, computer, iPad, laptop, etc)- screen time and
sedentary behaviour related to obesity or other health issues in children/adolescents aged
8-16- influences in sedentary time In children/adolescents eg. Ethnicity, parental income
and education level, etc- how parental rules influence a child’s sedentary time using
technology positively eg. Limited screen time usage could influence sedentary behaviour
positively.Articles must relate back to this study:Ramirez, E.R., Norman, G. J., Rosenberg, D.
E., Kerr, J., Saelens, B.E., Durant, N., & Sallis, J. F. (2011).Adolescent screen time and rules to
limit screen time in the home.Journal of Adolescent Health, 48, 379-385 doi:
10.1016/j.jadohealth.2010.07.01
need help with online accounting quiz and homework

Hello friend,I am currently taking an online course that I need help with. What I need done
is the homework and quiz that is due really soon. This course is online, and you will be
provided with the access to it. There is a syllabus and textbook that will be provided to you.
Feel free to use the course content stuff in the portal’s folders as well.Attached are images
that provide guidance on how to navigate the website, as well as what the homework looks
like. Chapter 8: Master Budgeting-Profit Planning IS WHAT YOU’LL CLICK ON. is the thing
you click on. COMPLETE BOTH THE HOMEWORK AND QUIZ. ONCE YOU ARE DONE WITH
THE HOMEWORK, DO NOT SUBMIT IT DIRECTLY BUT ATTACH IT HERE.ONCE AGAIN,
COMPLETE THE HOMEWORK AND ATTACH IT HERE ONLY. IF YOU SUBMIT IT DIRECTLY I
WILL BE FORCED TO ASK FOR A REFUND.
need help with online chemistry lab details below

ALL LABS REQUIRE A COMPLETE AND PROPERLY FORMATTED LAB REPORT; ANY
ASSIGNMENT THAT DOES NOT HAVE A LAB REPORT WILL BE GIVEN A FAILING GRADE. A
SAMPLE REPORT FORMAT CAN BE FOUND IN THE BLUE BOX IN THE TOP RIGHT CORNER
OF THE PAGE.Complete this Virtual Lab by interacting with the online Simulation. Answer
the Virtual Lab Questions in complete sentences to demonstrate your learning. Submit your
answers in a word document.Click on the link
http://www.intervisualtechnology.us/data/1/22383/Lab_report_outline.pdf to View the
Lab Report Outline. Your work must be done in this format.To open the lab link:
http://www.glencoe.com/sites/common_assets/science…
need help with paper 17

Need this due tomorrow by midnighYou will choose a theorist whose work is significant in
the field of child development. (Theorist choices: Piaget, Vygotsky, Bronfenbrenner,
Montessori, Erikson, Bowlby/Ainsworth (Attachment Theory), Watson and Skinner.)You
will write a five page paper covering the history, major concepts/ideas, and educational
relevance of your chosen theorist. You will use a minimum of three references (one can be
the text). You must use both in-text citations and a reference list in APA format (see the
following website for guidance on APA
https://owl.english.purdue.edu/owl/resource/560/01/ (Links to an external site.)Links to
an external site. ). Your paper will have the following sections:Relevant historical
information about the theorist including: events/trends that contributed to their work;
mentors who influenced the theorist’s work; how that person’s work was/is
received.Highlights of the theory, developmental stages (if any), and key concepts. In this
section, describe in detail the major concepts, assumptions, debates, and principles that are
central to this theory of child development.How does this theory address the cognitive
processes associated with various kinds of learning (e.g., critical and creative thinking,
problem-structuring and problem-solving, invention, memorization, and recall) – If this
theory does not address cognitive development, describe what domains of development it
addresses.How does this theory relate to education? From the perspective of this theory,
how can teachers support students in their learning and development?How does this theory
apply to children from diverse socio-economic and cultural backgrounds?
need help with paper 39

Search the following key terms: discrimination complaint process, litigation process,
mediation process, and dispute resolution.John identifies as a Hispanic employee in a
private sector organization. He is regularly called an “idiot” by his supervisor. The
supervisor has hardly ever called non-Hispanic employees derogatory names. Finally, the
supervisor starts calling John an inflammatory name that is known to be derogatory to
Hispanics. John now finds his work environment intolerable though his supervisor has no
intention to demote or fire John for any reason. John, however, wants to file a discrimination
complaint against his employer. He went to his HR department first, but was dissatisfied
with their lack of help.Prepare a 700- to 1,050-word paper written in the third person voice
in which you analyze and explain the discrimination complaint and civil litigation process as
it would potentially apply to John and his employer.What are the elements of a hostile work
environment harassment claim?Can John potentially satisfy the elements of a hostile work
environment harassment claim?Does his employer have any defense for the supervisor’s
conduct?Identify whether John can make a prima facie case of hostile work environment by
identifying the elements required to bring a cause of action for discrimination.Explain how
the complaint process begins with the Equal Employment Opportunity Commission (EEOC)
and proceeds with a right-to-sue letter through the civil litigation process from the state
level up to the U. S. Supreme Court.Include a discussion on Title VII of the Civil Rights Act of
1964 and other relevant aspects addressing discrimination complaints and disputes in the
workplace.Format your paper consistent with APA guidelines, including using headings to
appropriately signal topics to keep your document organized.Use a minimum of three
different in-text citation sources within your paper, and properly identify them in your
References page. Any laws and legal cases used in the body of your paper must also be
included in the References page.
need help with paper 45

Identify a situation that could be considered an example of discrimination and/or

harassment in the workplace. This can be something that you have experienced or seen in
person, or something that you create.Write a short 4- to 6-sentence case study scenario that
describes this incident. Conduct a 700- to 1,050-word analysis of the case study on the same
document.Include the following in your analysis:Explain the type of discrimination and/or
harassment that took place in your case study scenario. What were the key indicators that
this behavior was a violation of workplace policy? Summarize how to conduct a proper
investigation of these claims. Determine which U.S. employment laws were violated in your
case study scenario. How were the laws violated? What change(s) would you make to
minimize future occurrences of these violations?Cite any outside resources according to
APA formatting guidelines.
need help with paper 700 to 1000 words

During a global career succession assessment of leadership talent pipeline, a candidate was
asked to complete a personality/behavioral tendency profile. The candidate asked to speak
to the program administrator about the validity of the assessment. The assessment is based
on first responses to several sets of word values. The instructions were to respond with first
instinct to the set of words listed in several different categories. The candidate stated that
some of the words could have different interpretations based on values, beliefs, and cultural
origin. Therefore, the validity of the assessment could be biased in terms of
results/outcomes. The program administrator removed the weighting of the assessment
(not part of the overall assessment scoring) to be used for informational and team building
purposes only. Use the above information to answer the following in 700 to 1,050
words:Analyze whether the candidate has a valid discrimination concern about the
assessment.Determine what EEOC laws could potentially be at risk of violation.Evaluate
how the assessment could be altered so that it could still be used for the program. Cite all
sources according to APA 6th formatting guidelines. ONLY!
need help with paper about personality traits

Locate and take a free online assessment that uses the Big Five personality factors.Write a
1,050- to 1,400-word paper describing your personality traits based on your findings from
the Big Five assessment tool. Include the following in your paper:Summarize your
results.Propose solutions for working with other personality types using the information
from the Big Five assessment and the underlying principles of trait theories.Describe how
your results from the assessment compare to the 16 personality factors. Explain how your
results are relative to genetics.Include an introduction and conclusion, and cite at least two
sources other than your textbook.Format your paper according to APA guidelines.
need help with power point in leadership

Create a 15- to 20-slide Microsoft® PowerPoint® presentation on the interaction and

influence among leadership tactics according to the following criteria:Explain power and
compare how it relates to leadershipAnalyze the five sources of powerSummarize the
relationship between influence and powerDetermine how relationships between leaders
and staff affect influence and powerCite a minimum of two references other than the
text.Format your assignment consistent with APA guidelines.Submit your assignment.
need help with pressentation

Scenario: You are an employee of Cabot Nutrition, a company that manufactures various
vitamins, minerals, and other supplements including infant formula. An employee was
found to have tampered with infant formula during production, and has since been
terminated. On his termination day, the employee became violent and struck his supervisor.
Several infants have become ill as a result of the tampering, but all injuries have been
reported as non-life-threatening. Two of your employees used this infant formula with their
infants, and both infants are ill. You have been tasked with creating a response to this
product-tampering crisis.Create a 12- to 15-slide presentation with speaker notes to senior
management detailing your response.Include the following in your memo:Describe the
crisis in detail, including additional facts that you create and the results of your
investigation.Create a Crisis Management Taskforce, and list the job titles and
responsibilities of each member.Develop a Crisis Management Plan to address this incident
and help mitigate/prevent this type of crisis and workplace violence in the
future.Summarize key components of a Workplace Violence Prevention Policy.Explain how
you will communicate your response to this crisis both internally (to the company) and
externally (to the public), and include any support or recompensing plans.
need help with proofreading power point exercise

This week’s readings and activities focused on how reason, emotion, and
communication may influence critical thinking. In this assignment, you will identify the
concepts of reason, emotion, and communication in your everyday critical thinking
practices, and you will compile them in a Microsoft® PowerPoint® presentation
template that is provided for you. Ensure that you have installed Microsoft® Office 365
prior to beginning this assignment. The University provides this for you through
PhoenixConnect. If you do not already have this installed, go to Office 365 ProPlus & Email
Support and follow the 5 steps to install Office 365 on your computer. Review the
Microsoft® PowerPoint® video tutorials from the Media Library for additional
assistance. Complete the Reason, Emotion, and Communication in Everyday Critical
Thinking Presentation Template. Instructions for what to include are provided in the
speaker notes section for each slide, which can be accessed by clicking the “View― tab
at the top, and clicking “Notes.― The speaker notes represent what you would say in
regards to each slide were you to give the presentation in person. You may add pictures and
graphics to enhance your presentation, and you are welcome to change the design layout of
the presentation.Review PC – PowerPoint 2013 – View Speaker Notes and PC – PowerPoint
– View Speaker Notes for additional details on adding presenter notes to your presentation.
need help with psychology writing assignment

Note: At the start of the Marin video, listen very carefully to what the doctor advises about
the flu vaccine and how the mother replies. Also, listen carefully to the mother’s reasoning
behind her resistance to the Chicken Pox vaccine.Marin County Vaccine Refusal (Links to an
external site.)andSanta Monica Vaccine Refusal (Links to an external site.)STEP 2: watch 2
segments of a lecture given by sociologist Richard Arum on his studies (with Josipa Roksa)
of the causes and consequences of inadequate college educations. Watch the video from:
8:28 until 39:34 and then from 54:45 until the end. Richard Arum Video (Links to an
external site.)STEP 3: Write a 250-450 word (maximum) brief report on the issue of
inadequate critical thinking/reasoning among college educated persons. In your brief
report, address both questions below. Address the following questions:1. Identify the likely
presence (or evidence) of “pre-reflective” and “quasi-reflective” judgment among college
educated parents who refuse to have their children vaccinated. What did the parents say
that lead you to that conclusion?2. Describe the test Arum and Roksa used to measure
higher order reasoning and writing skills and what happens to students after graduation
when they failed to develop these generic skills. (Note: Arum will use the term “quintile.”
This means 20%. So the “top quintile” would be the top 20%, etc.). Make sure to refer to
information presented throughout the audio/videos, that is, your report should make clear
that you listened to/watched the audio/video assignments in their entirety.
need help with questions 2

1. From the scenario for Katrina’s Candies, determine the appropriate type of market
structure for the situation in question. Cite at least four (4) defining characteristics that
have helped you reach this decision regarding the appropriateness of the chosen
structure.2. Recommend two (2) kinds of pricing and output strategies that Katrina’s
Candies should use to reach the goal of profit maximization. Suggest key modifications that
Katrina’s Candies should make in order to maintain a competitive advantage when new
entrants enter the market. Provide a rationale for your suggestions.3.Imagine that you are a
manager of a chemical company. An accident has occurred in which chemicals leaked into
the ground water nearby. The community is unaware of the accident. Compare the primary
costs involved in cleaning up the water immediately (and thus confessing) versus hiding
your culpability now and possibly paying more in the future. Predict the impact on
profitability in both situations. Justify your response.
need help with questions 2-7MGMT 650 Fall 2016 Problem Set 11)Using the data file,
GRADSURVEY, answe

need help with questions 2-7MGMT 650 Fall 2016 Problem Set 11)Using the data file,
GRADSURVEY, answer the following:a)What does a row correspond to in the table?b)How
many variables are measured on each row?c)For each variable, would you describe it as
primarilycategorical, or quantitative? If quantitative, what are theunits? If categorical, is it
ordinal or simply nominal?d)Are these data a time series, or are these crosssectional?2. A
quality characteristic of interest for a tea-bag-fillingprocess is the weight of the tea in the
individual bags. If thebags are under filled, two problems arise. First, customersmay not be
able to brew the tea to be as strong as theywish. Second, the company may be in violation of
the truthin-labeling laws. In this example, the label weight on thepackage indicates that, on
average, there are 5.5 grams oftea in a bag. If the average amount of tea in a bag exceedsthe
label weight, the company is giving away product.Getting an exact amount of tea in a bag is
problematicbecause of variation in the temperature and humidity insidethe factory,
differences in the density of the tea, and theextremely fast filling operation of the
machine(approximately 170 bags a minute). The following tableprovides the weight in
grams of a sample of 50 bagsproduced in one hour by a single machine:5.85 5.84
5.425.45.53 5.34 5.54 5.45 5.52 5.415.57 5.4 5.535.67 5.4 5.475.77 5.57 5.425.61 5.45
5.445.545.615.585.255.55 5.62 5.66 5.465.53 5.32 5.67 5.295.68 5.5 5.32 5.55.56 5.63 5.5
5.575.645.495.535.675.515.555.585.36a. Compute the arithmetic mean and median.b.
Compute the first quartile and third quartile.c. Compute the range, interquartile range,
variance,standard deviation, and coefficient of variation.Parts d and e are your chance to
show your understanding.You are a consultant brought in by the company and giventhe
sample. What are your recommendations to thecompany, based on your reading for this
week?d. Interpret the measures of central tendency within thecontext of this problem. Why
should the companyproducing the tea bags be concerned about the centraltendency?e.
Interpret the measures of variation within the context ofthis problem. Why should the
company producing thetea bags be concerned about variation?3. According to Zillow.com,
here is a list of the prices of theproperty sold (in thousands) in Washington, DC June 29 –
30,2016.$316$265$299$469$240$575$1,015$105$320$1,250$192$721$320$700$420$4
40$368$918$2,950$585$428$563$451$560$956$333$536$625$562$930$1,575$406$67
3$780$405$444$961$570$288$475$443$675$449$1,550$945$785$913$879$495Use the
house price data and five bins create a histogramusing the data analysis tool.4.As part of the
marketing group of a film company, youare asked to find out the age distribution of the
audience ofthe latest film. You ask questions of customers who exit thetheatre. From 470
responses, you find that 45 are youngerthan 6 years old, 83 are 6 to 9 years, 154 are 10 to
14, 18are 15 to 21, and 170 are older than 21.a) Make a frequency table of these categorical
data.b) Make a relative frequency table.c) Make a bar chart using counts in the frequency
table.d) Would a bar chart of relative frequencies look anydifferent?e) Make a pie chart.f)
Write a few sentences summarizing the distributiondemonstrated by your charts and
tables.5.In addition to age grouping information, the audiencesinterviewed were also asked
if they had seen the moviebefore (Never, Once, More than Once). The two-waycontingency
table shows the results.neveroncemorethanonceunder63936 to960203310 to 15 to
over1421218416151382153204a) Find the marginal distributions of their previous
viewingof the movie.b) Verify that the marginal distribution of the ages is thesame as that
given previously.c) Find column percentages.d) Looking at these percentages, does the
distribution ofhow many times someone has seen the movie look thesame for each age
group?e) Make a stacked bar chart showing the distribution ofviewings for each age
level6)Age20303825353230222242341444324429294835443011263248A survey of
customer age also asked about gender.Gendermffmffmmmffmfffmmfffmmfffa) Compare
critical descriptive statistics for males andfemales. Write a sentence or two summarizing
whatyou found.b) Construct boxplots of male and female.7. This file contains the per capita
energy consumption in kilowatt hoursfor each of the 50 states and DC during a recent
year.a) Compute descriptive statistics.b) What proportion of states has per capita energy
consumption withinplus and minus 1 standard deviation of the mean, plus and minus 2 and
plus and minus 3?What should you expect to see? Look at information on the Empirical
Rule.Hint: Calculate z scoresStateCaliforniaRhode IslandNew
YorkMassachusettsHawaiiPennsylvaniaNewHampshireAlaskaNew
JerseyConnecticutVermontMaineColoradoUtahNew MexicoMichiganSouth
DakotaIllinoisMarylandMinnesotaArizonaWisconsinFloridaMissouriKansasIowaVirginiaNe
braskaMontanaOklahomaKilowattHours639667167135774479138006809585438667908
1930995321000210273103441049110806109031142512019120671210312393126141
27431325513536136911374313918DelawareOregonNorth
DakotaGeorgiaNevadaOhioWest
VirginiaNorthCarolinaTexasArkansasMississippiIndianaWashingtonTennesseeIdahoLouisia
naAlabamaSouthCarolinaKentuckyD.CWyoming1392614172143801446514511145931502
2150331505915595158851627716357169931745317902183991886519970200732456
7
need help with Rational Equations and Inequalities Practice? details attached in document

Don't use plagiarized sources. Get Your Custom Assignment on need help with
Rational Equations and Inequalities Practice? details attached in document Just
from $13/Page
Order Essay details of question attached below.
Need Help with research Critique

I need help with this research critique I need it done by 8/3/13 by 4amNO PLAGERISM
please it will be turned in through turn it in The research critique consists of reading three
research studies and answering several questions about each. All three studies have been
provided for you. The studies selected for the critique are as follows: Article 1:Guerette, Rob
T. (2007). “Immigration Policy, Border Security and Migrant Deaths: An Impact
Evaluation of Life Saving Efforts under the Border Safety Initiative.― Criminology &
Public Policy, 6(2): 201-222. Article 2:Kovandzic, T., Sloan, J., and Vieraitis, L. (2004.
“’Striking Out’ as Crime Reduction Policy: The Impact of ‘Three Strikes’
Laws on Crime Rates in U.S. Cities.― Justice Quarterly, 21(2): 207-239. Article
3:D’Alessio, S; Stolzenberg, L., and Terry, W. Clinton III (1999). “Eyes on the
Street―: The Impact of Tennessee’s Emergency Cellular Telephone Program on
Alcoholrelated Fatal Crashes.― Crime and Delinquency, 45(4): 453- 466. For each of these
research articles perform the following: 1. Identify the research design used. 2. Specify the
type of data used to conduct the analysis. 3. Identify the sampling procedure employed. 4.
Specify the dependent variable of the study. 5. Present the key findings of the study. 6.
Identify at least 3 limitations of the study (e.g. threats to validity, reliability, etc.) and
explain each. Provide separate answer sheets for each article and identify your responses to
the specific question above that you are answering. Your responses should be typed, 12
point font, and single spaced. Your answers are due on the last day of the week that the final
exam is scheduled). Be sure to explain each of your answers fully. You should strive to be
as comprehensive in your answers as possible as if you were explaining your answers to
a lay person who knows nothing about research methodology.
need help with peer’s response

need help with peer’s response

need help with rogerian paper

Paper is due October 28, 2018 and Annotated is due October 15, 2018 @ 8:00 pmLength: 5
full pages required, plus a Works Cited PageFormat: MLAAudience: AcademicStudents will
recall the various developmental writing methods and organizational structures and use
Standard English guidelines to create a college level research paper.Students will
understand the audience and appropriate tone to create a persuasive and believable
argument that avoids attacking the opposition but instead understands the opposition and
aims for compromise.Students will apply the rules of argumentation, including avoiding
fallacies and bias. Students will analyze the different sides of an issue in current events for
understanding, evaluate two opposing claims and form a solution that would compromise
between the two viewpoints. Students will evaluate the relative worth of outside sources
and their usefulness in the research and application to the arguments presented.Students
will compose a well-developed argumentative essay that integrates short quotes and
summaries/paraphrases applying correct MLA documentation. Assignment: You
may if you wish use the same issue that you explored in the first paper. However, remember
that this is a separate paper and different assignment. Follow instructions for this paper
closely. If you do use the same topic as the first paper, you will be able to condense and
revise the first paper to fit only section IV of this paper. You will still have to conduct new
research for the paper and write a considerable amount to cover the rest of the paper.
Your topic is a current problem in the world. After narrowing down your topic to a specific
concern with the problem, your paper would then present two opposing viewpoints, then a
compromise between the two viewpoints that would potentially solve the problem. You
may not write about abortion, religion (creationism vs. evolution), gay marriage, marijuana
legalization, or euthanasia/physician-assisted suicide. I do have the old paper but it was
not all that great totally up to you if you would like to use it
need help with science journal assignment

Hi good morning, I was wondering if you could help me with an assignment? I would need it
by Sunday at 6:00 pm eastern standard time zone if possible.The assignment is as
follows…..We currently (and for the past years) hear and read a lot about global warming. In
a few paragraphs explain what global warming is and what is the expected cause. As usual,
use outside references at least 5 different references and cite your sources. Identify
greenhouse gases, what has changed over time, and what potential outcomes might be.APA
format, Times New Roman, 12 point font, Double Spaced, and plagiarism free. 250 words so
about 2 to 3 pages in length.If your able to help me with this assignment I would be so
greatful. Thanks again.
need help with section homework

summary paragraphs about the articles: Do not rewrite the introduction.critique

paragraphs: give a reason critique of the articles- were that element of the experiment that
need improvement? were there weaknesses in the process? are the conclusion in the
articles fairly drawn? what was good or bad in the articles? Why?summary of the article (2
paragraph)critique- identified both strong and weak points of the article and/or
experimental design. A clear concise argument (2paragraph)reflection- relate article
information, give explanation why article is chosen
need help with sociology assignment

“Reality is not out there, it is socially constructed.”Analyze the above statement using an
example of gynecological exams Write 150-200 words). Next, relate the above statement
with the idea of dramaturgy in approximately 150 words. Second assignment- Research
paper on Communication 200 words or less need to be cited no Wikipedia
need help with some ethical or legal stuff

Patients have a bill of rights. Patients also consent to care and have a right to self-determine
their care. Those who care for patients are to keep information protected. Select one of the
patient rights (ethical or legal issues and a different one chosen by another student) from
readings this week. Discuss with your colleagues the right, the legal and/or ethical basis for
this right and how this translates into responsibility for a specific health service
organization setting. Provide two specific real life case examples that you find on the
internet or in the print media. Examples: assisted living facilities for disabled, long term
care facility, a home care nursing association, a small physician practice, a hospital, a
rehabilitation center, or a first responder/ambulance. Discuss 1. The patient right (with
proper legal citation);2. The setting; and3. The health care organization’s
responsibility.Reference Background Readings this
week:http://www.whitehouse.gov/files/documents/healthcare-fact-sheets/patients-bill-
rights.pdf [The White House]http://www.nrc-
pad.org/images/stories/PDFs/fedaddirectives2a.pdf [ Federal Law on Advance
Directives] http://www.aha.org/content/00-01/pcp_english_030730.pdf [Website may say
no there but just click on the heading above notice. Many articles on patience
rights]http://www.healthsourceglobal.com/docs/patient%20bill%20of%20rights_merged.
pdf [patient’s rights, protections and the law]http://partnershipforpatients.cms.gov/ [gov
website partnership for
patients]http://www.nejm.org/doi/full/10.1056/NEJMp1209500 [shared decision making]
need help with statistics homework

Power+,Inc. produces AA batteries used in remote controlled toy cars. The mean life of
these batteries follows the normal probability distribution with a mean of 37 hours and a
standard deviation of 5.5 hours. As part of its quality assurance program, Power+, Inc. tests
samples of 9 batteries a) What can you say about the shape of the distribution of the sample
mean?Binomial Uniform Normalb) what is the standard error of the distribution of the
sample mean? (Round your answer to 4 decimal place
need help with strategic marketing 4

McDonald’shttp://www.aboutmcdonalds.com/mcd/sustainability/our_focus_areas.htm
lRead about McDonald’s social responsibility initiatives.How has McDonald’s
integrated social responsibility with its marketing strategy?Are you surprised at
McDonald’s level of involvement in giving back to its communities?Other than Ronald
McDonald House Charities, why have most consumers never heard of McDonald’s many
philanthropic initiatives?
need help with the beginning stages of a research paper

Media’s influence on body image – this is the topic I selected.Please follow all instructions
carefully.Craft a research question on the topic you selected in your first discussion
question post. Then locate at least five articles from peer-reviewed journals that pertain to
your question that will be used to write the introduction section of your research
proposal.Submit these five citations in the form of an APA-style reference page. Under each
citation, write one paragraph summarizing the main points of the article. As you read your
articles, keep the following questions at hand; these will help you generate the information
about each article.What were the topic/research questions being investigated?How was the
study conducted (participants, materials, procedure, etc.)?What did the results reveal?How
might these methodological considerations affect the research findings and the conclusions
drawn from them?How does this article fit in with your paper? How did it influence your
own ideas about your paper?Based on your reading of the literature, what do you expect to
find?Include a hypothesis and a title page for your submission.Submit your paper to the
Submissions Area by the due date assigned. All written assignments and responses should
follow APA rules for attributing sources.
need help with the following questions

Chris and Karen are married and own a three-bedroom home in a large midwestern city.
Their son, Christian, attends college away from home and lives in a fraternity house. Their
daughter, Kelly, is a senior in high school. Chris is an accountant who works for a local
accounting firm. Karen is a marketing analyst and is often away from home several days at a
time. Kelly earns extra cash by babysitting on a regular basis.The family’s home contains
household furniture, personal property, a computer that Chris uses to prepare business tax
returns on weekends, and a laptop computer that Karen uses while traveling. The Swifts
also own three cars. Christian drives a 2007 Ford; Chris drives a 2012 Pontiac for both
business and personal use; and Karen drives a 2014 Toyota and a rental car when she is
traveling. Although the Swifts have owned their home for several years, they are
considering moving because of the recent increase in violent crime in their
neighborhood.Describe briefly the steps in the personal risk management process.Identify
the major pure risks or pure loss exposures to which Chris and Karen are exposed with
respect to each of the following:Personal loss exposuresProperty loss exposuresLiability
loss exposuresWith respect to each of the loss exposures mentioned above, identify an
appropriate personal risk management technique that could be used to treat the exposure.
need help with the listed below homework

Unit 4 Although your text does an excellent job of describing concepts and theories about
development, the ability to apply those theories to real world instances is an integral part of
learning. Pick at least two concepts for the applicable age group from this unit that are of
interest to you. Then find an individual or a video to watch that exhibits the concepts you
have chosen. If you choose to watch a video, be sure and cite the source in APA format. In at
least a one page, typed and double-spaced document, describe how and why your
observation exhibits the concept from your textbook.See Assignments And Grading for
details about the CA Observations Report.Due Sunday at 11:59 CTDevelopment Time
PeriodData CollectionUnit CA Observation Report DueThe First Two YearsObservation Unit
2The Play YearsObservation Unit 3 The School YearsObservation Unit 4AdolescenceLibrary
Research Unit 5Early/Middle AdulthoodObservation Unit 7Late AdulthoodObservation Unit
8
Need help with the topic for dehydration. Nurse The NoteBook…

Need help with the topic for dehydration. Nurse The NoteBook…Need help with the topic
for dehydration Image transcription textNurse The NoteBook Dehydration Related
Concepts Related Exemplars/Diseases Reading/Resources – Clinical Judgment
Class/Lab/Clinical – Clinical Judgment rse -Z hink Priority Assessments or Cues Priority
Labs & Diagnostics Priority Nursing Interventions N N N w W Priority Medications Priority
Potential & Priority Collaborative Goals Actual Complications 2 N N Copyright @ 2021 by
NurseTim, Inc. All rights reserved. No reproduction or distribution allowed.
NurseThink.com Learn Right the First Time 161 Place an
Order We do custom work 100% original and plagiarism free .If you need
help in any assignment just send us requirements with time limit ,we will quote a price and
after your confirmation ,we start working on your assignment. An original work ready for
submission provided to you Name*
First
Last
Email* Description**
Attachment

Drop files here or

PhoneThis field is for

validation purposes and should be left unchanged.
Δdocument.getElementById( "ak_js_1" ).setAttribute( "value", ( new Date() ).getTime() );
if(typeof gf_global == 'undefined') var gf_global = {"gf_currency_config":{"name":"U.S.
Dollar","symbol_left":"$","symbol_right":"","symbol_padding":"","thousand_separator":",","d
ecimal_separator":".","decimals":2},"base_url":"https:\/\/homeworklance.com\/wp-
content\/plugins\/gravityforms","number_formats":[],"spinnerUrl":"https:\/\/homeworkl
ance.com\/wp-
content\/plugins\/gravityforms\/images\/spinner.gif"};jQuery(document).bind('gform_po
st_render', function(event, formId, currentPage){if(formId == 1) {} }
);jQuery(document).bind('gform_post_conditional_logic', function(event, formId, fields,
isInit){} );
jQuery(document).ready(function(){jQuery(document).trigger('gform_post_render', [1, 1])
} );
Need help with These 8 questions. · 5 What does

Need help with These 8 questions.· 5What does a positive Homan’s sign indicate?·
Diagnosis of deep vein thrombosis· Peripheral artery disease· Calf pain with dorsiflexion of
the ankle· Vitamin B12 deficiency· Question Points: 0.0 / 1.5 · 6What is the most commonly
used steroid to treat spinal cord compression?· Prednisone· Methylprednisolone succinate
(Solu-Medrol)· Hydrocortisone succinate (Solu-Cortef)· Dexamethasone (Decadron)·
Question Points: 0.0 / 1.5 · 11What type of pain occurs due to bone metastasis?· Visceral
pain· Somatic pain· Neuropathic pain· Peripheral pain· Question Points: 0.0 / 1.5 · 12A 39-
year-old male with no significant past medical history presents to the ER with purulent
sputum, low-grade fever without chills, mild dyspnea on exertion, and rare hemoptysis for
the past 4 days. What diagnostic finding would support your diagnosis of acute bronchitis?·
Sputum gram stain and CNS: Usually show gram-negative diplococci.· CBC: Usually shows
elevated WBC with acute bronchitis.· CXR: Usually shows pleural effusion that layers out in
lateral decubitus position.· CXR: Usually shows absence of lung infiltrate.· Question Points:
0.0 / 1.5 · 14Which of the following criteria is not a requirement for acute rehab
admission?· Requiring two or more therapy disciplines· Able to follow commands· Able to
feed one’s self· Physical stamina for 3 hours a day· Question Points: 0.0 / 1.5 · 15Which of
the following patients would benefit most from being admitted to an acute rehab hospital
after discharge?· 42-year-old female after biocartilage implantation· 70-year-old
cantankerous male after a myocardial infarction· 65-year-old female after a stroke· 63-year-
old confused male after a laminectomy· Question Points: 0.0 / 1.5 · 19What is a common
problem for patients with spinal stenosis?· Pain upon waking· Radiating pain while sitting·
Pain in both legs with activity· Back pain that worsens with standing· Question Points: 0.0 /
1.5 · 23What is the most common contracture in a patient with cerebral palsy?· Adduction
of the shoulder· Adduction of the hip· Abduction of the hip· Adduction of the
shoulderQuestion Points: 0.0 / 1.5
Need Help with these questions. Reading Material attached Locate the

Premium Paper Help is a professional writing service that provides original papers. Our
products include academic papers of varying complexity and other personalized services,
along with research materials for assistance purposes only. All the materials from our
website should be used with proper references.
need help with this as soon as possible

Rhymes & PoemsPlease add a children's rhyme . Write down the rhyme, tell us if it's one
you know or where you found it online (please include a link to the site), and identify what
kind of rhyme it is: nonsense rhyme, counting rhyme, skipping rhyme, clapping game,
fingers & toes game, lullaby, riddle, dance, parody, didactic rhyme, story rhyme, or
something else. Also, tell us if it uses rhyme, assonance, and/or alliteration.Next, add a poem
about yourself! You can imitate a traditional poem (like "Mary had a little lamb") or follow a
modern pattern. Margaret Wise Brown (the author of Goodnight Moon) wrote a picture
book entitled The Important Book (1949). She describes ordinary objects by listing four
characteristics and highlighting the most important. For example: "The important thing
about a shoe is that you put your foot in it. / You walk in it, / and you take it off at night, /
and it's warm when you take it off. / But the important thing about a shoe is you put your
foot in it."(/// just indicate line breaks.)Here are my examples:Traditional: Katie had a baby
son / whose smiles were sweet as milk / And everywhere that Katie went / you could find
baby Nick. [milk/Nick uses assonance instead of a full rhyme]Modern: The important thing
about Katie is that she's Niko's mom. / She likes to garden and teach Niko each plant's
name. / She has to read every day or else the day is incomplete / and that's why she teaches
literature. / But the important thing about Katie is that she's Niko's mom.oh, please make it
look simple and clear and do not use any complicated words or sentences also, do use or
write sexual poems, find one look decent
need help with this assignment 52

The purpose of this assignment is to analyze the duties of administrative agencies and the
ethics behind regulatory compliance requirements. Assignment Steps Scenario: Eric is an
Assistant Vice President at marine paint manufacturing plant. One day, he accidentally
discovers an email from his boss, the Vice President, to the President, notifying him of an
internal study finding the paint leeches from the bottom of boats into the marine
environment. The paint has been found to create birth defects in marine life. He also sees
the President’s response email, in which he directs the Vice President to erase all evidence
of the study and tell no one. The President also directs the Vice President to erase the email.
Eric is concerned about the findings of the study, but he also fears losing his job.Create a
350- to 700-word analysis, written in the third person voice, with the following
information:Which administrative agency governs regulatory compliance of the
manufacturer?What are the ethical concerns regarding the President’s actions, and what do
you believe Eric should do?Format your paper consistent with APA guidelines. You must
use APA formatted headings to add organization to your paper. Use bold and centering for
first-level headings, and put second-level headings in bold at the left margin. Capitalize all
major words in both headings and eliminate italics. Have a Summary or Conclusion used as
a first-level heading.Format your paper so that all paragraphs have a minimum of three
sentences.Use at least a minimum of TWO different in-text citation reference sources within
your paper and they must be identified in your APA correctly formatted References page.
Using more than two sources will add further credibility to your paper.Save your paper as:
Last name, Wk 2, Torts & Ethics PaperClick the Assignment Files tab to submit your
assignment.PLEASE NO PLAGAIRISM
need help with this assignment 74

Case Study 2: iPad and Kindle Reading SpeedsDue Week 6 and worth 150 pointsRead the
“iPad and Kindle Reading Speeds” case, located at http://www.nngroup.com/articles/ipad-
and-kindle-reading-speeds/.Write a two to three (2-3) page paper in which you:Speculate
on two (2) major reasons that people read long-form text faster on tablets now than in the
past. Provide a rationale for your response.Examine the major reasons why readers still
read books faster than tablets. Propose two (2) changes that companies could make to
tablets to change this trend around.Analyze the major reasons why users in the case study
loved reading on iPads but hated reading on PCs. Suggest two (2) changes you could make
to PCs in order to get more users to like reading on PCs.Agree or disagree with the notion
that smartphone and tablet readers will eventually read faster on these devices compared
to physical books. Provide a rationale for your response.Use at least two (2) quality
resources in this assignment. Note: Wikipedia and similar Websites do not qualify as quality
resources.Your assignment must follow these formatting requirements:Be typed, double
spaced, using Times New Roman font (size 12), with one-inch margins on all sides; citations
and references must follow APA or school-specific format. Check with your professor for
any additional instructions.Include a cover page containing the title of the assignment, the
student’s name, the professor’s name, the course title, and the date. The cover page and the
reference page are not included in the required assignment page length.The specific course
learning outcomes associated with this assignment are:Describe and apply usability feature
and ethical issues inherent to mobile devices.Use technology and information resources to
research issues in mobile programming.Write clearly and concisely about mobile
programming topics using proper writing mechanics and technical style conventions.
need help with this assignment 89

INTRODUCTIONWith the increased mobility of human populations, diseases can quickly

spread around the world. In addition, changes in vaccination practices have revealed an
increase in communicable diseases that were once thought to be under control. These
global health issues present new problems for community health officials.In the Bentonville
simulation, you learned how an influenza virus impacted the community. You will provide a
PDF report of your completed activities.In this task, you will also analyze an outbreak of a
specific global communicable disease that occurred in the last 50 years that crossed
international borders (e.g., the measles outbreak that moved from the Philippines to the
United States).REQUIREMENTSYour submission must be your original work. No more than
a combined total of 30% of the submission and no more than a 10% match to any one
individual source can be directly quoted or closely paraphrased from sources, even if cited
correctly. An originality report is provided when you submit your task that can be used as a
guideYou must use the rubric to direct the creation of your submission because it provides
detailed criteria that will be used to evaluate your work. Each requirement below may be
evaluated by more than one rubric aspect. The rubric aspect titles may contain hyperlinks
to relevant portions of the course.A. Select one of the following communicable diseases that
has had an outbreak across international borders:• influenza• measles• respiratory
syndrome coronavirus• meningococcal disease• HIV/AIDS• Ebola virus•
hepatitis B• hepatitis C• tuberculosis• Zika virusB. Describe the outbreak of the
disease selected in part A, including each of the following:• name of the disease• the
countries involved• the date the outbreak was discovered• the dates the disease
reached each involved country1. Analyze the epidemiological determinants and risk factors
associated with the outbreak.2. Discuss the route of transmission of the selected disease.3.
Discuss how an outbreak of the selected disease would impact your community at a systems
level (e.g., the functioning of schools, local government, businesses, hospitals).4. Explain
what the reporting protocol would be if an outbreak of the selected disease were to occur in
your community.5. Discuss two strategies (e.g., patient education strategies, community
education strategies) that you would recommend to prevent an outbreak of the selected
disease in your community.C. Submit a PDF of your score summary from Bentonville that
includes each of the following completed activities:• Influenza in Bentonville•
Community Advocacy• Emergency Response• Communicable DiseaseNote: For an
example of how your score sheet should look, refer to the attached “Sample Final Results
Report: Influenza in Bentonville.”D. Acknowledge sources, using in-text citations and
references, for content that is quoted, paraphrased, or summarized.E. Demonstrate
professional communication in the content and presentation of your submission.File
RestrictionsFile name may contain only letters, numbers, spaces, and these symbols: ! – _ . * ‘
( )File size limit: 200 MBFile types allowed: doc, docx, rtf, xls, xlsx, ppt, pptx, odt, pdf, txt, qt,
mov, mpg, avi, mp3, wav, mp4, wma, flv, asf, mpeg, wmv, m4v, svg, tif, tiff, jpeg, jpg, gif, png,
zip, rar, tar, 7z
Need help with this assignment for IT Management 205

Assignment needed for Wednesday:Develop the flow diagram of the information and any
control
elements needed to ensure proper access for the information.
Submit a 700- to 1,050-word section of the paper with the
following elements:
A diagram of the information flow and any elements controlling
proper access to the information it uses
A description of any proposed business process changes for
the system along with flow diagrams
A specific discussion on any Internet and mobile access
components of the system
Note: Riordan Manufacturing is one of the Virtual
Organizations. Please see the link under Academic Resources or on this entry.Assignment
needed for Sunday:Develop the flow diagram of the information and any control
elements needed to ensure proper access for the information.
Submit a draft PowerPoint presentation with the following
elements:
A diagram of the information flow and any elements
controlling proper access to the information it uses
A description of any proposed business process changes for
the system along with flow diagrams
A specific discussion on any Internet and mobile access
components of the system
need help with this assignment (attached is company foundation i have already started)

Organize your training “day” or “days.” You will create a schedule for your training, and
justify it in this document. Your document will be read by higher management – and this is
the part which will explain to them the schedule of training, who will be attending and who
will be doing the training, the cost-benefit of your training, and your ROI (return on
investment). In the theory section of this, explain how the design of your training will lead
to transfer of training. Your detailed lesson plan and schedule used to conduct the training
will be an Appendix item. (See your textbook table 4.12 on page 157 for an
example.) Anticipated length of body of this assignment: 3-4 pages. Include at least 4
outside references in this portion of your paper, and properly cite them using APA
formatting.Grading for this part of the project will be:Theory of transfer of training and
training design – 15 pointsCost benefit/ROI analysis – 10 pointsLesson plan and schedule in
Appendix – 15 pointsAPA formatting and references – 10 points
need help with this assignment sunday

hello dear this my next assignment due Sunday, Watch the following video, 21st Century
Enlightenment and consider the video’s concluding statement,― Never doubt that a
small group of thoughtful committed citizens can change the world. Indeed it is the only
thing that ever has.― In a three- to four-page paper:Reflect on the video and explain how
it supports the statement above.Include a discussion of the terms social change, progressive
organizing, and community organizing.Describe how individual citizens can respond to
social problems.Consider the following quote, “Activism is living out one’s
values,― and discuss how becoming involved with social change aligns with your own
values.
need help with this assignment unfortunately the assignment is within 24 hours i am really
strugglin

The social marketing theory is a combination of theories that aim to influence attitudes and
behavior. The theory has been applied extensively in the public health field to influence
both healthy and unhealthy behavior. While behavior influence is one main objective of the
theory, it relies on four basic principles.Identify and describe the four main principles of the
social marketing theory.Provide at least one example how the theory can be applied to
influence behavior in a healthy way and an unhealthy way.View the Social and behavioral
change communication challenge (SBCC) at
https://www.youtube.com/watch?v=utW3c7ybv98&feature=youtu.be.According to the
video, what social marketing approach is needed today to effectively influence health
behaviors?Identify two areas mentioned in the video that social marketing have been used
and found to be successful in promoting health behavior changes.Which Responsibilities
and Competencies of a Health Education Specialist can the social marketing theory be
applied to? Please explain.Length: 2-3 pages (excluding the cover page and the reference
list).
Need Help with this Assignment

American History in Video – Assignment Instructions

http://ahiv.alexanderstreet.com.ezproxy.liberty.edu:2048/Playlists/408827
This assignment is broken up into 2
parts. First, view the video chosen from the American History in Video – Pre
Assignment, and write a 1–2-page summary of its content. You will not be asked
to analyze the information, only provide a synopsis of the material. Citations
or footnotes will not be required for this assignment.
For the second part of the
assignment, you will identify 5 scholarly books using the library search engine
and/or WorldCat, and 5 scholarly articles using JSTOR, Academic Search Complete,
or Academic OneFile that directly
relate to the specific topic covered in the video. You must use current
Turabian format to create a bibliography. You do not need to read your sources
entirely, but you must read enough make sure they are directly related to the
video summarized.
1.
You must use the template for the
assignment provided in Blackboard.
2.
The 1–2-page summary must be typed
and double-spaced, 12 pt Times New Roman font and have 1-inch margins.
3.
You will also submit a bibliography
of 5 books and 5 articles that directly relate to the chosen video. For
example: If you watch a video on the Battle of Gettysburg, you must choose
sources for your bibliography that deal with the Battle of Gettysburg, not the
Civil War. Although they are broadly related, the connection must be more
focused. This bibliography must conform to current Turabian format and follow
the template provided in Blackboard.
4. Read and apply the rules found in
theWriting Tipsdocumentto insure the
best score. Under most circumstances, the best papers will be those that are
revised several times. In your revisions, check for grammatical errors,
organizational issues, and clarity of communication.
.
need help with this discussion no plagarism

This assignment asks you to address your fantasy organization once again.Write 2 to 3
pages in APA format, Times New Roman 12 point font, double spaced, with 1― margins
all around. Again, avoid passive voice, check your grammar, and spell-check your
submission prior to completion. Be sure to include an APA formatted title page and
reference page.Address where your fantasy organization stands on job satisfaction.How
important is it? Why?What are the specific things that your organization does to address,
maintain, or improve employee job satisfaction, if any? Why or why not?Address in your
submission what the literature has to say about the relationship between job satisfaction
and a) organizational commitment b) performance c) organizational citizenship behaviors
d) absenteeism and turnoveruse attachment as the fictionary company
need help with this discussion

Managers and professionals often pay more attention to the levels of their measures
(means, sums, etc.) than to the variation in the data (the dispersion or the probability
patterns/distributions that describe the data). For the measures you identified in
Discussion 1, why must dispersion be considered to truly understand what the data is
telling us about what we measure/track? How can we make decisions about outcomes and
results if we do not understand the consistency (variation) of the data? Does looking at the
variation in the data give us a different understanding of results?
Need help with this Ethic questions

Here is the questions I have to answer tooInstruction: Provide a short essay responding to
each of the following questions. Your aim is to present your understanding of the material
and argue for your view on the subject. Make sure you: 1) Have a clearly stated thesis. 2)
Explain your selections and why you make the connection(s) that you do. 3) Answer
questions completely. 4) Cite material as needed. At least 3 paragraphs each What would be
a Kantian approach to the abortion issue (create an argument for or against abortion
employing Kant’s work as you understand it)? Answer: Explain Hobbesian social contract
theory. How does Hobbes’ “theory of motivation” inform his social contract theory? Explain
Rousseau’s position on the social contract and compare it to Hobbes’. Which rendition do
you like best? Why? (Thomas Hobbes Leviathan book & weblink) Answer: Explain what
Aristotle views as the goal of human life. Do you agree? Why or why not? Is Aristotle’s ethics
sufficiently action-guiding (does it help us make decisions)? If so, how so; if not, why not? (
Aristotle Nicomachean Ethic book & weblink)Each answer to the three questions should be
at least 3 paragraphs, they don't have to be long ones as long as they answer the question.
Need help with this ASAP. If you don’t have access to Westlaw or WestlawNext you won’t be
able to do

I NEED THIS COMPLETED BY WEDNESDAY THE 18TH WESTLAW RESEARCH

PRACTICE Lesson Two – Researching Issues Using Secondary Authority Objectives:
Appreciation for the value of consulting secondary resources in assisting the researcher in
fully understanding legal issues; in assisting the researcher in further refining legal issues;
and in assisting the researcher in locating additional primary and secondary authority.
Please refer to the following scenarios and complete the steps below for each.Scenario
OneJoanna Spring always insisted that she did not ever want to be kept alive by machines,
and even stated that when she was a young teenager. Her parents understood her feelings
on the subject. Joanna married Bill Spring and one month later, was involved in an auto
accident which left her in a persistent vegetative state. Joanna’s parents (Mr. and Mrs.
John Winters) have sued to have Joanna taken off life support. Joanna’s husband refused
to allow the hospital to do so. Joanna’s parents thing that it is only because he will not
inherit Joanna’s huge estate unless he has been married to her for more than two years.
The court sided with Bill Spring, and refused to order the removal of life support. The
Winters now want to appeal the decision and let Joanna die in peace before bill becomes
Joanna’s heir.Scenario TwoShirley Baker is a young woman suffering from breast
cancer. She has been on chemotherapy for several months, and has experienced terrible
side-effects. She did receive a prescription for the medicinal use of marijuana while living in
California, but moved to Oklahoma to be closer to her family. She did take several ounces of
marijuana with her when she moved, and was arrested while smoking marijuana on the
front porch of her parent’s home, the evening she arrived in Oklahoma. She was
convicted of illegal possession of the drug, and wants to appeal her conviction.Scenario
ThreeJoe Valle and Fred Hamper have been partners for many years. When same sex unions
became legal in California, they moved there just long enough to be “married,― and
then returned to their home in New Mexico. Joe applied for health insurance for himself and
his “spouse.” The insurance company refused to recognize the “marriage,’ and
Joe and Fred sued. The trial court found in favor of Big Time Insurance Company, and Joe
and Fred want to appeal.Scenario FourFlora Findley loves plants. She had become
interested in hydroponics and hybridizing plants. She began growing plants under full-
spectrum sunlight lamps in her home. She also has a teenaged son who expressed an
interest in growing plants. She was pleased that she and her son could share an interest.
One day, a police officer investigating a burglary next door, came to Flora’s home to ask
if she had seen anything. He noticed all of the plants growing under the lamps, and quickly
began inspecting them. He found a small plant that he thought was marijuana, and promptly
arrested Flora. Flora was convicted for possession, but insisted that the search of her home
was unwarranted. She wants to appeal the decision.Scenario FiveMr. Frank Incense was
arrested for theft when he took $500,000 worth of tools from behind a neighbor’s shed
which faced an alley. Frank insisted that he thought the tools were being thrown away. He
was having financial difficulty and thought he could make some money by selling the tools.
While being questioned, Frank asked for an attorney. Finally he was provided with an
attorney who specialized in Bankruptcy Law, and who was required to take on criminal
cases pro bono. The attorney really did not understand criminal procedure, and as a result,
Mr. Insence was not only found guilty, but also received a very stiff sentence. Mr. Insence
wants to appeal his case because he believes that he not only had a right to counsel, but a
right to counsel who was competent in handling criminal proceedings.Directions: Complete
the following steps in the order providedStep One: For each of the fact patterns provided,
list the legal issues involved, as you identify them prior to undertaking any additional
research. Note, some fact patterns may present more than one issue.Step Two: Form a
natural language search queries for each scenario based on the issues identified. Please list
your search terms.Sign on to Westlaw ClassicStep Three: Use the issues/terms provided in
Step One above, locate relevant secondary authority from AmJur, CJS, or ALR regarding
those issues, thoroughly review the information therein, and provide the following
information: i) The citation to the article or annotationii) Did your search return results
which pertained to the issues you identified? If not, please modify your search query until
your results are more on point; provide your new search terms.iii) Did the information in
the article or annotation cited cause you to change, add or refine your issues? If so, please
list the issues involved in each of the fact patterns as you now identify them.iv) Please
briefly summarize they type of information (ie, case law, statutory law, constitutional
provisions, other secondary resources, key numbers and other research references)Step
Four – Repeat Steps 3i, 3ii, 3iii using WestlawNext and briefly describe the differences
between WestlawNext and Westlaw Classic.
need help with this journal 1

Click on the “Create Journal Entry” button at the top of this page to start your journal. This is
not a timed activity.Journal 4: Marketing Plan Part E: Distribution Plan and Promotions
StrategyDue Week 8 and worth 160 pointsYou will now consider mechanisms by which
your customers will purchase your products and / or services (e.g., online, storefront, direct
sells) and the primary manner in which you intend to reach new customers (e.g.,TV, radio,
social media, special events).Consider the marketing materials that you intend to use.
According to the textbook, marketing materials are collateral used to promote your
business or products. Promotional strategy may include free trial offers, money-back
guarantees, and buy two (2) for the price of one (1) type of deals. Write a five to seven (5-7)
paragraph journal entry in which you:Determine the distribution strategy relative to your
target market, location, and selection of distribution channels. Indicate whether or not you
will leverage the following strategies: a.use stores located in different regions b.sell online
c.hire a sales team to sell directly to suppliers and door-to-doorRecommend three (3)
strategy options that you could use in order to get your product or services out to your
customer base.Outline your main marketing goals for promotions, offers, and giveaways.
Discuss the key types of marketing materials that you intend to develop and share.Propose
three (3) action steps that you can use to move your plan forward. Consider how, when, and
who will be involved in the execution of this plan.Use at least two (2) quality references.
Note: Wikipedia and other Websites do not qualify as academic resources.Note: Insert the
information from the completed Journal 5 entry into “Section 5: Distribution Plan and
Promotions Strategy― in the provided Marketing Plan Template (located in Week
4).Click here to view the grading rubric for this assignment.
need help with this journal

Click on the “Create Journal Entry” button at the top of this page to start your journal. This is
not a timed activity.Journal 3: Marketing Plan Part D: Pricing and Distribution StrategyDue
Week 7 and worth 120 pointsYou will now consider your company’s strengths and
weakness, along with your product or service price.Use the Internet to research strategies
for conducting a Strengths, Weaknesses, Opportunities, and Threats (SWOT) analysis. Based
on your company’s market information, consider the strengths and weakness of your
company and its products or services.Write a four to six (4-6) paragraph journal entry in
which you:Determine the key strengths and weaknesses of your company, as well as both
the primary opportunities and threats that it faces within its industry.Discuss your critical
steps within your supply-chain and operational system. Explain the key aspects of your
strategies for producing and distributing your products and services to both your stores
and customers. Determine whether you will use an outside vendor or complete the work in
house.Analyze the company’s pricing strategy relative to its pricing objective. Examine
major internal and major external factors that could potentially affect the pricing of the
company’s products or services.Use at least two (2) quality references. Note: Wikipedia
and other Websites do not qualify as academic resources.Note: Insert the information from
the completed Journal 4 entry into “Section 4: Pricing and Distribution Strategy― in
the provided Marketing Plan Template (located in Week 4).Click here to view the grading
rubric for this assignment.
Need help with this homework, Need ASAP was due 11/03/14

Key Assignment Over the past several weeks, you have been learning the various issues the
ethical and legal challenges and factors involving your organization. Your task is to compose
and submit an ethical code of conduct plan for your company that addresses the conduct of
its employees, vendors, board of directors, key stakeholders, as well as its business
operations in general. At this phase, you will be submitting a rough draft of this
international business expansion plan for review by your instructor. Take the feedback into
consideration from the instructor, and make any changes as you deem necessary. Your
ethical code of conduct plan which will be incorporated into your company’s
international business expansion plan should include the different concepts and ideas that
have been discussed over the past several weeks in this course. You are to submit a detailed
plan covering your operations both nationally and internationally in addition to the conduct
of its employees, vendors, board of directors, and its business operations overall. The
following points need to be addressed in your ethical code of conduct plan:The legal
regulations of conducting business overseasThe ethical code of conduct for employees and
vendorsGuidelines for adherence to EEOC, ADA, and Civil Rights lawsDistinguishing
between right and wrong in business dealings and when an action is legalIdentifying the
issues surrounding the motivation behind unethical or illegal business operations when the
consequences are properly documentedThe ethical responsibilities of companies in the
marketplace if they are a monopoly or oligopoly.Anything else that you deem important to
support your ethical code of conduct plan. The code of conduct plan should be structured so
as to be easily navigable for employees; including headings for each section, a clear
description of expected and required behavior, training requirements, method of reporting
of unethical or illegal behavior, and consequences of unethical or illegal behavior. The
deliverable length is 1,250–1,500 words. Don’t forget to include a cover page and
reference page with all of your resources cited in APA format. Your ethical code of conduct
plan should demonstrate your understanding of the concepts and ideas covered throughout
the course.Ensure that the assignment adheres to APA formatting and that it meets the
required deliverable length. Don’t forget to cite your resources.
Need help with this paper ASAP

Assignment 2: Required Assignment 1—Ethical and Legal IssuesHR ethics are important to
organizations as they can have legal and moral implications. In this assignment, you will
develop a plan to resolve some of the ethical and legal issues involved in a merger. Use the
Argosy University online library and textbooks to read about ethical and legal
issues.Consider the following scenario: As part of the employment contracts, employees
have certain rights. For example, employees have the right to not be coerced into situations
against their will. They expect to be able to access the information, which affects their job,
company, and career. Such work situations can increase stress, lower self-esteem and
productivity, cause loss of trust, and decrease efficiency. Good employees who are looking
for a more secure work environment may resign and take valuable tacit knowledge and
talent with them. It is the responsibility of HR management to create an ethical work
environment before, during, and after the merger. Instructions:As a strategic HR Director,
you have been asked to identify ethical and legal issues involved in a merger and develop a
plan to resolve these issues. Your plan should address the following:Identify specific legal
and ethical issues that should be considered before, during, and after the merger.Develop an
implementation plan for managing the potential legal and ethical concerns for the
merger.Explain how the proposed plan would help managers establish an ethical work
environment.Develop a plan for how to resolve ethical and legal issues.With in text citations
for each resource Write a five-to-six-page plan in Word format. Apply APA standards to
citation of sources. Use the following file naming convention:
LastnameFirstInitial_M3_A2.doc.
Need help with this paper please!!!

Business Model and Strategic Plan Part III: Balanced Scorecard and Communication
PlanBUS475 Wk1.docxBUS475 Wk3.docxI've uploaded my part 1 and part 2Identify key
trends, assumptions, and risks in the context of your final business model.Develop the
strategic objectives for your new division of the existing business in a balanced scorecard
format in the context of key trends, assumptions, and risks.The strategic objectives are
measures of attaining your vision and mission. As you develop them, consider the vision,
mission, and values for your business and the outcomes of your SWOTT analysis and supply
chain analysis.Consider the following four quadrants of the balanced scorecard when
developing your strategic objectives:Shareholder Value or Financial Perspective, includes
strategic objectives in areas such as:Market shareRevenues and
costsProfitabilityCompetitive positionCustomer Value Perspective, includes strategic
objectives in areas such as:Customer retention or turnoverCustomer satisfactionCustomer
valueProcess or Internal Operations Perspective, includes strategic objectives in areas such
as:Measure of process performanceProductivity or productivity improvementOperations
metricsImpact of change on the organizationLearning and Growth (Employee) Perspective,
includes strategic objectives in areas such as:Employee satisfactionEmployee turnover or
retentionLevel of organizational capabilityNature of organizational culture or
climateTechnological innovationDevelop at least three strategic objectives for each of the
four balanced scorecard areas identified (Financial, Customer, Process, Learning and
Growth). Your objectives should be selected, in part, based on an evaluation of a number of
potential alternatives to the issues and/or opportunities identified in the SWOTT Analysis
paper and table you completed in Week 3.Base your solutions on a ranking of alternative
solutions that includes an identification of potential risks and mitigation plans, and a
stakeholder analysis that includes mitigation and contingency strategies. You should also
incorporate the ethical implications of your solutions into your selection.For each strategic
objective, develop a metric and target using a balanced scorecard format. (For example, a
strategic objective in the shareholder or Financial Perspective is to increase market share. A
metric to actually measure this strategic objective of market share increase is, "The
percentage of increase in market share." The target is the specific number to be achieved in
a particular time period. The target for the metric of "Increase market share" could be
"Increase market share by 2% for each of the next 3 years" of an increase of 2% per year for
3 years.)Outline a brief communication plan discussing how you will communicate the
company's strategic objectives that includes the following:Define the purpose.Define the
audience.Identify the channel(s) of communication and why you selected that
channel.Write a 1,050- to 1,400-word strategic objectives summary. Include your balanced
scorecard and its impact on all stakeholders, and the communication plan.Format paper
consistent with APA guidelines.
Need help with this question

Question: Make an argument – Was HUAC justified in its attempts to uncover subversive
elements of Hollywood? Use evidence from your role sheet as well as the Cold War
PowerPoint slides to support your argument.I posted Page 1-3 for you to see my role sheet
evidence as well as I posted a PowerPoint presentation with some useful notes underneath
about HUAC. Remember only use the files I provided for
sources/resources/referencesWords max 200-350
Need help with this Taxation Home Work

Please read the details carefully before sending me handshake. Thanks You can just fill out
the forms mentioned in this problem( Form 1041 for the Green Trust and Schedule K–1 for
Marcus White). Prepare the 2012 fiduciary income tax return (Form 1041) for the Green
Trust. In addition, determine the amount and character of the income and expense items
that each beneficiary must report for 2012, and prepare a Schedule K–1 for Marcus White.
Omit all alternative minimum tax computations. The 2012 activities of the trust include the
following.Dividend income, all qualified U.S. stocks $10,000Taxable interest income
50,000Tax-exempt interest income 20,000Net long-term capital gain, incurred 11/1/12
25,000Fiduciary’s fees 6,000Under the terms of the trust instrument, cost recovery, net
capital gains and losses, and fiduciary fees are allocable to corpus. The trustee is required to
distribute $25,000 to Marcus every year. For 2012, the trustee distributed $40,000 to
Marcus and $40,000 to Marcus’s sister, Ellen Hayes. No other distributions were made. In
computing DNI, the trustee properly assigned all of the deductible fiduciary’s fees to the
taxable interest income. The trustee paid $3,500 in estimated taxes for the year on behalf of
the trust. Any 2012 refund is to be credited to 2013 estimates. The exempt income was not
derived from private activity bonds.The trust was created on December 14, 1953. It is not
subject to any recapture taxes, nor does it have any tax credits. None of its income was
derived under a personal services contract. The trust has no economic interest in any
foreign trust. Its Federal identification number is 11-1111111.The trustee, Wisconsin State
National Bank, is located at 3100 East Wisconsin Avenue, Milwaukee, WI 53201. Its
employer identification number is 11-1111111. Marcus lives at 9880 East North Avenue,
Shorewood, WI 53211. His Social Security number is 123-45-6789. Ellen lives at 6772 East
Oklahoma Avenue, Milwaukee, WI 53204. Her Social Security number is 987-65-4321.
need help with this assignment?

I have attached my paper with my thesis statement to this question.Prepare: First, read the
information on the Ashford Writing Center’s web page, Thesis Statements (Links to an
external site.)Links to an external site.. Then, read the ENG125 Sample Literary Analysis.
Pay close attention to the body paragraphs and thesis statements. Reflect: Compare your
working thesis statement to the thesis statement in the Sample Literary Analysis. Does your
thesis address relevant points like the example thesis? Then, look at a body paragraph in the
sample Literary Analysis. Compare its construction to a body paragraph in your own paper.
Write: Post your working thesis and your strongest body paragraph into the discussion by
Thursday (Day 3) at midnight; do not attach it as a separate document. For the purposes of
this discussion only, signify your working thesis by including it in bold type and italicize the
topic sentence of your body paragraph. Your body paragraph should include at least three
examples of paraphrases and/or quotations (there should be at least one of each) with
correct citations in APA format. After the body paragraph, be sure to include reference page
citations for the paraphrased and cited sources. Then, answer the following three
questions:Explain the connection between the topic sentence and your working thesis.
Would this connection be clear to someone without your explanation? If so, why? If not,
how can you modify your topic sentence and/or thesis statement to make this connection
more clear?Explain the choice of reference material. How do the references support the
topic sentence? Would this connection be clear to someone without your explanation? If so,
why? If not, what information should you add to the paragraph to make this connection
more clear?Does the paragraph contain any unnecessary information? Does everything in it
work to support the topic sentence? What information could be added or removed? In
essence, you are being asked to evaluate the cohesion of your paragraph.Note any other
specific challenges faced or successes experienced when writing this paragraph or
completing this discussion post.
need help with those 2 questions

QUESTION 1 Post a substantive and cohesive response to the following:Analyze one

vertically integrated health system in your area and share details about its size,
settings/locations, and the services it provides.Analyze one horizontally integrated health
system in your area and share details about its size, settings/locations, and the services it
provides.Assess the impact of integration on issues related to cost and access to care,
including implications for the management of the organization and the patient/consumer
experience.PART 2-Write a 3- to 4-page paper in which you:Compare the horizontally
integrated health system and the vertically integrated health system you have selected (e.g.,
size, settings/locations, and types of services).Explain each health system’s rationale for
pursuing integration and the strategies it has used to achieve integration.Assess the
business and health care-related implications of integration for your selected health
systems, including how integration impacts the patients/consumers the organization
serves.
Need help WITH THOSE

Locate and select financial statements for a particular health care organization. Analyze the
working capital of the organization.Consider the impact of regulations, business plans, and
economic dynamics on the working capital requirements of the business. Is there sufficient
working capital for business operations of the organization you selected?QUESTION 1
DISCUSSION Post a cohesive response to the following:Analyze the working capital of the
health care organization you selected. Evaluate the impact of regulations, business plans,
and economic dynamics on the working capital requirements of the business. Include
whether or not there is sufficient working capital for business operations and explain
why.QUESTION 2----- The Assignment:Using the “Week 9 Assignment Budget and Variance
Excel Template” address the following:Determine the total variance between the planned
and actual budgets for Surgical Volume. Is the variance favorable or unfavorable?Determine
the total variance between the planned and actual budgets for Patient Days. Is the variance
favorable or unfavorable?Determine the service-related variance for Surgical
Volume.Determine the service-related variance for Patient Days.Prepare a flexible budget
estimate. Present a side-by-side budget, flexible budget estimate, and the actual Surgical
Revenues.Prepare a flexible budget estimate. Present a side-by-side budget, flexible budget
estimate, and the actual Patient Expenses.Determine what variances are due to change in
volume and what variances are due to change in rates.
need help with three quesions in Corp. FIN

1. Santa’s Shoes is a retailer that has just begun having financial difficulty. Santa’s suppliers
are aware of the increased possibility of bankruptcy. What might Santa’s suppliers do
based 2. A few years ago, a friend of yours started a small business that develops gaming
software. The company is doing well and is valued at $1.5 million based on multiples for
comparable public companies after adjustments for their lack of marketability. With
300,000 shares outstanding, each share is estimated to be worth $5. Your friend, who has
been serving as CEO and CTO (chief technology officer), has decided that he lacks sufficient
managerial skills to continue to build the company. He wants to sell his 160,000 shares and
invest the money in an MBA education. You believe you have the appropriate managerial
skills to run the company. Would you pay $5 each for these shares? What are some of the
factors you should consider in making this decision? 3. A friend of yours is trying to value
the equity of a company and, knowing that you have read this book, has asked for your help.
So far she has tried to use the FCFE approach. She estimated the cash flows to equity to be
as follows:Sales$800.0-CGS-450.0-Depreciation-80.0-Interest-24.0Earnings before taxes
(EBT)246.0-Taxes (0.35 x EBT)-86.1= Cash Flow to Equity$159.9She also computed the cost
of equity using CAPM as follows: k E = k F + β E(Risk premium) = 0.06 + (1.25 x 0.084) =
0.165, or 16.5%where the beta is estimated for a comparable publicly traded company.
Using this cost of equity, she estimates the discount rate asWACC = x Debt k Debt pretax(1
– t) + xcskcs = [0.20 x 0.06 x (1-0.35)]+(0.80 x 0.165) = 0.14, or 14%Based on this
analysis, she concludes that the value of equity is $159.9 million/0.14 = $1,142
million. Assuming that the numbers used in this analysis are all correct, what advice would
you give your friend regarding her analysis?
need help with two assignments

First AssignmemtEstate tax 1.pdf Estate tax 2.pdf (Pages-Courtesy: “You

May Ask Yourself” by Dalton Conley)About estate tax and the recent limits (above
$5.4million for 2015)http://www.irs.gov/Businesses/Small-Businesses-&-Self-
Employed/Estate-Tax (Links to an external site.)Read about the estate tax in the two pages
linked above. Use the conflict perspective (Melvin M. Tumin), functionalist perspective
(Davis and Moore) and Gerhard Lenski’s perspective to analyze or question the rationality
of Estate tax.should be 150-250 words Second Assisgnment“Howard Shultz:
Starbucks.― Go to the Internet for more information at www.starbucks.com (Links to an
external site.) answer Q’s 1-5 from the case. Please type each question as a heading and
then type your answer below the question.Howard Schultz and Starbucks· Which traits
has Howard Schultz exhibited that would indicate he is an effective leader· Describe
Schultz basic leadership style. How would you rate his leadership using the leadership
grid· Which factors might lead Dr. Sherman to conclude that Howard Schultz is a
transformational and charismatic leader?· What actions does Schultz take to build
employee trust in his firm? Would you trust him?· Which leadership challenges might
going international pose to Schultz? In which countries might his style of leadership work or
not work?
Need help with two Excel simulation questions???????

Excel Simulation #1 : You are going to roll four twenty-sided dice. If the rolls total to 20 or
less, roll two more twenty-sided dice and add that to the total. For instance, if the total of
my four die rolls is 32, then that is the score of the game. If the total is 17, then I roll two
more dice and add that to the total. If these two bonus dice total 20, then the score of that
game is 37. Of ten thousand games, what is the average score? Excel Simulation #2 : You are
going to play a game where you bet a dollar and get to flip a coin ten times. If you get four
heads in a row, you win. If you make the tenth flip without getting four heads in a row, you
lose. Run this game ten thousand times. Approximately what is the probability that you will
win? I need both questions by 6:00pm, Sunday 3/24/13. I want to say thank you in advance
to all users for their help!!
need help with writing my home work for inf 630 system analysis

Week 1 – AssignmentExplaining the Business ProblemBefore beginning this exercise,

review the lecture, and read Chapters 1, 3, and 4 in the text. Evaluate the Cool Widgets, Inc.
(CWI) scenario located in your online classroom.Identify and explain the primary business
issues described in the CWI scenario. Based on your evaluation, explain the business
problem that CWI faces. Then using the concept of work as described in your Robertson and
Robertson (2015) text, explain the impact the business problem has on the business, users,
and other stakeholders. Explain the primary needs a solution must meet in this scenario and
what it must accomplish for the business. Include a context diagram depicting the scope of
work you have identified from the scenario (see Figure 4.2 in the text for an example).In
your paper,Identify the primary business issues described in the CWI scenario.Explain the
business problem facing CWI.Explain the impact the business problem has on the business,
users, and other stakeholders.Explain the primary needs a solution must meet and
accomplish in the CWI scenario.Create a context diagram depicting the scope of work.The
Explaining the Business Problem paperMust be three to four double-spaced pages in length
(not including title and references pages) and formatted according to APA style as outlined
in the Ashford Writing Center (Links to an external site.)Links to an external site..Must
include a separate title page with the following:Title of paperStudent’s nameCourse name
and numberInstructor’s nameDate submittedMust use at least two scholarly or credible
sources in addition to the course text.The Scholarly, Peer Reviewed, and Other Credible
Sources (Links to an external site.)Links to an external site. table offers additional guidance
on appropriate source types. If you have questions about whether a specific source is
appropriate for this assignment, please contact your instructor. Your instructor has the final
say about the appropriateness of a specific source for a particular assignment.Must
document all sources in APA style as outlined in the Ashford Writing Center.Must include a
separate references page that is formatted according to APA style as outlined in the Ashford
Writing Center.Carefully review the Grading Rubric (Links to an external site.)Links to an
external site. for the criteria that will be used to evaluate your assignment.
need help with writing the personal statement for university application

Admission Essay (Personal Statement)Personal Statement Structure:Total Paragraphs: 5,

Lines: 45-47, Pages: 2 pages (not to exceed)Font: Times new Roman with 1 inch margin——
————————————————————————————Paragraph-1:
IntroductionParagraph-2: Body Pragraph – Educational ExperienceParagraph -3: Body
Pragpraph – Research ExperienceParagraph-4: Body Parapraph – Professional work
experienceParagraph -5: Conclusion
Need help with writting an appeal letter for suspension

Due to my poor GPA i was suspend from community college but i do have a chance to
appeal. Please write me an good appeal letter . 1. In your own words explain why you did
not achieve the required credit completion rate and/grade point average. 2. Indicate what
action you have taken to prevent or correct the problem.
need help work load

For this week’s Individual Work, you will identify ten job search websites useful for criminal
justice students. Using the “Table” function in Microsoft Word, create a chart with following
information. First Column Heading – Name of WebsiteDescription of WebsiteTypes of jobs
found on websiteName of the person or department you would send your resume
toPreferred method of resume submission (i.e. mail resume directly, fill out company form,
in person drop off, etc.)The deliverable length of your homework assignment is 400-500
words, one or two double spaced pages (does not include title page or reference
page).Remember to create in-text citations for every source you use to create a sentence for
your paper. Every in-text citation must have a corresponding reference on the reference
page of your paper.All homework assignments must be in APA format.They must have a title
page, body, and reference page.They must be double spaced, using 10-12 point font, with
one inch margins all the way around.Tip: Website addresses are NOT references; they are
links to websites only.A reference contains four basic parts: An Author, year, title, and
publisher. A website address does not contain those parts and is, therefore, not a
reference.Please do not include only a website address as a “source” in your references
list.For citation guidelines, please refer to the table in the APA Style section of the syllabus.
Save your document with a file name that includes your_name_course code-section
number_title.For example: JaneSmith_CCJ1910-12_Week2-1.docx
Need help please. would really appreciate it. Its to do with managerial accounting .

FahrFmtc ‘ File Home Insert Draw Page Layout Formulas Data Review View Help .3 Share l3
Comments_ A o | . i ‘_’ Z AutoSum v Af“ [21 Ana. V A A «:0 v mam Custom v m 3% y e-H H-x 4-
1: Z? /O ;v ~11 Fill VPaste B I U 0, A e- ,_ H o (—11 .00 Conditional Format as Cell Insert
Delete Format Sort 8L Find 81 Ideasv v v — — Mer e&Center V V , . v .V _ 9 $ /0 ’00 i0
Formatting V Table V Styles V V V V 0053′ FIIterV Select V Clipboard IS. Font IS. Alignment
IS. Number IS. Styles Cells Editing Ideas A130 v E J fx vA A B l C l D l E i F , G H i | J i K i l M l N
l 0 l l l R l l T U l V l W l X l A67 Please put correct answer in the underlined space
provided.LL The following information was available from ABC Company’s financial
records.L Other10 Year 2004 Sales Purchases Expenses1L April 3 86,400 $ 50,400 $
18,00012_ May 79,200 57,600 16,560111 June 72,000 43,200 17,04011 July 93,600 64,800
18,96013 August 79.200 72,000 17,25015 Collections from customers are normally as
follows:1L Month of sale 70%187 Month [allowing sale 20%1% Second month following
sale 9%20_ The balance is expected to be uncollectible.2L2; The company takes full
advantage of discount allowed on purchases paid tor by the21 tenth of the following
month.2L Discount allowed 2%212g other expenses are paid for during the month of
expenses.27_287 The company’s cash balance on August 1 was 3 26.40021307
Required:317 a) Compute the estimated total cash collections during August. (2
Marks)3;3i3135,35.3L3i334i4L b) Compute the estimated total cash disbursement during
August. (2 Marks)4;43_4474i454L4iMi51L5L c) Compute the cash balance on August 31. (1
Mark)51L5i54 v i> iMarksiQ1iQZiQ3iQ4|QSiQG Q7 08‘ G) 4 r fl ,0 Type here to search
Need help writing a compare and contrast of 2 articles

Theme: Whiteness & Race – articles cruz_janzen AND hypersexuality (attached)Compare

what is similar regarding Whiteness & Race (150 words);Contrast what is different
Whiteness & Race (150 words);Conclusion (100
words);hypersexualizaiton_of_the_dark_body.pdfcruz_janzen.pdf
Need help writing a continuous improvement plan

Uses journal entries to guide personal and professional goals .Identifies personal
improvement objectivesIncludes a detailed action plan with time framesDescribes
strategies for achieving personal objectivesMajor points are stated clearly; are supported by
specific details, examples, or analysis; and are organized logically.The introduction provides
sufficient background on the topic and previews major points.The conclusion is logical,
flows from the body of the paper, and reviews the major points.
need help writing a papaer on informatics role in a clinical setting

Role description and education level required for the role.Describe their views on how their
role impacts patient safety and improves the quality of patient care.Describe the Human
Factors faced in the role and other challenges.Express insights gained from the
interview.Research and discuss the impact of the Agency for Healthcare Research and
Quality (AHRQ) Patient Safety Indicators and The Joint Commission Patient Safety Goals in
your clinical setting. Describe how these governing agencies impact delivery of direct
patient care.Research, discuss, and identify the Technology Informatics Guiding Education
Reform (TIGER) utilized in your clinical setting. Be sure to get the perspective of your
selected informatics professional during your interview.
need help writing a paper 9

This is the final assignment in which you are to address the fantasy organization that you
created at the beginning of the term. In a few pages, you are being asked to address your
organization’s policy on workplace safety. Remember, you must be specific. Your
submission should have two sections:The first part will address where the organization
itself stands on workplace safety, and steps that it takes to comply with OSHA regulations.
Remember, it’s all fine and good to say “we’re for safety.― Even the least
compliant companies would state that assertion. You must be more specific than that, and
address how you deal with the inevitable costs, reduced productivity, and lower profit
margin from enacting and enforcing safety measures. The second part will be an excerpt of a
page or two from the company’s employee safety training manual. Be sure to include a
company logo somewhere in the submission of part two.
Need help writing a proposal addressing the furture of the juvenile justice system.

please help!! 1750-2250 word proposal addressing the following scenario: you are a team of
juvenille justice consultants creating a proposal that will be presented to the state
legislature concerning the future of the juvenile justice sytem. Address the following in the
proposal: recommendation for all aspects of the sytem including the following: community
involvement, law enforcement, courts, corrections, private sector or privatization
involvement. A justification for the system and funding based on history, trends and
causation theories. Thank you!!!
Need help writing a summary on chapter 4 The Greek World Expands, 400-150 B.C.E

Need help writing a summary on chapter 4 The Greek World Expands, 400-150 B.C.E Single
spaced one page long and in own words.
Need help writing a paper!

Cost of capital Prepare a report on the different considerations that an MNC should keep in
mind when obtaining capital from a foreign source. In this report, you must outline and
evaluate two possible methods for determining cost of capital. What is the likely impact of
these financing methods on the company’s balance sheet? To present your report, create a
scenario depicting a leading steel company seeking foreign capital to expand its overseas
operations and exports. Describe your rationale for selecting the two methods.Your report
should be well researched—original and free from plagiarism. Sbmit the report as a
Microsoft Word document, not exceeding three pages, double-spaced, in Arial 12 pt font.All
written assignments and responses should follow APA rules for attributing sources.
need help writing an essay

Primary Source Assignment 1Choose ONE of the following documentsWilliam Dunning

Explains the Failures of Reconstruction (1901) (Links to an external site.)Links to an
external site.The American Federation of Labor (1883) by Samuel Gompers (Links to an
external site.)Links to an external site.An Indian’s Perspective, Chief Joseph (Links to an
external site.)Links to an external site.The Strengths and Weaknesses of the People’s
Movement (1892) (Links to an external site.)Links to an external site.In a Word document,
write 500-700 words about the document you chose, including the following:Provide a
historical context of the document – using the textbook or powerpoints, provide an
understanding of what is going on in the time periodProvide a summary of the document,
including the author(s) or any other important informationHow does this document fit into
the historical context?You are NOT ALLOWED to use outside sources for this assignment.
You must use only the textbook, notes from the PowerPoint, and the document itself.Make
sure to check your assignment for spelling and grammar.Save your file, and upload it to the
Primary Source Assignment #1 link
Need help writing an Essay: Literacy Narrative

In a minimum of 750 words, write a short literacy narrative about yourself. Literacy
narratives can often have slightly different focuses, so you have a small amount of room for
creativity, but they primarily deal with detailing a person’s path to reading and writing
(education and experiences as a reader) and/or the impact that reading and writing has on
their lives. Keep in mind that the focus here is on “literacy” (the act of reading and/or
writing) and not as much on “literature” (which we’ll be talking about in class). Your
literacy narrative can involve your experiences with various “great” books, but it will more
likely encompass your experiences with a variety of texts, from internet reading, to
newspapers, to comic books, to whatever you tend to read or even write in your spare time.
need help writing it

In the Final Research Paper, you will examine your own culture from an etic (outsider's)
perspective and another culture from an emic (insider's) perspective to demonstrate your
understanding of cultural relativism and examine misconceptions and ethnocentric beliefs
concerning each of these cultures. In doing so, you will demonstrate a culturally relativistic
perspective, in order to understand why different groups of people do what they do,
without expressing a positive or negative opinion of their cultural practices. Keep the
distinction between cultural relativism and moral relativism in mind as you write your final
paper. Even if you do not personally agree with a cultural practice, demonstrate your
understanding of the practice in its cultural context. Avoid opinionated or judgmental
language in your paper.Your Final Research Paper will consist of two main parts, framed by
an Introduction and a Conclusion. See the flow chart for a quick overview of the
assignment.IntroductionBegin with an introductory paragraph that has a thesis statement
at the end. The introduction should set up your topic, giving a preview and summary of the
analysis you will present in the body of the paper. The thesis statement is the last sentence
or two of the introduction and states what the main point structuring your paper will
be.Here is an example of an Introduction.Part IUsing the Miner (1956) article and the
feedback you received from your instructor on your “Summarize Your Sources for the Final
Research Paper” assignment in Week Three as a guide, describe one aspect of your own
culture from an etic perspective. See the appropriate sections in the textbook, based on your
chosen topic from Week Three, for information on how to approach your paper from an
anthropological perspective. You can describe American culture in general, as Miner does,
or you can describe an American subculture, such as a specific geographical group (e.g., New
Yorkers), a particular ethnicity (e.g., African Americans), or an age-related category of
Americans (e.g., millennials).Use reputable statistics and/or scholarly research to support
any factual statements. Do not rely solely on personal experience or opinion. Here is an
example of how to properly support your statements. Potential sources you can use to
support your analysis are listed below. You can also conduct your own research to find
other sources.United States Census Bureau (http://www.census.gov/)Gallup
(http://www.gallup.com/home.aspx)Pew Research Center
(http://www.pewresearch.org/)Important: see additional instructions in Part I under Final
Paper Requirements.Here is an example of Part I.Part II Refer to the article you chose for
Part II of the “Summarize Your Sources for the Final Research Paper” assignment in Week
Three and describe an aspect of another culture from an emic (insider’s) perspective. You
do not have to do research beyond reading your chosen article; however, if you do choose to
conduct additional research make sure to use reputable statistics and/or scholarly sources
to support any factual statements. Do not rely solely upon personal experience or
opinion.Important: see additional instructions in Part II under Final Paper
Requirements.Here is an example of Part II.ConclusionEnd with a concluding paragraph that
reinforces your thesis. Summarize and tie together your main points for the reader. Provide
a brief self-reflexive analysis of what you learned while writing this paper.Important: see
additional instructions in Conclusion under Final Paper Requirements.Here is an example of
a Conclusion.Cultural relativismCultural relativism is the idea that the beliefs and practices
of a culture should be understood within the context of that particular culture’s background,
history, and current events surrounding it. We should not ethnocentrically impose our own
beliefs and opinions, which are products of our own enculturationCultural relativism is not
the same as moral relativism, however. As Crapo (2013) notes:"We need not, for instance,
come to value infanticide in order to understand the roles it may play in peoples’ lives in a
society where it is customary. What cultural relativism requires of us is simply that we do
not confuse our own feelings about such a custom with understanding it. To do the latter,
we must investigate the meanings the custom has for those who practice it and the
functions it may fulfill in their society."(section 1.4, “Cultural Differences: Cultural
Relativism,” para. 3) Final Paper Requirements (Click links below)IntroductionThe
introduction should be one paragraph.Explain the scope of your paper and set up the topics
you will cover. Everything covered in your paper should relate back to the
introduction/thesis statement.Draw from what you learned in the Week Two thesis
statement identification assignment to help you craft your own thesis statement.Review
your instructor’s feedback on your thesis statement from your Week Three “Summarize
Your Sources for the Final Research Paper” assignment.See resources from the Ashford
Writing Center on Moving from Prompt to Thesis and Introductions and Conclusions.Part
IThis section should be two to two and a half pages long.Demonstrate a culturally
relativistic perspective throughout this section. Do not use opinionated or judgmental
language.Use the article by Miner to guide your own description. How would an
anthropologist describe the topic you've chosen?Use reliable sources to support your
analysis. Review the Evaluating Scholarly Sources tutorial from the Ashford Library.Include
an in-text citation every time you include information you learned from one of your
sources.Part IIThis section should be two to two and a half pages in length.Use what you
learned in the “Locating Scholarly Sources” assignment from Week Two to find your source
in the Ashford University Library.Weight your discussion evenly between Parts I and II. Do
not let one discussion overshadow the other.Demonstrate a culturally relativistic
perspective throughout this section. Do not use opinionated or judgmental language.Use the
article you have chosen to guide your own description. How would an anthropologist
describe the topic you have chosen?Include an in-text citation every time you include
information you learned from one of your sources.ConclusionThe conclusion should be one
paragraph.The conclusion should relate back to your introduction and thesis statement.
Reiterate what you have covered in the paper.Incorporate some of your self-reflexive
analysis from the “Self-Reflexive Journal” entry you created in Week Four.Writing the Final
Research PaperThe Final Research PaperMust be five to six double-spaced pages in length
(excluding title page and references page, meaning it will be seven to eight pages total), and
formatted according to APA style as outlined in the Ashford Writing Center (see the APA
Essay Checklist for Students).Must include a title page with the following:Title of
paperStudent’s nameCourse name and numberInstructor’s nameDate submittedMust begin
with an introductory paragraph that has a succinct thesis statement.Must have well-
structured body paragraphs with clear transitions from one topic to the next. Incorporate
in-text citations from your scholarly sources to support your analysis throughout the
paper.Must describe an aspect of your own culture from an etic perspective for Part I.Must
describe an aspect of another culture from an emic perspective for Part II.Must demonstrate
a perspective of cultural relativism throughout, avoiding judgmental and opinionated
language.Must end with a conclusion that that reinforces the thesis and provides a self-
reflexive analysis.Must use at least one scholarly resource in addition to the textbook, the
Miner article, and the article chosen from the list in Part II of the Week Three
assignment.Must document all sources in APA style in the body of the paper and on the
references page as outlined in the Ashford Writing Center.Must include a separate
references page that is formatted according to APA style as outlined in the Ashford Writing
Center.
need help writing paper 4

The purpose of this assignment is to analyze and select an appropriate method of

alternative dispute resolution (ADR) for a business dispute, to examine unethical business
behavior, and to develop risk management procedures to avoid or reduce claims and
litigation.Read the following scenario: Dazzling Dough Co. sells pizza dough to local pizza
restaurants. Most of the restaurants buy at least 150 pounds of pizza dough from Dazzling
Dough Co. in each order. Jerry’s Pizza contacted Dazzling Dough Co. to purchase 200 pounds
of pizza dough, along with some other items. Dazzling Dough Co. sent Jerry’s Pizza a written
contract, prepared by Dazzling Dough Co.’s lawyer, stating that “Jerry’s Pizza agrees to
purchase 200 pounds of pizza dough, pizza toppings, desserts and soft drinks for $30,000.”
Jerry’s Pizza signed and returned the contract.A few days later, Dazzling Dough Co. sent
Jerry’s Pizza 125 pounds of pizza dough and 75 pounds of pizza toppings, desserts, and soft
drinks. Jerry’s Pizza contacted Dazzling Dough Co. about the error in the contract and
demanded an extra 75 pounds of pizza dough. Dazzling Dough Co. said there was no error,
that Jerry’s Pizza signed the contract so they agreed to the terms, and it was not sending the
extra pizza dough.After several attempts to resolve the dispute and a pressing need for
dough, Jerry’s Pizza terminated the contract and sent Dazzling Dough Co. a check for
$15,000 for the 125 pounds of pizza dough, pizza toppings, desserts and soft drinks. Jerry’s
Pizza immediately purchased 75 pounds of pizza dough from another company for $12,000.
Both parties are threatening to sue each other for breach of contract. They prefer to resolve
the dispute out of court because the contract contains a clause that awards reimbursement
of attorney’s fees to the winning party.The board of directors of Jerry’s Pizza scheduled a
meeting with you and other senior management at the company to discuss the dispute.
You’ll need to prepare a strategic plan overview (an abbreviated strategic plan, not a full
plan) for the board that explains why there is a dispute, suggests various settlement
proposals, and provides recommendations on how Jerry’s Pizza can avoid this kind of
dispute in the future.Prepare a 525- to 875-word strategic plan overview to resolve the
legal dispute for the board (use the bullet point headings provided below to format your
overview) addressing the following:Summary of DisputeIdentify the source of the
dispute.Identify each party’s interpretation of the contract language.Identify whether each
party’s interpretation is reasonable.Identify any missing facts that would be helpful to know
in order to resolve the dispute.Proposed Revisions to Contract LanguageRecommend
specific revisions to the contract’s language so that it is clear what Jerry’s Pizza expected to
buy and what Dazzling Dough Co. is required to deliver.Ethical ConsiderationsExplain the
ethical considerations for a company to enforce specific terms of a contract against another
company if the other company is mistaken about what was agreed to. Discuss the factors
that should be considered.RecommendationsTwo to three possible settlement options (e.g.,
pay for the disputed dough, reduce the amount of dough to be purchased, split the
difference, refuse to pay, etc.)Two to three methods of dispute resolution (e.g., negotiation,
mediation, arbitration, litigation, etc.) that Jerry’s Pizza can propose to Dazzling Dough
Co.Create a one-page visualization to represent the information you provide in this
assignment. Use the Table, SmartArt, or Chart visual representation options available in
Microsoft® Word by clicking on the Insert tab located on the ribbon at the top of the
window. Locate the Word Help function in the version of Microsoft® Word that is installed
on your computer for assistance.
need help written optimization analysis

Needing someone to do this short assignment for me, thanks!==========This assignment

requires you to analyze and solve an optimization problem presented in an e-mail style
format. Download the attached Optimization word problem.pdf and read through the
scenario. Additional notes have been included within each problem.After you have analyzed
the scenario, solve the optimization problems. You will solve the problems using graphical
and computational methods. Directions on required resources are available at the
bottom.Include a graph along with your solution for problem 1.Include the results from
Excel spreadsheet with the values clearly labeled for problem 2.(These can be included
within the written response, or as separate files)Then draft a response to the questions
posed in each problem. NOTE: Write your response in a professional manner, as if
submitting your analysis to a supervisor. Submit your completed analysis in this
assignment.————————————-There are a few ways in which you can generate a
graph.1)Grapher application in the Utilities folder (within the Applications
folder)2)Download the free, open source, dynamic mathematical software Geogebra
available at: http://www.geogebra.org/You may either download and use one of the blank
templates, or create your own. The included ones match the template in the explanation
from the above website.
NEED HELP

The term 21st century skills suggests that there is a new set of skills that individuals need to
possess to be successful as learners, citizens, and employees in the competitive, global
economy. Compare and contrast what the authors identify as twenty-first century skills
with what you would identify as twenty-first century skills. Lastly, discuss how these skills
fit into the traditional element of schooling that focuses on ensuring that all students
develop the basic skills of reading, writing, and mathematics. Guided Response: Respond to
at least two of your classmates. Share how you might teach the twenty-first century skills
they identified in the classroom. Be specific about an activity that would help students gain
experience and mastery in these skills. Be sure also to respond to any questions that your
instructor might pose. Note: This discussion will continue into Week Two.
Need homework done

Need Homework Done. Decide upon an initiative you want to implement that would
increase sales over the next five years, (for example, market another product, corporate
expansion, and so on). Using the sample financial statements, create pro forma statements
of five year projections that are clear, concise, and easy to read. Be sure to double check the
calculations in your pro forma statements. Make assumptions that support each line item
increase or decrease for your forecasted statements. Discuss and interpret the financials in
relation to the initiative. Make recommendations on potential discretionary financing
needs. Write a 350 – 700 word analysis of the company’s short term and long term
financing needs and determine strategies for the company to manage working
capital. Materials to use as a reference: Sample Financial Statement: Balance Sheet Sample
Financial Statement: P
Need Herb/Spice Identification Speech written

I'm giving a speech about herb identification for my menu planning and purchasing class in
a couple days and I need it to be written for me. I will upload a paper that has all the
instructions and what to write, research and do for it. I don't need a bibliography and it
should be one page at most. It should be 6 minutes long and well researched. There are
seven points to focus on that will be shown on the sheet I upload and remember, the herb
I'm assigned is MINT! I will give the buyer plenty of time to write out the speech I just want
to be good enough to get me an A or B so if you're gonna bs me, leave now.
need in 1 hour and 30 mins 5 short essay questions for a project mgmt class

1. Compare and contrast top-down and bottom-up project estimating techniques. 2. You are
comparing two projects. Using the data below, calculate the CV, SV, SPI, and CPI. Second,
use the values to provide the status of each project. All values are in dollars. Project
AProject BEV850550PV875575AC9006503. What is the overall process of resource
leveling on a project? 4. Compare and contrast leaders versus managers on a
project.5. Most projects completed using traditional project management are done in a
weak matrix organization. Most projects completed in an agile project management
framework use a strong matrix or pure project environment. Why is this so?
NEED IN 10 HOURS (ONE FULL PAGE)

To prepare for this assignment you must listen to the You Tube link posted
below: http://www.youtube.com/watch?v=pOjpaIO2seY You are to write a 1 page paper,
double spaced, times new roman font, on the MLK sermon. In the paper you should begin
with a brief summary of the sermon, explain how the sermon spoke to your life, and
conclude with why it is important to have preachers prepare sermons from the Old
Testament. Do the things that happened over 2000 years ago still speak to today’s society?
Consider this and put it altogether in a 1 page paper.
NEED IN 10 hours Week 9 Assignment – Talent Value

NEED IN 10 hoursWeek 9 Assignment – Talent Value Proposition for the Present and
FutureOverview Acting as an HR Manager you have been asked to develop a proposal that
offers an overview of a Talent and Value Proposition. Leadership has asked you to include
information that includes the U.S. Department of Labor resources, “gig economy,” gig
workers, employee-based suggestion program, and remote work in your
proposal. Instructions6 page proposal in which you: Develop a proposal that provides an
overview of an original Talent and Value Proposition that focuses on creativity, annual
budget savings, and changes within the workplace regarding current employees.Explain
how employers could verify that their employee benefits comply with all federal laws by
using the U.S. Department of Labor resources. Explain how employees could verify that
their employee benefits comply with all federal laws using the U.S. Department of Labor
resources.Describe the steps that can be taken to support the development of individualized
strategies for the creation of an internal “gig economy” and why and how this can be
beneficial inside of an organization. Recommend a process that optimizes an employee-
based suggestion program to continually refresh the total rewards and contingent worker
development within an organization.Determine the unique needs of contingent workers as
non-employee talent continues to rise and remote work becomes more prevalent within
organizations.Discuss the pros and cons of providing benefits and rewards for gig
workers.Use at least five quality academic resources in this assignment. Note: Wikipedia
and other Websites do not quality academic resources. Please see the course resources list
in the course information section.This course requires the use of Strayer Writing Standards
but students may also opt to use APA 6 or APA 7. For assistance and information, please
refer to the “requirements documents” listed in the course information section. The specific
course learning outcomes associated with this assignment are:Create a strategy for
maximizing the advantages of a total rewards program, including how it’s
communicated.Assess the effectiveness of a total rewards program in motivating
employees.Review how employers and employees can benefit from the Health Plans and
Benefits section of the U.S. Department of Labor website.Determine innovative approaches
for optimizing employee benefits and rewards systems.
Need in 18 hours from now

Opening a New FactoryYour firm is considering to open a new factory via direct investment
in Latin America and management is evaluating the specific country locations for this
project. The pool of candidate countries has been narrowed to Honduras, Chile, and
Mexico.Discuss the national differences in political economy between these three
countries.Discuss any cultural barriers your firm may experience in each of the three
countries.Find each country’s rating on the corruptions perceptions index (CPI).Click here
to read the country commercial guides (CCGs) prepared by the U.S. Department of State.
Based on the reading, compare the FDI climate and regulations of these three
countries.Based on your findings, prepare a 4- to 6-page Microsoft Word document
addressing the above questions and making a recommendation to your firm as to which
country would be the best choice for your new factory.Support your responses with
examples.Cite any sources in APA format.
Need in 19 hours from now

Write a weekly reflective summary discussing the importance of what you have learned
from this week’s readings or searches on the Internet. In addition, discuss how this
knowledge will be useful to you in this week’s debate arguments or the final project as well
as a practicing public administrator.Select at least three topics from this week’s readings
and discuss how they can be applied to your final project. In addition, research for
appropriate resources that will be required to complete this week’s final project and
provide quantifiable proof of their validity and usefulness in completing the final project.In
your reflective summary, include the following details as well:What have you learned about
the implementation process of your new program? What are some major roadblocks that
you can come up against?How did you identify the agencies you need to include in your
project and why are these agencies important for the implementation process?How did you
decide on an evaluation process and what sources did you use?The information you
incorporate in your weekly summary may include material as it relates to the three domains
of learning: cognitive, affective, and conative.Complete your reflective summary in a 2- to 3-
page Microsoft Word document. Week reading is attached. Assignment 2 Grading
Criteria Discussed the importance of what you have learned from this week’s
readings or searches on the Internet and how this knowledge will be useful to you in weekly
debate arguments or the final project as well as a practicing public administrator. Identified
at least three key concepts from this week’s readings and how they can be applied to
your final project. Researched appropriate resources that will be required to complete
this week’s final project and provided quantifiable proof of their validity and usefulness
in completing the final project. Discussed what you have learned about the implementation
process of your new program and the major roadblocks that you can come up
against. Discussed how you identified the agencies you need to include in your project
and the importance of these agencies for the implementation process. Discussed how you
decided on an evaluation process and the sources to use. Presented a structured
document free of spelling and grammatical errors, and properly cited sources using the APA
format.
need in 2 days

Interpersonal Conflict in FilmChoose one (1) movie from a list provided below:Brooks, J.
(Director). (2004). Spanglish [Film]. Los Angeles: Gracie Films.Cohen, B. (Producer), &
Mendes, S. (Director). (1999). American beauty[Film]. Los Angeles: Dreamworks.Goldwyn,
T. (Director). (2006). The last kiss[Film]. Los Angeles: Dreamworks.Haggis, P. (Director).
(2004). Crash [Film]. Los Angeles: Bob Yari Productions.Mordaunt, W., Tadross, M.
(Executive Producers), &Tennant, A. (Director). (2005). Hitch [Film]. Los Angeles: Sony
Pictures.Watch your selected film, identify an interpersonal conflict that was not handled
effectively, and write a two-page paper (excluding title and reference pages) regarding why
the conflict was not handled effectively and what could have been done differently. Be sure
to focus on one particular interpersonal conflict and not the movie as a whole. Films can be
viewed online via streaming media sites, such as Netflix or Amazon Instant Video. You may
also rent DVDs from these sites, or from your local DVD rental outlet. Some films may be
available for free at streaming sites, such as Hulu or Crackle. You may also check them out at
low or no cost from your local library.Please Note: A synopsis of the film (e.g., which actors
are in the film or what the movie is about) should not be included. Be sure to reference at
least one of your course readings from this week in your paper. The paper must be
formatted according to APA style. Cite your resources in text and on the reference page. For
information regarding APA samples and tutorials, visit the Ashford Writing Center, within
the Learning Resources tab on the left navigation toolbar.
need in 4 hours

In the United States, we are fortunate to have an abundant supply of food. However, this
abundance is largely due to advances in agricultural technology, which have in turn created
numerous concerns surrounding our food sources. Provide at least two modern examples of
how the United States has increased its food production. Using at least two scholarly or
reputable resources and your textbook, discuss how these changes have affected the
environment, and what impact they have on food safety?
Need in 4 hrs . Must be done in 4hrs .

short answer paragraphs 150 words each1.Think about the pricing methods described in
this chapter–markup pricing, target-return pricing, perceived-value pricing, value pricing,
going-rate pricing, and auction-type pricing. As a consumer, which do you prefer to deal
with? Why? If the average price were to stay the same, which would you prefer a firm to do:
(1) set one price and not deviate or (2) employ slightly higher prices most of the year but
offer slightly discounted prices or specials for certain occasions? 2. does the kind of product
make a difference in the importance of channel image? 3. Think of your favorite stores.
What do they do that encourages your loyalty? What do you like about the in-store
experience? What further improvements would you suggest? 4. Think of some of your
favorite brands. Do you know where they come from? Where and how are they made or
provided? Do you think knowing these answers would affect your perceptions of quality or
satisfaction?could they make?
NEED IN 5 HOURS NO EXCEPTIONS NO ESSAY FILL IN BLANKS

Exercise 6:2 My Extrinsic Motivations The purpose of this exercise and the one that follows
is to guide you in identifying the motivations you have experienced in your life that give you
energy and persistence, and in classifying them by whether there are intrinsic and extrinsic
motivations. Please fill in Table 6:1 with a specific expression of each category of extrinsic
motivation you identify in your life story. For example, in the monetary compensation
category, you might say, “compensation in the top quartile of my peers.” After you have
completed the list, rank-order your extrinsic motivation (1 being the most powerful). Table
6:1 My Extrinsic
Motivations
Category My Extrinsic Motivations Rank 1
Monetary compensation 2 Having
power 3 Having a
title 4 Public
recognition 5 Social
status 6 Winning over
others 7 Association with
prestigious institutions 8
Other Exercise
6:3 My Intrinsic Motivations Fill in Table 6.2 with a specific expression of each category of
intrinsic motivation you identify in your story. For example, in the personal growth and
development category, you might say, “To help other people realize their full potential as
leaders.” After you have completed the list, rank-order your intrinsic motivations (1 being
the most powerful). Table 6:3 My Intrinsic
Motivations
Category My Intrinsic
Motivations Rank 1 Personal growth and
development 2 Doing a good
job 3 Helping
others 4 Leading and
organizing others 5 Being with people I
care about 6 Finding meaning from my
efforts 7 Being true to my
beliefs 8 Making a difference in
the world 9 Influencing
others 10
Others
NEED IN 5 HOURS NO EXCEPTIONS

Carefully watch each video located to the following three links. Write about how the bible
stories compare to the readings in your class book. What are the comparisons? What are the
differences? What have you taken away from this Module? (1
page) https://www.youtube.com/watch?v=BbPJgVWPpPM https://www.youtube.com/w
atch?v=BedH673V5mI https://www.youtube.com/watch?v=nSKjJ32XNAo
need in 7 days 1

In a paper 3-4 pages in lengthYou are a research analyst for the U.S. Department of
Homeland Security (DHS). The department has received credible intelligence from the NSA,
FBI, and Department of Defense that Al Qaeda is planning a biological attack using smallpox
against Los Angeles, CA. Although the dispersal method is unknown, it is believed the most
likely method will be airborne, through a populated shopping mall’s ventilation system.
The lax security at these locations, coupled with a wide social and economic population
sampling, will make identifying victims and stopping the spread of the disease difficult. The
intelligence indicates that the attack is scheduled to occur within 7–10 days.Your
department has been tasked with reviewing historical incidents of smallpox, including
academic assessments of its use as a biological agent for terrorism. Use the Centers for
Disease Control and Prevention’s smallpox Web site as a guide to available resources
and current planning (CDC Smallpox Information). With these tools, develop a
communication plan that addresses the following:Assignment GuidelinesAddress the
following in 3-4 pages:Provide an overview of the threat (disease characteristics). How can
mass hysteria be prevented within the population? What should the federal government
share with the state, and can this information be controlled? What should the federal
government share with the city, and how can this information be controlled? What should
the federal government share with the nation? When should information be disseminated to
each recipient (state, city, and nation)? What should be the characteristics of this
information’s release to the public (consider medium, frequency, and timeliness)? Be sure
to reference all sources using APA style.
Need in 8 Hours, Original, 4 Pages

Objective: To recommend a new product strategy for a clearly identified target market that
addresses the organizations root problem. Expectations: Begin by reading the “Mattel
Confronts Its Marketing Challenges” Case in the text. Prepare a case analysis and proposal
with a comprehensive new product strategy for a clearly identified target market. Your
proposal must include: Situation analysisAssumptions and missing informationIdentify root
problem & problem definitionIdentify target market and segmentation
strategiesDevelopment of alternatives for New ProductEvaluation of alternatives and
recommendation of new product development and or course of action to management New
Product Strategy – comprehensive description of tangible and intangible attributes of the
product, “type― of product, form of strategy option used for this new product
development, differentiation and positioning strategy. Be sure to include your rationale
supported by data. Be sure your case analysis and proposal is comprehensive and includes
the appropriate marketing concepts that will convince the Mattel Management of your
expertise and validity of ideas. Format: APA format3 references4 pages (not including
reference and title pages)
Need in 8 hours apa format 1-2 paragraphs Ben Horowitz

Need in 8 hours apa format1-2 paragraphsBen Horowitz from the video, Become a Great
CEO, indicates that as a CEO you may have to fire a good friend who works in the
organization. Is it possible for a CEO to have friends in the organization and still make the
best decisions for the organization? How difficult would it be for you to fire a good friend
who works for you, the CEO? Or, do you think you could easily let a good friend go after a
chance to take corrective action is missed?
Need in 8 hours 1-2 paragraphs apa format Total Rewards

Need in 8 hours1-2 paragraphs apa format Total Rewards Knowledge 6: Revisiting Pay for
PerformancePlease view the following video in its
entirety:https://www.youtube.com/watch?v=-XqfsfLiy90In the video, base pay and
variable pay are discussed. What are the main differences between each? How would you
know if your company’s base pay is equitable and how would you use variable pay to drive
organizational performance? Make the connection and be specific.
Need in 8 hours

Need in 8 hours1-2 paragraphs apa format

need information on two angiotensin receptor blocker drugs for a nursing class

Generic Name: Trade Name: Drug Classification: Dosage & Recommended Route &
Frequency of Administration: Mechanism of Action/Drug Effect: Indication: Side effect
(expect this): Adverse Effect (bad reaction): Interaction & Contraindication (DO NOT GIVE
if): Nursing responsibility (Before, During & After Administration): Assessment/Additional
notes: Angiotensin Receptor BlockersValsartan (Diovan)Valsartin Hydrochlorathiazide
(Diovan HCT)
need initial post by tomorrow and reply by wednesday i will post peer post after initial
response

In the last week of class, we are going to complete a reflection activity. This discussion topic
is to be reflective and will be using your own words and not a compilation of direct citations
from other papers or sources. You can use citations in your posts, but this discussion
exercise should be about what you have learned through your viewpoint and not a re-hash
of any particular article, topic, or the book.Items to include in the initial thread:
“Interesting Assignments― – What were some of the more interesting assignments to
you? “Interesting Readings― – What reading or readings did you find the most
interesting and why? “Interesting Readings”“Perspective” – How has this
course changed your perspective? “Course Feedback― – What topics or activities
would you add to the course, or should we focus on some areas more than others? DUE
WEDNESDAY!!!!
need initial post by wednesday and reply s by fallowing day i will post peer reply s after
initial p

Discuss an organization’s need for physical security. What methods, approaches, and
models can be used by organizations when designing physical security needs? Lastly,
explain how these security measures will safeguard the organization.Please make your
initial post and two response posts substantive. A substantive post will do at least TWO of
the following:Ask an interesting, thoughtful question pertaining to the topicAnswer a
question (in detail) posted by another student or the instructorProvide extensive additional
information on the topicExplain, define, or analyze the topic in detailShare an applicable
personal experienceProvide an outside source (for example, an article from the UC Library)
that applies to the topic, along with additional information about the topic or the source
(please cite properly in APA)Make an argument concerning the topic.At least one scholarly
source should be used in the initial discussion thread. Be sure to use information from your
readings and other sources from the UC Library. Use proper citations and references in your
post.After initial post I will post peer reply’s for res
need irac format summaries on international business case studies

Need a 1 – 2 page summary for the following business case studies each in IRAC format.
IRAC, i.e. Issue (basis of the case), Response (of the parties in the
case/Relevance/Recommendations (of the student), Application (to the issue or problem
raised and the different options out there) and Conclusion (Analysis of the company’s
response and well as your recommendations Thus, to expand on the above , the IRAC
categories are the main “headings― of your written case summary and under the
“IRAC― categories are sub-headings that may take the following forms, e.g. Basis of
the case/Pertinent issues (Issue), Analysis of the fact pattern in the case (Response),
alternative options prescribed (Application), Predicted, Possible, and Desired Outcomes
(Conclusion) etc. must be part of the case summary.Corruption in international business (a)
& (b) (1 – 2 Page)Diesel gate – heavy fumes exhausting the Volkswagen group (1 – 2
Page)Tesla: internationalization from Singapore to china (1 – 2 Page)Yahoo! In china (a) (1
– 2 Page)Gillette Singapore: managing global business integration on the ground up (1 – 2
Page)
need it asap in hours (dont bid if you need days and extra bucks)

Sequential Logic Structures are the most commonly used logic structures to accomplish a
task with a sequence of steps. Using the example from Phase 1 of an online retail business,
identify the sequential logic structure to capture the payment information.There are 2 parts
to this assignment.Part 1Document the steps for the logic structure to capture the payment
information. This can be done as either a flowchart or pseudocode. Be sure to include
inputs, variable declarations and assignments, and outputs.The following M.U.S.E. materials
may help you with this assignmentSequential Logic StructuresVariables, Constants, and
Data TypesPart 2Create a data dictionary that identifies the variables. For the dictionary, be
sure to include the variable name, data type, and scope of use. Complete the followingClick
here to download the data dictionary template.Using the first two lines as a guide, enter all
of the variables that you expect to use, define each data type, and identify the scope of each.
need it ASAP

Assignment 2: Discussion Question: Role of the Counselor in the CommunityBy Sunday,

March 27, 2016, respond to the discussion question assigned by the instructor. Submit your
responses to the appropriate Discussion Area. Use the same Discussion Area to comment on
your classmates’ submissions and continue the discussion until Wednesday, March 30,
2016.Nine-year-old Wanda’s teacher notices that for the past few weeks, Wanda has not
been talking to her friends and is always sitting alone in a corner. After talking to Wanda’s
friends, the teacher finds out that Wanda’s sixteen-year-old brother was killed in a gang
fight two months ago and her parents have since separated. The teacher talks to her friend
Daphne, a counselor, to see if there is anything she can do about Wanda. She wants to know
if there is any way in which children and families affected by exposure to violence can be
assisted with emotional impact of these events. The teacher also asks Daphne, in the role of
a counselor, to call Wanda’s parents to see if they would be willing to talk with her about the
death of their son, their separation, and Wanda’s behavior at school. Daphne is not
employed or affiliated with the school.What would be Daphne’s role, as a counselor, in
helping the teacher?What do you see as important roles of a counselor working in a
community?What are the ethical responsibilities that counselors and human services
professionals hold toward the community? When answering this question identify the
ethical code number and definition, using your own words, of the ethical responsibilities of
these professionals.Briefly speak how you, as an ethical counselor, would respond to the
teacher’s request for you to speak with Wanda and her family.
need it by tomorrow night the book is call the killer mocking bird

A NARRATIVE tells a story. A successful narrative should … Hook the reader’s
attention with a strong introductionInclude descriptive details and dialogue to develop the
characters, setting, and plot Structure includes a clear beginning, middle, and endProvide
logical organization, with clues and transitions that establish the order of eventsMaintain a
consistent tone and point of viewUse language appropriate to the audience Demonstrate the
significance of events or ideas Refer to chapter 11 when Mrs. Dubose upsets Jem. Begin
reading the paragraph that starts, “In later years, I sometimes wondered exactly what…”
and continue through four paragraphs ending with, “There was nothing to say.” Rewrite this
incident from someone other than Scout’s point of view. It could be Boo Radley, Jem, Miss
Maudie, Mrs. Dubose, her caretaker Jessie, or anyone else that would have been likely to see
this happen. Be sure to include details that clearly show how the story changes when
experienced from a new point of view. Your narrative should be approximately the same
length…4 paragraphs. Reword the dialogue… DON’T COPY.
Need it fast and done well

Discuss two individual difference variables that have been identified through empirical
research as contributing to OCBs. Based on your research during this course, what are some
of the most significant costs of work dysfunctions and potential mental disorders affecting
groups, teams, and organizations? Why are these costs significant?No sources that are older
than 2010 at least words excluding the references. Must have in text citations at least 3.
Need it in 2hours

SummaryView the following seven videos on You Tube, and write a ½ page summary of
each. I Pencil the movieI Pencil extended commentary: spontaneous orderI Pencil: creative
destructionI Pencil: ConnectivityMilton Friedman I PencilI Smart Phone Entrepreneur as
Hero, by Norberg (on Vimeo) A summary is a neutral presentation, not your opinions.
need it today. In this discussion, the students will learn about…

need it today. In this discussion, the students will learn about…need it todayImage
transcription textIn this discussion, the students will learn about management of various
problems with urinary function, including recognizing the process for Foley insertion and
specimen collection. (Initial response by Sat, no peer posts needed this week) Discuss the
following: 1. Describe to a patient the need for one of the many urine specimens collected
and teach them how it is collected correctly. 2. Describe what intake & output balance looks
like for a patient to be "balanced" and how to achieve that goal. Follow-Up Questions A.
Maintaining Healthy Urinary Elimination 1. What are the different types of urinary
incontinence. 2. What are the different treatment options for urinary incontinence?
Place an Order We do custom work 100% original and plagiarism free .If you
need help in any assignment just send us requirements with time limit ,we will quote a price
and after your confirmation ,we start working on your assignment. An original work ready
for submission provided to you Name*
First
Last
Email* Description**
Attachment

Drop files here or

PhoneThis field is for

validation purposes and should be left unchanged.
Δdocument.getElementById( "ak_js_1" ).setAttribute( "value", ( new Date() ).getTime() );
if(typeof gf_global == 'undefined') var gf_global = {"gf_currency_config":{"name":"U.S.
Dollar","symbol_left":"$","symbol_right":"","symbol_padding":"","thousand_separator":",","d
ecimal_separator":".","decimals":2},"base_url":"https:\/\/homeworklance.com\/wp-
content\/plugins\/gravityforms","number_formats":[],"spinnerUrl":"https:\/\/homeworkl
ance.com\/wp-
content\/plugins\/gravityforms\/images\/spinner.gif"};jQuery(document).bind('gform_po
st_render', function(event, formId, currentPage){if(formId == 1) {} }
);jQuery(document).bind('gform_post_conditional_logic', function(event, formId, fields,
isInit){} );
jQuery(document).ready(function(){jQuery(document).trigger('gform_post_render', [1, 1])
} );
need it today. ing respiratory status: 1. Describe lifestyle,…

need it today. ing respiratory status: 1. Describe lifestyle,…need it todayImage transcription

texting respiratory status: 1. Describe lifestyle, developmental, and environmental factors
that affect respiratory status. 2. Select one of the following and detail how you would
educate your patient: Oximetry, supplemental oxygen delivery devices, ventilation &
oxygenation diagnostics, incentive spirometry, respiratory assessment, tracheostomy care
and suctioning 3. Apply the nursing process to individuals with alterations in oxygenation
by doing each of the following (#4-#8 is the ADPIE=write care plan) 4. Describe
(A)ssessment techniques you use to assess oxygenation based on individual condition. 5.
Choose one nursing (Diagnostic statement from your text book and write a three part
nursing diagnosis. 6. What goal (Planning would you set for your patient? 7. List three
(Interventions the nurse can do and rationale why? 8. Lastly, (Evaluate how you will assess
that your patient has met the goals you have set. archentries or Juthor
Unread Place an Order We do custom
work 100% original and plagiarism free .If you need help in any assignment just send us
requirements with time limit ,we will quote a price and after your confirmation ,we start
working on your assignment. An original work ready for submission provided to you
Name* First
Last
Email* Description**
Attachment

Drop files here or

PhoneThis field is for

validation purposes and should be left unchanged.
Δdocument.getElementById( "ak_js_1" ).setAttribute( "value", ( new Date() ).getTime() );
if(typeof gf_global == 'undefined') var gf_global = {"gf_currency_config":{"name":"U.S.
Dollar","symbol_left":"$","symbol_right":"","symbol_padding":"","thousand_separator":",","d
ecimal_separator":".","decimals":2},"base_url":"https:\/\/homeworklance.com\/wp-
content\/plugins\/gravityforms","number_formats":[],"spinnerUrl":"https:\/\/homeworkl
ance.com\/wp-
content\/plugins\/gravityforms\/images\/spinner.gif"};jQuery(document).bind('gform_po
st_render', function(event, formId, currentPage){if(formId == 1) {} }
);jQuery(document).bind('gform_post_conditional_logic', function(event, formId, fields,
isInit){} );
jQuery(document).ready(function(){jQuery(document).trigger('gform_post_render', [1, 1])
} );
need it now

The focus of this assignment should be DR / BCP technology solutions for response and
recovery after a cyber security incident of sufficient duration and impact to require
activation of the organization’s Disaster Recovery and/or Business Continuity
Plan.http://www.youtube.com/watch?v=d60m6hUpgvs 1. 1- Discuss the importance of
disaster recovery and/or business continuity planning with respect to maintaining the
confidentiality, integrity, and availability of information and information systems.2. 2-
Identify three commercially available technology solutions (products or services) which
could be used to address cybersecurity problems specific to DR / BCP.3. 3- Research and
report upon each of the three technology solutions. For each solution include:a. Vendor
(name and Web site)b. Product Name and Capabilitiesc. How this product or service
can be used to support DR / BCP including protecting / restoring confidentiality, integrity,
and availability of information and information systems.4. 4- Provide a summary in which
you discuss the benefits of incorporating technology-based solutions when planning for
recovery and restoral of IT operations.
need it today asap

The Discussion Board (DB) is part of the core of online learning. Classroom discussion in an
online environment requires the active participation of students and the instructor to create
robust interaction and dialogue. Every student is expected to create an original response to
the open-ended DB question as well as engage in dialogue by responding to posts created by
others throughout the week. At the end of each unit, DB participation will be assessed based
on both level of engagement and the quality of the contribution to the discussion.At a
minimum, each student will be expected to post an original and thoughtful response to the
DB question and contribute to the weekly dialogue by responding to at least two other posts
from students. Two additional responses are required after Friday of each week. Students
are highly encouraged to engage on the Discussion Board early and often, as that is the
primary way the university tracks class attendance and participation.The purpose of the
Discussion Board is to allow students to learn through sharing ideas and experiences as
they relate to course content and the DB question. Because it is not possible to engage in
two-way dialogue after a conversation has ended, no posts to the DB will be accepted after
the end of each unit.Assignment DetailsThis assignment has 4 parts.Collaboration in a
business environment is a best practice that leverages the collective knowledge of the team
assembled. Peer evaluation and support, provided in the spirit of continuous improvement
and organizational success, result in higher quality deliverables than generally possible by
the efforts of an individual. Please describe the process you plan to use to conduct research,
identify findings, and develop the Comprehensive Project due in Unit 5 and present a
preliminary outline indicating how you intend to organize the project deliverable.Please
review the process and outlines of other students, providing an objective assessment and
constructive feedback that will help strengthen the effectiveness of their efforts and the
quality of the finished product.Understanding the customer profile is essential to the overall
marketing plan. The customer profiles also help with selecting the correct media for the
target markets. Visit Experian’s Consumer Profiles
http://www.experian.com/marketing-services/customer-profiling.html and complete the
following:Provide an overview of your productChoose three possible profiles for your
product’s target market/audience. Explain the profiles.How can this type of information
on consumers be used by the marketing manager in its marketing communications &
strategy?Assess the market being targeted. What group(s) of consumers would most likely
be drawn to the product? What are some ethical and legal implications? Explain why you
are targeting these segments and three possible channels you would use to place your
product for distribution to this target market.
need it today

need it today
Q&A need it tonight

1.Are technology-forcing standards a good idea? Why or why not? 2. The CAA makes the
states – not polluters – responsible for complying with NAAQS. Does this make sense? Why
or why not? 3 .Why should the states be barred from regulating mobile air pollution
sources? Should states be allowed to adopt stricter standards than federal standards for
mobile sources?
NEED LATE FRIDAY NIGHT (7/23) OR EARLY AFTERNOON SATURDAY (7/24)

NEED LATE FRIDAY NIGHT (7/23) OR EARLY AFTERNOON SATURDAY (7/24)Unit 4

Assignment: Toy Project Part 1 – Literature ReviewAttached Files:The unit 4 assignment is
part 1 of the toy project. In unit 7, the second and final part will be due. Based on feedback
from your instructor on this unit 4 assignment, your revised unit 4 assignment will be
submitted along with additional components due in unit 7. The unit 7 requirements are
substantial, so please be sure to work on these throughout the course. Refer to the attached
document for assignment details and grading rubric.
need math help need it asap

Work IndependentlyStep 1:A ferris wheel is an amusement park ride comprised of a large
wheel rotating on an axis. There are cars or compartments where people can sit or stand
that are evenly spaced about the circumference of the circle. The wheel rotates slowly
taking passengers on a ride around the circumference of the circle. Please select one of the
following famous ferris wheels to research:Star of NanchangYou will need to find the
diameter and number of compartments (or cars) for the one you chose in order to be able to
complete the calculations section of the assessment. Once you have your information, move
on to step 2.Step 2:Complete the following tasks and calculations. You must show all work
and steps to receive full credit.Name of the ferris wheel – Star of NanchangDiameter of the
wheel (in meters) –Number of cars or compartments –Circumference of the wheel (in
meters) –Area of the wheel (in meters) –Measure of a central angle in degrees –Measure of
a central angle in radians –Arc length between two cars or compartments –Area of a sector
between two cars or compartments –Step 3:If a smaller replica of the ferris wheel was
constructed, what conclusions could you draw about the central angle of the original wheel
and replica? What conclusions could you draw about the arc length of the original ferris
wheel and replica?Imagine the center of the ferris wheel is located at (0, 0) on a coordinate
grid and the radius lies on the x-axis. Write an equation of a circle for your ferris wheel, and
sketch an image of what your ferris wheel would look like on the grid.show work
Need modifications in my essay and add one page and half

The essay is already written but not finished and need more work. My professor wrote
couple of things that need to be changed or added. DQ means dropped quote, meaning that I
need a lead in before writing the quote. Also couple of questions that need to be answer.
You can use BBC, NPR or any newspaper for sources, but anything you put I need to have
access to it because I have to print it. I also used the Mc Bride article three times so I need
you to change it with another article in one of the three paragraphs.
Need more info ask. 1500 words How to complete: Read Case The Outsourcing Propos

Need
more info ask.
1500 words
How to complete: Read Case The Outsourcing
Proposal (17 th ed., p. 444)
Review the Guide to Case Study Submissions document and prepare a case study
report as described.
In preparing your case study, ensure that you answer the following questions:
a. What are the key background items to be considered in the case?
b. What are the potential price savings and what will it take to break even? Please
show your calculations.
c. What is the overarching key issue for this case?
d. What does the data tell us?
e. What recommendations should Joyce Guo make to Randy Haill?
Need more info ask. 1500 words How to complete: Read the Sarin Pharmaceuticals L

Need more
info ask.
1500 words
How to complete: Read the Sarin Pharmaceuticals Ltd. Case
1. Review the Guide to Case Study Submissions document and prepare a case study
accordingly
2. In preparing your case study, ensure you answer the following questions:
a. What is the impact of the multi-language requirement?
b. What is your impression of the Sarin supplier approval process? Should all
purchases have to go through this process?
c. What other departments in the organization should be involved in this
project?
d. What support do you expect to get from the current suppliers in Europe?
e. What support do you need from the Sarin purchasing organization in Europe to
help with the transition?
f. What products and suppliers are your first priorities? How do you want to
rank order the suppliers and products that should be tackled first?
Need more info ask 500 words How to complete: 1. Review the following company pr

Need more info ask

500 words
How to complete: 1. Review the following company profile and read the linked
article:
“All this at a time when global demand for oil and gas continues to grow. Oil
production in the United States alone has increased by two million barrels a
day, to 11 million, which, along with increased global production, is squeezing
Canadian supply even further. Transportation costs, especially by rail, for
lengthy supply chains are an additional burden.
The major problem is the chronic lack of pipeline capacity in Canada that would
enable shipments to markets south, east and west of our borders. Plans have
either been delayed, discarded or rejected outright by policy gridlock in
Ottawa, regulatory delays and erratic, judicial activism. The only plan that is
still alive is the extension of the Trans Mountain line in British Columbia.
When the owner (Kinder Morgan) backed away because of political and regulatory
uncertainties, the government nationalized the project at a cost of
$4.5-billion to taxpayers. Yet, there is still no guarantee that this pipeline
will ever be built.” (BURNEY, D. E. R. E. K., para, 2018)
2. Answer the following and submit:
a. In crafting a transportation strategy what factors/analysis/consideration
should be considered and why? Refer to strategies in your text on pp 269-270
(17th ed.)
b. In early 2019, Alberta Premier Rachel Notley implemented her own oil and gas
transportation strategy since the federal government was in policy paralysis.
In reading the linked article, which of
the factors/analysis/considerations on pp 268-9 (17th ed.) of your text best
describes her primary focus. Do you agree with her plan of action? Why or why
not?
Need my final paper written

Final Paper Global climate change has become one of the top environmental concerns. You
are to write a research-based paper that utilizes scholarly research to discuss the causes,
impacts, proposed solutions, and science surrounding global climate change. At a minimum,
the following topics should be covered in detail: Basic scientific processes and research
practices Greenhouse effectMethods of study (How do we know climate change is
occurring?)Major anthropogenic (human) causes Human population growthAir
PollutionAgricultureSignificant impacts Proposed solutions and adaptationsYour paper
must be eight to twelve double-spaced pages in length and formatted according to APA style
as outlined in the in the Ashford Writing Center, which is located within the Learning
Resources tab on the left navigation toolbar. Additionally, you must use at least four
scholarly resources as well as your text to provide sufficient detail of the topics listed above.
Writing the Final Paper The Final Paper: Must be eight to twelve double-spaced pages in
length (excluding title and reference pages), and formatted according to APA style as
outlined in the Ashford Writing Center.Must include a title page with the following:Title of
paperStudent’s nameCourse name and numberInstructor’s nameDate submittedMust begin
with an introductory paragraph that has a succinct thesis statement.Must address the topic
of the paper with critical thought.Must end with a conclusion that reaffirms your
thesis.Must use at least four scholarly sources.Must document all sources in APA style, as
outlined in the Ashford Writing Center.Must include a separate reference page, formatted
according to APA style as outlined in the Ashford Writing Center
need nice reflection paper

need reflection paper, I am going to attach chapters. I just need at least 500 h words double
space 12 format.And I am studding psychology Clinical Psychology, So I need this reflection
based on chapter kinda connect to the practice. I am studding to by a therapist. think is also
good to notice if chapter relate to it, I am white 27 year old, Polish, so multiculture is new to
me since i am in usa only 5 years.Its multicultutural class—Also are all expected to include a
ONE question that you had based on the readings in the end of the paper.paper need to
touch 2 chapters not only 1
Need no later than Monday afternoon

Research at least three quantitative data collection instruments and sampling methods
available to researchers using the text and additional resources Identify two articles: one
in which the business problem is researched using a descriptive statistical method and
another using an inferential method. Summarize each of the data collection instruments,
sampling methods, and the statistical methods. Write a 1,050- to 1,400-word paper in which
you compare and contrast each of the approaches:What are the strengths and weaknesses
of each sampling approach?What are the specific situations in which you would choose to
use each of the instruments and designs?What are the strengths and weaknesses of each
statistical approach?How can they be used most effectively in a combined approach?Which
methods are more appropriate for research in your own business and functional
area?Format your paper consistent with APA guidelines.
need of data visualization in sales explain about 2 research problem statement

Problem statement:In many a case we have sales data from multiple data source and in that
case its pretty cumbersome process to pull data from multiple sources and organize the
data, represent into end user via interactive reports. This tool will help us to embed sales
data into our application in real time. Need to find a way to find out the ongoing trends and
buying behaviors. And with manual data input it is hard to make a better decision on data
trend, so with the help of analysis and visualization tool will make it a automatic process so
that it will be easy to predict the trend. Also how to improve marketing to improve sales by
adhering analysis and visualizing tool instead of traditional way.provide 2-references and 2
pages anwerMake 2-3 slides of PPT for same question
need one hour or less timed quiz 1

. (TCO D) On January 2, Year 1 the Lyndhurst Company,Inc. a privately-held company,

issued $1,000,000, five –year , 10.00% bonds, dated January 2, Year 1. The bonds provided
for semi-annual interest payments to be made on June 30 and December 31 each year.
Terms of the bond indenture allowed the company to call the bonds at 102 after one year.
The bonds were issued when the market interest rate was 8.00%.Lyndhurst uses the
effective interest method for amortizing bond discounts and premiumThe bonds are term
bonds that mature on December 31, Year 5.Lyndhurst’s fiscal year for financial reporting
purposes is December 31.The company called the bonds at 102 on June 30, Year 2Lyndhurst
called its 10.00%, $1,000,000 bonds on June 30, Year 2, paying bondholders the 102 call
price. On that date, the bonds had a carrying value of $1,060,016. Compute the gain or loss
to Lyndhurst Company on reacquisition of bonds on June 30, Year 2 and record the
appropriate journal entry
Need one paragraph for each question

“Inventory Management” Please respond to the following:Just-in-time(JIT) software is

unable to foresee delivery problems resulting from bad weather, labor strikes, etc. Assess
how a company using JIT inventory management software should mitigate delivery
problems.An increasing number of retailers have installed self-checkout machines. Justify
the installation of these machines in terms of costs management, efficiency,productivity,
and trustworthiness of customers.“Knowledge Management” Please respond to the
following:Loyalty programs are programs that recognize customers who repeatedly use
services or buy products offered by a company. Examples include Bi-Lo’s Bonus Card,
Kroger’s VIP card, frequent flyers, etc. Determine the risks associated with loyalty
programs and identify the risk that is of most concern to you and why.From the e-Activity,
imagine you are a CTO of a large enterprise and have been tasked with choosing an ERP
system for your organization. Compare and contrast commercial ERP systems to open
source ERP systems focusing on flexibility and extensibility, supported platforms, support,
and intellectual property issues. Describe the one you would choose and why.
Need one PowerPoint slides on this topic SCM and CRM for Nike company and one
PowerPoint slides on this topic Technologies and strategies for Nike company With Word
document presentation on SCM and

Need one PowerPoint slides on this topic SCM and CRM for Nike company and
Don't use plagiarized sources. Get Your Custom Assignment on Need one
PowerPoint slides on this topic SCM and CRM for Nike company and one PowerPoint slides
on this topic Technologies and strategies for Nike company With Word document
presentation on SCM and Just from $13/Page
Order Essay one
PowerPoint slides on this topic Technologies and strategies for Nike company With Word
document presentation on SCM and CRM & Technologies and strategies ( 1 Page)
need only two paragraphs

I just need two paragraphs for two discussion posts1. Learning Objective: Analyze the
influence of Earth on human systems and vice versaEarth, it’s complicated. Why is Earth so
rare and complex? How do humans affect the Earth? How does Earth affect human
societies? Feel free to include a photo to connect others with your writing (6-8 sentences
long)For example, Earth is unusual planet as its core is bigger and heavier than other
planets of similar size….2. Learning Objective: Identify how human emotions shape the way
we interact with Earth and NatureHumans around the globe and throughout history have
interacted with nature, some even say we are nature. Provide one example about human
societies loving or fearing nature (6-8 sentences long)
cmgt/400 NEED ORIGANAL WORK WITH REFRENCES and citations and ((APA FORMAT))
before 500pm TODAY

Note to Faculty: The Week Two assignment has been identified as a tool to assist in the
university’s Programmatic Assessment Project. As such, completed student assignments
may be periodically sampled for program analysis purposes. To assist in maintaining the
integrity of the data collected, do not change the content of this assignment. Please delete
this note before submitting to students.Write a 1,000- to 1,500-word paper on at least three
major information security threats that a specific organization you choose faces
today.Describe potential risks to the information and the related vulnerabilities within the
organization. Identify the forces that drive each threat and the related
vulnerabilities.Discuss how the values for threat and vulnerability combine to indicate the
overall risk the organization faces.Describe how an organization can properly manage its
information security efforts using proper risk management techniques and cost-benefit
analyses for these information security efforts.Explain the legal, ethical, and regulatory
requirements for protecting data.Click the Assignment Files tab to submit your assignment.
need original work with good sources. The owner of Work Now, a nonprofit job referral
agency, has as

EASY ASSIGNMENT JUST STUCK AT WORK AND WON’T HAVE TIME TO FINISH!!!! The
owner of Work Now, a nonprofit job referral agency, has asked a few of his employees (you
and your fellow group members) for help and recommendations. In the current economy
employers seeking to fill professional positions are reluctant to hire applicants direct to full-
time. Instead they prefer to hire though temporary agencies (like yours) so they can
evaluate employees and be selective about which one(s) to hire full time. This is called
temp-to-fulltime.Because this is the largest trend in temporary hiring (temp-to-fulltime)
Work Now wants to not only understand this process (so they can help their clients) but
also identify other methods by which applicants can find fulltime employment. The goal is
to increase the number of fulltime hires from individuals who have contracted for Work
Now’s services (both prospective applicants and employers).Your group must do
analysis, have discussions (either via the small group chat or discussion board) and come to
a consensus to prepare a report (paper) that addresses the following:Part 1: Complete
research on temp-to-fulltime and prepare a written statement (3-4 paragraphs) that Work
Now can give to applicants so they can better understand this trend.Part 2: Aside from
temp-to-full time the group must identify and discuss 3-4 methods that job hunters can use
to find fulltime employment. Include specifics defining each method and explaining what
the job applicant needs to accomplish in order to be successful using each.Part 3: Make
recommendations to the owner of Work Now identifying how the information in Part 1 &
Part 2 can be distributed to applicants in a format that is easy to understand. Make sure you
explain “why― this methodology is the best for both Work Now and for the job
seeker. Individual Portion (75 points): Conduct research on the topics identified in Parts 1-
3. Compile your findings into a 2-4 page Word document. You will use your research to
discuss with group members and synthesize everyone’s findings and ideas into a
cohesive report for Work Now.
need outline apa paper

The body of the APA Paper below is not organized topically. Instead, it contains a series of
article summaries chained together. Reorganize the information into a logical topical
outline. Do not rewrite the whole paper. Instead, reconceptualize the content in outline
format with detailed bullets of the articles that are cited. There is no APA guideline for
outlines but you should adhere to APA guideslines when citing articles in your
outline. Every heading must have at least two entries (e.g., A, B; 1, 2). Assignment is due
Monday April 29 2013 by 10 pm
Need 2-3 page orginal paper on DNS design with Visio diagram in APA format for $35

I need a 2- to 3-page paper that includes a Visio diagram of the internal domain name
system (DNS) design for created from the information below, while paying special attention
to the notes for the assignment. The work has to original non-plagiarized, with references
cited and in APA format as soon possible. I will pay $35. Note: The San Jose office has an
ISDN line that is part of a long-term lease. This line is occasionally used to send and receive
potentially sensitive information. Note: The organization does not have an Internet
presence but requires Internet access Note:The model to use for this assignment is: 1
writable DC at central location in San Jose, CA with 1 RODC (read-only DCs) at each of the 5
locations) Requirements for paper. The paper must address the company has 1 central
location in San Jose, CA location with 1 subnet that uses a writable domain controller. (Note:
what is being done on this subnet and how will it be setup) There are 5 other locations with
2 subnets using IPv4 located at Los Angeles, CA; Reno, NV; San Diego, CA; Seattle, WA; and
Portland, OR each of these locations use Read-only domain controllers. Describe the domain
used for the organization. (Note:what is being done on this subnet and how will it be
setup) Tell how will you decide whether to use both forward and reverse lookup zones? Tell
why might you consider installing a redundant DNS infrastructure? Tell what type of server
or server role is needed to handle this type of traffic? I want you to use RODC (Read-Only
Domain Controller)
Need 1-2 pages in APA format along with refernces Describe the reasons why separation of
duties is a critical requirement for policy framework compliance.Understand how to
develop a separation of dut

Need 1-2 pages in APA format along with refernces Describe the reasons why separation of
duties is a critical requirement for policy framework compliance.Understand how to
develop a separation of dut Need 1-2 pages in APA format along with refernces
Don't use plagiarized sources. Get Your Custom Assignment on Need 1-2 pages
in APA format along with refernces Describe the reasons why separation of duties is a
critical requirement for policy framework compliance.Understand how to develop a
separation of dut Just from $13/Page
Order Essay Describe the
reasons why separation of duties is a critical requirement for policy framework compliance.
Understand how to develop a separation of duties policy. Assignment Requirements
Participate in a discussion on the importance of separation of duties for personnel. Discuss
examples of roles you would separate and why. For example, an administrator has full
administrative server login access, and a network technician has limited administrative
access but can view system login details. Payroll has access to employee financial records,
but only payroll managers can approve raises.
need paper 9

Information Technology (IT) professionals plays significant role in an organization. They

have access to sensitive information of the employees of the organization as well as external
business partners. It is therefore important that IT professionals exhibit certain ethical
behaviors in the roles they perform in the organization. In this assignment you will be using
the library resources to locate a peered review article that discusses the ethical behavior
and code of conduct for IT professionals. You will be using the citation resources to properly
cite the article in APA format and generate a reference. This assignment should be one (1)
page long excluding the title page and should be formatted as follows:Format: Times New
Roman, 12 point and double spacedThe assignment should be formatted under the
following headings:Last name, First name of author:Title of the article:Summary of the main
point:APA citation Reference:Paper with no plagrsim paper should follow this patter:1. title
of the article 2. Author of the article ( Last Name, First Name)3. Summary of the article4.
Reference.Paper with no plagrsim
need paper below written monday 112315

Write a 700- to 1,050-word paper in which you answer the following questions:What were
the major developments in the evolution of mass media during the last century?How did
each development influence American culture?What is meant by the term media
convergence, and how has it affected everyday life?Conclude your paper with a reflection on
why media literacy is important for responsible media consumption
today.Format consistent with APA formatting guidelines.
Need paper completely written

1. Using the industry life cycle model, elaborate on the stage of the life cycle that the car
industry was in prior to Tesla’s entry. How was Tesla able to enter this industry? What
competitive advantages has it created along the way?2. What does Tesla need to do to
“cross the chasm” and become a mainstream player in the car industry? What are likely to
be the key sources of resistance (consumer/supplier/distribution/etc) that it will
encounter, and how can it overcome them?3. Specify three key strategies that Tesla needs to
implement to stay ahead of the competition and ensure its viability in the long run.
need paper done by 10:30 tonight review attached links to get an idea of what th

need paper done by 10:30 tonight review attached links to get an idea of what the research
proposal should be like
Need paper done

Using the Internet or Strayer University databases, research health care organizations /
providers that have recently had a significant information technology failure, and complete
this assignment. Write a seven to eight (7-8) page paper in which you: 1. Determine
the key factors contributing to the failure in question. Next, analyze how the failure
impacted both the organization’s operations and patient information protection and
privacy. 2. Analyze the leadership team’s reaction to the failure, and indicate whether the
leadership took sufficient measures to deal with various stakeholder groups impacted by
the failure. Provide support for the rationale. 3. Take a position on whether the health care
provider that you identified should either develop a custom application or select a
proprietary system. Provide support for the rationale. 4. Recommend at least three (3)
best practices that any organization could adopt in order to avoid such a failure in the
future. Provide support for the recommendation. 5. Suggest how health care leaders can
use project metrics and portfolio management to ensure operational efficiency and
effectiveness. Provide specific examples to support the response. 6. Analyze a government
intervention into health care businesses, meant to ensure that health care and patient
information is secure and thus to minimize information breaches and technology failures.
Argue for or against such intervention. Support the position. 7. Use at least three (3)
quality resources in this assignment. Note: Wikipedia and similar Websites do not qualify as
quality resources.
Need paper fast by tomorrow. Must be plageriasm free in APA style...Must know ECON very
well

Please read allInstructions for the Research/Interview PaperThis document provides

instructions for the research/interview term paper. I am providing this to provide more
clarification than what is given in the syllabus so that the expectations are clear. This is both
expectations regarding the purpose of the paper, content of the paper, and the format of the
paper. Hopefully you will see these are all interconnected. Also note that I have slightly
altered the grading rubric in the syllabus to reflect these changes. Purpose of the PaperThe
purpose of the paper can be very simply stated. It is to apply a concept from managerial
economics to address a real world problem in business by conducting necessary research.It
is important to realize that this paper is not a report on some business topic related to
managerial economics. It may be quite different from other papers you have written, and
this is likely to be reflected in what is meant by “research” and the other contents of the
paper. This is described more fully below. Content of the PaperIt was stated that the
purpose of the paper is to apply a concept from managerial economics to address a real
world problem in business by conducting necessary research. Let’s break this into its
parts.1. A real world business problem:You must identify a real world business problem
that you think would be interesting to analyze. This could be a problem related to a
particular business, a particular industry, or an economy wide problem. I highly
recommend choosing a narrowly defined problem. Some examples could be(i) How
did company X incorporate business ethics into their human resource
policies?(ii) Should firms in the X industry increase their price?(iii) What is
the response of company X to an increase in minimum wages?These are just a few
examples. What is important is that your problem be very clearly defined and that it be
interesting to you.2. A concept from managerial economics:Throughout the term you will
be exposed to many concepts, or theories, from managerial economics. These include
forecasting, risk analysis, pricing strategies, optimal resources to hire, capital budgeting,
game theory, business ethics, etc. One of these concepts covered will be used in your paper
to address a problem, or issue, from a real world business situation. 3. Application of the
concept to the problem:A concept, or theory, is a logical framework that allows one to
highlight causal relationships between different variables. You then will use that
concept/theory to understand the business problem you are studying. For example,
suppose the business problem is the effect of minimum wages. But notice this is not narrow
enough. Does this mean the effect on business profits, the effect on employment, the effect
on teenage employment, the effect on business investment, etc. As one can see there are
many dimensions to the problem. So you need to pick one very narrow dimension. Let us
say the business problem is the effect of a minimum wage increase on teenage, part-time
employment. With that as the business problem the concept/theory from managerial
economics we need to apply is the concept of marginal resource cost and the firm’s profit-
maximizing decision to hire resources. And suppose the application of this concept suggests
that a firm will reduce its use of unskilled labor and cause a shift to capital investment in the
long-run, causing a fall in teenage, part-time employment. 4. By conducting necessary
research:The application of the concept tells you how the variables relevant to the problem
are related to each other. That is, it provides the framework to understand the problem.
Your research will apply this conceptual framework to the problem with real world data to
fully analyze the problem. Depending on the nature of the problem being studied, the
research may be investigating the extent to which the conceptual framework is correct, or it
may be measuring the impact of one variable on another that the conceptual framework has
identified as being important. For example, in the case of the effect of minimum wages, the
concept tells one how minimum wages and employment may be connected, and why they
are connected. Your research may investigate the extent to which this is true. Hence you
could collect information that will help in determining the extent to which minimum wages
cause teenage unemployment. Alternatively you may decide to investigate how one
company has planned for increases in minimum wages, including their plans to hire teenage
workers. There are undoubtedly many different types of data to be collected, but for this
paper we can say there are two options you have. (i) The first option is to collect
data on the variables of interest from publicly available sources (such as government
statistics, industry publications, company reports, journal publications, etc.), and then use
this information to apply the concept to analyze the problem. So in our example, you may
collect information on minimum wages and teenage employment and use that data to
determine the extent to which increases in minimum wages decrease teenage employment.
In this case that probably means doing some simple statistical analysis, but it is not
necessary to use statistics. In general, you simply need to use this data to help apply the
concept to analyze the problem. (ii) The second option is to use the interview option
to ask company executives about the issue at hand. Continuing with the above example, you
may ask a series of questions about their strategy for responding to increases in minimum
wage, etc. Again, the emphasis is on using these interview responses to apply the concept to
analyze the problem. As you can see, in either case the goal is to collect data/information
that will help apply the concept from managerial economics to analyze the problem. Of
course, the exact type of data needed, and the techniques needed, will vary with the
problems studied. Format of the PaperThe above makes clear the main purpose and content
of the paper. The format of the paper follows this content, and is given below. Please note in
addition to the format given below a title page is required.Format of the PaperSectionTitle
of the SectionContent of the Section1IntroductionThis section states the problem to be
analyzed, why it is an important problem to be studied, and the contents of the rest fo the
paper.2Conceptual FrameworkThis section will identify the concept/theory from
managerial economics you will use to study the problem. It will then show how that
concept/theory relates to the problem.3Research and AnalysisThis section explains the data
you will be using, present the data, and use the data to analyze the problem and discuss the
results.4ConclusionThis section summarizes the main findings and suggests areas of further
study if appropriate.5ReferencesYou must use a minimum of three resources beside the
textbooks and use the appropriate format for the references. Grading RubricI have amended
the grading rubric to reflect the more specific format and contents given above. This is
provided in a separate document. Helpful TipsI have a few tips that I think will be helpful in
completing this paper.1. Start soon: The paper is not meant to be terribly time
consuming, but even selecting the appropriate topic can take time. So begin thinking about
this now. 2. Choose a narrow, well-defined problem to analyze: The most common
problem for students is choosing too large a problem, or an ill-defined problem. That is, the
problem may be well-defined, but would require a major amount of research to adequately
address. Or it can be a problem that is not clearly defined. This will result in you not
knowing how to proceed. However if you choose a narrow and well-defined problem the
rest of the paper will be much easier. 3. There are no limits on the topics/problems you
can choose, other than you must analyze them with concepts from managerial economics.
However, for your own benefit, I highly recommend choosing problems that make use of
company specific research. You can use the interview for the research section, or rely on
company reports, but in either case I think you will learn more about applying managerial
economics to real world business problems when your focus is on a specific
company. Research or Interview Paper Grading RubricStudent:
ElementsInstructionsCriteriaPoints EarnedPoints PossibleInstructor’s
CommentsIntroduction· Provide a clear statement of the problem to be addressed and
why it is important.· Clearly state the contents of the paper· Is there a clear
thesis/problem statement? What is the topic you are going to address?· Does the
introduction provide a clear overview of the paper’s contents? 10 Content 1:(Conceptual
Framework) · Clearly describe the problem in more detail· Identify the relevant
concept from managerial economics you will use to analyze the problem, and explain how
that concept relates to the problem. · Are the issues raised in the topic properly
treated?· Is the concept being used appropriate?· Is the concept correctly applied to
understand the problem? 20 Content 2:(Research and Analysis)· Explain the data you will
be collecting and why that data is useful to analyze the problem· Present the data· Use
the data to analyze the problem and discuss the results· Does the data bein collected
allow for a thorough analysis of the problem?· Are differing viewpoints considered,
analyzed, and treated?· Is the analysis thorough?· Does the author provide personal
inputs? 30 Conclusion· Summarize your findings· Offer suggestion for further study
if appropriate· Does the conclusion offer a good summary of issues treated in the
paper?· Does the conclusion offer suggestions for further
study? 10 Materials/Sources· Use at leasts 3 sources besides the textbook· Cite these
sources properly in the references section· Does the bibliography contain at least 3
scholarly sources?· Are materials properly cited and quoted in current APA
style? 10 Structure· Use the section headings and format provided.· Are the transitions
between paragraphs and sections clear?· Are proper headings used?· Is the treatment
of the topic logically oriented? 10 Style· Write in a clear, concise manner without spelling
and grammatical errors.· Is the paper without spelling and grammatical errors?· Is the
paper clearly written? 10 Total: 100
need paper on client johnson amp amp johnson

Complete the final case study paper and presentation on your selected and approved
company. company :johnson&johnsonGuidelines:The final case study paper should cover 4
sections including an overview of the company and its competitive landscape along with 3
other sections addressing specific issues, problems, or strategies the company is facing.Each
section should be 1.5 – 2.0 pages (4 sections X 1.5 – 2.0 pages = 6 – 8 pages). The
evaluation of the final case study paper is based on how well students apply the course
concepts and ideas to the company they have selected.Submission Details: 6-8 pages
(double-spaced).Response is due 11:59 pm ET Sunday week 14. Click the attachemnt above
to read the detailed instructions.Use the complete APA style of writing including a title page
with running head, abstract, body, and reference list
need paper on cloud computing

For this project, select an organization that has leveraged Cloud Computing technologies in
an attempt to improve profitability or to give them a competitive advantage. Research the
organization to understand the challenges that they faced and how they intended to use
Cloud Computing to overcome their challenges. The paper should include the following
sections each called out with a header.• Company Overview: The section should include
the company name, the industry they are in and a general overview of the organization.•
Challenges: Discuss the challenges the organization had that limited their profitability
and/or competitiveness and how they planned to leverage Cloud Computing to overcome
their challenges.• Solution: Describe the organization’s Cloud Computing
implementation and the benefits they realized from the implementation. What was the
result of implementing Cloud Computing? Did they meet their objectives for fall short?•
Conclusion: Summarize the most important ideas from the paper and also make
recommendations or how they might have achieved even greater
success.Requirements:Evidence of copying from other papers or not properly citing sources
could result in a score of zero.The paper must adhere to APA guidelines including Title and
Reference pages. There should be at least three scholarly sources listed on the reference
page. Each source should be cited in the body of the paper to give credit where due. Per
APA, the paper should use a 12-point Time New Roman font, should be double spaced
throughout, and the first sentence of each paragraph should be indented .5 inches. The body
of the paper should be 3 – 5 pages in length. The Title and Reference pages do not count
towards the page count requirements.
Need paper on Global Education and Global Citizenship video

Reflecting on Personal Identity and Global CitizenshipReview the Global Education and
Global Citizenship (https://www.youtube.com/watch?v=XXzRHbISFW0) video and read the
article “A Model of Global Citizenship: Antecedents and
Outcomes ”(http://www.homeworkmarket.com/sites/default/files/qx/15/08/18/11/wee
k_1.pdf ) by Stephen Reysen and Iva Katzarska-Miller. Please take some time to reflect on
how the concept of global citizenship has shaped your identity and respond to the following
prompts:
need paper stat apa 6th edition on hipaa and ethics

Library Research AssignmentChief executive officer (CEO) Beranger wants to ensure that
the current regulations and requirements under the Health Insurance Portability and
Accountability Act (HIPAA) and the Security and Privacy Rules will be met as she continues
to move Silver Creek Hospital towards a culture of e-Health beyond the implementation of
an electronic health record system to the integration of telemedicine and data mining. She
asks that you compose a report of 3–4 pages that includes the following
information:Describe the objectives of the HIPAA Security and Privacy Rules. Discuss how
HIPAA attempts to safeguard protected health information (PHI). Explain how abiding by
HIPAA rules and regulations may challenge the ethics of health care professionals. Discuss
the limitation of HIPAA and the ethical issues related to the use of electronic health data for
research and development of evidence-based practice guidelines.Assignment
ObjectivesApply ethical principles to situations which challenge one’s own principles.
Describe basic ethical issues which healthcare professionals encounter in their areas of
work. Prepare students to take the HIPAA Awareness certification exam.Other
InformationThere is no additional information to display at this time.LegendExtra Credit
View Assignment RubricAssignment OverviewType: Individual Project Unit: Rules,
Regulations, and Accountability Due Date: Wed,2/27/19 Grading Type: Numeric Points
Possible: 100 Points Earned: Deliverable Length: 3–4 pages + at least 2 scholarly resources,
WRITTEN IN APA 6TH EDITION
Need Paper – Strategic Management (Plagiarism Free), management homework help

Don't use plagiarized sources. Get Your Custom Assignment on Need Paper –
Strategic Management (Plagiarism Free), management homework help Just
from $13/Page
Order Essay PLAGIARISM FREE – TEACHER WILL USE
‘TURN-IT-IN’ TO CHECK Purpose of Assignment – Students learn to understandassociate
and leadership involvement in creating metrics that fit theorganization’s culture and
strategy. They will also be able to successfullytrack progress to goals. Today’s workforce is
diverse in terms of age and otheraspects that influence performance and success. Leaders
must both motivate andsupport employees so that they can continuously adapt to change
while creatingopportunity in their careers. Assignment Steps: Develop a 2,100-word
analysis of how change management canhelp retain or promote employee loyalty by taking
into account: •Motivating individuals to stay engaged •Monitoring employee
performance through the controlfunction of management •Communicating the change
process at both a strategic andtactical level Include at least three peer reviewed
references. Format yourassignment consistent with APA guidelines
need paper with no plagrism 1

our final research paper assignment is to write a research paper that explains how
Information Technology (IT) promotes getting people who are affected by policies involved
in the policy-making process. Cite specific examples.To complete this assignment, upload a
Microsoft Word document (.doc or .docx) that contains your complete paper. Remember
that your paper, including your list of sources, must be in APA format, and you MUST cite
your reference in the body of the paper using APA in-text citation format. A source is any
paper or article that you will reference in your paper. If you need more information on APA
format (for references list AND in-text citations), visit this reference:
https://owl.english.purdue.edu/owl/resource/560/01…This assignment must be YOUR
OWN WORK! This is an individual assignment. Plagiarism detected in your work will result
in a grade of zero for the entire paper.Here are a few details about the overall research
paper Please look at the attached rubric for details on how the paper will be graded.You
must reference two (2) peer-reviewed articles or papers that support your thesis statement.
One of these papers may be from your annotated bibliography assignment. The final paper
must be at least 500 words in length. (DO NOT exceed 500 words by a material amount.
Excessive words or too many references will NOT impress me.)So in summary, here are the
research paper requirements:2 peer reviewed resources (articles or papers) (1 may be
from your annotated bibliography assignment)Paper MUST address: How Information
Technology (IT) promotes getting people who are affected by policies involved in the
policy-making process. Cite specific examples.Cited sources must directly support your
paper (i.e. not incidental references)At least 500 words in length (but NOT longer than 1000
words)If you are not sure how to identify peer reviewed papers or articles, please visit the
following resources:http://diy.library.oregonstate.edu/using-google-
sc…http://libguides.gwu.edu/education/peer-reviewed-a…
need paper with no plagrism

Each student will select one of the key terms listed below and conduct a search of 1 recent
peer reviewed article (within the past 3 years) that closely relate to the concept. Your
submission must include the following information in the following format:Key
terms:Multiparty NegotiationHaggling in NegotiationCounter-offering in
NegotiationAdversarial BargainingDEFINITION: a brief definition of the key term followed
by the APA reference for the term; this does not count in the word requirement.SUMMARY:
Summarize the article in your own words- this should be in the 150-200 word range. Be
sure to note the article’s author, note their credentials and why we should put any weight
behind his/her opinions, research or findings regarding the key term.ANALYSIS: Using 300-
350 words, write a brief analysis, in your own words of how the article relates to the
selected chapter Key Term. An analysis is not rehashing what was already stated in the
article, but the opportunity for you to add value by sharing your experiences, thoughts and
opinions. This is the most important part of the assignment.REFERENCES: All references
must be listed at the bottom of the submission–in APA format. Be sure to use the headers in
your submission to ensure that all aspects of the assignment are completed as required.Any
form of plagiarism, including cutting and pasting, will result in zero points for the entire
assignment.
need paper written 7

For this assignment, you’ll examine at least one of the macroeconomic indicators or policies
below withinthe context of the industry you have previously selected. GDP growth
Unemployment rates Inflation rates Interest rates International trade policy and issues
related to trade balances, trade restrictions, etc. Government fiscal policy and issues related
to taxation, government spending, and budgetdeficitsFED (central bank) monetary policy
and issues related to the FED’s mission to stabilize theeconomyInstructionsPrepare a Final
Report that is approximately two to three (2-3) pages long in which you:1. Assess your
selected industry’s relative size and growth rate in the economy.2. Identify at least one
newsworthy macroeconomic indicator or policy that is important for theindustry to
monitor, e.g., GDP, unemployment, inflation rates, interest rates, trade policy,government
taxation and spending decisions, and/or FED decisions.3. Explain why this macroeconomic
indicator or policy is important and how it may impact yourselected industry.4. Describe a
recent trend in the macroeconomic indicator or policy. Include a graph, chart, or tablethat
illustrates the observed trend.5. Conclude with a forecast for the industry based on whether
the trend identified in part 4 isexpected to continue. Provide support for your conclusion.6.
This course requires use of Strayer Writing Standards (SWS). The format is different
compared too Your brief should include a cover page.o Your brief should be two to three (2-
3) pages in length (not including the cover page),double-spaced, 12-point font.o Your report
should include a minimum of two (2) references/citations in the text. APA FormatTopic
from assignment 1 :Agricultural, Farming, and Fishing industry and other
government interventions ( Please Stick to this TOPIC ONLY)
need paper written 9

TOPIC Is: Augusta University HealthFor this assignment, use this health care provider
Augusta University HealthWrite a four to six (4-6) page paper in which you:Determine the
key characteristics of the users of the products and/or services of the health care provider
you selected.Analyze the competitive environment of the health care provider you selected
and recommend a course of action for strategic marketing success.Determine which tools of
the marketing mix available to health care providers would be most effective for the health
care provider you selected.Determine the best possible pricing strategy for at least one of
the products or services offered by the health care provider you selected.Provide at least
three (3) qualified sources, e.g., peer-reviewed journals, professional organization Website,
or health care provider Websites.Your assignment must follow these formatting
requirements:This course requires use of APA format.Be typed, double spaced, using Times
New Roman font (size 12), with one-inch margins on all sides; references must follow APA
or school-specific format. Check with your professor for any additional instructions.Include
a cover page containing the title of the assignment, the student’s name, the professor’s
name, the course title, and the date. The cover page and the reference page are not included
in the required page length.The specific course learning outcomes associated with this
assignment are:Analyze the competitive environment of a health services organization and
identify a course of action that will allow for strategic marketing success.Analyze the users
of the health care system.Describe the various tools of the marketing mix available to health
care providers.Use technology and information resources to research issues in health
services marketing.Write clearly and concisely about health services marketing using
proper writing mechanics.
Need paper written asap

Texts to Cite From:“Small Change: Why the Revolution Will Not Be Tweeted” by Malcolm
Gladwell (in They Say/I Say pg. 399)“Facebook Has Transformed My Students’ Writing for
the Better” from The Atlantic [opens in a new window] Link:
https://www.theatlantic.com/education/archive/2013/11/facebook-has-transformed-my-
students-writing-for-the-better/281563/.“Social Media Is Not Destroying America” from
Slate.com [opens in a new window]
Link:http://www.slate.com/articles/technology/future_te...Prompt:Whether it’s Facebook,
Twitter, Instagram, Snapchat, or YouTube, most people have some form of a social media
account. As evidenced by the readings above, these sites have many pros and cons. Make an
argument for whether you think social media is improving society or damaging society
overall. Be sure to provide reasons for your claim and offer ample examples/evidence to
support these reasons*500 to 750 words*MLA Format(8th edition)*Two citiationsYou may
use “I” in this essay, but the style should still be formal (no “you” or contractions)
need paper written on qualities of police

You have been asked to serve on the search committee for a new Chief of Police for your
agency. You have several years of experience as a Lieutenant and have a good working
relationship with the retiring chief, as well as an overall understanding of the
agency.Because of this, you and the other members of the search committee have been
asked to submit a report to the search committee chair that details the qualities most
important to the new chief. The search committee chair has asked that each member of the
committee choose the top four qualities/ KSAs that the new chief must have, with one page
of supporting details for each quality. Note that these are the four most critical
qualities/KSAs, so choose carefully and ensure that you provide supporting evidence.We
have reached the end of the semester, so you should have a wealth of knowledge about
police administration that you can rely upon to write this paper. The report should be
written with examples and clear details to indicate your understanding and application of
the material. Use information and resources from the book to help guide your decisions.
Utilize the book but do not plagiarize it. You must show independent critical thought
here.Remember that you will be turning this in on D2L and plagiarism detection software
will be used. If you use something from the book, cite it (in text like this: Cordner, 2016). If
you use those alone, there is no need for a works cited page. Feel free to use other sources
but you must cite them and include a reference page so that I can find them. I am not
particular about what type of citation formatting that you use, as long as I can identify the
source and locate it myself.See the syllabus for the late paper policy. See the grading rubric
attached to the assignment in D2L.Write the report in the form of one quality per page.Bold
the quality and then begin your supporting details and evidence.For example:Experience
with measuring productivityThe most important quality for the new Chief of Police is
experience measuring agency productivity……
need paper written tn

Essay 3: Research Argument (Synthesis) – 1500 words minimum; worth 25% of your
gradeRhetorical Situation – You are writing for a general audience that you would like to
educate about relevant issues.Assignment Objectives: There were many social issues raised
in Ta–Nehisi Coates: “Letter to My Son”, Ariel Felton: “A Letter to My Niece”,
and George Tillman’s film The Hate U Give. Please note that I am aware that due to our
current circumstances, access to the film might not be available for everyone. Therefore, in
addition to the clip that you viewed in the discussion forum, here are some interviews in
which various topics related to the film are discussed. Between these clips and the two
letters, there should be enough reference points for your essay. You still need to find
secondary sources such as news articles, journal articles, or recorded interviews from
reliable sources.Write an essay that examines the issues raised in all three pieces. Consider
focusing on one or more of the following topics:The practice of “code switching” and the
impact it has on a person’s sense of identity.Stereotypes—based on race, gender, and
social class.Drug-related crime.Race relations and the law.Community organizing and
development.The use of voice, as a community or an individual, to promote social justice.Or
any other topic that comes to mind related to these pieces.Your essay should:have a thesis
statementsupport the argument presented in the thesis by synthesizing at least five sources
that you have found and evaluated as credible or otherwise worthy of attentionsummarize,
paraphrase, and quote from these sources adequately to complete the task.RationaleThe
simplest explanation of this essay’s purpose is that by completing it, you will write an
essay that answers your research question. Ultimately, however, the purpose of this
assignment is to enter a scholarly conversation. By applying the skills in research, source
evaluation, and synthesis that you have been practicing through the term, you will
contribute to an existing conversation by presenting your own original argument. That
argument will speak to the exciting conversation by using sources to support your
argument (either as evidence, by extending or modifying your sources’ arguments, or by
refuting sources’ arguments). The most important thing to remember as you work on
this essay is that you cannot simply parrot the information or arguments that you find in
your sources. Rather, this essay will be driven by your unique argument answering your
research question. Your essay must be a persuasive argument that allows you as a young
scholar to enter and contribute to the ongoing conversation on your topic.AssignmentIn
short, this assignment requires you to write a thesis-driven essay that makes an argument
answering your research question that cites at least five sources to support your claims and
show your thesis’s relationship to the existing conversation on your topic.Do I need a
Works Cited Page?Because you will be quoting, paraphrase, and summarizing from your
sources, you will need to parenthetically cite them in your essay. You will also need an MLA
works cited page which lists all sources. Please ask if you have questions regarding citation,
and remember that all essays will go through the Turnitin Originality Check in the D2L
Dropbox.
need paper written

Written Paper Guidelines:Submission format:Each student will submit a research paper.

The paper will consist of:• APA formatted document; double space, and a minimum of 12
pages• A cover sheet containing the title of the paper, the student name, and the names of
each student member• Table of contents identifying major sections of the paper and the
corresponding page number• Executive summary• The written paper• ReferencesFormat
for bibliography entries examples:Article:Furst, Stacie A, & Cable, Daniel M (2008).
Employee resistance to organizational change: managerial influence tactics and leader-
member exchange. The Journal of Applied Psychology, 93(2), 453-62.Book:Glaser, B.G. and
Strauss, A. L. (1967), The Discovery of Grounded Theory: Strategies for Qualitative
Research, AldineTransaction, Piscataway, NJ.Internet:Bureau of Transportation Statistics,
U.S. Department of Transportation, National Transportation Statistics, Table 1-50,
http://www.rita.dot.gov/bts/sites/
rita.dot.gov.bts/files/publications/national_transportation_statistics/2010/html/table_01_
50.html, accessed December 30, 2013Figures and TablesAny figures or tables should be
imbedded within the text where appropriate. Do not reference a table or figure and then
place at the end of the paper as an attachment or appendix. Your references should use the
end notes feature within Microsoft Word. This approach will cause the references to be
sequentially listed at the end of the paper. Page 18 of 23SpacingThe written paper should be
double-spaced. Headings and sub-heading should be used as appropriate to assist the
reader in identifying major sections of the paper. Major headings must be used for the
Introduction, Discussion, and Conclusion sections. You may use other heading names as
appropriate for your paper.The bibliography is single spaced. A single line should be
inserted between each reference.Additional writing resourcesIf assistance is required with
developing your writing skills, several texts are available that may be of
assistance:Grammar:Hodges, J.C. and M.E. Whitten. Harbrace College Handbook, 9th ed.
(1984), New York: Harcourt brace Jovanovich.Corbett, E.P. The Little English Handbook:
Choices and Conventions, 4th ed. (1984), Glenview, IL: Scott, Foreman and
CompanyStyle:Strunk, W. Jr., and E.B. White. The Elements of Style, 3rd ed. (1990), Chicago,
IL: The University of Chicago PressUsage:Bernstein, T.M. The Careful Writer: A Modern
Guide to English Usage, New York: Atheneum. American Psychological Association. APA
Manual, 5th ed. (2001), Washington, D.C.Szuchman, L.T. and B. Thomlison, Writing with
Style: APA Style for Social Work, (2000), Blemont, CA: Wadsworth Publishing.Sources:This
paper should be written for a target audience of business professionals. As a result, you
need to write in a very direct, concise, and business-like style. As a result, you will need to
use sources with current information to include extensive internet searches. Please ensure
you carefully well document all sources used in your research.
Need paper

Essay Assignment These days, many people use the internet for their sources of information
on drugs. However, many internet sites don’t always have the most objective or valid
information. Some websites may have a particular agenda (such as promoting the
legalization of drugs, or supporting a stronger War on Drugs), and therefore use selective
bias in their information. Others may be written by non-experts who are simply giving their
opinion without substantiating their claims. In some cases it may be hard to tell if the
information you are reading was written by an expert on substance abuse issues who works
in a drug research center, or a high school student writing a blog in their parent’s
basement. For your assignment you need to select one illegal drug (i.e., marijuana, cocaine,
heroin, ecstasy, etc.), and compare and contrast two different websites that give information
about that drug. You first need to compare the information on each site. Then you need to
critically analyze the information on each site in terms of its validity and objectivity. In
order to do that you should address the following points in your comparison. •What is the
purpose and affiliation of the organization or author of the website?•What are the author’s
credentials?•Is the information current? When was the information last updated?•Does the
source contain bias without evidence to back up the claims? Finally, you need to discuss
which website you find more credible and why. One good way to justify your choice is to
cross-reference the information on the websites with another type of source that is known
to be credible – such as a peer reviewed journal article that you found on an academic
database at the John Jay Library. Generally, peer reviewed articles are considered more
credible because they have been checked for validity issues prior to being published.
Therefore, if your websites contain information that can also be found in a peer-reviewed
research article, it gives it more credibility. In other words, for this assignment, you not only
have to compare the two websites, but should also find a few academic articles to cross
reference the information with. *Paper should be around 5-8 double spaced pages*1-inch
margin all around, include page numbers* Use a 12 point font Make sure to reference any
direct quotes and to include a reference list at the end of the paper listing the websites and
journal articles you used.
need part 3 organization and staffing 1 5 page and part 4 control and leading 1 page

Event ScenarioYou have volunteered to organize a fundraiser for your child’s school
sports team to purchase new uniforms. For your event to be successful, you are responsible
for all aspects of its management: staffing, planning, organizing, controlling, and leading.
The general information known includes:You have a team of 15 volunteers willing to
assist.$1,600.00 is the cost to purchase the uniforms.A local fire department has offered its
picnic grove for use for free.Many local businesses (restaurants, bars, retail stores, etc.)
have comm itted to donating goods or services to your event.The school board has
requested you submit a formal proposal detailing each of these aspects and how you will
manage/lead the process to completion before they approve the eventI have the
answer.Will send when I accept.Also,I am attaching my previous work.
need peer reviewed references full apa and citations

It’s important to realize that risk management isn’t intended to be risk elimination.
Discuss.Discussion rubricSynthesis of Concepts – Initial Post50Clear Citations using APA
format10Writing Standards10Timeliness10Peer Reviews (minimum of 2)20
need perfect work 69

Detailed Description:You are required to develop a web page named“MCQs.html―.

This web page must contain five MCQs(Multiple Choice Questions) having four options each.
The web pagemust also contain two buttons “Check Result” and“Reset”.The
user has to select one option for each MCQ and thenclick “Check Result― button.When
user clicks “Check Result” button thenServlet named “SelfTest.java” process
HTML formdata, do some processing on that data and send the output of userresult back to
client as given below:Question 1: Correct/incorrect/unansweredQuestion 2:
Correct/incorrect/unansweredQuestion 3: Correct/incorrect/unansweredQuestion 4:
Correct/incorrect/unansweredQuestion 5: Correct/incorrect/unansweredAnswered
questions: ____Un-answered questions:____Correct questions: ____Incorrect questions:
___Your Totalscore:_____
need perfect work.................

discussion 1How can we sustain the environment for future populations? This week we
discuss global warming. Most people do not understand what global warming really is, its
causes, or its consequences. Most people do not know that some of their daily activities
could be contributing to global warming. There are some that argue against global warming
and say global warming is not occurring, or that if it is occurring, it is not primarily caused
by man. Conduct some research and respond to the following:Define "global climate
change."Explain the theory behind the Greenhouse Effect.Name 3 or more gases that
contribute to the Greenhouse Effect.Name some natural causes of greenhouse gases.Name
some anthropogenic causes of greenhouse gases.What one thing can you do differently that
would reduce greenhouse gases?Based on your research, summarize your own theories
regarding the issue of global warming, if it is or is not occurring, if it is or is not caused by
human activity, and what if anything we should be doing about the problem.discussion
2Fraud has become easier to commit with the advances in technology. Innovative criminals
are finding new ways to deceive people into paying for services that don't exist or giving up
their rights in some other way.Respond to the following:Choose a type of fraud that
interests you. Briefly summarize it for the class in your own words and give an example that
is not in your textbook.Identity theft is a concern for all citizens. Have you or anyone you
know been the victim of identity theft? If so, briefly describe the situation: how was it
discovered, how was it resolved, etc. If not, use the Internet to locate a news story about
identity theft and briefly describe it for the class.What advice would you give to young
people obtaining a credit card for the first time on how to protect their identity?
Need plagiarism free work. Question 1 Integrated Waveguide Technologies (IWT)

Need plagiarism free work.Question 1Integrated Waveguide Technologies (IWT) is a 6-

year-old company founded by Hunt Jackson and David Smithfield to exploit metamaterial
plasmonic technology to develop and manufacture miniature microwave frequency
directional transmitters and receivers for use in mobile Internet and communications
applications. IWT’s technology, although highly advanced, is relatively inexpensive to
implement, and its patented manufacturing techniques require little capital as compared to
many electronics fabrication ventures. Because of the low capital requirement, Jackson and
Smithfield have been able to avoid issuing new stock and thus own all of the shares. Because
of the explosion in demand for its mobile Internet applications, IWT must now access
outside equity capital to fund its growth, and Jackson and Smithfield have decided to take
the company public. Until now, Jackson and Smithfield have paid themselves reasonable
salaries but routinely reinvested all after-tax earnings in the firm, so dividend policy has not
been an issue. However, before talking with potential outside investors, they must decide on
a dividend policy. Your new boss at the consulting firm Flick and Associates, which has been
retained to help IWT prepare for its public offering, has asked you to make a presentation to
Jackson and Smithfield in which you review the theory of dividend policy and discuss the
following issues.a. (1) What is meant by the term “distribution policy”? How has the mix of
dividend payouts and stock repurchases changed over time?(2) The terms “irrelevance,”
“dividend preference” (or “bird-in-the-hand”), and “tax effect” have been used to describe
three major theories regarding the way dividend payouts affect a firm’s value. Explain these
terms, and briefly describe each theory.(3) What do the three theories indicate regarding
the actions management should take with respect to dividend payouts?(4) What results
have empirical studies of the dividend theories produced? How does all this affect what we
can tell managers about dividend payouts?b. Discuss the effects on distribution policy
consistent with: (1) the signaling hypothesis (also called the information content
hypothesis) and (2) the clientele effect.c. (1) Assume that IWT has completed its IPO and
has a $112.5 million capital bud-get planned for the coming year. You have determined that
its present capital structure (80% equity and 20% debt) is optimal, and its net income is
forecasted at $140 million. Use the residual distribution approach to determine IWT’s total
dollar distribution. Assume for now that the distribution is in the form of a dividend.
Suppose IWT has 100 million shares of stock outstanding. What is the forecasted dividend
payout ratio? What is the forecasted dividend per share? What would happen to the payout
ratio and DPS if net income were forecasted to decrease to $90 million? To increase to $160
million?(2) In general terms, how would a change in investment opportunities affect the
payout ratio under the residual distribution policy?(3) What are the advantages and
disadvantages of the residual policy? (Hint: Don’t neglect signaling and clientele
effects.)d. (1) Describe the procedures a company follows when it makes a distribution
through dividend payments.(2) What is a stock repurchase? Describe the procedures a
company follows when it makes a distribution through a stock repurchase.e. Discuss the
advantages and disadvantages of a firm repurchasing its own shares. f. Suppose IWT has
decided to distribute $50 million, which it presently is holding in liquid short-term
investments. IWT’s value of operations is estimated to be about $1,937.5 million; it has
$387.5 million in debt and zero preferred stock. As mentioned previously, IWT has 100
million shares of stock outstanding.(1) Assume that IWT has not yet made the distribution.
What is IWT’s intrinsic value of equity? What is its intrinsic stock price per share?2) Now
suppose that IWT has just made the $50 million distribution in the form of dividends. What
is IWT’s intrinsic value of equity? What is its intrinsic stock price per share?(3) Suppose
instead that IWT has just made the $50 million distribution in the form of a stock
repurchase. Now what is IWT’s intrinsic value of equity? How many shares did IWT
repurchase? How many shares remained outstanding after the repurchase? What is its
intrinsic stock price per share after the repurchase?g. Describe the series of steps that most
firms take when setting dividend policy. h. What are stock splits and stock dividends? What
are the advantages and disadvantages of each?i. What is a dividend reinvestment plan
(DRIP), and how does it work?Question 2 Gamut Satellite Inc. produces satellite earth
stations that sell for $150,000 each. The firm’s fixed costs, F, are $1.5 million, 20 earth
stations are produced and sold each year, profits total $400,000, and the firm’s assets (all
equity financed) are $5 million. The firm estimates that it can change its production process,
adding $10 million to assets and $500,000 to fixed operating costs. This change will reduce
variable costs per unit by $5,000 and increase output by 30 units. However, the sales price
on all units must be lowered to $140,000 to permit sales of the additional output. The firm
has tax loss carryforwards that render its tax rate zero, its cost of equity is 18%, and it uses
no debt.a. Determine the variable cost per unitb. Determine the new profit if the change is
madec. What is the incremental profit?d. What is the projects expected rate of return for the
next year (defined as the incremental profit divided by the investment)?e. Should the firm
make the investment? Why or why not?f. Would the firm’s break-even point increase or
decrease if it made the change?g. Would the new situation expose the firm to more or less
business risk than the old one? Show workingsSubmit your answers in a Word document.
c++ need porgams

Program Documentation and Style RequirementsOne of the requirements of this course is

that you program in a professional programming style. 20% of your grade on each
programming assignment will be based on program documentation and style. The goal is to
make your program easy to read and understand. Click here for an example program with
documentation.You should follow a standard indentation style that highlights the structure
of your program. I like the indentation style used in our textbook, but as long as you
consistently follow a neat, professional looking style, I won't complain. Each program must
begin with a comment that includes: a) your name, b) program status - either "Complete" or
describe any incomplete or non-functioning part of your program, and c) a brief 1 to 3 line
description of what the program does. In your source file, the code for the main function
should come first followed by your other functions. Before each function, include a 1 to 3
line comment describing what the function does. All local variables and constants should be
declared at the beginning of the function block. Use meaningful variable names. One or two
character names are rarely meaningful. For example, c and ch would not be acceptable
names for a variable that holds the change returned from a purchase. chng is OK. change
and changeDue are even better. Declare one variable or constant per line. Include a
comment to the right of each variable or constant declaration describing how it is used. If a
function is longer than 4 or 5 lines, it should be divided into sections by task with blank
lines between sections. Include a 1 or 2 line comment at the beginning of each section
describing what the section of statements does. I want to be able to read the comment at the
beginning of a section and understand what the section does without looking at the C++
code. Note: These comments should say WHAT the section does, and not necessarily HOW it
does it.
need powerpoint ppt

CriteriaIndividual Effort Only!ResourcesScholarly Source – _Online JournalsUC Library

databaseTextbookInstructionApply the knowledge gained throughout the class via textbook
chapter readings,Instructor lead audio chapter PowerPoint presentations, and transcript
readings toyour end of the course PowerPoint presentation. Use footnotes to further explain
orelaborate of a word or topic in the slide.GuidelinesSlide 1: Introduction of the
organization (we need to select any organization )Slide 2: History of the organizationSlide
3: Your role within the organizationSlides 4 -8: Describe 4 out of the following 6 elements
related to the organizationalexcellence concepts and practice.1) Operations Strategy and
Competitiveness2) Product Design and Process Selection3) Supply Chain Management4)
Total Quality Management5) Statistical Quality Control6) Just-in-Time and Lean
SystemsSlide 9: Your overall thoughts of the organizationSlide 10: SummarySlide 11: The
EndSlide 12-14: References for slides 2-10 and must be in APA style formatNoted: Pictures
must be relevant to the content of the slide. Use the notes view ofPowerPoint to include
details.Assessment criteria:1. The presentation makes good use of course
concepts/practices/strategies2. The presentation demonstrates understanding of
Operational Excellence Practice3. The presentation demonstrates appropriate application of
Operational Excellenceideas/concepts /practices/strategies4. Thoroughness,
appropriateness, and creativity demonstrated by the descriptions;clarity, organization,
coherence, and correctness (spelling, grammar) of the writing.5. The presentation
demonstrated use of innovative technology##########below attached is example ppt
using power point ##############should be in APA formatei need ppt to be simple and
eassy to explain
Need PowerPoint Slides Unit 6: Country Analysis Presentation – Cote

Need PowerPoint SlidesUnit 6: Country Analysis Presentation – Cote

d’IvoireIntroductionCommunicating findings and issues through presentations is an
integral part of business. Collate your research from the country analysis application
assignment into a group presentation. Elect a project manager, who will submit the
presentation on behalf of the group. Include all group members’ names in the presentation.
All group members are required to present. Equal distribution of workload among group
members is expected.Directions1. Base your presentation on Unit 6: Country Analysis: Cote
d’Ivoire.2. Your presentation should discuss the following components o Overview of the
country under consideration must be given (geographic location, date of the independence,
the capital city, current President or Premier Minister of the country, the total population,
per capita population, the political ideology etc.)o Discuss working days of the weeko
Discuss number of hours worked per day (Lunch time and breaks must be explained, in one
word discuss the business culture within the country)o The country time zone (explain time
zone differences)o Discuss Literacy rate within the country (male versus female)o Discuss
the official or business language
need ppt assignment and writing assignment completed

PPT Assignment:PS360 Abnormal Psychology – Week 7 Assignment 2Maltreatment of the

ElderlyIf you turn on the news, you will often hear stories of child abuse and domestic
violence. However, the maltreatment of the elderly is less heard of. As you have learned,
neurocognitive disorders affect people more when they are older. Those disorders,
combined with old age, leave many individuals susceptible to abuse.Assume you are
presenting at a mental health symposium. Develop a 5-7 slide PowerPoint presentation
with speaker notes discussing the concept of elder abuse. In particular, what forms it can
take and how it can be prevented. In your presentation, you should provide a news story as
an example of elder abuse.You will need to do some outside research for this presentation.
Provide at least one credible outside source besides your textbook and the news article.
Make sure to cite all of your sources on the last slide.View your assignment rubric.Writing
Assignment:Describe a behavior you engage in, analyze it in terms of the three term
contingency, explaining the relationship among the discriminative stimulus(S-D) – behavior
– outcome (reinforcer), and how this relationship would be different with S-Delta as the
antecedent stimulus condition, vs. S-D. Post a minimum of 300 wds.
need ppt on topic improving software quality for regular expression matching tools using

http://fac.ksu.edu.sa/sites/default/files/msc_thes…NOTE: This Document is used in

conjunction with Assessment 1 [Paper presentation & participation] and Assessment 2
[Research Report] in the Teaching and Assessment Plan document [MITS5502_Teaching
and Assessment Plan.doc] Objective(s) This assessment item relates to the unit learning
outcomes as in the unit descriptor. This assessment is designed to improve student
presentation skills and to give students experience in researching a topics relevant to the
Unit of Study subject matter. INSTRUCTIONS For this assignment you are required to do a 5-
10 minutes presentation on an academic paper on Software Quality, Software Change
Management or Software Testing. The paper you select must be directly relevant to these 3
topics. The paper can be from any academic conference or other relevant Journal or online
sources such as Google Scholar, Academic department repositories etc… All students must
select a different paper; thus the paper must be approved by your lecturer or tutor before
proceeding. In case two students are wanting to present on the same paper, the first who
emails the lecturer or tutor with their choice will be allocated that paper. A grade of 10% of
the Units mark will be awarded for your presentation and your participation in other
student presentations. Prepare a PowerPoint slide presentation for your presentation.
need ppt on topic name the impact of design and code reviews on software quality

NOTE: This Document is used in conjunction with Assessment 1 [Paper presentation &
participation] and Assessment 2 [Research Report] in the Teaching and Assessment Plan
document [MITS5502_Teaching and Assessment Plan.doc] Objective(s) This assessment
item relates to the unit learning outcomes as in the unit descriptor. This assessment is
designed to improve student presentation skills and to give students experience in
researching a topics relevant to the Unit of Study subject matter. INSTRUCTIONS For this
assignment you are required to do a 5-10 minutes presentation on an academic paper on
Software Quality, Software Change Management or Software Testing. The paper you select
must be directly relevant to these 3 topics. The paper can be from any academic conference
or other relevant Journal or online sources such as Google Scholar, Academic department
repositories etc… All students must select a different paper; thus the paper must be
approved by your lecturer or tutor before proceeding. In case two students are wanting to
present on the same paper, the first who emails the lecturer or tutor with their choice will
be allocated that paper. A grade of 10% of the Units mark will be awarded for your
presentation and your participation in other student presentations. Prepare a PowerPoint
slide presentation for your presentation.
need ppt on topic paper tittle analyzing the role of software testing in sqa manual vs
automation a

https://www.researchgate.net/publication/329374959…NOTE: This Document is used in

conjunction with Assessment 1 [Paper presentation & participation] and Assessment 2
[Research Report] in the Teaching and Assessment Plan document [MITS5502_Teaching
and Assessment Plan.doc] Objective(s) This assessment item relates to the unit learning
outcomes as in the unit descriptor. This assessment is designed to improve student
presentation skills and to give students experience in researching a topics relevant to the
Unit of Study subject matter. INSTRUCTIONS For this assignment you are required to do a 5-
10 minutes presentation on an academic paper on Software Quality, Software Change
Management or Software Testing. The paper you select must be directly relevant to these 3
topics. The paper can be from any academic conference or other relevant Journal or online
sources such as Google Scholar, Academic department repositories etc… All students must
select a different paper; thus the paper must be approved by your lecturer or tutor before
proceeding. In case two students are wanting to present on the same paper, the first who
emails the lecturer or tutor with their choice will be allocated that paper. A grade of 10% of
the Units mark will be awarded for your presentation and your participation in other
student presentations. Prepare a PowerPoint slide presentation for your presentation.
need ppt with discussion in apa format and references

Learning About Cookies as Spyware.Research what kind of information cookies store. You
might find the following websites
helpful:www.allaboutcookies.org/www.howstuffworks.com/cookie1.htmUsing WORD,
write an ORIGINAL brief essay of 300 words or more describing cookies and the way they
can invade privacy.Safe Assign is software that verifies the originality of your work against
on-line sources and other students.Note your Safe Assign score. Continue submitting until
your Safe Assign score is less than 25. For your first written assignment, you have unlimited
times to retry your assignment.Submit references separately (or add as text) otherwise they
cause the Safe Assign score to increase.Attach your WORD doc and then hit
SUBMT.https://www.youtube.com/watch?v=96VDo2yv3-g&feature=emb_titleRead
Chapter 1 of the Easttom text, Introduction to Computer Security.Primary topics:Types of
threatsNetwork attacksSecurity terminology
need project completed

There are 5 sections to this project. I am running behing with things going on like work and
drill and really need the help to get this done. I need everything completed in a upper
division level class quality. Please see attachment. It will be attached in a compressed
folder.I am attaching everything to make sure all directions are clear. Please revise what I
have already completed if you feel its needed. My project proposal is made up and feel free
to adjust it for better results.
Need proposal 10 pages

I need 10 pages proposal for this summary down here, pleas write it the same style and the
same sections such as the example on the file I attached and add ( Accounting section )
: Summary : I am proposing to work with Foot Locker to design, build and operate a new
branch at Riyadh the capital of Saudi Arabia. At our new branch we looking for new ideas
that would make Foot Locker much popular all over Middle East. Foot Locker knowing as
one of the best provider for sportswear, sneakers and sneakers cleaner. We focused in our
business on young men and women who are interested in this area. Foot Locker will take
four months to become fully operational. I am a student at Morgan State University in
Business Management major who is interested on sneakers and sportswear as an investor
in this field.ilovepdf_merged (2).pdf
need psy260 essay wrote

Children’s Defense Fund (CDF). (2014). State of America’s children 2014. Retrieved from
http://www.childrensdefense.org/child-research-data-publications/state-of-americas-
children/ Select a topic of interest to you from the report’s table of contents (after pulling
up the website, you can scroll down to In today’s global world, how do the children of the
U.S. fare? Are they prepared to compete in the international arena? The Children’s Defense
Fund (CDF) is a nonprofit child advocacy organization that provides a voice for children
who cannot speak for themselves. The State of America’s Children 2010 is the CDF’s report
highlighting some crucial issues affecting our children today. Visit the CDF Web site and
read the report:select a topic). Write a research paper on the topic. Be sure to include the
following:Present the CDF findings on the topic in a table or graph that you create. Note how
different populations are affected. For example, you might compare your state to national
statistics or compare the top or bottom states on the topic you chose, compare racial/ethnic
group data, etc.Research the selected topics using at least one additional resource. The data
and research publication sections at the CDF Web site offer useful publications.Identify and
analyze the main issues and discuss them in the context of relevant developmental theory,
as well as societal influences. Why is this data and the information you researched
important to understand in the context of child development?Present your conclusions and
support them with research information. What recommendations would you offer to
address this issue for future generations?Write a 4-5 page research paper in Word format.
Be sure to include introductory and concluding paragraphs in your paper, anda title page,
an abstract, and a reference page. Apply APA standards to citation of sources. Use the
following file naming convention LastnameFirstInitial_M2_A2.doc.
Need query that displays parents, grandparents, etc.

I posted this question on StackOverflow but never got a

reply...http://stackoverflow.com/questions/25677390/modifying-query-to-recognize-
children?noredirect=1#comment40161986_25677390I put the following resources
online:http://sqlfiddle.com/#!2/892bahttp://www.geobop.org/test/test-
gs.phphttp://www.geobop.org/test/test-gs-
planimals.phphttp://www.geobop.org/test/test-gw-geog.phpVery briefly, the table gs
contains the names of symbols, like the United States' national mammal, the bison (Bison
bison), derived from the fields gs.Symbol (bison) and gs.Latin (Bison-bison).All the plant
and animal symbols contained in the table gs are also found in the table gs_planimals, which
also includes their parents, grandparents, etc. In other words, it's a taxonomic ranking of the
animal kingdom.So here's the problem: I can display a list of U.S. state birds or Canadian
flower symbols, derived from the table gs only. Or I can display an identical list derived
from the table gs_planimals. But if I want to also display the symbols' parents and
grandparents, I'm stuck. I can either display ALL higher taxons or no higher taxons.The
bison's parent and grandparent are Bison and Bovidae, neither of which are contained in
the table gs. Therefore, I have no way of recognizing them as part of a particular flow of
data.Someone at StackOverflow told me what I want to do can be done, but he then
disappeared. ;)Thank you.
Need question 1 word docs with 3-4 references each in APA citation format - No Plagiarism
please

question 1:Using the guidelines provided in this week's chapter (and other resources as
needed), create a step-by-step IT security policy for handling user accounts/rights for a
student who is leaving prematurely (drops, is expelled, and so on).You will need to consider
specialized student scenarios, such as a student who works as an assistant to a faculty
member or as a lab assistant in a computer lab and may have access to resources most
students do not.(900-1000 words in word document with references 6 years or less
old)(Please follow APA format) Please 3 references from journals or books will be
appreciated.Also include abstract and conclusion in question 3
need question answer

you push with a 20-n horizonal force on a 2-kg mass resting on a horizonal surface. the
horizonal frictional force is 12 N . show that the accerleration is 4m/s2. how many joules of
potential energy does 1.5-kg book gain when it is elevated 2 m? when it is elevated 4 m (let
g= 10 N/kg) calculated the number of joules of kinetic energy a 1-kg parrot has when it flies
at 6m/s.
need questions answered middle eastern politics government class homework

1. Kemal Ataturk carried out policies that distanced the new Turkish republic of the 1920s
from the Ottoman past. Why? What specific policies did Ataturk pursue? 2. Why many Arabs
felt betrayed by the British (and the French) after the First World War? 3. Discuss at least
three features of patrimonial leadership. List three or more Middle Eastern states where
such type of political leadership persists 4. Describe the key processes (both internal and
external) that initiated political and economic disintegration of the Ottoman Empire in the
nineteenth century. 5. European military superiority in the late eighteenth century
prompted Ottoman rulers to respond with what specific political measures? 6. The Zionist
political movement originated in Europe rather than in the Middle East. Explain why and
how. 7. After the Second World War, several Arab countries went through the process of
transition from constitutional monarchies to republics. Identify three such countries and
describe the course of events that brought about this transition. 8. How is religious Zionism
different from secular Zionism? What is the relevance of this difference for the creation of
the state of Israel? Has the relative influence of the two remained stable since the creation
of the Israeli state? 9. What was the principle source of political legitimacy of the Ottoman
Empire? 10. While most Ottoman European provinces, riding the tide of the nineteenth
century nationalism, sought and won independence from Istanbul, Ottoman Arab provinces
maintained their political loyalty to the Ottomans. What explains this difference between
Arab and European provinces? 11. Social and political forces in favor of a constitutional
reform in Iran (1905-1911) were markedly different from the groups that promoted
constitutional limitations on executive powers of the sultan in the Ottoman Empire prior to
the First World War? Explain this difference. 12. What are some of the key features of Arab
socialisms? Which Arab leaders adopted socialist ideology? Which Arab leaders were
opposed to it? 13. After the First World War, the new Middle Eastern protectorates (e.g.,
Syria, Lebanon, Iraq) were expected to develop into modern secular states. What specific
policies did France and Britain try to implement? How successful have theses policies been?
14. The 1967 war was a watershed event for all major actors in the Middle East. Explain the
consequences of the war for domestic politics in Israel and Egypt respectively.
Need questions answered. "The Things They Carried" Must have basic grasp of literature
and "American" thought and knowledge on Vietnam War

Previous tutor not qualified. Now I have one hour before it is due!. I'm handing it all to you
here. The story, my take on it. Please do not accept if you do not have a basic understanding
of US political, cultural thought on Vietnam War. I will upload story after accepted. If you
have to google this all, that's fine, but no plagiarism.Anatomy of a Story—Breakdown. Use
complete sentences - be thorough but brief. Answer "philosophically" when possible.
Attached is an aspect of the story I wrote, but you need to read the story. I'm attaching it
here so you have an idea of what I was thinking.1) Summary – what is this story about?
What makes this story distinctly American?2) Author bio – short bio and key question: is
there anything in this bio that shines light on the story?3) Whose story is it? Narrator
(describe with key details) and point of view4) Who is the antagonist or key other
characters?5) What is the main conflict (s)?6) What is the setting? (place and time frame of
the story)7) What is the climax?8) Is there an epiphany in the story? If so, what is it?9) Is
there imagery (symbols, metaphors) that tell you something more? i.e. have larger ideas
attached to them?10) What stands out to you about the language used (the diction or word
choice?). Or, is there a particularly compelling scene or moment? BE SPECIFIC here.11) How
does the story resolve?12) Now look at the story through ONE of the literary lenses we have
discussed (Feminist literary theory, Marxist literary theory, Critical Race Theory). Define
the theory.13) --If selecting Feminist Literary Theory – what does this story tell us about
male and female gender roles? About patriarchy in our society?--If selecting Marxist
Literary Theory – what does this story tell us about class in our society?--If selecting Critical
Race Theory – what does this story tell us about race in America?14 & 15) How did you
respond to the story? Why did you choose this story? What did it make you think or
feel?Bonus: 2 points extra credit for creative execution of the“Anatomy of A Short Story.”
Need quickly

Today more than ever, photographs and other visual media are at our fingertips. Whether
it’s through Google Images or Flickr, we have endless visual media available for us to
use. Or, do we? Watch the video Copyright
Basics (http://www.copyright.com/content/cc3/en/toolbar/education/resources/copyrig
ht_basics1.html). Submit a two- to three-page paper (not including the title and reference
pages) describing the benefits and challenges associated with having so many visuals
available to us today. Describe the ethical and legal implications of using photos and other
visual media and describe how these issues can be avoided. Your paper must be formatted
according to APA style as outlined in the approved APA style guide, and you must cite at
least two scholarly sources, in addition to the textbook.
Need reply

1) Discuss legal issues regarding EBP and Clinical guidelines.

Need statistics/model/data, research proposal. Business field related examples… 1 answer
below »

You are about to commence a new research project in a field of your choice. You are
expected to write a report that cons:tutes a research proposal. Business field related
examples may include but are not limited to: ? Customer sa:sfac:on ? Employee sa:sfac:on ?
Employee contribu:on ?Quality control effec:veness ?Perceived Organiza:onal Support ?
Organiza:onal Commitment ?Wage Sa:sfac:on ?Leadership effec:veness ? Stock management
? Sale Forecas:ng ? Opera:ons research Working individually, youwill: Have chosen a clear
and specific research ques:on/ aim/ hypothesis for yourresearch; Have contextualised your
research ques:on/ aim within the academicliterature; Understand the philosophical and
methodological bases for yourresearch; Have a sound method to address the research
ques:on/ aim/hypothesis. Use APA style in-text cita8on andreferencing. Do not copy any
materials you use word for word unless you iden:fy these sec:ons clearly as quota:ons. If
you paraphrase any materials, you must iden:fy sources through in-textreferencing. This is
an individual assignment please do not work closely with anyoneelse. Write 2500 words(+
or – 10%) excluding the header sheet, cover page, contents page, reference list, footnotes
andappendices. Marks for criteria: Criteria 10% Focus and Comple8on Does the proposal
address the set tasks in a meaningful manner? 10% Research Objec8ve Does the proposal
clearly ar:culate 10% Synthesis and Soundness Does the proposal place the research
objec:ve in the context of the relevant academic literature and any relevant past studies?
Does the discussion demonstrate a comprehensive understanding of that literature? 40%
Analy8cal Methods Does the proposal sensibly outline methods for accessing sources of
data that will address or answer the research objec:ve? Are the calcula:on process and
analysis results clear? 30% Clarity of Coding – Analy8cal Approach Is the calcula:on (R
code/query) well organized, logically constructed and aden:ve to the needs of the user?
10% Mechanical Soundness Is the poreolio clearly wriden, spell Structuring the research
proposal Introduc8on (~200words) Explain the issue you are examining and why it is
significant. Describe the general area to be studied Explain why this area is important to the
general area under study (e.g., psychology of language, second language acquisi:on, teaching
methods) Attachments: Research-Pape….pdf
need research for question below

QUESTION: Bishops/Elders/Deacons. Explain what these terms mean. Consider the

following questions: do the terms refer to the same office or different offices; what is the
function of each in the church; must a church have all of these to function; how many of each
should a church have; where does the idea of “pastor― fit in, etc.INSTRUCTIONS:
Write a 1,000 word, double-spaced, scholarly essay using at least three sources which are
cited or used substantively for this topic. Sources are limited to solid commentaries and
journal articles. Each essay should define, present varying views, and argue for the most
biblically satisfying perspective of the theme. Grade will be based on word count, use of
sources, quality of discussion of the topic chosen (definition, views, biblical support, and a
demonstrated awareness of what the issues are)
need response to two discussion post 1 page each

don’t know of anyone who takes such extreme measures. This would preclude the use of
a personal email account and would require using a public terminal or borrowing someone
else’s computer in order to avoid creating a computer user account with login
credentials. Given the frequency of data breaches, I can certainly understand why someone
would want to minimize the amount of personal information they enter online. In fact, just
last week I received a notice from the Defense Information Systems Agency (DISA) stating
that my Personally Identifiable Information (PII) may have been compromised due to a data
breach which took place between May and July of 2019. In order to mitigate any harm due
to the release of this information, the letter from DISA stated that they had partnered with
an independent civilian agency which would offer me a free year of credit monitoring.
Ironically, in order to receive this protection service, the letter stated that I would have to
enter additional PII online including my first name, last name, email address, and a
verification code included with the letter (DISA, 2020).This seems like a vicious circle where
PII must be entered into another database in order to monitor against possible malicious
use of previously entered PII. One might think our hypothetical cyber-hermit would not
have to worry about a PII breach, but no doubt others have entered information on their
behalf into numerous databases each of which may be at risk to a similar data breach. These
databases would include governmental agencies tracking life events (births,
health/vaccination records, school transcripts, drivers’ licenses, tax records, etc.). More
than likely our cyber-hermit has been employed, had a bank account, owned a credit card,
signed a lease, etc. All of this information would also have been entered into a database.The
bottom line is that, in theory, minimizing our online footprint is a good practice but in
reality there already exists a wealth of personal information which we have little to no
ability to control. Sadly, there is no escape for a cyber-hermit. In order to minimize the
damage caused by a potential data breach, our cyber-hermit would be wise to give up some
PII in order to gain protection against the misuse of existing PII entries.DISA (2020).
Notification letter on the availability of a credit monitoring in the wake of a data breach.
[Personal Correspondence].
Need response 100-150 word So, to be honest until this

Need response 100-150 wordSo, to be honest until this week’s module I knew very little
about fallacies. I had a good time doing this week’s assignment matching up and explaining
how each statement is a fallacy and was able to learn a lot. The fallacy that is my favorite is
the red herring fallacy. Some of the examples I found were very comedic to me because of
how far out there or unrelated they were. Now in my own life I would say that I am guilty of
using the Ad hominem Fallacy. I can think of several instances where I have used it in an
attempt to be persuasive. Now I know that attacking an individual versus the issue is not a
good way to sway someone to my side or point of view and I will be sure to refrain from
using it. which one of the fallacies is your favorite and have you used any before?
need responses to other student initial posts 3

Instructions:Need 9 ResponsesEach response a minimum of 150 wordsNeed a minimum of

2 APA References of each responseIn Response need to coverWhat did you learn from this
posting?What additional questions do you have after reading the posting?What clarification
do you need regarding the posting?What differences or similarities do you see between
your idea and this posting?Outline:Response 1: 150 words, Reference 1, Reference
2Response 2: 150 words, Reference 1, Reference 2..Response 9: 150 words, Reference 1,
Reference 2
Need resume format (barebones). Find skills that crossover to new career

Tutor - I need a resume format without personal information where info can be put in later.
Need resume that will put in IT career, college experience, etc. and tie it into BSN nursing
program...so list skill sets in what can transfer over. You can use onet.org for great listings
on BSN skills, Computer engineering. The application is for BSN Nursing school using a
Baptist scholarship. Fill in what you can and make it easy for me to fill in the rest. Thanks!"A
resume is an important tool for your job, school, scholarship search because it offers a page
or two where you can display your top skills and qualities. However, a resume is much more
than that. Resumes help employers make hiring decisions and help you get your first
interview. That's why it matters how you structure your resume and what information you
decide to include.I have a question. I need to do a resume to apply to the BSN Nursing
program and the baptisit scholarship but I have always worked as a Tech Support because I
graduated in my country of Computer Engineering. now i live in the united states and i want
to study my bachelor in nursing. but I don't know how to make a resume that has nothing to
do with my IT career."
Need revisions with completed sentences ( the paper is very

Need revisions with completed sentences ( the paper is very difficult to follow) Creates a
Summarized Presentation Problem Contingency Plan for the Four Bulleted Issues As
Highlighted in the Assignment InstructionsAppraises the Value or Lack of Value Associated
With Asking For a Presentation to Be Rescheduled Because of an Emergency and Frames the
Response With Likely Client Reactions to the Request for a Rescheduled
PresentationDetermines Three Areas of Concern the Potential Client Might Have Based
Upon the Request to Reschedule the Presentation Written Communication: Control of
Syntax and MechanicsThe assignment is either nonexistent or lacks the components
described in the instructions.Written Communication: APA FormattingWritten
Communication: Page RequirementIntro, Thesis, & ConclusionWritten Communication:
Resource Requirement
NEED ROBERT HOLLANDER TRANSLATION of Dante Inferno
pick one topic which details

NEED ROBERT HOLLANDER TRANSLATION of Dante Inferno

pick one topic which details are attached for each one
Canto 1-22 ONLY
preferably topic 1 or 3
ONLY USE BOOK FOR ESSAY
LOOK HOW QUOTATION FROM CANTO ARE USED IN PICTURE
1.Dante’s struggle with pity
2.The struggle of the way
3. In me you may observe fit punishment
need rough draft assignment whoever does rough draft will be needed final paper due 3
weeks

Objectives Back to Top To create an original Strategic Staffing Handbook that contains
many of the vital tools used in the staffing process. Work must be original and written by
the student.Minimal borrowed material is permitted (no more than 10% of
the completed handbook, so plan accordingly for any borrowed material in the draft!) and
all information used that is not your own thought or own words must be cited via APA for
ALL sources used (textbook, Internet, etc.). The majority of the Handbook must be
original—meaning written by the student. (Note: this is NOT an employee or HR manual; it
is a STAFFING handbook that could be used by managers as a resource for the staffing
process.)Guidelines and Milestones Back to Top GuidelinesYou are the new HR Business
Partner at a fictitious medium-size organization and it is your job to create an original (not
copied from the text or other sources) handbook with many of the tools needed in
the strategic staffing process. The body of the project should develop the following staffing
tools:A definition of strategic staffing that supports the requirements of the organization.A
description of the job analysis process and an example job analysis format.The approach
to posting a position and the related rationale for taking that approach. Plus, a short
example job posting.An example application form and an explanation of how it should be
implemented and related reasoning for the approach recommended. Make sure your
application form contains only legally permitted inquiries. (The corrected application form
from Week 6 cannot be used.)Layout the interview process: (a) what is the organization’s
interview philosophy? (b) provide some examples of good (non-generic and legally
acceptable) interview questions. You may use some or all of the questions from your
interview questions assignment (Week 5) as long as you did not receive feedback that they
were generic. The questions from that assignment, however, were specific to a position you
chose so you may want to standardize them to make them broader in scope. In other words,
you are giving managers good examples of, perhaps, behavioral and/or situational
questions that they could then customize for various positions.Describe the organizational
philosophy and approach to pre-employment testing and assessment (performance,
background/criminal, drug, etc.).Include three additional staffing elements that you believe
are important to the staffing process. [If you are experiencing challenges with the final
section (three other staffing elements) try using the Index or Table of Contents from the
textbook for ideas. That way you won’t accidentally include topics such as termination or
discipline as these are not part of staffing.]It is acceptable to use original information from
your prior course assignments to help build this project (except the Week 6 Application
Form). In the end, you should have a Strategic Staffing Handbook that you can reference in
the future. Build this assignment for yourself!Note that there is a tips and sample verbiage
document in Doc Sharing that may help you get started on the Project. However, please note
that NO verbiage from this document can be used in your Project.The course project should
be 10-12 full pages in length, double-spaced. Milestones: (note- you must use
the required template in Doc Sharing for this project- for both the draft and final
version)The draft version of the project is due in Week 3 (approximately 25% of the work
should be completed in draft form). (90 points).The final version of the project is due in
Week 7. (250 points).Submit your assignment to the Dropbox located on the silver tab at the
top of this page. For instructions on how to use the Dropbox, read these step-by-step
instructions or watch this Dropbox Tutorial.See the Syllabus section “Due Dates for
Assignments & Exams” for due date information.Grading Rubrics Back to Top
CategoryPointsDescriptionDocumentation & Formatting25The project should have good
structure as indicated in the best practices listed in this document. All resources used must
be properly cited.Organization & Cohesiveness30The final project should make sense to the
reader from start to finish. The organization of the project should be logical and easy to
follow without confusion to the reader.Editing20Proofread the final project and ensure that
each sentence is complete, the correct grammar is used, spelling is correct,
etc.Content150The content of the project is the key deliverable and is mostly found in the
body of the project. All components of the project contribute to the final content.Summary
and Conclusion25Explain how this handbook can be used and the value that it brings to the
HR professional involved in strategic staffing. What did you get out of this
assignment? What did you learn?Total250A quality paper will meet or exceed all of the
above requirements.Best Practices Back to Top The following are the best practices in
preparing this final version of the project.Cover Page – Include your name, course number,
and the date.Table of Content – List the main ideas and section of your project and the pages
in which they are located. Any illustrations should be included separately.Introduction –
Your introduction should include the items below.Introduce the subject and why the subject
is important.Preview the main ideas and the order in which they will be covered.Establish a
tone for the document.Body of Your Report – Use a header titled with the name of your
project. Then proceed to break out the main ideas. State the main ideas, state major points
in each idea, and provide evidence. Break out each main idea you will use in the body of
your project. Show some type of division like separate sections that are labeled; separate
group of paragraphs; or headers. You would include the information you found during your
research and investigation.Summary and Conclusion – Summarizing is similar to
paraphrasing but presents the gist of the material in fewer words than the original. An
effective summary identifies the main ideas and major support points from the body of your
report. Minor details are left out. Summarize the benefits of the ideas and how they affect
the staffing industry.Work Cited – Use APA citation format as specified in the Syllabus. No
more than 10% of the total project can be from borrowed material and must be properly
cited via APA. Review the APA materials provided in the Syllabus and Student Resources, as
needed. Your instructor may submit your work to TurnItIn. Any uncited material or
excessive cited material (above the 10% minimum) can seriously jeopardize points earned
(beyond the Documenting and Formatting section of the rubric).Below are additional hints
on preparing the best possible project.Apply a three-step process of writing: plan, write, and
complete.Prepare an outline of your research project before you go forward.Complete a first
draft and then go back to edit, evaluate, and make any changes required.Use visual
communication to further clarify and support the written part of your report, such as
illustrations, diagrams, and the like.If you have any questions about the project, please post
in the Q & A thread or e-mail your instructor.
need segmentation and target market bmw

Segmentation and Target Market – BMW Write a white paper on a company of your choice
and discuss the market segmentation within that industry along with the target market for
the company and the selection process for that target market. Required Elements: No more
than 2100 words Include for the selected company
BMW demographic, psychographic, geographic, and behavioral characteristics for the
selected company. A positioning statement for the company with careful consideration of
their brand and strategy Paper is consistent with APA guidelines.
Need slides from word document Directions Base your presentation on

Premium Paper Help is a professional writing service that provides original papers. Our
products include academic papers of varying complexity and other personalized services,
along with research materials for assistance purposes only. All the materials from our
website should be used with proper references.
Need some assistance coding this assembler exercise. I haveincluded the test file. Thank you
very mu

Need some assistance coding this assembler exercise. I haveincluded the test file. Thank you
very much.package sequencer;import java.util.List;publicclass Assembler { /** * Creates
a new Assembler containing a list offragments. * * The list is copied into this assembler
so thatthe original list will not * be modified by the actions of this
assembler. * *@param fragments */ publicAssembler(List fragments) { } /** *
Returns the current list of fragments thisassembler contains. * *@return the current list
offragments */ public ListgetFragments() { returnnull; } /** * Attempts to
perform a single assembly, returningtrue iff an assembly was * performed. * * This
method chooses the best assembly possible,that is, it merges the * two fragments with the
largest overlap, breakingties between merged * fragments by choosing the shorter
mergedfragment. * * Merges must have an overlap of at least 1. * * After merging two
fragments into a new fragment,the new fragment is * inserted into the list of fragments in
thisassembler, and the two * original fragments are removed from the list. * *@return
true iff an assembly wasperformed */ publicbooleanassembleOnce()
{ returnfalse; } /** * Repeatedly assembles fragments until no moreassembly can
occur. */ publicvoidassembleAll() { } }AssemblerTest.java package sequencer; import
static org.junit.Assert.*; import java.util.ArrayList;import java.util.Arrays;import
java.util.List; import org.junit.Before;import org.junit.Rule;import org.junit.Test;import
org.junit.rules.Timeout; public class AssemblerTest {// @Rule// public Timeout
globalTimeout = Timeout.seconds(10);// 10 seconds private List one; private List
two; private List three; private List dupFullOverlap; // This method is run before each
test, performinginitialization // on and of objects for the test. @Before public void
setup() { one = newArrayList(); one.add(new Fragment(“GCAT”)); two =
newArrayList(); two.add(newFragment(“CATG”)); two.add(new
Fragment(“GCAT”)); three =
newArrayList(); three.add(newFragment(“ACTGTG”)); three.add(newFragment(“ACA
CAC”)); three.add(newFragment(“TGTGGG”)); dupFullOverlap =
newArrayList(); dupFullOverlap.add(newFragment(“AAGAA”)); dupFullOverlap.add(
newFragment(“AAGAA”)); } @Test public void testValidConstructor()
{ Assembler a = newAssembler(one); } @Test public void testSimpleAssemble()
{ Assembler a =
newAssembler(two); assertTrue(a.assembleOnce()); } @Test public void
testSimpleAssembleStop() { Assembler a =
newAssembler(two); assertTrue(a.assembleOnce()); assertFalse(a.assembleOnce());
} @Test public void testCorrectSimpleAssemble() { Assembler a =
newAssembler(two); assertTrue(a.assembleOnce()); assertFalse(a.assembleOnce());
assertEquals(Arrays.asList(newFragment(“GCATG”)),
a.getFragments()); } @Test public void testNoAssemble()
{ one.add(newFragment(“CAGT”)); Assembler a =
newAssembler(one); assertFalse(a.assembleOnce()); assertEquals(2,a.getFragments()
.size()); } @Test public void testDuplicateFullOverlapAssemble() { Assembler a =
newAssembler(dupFullOverlap); assertTrue(a.assembleOnce()); assertFalse(a.assemb
leOnce()); assertEquals(Arrays.asList(newFragment(“AAGAA”)),
a.getFragments()); } @Test public void testCorrectThreeAssembleStepwise()
{ Assembler a =
newAssembler(three); assertEquals(3,a.getFragments().size()); assertTrue(a.assembl
eOnce()); assertEquals(2,a.getFragments().size()); assertTrue(a.assembleOnce());
assertEquals(1,a.getFragments().size()); assertFalse(a.assembleOnce()); assertEquals
(1,a.getFragments().size()); assertEquals(Arrays.asList(newFragment(“ACACACTGTGGG
”)), a.getFragments()); } @Test public void testCorrectThreeAssembleAll()
{ Assembler a =
newAssembler(three); a.assembleAll(); assertEquals(Arrays.asList(newFragment(“A
CACACTGTGGG”)), a.getFragments()); } @Test public void
testConstructorArgumentUnharmed() { List copy = newArrayList(three); Assembler a
= newAssembler(three); a.assembleOnce(); assertEquals(copy,
three); } @Test public void testTiebreaker() { List l
= newArrayList(Arrays.asList( newFragment(“GGGAAAC”), newFra
gment(“AAACGGG”), newFragment(“CCCGTTTA”), newFragment(“TTTAG
CCC”))); Assembler a =
newAssembler(l); a.assembleOnce(); assertTrue(a.getFragments().contains(newFrag
ment(“GGGAAACGGG”))); } @Test public void
testSequenceHaemoglobinSubunitBeta(){ Assembler a =
newAssembler(Arrays.asList( new
Fragment( “CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTG
GTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTT
ATGGGCAACCCTAAGGTGAAGGCTCA”), new
Fragment( “TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAA
GTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAA
TTTCTATTAAAGGTTCCTT”), new
Fragment( “TTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAA
CTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTT
ATTTTCATTGC”), new
Fragment( “ACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGA
AAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACAC
TGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGA”), new
Fragment( “GCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGA
TCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAG
AATTCACCCCACCAGTGCAGGCTGCCTATCA”), new
Fragment( “ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACAC
CATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGG
ATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCT”))); a.assembleAll(); assertEquals(1,a
.getFragments().size()); assertEquals(newFragment(“ACATTTGCTTCTGACACAACTGTGT
TCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTG
CCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTC
TACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGC
AACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCT
GGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATC
CTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAA
TTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCAC
AAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCC
AACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACAT
TTATTTTCATTGC”), a.getFragments().get(0)); } } Attached
Need some assistance

Paper: Home Security VulnerabilitiesFor this assignment, we will focus on the various tools
and techniques available to the security professional in order to prepare a security
vulnerability assessment.Assess your residence, or one occupied by a relative or friend, for
every security vulnerability that you see. Remember, do not assume criminals will not
notice minor weaknesses. During your assessment, focus onthe neighborhood and general
area, andat least four of the
following:AlarmsLightingLandscapingDoorsWindowsLocksFences or WallsCamerasMotion
SensorsExplain why you believe your five focus areas are or are not potential
vulnerabilities.Then, discuss what you think could be done to reduce identified
vulnerabilities.For this assignment, you are required to prepare a report of 3–5 pages
(excluding title page and reference page), and post it in the respective Dropbox for this
week.Remember to include at least two authoritative references. They must be cited within
the paper as well as listed on a reference page.
need some help 10

This homework asks you to rebuild the album editor for Tk. The GUI (graphical user
interface) will allow a user to click an album to update. The user can change the album title
and year. Another button allows creating new albums.Your code does not need to use pickle
to open/save the album data; just make a simple starting list of a couple albums (a list of
dictionaries, as before).Refer to this https://www.youtube.com/watch?v=e-UoSIBuugc and
the Tkinter book.Here is the layout you should recreate:The behavior should be as
follows:Use a list of dictionaries to keep track of the album data.When the program starts,
there should be at least two albums already in the list. The list should only show album
titles.After the user clicks an album title in the list, they can click “Get Album―, which
causes the album title and year to appear in the respective text boxes.If the user updates the
album title or year in the text boxes, the user can then click “Save Album―, which
causes the text boxes to clear and the list to reflect the new album data.If the user clicks
“New Album― (regardless of whether an album is selected), the text boxes are cleared
and a new item is shown on the list with the title “(No Title)―.
need some help 12

students will write a short essay of comparative analysis which focuses on two figures
whose writings we read and discussed over the course of the semester (i.e. the assigned
readings besides the Oxtoby, Hussein, and Amore text book). The purpose of this exercise
will be to see how comparing and contrasting two figures might provide insights into how
religious traditions deal with a range of issues from the role of scriptural narratives in
religious communities to the challenges of confronting modernity to the place of ritual in
shaping adherents’ characters and worldviews. Students are able to choose any two
figures as long as they are from the same section. (this guarantees that the figures you
choose are discussing the same topic, which thus ensures that you are comparing apples to
apples, as it were). You may choose any two figures from the following three sections:
Formative Periods and the Power of Scriptural Narratives (Heschel, MLK, Jr., and al-
Bisá¹-Ä•mi) Modern Period and Its Challenges (Rubenstein, Sobrino, and Iqbal)Ritual and
Practice as Ethico-spiritual Formation (Plaskow, Williams, and Malcolm X)The essay will be
composed of five sections: 1) Introduction including thesis statement2) Brief summaries of
each figure’s writings3) Comparison of the writings which draws out their similarities
and differences4) What such a comparison might tell us about how these religious
traditions have dealt with the particular topic that is the focus of that section. The topic of
each section is as follows: a) formative periods: the power of scriptural narratives in the life
of the religious community; b) modern period: how religious traditions confront and
negotiate the challenges of modernity; and c) ritual and practice: how rituals as social
practices shape the character and worldviews of believers5) ConclusionYour essay should
be 4-6 double-spaced pages using 12-point Times New Roman font. Feel free to use which
ever citation style you’re most comfortable with (MLA, APA, Chicago/Turabian), but
make sure to be correct and consistent in your use of it!
need some help on brief ref based disccusion again

Please respond with a paragraph to the following post, add citations and references:The
best way to get a hospital to implement an outreach program is to communicate to
executives like our CEO and my stakeholders through written along with face to face
communication. The first important thing to do would be to explain the idea or ideas that I
have for an outreach program. For example, I believe strongly in heart failure clinics for
Congestive Heart Failure patients. I have recently visited a new by cities program and have
seen how successful it has been.Using billboards, bulletins, emails, scheduling meetings
with the board of nursing along with the CEO to share this vision with them would be a
great way to start to get the word out. I would need to have all the information to discuss
the plan for the outreach program, i.e. heart failure clinic. This information would include:
metrics, measures of performance and success rates of how patient’s less than 30-day
readmissions were decreased after following a program. This would show ad prove the
importance of the out-reach program and how it will help overall population of the CHF
patient’s remain in compliance with their medication and activities.Following an action plan
and execute these following steps will ensure to communicate effectively to the
stakeholders involved.1. Communicate- have a clear, concise plan to present your vision to
the stakeholders2. Learn how to embrace change3. Plan for implementation within the
organization4. Design a model or tool used to put the plan into operating action
(“amanet.org/training”)Reference(n.d.). Retrieved January 27, 2019, from
https://www.amanet.org/training/articles/transform…-vision-into-reality.aspx
Need some help with an APA format project

Even though the Final Project is not due until the end of Unit 9, beginning the writing
process now will help you avoid the frustration that occurs when you wait until the last
minute. Take the topic idea Survival Tips for Surviving Economic Hardships for Small
Businesses for your Final Project essay and do the following:Begin with an APA formatted
title page.Then, for part one of this assignment, write a sentence outline that establishes a
thesis and organizational plan for the essay you will write. The more detailed your outline
is, the more valuable it will be.For part two of this assignment, take that outline and flesh
out the ideas by writing a draft of the essay itself. The draft itself should be around 400-500
words. It does not have to include a formal essay introduction or conclusion, but it should
have a clear thesis and should be organized into clear, generally well-developed paragraphs.
You should incorporate and use at least two reliable sources and cite those sources both
within the body paragraphs where you use the source information and in the References
page at the end of the draft.For help with the Research Process and your Unit 6 Project, be
sure to review the following video created by your KU Library
staff:http://khe2.adobeconnect.com/cm107_Unit6_kol_research_tutorial/Be sure to review
the SAMPLE UNIT 6 PROJECT by clicking on the View/Print icon below. Review the
PROJECT RUBRIC linked here before you submit your Project.
need some help with my home work 2

This assignment asks you to practice with “regular expressions― (import re) to create
a Mad Libs program. A madlib is a story that has blank words. The player is asked to give a
list of words that will be inserted into the story. But the player doesn’t know how the
words will be used; he/she is only asked to give a noun, an adjective, etc. without knowing
what the story is first. Then, the player is shown the complete story, and it can be funny at
times.Your program should ask the user for a filename that contains a story with missing
words (“tags―). These missing words will have this format: {noun1} or similar
(adjective, plural_noun, whatever), always in braches ({}). The program uses a regular
expression to find each {} tag and asks the user for the value for that tag. Then the program
replaces every occurrence of that tag (there could be more than one occurrence of the same
tag) with the word the user typed. Then the program asks for the word for the next tag, until
there are none left. Finally, the program prints the story that the user created.
Need some help with my home works

First Assignment : The world is moving through an unprecedented time as we navigate the
realities of COVID-19. The virus has changed many parts of our lives. For this journal entry,
in at least 500 words, tell me about your experience in the pandemic. How have you coped
with the uncertainties and "new normals"? What do you think about how others are coping
and what sorts of regulations are (or have been) in place? How are the regulations helpful
or harmful? As always, the more specific details, examples, and anecdotes, the better.
Second home work: Each of the chapters you've read for this week has a section subtitled "A
Flash Nonfiction Exercise" or "A Flash Nonfiction Prompt." Choose one of these
exercises/prompts as a jumping-off point for a flash nonfiction essay of no more than 500
words. This should not be a first draft but instead should be the culmination of a number of
drafts as you craft the best essay you can by the due date. You will receive feedback on this
draft from me and from other students in the class. Do the best job you can on it so that our
feedback helps you further hone your writing. If you turn in a crappy draft that you haven't
spent time on, and we just tell you things you already know and would have changed if
you'd taken the time to revise, then the feedback portion of the course is of little use. Write
the author and chapter title of the exercise/prompt you chose in italics at the end of the
essay.Note that journals have to be at least 500 words and essays have to be no more than
500 words. This is to encourage a free-flow of ideas on the journal assignment (a first draft)
and more careful editing on the essay.Third one : Craft Group Responses (four per week)
should be substantive and thoughtful, but they need not be formal. They should be in
standard written English, though, not text-speak. Responses should expand on a point,
disagree with a point, compare or contrast to another passage or text, or explore a new way
to look at the craft point. Each of your four responses for the week may be to a different
prompt, or you may double-up or triple-up or quadruple-up your responses by engaging in
a discussion with other students on one prompt. The earlier you start responding to the
prompts in a given week, the more likely that the discussion group will foster lively back-
and-forth discussions among students instead of perfunctory answers to four different
prompts just before the deadline.
need some help with writing

Answer FOUR of the following FIVE questions. Each answer is worth TWENTY-FIVE points.
Be complete with your answers. Content, sentence style, and sentence structure will all be
evaluated 1. As a new worker in a juvenile treatment center, you have been asked to design
a sport-participation program for delinquent adolescents. Your supervisor says all the boys
in the program measure high in aggressiveness, and he wants you to organize a
“nonaggressive” sport experience for them. You suggest a traditional tae kwon do program,
and he asks you why you think a martial art could ever lead to decreases in delinquency
rates. How would you defend your suggestion?2. Why are most people surprised when they
are told that blacks are underrepresented in most amateur and professional sports? What
factors account for this under-representation?3. You are AD at a high school. Your school is
hosting a game between your #1-ranked football team and the #2-ranked team in your
conference. This is a huge rivalry game. Violence has occurred at this game in previous
years. Thoroughly explain a number of measures (at least three) you would take to control
the possibility of player and spectator violence at the event?4. As a football coach at an
integrated school, you notice that your black players get along with your white players just
fine on the field, but their off-the-field social activities are largely segregated. How would
you explain this and what could you do to change this pattern? Would changing this pattern
help your team? Why? How?5. Data clearly suggest that it is difficult to integrate positions of
power in sport organizations. What are the indications of this, and why has it been so
difficult for people from certain racial and ethnic backgrounds to move up into positions of
power in sport organizations?
Need somebody that’s a Information Technology Expert

I need somebody that’s a Information Technology Expert/major or good at looking up

answers real fast to take my Introduction to Information Technology online class exam. You
will have 3 hours to complete and I will provide you with the book. I am willing to pay 25
dollars for this. If you can look up answers real fast then you are ok. He didn’t put a due date
up, but if it can be done by Monday it will be greatly appreciated. The test can be taken
multiple times by the way(twice). Thanks.121
need someone good at complicated excel formulas

Please follow the detailed instructions attached.You will have the opportunity to put your
data-retrieving and logic function skills to the test by doing the following:– analyze a
fictional insurance agency’s business to determine whether altering the distribution of ages
in their client pool might impact the financial outcomes.– determine which applications to
approve for a fictional bank based on three predetermined rules.– help complete an orders
report for a fictional skiing equipment company.
need someone in finance major to do assignment in insurance and risk management class

Contact 4 Insurance Carriers and receive 4 different auto insurance quotes for your car.
Two quotes can be on-line quotes but two of the quotes should be from an insurance agent
of that particular insurance carrier.If you do not currently own a car then you can get
quotes on a virtual car. (A car you think you could be driving is best)When you contact an
agent explain to him/her that you are a student and doing this for an exercise for a class.
The agent should be willing to help you. If not, move on to another carrier. Compare quotes
by benefits, premium costs, and service Summary: After collecting the data on the 4
companies write a 1-page paper summarizing your experience. Include what companies you
contactedDescribe the vehicle quotedDescribe what coverages in your quote including
riders.Describe what benefits cover and how they workIndicate what Company you chose
(if you were buying) and why.
need someone to do a great job on my essay

ObjectiveRecognize classroom and study tactics for different learning

preferencesAssignment OverviewIn this writing assignment, you will describe the three
main learning styles or preferences and brainstorm and suggest five classroom and study
tactics for each of these learning preferences.DeliverablesA one- to two-page (250-300
word) paperStep 1 Brainstorm classroom and study tactics.Using what you have learned
about the different learning preferences (visual, auditory, and kinesthetic), come up with
five (5) classroom or study tactics for each. Include your own thoughts and tactics in
addition to what was stated in the lesson.Step 2 Write a short paper.In a one-to two-page
(250-300 word) paper, address the following:Define each of the learning preferences styles
and then describing the five classroom and study tactics you have come up with for each
preference.How could this information be used in the classroom either by you or other
students?What adjustments can be made to adapt to other teaching styles?How can you
improve your non-dominant learning preferences?Step 3 Save and submit your
assignment.When you have completed the assignment, save a copy for yourself in an easily
accessible place and submit a copy to your instructor using the dropbox.Grading
Requirements:Please remember to submit your assignment as an attachment in the week 2
assignment dropbox. If you have difficulty submitting your assignment, please call the help
desk at 1-866-397-6656, option 6. I also have step-by-step directions posted in Doc Sharing
for you. Item:Points:1. Identified five classroom or study tactics for each learning
preference: visual, auditory and kinesthetic.60 points (20 points for each learning
preference)2. Paragraph with 250 words – Please write 250 to 300 words.20 points(-10
points if write 150 – 249 words)(-20 points if write 1 – 149 words)3. Spelling and Grammar
– Please write complete sentences. Check your grammar and spelling.20 pointsAssignment
total:100 points
need someone to do a great job question

Understand
the meaning of extrinsic motivation.Define
S.M.A.R.T. goals.Understand
how values are related to motivations.Know
the steps involved in writing a personal mission statement.Know
the difference between long and short term goals.Understand
different ways to help time management.Know
the advantages and limitations of a to-do list.Know
how a syllabus is used.Understand
the difference between fixed-time and flexible-time activities.Know
the advantages and disadvantages of electronic time management tools.Understand
the various learning preferences. Describe
active listening techniques.Understand
the SQ3R active reading strategy.Explain
techniques for effective highlighting.Define
mnemonic devices. Review
effective study habits.
Need someone to do me this essay

Assignment Type: ArgumentativeAudience: Students NOT enrolled in this class.Topic: Is

there such a thing as free will?Consider all three books we've read this semester. Now, read
this essay by Stephen Cave:
https://www.theatlantic.com/magazine/archive/2016/06/theres-no-such-thing-as-free-
will/480750/ (Links to an external site.)After reading this essay, and considering the three
books you've read semester, and any other readings or experiences you've had with these
concepts before, I'd like you to respond to Harris' book and Cave's essay with your own
interpretation, analysis, and argument. You can start by summarizing the main points from
both Harris and Cave, and then from there, I'd like to see a healthy discussion of your
synthesis of these texts. Synthesis is when we combine multiple elements in order to create
something new. We've read a book about the importance of intrinsic motivation, the power
of habit and routines, as well as a book about free will. And now, you've closed out this short
semester with an essay on the topic of free will. Taken together, what is it you want to say?
In other words, it's your turn. Weigh in on all of it. I'd like to see a culmination of the last 6
weeks in your best 2000 words.Let me put it more simply to help you a bit:People don't
work well when they only have extrinsic motivation. The science proves it, according to
Pink.People get caught into habit loops. These loops are often related to extrinsic factors
(think f the mouse and the chocolate).Harris argues "Not only are we not as free as we think
we are--we do not feel as free as we think we do" (64). Again, consider the concepts of
"if/then" rewards, "habit loops" (Angie Bachman), and are you "free to change your mind"
(65) at any given moment, or is it that your mind can only change you?Grading: This essay is
worth 100 points. In your essay, be sure to use this checklist:A clear, focused, and specific
thesisParagraphs with a focus and a reasonable lengthEffective explanations, summaries,
and quotes that describe the ideas in the readingsExamples and details from the book or
from other sources that illustrate the author’s ideas (cross-reference his sources and find
them if necessaryThoughtful and in-depth discussion of the ideas from Free Will and the
Cave essayWell-written sentences (proofread, proofread, proofread)Words that effectively
express ideas (work on your style, try to find the proper verbs and look to omit unnecessary
wordsWorks cited pageSome Advice:Assume your reader is someone who is NOT in our
class.Spend time summarizing key ideas, defining any unfamiliar or important terms (eg.
autotelic, optimal experience, free will), selecting short quotes from the readings to help
your reader understand the authors' (plural) ideas.Include specific details, quotes, and
examples from the readings to illustrate the authors' ideas.Similarly, include specific
examples and details from your own experiences or observations so readers can
understand your point of view.Try to think beyond the obvious.Acknowledge the
complexities or difficulties in the authors' ideas or your own situation.Proofread your essay
carefully.
Need someone to do my english assignment.

I'm going to give you 2 poems to read and then you answer the following questions in a
word document. Poetry & Prose Response QuestionsHIPSHOOTERWhat is your first
reaction (uncensored)?HEART THROBWhat feelings does the text awaken? Which
words/phrases make you feel this way?MEMOREXWhat memory does the work call to
mind—songs, books, movies, experiences of the past?EAGLE EYEWhat do you see
happening? Paraphrase the poem.ARTISTWhat images are called to mind? How does the
writer use imagery to make you see, touch, smell, taste, hear, and feel (touch) ideas in the
poem?SPEAKERListen to the voice or speaker in the poem. What does he or she sound like?
Does the sound of his/her voice change? How would you describe this
person?DECODERWhat specific words, phrases, or lines appear to be symbols, metaphors,
similes, and personification that need to be decoded or investigated more fully? What could
they mean?WRITERIf you had to write to the poet, what ideas about your life, people,
society, and/or the world did he/she help you understand? How was the poem meaningful
for you? Be sure to follow the rubric attached.I also have the two poems in a word
document.
need someone to edit and revise if needed sorry for cheesy writing

1) In “Thank God for that Touchdown,” how might religion at sports events cause social
tension? Did any school you have attended ever promote a particular religion – explain.
(345) Religion at sport events may arise tensions when sport coaches and it administers
use religion as their reasoning for winning or another sense the exclusion of incorporating
other people who worship different religions in the act could aslo result in a problem. In
America, from what I have observe in public and social settings Christianity is act upon the
most, so other religious or anti-religious people may feel hostile or like an outcast because
they feel unheard. Additionally, this is why some people do not want religion being shared
at sport events due to different beliefs. 2) How are Finland’s schools different from US
schools? How did Finland improve from one of the worst school systems to one of the best?
(355-356) Finland’s school are different from US schools because of it interdisciplinary,
non-competitive, and positive way of bringing about education towards the students.
Indeed, America is full of competition, standardize tests, conflict, loss of jobs that has
imbalance the school systems and it teaches. Moreover, what Finland did was take some of
those approach away and use better approaches such as giving student less homework and
tests so that they can have quality time, or broaden education in a way for student to adapt
and find the creativity in it, eradicating standardized tests, and using motivation to help
students when they are failing and succeeding. Perhaps, it would be delightful if US follow
Finlands footstep in this case for education here has become problematic. 3) Why did 20
South Korean men chop off their fingers to protest school textbooks? In what way(s) might
U.S. high school history textbooks be biased? (102-103) The South Koreans men cut off their
fingers because they were despised and felt ashamed of how its school textbooks were
defaming their country and other Asian countries as tyrants who were evil and cause
unforgettable tribulations to japan. Next, U.S textbooks can be biased from- lack of evidence
provided, hearsay, personal feelings, questionable contexts or statements, lack of cited
work, inaccuracy, and among others as well.
Need someone to fill out the chart in the word

Need someone to fill out the chart in the word document that is provided for marketing my
Mental Health for College Students Program. Also attached is the PowerPoint for the
chapter we are on and it provides examples. Need it done by 11:59pm EST , if you cannot do
it for in this time frame with the price given then please do not bid. I am not paying more
than what I post as it is just a chart that you have to fill in the information that is missing. I
have done half of the work. Below are the assignment details in this message:In this
assignment you will outline a marketing plan that includes the following elements: the four
Ps (product, place, promotion, price) in table format; your recruitment plan of how you will
reach your priority population; and the motivational factors of your priority population.
need someone to management project

1- ESA Reflection about the project—— Due in 13hours In 2-3 typed pages, reflect on your
work a. What did you learn about your management skills?b. What did you learn about your
leadership skills?c. Talk about one triumph in this process that you experienced ?d. Discuss
something that could have gone better. e. Overall, what lessons did you learn from this
project? =================================================2- ESA project
about Spain due in 6 days requirements attached 3 references APA style 8 page include
references page
Need someone to read my paper

The paper is a 8 pages long and is in it's final draft. I am simply looking for someone to pick
it over with a comb and catch any mistakes. This is for a English 2 in college. It is a basic
research paper my subject being Polyamory. I welcome people who know nothing about the
topic or those with great amounts of knowledge. This is my fourth time posting this as I am
looking for four people review the paper, I have already chosen and paid two. I am unwilling
to pay more then $5
need someone to review and edit my reflection paper on life span development

I want someone to review my work and edit to make it sounds better and reword the
unclear sentences, THE WORK IS ALREADY DONE, it is just review and editing and adding a
conclusion so there is no much work need to be done. here is the assignment decryption to
have better idea when reviewing. changes need to be in different color so I can notice the
changes. Make the work ready to submit. EASY work but need good review.Aristotle’s
Three Golden Rules to Hackinga Great ProjectFollow these three golden rules when writing,
speaking, or presenting:First tell your audience what you’re going to tell themEngaging
introduction, this is your ‘opener’ – make it catchyProvide direction as to what to
expectStrong thesis statementThen tell themBody and content of your project must support
thesis statementBuild your case with organized key points (headings, sub-headings)Tell
them why these key points are important and relevantTell the audience what you just told
themMake your conclusions relating back to your thesis statementReview your salient
pointsFuture outlook and call to action if necessaryPlease follow these guidelines:Follow
Aristotle’s Three Golden RulesFollow the RUBRIC. See the Rubric section below.Have
FUN with this. This is more of a creative project. You can include graphs, images, drawings,
pictures, collages, etc. Creativity and innovative thinking are a graded criterion in your
Rubric.Start with a “Catchy― Introductionand remember your Thesis Statement. This
is a graded criterion in your Rubric.This project must be reflective.Listing the topics will
notbe enough and result in a poor grade. This is why it is important to understand exactly
what ‘reflection’ means in this project. Reflective thinking skills and analysis require
an in-depth analysis of your learning experience, learned topics, processes, and implications
for future learning and applications. The value of the learning experience from the topics,
others, and teachers involved are expressed while analyzing the value and appreciation for
the discipline (in this case, Developmental Psychology).Do not simply outline or summarize
the material we covered.Reflection projects need to express what the material means to
you. They take a personal approach (you can use first person singular but please stay away
from slang and colloquial language), express thoughts, dive deeply into the topic, analyze,
make connections, define and interpret main concepts and theories you learned, express
your views by using real-life examples, and evaluate the relevance of the course and topics
learned. *Hint: While this is a more personal project, successful reflection projects refrain
from being overly emotional and continue to incorporate critical thinking skills. This is a
graded criterion in your Rubric.RubricCriteriaExceeds Standards“The Wizard―9-10
points Meets standards“The Champion―6-8 points Approaching expectations,
nearly meeting the standards“Emerging Potential―4-5 points Does not meet
standards, missing the mark“The Beginner―2-3 points No evidence of progressing or
learning“Below Basic Candidate for Mentoring―0-1 pointsIntroduction & Thesis
Statement Student adheres to “golden rule #1― and engages the audience
immediately with a catchy introduction and strong clear & concise thesis. The reader is
engaged and knows exactly what to expect. Student adheres to “golden rule #1―
and engages the audience with a well put together introduction and thesis. The statement
may not give insight into how the project will be laid out or discussed, however. The
introduction is general, could be more engaging, and the thesis statement merely gives an
idea of what the project will be about, but the author does not clearly state it.The
introduction and thesis statement are unfocused and not clear. Shows no evidence of
learning or progress in this area.APA Format Title Page, Reference Page, and Within Text
Citations are properly formatted. Title Page, Reference Page, and Within Text Citations
are formatted with some errors. Title Page, Reference Page, and Within Text Citations
are not properly formatted with many errors at a distracting level. Title Page, Reference
Page, and Within Text Citations are not formatted in a recognizable APA format. Shows
no evidence of learning or progress in this area.Syntax, Grammar, & Mechanics No
errors in punctuation, capitalization, and spelling. Articulate and skillful communication
with clarity, and fluent language. Almost no errors in punctuation, capitalization, and
spelling. Language is straightforward and generally conveys meaning to the audience.
Many errors in punctuation, capitalization, and spelling. Basic language skills.
Numerous and distracting errors in punctuation, capitalization and spelling.
Language and communication skills often impede on meaning. Shows no evidence of
learning or progress in this area.Organization & Structure Clear organization and
structure that guides the reader along the entire project with smooth transitions from one
paragraph or slide to the next and invites the reader all the way to the conclusion where all
loose ends wrap up. The organization is structure is in logical order and maintains interest.
Clear organization and the details are in logical order but may be presented in less
interesting ways with more clunky transitions and does not lead the reader towards a
strong conclusion. There are significant lapses in organization. The structure is not
particularly inviting, and details are inconsistent with logical order and can be distracting.
The lead towards the end is lacking. Poor and hard to follow organization. There is no
clear beginning and ending in the structure. Evidence and resources don’t support the
flow. The reader is left to guess and fill in the gaps. The paper or presentation may be too
brief. Shows no evidence of learning or progress in this area.Reflection skills, making
connections, and personal learning Shows depth of knowledge, understanding, learning,
analysis, and reveals personal experiences, uses specific details. Includes exemplar analysis
(e.g. evaluates how the topics were presented in the text, by groups, or in lecture). Multiple
connections between this learning experience and other courses, past learning, life
experiences, and or future goals. Relates learning topics with research and this project,
uses personal and general reflections. The student meets standards in making connections
and analysis. Does not go deeply in the reflection of learning, more generalized with
limited insight, uses some detail. Shows little to no analysis and connection skills. Little
or no explanation or reflection on learning, no or very few details to support reflection.
Shows little to no analysis and connection skills. Shows no evidence of learning or
progress in this area.Minimum of Five Key Reflective Topics Student selects a minimum of
FIVE different reflection topics from various times in the semester. Student selects a
minimum of FIVE different reflection topics but does not demonstrate a timespan of the
semester (e.g. only selects topics from last few weeks). Student only selected THREE-
FOUR reflection topics, or the topics are not different enough to be considered separate
topics. Student only selected ONE – TWO different topics. Shows no evidence of learning
or progress in this area.Self-Awareness Student demonstrates an advanced level of
awareness of his/her/their own personal bias, cultural influence, group and support team
commitment, and self-responsibility for experiences (e.g. personal, academic, relational).
Self-awareness is recognizable in this project. Student demonstrates an adequate level of
awareness of his/her/their own personal bias, cultural influence, group and support team
commitment, and self-responsibility for experiences (e.g. personal, academic, relational).
Self-awareness is recognizable in this project. Student demonstrates a minimal level of
awareness of his/her/their own personal bias, cultural influence, group and support team
commitment, and self-responsibility for experiences (e.g. personal, academic, relational).
Self-awareness is not easily recognizable in this project. Opinions are expressed in this
project without self-awareness of personal bias, cultural influence, and group and support
team commitment or lack of commitment. Shows no evidence of learning or progress in
this area.Creativity Extends concepts and ideas into innovative thinking or creates new
ideas that cross disciplines and boundaries. Student uses images, graphs, drawing, etc. to
guide the audience. Inquiries, new ideas, and possibly even new knowledge is proposed.
Is able to synthesize and connect ideas into a coherent whole with experimentation
towards innovative thinking (e.g. novelty or uniqueness) Includes images. Student comes
short of meeting expectations in this criterion with little unique ideas, inquiries and images.
Little effort towards innovative thinking, novel ideas, inquiries, and no images.
Shows no evidence of learning or progress in this area.Evidence & Resources
Information is collected from a minimum of THREE resources with citations within
the text, proper referencing in the reference page, and offers interpretations and analysis.
This level goes above and beyond expectations by also comparing and contrasting
viewpoints from different experts and resources on one or more of your selected topics.
Information is collected from a minimum of THREE resources with citations within
the text, proper referencing in the reference page, and offers interpretations and analysis.
This level does not compare and contrast viewpoints. Information is collected from TWO
resources with citations within the text, proper referencing in the reference page, and offers
interpretations and analysis. Information is collected from ONE resource with citations
within the text, proper referencing in the reference page, and offers interpretations and
analysis. Shows no evidence of learning or progress in this area.Conclusion
Student adheres to golden rule #3 and engages the audience into “what was just
said― reinstating the thesis and why this project was important to hear/read. This
exemplar level also restates personal learning in this course. The conclusion works well
with wrapping up the project. The conclusion does not adequately restate the learning
experience, thesis statement, and is more generalized in wrapping it up. Incomplete/or
unfocused. Shows no evidence of learning or progress in this area.
Need someone to revise and check my writing, grammar, punctuation, and make sure I have
the answers correct.

Read the short article listed above. As we have seen in several pieces so far, cultures are
literally colliding with another. Wiginton asserts, "Although [the Green Knight] originally
confronts Gawain as an enemy, the two later are able to work together - perhaps a
metaphor for the assimilation of British Paganism with the new Christian theology." Using
the epic "Beowulf" and "Gawain and the Green Knight," note several instances (3-5
examples) in which both pieces collide with a foreign culture (remember to give page
numbers and lines if appropriate) only to later come together in unity. What is this
metaphor revealing about the rulers and the lower class? Historically, what is happening
during this time period especially in terms of using story telling for political gain? Its due
today at 10pm. This is what I wrote. In Beowulf, both paganism and Christianity play a role
in the epic. However, Beowulf seems to be more Christian-like in the way he expressed his
thanks for his bravery and protection when emphasizing about God- before and after the
battle. An example would be on page 605 line 610-614,’’ He (Grendel) is unschooled in
skills to strike against me, to shatter my shield, though feared for his fierceness. So, I shall
bear no blade in the night if he sees fit to fight without weapons. May God in his wisdom
grant whom he wills blessing in battle.’’ In paganism view “Wyrud” , which is define as fate
and freewill is articulated a lot in the Beowulf epic. Wyrud belief in freewill is still the same
concept in Christianity ideology. An example of Wyrud in pertaining to freewill would be on
page 595 line 170-180 to sum it up briefly- “Beowulf heard about the evils of Grendel mass
murdering and decided to sail and put an end to it.” We could think that this has to do with
Beowulf’s father debt he owed Hrothgar, but Beowulf still had the free will to fight off
Grendel or let Grendel continue his killing spree. Paganism and Christianity in Beowulf
tends to share a lot of the same elements- such as good vs evil, discovering one’s destiny
and fate, praying to one’s God for protection, along with others as well. In Sir Gawain and
the Green Knight in Christian wise- the Christmas gathering in the beginning of the story is
one of Christianity most devoted holiday. Even non-Christians partake in Christmas;
however, Christmas is a biblical symbolism for the celebration of Christ birth. Even pagans
partook in the Christmas spirit. The mistletoe and the Christmas trees were pagans'
traditions, and even today in modern society we use mistletoe and Christmas trees to
decorate or enlighten the holiday. The temptation game in the story to get Gawain to sleep
with Bertilak Mistress, or to sin against his honor, is similar to a lot of biblical trials where
people was tempted or tested and the aftermath led to a learning experience. The Green
knight green clothes represent rebirth and nature, which is paganism views. When Gawain
set off to find the Green Chapel, he encounters evil animals he had to fight off, which is also a
heroic view in paganism belief, similar to Beowulf. In the paganism and Christianity view,
telling the truth is essential, lying is considered a dishonor and a sin. The metaphors are
revealing that the higher class and lower class are sinful no matter how powerful or poor
you are. We all need to seek each other for help to learn more about one’s self and stop the
prideful act, for we all sin. Beowulf was the perfect warrior, had all the good abilities that no
other warrior had, but he sinned in being prideful. Historically, using storytelling for
political gain was a way of entertainment, enlightenment, and traditions.
I need someone to solve linear Algebra questions in certain time

I need someone to solve linear Algebra questions in certain time. There will be 20 questions.
The time I will be able to send the questions is April 30 at 8:30 Eastern Time Zone. you have
to send me the solutions within 1 hour from the time I send you the questions.I will attach
an example of the questions.****please pick up the question if you think you are able to be
available at this exact time (April 30 at 8:30 Eastern Time Zone.)
Need someone to take a class for me online

the class is in colorado technical university. The class is called career planning and
management. It has about 5 discussion board posts, in which you must post and also reply
to 2 other students posts. Then there are individual projects which are just small
assignments. About 3 individual projects. Would really appreciate the help, looking for
someone long term to do multiple classes and give me a fair price. Classes last about 4-5
weeks. Grading is not too hard either. Will provide login info and everything to complete
assignments.
Need someone to take my EDUCATIONAL PSYCHOLOGY EXAM and pass it! Must be able to
get the book . Exam

Hello my major is Criminal Justice with a minor in forensics. I am taking this course to fullfil
my college elective credits. I failed the first exam so i really need to pass this exam. Its about
Educational Psychology. Usually the exams are 60 questions timed with 1 hour 30min to
take it. The book used for this class is : Educational Psychology: Theory and Practice
Robert E. Slavin Merril, 10th Edition, 2011 ISBN-10: 0-13-703435-0 ISBN-13: 978-
0-13-703435-2 In order to take the exam you need to go
to http://online.fiu.edu/loginclick login Once logged in click on the Educational Phschology
calss (Second one on the list)On the left hand side click on assesmentScroll down on the
page and click quiz 2 you should be able to take the quiz then.
need someone to write a 1000 word thesis outline

Topic: The Opioid Crisis in AmericaWatch the YouTube video for an overview of the
problem: https://www.youtube.com/watch?v=oHlaz0kQlRE Thesis Statement/Outline
AssignmentIn Module/Week 2, you must develop an outline for the 1,000-1,200 word
proposal argument essay that you will write in Module/Week 3. Your outline should include
a clear thesis statement and plan of support. Be sure to consider all essay parts identified in
“The Elements of Argument (Planning A Proposal Argument)― in the textbook
readings, and include at least the minimum requirements listed in the chart below for this
week’s assignment. The research sources for this essay have been provided for you in
Blackboard. Any additional sources that you may choose to use must be credible academic
sources. You must integrate a total of 4 quotations, summaries and/or paraphrases from 3
credible sources to support your thesis statement and provide opposing arguments. Be sure
to document your sources correctly according to your documentation style (Current APA,
MLA, or Turabian). You may include biblical support. Proposal Argument PromptWrite a
proposal argument in which you address the question, “What needs to be done to
address the opiod crisis in the United States?” Helpful HintsRead “Outlining a
Proposal Argument” in this week’s textbook readings to understand all parts to
include in a proposal essay.Review the Minimum Outline Requirements Checklist (below) to
understand the content that you must include in your thesis/outline this week. Review the
Essay 1 Thesis/Outline Grading Rubric in Blackboard before submitting your thesis/outline
in Blackboard.Part 1
need someone very skilled with statistics and U.S English writing

need someone very skilled with statistics and U.S English writing to write a 5-page paper
following the instructions in the PDF document and using the Excel data set. This paper
must be written in perfect native U.S. English with no spelling or grammatical errors. Also
attached is a sample example of how the paper should look like.
Need someone with Information Technology background to do a paper.

Intrusion Detection and Incidence Response Course2 page paper APA format with
referencesAssignment: Symptoms of Attack You are a consultant requested by one of your
clients, a Chief Technology Officer (CTO) of a major online stock trading company, to
respond to an intrusion that has infected 350 Windows PCs users spread throughout a large
multi-level office building. The CTO is not satisfied with the current response and would like
an incident response professional to create a „hypothesis‟ on a possible cause of the
symptoms of the attack, and the specifics of the required approach related to intrusion
detection and response. An example of a hypothesis would be: “The PCs on the network are
suffering from a high rate of malicious code infection and network security has been
compromised.” After creating your hypothesis, what IDS approach, required tools, and
incident detection and response principles must be implemented by the professional to
prove or disprove your stated hypothesis? What are the steps used to prove or disprove
your hypothesis? How is your hypothesis verified to determine it was successful? This
paper should be 1-2 pages long and should reflect your ability to explore a problem and
analyze resulting troubleshooting methodologies.
 Need source of article, Why did you
choose this article, key message in the arti

Need source of article, Why did you choose this article, key message in the article and What
key strategic "organization dynamic concept" is reflected in this article.My course is
Organizational Dyanmics, topic is "Understanding Your Learning Style " and I am posting
screenshots of the text in organization dynamic concept.Please provide good information
like 6 paragraphs and references GET THIS OR ORDER A SIMILAR
PAPER NOW
Need SPSS output and data file for Statistics exercise

I have attached a Microsoft Word document containing easy-to-understand instructions and

the exercise questions. Part One involves a bilinear regression, and Part Two requires
coming up with any test that fits the given scenario. There is a Part Three (not in the Word
document), but I have already accomplished that. I'm looking for someone who has SPSS
and can provide the output and data files for both parts. I am using version 22, but as I
understand, other versions of SPSS should be compatible. For anyone with SPSS and the
understanding, this should be very quick and easy. Final clarification:This project involves
putting the exercise data into SPSS, generating an output and data file, and then writing a
short APA-format paragraph on the results. You DO NOT need to "paste the results" of the
SPSS output in the document you return. As long as you attach the output and data file, I
will do the pasting required.
NEED STUDY HELP PART A Activity 1 WATCH
https://www.youtube.com/watch?v=XOxsjdB4-ZQ&t=1s AND

NEED STUDY HELP PART A Activity 1

WATCH https://www.youtube.com/watch?v=XOxsjdB4-ZQ&t=1s AND ANSWER
QUESTIONS 1. Why is genetic diversity important? Genetic diversity it occurs among
distinct populations of single species 2. Explain the connection between population size and
genetic diversity. 3. What may occur as a result of closely related individuals breeding?4.
What usually precedes extinction? Why do you think this is5. What happens to the unique
genetic diversity of a species if it goes extinct? What implications may this have for
humans?6. How is human well-being threatened by a lack of genetic diversity in our
agriculturally important crops?Activity 2 WATCH VIDEO AND ANSWER QUESTIONS
https://www.youtube.com/watch?v=nQChYlCni-s1. In the Gorilla SSP, is equal breeding
priority given to all individuals? Why or why not?2. Why was the male gorilla’s background
helpful to the SSP breeding program?3. Let’s expand on this video, and EXPLORE WESBITE
https://en.wikipedia.org/wiki/Ex_situ_conservation#Genetic_management_of_captive_pop
ulationsWhat does mean kinship measure?4. What does it mean for an animal to have a low
mean kinship value?5. Would an animal with a low mean kinship value be desirable for a
captive breeding program? Explain.6. Why is the potential for the loss of genetic diversity
high in captive populations of endangered species?7. What is one harmful effect of
inbreedingPART BActivity 1For this activity, you’ll go to the Encyclopedia of Earth websites
on https://editors.eol.org/eoearth/wiki/Species_diversityand
https://editors.eol.org/eoearth/wiki/Species_richness While reviewing the information on
these sites, you’ll answer the following questions 1. How does species richness influence
species diversity?2. How does species evenness influence species diversity?3. What is the
range of estimates for total species richness on Earth?4. In terms of geographic patterns,
where is species richness generally higher?5. How do disturbances affect species
richness?Activity 2For this activity, you’ll be using a simulation to quantify biodiversity at
two different time periods. The calculation for diversity indexes take into account both
species evenness and species richness. These calculations can be quite complex, so we’ve
made it easy with a handy-dandy diversity index calculator.USE THE DIVERSITY INDEX
CALCULATOR ATTACHMENT THAT ATTACHED !!!GO TO WESBITE
https://www.biologysimulations.com/biodiversity1. Click on the red button that says
“produce community”2. Count the number of individuals of each species that you see. Enter
this data into the column labeled “abundance” for each species in the “community 1”
section.o Note: you may not see every species listed in your community. That’s ok. You can
either leave abundance blank or put a 0 in the column.o Think of this like a game of i-spy.
The species may be flying in the tree tops, perched on branches, on the ground. 3. Once
you’ve documented all the species in community 1, click “produce community” again. 4.
Repeat step 4, entering this data into the “community 2” section of the excel workbook.Once
you’ve documented the richness, evenness, and diversity for the two communities, answer
the following questions in your lab notebook. 1. What is the diversity index value for
community 1? For community 2?2. Was one community more diverse than the other?3. Was
this difference due to species richness or evenness?4. Community 1 represents a
community approximately 70 years ago. Community 2 represents the same community in
the present day. Write a description (at least 7 sentences) of a scenario to explain the
difference between the two samples. Be creative in designing your scenario, taking into
account factors from the surrounding area. Think about factors that can lead to
increased/decreased/stable biodiversity. Be as detailed as possible in your
description.PART C Activity 1 WATCH VIDEO AND ANSWER QUESTIONS
https://www.youtube.com/watch?v=RFEV-hiP2gQ&t=1s1. Define biome.2. List three
different biomes. 3. What is the initial energy source for nearly all biomes?4. What two
climatic factors influence the distribution of terrestrial biomes around earth?5. If you’re
living in Southern California or South Africa, in what biome are you living?6. Rainforests and
deserts both have high temperatures, why is one so much more diverse than the
other?Activity 2GO TO WEBSITE https://www.cepf.net/our-work/biodiversity-hotspots1.
Click on the California Floristic Province (CFP)2. Answer the questions below about this
hotspotAnswer the following questions in your notebook1. What are some of the types of
ecosystems found in the California Floristic Province?2. Approximately what percentage of
vegetation remains in more of less pristine condition? Why do you think there isn’t more
left?3. Click on “species.” How does the number of native vascular plants compare to the
surrounding geographical regions?4. What percentage of CFP native plants are endemic?5.
What is it about the environment in California that has led to a large number of specialized
flora?6. While there are only 10 bird species endemic to California, why else is the CFP
important for maintaining bird biodiversity?7. What animal appears on the California flag?
Why is this animal no longer found in California?8. What type of endemic amphibians is the
CFP known for?9. Click on “threats.” What are the main threats to the biodiversity of
CFP?10. One of California’s major economic activities is agriculture. How much of the food
consumed in the US on a yearly basis is produced in California?11. What percentage of
redwood forests are left? What happened to them?12. What are the consequences of the
destruction of wetlands?13. Go back to the map. What are three other hot spots found in
other regions?DISCUSSION FORUM MUST BE 8 SENTENCES PromptLet’s say you get the
following email from a close friend:I just don’t get it. The US spent 1.5 billion dollars on
protecting threatened and endangered species in 2016 Links to an external site.. This
money is being spent when we have veterans living on the streets homeless, millions of
people without adequate health care, and so many other large scale societal issues. It seems
like the money could be spent in better ways, in ways that help humans. I don’t see the need
to protect a tiny little kangaroo rat or a frog. Why should we be using our resources to help
save these species?Construct a response to your friend that argues that protecting
biodiversity indeed does benefit people. Provide at least 2 articles or videos for your friend
to view that help support your argument. And make it personal, include at least 3 direct
ways in which your friend benefits from the continued existence of a biodiverse planet.
Your friend mentioned a specific dollar amount. Can you counter this argument with
another dollar amount?WATCH VIDEO
https://www.youtube.com/watch?v=h5eTqjzQZDY&feature=emb_title
Need study help The 2020 Presidential election was one for

Need study help The 2020 Presidential election was one for the history books. President
Biden won the office by winning back from Donald Trump certain swing or battleground
states that Trump won in 2016. Explain the mathematics of the electoral college. Identify
those key swing states. Why did Biden win them back from Trump? Many Trump
supporters claim that Trump won those states again in 2020. What is their main
argument?Again, https://www.realclearpolitics.comis a good place to begin outside
research. Make sure it is 8 sentences to answer question
Need study help with 2 assignments PART 1 What were

Need study help with 2 assignmentsPART 1 What were the three main ideas that stood out
for you from this chapter?Without repeating information from the textbook, why are those
main ideas from the chapter important to you? (In other words, how have you experienced
the concepts/principles discussed in this chapter?)How will you use the information in this
chapter in your work life, AND what outcomes/results do you expect to achieve by doing
so?Make sure it is 300 words!!!!TO ANSWER PART ONE USE THE ATTACHMENTSPART
2What would you tell your supervisor at work if they asked you which rewards are most
important to you?Why are the rewards you mentioned in question 1 important to you?
Please describe the needs those rewards will satisfy for you.MAKE SURE ITS 300
WORDS TO ANSWER PART ONE USE THE ATTACHMENTS
need study help Your answer in this forum must be

need study helpYour answer in this forum must be no less than 300 words, must be
detailed, and must show evidence of your critical thinking skills. Please do not write the
questions below in your post. Rather, simply label your answers according to the question
they answer (i.e., 1., 2., 3., 4.). All posts must be written in your own words and not copied
from any other sources.Here is this week’s question:Please watch this video on Zappos and
answer the questions
below:https://www.youtube.com/watch?v=tFyW5s_7ZWc&t=3sLinks to an external
site.How would you describe Zappos’ culture overall? (do not just use one word – think
analytically)Describe the artifacts you saw in the video and why they are important to the
company (artifacts are things you can see, hear, and feel within an organization, but may be
hard to decipher)Describe the expressed values & beliefs you heard in the video and why
they are important to the companyWhat specifically stood out for you in this
video? Why?(Please be specific in your answer, and provide details and evidence of critical
thought to support your conclusions. You are being graded on (a) the content of your
answer, (b) how well you support your answer with details and evidence of your critical
thinking skills, and (c) your ability to follow the directions of this assignment.)
need summary written

Out of 200 applicants, you have been selected to work as the manager in the research
department for a special task force with the Centers for Disease Control and Prevention
(CDC). Review the CDC website at https://www.cdc.gov. Your first assignment on this
special task force is to focus on Opioid Overdose. The CDC reports that from 1999 to 2015,
more than 183,000 people died in the U.S. from overdose related to prescription
opioids.The CDC has been researching the impact of opioid overdose to protect the public’s
health and prevent opioid overdose deaths using surveillance and research. You will focus
on two primary areas: 1) opioid prescribing guidelines for physicians, and 2) ways hospitals
can create prescription drug monitoring as a part of their Quality Management Department
(see https://www.cdc.gov/drugoverdose/index.html).Locate a peer-reviewed journal
article related to quality in healthcare. Analyze how this article can be used in the Quality
Management (QM) Department.Determine how your article can be used by hospitals to
monitor prescription drug programs.Write a 150-word summary of your article and
determine how it can be used in the QM. The summary should follow the SESC formula:
State, Explain, Support and Conclude.Utilizing SWS format, write a reference at the bottom
of your summary. The citation must follow SWS format. Note: Wikipedia and similar
websites do not qualify as quality resources.This course requires use of new Student
Writing Standards (SWS). The format is different than other Strayer University courses.
Please take a moment to review the SWS documentation for details.The specific course
learning outcomes associated with this assignment are:Analyze the critical management
issues, purpose, functions, and performance measures of different departments within
healthcare organizations.Use technology and information resources to research issues in
health services organization management.Write clearly and concisely about health services
organization management using proper writing mechanics.
Need the above and attached assignment is done as soon

Need the above and attached assignment is done as soon as possible. Please read ALL of the
attached instructions and follow them to the “T” NO EXPECTATIONS!!!!! The new format
that is going to be used is SWS Strayer Writing Standards which is different from APA 6 and
7. Please use ALL of the resources that are provided in the attached instructions NO
EXPECTATIONS!!!!!!! Need the assignment completed by Monday, August 9, 2021, by 9:00
AM EST. Thanks
Need the attached Math questions answered. There are a total of 15 questions that need
solutions. Need within a day so I can use to verify the assignment
Need the following 4 assignments completed.

Module 1 - SLP INTRODUCTION AND DEFINING THE MSITM CAPSTONE COURSE

REQUIREMENTS As you know, the purpose of an SLP is to give you the opportunity to
explore the applicability of the course learning to your own work-life. By this time, most
MSITM students are assumed to have acquired a good deal of important knowledge about
information technology and its management. Interestingly, you have likely also functioned
(formally or informally) in the role of 'internal organizational IT consultant' (or can at least
imagine what this might be like). Those of you who have been (or are) IT consultants or
contractors (or simply just had to offer IT or other advice) certainly know that, in addition
to technical knowledge and skill, you also have to acquire a set of successful ‘consulting
techniques', to include a set of suitable interaction/communication/political behaviors. You
also have to know something about the organization and your customers, how to get at the
data/issues, then get your message across, getting people to trust and respect you and a
host of other things necessary to get the consulting role and keep it, or to get and keep an
important IT project moving. This is only a little less true for the internal IT specialist or
manager who must respond in many ways as a consultant to internal customers. The SLP
question thus is: "What do I really know about my personal ‘consulting' activities?" Your
task for this SLP is to: (1) do a little personal literature mining (properly cited) on the
particulars and importance of the role of the IT consultant and the IT unit as a consultant to
the organization. You are encouraged to look beyond personal behaviors and check out
'organization development' (OD) or general consulting literature to understand
organizational techniques (i.e., 'scanning') and issues (such as political realities). In
particular, you might wish to find one of the several 'step' models which suggest phased
consulting activities; (2) note some truly important characteristics; and then (3) using this
information as a guide, suggest your current most important consulting strengths as well as
opportunities you see for improvement, based on both personal knowledge and your
assignment literature review. Relate these strengths to the organizational unit for your
project and discuss how the strength could benefit the IT outreach from that unit. Try to do
this in three to four pages or so. (There is no penalty for a longer paper.) Note that you may
wish to seek the opinions of co-workers in this largely self-diagnostic project. They may
have some interesting insight for you. Remember, this is not a paper where you make
generalized comments about what consultants do. It is about your insight and typical
activities. Do not discuss personality 'traits' or 'style labels' you may have learned. You must
discuss actual activities you now use when dealing with others and providing expert IT
advice. For example, how well do you listen versus talk, or how well do you scan the
organizational environment and try to find out about the politics of a given situation before
you wade in with your advice or start a project? As noted above, you will wish to research
the Web and check out traditional models of consulting behavior and typical behaviors in
each 'stage.' For example, what are effective behaviors when one first enters any kind of
consulting relationship? Again, stay out of the personality and trait literature; this is about
observable activity. You may want to chat with people whom you have provided advice to,
to see what they have observed. Be forewarned that generalized papers with no personal
information, or including a 'personality assessment' will be graded as unresponsive to this
assignment. Do not provide a technical outline or project details such as: "conduct
project/needs analysis." This is assumed. SLP Assignment Expectations These SLP papers
require that you integrate, discuss, contiguously cite, and later fully reference at least three
academically sound sources. Use enough concurrent discussion so that the purpose of each
citation is apparent to the reader. Note that this paper is incomplete without at least three
academically sound references (relevant magazine articles such as CIO are OK. Also, you
may use Wikipedia and military/corporate references, but they do not count as one of the
required three). You will be assessed on the appropriateness and completeness of the detail
you provide regarding your topic, your use of citations and references as noted above, and
your intellectual insight into topically important issues. You are expected to use correct
grammar, spelling, and English vocabulary. Check your paper for missing or inappropriately
used words. If in doubt, check the dictionary and not 'spell check.' Consider that this paper,
and all others, will be reviewed by the CIO and/or your commanding officer. It is strongly
suggested that you ask a trusted colleague to review and edit each of your papers. Post your
paper once it is completed. Module 2 - SLP ARCHITECTING THE IT GOVERNANCE PLAN
SLP Assignment Expectations As a consultant to, or manager of, an IT unit within your
selected organization, you must be keenly aware of challenges facing your selected
organization. This assignment asks you to identify, intellectually discuss, and broadly report
on at least two of the most important (in your view) strategic issues faced by your selected
organization. In particular, note how these issues have influenced the organization you are
considering. Why has the consideration of them positively affected that organization?
Conversely, what have been the negative effects on the organization because of not
considering them? Make sure you relate the issues and concerns you discuss to IT
Governance. Additionally, if failure to properly consider an IT Governance issue has caused
the organization problems, how would you alter the IT Strategy? Alternately, if the
Governance Issues have aided the organization, what more might you recommend doing?
Please provide some detail/examples as you write this paper. Your paper's title might be:
Considering the Strategic Issues: Their Impact on IT Governance. Module 3 - SLP IT
ORGANIZATIONAL ASSESSMENT AND PLANNING These SLP papers require that you
integrate, discuss, contiguously cite, and later fully reference at least three academically
sound sources. Use enough concurrent discussion so that the purpose of each citation is
apparent to the reader. This paper is incomplete without at least three academically sound
references. Relevant magazine articles such as CIO are acceptable. Also, you may use
military/corporate references, but they do not count as one of the required three. SLP
Assignment Expectations You will be assessed on the appropriateness and completeness of
the detail you provide regarding your topic, your use of citations and references as noted
above, and your intellectual insight into topically important issues. You are expected to use
correct grammar, spelling, and English vocabulary. Check your paper for missing or
inappropriately used words. If in doubt, check the dictionary and not 'spell check.' Consider
that this paper, and all others, will be reviewed by the CIO and/or your commanding officer.
It is strongly suggested that you ask a trusted colleague to review and edit each of your
papers. Post your paper once it is completed. Finally, you are not to use any
government/military classified or corporate-sensitive information in the development of
any course papers or in any Discussion participation. Module 4 - SLP MANAGING COMPLEX
IT ORGANIZATIONAL CHANGE AND CAPSTONE PAPER The continuing professional
development of IT personnel is a key managerial responsibility. In this light, reflect on a
subordinate and prepare a somewhat detailed and actionable professional development
plan which would be intended for use in a forthcoming performance review session. In this
plan, you should hypothetically assume the individual to be reviewed has indicated interest
in a long-term organizational career and steady advancement. From your perspective, your
plan would include both near- and long-term objectives and milestones to assist this
individual in reaching his or her goals. This plan should include traditional professional
development issues such as potential schools and assignments as well as some counsel on
how to make use of organizational politics (e.g., getting a senior mentor) and maintain a
visible, positive profile. Begin the paper with a brief academic review of the importance of
subordinate professional development to personal and organizational performance (with
appropriate citations), and then follow this with your detailed plan. The plan title might be:
"Achieving Personal Success While Advancing Organizational Performance." SLP
Assignment Expectations These SLP papers require that you integrate, discuss, contiguously
cite, and later fully reference at least three academically sound sources. Use enough
concurrent discussion so that the purpose of each citation is apparent to the reader. This
paper is incomplete without at least three academically sound references. Relevant
magazine articles such as CIO are OK. Also, you may use military/corporate references, but
they do not count as one of the required three. You will be assessed on the appropriateness
and completeness of the detail you provide regarding your topic, your use of citations and
references as noted above, and your intellectual insight into topically important issues. You
are expected to use correct grammar, spelling, and English vocabulary. Check your paper for
missing or inappropriately used words. If in doubt, check the dictionary and not 'spell
check.' Consider that this paper, and all others, will be reviewed by the CIO and/or your
commanding officer. It is strongly suggested that you ask a trusted colleague to review and
edit each of your papers. Post your paper once it is completed.
Just need the questions to be answered with the articles down below please

First, write down 5 different body rituals in your post and 5 different adjectives you can use
to describe these people in your post.Who is this text REALLY about? Consider what
Nacirema is spelled backwards.Does knowing what this text is really about change your
opinion about these people? Why or why not?What is Miner’s purpose in writing about
these people in this way? What do we have to learn about the adjectives we initially used to
describe these people?What is Audre Lorde's claim about oppression?How does Miner's
lesson relate to Audre Lorde's claims in her text?How can we apply the idea of the “Voices
from the LEFT” to Miner’s and Lorde's
texts?https://courses.lumenlearning.com/readinganthology/chapter/body-ritual-among-
the-nacirema-by-horace-miner/#return-footnote-144-
8https://www.socialism.com/drupal-6.8/sites/all/pdf/class/Lorde-
Age%20Race%20Class%20and%20Sex.pdf
** need these 8 questions with provided answers re-written with

** need these 8 questions with provided answers re-written with no plagerism. 1. what is a
business model and how do business models differ from business-level strategies?– A
business model, which describes what a firm does to create, deliver, and capture value for
stakeholders, is part of a firm’s business-level strategy. In essence, a business model is a
framework for how the firm will use processes to create, deliver, capture value, while BLS is
the path the firm will follow to gain a competitive advantage by exploiting its core
competencies in a specific product market. There are many types of business models
including the franchise, freemium, subscription, and peer-to-peer models. Firms may pair
each type of business model with any one of the 5 generics BLS as the firm seeks to compete
successfully against rivals. 2. what are the difference among the cost leadership
differentiation strategy, focus strategy and integrated cost leadership / differentiation
business level strategies?– Cost Leadership: Broad Target & Lowest CostDifferentiation:
Broad Target & DistinctivenessFocused Cost Leadership: Narrow Target & Lowest
CostFocused Differentiation: Narrow Target & DistinctivenessIntegrated Cost
Leadership/Differentiation: Simultaneously low cost & differentiation 3.how can firms use
each of the business-level strategies to position themselves favorably relative to the five
forces of competition Cost Leadership:Competitors hesitate to compete on priceBuyers –
low prices shifts power back to firmSuppliers – can absorb cost increases and make very
large purchasesNew Entrants – frightened off by need to be on such a large scaleSubstitutes
– can lower prices in order to maintain positionsDifferentiationCompetitors – brand
loyaltyBuyers – less sensitive to price increasesSuppliers – higher margins to absorb
increases from suppliersNew Entrants – new products must be at least equal to
performance of proven productsSubstitutes – brand loyalty reduces switching brands 4. As
explained in this chapter’s Opening Case, Amazon purchased Whole Foods. How will this
transaction affect Aldi as it seeks to expand its presence in the United States? What
competitive actions might Aldi take in response to Amazon’s purchase of Whole Foods?–
Aldi has high competition throughout the United States. They have created competitive
rivalry in the retail grocers’ industry by selling brand-label products and more brand
options for each product category. This is able to keep packaging, transportation, and
employee expenses keep costs low. Aldi also limits their selection to make it easier and
faster for customer shopping experience.5. In a competitive rivalry sense, explain the
actions (strategic and/or tactical) you believe Walmart and Costco will take to respond to
Aldi’s intentions to have 2,500 U.S. stores by 2020.I believe that Walmart and Costco should
find other ways to differentiate from Aldi. They should keep low prices and improve their
customer service. Another option would be for Walmart and Costco to reduce their profit
offerings. Having less brands can be better for only one specific company, but it will reduce
waste. Usually, since customers have so much brands to choose from, some brand are more
preferred than other and the other food products end up going to waste.6. What are the
different level of diversification firms can pursue by using different corporate-level
strategies? – There are three different levels of diversification, that firms may pursue by
using different corporate-level strategies.1) Low level diversification strategy: This includes
single and dominant level business strategies. In such business strategies companies
generate their maximum revenue from their core business areas. Companies that follow
single- or dominant-business strategies have low levels of diversification. More than 95% of
the revenues come from single business unit in single level business strategy, whereas,
between 70% to 95% of the revenues come from single business unit in dominant level
business strategies. The example of the company using such kind of strategies is Frito Lay2)
Moderate to high level diversification: This includes moderate to high level diversification
strategies. This is the strategy where most of the companies use related diversification
strategy for their business. All the businesses in these cases are linked to each other.A
diversified company is one that earns at least 30% of its revenues from sources outside of
the dominant business and whose units are linked to each other by the sharing of resources,
and by product, technological, and distribution linkages. Moderately Diversified companies
also earn at least 30% of their revenues from the dominant business and all business units
share product, technological, and distribution linkages. The example of the company that
uses this kind of a strategy is GE3) Very high level diversification: This is the scenario where
companies use unrelated diversification strategy for their business purposes. Companies
that generally use such strategy are known as conglomerates.Unrelated diversified
companies generate at least 30% of their total revenues from the dominant business but
there are few linkages between key value-creating activities. Unrelated-diversified
companies do not share resources. Conglomerates (companies following unrelated
diversification strategies) dominate the private sector economy in several countries such as
Latin America, South Korea and India while US has more highly diversified companies. The
example of this kind of strategy is Samsung.Advantages of diversifying their operations :1)
To increase the value of a company: This is one of the major reasons why a company may
choose to diversify its operations. Diversifying its business will lead to the company
creating an edge over rest of its competitors which lead to sustainability of the business.2)
To decrease the risk for a company: The main motive behind this is to reduce the
competition and operational risks that an organization may encounter.3) To neutralize
another company’s strengths: This is very important as neutralizing competitor’s strengths
will prove to be a major achievement for the business. This will highly contribute to the
profitability and growth of the organization. 7. What are the two ways to obtain financial
economies when using an unrelated diversification strategy? – The first method is to make
efficient allocations of the internal capital, which will help mitigate risk. Capital can be
allocated in various ways like through debt and shares, etc. the holders of such debt or
shares will put efforts to enhance the value of their investments by taking interests in other
businesses with high growth and profitability prospects.The second method is restructuring
the already acquired assets. The restructuring entails purchasing another company,
restructuring it for efficiency and profitability, and then reselling for a profit.8. What
motives might encourage managers to overdiversify their firm? Increased compensation:
Through over diversification the company may generate more and more revenue which will
enable them to increase the compensation level of their employees resulting in better
employee satisfaction and increased level of motivation. All such factors will enhance the
performance of the overall organization and increase the competitiveness of the
firm.Reduction of managerial risks: If the firm gets over diversified, it eventually reduces
the managerial risks involved. This happens because the risk gets divided among all the
businesses that form a group for diversification. It has another added benefit that with over
diversification they get to explore more and more markets. This leads to more and more
ideas fro businesses coming in.
need these in a couple of hours

BE13-11 Buchanan Company recently was sued by a competitor for patent infringement.
Attorneys have determined that it is probable that Buchanan will lose the case and that a
reasonable estimate of damages to be paid by Buchanan is $300,000. In light of this case,
Buchanan is considering establishing a $100,000 self- insurance allowance. What entry(ies),
if any, should Buchanan record to recognize this loss contingency BE13-12Calaf’s
Drillers erects and places into service an off-shore oil platform on January 1, 2015, at a cost
of $10,000,000. Calaf is legally required to dismantle and remove the platform at the end of
its useful life in 10 years. Calaf estimates it will cost $1,000,000 to dismantle and remove
the platform at the end of its useful life in 10 years. (The fair value at January 1, 2015, of the
dismantle and removal costs is $450,000.) Prepare the entry to record the asset retirement
obligation.
need these questions answered my homework is completed the completed graphs are
attached All I need

Report the results of the calculations you performed above. Which strain of E. coli exhibited
the highest growth rate? Which strain of E. coli exhibited the lowest growth rate? Assuming
that all five of the E. coli strains present a high toxicity danger to humans, which do you
suppose would be the most manageable based upon growth? Why? Consider how you’ve
modeled the growth of the E. coli strains using the concept of geometric sequence. Is this a
realistic approach to modeling bacterial growth? What other factors do you think should be
considered when modeling the growth of bacteria such as E. coli? Conduct an Internet
search for research on E. coli. Look for information related to growth rate, environmental
conditions conducive to growth, methods of controlling growth, etc.
need this answered please 41

Discussion Questions. Answer each one individually. 150 words each question.1. What are
the technological functions within correctional environments? 2. How do technological
functions relate to security and management functions within correctional environments?
3. What would happen if there was a disconnect among these areas of a correctional
facility?1. Where do jails differ from prisons?2. What is the relationship between jails and
prisons, as they relate to community corrections? 3. What would happen if jails and prisons
were combined into one large correctional facility? Explain.
need this asap 11

Analysis and Application: Procedures in a Criminal TrialThe following case study presents
issues related to procedures in a criminal trial and the roles of the major participants.Case
Study:Jones, Walsh, and Bert have been arrested on suspicion of rape and criminal assault of
a 14-year-old girl. As the police investigation unfolds they locate and obtain the statement
of Bland, who provides them additional information about Jones. The evidence the police
uncover reveals that there have been three separate assault and rapes of juveniles over a 3-
day period.The prosecutor in the case files charges against Jones, Walsh, and Bert for their
acts. Bert hires an attorney to defend him. Bert tells his defense attorney that he did not
commit any of the rapes and that he was only present one time with Jones and all he did
was hit one of the girls. Bert explains that he can prove this because at the times the other
rapes are alleged to have occurred, he was with Mook. Mook is currently out of the country
on a mountain climbing trip and will not return for 2 months.Shortly after the prosecutor
files charges in the case, Bland contacts the prosecutor’s office and provides a written
statement to the prosecutor that Walsh was not present during any of the rapes.In a 2-page
paper (excluding the title page and reference page), discuss the following questions,
explaining your answers in detail by analyzing the facts presented and other factors you
consider relevant; defining and explaining key legal terms and principles; and citing legal
authority (your text and other legal authority) to support your conclusions.How should the
court rule on Bert’s motion for severance in the case?What should the prosecutor do
following the statement Bland after charges had been filed against Walsh?How should the
court rule on Bert’s motion to continue regarding Mook?Note: This Assignment will require
outside research. Use at least two credible sources beyond the text material, and discuss
how you evaluated the credibility of the resources used. You may consult the Library, the
internet, the textbook, course material, and any other outside resources in supporting your
task. Use proper citations in APA style.The paper should contain a cover page and a list of
references in APA format.All internal citation of outside sources plus the listing of all
references should also adhere to APA formatbonus questions, 1-2 paragraph each please
site the sources on their own document separate from the actual assignment 1.Discuss the
role of plea bargaining in criminal trials. What are the advantages of allowing defendants to
plea to reduced charges/sentences? To what extent should victims of crimes be consulted in
the plea bargaining process? Make sure you state whether you agree or disagree with the
plea bargaining process.In Court – What Would You Do?2.You are an undercover officer
who is on the stand testifying at the trial of a mid-level drug organization member. During
cross-examination you have been asked by the defendant’s attorney to reveal the name of
your informant in the organization. You have been advised by the prosecutor and your
commander to not reveal the name of this informant as doing so would result in the loss of a
very valuable resource inside the drug organization and most likely the informant’s life as
well. The judge has ordered you to answer the question over the objection of the District
Attorney handling the case and warned you that you will be held in contempt of court and
placed in a jail cell until such time as you will answer the question.Discuss how you would
handle this situation and your reasons
need this asap 43

Research Project – Annotated Outline InstructionsCJUS230After selecting a criminal

justice topic for the Final Research Paper and submitting your Thesis Statement on the topic
you chose, you will compose an Annotated Outline of your Final Research Paper. Your
Annotated Outline must fully support each facet of your Thesis Statement.The Annotated
Outline must provide a detailed blueprint of the Final Research Paper in current APA format
and contain the following:(1) The Thesis Statement;(2) Three Main Headings (at least);
and(3) A Reference Page.The complete thesis statement must also be provided. The three
main headings must provide an argument rather than ask a question. The three main
headings must be supported with at least 2 subpoints each. The subpoints must each be
3–5 sentences and accompanied by a current APA citation of an academic resource for
each subpoint. One of the three main headings and its subsequent subpoints must
incorporate a biblical worldview. The Annotated Outline must include a reference page with
5 academic resources published within the last 5 years and composed using current APA
formatting.Before submitting the Annotated Outline, review the Research Project –
Annotated Outline Grading Rubric to verify that all components of the assignment have
been completed. Save your work as a Microsoft Word document and submit it to
Blackboard.
***I NEED THIS ASSIGNMENT TODAY*** ***MUST FOLLOW THE LAST TWO

***I NEED THIS ASSIGNMENT TODAY*** ***MUST FOLLOW THE LAST TWO PAPERS***
***MUST PASS TURNITIN*** ***CONTINUE TO USE VIRGIN ATLANTIC WEAKNESSES AS
BASIS OF THE PAPER***For this assignment you will research the weaknesses of your
organization and provide a detailed paper on your findings. Consider the factors listed
below and remember the given outline from Module 1 is there for your use. This outline is a
great tool for getting your different sections fully completed and researched. In addition,
remember that this paper on the weaknesses of your organization will become the third
section of your overall SWOT paper due at the end of Module 8.Factors to consider when
you think about company weaknesses both from an internal and external point of view
include:What is the size and scale of the company, including the environment the company
operates in? Are they global, corporate, or small business?Consider supply and demand and
the costs of operating the company, including finances and outdated equipment and
technology.What about the organization’s brand name and reputation? These are extremely
important when considering weaknesses and should be researched thoroughly both in
person and online.What opportunities exist in your market or the environment that you can
benefit from?Is the perception of your business positive?Has there been recent market
growth or have there been other changes in the market that create an opportunity?Is the
opportunity ongoing, or is there just a window for it? In other words, how critical is your
timing?For this assignment, complete the following:Research and thoroughly explain at
least TWO major weaknesses of the organization.Research at least one management or
leadership theory can be used to improve upon the identified weaknesses. Provide a brief
description of the theory and explain how you can apply it to the weaknesses that you
identified.Compare the cost of purchase or leasing equipment for your organization.Choose
any type of equipment that would be applicable to your organization (e.g., postage machine,
copier, upgrading out-of-date technology such as computers, etc.)Research the cost of
buying the equipment vs. leasing the equipmentUsing the calculator (Links to an external
site.) (https://www.calcxml.com/calculators/lease-vs-buy-equipment), analyze the
financial impact and determine the best course of action, provide a recommendation (state
the cost difference and why you made your recommendation) to change this weakness into
an advantage.Discuss why each weakness is present and what can be done to change this
weakness into an advantage.You should have a minimum of at least one full paragraph for
each of the weaknesses presented. For each weakness you need to ensure you use relevant
business theories, concepts, and practices that are aligned to support the statements and
findings.Note that bullet points are not acceptable.Each of these weaknesses must come
from a force or forces occurring within a dimension of the general environment within the
organization’s external environment (keep in mind a weakness can stem from more than
one dimension within the general environment). Be sure to include in your analysis the
relevant dimension of the general environment from which each of these forces is derived.
Need this back in 2 hrs no exception 1. Discuss

Need this back in 2 hrs no exception 1. Discuss two developmental approaches to training
and how each approach aids organizations in workforce development. 2.Describe two
learning transfer activities, and identify how each activity effectively promotes knowledge
share. 3. Training professionals who operate in a global environment often face challenges
when dealing with various cultural differences. List two challenges that may arise when
training across cultures, and give solutions to each one of the challenges presented. 4.
Explain how organizations can enhance performance through learning and development
activities. 5. There are many delivery approaches that can help a trainer deliver the content
that needs to be learned. One core focus is to ensure that the delivery style is one that is
palatable for all learners. The knowledge for this comes through the understanding of the
various adult learning concepts and then tailoring the delivery approach to those concepts.
For this question, explain the three major adult learning styles. Then, choose one delivery
approach, and discuss the activities in the approach that would best fit each learning style.
need this badly

Six years ago, Leticia, Monica, and Nathaniel organized Lemona Corporation to developand
sell computer software. Each individual contributed $10,000 to Lemona in exchangefor
1,000 shares of Lemona stock (for a total of 3,000 shares issued and outstanding).The
corporation also borrowed $250,000 from Venture Capital Associates to financeoperating
costs and capital expenditures.Because of intense competition, Lemona struggled in its early
years of operation andsustained chronic losses. This year, Leticia, who serves as
Lemona’s president, decided toseek additional funds to finance Lemona’s working
capital.Venture Capital Associates declined Leticia’s request for additional capital
because ofthe firm’s already high credit exposure to the software corporation. Hi-Tech
Bank proposedto lend Limona $100,000, but at a 10% premium over the prime rate. (Other
softwaremanufacturers in the same market can borrow at a 3% premium.)
InvestmentManagers LLC proposed to inject $50,000 of equity capital into Lemona, but on
conditionthat the investment firm be granted the right to elect five members to
Lemona’s boardof directors. Discouraged by the “high cost― of external
borrowing, Leticia turned toMonica and Nathaniel.She proposed to Monica and Nathaniel
that each of the three original investors contributean additional $25,000 to Lemona, each in
exchange for five 20-year debentures.The debentures would be unsecured and
subordinated to Venture Capital Associates debt.Annual interest on the debentures would
accrue at a floating 5% premium over the primerate. The right to receive interest payments
would be cumulative; that is, each debentureholder would be entitled to past and current
interest payents before Lemona’s board coulddeclare a common stock dividend. The
debentures would be both nontransferable andnoncallable.Leticia, Monica, and Nathaniel
have asked you, their tax accountant, to advise themon the tax implications of the proposed
financing arrangement. After researching theissue, set forth your advice in a client letter. At
a minimum, you should consult the followingauthorities:• IRC Sec. 385• Rudolph A.
Hardman, 60 AFTR 2d 87-5651, 82-7 USTC ¶9523 (9th Cir., 1987)• Tomlinson v. The
1661 Corporation, 19 AFTR 2d 1413, 67-1 USTC ¶9438 (5th Cir.,1967)
NEED THIS BOOK TO COMPLETE ASSIGNMENT: Henry, N. (2017). Public administration
and public affairs. Routledge.

Write this post in the first person. Drawing upon what you have learned in this course as
wellas your own past experiences and/or future ambitions explore the nature of your
identity as acurrent and/or future public administrator. Draw references to at least four
chapter readings &supplementary readings, we have covered in class. You may also use
additional journalarticles to support your views.Some possible avenues to explore these
themes include: • Your identity as a professional, be ita sense of external affinity with a
profession or as a professional public administrator. • Youridentity as a leader and the role
that your ethical and philosophical dispositions play in shapingyour sense of yourself as a
leader. • Your identity as a citizen administrator, as one who isresponsive and accountable
to the public at large. • Other approaches are certainly welcome.This assignment should be
8 to 10 pages long (double spaced) and properly referenced.
Need this by 4pm tomorrow EST

The informational approach in measuring organizational effectivenessSelect a data

collection questionnaire or tool that has been designed by a healthcare organization to
obtain feedback on their overall effectiveness or the effectiveness of a particular
information system within the organization. These may be questionnaires that are
administered online or in paper form.There are several ways to find such questionnaires.
For example, they may appear in a journal article reporting on their use. To locate such
instruments, search the Kaplan Library business database on business evaluation topics
that may be of interest to you or on the names of particular organizations that might be of
interest to you. Some other possible sources of instruments or information about
instruments include:Survey Instruments in
IS:http://home.aisnet.org/displaycommon.cfm?an=1&subarticlenbr=675ETS Test
Collection. http://www.ets.org/test_link/aboutSpend some time reviewing the mission and
goals of the organization you select so that you understand what they are trying to
accomplish and why the questionnaire was used for evaluation. The names (and sources) of
the instrument and the company in which it has been used should be included in your
work.Analyze the instruments to determine the following:Who is likely to receive and
complete the questionnaire, and who is not? (Be sure to identify and briefly describe the
organization in which the instrument has been used.)Why has the organization created the
questionnaire or survey? Is it valid for this purpose?How difficult will it be for someone to
analyze the answers?What is likely to be learned from answers submitted?What effect are
the answers likely to have on the organization? What role would this information play in
improving the organization’s effectiveness?Finally, describe how you would redesign the
survey and explain how your revisions would improve it.Drawing upon your research,
respond to the above questions in a 4-6 page paper. Your completed exercise should follow
the conventions of Standard American English (correct grammar, punctuation, etc.). Your
writing should be well ordered, logical and unified, as well as original and insightful. Your
work should display superior content, organization, style, and mechanics.NOTE: Be sure to
cite sources in APA format throughout your paper, especially when drawing conclusions
and making recommendations, to support your ideas.
Assignment: Need this by 6pm est today Provide a reflection

Assignment: Need this by 6pm est todayProvide a reflection of at least 500 words (or 2
pages double spaced) of how the knowledge, skills, or theories of this course have been
applied, or could be applied, in a practical manner to your current work environment. If you
are not currently working, share times when you have or could observe these theories and
knowledge could be applied to an employment opportunity in your field of
study.Requirements:· Provide a 500 word (or 2 pages double spaced) minimum reflection.·
Use of proper APA formatting and citations. If supporting evidence from outside resources
is used those must be properly cited.· Share a personal connection that identifies specific
knowledge and theories from this course.· Demonstrate a connection to your current work
environment. If you are not employed, demonstrate a connection to your desired work
environment.· You should not provide an overview of the assignments assigned in the
course. The assignment asks that you reflect how the knowledge and skills obtained
through meeting course objectives were applied or could be applied in the workplace.
Need this By Friday

Compliance Presentation Imagine that you are a hospital’s compliance officer, and you are
charged with making a presentation to your hospital’s board of directors regarding the
moral right to healthcare. Your presentation should include at least three of the elements
learned throughout this course, which could include, but are not limited to: the Code of
Ethics, resource allocation, Stark Law, medical malpractice, and cultural competency. For
this discussion, begin by creating a PowerPoint presentation that addresses the issue of the
moral right to healthcare. Then, utilize the PowerPoint and create a presentation using a
screencast program. Your presentation must include at least five slides (not including a
cover slide and reference slide), utilize at least two scholarly sources, and be between 3 and
5 minutes long. Please post your references either on your last slide or within the discussion
post. Please also post your link to your screencast as well as your actual PowerPoint
presentation in the discussion forum. Required Response I (Due by Day 5): Imagine that you
are one of the board members listening to your compliance officer’s presentation. Respond
with a minimum of 150 words to at least two colleagues’ cases in an appropriate matter by
addressing the following:Give your overall impression of the presentation. Was it clear and
understandable?Examine at least three key points that were made in the presentation. Did
these elements make sense? Could they be accepted by the hospital?Challenge your
colleague regarding his or her presentation by questioning one or more of the key points in
the presentation. Your question should not be able to be answered with a yes or no. Use
phrases such as, “How can we…” “What do you think the response would be to…” and
similar notations.Required Response II (Due by Day 7): Your classmates will have posted
questions to your original post. You are required to respond to their question in a scholarly
manner. Use your research to support your response to the comments and question(s) they
posed. Your response should be at least 100 words. You may use Screenr, Jing, Screencast-
O-Matic, or any other screencast program, however the use of a screencast program is
required. Using Screenr.comReview the Screenr Quick-Start Guide and visit the
Screenr.com website to get started. You may view the Screenr demonstration video or
contact Screenr Help directly for assistance using the software program. If you find using
Screenr to be difficult, you may elect to use a different screencast program. Jing and
Screencast-O-Matic are other good screencast resources that are free. You may also search
on your own to locate a program of your choice. The use of a screencast program is
required.
need this by monday june 1st

Consider the following concepts related to economics:Supply & DemandElasticity &

SurplusMarket Equilibrium & DisequilibriumCompetitive Markets & Economies of ScaleCost
ShiftingSelect two concepts related to economics from the list provided to focus on for this
Discussion. (Note: Each bullet in the list is considered one concept)Reflect on how these
concepts may differ for the economics of healthcare compared to the economics of a typical
business.Post an explanation of the economics of healthcare. In your post, please be sure to
address the following for the two concepts related to economics that you selected:Describe
how the two concepts you selected are related to a typical business market with a tangible
products (e.g., applesauce, refrigerators, and cars).Explain how these same concepts may be
different for the business of healthcare which is an intangible product (for example,
consider a sudden illness or accident, elective surgical procedures, or management of
chronic illness). Be specific, and provide examples.Be sure to support your Discussion with
two references within the last three years.
Need This by Satuday

Assume that you recently graduated with a major in Finance and you landed a job as a
financial planner with a large financial services corporation. The organization where you
work has a research-intensive, value-based philosophy of investment that could be
summarized as “managing clients’ assets to earn maximum returns at minimum
risk”. Your assignment is to manage wealthy clients’ assets. The minimum
investment of each client is $100,000 and most of the investments are long-term (five years
or longer). Write a 8 to 10 page double-spaced paper discussing in detail:Investment
alternatives including diversified asset mix (bonds, stocks, derivatives, etc.) you would
recommend based on each client’s needs and situations.Account management strategies.
Include both passive and active strategies.The state of the economy’s effects on
assets’ management.The impact of estate and other tax considerations to provide
optimal financial outcomes. %Grading Rubric30Discuss investment alternatives.30Discuss
account management strategies.30Discuss the state of the economy’s effects on assets’
management.10APA format. Assignment: Brigham, Daves. Chapter 24. Due Date:
8/24/2014 11:59:59 PM (5 Days) Total Pts: 150 Points Earned:
n/a Category: Instructions: InstructorComments: Deliverable Length:
8–10 pages Assignment Type: Individual Project
need this by saturday

Consider the following scenario:You are a manager of a large rehabilitation center that
provides short-term care rehabilitation services on an inpatient and outpatient basis. Your
center is proposing a new addition of long-term care services, and with this expansion, you
must hire and train several new employees.Develop a 12- to 15-slide Microsoft®
PowerPoint® presentation on the organizational structure of the rehabilitation center
described in the scenario above. Create the presentation for the audience you selected in
Week Two.Address the following in your presentation:The effects of organizational
structure on communication.Identify communication methods for managers within this
organization.Explain the importance of the identified communication methods within this
organizational structure.Explain what internal relationships must be considered.Explain
what external relationships must be considered.The steps involved in organizational
planning and functions of managementIdentify the steps to plan and implement change
within the organization.Explain how the steps may be applied to the scenario.Strategies and
methods needed to influence organizational change and to minimize conflictAnalyze
strategies that might be used to bring about change in the organization.Explain how the
strategies may be used to prevent or to minimize conflict.Explain strategies that can be
applied if conflict does arise.Explain the manager’s role in conflict management.The ethical
issues considered important in today’s health care organizationExplain how ethical issues
may alter the way change is conducted in the organization.The effects of financial and
human resource management controlsExplain how financial and human-resource control
issues affect the decision-making process.The analysis of the administrative process needed
to track outcomes and improve qualityAnalyze environmental influences related to health
care which may affect outcomes and quality within the organization.Analyze how the
implemented change will be tracked or evaluated.List major points in the slides. Include
detailed explanations in the speaker notes section that correlate to each
point.Include videos, audio, photos, diagrams, or graphs as appropriate.Include at least five
references to support your presentation.Format your presentation consistent with APA
guidelines.
need this by sunday the 3rd by 11 am

Assignment: Home Health Case StudyIn order for healthcare facilities to be properly
reimbursed, certain requirements need to be met. For example, consider the scenario in this
week’s Introduction. Before determining that Derek Gonsalez needed a total knee
replacement, his doctor performed a physical examination, X-rays, and other tests to
determine the cause and extent of the damage. All of these tests would have been properly
documented with pertinent information sent to the insurance company for surgical pre-
authorization. This is the case with many different conditions and procedures.In this
Assignment, you will examine a case study involving home healthcare and the requirements
associated with it. You will propose a plan of action to ensure that patients who need face-
to-face encounters receive them.To prepare for this Assignment:Read the document, Case 8:
Home Health,” located in this week’s Learning Resources.Consider how home health
claims data were used to review the accuracy of reimbursement.The Assignment (5- to 8-
slide PowerPoint presentation):Imagine that you are in charge of the billing for a home
health organization. You have been tasked with creating an action plan to ensure that all
patients who need a face-to-face encounter receive one. Your action plan needs to be
communicated to the various stakeholders, so you are asked to present it at the next staff
meeting.Your action plan should have the following parts:Part 1: The IssueGive an overview
of the case study and findings. (1–2 slides)Explain why the face-to-face encounters are
important and how they can impact reimbursement for services. (1 slide)Provide talking
points in the “Notes― section of the PowerPoint.Provide specific examples.Part 2: The
SolutionPresent a step-by-step action plan that will ensure that all patients who need a face-
to-face encounter receive one. (2–3 slides)Include at least one strategy for discussing the
face-to-face requirement with providers/physicians. (1–2 slides)Provide talking points in
the “Notes― section of the PowerPoint.Provide specific examples.Part 3:
ReferencesSupport your action plan and strategy or strategies with at least Two scholarly
source.apa format please case study 8 attached
Need this by tomorrow morning

Unfortunately, over the last several years, there have been many examples of illegal and
unethical business dealings; some involved practicing unethical accounting processes, as
well as situations that involved public figures from various genres caught performing
various questionable activities. From a philosophical and theoretical point of view, do you
feel that individuals holding positions of power or influence should be held to higher levels
of accountability for their unethical actions or inactions? Primary Task Response: Within
the Discussion Board area, write up to 4-5 paragraphs that respond to the following
questions with your thoughts, ideas, and comments. This will be the foundation for future
discussions by your classmates. Be substantive and clear, and use examples to reinforce
your ideas: Using the Internet and library, provide at least 2 examples of how corporations
and individuals in positions of power and authority have acted unethically either by their
actions or inactions.Regarding the incidences you found, do you feel the individuals should
be held to a higher level of accountability based upon their real or perceived power and
influence over others? Explain. There are many examples of how the actions of a company
have negatively affected consumers. Product recalls, bans, and warning labels have helped
to protect consumers and companies are focusing more today on social responsibility.
Examine why has there been such a relatively high number of these incidences and what
companies can do to protect consumers.Assignment Guidelines: What legal and ethical
responsibilities do companies have to their customers?Cite and discuss in detail two cases
in which a company endangered customers because of the manufacture or design of their
products. How did the company address the issue?What consequences did the companies in
the cited cases face and were these consequences warranted? Why or why not?Compose
your findings in a Word document (850–1,100 words), and be sure to cite your sources.
need this by tuesday 11 59pm

PowerPoint Assignment For this Assignment, create a narrated PowerPoint presentation

about the crime trends in your state. In a minimum of 15 PowerPoint slides (excluding the
cover and references slides), addresses the following items:Your state’s homicide numbers
from the UCR (which will include not only homicide but non negligent manslaughter) from
1990-2015 (past 25 years)The rates for those yearsAre the rates going up or down? That is,
what are the trends?How does your state’s rate compare with the national rate?What are
the causes/patterns of homicide in your state? PowerPoint Format:Use the slide notes
section in the presentation to include information that follows your narration, being sure to
follow the conventions of Standard English.Slide content should include brief points that
identify the areas that will be addressed in the narration.In-text citations should be included
with any brief points that were researched from outside sources and the narration should
fully explain the pointsCite all sources on a separate reference slide at the end of the
PowerPoint and reference each source in the body of the presentation using APA
format.Identify the source of any pictures you use, being sure to cite them correctly in APA
style using in-text citations.
need this discussion done in by thursday this week with 0 plagiarism

In this discussion forum, you will assess the validity of popular assumptions and beliefs
about problem solving. Please note that your answers need be supported by scientific
evidence. For your initial post, complete the steps below:Watch the video, Rory Sutherland:
Sweat the Small Stuff, on how simplicity can benefit problem solving.Select one of the
following topics:Laypersons and scientists alike often report that after having tried to solve
a problem for an entire day, “sleeping on it― led to a solution. Does sleep indeed
promote problem solving?Laypersons and scientists alike often report that a solution to a
problem may come to mind after having taken a break from thinking about the problem.
Does incubation really work?Select a theoretical view/model of problem solving (e.g.,
Gestalt psychology, information processing approach, etc.). What is the evidence that
supports it? What evidence, if any, does not fit the model? Are experts better at solving
problems than non-experts? If so, what is responsible for experts’ superior
performance? Is their superiority general or limited to their field of expertise?Are there
individual differences in problem-solving abilities? For instance, is working memory’s
capacity linked to one’s ability to solve problems?After you select a topic, access the
Ashford University Library and Google Scholar and review the literature on problem
solving. Then select a research article that answers the question(s) related to the selected
topic. Lastly, share the evidence you have uncovered and your critical examination of such
evidence with the class. Your initial post must be a minimum of 300 words.
Need This Done ASAP

Expand your design document to integrate changes based on instructor feedback from
Week 2.Update your website that you started in Week 2 to at least 3 complete webpages,
with extra placeholder pages as needed. Include multimedia (e.g. images, audio, video)
appropriate to the site. Use CSS to control the look of the site. Make sure your navigation bar
is fully functional and connects all pages together.Submit your website folder, including all
contents (images, CSS, etc.) as a compressed zip file using the Assignment Files tab.
Need this done by Friday. Thank you.

Assignment: Action Plan 4: Supporting Families of DivorceApplication: Action Plan 4:

Supporting Families of DivorceAlmost one out of two marriages in the United States ends in
divorce (Berns, 2015, p. 93). This high rate of divorce potentially places many young
children and their parents in need of support. In Week 2, you read about some of the
changes and challenges that divorce can bring to families. This week, you will focus on the
role of an early childhood professional in helping young children and families who are
experiencing separation and divorce.Action Plan Professional Scenario: Imagine that you
are working in an early childhood setting and in the same year, three families are going
through divorces. You are committed to supporting each family as much as possible and so
decide to research the impact of this experience on infants, toddlers, and preschoolers in
order to help all adults involved better understand what the children and families are going
through. You also want to help each of the families—and others you will work with—
diminish the negative emotional and behavioral effects on young children that divorce can
bring. Your initial research underscores the complexity of divorce and family situations,
noting that some children may do better following a separation and divorce than children in
a household that is rife with conflict. You remind yourself to keep an open mind as you
continue research and form your Action Plan.As you put your Action Plan together,
consider:What adults who work with young children need to know in order to understand
the needs of children at different ages and stages who are experiencing separation and
divorceWhat ideas and advice from experts can be useful in assisting young children and
families dealing with divorceWhat an early childhood profession can do to help—both
directly, by offering information and suggestions, and by referring the family to other
community resources and professionalsFollow these steps to create your Action Plan:1.
What You Need to Know: Learning About Effects of Divorce on ChildrenReview the
information on divorce on pages 93-97 of your text. Also click on the links below to read the
following articles. As you read, take notes on information that you think is important to
share with parents and other significant family adults, including what infants, toddlers, and
preschoolers understand about divorce and how they may respond.Web Article: Dealing
With Divorcehttps://sesamestreetincommunities.org/topics/divor...Web Article: The
Different Age Stages as They Relate to
Divorcehttps://www.divorcesource.com/ds/children/the-diff...2. Ideas and Advice:
Checking ResourcesBased on what you have been learning, think concretely about how best
to help the parents and family members of an infant, a toddler, and a preschooler. Check
your notes from reading the articles above. As needed, skim the articles again, looking for
ideas and resources to share with parents and other significant adults. Access the articles
below as additional resources.Divorce: A Parents' Guide for Supporting Children (PDF)Facts
for Families: Children and Divorce (PDF)Web Article: Ways Child Care Providers Can Help
Children Deal with Grief and Loss https://articles.extension.org/pages/59556/ways-
ch...(For this article, adapt ideas as appropriate for an early childhood professional working
with families in nonprovider roles as well.)3. Taking Action: Supporting a Family
Experiencing Separation and DivorceWith knowledge and ideas in hand, you're ready to
take action to support young children by talking with the significant adults in their lives. Use
the information and advice from the articles to make your plan. Think of it as preparing a
script for meeting with the parents or other significant family adults. Include the following
in your plan:Part I: Supporting an InfantExplain in your own words:
Developmental information about what an infant may feel or understand about a separation
and divorcePossible ways that an infant may respondSpecific suggestions from experts on
how to help an infant through a separation and divorcePart II: Supporting a ToddlerExplain
in your own words:
Developmental information about what a toddler may understand about a separation and
divorcePossible ways that a toddler may respondSpecific suggestions from experts on how
to help a toddler through a separation and divorcePart III: Supporting a PreschoolerExplain
in your own words:
Developmental information about what a preschooler may understand about a family
separation and divorcePossible ways that a preschooler may respondThree specific ideas or
activities that the family can do to help a preschooler through a divorce and separationAs
you write your plan, remember:Your goal is to increase parents' awareness of how a child at
each age may respond to separation and divorce. Focus on information that you, as an early
childhood professional, are qualified to give.Most likely the parents are struggling, too. Be
considerate of their feelings in explaining children's needs.Choose language that you would
feel comfortable using—language that is respectful and sensitive—to create a model
presentation for talking with adult family members.Assignment length: 2–3 pagesBy Day
7Of this week, submit this assignment.Submission and Grading InformationTo submit your
completed Assignment for review and grading, do the following:Please save your
Assignment using the naming convention “WK4Assgn2+last name+first initial.(extension)”
as the name.Click the Week 4 Assignment 2 Rubric to review the Grading Criteria for the
Assignment.Click the Week 4 Assignment 2 link. You will also be able to “View Rubric” for
grading criteria from this area.Next, from the Attach File area, click on the Browse My
Computer button. Find the document you saved as “WK4Assgn2+last name+first
initial.(extension)” and click Open.If applicable: From the Plagiarism Tools area, click the
checkbox for I agree to submit my paper(s) to the Global Reference Database.Click on the
Submit button to complete your submission.Grading CriteriaTo access your rubric:Week 4
Assignment 2 RubricCheck Your Assignment Draft for AuthenticityTo check your
Assignment draft for authenticity:Submit your Week 4 Assignment 2 draft and review the
originality report.Submit Your Assignment by Day 7To submit your Assignment:Week 4
Assignment 2Week in ReviewThis Week you examined the critical topic of divorce and its
influence on family structure and functioning. Your Action Plan for this week focused on
supporting young children and families experiencing divorce. Next Week you will examine
the role of community in socializing and supporting young children and their families. You
will also consider your role as an advocate who can positively impact children families, and
communities. You will also create an Action Plan for advocacy on an issue affecting young
children that is of special concern to you.To go to the next week:Week 5
Need this done by tonight – 12 – hours

File is attached
Need this done in 1 1/2 hours!!! does not have to be perfect

This unit covered many strategies on marketing and advertising for e-commerce sites. As a
digital marketing professional, you have been tasked to develop an online campaign for
your company’s new apparel, which targets the 18–26 year old young adult market in the
United States.Write a three-page essay on your recommendations of at least six digital
marketing advertising strategies (concepts), and explain how each strategy will help the
company’s new brand of apparel for young adults. Determine the possible challenges and
benefits of online marketing communication. The essay should include an introduction,
which presents the main points of the essay.The title and reference pages do not count
toward meeting the minimum length requirement. Make sure your essay follows APA
format. You must use a minimum of two external sources other than the textbook. All
sources used, including the textbook, must be referenced; paraphrased and quoted material
must have accompanying citations.
need this done in 5 hours CRIMINAL JUSTICE

First off I trusted someone to do this easy assignment and it was done incorrectly please
somene with knowledge do this Click here to download the
worksheet. Crime rates are of great interest to policy makers as well as citizens. After all,
who wants to live in an area with a high crime rate? When you calculate crime rates, you are
able to compare cities, states, and countries of different sizes. For example, suppose city A
has a population of 120,000 and city B has a population of 500,000. The preceding year, city
A had 250 incidents of murder and city B had 400. On reading this, you may think that you
want to live in city A because it was host to fewer murders. However, when you calculate
the murder rates, you will see that the murder rate for city A is 208 per 100,000 citizens
and that for city B is 80 per 100,000 citizens, which is much lower.The mayor of Centervale
is concerned about the increase in violent crimes being reported to the police and has
commissioned you to study the crime problem, determine whether the crime rate is worse
in Centervale than other states, and create a report.Tasks:To prepare for this consulting
assignment, you need to learn more about crime rates and explore crime rates by state
using the Federal Bureau of Investigation’s (FBI’s) Uniform Crime Reports.Access Table 5
at Crime in the United States.Select two states to organize and compare to Centervale.Access
the Microsoft Excel worksheet that has been prepared for you to populate with information.
The worksheet has been populated with crime data pertinent to the state in which
Centervale is located.In the worksheet, organize the data for your two states and the violent
crime (Type 1 offenses) counts for those states and calculate the rate of each type of crime.
Need this done soon

Past Practices (at least 230 words) When it comes to urban growth, how do cities deal with
their past? Provide examples of best practices in which urban communities can glean new
ideas on how to deal with urban growth. Respond to at least two of your classmates’
postings. Global Challenges (at least 250 words) Many international communities are faced
with a variety of common challenges. Discuss three challenges that policy makers need to
consider when it comes to urban growth. What particular challenges do you think the U.S.
will face in the near future? Respond to at least two of your classmates’ postings.
need this excersice for tomorrow 1

Hi guys, Here is the info needed for this lab. The link is for a video doing the procedure. It’s
for KMnO4. As I said yesterday, you are going to calculate the % of Cu in brass. Same
procedure, different compound. You need to graph your calibration curve based on the
standards that I’m giving you and their respective absorptions. You need to calculate the
molar concentrations of the stock solution and the dilutions (standards). Then, you
intercalate the value of the unknown on the curve to find out the molar concentration of it.
After that, you need to give me the % of Cu. You need to show your calculations. All values
most have 4 digits after the decimal point. link:
https://www.youtube.com/watch?v=6VkOKpvEyP8 data: standard or stock solution of
cupric nitrate: 2.0000 g in 100 mL. Brass: 1.5000 g treated with nitric acid and taken to 100
mL. Dilutions: (amount of stock soln) + H2O volume (mL) [M] Absorbance 10mL 30
0.0267 0.175 20mL 20 ? 0.870 30mL 10 ? 1.778 40mL 00 ? 2.524 Brass ? 1.505 To
help you in your calculations, so you know whether you are on the right track, the [M]
concentration of first dilution is 0.0267 M.
Need this Financial Risk Management (Derivatives) assignment in next 6 hours

Hi, I need this Derivatives and Hedging assignment done in next 6 hours. Length has to be
5 pages including charts and graphs. I will pay $10 for this. Here is the question: You could
compare the values of two portfolios. One would be a simple investment in an index, the
other one would be the same index plus put options to protect the portfolio against losses.
You could compare which one would have the better performance. The Index Chosen is
S&P 500. I have attached the required data for Index Prices and Index Put Prices. Please
take 5 years scenario for analysis starting 2008. In the paper, I need to see the comparison
of returns for every 3 months for Normal Portfolio without options Vs Portfolio With
Options for S&P 500. The paper has to be divided into following parts: 1. Introduction, 2.
Main Part, 3. Conclusion, 4. References.
need this for tomorrow

P12-5 (Goodwill, Impairment) On July 31, 2014, Mexico Company paid $3,000,000 to
acquire all of the common stock of Conchita Incorporated, which became a division of
Mexico. Conchita reported the following balance sheet at the time of the acquisition.Current
assets Noncurrent assetsTotal assets$800,000 2,700,000$3,500,000Current liabilities Long-
term liabilitiesStockholders’ equityTotal liabilities and stockholders’ equity$600,000
500,0002,400,000$3,500,000It was determined at the date of the purchase that the fair
value of the identifiable net assets of Conchita was $2,750,000. Over the next 6 months of
operations, the newly purchased division experienced operating losses. In addition, it now
appears that it will generate substantial losses for the foreseeable future. At December 31,
2014, Conchita reports the following balance sheet information.Current assets Noncurrent
assets (including goodwill recognized in purchase) Current liabilities Long-term
liabilitiesNet assets$450,000 2,400,000(700,000) (500,000)$1,650,000It is determined that
the fair value of the Conchita Division is $1,850,000. The recorded amount for Conchita’s
net assets (excluding goodwill) is the same as fair value, except for property, plant, and
equip- ment, which has a fair value $150,000 above the carrying
value.Instructions(a)Compute the amount of goodwill recognized, if any, on July 31, 2014.
(b) Determine the impairment loss, if any, to be recorded on December 31, 2014. (c)Assume
that fair value of the Conchita Division is $1,600,000 instead of $1,850,000. Determine
theimpairment loss, if any, to be recorded on December 31, 2014. (d)Prepare the journal
entry to record the impairment loss, if any, and indicate where the loss would bereported in
the income statement
need this in 15 min

Question 6.6. (TCO F) David deposits all receipts and makes all payments by check. The
following information is available from the cash records. MARCH 31 BANK
RECONCILIATIONBalance per bank $26,746 Add: Deposits in transit 2,100
Deduct: Outstanding checks (3,800) Balance per books $25,046 Month
of April Results Per Bank Per BookBalance April 30 $27,995
$24,355April deposits 8,864 14,889April checks 12,200 16,080April note
collected 3,000 -0-(not included in April deposits) April bank service
charge 35 -0-April NSF check of a customer 900 -0-returned by the bank
(recorded by bank as a charge) InstructionsCalculate the
amount of the April 30(1) deposits in transit; and(2) outstanding checks.Show all your work
for potential partial credit. (Points : 25)
NEED THIS IN 3 HOURS!!!!!

I was screwed over and this is due n THREE HOURS Write a 1,050- to 1,400-word paper in
which you analyze the brain structures and functions associated with the motivation
to Exercise.Evaluate the influence of extrinsic and intrinsic factors, including heredity and
the environment, on the motivation to engage in your selected behavior.Include at least
three references from scholarly, peer-reviewed sources.Format your paper consistent with
APA guidelines
need this in 30 min

TCO A) The variable portion of advertising costs is a (Points : 6) Property taxes

on a company’s factory building would be classified as a(n) (Points : 6) (TCO
F) Which of the following statements about the process-costing system is incorrect? (Points
: 6) (TCO E) Under variable costing (Points : 6)
Need this in 30

Question 8. Question 9.
Need this is today in 3 hours This is for

Need this is today in 3 hours This is for an analytical research papercomplete the historical
background of the problem.The problem statement:The best method to ensure safety of
staff during a pandemic at Lee County Emergency Medical Services Department in order to
increase staff safety and reduce work related injuries.If I can improve the safety of the staff
that will improve the quality of care to patients Describe all aspects of the organization
related to the selected problem. (Lee County EMS Department this is a government
agency)This assignment must include the history of the problem, its emergence, and
solutions offered in the past. The research for this assignment will most likely be obtained
from newspapers, magazines, agency interviews, etc. Does NOT require peer review articles.
Remember all resources must be properly cited and referenced in APA format. Answer in
APA format all the below based on Lee County Emergency Medical Services Department
located in Fort Myers Florida USA Describe the organization, its number of personnel, its
budget, its Jurisdiction, and demographics of the jurisdiction served by this
organization Why does the situation you mentioned in your problem statement need
improvement? What would happen if no changes were made as you propose in your
problem statement? Is solving this problem worth the time, money, and resources that will
need to be expended? What is this problem’s history in this organization? What are the root
causes of this problem in this organization? Who are the stakeholders affected by this
problem? What interest do these stakeholders have in solving this problem? Has this
problem had any attempts at a viable solution in the past? If so, what were the
outcomes? How will a solution to this problem be beneficial to the agency and the public it
serves?
need this questions answered correctly in short sentences topic is retirement planning tax

Short but Correct answers please, No Plagiarism.Chapter 5 – Profit Sharing Plans Part
1What does substantial and recurring refer to with Profit Sharing Plan contributions?When
are final employer contributions due for the year?What are the three different way to
allocate contributions to employees?Which one of the three different ways to allocate
contributions provide the most benefit to older people who are also owners of the
company?How is a New Comparability Plan different from the other profit sharing
plans?Who do comparability plans end up benefiting the most?What does CODA stand
for?What are the maximum level of employee contributions to these plans?Chapter 5 –
Profit Sharing Plans Part 2Who can establish a 401(k) plan?Name at least three major
differences between a Roth IRA and a Roth 401(k).Describe which contributions to a
retirement plan are subject to taxes.Which plans have to pass the ACP & ADP
nondiscrimination testing?How is the ADP test calculated?What has to happen if the ADP
test is failed?How can ADP/ACP tests be avoided?
need this resume checked for errors and any changes neccessary

NameAddressEmail/Phone NumerTo obtain a job with a company where I can utilize and
enhance my proven abilitiesWork ExperienceConsumer ProductsConbraco
IndustriesAugust 2012 to Present> Efficient data entry skills> Prepared as well as
processed inventory/ invoice documents for company and truck drivers> Responsible for
packing, repacking, and distribution of products> Detailed oriented with the ability to
manage warehouse inventoryMachine OperatorShutterFlyNovember 2008 to February
2012> Inspected each book cover before loading laminator machine> Properly adjusted
machinery to meet product sizing requirement for each item> Laminated and sent product
down to the next level of production after full inspection of each product Press Operator >
Loaded book orders and printed out pages for each book> Took the necessary protocol to
trouble shoot machinery> Maintained clean work environmentLine Assembler/Temp
LeadBritaxJune 2008 to November 2008> Prepared the start of operations by assembling
the first piece for the product> Maintained records of all temporary employees that worked
for the company> Kept the line stocked with supplies and make production for the
dayMaterial HandlerFrito-Lay, Inc.March 1999 to December 2007> Load and unloaded
trucks using MSW system > Carefully inspected each bag of chips with the proper codes and
dates> Maintained daily, weekly, and monthly inventory records Packer > Sorted chips and
packed them in boxes according to amount per box> Inspected bags and made sure proper
date and plant number were on each bag > Complied with all rules and regulations set by
company > Helped with change over and wiped out linesEducationBusiness
Administration/ManagementStrayer University – presentCharlotte, NCJune 2012 to Present
Need this to be an A ++

Assignment 1: DiscussionDuring Module 4, we examine why most people tend to conform in

most of their social interactions, while others deviate from the existing social norms. After
you have read the reading assignment and lecture for this module, please respond to all
parts of the discussion by Saturday, December 19, 2015.Why do people sometimes feel that
they need to socially conform to what is going on around them, even if they do not want to
do so?How do the social institutions of our country (e.g., schools, the healthcare system, the
economy, religious organizations) play a role in encouraging social conformity, as well as
social deviance?In reviewing the following video “Solomon Asch’s Conformity Experiment
Today” at http://thesituationist.wordpress.com/2008/06/11/solomon-aschs-conformity-
experiment-today/, describe why the individuals in the Asch experiment usually gave the
same answer when they probably knew that it was wrong.Remember to respond to the
posts of at least two other students in the class. Complete your participation for this
assignment by Tuesday, December 22, 2015.
Need this to be rewritten as a business proposal without citation, only at the e

Need this to be rewritten as a business proposal without citation, only at the end of the
business proposal should citations be listed. with rationale
(Provide sections of an Employee handbook that address Constructive Conflict,
Consensus, Collaboration, and Positive Communication. Each section should be
1-2
paragraphs. These sections provide each employee with guidelines, and
expectations and
resources.
need this today by 11pm eastern time

Wireless NetworkingWhat do wireless clients use to identify a specific wireless access

point?How do multiple access points identify themselves as part of the same network?What
are the differences between 802.11a and 802.11g specifications?Devices that support the
802.11g standards are typically compatible with which other wireless standard?How does
MIMO differ from channel bonding?Prepare a 450- to 1,050-word paper that answers fully
discusses the topic questionsFormat your paper consistent with APA guidelines.
need this today please

Prepare a 4 to 5 page report that briefly summarizes the testimony and addresses the
following questions:Did your perception of FEMA’s handling of Hurricane Katrina change
after reading this article based on knowledge you have gained throughout this course? Why
or why not?Do you think the media’s handling of FEMA’s response was accurate?Your
complete paper should be 4 to 5 double spaced pages in length, using a readable font size
12, with 1″ margins all around. The assignment should have a formal introduction, a
statement of purpose on the first page, a body, and a conclusion. You must cite an
appropriate amount of sources using the APA style to support your writing. here are the
sites that need to be
read http://www.hsgac.senate.gov/download/102005bahamondehttp://www.gpo.gov/fds
ys/pkg/CHRG-109shrg27029/html/CHRG-109shrg27029.htm
need this today

BE11-9 Everly Corporation acquires a coal mine at a cost of $400,000. Intangible

development costs total $100,000. After extraction has occurred, Everly must restore the
property (estimated fair value of the obli- gation is $80,000), after which it can be sold for
$160,000. Everly estimates that 4,000 tons of coal can be extracted. If 700 tons are
extracted the first year, prepare the journal entry to record depletion *BE11-11
FrancisCorporationpurchasedanassetatacostof$50,000onMarch1,2014.Theassethasauseful
life of 8 years and a salvage value of $4,000. For tax purposes, the MACRS class life is 5
years. Compute tax depreciation for each year 2014–2019 E11-17 (Impairment) Assume
the same information as E11-16, except that Suarez intends to dispose of the equipment in
the coming year. It is expected that the cost of disposal will be
$20,000.Instructions(a)Prepare the journal entry (if any) to record the impairment of the
asset at December 31, 2014. (b) Prepare the journal entry (if any) to record depreciation
expense for 2015. (c) The asset was not sold by December 31, 2015. The fair value of the
equipment on that date is$5,300,000. Prepare the journal entry (if any) necessary to record
this increase in fair value. It is expected that the cost of disposal is still $20,000.
need this tomorrow very easy work

Discuss current or future applications of nanotechnology in fields such as medicine,

engineering, space exploration, fuel cell development, air and water purification, and
agriculture.Provide at least three examples of real-world applications in use or in
development with reliable references.must not be plagarised and must be clear accessible
references use whatever you want to discuss I do not mind wether is is medicine or any one
of the others listed. Just pick one to talk about need at least one paragraph thanks in
advance
Need this writing asap

"It is not only [the juror's] right, but his duty...to find the verdict according to his own best
understanding, judgment, and conscience, though in direct opposition to the direction of the
court." - John Adams, 1771The final decision-making body in most civil cases is the jury.
Deliberation takes place in a private room and they are allowed to consider the case until
they reach a verdict. The jury members are directed to apply the evidence presented by the
plaintiff to the law to determine if the burden has been met and the defendant must pay
damages. Sometimes a jury will reach a verdict contrary to the weight of evidence because it
rejects the law or how the law applies in the case. This can also happen in a criminal case,
where a guilty party is allowed to go free. In a criminal case, the judge is not free to
disregard the verdict unless the judge finds jury corruption or misconduct. In a civil case, a
judge has the power to overturn the verdict, but is generally reluctant to do so.Your
assignment this week is to answer the following questions:Provide a definition of jury
nullification and find one case involving this issue.Do you agree with this type of
decision?Why or why not?Can you give examples to bolster your point of view?
Need to analyze this case law and show the 4 elements of Negligence : Duty of care, breach,
causatio

Need to analyze this case law and show the 4 elements of Negligence : Duty of care, breach,
causation and damages I already did duty of care and causation, but I am stuck on breach
and damages So I would like you help me for those 2 breach and damage topics upon this
text : Thank you for your help Christine LeroyPaul, aged three years, was badly injured
when he fell from a third-floor balcony at the apartment block where he lived with his
mother, Deirdre At the time, Deirdre was semi-conscious as a result of drinking heavily and
taking heroin Before shooting up with heroin, Deirdre opened the sliding door to the
balcony of her apartment, so that Paul could play outside in the sunshine She then left him
outside alone The railing around the balcony did not reach all the way to the floor of the
balcony; there was enough space for a child as small as Paul to pass beneath the railing It is
not clear how Paul came to fall He does not remember exactly what happened, and no-one
saw the incidentThe State family services agency had previously taken custody of Paul after
neighbors had informed it that he was being neglected and abused by Deirdre The agency
placed Paul with foster parents for six months while Deirdre underwent a substance abuse
and detoxification program After reviewing her case, the agency returned Paul to Deirdre At
that time, it was satisfied that Deirdre’s addictions were under control and that she was
capable of looking after her son, something she was passionately keen to do Paul fell from
the balcony one month later In the period between Paul’s return and the accident, one of
Deirdre’s neighbors had contacted the agency, saying, “She’s shooting up again
– nothing good is going to come of it― The agency took no steps to respond, as it only
has the resources to respond to reports of actual neglect or abuseDeirdre rented the
apartment from Downside Apartments, Inc, which owned the whole apartment block
Downside’s agent knew that Deirdre had a three-year old son when she rented the
apartment No warning about the safety of the balcony was given, either by the agent in
person, or by signs in the apartmentAfter the fall, Paul was taken to the local hospital by a
neighbor Unfortunately, he was not treated immediately, despite the neighbor’s heated
requests for action, because the neighbor was not one of Paul’s parents and had no idea
about Paul’s medical insurance arrangements (Deirdre and Paul have no private medical
insurance) The evidence suggests that the delay in treatment at the hospital worsened
Paul’s conditionAn action has been brought on Paul’s behalf against the state family
services agency, alleging that his injuries were caused by its negligence No other actions
have yet been brought Advise the agency (Assume the incident occurred in a state that has
not modified the rules of joint and several liability, and which has abandoned the traditional
rules of occupier’s liability in favor of a unitary Rowland v Christian test)
need to answer 4 questions about 3d printing

Please answer the following 4 question regarding 3D Printing Questions:Describe the

technology and where it is in its maturity? Relatively new, more mature, very
mature/robust, etc. Please elaborate on your answer.What are the key barriers that must be
addressed to be successful and/or that have been addressed in more mature/successful
technologies?Explain the marketplace targeted currently or in the future – more of a
consumer based technology or better targeted at industry (Financial, Manufacturing,
Healthcare, etc.).Include your opinion on where you believe the technology will be in 5
years (will be successful/failure or will become successful). Be sure to justify your response
with research and references on why you believe it to be true. * Please remember that you
will need to cite the sources properly both in-text and at the end of your document. APA
style of formatting is preferred.
need to Answer A3.1 and using previous outcome from A2.1 work + need to follow t

need to Answer A3.1 and using previous outcome from A2.1 work + need to follow the
grading carefully
Comments from Customer
yes A2.1 was the previous work and A3.1 is the new one need to be resolved
Need to answer the following prompt for an interview: A teacher calls the psycho

Need to answer the following prompt for an interview: A teacher calls the psychology office
because a 3 rd grade student that you work with is under her desk and refusing to get out
to go to lunch. Although typically bright and talkative during your sessions, she is currently
presenting as withdrawn, tearful, and agitated. She is refusing to converse with or make eye
contact with staff and has shouted, “Just leave me alone!” The rest of her class has
transitioned to the cafeteria. Please describe the steps you would take to help this student.
This is a public school setting in NY State.
Need to answer the questions

I just need question 40 and 41 from ” questions_1.jpg“and all questions

from” questions_2.jpg“also i attached reading file to help with answers due date within 4
hrs
 Need to aswer this two questions in
one page:1. With a portfolio as diverse as

Need to aswer this two questions in one page:1. With a portfolio as diverse as Google's,
What are the company's core brand values?2. What's next for Google? Is the company right
to put so much focus on Mobile? Attached is the reading to use to answer the question and
there is a sample on how to answer question one. Only 5 pages for the reading. plagiarism
checker free GET THIS OR ORDER A SIMILAR PAPER NOW
Need to be in APA format with proper citation and

Need to be in APA format with proper citation and references.Network Management

Paper: In this paper, you will research and report on network management tools associated
with (1) policy compliance, (2) bandwidth management, and (3) asset management.
Compare and contrast, at least, one tool for each of the three network management areas.
What is the best tool for each area? Can one tool be used for managing more than one area?
Why or why not? Required Section Headings:IntroductionPolicy Compliance
ToolBandwidth Management ToolAsset Management ToolTool
ComparisonSummary/ConclusionRemember to support your statements with factual
information (i.e., attribution/citations). In addition, material from the course textbook or
the textbook’s author(s) cannot comprise more than 25% of the sourced and/or quoted
material.The paper must following the formatting guidelines in The Publication Manual of
the American Psychological Association (2020), (7th ed.), and contain, at least, three
scholarly/peer-reviewed references, three to five pages of content, and a reference page. In
addition, the paper will be submitted through the Turnitin originality-checking tool. More
APA assistance can be found at the Purdue University Online Writing Lab (Links to an
external site.).**********Required about 5-6 pages including title and reference pages
separately.*********
Need to be professionally created and understandable. Need to be screenshots for

Need to be professionally created and understandable. Need to be screenshots for easy

updates only unless the videos created are more useful and understanding. I prefer more
screenshots than videos and don’t have text to speech just reading what underneath it.
Review, edit, and add information Review, edit, and add text to speech Review, edit, and add
videos Review, edit and add questions Review, edit, and add descriptions and
hotspots/interactions Need to be professionally created.
***Solution need to be relating air pollution policy. Identify what…

***Solution need to be relating air pollution policy. Identify what… ***Solution need to be
relating air pollution policy.Identify what the least-cost, evidence-based solution is for
addressing lower respiratory infectionsDescribe how the solution works in detail.Explain
would need to be involved to make the solution work. Identify local, state,national or
international partners – either governmental or non-governmental. Describewhy their
participation is needed. Remember that global health often requiresintersectoral responses
so this section might be broad. Place an Order
We do custom work 100% original and plagiarism free .If you need help in any assignment
just send us requirements with time limit ,we will quote a price and after your confirmation
,we start working on your assignment. An original work ready for submission provided to
you Name*
First
Last
Email* Description**
Attachment

Drop files here or

PhoneThis field is for

validation purposes and should be left unchanged.
Δdocument.getElementById( "ak_js_1" ).setAttribute( "value", ( new Date() ).getTime() );
if(typeof gf_global == 'undefined') var gf_global = {"gf_currency_config":{"name":"U.S.
Dollar","symbol_left":"$","symbol_right":"","symbol_padding":"","thousand_separator":",","d
ecimal_separator":".","decimals":2},"base_url":"https:\/\/homeworklance.com\/wp-
content\/plugins\/gravityforms","number_formats":[],"spinnerUrl":"https:\/\/homeworkl
ance.com\/wp-
content\/plugins\/gravityforms\/images\/spinner.gif"};jQuery(document).bind('gform_po
st_render', function(event, formId, currentPage){if(formId == 1) {} }
);jQuery(document).bind('gform_post_conditional_logic', function(event, formId, fields,
isInit){} );
jQuery(document).ready(function(){jQuery(document).trigger('gform_post_render', [1, 1])
} );
Don’t need to be too long, just a paragraph.

I uploaded chapter 4, and chapter 5, I will upload chapter 6 after you accept the
assignmentPlease write three short summaries for three chapters. Tell what happened in
each chapter. Don’t need to be too long, just a paragraph. Please tell me what happened
clearly.After that, you need to come up with 5 questions about these three chapters, here is
the instruction for the 5 questions:Create a list of five discussion questions about the text.
These should not be questions about facts, but rather about complex or ambiguous events,
behavior, or language that seem to demand interpretation. To end your meeting, lead your
group through these questions.These 5 questions need to be used in tomorrows inclass
discussion, please do it well.
Instructions: DON’T NEED TO CITE SPECIFIC CASE LAW, HOWEVER, YOU

Instructions: DON’T NEED TO CITE SPECIFIC CASE LAW, HOWEVER, YOU MUST STILL
SUPPORT YOUR ANSWERS WITH GOOD LEGAL SOURCES FROM THE STATE OF
CALIFORNIA.EACH QUESTION MUST BE ANSWERED IN 1-2
PARAGRAPHS. =====================Brittany Walker is an 83 year old widow with
four children named Charles, Anthony, Suzanne and Walter.In 2017, Brittany executed a
simple last will and testament that revoked all her previous wills and codicils. The 2017 will
was drafted by Cindy Mason, a local attorney. The will left $10,000 to each of her
grandchildren. In addition, it stated, “I hereby grant my daughter, Suzanne, the right to live
in my house for as long as she likes after my death, rent-free. After her death, or if she
decides to leave the house, then the house shall be divided amongst my children, in equal
shares.” The Will then left her entire residuary estate to “my four children, in equal
shares.”The will named Charles and Anthony as co-executors, with Walter to take over as
co-executor in the event that either is unable to serve or to continue to serve.On March 10,
2018, Brittany was diagnosed with a terminal heart condition. The doctors informed her
that she was unlikely to live another six months. This sent Brittany into a tailspin of
depression. During this time, Anthony (who lived in Sacramento) visited her several times a
week. Suzanne also lived in Sacramento, but did not visit her mother often since her
mother’s mood makes her upset. She preferred instead to speak to Brittany by phone so
that she could hang up if the conversation became too unpleasant. However, she did call her
mother frequently. Since the other children lived in different cities, they visited much less
frequently.During the months of March through June, Anthony had many in person
conversations with his mother and frequently told her that since he has a large family, he is
in need of money more than his siblings. As the summer approached, Anthony started
turning to this subject with more frequency until the point that rarely a day went by that
Anthony hadn’t mentioned something about needing more money than his siblings.On July
17, Brittany took out a piece of paper and a pen and wrote the following handwritten note:“I
know that my previous will stated that Suzanne gets to live in my house after I die. But I
changed my mind. Since Suzanne doesn’t visit me as much as she should, Suzanne should
not have the right to live in my house after my death. Also, since my son Anthony visits me
all the time and really needs money, he should get 40% of my estate and the other children
should only get 20% each.”Brittany signed her name in script and placed the paper in an
envelope in her night table drawer. Later that day, Brittany told her neighbor, Yvonne, that
she “changed her will” to give Anthony “more money than the rest of those ungrateful
kids.”On July 31, 2018, Walter died in a tragic car accident in Portland, Oregon, leaving wife
Marcy and three children. On August 10, 2018, Brittany died of congestive heart
failure.A few weeks later, Charles and Anthony bring a probate proceeding in the
appropriate California probate court. Please assume that all of the above facts are
conclusively proven and not subject to any reasonable dispute.Please discuss and answer
the following questions:1. Is the handwritten page valid as a testamentary instrument? In
connection with this, is Yvonne’s testimony as to the conversation with Brittany on July 17
relevant and admissible?2. Assuming that the handwritten page is valid as a testamentary
instrument, what happens to the $10,000 gifts to the grandchildren? 3. Charles and
Suzanne challenge the July 17 “will,” arguing that the handwritten paper, even if valid as a
testamentary instrument, should be void based on incapacity and/or undue influence. Are
these arguments likely to succeed? 4. Who is entitled to Walter’s share of the
estate?5. Who is entitled to notice that the will is being probated?
need to compose a marketing plan based on the attached papers

I have this marketing plan that needs to be composed based on the attachments.Final
Project: The Marketing Plan & PresentationYour written marketing plan and
video/PowerPoint will cover/review the following sections: 1.Executive
Summary2.Company Overview3.Objectives or Goals4.Porter’s Generic Strategy5.Marketing
Strategy6.Target Market and Positioning7.Promotional Strategy8.Contingency PlanThis
assignment will help you understand the role of a marketing manager. It can be used
toward your professional advancement while helping you understand how an organization
evaluates a marketing plan to achieve competitive advantage. Therefore, you should ask
yourself the following questions: Is the strategy applicable or feasible to the firm? Can this
enhance the organization? Can this be used to introduce new strategies for an organization?
These are simple questions, but are essential toward your professional advancement.
Oftentimes, presentations on work-related issues can result in frameworks or opportunities
for discussion with fellow professionals. However, this critique can truly change the
dynamics of your career and help network with marketing professionals.REQUIREMENTS
While this is an individual assignment, do incorporate any appropriate data and suggestions
from Week 9’s discussion critique. Video presentations are generally 5-8 minutes in
length.Presentations can be a PowerPoint (with student visually in the presentation) or an
edited short video with evidence of student in the content.Video presentations should be
saved on YouTube that provides professor with link to videoSince this is the final
assignment no late work will be accepted. See rubric for grading points and criteria.Please
remember to use The Meal Plan Approach for Writing, Tips for Writing an Essay, APA 6th
ed. or OWL for APA Style formatting, and Mini-Research Paper Grading Rubric. All are
available in various resources folders in the Moodle classroom.
Need to analyze, evaluate, synthesize, create a report on a 07-09 double-spaced

Need to analyze, evaluate, synthesize, create a report on a 07-09 double-spaced Microsoft

Word document describing one ethical violation case/ scandal.
The case chosen is:
https://www.sec.gov/news/press-release/2023-149 – SEC Charges 11 Wall Street Firms
with Widespread Recordkeeping Failures
I have attached the guideline for the ethical analysis writing and I highlighted in yellow key
sections that must be followed.
Need to create a simple Java program that determines cost of insurance by including any
additional person based on age...

Need to create a simple Java program that determines cost of insurance by including any
additional person based on age (thus questions regarding age and how many people apply
to each category as far as age should be included). Baseline price is $1,000.00 per year per
person plus an additional price based on the information below. Also, one other basic
method other than main should be used. Age Rate 16 to 19 ~Add 15% of basic price 20 to
25~Add 5% of basic price Over 25~Discount 10% of basic price Any other age~No
insurance provided Should be able to open with any compiler, would need the file to
specifically be in java format (thus, must include .java extension). Class file included would
be necessary to verify it runs, but mostly the java file to test with compiler.
Need to develop a disaster recovery plan for an organization.

Need to develop a disaster recovery plan for an organization. There are many different
templates available online for you to use as reference and guidance. Your plan should cover
the following sections (these sections detail the elements in a DR plan in the sequence
defined by industry compliance standards ISO 27031 and ISO 24762): 1. Important: This
section should summarize key action steps (such as where to assemble employees if forced
to evacuate the building) and list key contacts with contact information for ease of
authorizing and launching the plan. 2. Introduction 3. Roles and Responsibilities 4. Incident
Response 5. Plan Activation 6. Document History 7. Procedures Research work should meet
the following requirements: Be approximately six pages in length, not including the
required cover page and reference page.
need to do 13 15 pages of ppt and write a speech

Extended DefinitionsIndividual Presentation to be recorded on Zoom Due Monday April

20th, 2020 Choose an abstract noun from the list and define it. ★ Guidelines:Intro: Why
did you choose this word? Thesis: How does this word connect with our quality of life?
Definition: What does it mean (denotation) (connotation)?Show the term in different forms
(Joy, joyful, joyous, enjoy, joyfully).Explain the difference in usage and use example
sentences. (Learner’s dictionary)Find 2-4 synonyms and explain how they are different
from the term. (thesaurus)Find two quotations that use the term and paraphrase/analyse
the quotation. Wikiquote is a good source. (citations)Use 3-5 images that illustrate the
term. Explain the connection. (citations)Conclusion: Why is this word important to
describing our quality of life or values? Why is it important to understand and pursue?★
Remember… Transition phrases Enthusiasm for topic / eye contact with the camera
Relevant visuals 5 minutes total Abstract noun choice must be approved by me Elaborate on
your slides; do not simply read Proper reference and citations
Need to do 3 Posts. 1. The First Post’s samples are attached in the “2-sample of

Need to do 3 Posts.
1. The First Post’s samples are attached in the “2-sample of first…” file.
You need Do it according to the Assessment requirement：
You are required to create two visualisations:
1) the Excel “recommended graph”, and
2) an improved, more thoughtful version of the same visualisation which enhances key
insights
you wish to communicate.
You must also explain what you did to improve it and why, referring to any external
materials
you used to help you with this (maximum 200 words – informal references are acceptable).
2.The 2nd and 3rd Posts requirement is attached in the “3-2nd…” file.
In the above is classmate’s post. You need to write a 100 words comment for each one.
So the total is 2 comments = 100 words *2
The below are others comment. You can see them as samples.
Need to do a detailed research paper without any plagerism. Has to have proper c

Need to do a detailed research paper without any plagerism. Has to have proper citations
and references.
Need to do One exploratory paper and then one position

Need to do One exploratory paper and then one position paper in 750 words each which
makes it 1500 words. One sample is also attached. Deadline is om 6 hours. Position Paper
Assignment Recap: You will write a 750-1000 word position paper in which you make a
claim and “prove” it. Your paper will primarily be a claim of policy. You can use the same
topic you used for the issue proposal and/or exploratory paper or you can select a new one
cleared by me. This paper must follow MLA format. The sources must be varied (books,
articles, Internet sources, journals, etc.). Wikipedia is not an acceptable source. Sample
Structure Introduction Briefly introduce the controversial issue you researched. Identify the
different perspectives. End with a claim of policy statement. Body Provide evidence to
support your claim. Include a refutation. A refutation is typically a paragraph before the
conclusion. In the refutation paragraph, you do 2 things: 1) show that you understand the
opposing side by summarizing their view briefly and gracefully (no name calling!) and 2)
you offer another piece of evidence to explain why your claim is reasonable, logical, a well
thought out plan, etc. Conclusion End the paper the same way you would any other
academic paper. Make a prediction or make a recommendation. You could summarize your
major points or end with a thought provoking quote/idea. exploratory paper An exploratory
paper does not present just one side of an issue. It presents multiple sides. EXPLORATORY
PAPER OUTLINE YOUR UNIQUE TITLE PARA 1: EXPLAIN THE ISSUE. DO NOT END
PARAGRAPH 1 WITH A CLAIM OR THESIS. THIS PAPER EXPLORES MULTIPLE
PERSPECTIVES BUT DOES NOT ASSERT A DEFINITIVE CLAIM OR ATTEMPT TO PROVE THE
CLAIM. PARA 2: THE FIRST PERSPECTIVE PARA 3: THE SECOND PERSPECTIVE PARA 4:
THE THIRD PERSPECTIVE (IF YOU CAN FIND ONE) PARA 5: YOUR CURRENT PERSPECTIVE
(BEFORE YOU’VE COMPLETED YOUR RESEARCH/READING/REFLECTION). END WITH A
TENTATIVE CLAIM FOR A FUTURE POSITION PAPER. LAST PAGE: WORKS CITED
Need to do PESTLE and VRIO Analysis Renewable Energy Corporation

Need to do PESTLE and VRIO Analysis Renewable Energy CorporationYou have been
tasked to help craft a strategy for the company. Use the Renewable Energy Corporation
case (from Harvard) to research the company’s business model, internal resources, external
environment, competitive landscape, and prior growth strategies in order to come up with
your own recommendations. You may want to augment the information in the case with
your own research to create a current state that will form the beginning of your future state,
but it is not required. Based upon your analysis develop a set of recommendations for the
company to pursue.Paper OutlineIntroduction External Environment (PESTEL and Industry
Structure)Internal Analysis (VRIO analysis)Competitive Landscape (Competitor Analysis,
Competitive Rivalry, Competitive
Analysis)RecommendationSummaryBibliographyAppendixSubmission must not exceed
2000 words, be no more than 4 pages in length, excluding the appendix.Single-spaced and a
font of 12 points, with normal margins.Please save it as a word document file (either .doc or
.docx format is fine) before posting.APA Format with Bibliography
Need to do stock project assignment

A PDF copy of your plot, results, and detailed analysis --- this means you should clearly
show all of your work! Write out all equations that you use, with the exception of those that
are functions in excel such as AVG, COVAR, VAR, etc. For example, you need to write out the
equations for portfolio weights, returns, standard deviations, and sharpe ratios for your
calculations in determining the MVP and ORP.You can see specific question belowAnd can
you do it for me the whole assignment
Need to do this article with report and power point

need to do this articlewith report and power point single spacedall standards and
requirment are in the attached photos7 pages including table diagram and referencesingle
spaced
Need to expend and add 500 words, but only based

i wrote memo on the given documents,, based on the insruction attached.Need to expend
and add 500 words, but only based on the original instruction.Attached both files.
need to fill a template by reading journal papers ?

I will provide the template of the document and it should be filled accordingly. I am giving
Ten papers from which you have to chose eight papers and fill the template. In one template
there are eight different to 10 different empty sections sperately for every topic
individually. we need to fill the space provided by reading each paper seperately.I am
providing the sample paper which is already filled and i am providing the journal papers.in
the template there is a colomn for URL which you cal lift blank i will fill that latter or i will
provide URL links later if needed.you need to write from the bellow ten papers andMy basic
topic is Applications of artificial Neural networks on weather forecasting.Journal papers
topics1. Non-Linearity Explanation in Artificial Neural Network Application with a Case
Study of Fog Forecast Over Delhi Region2. An ensemble of neural networks for weather
forecasting3. FLASH-FLOOD MODELLING WITH ARTIFICIAL NEURAL NETWORKS USING
RADAR RAINFALL ESTIMATES4. A new rainfall forecasting model using the CAPSO
algorithm and an artificial neural network5. Application of artificial neural networks in
regional flood frequency analysis: a case study for Australia6. Prediction and modelling of
rainfall–runoff during typhoon events using a physically-based and artificial neural network
hybrid model7. Artificial neural network for forecasting rainfall pattern in Prince Edward
Island, Canada8. Snow Disaster Early Warning in Pastoral Areas of Qinghai Province,
China9. Fog Forecasting for Melbourne Airport Using a Bayesian Decision Network0.
Forecasting Drought Using Multilayer Perceptron Artificial Neural Network Model
I need to fill out this information with all the

I need to fill out this information with all the research you have done for Oreo.Introduction
(setting up the discussion)The problem is … [people are carrying onto airplanes more and
more luggage, resulting in delays in boarding and continued problems for flight attendants
and gate agents]It’s important because … [the airline industry is vital to the economy; no
one likes delays; customers must not abandon airline travel for other options]Solving it
would result in … [improved customer experience, resulting in better economic stability for
the airlines]Literature Review (what has already been ‘said’ in this ‘conversation’)Previous
research in this area has shown …Ideas that keep coming up in articles and other sources
are … [the desire to carry on is driven by several factors: security of personal valuables,
convenience, baggage charges, fear of lost luggage and wait time at arrival airport]Pros and
cons [how these sources support and/or contradict each other]Solutions explored so far
include … [size and number limits, baggage fees, improved tracking of luggage]Summary of
lit review findings (where we are now with this problem)Researchers seem to keep trying
to … [find solutions focused on limits to the plane’s carry-on capacity and reducing fear of
lost luggage]Research Question (what new question/solution will be investigated)What
would happen if … [customer time were the focus of improvement, specifically, if
promptness of delivery to the carousel at arrival were improved? How important is it to
customers that their baggage arrive quickly at the pickup point?]Theoretical Framework
(how the question arises logically from the literature review)The dependent variable(s)
is/are … [delays in boarding, problems for flight attendants and gate agents, others….]The
independent variable(s) is/are … [amount of carry-on baggage]Hypotheses (what testable
speculations arise from the identified independent variables)Customers who are confident
that their bags will arrive at the carousel for pick-up within 10 minutes of exiting the plane
will be more likely to check baggage rather than carry itCustomers who value quick pickup
of luggage upon arrival will be more likely to check baggage rather than carry it.I have
attached a screen shot of the instruction so it can be more clear for you.You have already
looked up a lot of information, with that can you fill this out and if need add more
information please.this is just a draftIf need to add more pages let me know and i will pay
the difference.iI will also attached all the documents you have done so far.Thank you.
need to find statistics at the united states level

I need you to find statistics about two variables: 1- Number of mobile apps downloads at the
United States level from (any year before 2019) to 2024 or 20252- Increasing use of
Customer Relationship Management Systems (CRM) at the United States level from (any
year before 2019) to 2024 or 2025**Please provide me the link of each page which include
the above numbers. **If you didn’t find at the United States level, you can provide
Worldwide level.
need to get help with some algebra problems

Hello there, I have 5 algebra problems that I tried working on that I would like someone to
look over and just let me know if I am working/solving these problems correctly or not.
There are listed below…1.) Simplify the expression of: 4(x-8)-8x = (I got 4x-8) is that correct
or not? if not kindly explain what I did wrong and how I can fix the problem please.2.)
Simplify the expression of: 6(x-6)-9x= (I got 3x-6) is that correct or not?3.) Find the area of
the rectangle for 21 miles (2y+1)miles = (I got 22y+1 miles) is that correct?4.) Subtract the
polynominals for: (5a-6) – (a+3) = ( I got 4a – 3) is that correct?and lastly # 5) Find the
value of the polynominals for: 5x+5 = ( I got 40 is that correct)?I look forward to hearing
back from someone and am anxious to see how I did with solving these problems. Thanking
you in advance for your time and help.
Don’t need to have a large scale, just think small

Case Study Proposal The purpose of this assignment is to link theoretical/scholarly material
about media effects and content to a “real world” case. This assignment calls on you to
select a case of interest to you that played out publicly via some type of media channel. This
could include traditional news outlets, blogs, social media or some combination of these
channels. You will then critique and analyze the case from the theoretical framework(s) and
perspective(s) in the scholarly literature you have chosen. Your case study should conclude
with a summary of lessons learned from the case and/or any recommendations you have
for how the individuals and/or organizations involved could have used media more
strategically to realize more favorable outcomes. The final assignment should be
approximately 10-12 pages in length (double-spaced, Times New Roman 12 or Calibri 11;
page count excludes title page and references page). A complete Case Study will include all
of the following components: Introduction: Describes overall purpose of paper (includes
descriiption of case for background/context; briefly previews type of media content that
will be analyzed and theoretical/scholarly literature that will be used; makes argument for
why that area of scholarly literature is best suited to understanding the case) plus articulate
a clear hypothesis or thesis statement indicating the overall argument of the essay. You
must BOLD your thesis/hypothesis. Literature Review: Summary of theoretical/scholarly
literature reviewed for the case (at least 10 scholarly sources cited. You can include an
unlimited number of popular sources, articles, or other forms of media in addition to the
scholarly sources). Methodology: Identifies media content analyzed, provides rationale for
media content selected, describes how media content was collected, briefly identifies
qualitative content analysis as the method of data analysis. Media Review: Provides analysis
of the chosen media that derives from insights to the theoretical framework outlined in the
literature review. For example, if you reviewed crisis communication theories/principles,
you should be analyzing your data to report if and how those principles were used; if you
reviewed framing theory, you should be looking for types of frames used, etc.). Findings
from analyzed media texts are written in a narrative/thematic/descriiptive format with
example quotes interspersed to serve as evidence. Discussion/Conclusion: The discussion
and conclusion can occupy a single section, or individual sections can be created for the
discussion and conclusion, respectively. Either way, provide comparisons/contrasts to
previous literature and practical lessons learned and/or recommendations you have for
how the individuals and/or organizations involved could have used media more
strategically to realize more favorable outcomes. Furthermore, provide a conclusion that
summarizes the broader Case Study and what it has contributed to our understanding of the
issues/theories discussed. Case Study Proposal would be First step of the whole
assignment. Proposal needs: This assignment aims to ensure you have a clear and workable
plan for creating your Case Study assignment. Completion of this assignment requires you
to draft a short proposal for your Case Study assignment. Comprising your Case Study
Proposal will be an abstract articulating the theory or theories to be applied and the case or
context to which the theory or theories will be applied. Additionally, the proposal will
include three sections of what will become your final case study paper: the introduction, a
subsection of the literature review, and the methodology section. These sections should
take into consideration any insights from conversation(s) you have with the instructor
during the optional virtual office hours that will be held during Week 8. The proposal
should be around 5-6 pages long excluding title page and bibliography. Proposal is the first
part of a large case study. You’ll need to including an abstract, introduction, context, brief
letter literature review and message you are going to use. and Choose at least one of the
frames you have learned before, and mentioned it in your introduction: make an argument
for why this works, why this particular one (for example: why agenda setting) In literature
review part, you can add more subsections, or thematically organized paragraphs about the
frame that you are using, and how would that be apply to your own analysis In message
section, this is what you really gong to layout, what you going to analyze need to be specific
as possible: why that particular context, is that series of a news articles, is that something
about cooper-responsibility, or something controversial thats talk a lot in the media. Don’t
need to have a large scale, just think small and be specific around what you want to
examine: you can choose a series of websites, or some twitter posts, what cooperations are
doing on social media..etc.) (I’ll hire you again after case study proposal, and next time I’ll
need you to finish the rest of this case study, so it’s a continuous cooperation! Please follow
the rubric, and read the sample)
 Need to have a paper similar to the
examples that I uploaded. The hypothesis and

Need to have a paper similar to the examples that I uploaded. The hypothesis and
experiment is fully written and done, and the T-Tests too. All I need is for you to write a
proposal and discussion with a few sources and put everything together like the other
papers. So need an abstract, a proposal, then the hypothesis, then the design of study,
participants, instruments, and procedure for the methods section. then a results section,
and then a discussion section with one more related article. GET THIS OR
ORDER A SIMILAR PAPER NOW
need to have acces to “Introduction to Forensic Science And Criminalistics” book by
R.EGaensslen How

no later than 11:40 p.m. of the Tuesday that the assignment is duea minimum of two full
pages and a maximum of three full pages in length (no more, no less), with double-spacing,
MS Word’s default margins, and 12 pt. Times New Roman font in MS Word format.
However, each assignment is then to be saved and submitted as a .pdf file so that it can
easily be opened and read.At the top of the first page, the student is to provide a one-line
header with his or her name as it appears on the class roster, the assignment number and
the date of the submission, e.g.: John Sanchez, Assignment 1, January 29.The first double-
spaced paragraph then follows below. Please use at least three paragraphs per
page. Assignment: Please answer the following:1. The mnemonic “PRELIMINARY” is used to
remind the first responders of their duties and responsibilities at a crime scene. Provide the
phrase represented by each of the letters.2. Name the 5 steps associated with scene
processing and explain their purpose.3. Name the four major types of control and
comparison standards, explain their purpose, and provide an example for each, from the
book please.
Need to Have by 2 am tonight for Week 3 Assignment.

Course Project—Part 3In this assignment, you will study the OSI layers and how data flow
takes place between them.Using the South University Online Library or the Internet,
research the following:OSI layersNetwork addressing schemesContinuing with the scenario
you worked with in W2 Assignment 2, in which you designed a network and selected the
necessary hardware and software, this week you will complete the following task:Consider
the network design you created in W2 Assignment 2. A computer A in United Kingdom
sends data to computer B in Dreamz Inc. network. Discuss how data will flow at each OSI
layer. At each hop, what will be the source and destination Media Access Control (MAC) and
IP address? Mention a rationale for each address.Summative DocumentCreate a 3-page
Word document that presents the following:A summary of your Hands-on Labs 1–3 resultsA
summary of your work done till Week 3 on the course projectA discussion on how you will
utilize the experience gained from Hands-on Labs 1–3 and the first three parts of the course
project with supporting examples
NEED TO HAVE DONE ASAP

The Case Assignment focuses on several concepts from the labor market including marginal
production, total production, and wage determination. These terms are important in
determining how many workers will be hired by a firm.Write a 4- to 5-page paper that’s
addresses the following questions:Discuss two factors that would increase demand for
labor. (Hint: Recall that the demand for factors of production or resources is called a
derived demand)If the market price of the good or service that a firm produces increases,
what happen to the demand of labor? Explain.Numerical Problems. Answer the two
questions below.Take a look at the numerical example on page 76 of the online text
Principles of Microeconomics. What would be the marginal production at a level of 20
workers? Calculate. What can be said about the total production of cars as more workers
are added (Hint: use the economic concept from the chapter in your answer)?Using your
answer from (a) and using the information below:Each worker costs the firm $4,000 per
month.Each acre of land costs the firm $1,000 per month.Each machine costs the firm $600
per month.-Each worker costs the firm $4,000 per month.-Price of the output (car) is
$20,000Should the firm move from the 15th to the 20th worker? In other words, should the
firm hire 20 workers. Why? (Hint: You need to calculate the cost of total workers and the
marginal revenue product [MRP = price of output * marginal product of labor].)Assignment
ExpectationsUse concepts from the modular background readings as well as any good-
quality resources you can find. Be sure to cite all sources within the text and provide a
reference list at the end of the paper.Length: 4–5 pages double-spaced and typed.The
following items will be assessed in particular:Your ability to understand marginal
productivity and how firms make decisions.Some in-text references to the modular
background material (APA formatting not required).The essay should address each element
of the assignment. Remember to support your answers with solid references including the
case readings.
Need to have read Nora Roberts Angels Fall and have the textbook Think Marriages &
Families Kunz 2013

Relate 5 concepts from the textbook and what you have learned about in Chapters 3-7 to the
romance novel that you have read in 3 pages. For example, we will talk about traditional
gender roles. You could relate traditional masculinity to the main male character you’ve
read about. You would first define what traditional masculinity is, and then describe your
character and how he shows (or doesn’t) the characteristics of traditional masculinity. You
would then choose 4 other concepts to describe and apply. You can use your eye-openers
and select-a-quotes to help you write your paper. After reading the assigned romance novel,
students will need to choose 5 concepts (bolded terms or theories) from their textbooks and
relate those concepts to what they've read in the romance novel. For example, a student
could relate traditional masculinity, gender norms, Sternberg's theory of love, gender
differences in love, and the eros style of love to the romance novel.In order to earn top
points, students must first clearly identify the concept they will be discussing, then define it
(this should be cited), and then finally apply how that concept is present in the romance
novel. For example, if you chose traditional masculinity, you would list and define how your
textbook defines traditional masculinity (and cite the textbook!). Then, you would describe
how the character in the book displays the characteristics of masculinity in his actions,
behaviors, and/or looks. You may also include ways the character does not display
traditional masculinity. Be sure to provide clear and specific examples to strengthen your
paper.
-You need to interview a total of four people. To gain perspectives from differe

-You need to interview a total of four people. To gain perspectives from

different life stages, you are required to interview individuals from
two different age groups (select from the following age groups: 21-39,
40-59, 60-79, 80-90+). Interview at least two people for each age group
you select.
-Your goal is to explore what the interviewees perceive leisure and
recreation to be, what currently works for them, what doesn’t work and
why. Do they have any regrets concerning their respective past
opportunities for wellness?
-In addition to your personal interviews, please conduct further research on your selected
age groups. Your completed paper must include insights from various resources that might
include websites, blogs, articles, videos and more.
-Create a summary of your findings and what you think the combined
interviews tell you about the members of your community. What
insights did you get about leisure across the lifespan?
-Include a title page, the body of interviews and research, a closing
statement, and your references list (five references minimum).
need to make a powerpoint slides and with using credible sources subject is global crossing

{If it isn’t an original thought, then document where it came from. Your instructor will
utilize Turnitin software and other information to identify indications of plagiarism.}For a
notable financial statement fraud/auditing failure scandal that has impacted accounting
and/or auditing significantly, perform an ethical analysis using the Comprehensive Ethical
Decision-Making model presented by Mintz & Morris (2016, 77) or a similar one. Present a
brief discussion on Global Crossing (2002). based upon your analysis and a review of
relevant published literature. (the subject is global crossing, analysis should be made on
it)The presentation should include what you have learned in this course, focused on
implications for accounting professionals. The presentation may include ethical theories,
corporate governance and legal requirements, Sarbanes-Oxley requirements, Dodd-Frank
requirements, IRS Regulations, IFRS and GAAP specifications, auditing standards,
professional responsibilities, whistleblower regulations, internal controls, codes of conduct,
etc.(Use credible sources of information. The use of four or fewer published sources will be
considered insufficient support for your assertions. Similarly, the use of fewer than two
peer reviewed research articles will be considered insufficient support. That is, five credible
sources, at least two of which are “scholarly―, will be considered marginally
sufficient. “Discovery @ Tarleton” provides a filter for “scholarly (peer-reviewed)
journals―.)(The final page of your PowerPoint slide deck will be a reference page that
lists all sources used in preparing your presentation. All material (including, but not limited
to quotations, paraphrasing, and key ideas) should be appropriately cited in the reference
listing. Follow APA guidelines for citations. (Points will be deducted for references not in
proper APA format.)*number of slides = 20-25
need to paraphrase the word document and make sure there is no plagiarism little less than
4 pages w

No plagarism is the main goal here.Need to paraphrase the word document and make sure
there is no plagiarism. little less than 4 pages with questions which dont need any
paraphrasingNeed to paraphrase the word document and make sure there is no plagiarism.
little less than 4 pages with questions which dont need any paraphrasingNeed to
paraphrase the word document and make sure there is no plagiarism. little less than 4
pages with questions which dont need any paraphrasingNeed to paraphrase the word
document and make sure there is no plagiarism. little less than 4 pages with questions
which dont need any paraphrasingNeed to paraphrase the word document and make sure
there is no plagiarism. little less than 4 pages with questions which dont need any
paraphrasing
need to perform organizational analysis and write a report on it

hello i have attached an complete document of instructions. please do follow the

instructions. apa format is required, no double spacing. all the content should be written in
single space. the length of the paper should be 25-30 paper long excluding title page,
reference page. Need in depth analysis and please do write in an professional manner. This
analysis will be written in the form of a consultant’s report, including a title page, table
of contents, executive summary, headings, citations, bibliography, etc. please do write all the
sections mentioned clearly. plagiarism is strictly prohibited. similarity rate should be less
than 3%.
Need to prepare a 15-20 PowerPoint slide presentation on a

Need to prepare a 15-20 PowerPoint slide presentation on a topic of diversity. Can pick any
topic from the below.Suggested Topics Include: Diversity training, inclusion in the
workplace, the Christian response to diversity, laws regarding diversity, addressing
diversity complaints, communication differences of diverse groups, effective learning styles
of diverse groups, the history of workplace diversity, stereotypes and biases, illegal
immigration, Critical Race Theory
Need to prepare a resume and cover letter based on the attached job description. Please
make sure that plagiarism should be less than 10%.

Need to prepare a resume and cover letter based on the attached job description. Please
make sure that plagiarism should be less than 10%.
Need to prepare Network Diagram, RAM and Gantt Chart for the wedding plan project. This
is Individual case study. Attached is the required information. Once done, please attach
working files also like

Need to prepare Network Diagram, RAM and Gantt Chart for the wedding plan project. This
is Individual case study. Attached is the required information. Once done, please attach
working files also like excel, word. Don't use
plagiarized sources. Get Your Custom Assignment on Need to prepare Network
Diagram, RAM and Gantt Chart for the wedding plan project. This is Individual case study.
Attached is the required information. Once done, please attach working files also like
Just from $13/Page
Order Essay
Need to provide step-by-step instruction on how to do UR with gripper rviz-movei

Need to provide step-by-step instruction on how to do UR with gripper rviz-moveit gazebo

sim and help solve any issues faced when following instruction provided. Thanks.
need to provide two sentences of highlights that describe what you are seeing happen with
the data

I use the data from Google Analytics making a PowerPoint. Now need to provide TWO
sentences of highlights that describe what you are seeing happen with the data (slide 4-
slide11)ï‚– Note that the following statement would not count as a highlight: March 2018
users rose.ï‚– Your highlight needs to be more descriptive and provide the user reading the
report an insight into what is driving the changes across their website. For example this
provides a deeper look: March 2018 users experienced a 60% increase when compared to
February, with the continued push of driving users through paid search.
need to research information regarding blood pressure including: What is

need to research information regarding blood pressure including:What is measured

(obviously blood pressure but for the paper you need to be specific)?What are some of the
major factors that affect blood pressure? Do these factors “normally” affect blood pressure
consistently or do they only occur when there is a problem?Does it appear that abnormal
blood pressure can alter or affect the way blood cells normally look or function? Papers will
need to be typed with standard 1” margins. Double spaced. Approximately 3-4 pages long
but content is more important than length.You must make sure to cite all references (APA
format).
Need to respond to a post in 150 words

Application security acts as a counter measures for threats coming from different types
such as viruses, trojan, worms, ransomwares to the system. It protects the data from being
stolen, it may perform on both hardware and software level where we can set rules to the
software, for ex: A firewall acts a application security for allowing valid activities to be
performed with the internet. In the field of software development lifecycle(SDLC),
Application security should be started at early stages to ensure be aware of security risks
and should always utilize application security in the software development lifecycle and the
application can be aware of future threats. From a organization perspective often many
business end users are not aware of these security risks and when the application is being
built, we need to make sure that enough protocols and security tasks has been set on each
layers in an application. As the technology is advancing the need of application security is
very important to secure and protect the data from many threats from the internet. Today
most of the companies are moving towards advancing their application security to a multi-
stage level authentication to make sure they are being validating the users, there are many
companies which provide a best layer of security for data management, project
management etc. One of the instances of shifting their focus on application and organization
security, Microsoft started shifting its focus on security aspects based on their recent threat
landscapes which made them have counter measures for their application security. As the
large businesses shift to building secure models for application security by spending enough
time on planning, meetings to make sure all the policies are validated. if we compare with
small businesses, they usually have straight forward plans with a set of guidelines on how to
deal with the data, perform validation and protect it by identify how the data is flowing and
its usages by different users. References:1. Application Security.
VMware.https://www.vmware.com/topics/glossary/content/app...2. Dharmesh M Mehta
(2009, Oct 06). Application security should be addressed in initial SDLC
stageshttps://www.computerweekly.com/tip/Application-sec...3. Federal Communications
Commission, Cyber Security Planning
Guidehttps://transition.fcc.gov/cyber/cyberplanner.pdf4. Jeffery Schwartz (2016, Jan 05)
Microsoft's New Security Approach.https://redmondmag.com/Articles/2016/01/01/A-
New-S...
Need to respond to the letter as if I live in Rocky Narrows. Keep the letter sho

Need to respond to the letter as if I live in Rocky Narrows. Keep the letter short, no more
than 250 words is best.
Need to respond to two student discussions with at least 150 words minimum for each
response. Below.

Need to respond to two student discussions with at least 150 words minimum for each
response. Below in the bold are the questions the students are responding to.For this
assignment, create a new message and address the following items in your
response.Identify two specific ways in which security for enterprise computing is different
from personal computing.Describe two techniques to help reduce the insider threat.Explain
the difference between passive and active attacks on a network. Give an example of
eachStudent one:Good Evening Class, we are now in the home stretch! Best of luck to
everyone here.Personal computing and enterprise computing are very simply the difference
between a computer owned by you the end user and a computer used to perform a function
on a higher level for a corporation. Protecting a personal computer is usually as simple as
safe browsing and up to date anti-virus. Enterprise involves much more, firewalls,
penetration testing, training, software standards and policies. Each of these functions of
security serves a different purpose within a corporation.The topic of an insider threat is
such a hot button issue within corporations. This term covers many different aspects of
threats to a company but the underlying connective concept is that a person within an
organization uses that access to cause damage to an organization or its people. Many
companies are employing specialists to limit the exposure and investigate the persons that
may intend to cause harm. The US Army has employed 7 processes to limit the exposure to
an insider threat.– Screen the Army– Clear the Army– Protect the Networks– Secure
Installations– Share Information– Establish/Operate the Hub– Train, Report and
Respond(Caleb, 2016)The most important aspects of this list is to notice a pattern. That is to
secure what is valuable to the infrastructure, limit the damage done by training the
employees (in this case soldiers) on what to notice for someone who is an insider threat in
the making.Due to this being such a new form of threat to organizations the criteria in
which to evaluate and categorize possible threats is still evolving. Within my current
occupation we are establishing an insider threat program and rely heavily on big data
management and looking at patterns that exist within case studies for the various threats,
theft, data piracy and hostile acts are some of the most common form of insider
threat.Finally the difference between active and passive threats on a network. A passive
attack is something that is intended to not be noticed immediately and tends to hide in the
background, this is similar to phishing attacks and Man in the Middle. An active attack is
something that is unleashed to cause damage and interrupt the networks day to day activity
and may not be intended to remain quiet and unnoticed.DanCaleb. (2016, August 17).
Reducing Insider Threat. Retrieved from Smith, R. E. (2016). Elemantary Information
Security. Subury: Jones& Bartlett Learning.Student two:Enterprise computing, in contrast to
personal computing, relies on more than just one person caring about cyber security. In
order to have an effective computer security posture, all employees must be on board with
making sure that their online practices are safe. In personal computing as well as enterprise
computing, a single user can exercise great care while using the internet, however, “if an
employee must choose between computer security and meeting a deadline for the company
president, computer security isn’t going to win” (Smith, 2016). Another way that personal
and enterprise computing differ is the amount and type of threats. An enterprise computing
network is more likely to be attacked than an individual because companies have more
information that hackers might want.Reducing an insider threat is simply a matter of
making some tasks only doable by multiple people. When a person is able to complete a task
alone, they are much more likely to be an insider threat than when they are required to
work with others. Monitoring personnel is another solution to insider threats. If an
employer regularly checks on an employee or has a system where they can monitor work
that is getting done, the employee is far less likely to do anything wrong.A passive attack is
when information is viewed and data is collected. If an attacker were to hack into a bank
manager’s email and read how much money a person just transferred would be an example
of a passive attack. An active attack is when someone prompts the user to do something by
sending them information. If the person who looked into the bank manager’s email sent an
email that asked for information on previous transactions, that would be an example of an
active attack.ReferencesSmith, R. E. Elementary Information Security. [VitalSource].
Retrieved from -Austin
need to select a movie and write a research paper

need to select a movie and write a research paper on how the movie relates to biology, I
selected contagion. Please edit and correct and add. I will put paper in chat. somehow
unable to attach.
need to solve following set of problems An Introduction to

need to solve following set of problemsAn Introduction to Statistical Learning with

Applications in R, Second Editionwhich is available in the below fileChapter 2: #1 all parts,
#6, and #8 all partsChapter 3: #5, #6, #9 (a), (b), (c), (e), (f), #10 (a)-(g), #11 (a), (b), (c), (f),
#13 all parts, #15 all partsFor the applied problems, you need to provide R codes .
need to solve following set of problems from An Introduction

need to solve following set of problems fromAn Introduction to Statistical Learning with
Applications in R, Second Editionwhich is available in the below file Chapter 4: #5 all parts,
#7, #12 (a)-(d), #13 (a)-(f), (i), #14 (a)-(e), #15 all partsChapter 5: #1, #5 all parts, #6 all
parts, #7 all parts, #8 all partsFor the applied problems, you need to provide R codes as
well.
Need to Solve the business analytics problem set questions

Activity 8Attached Files: Data Set - Activity 8.xlsx (57.707 KB)Use the data in the attached
for this question.You are working as an analyst for a large cable company that offers
bundles of channels all across the United States. One of the bundles is the “basic package,”
which includes network channels along with a few other basic cable channels. You are
interested in learning how the price of this basic package influences the rate of
subscriptions in a market. You have data on subscriptions per 1,000 local residents, price
for the basic package, and average local household income. You also have data on local
telecom labor costs per subscriber. You believe this last variable influences the local price
but not subscriptions per se.Based on the data provided, write out an expression for the
data-generating process for subscriptions per 1,000 local residents.Estimate the effect of
basic package price on subscriptions per 1,000 local residents using OLS. Why might you
distrust this result as being a causal effect?
Hi, need to submit a 1000 words essay on the topic Blackhead. Two of such conditions are
mentioned..

Hi, need to submit a 1000 words essay on the topic Blackhead. Two of such conditions are
mentioned below. tetany and diabetes.Tetany: Calcium ion, Ca+2, is an essential ion in the
proper functioning of all cells in the body. Hence, its maintenance in the blood within a
narrow range is very important, as both its excess and deficiency can have very unpleasant
effects. Normally, it is kept at a concentration of around 10mg/100ml. This is achieved by
the antagonistic effect of two hormones. calcitonin and parathyroid hormone (PTH).
Calcitonin is released by the thyroid gland in cases of excess calcium ion concentration in
the blood, and so it reduces the concentration by causing increased calcium deposition in
the bones, and reducing uptake of the ion by the intestines and the kidneys. On the other
hand, parathyroid hormone (PTH) is released by the parathyroid glands in cases of a
lowering of blood calcium levels from the normal, and so it induces an increased absorption
of the ion by the intestines and the kidneys, and an increased decomposition of mineral
calcium into the calcium ion by osteoclasts in the bones, thereby increasing the
concentration in the blood and returning it to normal. However, in the condition known as
tetany, there is a dramatic decrease in the blood calcium levels, resulting in uncontrolled
convulsive contractions of the skeletal muscles. If worsened, tetany can be fatal. Hence, the
homeostatic control of calcium levels in the blood is compromised, resulting in dire effects
on the body.Diabetes: the blood glucose levels are maintained around a narrow set point of
90mg/100ml. Glucose levels are monitored and controlled with the antagonistic functioning
of two hormones, both released by the pancreas. insulin and glucagon. Insulin lowers the
blood glucose level by inducing an increased uptake of glucose by the cells, and its
conversion to glycogen to be stored in the liver and muscles, a decrease in the conversion of
amino acids and fatty acids to glucose, and inhibiting glycogen breakdown in the liver.
Glucagon, on the other hand, reduces blood glucose levels by decreasing an uptake of
glucose by the cells, so that more glucose is present in the blood, an increase in the
breakdown of glycogen to glucose in the liver, and an increased conversion of amino acids
and fatty acids into glucose. However, in the condition called diabetes, be it Type1 or Type2,
there is a drastic increase in the blood glucose levels, either due to insufficient insulin
production by the pancreas (Type1), or a decrease in the response of the target cells to
insulin (Type2). Glucose concentration if increased so much that it is secreted by the
kidneys in urine, and as excess urine is formed, this leads to dehydration and glucose
accumulation in the blood.
 Need to use heading levels for all APA
papers.See inline grading feedback and t

Need to use heading levels for all APA papers.See inline grading feedback and the rubric.For
week 3 paper: You will be adding to this paper after your examples of how the strategies
section of the week 2 paper, by add new heading levels and adding the specific required
content for your week 3 paper.Review the rubric for specific requirements also. This is a
continuation of the first assignment PLS NO PLAGARISM OR PREVIOUS STUDENTS PAPER
THANKS A MILLION GET THIS OR ORDER A SIMILAR PAPER NOW
Need to use R studio software to complete this assessment. Stage 1 instructions

Need to use R studio software to complete this assessment.

Stage 1 instructions
Compare the predictive performance of the base model with the indicated extension, using
the pilot data for
estimation (training) and the non-pilot data as the testing sample. Provide a justification of
this split and document
any modifications to the samples used due to missing data and/or outliers.
Complete the questions and table in the attached Appendix B Individual Report Template.
Dataset:
Please copy-paste the whole line into your R Studio, ensuring you are connected to the
internet.
library(“readr”)
df <- read.csv("https://raw.githubusercontent.com/dat-
analytics/data_assess2_t2_2024/main/z5398606_z5398606-Assessment2Data.csv",
encoding="UTF-8")
need to working on marketing 201 assignment

The Assignment must be (WORD format only)Students must mention question number
clearly in their answer.Avoid plagiarism, the work should be in your own words, copying
from students or other resources without proper referencing will result in ZERO marks. No
exceptions.All answered must be typed using Times New Roman (size 12, double-spaced)
font. No pictures containing text will be accepted and will be considered plagiarism).no
matching ratio
need to write 1page summary about article

Article about professional and networking (any article) just one page summary with
references*NOTE, Update :If you have not been able to attend any of the below listed events
up to the transition to online learning, feel free to use a current events article (within
3months), or an existing TedTalk (any timing) or virtually streamed meetings for your extra
credit write up. Again, summarize what the event/activity you are referring to, and then
draw ties back to our class discussions and concepts, to show that you are able to relate
terminology to real live examples. Provide 1 page+, single spaced write-up, submit via Extra
Credit Assignment button
need to write 2 papers 1

Week Four Discussion: Data Analytics – Big Data Big data enables health care organizations
to analyze various kinds of data in order to extract valuable health care information and
insights. The primary goal of big data is to aid the health industry in making better and
more informed health care decisions which is done by enabling data scientists, predictive
modelers, and other analytics professionals so as to analyze huge volumes of patient related
data, as well as some other forms of data that may be untapped by the conventional health
industry intelligence programs.For this discussion, you are asked to conduct research using
the Danforth online library databases (you must use the online library databases) to locate
an article on big data in health care organizations.Discuss three benefits of big data in health
care including at least three specific examples as to how big data is being used in health
care. Relate it to our course material to date.Cite your source both in-text and at the end of
your post using APA guidelines Provide at least one course and one non-course, scholarly
(peer reviewed) reference.Written Assignment #4: Predictive Analytics Please write at least
a two-paged double-spaced in five paragraph format paper on the use of predictive
analytics in medicine. Is it useful or a waste of time and money? Do we have enough data for
building models or validating the models we build? Is the data we have valid and/or
reliable? Do we have a means to analyze the data in a useful way? Use at least three quotes
(sources) to support your ideas. One quote should be included in each of your body
paragraphs.Cite your sources both in-text and at the end of your paper following APA
format. Include a meaningful title. The five-paragraph model includes:Thesis statement in
the intro paragraphTopic sentences in each body paragraphConclusionSupport your view
utilizing our course material as well.You can refer to the OWL at Purdue University for
writing help and refer to the writing rubric included in Blackboard. Write in your own
words. Do not copy. Do not use word substitution.
need to write 2 paperss 500 words each

Written Assignment #7: Value of KM in MedicinePlease write at least a two-page double-

spaced in five paragraph format paper on the value of knowledge management in medicine.
Provide concrete examples and illustration. Use at least three quotes (sources) to support
your ideas. One quote should be included in each of your body paragraphs. Cite your
sources both in-text and at the end of your paper following APA format. Include a
meaningful title. The five-paragraph model includes:Thesis statement in the intro
paragraphTopic sentences in each body paragraphConclusionSupport your view utilizing
our course material as well.You can refer to the OWL at Purdue University for writing
helpWeek Seven Discussion: Benefits of AI or Expert Systems in HealthcareAn expert
system uses facts and rules, taken from the knowledge of many human experts in a
particular field, to help make decisions and solve problems. Artificial intelligence (AI) is an
area of computer science that emphasizes the creation of intelligent machines that work
and reacts like humans.For our final class discussion, you are asked to conduct research
using the Danforth online library databases or the Internet to locate an article on artificial
intelligence or expert systems in healthcare.Describe three benefits of artificial intelligence
(AI) or expert systems in healthcare.Share a specific example as to how AI or expert systems
are being used in healthcare. Relate your viewpoint to our course material.Cite your source
both in-text and at the end of your post using APA guidelines
need to write 500 words about an essay

please read the instructions and follow the questions below This week, you read eight
chapters from Zinsser's book On Writing Well. Your discussion this week, I'd like you to
apply some of the ideas discussed in the reading. After you've completed the reading, visit
https://soslandjournal.wordpress.com/ to view either the current issue or a previous issue
of the Sosland Journal (UMKC-published academic journal of Undergraduate student work).
Pick an essay that is interesting to you and read it fully.After you've read an essay from the
Sosland, please evaluate it in the context of something you learned from this week's reading.
Is there a skill that this author does particularly well, especially in context of Zinsser's
advice? An aspect that they do well that actually contradicts a piece of Zinsser's advice? An
aspect that they do poorly? How might it be improved with Zinsser's advice? What effect
does the use/misuse of this writing skill have on the essay overall, if at all? Try to pull direct
evidence from both the essay you're reviewing and the Zinsser chapter you're discussing.
here is Zinsser's book on writing well links
:https://libguides.mjc.edu/researchassignments/beamhttps://ohiostate.pressbooks.pub/c
hoosingsources/chapter/using-beam-an-example/ask me if you have any questions .Thank
you
need to write 600 words after reading the chapter from the text book

his assignment will help you digest the textbook material. In the Discussion Forum, post an
APA formatted paper of at least 600-words about the week’s reading material. The post
must be substantive and demonstrate insight gained from the course material and be
posted no later than Wednesday at 11:55 p.m. What is your understanding of the material
covered? Also, address in your own words:Chapter FifteenExplain how country differences,
production technology, and production factors all affect the choice of where to locate
production activities.Identify the factors that influence a firm’s decision of whether to
source supplies from within the company or from foreign suppliers.Describe what is
required to efficiently manage a global supply chain.
need to write 600 words in apa format 5

– This assignment will help you digest the textbook material. In the Discussion Forum,
post an APA formatted paper of at least 600-words about the week’s reading What is
your understanding of the material covered? Also, address in your own words:Chapter
TenDescribe the functions of the foreign exchange market.What are spot exchange
rates.Compare and contrast the differences among translation, transaction, and economic
exposure, and explain the implications for management practice.
need to write a detailed evaluation of three dances from a video for theater 101

PLEASE READ THE ATTACHED FILES BEFORE YOU DO THE ASSIGNMENT.VIEW THE
FOLLOWING CLIP FROM BURN THE FLOOR WRITE A DETAILED EVALUATION OF THE
FIRST THREE DANCES THAT APPEAR WITHIN THE FIRST 20 MINUTES OF THIS CLIP
USING THE CRITERIA FOR FORMAL CRITICISM BELOW – WRITE ONE SECTION FOR EACH
DANCE USING THE FOLLOWING SUB HEADINGS AND FORMAT AS INDICATED BELOW.
Note, the second dance sequence starts AT APRPOX 5:40 with the audience applause and
dancers ripping their costumes off, the third dance begins AT 8:57 with the airport tower
announcer.1. DANCE #1 – CREATE YOUR OWN TITILE FOR IT THEN WRITE A PARAGRAPH
FOR EACH FOR A,B,C.A. DESCRIPTIVEB. INTERPRETIVEC. EVALUATIVE 2. DANCE #2 –
CREATE YOUR OWN TITILE FOR IT THEN WRITE A PARAGRAPH FOR EACH FOR A,B,C.A.
DESCRIPTIVEB. INTERPRETIVEC. EVALUATIVE 3. DANCE #3 – CREATE YOUR OWN TITILE
FOR ITTHEN WRITE A PARAGRAPH FOR EACH FOR A,B,C.A. DESCRIPTIVEB.
INTERPRETIVEC. EVALUATIVE
need to write a paper 3

One type of negotiation dealing is with contracts. While some verbal contracts can be
upheld in the court of law, it is imperative to have a written contract, as well. Having a
written contract details the specifics of the “deal― and is basically a verbal contract
on paper. Contracts should be written as if it were a recipe. Leaving out key items could
create a loophole, in the contract, which could later cause some issues.For this assignment,
you are asked to write an eight page paper is to develop a contract based on a scenario you
have created (the title and reference page will not count towards page count). Please ensure
that you address each of the following sections. Each section will need to be labeled with the
use of subtitles. You will need to be thorough in detailing your negotiation contract as well
as describing the scenario you have created. The scenario that you create will need to be
one that is specific and/or an unusual circumstance (be creative).Below are the subtitles
you can use; however, please note that you can change the name of the subtitles based on
your scenario.1. Introductiona. Define contracts and the importance of contracts2. Specific
circumstancesa. What is the scenario you have created for this assignment?3. Importance of
addressing other’s needsa. Be clear when identifying the needs of both parties4.
Preconditionsa. Explain any prerequisites that are imperative prior to moving forward with
the development of the contract.5. Contracta. Discuss the details of the contract, in full(no
more than 1 page).6. ConclusionBe sure to support and justify your positions and
conclusions with references to relevant library resources or reputable sources outside of
the library. All written assignments should follow APA requirements.The inclusion of your
textbook and two outside references (a total of three sources), retrieved from the university
library, is required for the completion of this paper
need to write a paper about negotiation

for this paper , you are asked to write a 10-page paper elaborating on the concept of
effective negotiation. In your paper, you will need to discuss the following concepts: •
Accurate introduction of negotiation• Importance of negotiation• Process of
negotiationo i.e. the three main stages of negotiation (prenegotiation, formal, and
agreement stages)• Ethical dilemmas in negotiationo i.e. honesty and trust• Accurate
conclusion of negotiationPlease ensure that you address each section. Each section will
need to be labeled with the use of subtitles. Be sure to support and justify your positions
and conclusions with references to relevant library resources or reputable sources outside
of the library. All written assignments should follow APA requirements. The inclusion of
your textbook and three reputable outside references (a total of four sources) are required
for the completion of this paper. Please remember that the title and reference page will not
count towards the page count.
Need to write a paper on a fermi question which is
How many photons/sec are emi

Need to write a paper on a fermi question which is

How many photons/sec are emitted by a 100 watt light bulb? (a number)
I need calculations, experimental methods data and data tables along with an explanation
for those calculations.
I’ve attached the instructions as well as a breakdown of what the paper has so far.
Need to write a Positive and respectful replay for the

Need to write a Positive and respectful replay for the below post ( 150 words max) Based
on the introduction to Industry 4.0 video, digital transformation has seen a more connected
industrial technology. In the software industry, one of the emerging digital technologies is
artificial intelligence. AI has become a critical component in software development as
developers seek to streamline processes and eliminate repetitive processes. Software
developers have adopted AI tools to execute tasks faster, automate testing as well as
compile codes. As the development of software applications moves from desktop to mobile
devices, new technologies have come up (Khan et al. (2019). The progressive web app is
one of the technologies adopted to allow developers to build web applications that have
mobile versions using web-based languages such as CSS, HTML, and JavaScript. Another
emerging digital technology in the software industry is augmented virtual reality
technology, which enables real-time integration of the digital world and the real world. It
allows developers to create and orient virtual objects and connect them with the real
world.One of the emerging digital products in the software industry is mobile applications.
Most developers today are developing mobile apps for various functions and tasks for
mobile platforms like Google’s Android and Apple’s iOS. These apps are often supported by
smartphones and tablets, among other mobile devices. The demand for mobile apps as
digital products has increased, especially for organizations that need to boost their
businesses. Video games are also considered digital products in the software industry
developed for the two prominent mobile platforms, Android and iOS. Moreover, video
games offer platforms for advertisements for other branded products (Glass, 2007). Web-
based applications are also software products downloaded from the web and installed on
mobile devices and computers. These applications often run in a web browser and are sold
as digital products. Such products include Google Drive, iCloud, and Dropbox, among other
digital products.Industry 4.0 is the fourth phase of the industrial revolution, which describe
the current technological advancements. It refers to the digital transformation in
automation and intelligent networking of machines and processes for industry supported
by information technologies. Industry 4.0 presents disruptive intelligence and information
technologies that have enabled high levels of production efficiencies and sustainable
development (Bai et al., 2020). However, one unique pain point in Industry 4.0 is the issue
of IT security, which is a recurring problem. The advent of online integration of processes
and systems has presented a possibility of security breaches, as IT security is vulnerable to
cyber-attacks. Furthermore, prevalent threats such as network misconfigurations and
software failures can disrupt operations and processes. This issue is often overlooked as
most of these technologies promise advanced security disregarding the fact that each new
technology presents a certain level of flaws and vulnerabilities
Need to write a report on pump.

The report is about pump. You have to complete the results and discussion in a way that it
covers the goals and hypothesis given in the document prelab. The document format is
given in the technical memo instruction pdf. Each thing mentioned in the memo should be
there (9 subtopics). Data needed for calculations are in the excel file.PS. Pump pdf is given
to get a better idea on how to complete the results and discussion part. Look at the
minimum analysis.
Need to write a reflection. The movie’s name is The Battle Of Algiers – Gillo Pontecorvo
(1966). There need to be four sections to the reflection. Introduction, key theme 1, key
theme 2, and final tho

Need to write a reflection. The movie’s name is The Battle Of Algiers – Gillo Pontecorvo
(1966). There need to be four sections to the reflection. Introduction, key theme 1, key
theme 2, and final thoughts. All combined, it should be about 3 to 4 pages (double-spaced).
For the introduction, please mention ● What is the purpose of this Learning Reflection? ●
What are the main lessons that I learned? ● Did this learning experience change my views
or knowledge? ● Thesis statement: My experience viewing Film Name taught me [theme 1]
and [theme 2]. Tell your reader the main themes you are discussing! Specific criteria need
to be met; they are as follows: Don't use
plagiarized sources. Get Your Custom Assignment on Need to write a reflection.
The movie’s name is The Battle Of Algiers – Gillo Pontecorvo (1966). There need to be four
sections to the reflection. Introduction, key theme 1, key theme 2, and final tho
Just from $13/Page
Order Essay ● Intellectual growth. Demonstrates critical
thinking by evaluating, applying, & analyzing the context of crucial course materials.
Insightful & relevant reflection. Demonstrates a conscious understanding of the breadth of
history. Insightful? Sincere? ● Personal growth. The student judges the merits of their
experience and applies their learning. Shows development in terms of perceptions,
opinions, decisions, knowledge, and/or values when describing their learning reflections.
● Writing. This reflection has a well-organized introduction, two or three meaningful
thematic reflections, and a strong conclusion. Strong academic writing includes spelling,
grammar, paragraph & sentence construction, punctuation, and word choice.
Need to write a reflection. The movie’s name is Congo: White King, Red Rubber, Black Death.
It is about the colonization of Africa by Europeans. There need to be four sections to the
reflection. Intro

Need to write a reflection. The movie’s name is Congo: White King, Red Rubber, Black Death.
It is about the colonization of Africa by Europeans. There need to be four sections to the
reflection. Introduction, key theme 1, key theme 2, and final thoughts. All combined, it
should be about 3 to 4 pages (double-spaced). For the introduction, please mention ● What
is the purpose of this Learning Reflection? ● What are the main lessons that I learned? ●
Did this learning experience change my views or knowledge? ● Thesis statement: My
experience viewing Film Name taught me [theme 1] and [theme 2]. Tell your reader the
main themes you are discussing! Specific criteria need to be met; they are as follows:
Don't use plagiarized sources. Get Your Custom Assignment on Need to write a
reflection. The movie’s name is Congo: White King, Red Rubber, Black Death. It is about the
colonization of Africa by Europeans. There need to be four sections to the reflection. Intro
Just from $13/Page
Order Essay ● Intellectual growth. Demonstrates critical
thinking by evaluating, applying, & analyzing the context of crucial course materials.
Insightful & relevant reflection. Demonstrates a conscious understanding of the breadth of
history. Insightful? Sincere? ● Personal growth. The student judges the merits of their
experience and applies their learning. Shows development in terms of perceptions,
opinions, decisions, knowledge, and/or values when describing their learning reflections.
● Writing. This reflection has a well-organized introduction, two or three meaningful
thematic reflections, and a strong conclusion. Strong academic writing includes spelling,
grammar, paragraph & sentence construction, punctuation, and word choice.
Need tutoring in week 5 in bus 642

Price Quotes and Pricing Decisions Applied ProblemsPlease, complete the following two
applied problems in a Word or Excel document. Show all your calculations and explain your
results. Submit your assignment in the drop box by using the Assignment Submission
button.Week 5 Assignment Study Guide1. Your company, Bright Paints, is one of a dozen
companies manufacturing a special reflective paint used for traffic signs. The State
Department of Transportation has called for tenders to supply 10,000 gallons of blue
reflective paint to be delivered within two months. You can foresee fitting in a production
run of the blue paint and have decided to bid on the job. You calculate your incremental
costs for this job to be $76,200. This particular contract is standard, similar in all in respects
to hundreds of contracts you have bid on over the past few years. Your pricing policy has
been to apply a mark-up to incremental costs to arrive at the bid price. Your mark-up has
been higher when you had plenty of orders and lower when you had few or no orders to
fulfill. You have assembled data relating the mark-up rate used and the percentage of
contracts won at each mark-up rate, as follows. Mark-up rate (%) Percentage of
contracts won at that rate (%)0101520253035 95.984.865.441.315.73.00. a. Why
would your company have bid with a zero mark-up on some past tenders? Why didn’t it win
all of those contracts? b. What is the bid price that maximizes the expected contribution
of the contract? c. Why, or why not, is the fixed-price mode of bidding likely to be the
best one to use for this contract? 2. In calculating the incremental cost of a particular
project, how would you treat the possible future costs of a lawsuit that may occur as a result
of this project, where the cost of the lawsuit might range from $10,000 to $500,000 with an
associated probability distribution?
Need two annotated bibliography on stand your ground law

Need to be from two different credible resources . I need it for this afternoon before 4pm
Need two assignments by Friday

First- Brainstorming: Brainstorm about specific positive and negative effects computers
have had onyour personal, professional, and academic life. Create a one-page list of your
ideas.Thesis: Based on your brainstorming, write a one-sentence working thesis statement
thatfocuses on the impact of computers related to a single area of your life (personal,
professional,or academic). The thesis should be one you could develop into an essay of
about one page(250–300 words), directed to readers of your local newspaper. Don’t draft
the essay in yourjournal, however. You need only your list from brainstorming and your
working thesis statement. Second-This entry builds on the brainstorming and thesis you
developed for the first part.Evidence: Identify three different types of evidence you could
use to develop your working thesisfrom part 1. Use specific information from your
brainstorming list, and any other ideas thatcome to you. (Length open)Organization: Choose
a method of organization for your evidence. Using that evidence, preparean outline or
simulate a graphic organizer to show your organizational plan for the one-pageessay. Don’t
draft the essay in your journal, however. (Length open)
NEED TWO DIFFERENT ANSWER FOR THIS WORK After watching the Teach Every Child
Abo

NEED TWO DIFFERENT ANSWER FOR THIS WORK

After watching the Teach Every Child About Food TED Talk from 2010, write an initial
discussion post addressing the following topics: What thoughts or questions did the
information on the video bring up for you?
What is one thing that you learned that you did not know before you watched the video?
Do you think that the environment is better, worse, or the same as it was in 2010 (find a
source online on article or information from something published in the last 2-3 years to
support your response and include the source in your post)?
What is one question that you have from the video?
Post your initial response as soon as possible. You will also need to post two responses to
other people in the class. Please try to have each initial post have a minimum of one person
respond to it. For example, do not have everyone respond to the first initial post and then
no other posts have responses. Look at the rubric for this assignment for further details on
grading, Initial posts for this discussion are due Thursday and responses are due by Sunday.
How do I get the most points for this discussion?
Discussions should be 8-12 complete sentences long and reference something that we
discussed in the module or something that you looked up online (with the exception of this
one which is just to get to know you). Main Discussions are worth 10-25 points, and replies
to discussions are 5 points each. This discussion requires two replies to other students.
These replies are worth 5 points each with the option for five extra credit points for an
additional reply. For example, if the discussion is worth 20 points and you need two replies,
then the initial post is worth 10 points and each reply is worth 5 points each for a total of 20
points. You can then write a third reply to another post in that discussion for an additional 5
points, which would give you 25 out of 20 points for the assignment.
need two different copies in different docs please follow apa will provide sample

Your assignment is to write a paper in which you discuss recent security issues faced by
organizations. In your paper you should address specific threats and countermeasures
which have been proposed by various researchers. The Final Paper is an expansion of the
Draft Paper you submitted in Week 4 and should include additional details on the threats
and countermeasures discussed in the Draft Paper. The requirements for the Final Paper
are as follows:The paper should include a minimum of ten peer-reviewed scholarly
references published since 2014Citations and references should be in APA formatThe paper
should be a minimum of 4000 wordsThe SafeAssign score of the paper should be less than
20%NO PLAGARISM2 COPIES SAME QUESTION IN DIFFERENT DOCS SP
need two different copies in separate docs same question please follow instructions and
complete wor

Your work over the next 8 weeks will lead-up to your ability to represent an enterprise
security architecture solution as a diagram or diagrams with annotations. The project
involves depicting a Security Architecture for one of the following businesses: Financial
(Bank, brokerage, Insurer, etc.) Hospital/Medical Services Pharmaceutical/ChemicalSocial
Media Company Energy Company (Electrical Utility, Oil Company, Solar, Wind, etc.)
Manufacturer (Automobile, Computer, Consumer Electronics, etc.) There are 2 milestone
deliverables for the project:Milestone 1:Project Abstract, Goals and Approach (Words limit:
800-1000)Identify the business type you have selected for your paper.Provide a brief
overview of the businessProvide the goals and approach to the projectSubmissions due
Sunday, end of Week 5. (20% of final grade) Milestone 2:Architectural diagrams and
annotations (Words limit: 1000-2000)Milestone 2 will include all materials from Milestone
1 and Architectural diagrams and annotationsSubmissions due Sunday, end of Week 8 (30%
of final grade)SubmissionCompose your work in a .doc or .docx file type using a word
processor (such as Microsoft Word, etc.) and save it frequently to your computer. Check
your work and correct any spelling or grammatical errors. surg
need two different copies please follow instructions no plagarism

Week03 HWAttached Files: HW03.docx (24.773 KB) Advertising.csv (4.645 KB) Auto.csv
(20.043 KB) Boston.csv (36.775 KB) Credit.csv (21.844 KB) Initially summarize the
questions attemptedQ1: ISLR Textbook chapter review questionsChapter 3 - Linear
Regression Review the following sections in PythonLoad Datasets3.1 Simple Linear
Regression3.2 Multiple Linear Regression3.3 Other Considerations in the Regression
ModelQ2 Textbook Theory Questions 3.7 Exercises1. Describe the null hypotheses to which
the p-values given in Table 3.4 correspond. Explain what conclusions you can draw based
on these p-values. Your explanation should be phrased in terms of sales, TV, radio, and
newspaper, rather than in terms of the coefficients of the linear model.Q3 Applied Textbook
Questions with Python 3.7 ExercisesHint – several github sites have the complete solution
in python e.g.https://github.com/mscaudill/IntroStatLearnhttps://botlnec.github.io/islp/8.
This question involves the use of simple linear regression on the Auto data set. (a) Perform
a simple linear regression with mpg as the response and horsepower as the predictor. Print
the results. Comment on the output. For example:i. Is there a relationship between the
predictor and the response? ii. How strong is the relationship between the predictor and the
response? iii. Is the relationship between the predictor and the response positive or
negative? iv. PredictionsWhat is the predicted mpg associated with a horsepower of 98?
What are the associated 95 % confidence and prediction intervals?Plot the response and the
predictor, display the least squares regression line. Produce diagnostic plots of the least
squares regression fit. Comment on any problems you see with the fit. 9. This question
involves the use of multiple linear regression on the Auto data set. (a) Produce a scatterplot
matrix which includes all of the variables in the data set. (b) Compute the matrix of
correlations between the variables. (c) Perform a multiple linear regression with mpg as the
response and all other variables except name as the predictors and print the results.
Comment on the output. For instance: i. Is there a relationship between the predictors and
the response? ii. Which predictors appear to have a statistically significant relationship to
the response?iii. What does the coefficient for the year variable suggest? (d) Produce
diagnostic plots of the linear regression fit. Comment on any problems you see with the fit.
Do the residual plots suggest any unusually large outliers? Does the leverage plot identify
any observations with unusually high leverage? (e) Fit linear regression models with
interaction effects. Do any interactions appear to be statistically significant? (f) Try a few
different transformations of the variables, such as log(X), √ X, X2. Comment on your
findings.Opional15. This problem involves the Boston data set, which we saw in the lab for
this chapter. We will now try to predict per capita crime rate using the other variables in
this data set. In other words, per capita crime rate is the response, and the other variables
are the predictors. (a) For each predictor, fit a simple linear regression model to predict the
response. Describe your results. In which of the models is there a statistically significant
association between the predictor and the response? Create some plots to back up your
assertions. (b) Fit a multiple regression model to predict the response using all of the
predictors. Describe your results. For which predictors can we reject the null hypothesis H0
: βj = 0? (c) How do your results from (a) compare to your results from (b)? Create a plot
displaying the univariate regression coefficients from (a) on the x-axis, and the multiple
regression coefficients from (b) on the y-axis. That is, each predictor is displayed as a single
point in the plot. Its coefficient in a simple linear regression model is shown on the x-axis,
and its coefficient estimate in the multiple linear regression model is shown on the y-axis.
(d) Is there evidence of non-linear association between any of the predictors and the
response? To answer this question, for each predictor X, fit a model of the form Y = β0 + β1X
+ β2X2 + β3X3 +
need two different copies same question with proper apa and references 350 words each

Big data in healthcare – What are the challenges and opportunities from a research
perspective?Start a discussion thread in big data in healthcare and discuss what type(s) of
challenges and opportunities from a research perspective. Be specific in your discussions
and provide use cases as examples.You must do this following:1) Create a new thread. As
indicated above, Start a discussion thread in big data in healthcare and discuss what type(s)
of challenges and opportunities from a research perspective. Be specific in your discussions
and provide use cases as examples.
need two different copies with the apa format in different docs please follow guide lines
price adde

GuidelinesShare screen shot on your response Share the code and the plots Put your name
and id numberClear mark question numberUpload Word documentInsert Cover page
Questions Attempted HW01 Cover SheetIdentify all questions that you attemptedQ0
pythoncrash course: https://www.kaggle.com/learn/python(optional)Q1 Download, install
Anaconda and launch: https://www.anaconda.com/distribution/Show screen shot Q2
Launch python IDE-spyder in anaconda
https://www.youtube.com/watch?v=8JiWEZEnJ40Show screen shot Q3
pandashttp://pandas.pydata.org/pandas-docs/stable/getting_started/10min.htmlQ4
numpyhttps://www.numpy.org/devdocs/user/quickstart.htmlQ5
matplotlibhttps://matplotlib.org/gallery/index.htmlDo: a)Stacked Bar Graph b) Barchart c)
horizontal bar graph, d) scatter plot e) histogram f) lineplot examples with codeQ6 pandas:
attached dataset: uk-500.csv and uk-500.py to manipulate the file with ilocQ7 plot iris
dataset https://www.kaggle.com/abhishekkrg/python-iris-data-visualization-and-
explanationQ8: visualize & analyze the titanic dataset (titanic.zip–
https://www.kaggle.com/c/titanic/data) use the reference as a
guide:https://www.kaggle.com/confusedpandas/titanic-survivors-analysis
Need two discussion completed No plagiarism

Prepare: Prior to beginning work on this discussion question, read Chapters 3 and 4
in American Government. In addition, watch the videos provided on federalism: Quick Study
of Federalism Part 1, Quick Study of Federalism Part 2, and Quick Study of Federalism Part
3, and the U.S. Constitution: Episode I - A More Perfect Union. Reflect: The U.S. government's
expansive role in public policy is caught in a swirl of conflicting crosscurrents. On the one
hand, popular expectations about government's responsibility to solve problems often
exceed the capacity of state and local authorities to respond effectively. On the other hand,
policies developed at the national level may not sufficiently reflect the great diversity of
interests across the U.S. to be effective at the local level. Moreover, the search for effective
policy is further complicated by theoretical debates about the constitutional framework of
federalism, that is, what limits on national power can be derived from the Tenth
Amendment? Write: Select a policy or piece of legislation that involves the program you are
seeking a degree in (i.e., your major). In your initial post, discuss the federalism challenges
that this policy is creating or facing. For example:If you are an education major, how are
local, state, and federal government policies affected by the No Child Left Behind legislation
or some other piece of education-related legislation?If you are a criminal justice major, how
does recent legalization of marijuana in some states affect local, state, and federal control
over this issue?If you are a business major, how does the insurance mandate in
the Affordable Care Actaffect local, state, and national businesses and their employees?If
you are a political science major how has the recent Citizen’s United ruling affected the
amount of money available for campaigns at the local, state, or federal levels?Fully respond
to all parts of the prompt and write your response in your own words. Your initial must be
200 to 250 words. Support your position with APA citations from two or more of the
assigned resources required for this discussion. Please be sure that you demonstrate
understanding of these resources, integrate them into your argument, and cite them
properly. Discussion #2Prepare: Prior to beginning your reflection this week, complete all
course readings, your introduction, and the Discussion, “The U.S.
Constitution.” Reflect: Once you have completed these assignments think about how
American politics have and could affect your career aspirations. The Founding Fathers
created an amazing governmental structure that affects almost every aspect of our lives
even today. For instance, if you are a criminal justice major, what parts of the U.S.
Constitution are applicable to what you are learning in your major? If you are a business
major, which branch of government – executive, legislative, or judicial – has, or will have,
the greatest influence on your business ambitions? If you are a political science major, how
does separation of powers in the U.S. government affect the operations of most economic,
social, and political processes throughout the United States? Write: In your initial post,
based on your current academic major (declared or not), completeone of the
following:Describe which actions of the Founding Fathers are continuing to affect your
future career goals.Discuss how separation of powers is influencing your current or future
job.Explain why checks and balances are important to know in your future employment
positions.Expound on how the Constitution is still relevant to the career you want to
pursue.Fully respond to all parts of the prompt and write your response in your own words.
Support your position with APA citations from two or more of the assigned resources
required for this discussion. Please be sure that you demonstrate understanding of these
resources, integrate them into your argument, and cite them properly. Your initial post
should be 200 to 250 words.
Need two papers completed by tomorrow evening

Read the following sections in Environmental Science: Toward a Sustainable Future:Chapter

15: Nuclear Power (pp. 373-387)15.2: How Nuclear Power Works15.3: The Hazards and
Cost of Nuclear Power FacilitiesChapter 17: Environmental Hazards and Human Health
(pages 415–426)17.1: Links Between the Environment and Human HealthChapter 18:
Global Climate Change (pages 445–462)18.2: Climate Change ScienceChapter 19:
Atmospheric Pollution (pages 472–484, 498–504)19.1: Air-Pollution Essentials19.2:
Major Air Pollutants and Their Sources19.5: Destruction of the Ozone LayerChapter 20:
Water Pollution and Its Prevention (pp.516-528)20.2: Wastewater Treatment and
Management20.3: EutrophicationChapter 21: Municipal Solid Waste: Disposal and Recovery
(pages 539–546)21.2: Better Solutions: Source Reduction and RecyclingRead Chapters 11
and 12 in Biology through the Eyes of Faith.From the handout, Workshop Four Post-
Reading Questions, choose one question for each chapter. Please note, there are no
questions related to Chapter 12 in Biology through the Eyes of Faith for this assignment, but
it is still important that you read the chapter.Write a short essay to answer each question
you selected. The essays are to be typed, double spaced, and each should be approximately
one-half to a full page long. Many of the questions contain several parts, so make sure that
you have answered all parts of the question and have done any drawings requested.Next
Assignment Atmospheric CO2 and Temperature Changes (Graphit)Write a 250- to 500-
word summary of what you’ve learned in this assignment. Be sure to reference specifics
and cite any sources in APA format.
need two paragraphs and two references each discussion question week 5 0

Week 5 Discussion 1 Small-business ideas prove themselves when customers start

buying.Dispute or defend the concept that a small business starts with abusiness plan. Take
a position on whether the customers come first orthe business plan comes first. Support
your answer.From the case study, give your opinion on whether or not Herreraoperated
from a formal business plan. Predict what would have happenedif Herrera had written out
his plan and presented it to venturecapitalists__________________________________Week 5
Discussion 2 From the first e-Activity, evaluate the business’ current businessstrategy;
propose a change in direction that would improve itsprospects. Support your answer.From
the second e-Activity, Mr. Gupta said, “A startup is a journey.” He also said, “Try to do as
much as you can with your own money andon your own time before you ask for investment.
As soon as you raisecapital, the stakes go up, your clock is ticking.” Interpret themeaning of
those statements. Take a position on whether you agree ordisagree with those statements.
Support your position.
need two parts completed 7 page

Part one: you have four-student opinions .you need to write response and discuss your
opinion for each one separately.In the end of each paragraph you find the student name use
it in the beginning of your answer. Your answer should be deep with financial
sophistication. Write one page for each one separately. (4 page one page for each response)
Part two: you have three topic. You need discuss and write opinion about each topic
separately. Write one page about each topic. Your answer should be deep with financial
sophistication. (Example of how to write an opinion can be seen from how students write
part one) (1 page for each parts total 3 page)
need two sections literature review and methodology

Need Literature review paper for topic: “Designing a Program to Enhance Consumers
Satisfaction and Improve Organization Performance”in short “Improving customer
satisfaction: (Attached paper worked till now)The Literature Review should be at the very
least 15-20 pages minimum including literature on methods of implementing the program.
Also after Literature, please include Methodology section. The Methodology chapter is two
paragraphs tying the Literature Review into the Project. An example of the Methodology
section is as follows:The literature reviewed in this study clearly (shows, indicates, etc.) the
successful implementation of a _______ program needs to contain _________.The Project section
of this paper describes the implementation of a ——— program to ————- that was
designed as a result of this study. The presentation used to describe the implementation to
———- is on display in Appendix A of this paper. (More on this next week.)
Need ur help with the assignment use trusted and up to date sources the dr is re

Need ur help with the assignment use trusted and up to date sources the dr is really strict
and checks for ai and he fails students so please I need ur best effort
Need Urgent Help for my paper Due in next 6 hours (Fin 571 Week 6 paper 100%
plagiarism free )

Harvard Business Publishing: Working Capital Simulation: Managing Growth AssignmentCh.

1 - 21 ofFundamentals of Corporate FinanceWileyPLUS AssignmentsAll additional resources
from each week Review the following scenario: Acting as the CEO of a small company, you
will apply the principles of capital budgeting to invest in growth and cash flow
improvement opportunities in three phases over 10 simulated years. Each opportunity has
a unique financial profile and you must analyze the effects on working capital. Examples of
opportunities include taking on new customers, capitalizing on supplier discounts, and
reducing inventory. You must understand how the income statement, balance sheet, and
statement of cash flows are interconnected and be able to analyze forecasted financial
information to consider possible effects of each opportunity on the firm's financial position.
The company operates on thin margins with a constrained cash position and limited
available credit. You must optimize use of internal and external credit as you balance the
desire for growth with the need for maintaining liquidity. Sign-in to the simulation and
review each of the following: Welcome StatementHow to PlayTerminology PrimerMore
Details (this includes information to help you understand how to play the
simulation) Write a paper of no more than 1,400 words that analyzes your decisions during
each phase (1-3) and how they influenced each of the following final outcomes (metrics) of
SNC: SalesEBITNet IncomeFree Cash FlowTotal Firm Value Address the following in your
paper: A summary of your decisions and why you made themHow they affected SNC's
working capitalWhat general effects are associated with limited access to
financing Include scholarly references (in addition to your course textbook and simulation
materials) to support your positions.
need with apa 300 400 words with references

Discussion Question 1 – Applied Concepts (AC) – Week/Course Learning OutcomesUsing

your textbook, LIRN-based research, and the Internet, apply the learning outcomes for
theweek/course and lecture concepts to one of the following scenarios:As applied to your
current professional careerAs applied to enhancing, improving, or advancing your current
professional careerAs applied to a management, leadership, or any decision-making
positionAs applied to a current or future entrepreneurial endeavorORUsing your textbook,
LIRN-based research, and the Internet, apply the learning outcomes for theweek/course
and lecture concepts to a business organization that exhibits and demonstrates
theseconcepts. You should develop a summary of the organization’s strategy and how they
use theseconcepts to compete.This is a learning and application exercise designed to give
you an opportunity to apply concepts learned in a pragmatic and meaningful way that will
enable you to gain valuable and relevant knowledge in an effort to augment your skill set
and enhance your professional careers.@ro
need within 2 hours 10 multiple choice questions

To provide quantitative responses to policy issues (Points :

1)
NEED WITHIN 8 HOURS!! Answer each question in 250 words

NEED WITHIN 8 HOURS!!Answer each question in 250 words with two resources each. 1.
Why do you think it is important to plan when you are going to instruct one or more
students who need AT? How do teachers determine key concept vocabulary and action
words to include on a device or in pictures to promote engagement during instruction for a
given topic?2. Describe 2-3 listening and speaking activities or strategies teachers could use
to help students develop phonemic awareness and develop an understanding about sounds
and symbol systems. Why is it important for the teacher to provide opportunities for
integrating phonological awareness activities throughout the school day?3. Describe at least
two pre-reading and two post-reading strategies or learning activities teachers can use to
assist elementary students in developing their awareness of sounds and print and to
facilitate conversations about books and stories. Rationalize your choices.4. How can
educators make a distinction between literacy delays that are the result of second language
acquisition and those that are the result of a language disorder? What are some specific
considerations for intervention and assessment for students who are language learners that
also have a language disorder?5. Describe assistive technology (AT) or augmentative and
alternative communication (AAC) and who benefits from the use of it. In addition, describe
current trends in AT or AAC that can be utilized in the classroom. Be specific.6. The purpose
of this course is to learn how to help students develop proficient language and
communication skills. How might such proficiency grow or restore a student’s sense of self-
worth? How does that affect your instruction, and your relationships with the students you
will be teaching?Resources to use:Q1Q2https://fod-infobase-
com.lopes.idm.oclc.org/p_ViewVideo.aspx?xtid=53714https://bibliu.com/app/#/view/boo
ks/9780133467567/epub/OPS/xhtml/toc.html#page_1200https://newteachercenter.org/
?s=Oral+Language+Developmenthttps://www.readingrockets.org/teaching/reading-
basics/phonemichttps://www.lexialearning.com/3&4http://www.corestandards.org/ELA-
Literacy/https://bibliu.com/app/#/view/books/9780133467567/epub/OPS/xhtml/toc.ht
ml#page_1200https://halo.gcu.edu/resource/65e9a7e7-b47b-445f-878d-
e2364d1f4eea?nestedResourceId=e1dacb87-3bde-4e42-981f-
4205e1855109https://legitliteracy.weebly.com/concepts-of-
print.htmlhttps://www.readingrockets.org/strategieshttps://www.readingrockets.org/arti
cle/concepts-print-
assessmenthttps://sedl.org/reading/framework1.cgi?sortby=elementhttp://literacyrefere
ncelem.pbworks.com/w/page/17979971/Concepts%20of%20Print5&6https://www.ldonl
ine.org/ld-topics/assistive-technology/tech-tools-students-learning-disabilities-infusion-
inclusivehttps://bibliu.com/app/#/view/books/9780133467567/epub/OPS/xhtml/toc.ht
ml#page_1200
NEED WITHIN A FEW HRS

Article Critique: Talking Styles Use the ProQuest database to locate and read the article
entitled, “Shared Talking Styles Herald New and Lasting Romance―. Then, visit the
Language Style Matching website and, using sample written communication between you
and another person, follow the directions on the website to retrieve your language style
matching score. Write a two-page paper (excluding title and reference pages) about your
thoughts on this article and your language style matching score. In your paper, be sure to
address the following:Do you think the results provide by the Language Style Matching
website are accurate? Why or why not?Do you believe that language style matching is a
comprehensive way to predict the quality of interpersonal relationships?Be sure to
reference the ProQuest article and at least one of your other course readings from this week
in your paper. This can be your textbook or one of the recommended articles.The paper
must be formatted according to APA style. Cite your resources in text and on the reference
page. For information regarding APA samples and tutorials, visit the Ashford Writing
Center, within the Learning Resources tab on the left navigation toolbar.
NEED “A” WORK IN 7 HOURS

Read the attached article. After reading the article you will compose an article critique.
Your critique should be at (2)two full pages in length, and in the critique, you will include
the following: · The main topic/question of the article · The author’s intended
audience · A discussion of what appears to be valid or invalid in the article · A
determination of whether or not you agree with the author’s assertion and an
explanation as to why you do or do not agree · A discussion of whether or not an
employee’s behavior can be affected by his/her compensation and why you believe this
to be so Be sure that any citations or references are in proper APA format. Also, be sure to
include an APA reference to your article.
Need A++ work with low turnitin score in APA format

Assignment 1: LASA 2: Enhancing the Product WebsiteDescription of LASA:In this

assignment, you will use HTML, CSS, and JavaScript to enhance the company website that
you have been creating throughout this course.Scenario:Based on your original website
design (submitted for M3 Assignment 2 LASA 1), Acme Products has contracted you to
enhance all its web pages. The company wants you to create a beta version of the website
and an executive summary for the chief technical officer (CTO) that summarizes your
choices in the design.Tasks:Revision of Website:Apply your knowledge of internal, inline,
and external style definition and of HTML to:Design and develop an external style definition
that can be applied to all the web pages.Assess the web pages designed for M3 Assignment 2
LASA 1 and revise, as appropriate, to include inline, internal, or external style definitions. All
three forms must be present and appropriately applied throughout the pages. You will be
asked to justify your choices in the executive summary. All pages must be designed
consistently.Generate an HTML application in which users can enter their name, e-mail
address, phone number, and a comment. The web page should use JavaScript to validate
that the user has provided information for each field. The form can submit the data (which
you will not process) to your personal e-mail address.All pages that utilize external style
definition must use the same file. Inline, internal, and external style definitions must each be
present at least once in the website. You must build the website content in HTML using a
basic text editor. You may not use existing web page templates.Executive Summary:Prepare
a 1- to 2-page executive summary for the CTO on the basis of the following:Provide your
website link and justify how your choices of inline, internal, and external style definitions
are most appropriate for this situation.Discuss the reasons for using external style sheets
for sites that constitute multiple pages.Review the grading rubrics for this assignment
before you submit your website link and cover letter for grading.Note: Make sure that you
write in a clear, concise, and organized manner; demonstrate ethical scholarship in accurate
representation and attribution of sources; display accurate spelling, grammar, and
punctuation.Submission Details:Save the revised website and the executive summary in a
zip folder as M5_A1_Lastname_Firstname.zip.By Monday, July 24, 2017, submit your zip
folder to the M5 Assignment 1 LASA 2 Dropbox.LASA 2 Grading Criteria and RubricAll
LASAs in this course will be graded using a rubric. This assignment is worth 300 points.
Download the rubric and carefully read it to understand the expectations.Assignment 1
Grading CriteriaMaximum PointsDesigned and developed an external style definition that
can be applied to all the web pages.60Assessed the web pages designed for M3 Assignment
2 LASA 1 and revised, as appropriate, to include inline, internal, or external style definitions.
Ensured that all three forms are present and appropriately applied throughout the pages.
Justified the choices in the executive summary. Designed all the web pages
consistently.64Generated an HTML application in which users can enter their name, e-mail
address, phone number, and a comment. The page should use Java Script to validate that the
user has provided information for each field.40Justified how your choices of inline, internal,
and external style definitions are most appropriate for this situation.28Discussed the
reasons for using external style sheets for sites that constitute multiple pages.44Writing
Components:Organization (16)Usage and Mechanics (16)APA Elements (24)Style
(8)64Total:300
Need A++ work with low turnitin score

Assignment 3: Protecting Confidential InformationIt is becoming more common for data to

be released to unauthorized parties. With an increasingly digitized world with networked
computers, data breaches are a growing concern. The Privacy Rights Clearinghouse reports
that more than 500,000,000 sensitive records were breached between January 2005 and
August 2010 in the United States alone (Stevens, 2012).Data breaches can include theft or
loss of digital media, including computer tapes, hard drives, or laptop computers. The
criminals look for data on these computer networks. Some of the information on these
computer networks includes the following:Personal health informationFinancial
information, such as credit card or bank detailsTrade secretsInformation that is otherwise
considered privateFor this assignment, you will create a Microsoft PowerPoint presentation
on the history and effects of security breaches in IT.Scenario:You have been asked to create
a plan for the board of directors in your organization on the history and effects of security
breaches in the IT field. Within your presentation, you have been asked to include the
following:An explanation of digital forensics and what a data breach is, along with real-life
examplesYour plan for the organization to safeguard against possible data
breachesTasks:Prepare a 6- to 8-slide Microsoft PowerPoint presentation with detailed
speaker notes for each slide, aimed at the board of directors of the organization. You need
to:Define digital forensics.Explain what a data breach is. Include a summary of legal and
criminal issues related to data breaches. Support your explanation using at least two real-
life examples of data breaches. Include citations from each of this module's
readings.Illustrate your plan to protect your organization against possible data breaches.
Include specific points and measurable goals.Note: Your final product should be a 6- to 8-
slide Microsoft PowerPoint presentation, incorporating two to three scholarly sources
beyond your course textbook.Submission Details:By Wednesday, September 14, 2016, save
the Microsoft PowerPoint presentation as M1_A3_Lastname_Firstname.ppt and submit it to
the M1 Assignment 3 Dropbox.Reference:Stevens, G. (2012, April 10). Data security breach
notification laws. Retrieved from
http://www.law.umaryland.edu/marshall/crsreports/crsdocuments/ R42475_04102
012.pdfAssignment 3 Grading CriteriaMaximum PointsWrote a complete and accurate
definition of digital forensics and included appropriate scholarly sources.24Wrote a
thorough and accurate explanation of data breach and included a summary of the legal and
criminal issues related to data breaches, supported the explanation using at least two
examples, and cited references of at least three specific pieces of information.24Illustrated
the plan to protect the organization against possible data breaches and included specific
points and measurable goals.32Wrote in a clear, concise, and organized manner;
demonstrated ethical scholarship in the accurate representation and attribution of sources;
and displayed accurate spelling, grammar, and punctuation.20Total:100
need write 8 10 page paper chalice and blade riane eisler essay must be

Need to write an 8-10 page paper on “The Chalice and the Blade” by Riane Eisler. The essay
must be based on this book plus three or more other shorter sources, including websites
and journal articles. The FOCUS of the paper should be one specific aspect of the cultures
talked about in this book. The structure of the paper should be as follows: Introduction – a
brief description of your focused topic. Context – one to two short paragraphs with
historical and geographic setting details for your chosen culture, civilization, or other
topical area. Cultural description – about one page (flexible) of general description of the
important features of the culture, civilization, or topic you have chosen, e.g. family structure,
religion, economics and agriculture or other food production system, political system, etc.
Discussion and argument on your focused topic – the bulk of your paper should be devoted
to a discussion of the focused topic, for example, “Changes in the Nomadic Lifestyle among
the Fulani”, or “Childrearing practices among the Dogon” etc. You should use information
from your book (“The Human Past”)and your supporting resources such as websites or
other journal articles. Construct an argument or theme according to your interests, e.g. “the
changes in the nomadic lifestyle have been mostly detrimental for the Fulani”. Support your
argument with evidence from your resources. Conclusion: Wrap up your argument with a
succinct, well-written conclusion that brings your theme(s) together. *Be sure to cite your
references in the text as needed, especially when you make a direct or indirect quote, or use
extensive material from a particular source. Example: (Smith, 1990). Bibliography: Include
all your sources, using a professional bibliography format of your choice, e.g. MLA or APA.
need write two answer the question

There are two questions for this discussion which are based on these articles regarding the
cell phone industry.Consumer protection for cell-phones exists through the FCC.
https://www.usa.gov/phone-tv-complaints (Links to an external
site.)http://arstechnica.com/business/2014/07/industry-self-regulation-has-cost-cell-
phone-users-millions/ (Links to an external site.)
http://www.nytimes.com/2014/08/24/business/two-countries-two-vastly-different-
phone-bills.html (Links to an external
site.)http://en.wikipedia.org/wiki/Attempted_purchase_of_T-Mobile_USA_by_AT%26T
(Links to an external site.)Some argue the cellphone market is similar to a natural monopoly
due to natural barriers to entry others say that it is not a natural monopoly due to the
leasing of the towers and technology. Regardless of your position, there are barriers to
entry due and the cell phone industry is characterized as an oligopoly in the United States
and England. Use your intuition from class on Natural Monopoly as well as from class on
Oligopoly to form your responses to these questions.Should the cell phone industry be more
highly regulated (price limits on service), why or why not?Is maintaining competition a
good thing (limiting acquisitions and mergers) in this market given the outcome?
need writing for below questions in apa format

Please find the attached Textbook and need both Questions in 2-3 pages (APA
Format)Chapter 11 – According to the authors, privacy and security go hand in hand; and
hence, privacy cannot be protected without implementing proper security controls and
technologies. Today, organizations must make not only reasonable efforts to offer
protection of privacy of data, but also must go much further as privacy breaches are
damaging to its customers, reputation, and potentially could put the company out of
business. As we continue learning from our various professional areas of practice, its no
doubt that breaches have become an increasing concern to many businesses and their
future operations. Taking Cyberattacks proliferation of 2011 into context, security experts
at Intel/McAfee discovered huge series of cyberattacks on the networks of 72 organizations
globally, including the United Nations, governments and corporations. Q1: From this
research revelation in our chapter 11, briefly state, name and discuss the countries and
organizations identified as the targeted victims and why they arr targeted. What are your
suggestions for improved privacy and security readiness? Chapter 12 – Information
Governance for E-Mail and Instant MessagingChapter 12 – From the chapter reading, we
learned that e-mail is a major area of focus for information governance (IG) efforts, and has
become the most common business software application and the backbone of business
communications today. In addition, the authors provided details to support their position
by providing 2013 survey results from 2,400 corporate e-mail users from a global
perspective. The results indicated that two-thirds of the respondents stated that e-mail was
their favorite form of business communication which surpassed not only social media but
also telephone and in-person contact. Q1: With this detail in mind, briefly state and discuss
why the e-Mail has become a critical component for IG implementation?
need writing in apa format in 4 pages

Use standard APA writing and the application of the Blooms taxonomy to answer the
following questions. 4 pages without the cover page and references.1.Define and discuss the
meaning Information Governance in context of Enterprise2. Identify 5 or more questions
organizations are asking themselves about Information Governance (IG), and provide
possible answers to those questions.3.What is Continuous Improvement and why is it
critical to the success of IG program? Name 5 or more success factors for Information
Governance. 4.In line with the differences in terminologies and definitions between
Information Governance (IG), Data Governance (DG) and Information Technology
Governance (ITG), how do you see these whole areas of IT evolving in the next 5- 10 years?
What framework will you suggest to implement and IG program. Feel free to use adopt a
best practice or depict yours with a diagram. 5. How do you see yourself evolving with the
developments in IG and what difference(s) do you see this discipline making in your career?
Do you think practitioners of IG should be restricted to a specific group or spread across an
organization?
need writing in apa format with a minimum of 400 words

Chapter 14 – Information Governance for Mobile DevicesChapter 14 – From the week’s
chapter reading, we learn from the authors that, the use of mobile devices in our society
today has indeed become ubiquitous. In addition, CTIA asserted that over 326 million
mobile devices were in use within The United States as of December 2012 – an estimated
growth of more than 100 percent penetration rate with users carrying more than one
device with notable continues growth. From this research, it’s evident that mobile
computing has vastly accelerated in popularity over the last decade due to several factors
noted by the authors in our chapter reading. Q1: In consideration with this revelation,
identify and name these factors, and provide a brief discussion about them?Chapter 15 –
According to Crocker and Smallwood, cloud computing represents one of the most
significant paradigms shifts in information technology (IT) history, due to an extension of
sharing an application-hosting provider that has been around for many years, and was
common in highly regulated vertical industries like banks and health care institutions. The
author’s knowledge from their research continue to assert that, the impetus behind
cloud computing lies on the idea that it provides economies of scale by spreading costs
across many client organizations and pooling computing resources while matching client
computing needs to consumption in a flexible, real-time version. Q2: Even with this great
news about the benefits of the cloud computing applications, the authors have warned the
business user community regarding the dangers associated with cloud computing
applications. Please identify and name these grave dangers/risks that pose as concerns, and
briefly support your discussion.
Need written assignment and presentation slides

Course : security architecture and Design Deliverable :Prepare a report to address all
aspects of the case study/assignment. This report should be no less than 10 pages of
content. You need to include outside sources and properly cite and reference your sources.
You must have at least 10 references, 5 of which must be scholarly peer-reviewed articles.
In addition to the 10 pages of content, you will want a title page and a reference sheet. This
report needs to be in proper APA format. Be prepared to present a 10 minute presentation
on this assignment. Students must submit both written assignment and presentation slides
in the folder labeled "Make Up Assignment" in your iLearn course. + Assignment Topic "The
Interplay of Threats, Defense against the Threats, and Security requirements" Assignment
Discuss different approaches to balance these three different criteria. In your discussion,
provide pros/cos of each approach.
need your assistance please

SCIE207-1301B-15 Biology LabAssignment Name:Unit 4 Individual ProjectDeliverable

Length:1 pageDetails:Student InstructionsFor each assignment, you will use the M.U.S.E.
link to complete the lab.In this lab, you will observe diagrams showing the major
components of the endocrine, circulatory, and respiratory systems. Using the textbook and
virtual library resources, fill in the tables.Explore Endocrine, Circulatory, and Respiratory
Systems LabUsing the M.U.S.E. link, review the background information and animation to
complete your report. Use the Lab 4 worksheet to complete the tables.Human body systems
have a variety of interconnectivity. This lab will explore the functions and structures of the
Endocrine, Circulatory (cardiovascular), and Respiratory systems.Your lab report will
consist of the completed tables.Please submit your completed assignment.For assistance
with your assignment, please use your text, Web resources, and all course materials.Course
MaterialsPoints Possible:200Date Due:Sunday, Apr 21, 2013Objective:No
ObjectiveSubmitted Files:Submit AssignmentScore:N/AInstructor Comments:No comments
have been made
need your opinion 7

Read each paragraph and give me your opinion if you agree or disagree with
it1.Autobiographical memory encompasses our recollections of specific, personal events.”
(Holland, 2010) Examples of autobiographical memory include first days of school,
childhood memories, the first street you lived on, etc. This differs from autobiographical
facts, which are “facts about the person that are devoid of personally experienced temporal
or spatial context information.” (Goode, 2008) A common example of autobiographical facts
is birth itself. You are aware that you were born but there is no real recollection of the event
its actual occurring. Based on my experiences I would say that people are able to draw, or
“fill in the blanks” on autobiographical facts with the use of autobiographical memory. Using
the birth scenario, I do not remember my birth, but I remember my mother telling me about
my weight and the induction process and that I was stubborn then and remain stubborn
now. The use of autobiographical memories creates the ability to draw more facts.
2.Autobiographicalmemory is defined as “memory for specific experiences from our life
which can include both episodic and semantic components” (Goldstein, 2019). Typically,
autobiographical memories are the memories of personal experiences that have occurred
intertwined with the general knowledge of the facts associated with the event.
Autobiographical facts, however, typically refer to the memories of specific factual events,
from which no personal attachment is necessary, other than hearing or experiencing that
the information itself is true.An example of an autobiographical memory is the day my first
cat, Oreo was given to me. The day before my official 13thbirthday, I had a party with a
group of my friends. Before the party started, a boy from my school that had expressed an
interest in me, Philip, stopped by my house with one of our mutual friends and his father.
When I answered the door, Philip told me he was sorry he was not going to be allowed to
come to the party, but that he wanted to give me my present. There he stood with a brown
box, a litter box, cat litter, cat food and a book about caring for a kitten. Inside of the brown
box was the tiniest black and white kitten, which I inevitably named Oreo. When examining
this autobiographical memory, the semantic (facts) component would be the date, the
people, and the details about the cat. The episodic components (personal experiences)
would include the details surrounding these specific facts. From my experience and what I
have learn about the differences, I would say that autobiographical memories can influence
autobiographical facts, mainly due to the time passed and the experiences that have
occurred since the original event. For example, I could confuse the autobiographical fact of
the date of which I first received Oreo, for a variety of reasons. One reason being that the
event occurred over ten years ago. Another reason may be that my memory of the day being
my birthday party, but not the actual date of my birthday, is also concurrent with the
memory of being told Oreo’s birthdate was the day after Valentine’s Day (February 15).
After such a long period of time passing since that event, I have had quite a few animals join
my family, some I know the birthdates of and some are estimated. One of these newer furry
family members, my dog Henrik’s birthday is the day before Valentine’s Day (February 13,
2015). Therefore, with all of these variables taken into consideration it would be very
plausible to confuse the date that I received Oreo (autobiographical fact).
Need your opinion

Read each paragraph give me your opinion if you agree or disagree with it 1.Identify what
public and private stakeholders are involved in the stadium, tournament, and surrounding
infrastructure in the simulation. Stakeholders for this event include Emergency
Management, Police and Fire Departments, Stadium Commander, the local school and
hospital, plus the surrounding community and the public that will be attending along with
the soccer teams are schedule to play.Explain what you perceive as the most salient
vulnerabilities of this special event venue as it pertains to the soccer tournament Traffic on
that Monday morning is a vulnerability as it coincides with morning rush hour which could
cause issues with emergency personal being able to get to emergency situations quickly.
Also, with the traffic more accidents are possible. Crowd control is also a vulnerability as
this event will bring in a large number of people and with that increase there is potential for
unruly behavior orDescribe what steps the core planning group of this event should take to
mitigate these vulnerabilities. Having a clear traffic plan would help with directing the flow
of traffic as well as leaving certain routes open for emergency vehicles to use if a situation
arises. Also, having emergency services station at different locations would help with the
dispatching.Increasing the law enforcement present as this event and having clearly marked
off areas that the public can’t access would help control the flow of the crowd. In the
simulation, none of the emergency professionals discuss the importance of considering the
impact on specific multicultural communities.Define some of the vulnerabilities that
particular cultural communities may face. Cultures tend to have different values and
traditions that they may clash with others. Limiting all visitors to the same guidelines and
requires would help with there being no favoritism towards one culture of the other. To
help the event succeed visitors will need to follow certain rules and regulations that are
designed to keep the public safe but allow for cultural differences to be honored.2.Given
that the emergency plan has not been assessed in 10 years, it is well overdue for revision. In
10 years of time, updated procedures, new techniques in training, and new technologies in
communication and detection of disaster events have been produced. Working with old
training techniques places the emergency responders and the public in danger with new
threats surfacing that were not present 10 years ago. New procedures and training with
those procedures should be established and practiced well in advance. In the event of a
disaster, there should be a seamless flow in which all responders are well versed in their
roles to avoid needless harm from lack of preparation. New communication technologies
should be implemented to ensure each team and stakeholder is well informed and has
access to all information as it happens. Installing new computer programs and
communication technologies will ensure that the town will receive advance notice of
impending hazard events and allow the town to communicate effectively with higher
governmental domains without delay. Inspections of infrastructures will need to occur, and
business owners will need to comply to avoid further economic disarray in the event of a
disaster. Lack of mitigation, preparedness, and updates would cause the town to suffer
economically and make recovery extremely difficult and especially lengthy. The council will
be provided documentation and examples of Hurricane Katrina and the aftermath of that
disaster. The disaster of Hurricane Katrina was proof that poor communication and lack of
mitigation and preparedness caused severe detriment to the town of New Orleans that
could have been avoided with pre-planning (Koliba, Zia, & Mills, 2011).The North Carolina
Department of Public Safety in 2018 posted that new response and recovery strategies were
being implemented with businesses joining the Business Emergency Operations Center
program. Those companies donated over $20 million in 2018 to support disaster relief.
NCEM (North Carolina Emergency Management) has received over $35.7 million in state
and federal funds in 2018. Around $9.6 million was allocated towards preparedness. The
funds also are deemed for: equipment to local, state, and county agencies; training for first
responders and management staff; state and local exercises for emergency situations, flood
plain mapping; response for hazardous materials; funds to real response; recovery for
former disasters; and providing 24/7 capability in governmental agencies (Annual Report,
2018).North Carolina has suffered from multiple hurricanes and thus uses a good portion to
federal funds to mitigate and prepare for flooding and disaster from hurricanes. The budget
appears to allocate appropriate funding for mitigation and preparedness. In the real case
scenario, the state has been fairly successful at maintaining the economy and recovering
from past hurricanes.3As I read in the Office of Budget and Management (OBM), I see the
City of Chicago’s budget for the current year of 2019. It looks as though there is an overall
decrease in the Office of Emergency Management and Communications under the Fund
Source(s) between Appropriation in 2018 ($ 291,423,019) and the Recommendation for
2019 ($ 233,860,841). (chicago.gov). On the other hand, I see an increase under the same
Fund Resource category in the Emergency Communication Fund , from $101,305,015 in
2018 Appropriation to $ 102,138,813 in the 2019 Recommendation. (chgo.gov). As the
Emergency Management description reads, it states that within this program , it prepares
Chicago for significant incidents (human caused, natural & technological ) emergencies ,
planned events , as well as providing disaster and recovery assistance to the residents &
institutions. This also mitigates the effects of catastrophic events & provides operational
coordination from a 24/7 Ops Center.(chgo.org). Although I am not a budget analyst , I do
see that this budget has not been looked at for 10 years, and our times and society has
changed. Technology has advanced as well as the the events our emergency responders
need to attend to whether planned or not. As I’m sure we are aware of the threat of
terrorism and cyberattacks as well as the natural disasters that come unexpectedly , we
need to be 10 steps ahead of the game and ready to deploy our emergency teams when
needed. Our CPD have faced numerous hurdles and increasingly need the City’s support. So,
do I feel this budget is adequate for one of the biggest City’s in the U.S that had one of the
largest crime rates and why? I feel as of now , we are on the right track. It took a lot of time
and there was much scrutiny of the CPD. If we consistently receive the backing and support
(both financial and moral), we as a city will see hopefully see an ongoing decrease. But it
takes the people themselves to make a difference. We have already seen a decline in gun
violence, and in 2018 there was a high level of partnership with local and federal LE
agencies including the FBI, ATF, DEA, and the U.S. Atty’s Office. (chicagopolice.org).
Manpower within the CPD has improved and the City saw an increase in adding 1,000 new
officers in under 2 years. (chicagoolice.org). Technology enhances police strategy and the
City saw a rollout of SDSC (Strategic Decision Support Centers ) in 20 police districts.
(chicagopolice.org). I do not see what area we can do differently in the budget but my
suggestion would be having an outside party look at the total picture that this is their forte
and has a strong background in budgeting, analysis and forecasting on a large scope.
Resource(s):
Need your skills

Emerging Economies and GlobalizationBackground Markets in developed economies are

approaching saturation level. Therefore, MNCs are searching for new untapped markets in
emerging countries such as India and China. Since the healthcare industry will continue to
grow in the future due to the size of the global population and its age composition, General
Electric Healthcare (GEH) is trying to capitalize on these trends. It is expanding its
operations and development of new drugs and manufacturing of the medical equipment in
India and China.Directions Read the following articles:At least one peer-reviewed article
related to the trade theories in general as well as for China and IndiaArticles related to the
human resource management for MNCs, cross-cultural management, expatriate training,
and expatriates’ success/failure in overseas assignmentsArticles related to GEHThen,
respond to the following:Select two trade theories that best explain why GEH expanded its
operations of developing new drugs to India, and manufacturing X-ray business to
China.Explain the selected theories, and then evaluate GEH’s reasoning.Explain possible
pitfalls for such strategy from GEH’s perspective.Identify solutions to the possible
pitfalls for the strategy.For each operation (India and China), evaluate GEH’s human
resource strategy.Identify how you would design training for preparing expatriates for their
assignments to India and China if you were in charge of their training prior to the overseas
assignment.Write a 7–10-page paper in Word format. Utilize at least five to seven
scholarly sources in your research. Apply APA standards to citation of sources.
Greetings, Need your support with the attached case study. Please

Greetings,Need your support with the attached case study.Please make sure to answer
within the range of required words for each question (250-300).
needed after 12 h

2 pages10$ after you read the book Kliebard pp. 1-75 Week one you only have readings to
do for tomorrow’s class. For this week, you will post a reflection to the discussion area
under Questions and Contentions. This posting is an analysis of the week’s readings. You
must post at lease a one page My teacher sends it that to me now On a weekly basis,
beginning with Week 2, students will be responsible for submitting, via Black Board, their
“Qs and Cs” for the week. More than just a review of the reading materials, “Qs
and Cs― are reflections, syntheses, and opportunities to theorize about the week’s
readings. ·What questions do they raise? ·At what points do you find the texts
contentious to your perspective? ·Can you articulate your contention? The readings are
grouped together that readers might approach the topic from multiple points. However,
there will be connections to be made between each reading. ·A Questions and Contentions
that meets all requirements is lucid, thoughtful, exploratory and pertinent to the week’s
topic as well as attendant to the links between the week’s readings. ·The “Qs and
Cs― will be graded using a check mark (excellent-20), and “S― (satisfactory-15)
and a “U― (unsatisfactory-0). They will be due each Monday at 11:59pm via the
Discussion Board in Blackboard. . You will then be responsible for at least one response to
each of your classmates original positing. (2 pages single-spaced for each posting). This is
what teacher wantsneeded after 12 h as max
needed asap 1

Case Scenario #1 You are the chief Environmental, Safety and Health (EHS) professional for
your small municipallity and it is the first work day after the Christmas Holiday. You are
settling in and looking forward to the typically nice and quiet period until the end of the
year. So quiet of a time it generally is that you decided, for once, to let the rest of your staff
enjoy the holidays with friends and family. The day has gone well, as you had expected and
it is a little after noon when you receive your first phone call of the day. The voice on the
other end of the phone is a familiar one and after you exchange season pleasantries you are
informed that there was a car fire in the City Hall parking lot and during the fire the car
battery was destroyed, spilling its contents on the ground and possibly into the stormwater
system. Does this present an environmental hazard and if so does it need to be cleaned up?
Who should do the clean up? How should any material recovered from this site be disposed
of? Can it be put into the city landfill? What if it is mixed with sand or an absorbent material
such as kitty litter? What potential hazards, if any, does this situation present to the
stormwater system? Who, if anyone, needs to be notified? Case Scenario #2 One of your
personnel discovers containers placed in the wood line at the edge of your facilities
property. The containers (3-55 gallon drums and some old 5-gallon paint pails containing
some dried and some still wet latex paint; in addition there are several cans that are labeled
as solvent based paint) are too old to determine the rightful owner or the contents within.
One 55 gallon drum is sealed yet it appears to be “bulging”. The other one has no more than
one inch of residue remaining on the bottom. The third 55 gallon drum is labelled “mirror
backing paint – contains lead pigment”. It’s outside condition is good, but it appears to be
almost 50% full. For the one 55-gallon drum that is open, according to RCRA is it empty?
Provide the regulatory citation (section) for your response. What should be done with
the bulging 55 gallon container and the mirror back paint drum? What should be done
with the old paint cans – the latex and solvent based cans?
Needed before next Monday

1,500-1,800 wordsDetails:Weekly tasks or assignments (Individual or Group Projects) will

be due by Monday and late submissions will be assigned a late penalty in accordance with
the late penalty policy found in the syllabus. NOTE: All submission posting times are based
on midnight Central Time.In this course you have been exposed to many authors, genres,
writing styles and themes. For your Key Assignment, you will reflect on what you learned
from the works of fiction, poetry and drama you have read and consider the impact
literature has had—and will hopefully continue to have—on your own life.Please write a
final paper of 1500 words or more discussing the following questions. Be sure to begin your
paper with an engaging introduction and clear thesis statement, develop each point in the
body of your paper using examples and quotes from the assigned readings, and conclude
your paper with a restatement of your thesis and closing remarks. As always, be sure to
maintain your credibility by including in-text citations and a reference list correctly
formatted in APA style.Short Stories: Analyze the elements of fiction, including setting,
characters, point of view, plot, symbolism, themes, tone and irony. Cite specific examples
from the assigned stories for each element. Which of the short stories we read was your
favorite, and why? Give several reasons.Poetry: Break down the elements of poetry,
including imagery, figurative language, symbolism, word choice, themes, tone and sound.
Cite specific examples from the assigned poems for each element. Which of the poems we
read was your favorite, and why? Share several reasons.Drama: Review the elements of
drama, including setting, characters, plot, stage directions, symbolism, themes and dialogue.
Cite specific examples from Trifles for each element. How has reading the play deepened
your understanding of live performances, television dramas and movies?Values and Morals:
Values and morality have been recurring considerations in many of our assigned works.
Talk about personal values and moral codes as they are conveyed in each of the following:
one short story (chosen from the Phase 1 or Phase 2 reading lists), one poem (chosen from
the Phase 3 reading list), and the play,Trifles.Which of all the works we’ve read is your
favorite and why? In what ways do you think it will make a lasting impact on you personally
and professionally?Final Considerations: Discuss how literature can provide “a reflection of
life” which can help us understand our own struggles, triumphs, values and moral codes and
increase our empathy for others. What is one thing you learned about yourself this term as a
result of gazing into literature’s “mirror?”
NEEDED FOR LESS THAN 4 HOURS PLEASE Conduct research either

NEEDED FOR LESS THAN 4 HOURS PLEASE Conduct research either using the textbook
and/or online website and provide a summary of the following concepts. The format of
your paper must follow APA format guidelines only to the extent you properly include in-
text citations to document where you got your information.• Discuss: the core concept of
sound and how sound is propagated• Discussed the characteristics of waves (velocity,
refraction, reflection, constructive and destructive interference• Discussed the concept of
Resonance• Discussed the concept of the nature of electricity and its characteristics•
Describe how electricity converts to power and work• Explain the danger associated with
electricity and some of the safety precautions one can take• Differentiate between series
and parallel circuits and why this is important.
Needed help in Finance

New Business Loan - Assume that you are planning to purchase a business in 10 years. You
anticipate the purchase price will be $500,000 and you will need a 20% down
payment.Assume that you are planning to purchase a business in 10 years. You anticipate
the purchase price will be $500,000 and you will need a 20% down payment.At a 6% rate of
return, how much do you need to save each year to accumulate the down payment?If you
need 25%, and the rate of return is 5%, how much do you need to save each year?For the
percentage of the price you need to borrow, and considering the current phase of the
business cycle, would you prefer a fixed or variable rate loan, assuming that you will have a
10 year payoff? Why?Now assume that you will own the business for 15 years, and that it
will grow at an annualized rate of 12%. Using the same $500,000 purchase price, what will
be your selling price at the end of 10 years?Thoroughly explain and answer the questions
above in a Word document.
Needed in 3 hours Answer the following questions: Chapter 15:

Needed in 3 hours Answer the following questions:Chapter 15:1) Questions for Review: 15-
1, 15-415-1 Explain the role of accountants and distinguish among the kinds of work done
by public accountants, private accountants, management accountants, and forensic
accountants.15-4 Explain the key standards and principles for reporting financial
statements.2) Application Exercises: 15-915-9 Interview an accountant at a local business,
nonprofit organization, or government entity. How does the firm use budgets? How does
budgeting help managers plan business activities? How does budgeting help them control
activities? Give examples.Please provide the name of the Accountant you interviewed. You
can choose an accountant of your choice.Chapter 16:1) Questions for Review, 16-1 – 16-
2,16-1 Define money and identify the different forms that it takes in the nation’s money
supply.16-2 Describe the different kinds of financial institutions that compose the U.S.
financial system and explain the services they offer.ReferenceEbert, R. J., & Griffin, R. W.
(2018). Business Essentials (12th Edition). Pearson Education
(US). https://bookshelf.vitalsource.com/books/9780134728759Requirements: To be
answered
Needed in 3 hours

Define your theory:•What is YOUR theory of character education? Provide three salient
points. Explain how your theory was implemented in practice this past week:1.Which point
from your theory of character education was implemented in practice this past week?
2.Briefly describe how you applied this point from your character education theory. How
was it implemented? Did the implementation have an impact on the setting in some way?
Explain. 3.What was the outcome of the implementation of this point from your character
education theory? Explain. 4.On a scale of 1-5 with 5 being the best, rate your
implementation of this point from your character education theory in terms of impact on
the setting in which it was applied. Explain your answer. 5.Reflect on the past 5 weeks. Give
a specific example of a strategy from this class that you implemented which impacted your
teaching. How did it impact your teaching? 6.Give a specific example of a strategy from this
class that impacted student learning in your classroom. How did it impact student learning?
NEEDED IN 8 HOURS. EXACTLY 8 HOURS. I WILL ONLY PAY 6. READ FIRST!!!!!

i will only pay six for TWO pages. text me if intrestedREAD THE CASE STUDY BELOW AND
ANSWER THE QUESTION Case 5, “Bargaining Strategy in Major League Baseball” case
study Evaluate the benefits (tangible and intangible), costs, and risks associated with
Donald Fehr negotiating the 2006 season compensation packages from the perspective of
Donald Fehr and the team owners
needed the below discussions posted below

In order to receive full credit discussion posts must include at least 2 scholarly references in
APA format, a detailed initial post1.Introduce and discuss a relevant issue regarding
Emerging Threats. 2.Introduce and discuss a relevant issue regarding Security in SDLC
versus Agile.3.I wish you all the best as you pursue educational and professional
development in the Information Technology field. IT is an exciting, dynamic environment
where we should consider education a life-long journey, rather than a destination. Provide a
brief or in-depth response of the class focusing on how the class can improve for future
students. No references are needed for this assignment. Suggestions below:How would you
improve the material for future classes?What sources of information would you add?Where
should there be deeper dives in material?Should there be more or less assignments?Any
other feedback?
needed URGENTLY

Financial Prospectus Content PaperPrepare the first seven components of your venture’s
Financial Prospectus. The Financial Prospectus must include the information you provided
in the individual assignments from Week One and two, revised as necessary based on
material covered in subsequent workshops and organized with new material added as
necessary. (400 WORDS)