Download as PPT, PDF, TXT or read online from Scribd
Download as ppt, pdf, or txt
You are on page 1of 53
Advances in the
Management of Non Small
Cell Lung Cancer Presenter Disclosures Personal financial relationships with commercial interests relevant to this presentation during the past 12 months:
Research support: Eli Lilly, Genetech, OSI pharmaceuticals Personal financial relationships with non-commercial interests (e.g., government or other nonprofit funding) relevant to this presentation, within past 12 months:
Relevant institutional financial interests:
Personal financial relationships with tobacco industry entities within the past 3 years:
No relationship to disclose
Jemal, CA Cancer J Clin 2008; 58: 71 Cancer Incidence Deaths
Colon 108,070 49,960 Breast 184,450 40,930 Prostate 186,320 28,660 Total 478,840 119,550 NSCLC Epidemiology Lung 215,020 161,840 Statistics for 2008 NSCLC: Stage at Diagnosis Stage IV 40% Stage I 10% Stage II 20% Stage IIIA 15% Stage IIIB 15% Ettinger et al. Oncology. 1996;10:81-111. Adapted with permission from Schiller JH et al. N Engl J Med. 2002 1 yr survival plateau at about 35-40% No clear efficacy benefit for non-platinum combinations or triplet combinations New paradigm is needed Cisplatin/Paclitaxel Cisplatin/Gemcitabine Cisplatin/Docetaxel Carboplatin/Paclitaxel 1.0 0.8 0.6 0.4 0.2 0.0 0 5 10 15 20 25 30 Months Stage IIIB/IV Patient Survival, % We had reached a Ceiling for Improved Benefit of Cytotoxic Chemotherapy in Advanced NSCLC ECOG 1594 Platinum Doublet Chemotherapy in Advanced NSCLC 1
1. NCCN Non-small Cell Lung Cancer Clinical Practice Guideline, v.2.2008. Available at: http://www.nccn.org/professionals/physician_gls/PDF/nscl.pdf 2. Frasci et al. J Clin Oncol. 1999;17:2316-2325 3. Kelly et al. Clin Cancer Res. 2000;6:3474-3479.
Non-Platinum Chemotherapy Single Agent Chemotherapy
Strategies to improve treatment effectiveness Better Patient Selection: What criteria?
Better Predictive Markers: Which ones?
Better Treatments: Less toxic More specific
Cisplatin 75 mg/m 2 day 1 plus Gemcitabine 1250 mg/m 2 d 1 & 8 Randomization Factors
Stage PS Gender Histo vs cyto dx Brain mets hx
R Cisplatin 75 mg/m 2 day 1 plus Pemetrexed 500 mg/m 2 d 1
Vitamin B 12 , folate, and dexamethasone given in both arms
Role of Histology in Patient Selection: JMDB Trial: Pemetrexed-Cisplation vs Gemcitabine-Cisplatin in Adv NSCLC Scagliotti & Gandara: JCO, 2008 1st-line NSCLC: Preplanned Analysis Pemetrexed+cisplatin Median OS: 12.6 mos Gemcitabine+cisplatin Median OS: 10.9 mos HR=0.844 (95% CI: 0.710.98) p=0.011 Pemetrexed+cisplatin Median OS: 9.4 mos Gemcitabine+cisplatin Median OS: 10.9 mos HR=1.229 (95% CI: 1.001.51) p=0.051 Nonsquamous* (n=1252) Squamous (n=473) Survival Time (months) Survival Time (months) S u r v i v a l
P r o b a b i l i t y
S u r v i v a l
P r o b a b i l i t y
* Non-squamous = adenocarcinoma, large cell carcinoma, and other/indeterminate NSCLC histology Scagliotti, et al. J Clin Oncol 2008 JMDB Trial: Cisplatin-Pemetrexed (CP) vs. Cisplatin-Gemcitabine (CG) in Adv NSCLC No difference in overall PFS or Survival between study arms CP improves Survival over CG in Non-SCCA (HR 0.81, p=0.005)
CG improves Survival over CP in SCCA (HR 1.23, p=0.05)
Ligand: IGF-I, IGF-II. Local bioavailability subject to regulation by binding with IGF-BP and release by IGF-BP protease IGF-IR: binds to IGF-I, II IGF-IR/IR-A: Hybrids with preferential binding to IGF-1 >> insulin. IR exists in two isoforms: IR-B: traditional insulin receptors. IR-A: preferentially binds IGF-II (a fetal form; re-expressed in some tumors) IGF-IIR: non-signaling receptor, acting as a sink for IGF-II. Insulin/IGF Receptor System
Hybrid Receptors C N N IGF-IR IGF-IIR IGF Binding Proteins (M6P-receptor) C C C IGF-I IGF-II N N IR-A IR-B C C C C N N N N Insulin RAS /MAPK mitogenesis PI3K/AKT survival 4 0,1 1 10 Adjusted Relative Risk Colorectal cancer Ma et al, 1999 Kaaks et al, 2001 Probst-Hensch et al, 2001 Giovannucci et al, 2000 Prostate cancer Stattin et al, 2000 (<59yrs) Stattin et al, 2000 Harman et al, 2000 Chan et al, 2002 Breast cancer Toniolo et al, 2000 (premenopausal) Toniolo et al, 2000 Hankinson et al, 1998 Hankinson et al, 1998 (<50yrs) Lung cancer London et al, 2002 Lukanova et al, 2000 Bladder cancer Zhao et al, 2003 Ischemic Heart disease IGT/NIDDM Osteoporotic fractures Juul et al, 2002 Sandhu et al, 2002 Garnero et al, 2000 IGF-I and risk of Cancers prospective population-based case-control studies 2:1 randomization N=150, 2 stages of 73 and 77 pts TC: paclitaxel 200 mg/m 2 , carboplatin (AUC=6) TCI: paclitaxel 200 mg/m 2 , carboplatin (AUC=6), Stage 1: CP-751,871 10 mg/kg Stage 2: CP-751,871 20 mg/kg TCI n=97 n=53 CP-751,871 Single agent Optional upon progression on TC alone CP-751,871 Single agent IGF1R Inhibitor Therapy: Randomized Phase II Trial Paclitaxel/Carboplatin +/-CP-751,871 in advanced NSCLC Karp: ASCO 08 TCI: paclitaxel 200 mg/m 2 , carboplatin (AUC=6) CP-751,871 20 mg/kg Stage 3: single-arm, post-study extension in SCC n=30, 14 pts evaluable Response Rate by Dose and Histology Histology TaxCarbo TaxCarbo + CP (10mg/kg) TaxCarbo + CP (20mg/kg) Squamous (randomized) 6/13 (46%) 4/7 (57%) 7/9 (78%)
Squamous (single arm) 11/14 (78%) Adenoca 5/20 (25%) 8/21 (38%) 16/28 (57%) NOS 8/15 (53%) 3/6 (50%) 9/18 (50%) Karp: ASCO 08 -100.0 -80.0 -60.0 -40.0 -20.0 0.0 20.0 40.0 Major Responses of TCI in Bulky Squamous RR 78% vs 57% October 2005 February 2006 August 2007 October 2007 April 2008 November 2007 BEST RESPONSE IN VISCERAL LESIONS > 5 cm 0 mg/kg 20 mg/kg 10 mg/kg C h a n g e
i n
L e s i o n
s i z e
Choice of treatment according to histology: Adenocarcinoma: Pemetrexed based Squamous cell carcinoma: Gemcitabine based Pac/carbo + IGF inhibitor CP 27181 1 6 ? Histology will ultimately prove to be Suboptimal for Selecting Chemotherapy (or Targeted Therapy) Histological sub typing groups tumors based on microscopic pattern recognition by a pathologist (using 18 th century technology) At best, Histology is the phenotypic expression of complex genetic and molecular interactions 21 st century approach will refine choice at the molecular level
Robert Hooke Tissue Microarray TS SCLC High TS Squamous High TS Adeno Low TS Thymidylate Synthtase Expression in Lung Cancer Bhattacharjee PNAS 2001 Possible explanation to SQCCA sensitivity to CP 721871 De-regulation of the IGFR pathway seems a possibility in squamous cell carcinoma:
ILGF binding protein 3 levels, which regulates activity of IGF-1, are low in SQCCA
IGF-R appears to be expressed more in SQCCA
IGF-IIR gene which codes for a negative regulator of the IGF-IR pathway is mutated in up to 60% of SQCCA Karp JCO 2009 Strategies to improve treatment effectiveness Better Patient Selection: -What criteria?
PI3k P P P P IGF-1R/ IR HER C-MET P P P P P P P P EGFR HGF IGF-1/ Insulin Src Ras Ras Raf MEK Erk PIP3 PTEN PIP2 PDK-1 Akt raptor mTOR rictor mTOR p70s6k 4EBP Hif-1 Protein Translation FoxO3a Transcription Angiogenesis Cell Cycle Progression Proliferation Differentiation BAD Apoptosis Anti-HER Lapatinib BMS599626 BMS690514 PF00299804 XL647 BIBH2992 ARRY334543 Anti-cMET XL880 ARQ197 PF02341066 JNJ388 MGCD265 SU11274 PHA665752 HGF mAb AMG102 OA5D5 IGF-1 mAb CP721871 AMG479 IMC-A12 R1507 BIIB022 Anti-IGF-1R XL228 OSI906 NDGA Anti-Src Bosutinib XL999 AZD0530 KX010107 Anti-mTOR Everolimus Deforolimus UCN01 Anti-Akt Perifosine GSK690693 Anti-PI3k PI103 BGT226 BEZ235 XL765 XL147 Anti-Ras Tipifarnib Lonafarnib BMS214662 Anti-Raf Sorafenib RAF265 XL281 PLX4032 Anti-MEK AZD6244 RDEA119 XL518 IRS Anti-DNMT 5-azacitadine 5-aza-2-deoxycitidine Anti-HDAC SNDX275 CI994 Apicidin Desipeptide Trapoxin Depeudecin SK7068 vorinostat The trick is: To pick right target To have the right agent To have the right pairing Many Targeted Therapies Failed to Show Additional Benefit when Combined with Platinum Based CT Median Survival results in months Placebo Agent INTACT-1
CG gefitinib 10.9 9.9/9.9 NS INTACT-2
CP gefitinib 9.9 9.8/8.7 NS TRIBUTE
CP erlotinib 10.5 10.6 NS TALENT
CG erlotinib 10.0 10.3 NS SPIRIT-1
VC bexarotene 9.9 8.7 NS SPIRIT-2
CP bexarotene 9.2 8.5 NS Paz-Ares et al.
CG aprinocarsen 10.4 10.0 NS ISIS-3521
CP aprinocarsen 9.7 10.0 NS AG-3340-017
CG prinomastat 10.8 11.5 NS BR.18
CG BMS-275291 9.2 8.6 NS Study 5404 CP panitumumab 8.0 8.5 NS ESCAPE CbP sorafenib Phase III study stopped due to high mortality BR.24 CbP cediranib Will not proceed to Phase III because of toxicity Courtesy: E. Vokes
Bevacizumab Blocks Angiogenesis
Recombinant humanized monoclonal antibody to VEGF-A E4599. Ph III RCT :Bevacizumab and CP vs CP in non-squamous NSCLC R A N D O M I Z E Paclitaxel 200 mg/m 2 IV Carboplatinum AUC 6 q 21d X6 cycles Paclitaxel 200 mg/m2 IV + Carboplatinum AUC 6 q 21d X6 cycles Bevacizumab 15mg/kg q3 wk til PD Stratification by: Stage (IIIB or IV) Geographic region Sandler. NEJM 2006; 355: 2542 IIIB and IV non-squamous No brain mets No hemoptysis No prior chemotherapy
HR: 0.79, 0.67-0.92 P = .003 Pac/carbo + bev, n=434 51% 23% Pac/carbo, n=444 44% 15% 0.0 0.2 0.4 0.6 0.8 1.0 P r o p o r t i o n
s u r v i v i n g
0 6 42 48 18 30 12 mo 24 mo 12 24 36 Months 12.3 10.3 Sandler AB, et al. New Engl J Med. 2006;355:2542-2550. ~37% of patients with advanced NSCLC are eligible to receive bevacizumab, <20% if also exclude age 70 years
Phase III ECOG 4599 trial: Paclitaxel/Carboplatin Bevacizumab Non-Squamous histology, no hemoptysis, brain metastases PC n=427 PCB n=420 Hemorrhage Hemoptysis 0 5 GI Bleed 1 2 Neutropenic Fever 1 5 CNS 0 2* Pulmonary Embolus 0 1 Total 2 15 ECOG Trial (E4599): Treatment Related Deaths* Sandler AB, et al. New Engl J Med. 2006;355:2542-2550.
Just when you think youve got it right.. 2 8 AVAIL Study design PD PD PD Bevacizumab Bevacizumab 2 2 1 1 Placebo 7.5 + CG Bevacizumab 15mg/kg + CG Bevacizumab 7.5mg/kg + Cis/Gem (CG) Placebo 15 + CG Previously untreated, stage IIIb, IV or recurrent non-squamous NSCLC N=1050 R A N D O M I Z E Manegold, et al. ASCO 2007, LBA 7514 Positive for primary endpoint: PFS Negative for Overall Survival AVAIL Efficacy Placebo CG Bevacizumab 7.5 mg/kg +CG Bevacizumab 15 mg/kg +CG PFS (mos) 6.2 6.8 HR 0.75 (0.64-0.87) P= 0.0003 6.6 HR 0.85 (0.73-1.00) P=0.0456 OS (mos) 13.1 13.6 HR 0.93 (0.78-1.11) P=0.42 13.4 HR 1.03 (0.86-1.23) P=0.76 The 1 o endpoint for the trial: PFS So that this was reported as a positive trial But is it really clinically significant? Epidermal Growth Factor Receptor (EGFR) Inhibitors in NSCLC: Status of Predictive Biomarkers Signal Transduction Blocked Signal Transduction Blocked TKI MoAb Ligand K K TKI K K Gefitinib Erlotinib
Single Agent EGFR mut=predictive EGFR FISH=predictive KRAS mut=predictive
TKIs + Chemo are negative (INTACT I/II TRIBUTE, TALANT all negative) Cetuximab
Single Agent Biomarkers Unclear
Cetux + Chemo
(FLEX=positive)
IgG1 monoclonal antibody Binds to EGFR and competitively inhibits ligand binding (e.g. EGF) Mechanisms different from TKI: Receptor Internalization Antibody-Dependent Cellular Cytotoxicity (ADCC) Combinations with Radiation or Chemotherapy effective in other tumor types Radiation: H & N Cancer Chemotherapy: Colon Cancer Harari: Clin Cancer Res, 2004 Cetuximab EGFR ADCC IgG1 MAb Cetuximab Mechanism of Action Chemotherapy- nave advanced NSCLC Vinorelbine 25 mg/m 2 d1,8 + cisplatin 80 mg/m 2 d1, Q3W FLEX: Pivotal Trial Cetuximab + Chemotherapy in 1 st -Line Advanced NSCLC Primary endpoint: OS
Secondary endpoints: PFS, ORR, DCR, QoL, Safety, PK n=557 n=568 Cetuximab 400 mg/m 2 d1 wk1, then 250 mg/m 2 , QW + Vinorelbine 25 mg/m 2 d1,8 + cisplatin 80 mg/m 2 d1, Q3W R A N D O M I Z E Up to 6 cycles of chemotherapy; patients not progressing continue on cetuximab maintenance Stratified by IIIB or IV ECOG PS 0,1 or 2 All histologic subtypes included ECOG PS 02 No known brain metastases EGFR expression by IHC (1 positive tumor cells) Pirker R, et al. Lancet 373(9674): 1525 1531, 2009. FLEX: Results CV + Cetuximab CV P RR 36% 29% 0.012 PFS 4.8 mos 4.8 mos NS TTF 4.2 mos 3.7 mos 0.015 NS=not significant; TTF=time to treatment failure. Months O S
( % )
Median OS 1-Yr Surv. CV + Cetuximab 11.3 mos 47% CV 10.1 mos 42% HR: 0.871; P=0.044 Pirker R, et al. Lancet 373(9674): 1525 1531, 2009. FLEX: Differences in Ethnicity Caucasian (N=946) Asian (N=121) Prognostic Factors Adenocarcinoma 44% 72% Female 27% 46% Never smoker
17% 52% ECOG PS 0/1 81% 94% Poststudy Treatment EGFR TKIs 17% 61% Median OS 9.6 mos 19.5 mos [95% CI] [9.010.4] [16.423.3] Pirker R, et al. Lancet 373(9674): 1525 1531, 2009. FLEX: Asian Subgroup (N=121) CV + Cetuximab (N=62) CV (N=59) P Value Baseline Prognostic Factors Adenocarcinoma 65% 80% Post-Study Treatment EGFR TKIs 50% 73% OS 17.6 mos 20.4 mos NS RR 50% 44% NS Cannot draw definitive conclusions because of small sample size (10% of total), differences in histology and differences in post-study EGFR TKI treatment Pirker R, et al. Lancet 373(9674): 1525 1531, 2009. Median OS 1-Year Survival CV + Cetuximab (N=466) 10.5 mos 45% CV (N=480) 9.1 mos 37% HR=0.803; P=0.003 FLEX: OS Caucasians (N=946) Prespecified Analysis Months P value: stratified log-rank test (2-sided) O v e r a l l
S u r v i v a l
( % )
Median OS CV + Cetuximab CV HR Caucasians (N=946) 10.5 mos 9.1 mos 0.803 Adenocarcinoma (N=413) 12.0 mos 10.3 mos 0.815 Squamous Cell (N=347) 10.2 mos 8.9 mos 0.794 Other (N=185) 9.0 mos 8.2 mos 0.807 CV=cisplatin/vinorelbine. Pirker R, et al. Lancet 373(9674): 1525 1531, 2009. CV + Cetuximab Any grade Grade 0 OS 15.0 mos 8.8 mos RR 44% 28% PFS 5.4 mos 4.3 mos O v e r a l l
S u r v i v a l
( % )
Months Any grade: CT + Cetuximab (N=290) Grade 0: CT + Cetuximab (N=228) HR=0.631 (95% CI: 0.515-0.774)* P<0.001 Patients at Risk Grade 0 228 145 88 54 15 0 Any Grade 290 238 163 101 38 3 *Landmark analysis. FLEX: OS Early Acne-Like Rash Pre-Planned Analysis Gatzemeier et al, JTO 2008, Vol 3, No. 11, S4 (abstract 8) Cetuximab + Platinum-Based Chemotherapy in 1st line NSCLC: Consistent Efficacy *Randomized to concurrent vs sequential cetuximab;
Randomized to pac/carbo q3w vs pac qw/carbo q4w
Pac qw/carbo q4w
* *Press release Aug 2008 Reference Phase Regimen N ORR, % TTP/PFS, m OS, m Thienelt et al, 2005 I/II Cet + pac/carbo 31 26 5 11 Robert et al, 2005 I/II Cet + gem/carbo 35 28.6 5.5 10.3 Herbst et al, 2007 II Cet + pac/carbo 204 34/31* 4/4 11/11 Socinski et al, 2009 II Cet + pac/carbo 168 29.6/25
4.7/4.3 11.4/9.8 Langer et al, 2007 II Cet + pac/carbo
53 57 5.5 13.8 Belani et al, 2007 II Cet + doc/carbo 76 14.5 4.7 11 Rosell et al, 2008 II Cet + vin/cis 43 35 5.0 8.3 Kim et al, 2008 II Cet+ bev/pac/carb 99 53 7 14.0 Butts et al, 2007 II Cet + gem/pla 65 27.7 5.1 12.0 Lynch et al, 2007 III Cet + tax/carbo 338 25.7 4.4 9.7**
Pirker et al, 2009 III Cet + vin/cis 1125 36 4.8 11.3 Structure of the EGFR-ATP Binding Site Red: deletions Light blue: missense mutations Dark blue: gefitinib From: Lynch TJ et al. N Engl J Med. 2004;350:2129-2139. Exons 18, 19, 20 and 21- Tyrosine kinase domain
In frame deletions and missense mutations
Individualizing Anti-EGFR Therapy: Methodology EGFR mutation status by gene sequencing EGFR gene copy number by fluorescence in situ hybridization (FISH) EGFR protein expression by immunohistochemistry (IHC) Serum Proteomics by MALDI MS GGCGGGCCAAACTGCTGGGTGCG NCIC-C BR.21 TRIAL NSCLC 1 prior combination regimen (no more than 2) Elderly may have had single-agent No requirement for PD R A N D O M I Z E Erlotinib 150 mg daily n=488 Placebo n=243 Shepherd et al.NEJM, 2005 *HR and P-value adjusted for stratification factors at randomization plus HER1/EGFR status. BR-21 Overall survival: all patients 42.5% improvement in median survival S u r v i v a l
1.00 0.75 0.50 0.25 0 0 5 10 15 20 25 30 31% 21% Log-rank: p=0.13 HR=0.73 (0.49, 1.10) BR.21 Survival According to EGFR Mutation p value for interaction = 0.97 No mutation 100 80 60 40 20 0 P e r c e n t a g e
0 6 12 18 24 30 Months Erlotinib Placebo + EGFR mutation 100 80 60 40 20 0 P e r c e n t a g e
Months Erlotinib Placebo Log-rank: p=0.45 HR=0.77 (0.40, 1.50) 0 6 12 18 24 30 EGFR Mutation is NOT a Prognostic Marker BR.21: EGFR FISH predicts Survival Log-rank: p=0.008 HR=0.44 (0.23, 0.82) Log-rank: p=0.59 HR=0.85 (0.48, 1.51) BR21 FISH + BR21 FISH - Time (months) 0.0 0.2 0.4 0.6 0.8 1.0 0 6 12 18 30 24 Erlotinib Placebo Time (months) 0.0 0.2 0.4 0.6 0.8 1.0 0 6 12 18 30 24 Erlotinib Placebo Tsao: NEJM, 2005 FISH positivity is a prognostic marker Biomarkers for EGFR-directed Therapy: Summary of Current Status EGFR TKIs EGFR protein (IHC) equivocal for predictive value EGFR mutation predicts response EGFR FISH predicts survival (BR.21) KRAS mutation predicts lack of activity Cetuximab EGFR protein (IHC): selection factor for FLEX EGFR mutation: not predictive (preclinical) EGFR FISH: conflicting data (S0342, BMS-099) KRAS mutation: not predictive (S0342, BMS-099) N0723: Predictive Marker Study Design 2 nd line NSCLC with specimen Initial Registration FISH Testing EGFR FISH + (~ 30%) EGFR FISH (~ 70%) Erlotinib Pemetrexed Erlotinib Pemetrexed Strata Randomize Outcome 1 PFS 2 OS, ORR
Power: validation of EGFR FISH as predictive biomarker 90% to detect 50% PFS improvement favoring erlotinib in FISH+ 90% to detect 30% PFS improvement favoring pemetrexed in FISH > 90% to detect interaction SWOG: Tumor repository & EGFR pathway analysis NCCTG (Study Chair: Alex Adjei) + CALGB, ECOG, SWOG, NCIC Others: C-Path & industry partners, Pharma 957 patients 4 years accrual, 1196 patients 1-2 years minimum additional follow-up Possible Selection Factors for Individualizing Therapy of NSCLC Characteristic Drug Class Population Clinical Factors EGFR TKIs Bevacizumab Female, Never- smoker, Asian No Hemoptysis Tumor Histology EGFR TKIs Bevacizumab Pemetrexed IGF1R Inhibitors Adenoca No SCCA b/o risk Non-SCCA SCCA (?) Molecular Factors EGFR TKIs Cetuximab ERCC1/RRM1 TS Anti-Angiogenics EGFR Mut/FISH EGFR IHC/FISH (?) Platinum Chemo Pemetrexed (?) from Gandara: CLC, 2008 Iressa Pan Asian Study (IPASS) Phase III Trial: Gefitinib vs Carboplatin/Paclitaxel in Selected Patients With Advanced NSCLC Never or light ex-smoker* with adenocarcinoma histology
PS 0-2
Stage IIIB or IV chemotherapy-nave NSCLC N=1217
R A N D O M I Z E
Gefitinib (250 mg/day)
Offered carboplatin/paclitaxel on progression Carboplatin (AUC 5 or 6) + Paclitaxel (200 mg/m 2 ) 3 times weekly up to 6 cycles
Primary endpoint: PFS (noninferiority) Secondary endpoints: ORR, OS, QOL, disease-related symptoms, safety, and tolerability Exploratory: biomarkers EGFR mutation, gene copy number, and protein expression Mok. ESMO. 2008 (abstr LBA2). *Never smoker=smoked <100 cigarettes in lifetime; light ex-smoker=stopped 15 years ago and smoked 10 pack-years. Progression-Free Survival in ITT Population 609 453 (74.4%) 608 497 (81.7%) N Events HR (95% CI) = 0.741 (0.651, 0.845) p<0.0001 Gefitinib
Gefitinib demonstrated superiority relative to carboplatin / paclitaxel in terms of PFS Primary Cox analysis with covariates HR <1 implies a lower risk of progression on gefitinib Carboplatin / paclitaxel Carboplatin / paclitaxel Gefitinib Median PFS (months) 4 months progression-free 6 months progression-free 12 months progression-free 5.7 61% 48% 25% 5.8 74% 48% 7% 609 212 76 24 5 0 608 118 22 3 1 0 363 412 0 4 8 12 16 20 24 Months 0.0 0.2 0.4 0.6 0.8 1.0 Probability of PFS At risk : Progression-Free Survival in EGFR Mutation Positive and Negative Patients EGFR mutation positive EGFR mutation negative Treatment by subgroup interaction test, p<0.0001 HR (95% CI) = 0.48 (0.36, 0.64) p<0.0001 No. events gefitinib, 97 (73.5%) No. events C / P, 111 (86.0%) Gefitinib (n=132) Carboplatin / paclitaxel (n=129)
ITT population Mutation rate ~60% Cox analysis with covariates