JOURNAL OF BACTERIOLOGY, Jan. 1999, p.

212217
0021-9193/99/$04.0010
Copyright 1999, American Society for Microbiology. All Rights Reserved.

Vol. 181, No. 1

Identification and Properties of the Genes Encoding Microcin

E492 and Its Immunity Protein
ROSALBA LAGOS,* JORGE E. VILLANUEVA,

AND

OCTAVIO MONASTERIO

Departamento de Biologa, Facultad de Ciencias, Universidad de Chile, Santiago, Chile

Received 18 May 1998/Accepted 29 October 1998

and that of any known channel-forming bacteriocin, and thus,

it appears that this microcin defines a novel class of lowmolecular-weight pore-forming bacteriocin which is not related to colicin-like channel-forming bacteriocins from gramnegative microorganisms or to channel-forming bacteriocins
from gram-positive bacteria. On the other hand, it was found
that microcin E492 shares some characteristic cleavage site
features with lactococcins and related bacteriocins found in
gram-positive bacteria, as in the case of colicin V (12, 17).
Insight into how the immunity protein- and microcin-encoding
genes are organized will enrich our understanding of the coordinated regulation of these genes during stationary phase
(35).

Microcin E492 is a low-molecular-weight channel-forming

bacteriocin (21) produced by Klebsiella pneumoniae that is active on strains of the family Enterobacteriaceae (7, 8). All of the
other low-molecular-weight channel-forming bacteriocins that
have been described are from gram-positive bacteria, among
them the lantibiotic nisin and lactococcins A and B, which are
nonlantibiotic heat-stable bacteriocins (reviewed in references
1, 19, and 33). Recently, there has been a renewed interest in
the study of the mechanism of action of different bacteriocins
and the effect of chemical modifications because understanding the strategies used by bacteriocins to kill specific bacteria
may be useful in the design of antibiotics for pharmaceutical
use (3). In order to better understand the mechanism of action,
export, processing, and possible posttranslational modification
of microcin E492, the genes needed for immunity protein and
microcin production, which encompass a 13-kb DNA fragment, were cloned and expressed in Escherichia coli (35). Studies of the genetic determinants of all microcin systems, with the
exception of microcins H47 and E492, have shown that these
determinants are encoded on plasmids encompassing DNA
segments of less than 6 kb. Microcins H47 (15) and E492 (35),
however, are both chromosomally encoded on DNA fragments
of more than 10 kb. Preliminary studies of random transposition mutagenesis of the cloned microcin E492 system suggest
that most of the 13-kb fragment is needed for the production
of active microcin, indicating that this system may involve more
components for the production of active microcin than other
systems already described. In previous work, we demonstrated
that the microcin E492 immunity protein is located inside a
3-kb ClaI DNA fragment (35). Here we report that, in addition
to the immunity protein gene, the microcin structural gene is
also encoded in this region. The deduced amino acids sequence indicates that no similarity exits between this sequence

MATERIALS AND METHODS

Bacterial strains and plasmids. The strains, vectors, and recombinant plasmids used in this work are described in Table 1. E. coli K38pGP1-2 and pT7-7
were kindly provided by S. Tabor (Harvard Medical School).
Microcin E492 assay on plates. To determine the capacity of the strains used
to produce microcin E492, 2 3 107 sensitive E. coli BL21(DE3)/p11a2 bacteria
were overlaid onto Luria broth-(LB)-ampicillin (100 mg/ml) plates with 3 ml of
soft agar. Single colonies to be checked were transferred with a toothpick onto
the seeded plates. After overnight incubation, the colonies producing microcin
E492 were surrounded by clear growth inhibition zones.
Microcin immunity test. Aliquots (50 to 300 ml) of cultures to be tested for
immunity were grown in LB-ampicillin, mixed with 3 ml of top agar, and overlaid
onto LB plates. Five-microliter volumes of serial dilutions of purified microcin
were tested (23). Immune cells did not show any inhibition halo. The purified
microcin used for this test was prepared as described by de Lorenzo (7).
DNA isolation and manipulation. Standard techniques were used for the
cloning, transformation, preparation, and restriction analysis of plasmid DNA
from E. coli (2, 28).
Nucleotide sequencing and analysis. Both strands were entirely sequenced
from plasmid pBSC-47 (Bluescript vector) by using automated sequencing technology from ABI, in accordance with the manufacturers directions, at Chiron
Corporation (Emeryville, Calif.). Sequence analysis was performed with the
University of Wisconsin Genetics Computer Group package, version 9.1 (10), at
CEM, Facultad de Ciencias, Universidad de Chile. Sequence comparisons were
performed with the TBLASTN, BLASTN, FASTA, and GAP programs.
Expression and localization of immunity protein MceB. The mceB gene was
amplified by PCR from pBSC-47. The forward primer (59CGGATAA
AAC*ATATGACATTACTTTCATTTGG39) generated a NdeI restriction site
at the mceB initiation codon (underlined). The reverse primer (59AAAGC
AAGAA*TTC*AGTCCTTTTGACTAATTTC39) was designated to be 15 bp
downstream of the mceB stop codon and contained an EcoRI site (underlined).
Nucleotides with asterisks indicate the changes made to create the restriction

* Corresponding author. Mailing address: Departamento de Biologa, Facultad de Ciencias, Universidad de Chile, Casilla 653, Santiago,
Chile. Phone: 56-2-678-7338. Fax: 56-2-271-3891. E-mail: rolagos
@abello.dic.uchile.cl.
Permanent address: Facultad de Ciencias, Campus San Andres,
Universidad Cato
lica de la Santsima Concepcio
n, Concepcio
n, Chile.
212

Downloaded from jb.asm.org by on September 10, 2008

The gene coding for the immunity protein (mceB) and the structural gene of microcin E492 (mceA), a
low-molecular-weight channel-forming bacteriocin produced by a strain of Klebsiella pneumoniae, have been
characterized. The microcin gene codes for a precursor protein of either 99 or 103 amino acids. Protein
sequencing of the N-terminal region of microcin E492 unequivocally identified this gene as the microcin
structural gene and indicated that this microcin is synthesized as a precursor protein that is cleaved at either
amino acid 15 or 19, at a site resembling the double-glycine motif. The gene encoding the 95-amino-acid
immunity protein (mceB) was identified by cloning the DNA segment that encodes only this polypeptide into
an expression vector and demonstrating the acquisition of immunity to microcin E492. As expected, the
immunity protein was found to be associated with the inner membrane. Analysis of the DNA sequence indicates
that these genes belong to the same family as microcin 24, and they do not share structural motifs with any
other known channel-forming bacteriocin. The organization of the microcin- and immunity protein-encoding
genes suggests that they are coordinately expressed.

VOL. 181, 1999

GENES ENCODING MICROCIN E492 AND ITS IMMUNITY PROTEIN

213

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid

E. coli strains
BL21(DE3)
XL1-Blue
K38pGP1-2

Plasmids
pBluescript SK(1/2)
pT7-7
pJAM434
pBSC-47
p157

Genotype or phenotype

Source or
reference

F2 ompT rB mB
recA endA1 gyrA96 thi-1 hsdR-17
supE44 relA1 lac (F9 proAB lacIq
ZDM15 Tn10)
HfrC (l) bearing plasmid encoding
cI857 and T7 RNA polymerase
gene under control of PL; Kmr

Novagen
Stratagene

Cloning vector; Ampr

T7 expression vector; Ampr
Encoding immunity and microcin
E492 determinants; Ampr
3-kb ClaI fragment from pJAM434
in pBluescript SK
0.3-kb NdeI-EcoRI fragment
(mceB) from pBSC-47 in pT7-7

Stratagene
S. Tabor
35

32

This study
This study

FIG. 1. Nucleotide sequence of the mceAB-containing region. The deduced

amino acid sequences for the mceA (microcin E492) and mceB (immunity protein) genes from K. pneumoniae RYC492 are given below the DNA sequences.
The putative transcriptional start is indicated by the curved arrow. Deduced 210
and 235 regions in DNA are in boldface, and the proposed consensus ShineDalgarno sequences are underlined. Two direct repeats are indicated between
the arrowheads. The inferred cleavage site in MceA is represented by a vertical
arrow between amino acids 19 and 20. The amino acids in boldface are those
confirmed by N-terminal sequencing of the protein.

RESULTS AND DISCUSSION

Cloning and sequence analysis of mceA and mceB genes. In
a previous study, we used deletion analysis to demonstrate that
the genetic determinant(s) required for immunity to microcin
E492 are encoded in a 3-kb ClaI fragment (35). This fragment,
obtained from pJAM434 (35), was cloned into the ClaI site of
pBluescript (pBSC-47). This DNA segment could be cloned
only in one orientation and conferred immunity to microcin
E492. The DNA sequence between the EcoNI and BamHI
sites of the cloned ClaI fragment is shown in Fig. 1. Two
overlapping open reading frames (ORFs) were identified. The
first, designated mceB, encoded a 95-amino-acid polypeptide
with a theoretical molecular weight of 10,943 and corresponds
to the microcin E492 immunity protein. The second, mceA,
encoded a polypeptide of either 103 amino acids with a theoretical molecular weight of 10,091 if the first methionine is
used as the start codon or a 99-amino-acid polypeptide with a
theoretical molecular weight of 9,562 if the methionine at
position 5 is used as the start codon. One of these polypeptide
(or both) would correspond to nonprocessed microcin E492.
The assignment of these genes (see below) was done experi-

Downloaded from jb.asm.org by on September 10, 2008

sites. The resulting 0.3-kb product was inserted into the corresponding sites of
expression vector pT7-7 to give p157 with the correct in-frame reading phase to
produce the 95-amino-acid product. The recombinant vector was introduced into
E. coli K38pGP1-2, grown to mid-exponential phase in LB plus kanamycinampicillin, transferred to M9 minimal medium (24) minus methionine, and
incubated for 30 min. The immunity protein was induced by shifting the temperature to 42C for 20 min. Rifampin was added to a final concentration of 200
mg/ml, and the culture was incubated further for 10 min at 42C. [35S]methionine
(50 mCi; ICN Translabel) was then added, and the incubation was continued for
15 min. The bacterial cells were collected by centrifugation, washed once with
TEN buffer (50 mM Tris-HCl [pH 8.0], 1 mM EDTA, 100 mM NaCl), and
immediately processed.
To assess the location of the immunity protein in either the soluble or particulate fraction, cells were resuspended in 1/20 volume of TEN buffer plus 2-mg/ml
lysozyme and incubated for 30 min to allow cell lysis. The incubation mixture was
adjusted to give final concentrations of 2 mM phenylmethylsulfonyl fluoride, 10
mM MgCl2, 100-mg/ml DNase, and 10-mg/ml RNase, and incubation was continued for 20 min on ice. Four cycles of freezing (liquid nitrogen) and thawing
(room temperature) were performed. The lysate was centrifuged at 15,000 3 g
for 30 min; the supernatant corresponded to the soluble fraction, and the pellet
corresponded to the particulate fraction. Each fraction was analyzed by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as described by
Schagger and von Jagow (29).
Separation of the inner and outer membrane fractions was performed by
selective solubilization with Triton X-100. Cells were grown in LB plus kanamycin-ampicillin to mid-exponential phase at 30C, induced for 5 h at 42C, collected by centrifugation, washed twice with TEN buffer, and resuspended in 50
mM Tris-HCl (pH 8.0)2 mM phenylmethylsulfonyl fluoride10-mM MgCl2
100-mg/ml DNase10-mg/ml RNase. Cellular disruption was achieved by sonic
oscillation (100 W, 4 3 1 min), and disrupted cells were kept on ice for 30 min.
After centrifugation at 2,000 3 g for 10 min at 4C, the supernatant was further
centrifuged at 105,000 3 g for 120 min at 4C to obtain the membrane fractions.
The supernatant corresponded to the soluble fraction, and the pellet (inner and
outer membrane fractions) was resuspended in 50 mM Tris-HCl (pH 8.0)10
mM MgCl22% Triton X-100 and incubated for 45 min at 37C to allow solubilization of the inner membrane proteins. This suspension was centrifuged at
105,000 3 g for 90 min at 4C. The supernatant contained the inner membrane
proteins, while the pellet (Triton X-100-insoluble fraction) corresponded to the
outer membrane fraction. Each fraction was analyzed by SDS-PAGE (29).
N-terminal microsequencing. Microcin E492 was transferred from polyacrylamide gels onto a polyvinylidene difluoride sequencing membrane (Bio-Rad) for
N-terminal sequencing by following the manufacturers instructions. The portion
of the polyvinylidene difluoride membrane containing the microcin band (without staining) was cut out and microsequenced. N-terminal Edman microsequencing was done with an Applied Biosystems 477A sequencer equipped for on-line
high-performance liquid chromatography analysis of the phenylthiohydantoin
derivatives at the Protein Chemistry Service, Centro de Investigaciones Biolo
gicas, Consejo Superior de Investigaciones Cientficas, Madrid, Spain.
Nucleotide sequence accession number. The nucleotide sequence reported
here has been submitted to the GenBank database under accession no.
AF063590.

214

LAGOS ET AL.

FIG. 2. Comparison of the deduced amino acid sequences of nonprocessed

microcin MceA with MtfS (A) and immunity protein MceB with MtfI (B).
Identical matches (vertical lines) and strongly (colons) and weakly (dots) conserved amino acid residues are indicated. The comparison was performed with
the GAP program. MceA and MtfS displayed an identity of 52% and a similarity
of 59%, while MceB and MtfI presented an identity of 39% and a similarity of
56%.

These results strongly suggest that both microcins belong to

the same family and probably have an ancestor in common. No
information is available about the mechanism of action of
microcin 24, but due to its similarity to microcin E492, it is
possible to speculate that the target of microcin 24 is probably
also the cytoplasmic membrane. The five determinants needed
for the production of microcin 24 and its immunity protein are
encoded in a 5.3-kb DNA segment (25), while the microcin
E492 system is encoded in a 13-kb segment. The difference in
size may reflect the complexity of the microcin E492 system, an
idea supported by preliminary results with random Tn5 mutagenesis that suggest that between six and eight cistrons (besides the structural gene) encoded in the 13-kb DNA fragment
are needed for the production of active microcin (4). In this
respect, microcin E492 is also different from colicin V, which
mechanism of action at the inner membrane level could be
related to microcin E492. Only four plasmid genes, spanning
4.5 kb of DNA, are required for colicin V synthesis, export, and
immunity (14, 19). The similarity between the sequences of the
microcin protein and the immunity protein of microcins 24 and
E492 that suggests that these proteins have an ancestor in
common is also present at the level of gene organization. In
both cases, the immunity protein- and microcin-encoding
genes seem to be under the control of the same promoter, and
the C-terminal coding region of the immunity protein overlaps
the N terminus of microcin, with a frameshift in the ORF of
the microcin protein. As with the transcription of the two
converging operons in colicin V, transcription of the mtfI/mtfS
operon of microcin 24 also could be under the control of the
Fur protein, which binds to DNA at a specific sequence called
the Fur box (9), because a sequence similar to a Fur box was
found in the mtfI/mtfS promoter region (25). Although microcin E492 expression is regulated by the presence of iron in the
growth medium (26), no site for the Fur repressor was found in
an extensive region upstream (240 bp) of the mceB gene.
Hydropathy profiles of MceA and MceB are shown in Fig. 3.
As expected, the hydropathy profile of immunity protein MceB
indicates that it is likely to be an integral membrane protein,

Downloaded from jb.asm.org by on September 10, 2008

mentally. A putative promoter region with characteristic features, such as AT-rich stretches and two likely 210 (AATA
AT) and 235 (TTGACG) regions with 17 bp between them,
was identified in the 59 region. The first ORF, corresponding to
mceB, has a potential ribosome binding site with a ShineDalgarno sequence (AACGGAT) 7 bp upstream of the ATG
initiation codon. The two genes (mceA and -B) overlap by
either 23 or 11 nucleotides (depending on the start codon),
with a 11 shift for the mceA gene. No independent promoter
or ribosome binding site for mceA could be identified if the
translation starts in the first methionine, but if translation
initiation occurs at the methionine in position 5, a good consensus for a Shine-Dalgarno sequence (TGGAGC) 5 bp upstream of this methionine can be found. Thus, it is more likely
that translation initiation occurs at the methionine in position
5. It is possible that these genes are transcriptionally and translationally coupled, and this is consistent with the in vivo studies
reported by Wilkens et al. (35) showing that microcin and the
immunity protein are expressed only during the exponential
phase of growth. An exhaustive analysis of the DNA sequence
upstream of the putative promoter by using the computer
programs FASTA and BLASTN was performed to search for
sequence similarities. No obvious known regulation sites were
found, although some similarities to E. coli and Bacillus subtilis
genomic sequences with unknown functions were observed.
However, it is interesting that there are two direct repeats that
overlap the putative 235 region indicated between arrowheads
in Fig. 1.
Regulation of the expression of the microcin- and immunity
protein-encoding genes seems to be complex, since this regulation requires the presence of at least a 5-kb DNA segment
contiguous to these genes, which is present in plasmid pJI (35).
pJI contains a 6-kb DNA fragment of the 13 kb needed for the
production of microcin and its immunity protein (35). By Tn5
mutagenesis (4), it was determined that this plasmid codes for
two or three cistrons, besides the structural genes for microcin
and its immunity protein, that may be involved in the regulation of gene expression. Cells harboring pBSC-47, the plasmid
used for sequencing of the immunity protein and microcin
genes, lack two of these cistrons and express the immunity
protein in the exponential and stationary phases of growth. In
contrast, cells harboring pJI do not express the immunity protein in the stationary phase. Further characterization of the
regulation of the production of microcin and its immunity
protein awaits the study of the other components of this system
involved in the expression. However, a possible target for regulatory proteins are the direct repeats found overlapping the
putative promoter region.
The genes encoding microcin E492 and its immunity protein
are homologous to those of the microcin 24 system. Analysis of
the sequences of mceA and mceB by using the computer programs FASTA and TBLASTN revealed that the two corresponding ORFs belong to a novel family of bacteriocins and
that each presents significant similarities to only one protein in
the GenBank database. mceA turned out to be homologous to
mtfS, the structural gene of microcin 24, isolated from an E.
coli uropathogenic strain (25), while mceB is a homolog of
mtfI, a gene encoding the microcin 24 immunity protein (25).
Information concerning microcin 24 is only available in GenBank. The deduced amino acid sequences were compared by
using the GAP program (Fig. 2). The MtfS and MceA proteins
are 90 and 103 amino acids (for comparison, we will use the
sequence that starts at the first methionine), respectively, with
an identity of 52% and a similarity of 59%. On the other hand,
MtfI and MceB are very similar in size (93 and 95 amino acids,
respectively), with an identity of 39% and a similarity of 56%.

J. BACTERIOL.

VOL. 181, 1999

GENES ENCODING MICROCIN E492 AND ITS IMMUNITY PROTEIN

with three strong transmembrane regions, comprising amino

acids 1 to 21, 35 to 55, and 66 to 90. In contrast, a single
proposed transmembrane region is present in the MceA protein, between amino acids 40 and 60 in the nonprocessed
protein. These conclusions were based not only on the KyteDoolittle (20) profiles shown in Fig. 3 but also on other, independent analyses, such as TMpred (18) and the hydrophobicity
profiles obtained by the method of Eisenberg et al. (11). Both
sequences were further analyzed, and a comparison of these
proteins with several channel-forming bacteriocins and their
immunity proteins did not reveal regions with structural homology.
Microcin E492 resembles colicins from group B in its requirement for tonB and exbB gene products for its uptake into
cells (27). TonB-dependent colicins (Ia, Ib, and B) that use the
TonB uptake pathway have a sequence motif Asp(Glu)Thr(Ile)-X-Val(X)-Val, called the TonB box, located near the
N-terminal region (6). The possibility that microcin E492 has a
TonB box was examined, but it was not possible to draw a
definitive conclusion. The only possible TonB box in microcin
E492 is the region between amino acids 69 and 73 of the
nonprocessed form (Asp-His-Gly-Pro-Val), but this sequence
only poorly resembles the consensus.

N-terminal amino acid sequencing of microcin E492. The

amino acid sequence determined by microsequencing of the
N-terminal region of microcin E492 cloned in E. coli was X-XThr-Asp-Pro-Asn-Thr-Glu-Leu-Leu-Asn-Asp-Leu. The two
first amino acids could not be identified due to interference, so
it was not until cycle 3 that the amino acids were clearly
identified. The same interference was observed with microcin
E492 from K. pneumoniae purified by high-performance liquid
chromatography (34). This result indicates that the primary
translation product of mceA is a precursor that is processed to
remove the first 15 or 19 amino acids. Thus, the processed
microcin E492 molecule would be an 84-amino-acid polypeptide with a predicted molecular weight of 7,887.
Similarity between cleavage sites of microcin E492 and
those of colicin V and lactococcins. Microcin E492 was found
to share many cleavage site features with colicin V and lactococcins and related bacteriocins found in gram-positive bacteria. These features (12, 17) include the presence of Gly residues in position 22 or 21 relative to the processing site. Most
of the sequences contain the double-glycine motif, with the
exception of lactococcin DR, which contains a glycine-alanine
motif (17). Analysis of several leader peptides of the doubleglycine motif showed that seven amino acids are found to be
conserved in more than half of the aligned leader peptides
(17): glycine in position 21, glycine in position 22, isoleucine
in position 24, leucine in position 27, glutamic acid in position
28, serine in position 211, and leucine in position 212. From
these amino acids, microcin E492 presents glycine in position
22, leucine in position 27, and serine in position 211. The
aspartic acid in position 28 is a conservative amino acid substitution for glutamic acid, and isoleucine in position 212 is a
conservative amino acid substitution for leucine. Other similarities were found among the cleavage sites of microcin E492,
colicin V, and lactococcins and related bacteriocins. The first is
a cleaved leader sequence of 15 to 20 amino acids (microcin
E492 has an either 15- or 19-amino-acid leader peptide). The
second is a predicted a-helical structure over most of the
leader sequence. The prediction was made by using the Chouand-Fasman (5) and Levitt (22) methods (data not shown).
This analysis suggested that leader sequence residues 1 to 16
are mostly a-helical and are followed by a b-turn that begins at
amino acid 17 (data not shown). It is necessary to point out
that these studies were done only for comparison, as these
methods are frequently used when comparing these properties
of bacteriocins. The third is a predicted b-turn that begins one
to three amino acids before the cleavage site (amino acid 23,
in this case), which would expose the cleavage site to allow
cutting by the specific peptidase. The fourth is the fact that the
processed products, in all of these cases, are small, heat-stable
protein bacteriocins (43 to 88 amino acids in length) which
function by increasing membrane permeability in target cells.
The fact that the secretion of microcin E492 seems to be
signal sequence independent, as is that of the colicin V and
lactococcin type, leads us to expect that microcin E492 should
be secreted by dedicated ABC exporters (13).
Genetic identification and localization of immunity protein
MceB. To demonstrate unequivocally that mceB is the gene
that encodes a protein that confers immunity to microcin E492,
the DNA fragment containing only the ORF coding for the
95-amino-acid immunity protein was cloned into an expression
vector. For this purpose, the pT7-7 expression vector under the
control of T7 RNA polymerase was employed. The DNA segment coding only for the immunity protein was PCR amplified
and cloned into pT7-7 (see Materials and Methods). Cells
transformed with this recombinant vector (p157) acquired immunity to microcin E492, in contrast with the control trans-

Downloaded from jb.asm.org by on September 10, 2008

FIG. 3. Hydrophobicity profiles of MceA (A) and MceB (B). Hydropathy

was calculated by the method of Kyte and Doolittle (20) with a span length of 13
amino acid residues and by using a linear weight variation model. The dashed
line in panel A shows the inferred processing site for microcin E492.

215

216

LAGOS ET AL.

formed with pT7-7, which was not immune to microcin, demonstrating that this gene is enough to confer immunity to a
high-titer microcin suspension. This construct was first introduced in E. coli XL1-Blue, in order to screen for the cloned
immunity gene in a background where no expression was expected, but surprisingly, it was found that these cells acquired
immunity to microcin E492. Although expression under the
control of a T7 promoter is thought to be completely restricted
to cells that express T7 RNA polymerase, there are reports
(30) demonstrating that it is possible to find basal T7 RNA
polymerase-independent expression of genes situated downstream from a T7 promoter. This very low level of expression
would be enough to confer immunity to microcin E492. The
pT7 system allows specific radioactive labeling of the protein
under the control of the T7 RNA polymerase promoter (32;
see Materials and Methods), and we took advantage of this
characteristic to determine the localization of the immunity
protein. For these experiments, the host strain E. coli
BL21(DE3) was not suitable, because these cells segregated
the immunity character. This strain does not tightly regulate
the expression of T7 RNA polymerase (which is under the
control of the lac promoter), resulting in a basal expression of
20 to 30% with respect to that of the fully induced protein.
Overexpression of this protein seems to be harmful for the host
cells, which, in turn, develop a mechanism to bypass its expression. This interpretation is consistent with the fact that the 3-kb
ClaI DNA fragment could be cloned in pBluescript in one only
orientation, in which the immunity and microcin genes are
opposite to the lac promoter, probably because the cells could
not tolerate high-level expression of these proteins. For this
reason, we used the tightly regulated system of E. coli
K38pGP1-2, in which the T7 RNA polymerase gene is under
the control of promoter PL, and thus permitted induction by a
temperature shift just before protein labeling (32). E. coli
K38pGP1-2 harboring p157 was immune to a microcin suspension with the highest titer available (106 U/ml). Figure 4A
shows SDS-PAGE of the soluble and particulate fractions of a
bacterial extract in which the immunity protein has been induced and the corresponding autoradiograph (Fig. 4B). This

FIG. 5. Localization of the immunity protein in the inner membrane. Induction of the T7 RNA polymerase of E. coli K-38pGP1-2 harboring pT7-7 or p157
was performed by incubation at 42C for 5 h, and the separation of inner and
outer membrane fractions was carried out as described in Materials and Methods. SDS14% PAGE samples corresponding to E. coli K-38pGP1-2/pT7-7 are
in lanes 1, 2, and 3, and those corresponding to E. coli K-38pGP1-2/p157 are in
lanes 5, 6, and 7. Total (lanes 1 and 5), inner membrane (2 and 6), and outer
membrane (3 and 7) fractions of the bacterial extracts were analyzed separately.
The arrowhead indicates the band corresponding to the immunity protein. Molecular weight markers in lane 4 were myoglobin fragments with Mrs of 16,950,
14,440, 8,160, 6,210, and 3,460.

protein was clearly identified in the autoradiograph as the only

labeled protein, and as expected, it was located in the particulate fraction, which contains the inner and outer membrane
fractions.
The localization of the immunity protein in the inner membrane was achieved by selective solubilization of the cytoplasmic membrane proteins with Triton X-100. Figure 5 shows
SDS-PAGE of the inner and outer membrane fractions. The
band corresponding to the immunity protein was identified as
shown in Fig. 4, and it is only present in the fraction corresponding to the inner membrane. This protein band is absent
in the induced control transformed with pT7-7. The estimated
molecular weight of the immunity protein from this gel is
11,500, which, within the range of experimental error, is in
close agreement with that predicted from the amino acid sequence (10,943).
The action of immunity proteins of channel-forming colicins,
which are always located in the cytoplasmic membrane, is
highly specific. Two basic mechanisms have been described. In
one, there is a direct interaction between the colicin and the
immunity protein that inactivates the function of the poreforming domain of colicins. Such is the case with colicins A and
B (16). Alternatively, the immunity protein exerts its specific
effect in the cytoplasmic membrane not only through recognition with the pore-forming domain of colicins but through an
interaction with the translocation apparatus, in which the immunity protein would be associated with supermolecular complexes comprised of the receptor and translocation proteins
(6). The latter model could explain why low-level expression of
an immunity protein, such as the colicin E1 immunity protein
(31), would prevent ion channel formation, since the probability of an encounter and association of colicin with the colicin
translocation apparatus would be higher. In this respect, this
model would fit better the possible mechanism of action of
immunity to microcin E492, because extremely low levels of

Downloaded from jb.asm.org by on September 10, 2008

FIG. 4. Expression of the immunity protein from p157. (A) Expression from
the T7 promoter of pT7-7 and p157 was assessed by using E. coli K-38pGP1-2 as
the bacterial host. Induction of T7 RNA polymerase was performed by incubation at 42C. Specific transcription from the T7 promoter was performed by
addition of rifampin, and proteins were labeled with [35S]methionine. SDS16%
PAGE samples corresponding to E. coli K-38pGP1-2/pT7-7 are in lanes 1, 2, and
3, and those corresponding to E. coli K-38pGP1-2/p157 are in lanes 4, 5, and 6.
Total (lanes 1 and 4), soluble (2 and 5), and particulate (3 and 6) fractions of the
bacterial extracts were analyzed separately. The arrow indicates the band corresponding to the immunity protein. Molecular weight markers in lane 7 were
myoglobin fragments with Mrs of 16,950, 14,440, 8,160, 6,210, and 3,460. (B)
Autoradiography of the SDS-PAGE shown in panel A.

J. BACTERIOL.

VOL. 181, 1999

GENES ENCODING MICROCIN E492 AND ITS IMMUNITY PROTEIN

expression of the immunity protein still confer protection to

microcin E492.
ACKNOWLEDGMENTS
We thank Catherine Connelly and Stanley Maloy for critical reading
of the manuscript and Jose Manuel Andreu and Juan Evangelio for the
facilities provided for microsequencing of microcin E492. We are also
indebted to Carlos Medina for helpful discussions and to Claudio Hetz
and Mara Jose Chiucholo for their help in different stages of this
work. The excellent technical assistance of Marcela Vargas is acknowledged.
This work was supported by grant 1961009 from the Fondo Nacional
de Desarrollo Cientfico y Tecnolo
gico.
REFERENCES

16.
17.

18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.

31.
32.
33.
34.
35.

(ed.), Bacteriocins, microcins, and lantibiotics. Springer Verlag, Heidelberg,

Germany.
Gaggero, C., F. Moreno, and M. Lavin
a. 1993. Genetic analysis of microcin
H47 antibiotic system. J. Bacteriol. 175:54205427.
Geli, V., and C. Lazdunski. 1992. An a-helical hydrophobic hairpin as a
specific determinant in protein-protein interaction occurring in Escherichia
coli colicin A and B immunity systems. J. Bacteriol. 174:64326437.
Havarstein, L. S., H. Holo, and I. F. Nes. 1994. The leader peptide of colicin
V shares consensus sequences with leader peptides that are common among
peptide bacteriocins produced by Gram-positive bacteria. Microbiology 140:
23832389.
Hofmann, K., and W. Stoffel. 1993. TMbasea database of membrane
spanning protein segments. Biol. Chem. Hoppe-Seyler 347:166.
Kolter, R., and F. Moreno. 1992. Genetics of ribosomally synthesized peptide
antibiotics. Annu. Rev. Microbiol. 46:141163.
Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying the
hydropathic character of a protein. J. Mol. Biol. 157:105132.
Lagos, R., M. Wilkens, C. Vergara, X. Cecchi, and O. Monasterio. 1993.
Microcin E492 forms ion channels in phospholipid bilayer membranes.
FEBS Lett. 321:145148.
Levitt, M. 1978. Conformational preferences of amino acids in globular
proteins. Biochemistry 17:42774285.
Mayr-Harting, A., A. J. Hedges, and C. W. Berkeley. 1972. Methods for
studying bacteriocins. Methods Microbiol. 7A:315422.
Miller, J. H. 1972. Experiments in molecular genetics, p. 431433. Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
OBrien, G. J., and H. K. Mahanty. 1996. GenBank accession no. U47048.
Orellana, C., and R. Lagos. 1996. The activity of microcin E492 from Klebsiella pneumoniae is regulated by a microcin-antagonist. FEMS Microbiol.
Lett. 136:297303.
Pugsley, A. P., F. Moreno, and V. de Lorenzo. 1986. Microcin-E492-insensitive mutants of Escherichia coli K12. J. Gen. Microbiol. 132:32533259.
Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.
Scha
gger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis for the separation of proteins in the range
from 1 to 100 kDa. Anal. Biochem. 166:368379.
Somerville, R. L., T.-L. Ni Shieh, B. Hagewood, and J. Cui. 1991. Gene
expression from multicopy T7 promoter vectors proceeds at single copy rates
in the absence of T7 RNA polymerase. Biochem. Biophys. Res. Commun.
181:10561062.
Song, H. Y., and W. A. Cramer. 1991. Membrane topography of ColE1 gene
products: the immunity protein. J. Bacteriol. 173:29352943.
Tabor, S., and C. C. Richardson. 1985. A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.
Proc. Natl. Acad. Sci. USA 82:10741078.
Venema, K., G. Venema, and J. Kok. 1995. Lactococcal bacteriocins: mode of
action and immunity. Trends Microbiol. 3:299304.
Wilkens, M., and R. Lagos. Unpublished data.
Wilkens, M., J. E. Villanueva, J. Cofre, J. Chnaiderman, and R. Lagos. 1997.
Cloning and expression in Escherichia coli of genetic determinants for production of and immunity to microcin E492 from Klebsiella pneumoniae. J.
Bacteriol. 179:47894794.

Downloaded from jb.asm.org by on September 10, 2008

1. Abee, T. 1995. Pore-forming bacteriocins of Gram-positive bacteria and

self-protection mechanisms of producer organisms. FEMS Microbiol. Lett.
129:110.
2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman,
J. A. Smith, and K. Struhl. 1992. Short protocols in molecular biology,
2nd ed. Greene Publishing Associates and John Wiley & Sons, Inc., New
York, N.Y.
3. Baba, T., and O. Schneewind. 1998. Instruments of microbial warfare: bacteriocin synthesis, toxicity and immunity. Trends Microbiol. 6:6671.
4. Baeza, M., C. Hetz, C. Villota, J. E. Villanueva, and R. Lagos. Unpublished
data.
5. Chou, P. Y., and G. D. Fasman. 1978. Empirical predictions of protein
conformation. Annu. Rev. Biochem. 47:251276.
6. Cramer, W. A., J. B. Heymann, S. L. Schendel, B. N. Deriy, F. S. Cohen, P. A.
Elkins, and C. V. Stauffacher. 1995. Structure-function of the channel-forming colicins. Annu. Rev. Biophys. Biomol. Struct. 24:611641.
7. de Lorenzo, V. 1984. Isolation and characterization of microcin E492 from
Klebsiella pneumoniae. Arch. Microbiol. 139:7275.
8. de Lorenzo, V., and A. Pugsley. 1985. Microcin E492, a low-molecular-weight
peptide antibiotic which causes depolarization of the Escherichia coli cytoplasmic membrane. Antimicrob. Agents Chemother. 27:666669.
9. de Lorenzo, V., S. Wee, M. Herrero, and J. B. Neilands. 1987. Operator
sequences of the aerobactin operon of plasmid ColV-K30 binding the ferric
uptake regulation (fur) repressor. J. Bacteriol. 169:26242630.
10. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of
sequence analysis programs for the VAX. Nucleic Acids Res. 12:387395.
11. Eisenberg, D., E. Scharwz, M. Komaromy, and R. Wall. 1984. Analysis of
membrane and surface protein sequences with the hydrophobic moment
plot. J. Mol. Biol. 179:125142.
12. Fath, M., L. H. Zhang, J. Rush, and R. Kolter. 1994. Purification and
characterization of colicin V from Escherichia coli culture supernatants.
Biochemistry 33:69116917.
13. Fath, M. J., and R. Kolter. 1993. ABC transporters: bacterial exporters.
Microbiol. Rev. 57:9951017.
14. Fath, M. J., R. Skvirky, L. Gilson, H. K. Mahanty, and R. Kolter. 1992. The
secretion of colicin V, p. 331348. In R. James, C. Lazdunski, and F. Pattus

15.

217