Aw1435@txstate - Edu: Amanda Wilson #594648 Bio 2450 Genetics Dr. N. Martin Amanda Schultz
Aw1435@txstate - Edu: Amanda Wilson #594648 Bio 2450 Genetics Dr. N. Martin Amanda Schultz
Aw1435@txstate - Edu: Amanda Wilson #594648 Bio 2450 Genetics Dr. N. Martin Amanda Schultz
#594648
[email protected]
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz
DNA/PCR–Lab Paper
Abstract
Polymerase chain reaction (PCR) has many applications in modern genetics but it has
become particularly important in the use of forensic genetic profiling. PCR was invented in 1983
but has come quite a long way since. The development of Real Time PCR has improved
conceptualization but is also accompanied with increased risks of error. This experiment
chronicles the investigation of muscle tissue purchased from a meat market in Texas to assess its
originating specie. PCR techniques used are a modification of those in the McGrath and Dooley,
(2000) experiment. Electrophoresis difficulties experienced did not prevent the success of PCR.
Despite necessary editing on the electropherogram, Basic Local Alignment Search Tool
deciphered the tissue to be the mitochondrial genetics of Lama paco, with a max identity value
of 98% and a low E-value of 0.0. The arduous, but positive, identification of originating specie
from the given tissue sample exposes the need for practitioner experience in the laboratory and
Introduction
The continual expansion of known life and the diverse mechanisms with which they
function has directly led to the necessity of complex techniques to deduce genetic identity and
Polymerase Chain Reaction (PCR) has been the solution. PCR’s ability to disseminate species’
tissue samples and viral hosts, such as the koi herpes virus, in both flora and fauna expediently
makes it particularly valuable to the scientific community (Gray et al., 2002). In addition to the
distinction of varying genomic identities of living organisms, modified PCR techniques have
allowed insight on ancient or extinct organisms (d’Abbadie et al., 2007). Recent examination of
38,000 year old Neanderthal DNA from Croatia has allowed evolutionary biologist to
Amanda Wilson
#594648
[email protected]
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz
conceptualize a genomic divergence, but also how the linguistic capabilities of modern man may
have developed (Green et al., 2006; Krings et al., 1997). While elucidation of earthly heredity
habits, past and present, is tacitly beneficial, its potential for understanding future non-terrestrial
existence is just as critical (Mullis, 1990). Such consideration is not as preposterous when related
conditions, that make PCR possible (Dabrowski et al., 2002; Gibbs et al., 2009).
PCR was developed in 1983 by geneticist Kary Mullis, for which he was given the Nobel
Peace Prize in Chemistry (Sinclair, 2002; Mullis, 2000). His associations with Albert Hofmann
have likely been the source where speculative rumor claims the idea came to him during a
hallucination on LSD (Cohen, 1995). PCR is a quick and simple way of cloning genes in a test
tube, without the need of bacteria; the geneticist’s photocopier, if you will. It can generate
billions of copies of a specific DNA sequence in a limited amount of time. Though it has usurped
conventional cloning techniques in many areas of molecular genetics, it can only be performed
Mullis and Faloona (1987) insist PCR reactions necessitate a highly specific pair of DNA
copied. These primers, in addition to the DNA sample, DNA polymerase enzyme and copious
amounts of ATCG nucleotides, are placed in a test tube to begin cycling. PCR reactions are
performed in a thermocycler –a machine that can rapidly shift between temperatures in a pre-
programmed array. Ordinary DNA polymerase won’t work at the high temperatures involved in
PCR, thusly a special heat-resistant variety, derived from the bacterium Thermus aquaticus (T.
in hot springs at temps of up to 90 ̊C, while G. thermoleovorans thrives in the oceanic thermal
Cycling is a process of three steps, lasting around a minute each, repeated several times
to produce molecular copies of a particular DNA sequence. In the first step the reaction mixture
is heated up to about 90 ̊C to separate DNA into two strands. The right temperature is critical. At
this point the temperature is too high for the primers to bind, so the second step is to lower it
̊ allowing the primers to make complementary strands for the two single strands of
around 50 C,
DNA. The third step requires increasing the temp to 72 ̊C where DNA polymerase will
synthesize new DNA from the each of the two primer sequences. The repetition of these three
steps will yield an analogous increase of DNA molecules for every cycle performed. 30 cycles
will have increased the original DNA molecules to about a billion DNA copies. The effective
range of PCR—PCR works best on segments of DNA that are longer than 100 base pairs and
The standard PCR method was used on an unknown muscle tissue with the
intentions of positively identifying its originating specie through genetic profiling. Success of
this experiment proves the utility of PCR in several scientific fields and urges application of the
DNA Extraction
The muscle tissue used for excising the mitochondrial DNA (mtDNA) template from an
unknown, labeled simply 102 B, was per-purchased at a wild game butchery shop in Texas.
DNA extraction was carried out using the animal tissue DNeasy extraction kit from Quiagen (#
Amanda Wilson
#594648
[email protected]
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz
69506) and enumerated protocol steps. About 25 mg of tissue was extracted from the unknown
sample for homogenization with the intent of collecting cells to be lysed; concurrently
preventing osmotic damage, which has a propensity to jeopardize the cellular integrity of
samples used, during the course of testing. Unknown tissue and Lysis Master Mix, 180 µl of
Buffer ATL in conjunction with 20 µl of Proteinase K, was mixed thoroughly in a vortex for 15s
at 115 rpm, and incubated at 56 ̊C for 45 minutes to lyse the cellular membrane and digest
proteins. Lysis and digestion were then halted by adding 200 µl of Buffer AL to the sample mix
and incubated for 10 min. at 70 ̊C; this process was followed by the addition 200 µl of EtOH and
spun-down for 10s to precipitate the DNA. This was followed by centrifugation at 8000rpm for 1
min., addition of 500 µl Buffer AW1 centrifuged again with the same specifications, addition of
500 µl Buffer AW2 centrifuged at 14,000 rpm for 3 min., followed by relegation of flow-through
waste and an additional spin at 14,000 rpm for 1 min. to ensure proper anhydration. The addition
of 500 µl Buffer AE to the mixture, incubated for 1 min., and followed by centrifugation at 8,000
rpm for 1 min. at room temperature, was used to elute the DNA. The success of DNA extraction
was then assayed via gel electrophoresis in a 1% agarose gel and the resulting bands stained with
Ethidium bromide to enhance visualization. The DNA was then victualled in storage at 4 ̊C for
PCR
A pre-made Master Mix totaling in 49.5 µl, containing 37.75 µl ddH2O, 10.0 µl buffer A,
0.05 µl dNTPs, and 0.25 µl Taq polymerase, 0.05 µl of forward primer (ND4), 0.05 µl reverse
primer (PII), was added 0.05 µl of the warmed DNA material. Thermal cycling of this mixture,
which consisted of 3 phases at specific varying times and temperatures, was then performed
Amanda Wilson
#594648
[email protected]
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz
using the GeneAmp® PCR System 9700 to obtain a target sequence for cycle sequencing. The
success of PCR was then assayed via gel electrophoresis in a 1% agarose gel and the resulting
bands stained with Ethidium bromide to enhance visualization. The PCR product was again
PCR Clean-up
The Wizard SV Gel and OCR Clean-up System from Promega were used to purify the
PCR product of materials that would inhibit cycle sequencing. The PCR product was then
prepped for cycle sequencing by adding 40 µl of Membrane Wash Solution and incubated for 1
min., followed by centrifugation at 13,200 rpm for 1min. Relegation of flow-through waste was
carried out proceeded by the addition of 700 µL Membrane Wash Solution and centrifuged at
16,000 rpm for 1 min. Yet again, relegation of flow-through waste was carried out, superseded
by the addition of 500 µL Membrane Wash Solution and centrifuged at 16,000 rpm for 5 min.
Relegation of flow-through waste was repeated and mixture was again centrifuged at 16,000 rpm
for 1 min. to evaporate remaining ethanol. 50 µl of nuclease-free water was aspirated in with the
clean PCR product, allowed to incubate for 1 min., and then centrifuged at 16,000 rpm for 1 min.
The success of PCR clean up, was then assayed via gel electrophoresis in a 2% agarose gel, and
the resulting bands stained with Ethidium bromide to enhance visualization. The intensity of the
clean PCR product band was compared to a control of standard PCR product (pGEM) band. The
clean PCR product was then victualled in storage at 4 ̊C for later use in cycle sequencing.
Cycle Sequencing
2.0 µl of clean PCR product was combined with 2.0 µl DTCS Quick Start Mix from
Beckman Coulter Inc., 1.0 µl primer (ND4), and 15 µl ddH2O, totaling in 20 µl. Thermal cycling
Amanda Wilson
#594648
[email protected]
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz
of this mixture, which consisted of 3 phases at specific varying times and temperatures, was then
performed using the GeneAmp® PCR System 9700. The cycled product was then victualled in
The cycle sequencing product was combined with 5.0 µl of Prep Solution; the Prep
Solution contained 2.0µ l 100mM EDTA, 2.0 µl 3M NaOAc and 1.0 µl Glycogen. This mixture
was pooled with 60 µl of cold 95% EtOh, mixed and centrifuged at 13,200 rpm for 15 min. to
pellet supernatant for removal. 200µl cold 70% EtOH was then added and again, centrifuged at
13,200 rpm for 5 min. to pellet supernatant for removal, and again repeated. The samples were
then air-dried for 25 min. to evaporate all EtOH. The success of cycle sequencing was assayed
by gel electrophoresis using a 6% polyacrylamide gel in the Beckman Coulter CEQ 800 DNA
which interpreted the sequence material and produced an electropherogram of the results.
Results
The results of the PCR cycle sequence clean up, as seen in Figure 1; display the successful
location of target sequences for unknowns labeled 105, 107, 109, 111 and 113. Unknowns 102,
sample 102B, had relatively minor background noise, which yielded 368, from 500, for use in
[CTAGGAGGCTACGGCATACTACGCCTCACAGCTATACTAAATCCCCTCACAGAGTATATAG
CATATCCATTCCTAATACTATCCCTCTGAGGCATAATCATGACCAGCTCCATCTGCTTACGC
Amanda Wilson
#594648
[email protected]
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz
CAAACTGACCTAAAGTCACTTATTGCCTACTCCTCAGTTAGTCACATGGCCCTGGTTATGTA
CCTATCCTAATCCAAACTCCCTGAAGCTACATAGGGGCTACCACCCTCATAGTCGCCCACG
GACTCACATCCTCTATACTTTTCTGTCTACAAATACAAATTATGAACGTACCCACAGTCGAA
CAATAATTCTGGCGCGAGGCCTGCAAACACTACTACCTTTAATACAATATGATGATTACTGG
CA]. BLAST found the DNA to best match species Alpaca, accession AJ566364.1 , Lama pacos.
The top three matches revealed by GeneBank can be viewed in Table 1; Lama pacos, Lama
glama, and Lama guanicoe with Max Identity values of 98%, 98%, and 96%, respectively. The
E-values and Query Coverage values were constant among all three species E-values being 0.0
Discussion
The PCR process adequately identified a species of lama; however, it was not without difficulty.
The failure of the second electrophoresis was attributed to poor constitution of master mix. It is
likely that some form of contamination or inadequate amounts of some substance impaired
functioning. Some sources point to the type of polymerase and 5’ to 3’ nuclease activity
experiments in this study, this does not account for the errors (Huang et al., 2009). The success
of identification came selective editing of the electropherogram result prior to BLAST search
and the resulting low E-values expressed during matching. Deepak et al. (2007) discusses the use
of Real Time PCR as a more sensitive version of the standard PCR and may have aided in better
quantification of expressive gene profiles but also insists the sampling risks are amplified due to
this sensitivity. Research done by Kubista et al. (2006) appear to agree that Real Time PCR
development of both methods will hopefully yield increasingly efficient methods of genetic
profiling, in the mean time; it may simply be a case of enhancing experience of practitioners
Literature Cited
Cohen, J. 1995. Genes and behavior make an appearance in the O.J. trial. Science, 268(5207), 22.
d'Abbadie, M., Hofreiter, M., Vaisman, A., Loakes, D., Gasparutto, D., Cadet, J., et al. (2007).
Dąbrowski, S., Olszewski, M., Piątek, R., & Kur, J. 2002. Novel thermostable ssDNA-binding
Deepak, S., Kottapalli, K., Rakwal, R., Oros, G., Rangappa, K., Iwahashi, H., et al. (2007). Real-
Gibbs, M., Reeves, R., Mandelman, D., Qingli, M., Jun, L., & Bergquist, P. (2009). Molecular
diversity and catalytic activity of Thermus DNA polymerases. Extremophiles, 13(5), 817-
826. doi:10.1007/s00792-009-0269-8.
Green, R. E., Krause, J., Ptak, S. E., Briggs, A.W., Ronan, M. T., Simons, J. F., Du, L., Egholm,
M., Rothberg, J. M., Paunovic, M., and Paabo, S. 2006. Analysis of one million base
Gray, W., Mullis, L., LaPatra, S., Groff, J., & Goodwin, A. (2002). Detection of koi herpesvirus
doi:10.1046/j.1365-2761.2002.00355.x.
Huang, Q., & Li, Q. (2009). Characterization of the 5′ to 3′ nuclease activity of Thermus
Krings, M., Stone, A., Schmitz, R. W., Krainitzki, H., Stoneking, M., Paabo, S. 1997.
Neanderthal DNA sequences and the origin of modern humans. Cell 90:19-30.
Kubista, M., Andrade, J., Bengtsson, M., Forootan, A., Jonák, J., Lind, K., et al. (2006). The
doi:10.1016/j.mam.2005.12.007.
McGrath, S., and Dooley, J. (2000). Quantification of Clostridium botulinum Toxin Gene
Mullis, K. B., 2000. Dancing naked in the mind field. New York: Vintage Books.
Mullis, K. B., 1990. The unusual origin of the polymerase chain reaction. Sci Am. 262 (Apr):56-
65.
Mullis, K. B., and Faloona, F. A. 1987. Specific synthesis of DNA in vitro via a polymerase-
Rohde, R., and Mulawski, O.K. 2004. National laboratory training network public health series
course: Molecular diagnostic techniques for the public health laboratory. Laboratory
Medicine, 35:497-501.
Sharkey, F., Banat, I., & Marchant, R. (2004). A rapid and effective method of extracting fully
intact RNA from thermophilic geobacilli that is suitable for gene expression analysis.
Sinclair, A. (2002). Genetics 101: polymerase chain reaction. CMAJ: Canadian Medical
Appendix
Amanda Wilson
#594648
[email protected]
Bio 2450 Genetics
Dr. N. Martin
Amanda Schultz