Acta Biol. Univ. Daugavp.

16 (1) 2016
ISSN 1407 - 8953

DNA BARCODING OF SELECTED PACHYRHYNCHUS

SPECIES (COLEOPTERA:CURCULIONIDAE) FROM MT.
APO NATURAL PARK, PHILIPPINES

Analyn Anzano Cabras, Reggie Dela Cruz

Anzano Cabras A., Dela Cruz R. 2016. DNA barcoding of selected Pachyrhynchus species
(Coleoptera:Curculionidae) from Mt. Apo Natural Park, Philippines. Acta Biol. Univ. Daugavp.,
16 (1): 111 – 118.

Pachyrhynchus Germar, 1824 is a genus with a center of diversity in the Philippines and
has roughly 90% of endemism. Despite their narrow distribution often confined to a single
mountain range or island, a wide range of interspecific variation is present which provides
difficulty in its classification and identification. Currently, the subtle difference in genitalia
structure is the only most conclusive basis in delineating species. To address this problem
combining morphological traits and DNA barcoding in identifying species is believed to
be helpful especially for problematic groups. For this study, three species of Pachyrynchus
sympatrically found in Mt. Apo Natural Park, Mindanao which shows low morphological
variation were selected for DNA barcoding. The first partial DNA sequence of the mitochondrial
c cytochrome oxidase (cox1) gene of the genus Pachyrhynchus is presented in this paper.
DNA extraction was conducted using modified CTAB-PVP method and Promega Wizard
Genomic DNA Purification Kit. Gene amplification was done using LCO1490 and HCO 2198
primers producing 600-800 bp. Neighbour-Joining (NJ) and Maximum Likelihood were used
to measure evolutionary distance. Three distinctive topologies with high bootstrap (100%)
were generated. Thirty five nucleotide positions of COI were found to vary which shows the
capacity of COI gene in distinguishing Pachyrhynchus to the species level. The data support
the initial finding that P. apoensis Yoshitake, 2012 and P.pseudamabalis Yoshitake, 2012 are
closely related because of the structure of their reproductive organ. DNA barcoding together
with morphological characters should be used in delineating species especially in problematic
groups for taxonomic and conservation purposes.

Key words: DNA barcode, cytochrome oxidase 1, Mindanao Island, endemic, beetles.

Analyn Anzano Cabras.Math and Science Department, University of Mindanao,

Davao City, Philippines, E-mail: [email protected]
Reggie Yadao Dela Cruz. Biology Department,Central Mindanao University, Musuan Town,
Maramag,Bukidnon, Email: [email protected]

111
 Anzano Cabras A., Dela Cruz R.

INTRODUCTION in the animal kingdom(Hebert et al. 2003).

Data on the sequence of cytochrome c oxidase
One of the problematic taxa in the order subunit 1 (COl) gene will not only help solve
Coleoptera is the family Curculionidae which problematic taxa but also help provide these
comprises the family of the “true” weevils or species evolutionary relationship.
“snout beetles”. It is the third-largest animal
family, with over 50,000 species described In this study, three closely related species of
worldwide (Oberprieler et al. 2007). They are Pachyrhynchus which occur sympatrically in
recognized by their distinctive long snouts Mt. Apo Natural Park were subjected to DNA
and geniculate antennae with small clubs. barcoding which will provide the first data of
Curculionids have considerable diversity of form mitochondrial cytochrome c oxidase subunit 1
and size and some are polymorphic (Oberprieler (COl) gene sequence of the genus Pachyrhynchus.
et al. 2007). Hence, difficulty in its classification A phylogenetic tree was also be inferred to show
even in the higher classification is observed as their evolutionary relationship with other species
there is a wide range of variation present (Wink of Pachyrynchini.
et al. 1997).

Pachyrynchini is a tribe of the family Curculionidae MATERIAL AND METHODS

or true weevils and subfamily Entiminae with its
center of diversity in the Philippines. Majority of Specimen collection
its genera are found in the country and has 90% of
endemism for its species in the Philippines. One Samples were obtained from shrubs and trees at
of the genera of the tribe which is highly endemic an elevation between 1000 to 2000 masl which
in the Philippines is the genus Pachyrhynchus. was the recorded distribution of the selected
The species under this genus are known to have Pachyrynchus species in Mt. Apo Natural Park
a narrow distribution often confined to a single (Cabras et al. 2016). Specimens were collected
mountain, mountain range or island due to their through beating sheet and handpicking and killed
flightless characteristic. Interspecific variations in vials with ethyl acetate. Specimens were
in the elytral markings as well as color of then soaked in 95% ethanol. Identification prior
integuments have been observed from various to DNA extraction was done using taxonomic
collections from the different mountains and descriptions provided by Yoshitake (2012).
islands. These variations provide a difficulty in
identifying them to the species level. Accurate DNA extraction protocol
taxonomic identification is deemed necessary
especially for their conservation since they are Two DNA extraction protocols were used in the
forest dweller species and our rapid habitat loss study. For species with numerous specimens,
threatens their survival in the wild. a CTAB- PVP protocol which followed that of
Mega and Revers (2011) with some modification
DNA barcoding of animals using mitochondrial was used. For species with limited number of
cytochrome c oxidase subunit 1 was established specimens Promega Wizard Genomic DNA
by Herbert et al. (2003) as a new approach to Purification Kit was used following the protocol
taxon recognition and has been an important tool from its manual. The tissues used for DNA
in delineating species, identifying new species extraction of Pachyrhynchus were the legs since it
and in establishing phylogenetic relationships has lots of muscle which is rich in mitochondrial
(Herbert et al. 2003).Mitochondrial cytochrome DNA (Cox et al. 2013). Legs were obtained from
c oxidase subunit 1 which is one of the most each Pachyrhynchus specimen and weighed.
widely used genes in animal DNA barcoding For the CTAB-PVP method, legs were crushed
has been proven to have the capacity to show partially and added with liquid nitrogen and
high divergence among closely allied taxon immediately crushed further into a finer powder

112
 DNA barcoding of selected Pachyrhynchus species (Coleoptera:Curculionidae) from Mt. Apo Natural Park, Philippines

and placed in a 1.5ml sterile microcentrifuge tubes. primers LCO 1490 (sequence: 5’-
Crushed tissues were mixed with PVPP (Sigma, GGTCAACAAATCATAAAGATATTGG-3’)
P6755) in a proportion of 100mg of PVPP per and HCO 2198 (sequence: 5’-
1g of grinded tissue, 600μL of extraction buffer TAAACTTCAGGGTGACCAAAAAATCA - 3’)
(50mM Tris pH 8.0, 20 mM EDTA pH 8.0, 1.1M to yield an approximately 600-900 bp fragment
NaCl, 0.4M LiCl, 1% CTAB, 2% PVP40 (Sigma), of the cytochrome oxidase subunit I (COI) region
0.5% Tween 20, 0.2% β- mercaptoethanol) and of the mitochondrial DNA (Folmer et al., 1994;
poured in a 1.5ml micro centrifuge tubes and Cox et al. 2013). The PCR reaction contained 1x
mixed thoroughly. The tubes were then placed PCR buffer, 0.8 mM MgCl2, 1.2 mM dNTP mix,
in water bath at 60°C for 25 minutes. Then the 0.2 mM forward and reverse primer, 1 unit Taq
tubes were inverted to obtain a good solution of DNA polymerase and 100 ng genomic DNA.
the crushed tissues with the buffer. The tubes Cycling condition was: 2 min at 95°C; 43 cycles
were cooled at room temperature and 600μL of 30 s at 94°C; 30 s at 45°C; 5 min at 65°C, and
of chloroform: isoamyl alcohol mixture (24:1) a final elongation step of 5 min at 72°C. A PCR
was added. The tubes were mixed gently by blank control was incorporated. PCR product was
inversion to form an emulsion during 4 minutes. again run on a 1% agarose gel in a 35ml 0.25x
After that the tubes were centrifuged (Eppendorf TBE buffer. Electrophoresis was done at 100V for
Centrifuge 5415R) at 10.600g for 5 minutes at 30 min and visualized using Gel Doc EZ Imager
room temperature. The aqueous phase present in (BIO-RAD).
each tube were transferred to a new 1.5ml micro
centrifuge tube gently. Each tube was added with DNA Analysis
250μL of 5M NaCl and 750μL of cold (-20°C)
isopropanol. NaCl degrades polysaccharides. Mitochondrial cytochrome oxidase subunits
The solutions were kept in the freezer at -20ºC 1 genomic sequences ranging from 600 to
for 20 minutes to improve precipitation nucleic 800 bp of the 7 individuals of Pachyrynchus
acids. Samples were then centrifuged at 10,600g belonging to three species were aligned with
(Eppendorf Centrifuge 5415R) for 10 minutes at Clustal W. Sequences from National Center
room temperature and the supernatant poured off. for Biotechnology Information genbank were
The DNA pellets were washed with 1000μL of was used as well in constructing a phylogenetic
cold 76% ethanol. Next, the samples were spun relationship. Maximum Composite Likelihood
quickly and the excess ethanol was removed with method (Tamura et al. 2004) was used to
a micropipette. Washed DNA pellets were dried compute the evolutionary distance of the species
by leaving the tubes uncovered at 37°C for 20 and Neighbour-Joining (NJ) method (Saitou and
minutes. DNA samples were dissolved in 50μL Nei 1987) was selected for the construction of
TE (10mM Tris HCl pH 8.0, 0.1mM EDTA pH phylogenetic trees. Mega 7.0.14 was used in
8.0) and treated with 1μL of RNAase A (10mg creating a phylogenetic tree. Pairwise distance
mL-1) at 50°C for 20 minutes. was also computed using Mega 7.0.14. For
haplotypes, variation in sequences was identified
Gel Electrophoresis by Mega 7.0 Sequence Data Explorer and was
selected, identified in a table and compared to
Extracted DNA were run on a 1% agarose gel in produce haplotypes.
0.25x TBE buffer. Electrophoresis was done at
100V for 30 min and visualized using Gel Doc
EZ Imager (BIO-RAD). RESULTS AND DISCUSSION

DNA amplification and sequencing reactions DNA Barcoding Result

Polymerase chain reaction (PCR) was For Pachyrhynchus apoensis Yoshitake,

carried out using the universal barcoding 2012, 606-bp amplicons were generated

113
 Anzano Cabras A., Dela Cruz R.

from mitochondrial cytochrome oxidase gene species are the scaly patterns of their elytra. The
while Pachyrhynchus hirokii Yoshitake, 2012 tree shows that P. hirokii evolved independently
generated 708 bp and 797 bp for Pachyrhynchus among the three species of Pachyrynchus. P.
pseudamabilis Yoshitake, 2012. hirokii’s morphology is quite distinct from the
other two species by its more slender and stouter
NJ Analysis and percent divergence rostrum and body compared to P.apoensis
and P.pseudamabilis and heavily punctured
DNA sequences of Pachyrhynchus from Mt. elytra. Despite the closer elytral patterns of P.
Apo Natural Park fell into three major topologies pseudamabilis and P. hirokii other morphological
(Fig.1) each with 100% bootstrap support. P. traits including the shape of prothorax, rostrum
apoensis and P. pseudamabilis formed two and elytra as well as the extensive punctures of
closely related clades by bootstrap value of P. hirokii’s elytra, clearly distinguishes the two
92% while P. hirokii is separate from the other species. In case of the structure of the aedeagus
two species of Pachyrhynchus in Mt. Apo. which is now considered as the most conclusive
Metapocyrtus hederaephilus Yoshitake, H., S. distinguishing morphological character of
Miyahara, M. Nishino, and K. Suzuki, 2012 is Pachyrynchini, P.apoensis and P.pseudamabilis
an outgroup and belongs to another genus in this have more similar structure which means that
tribe. It is the only Metapocyrtus species with a these two are more closely related as compared
DNA barcode in NCBI. to P.hirokii. It can be inferred that scaly markings
of the elytra is not the main morphological
A high topology for the phylogenetic tree using distinguishing character for Pachyrhynchus
partial COI gene shows the high discrimination but more characters that varies such as the
power of COI gene in delineating Pachyrynchini shape of rostrum, pronotum and elytra and
fauna to the species level (Herbert et al. especially the aedeagus which is a reproductive
2003). The phylogenetic result shows a part. Conducting more DNA barcoding of
closer evolutionary relationship between P. other Pachyrhynchus species will validate this
apoensis and P. pseudamabilis. This is also inference.
supported by the morphology of P. apoensis
and P. pseudamabilis as described by Yoshitake DNA barcoding and Haplotype construction
(2012). The major differences between the two
Haplotype which refers to
the variation of nucleotides
P.apoensis 1
selected in a region is used to
100
P.apoensis 2 easily identify the nucleotide
variations of the selected
92 P.apoensis 3
species to facilitate sequence
P.pseudamabilis 1 analysis. For the three
100
species of Pachyrhynchus
P.pseudamabilis 2
in Mt. Apo Natural Park, 35
P.hirokii 1 haplotypes were recognized.
This is a high number of
P.hirokii 2
100 haplotypes and reveals the
P.hirokii 3 high discrimination power of
COI gene in distinguishing
Metapocyrtus hederaephilus
species. In other taxon such
as plants, a combination of
0.10 one or two genes are used
Fig. 1. Molecular Phylogenetic analysis by Maximum Likelihood to generate a high number
method. of haplotypes but in the case

114
 DNA barcoding of selected Pachyrhynchus species (Coleoptera:Curculionidae) from Mt. Apo Natural Park, Philippines

Table 1. Sample of haplotypes sequence variation in the three Pachyrhynchus species. The number
indicates the nucleotide position with variation

Table 2. Pairwise differences (% range) in COX I sequences among species of Pachyrhynchus

of COI one gene alone can give such a high identifying taxa up to the species level except
number of haplotypes (Pang et al. 2011, Herbert for some cases of Lepidoptera and Cnidaria
et al. 2003). The high discrimination power of which has a short divergence time. As for other
COI gene was also well studied by Herbert et taxon like Odonata, one gene is not sufficient
al. (2003) and was found to be very effective in in distinguishing species in some families and

115
 Anzano Cabras A., Dela Cruz R.

they use a combination of two genes (Chen et al. such as Pachyrhynchus which also faces
2013). In the case of Pachyrhynchus, COI was high extinction rates due to deforestation,
observed to be effective in delineating species accurate identification is highly important in
and clearly distinguishes one species from assessing abundance, habitat threats and actual
another. The analysis of the haplotypes gives distribution and endemism. DNA barcoding of
clear and definite nucleotides that may serve as Pachyrhynchus using mitochondrial COI gene
potential barcode (Maranan & Diaz, 2013). Table will be very helpful in accurate identification
1 shows the regions of the nucleotides which together with morphological data.
show variation reveals that no between species
variation was present in P. apoensis as well as P.
hirokii and P. pseudamabilis. CONCLUSION

The numbers of base differences per site from A high sequence variation using mitochondrial
between sequences are shown. The analysis cytochrome c oxidase gene was observed
involved 9 nucleotide sequences. Codon positions among the three species of Pachyrynchus found
included were 1st+2nd+3rd+Noncoding. All in Mt. Apo Natural Park, Mindanao Island. No
positions with less than 95% site coverage were within species sequence variation was observed
eliminated. That is, fewer than 5% alignment for P.apoensis, P.pseudamabilis and P.hirokii.
gaps, missing data, and ambiguous bases were Distinctive clades with higher bootstrap of 100%
allowed at any position. There were a total of for the three Pachyrhynchus species showing high
527 positions in the final dataset. Evolutionary discrimination power of COI gene in delineating
analyses were conducted in MEGA7. species of Pachyrhynchus was observed. Results
reveal the high usability of COI gene as aid in
Pairwise alignment (Table 3) shows that among identifying Pachyrhynchus to the species level.
the three Pachyrynchus species sequenced from This is highly helpful especially in problematic
Mt. Apo Natural Park, P.apoensis is closer to group of species under the genus which shows
P.pseudamabilis (i.e. d=0.25) while P.apoensis is remarkable variation in every locality. DNA
more distant compared to P.hirokii (i.e. d=0.41). barcoding supports the idea of using reproductive
Both, P.apoensis and P.pseudamabilis are character such as the aedeagus in delineating
distinguished morphologically from the pattern species. DNA barcoding using mitochondrial COI
of their elytra while P.apoensis and P.hirokii have gene should support morphological characters and
wider range of difference in the elytral pattern as aedeagus in identification of species especially for
well as shape of rostrum, pronotum and elytra. problematic taxon and for conservation purposes.
For cryptic species or species group with high
level of variation, DNA barcoding should be
further used together with morphological data REFERENCES
in identifying species. A precise and accurate
identification especially Pachyrhynchus should Ballardini, M., Mercuri, A., Littardi, C., Abbas,
be established since these are highly endemic S., Courdec, M., Ludena, B. & Pintaud,
and is highly threatened due to the loss of their J.C. 2013. The Chloroplast DNA locus
habitats. For Pachyrynchus species complex psbZ- trnfM as a potential barcode marker
such as P. venustus group and P.speciousus group in Phoenix L. (Arecaceae). ZooKeys 365:
which shows remarkably high variation in every 71–82
mountain and island, DNA barcoding should
supplement morphological data in delineating Cabras, A., Nique, G., & Mohagan, A. Diversity
species. Similar recommendation was given by and Distribution of Pachyrynchini
Bondoc (2013) in supplementing phenotypic (Coleoptera: Curculionidae: Entiminae) in
traits with DNA barcodes in authenticating Mt. Apo, Natural Park, Philippines. Journal
buffalo species. For highly endemic species of Biodiversity and Environmental Science.

116
 DNA barcoding of selected Pachyrhynchus species (Coleoptera:Curculionidae) from Mt. Apo Natural Park, Philippines

Vol. 8, No. 2, p. 312-319, 2016 Oberprieler, R. , Marvaldi, A. & Anderson, R.

2007.Weevils, Weevils, Weevils Everywhere.
Calderón-Cortés, N., Quesada,M., Cano- Zootaxa 1668: 491–520
Camacho, H., and Zavala-Páramo,G. A
Simple and Rapid Method for DNA Isolation Pang X, Song J, Zhu Y, Xu H, Huang L, Chen
from Xylophagous Insects. International S. 2011. Applying Plant Dna Barcodes For
Journal of Molecular Science. 2010; 11(12): Rosaceae Species Identification. Cladistics
5056–5064. 27:165–170.

Chen H., Shu-Miaw Chaw, Jo-Fan Wang, Reagan Pokluda, P., Čížek,L., Stříbrná,E., Drag,L,. Julius
Joseph T. Villanueva, Olga M. Nuñeza Lukeš 2, 3 and Vojtěch Novotný. A goodbye
& Chung-Ping Lin. 2013. Mitochondrial letter to alcohol: An alternative method for
genome of a flashwing demoiselle, Vestalis field preservation of arthropod specimens
melania from the Philippine Archipelago. and DNA suitable for mass collecting
Taylor and Francis. Vol.26, Issue 5. methods. European Journal of Entomology
111(2): 175–179, 2014 doi: 10.14411/
Chomczynski P, Mackey K, Drews R, Wilfinger eje.2014.024
W. DNAzol: A reagent for the rapid isolation
of genomic DNA. BioTechniques. 1997; Schultze, W., 1923. A monograph of the
22:550–553. Pachyrrhynchid group of the Brachyderinae,
Curculionidae: Part I. Philippine Journal of
Hebert PDN, Cywinska A, Ball SL, deWaard JR Science. 23: 609-673 + 6 pls.
(2003) Biological identifications through
DNA barcodes. Proceedings of the Royal Schultze, W., 1925. A monograph of the
Society Series B 270: 313–321. doi: 10.1098/ pachyrrhynchid group of the Brachyderinae,
rspb.2002.2218 Curculionidae: Part III. The genera
Apocyrtidius Heller and Metapocyrtus
Kumar S., Stecher G., and Tamura K. (2015). Heller. Philippine Journal of Science., 26:
MEGA7: Molecular Evolutionary Genetics 131-309 + pls. I–XII.
Analysis version 7.0 for bigger datasets.
Molecular Biology and Evolution. Starr, C. & Wang, H. 1992.Pachyrynchine
Weevils (Coleoptera: Curculionidae) of the
Maranan, F. and Diaz, M.G. Molecular Diversity Islands Fringing Taiwan. Journal of Taiwan
and DNA Barcode Identification of Museum. 45(2):5-14 December 1992
Selected Philippine Endemic Hoya Species
(Apocynaceae). Philippine Agricultural Tamura K., Nei M., and Kumar S. (2004).
Scientist Vol. 96 No. 1, 86–92 March 2013 Prospects for inferring very large phylogenies
by using the neighbor-joining method.
Mega, N. O. & Revers, L.F. Developing a rapid, Proceedings of the National Academy of
efficient and low cost method for rapid DNA Sciences (USA) 101:11030-11035.
extraction from arthropods. Ciência Rural,
v.41, n.9, set, 2011 Wink, M., Mikes, Z. and Rheinheimer, J.1997.
Phylogenetic Relationship in Weevils
Milligan BG. Total DNA isolation. In: Hoelzel (Coleoptera:Curculionoidea) Inferred from
AR, editor. Oxford, , New York, Tokyo: Nucleotide Sequences of Mitochondrial 16S
Oxford University Press; 1998. pp. 29–64. rDNA. Naturwissenschaften 84,318-321.
Molecular Genetic Analysis of Population:
A Practical Approach, 2nd Edition.

117
 Anzano Cabras A., Dela Cruz R.

Woodruff, R. E. 1964. A Puerto Rican weevil Received: 04.05.2016.

new to the United States (Coleoptera: Accepted: 12.05.2016.
Curculionidae). Florida Div. Plant Ind.
Entomol. Circ. No. 30: 1-2

Woodruff, R. E., and Bullock, R. C. 1979. Fuller’s

rose weevil Pantomorus cervinus (Boheman)
in Florida (Coleoptera: Curculionidae).
Florida Div. Plant Ind. Entomol. Circ. No.
207: 1-4; 3

Yap, S. A. & V. P. Gapud, 2007. Taxonomic

review of the genus Metapocyrtus Heller
(Coleoptera: Curculionidae: Entiminae:
Pachyrrhynchini). Philipppine Entomology.,
21: 115-135.

Yoshitake, H., 2012. Nine New Species of the

Genus Pachyrhynchus Germar (Coleoptera:
Curculionidae) from the Philippines. Esakia,
(52): 17-34.

Yoshitake, H., S. Miyahara, M. Nishino, and

K. Suzuki. Metapocyrtus (Trachycyrtus)
hederaephilus sp. nov. (Coleoptera,
Curculionidae, Entiminae), a pest of the
English ivy cultivated in Mie Prefecture,
Honshu, Japan. Japanese Journal of
Systematic Entomology, 18, pp. 261-267,
2012.

118