ISSN (Print) 0023-4001 ISSN (Online) 1738-0006 

Korean J Parasitol Vol. 55, No. 4: 425-428, 

August 2017 ▣ CASE REPORT https://doi.org/10.3347/kjp.2017.55.4.425 Molecular Identification of Diphyllobothrium latum 
from a Pediatric Case in Taiwan 

Yu-Chin An1, Chia-Cheng Sung2, Chih-Chien Wang2, Hsin-Chung Lin3, Kuang-Yao Chen4, Fu-Man Ku5, 
Ruei-Min Chen3, Mei-Li Chen3, Kuo-Yang Huang6,* 
1Department of Emergency Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan; 
2Departments of Pediatrics, Tri-Service General Hospital, National Defense Medical Center, Taiwan; 3Division of Clinical 
Pathology, Department of Pathology, Tri-Service General Hospital, National Defense Medical Center,Taipei, Taiwan; 
4Department of Parasitology, College of Medicine, Chang Gung University, Taoyuan, Taiwan; 5Molecular Regulation and 
Bioinformatics Laboratory, Department of Parasitology, College of Medicine, Chang Gung University, Taoyuan, Taiwan; 
6Graduate Institute of Pathology and Parasitology, National Defense Medical Center, Taipei, Taiwan 
Abstract:  Human  diphyllobothriasis  is  a  parasitic  disease  caused  by  ingestion  of  larvae  (plerocercoids)  in  raw or under- cooked 
fish  and  commonly  found  in temperate areas. Rare cases were reported in tropical or subtropical areas especially in children. The 
first  documented  case  of  pediatric  diphyllobothriasis  in  Taiwan  had  been  reported  11  years  ago.  Here,  we  report  another 
8-year-old  girl  case  who  presented  with  a  live  noodle-like  worm  hanging  down  from  her  anus,  with  no  oth-  er  detectable 
symptoms. We pulled the worm out and found the strobila being 260 cm in length. Examination of gravid proglottids showed that 
they  were  wider  than  their  lengths,  containing  an  ovoid  cirrus  sac  in  the  anterior  side  and  the  ro-  sette-shaped  uterus.  Eggs 
extracted  from  the  uterus  were  ovoid  and  operculated.  Diphyllobothrium  latum  was  confirmed  by  molecular  analysis  of  the 
mitochondrial  DNA cytochrome c oxidase subunit 1 (cox1) gene. The girl was treated with a single oral dose of praziquantel, and 
no  eggs  or proglottids were observed from her stool in the subsequent 3 months. The reemergence of human diphyllobothriasis in 
non-endemic  countries  is  probably  due  to  prevalent  habit  of  eating  im-  ported  raw  fish  from  endemic  areas. This pediatric case 
raised our concern that human diphyllobothriasis is likely under- estimated because of unremarkable symptoms. 
Key words: Diphyllobothrium latum, diphyllobothriasis, pediatric case, cox1 

INTRODUCTION 
Tapeworms  of  the  genus  Diphyllobothrium,  known  as  “fish  tapeworms” or “broad tapeworms”, are worldwide in 
distribu-  tion  and  commonly  found  in  temperate  freshwater  ecosys-  tems.  Infections  of  Diphyllobothrium  spp. 
(diphyllobothriasis)  are  mostly  reported  in  Western  Europe,  North  America,  South  America,  and  the  Far  East, 
including  Korea,  Japan,  and  Russia  [1,2]. Rare cases were reported in tropical or subtropical coun- tries where these 
cases  may  be  related  to  imported  fish  from  endemic  areas  [2].  The  most  prevalent  human  diphyllobothri-  asis  are 
caused  by  D.  latum,  D.  dendriticum,  D.  nihonkaiense,  and  D.  pacificum.  The  life  cycles  of  these  species  are 
complex, 
•Received 11 June 2017, revised 27 June 2017, accepted 2 July 2017. *Corresponding author ([email protected]) © 
2017, Korean Society for Parasitology and Tropical Medicine This is an Open Access article distributed under the terms of the 
Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits 
unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 
comprising of 2 intermediate hosts (a copepod and a fish) and a definitive host (humans or other piscivorous 
mammals). 
Human  diphyllobothriasis  takes  place  through  the  ingestion  of  larvae  (plerocercoids)  in raw or undercooked fish. 
In  recent years, eating raw fish becomes popular in Taiwan, resulting in the demand for imported fish. This may also 
increase  the  risk  of  Diphyllobothrium  infection  due to eating imported fish. Since Taiwan is not in an endemic area, 
rare  cases  were  previously  reported,  especially  for  pediatric  cases.  The  first  published  pe-  diatric  case  of  D.  latum 
infection  in  Taiwan  had  been  reported  11  years  ago  [3].  Here,  we  present another rare case of D. latum infection in 
an  8-year-old  girl,  which  was  confrimed  by  molec-  ular  analysis  of  the  mitochondrial  DNA  cytochrome  c  oxidase 
subunit 1 (cox1) gene. 
CASE REPORT 
An 8-year-old Taiwanese girl who was 127 cm tall and weighed 24 kg presented without discomfort, but a live 
noo- 
425 
 
426 Korean J Parasitol Vol. 55, No. 4: 425-428, August 2017 

A B C D 
Fig.  1.  (A)  A  strobila  of Diphyllobothrium latum expelled by the patient (about 260 cm). (B) An egg extracted from the uterus of 
a  gravid  proglottid.  The  egg  was  ovoid  and  operculated.  (C)  Tissue  section  stained  with  hematoxylin  and  eosin  showing  the 
rosette-shaped  uter-  us  of  a  gravid  proglottid.  An  ovoid  cirrus  sac  is  located in the anterior side of the gravid proglottid. Several 
eggs  are  observed  in  the  loops  of  the  uterus.  (D)  Molecular  identification  of  D.  latum  by  PCR.  Lanes  (1-4)  represent  the  PCR 
products  amplified  by  using  different  primers  for  the  most  common  Diphyllobothrium  species. Lane 1, D. pacificum; lane 2, D. 
latum; lane 3, D. dendriticum; lane 4, D. ni- honkaiense. M: marker. 
dle-like  worm  hanging  down  from  her  anus  which  was  discov-  ered  after defecation. She was a healthy elementary 
school  stu-  dent,  lived  in  a  well-off  family  and  loved  to  eat  raw  fish  with-  out  any  history  of  travel  to  a  foreign 
country.  Initially  we  pulled  the  worm  out  and  found  a  strobila  of  about  260  cm  in length (Fig. 1A). The worm was 
still alive and movable while we put it on the towel. 
Physical  examinations showed no specific signs, such as pale conjunctiva or abdominal tenderness. The laboratory 
data  re-  vealed  the  hemoglobin  count  to  be  12.3  g/dl,  the  red  blood  cell  count  to  be  4.51×106/μl,  and  the  mean 
corpuscular  vol-  ume  (MCV)  of  79.8  fl.  Platelet  count  was  248×103/μl,  and  the  white  blood  cell  count  was 
5.07×103/μl (neutrophils 51.1%; lymphocytes 40.2%; eosinophils 3.2%). 
Diphyllobothriasis  was  diagnosed  by examination of the gravid proglottids and eggs. The segments are wider than 
their  lengths,  which  contain  an  ovoid  cirrus  sac  in  the  anterior  side  of  each  proglottid.  The  rosette-shaped  gravid 
uterus  has  5-6  loops  on  each  side  (Fig.  1B).  Eggs  extracted  from  the  worm’s  uterus  were  found  to  be  ovoid, 
yellow-brown,  and  operculated  (Fig.  1C).  The  specific  identification  of  Diphyllobothrium  species  is  very  difficult 
only by morphological observations. Hence, 
molecular  analysis using PCR (Table. 1) is the only reliable ap- proach to differentiate these parasites. Amplification 
of  the  mitochondrial  DNA  cox1  gene  was  performed  as  previously  described  [4]  (Fig.  1D).  The  expected  product 
sizes  were  437  bp  for  D.  latum,  318  bp  for  D.  dendriticum,  727  bp  for  D.  pacifi-  cum,  and  1,232  bp  for  D. 
nihonkaiense.  DNA  extracted  from  the  tapeworm  sample  was  successfully  amplified  for  D.  latum,  yielding  a 
specific  product  size  close  to  the  expected  one, and no products were amplified for the other Diphyllobothrium spe- 
cies. The data confirmed that the species of Diphyllobothrium is D. latum. 
The  girl  was  treated  with  a  single  oral  dose  of  praziquantel  (8.5  mg/kg/dose).  After  administration,  no  eggs  or 
proglottids were observed from the stool in the subsequent 3 months. Ra- 
20 μM 
M (bp) 
1 2 3 4 
1,000 
500 
Table 1. Primers used for PCR in this study 
Specificity Strand Sequence (5’ > 3’) 
Common Reverse ATGATAAGGGAYAGGRGCYCA Diphyllobothrium 
latum 
Forward GGGGTGTTACGGGTATTATACTC 
D. dendriticum Forward GTGTTTTTCATTTGATGATGACCAGTC D. pacificum Forward 
ACATGTGTGTAGTAACCTTGGC D. nihonkaiense Forward CTTTGTTGTCTGGCCTTCCT 
 
An et al.: A pediatric case of Diphyllobothrium latum infection, Taiwan 427 
diological  examinations  or  gastrointestinal  fiberoptic  endos-  copy  were  not  performed  due  to her young age and no 
other remarkable symptoms. 
DISCUSSION 
There  are  several  species  of  Diphyllobothrium  infecting  hu-  mans.  Among  these,  D.  latum,  D.  dendriticum,  D. 
pacificum,  and  D.  nihonkaiense  have  been  shown  to  be  the main species. D. latum was commonly reported all over 
the  world,  including  Europe,  North  America  (Alaska,  Great  Lakes),  and  Asia  [2,5].  D.  pacificum  was  found  in the 
Pacific  Coast  of  South  America  and  Japan.  D.  nihonkaiense  is  prevalent  in  Japan  and  Korea,  but  rare in Europe or 
America.  In  Taiwan,  only  rare  cases  of  diphyl-  lobothriasis  were  reported  in  the  past  caused  by  D.  latum  and 
presumably  related  to  imported  salmon  [3,6].  Recent  taxo-  nomic  studies  indicated  that  the  majority  of  human 
diphyllo-  bothriasis  was  caused  by  D.  nihonkaiense.  Many  cases  of  D.  la-  tum  infection  reported  in  Korea  were 
re-identified  as  D.  ni-  honkaiense  based  on molecular analysis of the mitochondrial cox1 gene [7]. Therefore, it was 
necessary  to  perform  molecular  analysis  in  order  to  identify  the  species  of  Diphyllobothrium.  In  our  study,  we 
successfully  identified  the  broad  tapeworm  to  the  species  level  by  PCR  analysis  of cox1 gene. We used forma- lin- 
and  ethanol-preserved  samples  for  extraction  of  DNA  and  subsequent  PCR  analysis.  However,  DNA  can  be 
extracted  only  from  ethanol-preserved  samples  but  only  with  difficulty  from  formalin-preserved  ones.  This 
observation is consistent with the results of previous studies, indicating that formalin irre- versibly affects the quality 
of DNA. 
Since  D.  latum  was  identified,  we  sought  to  investigate  the  possible  source of this parasitic infection. In previous 
studies,  including  rare  cases  reported  in  subtropical  and  tropical  Asia  [1,2,5],  D.  latum is worldwide in distribution 
but  D.  ni-  honkaiense  seems  to  dominate  in  the  northern  Pacific region. The second intermediate hosts of D. latum, 
including  freshwa-  ter,  anadromous,  and  marine  fish  had  been  reported,  and  the  pacific  salmon  was  the major host 
which  contributed  to  D.  ni-  honkaiense  infection  [2,7].  More  species  of  second  intermediate  hosts infected with D. 
latum  possibly  result  in  wider  distribu-  tion,  especially  in  non-endemic  areas,  due  to  imported  fish.  However,  the 
reliable  cause  of  D.  latum  infection  in  Taiwan  in-  stead  of  D.  nihonkaiense  or  other  Diphyllobothrium  spp.  infec- 
tion  was  still  unclear.  The  different  environmental  adaptability of Diphyllobothrium spp. is worthy of investigation. 
In our case, 
the  girl  had  never  ingested  salmon.  Thus,  her  diphyllobothria-  sis  was  presumably  caused  by  ingestion  of  other 
species of im- ported fish, although it is hard to trace the specific source. 
D.  latum  infections  are  mostly  asymptomatic,  but  some  pa-  tients  may  present  with  transient  abdominal 
discomfort,  ab-  dominal  pain,  diarrhea,  fatigue,  and  less  commonly  intestinal  obstruction.  Severe cases of D. latum 
infection may lead to megaloblastic anemia because vitamin B 
12 
is  absorbed  by  the worm. Lee et al. [8] showed 5 cases of D. latum infection 
among  children  in  Korea,  and  3  of  them  presented  with  ab-  dominal  pain,  1  with  anemia,  and  1  with  passage  of 
proglot-  tids  [8].  The  first  pediatric  case  in Taiwan, a 8-year-old boy, also presented with passage of proglottids [3]. 
In  our  case,  the tapeworm was initially misidentified as a part of intestine and finally recognized as D. latum. Due to 
the  unremarkable  symp-  toms  and  chief  complaints  of  our  case,  we  propose  that  D.  la-  tum  infection  may  be 
underestimated in Taiwan. 
Praziquantel is the first choice of treatment for diphyllo- bothriasis. Oral administration of a single dose from 10 to 
25  mg/kg  has  been recommended to treat D. latum infection. Al- most all reported cases have been effectively cured 
with  rare  side  effects.  In  our  case,  the  proglottids  were  expelled  before  a  single  dose of praziquantel treatment (8.5 
mg/kg/dose),  and  no  eggs  or  proglottids  were  observed  in  the  stool  during  fol-  low-up.  Intraduodenal  gastrografin 
has  been  reported  to  be  an  effective  treatment  as  an  alternative  therapy  for  diphylloboth-  riasis.  However,  this 
method is limited for choice because in- sertion of duodenal tube is painful, which is not suitable for children. 
We  examined  the level of hemoglobin and the stool in the subsequent 3 months for follow-up. All of them showed 
nega- tive results. We did not check the level of vitamin B 
12 
because  the  levels  of  hemoglobin  and  MCV  were  normal,  and no 
evi-  dence of anemia was found. In previous reports, gastrointesti- nal fiberoptic endoscopy and abdominal magnetic 
resonance  imaging  were  used  for  diagnosis  and  removal  of  the  residual  scolex  [2,8].  However,  these examinations 
are costly and diffi- cult to be accepted for children. 
Since  eating  raw  fish  imported  from  the  endemic  area  be-  comes  more  popular,  prevention  of  diphyllobothriasis 
should  be  taken  seriously.  Deep-frozen  fish  (at  -10  ̊C  for  24-48  hr)  or  brine-treated  fish  (12%  NaCl)  is  safe  for 
consumption  [6].  Ad-  ditionally,  plerocercoid  larvae  could  be  killed at a temperature of 55 ̊C in 5 min [5]. Hence, it 
is not recommended to eat raw or smoked fish and consumption of well-cooked fish is the 
 
428 Korean J Parasitol Vol. 55, No. 4: 425-428, August 2017 
better way to prevent the reemergence of diphyllobothriasis. 
In  conclusion,  we  should  be  aware  of reemergence of hu- man diphyllobothriasis in non-endemic countries due to 
prevalent  habit  of  eating  raw  fish  that  may  be  imported  from  endemic  areas.  Additionally,  it  is  noteworthy  that 
human di- phyllobothriasis is likely underestimated because of unre- markable symptoms. 
ACKNOWLEDGMENT 
This  work  was  funded  by  the  Ministry  of  Science  and  Tech- nology, Republic of China (MOST 105-2320-B-016 
-019 -MY2) to Kuo-Yang Huang. 
CONFLICT OF INTEREST 
All authors declare no conflict of interest. 
REFERENCES 
1. Kuchta R, Brabec J, Kubackova P, Scholz T. Tapeworm Diphyllo- bothrium dendriticum (Cestoda)--neglected or emerging 
human parasite? PLoS Negl Trop Dis 2013; 7: e2535. 2. Scholz T, Garcia HH, Kuchta R, Wicht B. Update on the human broad 
tapeworm (genus diphyllobothrium), including clinical rel- 
evance. Clin Microbiol Rev 2009; 22: 146-160. 3. Chou HF, Yen CM, Liang WC, Jong YJ. Diphyllobothriasis latum: the first 
child case report in Taiwan. Kaohsiung J Med Sci 2006; 22: 346-351. 4. Wicht B, Yanagida T, Scholz T, Ito A, Jimenez JA, 
Brabec J. Multi- plex PCR for differential identification of broad tapeworms (Cestoda: Diphyllobothrium) infecting humans. J 
Clin Microbiol 2010; 48: 3111-3116. 5. Dick TA, Nelson PA, Choudhury A. Diphyllobothriasis: update on human cases, foci, 
patterns and sources of human infections and future considerations. Southeast Asian J Trop Med Public Health 2001; 32 (suppl): 
59-76. 6. Lou HY, Tsai PC, Chang CC, Lin YH, Liao CW, Kao TC, Lin HC, Lee WC, Fan CK. A case of human 
diphyllobothriasis in north- ern Taiwan after eating raw fish fillets. J Microbiol Immunol In- fect 2007; 40: 452-456. 7. Park SH, 
Jeon HK, Kim JB. Four additional cases of Diphylloboth- rium nihonkaiense infection confirmed by analysis of COX1 gene in 
Korea. Korean J Parasitol 2015; 53: 105-108. 8. Kim HJ, Eom KS, Seo M. Three cases of Diphyllobothrium ni- honkaiense 
infection in Korea. Korean J Parasitol 2014; 52: 673- 676. 9. Lee SH, Park H, Yu ST. Diphyllobothrium latum infection in a child 
with recurrent abdominal pain. Korean J Pediatr 2015; 58: 451-453. 10. Raether W, Hänel H. Epidemiology, clinical 
manifestations and diagnosis of zoonotic cestode infections: an update. Parasitol Res 2003; 91: 412-438.