Chondrus Crispus: RT-QPCR Normalization Genes in The Red Alga

Download as pdf or txt
Download as pdf or txt
You are on page 1of 7

RT-qPCR Normalization Genes in the Red Alga Chondrus

crispus
Nathalie Kowalczyk1,2, Sylvie Rousvoal1,2, Cécile Hervé1,2, Catherine Boyen1,2, Jonas Collén1,2*
1 Centre National de la Recherche Scientifique, UMR7139 Végétaux marins et biomolécules, Station Biologique de Roscoff, Roscoff, Brittany, France, 2 Université Pierre et
Marie Curie - UPMC Paris 6, Station Biologique de Roscoff, Roscoff, Brittany, France

Abstract
Chondrus crispus is a common red macroalga living on the rocky shores of the North Atlantic Ocean. It has a long research
history, being a major source of carrageenan, a thickener widely used in the food industry, but also for physiological and
ecological studies. To establish it as a model for red algae, its genome has been sequenced, allowing the development of
molecular tools such as quantification of gene expression, including RNAseq and RT-qPCR. To determine appropriate genes
for RT-qPCR normalization, the expression of 14 genes was monitored in 18 conditions using two sets of algal samples:
samples from the sequenced strain, cultured and stressed in laboratory conditions and C. crispus collected on the shore and
stressed in situ. The expression stability of the genes between the samples was evaluated by comparing the Ct range and
using the programs geNorm and NormFinder. The candidate genes encoded translation related proteins (initiation factors
IF4A-1 and IF4A-2, elongation factor EF1a and eRF3, an eukaryotic polypeptide chain release factor), cytoskeleton proteins
(two b-tubulins, a-tubulin and actin), enzymes involved in the pentose phosphate pathway (glucose 6-phosphate
deshydrogenase), protein recycling process (ubiquitin and ubiquitin-conjugating enzyme) and glycolysis (isocitrate
dehydrogenase). The two sets of samples showed different expression patterns. Most of the genes were stable in the algae
cultivated in the laboratory, whereas environmental samples showed a more important variation in gene expression. When
analyzing the two sets separately, the ranking of the most stables genes were different from one method to another. When
considering all samples, the two statistical methods were concordant, revealing translation initiation factor 4A-2 and
eukaryotic polypeptide chain release factor 3 as pertinent normalization genes. This study highlights thus the importance of
testing reference genes according to the experiments as well as the genetic and physiological background of the organism.

Citation: Kowalczyk N, Rousvoal S, Hervé C, Boyen C, Collén J (2014) RT-qPCR Normalization Genes in the Red Alga Chondrus crispus. PLoS ONE 9(2): e86574.
doi:10.1371/journal.pone.0086574
Editor: Ross Frederick Waller, University of Melbourne, Australia
Received May 29, 2013; Accepted December 12, 2013; Published February 3, 2014
Copyright: ß 2014 Kowalczyk et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by funding from IDEALG Grants ANR-10-BTBR-04-02 and 04-04 ‘‘investissements d’avenir,’’ Biotechnologies-Bioressources. The
funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: [email protected]

Introduction plants (rice [16], grapevine [17], banana [18]) and more recently
in the brown algal model Ectocarpus siliculosus [19].
Chondrus crispus is a red macroalga, widely represented in the Until now, actin has been used as a normalization gene for C.
intertidal and subtidal zones of the rocky shores of the North crispus, based on the use of this gene as a common reference gene
Atlantic Ocean. Because of its ecological abundance and its in other species. However, the stability of the expression of this
economical importance, it has been one of the principal sources gene has not been tested in C. crispus. To our knowledge, few other
for carrageenan, a gellifying and thickening molecule used in the studies in red algae have used RT-qPCR for gene expression,
food industry, it also has a relatively important research history. Its however, when performed, usually without data normalization
habitat is a dynamic environment undergoing rapid changes of [20] [21]. In one case, a gene with an unknown function was used
large amplitude in physical and chemical parameters due to the as a reference [22], and in one recent study, Wu et al. showed that
tidal cycles, combined with diurnal and weather variations. Studies b-tubulin was an appropriate normalization gene for expression
about stress in C. crispus have been carried out, first with studies between Porphyra haitanensis gametophyte and tetraspor-
physiological approaches [1] [2] [3], then with molecular tools ophyte [23]. Even if normalization genes have been defined in
such as large scale quantitative transcriptomics [4] [5]. many species, it appears that there is no universal gene common to
In previous reports [4] [6] [7], RT-qPCR has been used for every organism. Quantitative transcriptomics is an important part
targeted expression studies in C. crispus. This technique is sensitive of the work on C. crispus and RT-qPCR aims to exploit accurately
to quantify gene expression and highly reliable [8] [9], but the high-throughput data. The genome of C. crispus has been
depends on the stability of the genes used as reference for data sequenced and annotated [24], simplifying the determination and
normalization. Different methods of identifying normalization identification of the optimal normalization genes.
genes have been developed so far, such as geNorm [10],
NormFinder [11] and BestKeeper [12]. These algorithms have
been used in many reports, in a wide range of organisms and
tissues, first in animals (dolphin [13], fish [14], worm [15]), then in

PLOS ONE | www.plosone.org 1 February 2014 | Volume 9 | Issue 2 | e86574


Normalization Genes in Chondrus crispus

Materials and Methods Three biological replicates, each containing a pool of algal
thalli, were obtained for each treatment and these were used for
Culture conditions and treatments RNA extraction.
The collections of algae were made on public property and
according to French law no permission is needed for the collection Nucleic acid extractions
of limited amounts of seaweed for non-commercial purposes. RNA and DNA were extracted using respectively Qiagen
Chondrus crispus is a common seaweed, is not considered RNeasy plant kit and DNeasy plant kit, according to the
endangered and is not a protected species. manufacturer’s protocols with the following two modifications:
The red alga Chondrus crispus Stackhouse (Gigartinales, Rhodo- 100 mg of frozen tissue were ground in liquid nitrogen and were
phyta) from two different origins was used for the experiments (see resuspended in the extraction buffer. After mixing vigorously for
table 1), the samples A, F, G, H, I and M were gametophytes several minutes, a centrifugation step was added to eliminate
collected near the port of Bloscon in Roscoff (48.724, 23.970 cellular debris. After the RNA extraction, a treatment with
Brittany, France). The algae labelled C1 to C12 were samples RNAse-free DNAse I (Turbo DNAse, Ambion) was performed in
from the strain of C. crispus ‘‘Peggy’s Cove’’, a gametophyte order to eliminate residual genomic DNA.
collected in 1986 in Peggy’s Cove, Canada and kept in 10 L plastic
flasks in filtered and autoclaved NSW (natural sea water) in a RNA quantification and cDNA synthesis
culture room at 13uC and bubbled with compressed air. Light was Nucleic acid concentrations were measured by absorbance at
provided by fluorescent tubes with a photon flux density of OD260 using a Thermo NanoDrop 2000 spectrophotometer. The
100 mmol of photons?m2?s21 for 12 hours per day. purity of RNA samples was assessed by measuring the ratio
For the chemical treatments the algae were transferred into OD260/OD280 and OD230/OD260 (see table S1 and table S2).
Petri dishes containing 5 mL of NSW and the additives for RNA integrity was verified by capillary electrophoresis using the
3 hours. The treatments were 10 mM H2O2, 200 mg?L21 harpin, Agilent Bioanalyzer 2100 (Fig. S1), according to the manufactur-
200 mM CdCl2, 200 mM CuSO4, 200 mM ZnCl2, 200 mM AlCl3, er’s instructions or by agarose gel electrophoresis (Fig. S2). The
500 mM dichlorvos, 500 mM glyphosate, 500 mM paraquat, 1% RNA of each sample was diluted and 800 ng was reverse-
DMSO and 100 mM methyl jasmonate with DMSO (1%). transcribed to cDNA using oligo(dT)12–18 and the Superscript II
The treatments for the field collected algae were full sunlight in RT kit (InVitrogen) according to the manufacturer’s protocol, and
NSW for 0, 3 and 5 h to follow the diurnal cycle. For hypersaline subsequently diluted with nuclease free water to 0.5 ng mL21.
stress combined with light stress, algae were exposed to full
sunlight in enriched NSW with 33 g?L21 of NaCl added (200% Real-time PCR
NSW), sunlight filtered to 35% in NSW and sunlight filtered to For each gene, a pair of oligonucleotide sequences was designed
35% in NSW enriched with 33 g?L21 of NaCl. All samples were close to the 39 end of the coding sequence using Primer Express
immediately frozen in liquid nitrogen and stored at 280uC for 12 from Applied Biosystems (Table 2). Primers were designed to have
months. a melting temperature around 60uC, a length between 18–26
nucleotides, a GC content between 40–60%, and avoiding
secondary structures and self- and cross-annealing. The specificity
Table 1. Culture conditions, treatments and duration. of the oligonucleotides was tested in silico, using BLAST on the
whole genome of C. crispus. The Q-PCR reactions were performed
in a 96-well Chromo 4 thermocycler (Bio-Rad) with SYBRgreen
Sample Treatment Duration PCR master kit. The protocol was: 14 min at 95uC, followed by 40
A 100% NSW - 100% sunlight 0h
cycles of 15 s at 95uC and 60 s at 60uC. Each sample was
technically triplicated. C. crispus genomic DNA was used as a
F 200% NSW - 35% sunlight 3h
quantification reference. A 1:6 dilution series ranging from 29 to
G 100% NSW - 35% sunlight 3h 37,500 copies of the C. crispus genome was prepared and tested for
H 200% NSW - 100% sunlight 3h each gene in order to determine the amplification efficiency
I 100% NSW - 100% sunlight 3h (equations of the standard curves in the data S1). T he specificity
M 100% NSW - 100% sunlight 5h
of the amplification was verified with a dissociation curve obtained
by heating the samples from 65uC to 95uC. In addition to the
C1 NSW 3h
DNAse I treatments, the absence of genomic DNA was confirmed
C2 10 mM H2O2 3h by attempting to amplify an intron sequence using the cDNA
C3 200 mg?L21 harpin 3h as a template. The number of copies of contaminant gDNA
C4 200 mM CdCl2 3h (less than 100 copies) was subtracted from all other values, prior
C5 200 mM CuSO4 3h to any further analysis.
C6 200 mM ZnCl2 3h
Results and Discussion
C7 200 mM AlCl3 3h
C8 500 mM dichlorvos 3h Treatments and choice of housekeeping genes
C9 500 mM glyphosate 3h Two sets of conditions were tested in this study. In one set, algae
C10 500 mM paraquat 3h
collected on the shore were submitted to treatments in situ
immediately after sampling in order to reproduce conditions close
C11 NSW+1% DMSO 3h
to natural stresses. As the diurnal rhythm has a strong influence on
C12 100 mM methyl jasmonate in DMSO (1%) 3h metabolism and physiology of red algae, a series of samples
Culture conditions and duration. NSW: natural sea water, DMSO: Dimethyl
collected at three different times of the day was also analyzed. In
sulfoxide. tide pools, light, temperature and salinity are known to vary
doi:10.1371/journal.pone.0086574.t001 considerably, with subsequent changes in the gene expression. The

PLOS ONE | www.plosone.org 2 February 2014 | Volume 9 | Issue 2 | e86574


Normalization Genes in Chondrus crispus

Table 2. Sequences of the primers used for quantitative PCR in C. crispus.

Gene code Accession number 59 (forward) - 39 (reverse) E (%) R2 Tm product PRL (bp)

IF4A-1 XM_005714063.1 CCCGACAAACCGTGAGAAC 99 0.997 82.57 82


CAAGAAGTTAATGGCGACACC
UBQ XM_005711099.1 TCAGACTACAACATCCAGAAGG 100 0.9945 85.87 126
CTTACGGCACACCATACGG
eRF3 XM_005712129.1 GAGGAGTTCACCGTGTCTAAG 94 0.9975 81.46 117
CGACATCTTCAACTGTACTAAGC
Tub b-1 XM_005714305.1 TTGCCGCCACCTTTATCG 91 0.995 83.54 137
GAACTCCATCTCATCCATACCC
G6PdH XM_005717558.1 AAACGGACCTGAAAGTAGTAATG 105 0.9645 83.32 114
ATGCCCAAACACGAGAACC
EF1a XM_005712045.1 CTCCGCAGCAACCATTCG 103.5 0.9945 82.35 91
AGCATGACCACTGTGTTACC
IF4A-2 XM_005718687.1 CTCGCCTCTGCCACATTC 99.5 0.994 83.23 100
GCCTTGTCGTCCTGGTAATC
UbCE XM_005713333.1 GCCACCAGTTGTCAAGTTTG 100 0.9975 79.88 80
GAGGATGTCCAAGCAGATACC
Tub b-2 XM_005715615.1 CGACCTTGTTTCCGAATATCAG 98 0.9855 80.17 84
TCGTTCTCATACCCTTCTTCTTC
IcdH XM_005711636.1 AATCCGATTGCCTCTATATTTGC 101 0.995 80.3 66
GGTCCCATCCAACTTTCCTC
Actin XM_005717205.1 ATTTGACTGCCTTTAACTCCATC 99 0.998 80.61 135
GGGTCTCAATCTCCTTCTGC
Tub-a XM_005713236.1 TGCTCAATCGCCAACTCG 98 0.999 82.33 113
ATACCCTCGCCCACATACC
NUox XM_005716764.1 AGTGCCATACACGATTCTGC 100 0.998 82.8 72
AACAACAGCGAGTCCATCC
Sulf XM_005713481.1 TTTGAGAATCGCACTGGTAAAC 89 0.968 85.13 133
ATACTCCTTATCCATCCACTCTG
Intron XM_005711099.1 GCTTGGGTTTCGCACATTAC 100 0.999 85.27 146
GCATCAAGAAGAAGATTAAGCCT

E: efficiency, R2: correlation coefficient, PRL: PCR product length, bp: base pair.
doi:10.1371/journal.pone.0086574.t002

environmental samples had a genetic background different from abundance of the transcripts of 14 potential housekeeping genes
the sequenced strain from which the PCR primers were designed. was assayed. First, candidate genes considered as normalization
The comparison of environmental samples with cultured samples genes for RT-qPCR in other marine eukaryotic and prokaryotic
represents the originality of this study. species were chosen [19] [25]. Then, among this list, 12 genes
The other set of experiments was carried out in laboratory have been selected from a transcriptomics experiment done on
controlled conditions, using samples of the sequenced strain of C. environmental samples of C. crispus and correspond to the most
crispus. The agents used such as H2O2, a reactive oxygen species stably expressed genes in this experiment (unpublished data). The
produced by many organisms, including algae, under conditions of candidate genes encoded translation related proteins (initiation
abiotic and biotic stress, as well as methyl jasmonate, are known to factors IF4A-1 and IF4A-2, the elongation factor EF1a and eRF3,
induce a strong stress response at the transcriptomic level in C. an eukaryotic polypeptide chain release factor), cytoskeleton
crispus [4]. Metals like copper, cadmium, zinc and aluminium were proteins (two b-tubulins, a-tubulin and actin), an enzyme involved
also tested, being important pollutants in marine environments. in the pentose phosphate pathway (glucose 6-phosphate deshy-
Harpin, dichlorvos, paraquat (methyl viologen) and glyphosate are drogenase), proteins involved in the protein degradation and
widely used pesticides able to induce a strong expression of stress recycling process (ubiquitin and ubiquitin-conjugating enzyme)
response genes [6]. Paraquat and glyphosate are herbicides, the and also and enzyme involved in glycolysis (isocitrate dehydroge-
first generates reactive oxygen species by re-rooting electrons from nase). Two additional genes were also selected for their high
the photosystem I to molecular oxygen and the other alters the differential expression as negative controls: a NADH-ubiquinone
structure of cell wall polysaccharides. oxidoreductase and a Galactose-2,6-sulfurylase (table 2).
RNA was extracted from biological triplicates of algae treated as
above, resulting in a total of 54 samples for 18 conditions. The

PLOS ONE | www.plosone.org 3 February 2014 | Volume 9 | Issue 2 | e86574


Normalization Genes in Chondrus crispus

Quantification and data analysis Another approach, using NormFinder, was also used to test the
The first analysis aimed to assess whether the transcript levels of candidate genes (Fig. 3A). The ranking of the genes with
the candidate genes were comparable between the different intermediate M values was different, compared to the geNorm
conditions. The cycle threshold (Ct [9]) value variations have been analysis. However, there was a good correlation for the two most
calculated for each gene and are shown in Fig. 1 (and Fig. S3). All stable genes (eRF3 and IF4A-1) and the three most fluctuating. To
genes had different levels of expression, corresponding to Ct-range calculate a normalization factor, NormFinder showed that the best
from 21.66 to 28.94, and some of them were influenced by the combination of two genes was eRF3 and actin, with a stability value
treatments. Actin and IF4A-2 showed higher average expression of 0.195. Interestingly, when the analysis was done with culture
values than the other genes, while G6PdH had the lowest samples the ranking was different (Fig. 3B), eRF3 and EF1a being
expression. Most of the genes had more than 7 cycles of variation the most stable, but with the environmental samples (Fig. 3C) the
between the samples and one gene, eRF3, was equally expressed in same genes as the full analysis were considered as most stable.
all samples and showed very little variation in the Ct values with Plotting the geNorm and NormFinder analyses one against the
only 1.81 cycles of variation. other (Fig. 4) supports the global ranking of the 14 genes, for the
When considering the two sets of samples separately, the whole set of samples.
variations in the Ct range were smaller, 7 genes from the
‘‘cultured’’ set showed less than 3 cycles of variations (see Conclusion
supplementary data Fig. S3A), eRF3 was still stable but at the In this study, two methods were used to identify the best
second position (1.81 cycles), the smallest Ct value variation was normalization genes : geNorm and NormFinder and the results
showed by Tub b-2 (1.16 cycles). A similar shrinking was observed were concordant. The experiment was made with two sets of
for the field samples (supplementary data Fig. S3B) were eRF3 and samples, six samples harvested on the field and thus with a varied
Tub b-2 had the same rank and showed even smaller variations in genetic and physiological background, and twelve samples
Ct values (1.5 and 0.56 cycles respectively). corresponding to the laboratory-cultured sequenced strain of C.
The geNorm pairwise analysis was performed to test the crispus thus having the same genetic and physiological background.
robustness of the data. This analysis was first described by The field samples came from an environment with dynamic
Vandesompele et al. [10] and is still widely used to evaluate conditions, due to tidal cycles and weather changes. The
normalization genes. The stability of the genes was tested between sequenced strain is cultured in very stable conditions. These two
the different conditions and the results are shown in Fig. 2A. environments lead to different physiological responses to the
Genes were considered suitable when M was inferior to 0.5. Two stressing conditions to which the algae have been submitted. Field
genes fulfilled this criterium: eRF3 and IF4A-1, the most stable samples have a more plastic metabolism than the cultured algae,
being IF4A-1. The least stable genes were IcdH, Nuox and Sulf. The that were acclimated to stable conditions. When considering the
M values were also calculated for the two sets of samples complete data set, the large variations in Ct values are clearly due
separately. For the culture samples (Fig. 2B) the most stable genes to the differences between the two sets of samples, which are more
were eRF3, UBQ and IF4A-1. For the field samples (Fig. 2C) the homogenous when considered separately than all together. The
genes were different: actin, Tub b-1 and IF4A-1. cultivated samples had less variation in Ct values than the samples
from the field (see data S2).

Figure 1. Ct values of the 14 housekeeping genes considering all tested samples. The range of expression of the 14 candidate genes are
represented by the average Ct values (diamonds) and Ct ranges (bars).
doi:10.1371/journal.pone.0086574.g001

PLOS ONE | www.plosone.org 4 February 2014 | Volume 9 | Issue 2 | e86574


Normalization Genes in Chondrus crispus

Figure 2. M value analysis of the expression stability of the 14 Figure 3. NormFinder analysis of the expression stability of the
housekeeping genes. The 14 genes are ranked according to their M 14 housekeeping genes. The stability of expression of the 14
value, calculated by the geNorm software [10]. Low values of M candidate genes was calculated using the NormFinder method [11]. A.
inidicate that a gene is expressed very stably. A. all samples, B. culture all samples, B. culture samples, C. field samples.
samples, C. field samples. doi:10.1371/journal.pone.0086574.g003
doi:10.1371/journal.pone.0086574.g002

Supporting Information
From the result of the geNorm analysis, the samples from
Peggy’s Cove exhibited a stable expression for all the candidate Figure S1 RNA Bioanalyzer gel for environmental
genes. The trend was similar with the NormFinder analysis, but samples. Quality of RNA in environmental samples.
since the differences between values was small, the ranking of the (TIFF)
genes was slightly different. Thus if the experiment was carried out
Figure S2 RNA gel for culture samples. Quality of RNA in
with only laboratory samples, as it is frequently done, all the tested
culture samples. Ladder range : 0.2–10 kb.
genes could have been used as normalization genes, even those
(PDF)
which were supposed to have differential expression. However,
when considering the field samples, the stability values are higher Figure S3 Ct-range of the 14 housekeeping genes. A.
and the ranking of the genes is different. culture samples, B. field samples.
For expression studies concerning only environmental samples, (TIFF)
even if the results were not fully concordant, a trend emerged, Tub
Table S1 RNA quantifications for environmental sam-
b-1 and IF4A-1 were well ranked in the different methods used.
ples. Concentration of RNA in environmental samples.
When tallying all methods, IF4A-1 and eRF3 are the best candidate
(PDF)
gene for normalization, as they have a good rank whatever the
method used for calculations, especially when analyzing samples Table S2 RNA quantifications for culture samples.
from various origins and having thus different behaviors. Concentration of RNA in culture samples.
(PDF)

PLOS ONE | www.plosone.org 5 February 2014 | Volume 9 | Issue 2 | e86574


Normalization Genes in Chondrus crispus

Figure 4. NormFinder analysis vs. geNorm analysis of the 14 housekeeping genes. The stability of expression of the 14 candidate genes
was compared between the NormFinder method (abscissa axis) and the geNorm method (ordinate axis). (R2 = 0.94).
doi:10.1371/journal.pone.0086574.g004

Data S1 Equations of the standard curves for both PCR Acknowledgments


runs.
The authors would like to thank S. Dittami for his help and critical reading
(TXT)
of the manuscript. NK is granted by the Conseil Régional de Bretagne
Data S2 Ct values of all the samples. (Rannvro Breizh) and GIS Europole Mer.
(XLS)
Author Contributions
Conceived and designed the experiments: NK. Performed the experiments:
NK SR CH. Analyzed the data: NK. Wrote the paper: NK JC CB.

References
1. Collén J, Davison I (1999) Stress tolerance and reactive oxygen metabolism in 11. Andersen C, Jensen J, Ørntoft T (2004) Normalization of real-time quantitative
the intertidal red seaweeds Mastocarpus stellatus and Chondrus crispus. Plant, Cell & reverse transcription-PCR data: a model-based variance estimation approach to
Environ 22: 1143–1151. identify genes suited for normalization, applied to bladder and colon cancer data
2. Cabello-Pasini A, Aguirre-von-Wobeser E, Figueroa F (2000) Photoinhibition of sets. Cancer Res 64: 5245–5250.
photosynthesis in Macrocystis pyrifera (Phaeophyceae), Chondrus crispus (Rhodophy- 12. Pfaffl M, Tichopád A, Prgomet C, Neuvians T (2004) Determination of stable
ceae) and Ulva lactuca (Chlorophyceae) in outdoor culture systems. J Photochem housekeeping genes, differentially regulated target genes and sample integrity:
Photobiol B 57: 169–78. Bestkeeper? Excel-based tool using pair-wise correlations. Biotechnol Lett 26:
3. Lohrmann N, Logan B, Johnson A (2004) Seasonal acclimatization of 509–515.
antioxidants and photosynthesis in Chondrus crispus and Mastocarpus stellatus, two 13. Spinsanti G, Panti C, Lazzeri E, Marsili L, Casini S, et al. (2006) Selection of
co-occurring red algae with differing stress tolerances. Biol Bull 207: 225–32. reference genes for quantitative RT-PCR studies in striped dolphin (Stenella
4. Collén J, Hervé C, Guisle-Marsollier I, Léger J, Boyen C (2006) Expression coeruleoalba) skin biopsies. BMC Mol Biol 7: 32.
profiling of Chondrus crispus (Rhodophyta) after exposure to methyl jasmonate. 14. Ingerslev H, Pettersen E, Jakobsen R, Petersen C, Wergeland H (2006)
J Exp Bot 57: 3869–81. Expression profiling and validation of reference gene candidates in immune
5. Collén J, Guisle-Marsollier I, Léger J, Boyen C (2007) Response of the relevant tissues and cells from Atlantic salmon (Salmo salar L.). Mol Immunol 43:
transcriptome of the intertidal red seaweed Chondrus crispus to controlled and 1194–1201.
natural stresses. New Phytol 176: 45–55. 15. Hoogewijs D, Houthoofd K, Matthijssens F, Vandesompele J, Vanfleteren J
6. Hervé C, Tonon T, Collén J, Corre E, Boyen C (2006) NADPH oxidases in (2008) Selection and validation of a set of reliable reference genes for
eukaryotes: red algae provide new hints! Curr Genetics 49: 190–204. quantitative SOD gene expression analysis in C. elegans. BMC Mol Biol 9: 9.
7. Hervé C, de Franco PO, Groisillier A, Tonon T, Boyen C (2008) New members 16. Jain M, Nijhawan A, Tyagi A, Khurana J (2006) Validation of housekeeping
of the glutathione transferase family discovered in red and brown algae. genes as internal control for studying gene expression in rice by quantitative real-
Biochem J 412: 535–544.
time PCR. Biochem Biophys Res Commun 345: 646–651.
8. Gachon C, Mingam A, Charrier B (2004) Real-time PCR: What relevance to
17. Reid K, Olsson N, Schlosser J, Peng F, Lund S (2006) An optimized grapevine
plant studies? J Exp Bot 55: 1445–1454.
RNA isolation procedure and statistical determination of reference genes for
9. Bustin S, Benes V, Nolan T, Pfaffl M (2005) Quantitative real-time RT-PCR? a
real-time RT-PCR during berry development. BMC Plant Biol 6: 27.
perspective. J Mol Endocrinol 34: 597–601.
18. Chen L, Zhong H, Kuang J, Li J, Lu W, et al. (2011) Validation of reference
10. Vandesompele J, de Preter K, Pattyn F, Poppe B, van Roy N, et al. (2002)
genes for RT-qPCR studies of gene expression in banana fruit under different
Accurate normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome Biol 3: R34.1–34.11. experimental conditions. Planta 234: 377–390.

PLOS ONE | www.plosone.org 6 February 2014 | Volume 9 | Issue 2 | e86574


Normalization Genes in Chondrus crispus

19. Le Bail A, Dittami S, de Franco PO, Rousvoal S, Cock M, et al. (2008) 22. Teo S, Ho C, Teoh S, Rahim R, Phang S (2009) Transcriptomic analysis of
Normalisation genes for expression analyses in the brown alga model Ectocarpus Gracilaria changii (Rhodophyta) in response to hyper- and hypoosmotic stresses.
siliculosus. BMC Mol Biol 9: 75. J Phycol 45: 1093–1099.
20. Lu N, Zang X, Zhang X, Chen H, Feng X, et al. (2012) Gene cloning, 23. Wu X, Niu J, Huang A, Xu M, Wang G (2012) Selection of internal control gene
expression and activity analysis of manganese superoxide dismutase from two for expression studies in Porphyra haitanensis (Rhodophyta) at different life-history
strains of Gracilaria lemaneiformis (Gracilariaceae, Rhodophyta) under heat stress. stages. J Phycol 48: 1040–1044.
Molecules 17: 4522–32. 24. Collén J, Porcel B, Carré W, Ball SG, Chaparro C, et al. (2013) Genome
21. Ho C, Teoh S, Teo S, Rahim R, Phang S (2009) Profiling the transcriptome of structure and metabolic features in the red seaweed Chondrus crispus shed light on
Gracilaria changii (Rhodophyta) in response to light deprivation. Mar Biotechnol evolution of the Archaeplastida. PNAS 110: 5247–5252.
(NY) 11: 513–9. 25. Thomas F, Barbeyron T, Michel G (2011) Evaluation of reference genes for real-
time quantitative PCR in the marine flavobacterium Zobellia galactanivorans.
J Microbiol Meth 84: 61–6.

PLOS ONE | www.plosone.org 7 February 2014 | Volume 9 | Issue 2 | e86574

You might also like