Xii STD - Zoology English Medium Combined 26.02.2019-1 PDF

GOVERNMENT OF TAMIL NADU
HIGHER SECONDARY SECOND YEAR
ZOOLOGY
A publication under Free Textbook Programme of Government of Tamil Nadu
Department of School Education

Untouchability is Inhuman and a Crime
front pages 1.indd 1 25-02-2019 18:15:02

Government of Tamil Nadu
First Edition - 2019

(Published under New Syllabus)
NOT FOR SALE
Content Creation
The wise
possess all
State Council of Educational Research

and Training
© SCERT 2019
Printing & Publishing
Tamil NaduTextbook and Educational

Services Corporation
www.textbooksonline.tn.nic.in
II
front pages 1.indd 2 25-02-2019 18:15:02

CONTENTS
ZOOLOGY Page No
UNIT I
Chapter 1 Reproduction in Organisms 1
Chapter 2 Human Reproduction 13
Chapter 3 Reproductive Health 34
UNIT II
Chapter 4 Principles of Inheritance and Variation 47
Chapter 5 Molecular Genetics 68
Chapter 6 Evolution 99
UNIT III
Chapter 7 Human Health and Diseases 119
Chapter 8 Immunology 136
Chapter 9 Microbes in Human Welfare 155
UNIT IV
Chapter 10 Applications of Biotechnology 168
UNIT V
Chapter 11 Organisms and Population 189
Chapter 12 Biodiversity and its Conservation 213
Chapter 13 Environmental Issues 235
Let's use the QR code in the text books ! How ?

• Download the QR code scanner from the Google PlayStore/ Apple App Store into your smartphone.
• Open the QR code scanner application
• Once the scanner button in the application is clicked, camera opens and then bring it closer to the QR code in the text book.
• Once the camera detects the QR code, a URL appears in the screen.Click the URL and go to the content page.
E-book Assessment DIGI links
III
front pages 1.indd 3 25-02-2019 18:15:02

front pages 1.indd 4 25-02-2019 18:15:02
Conceptual picture with caption relating to
every chapter is given in this text book.
New life for woolly mammoth DNA-researchers can now re-create the
genes of mammoth and study the proteins they encoded
Chapter Outline Presents a complete overview of the chapter
Goals to transform the classroom processes into

Learning Objectives:
learner centric with a list of bench marks
Amazing facts, Rhetorical questions to lead students

to biological inquiry
Directions are provided to students to conduct activities

Activity in order to explore, enrich the concept.
Infographics Visual representation of the lesson to enrich learning .
HOW TO USE Superfluous information about a personality or day to

THE BOOK day life experience relating to the content
To motivate the students to further explore the content

digitally and take them to virtual world
ICT To enhance digital Science skills among students
Conceptual diagram that depicts relationships between

Concept Map concepts to enable students to learn the content schematically
Glossary Explanation of scientific terms
Evaluation Assess students to pause, think and check their understanding
References List of related books for further details of the topic
Web links List of digital resources
front pages 1.indd 5 25-02-2019 18:15:02

Prospects of Zoology
National and International Biology Olympiad Exam
Who can participate? : Secondary and Higher Secondary students
Five stages of Exam
stage I : National Standard Examination in Biology
stage II : Indian National Biology Olympiad
stage III : Orientation cum Selection Camp in Biology
stage IV : Pre-departure Training Camp for
International Biology Olympiad
(IBO) (for 4 members)
stage V : Participation in IBO.
Weblink: https://www.entrancei.com
Scholarship for Biology Students

Ministry of Science and Technology offers biology scholarship to 100 students from
schools around the country. Among them 52 (two from each state board) are selected for the
award which carries a cash prize of Rs 20,000, a certificate and a medal. http://www.dbtindia.
nic.in
It also offers INSPIRE programme for science students. www.online.inspire.gov.in
Tamilnadu State council of Science and technology offers Young Scientists Fellowship
Scheme to encourage scientist below 40 years, who are working in educational institutions.
They are given Rs.10000 for 2- 6 months (http://www.tanscst.nic.in/)
Tamilnadu State Council of Science and technology offers Student project
scheme for Science and Technology useful to our society. Student scientists are
awarded with the cash prize of Rs.5000 - 10000 for their best project or model.
(http://www.tanscst.nic.in/)
Institutes
Institutes affiliated
affiliated to Dr. M.G.R.
to Dr. M.G.R. Medical
Medical University,
University, Chennai.
Chennai.
Occupation Therapy Colleges:
• College of Occupational Therapy, Christian Medical College, Vellore
Physiotherapy Colleges:
• Govt. College of Physiotherapy, Trichy
• Govt. Institute of Rehabilitation Medicine, Chennai
• College of Physiotherapy, Christian Medical College, Vellore
• Tamilnadu Paramedical Institutions College of Physiotherapy, Chennai
Siddha Colleges:
• Govt. Siddha Medical College, Chennai
• Govt. Siddha Medical College, Tirunelveli
• National Institute of Siddha, Chennai
VI
front pages 1.indd 6 25-02-2019 18:15:02

Pharmacy Colleges: • Vellore Govt. Medical College, Vellore

• Coimbatore Medical College, Coimbatore Homeopathy Colleges:
• College of Pharmacy, Madras Medical • Govt. Homoeopathic Medical College
College, Chennai and Hospital, Tirumangalam
• College of Pharmacy, Madurai Medical • Tamil Nadu Homoeopathy Medical
College, Madurai College, Salem
• Thanjavur Medical College, Thanjavur
Dental Colleges:
• College of Allied Medical Sciences,
• Tamilnadu Govt. Dental College,
Madurai
Chennai
• Department of Pharmacy, Annamalai
University, Cuddalore Ayush Institutions In Tamilnadu
• Ayurveda College, 242-B, Trichy Road,
Nursing Colleges: Sulur, 215 Pathanjalipuri (POST),
• College of Nursing, Madras Medical Coimbatore – 641402
College, Chennai
• Venkataramana Ayurveda College, 216
• College of Nursing, Madurai Medical 596,A1&A2,31st St. TNHB Colony,
College, Madurai Periyar Nagar, Korattur, Chennai
Medical Colleges: • Sri Sai Ram Ayurvedic Medical
• Cancer Institute, College of Oncological College & 217 Research Centre,
Sciences, Chennai Saileo Nagar, Poonthandalam Village,
• Chengalpattu Medical College, Sriperumbudur, Chennai – 600044
Chengalpattu • Dharma Ayurvedic Medical College and
• Christian Medical College, Vellore Hosp, 48 218 Grand West Trunk Road,
• Coimbatore Medical College, Coimbatore Sriperumbudur, Kanchipuram, 602 105
• Government Dharamapuri Medical • Sri Sankara College of Ayurveda,
College, Dharampuri Sannasipatti, 219 Poolankulathupatti
Post Trichy-620009
• Kanyakumari Govt. Medical College,
Kanyakumari
• Kilpauk Medical College, Chennai List of Tamilnadu Veterinary
• Madras Medical College and Research
colleges affiliated to Tamilnadu
Institute, Chennai
Veterinary University
• Madurai Medical College, Madurai
• Stanley Medical College, Chennai • Tamilnadu Veterinary University,
• Thanjavur Medical College, Thanjavur Chennai
• Theni Government Medical College, • Veterinary College and Research
Theni Institute, Namakkal
• Thoothukudi Govt. Medical College, • Fishery College and Research Institute,
Thoothukudi Thoothukudi
• Tirunelveli Medical College, Tirunelveli
VII
front pages 1.indd 7 25-02-2019 18:15:03

List of Tamilnadu Agricultural Salim Ali Centre for Ornithology

colleges affiliated to Tamilnadu and Natural History (SACON)
Agricultural University Coimbatore
in Tamilnadu • National Ornithological Databank
(NOD) Cell
• GIS Laboratory
• Tamilnadu Agricultural University,
• Ecotoxicology Laboratory
Coimbatore.
• Conservation Genetics Laboratory
• Agricultural College and Research
Institute, Kanniyakumari Institute of Basic Medical Science
(IBMS) Tharamani, Chennai
• Agricultural Engineering College and
• Blood transfusion
Research Institute, Coimbatore.
• Chromatography
• Avvaiyar Government College for • Mass spectroscopy
women, Kodaikanal • Clinical Data interpretation
• Horticulture College and Research • Diagnosis of blood courses
Institute, Periyakulam
Centre for Marine Fisheries and
Research Institute (CMFRI)
Institutes conducting
• Marine capture fisheries
Researches in Zoology • Mariculture
Indian institute of science (IISC) • Biodiversity
Bangalore • Marine Biotechnology
• Fishery environment
• Biochemistry (BC)
• Central Animal Facility (CAF) National Environmental
• Centre for Ecological Sciences (CES) Engineering Research Institute
(NEERI)
• Centre for Infectious Disease Research
• Air Pollution control
(CIDR)
• Climate sustainability and skill
• Centre for Neuroscience (CNS)
development
• Microbiology and Cell Biology (MCB) • Cleaner technology and modeling
• Molecular Biophysics Unit (MBU) • Environmental Biotechnology and
Genomic division
IFS Service
IFS (Indian Forest (IndianExamination)
Forest Service)Examination
Examination
• Conducting authority - UPSC
• Educational - B.Sc. in any one degree like Physics, Chemistry, Botany, Zoology,
Qualification: Agriculture, Maths, Geology, or B.E or B.V.Sc.
• Age - Minimum 21, Maximum 32 Yrs.
• Weblink - https://upsconline.nic.in
VIII
front pages 1.indd 8 25-02-2019 18:15:03

1
UNIT - I
Reproduction
in Organisms
CHAPTER
Paramecium are capable of both sexual and

Chapter Outline asexual reproduction.
1.1. Modes of reproduction

1.2. Asexual reproduction in continuation of species and introduces
1.3. Sexual reproduction variations in organisms, which are essential
for adaptation and evolution of their
own kind.
Learning Objectives
1.1. Modes of reproduction
➢ Learns the modes of asexual All modes of reproduction have some
reproduction in organisms. basic features such as synthesis of RNA and
proteins, replication of DNA, cell division and
➢ Understands the growth, formation of reproductive units and
significance of asexual their fertilization to form new individuals.
reproduction.
Organisms exhibit two major modes of
➢ Comprehends the reproduction namely asexual and sexual
different modes of reproduction. Reproduction by a single parent
sexual reproduction. without the involvement of gamete formation
is asexual reproduction and the offspring
➢ Realizes the significance and produced are genetically identical. Asexual
advantage of sexual reproduction and reproduction is usually by amitotic or mitotic
its role in evolution. division of the somatic (body) cells, hence
is also known as somatogenic or blastogenic
reproduction. When two parents participate
L iving organisms show a life cycle in the reproductive process involving two
involving birth, growth, development, types of gametes (ova and sperm), it is called
maturation, reproduction and death. sexual reproduction.
Reproduction is the fundamental feature of
all living organisms. It is a biological process 1.2. Asexual reproduction
by which organisms produce their young Asexual reproduction is wide spread
ones. The young ones grow and mature to among different organisms. It is common in
repeat the process. Thus reproduction results members of Protista, Bacteria, Archaea and
TN_GOVT_XII_Zoology_chapter1.indd 1 25-02-2019 18:17:54

in multicellular organisms with relatively i) Simple irregular binary fission
simple organisation. The offsprings show ii) Transverse binary fission
“uniparental inheritance” without any genetic
iii) Longitudinal binary fission
variation. The different modes of asexual
iv) Oblique binary fission
reproduction seen in animals are fission,
sporulation, budding, gemmule formation, Simple binary fission is seen in Amoeba
fragmentation and regeneration. like irregular shaped organisms (Fig. 1.1),
where the plane of division is hard to observe.
Fission is the division of the parent The contractile vacuoles cease to function
body into two or more identical daughter and disappear. The nucleoli disintegrate and
individuals. Four types of fission are seen in the nucleus divides mitotically. The cell then
animals. They are binary fission, multiple constricts in the middle, so the cytoplasm
fission, sporulation and strobilation. divides and forms two daughter cells.
In binary fission, the parent In transverse binary fission, the plane of
organism divides into two halves and the division runs along the transverse axis of
each half forms a daughter individual. the individual. e.g. Paramecium and Planaria.
The nucleus divides first amitotically or In Paramecium (Fig. 1.2) the macronucleus
mitotically (karyokinesis), followed by the divides by amitosis and the micronucleus
Simple irregular Binary Fission in Amoeba
division of the cytoplasm (cytokinesis). divides by mitosis.
The resultant offsprings are genetically In longitudinal binary fission, the nucleus
Nuclear
identical to the parent. Depending on theContractile
vacuole and the cytoplasm divides membrane
in the longitudinal
plane of fission, binary fission is of the axis of the organism (Fig 1.3). In flagellates, the
Nucleus
following types Hyaline area flagellum is retained usually by one daughter cell.
Chromosomes
Simple irregular Binary Fission in Amoeba Contractile

vacuole
Nuclear
Contractile
membrane
vacuole
Nucleus
Hyaline area
Chromosomes
Contractile
vacuole Daughter amoebae
Fig. 1.1 Irregular simple binary fission in Amoeba
Macronucleus
New oral
groove
forming
Micronucleus Oral groove

disappearing
Daughter
Daughter amoebae paramecia
New
contractile
vacuoles
Macronucleus Micronucleus New

dividing dividing oral groove
amitotically mitotically forming
A B C D E
Fig. 1.2 Transverse binary fission in Paramecium
Reproduction in Organisms 2

Longitudinal furrow
Daughter
Euglena
Chromosomes
Nucleus
Nucleoli
Nucleus
Chromatids Nucleolar Nuclear

body constriction
A B C D E
Fig. 1.3 Longitudinal binary fission in Euglena

The basal granule is divided into two and the individuals are called merozoites (Fig. 1.4).
new basal granule forms a flagellum in the other When multiple fission occurs in the oocyte,
daughter individual. e.g. Vorticella and Euglena. it is called sporogony and the daughter
In oblique binary fission the plane of individuals are called sporozoites.
division is oblique. It is seen in dinoflagellates. During unfavorable conditions (increase
e.g. Ceratium or decrease in temperature, scarcity of food)
In multiple fission the parent body Amoeba withdraws its pseudopodia and
divides into many similar daughter cells secretes a three-layered, protective, chitinous
simultaneously. First, the nucleus divides cyst wall around it and becomes inactive
repeatedly without the division of the (Fig. 1.5). This phenomenon is called
cytoplasm, later the cytoplasm divides into as encystment. When conditions become
many parts as that of nuclei. Each cytoplasmic favourable, the encysted Amoeba divides
part encircles one daughter nucleus. This by multiple fission and produces many
results in the formation of many smaller minute amoebae called pseudopodiospore
individuals from a single parent organism. or amoebulae. The cyst wall absorbs
If multiple fission produces four or many water and breaks off liberating the young
daughter individuals by equal cell division pseudopodiospores, each with a fine
and the young ones do not separate until pseudopodia. They feed and grow rapidly to
the process is complete, then this division is lead an independent life.
called repeated fission e.g. Vorticella. In some metazoan animals, a special type
In Plasmodium, multiple fission occurs in of transverse fission called strobilation occurs
the schizont and in the oocyte stages. When (Fig. 1.6). In the process of strobilation, several
multiple fission occurs in the schizont, the transverse fissions occur simultaneously
process is called schizogony and the daughter giving rise to a number of individuals which
Rupturing
Schizont Daughter nuclei schizont wall Merozoites
Fig. 1.4 Multiple Fission in Plasmodium
3 Reproduction in Organisms

Pseudopodiospores
Ruptured
Three cyst wall
layered
cyst wall
Nucleus
Cytoplasm
Daughter
nuclei
Daughter nuclei Pseudopodiospores Young
cyst formation formation amoebae
A B C D
Fig. 1.5 Multiple fission in encysted Amoeba
Tentacles
Tentacles
Mouth
Manubrium
Manubrium
Mouth
Ephyrae Early Ephyra
budding (side view)
Inter radial
canal Per radial
canal
Mouth
Stomach Sense
organ
Stalk Manubrium
Stolon Marginal
lappet Bifid arm
Adhesive
disc
Young Adult Early Ephyra
strobila strobila (oral view)
Fig. 1.6 Strobilation in Aurelia
often do not separate immediately from a nuclear membrane, becomes surrounded by
each other e.g. Aurelia. Plasmotomy is the cytoplasm and develops a spore-case around
division of multinucleated parent into many it (Fig. 1.7). When conditions become
multinucleate daughter individuals with the favourable, the parent body disintegrates and
division of nuclei. Nuclear division occurs the spores are liberated, each hatching into a
later to maintain normal number of nuclei. young amoeba.
Plasmotomy occurs in Opalina and Pelomyxa In budding, the parent body produces one
(Giant Amoeba). or more buds and each bud grows into a young
During unfavourable conditions Amoeba one. The buds separate from the parent to lead
multiplies by sporulation without encystment. a normal life. In sponges, the buds constrict
Nucleus breaks into several small fragments and detach from the parent body and the bud
or chromatin blocks. Each fragment develops develops into a new sponge (Fig. 1.8).

Chromatin Nuclear membrane Spores Spore case
blocks disintegrating
Nuclei
Nucleus
D Cytoplasm
Nucleus Spore case

Young
amoeba
Nucleus
Cytoplasm
E Cytoplasm
A B C
Fig. 1.7 Sporulation in Amoeba

Individual
parent Osculum In Noctiluca, hundreds of buds are
formed inside the cytoplasm and many remain
within the body of the parent. This is called
endogenous budding. In freshwater sponges
and in some marine sponges a regular and
peculiar mode of asexual reproduction occurs
Bud Bud Daughter
by internal buds called gemmules is seen
forming growing individual (Fig. 1.10). A completely grown gemmule is a hard
Fig. 1.8 Budding in Leucosolenia (Sponge) ball, consisting of an internal mass of food-laden
archaeocytes. During unfavourable conditions,
the sponge disintegrates but the gemmule can
withstand adverse conditions. When conditions
become favourable, the gemmules begin to hatch.
Micropyle
Monaxon
spicules Outer
Growth Bud develops Bud detaches membrane
Hydra
of bud mouth and from parent and
tentacles leads an Archaeocytes
independent life
Fig. 1.9 Budding in Hydra

Inner
When buds are formed on the outer surface membrane
of the parent body, it is known as exogenous
budding e.g. Hydra. In Hydra when food is
plenty, the ectoderm cells increase and form a
small elevation on the body surface (Fig. 1.9). Fig. 1.10 Gemmule in sponges
Ectoderm and endoderm are pushed out to In fragmentation, the parent body
form the bud. The bud contains an interior breaks into fragments (pieces) and each of
lumen in continuation with parent’s gastro- the fragment has the potential to develop
vascular cavity. The bud enlarges, develops a into a new individual. Fragmentation or
mouth and a circle of tentacles at its free end. pedal laceration occurs in many genera of
When fully grown, the bud constricts at the sea anemones. Lobes are constricted off from
base and finally separates from the parent the pedal disc and each of the lobe grows
body and leads an independent life. mesenteries and tentacles to form a new sea
anemone.

In the tapeworm, Taenia solium the regeneration. In reparative regeneration, only
gravid (ripe) proglottids are the oldest at certain damaged tissue can be regenerated,
the posterior end of the strobila (Fig. 1.11). whereas in restorative regeneration severed
The gravid proglottids are regularly cut off body parts can develop. e.g. star fish, tail of
either singly or in groups from the posterior wall lizard.
end by a process called apolysis. This is very
significant since it helps in transferring the longitudinal incision
developed embryos from the primary host

(man) to find a secondary host (pig).
Scolex
Neck
longitudinal incision
regenerated
regenerated
parts
parts
Immature
proglottids old part
Mature
regenerated
proglottids parts regenerated
longitudinal incision parts
old part
old part
old part
Gravid
proglottids
regenerated
parts Regeneration in Hydra
Fig. 1.12regenerated
parts
old part
Fig. 1.11 Apolysis in Taenia solium

old part
Regene ration is regrowth in the injured

region. Regeneration was first studied
in Hydra by Abraham Trembley in 1740.
Regeneration is of two types, morphallaxis
and epimorphosis. In morphallaxis the Fig. 1.13 Reparative regeneration in star fish
whole body grows from a small fragment
e.g. Hydra and Planaria. When Hydra is
accidentally cut into several pieces, each piece POWER OF
can regenerate the lost parts and develop REGENERATION
into a whole new individual (Fig. 1.12).
Sponge when macerated
The parts usually retain their original
and squeezed through
polarity, with oral ends, by developing
fine silk cloth, the cluster of cells pass
tentacles and aboral ends, by producing
through, and these can regenerate new
basal discs. Epimorphosis (Fig. 1.13) is the
sponges. This technique is used for
replacement of lost body parts. It is of two
cultivation of sponges.
types, namely reparative and restorative

1.3. Sexual reproduction Monocystis, whereas the fusion of dissimilar
Sexual reproduction gametes is called anisogamy (Gr. An-without;
involves the fusion of iso-equal; gam-marriage). Anisogamy occurs
male and female gametes in higher animals but it is customary to use
to form a diploid zygote, the term fertilization instead of anisogamy
which develops into a or syngamy. e.g. higher invertebrates and all
new organism. It leads vertebrates.
to genetic variation. The types of sexual Conjugation is the temporary union of the
reproduction seen in animals are syngamy two individuals of the same species. During their
( fertilization) and conjugation. In syngamy, union both individuals, called the conjugants
the fusion of two haploid gametes takes place to exchange certain amount of nuclear material
produce a diploid zygote. Depending upon the (DNA) and then get separated. Conjugation
place where the fertilization takes place, it is of is common among ciliates, e.g. Paramecium,
two types. In external fertilization, the fusion Vorticella and bacteria (Prokaryotes).
of male and female gametes takes place outside Phases of life cycle: Organisms have three
the body of female organisms in the water phases – Juvenile phase, reproductive phase and
medium. e.g. sponges, fishes and amphibians. senescent phase. Juvenile phase/ vegetative
In internal fertilization, the fusion of male phase is the period of growth between the birth
and female gametes takes place within the of the individual upto reproductive maturity.
body of female organisms. e.g. reptiles, aves During reproductive phase/ maturity phase
and mammals. the organisms reproduce and their offsprings
Different kinds of syngamy (fertilization) reach maturity period. On the basis of time,
are prevalent among living organisms. In breeding animals are of two types: seasonal
autogamy, the male and female gametes are breeders and continuous breeders. Seasonal
produced by the same cell or same organism breeders reproduce at particular period of
and both the gametes fuse together to form a the year such as frogs, lizards, most birds,
zygote e.g. Actinosphaerium and Paramecium. deers etc., Continuous breeders continue to
In exogamy, the male and female gametes are breed throughout their sexual maturity e.g.
produced by different parents and they fuse to honey bees, poultry, rabbit etc., Senescent
form a zygote. So it is biparental. e.g. Human – phase begins at the end of reproductive phase
dioecious or unisexual animal. when degeneration sets in the structure and
In lower organisms, sometimes the functioning of the body.
entire mature organisms do not form gametes PARTHENOGENESIS
but they themselves behave as gametes and (Gr. Parthenos – virgin, Genesis-produce)
the fusion of such mature individuals is
known as hologamy e.g. Trichonympha. Development of an egg into a complete
Paedogamy is the sexual union of young individual without fertilization is known as
individuals produced immediately after the parthenogenesis. It was first discovered by
division of the adult parent cell by mitosis. Charles Bonnet in 1745. Parthenogenesis is of
In merogamy, the fusion of small sized two main types namely, Natural Parthenogenesis
and morphologically different gametes and Artificial Parthenogenesis. In certain
(merogametes) takes place. The fusion of animals, parthenogenesis occurs regularly,
morphological and physiological identical constantly and naturally in their life cycle and
gametes (isogametes) is called isogamy. e.g. is known as natural parthenogenesis.

Natural
parthenogenesis are of
different types:
a) Arrhenotoky: In
this type only males are produced by
parthenogenesis. eg: honey bees
b) Thelytoky: In this type of
parthenogenesis only females are
produced by parthenogenesis.eg: Fig. 1.14 Oviparous-Hen with Eggs
Solenobia
c) Amphitoky: In this type
parthenogenetic egg may develop into
individuals of any sex. Eg: Aphis.
Natural parthenogenesis may be of

two types, viz., complete and incomplete.
Complete parthenogenesis is the only form
of reproduction in certain animals and there is
no biparental sexual reproduction. These are Fig. 1.15 Viviparous-Cow with calf
no male organisms and so, such individuals
are represented by females only. Incomplete
parthenogenesis is found in some animals
in which both sexual reproduction and
parthenogenesis occurs. e.g. In honeybees;
fertilized eggs (zygotes) develop into queen
and workers, whereas unfertilized eggs
develop into drones (male). In paedogenetic
parthenogenesis (paedogenesis) the larvae
produce a new generation of larvae by
parthenogenesis. It occurs in the sporocysts
and Redia larvae of liver fluke. It is also seen
in the larvae of some insects. e.g. Gall fly. In Fig. 1.16 Ovoviviparous-Shark and three
artificial parthenogenesis, the unfertilized months embryo
egg (ovum) is induced to develop into a Ovum-egg-, Parere- to produce) animals (egg
complete individual by physical or chemical laying animals), the young hatch from eggs
stimuli. e.g., Annelid and seaurchin eggs. laid outside the mother’s body. e.g. reptiles
Animals are classified mainly into and birds (their eggs are covered by hard
three groups namely – Oviparous, Viviparous calcareous shells), invertebrates, fishes and
and Ovoviviparous depends on the site of amphibians (eggs are not covered by hard
development of embryo and whether they lay calcareous shells but covered by a membrane).
eggs (unfertilized or fertilized) or give birth Viviparous (Fig 1.15) (L., Vivus - alive, Parere
to young ones. In Oviparous (Fig 1.14) (L., - to produce) animals give rise to young ones.

Viviparity is a type of development in which According to the plane of fission different
the young ones are born alive after being kinds of binary fission have been identified
nourished in the uterus through the placenta. in different organisms. They are simple
Majority of mammals including human irregular binary fission, transverse binary
beings are viviparous. In Ovoviviparous fission, longitudinal binary fission and
animals, the embryo develops inside the egg oblique binary fission. Multiple fission is
and remains in the mother’s body until they the division of the parent into many small
are ready to hatch (Fig 1.16). This method of daughter cells simultaneously. Budding is
reproduction is similar to viviparity but the another mode of asexual reproduction. The
embryos have no placental connection with parent body produces one or more buds; each
the mother and receive their nourishment bud grows into a young one and may separate
from the egg yolk. Ovoviviparity is seen in from the parent to lead a normal life. When
fishes like shark. many buds are formed on the outer surface of
the parent, it is known as exogenous budding.
Hundreds of buds are formed inside the
cytoplasm and remain within the body of
the parent, this process is called endogenous
budding. Fragmentation is another mode
of asexual reproduction. In fragmentation
the body of the parent breaks into fragments
(pieces). Each fragment has the potential to
develop into a new individual. Regeneration
is the development of the whole body of an
organism from a small fragment. It is of two
types namely restorative regeneration and
The viviparous lemon shark gives birth reparative regeneration.
to a young one, which is still attached by Various modes of sexual reproduction
its placental cord. is seen in animals. In syngamy the fusion of
two haploid gametes takes place to produce
Summary a zygote. The following kinds of syngamy
Reproduction is a process by which the is prevalent among the living organism.
living beings propagate or duplicate their They are autogamy, exogamy, hologamy,
own kind. Reproduction can be broadly paedogamy, merogamy, isogamy, anisogamy
classified into asexual reproduction and and conjugation. Parthenogenesis is the
sexual reproduction. In asexual reproduction special type of sexual reproduction seen
fusion of gametes are not involved, but in in animals. It is of two main types namely
sexual reproduction the formation and natural parthenogenesis and artificial
fusion of gametes occur. Different modes of parthenogenesis.
asexual reproduction are fission, budding, According to the development of the
fragmentation and regeneration. Fission is embryo, animals may be oviparous, viviparous
further divided into binary fission, multiple and ovoviviparous.
fission, sporulation and strobilation.

Evaluation Reason: Asexual
reproduction
1. In which type of involves only mitosis and no meiosis.
parthenogenesis are A B C D
only males produced? III. Assertion: Viviparous animals give
a) Arrhenotoky better protection to their offsprings.
b) Thelytoky R
eason: They lay their eggs in the
c) Amphitoky d) Both a and b safe places of the environment.
2. Animals giving birth to young ones: A B C D
a) Oviparous b) Oviviviparous 6. Name an organism where cell division is
c) Viviparous d) Both a and b itself a mode of reproduction.
3. The mode of reproduction in bacteria is 7. Name the phenomenon where the female
by gamete directly develops into a new
a) Formation of gametes organism with an avian example.
b) Endospore formation 8. What is parthenogenesis? Give two
c) Conjugation examples from animals
d) Zoospore formation 9. Which type of reproduction is effective
4. In which mode of reproduction variations -Asexual or sexual and why?
are seen 10. The unicellular organisms which
a) Asexual b) Parthenogenesis reproduce by binary fission are considered
c) Sexual d) Both a and b immortal. Justify.
5. Assertion and reasoning questions: 11. Why is the offspring formed by asexual
In each of the following questions there reproduction referred as a clone?
are two statements. One is assertion (A) 12. Why are the offsprings of oviparous
and other is reasoning (R). Mark the animal at a greater risk as compared to
correct answer as offsprings of viviparous organisms?
A. If both A and R are true and R is correct
13. Give reasons for the following:
explanation for A
(a) S ome organisms like honey bees are
B If both A and R are true but R is not the
called parthenogenetic animals
correct explanation for A
(b) A male honey bee has 16 chromosomes
C. If A is true but R is false
where as its female has 32 chromosomes.
D. If both A and R are false.
14. Differentiate between the following:
I. Assertion: In bee society, all the
(a) Binary fission in amoeba and multiple
members are diploid
fission in Plasmodium
except drones.
(b) Budding in yeast and budding in Hydra
Reason: Drones are produced by

(c) Regeneration in lizard and Planaria
parthenogenesis.
A B C D 15. How is juvenile phase different from
II. Assertion: Offsprings produced by reproductive phase?
asexual reproduction are genetically 16. What is the difference between syngamy
identical to the parent. and fertilization?

Concept Map
Simple irregular fission
Transverse fission
Binary fission
Longitudinal fission
Oblique fission
Multiple fission Repeated fission

Fission
Sporulation
Strobilation
Exogenous budding
Budding
Asexual Endogenous budding
Fragmentation
Restorative
Regeneration
Reparative
External fertilization
Syngamy Internal fertilization
Autogamy
Reproduction Sexual Conjugation
Exogamy
Automixis
Hologamy
Paedogamy
Oviparous Merogamy
Ovoviviparous Isogamy
Anisogamy
Viviparous
Natural
Complete parthenogenesis
Parthenogenesis Artificial
Incomplete parthenogenesis
Paedogenesis

ICT CORNER
Reproduction in Organisms
Let us know the DNA

Recombinant Technology
Procedure :
Step -1 Type the URL or scan the QR code to open the activity page
Step -2 Click “Mitosis” and “Meiosis” on the left panel to go through the animations
plays on clicking “START” AND “NEXT”.
Step -3 Click “Work of a Vaccine” to know the process of it.
Step – 4 Click “Recombinant DNA Technology” and click “START VIRTUAL LAB” to go
through the process of it.
Step 1 Step 2 Step 3
Step 4
Reproduction in Organisms URL:

http://www.bch.cuhk.edu.hk/vlab/hpv/index.html
*Pictures are indicative only
*Allow flash player

2
UNIT - I
Human
Reproduction
CHAPTER
In every child who is born, the potentiality of

Chapter Outline the human race is born again
- James Agee
2.1 Human reproductive system
2.2 Gametogenesis
2.3 Menstrual cycle
2.4 Menstrual disorders and menstrual E very organ system in the human
body works continuously to maintain
homeostasis for the survival of the individual.
hygiene
The human reproductive system is essential for
2.5 Fertilisation and implantation
the survival of the species. An individual may
2.6 Maintenance of pregnancy and
live a long healthy life without producing an
embryonic development
offspring, but reproduction is inevitable for the
2.7 Parturition and lactation existence of a species.
The reproductive system has four
Learning Objectives main functions namely,
• to produce the gametes namely

➢ Creates an awareness towards a
sperms and ova
healthy reproductive life in adolescents.
• to transport and sustain these gametes
➢ Understands the structure of the male
and female reproductive systems. • to nurture the developing offspring
➢ Explains the functions of • to produce hormones
the structures associated
The major reproductive events in human
with the male and female
beings are as follows:
reproductive system.
➢ Compares the process • Gametogenesis: Formation of gametes by
of spermatogenesis and spermatogenesis and oogenesis.
oogenesis. • Insemination: Transfer of sperms by the
➢ Discusses the changes in a female body male into the female genital tract.
during and after fertilisation. • Fertilisation: Fusion of male and
➢ Appraises the role of hormones in the female gametes to form zygote, called
process of reproduction. fertilisation.
➢ Understands the events in pregnancy • Cleavage: Rapid mitotic divisions of
and foetal development. the zygote which convert the single celled
13

zygote into a multicellular structure 2.1 Human reproductive system
called blastocyst. The male reproductive system comprises
• Implantation: Attachment of blastocyst of a pair of testes, accessory ducts, glands and
to the uterine wall. external genitalia (Fig. 2.1).
• Placentation: Formation of placenta Testes are the primary male sex organs.
which is the intimate connection between They are a pair of ovoid bodies lying in the
foetus and uterine wall of the mother for scrotum (Fig.2.2 a). The scrotum is a sac of
exchange of nutrients. skin that hangs outside the abdominal cavity.
• Gastrulation: Process by which Since viable sperms cannot be produced
blastocyst is changed into a gastrula with at normal body temperature, the scrotum
three primary germ layers is placed outside the abdominal cavity to
• Organogenesis: Formation of specific provide a temperature 2-3oC lower than the
tissues, organs and organ systems from normal internal body temperature. Thus,
three germ layers. the scrotum acts as a thermoregulator for
spermatogenesis.
• Parturition: Expulsion of the foetus from
the mother’s womb. Each testis is covered by an outermost
fibrous tunica albuginea and is divided
These functions are carried out by the
by septa into about 200 - 250 lobules each
primary and accessory reproductive organs.
containing 2-4 highly coiled testicular
The primary reproductive organs namely
tubules or seminiferous tubules. These highly
the ovary and testis are responsible for
convoluted tubules which form 80 percent of
producing the ova and sperms respectively.
the testicular substance are the sites for sperm
Hormones secreted by the pituitary gland and
production.
the gonads help in the development of the
secondary sexual characteristics, maturation The stratified epithelium of the seminiferous
of the reproductive system and regulation tubule is made of two types of cells namely sertoli
of normal functioning of the reproductive cells or nurse cells and spermatogonic cells
system. The accessory organs help in or male germ cells. Sertoli cells are elongated
transport and to sustain the gametes and to and pyramidal and provide nourishment to
nurture the developing offspring. the sperms till maturation. They also secrete
inhibin, a hormone which
is involved in the negative
feedback control of sperm
production. Spermatogonic
8ULQDU\ 8UHWHU cells divide meiotically and
EODGGHU
5HFWXP differentiate to produce
9DV
GHIHUHQV 6HPLQDOYHVLFOH spermatozoa.
3HQLV (MDFXODWRU\GXFW Interstitial cells or
8UHWKUD 3URVWDWHJODQG Leydig cells are embedded
(SLGLG\PLV $QXV in the soft connective
*ODQVSHQLV %XOERXUHWKUDO tissue surrounding the
7HVWLV JODQG
seminiferous tubules.
6FURWXP These cells are endocrine
in nature and secrete
Fig. 2.1 Male reproductive system
Human Reproduction 14

CRYPTORCHISM The failure of one or both testes to descend down into the scrotal sacs is
known as cryptorchism (crypto – hidden + orchis – testicle). It occurs in 1 – 3 percent of new
born males. A surgical correction at a young age can rectify the defect, else these individuals
may become sterile and are unable to produce viable sperms.
androgens namely the testosterone hormone bulbourethral glands also called Cowper’s
which initiates the process of spermatogenesis. gland and a single prostate gland. The seminal
These cells are endocrine in nature and vesicles secrete an alkaline fluid called seminal
are characteristic features of the testes of plasma containing fructose sugar, ascorbic acid,
mammals. Other immunologically competent prostaglandins and a coagulating enzyme called
cells are also present.
The accessory ducts associated Ureter
with the male reproductive system

Urinary bladder
include rete testis, vasa efferentia,
epididymis and vas deferens (Fig. Seminal vesicle
2.2 b). The seminiferous tubules of
Prostate gland
each lobule converge to form a tubulus Bulbourethral
rectus that conveys the sperms into the gland
rete testis. The rete testis is a tubular Vas deferens
network on the posterior side of the Epididymis
testis. The sperms leave the rete testis Glans penis
and enter the epididymis through Scrotum
the vasa efferentia. The epididymis
Testis
is a single highly coiled tube that
temporarily stores the spermatozoa Fig. 2.2 (a) Diagrammatic view of
the male reproductive system
and they undergo physiological
maturation and acquire increased
motility and fertilizing capacity. The
epididymis leads to the vas deferens
and joins the duct of the seminal
vesicle to form the ejaculatory duct Blood vessels
which passes through the prostate and nerves
and opens into the urethra. The Vas deferens
urethra is the terminal portion of the
Epididymis
male reproductive system and is used
to convey both urine and semen at Rete testis
different times. It originates from the
Tunica albuginea
urinary bladder and extends through Tubulus rectus
the penis by an external opening Seminiferous tubule
called urethral meatus.
The accessory glands of the
male reproductive system include
Fig. 2.2 (b) Testis showing
the paired seminal vesicles and inner details
15 Human Reproduction

vesiculase which enhances sperm motility. The region (Fig. 2.3 a). These parts along with the
bulbourethral glands are inferior to the prostate mammary glands are integrated structurally and
and their secretions also help in the lubrication of functionally to support the process of ovulation,
the penis. The prostate encircles the urethra and fertilisation, pregnancy, child birth and child
is just below the urinary bladder and secretes a care.
slightly acidic fluid that contains citrate, several Ovaries are the primary female sex organs
enzymes and prostate specific antigens. Semen that produce the female gamete, ovum. The
or seminal fluid is a milky white fluid which ovaries are located one on each side of the lower
contains sperms and the seminal plasma (secreted abdomen. The ovary is an elliptical structure
from the seminal vesicles, prostate gland and the about 2-4 cm long. Each ovary is covered by a
bulbourethal glands). The seminal fluid acts as a thin cuboidal epithelium called the germinal
transport medium, provides nutrients, contains epithelium which encloses the ovarian stroma.
chemicals that protect and activate the sperms The stroma is differentiated as the outer cortex and
and also facilitate their movement. inner medulla. Below the germinal epithelium is
The penis is the male external genitalia a dense connective tissue, the tunica albuginea.
functioning as a copulatory organ. It is made The cortex appears dense and granular due
of a special tissue that helps in the erection of to the presence of ovarian follicles in various
penis to facilitate insemination. The enlarged stages of development. The medulla is a
end of the penis called glans penis is covered loose connective tissue with abundant blood
by a loose fold of skin called foreskin or vessels, lymphatic vessels and nerve fibres.
prepuce. The ovary remains attached to the pelvic
wall and the uterus by an ovarian ligament
The female reproductive system is far more
called mesovarium.
complex than the male because in addition
to gamete formation, it has to nurture the The fallopian tubes (uterine tubes or
developing foetus. The female reproductive oviducts), uterus and vagina constitute the
system consists of a pair of ovaries along with female accessory organs (Fig. 2.3 b). Each
a pair of oviducts, uterus, cervix, vagina and fallopian tube extends from the periphery
the external genitalia located in the pelvic of each ovary to the uterus. The proximal
part of the fallopian tube bears a
funnel shaped infundibulum. The
8WHULQH
WXEH edges of the infundibulum have
2YDU\ many finger like projections called
)LPEULDH
fimbriae which help in collection
8WHUXV &HUYL[
of the ovum after ovulation.
8ULQDU\ 5HFWXP
EODGGHU
8UHWKUD 9DJLQD
&OLWRULV Female
/DELXP $QXV
PLQRUD uterus
/DELXP contains
PDMRUD one of the
Fig. 2.3 (a) Female pelvis showing reproductive system strongest muscles of the
human body.

8WHUXV
minora, hymen and
,VWKPXV clitoris.
$PSXOOD The Bartholin’s glands
)DOORSLDQ
WXEH
,QIXQGLEXOXP (also called greater
)LPEULDH vestibular glands) are
(QGRPHWULXP 2YDU\ located posterior to
0\RPHWULXP
3HULPHWULXP
&HUYL[ the left and right of the
&HUYLFDOFDQDO opening of the vagina.
9DJLQD They secrete mucus to
lubricate the vagina and
Fig. 2.3 (b) Diagrammatic view of female reproductive system are homologous to the
bulbourethral glands of
The infundibulum leads to a wider central the male. The Skene’s glands are located on
portion called ampulla. The last part of the the anterior wall of the vagina and around
oviduct is the isthmus which is short and the lower end of the urethra. They secrete a
thick walled connecting the ampulla and lubricating fluid and are homologous to the
infundibulum to the uterus. prostate gland of the males.
The uterus or womb is a hollow, thick-walled, The external opening of the vagina is
muscular, highly vascular and inverted pear partially closed by a thin ring of tissue called
shaped structure lying in the pelvic cavity the hymen. The hymen is often torn during
between the urinary bladder and rectum. The the first coitus (physical union). However
major portion of the uterus is the body and the in some women it remains intact. It can be
rounded region superior to it, is the fundus. The stretched or torn due to a sudden fall or jolt
uterus opens into the vagina through a narrow and also during strenuous physical activities
cervix. The cavity of the cervix called the such as cycling, horseback riding, etc., and
cervical canal communicates with the vagina therefore cannot be considered as an indicator
through the external orifice and with the uterus of a woman’s virginity.
through the internal orifice. The cervical canal The mammary glands are modified sweat
along with vagina forms the birth canal. glands present in both sexes. It is rudimentary
The wall of the uterus has three layers of in the males and functional in the females. A
tissues. The outermost thin membranous pair of mammary glands is located in the
serous layer called the perimetrium, thoracic region. It contains glandular tissue
the middle thick muscular layer called and variable quantities of fat with a median
myometrium and the inner glandular layer nipple surrounded by a pigmented area called
called endometrium. The endometrium the areola. Several sebaceous glands called
undergoes cyclic changes during the the areolar glands are found on the surface
menstrual cycle while myometrium exhibits and they reduce cracking of the skin of the
strong contractions during parturition. nipple. Internally each mammary gland
Vagina is a large fibromuscular tube that consists of 2-25 lobes, separated by fat and
extends from the cervix to the exterior. It is connective tissues (Fig. 2.4). Each lobe is made
the female organ of copulation. The female up of lobules which contain acini or alveoli
reproductive structures that lie external to lined by epithelial cells. Cells of the alveoli
the vagina are called as the external genitalia secrete milk. The alveoli open into mammary
or vulva comprising of labia majora, labia tubules. The tubules of each lobe join to form

2.2 Gametogenesis
Gametogenesis is the process of formation
of gametes i.e., sperms and ovary from the
6XVSHQVRU\
OLJDPHQW primary sex organs in all sexually reproducing
$GLSRVHWLVVXH organisms. Meiosis plays the most significant
/REH
role in the process of gametogenesis (Fig.2.5).
$UHROD
1LSSOH
Spermatogenesis
/DFWLIHURXVGXFW
0DPPDU\DPSXOOD
Spermatogenesis is the sequence of
0DPPDU\GXFW events in the seminiferous tubules of the
/REXOHFRQWDLQLQJ testes that produce the male gametes, the
DOYHROL
0DPPDU\WXEXOHV sperms. During development, the primordial
germ cells migrate into the testes and become
immature germ cells called sperm mother
Fig. 2.4 Mammary gland cells or spermatogonia in the inner surfaces
of the seminiferous tubules (Fig. 2.6 a). The
a mammary duct. Several mammary ducts spermatogonia begin to undergo mitotic
join to form a wider mammary ampulla division at puberty and continue throughout
which is connected to the lactiferous duct in life.
the nipple. Under the nipple, each lactiferous In the first stage of spermatogenesis, the
duct expands to form the lactiferous sinus spermatogonia migrate among sertoli cells
which serves as a reservoir of milk. Each towards the central lumen of the seminiferous
lactiferous duct opens separately by a minute tubule and become modified and enlarged
pore on the surface of the nipple. to form primary spermatocytes which are
Normal development of the breast diploid with 23 pairs i.e., 46 chromosomes.
begins at puberty and
progresses with changes 6SHUPDWRJHQHVLV 2RJHQHVLV
during each menstrual
0XOWLSOLFDWLRQ
6SHUPDWRJRQLD Q )RHWDO Q 2RJRQLD

cycle. In non-pregnant
3KDVH
OLIH
women, the glandular 0LWRWLFGLYLVLRQ 0LWRWLFGLYLVLRQ
structure is largely 3ULPDU\ Q 3ULPDU\RRF\WH

Q
underdeveloped and VSHUPDWRF\WH
*URZWK
0HLRVLV,
3KDVH
the breast size is largely 0HLRVLV,FRPSOHWHG

SULRUWRRYXODWLRQ
due to amount of fat 6HFRQGDU\
Q Q
)LUVW
SRODU
Q
VSHUPDWRF\WH Q 6HFRQGDU\RRF\WH
deposits. The size of ERG\
0HLRVLV,,
the breast does not have $GXOW
XOW
UHSURGXFWLYH
an influence on the 6SHUPDWLG Q Q Q Q
OLIH
&RPSOHWLRQ
efficiency of lactation. 6SHUPLRJHQHVLV
0DWXUDWLRQ
6HFRQG RIPHLRVLV,,
SRODU
3KDVH
6SHUPDWR]RD Q Q Q Q Q
ERG\
Q 2YXP
Fig. 2.5 Gametogenesis


Spermatid
Spermatogonia
Sertoli cells
Interstitial cell
Fig. 2.6 (a) Cross sectional view of seminiferous tubule
Some of the primary spermatocytes

undergo first meiotic division to form two
secondary spermatocytes which are haploid
with 23 chromosomes each. The secondary
spermatocytes undergo second meiotic
division to produce four haploid spermatids.
The spermatids are transformed into mature
spermatozoa (sperms) by the process Fig. 2.6 (b) Seminiferous
called spermiogenesis. Sperms are finally tubules (Enlarged)
released into the cavity of seminiferous
Structure of human spermatozoan
tubules by a process called spermiation.
The human sperm is a microscopic,
The whole process of spermatogenesis
flagellated and motile gamete (Fig. 2.7).
takes about 64 days. At any given time,
The whole body of the sperm is enveloped
different regions of the seminiferous tubules
by plasma membrane and is composed of a
contain spermatocytes in different stages
head, neck and a tail. The head comprises
of development (Fig. 2.6 b). The sperm
of two parts namely acrosome and nucleus.
production remains nearly constant at a rate
Acrosome is a small cap like pointed
of about 200 million sperms per day.
structure present at the tip of the nucleus
Spermatogenesis starts at the age of and is formed mainly from the Golgi body
puberty and is initiated due to the increase of the spermatid. It contains hyaluronidase,
in the release of Gonadotropin Releasing a proteolytic enzyme, popularly known as
Hormone (GnRH) by the hypothalamus. sperm lysin which helps to penetrate the
GnRH acts on the anterior pituitary gland and ovum during fertilisation. The nucleus is flat
stimulates the secretion of two gonadotropins and oval. The neck is very short and is present
namely Follicle Stimulating Hormone between the head and the middle piece.
(FSH) and Lutenizing Hormone (LH). FSH It contains the proximal centriole towards
stimulates testicular growth and enhances the the nucleus which plays a role in the first
production of Androgen Binding Protein division of the zygote and the distal centriole
(ABP) by the sertoli cells and helps in the gives rise to the axial filament of the sperm.
process of spermiogenesis. LH acts on the The middle piece possesses mitochondria
Leydig cells and stimulates the synthesis of spirally twisted around the axial filament
testosterone which in turn stimulates the called mitochondrial spiral or nebenkern.
process of spermatogenesis. It produces energy in the form of ATP
molecules for the movement of sperms. The

tail is the longest part
Out of the million eggs
of the sperm and is Acrosome
women possess during
slender and tapering. Head
Nucleus birth, only about 300 to
It is formed of a
400 will ovulate before
central axial filament Neck menopause.
or axoneme and an
outer protoplasmic Mitochondria On the other hand, males produce more
sheath. The lashing
Middle
piece
than 500 billion sperms in their life time.
movements of the
The primary follicle gets surrounded
tail push the sperm
forward. The human by many layers of granulosa cells and a new
Tail
male ejaculates about theca layer to form the secondary follicle. A

200 to 300 million fluid filled space, the antrum develops in the
sperms during coitus. follicle and gets transformed into a tertiary
It is estimated that follicle. The theca layer gets organized into an
around 60 percent inner theca interna and an outer theca externa.
of sperms must have At this time, the primary oocyte within the
normal shape of which Fig. 2.7 Structure of tertiary follicle grows in size and completes its
at least 40 per cent human sperm first meiotic division and forms the secondary
must show vigorous oocyte. It is an unequal division resulting in
motility for normal fertility. the formation of a large haploid secondary
oocyte and a first polar body. The first polar
body disintegrates. During fertilisation, the
The sperm is the smallest
secondary oocyte undergoes second meiotic
human cell and the
division and produces a large cell, the ovum
ovum or egg is the largest
and a second polar body. The second polar body
human cell.
also degenerates. The tertiary follicle eventually
becomes a mature follicle or Graafian follicle.
Oogenesis
If fertilisation does not take place, second
Oogenesis is the process of development
meiotic division is never completed and the
of the female gamete or ovum or egg in the
egg disintegrates. At the end of gametogenesis
ovaries. During foetal development, certain cells
in females, each primary oocyte gives rise to
in the germinal epithelium of the foetal ovary
only one haploid ovum.
divide by mitosis and produce millions of egg
mother cells or oogonia. No more oogonia Structure of ovum
are formed or added after birth. The oogonial Human ovum is non-cleidoic, alecithal
cells start dividing and enter into Prophase I of and microscopic in nature. (Fig. 2.8 (b)). Its
meiotic division I to form the primary oocytes cytoplasm called ooplasm contains a large
which are temporarily arrested at this stage. nucleus called the germinal vesicle. The ovum
The primary oocytes then get surrounded by is surrounded by three coverings namely an
a single layer of granulosa cells to form the inner thin transparent vitelline membrane,
primordial or primary follicles (Fig. 2.8 a). A middle thick zona pellucida and outer thick
large number of follicles degenerate during the coat of follicular cells called corona radiata.
period from birth to puberty, so at puberty only Between the vitelline membrane and zona
60,000 to 80,000 follicles are left in each ovary. pellucida is a narrow perivitelline space.

7HUWLDU\ 6HFRQGDU\ 3ULPDU\ 3ULPRUGLDO %ORRG
IROOLFOH IROOLFOH IROOLFOH IROOLFOHV YHVVHOV
&RURQDUDGLDWD
=RQD3HOOXFLGD
9LWHOOLQH
PHPEUDQH
&RUSXV 1XFOHXV
DOELFDQV *HUPLQDOYHVLFOH
2RSODVP
&RUSXV
OXWHXP
0DWXUH 6HFRQGDU\
JUDDILDQ RFF\WH
IROOLFOH Fig. 2.8 (b) Diagrammatic view of the
human ovum
Fig. 2.8 (a) Sectional view of the ovary
2.3 Menstural cycle 2. Follicular or proliferative phase

The menstrual or ovarian cycle occurs The follicular phase extends from the 5th
approximately once in every 28/29 days day of the cycle until the time of ovulation.
during the reproductive life of the female from During this phase, the primary follicle in the
menarche (puberty) to menopause except ovary grows to become a fully mature Graafian
during pregnancy. The cycle of events starting follicle and simultaneously, the endometrium
from one menstrual period till the next one is regenerates through proliferation. These changes
called the menstrual cycle during which cyclic in the ovary and the uterus are induced by the
changes occurs in the endometrium every secretion of gonadotropins like FSH and LH,
month. Cyclic menstruation is an indicator of which increase gradually during the follicular
normal reproductive phase (Fig. 2.9). phase. It stimulates follicular development and
Menstrual cycle comprises of the following secretion of oestrogen by the follicle cells.
phases 3. Ovulatory phase
1. Menstrual phase Both LH and FSH attain peak level in
2. Follicular or proliferative phase the middle of the cycle (about the 14th day).
3. Ovulatory phase Maximum secretion of LH during the mid
4. Luteal or secretory phase cycle called LH surge induces the rupture of
the Graafian follicle and the release of the ovum
1. Menstrual phase (secondary oocyte) from the ovary wall into
The cycle starts with the menstrual phase the peritoneal cavity. This process is called
when menstrual flow occurs and lasts for 3-5 as ovulation.
days. Menstrual flow is due to the breakdown of 4. Luteal or secretory phase
endometrial lining of the uterus, and its blood During luteal phase, the remaining part
vessels due to decline in the level of progesterone of the Graafian follicle is transformed into
and oestrogen. Menstruation occurs only if the a transitory endocrine gland called corpus
released ovum is not fertilized. Absence of luteum. The corpus luteum secretes large
menstruation may be an indicator of pregnancy. amount of progesterone which is essential
However it could also be due to stress, hormonal for the maintenance of the endometrium.
disorder and anaemia. If fertilisation takes place, it paves way for

(a) FSH and LH secreted by the anterior pituitary
14th day LH Surge triggers ovulation
Lutenizing hormone(LH)
Follicle stimulating hormone(FSH)
(b) Events in the ovary

Single mature Ovulation Corpus Corpus
follicle luteum albicans
Several follicles start developing
Follicular phase Luteal phase
(c) Ovarian hormones
Progesterone
Oestrogen
(c) Events in the endometrium of the uterus Highly proliferated and vascularized endometrium
Bleeding and sloughing

Thickness of the
(menstruation)
endometrium
Days 1 3 5 7 9 11 13 17 19 21 23 25 27 28
Menstrual phase Follicular phase Luteal phase
Fig. 2.9 Different phases of the menstrual cycle

the implantation of the fertilized ovum. The In the absence of fertilisation, the corpus
uterine wall secretes nutritious fluid in the luteum degenerates completely and leaves a scar
uterus for the foetus. So, this phase is also tissue called corpus albicans. It also initiates
called as secretory phase. During pregnancy the disintegration of the endometrium leading
all events of menstrual cycle stop and there is to menstruation, marking the next cycle.
no menstruation.
POLY CYSTIC OVARY SYNDROME (PCOS)

PCOS is a complex endocrine system disorder that affects women in their reproductive
years. Polycystic means ‘many cysts’. It refers to many partially formed follicles on the ovaries,
which contain an egg each. But they do not grow to maturity or produce eggs that can be
fertilized. Women with PCOS may experience irregular menstrual cycles, increased androgen
levels, excessive facial or body hair growth (hirsutism), acne, obesity, reduced fertility and
increased risk of diabetes. Treatment for PCOS includes a healthy lifestyle, weight loss and
targeted hormone therapy.

2.4 Menstrual disorders and productivity of women. The impact of
Absence of menstruation is called poor menstrual hygiene on girls is increased
amenorrhoea. If menarche does not stress levels, fear and embarrassment during
appear till the age of 18, it is called primary menstruation. This can keep girls inactive
amenorrhoea. Absence of menstruation for during such periods leading to absenteeism
over three consecutive months is secondary from school.
amenorrhoea. Clean and safe absorbable clothing
Polymenorrhoea is a term used to materials, sanitary napkins, pads, tampons
describe a menstrual cycle that is shorter than and menstrual cups have been identified
21 days. It may be due to hyperactivity of the as materials used to manage menstruation.
anterior pituitary gland causing frequent Changing sanitary material 4-5 hours as per
ovulation, psychological disturbances and the requirement, provides comfort, cleanliness
malnutrition. Chronic pelvic inflammation by and protection from infections. It also helps in
certain sexually transmitted diseases (STD) enhancing the quality of life of women during
such as chlamydiasis or gonorrhoea can this period. Used sanitary napkins should be
cause inflammation in the uterus causing wrapped in paper and disposed. It should not
polymenorrhoea. be thrown in open areas or drain pipe of toilets.
Flushing of sanitary napkins in the drain pipes
Pain associated with menstruation is called
causes choking of the drainage line leading to
dysmenorrhoea. It is the most commonly
water pollution.
reported menstrual disorder. There are two types
of dysmenorrhoea viz primary and secondary
dysmenorrhoea. Primary dysmenorrhoea is Disposal of Napkins
pain or cramps during menstrual period and The ecofriendly way to dispose
is caused by secretions of prostaglandin in the menstrual waste scientifically and
uterus. Secondary dysmenorrhoea is caused hygienically is to destroy the sanitary
by a disorder in the reproductive system like napkins using incinerators. Measures are
endometriosis or uterine fibroids. being taken to install incinerators and
Heavy and prolonged menstrual period napkin vending machines in washrooms
that disrupts a woman’s normal activities is of schools , colleges and public facilities.
referred to as menorrhagia. Menorrhagia
may be due to hormonal imbalance, ovarian Menopause
dysfunction, uterine fibroids and may also be Menopause is the phase in a women’s
due to cancer of the ovary, uterus or cervix. life when ovulation and menstruation stops.
Oligomenorrhoea is a condition with The average age of menopause is 45-50 years.
infrequent menstrual periods. It occurs in It indicates the permanent cessation of the
women of childbearing age. Some variation primary functions of the ovaries.
in menstruation is normal, but a woman
who regularly goes more than 35 days 2.5 Fertilisation and implantation
without menstruating may be diagnosed with Fertilisation occurs when a haploid sperm
oligomenorrhoea. fuses with a haploid ovum to form a fertilized
Menstrual hygiene egg or diploid zygote.
Menstrual hygiene is vital for good The sperms deposited in the female
health, well-being, dignity, empowerment reproductive tract undergo capacitation, which

is a biochemical event that enables the sperm cluster of 16 or more cells called the morula (Fig.
to penetrate and fertilise the egg. Fertilisation 2.11).
occurs only if the ovum and sperms are Under the influence of progesterone,
transported simultaneously to the ampullary smooth muscles of the fallopian tube relax
isthmic junction of the fallopian tube. and the dividing embryo takes 4-5 days to
Before a sperm can enter the egg, move through the fallopian tube into the
it must penetrate the multiple layers of uterine cavity and finally gets implanted in
granulosa (follicular) cells which are around the uterine wall. At this point the embryo
the ovum forming the corona radiata (Fig. consists of a fluid filled hollow ball of about
2.10). The follicular cells are held together 100 cells, called the blastocyst. The blastocyst
by an adhesive cementing substance called is composed of a single layer of large flattened
hyaluronic acid. The acrosomal membrane cells called trophoblast and a small cluster
disintegrates releasing the proteolytic enzyme, of 20-30 rounded cells called the inner cell
hyaluronidase during sperm entry through mass. The inner cell mass of the blastocyst
the corona radiata and zona pellucida. This is develops into the embryo and becomes
called acrosomal reaction. Once fertilisation embedded in the endometrium of the uterus.
is accomplished, cortical granules from the This process is called implantation and it
cytoplasm of the ovum form a barrier called results in pregnancy.
the fertilisation membrane around the ovum If the fertilised ovum is implanted outside
preventing further penetration of other sperms. the uterus it results in ectopic pregnancy.
Thus polyspermy is prevented. About 95 percent of ectopic pregnancies
The first cleavage produces two identical occur in the fallopian tube. The growth of
cells called blastomeres. These produce 4 cells, the embryo may cause internal bleeding,
then 8 and so on. After 72 hours of fertilisation, infection and in some cases even death due to
a loose collection of cells forms a berry shaped rupture of the fallopian tube.

7KHQXFOHXVDQGRWKHU &RUWLFDOJUDQXOHVIRUPDEDUULHU
FRPSRQHQWVRIWKHVSHUP FDOOHGIHUWLOL]DWLRQPHPEUDQH
HQWHUWKHHJJ ZKLFKQRZIXQFWLRQVDVDEORFN
WRSRO\VSHUP\

%UHDNGRZQRIWKH]RQD
SHOOXFLGDE\WKHVHHQ]\PHV
DOORZVWKHVSHUPWRUHDFK
WKHSODVPDPHPEUDQHRIWKH
HJJ

7KLVELQGLQJLQGXFHVWKH )ROOLFOHFHOOV
DFURVRPHUHDFWLRQLQZKLFKWKH &RUWLFDO
VSHUPUHOHDVHVK\DOXURQLGDVH 6SHUP JUDQXOH
LQWRWKH]RQDSHOOXFLGD QXFOHXV
=RQDSHOOXFLGD
7KHVSHUPPLJUDWHVWKURXJK
WKHFRDWRIIROOLFOHFHOOVDQGELQGV (JJSODVPD
WRUHFHSWRUPROHFXOHVLQWKH]RQD
PHPEUDQH
SHOOXFLGDRIWKHHJJ
$FURVRPH (JJ
F\WRSODVP
Fig. 2.10 Events of fertilisation


D=\JRWH
IHUWLOL]HGHJJ
EFHOOVWDJH F0RUXOD G(DUO\EODVWRF\VW
to specific tissues, organs and organ systems
during organogenesis.
The extra embryonic membranes namely
)HUWLOL]DWLRQ
the amnion, yolk sac, allantois and chorion
2RF\WHHJJ protect the embryo from dessication, mechanical
shock and help in the absorption of nutrients
HLPSODQWHG
EODVWRF\VW
and exchange of gases (Fig. 2.12). The amnion
is a double layered translucent membrane filled
with the amniotic fluid. It provides a buoyant
environment to protect the developing embryo
Fig. 2.11 From zygote to blastocyst : passage from injury, regulates the temperature of the
of growing embryo through the foetus and provides a medium in which the
fallopian tube foetus can move. The yolk sac forms a part of
the gut and is the source of the earliest blood
Twins are two offsprings produced in the cells and blood vessels.
same pregnancy. 3ODFHQWDO
YLOOL 3ODFHQWD
➢
Monozygotic (Identical) twins are
produced when a single fertilised $OODQWRLV
egg splits into two during the first 8PELOLFDO

FRUG
)DOORSLDQ
cleavage. They are of the same sex, WXEH
8WHUXV
look alike and share the same genes. )RHWXV
&KRULRQ
$PQLRWLF
➢
Dizygotic (Fraternal) twins are IOXLG $PQLRQ
produced when two separate eggs

are fertilised by two separate sperms.
The twins may be of the same sex or
different sex and are non-identical. Fig. 2.12 Human foetus within the uterus
➢
Siamese (United) twins are the
conjoined twins who are joined The allantois forms a small out pocketing
during birth. of embryonic tissue at the caudal end of the yolk
sac. It is the structural base for the umbilical
cord that links the embryo to the placenta and
2.6 Maintenance of pregnancy ultimately it becomes part of the urinary bladder.
and embryonic development The chorion is the outermost membrane which
The inner cell mass in the blastula is encloses the embryo and all other membranes
differentiated into epiblast and hypoblast and also helps in the formation of the placenta.
immediately after implantation. The hypoblast The trophoblast cells in the blastocyst
is the embryonic endoderm and the epiblast send out several finger like projections called
is the ectoderm. The cells remaining in chorionic villi carrying foetal blood and are
between the epiblast and the endoderm form surrounded by sinuses that contain maternal
the mesoderm. Thus the transformation of the blood. The chorionic villi and the uterine
blastocyst into a gastrula with the primary germ tissues form the disc-shaped placenta. Placenta
layers by the movement of the blastomeres is is a temporary endocrine organ formed during
called gastrulation. Each germ layer gives rise pregnancy and it connects the foetus to the

uterine wall through the umbilical cord. It is hCG, hPL and relaxin are produced only during
the organ by which the nutritive, respiratory pregnancy. In addition, during pregnancy the
and excretory functions are fulfilled. The level of other hormones like oestrogen and
embryo’s heart develops during the fourth week progesterone, cortisol, prolactin, thyroxine, etc.,
of pregnancy and circulates blood through the is increased several folds in the maternal blood.
umbilical cord and placenta as well as through These hormones are essential for supporting
its own tissues. foetal growth.
The primary germ layers serve as the
primitive tissues from which all body organs A female uterus is
develop. The ectoderm gives rise to the central normally about 3 inches
nervous system (brain and spinal cord),
long and 2 inches wide
peripheral nervous system, epidermis and
but can expand 20 times
its derivatives and mammary glands. The
during pregnancy.
connective tissue, cartilage and bone, muscles,
organs of urinogenital system (kidney, ureter
and gonads) arise from the mesoderm. The 2.7 Parturition and lactation
endodermal derivatives are epithelium of Parturition is the completion of pregnancy
gastrointestinal and respiratory tract, liver, and giving birth to the baby. The series of
pancreas, thyroid and parathyroids. events that expels the infant from the uterus
Human pregnancy lasts for about 280 is collectively called “labour”. Throughout
days or 40 weeks and is called the gestation pregnancy the uterus undergoes periodic
period. It can be divided for convenience into episodes of weak and strong contractions.
three trimesters of three months each. The first These contractions called Braxter-Hick’s
trimester is the main period of organogenesis, contractions lead to false labour. As the
the body organs namely the heart, limbs, pregnancy progresses, increase in the oestrogen
lungs, liver and external genital organs are well concentration promotes uterine contractions.
developed. By the end of the second trimester, These uterine contractions facilitate moulding
the face is well formed with features, eyelids and of the foetus and downward movement of
eyelashes, eyes blink, body is covered with fine the foetus. The descent of the foetus causes
hair, muscle tissue develops and bones become dilation of cervix of the uterus and vaginal
harder. The foetus is fully developed and is canal resulting in a neurohumoral reflex called
ready for delivery by the end of nine months Foetal ejection reflex or Ferguson reflex. This
(third trimester). initiates the secretion of oxytocin from the
During pregnancy, the placenta acts as neurohypophysis which in turn brings about
a temporary endocrine gland and produces the powerful contraction of the uterine muscles
large quantities of human Chorionic and leads to the expulsion of the baby through
Gonadotropin (hCG), human Chorionic the birth canal. This sequence of events is called
Somatomammotropin (hCS) or human as parturition or childbirth.
Placental Lactogen (hPL), oestrogens and Relaxin is a hormone secreted by the
progesterone which are essential for a normal placenta and also found in the corpus luteum.
pregnancy. A hormone called relaxin is also It promotes parturition by relaxing the pelvic
secreted during the later phase of pregnancy joints and by dilatation of the cervix with
which helps in relaxation of the pelvic ligaments continued powerful contractions. The amnion
at the time of parturition. It should be noted that ruptures and the amniotic fluid flows out

STAGES OF
FOETAL DEVELOPMENT
20 Weeks
Length of foetus increases
Hair on the head and
eyebrows. Skin becomes
covered with
16 Weeks sebaceous gland 24 Weeks
Lower limbs reach final Lungs are well developed
development. Rapid eye movements
Movements are seen begin. Foetus starts
gaining weight
12 Weeks 28 Weeks
Eyes and ears are well Immune system starts
defined. Ossification of developing. Central
long bones are seen nervous system
Urine formation begins developed. Retina is
well developed
8 Weeks 32 Weeks
Limbs and digits fully formed. Body weight increases
Movements start taking rapidly. Skin is smooth
place. Neck appears between due to deposition of
head and thorax. External genitalia subcutaneous fat
show sex differences
4 Weeks 36 Weeks
Formation of foregut, midgut and Blood vessels are
hindgut. Heart starts functioning. completely developed.
Forebrain is most prominent. Baby is positioned into
Upper limbs appears as the pelvis in head
paddle-shaped buds down position
40 Weeks
Baby is fully formed.
Ready to be born
any day

CAESAREAN When normal vaginal delivery is not possible due to factors like position of
the baby and nature of the placenta, the baby is delivered through a surgical incision in the
woman’s abdomen and uterus. It is also termed as abdominal delivery or Caesarean Section or
‘C’ Section.
through the vagina, followed by the foetus. The Colostrum is also rich in IgA antibodies. This
placenta along with the remains of the umbilical helps to protect the infant’s digestive tract
cord called “after birth” is expelled out after against bacterial infection. Breast milk is the
delivery. ideal food for infants as it contains all the
Lactation is the production of milk by constituents in suitable concentration and is
mammary glands. The mammary glands show easily digestible. It is fully sufficient till about
changes during every menstrual cycle, during 6 months of age and all infants must be breast
pregnancy and lactation. Increased level of fed by the mother to ensure the growth of a
oestrogens, progesterone and human Placental healthy baby.
Lactogen (hPL) towards the end of pregnancy
stimulate the hypothalamus towards prolactin Summary
– releasing factors. The anterior pituitary Reproduction is a process which helps in
responds by secreting prolactin which plays a the continuity and maintenance of a species.
major role in lactogenesis. Human beings are sexually reproducing and
viviparous. The reproductive events include
Oxytocin causes the “Let-Down” reflex-
gametogenesis, insemination, Fertilisation,
the actual ejection of milk from the alveoli
cleavage, implantation, placentation,
of the mammary glands. During lactation,
gastrulation, organogenesis and parturition.
oxytocin also stimulates the recently emptied
uterus to contract, helping it to return to pre - The female reproductive system consists
pregnancy size. of a pair of ovaries, a pair of oviducts, uterus,
cervix, vagina and external genitalia. The male
Colostrum reproductive system consists of a pair of testes,
Colostrum, a nutrient rich a pair of duct system, accessory glands and
fluid produced by the human female external genitalia called penis.
immediately after giving birth, is loaded The process of formation of gametes in
with immune, growth and tissue repair the male is called spermatogenesis and in the
factors. It acts as a natural antimicrobial female is called oogenesis. The reproductive
agent to actively stimulate the maturation cycle in females is called menstrual cycle and
of the infant’s immune system. No artificial it is initiated at puberty. The ovum released
feed can substitute the first milk, with all during the menstrual cycle is fertilized by the
its natural benefits and therefore should be sperm and the zygote is formed.
definitely fed to the baby after birth. Zygote undergoes repeated mitotic division
and the blastocyst is implanted on the walls of
The mammary glands secrete a yellowish the uterus. It takes about 280 days or 40 weeks
fluid called colostrum during the initial for the entire development of the human foetus
few days after parturition. It has less lactose and it is delivered out through the process of
than milk and almost no fat, but it contains child birth or parturition. The new born baby is
more proteins, vitamin A and minerals. breast fed by the mother.

World Breast feeding week (WBW)
August 1st week
WBW is organized and promoted world wide by WABA (World Alliance for
Breast feeding Action), WHO (World Health Organization) and UNICEF (United
Nations International Children's Emergency Fund) to stress the importance of
breast feeding during the first six months of baby’s life and a supplemented breast
feeding for two years in order to encourage new mothers for the healthy growth
and development of their children, to guard them from lethal health problems and
diseases including neonatal jaundice, pneumonia, cholera, etc., The Government
of Tamil Nadu has also initiated various projects like Mother’s Milk Bank, Feeding
rooms in bus terminals and also organisizes awareness campaigns during the first
week of August to highlight the importance of breast feeding to infants.
INTERESTING FACTS
1. Males are said to be sterile when they fail to produce viable sperms.
2. Azospermia refers to the failure of spermatogenesis.
3. Enlargement of prostate gland is called prostatitis and can lead to difficulty in urination.
4. Castration or surgical removal of testis is known as orchidectomy
5. Spermarche is the first ejaculation of the semen.
Arunachalam Muruganantham
Inventor And Social Entrepreneur
Arunachalam Muruganantham is the man behind the world’s first low cost sanitary napkin
making machine. His mission was to provide sanitary napkins at minimal cost to poor
women across the country, especially in rural areas. The journey began when he was shocked
by the fact that women in India including his wife often used things such as old rags, leaves
and even ash during menstruation. Approximately 70 percent of all reproductive diseases
in India are caused by poor menstrual hygiene. 23 percent of girls drop out of schools once
they attain puberty. He wished to make a social impact by creating more livelihoods and
improving the menstrual hygiene of rural women.
Arunachalam initiated his research in 1999 and almost after 5 years, successfully created
a low cost machine for the production of sanitary napkins. He presented his prototype
to IIT, Madras for a national innovation competition in 2006 and out of 943 entries, his
machine stood first. Arunachalam made 250 machines in 18 months and set out to states in
Northern India namely Bihar, Madhya Pradesh, Rajasthan and Uttar Pradesh.
Arunachalam Muruganantham was named one of the Time Magazine’s 100 most
influential people in 2014. He was awarded the Padma Shri in 2016.

Evaluation c. Spermiogenesis
1. The mature sperms are d. Capacitation
stored in the 10. Painful menstruation is termed as
a. Seminiferous tubules a. Dysmenorrhoea
b.Vas deferens b. Menorrhagia
c. Epididymis c. Amenorrhoea
d. Seminal vesicle d. Oligomenorrhoea
2. The male sex hormone testosterone is 11. The milk secreted by the mammary glands
secreted from soon after child birth is called
a. Sertoli cells b. Leydig cell a. Mucous b. Colostrum
c. Epididymis d. Prostate gland c. Lactose d. Sucrose
3. The glandular accessory organ which 12. Colostrum is rich in
produces the largest proportion of semen a. Ig E b. Ig A
is c. Ig D d. Ig M
a. Seminal vesicle
b. Bulbourethral gland 13. The Androgen Binding Protein (ABP) is
c. Prostate gland produced by
d. Mucous gland a. Leydig cells b. Hypothalamus
c. Sertoli cells d. Pituitary gland
4. The male homologue of the female clitoris is
a. Scrotum b. Penis 14. Which one of the following menstrual
c. Urethra d.Testis irregularities is correctly matched?
a. Menorrhagia - excessive
5. The site of embryo implantation is the
menstruation
a. Uterus b. Peritoneal cavity
b. Amenorrhoea - absence of
c. Vagina d. Fallopian tube
menstruation
6. The foetal membrane that forms the basis c. Dysmenorrhoea - irregularity of
of the umbilical cord is menstruation
a. Allantois b. Amnion d. Oligomenorrhoea - painful
c. Chorion d. Yolk sac menstruation
7. The most important hormone in intiating 15. Find the wrongly matched pair
and maintaining lactation after birth is
a. Oestrogen b. FSH a. Bleeding phase - fall in oestrogen and
c. Prolactin d. Oxytocin progesterone
b. Follicular phase - rise in oestrogen
8. Mammalian egg is
c. Luteal phase - rise in FSH level
a. Mesolecithal and non cleidoic
d. Ovulatory phase - LH surge
b. Microlecithal and non cleidoic
c. Alecithal and non cleidoic
Answer the following type of questions
d. Alecithal and cleidoic
Assertion (A) and Reason (R)
9. The process which the sperm undergoes
a. A and R are true, R is the correct
before penetrating the ovum is
explanation of A
a. Spermiation b. A and R are true, R is not the correct
b. Cortical reaction explanation of A

c. A is true, R is false 31. Describe the structure of the human ovum
d. Both A and R are false with a neat labelled diagram.
16. A –
In human male, testes are extra 32.
Give a schematic representation of
abdominal and lie in scrotal sacs. spermatogenesis and oogenesis in humans.
R – S crotum acts as thermoregulator and 33.
Explain the various phases of the
keeps temperature lower by 2oC for menstrual cycle.
normal sperm production .
(a) A and R are true, R is the correct 34. List the various menstrual disorders.
explanation of A 35. Explain the role of oxytocin and relaxin in
17. A – O vulation is the release of ovum from parturition and lactation.
the Graafian follicle. 36. Identify the given image and label its parts
R – It occurs during the follicular phase of marked as a, b, c and d
the menstrual cycle.
d
(c) A is true, R is false
18. A –
Head of the sperm consists of a
acrosome and mitochondria.
b
R– Acrosome contains spiral rows of
mitochondria. c
(d) Both A and R are false
19.
Mention the differences between
spermiogenesis and spermatogenesis.
20. At what stage of development are the 37. The following is the illustration of the
gametes formed in new born male and sequence of ovarian events (a-i) in a
female? human female.
21. Expand the acronyms
a. FSH b. LH c. hCG d. hPL
22. How is polyspermy avoided in humans?
23. What is colostrum? Write its significance. a) Identify the figure that illustrates ovulation
and mention the stage of oogenesis it
24. Placenta is an endocrine tissue. Justify. represents.
25. Draw a labeled sketch of a spermatozoan. b) Name the ovarian hormone and the
26. What is inhibin? State its functions. pituitary hormone that have caused the
above-mentioned events.
27. Mention the importance of the position of
the testes in humans. c) Explain the changes that occurs in the
uterus simultaneously in anticipation.
28. What is the composition of semen?
d) Write the difference between C and H.
29. Name the hormones produced from the
placenta during pregnancy.
30. Define gametogenesis.

Human Reproduction
Concept Map
32
TN_GOVT_XII_Zoology_chapter2.indd 32
+XPDQUHSURGXFWLRQ
0DOHUHSURGXFWLYHV\VWHP )HPDOHUHSURGXFWLYHV\VWHP
*DPHWRJHQHVLV
$FFHVVRU\JODQGV 3ULQFLSDORUJDQV 3ULQFLSDORUJDQV $FFHVVRU\JODQGV 0HQVWUXDOF\FOH
6SHUPDWRJHQHVLV 2RJHQHVLV
6HPLQDO 7HVWLV 6SHUP 2YXP 2YDU\ 0DPPDU\ 0HQVWUXDO

YHVLFOH JODQGV SKDVH
3URVWDWH 6HPLQLIHURXV )DOORSLDQ )ROOLFXODU

6(0(1 )HUWLOLVDWLRQ
JODQG WXEXOHV WXEH SKDVH
=\JRWH
2YXODWRU\
%XOERXUHWKUDO 8WHUXV
9DVGHIHUHQV SKDVH
JODQG ,PSODQWDWLRQ
/XWHDO
)RHWDO 9DJLQD
SKDVH
3HQLV GHYHORSPHQW
3DUWXULWLRQ
/DFWDWLRQ
25-02-2019 18:19:52
ICT CORNER
HUMAN REPRODUCTION
Baby’s Journey to the world.
Procedure:
Step 1: Use the URL or scan the QR Code to launch the “Stages of Development before
Birth” activity page.
Step 2: On the right of the window, Click “Video” and view the development of embryo
during that particular stage.
Step 3: Click “Show Features” to know the parts. Click “Heartbeat-Symbol” to hear the
heartbeat of the embryo at that particular stage. Click “Weighing Machine” placed
below to know the weight of the offspring at that stage.
Step 4: Repeat the above steps with the different weeks by clicking the respective week tabs
placed below.
Step 4
HUMAN REPRODUCTION URL:

http://www.glencoe.com/sites/common_assets/science/virtual_labs/
LS26/LS26.html

*Allow flash player

3
UNIT - I
Reproductive
Health
CHAPTER
Safe motherhood begins before conception
with healthy lifestyle and proper nutrition.
Chapter outline
3.1. Need for reproductive health Problems
and strategies
3.2. Amniocentesis and its statutory ban
3.3. Social impact of sex ratio,
R eproductive health represents a society with
people having physically and functionally
normal reproductive organs. Healthy people
female foeticide and infanticide have healthier babies and are able to care for
3.4. Population explosion and birth control their family, and contribute more to the society
3.5. Medical termination of pregnancy (MTP) and community. Hence, health is a community
3.6. Sexually transmitted diseases (STD) issue. Reproductive system is a complex system
3.7. Infertility controlled by the neuro-endocrine system,
3.8. Assisted reproductive technologies (ART) hence, it is important to take necessary steps to
3..9. Detection of foetal disorders during early protect it from infectious diseases and injury.
pregnancy
3.1. Need for reproductive health-
Learning objectives Problems and strategies
India is amongst the first few countries
➢ Understands the importance of sex in the world to initiate the ‘Family planning
education and reproductive health. programme’ since 1951 and is periodically
➢ Learns the importance of amniocentesis as assessed every decade. These programmes are
a pre-natal diagnosis. popularly named as ‘Reproductive and Child
➢ Evaluates the effects of Health Care (RCH). Major tasks carried out
maternal and infant under these programmes are:
mortality. • Creating awareness and providing medical
➢ Identifies, compares and assistance to build a healthy society.
explains different types of • Introducing sex education in schools to
contraceptive devices. provide information about adolescence and
➢ Discusses the medical necessity and social adolescence related changes.
consequences of MTP.
• Educating couples and those in the
➢ Explains the reasons of transmission and
marriageable age groups about the
prevention of STDs.
available birth control methods and
➢ Highlights the reasons of infertility.
family planning norms.
➢ Develops a positive and healthy attitude
towards reproductive life.
34

the foetus. Once the sex of the foetus is known,
Globally, about 800 women there may be a chance of female foeticide. Hence,
die every day of preventable a statutory ban on amniocentesis is imposed.
causes related to pregnancy
and childbirth; 20 per cent of these 3.3. Social impact of sex ratio,
women are from India. Similarly India's female foeticide and infanticide
infant mortality rate was 44 per 1,000 live. The sex ratio is the ratio of males to the
Although, India has witnessed dramatic females in a population. In India, the child sex
growth over the last two decades, ratio has decreased over the decade from 927
maternal mortality still remains high to 919 female for every 1000 males. To correct
as in comparison to many developing this ratio, steps are needed to change the mind
nations. set and attitudes of people, especially in the
source: http://unicef.in
young adults. Female foeticide and infanticide
is the manifestation of gender discrimination
• Creating awareness about care for pregnant in our society.
women, post-natal care of mother and child
Female foeticide refers to ‘aborting the
and the importance of breast feeding.
female in the mother’s womb’; whereas female
• Encouraging and supporting infanticide is ‘killing the female child after her
governmental and non-governmental birth’. These have resulted in imbalance in sex
agencies to identify new methods and/or ratio. In UNDP’s GII 2018 (United nations
to improve upon the existing methods of developmental programmes gender inequality
birth control. index) reflected that India was ranked at 135
out of 187 countries due to availability of
Health care programmes such as very few economic opportunities to women
massive child immunization, supply of as compared to men.
nutritional food to the pregnant women, In order to prevent female foeticide
Janani Suraksha Yojana, Janani Shishu and infanticide, Government of India has
Suraksha Karyakaram, RMNCH+A taken various steps like PCPNDT Act
approach (an integrated approach for (Preconception and Prenatal diagnostic
reproductive, maternal, new born, child technique act-1994) enacted to ban the
and adolescent health), Pradhan Mantri identification of sex and to prevent the
Surakshit Matritva Abhiyan, etc., are use of prenatal diagnostic techniques for
taken up at the national level by the selective abortion. Various measures are
Government of India. taken by the Government to ensure survival,
provision of better nutrition, education,
protection and empowerment of girls by
3.2. Amniocentesis and its
eliminating the differences in the sex ratio,
statutory ban infant mortality rate and improving their
Due to small family norms and the skewed
nutritional and educational status. POCSO
choice for a male child, female population is
Act (Prevention of children from sexual
decreasing at an alarming rate. Amniocentesis
offences), Sexual harassment at workplace
is a prenatal technique used to detect any
(Prevention, prohibition and redressal) Act
chromosomal abnormalities in the foetus and it
and the changes in the Criminal law based
is being often misused to determine the sex of
on the recommendations of Justice Verma
35 Reproductive Health

Committee, 2013 aims at creating a safe and a. Periodic abstinence/rhythm method
secure environment for both females and Ovulation occurs at about the 14th day
males. of the menstrual cycle. Ovum survives
for about two days and sperm remains
3.4. Population explosion and alive for about 72 hours in the female
birth control reproductive tract. Coitus is to be avoided
Increased health facilities and better living during this time.
conditions have enhanced longevity. According b. Continuous abstinence is the simplest
to a recent report from the UN, India’s and most reliable way to avoid pregnancy
population has already reached 1.26 billion is not to have coitus for a defined period
and is expected to become the largest country that facilitates conception.
in population size, surpassing China around c. Coitus interruptus is the oldest family
2022. To overcome the problem of population planning method. The male partner
explosion, birth control is the only available withdraws his penis before ejaculation,
solution. People should be motivated to have thereby preventing deposition of semen
smaller families by using various contraceptive into the vagina.
devices. Advertisements by the Government
d. Lactational amenorrhoea Menstrual
in the media as well as posters/bills, etc., with
cycles resume as early as 6 to 8 weeks from
a slogan Naam iruvar namakku iruvar (we two,
parturition. However, the reappearance
ours two) and Naam iruvar namakku oruvar (we
of normal ovarian cycles may be
two, ours one) have also motivated to control
delayed for six months during breast-
population growth in Tamilnadu. Statutory
feeding. This delay in ovarian cycles is
rising of marriageable age of the female to 18
called lactational amenorrhoea. It serves
years and that of males to 21 years and incentives
as a natural, but an unreliable form of
given to couples with small families are the other
birth control. Suckling by the baby during
measures taken to control population growth in
breast-feeding stimulates the pituitary
our country.
to secrete increased prolactin hormone
Birth control methods in order to increase milk production.
The voluntary use of contraceptive This high prolactin concentration in the
procedures to prevent fertilization or prevent mother’s blood may prevent menstrual
implantation of a fertilized egg in the cycle by suppressing the release of GnRH
uterus is termed as birth control. An ideal (Gonadotropin Releasing Hormone)
contraceptive should be user friendly, easily from hypothalamus and gonadotropin
available, with least side effects and should not secretion from the pituitary.
interfere with sexual drive. The contraceptive 2. Barrier methods In these methods, the
methods are of two types – temporary and ovum and sperm are prevented from meeting
permanent. Natural, chemical, mechanical so that fertilization does not occur.
and hormonal barrier methods are the
a. Chemical barrier Foaming tablets,
temporary birth control methods.
melting suppositories, jellies and creams
1. Natural method is used to prevent meeting are used as chemical agents that inactivate
of sperm with ovum. i.e., Rhythm method the sperms in the vagina.
(safe period), coitus interruptus, continuous b. Mechanical barrier Condoms are a
abstinence and lactational amenorrhoea. thin sheath used to cover the penis in
Reproductive Health 36

male whereas in female it is used to cover such as Cu T-380 A, Nova T, Cu 7, Cu T 380
vagina and cervix just before coitus so as to Ag, Multiload 375, etc. release free copper
prevent the entry of ejaculated semen into and copper salts into the uterus and suppress
the female reproductive tract. This can sperm motility. They can remain in the uterus
prevent conception. Condoms should be for five to ten years.
discarded after a single use. Condom also
Hormone-releasing IUDs such as
safeguards the user from AIDS and STDs.
Progestasert and LNG – 20 are often called
Condoms are made of polyurethane, latex
as intrauterine systems (IUS). They increase
and lambskin.
the viscosity of the cervical mucus and thereby
Diaphragms, cervical caps and vaults prevent sperms from entering the cervix.
are made of rubber and are inserted into
the female reproductive tract to cover the Non-medicated IUDs are made of plastic
cervix before coitus in order to prevent or stainless steel. Lippes loop is a double
the sperms from entering the uterus. S-shaped plastic device.
c. Hormonal barrier
3. Permanent birth control methods are
It prevents the ovaries from releasing the adopted by the individuals who do not want
ova and thickens the cervical fluid which to have any more children.
keeps the sperm away from ovum.
Surgical sterilisation methods are the
Oral contraceptives — Pills are used permanent contraception methods advised for
to prevent ovulation by inhibiting the male and female partners to prevent any more
secretion of FSH and LH hormones. A pregnancies. It blocks the transport of the
combined pill is the most commonly gametes and prevents conception. Tubectomy
used birth control pill. It contains is the surgical sterilisation in women. In this
synthetic progesterone and estrogen procedure, a small portion of both fallopian
hormones. Saheli, contraceptive pill tubes are cut and tied up through a small
by Central Drug Research Institute incision in the abdomen or through vagina.
(CDRI) in Lucknow, India contains This prevents fertilization as well as the entry
a non-steroidal preparation called of the egg into the uterus. Vasectomy is the
centchroman. surgical procedure for male sterilisation. In
d. Intrauterine Devices (IUDs) this procedure, both vas deferens are cut and
Intrauterine devices are inserted by tied through a small incision on the scrotum
medical experts in the uterus through to prevent the entry of sperm into the urethra.
the vagina. These devices are available as Vasectomy prevents sperm from heading off
copper releasing IUDs, hormone releasing to penis as the discharge has no sperms in it.
IUDs and non-medicated IUDs. IUDs
increase phagocytosis of sperm within the 3.5. Medical termination of
uterus. IUDs are the ideal contraceptives pregnancy (MTP)
for females who want to delay pregnancy. Medical method of abortion is a
It is one of the popular methods of voluntary or intentional termination of
contraception in India and has a success pregnancy in a non-surgical or non-invasive
rate of 95 to 99%. way. Early medical termination is extremely
Copper releasing IUDs differ from each safe upto 12 weeks (the first trimester) of
other by the amount of copper. Copper IUDs

Approximately half of unintended pregnancies are due to contraceptive
failure, largely owing to inconsistent or incorrect use of contraceptive
methods. The effectiveness of long-acting reversible contraception
(intrauterine devices and contraceptive implants) is superior to that of contraceptive pills,
patch, or ring and is not altered in adolescents and young women. Educating young women
about the usage of intrauterine devices and contraceptive implants would dramatically
reduce the number of unintended pregnancies among women seeking family planning.
pregnancy and generally has no impact on a of infusion needles, surgical instruments,

women’s fertility. Abortion during the second etc with infected people, blood transfusion
trimester is more risky as the foetus becomes or from infected mother to baby. People in
intimately associated with the maternal the age of 15 to 24 years are prone to these
tissue. Government of India legalized MTP infections. The bacterial STI are gonorrhoea,
in 1971 for medical necessity and social syphilis, chancroid, chlamydiasis and
consequences with certain restrictions like sex lymphogranuloma venereum. The viral
discrimination and illegal female foeticides STI are genital herpes, genital warts,
to avoid its misuse. MTP performed illegally Hepatitis-B and AIDS. Trichomoniasis is a
by unqualified quacks is unsafe and could be protozoan STI, and candidiasis is a fungal STI.
fatal. MTP of the first conception may have STI caused by bacteria, fungi and protozoa
serious psychological consequences or parasites, can be treated with antibiotics
or other medicines, whereas STI caused by
3.6. Sexually transmitted virus cannot be treated but the symptoms
diseases (STD) can be controlled by antiviral medications.
Sexually transmitted Latex condoms usage greatly reduces the risk,
diseases (STD) or but does not completely eliminate the risk of
Venereal diseases (VD) or transmission of STI.
Reproductive tract infections
(RTI) are called as Sexually Prevention of STDs
transmitted infections (STI). Normally STI a. Avoid sex with unknown partner/
are transmitted from person to person during multiple partners
intimate sexual contact with an infected partner. b. use condoms
Infections like Hepatitis-B and HIV are
c. In case of doubt, consult a doctor for
transmitted sexually as well as by sharing
diagnosis and get complete treatment.
According to World Health

Organization (WHO), 2017 TNHSP (Tamilnadu health
more than one million people systems project), a unit
of the Health and family
globally acquires a sexually
welfare department of the
transmitted infection every day. India has the Government of Tamilnadu
third largest HIV epidemic in the world, with does free screening for cervical and
2.1 million people living with HIV. breast cancer.

Table 3.1. STD and their symptoms
Name of the Incubation
Causative agent Symptom
Disease period
Bacterial STI
Affects the urethra, rectum and throat
and in females the cervix also get
Gonorrhoea Neisseria gonorrhoeae affected. 2 to 5 days
Pain and pus discharge in the genital tract
and burning sensation during urination.
Primary stage
Formation of painless ulcer on the
external genitalia.
Secondary stage
Skin lesions, rashes, swollen joints and
fever and hair loss.
Syphilis Treponema palladium 10 to 90 days
Tertiary stage
Appearance of chronic ulcers on nose,
lower legs and palate. Loss of movement,
mental disorder, visual impairment, heart
problems, gummas (soft non-cancerous
growths) etc
Trachoma , affects the cells of the
Chlamydiasis Chlamydia trachomatis columnar epithelium in the urinogenital
tract, respiratory tract and conjunctiva. 2 to 3 weeks
Cutaneous or mucosal genital damage, or upto 6
Lymphogranuloma urithritis and endocervicitis. weeks
Chlamydia trachomatis
venereum Locally harmful ulcerations and genital
elephantiasis.
Viral STI
Sores in and around the vulva, vagina,
urethra in female or sores on or around
the penis in male. 2- 21 days
Genital herpes Herpes simplex virus (average 6
Pain during urination, bleeding
days)
between periods.
Swelling in the groin nodes.
Hard outgrowths (Tumour) on
Human papilloma
Genital warts the external genitalia, cervix and 1-8 months
virus (HPV)
perianal region.
Fatigue, jaundice, fever, rash and
stomach pain.
Hepatitis-B Hepatitis B virus (HBV) 30-80 days
Liver cirrhosis and liver failure occur in
the later stage.
Human Enlarged lymph nodes, prolonged fever, 2 to 6 weeks

AIDS immunodeficiency prolonged diarrhoea, weight reduction, even more
virus (HIV) night sweating. than 10 years.

Name of the Incubation
Causative agent Symptom
Disease period
Fungal STI
Attacks mouth, throat, intestinal tract
and vagina.
Candidiasis Candida albicans Vaginal itching or soreness, abnormal _
vaginal discharge and pain during
urination.
Protozoan STI
Vaginitis , greenish yellow vaginal
discharge, itching and burning
Trichomoniasis Trichomonas vaginalis 4-28 days
sensation, urethritis, epididymitis and
prostatitis
Cervical cancer 3.7. Infertility

Cervical cancer is caused by a sexually Inability to conceive or produce children
transmitted virus called Human Papilloma even after unprotected sexual cohabitation
virus (HPV). HPV may cause abnormal is called infertility. That is, the inability of a
growth of cervical cells or cervical dysplasia. man to produce sufficient numbers or quality
The most common symptoms and signs of of sperm to impregnate a woman or inability
cervical cancer are pelvic pain, increased vaginal of a woman to become pregnant or maintain
discharge and abnormal vaginal bleeding. The a pregnancy.
risk factors for cervical cancer include The causes for infertility are tumours
1. Having multiple sexual partners formed in the pituitary or reproductive organs,
2. Prolonged use of contraceptive pills inherited mutations of genes responsible for the
biosynthesis of sex hormones, malformation
Cervical cancer can be diagnosed by a
of the cervix or fallopian tubes and inadequate
Papanicolaou smear (PAP smear) combined with
nutrition before adulthood. Long-term stress
an HPV test. X-Ray, CT scan, MRI and a PET scan
damages many aspects of health especially the
may also be used to determine the stage of cancer.
menstrual cycle. Ingestion of toxins (heavy
The treatment options for cervical cancer include
metal cadmium), heavy use of alcohol, tobacco
radiation therapy, surgery and chemotherapy.
and marijuana, injuries to the gonads and aging
Modern screening techniques can detect also cause infertility.
precancerous changes in the cervix. Therefore
screening is recommended for women above Other causes of infertility
30 years once in a year. Cervical cancer can • Pelvic inflammatory disease (PID), uterine
be prevented with vaccination. Primary fibroids and endometriosis are the most
prevention begins with HPV vaccination of common causes of infertility in women.
girls aged 9 – 13 years, before they become
• Low body fat or anorexia in women. i.e. a
sexually active. Modification in lifestyle can
psychiatric eating disorder characterised
also help in preventing cervical cancer. Healthy
by the fear of gaining weight.
diet, avoiding tobacco usage, preventing early
• Undescended testes and swollen veins
marriages, practicing monogamy and regular
(varicocoele) in scrotum.
exercise minimize the risk of cervical cancer.

• Tight clothing in men may raise the laboratory. One or more fertilized eggs may be
temperature in the scrotum and affect transferred into the woman’s uterus, where they
sperm production. may implant in the uterine lining and develop.
• Under developed ovaries or testes. Excess embryos may be cryopreserved (frozen)
• Female may develop antibodies against for future use. Initially, IVF was used to treat
her partner's sperm. women with blocked, damaged, or absent
fallopian tubes. Today, IVF is used to treat
• Males may develop an autoimmune
many causes of infertility. The basic steps in an
response to their own sperm.
IVF treatment cycle are ovarian stimulation,
egg retrieval, fertilization, embryo culture, and
All women are born with ovaries, but some embryo transfer.
do not have functional uterus. This condition
is called Mayer-Rokitansky syndrome. Egg retrieval is done by minor surgery
under general anesthesia, using ultrasound
guide after 34 to 37 hours of hCG (human
3.8. Assisted reproductive chorionic gonadotropin) injection. The eggs are
technology (ART) prepared and stripped from the surrounding
A collection of procedures, cells. At the same time, sperm preparation is
which includes the handling done using a special media. After preparing
of gametes and/or embryos the sperms, the eggs are brought together.
outside the body to achieve a 10,000-1,00,000 motile sperms are needed for
pregnancy, is known as Assisted each egg. Then the zygote is allowed to divide to
Reproductive Technology. form 8 celled blastomere and then transferred
It increases the chance of pregnancy in infertile into the uterus for a successful pregnancy.
couples. ART includes intra-uterine insemination The transfer of an embryo with more than
(IUI), in vitro fertilization, (IVF) Embryo 8 blastomeres stage into uterus is called
transfer (ET), Zygote intra-fallopian transfer Embryo transfer technique.
(ZIFT), Gamete intrafallopian transfer (GIFT),
Intra-cytoplasmic sperm injection
(ICSI), Cryopreservation (or
Preimplantation genetic diagnosis, oocyte and freezing) of embryos is
sperm donation and surrogacy. often used when there
are more embryos than
Intra-uterine insemination (IUI) needed for a single IVF
This is a procedure to treat infertile men
transfer. Embryo cryopreservation can
with low sperm count. The semen is collected
provide an additional opportunity for
either from the husband or from a healthy
pregnancy, through a Frozen embryo
donor and is introduced into the uterus through
transfer (FET), without undergoing
the vagina by a catheter after stimulating the
another ovarian stimulation and retrieval.
ovaries to produce more ova. The sperms swim
towards the fallopian tubes to fertilize the egg,
resulting in normal pregnancy.
Zygote intra-fallopian transfer (ZIFT)
As in IVF, the zygote upto 8 blastomere
In vitro fertilization (IVF) or stage is transferred to the fallopian tube by
Test tube baby laparoscopy. The zygote continues its natural
In this technique, sperm and eggs divisions and migrates towards the uterus
are allowed to unite outside the body in a where it gets implanted.

Intra uterine transfer (IUT) 3.9. Detection of foetal disorders
Embryo with more than 8 blastomeres during early pregnancy
is inserted into uterus to complete its further
development. Ultrasound scanning
Ultrasound has no known risks other
Gamete intra-fallopian transfer (GIFT) than mild discomfort due to pressure from
Transfer of an ovum collected from a the transducer on the abdomen or vagina.
donor into the fallopian tube. In this the eggs No radiation is used during this procedure.
are collected from the ovaries and placed Ultrasonography is usually performed in the
with the sperms in one of the fallopian tubes. first trimester for dating, determination of
The zygote travels toward the uterus and gets the number of foetuses, and for assessment
implanted in the inner lining of the uterus. of early pregnancy complications.
Intra-cytoplasmic sperm injection (ICSI) There are several types of ultrasound

In this method only one sperm is injected imaging techniques. As the most common
into the focal point of the egg to fertilize. The type, the 2-D ultrasound provides a flat
sperm is carefully injected into the cytoplasm picture of one aspect of the baby. The 3-D
of the egg. Fertilization occurs in 75 - 85% image allows the health care provider to see
of eggs injected with the sperms. The zygote the width, height and depth of the images,
is allowed to divide to form an 8 celled which can be helpful during the diagnosis.
blastomere and then transferred to the uterus The latest technology is 4-D ultrasound,
to develop a protective pregnancy. which allows the health care provider to
Surrogacy visualize the unborn baby moving in real
Surrogacy is a method of assisted time with a three-dimensional image.
reproduction or agreement whereby a woman
agrees to carry a pregnancy for another person, Amniocentesis
who will become the newborn child's parent Amniocentesis involves taking a small
after birth. Through in vitro fertilization (IVF), sample of the amniotic fluid that surrounds
embryos are created in a lab and are transferred the foetus to diagnose for chromosomal
into the surrogate mother's uterus. abnormalities (Fig. 3.1).
Male infertility prevention

Azoospermia is defined as the absence of Ultrasound
spermatozoa in the ejaculate semen on at least Transducer
two occasions and is observed approximately Amniotic Fluid

in 1% of the population.
Micro-testicular sperm extraction (TESE) Placenta
Microsurgical sperm retrieval from the testicle
Foetus
involves a small midline incision in the scrotum,
Uterus
through which one or both testicles can be seen.
Under the microscope, the seminiferous tubules
are dilated and small amount of testicular tissue
in areas of active sperm production are removed
and improved for sperm yield compared to
traditional biopsy techniques. Fig. 3.1 Amniocentesis

Amniocentesis is generally performed A hand-held doppler device is often used
in a pregnant woman between the 15th and during prenatal visits to count the foetal heart
20th weeks of pregnancy by inserting a long, rate. During labour, continuous electronic
thin needle through the abdomen into the foetal monitoring is often used.
amniotic sac to withdraw a small sample of
amniotic fluid. The amniotic fluid contains
• Vitamin E is known as anti-sterility
cells shed from the foetus.
vitamin as it helps in the normal
functioning of reproductive structures.
Chorionic villus sampling (CVS)
CVS is a prenatal test that involves taking • Sex hormones were discovered by
a sample of the placental tissue to test for Adolf Butenandt.
chromosomal abnormalities.
• 11th July is observed as World
Foetoscope Population Day.
Foetoscope is used to monitor the foetal
• 1st December is observed as World
heart rate and other functions during late
AIDS Day.
pregnancy and labour. The average foetal heart
rate is between 120 and 160 beats per minute. • NACO (National AIDS Control
An abnormal foetal heart rate or pattern may Organisation) was established in 1992.
mean that the foetus is not getting enough
• Syphilis and gonorrhoea are commonly
oxygen and it indicates other problems.
called as international diseases.
BREAST SELF EXAMINATION AND

EARLY DIAGNOSIS OF CANCER
1. Breast is divided Summary
into 4 quadrants Reproductive health refers to a total well-
and the center 1
5
2 being in all aspects of reproduction. Providing
(Nipple) which medical facilities and care to the problems like
is the 5th menstrual irregularities, pregnancy related
quadrant. 3 4
aspects, medical termination of pregnancy, STI,
2. Each quadrant birth control, infertility, post natal child and
of the breast is
maternal management are the important aspect
felt for lumps using the palm of the
opposite hand. of the Reproductive and Child Health Care
programmes.
3. The examination is done in both
lying down and standing positions, An overall improvement in reproductive
monthly once after the 1st week of health has taken place in our country as indicated
menstrual cycle. by reduced maternal and infant mortality rates,
This way if there are lumps or any assistance to infertile couples, etc. Improved health
deviation of the nipple to one side or any facilities and better living conditions promote an
blood discharge from the nipple we can explosive growth of population. Such a growth
identify cancer at an early stage. necessitated intense propagation of contraceptive
Mammograms are done for women above methods. Various contraceptive options are
the age of 40 years and for young girls
available now such as natural, traditional, barrier,
and women below 40 years. Ultrasound
of the breast aids in early diagnosis. IUDs, pills, injectables, implants and surgical
methods. Though contraceptives are not regular

requirements for reproductive health, one is (d) Syphilis, trichomoniasis and
adviced to use them to avoid pregnancy or to pediculosis
delay or space pregnancy. 3. Identify the correct statements from
Diseases or infections transmitted through the following
coitus are called Sexually transmitted infections
(a)Chlamydiasis is a viral disease.
(STIs). Pelvic inflammatory diseases (PIDs), still
birth, infertility are some of the complications (b) Gonorrhoea is caused by a spirochaete
of STDs. Early detection facilitates better cure of bacterium, Treponema palladium.
these diseases. Avoiding coitus with unknown/ (c) The incubation period for syphilis is
multiple partners, use of condoms during coitus is 2 to 14 days in males and 7 to 21
are some of the simple precautions to avoid days in females.
contracting STIs. (d) B oth syphilis and gonorrhoea are
Inability to conceive or produce children even easily cured with antibiotics.
after unprotected sexual cohabitation is called 4. A contraceptive pill prevents ovulation by
infertility. Various methods are now available to
(a) blocking fallopian tube
help such couples. In vitro fertilization followed by
transfer of embryo into the female genital tract is (b) inhibiting release of FSH and LH
one such method. (c) stimulating release of FSH and LH
(d) causing immediate degeneration of
Evaluation released ovum.
1. Which of the following 5. The approach which does not give the
is correct regarding defined action of contraceptive is
HIV, hepatitis B, (a) Hormonal Prevents entry of sperms,
gonorrhoea and contraceptive prevent ovulation and
fertilization
trichomoniasis?
(b) Vasectomy Prevents spermatogenesis
(a) Gonorrhoea is a STD whereas
others are not. (c) Barrier Prevents fertilization
method
(b) Trichomoniasis is a viral disease (d) Intra uterine Increases phagocytosis of
whereas others are bacterial. device sperms, suppresses sperm
motility and fertilizing capacity
(c) HIV is a pathogen whereas others of sperms
are diseases.
6. Read the given statements and select the
(d) Hepatitis B is eradicated completely correct option.
whereas others are not. Statement 1: Diaphragms, cervical caps
2. Which one of the following groups and vaults are made of rubber and are
includes sexually transmitted diseases inserted into the female reproductive
caused by bacteria only? tract to cover the cervix before coitus.
(a) Syphilis, gonorrhoea and candidiasis Statement 2: They are chemical barriers
(b) Syphilis, chlamydiasis and of conception and are reusable.
gonorrhoea (a) B oth statements 1 and 2 are correct
(c) Syphilis, gonorrhoea and and statement 2 is the correct
trichomoniasis explanation of statement 1.

(b) B oth statements 1 and 2 are correct 11. Correct the following statements
but statement 2 is not the correct a) Transfer of an ovum collected from
explanation of statement 1. donor into the fallopian tube is called
(c) Statement 1 is correct but statement ZIFT.
2 is incorrect.
b) Transfering of an embryo with more
(d) Both statements 1 and 2 are incorrect. than 8 blastomeres into uterus is
7. Match column I with column II and select the called GIFT.
correct option from the codes given below.
c) Multiload 375 is a hormone releasing
Column I Column II IUD.
A. Copper releasing IUD (i) LNG-20
12. Which method do you suggest the couple
B. Hormone releasing (ii) Lippes loop IUD to have a baby, if the male partner fails to
C. Non medicated IUD (iii) Saheli inseminate the female or due to very low
D. Mini pills (iv) Multiload-375 sperm count in the ejaculate?
(a) A-(iv), B-(ii), C-(i), D-(iii) 13. Expand the following
(b) A-(iv), B-(i), C-(iii), D-(ii) a) ZIFT b) ICSI
(c) A-(i), B-(iv), C-(ii), D-(iii) 14. What are the strategies to be
(d) A-(iv), B-(i), C-(ii), D-(iii) implemented in India to attain total
reproductive health?
8. Select the incorrect action of hormonal
contraceptive pills from the following 15. Differentiate foeticide and infanticide.
16. Describe the major STDs and their
(a) Inhibition of spermatogenesis.
symptoms.
(b) Inhibition of ovulation.
17. How are STDs transmitted?
(c) Changes in cervical mucus impairing
18. Write the preventive measures of STDs.
its ability to allow passage and
transport of sperms. 19. The procedure of GIFT involves the
transfer of female gametes into the
(d) Alteration in uterine endometrium to
fallopain tube, can gametes be transferred
make it unsuitable for implantation.
to the uterus to achieve the same result?
9. What is amniocentesis? Why a statutory Explain.
ban is imposed on this technique?
20. Amniocentesis, the foetal sex
10. Select the correct term from the bracket determination test, is banned in our
and complete the given branching tree country, Is it necessary? comment.
Periodic abstinence
Natural methods B
Coitus interruptus
21. Open Book Assessment
Condoms, vaults,
A Caps etc ‘Healthy reproduction, legally checked
Birth control
Oral contraceptives Pills birth control measures and proper family
methods
Vasectomy planning programmes are essential for
Surgical methods
C the survival of mankind’ Justify.
IUDs D
(Barriers, Lactational amenorrhoea, CuT,

Tubectomy)

Reproductive Health
Concept Map
46
%,57+&21752/0(7+2'6
7HPSRUDU\ 3HUPDQHQW
PHWKRG 0HWKRG
1DWXUDO %DUULHU ,QWUDXWHULQH

PHWKRG PHWKRG 'HYLFHV 6WHULOLVDWLRQ
,PSODQW(VVXUH
9DJLQDO
&KHPLFDO 0HFKDQLFDO 2UDO +RUPRQDO 5LQJ
3HULRGLF EDUULHU EDUULHU FRQWUDFHSWLYHV EDUULHU
DEVWLQHQFH 7XEHFWRP\
UK\WKP 1RQ
PHWKRG 6XEFXWDQHRXV PHGLFDWHG
&RQGRP
)RDPLQJWDEOHWV ,PSODQWV ,8'V
PHOWLQJVXSSRVLWRULHV 0LQLSLOOV
&RQWLQXRXV MHOOLHVDQGFUHDPV 6DKHOLFHQWFKURPDQ
9DVHFWRP\
DEVWLQHQFH 3URJHVWDVHUW +RUPRQDOUHOHDVLQJ
'LDSKUDJP /1* ,8'V
&RLWXV
LQWHUUXSWXV &X7$
1RYD7&X &RSSHU
&X7$J UHOHDVLQJ,8'V
/DFWDWLRQDO 0XOWLORDG
$PHQRUUKRHD
25-02-2019 18:21:12
4
UNIT - II
Principles of
Inheritance and
Variation
CHAPTER
Drosophila are ideal for the study of genetics

Chapter outline and development
4.1 Multiple alleles
4.2 Human blood groups
4.3 Genetic control of Rh factor
4.4 Sex determination in human, insects and birds
G enetics is a branch of biology that deals
with the study of heredity and variations. It
describes how characteristics and features pass
4.5 Sex linked inheritance on from the parents to their offsprings in each
4.6. Karyotyping successive generation. The unit of heredity is
4.7. Pedigree analysis known as the gene. Gene is the inherited factor
4.8. Mendelian disorders that determines the biological character of an
4.9. Chromosomal abnormalities organism. A variation is the degree by which
4.10. Extra chromosomal inheritance the progeny differs from their parents.
4.11. Eugenics, euphenics and euthenics In this chapter, we are going to learn about
multiple alleles with reference to the human
blood groups, sex determination in man, insects
Learning objectives and birds, sex linked inherited traits, genetic
➢ Learns the inheritance of multiple alleles disorders and extra chromosomal inheritance.
with reference to human blood groups. The betterment of human race can be achieved
➢ Understands the mechanism of sex by methods like eugenics, euthenics and
determination in human euphenics.
beings, insects and birds. 4.1 Multiple alleles
➢ Learns about sex linked (X The genetic segregations in Mendelian
and Y) inherited diseases in inheritance reveal that all genes have two
human beings. alternative forms – dominant and recessive
➢ Understands the Mendelian alleles e.g. tall versus dwarf (T and t). The
disorders and diseases associated with former is the normal allele or wild allele and
chromosomal abnormalities. the latter the mutant allele. A gene can mutate
➢ Gains knowledge on extra chromosomal several times producing several alternative
inheritance. forms. When three or more alleles of a gene
➢ Realises the significance of the applications of that control a particular trait occupy the same
genetics in the improvement of human race. locus on the homologous chromosome of an
organism, they are called multiple alleles and
their inheritance is called multiple allelism.
47
TN_GOVT_XII_Zoology_chapter 4.indd 47 25-02-2019 18:21:56

4.2 Human Blood Groups determines B antigen and IO allele specifies
Multiple allelism occurs in humans, no antigen. Individuals who possess these
particularly in the inheritance of different types antigens in their fluids such as the saliva
of blood groups. The blood group inheritance are called secretors.
in human can be understood by learning about Each allele (IA and IB) produces a
antigens and antibodies. The composition of transferase enzyme. IA allele produces
blood, different types of blood groups (ABO) the N-acetyl galactose transferase and can add
blood antigens and antibodies were discussed N-acetyl galactosamine (NAG) and IB allele
in chapter 7 of class XI. encodes for the enzyme galactose transferase
that adds galactose to the precursor (i.e.
4.2.1 ABO blood types H substances) In the case of IO/IO allele no
Multiple allele inheritance of ABO blood terminal transferase enzyme is produced and
groups therefore called “null” allele and hence cannot
add NAG or galactose to the precursor.
Blood differs chemically from person
to person. When two different incompatible From the phenotypic combinations it is
blood types are mixed, agglutination evident that the alleles IA and IB are dominant
(clumping together) of erythrocytes to IO, but co-dominant to each other (IA=IB).
(RBC) occurs. The basis of these chemical Their dominance hierarchy can be given
differences is due to the presence of antigens as (IA=IB> IO). A child receives one of three
(surface antigens) on the membrane of alleles from each parent, giving rise to six
RBC and epithelial cells. Karl Landsteiner possible genotypes and four possible blood
discovered two kinds of antigens called types (phenotypes). The genotypes are IAIA, IA
antigen ‘A’ and antigen ‘B’ on the surface IO, IBIB, IB IO, IAIB and IO IO.
of RBC’s of human blood. Based on the
presence or absence of these antigens three • Antigens similar
kinds of blood groups, type ‘A’, type ‘B’, and to those found among
type ‘O’ (universal donor)were recognized. human beings have been
The fourth and the rarest blood group ‘AB’ recognized in the blood
(universal recipient) was discovered in 1902 of other organisms.
by two of Landsteiner’s students Von De A-type antigens have been found in
Castelle and Sturli. chimpanzees and in gibbons, A, B and
Bernstein in 1925 discovered that the AB antigen in orangutans.
inheritance of different blood groups in
• New world monkeys (Platyrrhina) and
human beings is determined by a number
lemurs have a substance similar but not
of multiple allelic series. The three
identical with B antigen in humans.
autosomal alleles located on chromosome 9
are concerned with the determination of • Three blood groups have been
blood group in any person. The gene distinguished in cats with a genetic
controlling blood type has been labeled as system similar to those in humans.
‘L’ (after the name of the discoverer, • The secretors (antigens found in the
Landsteiner) or I (from isoagglutination). body fluids) can be detected in tears,
The I gene exists in three allelic forms, IA, I B saliva, urine, semen, gastric juice and
and IO. IA specifies A antigen. I B allele in the milk of animals.
Principles Of Inheritance And Variation 48

Table 4.1 Genetic basis of the human ABO 4.3 Genetic control of Rh factor
blood groups
Antigens Antibodies
Fisher and Race hypothesis:
ABO blood Rh factor involves three different pairs of
present on present
Genotype group
red blood in blood alleles located on three different closely linked
phenotype
cell plasma loci on the chromosome pair. This system is
more commonly in use today, and uses the 'Cde'
IAIA Type A A Anti -B nomenclature.
IAIo Type A A Anti -B C or c C or c
IBIB Type B B Anti -A

D or d D or d
IBIo Type B B Anti -A
Neither E or e E or e
IAIB Type AB A and B Anti
-A nor
Anti-B Fig. 4.1 Fischer and Race hypothesis – Rh
Blood Type - Homologous Chromosome pair
Anti -A (showing 3 loci and 2 alleles per locus)
IoIo Neither
Type O and anti In the above Fig. 4.1, three pairs of Rh
A nor B
-B alleles (Cc, Dd and Ee) occur at 3 different
loci on homologous chromosome pair-1. The
Rhesus or Rh – Factor possible genotypes will be one C or c, one D or
The Rh factor or Rh antigen is found on d, one E or e from each chromosome. For e.g.
the surface of erythrocytes. It was discovered CDE/cde; CdE/cDe; cde/cde; CDe/CdE etc.,
in 1940 by Karl Landsteiner and Alexander All genotypes carrying a dominant ‘D’ allele
Wiener in the blood of rhesus monkey, will produce Rh+positive phenotype and double
Macaca rhesus and later in human beings. recessive genotype ‘dd’ will give rise to Rh-
The term ‘Rh factor’ refers to “immunogenic negative phenotype.
D antigen of the Rh blood group system. An
individual having D antigen are Rh D positive
Wiener Hypothesis
Wiener proposed the existence of eight
(Rh+) and those without D antigen are Rh D
alleles (R1, R2, R0, Rz, r, r1, r11, r y) at a single Rh
negative (Rh-)”. Rhesus factor in the blood
locus. All genotypes carrying a dominant ‘R
is inherited as a dominant trait. Naturally
allele’ (R1, R2 ,R0 ,Rz) will produce Rh+positive’
occurring Anti D antibodies are absent in the
phenotype and double recessive genotypes
plasma of any normal individual. However if
(rr, rr1, rr11, rr y) will give rise to Rh-negative
an Rh- (Rh negative) person is exposed to Rh+
phenotype.
(Rh positive) blood cells (erythrocytes) for
the first time, anti D antibodies are formed
4.3.1 Incompatibility of Rh – Factor –
in the blood of that individual. On the other
Erythroblastosis foetalis
hand, when an Rh positive person receives Rh
Rh incompatability has great significance
negative blood no effect is seen.
in child birth. If a woman is Rh negative and
49 Principles Of Inheritance And Variation

the man is Rh positive, the foetus may be chromosomes determine the sex of the
Rh positive having inherited the factor from individual in dioecious or unisexual
its father. The Rh negative mother becomes organisms. The chromosomes other than the
sensitized by carrying Rh positive foetus within sex chromosomes of an individual are called
her body. Due to damage of blood vessels, autosomes. Sex chromosomes may be similar
during child birth, the mother’s immune (homomorphic) in one sex and dissimilar
system recognizes the Rh antigens and gets (heteromorphic) in the other. Individuals
sensitized. The sensitized mother produces Rh having homomorphic sex chromosomes
antibodies. The antibodies are IgG type which produce only one type of gametes
are small and can cross placenta and enter the (homogametic) whereas heteromorphic
foetal circulation. By the time the mother gets individuals produce two types of gametes
sensitized and produce anti ‘D’ antibodies, the (heterogametic).
child is delivered.
Usually no effects are associated with
Y CHROMOSOME
exposure of the mother to Rh positive antigen
The human Y chromosome
during the first child birth, subsequent Rh
is only 60 Mb in size with
positive children carried by the same mother,
60 functional genes whereas
may be exposed to antibodies produced by
X chromosomes are 165 Mb in size with
the mother against Rh antigen, which are
about 1,000 genes.
carried across the placenta into the foetal
blood circulation. This causes haemolysis of
foetal RBCs resulting in haemolytic jaundice Chromosomal basis of
and anaemia. This condition is known as sex determination
Erythoblastosis foetalis or Haemolytic
disease of the new born (HDN).
Heterogametic Sex
Determination:
Prevention of Eryhroblastosis foetalis In heterogametic sex
If the mother is Rh negative and foetus determination one of the sexes produces
is Rh positive, anti D antibodies should be similar gametes and the other sex produces
administered to the mother at 28th and 34th dissimilar gametes. The sex of the offspring is
week of gestation as a prophylactic measure. determined at the time of fertilization.
If the Rh negative mother delivers Rh
positive child then anti D antibodies should
Heterogametic Males
In this method of sex determination the
be administered to the mother soon after
males are heterogametic producing dissimilar
delivery. This develops passive immunity and
gametes while females are homogametic
prevents the formation of anti D antibodies in
producing similar gametes. It is of two kinds
the mothers blood by destroying the Rh foetal
XX-XO type and XX-XY type.
RBC before the mother’s immune system is
sensitized. This has to be done whenever the
XX-XO Type
woman attains pregnancy.
This method of sex determination is seen
4.4 Sex Determination in bugs, some insects such as cockroaches
Sex determination is the method by and grasshoppers. The female with two X
which the distinction between male and chromosomes are homogametic (XX) while
female is established in a species. Sex the males with only one X chromosome

are heterogametic (XO). The presence of Heterogametic Females
an unpaired X chromosomes determines In this method of sex determination,
the male sex. The males with unpaired ‘X’ the homogametic male possesses two ‘X’
chromosome produce two types of sperms, chromosomes as in certain insects and
one half with X chromosome and other certain vertebrates like fishes, reptiles and
half without X chromosome. The sex of birds producing a single type of gamete; while
the offspring depends upon the sperm that females produce dissimilar gametes. The
fertilizes the egg (Fig. 4.2). female sex consists of a single ‘X’ chromosome
or one ‘X’ and one ‘Y’ chromosome. Thus
the females are heterogametic and produce
P1 AAXX AAXO two types of eggs. To avoid confusion
Gametes AX AX AO with the XX-XO and XX-XY types of sex
determination, the alphabets ‘Z’ and ‘W’ are
used here instead of X and Y respectively.
F1 Generation AAXX AAXO Heterogametic females are of two types,
ZO-ZZ type and ZW-ZZ type.
Fig. 4.2 XX-XO Type of sex determination
ZO-ZZ Type
This method of sex determination is seen
XX-XY type (Lygaeus Type) in certain moths, butterflies and domestic
This method of sex determination is chickens. In this type, the female possesses
seen in human beings and in Drosophila. single ‘Z’ chromosome in its body cells and
The females are homogametic with is heterogametic (ZO) producing two kinds
XX chromosome, while the males are of eggs some with ‘Z’ chromosome and
heterogametic with X and Y chromosome. some without ‘Z’ chromosome, while the
Homogametic females produce only one kind male possesses two ‘Z’ chromosomes and is
of egg, each with one X chromosome, while homogametic (ZZ) (Fig. 4.4).
the heterogametic males produce two kinds of

sperms some with X chromosome and some
P1 AAZO AAZZ
with Y chromosome. The sex of the embryo
depends on the fertilizing sperm. An egg Gametes AZ AO AZ
fertilized by an ‘X’ bearing sperm produces a

female, if fertilized by a ‘Y’ bearing sperm, a F1 Generation AAZZ AAZO
male is produced (Fig. 4.3).

Fig. 4.4 ZO-ZZ type of sex determination
P1 AAXX AAXY
Gametes AX AX AY ZW-ZZ type
This method of sex determination
occurs in certain insects (gypsy moth) and in
F1 Generation AAXX AAXY vertebrates such as fishes, reptiles and birds.
In this method the female has one ‘Z’ and one
‘W’ chromosome (ZW) producing two types of
Fig. 4.3 XX-XY Type of sex determination eggs, some carrying the Z chromosomes and
some carry the W chromosome. The male sex

has two ‘Z’ chromosomes and is homogametic potential genetic function; some genes with
(ZZ) producing a single type of sperm (Fig .4.5). or without homologous counterparts are
seen on the X. Present at both ends of the Y
chromosome are the pseudoautosomal regions
(PARs) that are similar with regions on the X
P1 AAZW AAZZ
chromosome which synapse and recombine
Gametes AZ AW AZ
during meiosis. The remaining 95% of the Y
chromosome is referred as the Non - combining
F1 Generation AAZZ AAZW Region of the Y (NRY). The NRY is divided
equally into functional genes (euchromatic)
and non functional genes (heterochromatic).
Fig. 4.5 ZW-ZZ type of sex determination
Within the euchromatin regions, is a gene
called Sex determining region Y (SRY). In
Sex determintion in human beings
humans, absence of Y chromosome inevitably
Genes determining sex in human beings are
leads to female development and this SRY gene
located on two sex chromosomes, called
is absent in X chromosome. The gene product
allosomes. In mammals, sex determination is
of SRY is the testes determining factor (TDF)
associated with chromosomal differences
present in the adult male testis.
between the two sexes, typically XX females and
XY males. 23 pairs of human chromosomes
include 22 pairs of autosomes (44A) and one pair 4.4.1 Genic balance in Drosophila
of sex chromosomes (XX or XY). Females are Genic balance mechanisms of sex
homogametic producing only one type of determination in Drosophila was first studied
gametes (egg), each containing one X by C.B. Bridges. In Drosophila, the presence
chromosome while the males are heterogametic of Y chromosome is essential for the fertility
producing two types of sperms with X and Y of male sex, but does not determine the male
chromosomes. An independently evolved XX: sex. The gene for femaleness is located on the
XY system of sex chromosomes also exist in X chromosome and those for maleness are
Drosophila. (Fig. 4.6). located on the autosomes. When geneticist
C.B. Bridges, working with Drosophila, crossed
Male Female
(Heterogametic) (Homogametic) a triploid (3n) female with a normal male, he
Parents 44A + XY 44A + XX observed many combinations of autosomes
Gametes Sperms Ova and sex chromosomes in the offspring. From
(22A+X) (22A+Y) (22A+X) (22A+X) his results Bridges in 1921 suggested that sex
in Drosophila is determined by the balance
between the genes for femaleness located on
the ‘X’ chromosomes and those for maleness
Offsprings/ located on the ‘autosomes’ . Hence the sex
Progeny (44A+XX) (44A+XY) (44A+XX) (44A+XY) of an individual is determined by the ratio
Female Male Female Male
of its X chromosome to that of its autosome
Fig. 4.6 Sex determination in human beings sets. This ratio is termed sex index and is
expressed as:
The Y Chromosome and Male
Development Number of X Chromosomes X
Current analysis of Y chromosomes has Sex index =
Number of Sets of Autosomes A
revealed numerous genes and regions with

Change in this ratio leads to a changed sex When the X : A ratio is 1.00 as in a normal
phenotype. The results obtained from a cross female, or greater than 1.00, the organism is a
between triploid female Drosophila (3A:3X) female. When this ratio is 0.50 as in a normal
with a diploid male (2A: XY) is shown in tables male or less than 0.50 the organism is a male.
4.2. and 4.3. At 0.67, the organism is an intersex. metamales
Table: 4.2 Bridges classical cross of a triploid (X/A = 0.33) and metafemales (X/A=1.50) are
(3A+XXX) female fly and a diploid (2A+XY) usually very weak and sterile.
male fly A sex–switch gene in Drosophila directs
female development. This gene, sex–lethal
Triploid Diploid (SxL) located on the X chromosome, has
Parent 3A + XXX 2A + XY two states of activity. When it is ‘on’ it directs
Gametes (2A + XX) (A + X) (A + X) (A + Y) female development and when it is ‘off ’
(2A + X) (A + XX) maleness ensures. Other genes located on the X
chromosome and autosomes regulate this sex-
A+X A+Y switch gene. However, the Y- chromosome of
2A+XX 3A + XXX 3A + XXY Drosophila is required for male fertility.
Triploid Female Triploid Intersex
3A + XX 3A + XY
2A+X Triploid Intersex Super Male • X-Chromosome was discovered by
2A + XXX 2A + XXY Henking (1891)
A+XX Super female Diploid Female
• Y-Chromosome was discovered by
2A + XX 2A + XY Stevens (1902)
A+X Diploid Female Diploid Male
Table: 4.3 Different doses of X chromosomes and autosome sets and their effect on sex
determination in Drosophila
Number of X
Number of chromosome
Number of ‘X’
Phenotype Autosome sets Sex Index =
Chromosomes (X) Number of
(A)
autosome sets
Meta female / Super female 3 2 3/2 = 1.5

Tetraploid 4 4 4/4 = 1.0
Normal
Triploid 3 3 3/3 = 1.0
Female
Diploid 2 2 2/2 = 1.0
Haploid 1 1 1/1 = 1.0
Inter sex 2 3 2/3 = 0.67
Normal male 1 2
½ = 0.50
Meta male / Super male 1 3 1/3 = 0.33

Gynandromorphs of sex determination is common. In this system,
These individuals have parts of their the sex of the offspring is determined by the
body expressing male characters and other number of sets of chromosomes it receives.
parts of the body expressing female characters. Fertilized eggs develop into females (Queen
The organism is made up of tissues of male or Worker) and unfertilized eggs develop into
and female genotype and represents a mosaic males (drones) by parthenogenesis. It means that
pattern. the males have half the number of chromosomes
(haploid) and the females have double the
4.4.2 Dosage compensation - number (diploid), hence the name haplodiplody
Barr body for this system of sex determination.
In 1949, Barr and Bertram first observed a This mode of sex determination facilitates
condensed body in the nerve cells of female cat the evolution of sociality in which only one
which was absent in the male. This condensed diploid female becomes a queen and lays the
body was called sex chromatin by them and eggs for the colony. All other females which are
was later referred as Barr body. In the XY diploid having developed from fertilized eggs
chromosomal system of sex determination, help to raise the queen’s eggs and so contribute
males have only one X chromosome, whereas to the queen’s reproductive success and
females have two. A question arises: how indirectly to their own, a phenomenon known
does the organism compensate for this dosage as Kin Selection. The queen constructs their
differences between the sexes? In mammals the social environment by releasing a hormone that
necessary dosage compensation is accomplished suppresses fertility of the workers.
by the inactivation of one of the X chromosome
in females so that both males and females have 4.5 Sex Linked Inheritance
only one functional X chromosome per cell. The inheritance of a
trait that is determined by
Mary Lyon suggested that Barr bodies
a gene located on one of the
represented an inactive chromosome, which
sex chromosomes is called
in females becomes tightly coiled into a
sex linked inheritance.
heterochromatin, a condensed and visible form
Genes present on the
of chromatin (Lyon’s hypothesis). The number
differential region of X or Y chromosomes are
of Barr bodies observed in cell was one less than
called sex linked genes. The genes present in
the number of X-Chromosome. XO females
the differential region of “X” chromosome are
have no Barr body, whereas XXY males have
called X linked genes. The X–linked genes have
one Barr body.
no corresponding alleles in the Y chromosome.
The genes present in the differential region
• The number of Barr bodies follows
of Y chromosome are called Y- linked or
N-1 rule (N minus one rule), where N
holandric genes. The Y linked genes have no
is the total number of X chromosomes
corresponding allele in X chromosome. The Y
present.
linked genes inherit along with Y chromosome
and they phenotypically express only in the
Haplodiploidy in Honeybees male sex. Sex linked inherited traits are more
In hymenopteran insects such as common in males than females because,
honeybees, ants and wasps a mechanism of sex males are hemizygous and therefore express
determination called haplodiploidy mechanism the trait when they inherit one mutant allele.

The X – linked and Y – linked genes in the normal visioned male and female individuals
differential region (non–homologus region) in F1 generation but the females are carriers.
do not undergo pairing or crossing over during The marriage between a F1 normal visioned
meiosis. The inheritance of X or Y linked genes carrier woman and a normal visioned male
is called sex-linked inheritance. will produce one normal visioned female, one
carrier female, one normal visioned male and
4.5.1 Inheritance of X - linked genes one colour blind male. Colour blind trait is
Red-green colour blindness or daltonism, inherited from the male parent to his grandson
haemophilia and Duchenne’s muscular dystrophy through carrier daughter, which is an example
are examples of X-linked gene inheritance in of criss-cross pattern of inheritance (Fig. 4.7).
humans.
;; ; ;F<
1. Haemophilia 3DUHQW 1RUPDOIHPDOH &RORXUEOLQGPDOH
Haemophilia is commonly known as
bleeder’s disease, which is more common in *DPHWHV
; ; ;F <
men than women. This hereditary disease
was first reported by John Cotto in 1803.
Haemophilia is caused by a recessive X-linked
gene. A person with a recessive gene for ) ;;F ;<
haemophilia lacks a normal clotting substance 1RUPDOEXWFDUULHU 1RUPDOPDOH
(thromboplastin) in blood, hence minor IHPDOH
injuries cause continuous bleeding, leading to ;;F ; ;<

death. The females are carriers of the disease *DPHWHV ; ;F ; <
and would transmit the disease to 50% of
their sons even if the male parent is normal.
Haemophilia follows the characteristic criss -
;; ;< ;F; ;F<
cross pattern of inheritance. 1RUPDO 1RUPDO 1RUPDOEXW &RORXUEOLQG
IHPDOH PDOH FDUULHUIHPDOH PDOH
1RUPDOYLVLRQFDUULHUFRORXUEOLQG
2. Colour blindness
In human beings a dominant X – linked Fig. 4.7 Marriage between colour blind
gene is necessary for the formation of colour man and normal visioned woman
sensitive cells, the cones. The recessive form
of this gene is incapable of producing colour ii) Marriage between normal visioned man
sensitive cone cells. Homozygous recessive and colour blind woman
females (XcXc) and hemizygous recessive males If a colour blind woman (XcXc) marries
(XcY) are unable to distinguish red and green a normal visioned male (X+Y), all F1 sons will
colour. The inheritance of colour blindness be colourblind and daughters will be normal
can be studied in the following two types of visioned but are carriers.
marriages.
Marriage between F1 carrier female with a
(i) arriage between colour blind man
M colour blind male will produce normal visioned
and normal visioned woman carrier daughter, colourblind daughter, normal
A marriage between a colour blind man visioned son and a colourblind son in the
and a normal visioned woman will produce F2 generation (Fig. 4.8).

;F;F ; ;< The individual chromosomes are cut from the
3DUHQW &RORXUEOLQGIHPDOH 1RUPDOPDOH
photograph and are arranged in an orderly
fashion in homologous pairs. This arrangement
;F ;F ; <
*DPHWHV
is called a karyotype. Chromosome banding
permits structural definitions and differentiation
of chromosomes.
) ;F; ;F<
Applications of Karyotyping:
1RUPDOEXWFDUULHU &RORXUEOLQGPDOH
IHPDOH ;F< • It helps in gender identification.
;F;
• It is used to detect the chromosomal
*DPHWHV ;
;F
; F
< aberrations like deletion, duplication,
translocation, nondisjunction of
chromosomes.
) ;F; ;< ;F;F ;F< • It helps to identify the abnormalities of
1RUPDOEXW 1RUPDO &RORXUEOLQG &RORXUEOLQG
FDUULHUIHPDOH PDOH IHPDOH PDOH chromosomes like aneuploidy.
Fig. 4.8 Marriage between normal visioned • It is also used in predicting the evolutionary
man and colour blind woman relationships between species.
• Genetic diseases in human beings can be
4.5.2 Inheritance of Y- linked genes
detected by this technique.
Genes in the non-homologous region
of the Y-chromosome are inherited directly
from male to male. In humans, the Y-linked or
Human Karyotype
Depending upon the position of the
holandric genes for hypertrichosis (excessive
centromere and relative length of two arms,
development of hairs on pinna of the ear) are
human chromosomes are of three types:
transmitted directly from father to son, because
Metacentric, sub metacentric and acrocentric.
males inherit the Y chromosome from the
The photograph of chromosomes are arranged
father. Female inherits only X chromosome
in the order of descending length in groups
from the father and are not affected.
from A to G (Fig. 4.9).
4.6 Karyotyping
Karyotyping is a technique through which
a complete set of chromosomes is separated
from a cell and the chromosomes are arranged
in pairs. An idiogram refers to a diagrammatic $ %
representation of chromosomes.

Preparation of Karyotype &
Tjio and Levan (1960) described a simple

method of culturing lymphocytes from the ' (
human blood. Mitosis is induced followed by
addition of colchicine to arrest cell division ; <
* & *
at metaphase stage and the suitable spread of )
)LJ+XPDQNDU\RW\SHPDOH
metaphase chromosomes is photographed.
Fig. 4.9 - Human karyotype (male)

4.7 Pedigree Analysis a single gene to the addition or subtraction
Pedigree is a “family tree”, drawn with of an entire chromosome or even a set of
standard genetic symbols, showing the chromosomes. Genetic disorders are of two types
inheritance pathway for specific phenotypic namely, Mendelian disorders and chromosomal
characters.(Fig. 4.10). Pedigree analysis is the disorders.
study of traits as they have appeared in a given
family line for several past generations.
4.8 Mendelian disorders
Alteration or
mutation in a single
gene causes Mendelian
disorders. These disorders
are transmitted to the
offsprings on the same
line as the Mendelian
pattern of inheritance.
Some examples for
Mendelian disorders are
Thalassemia, albinism,
phenylketonuria,
sickle cell anaemia,
Huntington's chorea, etc.,
These disorders may be
dominant or recessive and
autosomal or sex linked.
Thalassemia
Thalassemia is an
autosomal recessive
disorder. It is caused by
gene mutation resulting
in excessive destruction
of RBC’s due to the
formation of abnormal
haemoglobin molecules.
Normally haemoglobin
is composed of four
Fig. 4.10 Symbols commonly used in pedigree charts polypeptide chains, two
alpha and two beta globin
Genetic Disorders chains. Thalassemia patients have defects in
A genetic disorder is a either the alpha or beta globin chain causing
disease or syndrome that is the production of abnormal haemoglobin
caused by an abnormality molecules resulting in anaemia.
in an individual DNA.
Thalassemia is classified into alpha and beta
Abnormalities can range
based on which chain of haemoglobin molecule
from a small mutation in
is affected. It is controlled by two closely linked

genes HBA1 and HBA2 on chromosome 16. Huntington’s chorea
Mutation or deletion of one or more of the four It is inherited as an autosomal dominant
alpha gene alleles causes Alpha Thalassemia. lethal gene in man. It is characterized by
In Beta Thalassemia, production of beta globin involuntary jerking of the body and progressive
chain is affected. It is controlled by a single degeneration of the nervous system,
gene (HBB) on chromosome 11. It is the most accompanied by gradual mental and physical
common type of Thalassemia and is also known deterioration. The patients with this disease
as Cooley’s anaemia. In this disorder the alpha usually die between the age of 35 and 40.
chain production is increased and damages the
membranes of RBC. 4.9 Chromosomal Abnormalities
Each human diploid (2n) body cell has
Phenylketonuria 46 chromosomes (23 pairs). Chromosomal
It is an inborn error of Phenylalanine disorders are caused by errors in the number
metabolism caused due to a pair of autosomal or structure of chromosomes. Chromosomal
recessive genes. It is caused due to mutation anomalies usually occur when there is an
in the gene PAH (phenylalanine hydroxylase error in cell division. Failure of chromatids
gene) located on chromosome 12 for the hepatic to segregate during cell division resulting in
enzyme “phenylalanine hydroxylase” This enzyme the gain or loss of one or more chromosomes
is essential for the conversion of phenylalanine to is called aneuploidy. It is caused by non-
tyrosine. Affected individual lacks this enzyme, disjunction of chromosomes. Group of
so phenylalanine accumulates and gets converted signs and symptoms that occur together and
to phenylpyruvic acid and other derivatives. It is characterize a particular abnormality is called
characterized by severe mental retardation, light a syndrome. In humans, Down’s syndrome,
pigmentation of skin and hair. Phenylpyruvic acid Turner’s syndrome, Klinefelter's syndrome,
is excreted in the urine. Patau’s syndrome are some of the examples of

phenylalanine chromosomal disorders.
Phenylalanine hydroxylase Tyrosine

a. Autosomal
aneuploidy in human
beings
Albinism Several autosomal aneuploidies have been
Albinism is an inborn error of metabolism, reported in human beings. eg. Down’s syndrome
caused due to an autosomal recessive gene. (21-Trisomy), Patau’s syndrome (13-Trisomy).
Melanin pigment is responsible for skin colour.
Absence of melanin results in a condition called 1. Down’s Syndrome/Trisomy – 21
albinism. A person with the recessive allele Trisomic condition of chromosome - 21
lacks the tyrosinase enzyme system, which is results in Down’s syndrome. It is characterized by
required for the conversion of dihydroxyphenyl severe mental retardation, defective development
alanine (DOPA) into melanin pigment inside of the central nervous system, increased separation
the melanocytes. In an albino, melanocytes are between the eyes, flattened nose, ears are malformed,
present in normal numbers in their skin, hair, mouth is constantly open and the tongue protrudes.
iris, etc., , but lack melanin pigment.
2. Patau’s Syndrome/Trisomy-13
3, 4 dihydroxy
Melanin Trisomic condition of chromosome 13
phenylalanine
results in Patau’s syndrome. Meiotic non
(DOPA)

disjunction is thought to be the cause for this do not reveal Mendelian pattern of inheritance.
chromosomal abnormality. It is characterized The inheritance of the extra chromosomal genes
by multiple and severe body malformations as are found to exhibit maternal influence. Maternal
well as profound mental deficiency. Small head effect is due to the asymmetric contribution
with small eyes, cleft palate, malformation of of the female parent to the development of
the brain and internal organs are some of the zygote. Although both male and female parents
symptoms of this syndrome. contribute equally to the zygote in terms of
chromosomal genes, the female parent usually
b. Allosomal
abnormalities in human contributes the zygote’s initial cytoplasm and
beings organelles, since the sperms contain very little
Mitotic or meiotic non-disjunction of sex cytoplasm. If there are hereditary units in the
chromosomes causes allosomal abnormalities. cytoplasm, these will be transmitted to the
Several sex chromosomal abnormalities have offsprings through the egg, so the offsprings
been detected. Eg. Klinefelter’s syndrome and exhibit maternal effect.
Turner’s syndrome.
The cytoplasmic extranuclear genes
1. Klinefelter's Syndrome (XXY Males) have a characteristic pattern of inheritance
This genetic disorder is due to the presence which do not resemble the genes of nuclear
of an additional copy of the X chromosome chromosomes and is known as extra
resulting in a karyotype of 47,XXY. Persons chromosomal or extra nuclear or cytoplasmic
with this syndrome have 47 chromosomes inheritance and exhibit maternal influence.
(44AA+XXY). They are usually sterile males, In extra nuclear inheritance, male and female
tall, obese, with long limbs, high pitched voice, parents contribute equally their nuclear
under developed genitalia and have feeble breast genes to the progeny but do not make equal
(gynaecomastia) development. contribution of extra chromosomal genes
hence, the crosses can yield different (or) non
2. Turner’s Syndrome (XO Females)
Mendelian results. Cytoplasmic inheritance
This genetic disorder is due to the loss in animals can be studied with reference to
of a X chromosome resulting in a karyotype shell coiling in Limnaea and kappa particles in
of 45,X. Persons with this syndrome have Paramecium.
45 chromosomes (44 autosomes and one X
chromosome) (44AA+XO) and are sterile 1. Shell coiling in Limnaea
females. Low stature, webbed neck, under Limnaea peregra is a freshwater snail.
developed breast, rudimentary gonads lack of The shell of these animals are spirally coiled.
menstrual cycle during puberty, are the main The coiling of the shell is clockwise (dextral)
symptoms of this syndrome. or anticlockwise (sinistral). Both type of
coilings are produced by two different types
4.10 Extra chromosomal / of genetically controlled cleavages namely,
cytoplasmic inheritance dextral cleavage and sinistral cleavage.
Certain characters In Limnaea, dextral coiling is normal
are controlled by non- and sinistral coiling is a mutant character.
nuclear genomes found in Direction of coiling is determined by a pair
chloroplast, mitochondria, of nuclear genes, D(dextral) and d (sinistral).
infective agents and The gene for dextral (D) being dominant over
plasmids. These characters

sinistral coiling (d). In Fig.4.11 a dextral snail maturation division of the oocyte nucleus and
provides the eggs and a sinistral snail provides by the influence of the maternal genotype.
the sperm. The offsprings are all dextral (Dd), The direction of coiling of the shell depends
in the F1 generation. upon the orientation of the mitotic spindle
When the F1 heterozygous dextral during the first cleavage. Obviously, maternal
individual (Dd) were self crossed the F2 control affects only one generation. In each
generation showed dextral coiling with generation the coiling is dependent on the
genotype of 1DD, 2Dd and 1dd (Fig-4.11 left). maternal genotype.
When a reciprocal cross is made (Fig. 2. Kappa particles in Paramecium

4.11-right) The F1 individuals have Dd Sonneborn and his associates have
genotype but are coiled sinistrally, as in the reported the transmission of the cytoplasmic
female parent. In both the crosses the F1 are kappa particles in Paramecium aurelia. The
phenotypically similar to the female parent, kappa particles are cytoplasmic symbionts
though the offsprings in both crosses have occurring in some strains of the ciliated
the same genotype Dd. This is because the Paramecium. The strains possessing the kappa
genotype of the maternal parent determines particles are known as “killer Paramecia”.
the phenotype of the offspring.
3 dextral: 1 sinistral
Fig. 4.11 Shell coiling in Limnaea
When the F1 sinistral individuals were self The kappa liberates a toxin, paramecin
crossed, the shell coiling in the F2 generation, which is lethal to other individuals called
were all dextral (Fig-4.11 right). This is because “sensitives”.
the genes do not segregate in the F2 generation. Kappa particles appear to be either
Only in the F3 generation segregation occurs in parasites or more possible symbionts since
the ratio of 3 dextral : 1 sinistral. they do not harm their hosts. A killer
Why does this pattern occur? The type Paramecium may contain hundreds of kappa
of cleavage depends on the organization particles which have their own DNA and
of the egg which is established before the which in turn are dependent on a dominant

gene ‘K’ for its presence in the killer confirms that the killer trait is determind
Paramecia. Paramecia with nuclear genotype cytoplasmically. Dominant chromosomal genes
“kk” are unable to produce kappa particles. (KK) are required to maintain the cytoplasmic
The inheritance of killer trait does not follow kappa particles. Without a dominant gene this
the Mendelian pattern of inheritanc. particle would disappear from the cytoplasm
When a killer Paramecium KK conjugates of the host.
with sensitive ”kk”, the exconjugants are all The kappa appears to be a bacterium,
heterozygous for Kk genes. The Kk genotype Caedobacter taeniospiralis that has its own
suggest that both exconjugants should be DNA and replicates autonomously. Kappa
killers. But this is not seen. If conjugation particle occurs in atleast two forms; N and B
lasts only for a short period of time, there is forms. The N form is the infective form that
no exchange of cytoplasm between the two passes from one Paremicium to another and
Paramecia resulting in both killers (Kk) and confers the killer specificity to the host cell.
sensitives. However prolonged conjugation The “N” form is attacked by a bacteriophage
permits mixing of cytoplasm of both the that induces the formation of inculsions
conjugants resulting in killers only. This called “R” bodies, inside the kappa particles
Killer Sensitive Killer Sensitive
Kappa
particles
KK kk KK kk
genotype conjugation genotype Rare
conjugation
Ex-conjugants
Kk Kk Kk Kk
Fission
Fission
KK or Kk kk KK or Kk KK or Kk
Killers Sensitives Killers Killers
Fig .4.12 Kappa particles in Paramecium


and convert it to the “B” form. These “R” (ii) Negative eugenics
bodies are visible under the light microscope Negative Eugenics attempts to eliminate the
as refractile bodies. In the “B” form, kappa defective germplasm of the society by adopting
can no longer replicate, it is offen lysed within the following measures:
the cell, however, it confers killer specificity
(i) Sexual
separation of the defectives
on the host cell. Whether viral DNA or kappa
DNA codes the toxin paramecin is not known (ii) Sterilization of the defectives
at present. (iii) Control of immigration and
(iv) Regulation of marriages
4.11 Eugenics, Euphenics And
Euthenics Euphenics
The symptomatic treatment of genetic
Eugenics disease of man is called Euphenics or Medical
Application of the laws of genetics for engineering. In 1960 Joshua Lederberg coined
the improvement of human race is called the term Euphenics. It means normal appearing.
eugenics. The term eugenics means “well It deals with the control of several inherited
born” and was coined by Francis Galton in human diseases especially the inborn errors of
1885. For the betterment of future generations metabolism. Eg. Phenylketonuria (PKU)
it is necessary to increase the population
of outstanding people and to decrease the Euthenics
population of abnormal and defective people The science of improvement of existing
by applying the principles of eugenics. human race by improving the environmental
Two methods of Eugenics conditions is called euthenics. It can be
achieved by subjecting them to better nutrition,
(i) Constructive method or Positive eugenics
better unpolluted ecological conditions, better
(ii) Restrictive method or Negative eugenics education and sufficient medical facilities.
(i) Positive eugenics Summary

Positive eugenics attempts to increase
Genetics is a branch of biology that deals
consistently better or desirable germplasm
with the study of heredity and variation. It
and to preserve the best germplasm of the
describes how characteristics and features
society. The desirable traits can be increased by
pass on from the parents to their offsprings in
adopting the following measures:
successive generations. Variation is the degree by
(i)
Early marriage of those having which progeny differ from their parents. A set of
desirable traits three or more alleles of the same gene occupying
(ii) Subsiding the fit and establishing sperm the same locus in a given pair of homologous
and egg banks of precious germplasm chromosomes controlling a particular trait is
(iii)
Educating the basic principles of called Multiple allele. ABO blood grouping in
genetics and eugenics man is a good example for multiple allelism.
(iv)
Improvement of environmental Apart from A and B antigens, the RBC’s of
conditions humans contain a special type of antigen called
Rh antigen/Rh factors. Erythroblastosis foetalis,
(v) Promotion of genetic research
also called haemolytic disease of the newborn,
in which the red blood cells of a foetus are
destroyed due to maternal immune reaction

resulting from a blood group incompatibility The cytoplasmic extra nuclear genes have a
between the foetus and the mother. characteristic pattern of inheritance which does
not resemble genes of nuclear chromosomes
The mechanism of determination of male
and are known as Extrachromosomal/
and female individuals in a species is called sex
Cytoplasmic inheritance. The betterment of
determination. The chromosomes are different
human race can be achieved by methods like
in two sexes and referred to as allosomes; the
Eugenics, Euthenics and Euphenics.
remaining chromosomes are named autosomes.
In human beings a normal female has 22 pairs of Evaluation
autosomes and a pair of sex chromosomes (44A
+ XX) and a male has 22 pairs of autosomes and 1. Haemophilia is more
a pair of sex chromosomes (44A + XY). In birds, common in males
reptiles and some fishes, sex chromosomes are because it is a
a) Recessive character
ZZ in males and ZW in females. In moths and
carried by
butterflies, sex chromosomes are represented
Y-chromosome
as ZZ in males and ZO in females. Sex in
Drosophila is determined polygenically. The sex b) D
ominant character carried by
of an individual depends upon the ratio of X Y-chromosome
chromosomes to autosome sets. The inheritance c) D
ominant trait carried by
of a trait that is determined by a gene located on X-chromosome
one of the sex chromosomes is called sex linked d) R
ecessive trait carried by
inheritance. Haemophilia, colourblindness, X-chromosome
muscular dystrophy are some examples for X 2. ABO blood group in man is controlled by
linked inheritance in human beings.
a) Multiple alleles
Pedigree analysis is the study of traits as b) Lethal genes
they have appeared in a given family line for
c) Sex linked genes
several generations. The genetic disorders are
of two types- Mendelian and chromosomal. d) Y-linked genes
Alternations or mutation in single gene causes 3. Three children of a family have blood
Mendelian disorders like, thalassemia, albinism, groups A, AB and B. What could be the
phenylketonuria, and Huntington’s chorea. genotypes of their parents?
Chromosomal abnormalities arise due to a) IA IB and ii b) IA Io and IBIo
chromosomal non-disjunction, translocation, c) IB IB and IA IA d) IA IA and ii
deletion, duplication and inversion. Downs
4. Which of the following is not correct?
syndrome, Klinefelter’s syndrome, Turner’s
syndrome and Patau’s syndrome are some of the a) T
hree or more alleles of a trait in the
chromosomal disorders. Downs syndrome is population are called multiple alleles.
due to trisomy of chromosome 21. Presence of b) A
normal gene undergoes mutations
trisomic condition of chromosome 13 results in to form many alleles
Patau’s syndrome. In Turner’s syndrome the sex c) M
ultiple alleles map at different loci
chromosome is XO and in Klinefelter’s syndrome of a chromosome
the condition is XXY. An idiogram refers to a d) A
diploid organism has only two
diagrammatic representation of chromosomes. alleles out of many in the population

5. Which of the following phenotypes in the 11. In an accident there is great loss of
progeny are possible from the parental blood and there is no time to analyse the
combination AxB? blood group which blood can be safely
a) A and B only transferred?
b) A,B and AB only a) ‘O’ and Rh negative
c) AB only b) ‘O’ and Rh positive
d) A,B,AB and O
c)’B’ and Rh negative
6. Which of the following phenotypes is not
d) ‘AB’ and Rh positive
possible in the progeny of the parental
genotypic combination IAIO X IAIB? 12. Father of a child is colourblind and
mother is carrier for colourblindness, the
a) AB b) O
probability of the child being colourblind
c) A d) B
is
7. Which of the following is true about
a) 25% b) 50%
Rh factor in the offspring of a parental
c) 100% d) 75%
combination DdXDd (both Rh positive)?
13. A marriage between a colourblind man
a) All will be Rh-positive
and a normal woman produces
b) Half will be Rh positive
c) About ¾ will be Rh negative a)
All carrier daughters and normal
d) About one fourth will be Rh sons
negative b) 50% carrier daughters, 50% normal
8. What can be the blood group of offspring daughters
when both parents have AB blood group? c)
50% colourblind sons, 50% normal
a) AB only b) A, B and AB sons
c) A, B, AB and O d) A and B only d) All carrier offsprings
9. If the childs blood group is ‘O’ and fathers 14. Mangolism is a genetic disorder which
blood group is ‘A’ and mother’s blood is caused by the presence of an extra
group is ‘B’ the genotype of the parents chromosome number
will be
a) 20 b) 21
a) I I and I I b) I I and I I
A A B o A o B o
c) 4 d) 23
c) IA Io and IoIo d) IoIo and IB IB
15. Klinefelters’ syndrome is characterized by
10. XO type of sex determination and XY type a karyotype of
of sex determination are examples of
a) XYY b) XO
a) Male heterogamety c) XXX d) XXY
b) Female heterogamety
16. Females with Turners’ syndrome have
c) Male homogamety
d) Both (b) and (c) a) Small uterus
b) Rudimentary ovaries
c) Underdeveloped breasts
d) All of these

17. Pataus’ syndrome is also referred to as 25. What is haplodiploidy?
a) 13-Trisomy b) 18-Trisormy 26. Distinguish between heterogametic and
c) 21-Trisormy d) None of these homogametic sex determination systems.
18. Who is the founder of Modern Eugenics 27. What is Lyonisation?
movement? 28. What is criss-cross inheritance?
a) Mendel b) Darwin 29. Why are sex linked recessive characters
c) Francis Galton d) Karl pearson more common in the male human beings?
19. Improvement of human race by 30. What are holandric genes?
encouraging the healthy persons to marry
early and produce large number of children 31. Mention the symptoms of Phenylketonuria.
is called 32. Mention the symptoms of Downs
a) Positive eugenics syndrome.
b) Negative eugenics 33. Differentiate Intersexes from Supersexes.
c) Positive euthenics
d) Positive euphenics 34. Explain the genetic basis of ABO blood
grouping man.
20. The _______deals with the control
of several inherited human diseases 35. How is sex determined in human beings?
especially inborn errors of metabolism 36. Explain male heterogamety.
a) Euphenics b) Eugenics 37. Brief about female heterogamety.
c) Euthenics d) All of these
38. Give an account of genetic control of Rh
21. “Universal Donor” and “Universal factor.
Recipients” blood group are _____
and_______respectively 39. Explain the mode of sex determination in
honeybees.
a) AB, O b) O, AB
c) A, B d) B, A 40. Discuss the genic balance mechanism
22. ZW-ZZ system of sex determination of sex determination with reference to
occurs in Drosophila.
a) Fishes b) Reptiles 41. What are the applications of Karyotyping?
c) Birds d) All of these 42. Explain the inheritance of sex linked
23. Co-dominant blood group is characters in human being.
a) A b) AB 43. What is extra chromosomal inheritance?
c) B d) O Explain with an example.
24. Which of the following is incorrect 44. Comment on the methods of Eugenics.
regarding ZW-ZZ type of sex
determination?
a) I t occurs in birds and some reptiles
b) Females are homogametic and
males are heterogametic
c) Male produce two types of gametes
d) It occurs in gypsy moth

Concept Map
6LPSOH
0XOWLSOHDOOHOHV GRPLQDQFH
(J$%2EORRG
JURXSLQJLQ
KXPDQEHLQJ &RGRPLQDQFH
;OLQNHG(J
+DHPRSKLOLD
&RORXUEOLQGQHVV
6H[OLQNHG
,QKHULWDQFH <OLQNHG(J
+\SHUWULFKRVLV
.DU\RW\SLQJ 3HGLJUHHDQDO\VLV
([WUD
FKURPRVRPDO
&\WRSODVPLF
LQKHULWDQFH
(J.DSSD
SDUWLFOHV
LQSDUDPLFLXP
6KHOOFRLOLQJLQ
VQDLOV
;;)HPDOH;20DOH
3ULQFLSOHVRI (J%XJVFRFNURDFKHV
*UDVVKRSSHUV
LQKHULWDQFH
DQGYDULDWLRQ 0DOH
KHWHURJDPHW\ ;;)HPDOH;<0DOH
(J0DQ%DUUERGLHV;
LQDFWLYDWLRQ'URVRSKLOD
*HQLFEDODQFHPHFKDQLVP
6H[ =2)HPDOH==0DOH
GHWHUPLQDWLRQ (J0RWKV
%XWWHUIOLHV'RPHVWLFFKLFNHQV
)HPDOH
KHWHURJDPHW\
=:)HPDOH==0DOH
(J%LUGV5HSWLOHV
VRPH)LVKHV
+DSORGLSORLG\

(J+RQH\EHHV
7KDODVVHPLD$OELQLVP
0HQGHOLDQ 3KHQ\ONHWRQXULD
GLVRUGHUV +XQWLQJWRQ
VFKRUHD
*HQHWLF
GLVRUGHUV
'RZQ
VV\QGURPH.OLQHIHWHU
V
&KURPRVRPDO
V\QGURPH7XUQHU
VV\QGURPH
GLVRUGHUV
3DWDX
VV\QGURPH
9DULDWLRQ (XJHQLFV(XSKHQLFV
(XWKHQLFV

ICT CORNER
PRINCIPLES OF INHERITANCE AND
VARIATION
Shall we can investigate

on DNA?
Procedure:
Step -1: Type the URL or scan the QR code to open the activity page.
Step -2 :Click “Timeline” to know the history of DNA identification and the work of scientists.
On the right top of the window, find hexagons revealing about other tabs to click.
Step -3 :Click “Genome” to go through “FLYOVER”, “ Chromosome Close Up” and in “
Genome Fishing”, click on the tabs such as “Centromere”, etc., to know the shape. And
Click “Genome Spots” to know the various responsible Spots respective to their activities.
Step – 4 :Find “Launch Gene Body” on the right bottom of the window, and Click it to analyse
and understand about the cloning.
Step -5 :Click on “Applications (Hexagon 4)” to know the uses behind. And click “Chronicle
(Hexagon 5)” to know the documentations.
Step 4
PRINCIPLES OF INHERITANCE AND VARIATION URL:

http://www.dnai.org/

*Allow flash player

5
UNIT - II
Molecular
Genetics
CHAPTER
New life for Woolly Mammoth DNA-researchers

Chapter Outline can now re-create the genes of mammoth and
study the proteins they encoded
5.1 Gene as the functional unit of inheritance
5.2 In search of the genetic material
M
5.3 DNA is the genetic material endel’s theory dispelled the mystery
5.4 Chemistry of nucleic acids
of why traits seemed to appear and
5.5 RNA world
5.6 Properties of genetic material disappear magically from one generation to
5.7 Packaging of DNA helix the next. Mendel’s work reveals the patterns of
5.8 DNA Replication heredity and reflect the transmission of evolved
5.9 Transcription information from parents to offspring. This
5.10 Genetic code information is located on the chromosomes.
5.11 tRNA – the adapter molecule One of the most advanced realizations of
5.12 Translation
human knowledge was that our unique
5.13 Regulation of Gene expression
5.14 Human Genome Project (HGP) characteristics are encoded within molecules
5.15 DNA finger printing technique of DNA. The discovery that DNA is the genetic
material left several questions unanswered.
How is the information in DNA used? Scientists
Learning Objectives
now know that DNA directs the construction
➢ Identifies DNA as the genetic material. of proteins. Proteins determine the shapes of
➢ Understands the organization of prokaryotic cells and the rate of chemical reactions, such
and eukaryotic genome. as those that occur during metabolism and
➢ Learns to differentiate the nucleotides of DNA photosynthesis. The hereditary nature of every
and RNA. living organism is defined by its genome,
➢ Understands gene expression - which consists of a long sequence of nucleic
Replication, Transcription and
acids that provide the information needed to
Translation.
construct the organism. The genome contains
➢ Learns about codons and the
salient features of genetic code. the complete set of hereditary information for
➢ Understands the gene regulation any organism. The genome may be divided into
through Lac operon model. a number of different nucleic acid molecules.
➢ Realizes the importance of Human Genome Each of the nucleic acid molecule may contain
Project. large number of genes. Each gene is a sequence
➢ Illustrates the applications of DNA finger within the nucleic acid that represents a single
printing technique.
protein. In this chapter we will discuss the
68

structure of DNA, its replication, the process
of making RNA from DNA (transcription), the One gene-one enzyme hypothesis
genetic code that determines the sequence of The experiments of George Beadle
amino acid in protein synthesis (translation), and Edward Tatum in the early 1940’s
regulation of gene expression and the essentials on Neurospora crassa (the red bread
of human genome sequencing. mould) led them to propose one gene-
one enzyme hypothesis, which states that
5.1 Gene as the functional unit one gene controls the production of one
of inheritance enzyme.
A gene is a basic physical and functional One gene-one polypeptide hypothesis
unit of heredity. The concept of the gene It was observed that an enzyme
was first explained by Gregor Mendel in may be composed of more than one
1860’s. He never used the term ‘gene’. He polypeptide chain and a gene can code
called it ‘factor’. In 1909, the Danish biologist for only one polypeptide chain. Thus one
Wilhelm Johannsen, coined the term ‘gene’, gene-one polypeptide hypothesis states
that was referred to discrete determiners of that one gene controls the production of
inherited characteristics. only one polypeptide chain of an enzyme
molecule.
According to the classical concept of
gene introduced by Sutton in 1902, genes 5.2 In search of the genetic material
have been defined as discrete particles that
As early as 1848, Wilhelm Hofmeister,
follow Mendelian rules of inheritance,
a German botanist, had observed that cell
occupy a definite locus in the chromosome nuclei organize themselves into small,
and are responsible for the expression of rod like bodies during mitosis called
specific phenotypic character. They show the chromosomes. In 1869, Friedrich Miescher,
following properties: a Swiss physician, isolated a substance from
• Number of genes in each organism is the cell nuclei and called it as nuclein. It
more than the number of chromosomes; was renamed as nucleic acid by Altman
hence several genes are located on the (1889), and is now known as DNA. By 1920,
it became clear that chromosomes are made
same chromosome.
up of proteins and DNA. Many experiments
• The genes are arranged in a single linear were carried out to study the actual carriers
order like beads on a string. of genetic information. Griffith's experiment
• Each gene occupies a specific position proved that DNA is the genetic material
which has been dealt in class XI. Bacterial
called locus.
transformation experiments provided the
• Genes may exist in several alternate forms first proof that DNA is the genetic material.
called alleles. However, he could not understand the
• Genes may undergo sudden change cause of bacterial transformation, and the
in positions and composition called biochemical nature of genetic material was
not defined from his experiments.
mutations.
Later, Oswald Avery, Colin Macleod and
• Genes are capable of self-duplication Maclyn McCarty in 1944 repeated Griffith’s
producing their own copies. experiments in an ‘in vitro’ system in order
69 Molecular Genetics

+\SRWKHVLV7KHJHQHWLFPDWHULDORIWKHFHOOLVHLWKHUSURWHLQRUQXFOHLFDFLG'1$RU51$
5HPRYHOLSLGVDQG
VXJDUVIURPDVROXWLRQRI
+HDWNLOOHG /LSLGV KHDWNLOOHG6FHOOV
6FHOOV 6XJDUV 3URWHLQV51$DQG'1$
UHPDLQ
$GGSURWHLQDVH $GG51DVH $GG'1DVH 7UHDWVROXWLRQVZLWK

HQ]\PHVWRGHVWUR\
SURWHLQ51$RU'1$
123527(,1 1251$ 12'1$
$GGWRFXOWXUHFRQWDLQLQJ
$GG5FHOOV $GG5FHOOV $GG5FHOOV
OLYLQJ5FHOOV2EVHUYHIRU
WUDQVIRUPDWLRQE\WHVWLQJ
IRUWKHSUHVHQFHRI
YLUXOHQW6FHOOV
6FHOOVDSSHDU 6FHOOVDSSHDU 1R6FHOOV
&RQFOXVLRQ7UDQVIRUPDWLRQUHTXLUHV'1$WKHUHIRUHLWLVWKHJHQHWLFPDWHULDORIWKHFHOO
Fig. 5.1 Transformation experiment of Avery et. al., (1944)
to identify the nature of the transforming (an enzyme which destroys protein) did not
substance responsible for converting a non- affect the transformation. Digestion with
virulent strain into virulent strain. They DNase inhibited transformation suggesting
observed that the DNA, RNA and proteins that the DNA caused the transformation.
isolated from the heat-killed S-strain when These experiments suggested that DNA and
added to R-strain changed their surface not proteins is the genetic material. The
character from rough to smooth and also phenomenon, by which DNA isolated from
made them pathogenic (Fig. 5.1). But one type of cell (R – strain), when introduced
when the extract was treated with DNase into another type (S-strain), is able to retain
(an enzyme which destroys DNA) the some of the properties of the R - strain is
transforming ability was lost. RNase (an referred to as transformation.
enzyme which destroys RNA) and proteases
Molecular Genetics 70

Fig. 5.2 The Hershey-Chase (blender) experiment
5.3 DNA is the genetic material phages (virus) are added to bacteria, they
Many biologists despite the earlier adsorb to the outer surface, some material
experiments of Griffith, Avery and others, enters the bacterium, and then later each
still believed that protein, not DNA, was the bacterium lyses to release a large number of
hereditary material in a cell. As eukaryotic progeny phage. Hershey and Chase wanted
chromosomes consist of roughly equal to observe whether it was DNA or protein
amounts of protein and DNA, it was said that entered the bacteria. All nucleic acids
that only a protein had sufficient chemical contain phosphorus, and contain sulphur (in
diversity and complexity to encode the the amino acid cysteine and methionine).
information required for genetic material. Hershey and Chase designed an experiment
In 1952, however, the results of the using radioactive isotopes of Sulphur (35S)
Hershey-Chase experiment finally provided and phosphorus (32P) to keep separate track of
convincing evidence that DNA is the genetic the viral protein and nucleic acids during the
material. infection process. The phages were allowed
5.3.1 Hershey and Chase experiment to infect bacteria in culture medium which
on T2 bacteriophage containing the radioactive isotopes 35S or 32P.
The bacteriophage that grew in the presence of
Alfred Hershey and Martha Chase (1952) 35
S had labelled proteins and bacteriophages
conducted experiments on bacteriophages
grown in the presence of 32P had labelled DNA.
that infect bacteria. Phage T2 is a virus that
infects the bacterium Escherichia coli. When

The differential labelling thus enabled them to Nitrogenous bases
identify DNA and proteins of the phage. The bases are nitrogen containing
Hershey and Chalse mixed the labelled molecules having the chemical properties
phages with unlabeled E. coli and allowed of a base (a substance that accepts H+ ion or
bacteriophages to attack and inject their proton in solution). DNA and RNA both have
genetic material. Soon after infection (before four bases (two purines and two pyrimidines)
lysis of bacteria), the bacterial cells were gently in their nucleotide chain. Two of the bases,
agitated in a blender to loosen the adhering Adenine (A) and Guanine (G) have double
phase particles. It was observed that only 32P carbon–nitrogen ring structures and are
was found associated with bacterial cells and called purines. The bases, Thymine (T),
35
S was in the surrounding medium and not Cytosine (C) and Uracil (U) have single ring
in the bacterial cells. When phage progeny structure and these are called pyrimidines.
was studied for radioactivity, it was found Thymine is unique for DNA, while Uracil is
that it carried only 32P and not 35S (Fig. 5.2). unique for RNA.
These results clearly indicate that only DNA
and not protein coat entered the bacterial The phosphate functional group
cells. Hershey and Chase thus conclusively It is derived from phosphoric acid
proved that it was DNA, not protein, which (H3PO4), has three active OH- groups of which
carries the hereditary information from virus two are involved in strand formation. The
to bacteria. phosphate functional group (PO4) gives DNA
and RNA the property of an acid (a substance
5.4 Chemistry of Nucleic Acids that releases an H+ ion or proton in solution)
Having identified the genetic material as at physiological pH, hence the name nucleic
the nucleic acid DNA (or RNA), we proceed acid. The bonds that are formed from
to examine the chemical structure of these phosphates are esters. The oxygen atom of the
molecules. Generally nucleic acids are a phosphate group is negatively charged after
long chain or polymer of repeating subunits the formation of the phosphodiester bonds.
called nucleotides. Each nucleotide subunit is This negatively charged phosphate ensures
composed of three parts: a nitrogenous base, the retention of nucleic acid within the cell or
a five carbon sugar (pentose) and a phosphate nuclear membrane.
group.
Nucleoside and nucleotide
Pentose sugar The nitrogenous base is chemically
There are two types of nucleic acids linked to one molecule of sugar (at the
depending on the type of pentose sugar. 1-carbon of the sugar) forming a nucleoside.
Those containing deoxyribose sugar are called When a phosphate group is attached to the 5'
Deoxyribo Nucleic Acid (DNA) and those carbon of the same sugar, the nucleoside
with ribose sugar are known as Ribonucleic becomes a nucleotide. The nucleotides are
Acid (RNA). DNA is found in the nucleus joined (polymerized) by condensation
of eukaryotes and nucleoid of prokaryotes. reaction to form a polynucleotide chain. The
The only difference between these two hydroxyl group on the 3' carbon of a sugar of
sugars is that there is one oxygen atom less in one nucleotide forms an ester with the
deoxyribose. phosphate of another nucleotide. The
chemical bonds that link the sugar

components of adjacent nucleotides are called separated RNA from the protein of TMV
phosphodiester bond (5' 3'), indicating viruses. Three molecular biologists in the early
the polarity of the strand. 1980’s (Leslie Orgel, Francis Brick and Carl
The ends of the DNA or RNA are distinct. Woese) independently proposed the ‘RNA
The two ends are designated by the symbols 5' world’ as the first stage in the evolution of
and 3'. The symbol 5' refers to carbon in the life, a stage when RNA catalysed all molecules
sugar to which a phosphate (PO4) functional necessary for survival and replication. The
group is attached. The symbol 3' refers to term ‘RNA world’ first used by Walter Gilbert
carbon in the sugar to which hydroxyl (OH) in 1986, hypothesizes RNA as the first genetic
functional group is attached. In RNA, every material on earth. There is now enough
nucleotide residue has an additional –OH evidence to suggest that essential life processes
group at 2' position in the ribose. (such as metabolism, translation, splicing etc.,)
Understanding the 5' 3' direction of a evolved around RNA. RNA has the ability to act
nucleic acid is critical for understanding the as both genetic material and catalyst. There are
aspects of replication and transcription. several biochemical reactions in living systems
Based on the X - ray diffraction analysis of that are catalysed by RNA. This catalytic
Maurice Wilkins and Rosalind Franklin, the RNA is known as ribozyme. But, RNA being
double helix model for DNA was proposed by a catalyst was reactive and hence unstable.
James Watson and Francis Crick in 1953. The This led to evolution of a more stable form of
highlight was the base pairing between the DNA, with certain chemical modifications.
two strands of the polynucleotide chain. This Since DNA is a double stranded molecule
proposition was based on the observations having complementary strand, it has resisted
of Erwin Chargaff that Adenine pairs with changes by evolving a process of repair. Some
Thymine (A = T) with two hydrogen bonds RNA molecules function as gene regulators by
and Guanine pairs with Cytosine (G ≡ C) binding to DNA and affect gene expression.
with three hydrogen bonds. The ratios Some viruses use RNA as the genetic material.
between Adenine with Thymine and Guanine Andrew Fire and Craig Mellow (recipients of
with Cytosine are constant and equal. The Nobel Prize in 2006) were of the opinion that
base pairing confers a unique property to RNA is an active ingredient in the chemistry of
the polynucleotide chain. They are said to be life. The types of RNA and their role have been
complementary to each other, that is, if the discussed in class XI.
sequence of bases in one strand (template) is
known, then the sequence in the other strand 5.6 Properties of genetic material
can be predicted. The salient features of DNA (DNA versus RNA)
structure has already been dealt in class XI. The experiment by Hershey and Chase
clearly indicates that it is DNA that acts
5.5 RNA world as a genetic material. However, in some
A typical cell contains about ten times as viruses like Tobacco mosaic virus (TMV),
much RNA as DNA. The high RNA content bacteriophage θB, RNA acts as the genetic
is mainly due to the variety of roles played by material. A molecule that can act as a genetic
RNA in the cell. Fraenkel-Conrat and Singer material should have the following properties:
(1957) first demonstrated that RNA is the
• Self
Replication: It should be able to
genetic material in RNA containing viruses
replicate. According to the rule of base
like TMV (Tobacco Mosaic Virus) and they
pairing and complementarity, both nucleic

acids (DNA and RNA) have the ability to a faster rate. Thus viruses having RNA
direct duplications. Proteins fail to fulfill genome with shorter life span can mutate
this criteria. and evolve faster.
• Stability: It should be stable structurally and The above discussion indicates that both
chemically. The genetic material should be RNA and DNA can function as a genetic
stable enough not to change with different material. DNA is more stable, and is preferred
stages of life cycle, age or with change in for storage of genetic information.
physiology of the organism. Stability as one
of property of genetic material was clearly 5.7 Packaging of DNA helix
evident in Griffith’s transforming principle.
The distance between two consecutive
Heat which killed the bacteria did not
base pairs is 0.34nm (0.34×10-9m) of the
destroy some of the properties of genetic
DNA double helix in a typical mammalian
material. In DNA the two strands being
cell. When the total number of base pairs is
complementary, if separated (denatured) by
multiplied with the distance between two
heating can come together (renaturation)
consecutive base pairs (6.6 × 10-9 × 0.34 ×10-9
when appropriate condition is provided.
m/bp), the length of DNA double helix is
Further 2' OH group present
at every nucleotide in RNA is a
$
reactive group that makes RNA
liable and easily degradable. RNA
is also known to be catalytic and
reactive. Hence, DNA is chemically
more stable and chemically less 1XFOHRVRPH
reactive when compared to RNA. &RUH'1$
Presence of thymine instead of +$ +% + +
uracil in DNA confers additional /LQNHU'1$

% +
stability to DNA.
• Information storage: It should be
able to express itself in the form $
of ‘Mendelian characters’. RNA $ &
can directly code for protein '
synthesis and can easily express

the characters. DNA, however
depends on RNA for synthesis
of proteins. Both DNA and RNA )
can act as a genetic material, but (
DNA being more stable stores

the genetic information and RNA +
'1$
+$+%+
transfers the genetic information. DQG+WZR
PROHFXOHVHDFK
+LVWRQHRFWDPHU
+ +LVWRQHSURWHLQ
• Variation through mutation: It

1XFOHRVRPH
should be able to mutate. Both
DNA and RNA are able to mutate. Fig. 5.3 Condensation of DNA - A - DNA, B-Nucleosomes
RNA being unstable, mutates at and Histones, C- Chromatin fiber, D- Coiled chromatin
fiber, E- Coiled coil, F- metaphase chromatid

approximately 2.2 m. (The total length of the makes two complete turns around the histone
double helical DNA = total number of base octameres and the two turns are sealed off by
pairs × distance between two consecutive an H1 molecule. Chromatin lacking H1 has a
base pairs). If the length of E. coli DNA is beads-on-a-string appearance in which DNA
1.36 mm, the number of base pairs in E. coli enters and leaves the nucleosomes at random
is 4 ×106m (1.36 × 103 m/0.34 ×10-9). The places. H1 of one nucleosome can interact
length of the DNA double helix is far greater with H1 of the neighbouring nucleosomes
than the dimension of a typical mammalian resulting in the further folding of the fibre.
nucleus (approximately 10-6 m). How is such The chromatin fiber in interphase nuclei and
a long DNA polymer packaged in a cell? mitotic chromosomes have a diameter that
Chromosomes are carriers of genes which vary between 200-300 nm and represents
are responsible for various characters from inactive chromatin. 30 nm fibre arises from the
generation to generation. Du Praw (1965) folding of nucleosome, chains into a solenoid
proposed a single stranded model (unineme), structure having six nucleosomes per turn. This
as a long coiled molecule which is associated structure is stabilized by interaction between
with histone proteins in eukaryotes. Plants different H1 molecules. DNA is a solenoid and
and animals have more DNA than bacteria packed about 40 folds. The hierarchical nature
and must fold this DNA to fit into the cell of chromosome structure is illustrated in (Fig.
nucleus. In prokaryotes such as E. coli though 5.3). Additional set of proteins are required
they do not have defined nucleus, the DNA for packing of chromatin at higher level and
is not scattered throughout the cell. DNA are referred to as non-histone chromosomal
(being negatively charged) is held with some proteins (NHC). In a typical nucleus, some
proteins (that have positive charges) in a regions of chromatin are loosely packed (lightly
region called the nucleoid. The DNA as a stained) and are referred to as euchromatin.
nucleoid is organized into large loops held The chromatin that is tightly packed (stained
by protein. DNA of prokaryotes is almost darkly) is called heterochromatin. Euchromatin
circular and lacks chromatin organization, is transcriptionally active and heterochromatin
hence termed genophore. is transcriptionally inactive.
In eukaryotes, this organization is much more
complex. Chromatin is formed by a series of 5.8 DNA Replication
repeating units called nucleosomes. Kornberg Replication of DNA takes place during the
proposed a model for the nucleosome, in S phase of cell cycle. During replication, each
which 2 molecules of the four histone proteins DNA molecule gives rise to two DNA strands,
H2A, H2B, H3 and H4 are organized to identical to each other as well as to the parent
form a unit of eight molecules called histone strand. Three hypotheses of DNA replication
octamere. The negatively charged DNA have been proposed. They are conservative
is wrapped around the positively charged replication, dispersive replication, and semi-
histone octamere to form a structure called conservative replication.
nucleosome. A typical nucleosome contains In conservative replication, the original
200 bp of DNA helix. The histone octameres double helix serves as a template. The original
are in close contact and DNA is coiled on molecule is preserved intact and an entirely
the outside of nucleosome. Neighbouring new double stranded molecule is synthesized.
nucleosomes are connected by linker DNA In dispersive replication, the original molecule
(H1) that is exposed to enzymes. The DNA is broken into fragments and each fragment

3' 5'
Semi-conservative replication was
T A
proposed by Watson and Crick in 1953. This
C G mechanism of replication is based on the
A T
Parent DNA model. They suggested that the two
C G polynucleotide strands of DNA molecule
C G
G C unwind and start separating at one end.
T A
During this process, covalent hydrogen bonds
C G are broken. The separated single strand then
T A
C G acts as template for the synthesis of a new
T A
strand. Subsequently, each daughter double
T A
Parental Parental helix carries one polynucleotide strand from
A T
strand A T strand the parent molecule that acts as a template
C 3' 5' C
C G C G
and the other strand is newly synthesised
G C and complementary to the parent strand
G C TA
T A
C G
(Fig. 5.4).
C G T A
T A
T A
C G C G 5.8.1 Experimental proof of
A T
T A
DNA replication
T A
A T A T The mode of DNA replication was
5'
3'
3'
determined in 1958 by Meselson and Stahl.
5'
They designed an experiment to distinguish
Daughter
strands between semi conservative, conservative and
dispersive replications. In their experiment,
Fig. 5.4 Semiconservative DNA replication they grew two cultures of E.coli for many
serves as a template for the synthesis of generations in separate media. The ‘heavy’
complementary fragments. Finally two new culture was grown in a medium in which
molecules are formed which consist of both the nitrogen source (NH4Cl) contained the
old and new fragments. heavy isotope 15N and the ‘light’ culture was
grown in a medium in which the nitrogen
Generation I Generation II
15 14
N-DNA N-DNA 14
N-DNA
15
N-DNA 15
N-DNA
14
20 min 40 min N-DNA
14
Gravitational force N-DNA
15 15 14 15 14 14 14 15
N N N N N N N N
Heavy Hybrid Light Hybrid
Fig. 5.5 Meselson and Stahl experiment to support semiconservative mode of DNAreplication

source contained light isotope 14N for many errors are corrected by repair enzymes such
generations. At the end of growth, they as nucleases. Deoxy nucleotide triphosphate
observed that the bacterial DNA in the heavy acts as substrate and also provides energy for
culture contained only 15N and in the light polymerization reaction.
culture only 14N. The heavy DNA could be Replication begins at the initiation site called
distinguished from light DNA (15N from 14N) the site of ‘origin of replication’ (ori). In
with a technique called Cesium Chloride prokaryotes, there is only one origin of
(CsCl) density gradient centrifugation. In replication, whereas in eukaryotes with giant
this process, heavy and light DNA extracted DNA molecules, there can be several origins
from cells in the two cultures settled into two of replication (replicons). Since the two
distinct and separate bands (hybrid DNA) strands of DNA cannot be separated
(Fig. 5.5). throughout at a time (due to large requirement
The heavy culture (15N) was then transferred of energy) the replication occurs within a
into a medium that had only NH4Cl, and took small opening of the DNA helix called as
samples at various definite time intervals (20 replication fork. Unwinding of the DNA
minutes duration). After the first replication, strand is carried out by DNA helicase. Thus, in
they extracted DNA and subjected it to density one strand (template strand with polarity
gradient centrifugation. The DNA settled 3' 5') the replication is continuous and is
into a band that was intermediate in position known as the leading strand while in the
between the previously determined heavy and other strand (coding strand with polarity
light bands. After the second replication (40 5' 3') replication is discontinuous, known
minutes duration), they again extracted DNA as the lagging strand (Fig. 5.6). The
samples, and this time found the DNA settling discontinuously synthesized fragments of the
into two bands, one at the light band position lagging strand (called the Okazaki fragments)
and one at intermediate position. These results are joined by the enzyme DNA ligase.
confirm Watson and Crick’s semi conservative
replication hypothesis.
5.8.2 Enzymes and mechanism

of replication
In prokaryotes, replication process requires
three types of DNA polymerases (DNA
polymerase I, II, and III). DNA polymerase
III is the main enzyme involved in DNA
replication. DNA polymerase I (also known
as Kornberg enzyme) and DNA polymerase
II are involved in DNA repair mechanism.
Eukaryotes have five types of DNA
polymerases that catalyses the polymerization
of nucleotides at the 3' OH of the new strand
within a short period of time. E.coli that has
4.6 X 106 bp completes its replication process
within 38 minutes. Replication takes place
faster at the same time accurately. Any error Fig 5.6 Mechanism of replication showing a
will lead to mutation. However replication replication fork

As they move away in both directions, newly information is reversed. RNA synthesizes DNA
synthesized complementary nucleotides are by reverse transcription, then transcribed into
paired with the existing nucleotides on the mRNA by transcription and then into proteins
parent strand and covalently bonded together by translation.
by DNA polymerase. Formation of new strand For a cell to operate, its genes must be
requires a primer (a short stretch of RNA)for expressed. This means that the gene products,
initiation. The primer produces a 3'-OH end on whether proteins or RNA molecules must be
the sequence of ribonucleotides, to which deoxy made. The RNA that carries genetic information
ribonucleotides are added. The RNA primer is encoding a protein from genes into the cell is
ultimately removed leaving a gap in the newly known as messenger RNA (mRNA). For a gene
synthesized DNA strand. It is removed from to be transcribed, the DNA which is a double
5' end one by one by the exonuclease activity helix must be pulled apart temporarily, and
of DNA polymerase. Finally, when all the RNA is synthesized by RNA polymerase. This
nucleotides are in position, gaps are sealed by enzyme binds to DNA at the start of a gene and
the enzyme DNA ligase. opens the double helix. Finally, RNA molecule
At the point of origin of repliction, the is synthesized. The nucleotide sequence in the
helicases and topoisomerases (DNA gyrase) RNA is complementary to the DNA template
unwind and pull apart the strands, forming a strand from which it is synthesized.
Y-Shaped structure called the replication fork. Both the strands of DNA are not copied during
There are two replication forks at each origin. transcription for two reasons. 1. If both the strands
The two strands of a DNA helix have an act as a template, they would code for RNA with
antiparallel orientation. The enzyme DNA different sequences. This in turn would code for
polymerase can only catalyse the addition of a proteins with different amino acid sequences.
nucleotide to the new strands in the 5' 3' This would result in one segment of DNA coding
direction, as it can only add nucleotides to the for two different proteins, hence complicate the
3' carbon position. genetic information transfer machinery. 2. If two
RNA molecules were produced simultaneously,
5.9 Transcription double stranded RNA complementary to each
Francis Crick proposed the Central dogma other would be formed. This would prevent RNA
in molecular biology which states that genetic from being translated into proteins.
information flows as follows:
5.9.1 Transcription unit and gene
A transcriptional unit in DNA is defined by
three regions, a promoter, the structural gene
and a terminator. The promoter is located
towards the 5' end. It is a DNA sequence that
provides binding site for RNA polymerase. The
presence of promoter in a transcription unit,
The process of copying genetic information
defines the template and coding strands. The
from one strand of DNA into RNA is termed
terminator region located towards the 3' end
transcription. This process takes place in
of the coding strand contains a DNA sequence
presence of DNA dependent RNA polymerase.
that causes the RNA polymerase to stop
In some retroviruses that contain RNA as transcribing. In eukaryotes the promoter has
the genetic material (e.g, HIV), the flow of AT rich regions called TATA box (Goldberg-

Fig. 5. 7 Schematic structure of a transcription unit
Hogness box) and in prokaryotes this region RNA polymerase opens up the DNA to form the
is called Pribnow box. Besides promoter, transcription bubble. The core enzyme moves
eukaryotes also require an enhancer. ahead, manufacturing RNA leaving the sigma
The two strands of the DNA in the structural subunit behind at the promoter region. The end
gene of a transcription unit have opposite of a gene is marked by a terminator sequence
polarity. DNA dependent RNA polymerase that forms a hair pin structure in the RNA. The
catalyses the polymerization in only one sub-class of terminators require a recognition
direction, the strand that has the polarity protein, known as rho (ρ), to function.
3' 5' acts as a template, and is called the
5.9.2 Process of transcription
template strand. The other strand which has
In prokaryotes, there are three major types of
the polarity 5' 3' has a sequence same as
RNAs: mRNA, tRNA, and rRNA. All three RNAs
RNA (except thymine instead of uracil) and is
are needed to synthesize a protein in a cell. The
displaced during transcription. This strand is
mRNA provides the template, tRNA brings amino
called coding strand (Fig. 5.7).
acids and reads the genetic code, and rRNAs play
The structural gene may be monocistronic
structural and catalytic role during translation.
(eukaryotes) or polycistronic (prokaryotes). In
There is a single DNA-dependent RNA polymerase
eukaryotes, each mRNA carries only a single
that catalyses transcription of all types of RNA. It
gene and encodes information for only a single
binds to the promoter and initiates transcription
protein and is called monocistronic mRNA. In
(Initiation). The polymerases binding sites are
prokaryotes, clusters of related genes, known as
called promoters. It uses nucleoside triphosphate as
operon, often found next to each other on the
substrate and polymerases in a template depended
chromosome are transcribed together to give a
fashion following the rule of complementarity.
single mRNA and hence are polycistronic.
After the initiation of transcription, the polymerase
Before starting transcription, RNA polymerase continues to elongate the RNA, adding one
binds to the promoter, a recognition sequence in nucleotide after another to the growing RNA
front of the gene. Bacterial (prokaryotic) RNA chain. Only a short stretch of RNA remains bound
polymerase consists of two major components, to the enzyme, when the polymerase reaches a
the core enzyme and the sigma subunit. The terminator at the end of a gene, the nascent RNA
core enzyme (β1, β, and α) is responsible for falls off, so also the RNA polymerase.
RNA synthesis whereas a sigma subunit is
The question is, how the RNA polymerases
responsible for recognition of the promoter.
are able to catalyse the three steps initiation,
Promoter sequences vary in different organisms.
elongation and termination? The RNA

Initiation
5' 5'
3' 3'
Promoter σ RNA polymerase DNA helix
Sigma factor
polymerase found in the
Elongation organelles). There is a clear
division of labour. The RNA
5' 5'
polymerase I transcribes
3' 3' rRNAs (28S, 18S and
Terminator
RNA σ 5.8S), whereas the RNA
polymerase III is responsible
Termination for transcription of tRNA,
5' 5'
5srRNA and snRNA.
The RNA polymerase
3' 3'
II transcribes precursor
Rho factor ρ of mRNA, the hnRNA
RNA (heterogenous nuclear
RNA Polymerase RNA). In eukaryotes, the
Fig. 5. 8 Process of transcription in prokaryotes monocistronic structural
genes have interrupted coding sequences
polymerase is only capable of catalyzing the known as exons (expressed sequences) and non-
process of elongation. The RNA polymerase coding sequences called introns (intervening
associates transiently with initiation factor sigma sequences). The introns are removed by a process
(σ) and termination factor rho (r) to initiate called splicing. hnRNA undergoes additional
and terminate the transcription, respectively. processing called as capping and tailing. In
Association of RNA with these factors instructs capping an unusual nucleotide, methyl guanosine
the RNA polymerase either to initiate or triphosphate is added at the 5' end, whereas
terminate the process of transcription (Fig. 5.8). adenylate residues (200-300) (Poly A) are added
at the 3' end in tailing (Fig. 5.9). Thereafter,
In bacteria, since the mRNA does not
this processed hnRNA, now called mRNA is
require any processing to become active
transported out of the nucleus for translation.
and also since transcription and translation
take place simultaneously in the same The split gene feature of eukaryotic genes
compartment (since there is no separation of is almost entirely absent in prokaryotes.
cytosol and nucleus in bacteria), many times Originally each exon may have coded for
the translation can begin much before the a single polypeptide chain with a specific
mRNA is fully transcribed. This is because function. Since exon arrangement and intron
the genetic material is not separated from removal are flexible, the exon coding for
other cell organelles by a nuclear membrane these polypeptide subunits act as domains
consequently; transcription and translation combining in various ways to form new genes.
can be coupled in bacteria. Single genes can produce different functional
proteins by arranging their exons in several
In Eukaryotes, there are at least three RNA
different ways through alternate splicing
polymerases in the nucleus (in addition to RNA

language of codes
5' 5' what is the nature
of genetic code?
3' 3' The translation of
Capping proteins follows
3' m RNA
Intron the triplet rule; a
Cap Exon sequence of three
mRNA base (a
m
Gppp Polyadenylation codon) designates
5'
RNA splicing one of the 20
3' different kinds of
m
Gppp
5' amino acids used in
Poly A tail protein synthesis.
m
Gppp Genetic code is the
5' sequence relationship
3'
between nucleotide in
Messenger 5' Gppp
m
genes (or mRNA) and

RNA (m RNA)
the amino acids in the
proteins they encode.
Fig. 5.9 Process of transcription in eukaryotes
There are 64 possible
patterns, a mechanism known to play an
triplets, and 61 of them are used to represent
important role in generating both protein and
amino acids. The remaining three triplet codons
functional diversity in animals. Introns would
are termination signals for polypeptide chains.
have arosen before or after the evolution of
Since there are only 20 amino acids involved
eukaryotic gene. If introns arose late how did
in protein synthesis, most of them are encoded
they enter eukaryotic gene? Introns are mobile
by more than one triplet. Two things make this
DNA sequences that can splice themselves out
multiple (degenerate) coding possible. First,
of, as well as into, specific ‘target sites’ acting
there is more than one tRNA for most amino
like mobile transposon-like elements (that
acids. Each tRNA has a different anticodon.
mediate transfer of genes between organisms
Second, this pairing is highly specific for the
– Horizontal Gene Transfer - HGT). HGT
first two portions on the codon, permitting
occurs between lineages of prokaryotic
Watson and Crick base pairs (A – U and G - C)
cells, or from prokaryotic to eukaryotic cells
to be formed. But at the third position there is
and between eukaryotic cells. HGT is now
a great deal of flexibility as to which base pairs
hypothesized to have played a major role in
are acceptable. Most part of the genetic code is
the evolution of life on earth.
universal, being the same in prokaryotes and
5.10 Genetic Code eukaryotes.
DNA is the genetic material that carries The order of base pairs along DNA molecule
genetic information in a cell and from controls the kind and order of amino acids
generation to generation. At this stage, an found in the proteins of an organism. This
attempt will be made to determine in what specific order of base pairs is called genetic
manner the genetic information exists in DNA code, the blue print establishing the kinds of
molecule? Are they written in coded language proteins to be synthesized which makes an
on a DNA molecule? If they occur in the organism unique.

Marshall Nirenberg, Severo Ochoa (enzyme • A non-overlapping codon means that the
polynucleotide phosphorylase called Ochoa’s same letter is not used for two different
enzyme), Hargobind Khorana, Francis Crick codons. For instance, the nucleotide
and many others have contributed significantly sequence GUU GUC represents only two
to decipher the genetic code. The order in which codons.
bases are arranged in mRNA decides the order • It is comma less, which means that the
in which amino acids are arranged in proteins. message would be read directly from one
Finally a checker board for genetic code was end to the other i.e., no punctuation are
prepared (table 5.1). needed between two codes.
The salient features of genetic code are as • A degenerate code means that more than
follows: one triplet codon could code for a specific
• The genetic codon is a triplet code and 61 amino acid. For example, codons GUU,
codons code for amino acids and 3 codons GUC, GUA and GUG code for valine.
do not code for any amino acid and • Non-ambiguous code means that one
function as stop codon (Termination). codon will code for one amino acid.
• The genetic code is universal. It means that • The code is always read in a fixed direction
all known living systems use nucleic acids i.e. from 5'→3' direction called polarity.
and the same three base codons (triplet
• AUG has dual functions. It acts as a
codon) direct the synthesis of protein
initiator codon and also codes for the
from amino acids. For example, the mRNA
amino acid methionine.
(UUU) codon codes for phenylalanine in all
• UAA, UAG (tyrosine) and UGA
cells of all organisms. Some exceptions are
(tryptophan) codons are designated as
reported in prokaryotic, mitochondrial and
termination (stop) codons and also are
chloroplast genomes. However similarities
known as “non-sense” codons.
are more common than differences.
Table 5.1 Genetic code dictionary

6HFRQG1XFOHRWLGHLQ&RGRQ
8 & $ *
8883KH)3KHQ\ODODQLQH 8&86HU66HULQH 8$87\U<7\URVLQH 8*8&\V&&\VWHLQH 8
88&3KH)3KHQ\ODODQLQH 8&&6HU66HULQH 8$&7\U<7\URVLQH 8*&&\V&&\VWHLQH &
8 8&$6HU66HULQH 8$$7HUPLQDWLRQ 8*$7HUPLQDWLRQ
88$/HX//HXFLQH $
8*&6HU66HULQH 8$*7HUPLQDWLRQ 8**7US:7U\SWRSKDQ
7KLUGQXFOHRWLGHLQFRGRQ¶HQG
88*/HX//HXFLQH
)LUVWQXFOHRWLGHLQFRGRQ¶HQG
&88/HX//HXFLQH &&83UR33UROLQH &$8+LV++LVWLGLQH &*8$UJ5$UJLQLQH 8

&$&+LV++LVWLGLQH &*&$UJ5$UJLQLQH
& &8&/HX//HXFLQH &&&3UR33UROLQH &
&8$/HX//HXFLQH &&$3UR33UROLQH &$$*OQ4*OXWDPLQH &*$$UJ5$UJLQLQH $
&8*/HX//HXFLQH &&*3UR33UROLQH &$**OQ4*OXWDPLQH &**$UJ5$UJLQLQH *
$88,OH,,VROHXFLQH $&87KU77KUHRQLQH $$8$VQ1$VSDUDJLQH $*86HU66HULQH 8

$ $8&,OH,,VROHXFLQH $&&7KU77KUHRQLQH $$&$VQ1$VSDUDJLQH $*&6HU66HULQH &
$8$,OH,,VROHXFLQH $&$7KU77KUHRQLQH $$$/\V./\VLQH $*$$UJ5$UJLQLQH $
$8*0HW00HWKLRQLQH $&*7KU77KUHRQLQH $$*/\V./\VLQH $**$UJ5$UJLQLQH *
*889DO99DOLQH *&8$OD$$ODQLQH *$8$VS'$VSDUWLFDFLG **8*O\**O\FLQH 8

* *8&9DO99DOLQH *&&$OD$$ODQLQH *$&$VS'$VSDUWLFDFLG **&*O\**O\FLQH &
*8$9DO99DOLQH *&$$OD$$ODQLQH *$$*OX(*OXWDPLFDFLG **$*O\**O\FLQH $
*8*9DO99DOLQH *&*$OD$$ODQLQH *$**OX(*OXWDPLFDFLG ****O\**O\FLQH *
&RGRQ 7KUHHOHWWHUDQGVLQJOHOHWWHUDEEUHYLDWLRQV

5.10.1 Mutation and genetic code
Wobble Hypothesis
Comparative studies of mutations (sudden
change in a gene) and corresponding It is a hypothesis proposed by Crick
alteration in amino acid sequence of specific (1966) which states that tRNA anticodon
protein have confirmed the validity of the has the ability to wobble at its 5’ end by
genetic code. The relationship between genes pairing with even non-complementary
and DNA are best understood by mutation base of mRNA codon. According to this
studies. The simplest type of mutation at the hypothesis, in codon-anticodon pairing
molecular level is a change in nucleotide that the third base may not be complementary.
substitutes one base for another. Such changes The third base of the codon is called
are known as base substitutions which may wobble base and this position is called
occur spontaneously or due to the action of wobble position. The actual base pairing
mutagens. A well studied example is sickle occurs at first two positions only. The
cell anaemia in humans which results from a importance of Wobbling hypothesis
point mutation of an allele of β-haemoglobin is that it reduces the number of tRNAs
gene (βHb). A haemoglobin molecule required for polypeptide synthesis and it
consists of four polypeptide chains of two overcomes the effect of code degeneracy.
types, two α chains and two β-chains. Each
chain has a heme group on its surface. The
heme groups are involved in the binding of
oxygen. The human blood disease, sickle cell
anaemia is due to abnormal haemoglobin.
This abnormality in haemoglobin is due to a
single base substitution at the sixth codon of
the beta globin gene from GAG to GTG in β
-chain of haemoglobin. It results in a change In the above example though the
of amino acid glutamic acid to valine at the 6th codon and the anti codon do not match
position of the β -chain. This is the classical perfectly, yet the required amino acid
example of point mutation that results in the is brought perfectly. This enables the
change of amino acid residue glutamic acid to economy of tRNA, GUU, GUC, GUA and
valine (Fig. 5.10). The mutant haemoglobin GUG code for the amino acid - Valine.
DNA sequence 5' 3'

of non-template G T G C A C C T G A C T C C T G A G G A G
(coding) strand
Amino acid Glutamic Glutamic

sequence Valine Histidine Leucine Threonine Proline acid Normal red blood cells
acid
DNA sequence 5' 3'

of non-template G T G C A C C T G A C T C C T G T G G A G
(coding) strand
Amino acid Glutamic

Valine Histidine Leucine Threonine Proline Valine
sequence acid
Mutant Sickled red blood cells
DNA point mutation can lead to a different amino acid sequence Phenotype
Fig. 5. 10 DNA point mutation

undergoes polymerisation under oxygen variable loop or extra arm. The amino acid
tension causing the change in the shape of is attached to one end (amino acid acceptor
the RBC from biconcave to a sickle shaped end) and the other end consists of three
structure. anticodon nucleotides. The anticodon pairs
with a codon in mRNA ensuring that the
The effect of point mutation can be
correct amino acid is incorporated into the
understood by the following example.
growing polypeptide chain. Four different
ABC DEF GHI JKL regions of double-stranded RNA are formed
during the folding process. Modified bases
If we insert a letter O between DEF are especially common in tRNA. Wobbling
and GHI the arrangement would be between anticodon and codon allows some
ABC DEF OGH IJK L tRNA molecules to read more than one codon.
The process of addition of amino acid
If we insert OQ at the same place the to tRNA is known as aminoacylation or
arrangement would be charging and the resultant product is called
aminoacyl- tRNA (charged tRNA). Without
ABC DEF OQG HIJ KL
aminoacylation tRNA is known as uncharged
The above information shows that insertion tRNA (Fig. 5.12). If two such tRNAs are
or deletion of one or two bases, changes the brought together peptide bond formation is
reading frame from the point of insertions or favoured energetically. Numbers of amino
deletions. Such mutations are referred to as acids are joined by peptide bonds to form a
frame shift insertion or deletion mutations. polypeptide chain. This aminoacylation is
This forms the genetic basis of proof that codon catalyzed by an enzyme aminoacyl – tRNA
is a triplet and is read in a continuous manner synthetase. This is an endothermic reaction
and is associated with ATP hydrolysis. 20
5.11. tRNA – the adapter molecule
$PLQRDFLGDWWDFKHGKHUH
The transfer RNA, (tRNA) molecule of a
cell acts as a vehicle that picks up the amino $
HQG
&
acids scattered through the cytoplasm and &
$ 6WHP
also reads specific codes of mRNA molecules.
HQG * *
& *
Hence it is called an adapter molecule. This * &
* 8
term was postulated by Francis Crick. $ 8
8 $ 7ORRS7\&
The two dimensional clover leaf model of 'ORRS'+8 8 $ 8
tRNA was proposed by Robert Holley. The ' * $ & 8 & * $8 *$ & $& & $
& *
secondary structure of tRNA depicted in * & 8* 8* 7 \ &
* ' $ * $ * ** &
Fig. 5.11 looks like a clover leaf. In actual 8 7K\PLGLQH3VHXGRXULGLQH
'LK\GURXULGLQH & *$ * DQG&\WLGLQH
structure, the tRNA is a compact molecule & * * 9DULDEOHORRS
$ 8
which looks like an inverted L. The clover * *
leaf model of tRNA shows the presence of $ \
& $
three arms namely DHU arm, middle arm 8 < $QWLFRGRQORRS
*$ $
and TΨC arm. These arms have loops such
as amino acyl binding loop, anticodon loop $QWLFRGRQ
and ribosomal binding loop at their ends. Fig. 5.11 Holley’s two-dimensional clover
In addition it also shows a small lump called leaf model of transfer RNA

different aminoacyl – tRNA synthetases are out by ribosomes that bind
known. The power to recognize codon on the mRNA and charged tRNA
mRNA lies in the tRNA and not in the attached molecules. The mRNA is
amino acid molecule. translated, starting at the 5'
end. After binding to mRNA,
The tRNA charged with amino acid serves as
the ribosomes move along
an adapter molecule to decode the information
it, adding new amino acids to the growing
on mRNA. This is achieved by the interaction
polypeptide chain each time it reads a codon.
of tRNA with mRNA. The tRNA molecule has
Each codon is read by an anticodon on the
a region that contains complementary bases
corresponding tRNA. Hence the order and
(anticodon) to the codon on the mRNA. For
sequence of amino acids are defined by the
initiation, there is another specific tRNA that
sequence of bases in the mRNA.
is referred to as initiator tRNA. There are no
tRNAs for stop codons. 5.12.1 Mechanism of Translation
The cellular factory responsible for
synthesizing protein is the ribosome. The
ribosome consists of structural RNAs and
about 80 different proteins. In inactive state,
it exists as two subunits; large subunit and
small subunit. When the subunit encounters
an mRNA, the process of translation of the
mRNA to protein begins. The prokaryotic
ribosome (70 S) consists of two subunits,
the larger subunit (50 S) and smaller subunit
(30 S). The ribosomes of eukaryotes (80 S)
are larger, consisting of 60 S and 40 S sub
units. ‘S’ denotes the sedimentation efficient
which is expressed as Svedberg unit (S). The
30 S subunit of bacterial ribosome contains
16Sr RNA and 50 S subunit contains 5Sr RNA
molecules and 23 S RNA and 31 ribosomal
proteins. The larger subunit in eukaryotes
consist of a 23 S RNA and 5Sr RNA molecule
and 31 ribosomal proteins. The smaller
eukaryotic subunit consist of 18Sr RNA
Fig. 5.12 Steps involved in charging tRNA. component and about 33 proteins.
The ‘X’ denotes that for each amino acid
One of the alternative ways of dividing
only the corresponding specific tRNA and
specific aminoacyl tRNA synthetase enzyme up a sequence of bases in DNA or RNA
are involved in the charging process. into codons is called reading frame. Any
sequence of DNA or RNA, beginning with
5.12 Translation a start codon and which can be translated
into a protein is known as an Open Reading
Translation refers to the process of
Frame (ORF). A translational unit in mRNA
polymerization of amino acids to form poly
is the sequence of RNA that is flanked by
peptide chain. The decoding process is carried

Initiation of translation in E. coli begins
with the formation of an initiation complex,
consisting of the 30S subunits of the
ribosome, a messenger RNA and the charged
N-formyl methionine tRNA (f met – t RNA
f met), three proteinaceous initiation factors
(IF1, IF2, IF3), GTP(Guanine Tri Phosphate)
and Mg 2+.
Fig. 5.13 a-Translation components
the start codon (AUG) and the stop codon

and codes for polypeptides. mRNA also
have some additional sequences that are not
translated and are referred to as Untranslated
Regions (UTR). UTRs are present at both 5'
end (before start codon) and at 3' end (after
stop codon). The start codon (AUG) begins
the coding sequence and is read by a special
tRNA that carries methionine (met). The
initiator tRNA charged with methionine
binds to the AUG start codon. In prokaryotes,
N - formyl methionine (f met) is attached to
the initiator tRNA whereas in eukaryotes
unmodified methionine is used. The 5' end
of the mRNA of prokaryotes has a special
sequence which precedes the initial AUG
start codon of mRNA. This ribosome binding
site is called the Shine – Dalgarno sequence
or S-D sequence. This sequences base-pairs
with a region of the 16Sr RNA of the small
ribosomal subunit facilitating initiation. The
subunits of the ribosomes (30 S and 50 S) are
usually dissociated from each other when not
involved in translation (Fig. 5.13a). Fig. 5.13 b- Initiation

The components that form
the initiation complex interact
in a series of steps. IF3 binds
to the 30S and allows the 30S
subunit to bind to mRNA.
Another initiation protein
(IF2) then enhances the
binding of charged formyl
methionine tRNA to the small
subunit in response to the
AUG triplet. This step ‘sets’
the reading frame so that all
subsequent groups of three
ribonucleotides are translated
accurately.
The assembly of ribosomal
subunits, mRNA and tRNA
represent the initiation
complex. Once initiation
complex has been assembled,
IF3 is released and allows the
initiation complex to combine
with the 50S ribosomal subunit
to form the complete ribosome
(70S). In this process a
molecule of GTP is hydrolyzed
providing the required energy
and the initiation factors (IF2
and IF2 and GDP) are released
(Fig. 5.13 b).
Elongation is the second
phase of translation. Once Fig. 5.13 c- Elongation of the growing polypeptide chain
both subunits of the ribosomes during translation
are assembled with the mRNA,
correct transfer RNA, another GTP and two
binding sites for two charged tRNA molecules
proteins called elongation factors (EF-Ts and
are formed. The sites in the ribosome are
EF-Tu).
referred to as the aminoacyl site (A site), the
peptidyl site (P site) and the exit site (E site). Once the charged tRNA molecule is positioned
The charged initiator tRNA binds to the P at the A site, the enzyme peptidyl transferase
site. The next step in prokaryotic translation catalyses the formation of peptide bonds that
is to position the second tRNA at the ‘A’ site link the two amino acids together (step 2). At the
of the ribosome to form hydrogen bonds same time, the covalent bond between the amino
between its anticodon and the second codon acid and tRNA occupying the P site is hydrolyzed
on the mRNA (step1). This step requires the (broken). The product of this reaction is a

dipeptide which is attached to the 3' end of tRNA ‘A’ site of the ribosome. The terminal codon
still residing in the A site. For elongation to be signals the action of GTP – dependent release
repeated, the tRNA attached to the P site, which factor, which cleaves the polypeptide chain
is now uncharged is released from the large from the terminal tRNA releasing it from
subunit. The uncharged tRNA moves through the translational complex (step 1). The tRNA
the ‘E’ site on the ribosome. is then released from the ribosome, which
The entire mRNA-tRNA-aa1-aa2 complex then dissociates into its subunits (step 2)
shifts in the direction of the ‘P’ site by a distance (Fig. 5.13 d).
of three nucleotides (step 3). This step requires Many antibiotics do not allow pathogenic
several elongation factors (EFs) and the energy bacteria to flourish in animal host because
derived from hydrolysis of GTP. This results in the they inhibit one or the other stage of bacterial
third triplet of mRNA to accept another charged protein synthesis. The antibiotic tetracycline
tRNA into the A site (step 4). The sequence of inhibits binding between aminoacyl
elongation is repeated over and over (step 5 and tRNA and mRNA. Neomycin inhibits the
step 6). An additional amino acid is added to the interaction between tRNA and mRNA.
growing polypeptide, each time mRNA advances Erythromycin inhibits the translocation of
through the ribosome. Once a polypeptide chain mRNA along the ribosome. Streptomycin
is assembled, it emerges out from the base of the inhibits the initiation of translation and
large subunit (Fig. 5.13 c). causes misreading. Chloramphenicol
Termination is the third phase of translation. inhibits peptidyl transferase and formation
Termination of protein synthesis occurs when of peptide bonds.
one of the three stop codons appears in the
5.13 Regulation of gene expression

We have previously established how DNA
is organized into genes, how genes store
genetic information, and how this information
is expressed. We now consider the most
fundamental issues in molecular genetics.
How is genetic expression regulated? Evidence
in support of the idea that genes can be turned
on and off is very convincing. Regulation of
gene expression has been extensively studied
in prokaryotes, especially in E. coli. Gene
expression can be controlled or regulated
at transcriptional or post transcriptional or
translational level. Here, we are going to discuss
regulation of gene expression at transcriptional
level. Usually, small extracellular or intracellular
metabolites trigger initiation or inhibition
of gene expression. The clusters of gene with
related functions are called operons. They
usually transcribe single mRNA molecules.
Fig. 5.13 d- Termination of
the process of translation

In E.coli, nearly 260 genes are grouped into 75 and regulatory gene. When the cell is using its
different operons. normal energy source as glucose, the ‘i’ gene
Structure of the operon: Each operon is a unit transcribes a repressor mRNA and after its
of gene expression and regulation and consists translation, a repressor protein is produced. It
of one or more structural genes and an adjacent binds to the operator region of the operon and
operator gene that controls transcriptional prevents translation, as a result, β-galactosidase is
activity of the structural gene. not produced. In the absence of preferred carbon
source such as glucose, if lactose is available as
i) The structural gene codes for proteins,
an energy source for the bacteria then lactose
rRNA and tRNA required by the cell.
enters the cell as a result of permease enzyme.
ii) Promoters are the signal sequences in
Lactose acts as an inducer and interacts with the
DNA that initiate RNA synthesis. RNA
repressor to inactivate it.
polymerase binds to the promoter prior
The repressor protein binds to the operator
to the initiation of transcription.
of the operon and prevents RNA polymerase
iii) The operators are present between the
from transcribing the operon. In the presence
promoters and structural genes. The
of inducer, such as lactose or allolactose, the
repressor protein binds to the operator
repressor is inactivated by interaction with the
region of the operon.
inducer. This allows RNA polymerase to bind
The Lac (Lactose) operon: The metabolism to the promotor site and transcribe the operon
of lactose in E.coli requires three enzymes to produce lac mRNA which enables formation
– permease, β-galactosidase (β-gal) and of all the required enzymes needed for lactose
transacetylase. The enzyme permease is metabolism (Fig. 5.14). This regulation of
needed for entry of lactose into the cell, lac operon by the repressor is an example of
β-galactosidase brings about hydrolysis negative control of transcription initiation. Lac
of lactose to glucose and galactose, while
transacetylase transfers acetyl
51$3RO\PHUDVH
group from acetyl Co A to XQDEOHWRELQGWR
β-galactosidase. SURPRWRU
,QDEVHQFH
S L S R ] \ D RILQGXFHU
The lac operon consists of one
regulator gene (‘i’ gene refers to 5HSUHVVRUELQGVWRWKHRSHUDWRU
inhibitor) promoter sites (p), 5HSUHVVRUP51$ UHJLRQRDQGSUHYHQWV51$
SRO\PHUDVHIURPWUDQVFULELQJ
and operator site (o). Besides WKHRSHURQ
these, it has three structural

5HSUHVVRU
genes namely lac z,y and lac
a. The lac ‘z’ gene codes for 51$3RO\PHUDVHELQGWRSURPRWRU
,QSUHVHQFH
β-galactosidase, lac ‘y’ gene S L S R ] \ D RILQGXFHU
codes for permease and ‘a’ gene 7UDQVFULSWLRQ

codes for transacetylase.
5HSUHVVRUP51$ ODFP51$
Jacob and Monod proposed
the classical model of Lac operon ] \ D
,QGXFHU 7UDQVODWLRQ
to explain gene expression and
regulation in E.coli. In lac operon, βJDODFWRVLGDVHSHUPHDVHWUDQVDFHW\ODVH
a polycistronic structural gene is ,QDFWLYHUHSUHVVRU
regulated by a common promoter Fig. 5.14 Lac Operon model


operon is also under the control of positive a cell is isolated and converted into random
regulation as well. fragments of relatively smaller sizes and cloned
in suitable hosts using specialized vectors. This
5.14 Human Genome cloning results in amplification of pieces of
Project (HGP) DNA fragments so that it could subsequently
The international human genome project be sequenced with ease. Bacteria and yeast
was launched in the year 1990. It was a mega are two commonly used hosts and these
project and took 13 years to complete. The vectors are called as BAC (Bacterial Artificial
human genome is about 25 times larger than Chromosomes) and YAC (Yeast Artificial
the genome of any organism sequenced to Chromosomes). The fragments are sequenced
date and is the first vertebrate genome to be using automated DNA sequencers (developed
completed. Human genome is said to have by Frederick Sanger). The sequences are then
approximately 3×109 bp. HGP was closely arranged based on few overlapping regions,
associated with the rapid development of a using specialized computer based programs.
new area in biology called bioinformatics. These sequences were subsequently annotated
and are assigned to each chromosome. The
5.14.1 Goals and methodologies of genetic and physical maps on the genome are
Human Genome Project assigned using information on polymorphism
The main goals of Human Genome Project of restriction endonuclease recognition
are as follows sites and some repetitive DNA sequences,
called microsatellites. The latest method of
• Identify all the genes (approximately sequencing even longer fragments is by a
30000) in human DNA. method called Shotgun sequencing using
• Determine the sequence of the three super computers, which has replaced the
billion chemical base pairs that makeup traditional sequencing methods.
the human DNA.
• To store this information in databases. 5.14.2 Salient features of Human
Genome Project:
• Improve tools for data analysis.
• Although human genome contains
• Transfer related technologies to other 3 billion nucleotide bases, the DNA
sectors, such as industries. sequences that encode proteins make up
• Address the ethical, legal and social only about 5% of the genome.
issues (ELSI) that may arise from the • An average gene consists of 3000 bases,
project. the largest known human gene being
The methodologies of the Human Genome dystrophin with 2.4 million bases.
Project involved two major approaches. One • The function of 50% of the genome is
approach was focused on identifying all the derived from transposable elements such
genes that are expressed as RNA (ETSS – as LINE and ALU sequence.
Expressed Sequence Tags). The other approach • Genes are distributed over 24
was sequence annotation. Here, sequencing the chromosomes. Chromosome 19 has the
whole set of genome was taken, that contains all highest gene density. Chromosome 13 and
the coding and non-coding sequences and later Y chromosome have lowest gene densities.
assigning different regions in the sequences with
functions. For sequencing, the total DNA from

• The chromosomal organization of human characterized by looking into the most
genes shows diversity. fundamental causes of disease than treating the
• There may be 35000-40000 genes in the symptoms will be an important advantage.
genome and almost 99.9 nucleotide bases • Once genetic sequence becomes easier
are exactly the same in all people. to determine, some people may attempt
• Functions for over 50 percent of the to use this information for profit or for
discovered genes are unknown. political power.
• Less than 2 percent of the genome codes • Insurance companies may refuse to insure
for proteins. people at ‘genetic risk’ and this would save
the companies the expense of future medical
• Repeated sequences make up very large bills incurred by ‘less than perfect’ people.
portion of the human genome. Repetitive
sequences have no direct coding functions • Another fear is that attempts are being
but they shed light on chromosome made to “breed out” certain genes of
structure, dynamics and evolution people from the human population in
(genetic diversity). order to create a ‘perfect race’.
• Chromosome 1 has 2968 genes whereas

chromosome ’Y’ has 231 genes. Pharmacogenomics
is the study of how
• Scientists have identified about 1.4
million locations where single base
genes affect a person’s
DNA differences (SNPs – Single response to drugs.
nucleotidepolymorphism – pronounce as This relatively new field combines
‘snips’) occur in humans. Identification of pharmacology (the science of drugs)
‘SNIPS’ is helpful in finding chromosomal and genomics (the study of genes and
locations for disease associated sequences their functions) to develop effective,
and tracing human history. safe medications and doses that will be
tailored to a person’s genetic makeup.
5.14.3 Applications and
future challenges
The mapping of human chromosomes is
5.15 DNA fingerprinting technique
possible to examine a person’s DNA and to The DNA fingerprinting technique was first
identify genetic abnormalities. This is extremely developed by Alec Jeffreys in 1985 (Recipient
useful in diagnosing diseases and to provide of the Royal Society’s Copley Medal in 2014).
genetic counselling to those planning to have Each of us have the same chemical structure of
children. This kind of information would also DNA. But there are millions of differences in
create possibilities for new gene therapies. Besides the DNA sequence of base pairs. This makes
providing clues to understand human biology, the uniqueness among us so that each of us
learning about non-human organisms, DNA except identical twins is different from each
sequences can lead to an understanding of their other genetically. The DNA of a person and
natural capabilities that can be applied towards finger prints are unique. There are 23 pairs of
solving challenges in healthcare, agriculture, human chromosomes with 1.5 million pairs
energy production and environmental of genes. It is a well known fact that genes are
remediation. A new era of molecular medicine, segments of DNA which differ in the sequence

of their nucleotides. Not all segments of categories such as micro-satellites, mini-
DNA code for proteins, some DNA segments satellites, etc., These sequences do not code for
have a regulatory function, while others are any proteins, but they form a large portion of
intervening sequences (introns) and still human genome. These sequences show high
others are repeated DNA sequences. In DNA degree of polymorphism and form the basis of
fingerprinting, short repetitive nucleotide DNA fingerprinting (Fig. 5.15). DNA isolated
sequences are specific for a person. These from blood, hair, skin cells, or other genetic
nucleotide sequences are called as variable evidences left at the scene of a crime can be
number tandem repeats (VNTR).The compared through VNTR patterns, with the
VNTRs of two persons generally show DNA of a criminal suspect to determine guilt
variations and are useful as genetic markers. or innocence. VNTR patterns are also useful in
establishing the identity of a homicide victim,
1
either from DNA found as evidence or from
2 Chromosome 7 Chromosome 7
the body itself.
Chromosome 2 Chromosome 2 The Steps in DNA Fingerprinting technique
is depicted in Fig. 5.16.
Chromosome 16 Chromosome 16
1 Paternal Chromosome DNA from individual (A)

1. Extraction of DNA
2 Maternal Chromosome DNA from individual (B) The process of DNA fingerprinting starts
0 11
C A B with obtaining a sample of DNA from
Number of short tandem repeats
12 blood, semen, vaginal fluids, hair roots,

11
Chromosome 7 10
9
teeth, bones, etc.,
8
Chromosome 2
7
6
2. Polymerase chain reaction (PCR)
5
4
3
In many situations, there is only a small
Chromosome 16
2
1 amount of DNA available for DNA
DNA from crime scene (c) Amplified repeats, separated by size on
a gel, give a DNA fingerprint fingerprinting. If needed many copies of
Fig. 5.15 Schematic representation of the DNA can be produced by PCR (DNA
DNA fingerprinting : Few representative amplification).
chromosomes have been shown to contain 3. Fragmenting DNA
different copy number of VNTR DNA is treated with restriction enzymes
which cut the DNA into smaller fragments
DNA finger printing involves identifying at specific sites.
differences in some specific regions in DNA 4. Separation of DNA by electrophoresis
sequence called repetitive DNA, because During electrophoresis in an agarose gel, the
in these sequences, a small stretch of DNA DNA fragments are separated into bands
is repeated many times. These repetitive of different sizes. The bands of separated
DNA are separated from bulk genomic DNA DNA are sieved out of the gel using a nylon
as different peaks during density gradient membrane (treated with chemicals that
centrifugation. The bulk DNA forms a major allow for it to break the hydrogen bonds of
peak and the other small peaks are referred DNA so there are single strands).
to as satellite DNA. Depending on base
5. Denaturing DNA
composition (A : T rich or G : C rich), length
of segment and number of repetitive units, The DNA on gels is denatured by using
the satellite DNA is classified into many sub alkaline chemicals or by heating.

2 3
DNA is extracted DNA is cut into

from blood cells fragments by a
1
restriction enzyme 4
Blood sample
The DNA fragments
are separated into bands
during electrophoresis
11 in an agarose gel
The X-ray film is developed
to make visible the pattern of
bands which is known as a
DNA fingerprint 6 5
The radioactive The DNA band pattern in
DNA probe the gel is transferred to
is prepared a nylon membrane by
10 a technique known
as southern blotting
X-ray film is placed
next to the membrane
to detect the radioactive
pattern 7
The DNA probe binds
to specific DNA
sequences on the
9 membrane
At this stage, the
8
radioactivity probe is
bound to the DNA pattern Excess DNA probe is
on the membrane washed off
Fig. 5.16 Steps in DNA finger printing

6. Blotting corresponding to specific DNA bands.
The DNA band pattern in the gel is The thick and thin dark bands form a
transferred to a thin nylon membrane pattern of bars which constitutes a genetic
placed over the ‘size fractionated DNA fingerprint.
strand’ by Southern blotting.
7. Using probes to identify specific DNA Application of DNA
A radioactive probe (DNA labeled with finger printing
a radioactive substance) is added to the • Forensic analysis - It can be used in the
DNA bands. The probe attaches by base identification of a person involved in
pairing to those restriction fragments that criminal activities, for settling paternity
are complementary to its sequence. The or maternity disputes, and in determining
probes can also be prepared by using either relationships for immigration purposes.
‘fluorescent substance’ or ‘radioactive
• Pedigree analysis – inheritance pattern
isotopes’.
of genes through generations and for
8. Hybridization with probe detecting inherited diseases.
After the probe hybridizes and the excess • Conservation of wild life – protection of
probe washed off, a photographic film endangered species. By maintaining DNA
is placed on the membrane containing records for identification of tissues of the
‘DNA hybrids’. dead endangered organisms.
9. Exposure on film to make a genetic/ • Anthropological studies–It is useful in
DNA Fingerprint determining the origin and migration of
The radioactive label exposes the film human populations and genetic diversities.
to form an image (image of bands)

Summary Jacob and Monod proposed the classical model
In the twentieth century, one of the landmark of Lac operon to explain gene expression and
discovery in biology was the identification of regulation in E. coli. In lac operon a polycistronic
DNA, as genetic material of living organisms. structural gene is regulated by a common
Gene may be defined as a segment of DNA which promoter and regulator. It is an example of
is responsible for inheritance and expression of a negative control of transcription initiation.
particular character. Human genome project, a mega project was
In 1953, James Watson and Francis Crick aimed to sequence every gene in the human
proposed DNA structure based on X-ray genome. Polymerase chain reaction is an in vitro
crystallographic studies provided by Maurice method of synthesis of nucleic acids wherein,
Wilkins and Rosalind Franklin. Nucleotides a specific DNA segment is amplified rapidly
are the structural units of nucleic acids. Each without concomitant replication of the rest of
nucleotide has three components, i) pentose sugar the DNA molecule. DNA fingerprinting is a
ii) nitrogenous base and iii) phosphate. DNA technique to identify variations in individuals of
and RNA are polynucleotides. DNA has double a population at the DNA level. It has immense
stranded helical structure while RNA is a single applications in the field of forensic analysis,
stranded structure. DNA acts as genetic material of pedigree analysis, anthropological studies, and
almost all the living organism except few viruses. conservation of wild life.
The non genetic RNAs are of three types; Evaluation
m-RNA, r-RNA and t-RNA. They help in protein 1. Hershey and Chase
synthesis. DNA has capacity of replication, while experiment with
the three types of RNA are transcribed on DNA. bacteriophage showed
Meselson and Stahl (1958) proved experimentally that
the semi-conservative nature of DNA replication a) P rotein gets into the bacterial cells
using heavy isotope of nitrogen N15 in E.coli. b) DNA is the genetic material
In 1958 Crick proposed that DNA determines c) DNA contains radioactive sulphur
the sequence of amino acids in a polypeptide d) Viruses undergo transformation
(protein) through mRNA, and proposed the 2. DNA and RNA are similar with respect to
central dogma of protein synthesis which a) Thymine as a nitrogen base
involves transcription and translation. The b) A single-stranded helix shape
process of copying genetic information from one c) Nucleotide containing sugars, nitrogen
strand of DNA into RNA is termed transcription. bases and phosphates
The DNA transcribed RNA molecules serve as a d) The same sequence of nucleotides for the
template for the synthesis of polypeptides by a amino acid phenyl alanine
process termed translation. Each amino acid in 3. A mRNA molecule is produced by
a polypeptide chain is represented by a sequence a) Replication b) Transcription
of three nucleotides in the RNA known as the c) Duplication d) Translation
genetic code. RNA transfers genetic message 4. The total number of nitrogenous bases in
from nucleus to the cytoplasm. DNA is always human genome is estimated to be about
present in the nucleus and synthesis is also a) 3.5 million b) 35000
confined to the nucleus c) 35 million d) 3.1 billion

5. E. coli cell grown on 15N medium are 9. Which of the following statements is not
transferred to 14N medium and allowed to true about DNA replication in eukaryotes?
grow for two generations. DNA extracted (a) Replication begins at a single origin of
from these cells is ultracentrifuged in a replication.
cesium chloride density gradient. What (b) Replication is bidirectional from the
density distribution of DNA would you origins.
expect in this experiment? (c) Replication occurs at about 1 million
(a) One high and one low density band. base pairs per minute.
(b) One intermediate density band. (d) There are numerous different
(c) One high and one intermediate density bacterial chromosomes, with
band. replication ocurring in each at the
(d) One low and one intermediate same time.
density band. 10.
The first codon to be deciphered was
6. What is the basis for the difference in the __________ which codes for ________.
synthesis of the leading and lagging strand (a) AAA, proline (b) GGG, alanine
of DNA molecules? (c) UUU, Phenylalanine (d)TTT, arginine
(a) Origin of replication occurs only at the 11. Meselson and Stahl’s experiment proved
5' end of the molecules. (a)Transduction
(b) DNA ligase works only in the 3' → 5' (b) Transformation
direction. (c) DNA is the genetic material
(c)
DNA polymerase can join new (d)
S emi-conservative nature of DNA
nucleotides only to the 3' end of the replication
growing stand.
12. Ribosomes are composed of two subunits;
(d) Helicases and single-strand binding
the smaller subunit of a ribosome has a
proteins that work at the 5' end.
binding site for _________ and the larger
7. Which of the following is the correct subunit has two binding sites for two
sequence of event with reference to the __________.Ans (mRNA, tRNA)
central dogma?
13. An operon is a:
(a) Transcription, Translation, Replication
(b) T ranscription, Replication, Translation (a) Protein that suppresses gene expression
(c) D
uplication, Translation, Transcription (b) P rotein that accelerates gene expression
(d) Replication, Transcription, Translation (c)
C luster of structural genes with
related function
8. Which of the following statements about
(d) Gene that switched other genes on or off
DNA replication is not correct?
(a) Unwinding of DNA molecule occurs 14. When lactose is present in the culture
as hydrogen bonds break. medium:
(b) Replication occurs as each base is (a) Transcription of lac y, lac z, lac a genes
paired with another exactly like it. occurs.
(c) Process is known as semi conservative (b) Repressor is unable to bind to the
replication because one old strand is operator.
conserved in the new molecule. (c) Repressor is able to bind to the
(d) C omplementary base pairs are held operator.
together with hydrogen bonds. (d) Both (a) and (b) are correct.

15. Give reasons: Genetic code is ‘universal’. 27. What are the three structural differences
16. Name the parts marked ‘A’ and ‘B’ in the between RNA and DNA?
given transcription unit: 28. Name the anticodon required to recognize
the following codons: AAU, CGA, UAU,
3’ and GCA.
A
29. a) Identify the figure given below
3’ b) Redraw the structure as a replicating
fork and label the parts
B
3'
17. Differentiate - Leading stand and lagging
5'
strand
3'
18. D
ifferentiate - Template strand and
5'
coding strand.
19. Mention any two ways in which single c)
Write the source of energy for this
nucleotide polymorphism (SNPs) replication and name the enzyme
identified in human genome can bring involved in this process.
revolutionary change in biological and d) Mention the differences in the synthesis
medical science. of protein, based on the polarity of the
20. State any three goals of the human genome two template strands.
project. 30. If the coding sequence in a transcription
21. In E.coli, three enzymes β- galactosidase, unit is written as follows:
permease and transacetylase are produced 5' TGCATGCATGCATGCATGCATGCATGC 3'
in the presence of lactose. Explain why Write down the sequence of mRNA.
the enzymes are not synthesized in the
31. How is the two stage process of protein
absence of lactose.
synthesis advantageous?
22.
Distinguish between structural gene, 32.Why did Hershey and Chase use
regulatory gene and operator gene. radioactively labelled phosphorous
23. A low level of expression of lac operon and sulphur only? Would they have got
occurs at all the windows for treatment the same result if they use radiolabelled
of various genetic disorders. Justify the carbon and nitrogen?
statement. 33. Explain the formation of a nucleosome.
24. Why the human genome project is called 34. It is established that RNA is the first
a mega project? genetic material. Justify giving reasons.
25. From their examination of the structure
of DNA, What did Watson and Crick
infer about the probable mechanism of
DNA replication, coding capability and
mutation?
26. Why tRNA is called an adapter molecule?

Concept Map
&RQFOXVLYHO\
'1$LVWKH 'RXEOHKHOL[ 6SOLFLQJ
6LQJOHVWUDQG
JHQHWLFPDWHULDO QXFOHRVLGHV FDSSLQJ
P51$
QXFOHRWLGHV +HOLFDVH WDLOLQJ
W51$U51$
SRODULW\ LVRPHUDVH
%LRORJLVW
QRW SRO\PHUDVH
+HUVKH\
FRQYLQFHG DQG&KDVH
H[SHULPHQW &LVWURQ
([RQ,QWURQ
'1$LVWKH 51$
*ULIILWK¶V
JHQHWLF
H[SHULPHQW
PDWHULDO 7UDQVFULSWLRQ
5HSOLFDWLRQ XQLW3URPRWRU
'1$ 6WUXFWXUDOJHQH
%DFWHULDO 7HUPLQDWRU
WUDQVIRUPDWLRQ
6HDUFKLQJ
IRUJHQHWLF
PDWHULDO 7UDQVFULSWLRQ
FRGRQVVWRS
0ROHFXODU FRGRQV8QDPELJXRXV
'1$)LQJHU *HQHWLFV VSHFLILFGHJHQHUDWH
*HQHWLF XQLYHUVDO$8*
SULQWLQJ
FRGH LQLWLDWRUFRGRQ
+XPDQ
9175DV JHQRPH 7UDQVODWLRQ
SUREH SURMHFW 5HJXODWLRQ
RIJHQH
H[SUHVVLRQ
&KDUJLQJRIW51$
$PLQRDF\ODWLRQ
,QHXNDU\RWHV± RIW51$8QUHODWHG
WUDQVFULSWLRQDOOHYHO UHJLRQVDQG
,GHQWLI\GHWHUPLQHWKH
97
3URFHVVLQJOHYHO 5HOHDVHIDFWRU
VHTXHQFHVWRUHGDWD
DQDO\VLVWUDQVIHUDQG 7UDQVSRUWRIP51$
(/6, DQG7UDQVODWLRQDO
OHYHO
Molecular Genetics
25-02-2019 18:23:10
ICT CORNER
Molecular Genetics
Lets us explore the gene

expression
Procedure :
Step 1: Use the URL or scan the QR Code to launch the “Gene Expression Essentials” activity
page.
Step 2: Click “Expression” pick the genetic material from the Biomolecule Toolbox,
understand the changes for the three different genes.
Step 3: Click “mRNA” and slide through the slider in Positive Transcription factors and
Negative Transcription factors such as Concentration, Affinity. Also Slide through
“Affinity” in RNA Polymerase.
Step 4: Click “Multiple Cells” and find the average protein level vs Time in the graph indicated
above.
Step 4
Molecular Genetics URL:

https://phet.colorado.edu/sims/html/gene-expression-essentials/
latest/gene-expression-essentials_en.html

*Allow flash player

6
UNIT - II
Evolution
CHAPTER
"Each has his own tree of ancestors, but at the top

Chapter Outline of all sits probably arboreal"
6.1 Origin of life - Evolution of life forms

6.2 Geological time scale
6.3 Biological evolution
6.4 Evidences for biological evolution
T he term evolution is used to describe
heritable changes in one or more
characteristics of a population of species from
6.5 Theories of biological evolution
one generation to the other. The present state
6.6 Mechanism of evolution
of mankind on earth is the outcome of three
6.7 Hardy Weinberg principle kinds of evolution - chemical, organic and
6.8 Origin and evolution of man social or cultural evolution.
6.9 Isolating mechanisms Radiometric dating of meteorites yields
6.10 Speciation an estimated age for the solar system and for
6.11 Extinction of animals earth as around 4.5 – 4.6 billion years. The
new born earth remained inhospitable for at
least few hundred millions years. At first it
Learning Objectives was too hot. This is because the collisions of
the planetesimals that coalesced to form earth
➢ Understands the evolution of life on earth. released much heat to melt the entire planet.
➢ Gains knowledge on theories of evolution. Eventually outer surface of the earth cooled
and solidified to form a crust. Water vapour
➢ Interprets evidences
released from the planet’s interior cooled
(anatomical, embryological and and condensed to form oceans. Hence origin
geological) of evolution. of life can be reconstructed using indirect
➢ Learns the principles of evidences. Consequently, biologists have
biological evolution. turned to gather disparate bits of information
and filling them together like pieces of jig saw
➢ Understands the importance of
puzzle. Many theories have been proposed
gene frequencies in a population. to explain the origin of life. Few have been
➢ Studies the geological time scale. discussed in this chapter.
➢ Understands the importance of isolating
mechanisms in speciation
99 Evolution

6.1 Origin of life – Evolution of physical forces such, as lightning, UV radiations,
life forms volcanic activities, etc.,., Oparin (1924)
suggested that the organic compounds could
Theory of special creation states that
have undergone a series of reactions leading
life was created by a supernatural power,
to more complex molecules. He proposed that
respectfully referred to as “God”. According
the molecules formed colloidal aggregates or
to Hinduism, Lord Brahma created the Earth.
‘coacervates’ in an aqueous environment. The
Christianity, Islam and most religions believe
coacervates were able to absorb and assimilate
that God created the universe, the plants and
organic compounds from the environment.
the animals.
Haldane (1929) proposed that the primordial
According to the theory of spontaneous
sea served as a vast chemical laboratory
generation or Abiogenesis, living organisms
powered by solar energy. The atmosphere
originated from non-living materials and
was oxygen free and the combination of CO2,
occurred through stepwise chemical and
NH3 and UV radiations gave rise to organic
molecular evolution over millions of years.
compounds. The sea became a ‘hot’ dilute
Thomas Huxley coined the term abiogenesis.
soup containing large populations of organic
Big bang theory explains the origin monomers and polymers. They envisaged that
of universe as a singular huge explosion in groups of monomers and polymers acquired
physical terms. The primitive earth had no lipid membranes and further developed into
proper atmosphere, but consisted of ammonia, the first living cell. Haldane coined the term
methane, hydrogen and water vapour. The prebiotic soup and this became the powerful
climate of the earth was extremely high. UV symbol of the Oparin-Haldane view on the
rays from the sun split up water molecules origin of life (1924-1929).
into hydrogen and oxygen. Gradually the
Oparin and Haldane independently
temperature cooled and the water vapour
suggested that if the primitive atmosphere was
condensed to form rain. Rain water filled
reducing and if there was appropriate supply
all the depressions to form water bodies.
of energy such as lightning or UV light then
Ammonia and methane in the atmosphere
a wide range of organic compounds can be
combined with oxygen to form carbon-
synthesized.
dioxide and other gases.
6.2 Geological time scale
Coacervates (large colloidal particles
The duration of the earth’s history has been
that precipitate out in aqueous medium)
divided into eras that include
are the first pre-cells which gradually
the Paleozoic, Mesozoic, and
transformed into living cells.
Cenozoic. Recent eras are
According to the theory of biogenesis further divided into periods,
life arose from pre-existing life. The term which are split into epochs.
biogenesis also refers to the biochemical The geological time scale
process of production of living organisms with the duration of the eras and periods with
This term was coined by Henry Bastian. the dominant forms of life is shown in Table 6.1.
According to the theory of chemical The Paleozoic era is characterized by
evolution primitive organisms in the abundance of fossils of marine invertebrates.
primordial environment of the earth evolved Towards the later half, other vertebrates (marine
spontaneously from inorganic substances and and terrestrial) except birds and mammals
Evolution 100

appeared. The seven periods of Paleozoic era in fishes), Mississippian (earliest amphibians,
order from oldest to the youngest are Cambrian Echinoderms), Pennsylvanian (earliest reptiles),
(Age of invertebrates), Ordovician (fresh Permian (mammal like reptiles).
water fishes, Ostracoderms, various types of Mesozoic era (dominance of reptiles)
Molluscs), Silurian (origin of fishes), Devonian called the Golden age of reptiles, is divided
(Age of fishes, many types of fishes such as into three periods namely Triassic (origin of
lung fishes, lobe finned fishes and ray finned egg laying mammals), Jurassic (Dinosaurs
Table 6.1 Geological Time Scale

YEARS IN
ERA
PERIOD EPOCH FAUNA FLORA

MILLION
Recent Angiosperms
1 Age of Mammals
Quaternary (Holocene) Monocotyledons
6 Pleistocene Age of Human beings
Cenozoic
15 Pliocene Human evolution

Age of
10 Miocene
Angiosperms -
20 Tertiary Oligocene
Mammals and birds Dicotyledons
Eocene
100
Paleocene
Sphenopsides,
125 Cretaceous Ginkgos, Gnetales,
(Dicotyledons)
Mesozoic
(Golden age of
Reptiles) Rise of Herbaceous
150 Jurassic Dinosaurs lycopods, Ferns,
Conifers, Cycads
180 Triassic
Arborescent
205 Permian Mammal like reptiles
lycopods
Earliest Amphibians and Seed ferns and
230 Pennsylvanian
Carboniferous abundant Echinoderms Bryophytes
255 Mississippian Earliest reptiles
Paleozoic
315 Devonian Age of fishes Progymnosperms

Earliest fishes and land
350 Silurian Zosterophyllum
invertebrates
Dominance of Appearance of
430 Ordovician
invertebrates first land plants
510 Cambrian Fossil invertebrates Origin of algae
Upper Multicellular organisms
Precambrian
3000 Middle Appearance of eukaryotes

Planktons
Lower
prokaryotes
101 Evolution

were dominant on the earth, fossil bird – viruses. Two major cell types that appeared
Archaeopteryx) and Cretaceous (extinction during this time were significant. One form of the
of toothed birds and dinosaurs, emergence of earliest cell contained clumps of nucleoproteins
modern birds). embedded in the cell substance. Such cells were
Cenozoic era (Age of mammals) similar to the Monera. They are considered as
ancestral to the modern bacteria and blue green
is subdivided into two periods namely
algae. The other form of earliest cells contained
Tertiary and Quaternary. Tertiary period is
nucleoprotein clumps that condensed into a
characterized by abundant mammalian fauna.
central mass surrounded by a thin membrane.
This period is subdivided into five epochs This membrane separated nucleoproteins from
namely, Paleocene (placental mammals, the cell substances. Such cells were referred
Eocene (Monotremes except duck billed to as Protista. When the natural sources of
Platypus and Echidna, hoofed mammals and food in the ocean declined in course of time
carnivores), Oligocene (higher placental the ancestors of Monera and Protista had to
mammals appeared), Miocene (origin of evolve different methods for food procurement.
first man like apes) and Pliocene (origin of These may be summarized as parasitism,
man from man like apes).Quaternary period saprophytism, predator or animalism and
witnessed decline of mammals and beginning chemosynthesis or photosynthesis. When the
of human social life. number of photosynthetic organisms increased
The age of fossils can be determined there was an increase in the free O2 in the sea
and atmosphere.
using two methods namely, relative dating
and absolute dating. Relative dating is used to CH4+2O2 → CO2 +2H2O
determine a fossil by comparing it to similar 4NH3+3O2 → 2N2+6H2O
rocks and fossils of known age. Absolute The atmospheric oxygen combined with
dating is used to determine the precise age methane and ammonia to form CO2 and free
of a fossil by using radiometric dating to nitrogen. The presence of the free O2 brought
measure the decay of isotopes. about the evolution of aerobic respiration
which could yield large amounts of energy
6.3 Biological evolution by oxidation of food stuffs. Thus Prokaryotes
and Eukaryotes evolved.
Formation of protobionts
Abiotically produced molecules can Experimental approach to the origin
spontaneously self assemble into droplets of life
that enclose a watery solution and maintain Urey and Miller (1953), paved way
a chemical environment different from their
for understanding the possible synthesis of
surroundings. Scientists call these spheres
organic compounds that led to the appearance
as ‘protobionts’. Liposomes are lipids in a
of living organisms is depicted in the Fig. 6.1.
solution that can self assemble into a lipid
bilayer. Some of the proteins inside the In their experiment, a mixture of gases was
liposomes acquired the properties of enzymes allowed to circulate over electric discharge
resulting in fast multiplication of molecules. from an tungsten electrode. A small flask was
The coacervates with nucleoprotein and kept boiling and the steam emanating from
nutrients had a limiting surface membrane that it was made to mix with the mixture of gases
had the characters of a virus or free living genes. (ammonia, methane and hydrogen) in the large
Sub sequently number of genes united to form chamber that was connected to the boiling
‘proto viruses’ somewhat similar to present day water. The steam condensed to form water
Evolution 102

of various geological strata of
Tungsten electrode evolution. Fossilization is the
process by which plant and
Spark discharge animal remains are preserved
Flask
in sedimentary rocks. They fall
under three main categories.
Gaseous mixture
(CH4 + NH3 + H2 + H2O) i) Actual remains – The
Water out original hard parts such as bones,
Condenser teeth or shells are preserved as
Cold water in such in the earth’s atmosphere.
This is the most common method
of fossilization. When marine
animals die, their hard parts such
as bones, shells, etc., are covered
with sediments and are protected
Aqueous medium from further deterioration. They
Boiling water containing organic get preserved as such as they
compounds
are preserved in vast ocean; the
salinity in them prevents decay.
Tap for
withdrawing The sediments become hardened
sample
to form definite layers or strata.
For example, Woolly Mammoth
that lived 22 thousand years ago
were preserved in the frozen
coast of Siberia as such. Several
Fig. 6.1 Diagrammatic representation of Urey-Miller’s human beings and animals living
experiment in the ancient city of Pompeii were
which ran down the ‘U’ tube. Experiment was preserved intact by volcanic ash
conducted continuously for a week and the which gushed out from Mount Vesuvius.
liquid was analysed. Glycine, alanine, beta ii) Petrifaction – When animals die
alanine and aspartic acid were identified. Thus the original portion of their body may be
Miller’s experiments had an insight as to the replaced molecule for molecule by minerals
possibility of abiogenetic synthesis of large and the original substance being lost through
amount of variety of organic compounds in disintegration. This method of fossilization
nature from a mixture of sample gases in which is called petrifaction. The principle minerals
the only source of carbon was methane. Later
involved in this type fossilization are iron
in similar experiments, formation of all types of
pyrites, silica, calcium carbonate and
amino acids, and nitrogen bases were noticed.
bicarbonates of calcium and magnesium.
6.4 Evidences for iii) Natural moulds and casts – Even
biological evolution after disintegration, the body of an animal
might leave indelible impression on the soft
6.4.1 Paleontological evidences mud which later becomes hardened into
Paleontology is the study of prehistoric
stones. Such impressions are called moulds.
life through fossils. Fossils are described as
The cavities of the moulds may get filled up
the true witnesses of evolution or documents
103 Evolution

by hard minerals and get fossilized, which are homologous structures that brings about
called casts. Hardened faecal matter termed divergent evolution (Fig 6.2).
as coprolites occur as tiny pellets. Analysis of Similarly the thorn of Bougainvillea and
the coprolites enables us to understand the the tendrils of Curcurbita and Pisum sativum
nature of diet the pre-historic animals thrived represent homology. The thorn in former is
on. used as a defence mechanism from grazing
animals and the tendrils of latter is used as a
Visit any museum nearer to your
support for climbing.
school with your teacher and identify
the bones of different animals including Analogous structures
mammals. The famous Egmore Museum Organisms having different structural
is in Chennai. patterns but similar function are termed as
analogous structures. For example, the wings
6.4.2 Evidences from of birds and insects are different structurally
comparative anatomy but perform the same function of flight that
Similarities in structure between groups brings about convergent evolution (Fig. 6.3).
of organisms are accepted as indicators of
relationship. For example, a comparative study
of the forelimbs of different vertebrates exhibits Ulna
Carpals
a fundamental plan of similarity in structure.
Radius
These relationships can be studied under Humerus
homologous organs, analogous organs, vestigial
organs, connecting links and atavistic organs.
Homologous structures
In vertebrates, comparative anatomical
studies reveal a basic plan in various
structures such as fore limbs and hind limbs.
Fore limbs of vertebrates exhibit anatomical
similarity with each other and is made of
similar bones such as humerus, radius, ulna,
carpals, metacarpals and phalanges. Forewing
Bird Bat
Hindwing
Human
Whale Cat Horse
Humerus Ulna Radius Carpals Phalanges
Fig. 6.2 Forelimbs of terrestrial vertebrates to Fig. 6.3 Comparison of insect and bird wing
show homology to show their analogy
Structures which are similar in origin Other examples of analogous organs
but perform different functions are called include the eyes of the Octopus and of
Evolution 104

mammals and the flippers of Penguins include coccyx, wisdom teeth, ear muscles,
and Dolphins. Root modification in sweet body hair, mammae in male, nictitating
potato and stem modification in potato are membrane of the eye, etc.,
considered as analogous organs. Both of these
plants have a common function of storage of
Connecting link
food. The organisms which possess the
characters of two different groups (transitional
Vestigial organs stage) are called connecting links. Example
Peripatus (connecting link between Annelida
Structures that are of no use to the
and Arthropoda), Archeopteryx (connecting
possessor, and are not necessary for their
link between Reptiles and Aves).
existence are called vestigial organs. Vestigial
organs may be considered as remnants of Atavistic organs
structures which were well developed and Sudden appearance of vestigial organs in
functional in the ancestors, but disappeared highly evolved organisms is called atavistic
in course of evolution due to their non- organs. Example, presence of tail in a human
utilization. Human appendix is the remnant baby is an atavistic organ.
of caecum which is functional in the digestive 6.4.3 Embryological evidences
tract of herbivorous animals like rabbit. Embryology deals with the study of the
Cellulose digestion takes place in the caecum development of individual from the egg to the
of these animals. Due to change in the diet adult stage. A detailed study of the embryonic
containing less cellulose, caecum in human development of different forms makes us to
became functionless and is reduced to a think that there is a close resemblance during
vermiform appendix, which is vestigial. Other development.
examples of vestigial organs in human beings The development of heart in all vertebrates
follows the same pattern of development as a
pair of tubular structures
)LVK 6DODPDQGHU 7RUWRLVH &KLFN +XPDQ that later develop into
two chambered heart in
fishes, three chambered in
amphibians and in most
3KDU\QJHDO 3RVWDQDO reptiles and four chambered
SRXFKHV WDLO
in crocodiles, birds and
mammals; indicating a
common ancestry for all the
vertebrates,
Hence scientists in the
19th century concluded that
higher animals during their
embryonic development
pass through stages of lower
animals (ancestors). Ernst
Von Haeckel, propounded
the “biogenetic law or
Fig 6.4 Embryological evidences
105 Evolution

theory of recapitulation” which states 6.5 Theories of biological evolution
that the life history of an individual
(ontogeny) briefly repeats or recapitulates the 6.5.1 Lamarck’s theory
evolutionary history of the race (phylogeny). Jean Baptiste de Lamarck, was the first
In other words “Ontogeny recapitulates to postulate the theory of evolution in his
Phylogeny”. The embryonic stages of a famous book ‘Philosophie Zoologique’ in the
higher animal resemble the adult stage of its year 1809. The two principles of Lamarckian
ancestors. Appearance of pharyngeal gill slits, theory are:
yolk sac and the appearance of tail in human i. The theory of use and disuse - Organs
embryos are some of the examples (Fig. 6.4). that are used often will increase in size and
The biogenetic law is not universal and it is those that are not used will degenerate. Neck
now thought that animals do not recapitulate in giraffe is an example of use and absence
the adult stage of any ancestors. The human of limbs in snakes is an example for disuse
embryo recapitulates the embryonic history theory.
and not the adult history of the organisms. ii. The theory of inheritance of
acquired characters - Characters that are
The comparative study of the embryo of
developed during the life time of an organism
different animals shows structural similarities
are called acquired characters and these are
among themselves. The embryos of fish,
then inherited.
salamander, tortoise, chick and human start
life as a single cell, the zygote, and undergo The main objection to Lamarckism
cleavage to produce the blastula, change to Lamarck’s “Theory of Acquired
gastrula and are triploblastic. This indicates characters” was disproved by August
that all the above said animals have evolved Weismann who conducted experiments on
from a common ancestor. mice for twenty generations by cutting their
Molecular evidences tails and breeding them. All mice born were
with tail. Weismann proved that change in the
Molecular evolution is the process
somatoplasm will not be transferred to the
of change in the sequence composition of
next generation but changes in the germplasm
molecules such as DNA, RNA and proteins
will be inherited.
across generations. It uses principles of
evolutionary biology and population genetics Neo-Lamarckism
to explain patterns in the changes of molecules. The followers of Lamarck (Neo-
One of the most useful advancement in the Lamarckists) like Cope, Osborn, Packard and
development of molecular biology is proteins and Spencer tried to explain Lamarck’s theory on
other molecules that control life processes are a more scientific basis. They considered that
conserved among species. A slight change that adaptations are universal. Organisms acquire
occurs over time in these conserved molecules new structures due to their adaptations to
(DNA, RNA and protein) are often called the changed environmental conditions. They
molecular clocks. Molecules that have been used argued that external conditions stimulate the
to study evolution are cytochrome c (respiratory somatic cells to produce certain ‘secretions’
pathway) and rRNA (protein synthesis). which reach the sex cells through the blood
and bring about variations in the offspring.
Evolution 106

6.5.2 Darwin’s theory of Natural found in an organism help them to overcome
Selection struggle and such variations are passed on to the
Charles Darwin explained the theory of next generation.
evolution in his book ‘The Origin of Species by 4. Origin of species by Natural Selection
Natural Selection’. During his journey around According to Darwin, nature is the most
the Earth, he made extensive observations of powerful selective force. He compared origin
plants and animals. He noted a huge variety
of species by natural selection to a small
and remarkable similarities among organisms
isolated group. Darwin believed that the
and their adaptive features to cope up to their
struggle for existence resulted in the survival
environment. He proved that fittest organisms
of the fittest. Such organisms become better
can survive and leave more progenies than the
unfit ones through natural selection. adapted to the changed environment.
Darwin’s theory was based on several facts, Objections to Darwinism
observations and influences. They are:
Some objections raised against Darwinism
1. Over production (or) prodigality of
were –
production
• D
arwin failed to explain the mechanism
All living organisms increase their
population in larger number. For example, of variation.
Salmon fish produces about 28 million eggs • D
arwinism explains the survival of the
during breeding season and if all of them hatch, fittest but not the arrival of the fittest.
the seas would be filled with salmon in few • H
e focused on small fluctuating variations
generations. Elephant, the slowest breeder that that are mostly non-heritable.
can produce six young ones in its life time can
• H
e did not distinguish between somatic
produce 6 million descendants at the end of 750
and germinal variations.
years in the absence of any check.
2. Struggle for existence • H
e could not explain the occurrence of
Organisms struggle for food, space and vestigial organs, over specialization of
mate. As these become a limiting factor, some organs like large tusks in extinct
competition exists among the members of mammoths, oversized antlers in the
the population. Darwin denoted struggle for extinct Irish deer, etc.,
existence in three ways –
Neo Darwinism
Intra specific struggle between the same
species for food, space and mate. Neo Darwinism is the interpretation
Inter specific struggle with different species of Darwinian evolution through Natural
for food and space. Selection as it has been modified since it
Struggle with the environment to cope was proposed. New facts and discoveries
with the climatic variations, flood, earthquakes, about evolution have led to modifications
drought, etc., of Darwinism and is supported by Wallace,
3. Universal occurrence of variations Heinrich, Haeckel, Weismann and Mendel.
No two individuals are alike. There are This theory emphasizes the change in the
variations even in identical twins. Even the frequency of genes in population arises due
children born of the same parents differ in colour, to mutation, variation, isolation and Natural
height, behavior, etc., The useful variations selection.
107 Evolution

6.5.3 Mutation theory iii. Genetic recombination is due to crossing
Hugo de Vries put forth the Mutation over of genes during meiosis. This brings
theory. Mutations are sudden random changes about genetic variations in the individuals
that occur in an organism that is not heritable. De of the same species and leads to heritable
Vries carried out his experiments in the Evening variations.
Primrose plant (Oenothera lamarckiana) and iv. Natural selection does not produce any
observed variations in them due to mutation. genetic variations but once such variations
According to de Vries, sudden and large occur it favours some genetic changes
variations were responsible for the origin of new while rejecting others (driving force of
species whereas Lamarck and Darwin believed evolution).
in gradual accumulation of all variations as the v. Reproductive isolation helps in
causative factors in the origin of new species. preventing interbreeding between related
organisms.
Salient features of Mutation Theory
• M utations or discontinuous variation are 6.5.5 Evolution by anthropogenic
transmitted to other generations. sources
• In naturally breeding populations, mutations Natural Selection (Industrial melanism)
occur from time to time. Natural selection can be explained
• There are no intermediate forms, as they are clearly through industrial melanism.
fully fledged. Industrial melanism is a classical case of
• They are strictly subjected to natural Natural selection exhibited by the peppered
selection. moth, Biston betularia. These were available
6.5.4 Modern synthetic theory in two colours, white and black. Before
Sewell Wright, Fisher, Mayer, Huxley, industrialization peppered moth both
Dobzhansky, Simpson and Haeckel explained white and black coloured were common in
Natural Selection in the light of Post-Darwinian England. Pre-industrialization witnessed
discoveries. According to this theory gene white coloured background of the wall of
mutations, chromosomal mutations, genetic the buildings hence the white coloured
recombinations, natural selection and moths escaped from their predators. Post
reproductive isolation are the five basic factors industrialization, the tree trunks became
involved in the process of organic evolution. dark due to smoke and soot let out from the
industries. The black moths camouflaged on
i. Gene mutation refers to the changes in the
the dark bark of the trees and the white moths
structure of the gene. It is also called gene/
were easily identified by their predators.
point mutation. It alters the phenotype of
Hence the dark coloured moth population
an organism and produces variations in
was selected and their number increased
their offspring.
when compared to the white moths. Nature
ii. Chromosomal mutation refers to the
offered positive selection pressure to the
changes in the structure of chromosomes
black coloured moths. The above proof shows
due to deletion, addition, duplication,
that in a population, organisms that can adapt
inversion or translocation. This too
will survive and produce more progenies
alters the phenotype of an organism and
resulting in increase in population through
produces variations in their offspring.
natural selection.
Evolution 108

Artificial selection is a byproduct of different species to utilize different food
human exploitation of forests, oceans and resources such as insects, seeds, nectar from
fisheries or the use of pesticides, herbicides cactus flowers and blood from iguanas, all
or drugs. For hundreds of years humans have driven by Natural selection. Fig. 6.6 represents
selected various types of dogs, all of which are some of the finches observed by Darwin.
variants of the single species of dog. If human Genetic variation in the ALX1 gene in the
beings can produce new varieties in short DNA of Darwin finches is associated with
period, then “nature” with its vast resources variation in the beak shape. Mild mutation in
and long duration can easily produce new the ALX1 gene leads to phenotypic change in
species by selection. the shape of the beak of the Darwin finches.
6.5.6 Adaptive Radiation Marsupials in Australia and placental
The evolutionary process which produces mammals in North America are two
new species diverged from a single ancestral subclasses of mammals they have adapted
form becomes adapted to newly invaded in similar way to a particular food resource,
habitats is called adaptive radiation. Adaptive locomotory skill or climate. They were
radiations are best exemplified in closely separated from the common ancestor more
related groups that have evolved in relatively than 100 million year ago and each lineage
short time. Darwin’s finches and Australian continued to evolve independently. Despite
marsupials are best examples for adaptive temporal and geographical separation,
radiation. When more than one adaptive marsupials in Australia and placental
radiation occurs in an isolated geographical mammals in North America have produced
area, having the same structural and varieties of species living in similar habitats
functional similarity it is due to convergent with similar ways of life. Their overall
evolution. resemblance in shape, locomotory mode,
feeding and foraging are superimposed
Darwin’s finches upon different modes of reproduction. This
Their common ancestor arrived on the feature reflects their distinctive evolutionary
Galapagos about 2 million years ago. During relationships.
that time, Darwin's finches have evolved into Over 200 species of marsupials live in
14 recognized species differing in body size, Australia along with many fewer species of
beak shape and feeding behavior. Changes in placental mammals. The marsupials have
the size and form of the beak have enabled undergone adaptive radiation to occupy
the diverse habitats in Australia, just as the
placental mammals have radiated across
Warbler finch
(Certhidea olivacea) Cactus ground finch
North America.
(Geospiza scandens)
6.6 Mechanism of evolution

Woodpecker finch
(Cactospiza pallida) Warbler Sharp-beaked ground
finch finch (Geospiza difficilis)
Small insectivorous
tree finch Small ground
Microevolution (evolution on a
bing bills
(Camarhynchus
parvulus) Pro
Gr
ou
finch (Geospiza
fuliginosa) small scale) refers to the changes in allele
r
C
s eate
s
nd hing
frequencies within a population. Allele

he
Large insectivorous
ills
ru
fin
nc
Medium
s
gb
Insect
ch
tree finch
e fi
Cactu
ground finch
es
pin
frequencies in a population may change due to

(Camarhynchus eaters
Tre
(Geospiza fortis)
bills
Gras
psittacula) Seed
eaters
Bud eater Large ground four fundamental forces of evolution such as
Vegetarian tree finch (Geospiza
finch (Platyspiza
crassirostris)
Parrot-like bill magnirostris) natural selection, genetic drift, mutation and
gene flow.
Fig 6.5 Darwin’s finches
109 Evolution

6.6.1 Natural selection storm clustered around the extremes of the
It occurs when one allele (or combination variation showing stabilizing selection.
of alleles of differences) makes an organism ii. Directional Selection: The environment
more or less fit to survive and reproduce which undergoes gradual change is subjected
in a given environment. If an allele reduces to directional selection (Fig. 6. 7b). This
fitness, its frequencies tend to drop from one type of selection removes the individuals
generation to the next. from one end towards the other end of
The evolutionary path of a given gene phenotypic distribution. For example,
i.e., how its allele's change in frequency in the size differences between male and female
population across generation, may result from sparrows. Both male and female look alike
several evolutionary mechanisms acting at externally but differ in body weight. Females
once. For example, one gene’s allele frequencies show directional selection in relation to
might be modified by both gene flow and body weight.
genetic drift, for another gene, mutation
may produce a new allele, that is favoured by iii. Disruptive Selection (centrifugal selection):
natural selection (Fig. 6.6). When homogenous environment changes
into heterogenous environment this type
Selection
of selection is operational (Fig. 6.7c). The
There are mainly three types of natural organisms of both the extreme phenotypes
selection are selected whereas individuals with
i. Stabilising Selection (centipetal selection): average phenotype are eliminated. This
This type of selection operates in a stable results in splitting of the population into
environment (Fig. 6.7a). The organisms sub population/species. This is a rare form
with average phenotypes survive whereas of selection but leads to formation of two
the extreme individuals from both the ends or more different species. It is also called
are eliminated. There is no speciation but the adaptive radiation. E.g. Darwin's finches-
phenotypic stability is maintained within the beak size in relation to seed size inhabiting
population over generation. For example, Galapagos islands.
measurements of sparrows that survived Group selection and sexual selection are
the storm clustered around the mean, and other types of selection. The two major group
the sparrows that failed to survive the selections are Altrusim and Kin selection.
Dark rock environment Next generation
light grey beetles

are spotted and eaten
Aa by birds more often Aa
AA
AA
than dark ones
Aa AA
aa aa If ‘X’ is eaten by aa AA Aa
aa AA
Aa birds then only
Aa survivors reproduce
aa aa Aa aa Aa
Fig 6.6 Natural selection
Evolution 110

Medium-sized
Number of individuals
Phenotypes individuals
are favoured
with phenotype
favoured
by natural
selection
Peak gets higher Peak shifts in

and narrower one direction
Two peaks form
(a) (b) (c)
Fig 6.7 Operation of natural selection on different traits (a) Stabilising (b) Directional and (c) Disruptive
6.6.2 Gene flow (Fig. 6.9). It may result in a loss of some

Movement of genes through gametes or alleles (including beneficial ones) and fixation
movement of individuals in (immigration) and of other alleles. Genetic drift can have major
out (emigration) of a population is referred to as effects, when the population is reduced in size
gene flow. Organisms and gametes that enter the by natural disaster due to bottle neck effect or
population may have new alleles or may bring when a small group of population splits from
in existing alleles but in different proportions the main population to form a new colony due
than those already in the population. Gene flow
to founder’s effect.
can be a strong agent of evolution (Fig 6.8).
AA 'XHWRFKDQFH
HYHQWVRQO\
WKHVHEHHWOHV
$D JLYHVULVHWR 1H[WJHQHUDWLRQ
Migration $$ RIIVSULQJV
AA AA $D
DD DD
aa $D
DD
AA $D
aa
aa DD DD
AA )UHTXHQF\RI$
)UHTXHQF\RI$
aa )UHTXHQF\RID )UHTXHQF\RID
Fig 6.8 Gene flow Fig 6.9 Genetic drift
6.6.3 Genetic drift / Sewall 6.6.4 Mutation

Wright Effect Although mutation is the original source
of all genetic variation, mutation rate for
Genetic drift is a mechanism of evolution in
most organisms is low. Hence new mutations
which allele frequencies of a population change on an allele frequencies from one generation
over generation due to chance (sampling error). to the next is usually not large.
Genetic drift occurs in all population sizes,
but its effects are strong in a small population
111 Evolution

6.7 Hardy - Weinberg Principle q2= frequency of aa
In nature, populations are usually p = 0.3, q = 0.7 then,
evolving such as the grass in an open meadow, p2 = (0.3)2 = 0.09 = 9 % AA
wolves in a forest and bacteria in a person’s 2pq = 2(0.3) (0.7) = 0.42 = 42 % Aa
body are all natural populations. All of these q2 = (0.7)2 0.49 = 49 % aa
populations are likely to be evolving some Hence the beetle population appears to
of their genes. Evolution does not mean that be in Hardy- Weinberg equilibrium. When
the population is moving towards perfection the beetles in Hardy- Weinberg equilibrium
rather the population is changing its genetic reproduce, the allele and genotype frequency
makeup over generations. For example in a in the next generation would be: Let’s assume
wolf population, there may be a shift in the that the frequency of ‘A’ and ‘a’ allele in the
frequency of a gene variant for black fur than pool of gametes that make the next generation
grey fur. Sometimes, this type of change is would be the same, then there would be
due to natural selection or due to migration no variation in the progeny. The genotype
or due to random events. frequencies of the parent appears in the next
First we will see the set of conditions generation. (i.e. 9% AA, 42% Aa and 49% aa).
required for a population not to evolve. Hardy If we assume that the beetles mate
of UK and Weinberg of Germany stated that randomly (selection of male gamete and
the allele frequencies in a population are female gamete in the pool of gametes), the
stable and are constant from generation to probability of getting the offspring genotype
generation in the absence of gene flow, genetic depends on the genotype of the combining
drift, mutation, recombination and natural parental gametes.
selection. If a population is in a state of Hardy
Hardy Weinberg’s assumptions include
Weinberg equilibrium, the frequencies of
alleles and genotypes or sets of alleles in that No mutation – No new alleles are generated
population will remain same over generations. by mutation nor the genes get duplicated or
Evolution is a change in the allele frequencies deleted.
in a population over time. Hence population Random mating – Every organism gets a
in Hardy Weinberg is not evolving. chance to mate and the mating is random
Suppose we have a large population of with each other with no preferences for a
beetles, (infinitely large) and appear in two particular genotype.
colours dark grey (black) and light grey, and No gene flow - Neither individuals nor
their colour is determined by ‘A’ gene. ‘AA’ their gametes enter (immigration) or exit
and ‘Aa’ beetles are dark grey and ‘aa’ beetles (emigration) the population.
are light grey. In a population let’s say that ‘A’ Very large population size - The population
allele has frequency (p) of 0.3 and ‘a’ allele has should be infinite in size.
a frequency (q ) of 0.7. Then p+q=1. No natural selection- All alleles are fit to
If a population is in Hardy Weinberg survive and reproduce.
equilibrium, the genotype frequency can If any one of these assumptions were not
be estimated by Hardy Weinberg equation. met, the population will not be in Hardy-
(p + q)2 = p2 + 2pq + q2 Weinberg equilibrium. Only if the allele
p2 = frequency of AA frequencies changes from one generation to
2pq= frequency of Aa the other, evolution will take place.
Evolution 112

6.8 Origin and Evolution of Man of modern human found from the rocks of
Cro-Magnon, France and is considered as the
Mammals evolved in
ancestor of modern Europeans. They were
the early Jurassic period,
not only adapted to various environmental
about 210 million years ago.
conditions, but were also known for their cave
Hominid evolution occurred
paintings, figures on floors and walls.
in Asia and Africa. Hominids
Homo sapiens or modern human arose in
proved that human beings
Africa some 25,000 years ago and moved to
are superior to other animals and efficient in
other continents and developed into distinct
making tools and culture. The earliest fossils
races. They had a brain capacity of 1300 –
of the prehistoric man like Ramapithecus and
1600 cc. They started cultivating crops and
Sivapithecus lived some 14 mya and were derived
domesticating animals.
from ape like Dryopithecus. Dryopithecus and
Ramapithecus were hairy and walked like 6.9 Isolating Mechanism
gorillas and chimpanzees. Australopithecus Isolation is the separation of the members
lived in East African grasslands about 5 mya of a single population into sub populations so
and was called the Australian ape man. He was that genetic integrity of the subpopulation can
about 1.5 meters tall with bipedal locomotion, be maintained. Closely related species living in
omnivorous, semi erect, and lived in caves. Low the same area do not breed together; they are
forehead, brow ridges over the eyes, protruding prevented by isolating barriers. An isolating
face, lack of chin, low brain capacity of about 350 barrier is any evolved character of the two
– 450 cc, human like dentition, lumbar curve in species that stops them from interbreeding.
the vertebral column were his distinguishing Several kinds of isolating barriers are
features. Homo habilis lived about 2 mya. Their distinguished. The most important distinction
brain capacity was between 650 – 800cc, and is Prezygotic and post zygotic isolation.
was probably vegetarian. They had bipedal Prezygotic mechanisms include those which
locomotion and used tools made of chipped prevent two species from coming into contact.
stones. This includes ecological, seasonal, ethological
Homo erectus the first human like being was and morphological. Post zygotic mechanisms
around 1.7 mya and was much closer to human are those which act after fertilization that
in looks, skull was flatter and thicker than the include hybrid sterility, hybrid inviability and
modern man and had a large brain capacity of hybrid breakdown.
around 900 cc. Homo erectus probably ate meat. i. Ecological isolation or habitat isolation
Homo ergaster and Homo erectus were – the members of the same population
the first to leave Africa. Neanderthal human may be separated from one another by a
was found in Neander Valley, Germany with a differences in their habitat. For example
brain size of 1400 cc and lived between 34,000 - Rana areolata occupies burrows dug
1,00,000 years ago. They differ from the modern by mammals and tortoises during
human in having semierect posture, flat cranium, the day and breeds in grassy shallow
sloping forehead, thin large orbits, heavy brow ponds whereas Rana grylio breeds in
ridges, protruding jaws and no chin. They used deep waters. Due to the difference in
animal hides to protect their bodies, knew the their habitat the two species are able
use of fire and buried their dead. They did not to maintain their respective species
practice agriculture and animal domestication. identities.
Cro-Magnon was one of the most talked forms
113 Evolution

ii. Seasonal isolation – In this type of vii. Hybrid inviability – In this type, the
isolation, difference in the breeding sperm enters the egg, fertilization occurs
seasons prevents interbreeding. E.g. and the embryo develops into the adult
Toad, Bufo americanus breeds much but it dies before reaching maturity.
early in the spring; whereas Bufo In certain fishes, frogs, beetles, even if
fowleri breeds very late in the season. fertilization takes place between two
They are able to maintain their species species, due to genetic incompatibility
identity because of the differences in the they do not leave any surviving offspring.
breeding seasons. viii. Hybrid sterility – In this type,
iii. Sexual or ethological isolation/ hybrids are formed due to inter specific
Behavioural isolation – Prevents crosses but they are sterile due to the
mating due to the difference in their failure of the chromosomes to segregate
sexual behavior. The species are not normally during meiosis, example Mule
separated from one another either in (inter specific cross between a horse and
time or in space. The mating calls of a donkey).
two closely related species of frogs, ix. Hybrid breakdown – F1 Hybrids are
Hyla versicolor (grey tree frog) and viable and fertile, but F2 hybrids may be
Hyla femoralis (pine wood tree frog) are inviable or sterile.
different which prevents interbreeding.
iv. Morphological isolation or mechanical 6.10 Speciation
isolation – This type of isolation is The process by which one species evolves
due to the differences in their external into one or more different species is called
genitalia that is seen in two different speciation. A.E. Emerson defines species
species. The size difference between the as a ‘genetically distinctive, reproductively
toad species Bufo quercicus and Bufo isolated natural population’. Speciation is a
valliceps, prevents their interbreeding. fundamental process in evolution. Evolution
v. Physiological isolation –Though of a new species in a single lineage is called an
mating may occur, the gametes are agenesis / phyletic speciation. If one species
prevented from fertilization due to diverges to become two or more species it is
mechanical or physiological factors. cladogenesis or divergent evolution.
E.g. The sperms of Drosophila virilis 6.10.1 Sympatric speciation/
survive only for about a day when Reproductive isolation
introduced into the sperm receptacle of It is a mode of speciation through which
Drosophila americana while the sperms new species form from a single ancestral
of Drosophila americana live for a longer species while both species continue to inhabit
time. the same geographical region. Two or more
vi. Cytological isolation – Fertilization species are involved. New species formed due
does not take place due to the to genetic modification in the ancestor that
differences in the chromosome numbers is naturally selected can no longer breed with
between the two species, the bull frog the parent population. Sexual isolation is
Rana catesbiana and gopher frog Rana strongest. Phenotypic plasticity has emerged
areolata. as potentially important first step in speciation
initiated within an isolated population.
Evolution 114

impact of extinction can conveniently be
Phenotypic plasicity is the ability of considered at three levels.
single genotype to produce more than
Species extinction eliminates an entire
one phenotype. When this plasticity is
species, by an environmental event (flood
expressed seasonally in planktons, it is
etc.,) or by biological event (disease or non
referred to as cyclomorphosis.
availability of food resource half or more).
Table 6.2 Details of the five major mass
extinctions since the Cambrian period
6.10.2 Allopatric speciation/ Estimated
Geographical speciation % of Marine
Date
It is a mode of speciation that occurs Extinction Period Animal
(Mya)
when biological populations of similar Extinction
Genera Species
species become isolated from each other that End of the
prevents gene flow. One species becomes 440 61 85
Ordovician
two species due to geographical barriers
End of the Devonian 365 55 82
hence new species is evolved e.g. Darwin's
End of the Permian 245 84 96
finches. The barriers are land separation,
End of the Triassic 208 50 76
migration or mountain formation. When
barriers occur between species, change in End of the Cretaceous 65 50 76
ecological conditions and environment leads
to adaptations that produce differences. Mass extinction eliminates half or more
If there are no adaptations, they will not species in a region or ecosystem, as might
survive. Sexual isolation is weakest. occur following a volcanic eruption. Five
A well studied example is the adaptation major mass extinction that occurred since
of Apple maggots that feed on apples in the Cambrian period. This mass extinction is
North America. When the apple trees were often referred to as K-T extinction. Table 6.2
imported to North America, Apple maggot represents the K-T extinction.
flies (Rhagoletis pomonella) a parasitic
K-T Extinction refers to the German
insect that normally laid its eggs in the
word Cretaceous and Tertiary periods.
fruit of wild hawthorns until one subset of
population began to lay its eggs in the fruit of Global extinction eliminates most of
domesticated apple trees (Malus domestica) the species on a large scale or larger
that grew in the same area. This small group taxonomic groups in the continent or the
of apple maggot flies selected a different Earth. Snow ball Earth and extinction
host species from the rest of the population following elevation in CO 2 levels are
and its offsprings became accustomed to example. Extinction events opens up new
domesticated apples. habitats and so can facilitate the radiation
6.11 Extinction of Animals of organisms that survived the mass
extinction.
Extinction
Summary
Extinction was common if not inevitable
Evolutionary Biology is the study
because species could not always adapt to
of history of life forms on Earth which
large or rapid environmental changes. The
originated on Earth millions of years ago.
115 Evolution

How Earth originated, how life originated, 3) hich of the following was the contribution
W
what is the place of man in the universe are of Hugo de Vries?
all general questions. This chapter deals with
a) Theory of mutation
several theories to explain the life on Earth.
Evidence from the fossil record and many b) Theory of natural Selection
other areas of biology like embryology, c
)
Theory of inheritance of acquired
anatomy and molecular biology indicates a characters
common ancestry.
d) Germplasm theory
The theories advanced by Lamarck, 4) e wings of birds and butterflies is an
Th
Darwin, Hugo de Vries explained the intricate
example of
evolutionary process. Geological time scale
with different eras, periods and epochs gives a) Adaptive radiation
an idea about the dominant species in those b) convergent evolution
days. The mathematical distribution of gene c) divergent evolution
and genotype frequencies remains constant in
a small population was contributed by Hardy d) variation
and Weinberg in 1608. Natural Selection and 5) e phenomenon of “ Industrial Melanism”
Th
gene pool are the important factors those demonstrates
affect Hardy Weinberg equilibrium.
a) Natural selection
Human evolution states that humans b) induced mutation
developed from primates or ape like
c) reproductive isolation
ancestors. The emergence of Homo sapiens
as a distinct species from apes and placental d) geographical isolation
mammals in brain size, eating habit and other 6) Darwin’s finches are an excellent example of
behavior proves that ‘Ontogeny recapitulates
a) connecting links b) seasonal migration
Phylogeny’.
c) adaptive radiation d) parasitism
Separation of a single population into
its subunits preserves the genetic integrity. 7) Who proposed the Germplasm theory?
Types of isolating mechanism and speciation a ) Darwin b) August Weismann
prevent interbreeding of different species. c) Lamarck d) Alfred Wallace
Various causes of extinction of animals and
8) The age of fossils can be determined by
the levels of impact are dealt with in the
lesson. a) electron microscope
b) weighing the fossils
Evaluation c) carbon dating
1) e first life on earth
Th d) analysis of bones
originated
9) Fossils are generally found in
a) in air b) on land
a) igneous rocks b) metamorphic rocks
c) in water d) on mountain
c) volcanic rocks d) sedimentary rocks
2) ho published the book “Origin of species
W
10) Evolutionary history of an organism is called
by Natural Selection” in 1859?
a) ancestry b) ontogeny
a) Charles Darwin b) Lamarck
c) phylogeny d) paleontology
c) Weismann d) Hugo de Vries
Evolution 116

11) The golden age of reptiles was 25) How does Mutation theory of De Vries
a) Mesozoic era b) Cenozoic era differ from Lamarck and Darwin’s view
in the origin of new species.
c) Paleozoic era d) Proterozoic era
26) Explain stabilizing, directional and
12) Which period was called “Age of fishes”?
disruptive selection with examples.
a) Permian b) Triassic
27) Rearrange the descent in human evolution
c) Devonian d) Ordovician ustrolopithecus → Homo erectus → Homo
A
13) Modern man belongs to which period? sapiens → Ramapithecus → Homo habilis.
a) Quaternary b) Cretaceous 28) Differentiate between the eating habit
c) Silurian d) Cambrian and brain size of Australopithecus and
Ramapithecus.
14) The Neanderthal man had the brain capacity of
29) How does Neanderthal man differ from
a) 650 – 800cc b) 1200cc
the modern man in appearance?
c) 900cc d) 1400cc 30) Mention any three similarities found
15) List out the major gases seems to be found in common in Neanderthal man and
the primitive earth. Homo sapiens.
16) Explain the three major categories in which 31) Define isolating mechanism and explain
fossilization occur? its types with suitable examples.
17) Differentiate between divergent evolution and 32) Define speciation according to A.E.
convergent evolution with one example for each. Emerson and explain its types giving
suitable examples.
18) How does Hardy-Weinberg’s expression
33) Give an account on the major causes for the
(p2+2pq+q2=1) explain that genetic
extinction of a particular species on earth.
equilibrium is maintained in a
34) Explain the three level of impact of
population? List any four factors that can
extinction of species.
disturb the genetic equilibrium.
35) According to Darwin, the organic
19) Explain how mutations, natural selection
evolution is due to [AIPMT-2013]3)
and genetic drift affect Hardy Weinberg
a) Intraspecific competition
equilibrium.
b) Interspecific competition
20) How did Darwin explain fitness of organisms?
c) Competition within closely related species.
21) Mention the main objections to Darwinism.
) Reduced feeding efficiency in one species
d
22) Taking the example of Peppered moth, due to the presence of interfering species.
explain the action of natural selection. 36) A population will not exist in Hardly-
What do you call the above phenomenon? Weiberg equilibrium if [AIPMT-2015]
23) Darwin's finches and Australian a) Individuals mate selectively
marsupials are suitable examples of b) There are no mutations
adaptive radiation – Justify the statement. c) There is no migration
24) Who disproved Lamarck’s Theory of d) The population is large
acquired characters? How?
117 Evolution

Evolution
Concept Map
118
3DQVSHUPLD 0XWDWLRQ
6SRQWDQHRXV
JHQHUDWLRQ 6WDELOLVLQJ
6SHFLDWLRQ
6SHFLDO
FUHDWLRQ 1DWXUDOVHOHFWLRQ 'LVUXSWLYH
2ULJLQRIOLIH
'LUHFWLRQDO
$ELRJHQHVLV
(92/87,21 $FTXLUHG
FKDUDFWHUV
+XPDQHYROXWLRQ 3RSXODWLRQ
(PEU\RORJLFDO
'U\RSLWKHFXV +DUG\:HLQEHUJ
HTXLOLEULXP
(YLGHQFHV
5DPDSLWKHFXV
)DFWRUVDIIHFWLQJ
0RUSKRORJLFDO *HQHIORZ +DUG\:HLQEHUJ 5HFRPELQDWLRQ
DQG$QDWRPLFDO HTXLOLEULXP
$XVWUDORSLWKHFXV %LRFKHPLFDO
0XWDWLRQ
+RPRKDELOLV *HQHWLFGULIW
'LYHUJHQW 1DWXUDOVHOHFWLRQ
HYROXWLRQ
+RPRORJ\
+RPRHUHFWXV 3DOHRQWRORJLFDO
&RQYHUJHQW
HYROXWLRQ
+RPRVDSLHQV $QDORJ\
25-02-2019 18:24:10
7
UNIT - III
Human Health
and Diseases
CHAPTER
Sneezing spreads diseases through the droplets

Chapter outline of mucus
7.1 Common diseases in human beings:

Infectious and non infectious
diseases
7.2 Maintenance of personal and public
hygiene
T he World Health Organization [WHO]
defines health as ‘a state of complete
physical, mental and social wellbeing and not
7.3 Adolescence – Drug and alcohol merely absence of diseases’. We can also say
abuse “HEALTH IS WEALTH”, when people are
7.4 Mental health – Depression healthy they are more efficient at work. Health
increases longevity of people and reduces
7.5 Lifestyle disorders in human beings
infant and adult mortality. Personal hygiene,
regular exercise and balanced diet are very
important to maintain good health.
Learning Objectives
7.1 Common diseases in
➢ Learns about various bacterial, human beings
viral, fungal, protozoan and Disease can be defined as a disorder or
helminth diseases.
malfunction of the mind or body. It involves
➢ Understands the life cycle of morphological, physiological and psychological
malarial parasite. disturbances which may be due to environmental
factors or pathogens or genetic anomalies or life
➢ Learns the ill effects of style changes. Diseases can be broadly grouped
drugs and alcohol. into infectious and non infectious types.
➢ Realizes the responsibility Diseases which are transmitted from one
for their behaviour, health person to another are called infectious diseases
care and life styles. or communicable diseases. Such disease
causing organisms are called pathogens
➢ Understands the importance of and are transmitted through air, water, food,
mental health and life style physical contact and vectors. The disease
modifications to be followed for
causing pathogen may be virus, bacteria, fungi,
their well being.
protozoan parasites, helminthic parasites, etc.,
Infectious diseases are common and everyone
119

Common human diseases
Bacterial diseases Viral diseases Fungal diseases Protozoan Helminthic

• Dysentery • Common cold • Candidiasis diseases diseases
• Plague • Mumps • Athlete’s foot • Malaria • Ascariasis
• Diphtheria • Measles • Amoebiasis • Filariasis
• Cholera • Viral hepatitis • African
• Typhoid • Dengue fever sleeping
• Pneumonia • Chikungunya sickness
• Chicken pox • Kala-azar
• Poliomyelitis
suffers from such diseases at some time or the

Bacterial resistance
other. Most of the bacterial diseases are curable
If an antibiotic is used too often to
but all viral diseases are not. Some infectious
fight a specific bacterial infection, the
disease like AIDS may be fatal.
bacteria may become resistant to the
Non-infectious diseases are not
specific antibiotic. Hence the specific
transmitted from an infected person to
antibiotic can no longer be used to
a healthy person. In origin they may be
treat the bacterial infection. Some
genetic (cystic fibrosis), nutritional (vitamin
deficiency diseases) and degenerative bacteria have developed resistance to
(arthritis, heart attack, stroke). Among non - many antibiotics. Therefore, infections
infectious diseases, cancer is one of the major caused by these bacteria are difficult to
causes of death. be cured.
Risk of bacterial resistance can be
7.1.1 Bacterial and viral diseases reduced by observing the following steps
Bacterial diseases
• Avoid using antibiotics to treat minor
Though the number of bacterial
infections that can be taken care by our
species is very high, only a few bacteria are
immune system.
associated with human diseases and are called
pathogenic bacteria. Such pathogens may • Do not use an antibiotic to treat viral
emit toxins and affected the body. Common infections such as common cold or flu.
pathogenic bacteria and the bacterial diseases • Always follow the prescription.
are given in table 7.1. Skipping doses or failing to complete
Bacteria spread through air, water or the prescription may allow antibiotic
by inhaling the droplets/aerosols or even resistance to develop.
by sharing utensils, dresses with an infected
person. Typhoid fever can be confirmed by living cells. Outside the living cells they
Widal test. cannot carry out the characteristics of a
living organism. Viruses invade living cells,
Viral diseases forcing the cells to create new viruses. The
Viruses are the smallest intracellular new viruses break out of the cell, killing it
obligate parasites, which multiply within and invade other cells in the body, causing
Human Health and Diseases 120

Table 7.1. Bacterial diseases in human beings
S. Diseases Causative agent Site of Mode of Symptoms
No infection transmission
1 Shigellosis Shigella sp. Intestine Food and water Abdominal pain,
(Bacillary contaminated dehydration, blood
dysentery) by faeces / and mucus in the
faecal oral route stools
2 Bubonic Yersinia pestis Lymph Rat flea vector- Fever, headache,

plague nodes Xenopsylla and swollen lymph
( Black death) cheopis nodes
3 Diphtheria Corynebacterium Larynx, Droplet Fever, sore throat,
diphtheriae skin, nasal infection hoarseness and
and genital difficulty in
passage breathing
4 Cholera Vibrio cholerae Intestine Contaminated Severe diarrhoea
food and water/ and dehydration
faecal oral route
5 Tetanus Clostridium Spasm of Through wound Rigidity of jaw
( Lock jaw) tetani muscles infection muscle, increased
heart beat rate
and spasm of the
muscles of the jaw
and face
6 Typhoid Salmonella typhi Intestine Through Headache,
( Enteric fever) contaminated abdominal
food and water discomfort, fever
and diarrhoea
7 Pneumonia Streptococcus Lungs Droplet Fever, cough,
pneumoniae infection painful breathing
and brown sputum
8 Tuberculosis Mycobacterium Lungs Droplet Thick
tuberculosis infection mucopurulant
nasal discharge
diseases in human beings. Rhino viruses cause i. Pneumotropic diseases (respiratory

one of the most infectious human ailment tract infected by influenza)
called the “Common cold”. ii. Dermotropic diseases (skin and
Viral diseases are generally grouped subcutaneous tissues affected by chicken pox
into four types on the basis of the symptoms and measles)
produced in the body organs.
121 Human Health and Diseases

Table: 7.2 Viral diseases in human beings
S. Diseases Causative Site of Mode of Symptoms
No agent infection transmission
1 Common cold Rhino viruses Respiratory Droplet Nasal congestion
tract infection and discharge, sore
throat, cough and
headache
2 Mumps Mumps virus Salivary glands Saliva and Enlargement of the
(RNA virus) droplet parotid glands
Paramyxo infection
virus
3 Measles Rubella virus Skin and Droplet Sore throat,
(RNA virus), respiratory infection running nose,
Paramyxo tract cough and fever.
virus reddish rashes on
the skin, neck and
ears.
4 Viral hepatitis Hepatitis - B Liver Parenteral Liver damage,
virus route, blood jaundice, nausea,
transfusion yellowish eyes,
fever and pain in
the abdomen
5 Chicken pox Varicella Respiratory Droplet Mild fever with
-Zoster virus tract, skin and infection and itchy skin, rash and
(DNA Virus ) nervous system direct contact blisters
6 Poliomyelitis Polio virus Intestine, Droplet Fever, muscular
(RNA virus) brain, spinal infection stiffness and
cord through weakness, paralysis
faecal oral and respiratory
route failure
7 Dengue fever Dengue virus Skin and blood Mosquito Severe flu like
(Break bone or Flavi virus vector illness with a
fever) (DENV 1-4 Aedes aegypti sudden onset of
virus) fever and painful
headache, muscle
and joint pain.
8 Chikungunya Alpha virus Nervous Mosquito Fever and joint
(Toga virus) system vector Aedes pain, headache and
aegypti joint swelling

the walls of the host intestine (colon) and
Nipah virus is a zoonotic virus
secretes histolytic enzymes causing ulceration,
(transmitted from animals to humans) and
bleeding, abdominal pain and stools with
also transmitted through contaminated
excess mucus. Symptoms of amoebiasis can
food. In infected people, it causes a range
range from diarrhoea to dysentery with blood
of illness from asymptomatic infection and mucus in the stool. House flies (Musca
to acute respiratory illness and fatal domestica) acts as a carrier for transmitting the
encephalitis. parasite from contaminated faeces and water.
Endosome Food vacuole
Plasmalemma
Ectoplasm
Endoplasm
iii. Viscerotropic diseases (blood and

visceral organs affected by yellow fever and Nucleus
dengue fever) Fig. 7.1 Entamoeba histolytica

iv. Neurotropic diseases (central
nervous system affected by rabies and polio). African sleeping sickness is caused
Some common viral diseases of human beings by Trypanosoma species. Trypanosoma is
are given in table 7.2. generally transmitted by the blood sucking
Tsetse flies. Three species of Trypanosoma
Swine flu was first cause sleeping sickness in man.
recognised in the 1919 Free flagellum
pandemic and still circulates
as a seasonal flu virus. Swine Attached
flu is caused by the H1N1 flagellum
virus strain. Symptoms include fever, cough,

sore throat, chills, weakness and body aches. Undulating
membrane
Children, pregnant women and the elderly
are at risk from severe infection. Pellicle
7.1.2 Protozoan diseases

Nucleus
About 15 genera of protozoans live as
parasites within the human body and cause Reserve
food
diseases. granules
Amoebiasis also called amoebic dysentery

or amoebic colitis is caused by Entamoeba
histolytica, which lives in the human large Basal granule
intestine and feeds on food particles and Kinetoplast
bacteria (Fig. 7.1). Infective stage of this

Fig. 7.2. Trypanosoma
parasite is the trophozoite, which penetrates gambiense

1. T. gambiense is transmitted by Glossina being released from liver cells, the merozoites
palpalis (Tsetse fly) and causes Gambian or penetrate the RBC’s.
Central African sleeping sickness (Fig. 7.2). Inside the RBC, the merozoite begins
2. T. rhodesiense is transmitted by Glossina to develop as unicellular trophozoites. The
morsitans causing Rhodesian or East trophozoite grows in size and a central vacuole
African sleeping sickness. develops pushing them to one side of cytoplasm
and becomes the signet ring stage. The
3. T. cruzi is transmitted by a bug called
trophozoite nucleus then divides asexually to
Triatoma megista and causes Chagas disease
produce the schizont. The large schizont shows
or American trypanosomiasis.
yellowish - brown pigmented granules called
Kala – azar or visceral leishmaniasis Schuffners granules. The schizont divides
is caused by Leishmania donovani, which is and produces mononucleated merozoites.
transmitted by the vector Phlebotomus (sand Eventually the erythrocyte lyses, releasing the
fly). Infection may occur in the endothelial cells, merozoites and haemozoin toxin into the blood
bone marrow, liver, lymph glands and blood stream to infect other erythrocytes. Lysis of red
vessels of the spleen. Symptoms of Kala azar blood cells results in cycles of fever and other
are weight loss, anaemia, fever, enlargement of symptoms. This erythrocytic stage is cyclic
spleen and liver. and repeats itself approximately every 48 to
Malaria is caused by different types of 72 hours or longer depending on the species
Plasmodium species such as P. vivax, P. ovale, of Plasmodium involved. The sudden release
P. malariae and P. falciparum (Table 7.3). of merozoites triggers an attack on the RBCs.
Plasmodium lives in the RBC of human in its Occasionally, merozoites differentiate into
mature condition it is called as trophozoite. It is macrogametocytes and microgametocytes.
transmited from one person to another by the When these are ingested by a mosquito,
bite of the infected female Anopheles mosquito. they develop into male and female gametes
respectively.
Life cycle of Plasmodium In the mosquito's gut, the infected
Plasmodium vivax is
erythrocytes lyse and male and female
a digenic parasite, involving
gametes fertilize to form a diploid zygote
two hosts, man as the
called ookinete. The ookinete migrates to the
secondary host and female
mosquito's gut wall and develop into an oocyte.
Anopheles mosquito as the
The oocyte undergoes meiosis by a process
primary host. The life cycle
called sporogony to form sporozoites. These
of Plasmodium involves three phases namely
sporozoites migrate to the salivary glands of
schizogony, gamogony and sporogony (Fig. 7.3).
the mosquito. The cycle is now completed and
The parasite first enters the human blood when the mosquito bites another human host,
stream through the bite of an infected female the sporozoites are injected and the cycle begins
Anopheles mosquito. As it feeds, the mosquito a new.
injects the saliva containing the sporozoites. The
The pathological changes caused by
sporozoite within the blood stream immediately
malaria, affects not only the erythrocytes
enters the hepatic cells of the liver. Further in
but also the spleen and other visceral organs.
the liver they undergo multiple asexual fission
Incubation period of malaria is about 12 days.
(schizogony) and produce merozoites. After
The early symptoms of malaria are headache,
nausea and muscular pain. The classic

,QPRVTXLWRJXW ,QKXPDQ
6SRUR]RLWHV 6SRUR]RLWHV
6DOLYDU\
JODQGV
/LYHU
2RF\VW 0HUR]RLWHV
6FKL]RQW
IRUPV
'1$UHSOLFDWLRQIROORZHG 0HUR]RLWHV
E\VSRURJRQ\ UXSWXUHIURP
5%&
2RNLQHWH 5%&V
0LGWURSKR]RLWH
'1$UHSOLFDWLRQDQG0HLRVLV 6SKDVHEHJLQV 1XFOHXV
=\JRWH +HPR]RLQ
(DUO\WURSKR]RLWH 6LJQHWULQJ
IRUPV IRUPV
0DFURJDPHWH
0DFURJDPHWRF\WH
0LFURJDPHWH
0LFURJDPHWRF\WH
([IODJHOODWLRQ *DPHWRF\WHV3ODVPRGLXP
Fig. 7.3 Life cycle of Plasmodium

symptoms first develop with the synchronized Prevention
release of merozoites, haemozoin toxin and It is possible to break the transmission
erythrocyte debris into the blood stream cycle by killing the insect vector. Mosquito's
resulting in malarial paroxysms – shivering lay their eggs in water. Larvae hatch and
chills, high fever followed by sweating. Fever develop in water but breathe air by moving to
and chills are caused partly by malarial toxins the surface. Oil can be sprayed over the water
that induce macrophages to release tumour surface, to make it impossible for mosquito
necrosis factor (TNF-α) and interleukin. larvae and pupae to breathe.
Table 7.3 Types of malaria
Sl Types of Malaria Causative agent Duration of

No Erythrocytic cycle
1 Tertian, benign tertian or vivax P. vivax 48 hours
malaria
2 Quartan malaria P. malariae 72 hours
3 Mild tertian malaria P. ovale 48 hours
4 Malignant tertian or quotidian P. falciparum 36 – 48 hours
malaria

Ponds, drainage ditches and other to grow and makes them to thrive in skin
permanent bodies of water can be stocked folds such as those in the groin or between
with fishes such as Gambusia which feed on the toes. Ringworms of the feet is known as
mosquito larvae. Preparations containing Athlete’s foot caused by Tinea pedis (Fig.
Bacillus thuringiensis can be sprayed to kill 7.5). Ringworms are generally acquired from
the mosquito larvae since it is not toxic to soil or by using clothes, towels and comb used
other forms of life. The best protection against by infected persons.
malaria is to avoid being bitten by mosquito.
People are advised to use mosquito nets, wire
gauging of windows and doors to prevent
mosquito bites.
In the 1950’s the World Health
Organisation (WHO) introduced the Malaria
eradication programme. This programme
was not successful due to the resistance of
Plasmodium to the drugs used to treat it and
resistance of mosquito's to DDT and other
insecticides. Fig. 7.4 Symptoms of ringworm
Malaria vaccine is used

to prevent malaria.
The only approved
vaccine as of 2015 is
RTS,S(Mosquirix). It
requires four injections and has
relatively low efficacy (26–50%). Due
to this low efficacy, WHO does not
Fig. 7.5 Symptoms of Athlete’s foot
recommend the use of RTS,S vaccine
in babies between 6 and 12 weeks
of age. 7.1.4 Helminthic diseases
Helminthes are mostly endoparasitic
in the gut and blood of human beings and
7.1.3 Fungal diseases cause diseases called helminthiasis. The
Fungi was recognized as a causative two most prevalent helminthic diseases are
agent of human diseases much earlier than Ascariasis and Filariasis.
bacteria. Dermatomycosis is a cutaneous
Ascaris is a monogenic parasite and exhibits
infection caused by fungi belonging to the
sexual dimorphism. Ascariasis is a disease
genera Trichophyton, Microsporum and
caused by the intestinal endoparasite Ascaris
Epidermophyton.
lumbricoides commonly called the round worms
Ringworm is one of the most common (Fig. 7.6). It is transmitted through ingestion of
fungal disease in humans (Fig. 7.4). embryonated eggs through contaminated food
Appearance of dry, scaly lesions on the skin, and water. Children playing in contaminated
nails and scalp are the main symptoms of the soils are also prone to have a chance of transfer
disease. Heat and moisture help these fungi of eggs from hand to mouth. The symptoms

Triradiate mouth
with lips
of the disease are In some cases, the obstruction of lymph vessels
Excretory
pore abdominal pain, causes elephantiasis or filariasis of the limbs,
Lateral line vomiting, headache, scrotum and mammary glands (Fig. 7.8).
anaemia, irritability
and diarrhoea. A heavy 7.2 Maintenance of personal and
infection can cause public hygiene
Cloacal aperture
nutritional deficiency Hygiene is a set of practices performed
Penial setae
and severe abdominal to conserve good health. According to the World

pain and causes stunted Health Organization (WHO), hygiene refers to
Ventrally
curved tail
growth in children. “conditions and practices that help to maintain
Fig. 7.6 health and prevent the spread of diseases."
Ascaris It may also cause
male and Anus
enteritis, hepatitis and Personal hygiene refers to maintaining
female worm bronchitis. one’s body clean by bathing, washing hands,
trimming fingernails, wearing clean clothes
Filariasis is caused by Wuchereria
and also includes attention to keeping surfaces
bancrofti, commonly called filarial worm.
in the home and workplace, including toilets,
It is found in the lymph vessels and lymph
bathroom facilities, clean and pathogen-free.
nodes of man (Fig. 7.7). Wuchereria bancrofti
is sexually dimorphic, viviparous and digenic. Our public places teem with infection,
The life cycle is completed in two hosts, man contamination and germs. It seems that every
and the female Culex mosquito The female surface we touch and the air we breathe are with
filarial worm gives rise to juveniles called pollutants and microbes. It’s not just the public
microfilariae larvae. In the lymph glands, the places that are unclean, but we might be amazed
juveniles develop into adults. The accumulation at the number of people who do not wash their
of the worms block the lymphatic system hands before taking food, after visiting the
resulting in inflammation of the lymph nodes. restroom, or who sneeze without covering their
faces. Many infectious diseases such as typhoid,
amoebiasis and ascariasis are transmitted
through contaminated food and water.
Advancement in science and technology
provide effective controlling measures for many
infectious and non-infectious diseases. The use of
vaccines and adopted immunization programmes
have helped to eradicate small pox in India.
Moreover a large number of infectious diseases
like polio, diphtheria, pneumonia and tetanus
have been controlled by the use of vaccines and
by creating awareness among the people.
7.3 Adolescence – drug and

alcohol abuse
Adolescence begins with a period of rapid
physical and sexual development called puberty
Fig. 7.7 Wuchereria Fig. 7.8 Chronic to maturity at 12 to 19 years of age. Adolescence
bancrofti inflammation of the is also a highly dynamic period of psychological
lower limbs

and social changes in individuals. Adolescents compound. It is obtained by acetylation of
are vulnerable to group (peer) pressure and morphine, which is extracted from flowers of
many youngsters are pushed into experimenting the poppy plant (Fig. 7.9). Morphine is one
with drugs and alcohol. Proper education and of the strongest pain killer and is used during
guidance would enable youth to say no to drugs surgery. It is the most widely abused narcotic
and alcohol and to follow a healthy life style. drug which acts as a depressant and slows
down body functions.
Alcohol is a psychoactive drug, which
Cannobinoids are a group of chemicals
acts on the brain, affecting a person’s mind and
obtained from Cannabis sativa, the Indian hemp
behaviour. It is a depressant, which slows down
plant (Fig. 7.10). Natural cannabinoids are
the activity of the nervous system. The intake
the main source of marijuana, ganja, hashish
of certain drugs for a purpose other than their and charas. It interferes in the transport of the
normal clinical use in an amount and frequency neurotransmitter, dopamine and has a potent
that impair one’s physical, physiological and stimulating action on the CNS, producing
psychological functions is called drug abuse. increased energy and a sense of euphoria.
The drugs which are commonly abused
include opioids, cannabinoids, coca-alkaloids,
barbiturates, amphetamines and LSD.
Opioids are drugs which bind to specific
opioid receptors present in the central
nervous system and intestinal tract. Heroin
(smack) is chemically diacetyl morphine, Fig. 7.10 Cannabis sativa (Hemp plant)
which is white, odourless and bitter crystalline
Cocaine is a white powder that is obtained
from the leaves of the coca plant, Erythroxylum
coca. It is commonly called coke or crack. Cocaine
causes serious physical and psychological
problems including hallucinations and
paranoia. The other plants with hallucinogenic
properties are Atropa belladonna and Datura
Fig. 7.9 Opium plant (poppy plant) (Fig. 7.11 and Fig. 7.12).
Table 7.4 classification of drugs
Group Drugs Effects
Amphetamines, cocaine,
Stimulants Accelerates the activity of the brain
nicotine and tobacco
Alcohol, Barbiturates,
Depressants Slows down the activity of the brain
Tranquilizers
Narcotic/ Act as depressants on the Central
Opium, Morphine
Analgesics Nervous System
Cannabis Bhang (Marijuana), Ganja, Charas Affects the cardiovascular system
Lysergic acid diethylamide Distorts the way one sees, hears and
Hallucinogens
(LSD), Phencyclidine feels

respond only to highest doses of drugs and
alcohol leading to greater intake and addiction.
Excessive use of drug and alcohol leads to
physical and psychological dependence.
When psychological dependence develops,
the drug user gets mentally ‘hooked on’ to
the drug. The drug user constantly thinks
only about the drug and has continuous
Fig. 7.11 Atropa Fig. 7.12 Datura uncontrollable craving for it. This state called
belladonna “euphoria” is characterized by mental and
Drugs like methamphetamine, emotional preoccupation with the drug.
amphetamines, barbiturates, tranquilizers, Physical dependence is a state in which
Lysergic acid diethylamide (LSD) are the user’s body requires a continuous presence
normally used as medicine to treat patients of the drug. If the intake of the drug or alcohol
with mental illness like depression and is abruptly stopped, he or she would develop
insomnia and are often abused. withdrawal symptoms. In a sense, the body
Tobacco is smoked, chewed and becomes confused and protests against the
used as snuff. It increases the carbon absence of the drug. The withdrawal symptoms
monoxide content of blood and reduces may range from mild tremors to convulsions,
the concentration of haem bound oxygen, severe agitation and fits, depressed mood, anxiety,
thus causing oxygen deficiency in the body. nervousness, restlessness, irritability, insomnia,
Tobacco contains nicotine, carbon monoxide dryness of throat, etc, depending on the type of
and tars, which cause problems in the heart, drug abuse.
lung and nervous system. Adrenal glands are
stimulated by nicotine to release adrenaline
7.3.2 Effects of drugs and alcohol
Short-term effect appears only for a few
and nor adrenaline which increases blood
minutes after the intake of drugs and alcohol.
pressure and heart beat.
The abuser feels a false sense of well being and
7.3.1 Addiction and dependence a pleasant drowsiness. Some short term effects
are euphoria, pain, dullness of senses, alteration
Addiction is a physical or psychological
in behaviour, blood pressure, narcosis (deep
need to do or take or use certain substance
sleep), nausea and vomiting.
such as alcohol, to the point where it could
be harmful to the individual. This addictive Drugs and alcohol have long-term effect
behaviour can be personally destructive to that lead to serious damages, because of the
a person. Overtime addicts start to lose not
only their jobs, homes and money, but also Alcoholism is the inability to control
friendship, family relationships and contact drinking due to physical and emotional
with the normal world. Addiction to drugs dependence on alcohol. Treatment involves
and alcohol can lead to a psychological counseling by a healthcare professional.
attachment to certain effects such as euphoria Detoxification programme in a hospital or
and temporary feeling of well being. medical facility is an option for those who
need additional assistance. Medications
Repeated use of drugs and alcohol may
are available to reduce the desire to drink
affect the tolerance level of the receptors
and smoke.
present in the body. These receptors then

constant and excessive use. The physical and sought from close and trusted friends. Getting
mental disturbance makes the life of the user proper advice to sort out their problems would
unbearable and torturous. For example heavy help the young to vent their feelings of anxiety
drinking permanently damages the liver and guilt.
and brain.
3. Education and counselling
The use of alcohol during adolescence may
Education and counselling create
have long-term effects. Alcohol interferes with
positive attitude to deal with many problems
the ability of the liver to break down fat. Over
and to accept disappointments in life.
time fat accumulation and high levels of alcohol
destroy the liver cells and a scar tissue grows in 4. Looking for danger signs
the place of dead cells. This scarring of the liver Teachers and parents need to look
is called “Liver cirrhosis”. Alcohol irritates the for sign that indicate tendency to go in for
stomach lining due to the production of excess addiction.
acid leading to ulcers. Excessive alcohol use
weakens the heart muscle, causing scar tissue 5. Seeking professional and
to build up in the cardiac muscle fibers. As a medical assistance
result, heavy drinkers have an increased risk Assistance is available in the form of
of high blood pressure, stroke, coronary artery highly qualified psychologists, psychiatrists and
disease and heart attack. Korsakoff syndrome, de-addiction and rehabilitation programmes to
a chronic memory disorder is most commonly help individuals to overcome their problems.
caused by alcohol misuse.
7.4 Mental health – Depression
7.3.3 Prevention and control Mental health is a state of well being of
It is practically possible to prevent some the mind, with self esteem. Self esteem means
one from using drugs and alcohol. Here are liking yourself and being able to stand up for what
some ways that help to prevent drug and you believe is right. Positive mental health is an
alcohol abuse. important part of wellness. A mentally healthy
person reflects a good personality. Activities of
1. Effectively dealing with peer pressure
mentally healthy people are always appreciated
The biggest reason for teens to start
and rewarded by the society as these persons
on drugs is due to their friends / peer groups
are creative as well as cooperative with others.
imposing pressure on them. Hence, it is
Mental health improves the quality of life.
important to have a better group of friends to
avoid such harmful drugs and alcohol. Depression is a common mental disorder
that causes people to experience depressed
2. Seeking help from parents and peers mood, loss of interest or pleasure, feelings of
Help from parents and peer group guilt or low self-worth, disturbed sleep poor
should be sought immediately so that they can appetite, low energy and poor concentration.
be guided appropriately. Help may even be
Alcoholic Anonymous
Alcoholic anonymous was started in 1935 by a businessman and a doctor who had been a
“hopeless drunk” for many years. After the men helped each other to stop drinking and to stay
sober, they then founded the alcoholic anonymous to help other alcoholics. Since that time
alcoholic anonymous has spread throughout the world.

Signs and symptoms of mental of thirty to sixty due to life style related
depression disorders.
Loss of self confidence and self esteem
yy The following facts will help in better
Anxiety
yy understanding of life style disorders.
Not being able to enjoy things that are
yy • Life style disorder causes cardiovascular
usually pleasurable or interesting. diseases resulting in 31 percent of global
deaths.
Lifestyle changes like exercise,
meditation, yoga and healthy food habits can • The sedentary life style also causes deficiency
help to be relieved from depression. Exercise of vitamins such as vitamin D resulting in
stimulates the body to produce serotonin and fatigue, tiredness, back pain, depression,
endorphins, which are neurotransmitters that bone loss, muscle pain, etc,
suppress depression. Practicing exercise in daily • Life style disorder also includes social
life creates a positive attitude . isolation resulting in age related problems.
Participating in an exercise programme can:
• Eating junk foods that have high caloric
yy Increase self-esteem
values, rich in carbohydrates and fat can
yy Boost self-confidence
lead to obesity and early health issues.
yy Create a sense of empowerment
• Consumption of processed and packaged
Enhance
yy social connections and
food, which lacks in fiber may result in
relationships
constipation.
Brain is one of the most metabolically active
• Several people today complain of irritable
part of the body and needs a steady stream
bowel syndrome with stomach discomfort
of nutrients to function. A poor diet may not
or pain and trouble with bowel movements,
provide the nutrients for a healthy body and may
causing diarrhoea. The main cause of
provoke symptoms of anxiety and depression.
irritable bowel syndrome is stress and other
7.5 Lifestyle disorders in illnesses.
human beings
The old saying that “health is wealth” Life style modifications
is truly applicable to human beings. With the • Avoid eating junk food and foods that have
changes in life style, there are many emerging preservatives and colouring agents.
medical conditions and diseases that are • Physical exercises such as brisk walking and
reducing human longevity. Life style disorder yoga can be done regularly.
result due to activities involving smoking,
• Following medical advice, if any health
alcohol and drug abuse, consuming high fat
problems in addition to life style disorders.
diet, lack of exercise or living a latent life.
The World Health Organization (WHO) • To avoid smoking drugs and drinking
in its report cautions a slow moving public alcohol.
health disaster due to life style disorders in • To follow a healthy balanced diet rich in
the form of non-communicable diseases like vitamins and proteins.
diabetes, cardiovascular and lung diseases. • 7 – 8 hours of sleep every day is required.
WHO believes that not thousands but millions
of people die every year within the age group

Summary Activities
Health is a state of complete physical
and psychological well being. Many other Activity 1: Students examine the impact
extended factors like microbes may cause of microorganisms in our daily life and
illness to human body. Protozoans like consider their applied potential. They
Entamoeba, Plasmodium and Leishmania can also conduct independent research
cause diseases such as amoebic dysentery, and communicate their findings.
malaria and kala-azar repectively. Personal Activity 2: Students prepare wet mounts
cleanliness and hygiene, proper disposal of
to observe the microbes found in curd.
waste, safe drinking water and immunization
Activity 3: The leader will blow bubbles
are very useful in preventing diseases. Drug
at the group of students to demonstrate
and alcohol abuse of young and adolescent
is another cause of concern. Addiction
how some diseases can be air borne?
to drugs and alcohol is happening due to Activity 4: Which parasite acts as a
peer pressure, examination–related and transporter host for other parasites? Discuss
competition–related stresses. The addicted Activity 5: Your friends call you a “sissy
person should receive proper counselling, boy” because you do not smoke or chew
education and professional medical help to tobacco. What answer will you give? How
liberate themselves from all forms of addiction. will you prove your strength?
INTERESTING FACTS
1. Freezing does not kill bacteria; it Integrated Methods of Vector
only arrests their growth. Control.
2. Antibiotics not only kill harmful 7. Sterile insect technique (SIT)
bacteria, but also kill beneficial
bacteria of our body.
3. UTI- Urinary Tract Infection is
one of the most common bacterial
infections affecting 150 million
people each year worldwide.
4. World malaria day is on 25th April .
5. Iceland and the Faroe islands are The screw-worm fly was the
the only countries in the world, first pest successfully eliminated
where there are “No mosquitos” from an area through the sterile
(Mosquito free countries). insect technique, by the use of an
6. VCRC- Vector Control Research integrated area-wide approach.
Center is situated in Puduchery. 8. Zika virus could become a surgical
WHO is collaborating with the weapon against brain cancer.
Centre for Research and Training
in Lymphatic Filariasis and
Human Health and Diseases 132 132

Evaluation 8. Marijuana is extracted from
1. Malaria caused a) Dried leaves and flowers of
by Plasmodium hemp plant.
is transmitted b) Ergot fungus c) Roots of hemp plant
through-------- d) Cocoa plant
a) Air
9. Choose the correctly match pair.
b) Contact
a) Amphetamines - Stimulant
c) Fleas on food
b) LSD - Narcotic
d) Mosquito bites
c) Heroin - Psychotropic
2. A 30 year old woman has bleedy
d) Benzodiazepine - Pain killer
diarrhoea for the past 14 hours, which
one of the following organisms is likely 10. The Athlete’s foot disease in human is
to cause this illness? caused by-------
a) Streptococcus pyogens a) Bacteria b) Fungi
b) Clostridium difficile c) Virus d) Protozoan
c) Shigella dysenteriae
11. Cirrhosis of liver is caused by chronic
d) Salmonella enteritidis intake of ------
3. Which of the following disease is spread a) Opium b) Alcohol
through droplet nuclei? c) Tobacco d) Cocaine
a) Tularemia b) Listeriosis
12. The sporozoite of the malarial parasite is
c) Chicken pox d) Mumps
present in ----
4. Exo-erythrocytic schizogony of a) saliva of infected female Anopheles
Plasmodium takes place in ------- mosquito.
a) RBC b) Leucocytes b) RBC of human suffering from
c) Stomach d) Liver malaria.
5. The sporozoites of Plasmodium vivax are c) Spleen of infected humans.
formed from ------------ d) Gut of female Anopheles mosquito.
a) Gametocytes b) Sporoblasts 13. Haemozoin is
c) Oocysts d) Spores a) A precursor of haemoglobin.
6. Poliomyelitis which causes infantile b)A toxin from Streptococcus.
paralysis enters the body through………. c) A toxin from Plasmodium species.
a) Skin b) Mouth and nose d) A toxin from Haemophilus species.
c) Ears d) Eyes
14. The drug synthesised from Datura is
7. Amphetamines are stimulants of the a) Hallucinogen b) Depressant
CNS, whereas barbiturates are ----
c) Stimulant d) Pain killer
a) CNS stimulant b) both a and b
c) hallucinogenic d) CNS depressants

15. Where do the following events in the life cycle of Plasmodium takes place?
a) Fertilization - _________
b) Development of gametocytes - ____
c) Release of sporozoites - ________
d) Schizogony - _________
16. Match the pathogens with respective diseases caused by them and select the correct match
using the codes given below. Codes
I. Leishmania donavani - 1. Malaria I II III IV
II. Wuchereria bancrofti - 2. Amoebiasis a) 1 4 2 3
III. Trypanosoma gambiense - 3. Kala – azar b) 3 5 4 2
IV. Entamoeba histolytica - 4. Sleeping sickness c) 3 5 2 4
5. Filariasis d) 1 4 3 2
17. Complete the following table
Diseases Causative agent Site of infection Incubation period

Mumps
Chicken pox
Dengue fever
18. List the causative agent, mode of transmission and symptoms for Diphtheria and Typhoid.
19. Compare and contrast bacillary dysentery and amoebic dysentery.
20. A patient was hospitalized with fever and chills. Merozoites were observed in her blood.
What is your diagnosis?
21. (i) Write the scientific name of the filarial worm that causes filariasis.
(ii) Write the symptoms of filariasis.
(iii)How is this disease transmitted?
22. List the common withdrawal symptoms of drugs and alcohol abuse.
23. Complete the given table.

Diseases Causative agent Symptoms
Ascariasis Ascariasis
Trichophyton Appearance of dry, scaly lesions on various parts of the body
Typhoid High fever, weakness, headache, stomach pain and constipation.
Pneumonia
24. What is Kala-azar?
25. Why do you think it is not possible to produce vaccine against 'common cold'?

6DOPRQHOOD 9LEULR &RUQ\EDFWHULXP 6WUHSWRFRFFXV &ORVWULGLXP
6KLJHOOD 5DWIOHD
W\SKL FKROHUDH GLSKWKHULDH SQHXPRQLD WHWDQL
<HUVLQLDSHVWLV
%DFLOODU\ &KROHUD
7\SKRLG 'LSKWKHULD 3QHXPRQLD 7HWDQXV
G\VHQWHU\
3ODJXH
&RQWDPLQDWHGIRRGDQG 9HFWRUERUQH &RQWDPLQDWHG

$LUERUQHGLVHDVHV
ZDWHUERUQHGLVHDVHV GLVHDVHV VRLOERUQHGLVHDVHV
%DFWHULDO 9HFWRUERUQH :XFKHUHULD

)LODULDVLV
GLVHDVHV GLVHDVHV EDQFURIWL
&DQGLGLDVLV
Concept Map
)XQJDO +HOPLQWKV &XOH[PRVTXLWR
GLVHDVHV GLVHDVHV
&RQWDPLQDWHG
$WKOHWH¶VIRRW $VFDULV
IRRGDQGZDWHU $VFDULDVLV
+XPDQ OXPEULFRLGHV
ERUQHGLVHDVHV
KHDOWKDQG
GLVHDVHV
6WLPXODQWV
(QWDPRHED &RQWDPLQDWHG
$PRHELDVLV IRRGDQGZDWHU
KLVWRO\WLFD (IIHFWVRI
ERUQHGLVHDVHV 3URWR]RDQ 'HSUHVVDQWV
GUXJVDQG
)HPDOH GLVHDVHV DOFRKRO
3ODVPRGLXP
$QRSKHOHV 0DODULD
YLYD[ 9HFWRUERUQH
PRVTXLWR 1DUFRWLF
GLVHDVHV
/HLVKPDQLD
6DQGIO\ .DODD]DU
GRQRYDQL &DQQDELV
7U\SDQRVRPD 6OHHSLQJ 9LUDO

7VHWVHIO\ GLVHDVHV +DOOXFLQRJHQV
JDPELHQVH VLFNQHVV
&RQWDPLQDWHGIRRG
$LUERUQH 9HFWRUERUQH %ORRGDQGRWKHU
DQGZDWHUERUQH
GLVHDVHV GLVHDVHV ERG\IOXLGV
GLVHDVHV
3ROLRP\HOLWLV &RPPRQFROG 0XPSV 0HDVOHV &KLFNHQSR[ 'HQJXHIHYHU &KLNXQJXQ\D 9LUDOKHSDWLWLV
9DULFHOOD]RVWHU )ODYLYLUXVRU +HSDWLWLV%

3ROLRYLUXV 5KLQRYLUXV 0XPSVYLUXV 5XEHOODYLUXV 7RJDYLUXV
YLUXV GHQJXHYLUXV YLUXV
$HGHV
PRVTXLWR
25-02-2019 18:25:26
8
UNIT - III
IMMUNOLOGY
CHAPTER
Natural forces within us are the true healers of

disease
Chapter outline - Hippocrates
8.1 Basic concepts of immunology

8.2 Innate immunity I n the previous chapter, we have studied in
detail the various infections which cause
diseases in human beings. In this chapter, we
8.3 Acquired immunity
shall discuss how our body protects us from
8.4 Immune responses
these infections by the effective mechanism of
8.5 Lymphoid organs
the immune system.
8.6 Antigens
8.7 Antibodies 8.1 Basic concepts of immunology
8.8 Antigen- antibody interactions Immunology is the study of immune
8.9 Vaccines system. This system protects an indvidual
8.10 Vaccination and immunization from various infective agents. It refers to
8.11 Hypersensitivity all the mechanisms used by the body for
protection from environmental agents that
8.12 Immunodeficiency diseases
are foreign to the body.
8.13 Autoimmune diseases
8.14 Tumour immunology When the immune system does not
function efficiently in an individual, it leads to
infection causing disease. The overall ability
Learning objectives
of body to fight against the disease causing
pathogen is called immunity. It is also called
➢➢ Understands the basic
concepts of immunology. disease resistance and the lack of immunity
is known as susceptibility. Immunity is highly
➢➢ Differentiates between
innate immunity and specific.
acquired immunity, Normally many of the responses of the
primary immune response immune system initiate the destruction and
and secondary immune
elimination of invading organisms and any
response, active and passive immunity.
toxic molecules produced by them. These
➢➢ Realizes the importance of immunization.
immune reactions are destructive in nature
➢➢ Learns to comphrend the concept of and are made in response only to molecules
hypersensitivity.
136

that are foreign to the host and not to those of
Immunity
host itself. This ability to distinguish foreign
molecules from self is another fundamental
Innate Adaptive
feature of the immune system. However, Immunity Immunity
occasionally, it fails to make its distinction
and reacts destructively against the host's
Artificial
own molecules; such autoimmune diseases Natural
can be fatal to the organism.

Active Passive Active Passive
Almost all the macromolecules e.g. (infection) (maternal) (immunization) (antobody
transfer)
proteins, polysaccharides, nucleic acids,
etc., as long as they are foreign to recipient Fig. 8.1 Immune system
organism can induce immune response.
Any substance capable of eliciting immune
response is called an ANTIGEN (ANTIbody 8.2 Innate immunity
GENerator). There are two broad classes of Innate immunity is the natural
immunity responses namely, innate immunity phenomenon of resistance to infection which
and acquired immunity (Fig. 8.1). an individual possesses right from the birth.
Table 8.1 Innate immunity- types and mechanisms
Type of innate immunity Mechanism

1. Anatomical barriers
Prevents the entry of microbes.
Skin
Its acidic environment (pH 3-5) retards the growth of microbes.
Mucus entraps foreign microorganisms and competes with microbes

Mucus membrane
for attachment.
2. Physiological barriers
Normal body temperature inhibits the growth of pathogens.

Temperature
Fever also inhibits the growth of pathogens.
Low pH Acidity of gastric secretions (HCl) kills most ingested microbes.
Lysozyme acts as antibacterial agent and cleaves the bacterial cell wall.
Interferons induce antiviral state in the uninfected cells.
Chemical mediators
Complementary substances produced from leucocytes lyse the
pathogenic microbes or facilitate phagocytosis.
Specialized cells (Monocytes, neutrophils, tissue macrophages)

3. Phagocytic barriers
phagocytose, and digest whole microorganisms.
Tissue damage and infection induce leakage of vascular fluid,

containing chemotactic signals like serotonin, histamine and
4. Inflammatory barriers
prostaglandins. They influx the phagocytic cells into the affected area.
This phenomenon is called diapedesis.
137 Immunology

The innate defense mechanisms are non-specific as cell mediated immune response or cell
in the sense that they are effective against a mediated immunity. This is brought about by T
wide range of potentially infectious agents. It is cells, macrophages and natural killer cells.
otherwise known as non-specific immunity or 2. Antibody mediated immunity or humoral
natural immunity. immunity
A number of innate defense mechanisms are When pathogens are destroyed by the
operative non-specifically against a large number production of antibodies, then it is known
of microorganisms as shown in the Table 8.1 and as antibody mediated or humoral immunity.
Fig. 8.2. This is brought about by B cells with the help
of antigen presenting cells and T helper cells.
Antibody production is the characteristic
Lysozyme in tears feature of vertebrates only.
Removal of airbrone
particles
Bronchi
Types of acquired immunity
mucus,cilia Acquired immunity may be active
Gut immunity or passive immunity (Table 8.2).
acid
The immunological resistance developed
Skin
Physical barrier by the organisms through the production
of antibodies in their body is called active
Rapid pH change
immunity. Active immunity is acquired through
Flushing of
the use of a person’s immune responses, which
urinary tract lead to the development of memory cells.
Active immunity results from an infection or an
Low pH
of vagina immunization.
Fig. 8.2 Various anatomical and physiological Passive immunity does not require the
barriers to microbial attack body to produce antibodies to antigens. The
antibodies are introduced from outside into the
8.3 Acquired immunity organism. Thus, passive immunity is acquired
The immunity that an individual acquires without the activation of a person’s immune
after birth is known as acquired immunity. response, and therefore there is no memory.
It is the body's resistance to a specific pathogen.
The process of production
The unique features of acquired immunity
of blood cells in the
are antigenic specificity, diversity, recognition of
bone marrow is called
self and non-self and immunological memory.
haematopoiesis.
Components of acquired immunity
Acquired immunity has two components – 8.4 Immune responses
cell mediated immunity (CMI) and antibody The immune responses may be primary
mediated immunity or humoral immunity. or secondary (Table 8.3).
1. Cell mediated immunity Primary immune response

When pathogens are destroyed by cells The primary immune response occurs
without producing antibodies, then it is known when a pathogen comes in contact with the
Immunology 138

Table 8.2 Differences between active and passive immunity
Sl.No Active Immunity Passive Immunity

Active immunity is produced actively by Passive immunity is received passively and
1
host’s immune system. there is no active host participation.
It is produced due to contact with pathogen It is produced due to antibodies obtained
2
or by its antigen. from outside.
3 It is durable and effective in protection. It is transient and less effective.
4 Immunological memory is present. No memory.
Booster effect on subsequent dose is
5 Subsequent dose is less effective.
possible.
Immunity is effective only after a short
6 Immunity develops immediately.
period.
immune system for the first time. During Within hours after recognition of the antigen, a
this, the immune system has to learn to new army of plasma cells are generated. Within
recognize the antigen, produce antibody 2 to 3 days, the antibody concentration in the
against it and eventually produce memory blood rises steeply to reach much higher level
lymphocytes. The primary immune response than primary response. This is also called as
is slow and short-lived. “booster response”.
Secondary immune response 8.5 Lymphoid organs

The secondary immune response occurs Immune system of an organism consists of
when a person is exposed to the same antigen several structurally and functionally different
again. During this time, immunological memory organs and tissues that are widely dispersed
has been established and the immune system in the body. The organs involved in the origin,
can start producing antibodies immediately. maturation and proliferation of lymphocytes
are called lymphoid organs (Fig. 8.3). Based on
Table 8.3 Differences between primary and secondary immune responses
Sl.No Primary Immune Response Secondary Immune Response

It occurs as a result of second and
It occurs as a result of primary contact
1 subsequent contacts with the same
with an antigen.
antigen.
Antibody level reaches peak in 7 to 10 Antibody level reaches peak in 3 to 5
2
days. days.
Prolonged period is required to establish
3 It establishes immunity in a short time.
immunity.
Antibody level remains high for longer
4 There is rapid decline in antibody level.
period.
It appears mainly in the lymph nodes It appears mainly in the bone marrow,
5
and spleen. followed by the spleen and lymph nodes.
139 Immunology

Primary lymphoid organs
Bursa of Fabricius of birds, bone marrow
and thymus gland of mammals constitute
the primary lymphoid organs involved
in the production and early selection of
lymphocytes. These lymphocytes become
dedicated to a particular antigenic specificity.
Only when the lymphocytes mature in the
primary lymphoidal organs, they become
immunocompetent cells. In mammals, B cell
maturation occurs in the bone marrow and
T cells maturation occurs in the thymus.
Thymus
The thymus is a flat and bilobed organ
located behind the sternun, above the heart.
Each lobe of the thymus contains numerous
lobules, separated from each other by
connective tissue called septa. Each lobule
is differentiated into two compartments,
Fig. 8.3 Lymphoid organs in human body
the outer compartment or outer cortex, is
their functions, they are classified into primary densely packed with immature T cells called
or central lymphoid organs and secondary thymocytes, whereas the inner compartment
or peripheral lymphoid organs. The primary or medulla is sparsely populated with
lymphoid organs provide appropriate thymocytes. One of its main secretions is the
environment for lymphocytic maturation. The hormone thymosin. It stimulates the T cell to
secondary lymphoid organs trap antigens and become mature and immunocompetent. By
make it available for mature lymphocytes, which the early teens, the thymus begins to atrophy
can effectively fight against these antigens. and is replaced by adipose tissue (Fig. 8.4).
Thus thymus is most active during the
neonatal and pre-adolescent periods.
7K\URLG
JODQG
7UDFKHD
5LJKWOREH
/HIWOREH
7K\PXV
6HSWDH
/REXOH
$ %
/XQJV
Bursa of Fabricius is a primary lymphoid organ +HDUW
of birds. It is attached to the dorsal side of the Fig. 8.4 Primary lymphoid organ - Thymus
cloaca. B lymphocytes mature in the bursa and A) Location B) Structure
bring about humoral immunity.
Immunology 140

Bone marrow
The adenoids are glands
Bone marrow is a lymphoid tissue found
located in the roof of
within the spongy portion of the bone.
the mouth, behind the
Bone marrow contains stem cells known as
soft palate where the
haematopoietic cells. These cells have the
nose connects to the
potential to multiply through cell division
throat. The adenoids produce antibodies
and either remain as stem cells or differentiate
that help to fight infections. Typically,
and mature into different kinds of blood cells.
the adenoids shrink during adolescence
Secondary or peripheral lymphoid and may disappear by adulthood.
organs
In secondary or peripheral lymphoid Lymph node
organs, antigen is localized so that it can be
effectively exposed to mature lymphocytes. Lymph node is a small bean-shaped
The best examples are lymph nodes, structure and is part of the body’s immune
appendix, Peyer’s patches of gastrointestinal system. It is the first one to encounter
tract, tonsils, adenoids, spleen, MALT the antigen that enters the tissue spaces.
(Mucosal-Associated Lymphoid Tissue), Lymph nodes filter and trap substances that
GALT (Gut-Associated Lymphoid Tissue), travel through the lymphatic fluid. They
BALT (Bronchial/Tracheal-Associated are packed tightly with white blood cells,
Lymphoid Tissue). namely lymphocytes and macrophages.
There are hundreds of lymph nodes found
Peyer’s patches are oval-shaped throughout the body. They are connected
areas of thickened tissue that are to one another by lymph vessels. Lymph is
embedded in the mucus-secreting lining a clear, transparent, colourless, mobile and
of the small intestine of humans and extracellular fluid connective tissue. As the
other vertebrate animals. Peyer’s patches lymph percolates through the lymph node,
contain a variety of immune cells, the particulate antigen brought in by the
including macrophages, dendritic cells, lymph will be trapped by the phagocytic cells,
T cells, and B cells. follicular and interdigitating dendritic cells.
The tonsils (palatine tonsils) are

Afferent lymphatic vessel
a pair of soft tissue masses located at
the back of the throat (pharynx). The
tonsils are part of the lymphatic system,
which help to fight infections. They stop
invading germs including bacteria and Sinuses
Mantle zone
viruses. Follicle
Spleen is a secondary lymphoid Cortex
organ located in the upper part of the Paracortex

abdominal cavity close to the diaphragm. Medullary
cords
Efferent lymphatic vessel
Spleen contains B and T cells. It brings
humoral and cell mediated immunity. Fig. 8.5 Secondary lymphoid organ –
Structure of lymph node
141 Immunology

Lymph node has three zones (Fig. 8.5). node. Sometimes visible swelling of lymph
They are the cortex, paracortex and medulla. nodes occurs due to active immune response
The outer most layer of the lymph node is and increased concentration of lymphocytes.
called cortex, which consists of B-lymphocytes, Thus swollen lymph nodes may signal an
macrophages, and follicular dendritic cells. infection. There are several groups of lymph
The paracortex zone is beneath the cortex, nodes. The most frequently enlarged lymph
which is richly populated by T lymphocytes nodes are found in the neck, under the chin, in
and interdigitating dendritic cells. The inner the armpits and in the groin.
most zone is called the medulla which is
sparsely populated by lymphocytes, but many Cells of the immune system
of them are plasma cells, which actively The immune system is composed of many
secrete antibody molecules. As the lymph interdependent cells that protect the body from
enters, it slowly percolates through the cortex, microbial infections and the growth of tumour
paracortex and medulla, giving sufficient cells. The cellular composition of adult human
chance for the phagocytic cells and dendritic blood is given in Table 8.4.
cells to trap the antigen brought by the lymph.
The lymph leaving a node carries enriched Table 8.4 The cellular composition of adult
antibodies secreted by the medullary plasma human blood
cells against the antigens that enter the lymph
Number of Approximate
Cell type
cells per µl percentage
The mucosa-associated lymphoid
tissue (MALT) is a diffuse system of 4200,000 -
Red blood cells -
6500,000
small concentrations of lymphoid tissue
in the alimentary, respiratory and urino-
White blood cells
genital tracts. MALT is populated by
lymphocytes such as T and B cells, as well
Agranulocytes
as plasma cells and macrophages, each
of which is well situated to encounter Lymphocytes 1500 - 4000 20-30
antigens passing through the mucosal
Monocytes 200 - 950 2-7
epithelium.
Granulocytes
Gut-associated lymphoid tissue
(GALT) is a component of the mucosa- Neutrophils 2000-7000 50-70
associated lymphoid tissue (MALT)
which works in the immune system to Basophils 50-100 <1
protect the body from invasion in the gut. Eosinophils 40-500 2-5
Bronchus Associated Lymphoid
Tissues (BALT) also a component of 150,000-
Platelets -
500,000
MALT is made of lymphoid tissue
(tonsils, lymph nodes, lymph follicles) is
All these cells are derived from pluripotent
found in the respiratory mucosae from
haematopoetic stem cells. Each stem cell has the
the nasal cavities to the lungs.
capacity to produce RBC, WBC and platelets.
Immunology 142

The only cells capable of specifically recognising B cells do not produce antibodies but become
and producing an immune response are the memory cells. These cells are responsible for
lymphocytes. The other types of white blood cells secondary immune response. T lymphocytes do
play an important role in non specific immune not produce antibodies. They recognize antigen-
response, antigen presentation and cytokine presenting cells and destroy them. The two
production. important types of T cells are Helper T cells and
Killer T cells. Helper T cells release a chemical
Lymphocytes
called cytokine which activates B cells. Killer
About 20-30% of the white blood cells are
cells move around the body and destroy cells
lymphocytes. They have a large nucleus filling
which are damaged or infected (Fig. 8.6).
most of the cell, surrounded by a little cytoplasm.
The two main types of lymphocytes are B and Apart from these cells neutrophils and
T lymphocytes. Both these are produced in the monocytes destroy foreign cells by phagocytosis.
bone marrow. B lymphocytes (B cells) stay in the Monocytes when they mature into large cells,
bone marrow until they are mature. Then they they are called macrophages which perform
circulate around the body. Some remain in the phagocytosis on any foreign organism.
blood, while others accumulate in the lymph
nodes and spleen. T lymphocytes leave the bone Dendritic cells are called so because
marrow and mature in the thymus gland. Once its covered with long, thin membrane
mature, T cells also accumulate in the same areas extensions that resemble dendrites of nerve
of the body as B cells. Lymphocytes have receptor cells. These cells present the antigen to
proteins on their surface. When receptors on a T-helper cells. Four types of dendritic cells
B cell bind with an antigen, the B cell becomes are known. They are langerhans, interstitial
activated and divides rapidly to produce plasma cells, myeloid and lymphoid cells
cells. The plasma cells produce antibodies. Some
Fig. 8.6 Cells of the immune system
143 Immunology

8.6 Antigens 8.7 Antibodies
The term antigen (Ag) is used in two Antibodies are immunoglobulin (Ig)
senses, the first to describe a molecule which protein molecules synthesized on exposure
generates an immune response and the second, to antigen that can combine specifically with
a molecule which reacts with antibodies. In the antigen. Whenever pathogens enter our
general antigens are large, complex molecular body, the B-lymphocytes produce an army
substances that can induce a detectable immune of proteins called antibodies to fight with
response. Thus an antigen is a substance that is them. Thus, they are secreted in response to
specific to an antibody or a T-cell receptor and an antigen (Ag) by the effect of B cells called
is often used as a synonym for immunogen. plasma cells. The antibodies are classified
into five major categories, based on their
The histocompatibility physiological and biochemical properties.
antigens are cell surface They are IgG (gamma), IgM (mu), IgA
antigens that induce an (alpha), IgD (delta) and IgE (epsilon).
immune response leading
In the 1950s, experiments by Porter and
to rejection of allografts.
Edelman revealed the basic structure of the
immunoglobulin. An antibody molecule
An immunogen is a substance capable of
is Y shaped structure that comprises of
initiating an immune response. Haptens are
four polypeptide chains, two identical light
substance that are non-immunogenic but can react
chains (L) of molecular weight 25,000 Da
with the products of a specific immune response.
(approximately 214 amino acids) and two
Substances that can enhance the immune
identical heavy chains (H) of molecular
response to an antigen are called adjuvants.
weight 50,000 Da (approximately 450 amino
Epitope is an antigenic determinant and is the
acids). The polypeptide chains are linked
active part of an antigen. A paratope is the antigen
together by di-sulphide (S-S) bonds. One
– binding site and is a part of an antibody which
light chain is attached to each heavy chain
recognizes and binds to an antigen.
and two heavy chains are attached to each
Antigenicity is the property other to form a Y shaped (Fig. 8.7) structure.
of a substance (antigen) Hence, an antibody is represented by H2 L2.
that allows it to react with The heavy chains have a flexible hinge region
the products of the specific at their approximate middles.
immune response.
Antigen binding
Types of antigens site
On the basis of origin, antigens are

classified into exogenous antigens and Variable
region
endogenous antigens. Light chain
The antigens which enter the host from the Disulphide

bond
outside in the form of microorganisms, pollens,
Heavy chain
drugs, or pollutants are called exogenous
Constant
antigens. The antigens which are formed within region
the individual are endogenous antigens. The
best examples are blood group antigens. Fig. 8.7 Structure of immunoglobulin
Immunology 144

Each chain (L and H) has two terminals. They are When antigen and antibody are closely
C - terminal (Carboxyl) and amino or N-terminal. fitted, the strength of binding is great. When
Each chain (L and H) has two regions. They have they are apart binding strength is low.The bonds
variable (V) region at one end and a much larger that hold the antigen to the antibody combining
constant (C) region at the other end. Antibodies site are all non-covalent in nature. These
responding to different antigens have very different include hydrogen bonds, electrostatic bonds,
(V) regions but their (C) regions are the same Van der Waals forces and hydrophobic bonds.
in all antibodies. In each arm of the monomer Antibody affinity is the strength of the reaction
antibody, the (V) regions of the heavy and light between a single antigenic determinant and a
chains combines to form an antigen – binding site single combining site on the antibody.
shaped to ‘fit’ a specific antigenic determinant.
The chief application of antigen - antibody
Consequently each antibody monomer has two
reactions are to determine blood groups for
such antigen – binding regions. The (C) regions
transfusion, to study serological ascertainment
that forms the stem of the antibody monomer
of exposure to infectious agents, to develop
determine the antibody class and serve common
immunoassays for the quantification of various
functions in all antibodies.
substances, to detect the presence or absence
The functions of immunoglobulin are of protein in serum and to determine the
agglutination, precipitation, opsonisation, characteristics of certain immunodeficiency
neutralization etc., diseases.
8.8 Antigen and Different types of antigen and antibody

antibody interaction reactions
The reaction between The reaction between soluble antigen
an antigen and antibody and antibody leads to visible precipitate
is the basis for humoral formation, which is called precipitin reaction.
immunity or antibody Antibodies that bring about precipitate
mediated immunity. The formation on reacting with antigens are called
reaction between antigen as precipitins.
and antibody occurs in Whenever a particulate antigen interacts
three stages. During the first stage, the reaction with its antibody, it would result in clumping or
involves the formation of antigen - antibody agglutination of the particulate antigen, which
complex. The next stage leads to visible events is called agglutination reaction. The antibody
like precipitation, agglutination, etc., The final involved in bringing about agglutination
stage includes destruction of antigen or its reaction is called agglutinin.
neutralization (Fig. 8.8). Opsonisation or enhanced attachment
is the process by which a pathogen is marked
Binding force of antigen - antibody of ingestion and destruction by a phagocyte.
reaction Opsonisation involves the binding of an
The binding force between antigen and opsonin i.e., antibody, to a receptor on the
antibody is due to three factors. They are pathogen’s cell membrane. After opsonin
closeness between antigen and antibody, non- binds to the membrane, phagocytes are
covalent bonds or intermolecular forces and attracted to the pathogen. So, opsonisation is
affinity of antibody. a process in which pathogens are coated with
145 Immunology

Antigen and Antibody interactions
Neutralisation Agglutination Precipitation

Complement system
(Exotoxin, toxoid) (Particulate antigen) (Soluble antigen)
Bacteria Complement
Virus molecule
Antigen
Bacterium molecules
Foreign cell Hole
Leads to
Enhances
Phagocytosis Inflammation Cell lysis

Inflammation
Injury
Macrophage
Fig. 8.8 Antigen and antibody reaction
a substance called an opsonin, marking the are known as antitoxins. This specific
pathogen out for destruction by the immune antibody is produced by a host cell in response
system. This results in a much more efficient to a bacterial exotoxin or corresponding
phagocytosis. toxoid (inactivated toxin).
The neutralization reactions are the
reactions of antigen-antibody that involve the 8. 9 Vaccines
elimination of harmful effects of bacterial A vaccine is a biological preparation
exotoxins or a virus by specific antibodies. that provides active acquired immunity
These neutralizing substances i.e., antibodies to a particular disease and resembles a
Attenuated
(weakening)
Live Attenuated
pathogen non-pathogenic
form (vaccine)
Natural live vaccine Live attenuated vaccine
Chemical
Inactivation
Modification
Live
pathogen Killed pathogens Toxin Toxoid
(vaccine) (vaccine)
Fig. 8.9 Types of vaccines
Immunology 146

disease-causing microorganism and is
often made from weakened or attenuated Vaccino therapy is the
or killed forms of the microbes, their method of use of vaccine
toxins, or one of its surface proteins. for treatment of disease.
Vaccines “teach” our body how to defend Dr. Edward Jenner
itself when viruses or bacteria, invade it. prepared first vaccine
Vaccines deliver only very little amounts of for small pox in 1796. Polio vaccine was
inactivated or weakened viruses or bacteria, developed by Dr. Jonas Salk (vaccine
or parts of them. This allows the immune consists of inactivated microorganism)
system to recognize the organism without and Dr. Albert Sabin (live attenuated
actually experiencing the disease. Some oral polio vaccine). Louis Pasteur (1885)
vaccines need to be given more than once discovered vaccine against rabies, anthrax
(i.e., a ‘booster’ vaccination) to make sure and cholera. BCG vaccine was developed
the immune system can overcome a real by Calmette and Guerin against
infection in the future. tuberculosis in France in the year 1908.
Vaccine initiates the immunization

process. The vaccines are classified as first, 8. 10 Vaccination and
second and third generation vaccines. immunization
First generation vaccine is further “Vaccination is the process of
subdivided into live attenuated vaccine, administrating a vaccine into the body or the act
of introducing a vaccine into the body to produce
killed vaccine and toxoids (Fig. 8.9). Live
immunity to a specific disease.” Immunization
attenuated vaccines use the weakened
is the process of the body building up immunity
(attenuated), aged, less virulent form
to a particular disease. Immunization describes
of the virus. E.g. Measles, mumps and
the actual changes in the body after receiving a
rubella (MMR) vaccine and the Varicella vaccine. Vaccines work by fighting the pathogen
(chickenpox) vaccine, Killed (inactivated) and then recording it in their memory system
vaccines are killed or inactivated by heat to ensure that the next time this pathogen enters
and other methods. E.g. Salk’s polio vaccine. the body, it is eliminated far quickly. Once, the
Toxoid vaccines contain a toxin or chemical body is able to fight against the disease, it is
secreted by the bacteria or virus. They make believed to have built the immunity for it, also
us immune to the harmful effects of the known as the body being immunized against
infection, instead of to the infection itself. the disease.
E.g. DPT vaccine (Diphtheria, Pertussis
and Tetanus). 8.11 Hypersentivity – Overactive
Immune Response
Second generation vaccine contains
Some of the individuals are very sensitive
the pure surface antigen of the pathogen.
to some particles present in the environment.
E.g.Hepatitis-B vaccine. Third generation
The exaggerated response of the immune system
vaccine contains the purest and the highest
to certain antigens present in the environment
potency vaccines which are synthetic in
is called allergy (allo-altered, erg-reaction).
generation. The latest revolution in vaccine is
The substances to which such an immune
DNA vaccine or recombinant vaccine (Refer
response is produced are called allergens. An
Chapter- 10 for details).
147 Immunology

allergen is an antigen that causes an allergic Structure of HIV
reaction. Allergic reactions begin within few The human immunodeficiency virus
seconds after the contact with the allergen belongs to the genus Lentivirus. When
and last about half an hour. The common observed under the electron microscope,
examples of allergens are mites in dust, pollens HIV is seen as a spherical virus, 100-120
and some proteins in insect venom. Hay fever nm in diameter, containing a dense core
and asthma are some common examples of surrounded by a lipoprotein envelope.
allergy. Symptoms of allergic reactions include The envelope has glycoprotein (gp)
sneezing, watery eyes, running nose and spikes termed gp 41 and gp 120. At the
difficulty in breathing. Allergy is a form of over core, there are two large single stranded
active immune response mediated by IgE and RNA. Attached to the RNA are molecules
mast cells. It can also be due to the release of of reverse transcriptase. It also contains
chemicals like histamine and serotonin from enzymes like protease and ribonuclease.
the mast cells. The core is covered by a capsid made
Anaphylaxis is the classical immediate of proteins. This is followed by another
hypersensitivity reaction. It is a sudden, systematic, layer of matrix proteins as shown in the
severe and immediate hypersensitivity reaction Fig 8.10.
occurring as a result of rapid generalized mast-cell
degranulation. gp41
gp120
8.12 Immunodeficiency disease

Lipid bilayer
–Ineffective immune response –

Matrix protein
AIDS Capsid protein
Immunodeficiency results from the Reverse

transcriptase
failure of one or more components of the
immune system. Primary immune deficiencies Two single-stranded
RNAs
are caused by genetic developmental defects.
Secondary immune deficiencies arise due to
various reasons like radiation, use of cytolytic
and immunosuppressive drugs and infections. Fig. 8. 10 Structure of HIV
AIDS is an acronym for Acquired Immuno
Deficiency Syndrome. It is the deficiency HIV Transmission
of immune system, acquired during the life The HIV is often located within the
time of an individual indicating that it is cells especially in macrophages. HIV can
not a congenital disease. AIDS is caused by survive for 1.5 days inside a cell but only
Human Immuno Deficiency Virus (HIV). It about 6 hours outside a cell. Routes of HIV
selectively infects helper T cells. The infected transmission include unsafe sexual contact,
helper T cells will not stimulate antibody blood-contaminated needles, organ
production by B-cells resulting in loss of transplants, blood transfusion and vertical
natural defence against viral infection. On the transmission from HIV infected mother to
basis of genetic characteristics and differences child. HIV is not transmitted by insects or
in the viral antigens, HIV is classified into the by casual contact.
types 1 and 2 (HIV-1, HIV-2).
Immunology 148

After getting into the body of the person, non-self and attacks its own body. Our body
the virus enters into macrophages where RNA produces antibodies (auto antibodies) and
genome of the virus replicates to form viral cytotoxic T cells that destroy our own tissues.
DNA with the help of the enzyme reverse If a disease-state results, it is referred to as
transcriptase. This viral DNA gets incorporated auto-immune disease. Thus, autoimmunity is a
into the DNA of host cells and directs the infected misdirected immune response. Autoimmunity
cells to produce viral particles. The macrophages is evidenced by the presence of auto antibodies
continue to produce virus and in this way acts like and T cells that are reactive with host antigens.
a HIV factory. Simultaneously, HIV enters into When the cells act as antigens in the same body,
helper T-lymphocytes, replicates and produces they are called autoantigens.
progeny viruses. The progeny viruses released
Autoimmune diseases in human can be
in the blood attack other helper T-lymphocytes.
divided into two broad categories, namely organ-
This is repeated, leading to a progressive decrease
specific and non-organ-specific (systemic)
in the number of helper T lymphocytes in the
autoimmune diseases. In organ-specific disease,
body of the infected person. During this period,
the autoimmune process is directed mostly
the person suffers from bouts of fever, diarrhoea
against one organ. The autoantibodies may
and weight loss. Due to decrease in the number of
block the functions performed by the organs.
helper T lymphocytes, the person starts suffering
Examples include Hashimoto’s thyroiditis,
from infections and becomes immune deficient
Graves’ disease (thyroid gland) and Addison’s
and unable to protect against any infection.
disease (adrenal glands).
A simple blood test is available that can
In non-organ specific (systemic) disorders,
determine whether the person has been infected
autoimmune activity is widely spread throughout
with HIV. The ELISA test (Enzyme Linked
the body. Rheumatoid arthritis and multiple
ImmunoSorbent Assay) detects the presence of
sclerosis are example for systemic disorder.
HIV antibodies. It is a preliminary test. Western
blot test is more reliable and a confirmatory
test. It detects the viral core proteins. If both 8.14 Tumour immunology
tests detect the presence of the antibodies, the A tumour or neoplasm is a group of cells
person is considered to be HIV positive. whose growth has gone unchecked. When a
tumour continues to grow and invades healthy
AIDS has no cure. Prevention of AIDS
tissue, it is called cancer. They spread to other
is the best option. Advocating safe sex and
parts of the body from the tumour and give rise to
promoting regular check-up, safe blood for
transfusion, use of disposable needles, use of secondary tumour. This is known as metastasis.
condoms during sexual contact, prevention of Tumour may be benign or malignant depending
drug abuse, AIDS awareness programme by on its characteristics. Benign or non-cancerous
NACO (National AIDS Control Organisation), tissues are capable of indefinite growth and do
NGOs (Non-Governmental Organisations) and not invade other body parts. In the malignant
WHO are to prevent the spreading of AIDS. tumour, the cells grow indefinitely, detach and
migrate into healthy surrounding tissues.
8.13 Autoimmune diseases In normal cells, cell growth and differentiation
Autoimmunity is due to an abnormal
is highly controlled and regulated. But in cancer
immune response in which the immune system
cells, there is breakdown of this regulatory
fails to properly distinguish between self and
149 Immunology

mechanism. Normal cells show a property called Immunotherapy of cancer
contact inhibition, which inhibits uncontrolled
Immunotherapy also called biological
growth. Cancer cells do not have this property. As
therapy uses substances made by the body
a result, cancerous cells divide continuously giving
or in a laboratory (monoclonal antibodies)
rise to mass of tissues called tumours (Table 8.5).
to improve or to resist the immune system
When a cell undergoes malignant function. Different approaches have been
transformation, it acquires new surface antigen attempted in the immunotherapy of cancer.
and may also lose some normal antigens. Immunotherapy appears to be important in
These antigens are present on the membranes getting rid of the residual malignant cells after
of malignant cells and they induce an immune the gross tumour has been removed. The best
response. Both humoral and cellular responses results in the treatment of cancer is to follow
can be observed in malignancy. Cancer cells can an integrated approach to therapy, combining
avoid immune detection as they are not foreign surgery, radiotherapy, chemotherapy and
bodies but are abnormally functioning body immunotherapy.
cells. This makes them difficult to treat.
Scope of Immunology
The concept of immunological surveillance
The younger graduates in this field can
postulates that the primary function of the
find number of employment opportunities in
immune system is to “seek and destroy” Government as well as private hospitals. The
malignant cells that arise by somatic mutation. scope of the immunology is immunotherapy,
The efficiency of the surveillance mechanism microbial immunology, clinical immunology,
reduces either as a result of ageing or due to cellularimmunology,allergyandimmunology,
congenital or acquired immunodeficiencies, translational immunology, transplantation
leads to increased incidence of cancer. Thus, if immunology, neuro-inflammatory disorders,
immunological surveillance is effective, cancer tumour immunology, vaccine immunology,
should not occur. The development of tumour inflammatory disorders, ocular immunology
represents a lapse in surveillance. and inflammation.
Table 8.5. Differences between normal cell and cancer cell
Immunology 150

Summary Evaluation
Immunology deals with a study of the immune 1. Colostrum provides
system. The immune system recognises and a) Naturally acquired active
eliminates the invaders, and the ability of immunity
the body to overcome the pathogen is called b) Naturally acquired
immunity. Immunity is classified into innate passive immunity
immunity and acquired immunity. Acquired
immunity is further classified into cell mediated c) Artificially acquired active
immunity and antibody mediated immunity as immunity
its components. Acquired immunity may be d) Artificially acquired passive immunity
active or passive immunity. Immune response 2. Paratope is an
is the body’s response to pathogens and it may (A) Antibody binding site on variable regions
be primary or secondary. The organs involved (B) Antibody binding site on heavy regions
in the origin, maturation and proliferation (C) Antigen binding site on variable regions
of lymphocytes are called lymphoid organs. (D) Antigen binding site on heavy regions
Thymus, bone marrow are primary lymphoid 3. Allergy involves
organs. The secondary lymphoid organs are
a) IgE b) IgG
lymph node, MALT, GALT and BALT.
c) lgA d) IgM
An antigen is a substance that is specific to an
4. Anaphylactic shock is due to
antibody. An immunogen is a substance capable
of initiating an immune response. Haptens are (A) Allergic reaction
substance that are non-immunogenic but can (B) Secretion of toxins
react with the product of a specific immune (C) Secretion of histamines
response. Substances that can enhance the (D) All the above
immune response to an antigen are called 5. Spread of cancerous cells to distant sites
adjuvants. An epitope is also known as antigenic is termed as
determinant and is the active part of the antigen. (A) Metastasis
A paratope is the part of antibody. Precipitation, (B) Oncogenes
agglutination, neutralization, opsonisation etc. (C) Proto-oncogenes
are the different types of antigen and antibody (D) Malignant neoplasm
reaction. A vaccine is biological preparation 6. AIDS virus has
that provides active acquired immunity. The (A) Single stranded RNA
malfunctioning of immune system leads (B) Double stranded RNA
to hypersensitivity, immunodeficiency or (C) Single stranded DNA
autoimmune diseases. A tumour or neoplasm (D) Double stranded DNA
is a group of cells whose growth has gone 7. All are peripheral lymphoid organs except
unchecked. The best results in the treatment of
(A) Lymph nodes
cancer is achieved by an integrated approach to
(B) Spleen
therapy, surgery, radiotherapy, chemotherapy
(C) Mucosa associated lymphoid tissue
and immunotherapy.
(D) Thymus
8. Which is not a macrophage?
(A) Monocyte (B) Microglia
(C) Kupffer cell (D) Lymphocyte
151 Immunology

9. True about interferon is that lymphoid organ. Explain its role.
(A) It is synthetic antiviral agent Liver, thymus, stomach, thyroid, tonsils
(B) It inhibits viral replication in cells 16. How does saliva act in body defence?
(C) It is specific for a particular virus 17. How does immune system work?
(D) It causes infection 18. Name and explain the type of barriers
which involve macrophages.
10. Cell mediated immunity is carried out
19. What are interferons? Mention their role.
by………….. while humoral immunity is
mainly carried out by 20. List out chemical alarm signals produced
(A) B cells/T cells during inflammation.
(B) Epitopes/antigens 21. Differentiate between
(C) T cells/B cells (A)

Innate immunity and acquired
immunity
(D) antibodies/antigens
(B) P
rimary and secondary immune
11. B Cells are activated by responses
(A) Complement (C) Active and passive immunity
(B) Antibody (D) Humoral and CMI immunity
(C) Interferon (E) Autoimmune disease and
(D) Antigen Immunodeficiency disease
12. In agglutination and precipitation 22. Where are B-cells and T-cells produced in
reactions, the antigen is a ______________ the human body? How do they differ from
and ____________ respectively each other? Mention any two differences.
(A) Whole cell/soluble molecule 23. Explain the process of replication of
(B) Soluble molecule/whole cell retrovirus after it gains entry into the
human body.
(C) Bacterium/virus
24. Why is an antibody molecule represented
(D) Protein/Antibody
as H2 L2?
13. B cells that produce and release large 25. Explain the structure of immunoglobulin
amounts of antibody are called with suitable diagram.
(A) Memory cells (B) Basophils 26. What are the cells involved innate immune
(C) Plasma cells (D) killer cells system?
14. Raja is injured and got swelling. The 27. Why is opsonisation efficient in
swelling is due to the infection of tissue is phagocytosis?
an example of 28. What is vaccine? What are its types?
(A) Mechanical barrier 29. A person is infected by HIV. How will you
(B) Physiological barrier diagnose for AIDS?
(C) Phagocytosis 30. Autoimmunity is a misdirected immune
(D) Inflammation response. Justify.
15. Given below are some human organs.

Identify one primary and one secondary
Immunology 152

Concept Map
Memory
Antibodies
B-cells Cell-Mediated Immunity Antibody Mediated
TN_GOVT_XII_Zoology_chapter 8.indd 153

Immunity or Humoral
Immunity
Types of Acquired
Activates Immunity
B-cells Components Primary
Memory of Acquired immune
T-cells Immunity response
Innate
Activates immunity Acquired
T-cells Antigens immunity
Killer Secondary
T-cells Immune immune
Tumour
Responses response
Immunology
Thymus
Immunodeficiency Basic Lymphoid Primary

disease organs lymphoid Bone
concepts of
organs Marrow
immunology
Hypersensitivity Antibodies
Secondary
Lymph
(peripheral)
Vaccination and Vaccines Autoimmune Node
lymphoid organs
Immunization disease
Antigen - Antibody
interactions Cells of the immune
153
system
Binding force of antigen

- antibody reaction
Immunology
Different types of Antigen
and Antibody reactions
25-02-2019 20:06:09
ICT CORNER
IMMUNOLOGY
Let us do examine to know the

chronic disease - systemic lupus
erythematosus (SLE)
Procedure :
Step -1 : Type the URL or scan the QR code to open the activity page. Click “To enter the lab” to
start the test.
Step -2 : Follow the interactive steps guided by the virtual lab starting from centrifugation and to
ELISA.
Step -3 : On the right, Find the different headers such as “Diagnosis, Background, Notebook,
Glossary and Help” and click to know the virtual procedure happening aside on the left.
Step – 4 : Find “Launch Gene Body” on the right bottom of the window, and Click it to analyse
and understand about the cloning.
Step -5: Complete this ELISA to know a patient acquired the disease or not.
Step 4
IMMUNOLOGY URL:
http://media.hhmi.org/biointeractive/vlabs/immunology/index.html?_
ga=2.219254809.1253796128.1545143882-264360672.1545143882

*Allow flash player
Immunology 154

9
UNIT - III
Microbes in
Human Welfare
CHAPTER
Saccharomyces cerevisiae, a species of yeast
used in baking and brewing industry.
Chapter outline
9.1 Microbes in household products Microbes such as bacteria, fungi,
9.2 Microbes in industrial products protozoa, certain algae, viruses, viroids and
9.3 Microbes in sewage treatment and prions are some of the major components
energy generation of the biological system on Earth. Several
microorganisms are beneficial and contribute
9.4 Microbes in the production of biogas
to human welfare. Microbes are present
9.5 Microbes as bio-control agents and
everywhere – in soil, water, air and within
bio-fertilisers
bodies of animals and plants. Microbes like
9.6 Bioremediation bacteria and fungi can be grown on nutritive
media to form colonies which can be visibly
seen. Some of the microbes useful to human
welfare are discussed here.
Learning objectives
9.1 Microbes in household
➢ Differentiates probiotics from products
pathogens. In every day life, microbes and their
➢ Understands the use of microbes in products are used in the preparation of idli,
household products. dosa, cheese, curd, yogurt, dough, bread,
➢ Learns about antibiotic vinegar, etc., Bacteria like Lactobacillus
production and fermented acidophilus, L. lactis and Streptococcus lactis
beverages. commonly called lactic acid bacteria (LAB)
➢ Realizes the importance are probiotics which check the growth of
of microbes in sewage pathogenic microbes in the stomach and
treatment and energy other parts of the digestive tract.
generation. The LAB bacteria grows in milk and
➢ Learns the role of bio-fertilisers convert it into curd, thereby digesting the milk
in farming. protein casein. A small amount of curd added
➢ Realizes the applications of microbes in to fresh milk as a starter or inoculum contains
bio-remediation. millions of Lactobacilli, which under suitable
155

o
temperature (≤40 C) multiply and convert di-oxide, which is responsible for leavening of
milk into curd. Curd is more nutritious than dough. When leavened dough is baked, both
milk as it contains a number of organic acids carbon-di-oxide and ethyl alcohol evaporate
and vitamins. making the bread porous and soft.
Prebiotics are compounds Single cell protein (SCP)

in food (fibers) that induce Single cell protein refers to edible
the growth or activity of unicellular microorganisms like Spirulina.
beneficial microorganisms. Protein extracts from pure or mixed cultures
Probiotics are live of algae, yeasts, fungi or bacteria may be used
microorganisms intended to provide health as ingredient or as a substitute for protein rich
benefits when consumed, generally by foods and is suitable for human consumption
improving or restoring the gut flora. or as animal feed.
Yogurt is produced by bacterial 9.2 Microbes in industrial

fermentation of milk, and lactic acid is products
produced as a byproduct. Microorganisms Microbes are used to synthesize a number
such as Streptococcus thermophilus and of products valuable to human beings. Products
Lactobacillus bulgaricus coagulate the milk like beverages, antibiotics, organic acids, amino
protein and convert the lactose in the milk acids, vitamins, biofuels, single cell protein,
to lactic acid. The flavour in yogurt is due to enzymes, steroids, vaccines, pharmaceutical
acetaldehyde. drugs, etc., are produced in industries.
Cheese is a dairy product produced in a Production on a large scale requires growing
wide range of flavours, textures and is formed microbes in very large vessels called fermentors.
by coagulation of the milk protein, casein. A fermentor (bioreactor) is a closed vessel with
During cheese production, milk is usually adequate arrangement for aeration, agitation,
acidified and the enzyme rennet is added to temperature, pH control and drain or overflow
cause coagulation. The solids are separated and vent to remove the waste biomass of cultured
pressed to form cheese. Most cheese are made microorganisms along-with their products.
with a starter bacteria, Lactococcus, Lactobacillus
or Streptococcus. 9.2.1 Antibiotic production
Paneer (cottage cheese) is fresh cheese Antibiotics are chemical substances
common in South Asia, especially in India. produced by microorganisms which can kill
It is made by curdling milk with lemon juice, or retard the growth of other disease causing
vinegar and other edible acids. Large holes in microbes even in low concentration. Antibiotic
Swiss cheese is due to the production of large means “against life”. Antibiotics are used to treat
amount of carbon-di-oxide by the bacterium diseases such as plague, meningitis, diphtheria,
Propionibacterium shermanii. syphilis, leprosy, tuberculosis etc., Selman
The dough used in the preparation of idlis and Waksman discovered Streptomycin and was the
dosas are fermented by the bacteria Leuconostoc first to use the term “antibiotic” in 1943.
mesenteroides whereas the dough used in While working on Staphylococci bacteria,
bread making is fermented by Saccharomyces Alexander Fleming observed a green mould
cerevisiae (Baker’s Yeast). Fermentation of growing in one of his unwashed culture plates
glucose mainly forms ethyl alcohol and carbon- around which Staphylococci could not grow. He
Microbes in Human Welfare 156

found that it was due to a chemical produced
by the mould and he named it as penicillin, Hypersensitivity reaction
which was the first antibiotic discovered by is a major problem with
Alexander Fleming in 1926 (Fig. 9.1). Penicillin the use of penicillin,
is produced by the fungi Penicillium notatum resulting in nausea,
and Penicillium chrysogenum. It is bactericidal vomiting, wheezing and
(antibiotics that kill bacteria) in action and ultimately cardiovascular collapse. To check
inhibits the synthesis of the bacterial cell wall. the sensitivity reaction, doctors use a needle
to prick the forearm of the patients to give a
Penicillin is also referred as the “queen
weak dose of penicillin. An itchy red region in
of drugs” and its full potential as an effective
the forearm is an indication that the patient
antibiotic was established much later by
is allergic to penicillin. This test is important
Earnest Chain and Howard Florey when they
before administration of penicillin to a patient.
treated the wounded soldiers in World War II
with penicillin. Fleming, Chain and Florey Tetracycline is a broad spectrum
were awarded the Nobel prize in 1945 for the bacteriostatic antibiotic (antibiotics that limit the
discovery of penicillin. growth of bacteria) that inhibits microbial protein
synthesis. Chlortetracycline is the first antibiotic
Antibiosis is the property of antibiotics to
of this group, isolated from the cultures of
kill microorganisms.
Streptomyces aureofaciens. Streptomycin is
Broad-spectrum antibiotics act against a
a broad spectrum antibiotic isolated from
wide range of disease-causing bacteria.
the actinomycetes, Streptomyces griseus. It is
Narrow-spectrum antibiotics are active
bactericidal against both gram positive and
against a selected group of bacterial types.
gram negative bacteria, especially against
Mycobacterium tuberculosis. Antibiotics, such
ng
as erythromycin, chloromycetin, griseofulvin,

Alexander Flemin
neomycin, kenamycin, bacitracin, etc., are also

isolated as microbial products.
Antibiotic resistance
Antibiotic resistance occurs when bacteria
develop the ability to defeat the drug designed
to kill or inhibit their growth. It is one of the
most acute threat to public health. Antibiotic
resistance is accelerated by the misuse and
over use of antibiotics, as well as poor infection
prevention control. Antibiotics should be used
H only when prescribed by a certified health
Penicillium N S
chrysogenum professional. When the bacteria become
O
O
N resistant, antibiotics cannot fight against them
OH and the bacteria multiply. Narrow spectrum
O
antibiotics are preferred over broad spectrum
antibiotics. They effectively and accurately target
Stap
Staphylococcus aureus
specific pathogenic organisms and are less likely
Fig. 9.1 Discovery of penicillin to cause resistance. "Superbug" is a term used to
157 Microbes in Human Welfare

describe strains of bacteria that are resistant to
Alcohol content in various beverages
the majority of antibiotics commonly used today.
• Beer contains 3 to 5 percent of alcohol.
9.2.2 Fermented beverages • Wine contains 9 to 14 percent alcohol.
Microbes especially yeast is being used Wine coolers are made of wine mixed
from time immemorial for the production with carbonated water and flavourings.
of beverages like wine, beer, whisky, brandy Wine coolers have about 4 to 6 percent
and rum. Wine is among the oldest alcoholic alcohol.
beverages known and is produced by • Distilled spirits such as whiskey, gin,
fermentation of fruit juice by yeast. Zymology scotch and vodka usually contain 35
is an applied science which deals with the to 50 percent alcohol.
biochemical process of fermentation and its
practical uses. In some parts of South India, a traditional
Saccharomyces cerevisiae commonly drink called pathaneer is obtained from
called brewer’s yeast is used for fermenting fermenting sap of palms and coconut trees. A
malted cereals and fruit juices to produce common source is tapping of unopened spadices
various alcoholic beverages. Wine and beer of coconut. It is a refreshing drink, which on
are produced without distillation, whereas boiling produces jaggery or palm sugar. When
whisky, brandy and rum are obtained by pathaneer is left undisturbed for few hours it
fermentation and distillation. gets fermented to form toddy with the help of
naturally occurring yeast, to form a beverage
The Pasteur effect is the that contains 4 percent alcohol. After 24 hours
inhibiting effect of oxygen toddy becomes unpalatable and is used for the
on the fermentation production of vinegar.
process. Saccharomyces cerevisiae is the major
producer of ethanol (C2H5OH). It is used for
Oenology is the science and study of industrial, laboratory and fuel purposes. So
wine and wine making. Wine is made from ethanol is referred to as industrial alcohol.
the fermentation of grape juice. Grape juice is Bacteria such as Zymomonas mobilis and Sarcina
fermented by various strains of Saccharomyces ventriculi are also involved in ethanol production.
cerevisiae into alcohol. Grape wine is of two types, The principal substrates for the commercial
red wine and white wine. For red wine, black production of industrial alcohol include molasses
grapes are used including skins and sometimes or corn, potatoes and wood wastes. The process
the stems also are used. In contrast white wine is of ethanol production starts by milling a feed
produced only from the juice of either white or stock followed by the addition of dilute or fungal
red grapes without their skin and stems. amylase (enzyme) from Aspergillus to break
down the starch into fermentable sugars. Yeast
Beer is produced from germinated barley
is then added to convert the sugars to ethanol
malt grain by Saccharomyces carlsbergensis which is then distilled off to obtain ethanol which
or Saccharomyces cerevisiae. Rum is made is upto 96 percent in concentration. The two
from fermented sugarcane or molasses or most common type of biofuels in use today are
directly from sugarcane juice by Saccharomyces ethanol and biodiesel, both of them represent the
cerevisiae. Whisky is a type of distilled alcoholic first generation of biofuel technology. Ethanol is
beverage made from fermented grain mash by often used as a fuel, mainly as a biofuel additive
Saccharomyces cerevisiae. for gasoline.

Biodiesel is a fuel made from vegetable oils, fats or greases. Biodiesel fuel can be used in diesel
engines without altering the engine. Pure biodiesel is non-toxic, biodegradable and produces
lower level of air pollutants than petroleum-based diesel fuel. The Government of India
approved the National Policy on Biofuels in December 2009 and identified Jatropha curcas as
the most suitable oilseed for biodiesel production. Pongamia species is also a suitable choice
for production of biodiesel.
removing clots from the blood vessels of

C6H12O6 Yeast 2C2H5OH + 2CO2↑ patients who have undergone myocardial
(Glucose) Fermentation (Ethanol)
infarction.
Cyclosporin A, an immunosuppressant
World biofuel day is used in organ transplantation is produced
observed every year on from the fungus Trichoderma polysporum.
10th August to create It is also used for its anti-inflammatory,
awareness about the anti-fungal and anti-parasitic properties.
importance of renewable Statins produced by the yeast Monascus
bio-fuels as an alternative to conventional purpureus have been used to lower blood
non-renewable fossil fuels. This day also cholesterol levels. It acts by competitively
highlights the various efforts taken by the inhibiting the enzyme responsible for the
Government in the biofuel sector. synthesis of cholesterol. Recombinant human
insulin has been produced predominantly
9.2.3 Chemicals, enzymes and other using E. coli and Saccharomyces cerevisiae for
bioactive molecules therapeutic use in human.
Microbes are not only used for commercial
and industrial production of alcohol, but also 9.3 Microbes in sewage treatment
used for production of chemicals like organic and energy generation
acids and enzymes. Examples of organic acid Sewage is the waste generated every day in
producers are Aspergillus niger for citric acid, cities and towns containing human excreta. It
Acetobacter aceti for acetic acid, Rhizopus contains large amounts of organic matter and
oryzae for fumaric acid, Clostridium microbes, which are pathogenic to humans and
butyricum for butyric acid and Lactobacillus are bio-degradable pollutants. Domestic waste
for lactic acid. consists of approximately 99 percent water,
Yeast (Saccharomyces cerevisiae) and suspended solids and other soluble organic and
bacteria are used for commercial production inorganic substances. Sewage should not be
of enzymes. Lipases are used in detergent discharged directly into natural water bodies like
formulations and are used for removing oily rivers and streams. Before disposal, sewage should
stains from the laundry. Bottled juices are be treated in sewage treatment plants to make it
clarified by the use of pectinase, protease and less polluting (Fig. 9.2).
cellulase. Rennet can also be used to separate
milk into solid curds for cheese making. 9.3.1 Wastewater treatment
Streptokinase produced by the bacterium The main objective of a wastewater treatment
Streptococcus and genetically engineered process is to reduce organic and inorganic
Streptococci are used as “clot buster” for components in wastewater to a level that it no

Preliminary Primary Secondary or biological Tertiary
treatment treatment treatment treatment
Primary Secondary Treated

Aeration zone Disinfection
Pretreatment settling tank settling tank sewage
(air + liquid water) zone
Waste for
water from dispose/reuse
cities and towns Remove
coarse solids Air 80-90% Organic
sand and grit solids
Recirculated to aeration tank
Primary Secondary
sludge Anaerobic sludge
sludge digester
Production of biogas
Fig. 9.2 Sewage treatment process

longer supports microbial growth and to eliminate major part of the organic matter in the effluent.
other potentially toxic materials. Microorganisms This significantly reduces the BOD (Biochemical
mainly bacteria and some protozoa play an oxygen demand or Biological oxygen demand).
essential part in the treatment of sewage to make BOD refers to the amount of the oxygen that
it harmless. Sewage contains pathogenic bacteria. would be consumed, if all the organic matter in
These bacteria must be destroyed in order to one litre of water were oxidized by bacteria. The
prevent the spread of diseases. Sewage treatment sewage water is treated till the BOD is reduced.
is usually performed in the following three stages. The greater the BOD of the waste water more is its
polluting potential.
Primary treatment Once the BOD of sewage water is reduced
Primary treatment involves the physical significantly, the effluent is then passed into
removal of solid and particulate organic and a settling tank where the bacterial “flocs” are
inorganic materials from the sewage through allowed to sediment. This sediment is called
filtration and sedimentation. Floating debris activated sludge. A small part of activated sludge
is removed by sequential filtration. Then the is pumped back into the aeration tank to serve as
grit (soil and small pebbles) are removed by the inoculum. The remaining major part of the
sedimentation. All solids that settle form the sludge is pumped into large tanks called anaerobic
primary sludge and the supernatant forms the sludge digesters. Here, the bacteria which grow
effluent. The effluent from the primary settling anaerobically, digest the bacteria and the fungi in
tank is taken for secondary treatment. the sludge. During this digestion, bacteria produce
a mixture of gases such as methane, hydrogen
Secondary treatment or sulphide and CO2. These gases form biogas and
biological treatment can be used as a source of energy.
The primary effluent is passed into large
aeration tanks where it is constantly agitated Tertiary treatment
mechanically and air is pumped into it. This Tertiary treatment is the final process
allows vigorous growth of useful aerobic microbes that improves the quality of the waste water
into floc (masses of bacteria associated with before it is reused, recycled or released into
fungal filaments to form mesh like structures). natural water bodies. This treatment removes
While growing, these microbes consume the the remaining inorganic compounds and

substances, such as nitrogen and phosphorus. bacteria and mimicking bacterial interaction
UV is an ideal disinfectant for wastewater since found in nature (Fig. 9.3). Microbial fuel cells
it does not alter the water quality – except for work by allowing bacteria to oxidize and reduce
inactivating microorganisms. UV is a chemical- organic molecules. Bacterial respiration is basically
free process that can completely replace one big redox reaction in which electrons are
the existing chlorination system and also being moved around. A MFC consists of an anode
inactivates chlorine-resistant microorganisms and a cathode separated by a proton exchange
like Cryptosporidium and Giardia. membrane. Microbes at the anode oxidize the
organic fuel generating protons which pass
Act enforced by Government to through the membrane to the cathode and the
conserve water bodies electrons pass through the anode to the external
National river conservation plan (NRCP) circuit to generate current.
was enacted in 1995 to improve the water
quality of the rivers, which are the major
e-
fresh water resources in our country. This
e-
important assignment taken up under the
NRCP includes, Substrate C
A a O2 + 4H+
• To capture the raw sewage flowing into the n t
river through open drains and divert them o h
for treatment. d o
Re e 2H2O
• Setting up sewage treatment plants for d
OX e
treating the diverted sewage.
CO2 H+ H+
• Construction of low cost sanitation toilets to
prevent open defecation on river banks.
Proton exchange membrane
The ministry for environment, forest and
climate change has initiated the Ganga action Fig. 9.3 Microbial fuel cell
plan and the Yamuna action plan to save the 9.4 Microbes in the production of
major rivers of the country.
biogas (Gobar gas)
The Ganga action plan was launched on Biogas is a mixture of different gases
14th January 1986. The main objective of the produced by the breakdown of organic matter in
programme is to improve the water quality of the absence of oxygen. Biogas can be produced
River Ganges by interception, diversion and from raw materials such as agricultural wastes,
treatment of domestic sewage and to identify manure, municipal wastes, plant material,
grossly polluting units to prevent pollution. sewage, food waste, etc., Biogas is produced
The Yamuna Action Plan is a bilateral under anaerobic condition, when the organic
project between the Government of India and materials are converted through microbiological
Japan. It was formally launched in April 1993. It reactions into gas and organic fertilizer. Biogas
was proposed to build large number of sewage primarily consists of methane (63 percent), along
treatment plants to discharge treated wastewater with CO2 and hydrogen. Methane producing
into the rivers. bacteria are called methanogens and one such
common bacterium is Methanobacterium.
9.3.2 Microbial fuel cell(MFC)
Biogas is devoid of smell and burns with a blue
A microbial fuel cell is a bio-electrochemical
flame without smoke. The Methanogens are also
system that drives an electric current by using
present in anaerobic sludge and rumen of cattle.

such as fungi, bacteria, viruses
Gas storage
tank
Gas Control valve
(outlet for Biogas)
or by naturally occurring
substances derived from plants
and animals. The use of a
microbes or other biological
Mixing
tank Overflow agents to control a specific
tank
pest is called a biopesticide.
Inlet pipe
Outlet pipe
Biopesticides are used to
Inlet tank control insect pests. The lady
Partition
Digester
wall bird beetle and dragonflies
tank
are useful to control aphids and
mosquito larvae respectively.
Fig. 9.4 Biogas unit
Bacillus thuringiensis is a
In rumen, these bacteria help in the breakdown soil dwelling bacterium which is commonly used
of cellulose. The excreta of cattle called dung is as a biopesticide and contains a toxin called cry
commonly called “Gobar”. Gobar gas is generated toxin (Fig. 9.5). Scientists have introduced this
by the anaerobic decomposition of cattle dung. It toxin producing genes into plants and have raised
consists of methane, CO2 with some hydrogen, genetically engineered insect resistant plants. E.g.
nitrogen and other gases in trace amounts. Bt-cotton.
In a biogas plant, anaerobic digestion is During sporulation Bacillus thuringiensis
carried out in an air tight cylindrical tank known produces crystal proteins called Delta-endotoxin
as digester (Fig. 9.4). It is made up of concrete which is encoded by cry genes. Delta-endotoxins
bricks and cement or steel. Bio-wastes are collected have specific activities against the insects of the
and slurry of dung is fed into this digester. It orders Lepidoptera, Diptera, Coleoptera and
has a side opening into which organic materials Hymenoptera. When the insects ingest the toxin
for digestion are incorporated for microbial crystals their alkaline digestive tract denatures
activity. Anaerobic digestion is accomplished the insoluble crystals making them soluble.
in three stages: solubilisation, acidogenesis and The cry toxin then gets inserted into the gut cell
methanogenisis. The outlet is connected to a pipe membrance and paralyzes the digestive tract. The
to supply biogas. The slurry is drained through insect then stops eating and starves to death.
another outlet and is used as fertilizer. Biogas is Weedicides are substances, which
used for cooking and lighting. The technology of destroy weeds without harming the useful
biogas production was developed in India mainly plants. Bioweedicides are compounds
due to the efforts of Indian Agricultural Research and secondary metabolites derived from
Institute (IARI) and Khadi and Village Industries microbes such as fungi, bacteria or protozoa.
Commission (KVIC). The first bioherbicide developed in 1981 was
a Mycoheribicide derived from the fungus
9.5 Microbes as bio control agents Phytophthora palmivora. It controls the
and biofertilisers growth of strangler vine in citrus crops.
Large scale application of chemical Trichoderma species are free living fungi
insecticides and pesticides have a deleterious that are very common in the root ecosystem. They
effect on the health of human beings and are effective biocontrol agents for several plant
pollute our environment. Biocontrol is a pathogens. Buculoviruses are pathogens that
method of controlling pest by use of microbes

form mycorrhiza. Cyanobacteria
(or) blue green algae (BGA) are
prokaryotic free-living organisms
which can fix nitrogen. Oscillatoria,
Nostoc, Anabaena, Tolypothrix are well
known nitrogen fixing cyanobacteria.
Their importance is realized in the
water logged paddy fields where
Cyanobacteria multiply and fix
molecular nitrogen. Cyanobacteria
secrete growth promoting substances
like indole-3-acetic acid, indole-3-
butyric acid, naphthalene acetic acid,
Fig. 9.5 Actions of cry toxin amino acids, proteins, vitamins which
promotes plant growth and production.
attack insects and other arthropods. The genus Biofertilisers are commonly used in
Nucleopolyhedrovirus is used as a biocontrol organic farming methods. Organic farming is a
agent. These viruses are species specific and have technique, which involves cultivation of plants
narrow spectrum insecticidal applications. and rearing of animals in natural ways. This
9.5.1 Biofertilisers process involves the use of biological materials,
avoiding synthetic substances to maintain
Biofertilisers are formulation of living
soil fertility and ecological balance thereby
microorganisms that enrich the nutrient quality
minimizing pollution and wastage.
of the soil. They increase physico – chemical
properties of soils such as soil structure, Key features of organic farming
texture, water holding capacity, cation exchange • Protecting soil quality using organic materials
capacity and pH by providing several nutrients and encouraging biological activity.
and sufficient organic matter. The main • Indirect provision of crop nutrients using
sources of biofertilisers are bacteria, fungi and soil microorganisms.
cyanobacteria. Rhizobium is a classical example • Nitrogen fixation in soils using legumes.
for symbiotic nitrogen fixing bacteria. This • Weed and pest control based on methods
bacterium infects the root nodules of leguminous like crop rotation, biological diversity,
plants and fixes atmospheric nitrogen into natural predators, organic manures and
organic forms. Azospirillum and Azotobacter are suitable chemical, thermal and biological
free living bacteria that fix atmospheric nitrogen interventions.
and enrich the nitrogen content of soil.
A symbiotic association between a fungus 9.6 Bioremediation
and the roots of the plants is called mycorrhiza. The use of
The fungal symbiont in these associations naturally occurring or
absorbs the phosphorus from soil and transfers genetically engineered
to the plant. Plants having such association microorganisms to reduce or degrade
show other benefits such as resistance to root- pollutants is called bioremediation.
borne pathogens, tolerance to salinity, drought, Bioremediation is less expensive and more
enhances plant growth and developments. For sustainable than other remediations available.
example, many members of the genus Glomus It is grouped into in situ bioremediation

chrysosporium an anaerobic
fungus exhibits strong
potential for bioremediation
Microorganism of pesticides, polyaromatic
O
hydrocarbons, dyes,
O
+ H2
2
+H
CO 2
oil
2
CO
oil CO 2
O
+ H2 trinitrotoluene, cyanides,
carbon tetrachloride, etc.,
Microorganisms Microorganisms digest Microorganisms Dehalococcoides species are
eat oil or other oil and convert it to give off
organic contaminants carbon dioxide (CO ) CO and H O
responsible for anaerobic
2 2 2
and water (H O)
2 bioremediation of toxic
trichloroethene to non-
toxic ethane. Pestalotiopsis
Fig. 9.6 The process of bioremediation microspora is a species of
endophytic fungus capable
(treatment of contaminated soil or water in the
of breaking down and digesting polyurethane.
site) and ex situ bioremediation (treatment of
This makes the fungus a potential candidate
contaminated soil or water that is removed
for bioremediation projects involving large
from the site and treated) .
quantities of plastics.
9.6.1 Microorganisms involved
in bioremediation Breaks down
PET into
Ideonella sakaiensis
adhere to
Aerobic microbes degrade the terephthalic acid
& ethylene glycol
PET film
pollutants in the presence of oxygen. They

mainly degrade pesticides and hydrocarbons.
Pseudomonas putida is a genetically
engineered microorganism (GEM). Ananda
Mohan Chakrabarty obtained patent for Eats the
terephthalic
this recombinant bacterial strain. It is multi- acid & ethylene PET Bottle
glycol
plasmid hydrocarbon-degrading bacterium
which can digest the hydrocarbons in the oil
spills (Fig. 9.6). Fig. 9.7 Actions of Ideonella sakaiensis
Nitrosomonas europaea is also capable of
degrading benzene and a variety of halogenated Summary
organic compounds including trichloroethylene All microbes are not pathogenic, many of them are
and vinyl chloride. Ideonella sakaiensis is beneficial to human beings. We use microbes and
currently tried for recycling of PET plastics their derived products almost every day. Lactic acid
(Fig. 9.7). These bacteria use PETase and bacteria convert milk into curd. Saccharomyces
MHETase enzymes to breakdown PET plastic cerevisiae (yeast) is used in bread making. Idly
into terephthalic acid and ethylene glycol. and dosa are made from dough fermented by
microbes. Bacteria and fungi are used in cheese
Anaerobic microbes degrade the
making. Industrial products like lactic acid, acetic
pollutants in the absence of oxygen.
acid and alcohol are produced by microbes.
Dechloromonas aromatica has the ability
Antibiotics are produced from useful microbes
to degrade benzene anaerobically and to
to kill the disease causing harmful microbes. For
oxidize toluene and xylene. Phanerochaete
more than a hundred years, microbes are being

used to treat sewage by the process of activated a) Bacillus thurigiensis
sludge formation. Bio-gas produced by microbes is b) Bacillus subtilis
used as a source of energy in rural areas. Microbes c) Lactobacillus acidophilus
are also used as bio-control agents to avoid the use d) Streptococcus lactis
of toxic pesticides. Now a days chemical fertilisers 7. Which of the following is not involved in
are gradually replaced by bio-fertilisers. In bio- nitrogen fixation?
remediation naturally occurring or genetically
a) Pseudomonas b) Azotobacter
engineered microorganisms are used to reduce or
c) Anabaena d) Nostac
degrade pollutants.
8. CO2 is not released during
a) Alcoholic fermentation
Evaluation
b) Lactate fermentation
1.
Which of the following c) Aerobic respiration in animals
microorganism is used for d) Aerobic respiration in plants
production of citric acid in
industries? 9. The purpose of biological treatment of waste
water is to _______
a) Lactobacillus bulgaris
a) Reduce BOD b) Increase BOD
b) Penicillium citrinum
c) Reduce sedimentation
c) Aspergillus niger d) Rhizopus nigricans
d) Increase sedimentation
2. W
hich of the following pair is correctly 10. The gases produced in anaerobic sludge
matched for the product produced by them? digesters are
a) Acetobacter aceti - Antibiotics a) Methane, oxygen and hydrogen sulphide.
b) Methanobacterium - Lactic acid b) Hydrogen sulphide, methane and sulphur
c) Penicilium notatum - Acetic acid dioxide.
d) Saccharomyces cerevisiae - Ethanol c) Hydrogen sulphide, nitrogen and methane.
3.
The most common substrate used in d) Methane, hydrogen sulphide and CO2.
distilleries for the production of ethanol 11. How is milk converted into curd? Explain
is_________ the process of curd formation.
12. Give any two bioactive molecules produced
a) Soyameal b) Groundgram
by microbes and state their uses.
c) Molasses d) Corn meal
13. What is biological oxygen demand?
Cry toxins obtained from Bacillus
4. 14. Explain the role of cry-genes in genetically
thuringiensis are effective against for______ modified crops.
a) Mosquitoes b) Flies 15. Write the key features of organic farming.
c) Nematodes d) Bollworms 16. Justify the role of microbes as a bio-fertilizer.
5. Cyclosporin – A is an immunosuppressive 17. Write short notes on the following.
drug produced from _______ a) Brewer's yeast b) Ideonella sakaiensis
c) Microbial fuel cells
a) Aspergillus niger
b) Manascus purpureus 18. List the advantages of biogas plants in rural
c) Penicillium notatum areas.
d) Trichoderma polysporum 19. When does antibiotic resistance develop?
20. What is the key difference between primary
6.
Which of the following bacteria is used
and secondary sewage treatment?
extensively as a bio-pesticide?

Concept Map
TN_GOVT_XII_Zoology_chapter 9.indd 166

0LFUREHVLQ
KXPDQZHOIDUH
6HZDJH %LRFRQWURO +RXVHKROG (QHUJ\

,QGXVWULHV %LRIHUWLOLVHU %LRJDV
WUHDWPHQW DJHQWV SURGXFWV SURGXFWLRQ
3URGXFWLRQRI
IHUPHQWHGEHYHUDJHV 3ULPDU\ 1RVWRF$QDEDHQD 0HWKDQRJHQV &XUG 0LFURELDOIXHO
$]RVSLULOOXP 2UJDQLFIDUPLQJ %LRZHHGLFLGHV %LRSHVWLFLGH
WUHDWPHQW JURZ FHOOV
5KL]RELXP DQDHURELFDOO\RQ
0\FRUUKL]DDQG FHOOXORVLFPDWHULDO
3URGXFWLRQRIDQWLELRWLFV &\DQREDFWHULD <RJXUW
DQGSURGXFH
FDUERQGLR[LGH
0\FRKHUELFLGH DQGK\GURJHQ
DORQJZLWK &KHHVH
&KHPLFDOVOLNHFLWULFDFLG 6HFRQGDU\ %WKXULQJLHQVLV
DFHWLFDFLGODFWLFDFLG WUHDWPHQW PHWKDQH
EXW\ULFDFLGHWF
%UHDG
3URGXFWLRQRI
%LRDFWLYHPROHFXOHV &U\JHQHSURGXFH
GHOWDHQGRWR[LQ
7HUWLDU\ DQGNLOOLQJHVWLQJ
WUHDWPHQW LQVHFWV
25-02-2019 18:40:24
ICT CORNER
MICROBES IN HUMAN WELFARE
How the fermentation takes place?

Lets us experiment it virtually
Procedure :
Step -1: Type the URL or scan the QR code to open the activity page and click “START” to
begin the fermentation experiment.
Step -2: Click “next” for all the flasks combination.
Step -3: When the “Matching Game” starts to know the result, “Drag and place” the
combination perfectly to their respective flasks.
Step – 4 :Go on through the other tests, explanations and the principle involved in the
fermentation process.
Step 4
MICROBES IN HUMAN WELFARE URL:

http://www.bch.cuhk.edu.hk/vlab2/animation/fermentation/

*Allow flash player

10
UNIT - IV
Applications of
biotechnology
CHAPTER
"Our world is built on biology"
Chapter outline
10.1 Applications in Medicine
B efore we start this chapter, it will be helpful
if you revise the structure of DNA, Protein
synthesis and genetic engineering. Genetic
10.2 Gene therapy engineering involves the manipulation of DNA
10.3 Stem Cell Therapy and naturally occurring processes such as protein
10.4 Molecular Diagnosis synthesis for a wide range of applications including
10.5 Transgenic Animals the production of therapeutically important
10.6 Biological products and proteins. This also involves extracting a gene from
their uses one organism and transferring it to the DNA of
10.7 Animal cloning another organism, of the same or another species.
The DNA produced in this way is referred to as
10.8 Ethical issues
recombinant DNA (rDNA) and this technique as
10.9 Regulation in biotechnology
recombinant DNA technology. All these are part of
10.10 Possible threats of Genetically the broad field biotechnology which can be defined
Modified Organisms as the applications of scientific and engineering
10.11 Biosafety guidelines principles to the processing of material by biological
agents to provide goods and services.
Biotechnology is an umbrella term that covers
Learning objectives various techniques for using the properties of
living things to make products or provide services.
➢ Understand the applications of rDNA The term biotechnology was first used before
technology in the field of medicine. 20th century for such traditional activities as
➢ Analyse the role of making idli, dosa, dairy products, bread or
diagnostic tools in wine, but none of these would be considered
Molecular diagnosis. biotechnology in the modern sense.
➢ Learn animal cloning In this chapter we will study the applications
and its applications. of bio-technology in various fields including
➢ Create awareness on the the field of Medicine. Recombinant DNA
ethical issues involved in biotechnology. technology has led to the large scale
➢ Realise the need for biosafety guidelines production of various hormones and proteins
and regulations in Biotechnology. of therapeutic use.
168

10.1 Applications in Medicine the animal insulin as compared to human
insulin, it resulted in the occurrence of
10.1.1 Recombinant Human Insulin allergic reactions in some diabetic patients.
The Human insulin is synthesized by the β Production of insulin by recombinant DNA
cells of Islets of Langerhans in the pancreas. It technology started in the late 1970s. This
is formed of 51 aminoacids which are arranged technique involved the insertion of human
in two polypeptide chains, A and B. The insulin gene on the plasmids of E.coli. The
polypeptide chain A has 21 amino acids while polypeptide chains are synthesized as a
the polypeptide chain B has 30 amino acids. precursor called pre-pro insulin, which
Both A and B chains are attached together by contains A and B segments linked by a third
disulphide bonds. Insulin controls the levels chain (C) and preceded by a leader sequence.
of glucose in blood. It facilitates the cellular The leader sequence is removed after
uptake and utilization of glucose for the translation and the C chain is excised, leaving
release of energy. Deficiency of insulin leads the A and B polypeptide chains (Fig. 10.1).
to diabetes mellitus which is characterized by Insulin was the first ever pharmaceutical
increased blood glucose concentration and product of recombinant DNA technology
a complex of symptoms which may lead to administered to humans. The approval to use
death, if untreated. A continuous program of recombinant insulin for diabetes mellitus was
insulin dependence is required to treat this given in 1982. In 1986 human insulin was
deficiency. marketed under the trade name Humulin.
In the early years, insulin isolated and
purified from the pancreas of pigs and cows Best and Banting in 1921, isolated insulin from
was used to treat diabetic patients. Due the pancreatic islets of a dog and demonstrated
to minor differences in the structure of its effectiveness against diabetes.
Extraction &
DNA Introduction of purification of
recombinant human insulin
DNA into a C chain
bacterial cell Recombinant A chain
Bacterium COOH
Human H2N
pancreas cell Signal B chain
Human Recombinant
peptide
Pre pro insulin
insulin-producing bacteria
gene multiplying C chain
Recombinant and producing A chain
human insulin in COOH Human insulin

DNA S S
fermentation tank S S
H 2N
Bacterial Plasmid DNA B chain
DNA cut with restriction Pro insulin

Fermentation
enzymes
Tank A chain
S S
H 2N COOH
Plasmid S
S
S
S
DNA H 2N COOH
B chain
Bacterium
Human insulin Insulin
Fig. 10.1 Human Insulin Production
169 Applications of biotechnology

10.1.2 Human alpha lactalbumin In 1997, Rosie, the first
Alpha lactalbumin is a protein composed transgenic cow produced
of 123 amino acids and 4 disulphide bridges, human protein enriched
with a molecular weight of 14178 Da. In milk, which contained the
human milk, α lactalbumin is the most human alpha lactalbumin. The protein
abundant protein comprising 25% of total rich milk (2.4 gm/litre) was a nutritionally
protein found in human milk. It is synthesized balanced food for new born babies than
by the mammary glands. α lactalbumin the normal milk produced by the cows.
binds calcium and zinc ions and possesses
bactericidal and anti tumour activities. 10.1.3 Human Growth Hormone (hGH)
Improvement of the nutritional value At about the same time when recombinant
of cow’s milk with transgenic expression of insulin was first made in E. coli, other research
recombinant human alpha lactalbumin has groups worked on human growth hormones
been attempted. Healthy transgenic cows were somatostatin and somatotropin. These are
produced by somatic nuclear transfer, in which peptide hormones secreted by the pituitary
expression of upto 1.55g/L of recombinant gland that helps in the growth and development
human alpha lactalbumin was achieved. by increasing the uptake of amino acids and
Similarly transgenic goats were also produced, promoting protein synthesis. Deficiency of
in which the expression of Human alpha human growth hormone causes dwarfism, which
lactalbumin was about 0.1 to 0.9mg/mL. could be treated by injecting hGH extracted from
Somatic cell nuclear transfer is a the human pituitary glands.
technique for creating a viable embryo from Using recombinant DNA technology hGH
a body cell and an egg cell. This technique is can be produced (Fig. 10.2). The gene for hGH
discussed later in animal cloning. is isolated from the human pituitary gland cells.
EcoRI
Gene for human

Recombinant growth hormone
Gene for human DNA
growth hormone
DNA
recombination
Sticky
ends
Human Cell
DNA
Bacterial Cell insertion
Bacterial
chromosome
EcoRI
Bacterial cell for

containing gene for
Plasmid human growth hormone
Fig. 10.2 Production of human growth hormone

Applications of biotechnology 170

The isolated gene is inserted into a plasmid be isolated from blood, but the amount of
vector and then is transferred into E. coli. The blood required for isolation of interferons is
recombinant E. coli then starts producing human enormous and not practical. To overcome this
growth hormone.The recombinant E. coli are issue interferons could be produced by rDNA
isolated from the culture and mass production of technology. The yeast Saccharomyces cerevisiae
hGH is carried out by fermentation technology. is more suitable for production of recombinant
A recombinant form of human growth interferons than E.coli, since E.coli does not
hormone called somatropin is used as a drug to possess the machinery for glycosylation of
treat growth disorders in children. proteins. Interferons are used for the treatment
of various diseases like cancer, AIDS, multiple
10.1.4 Human Blood-Clotting sclerosis, hepatitis C and herpes zoster. In spite
Factor VIII of the therapeutic applications interferons are
You would have studied in your earlier not within the reach of the common man due to
class that many factors are required for normal high cost for its production.
blood clotting process and the factor VIII is
one of them. The genes for the formation of 10.1.6 Recombinant Vaccines
factor VIII is located in the X chromosome. A Recombinant DNA technology has been
genetic defect in the synthesis of factor VIII used to produce new generation vaccines.The
results in Haemophilia A, a sex-linked disease limitations of traditional vaccine production could
characterized by prolonged clotting time and be overcome by this approach.
internal bleeding (Refer Chapter 4). Clotting The recombinant vaccines are generally of
factor VIII isolated from blood of normal uniform quality and produce less side effects as
human being was used in the treatment of compared to the vaccines produced by conventional
Haemophilia A. Requirement of large quantities methods. Different types of recombinant vaccines
of blood for this purpose and the risk of include subunit recombinant vaccines, attenuated
transmission of infectious diseases like AIDS is recombinant vaccines and DNA vaccines.
a disadvantage. Recombinant DNA technology Subunit recombinant vaccines
was used to produce Recombinant Factor VIII Vaccines that use components of a pathogenic
in the Chinese Hamster ovary and in the baby organism rather than the whole organism are called
Hamster kidney cells. More recently a cell line subunit vaccines; recombinant DNA technology
of human origin has been used for the first time is very suited for developing new subunit vaccines.
to produce human blood clotting factor VIII. It includes components like proteins, peptides and
DNAs of pathogenic organisms. The advantages of
10.1.5 Interferons these vaccines include their purity in preparation,
Interferons are proteinaceous, antiviral, stability and safe use.
species specific substances produced by Attenuated recombinant vaccines
mammalian cells when infected with viruses. This includes genetically modified
Interferons were discovered by Alick Isaacs pathogenic organisms (bacteria or viruses)
and Jean Lindemann in 1957. Based on the that are made nonpathogenic and are used
structure of interferons they are classified as vaccines. It is now possible to genetically
as α, β and γ interferons. They stimulate the engineer the organisms (bacteria or viruses) and
cellular DNA to produce antiviral enzymes use them as live vaccines and such vaccines are
which inhibit viral replication and protect the referred to as attenuated recombinant vaccines.
cells. Similar to factor VIII , interferons could

inserted onto a plasmid, and then incorporated
Edible vaccines are prepared by molecular into the cells in a target animal. DNA instructs
pharming using the science of genetic the cells to make antigenic molecules which are
engineering. Selected genes are introduced displayed on its surfaces. This would evoke an
into plants and the transgenic plants are antibody response to the free floating antigen
induced to manufacture the encoded protein. secreted by the cells. The DNA vaccine cannot
Edible vaccines are mucosal targeted vaccines cause the disease as it contains only copies of a
which cause stimulation of both systemic and few of its genes. DNA vaccines are relatively easy
mucosal immune response. At present edible and inexpensive to design and produce.
vaccines are produced for human and animal
diseases like measles, cholera, foot and mouth Vaccines produced by these new techniques
disease and hepatitis. have definite advantages like producing target
proteins, long lasting immunity and trigger
DNA Vaccines immune response only against specific
Genetic immunisation by using DNA pathogens with less toxic effects.
vaccines is a novel approach that came into being Recombinant hepatitis B vaccine as a
in 1990. The immune response of the body is subunit vaccine is produced by cloning
stimulated by a DNA molecule. A DNA vaccine hepatitis B surface antigen (HbsAg) gene in
consists of a gene encoding an antigenic protein, the yeast, Saccharomyces cerevisiae (Fig. 10.3).
The recombinant vaccine for hepatitis B (HbsAg) was the first synthetic vaccine launched in 1997
which was marketed by trade names Recombivax and Engerix-B. India is the fourth country in
the world after USA, France and Belgium to develop an indigenous hepatitis B vaccine.
DNA
HB
Recombinant vaccine
Bacterium
Extraction &
Hepatitis B purification of
Virus HB antigen HB vaccine
producing
gene Recombinant yeast
Recombinant cell multiplying and
DNA producing HB antigen
in fermentation tank
Bacterial Plasmid DNA
DNA cut with restriction
enzymes Fermentation
Tank
Plasmid
DNA
Bacterium HB antigen
Fig. 10.3 Production of recombinant HB Vaccine


10.2 Gene Therapy most genetic diseases have no effective treatment
If a person is born with a hereditary and so gene therapy could offer hope for many
disease, can a corrective therapy be given for people. There are two strategies involved in
such disease? Yes, this can be done by a process gene therapy namely; Gene augmentation
known as gene therapy. This process involves therapy which involves insertion of DNA into
the transfer of a normal gene into a person’s the genome to replace the missing gene product
cells that carries one or more mutant alleles. and Gene inhibition therapy which involves
Expression of normal gene in the person results insertion of the anti sense gene which inhibits
in a functional gene product whose action the expression of the dominant gene (Fig. 10.4).
produces a normal phenotype. Delivery of the The two approaches to achieve gene therapy
normal gene is accomplished by using a vector. are somatic cell and germ line gene therapy.
The main thrust of gene therapy has been Somatic cell therapy involves the insertion of
directed at correcting single gene mutations as a fully functional and expressible gene into a
in cystic fibrosis and haemophilia. At present target somatic cell to correct a genetic disease
Table 10.1 Differentiation between somatic cell gene therapy and germ line gene therapy
SOMATIC CELL GENE THERAPY GERM LINE GENE THERAPY
Therapeutic genes transferred into the somatic Therapeutic genes transferred into the germ
cells. cells.
Introduction of genes into bone marrow cells,
Genes introduced into eggs and sperms.
blood cells, skin cells etc.,
Will not be inherited in later generations. Heritable and passed on to later generations.
The first clinical gene therapy was given in 1990 by French Anderson to a four year
old girl with adenosine deaminase (ADA) deficiency. ADA deficiency or SCID (Severe
combined immunodeficiency) is an autosomal recessive metabolic disorder. It is caused
by the deletion or dysfunction of the gene coding for ADA enzyme. In these patients the
nonfunctioning T-Lymphocytes cannot elicit immune responses against invading pathogens.
The right approach for SCID treatment would be to give the patient a functioning ADA
which breaks down toxic biological products.
In some children ADA deficiency could be cured by bone marrow transplantation,
where defective immune cells could be replaced with healthy immune cells from a donor. In
some patients it can be treated by enzyme replacement therapy, in which functional ADA is
injected into the patient.
During gene therapy the lymphocytes from the blood of the patient are removed and
grown in a nutrient culture medium. A healthy and functional human gene, ADA cDNA
encoding this enzyme is introduced into the lymphocytes using a retrovirus. The genetically
engineered lymphocytes are subsequently returned to the patient. Since these cells are not
immortal, the patient requires periodic infusion of such genetically engineered lymphocytes.
The disease could be cured permanently if the gene for ADA isolated from bone marrow cells
are introduced into the cells of the early embryonic stages.

Bacterium carrying
plasmid with cloned normal Genetically disabled
human ADA gene retrovirus
Cloned ADA gene is

T cells
incorporated into virus
with disabled ADA gene
isolated from SCID patient Genetically altered
cells are reimplanted to
produce ADA
Retrovirus infects
T cells, transfer
ADA gene to cells
Cells are grown
in culture to
ensure ADA gene
is active
Fig. 10.4 Process of gene therapy
permanently whereas Germline gene therapy ability to regenerate damaged and diseased
involves the introduction of DNA into germ cells organs. Stem cells are capable of self renewal
which is passed on to the successive generations. and exhibit ‘cellular potency’. Stem cells can
Gene therapy involves isolation of a specific differentiate into all types of cells that are
gene and making its copies and inserting them derived from any of the three germ layers
into target cells to make the desired proteins. ectoderm, endoderm and mesoderm.
It is absolutely essential for gene therapists to In mammals there are two main types of
ensure that the gene is harmless to the patient stem cells – embryonic stem cells (ES cells)
and it is appropriately expressed and that the and adult stem cells. ES cells are pluripotent
body’s immune system does not react to the and can produce the three primary germ
foreign proteins produced by the new genes. layers ectoderm, mesoderm and endoderm.
Embryonic stem cells are multipotent stem
10.3 Stem Cell Therapy cells that can differentiate into a number of
Stem cells are undifferentiated cells types of cells (Fig. 10.5). ES cells are isolated
found in most of the multi cellular animals. from the epiblast tissue of the inner cell mass
These cells maintain their undifferentiated of a blastocyst. When stimulated ES can
state even after undergoing numerous mitotic develop into more than 200 cells types of the
divisions. adult body. ES cells are immortal i.e., they
Stem cell research has the potential to can proliferate in a sterile culture medium
revolutionize the future of medicine with the and maintain their undifferentiated state.

Adult stem cells are found in various tissues Stem Cell Banks
of children as well as adults. An adult stem cell or Stem cell banking is the extraction,
somatic stem cell can divide and create another processing and storage of stem cells, so that
cell similar to it. Most of the adult stem cells are they may be used for treatment in the future,
multipotent and can act as a repair system of the when required. Amniotic cell bank is a facility
body, replenishing adult tissues.The red bone that stores stem cells derived from amniotic
marrow is a rich source of adult stem cells. fluid for future use. Stem cells are stored in
The most important and potential banks specifically for use by the individual
application of human stem cells is the generation from whom such cells have been collected
of cells and tissues that could be used for cell and the banking costs are paid. Cord Blood
based therapies. Human stem cells could be used Banking is the extraction of stem cells from
to test new drugs. the umbilical cord during childbirth. While
the umbilical cord and cord blood are the most
Totipotency (Toti-total) is the ability of popular sources of stem cells, the placenta,
a single cell to divide and produce all of the amniotic sac and amniotic fluid are also rich
differentiated cells in an organism.
sources in terms of both quantity and quality.
Pluripotency (Pluri-several) refers to a
stem cell that has the potential to differentiate
into any of the three germ layers-ectoderm,
10.4 Molecular Diagnostics
endoderm and mesoderm. Early diagnosis of infectious diseases
Multipotency (multi-Many) refers or inherent genetic defects is essential for
to the stem cells that can differentiate into appropriate treatment. Early detection of the
various types of cells that are related. For disease is not possible using conventional
example blood stem cells can differentiate into diagnostic methods like microscopic
lymphocytes, monocytes , neutrophils etc., examinations, serum analysis and urine
Oligopotency (Oligo-Few) refers to stem analysis.These laboratory techniques are
cells that can differentiate into few cell types. indirect and not always specific. Scientists
For example lymphoid or myeloid stem cells
are continuously searching for specific,
can differentiate into B and T cells but not
RBC. sensitive and simple diagnostic techniques
for diagnosis of diseases. Recombinant DNA
Unipotency ( Uni- Single) refers to the
ability of the stem cells to differentiate into technology, Polymerase Chain Reactions
only one cell type. (PCR) and Enzyme Linked Immunosorbent
Assay (ELISA) are some of the techniques
that are reliable and help in early diagnosis.
More Presence of pathogens like virus, bacteria,
Stem cell
Stem cell etc., is detected only when the pathogen
produces symptoms in the patient. By the
time the symptoms appear concentration
of pathogen becomes very high in the body.
However very low concentration of a bacteria
Muscle cell Neuron or a virus, even when the symptoms of the
disease does not appear, can be detected by
amplification of their nucleic acid.
Red blood corpuscles
Fig. 10.5 Embryonic stem cells

ELISA [Enzyme Linked Immunosorbent Assay] There are four kinds of ELISA namely,
ELISA is a biochemical procedure Direct ELISA, Indirect ELISA, sandwich
discovered by Eva Engvall and Peter ELISA and competitive ELISA. It is a
Perlmanin (1971) to detect the presence of highly sensitive and specific method used
specific antibodies or antigens in a sample for diagnosis. ELISA possesses the added
of serum, urine, etc., It is a very important
diagnostic tool to determine if a person is Coating
Antigen is adsorbed onto the wells in
HIV positive or negative. ELISA is a tool for ELISA plate in coating buffer
determining serum antibody concentrations
(such as the antibodies produced in a person Remove buffer and wash plate
infected by pathogens such as HIV) and also
Blocking
for detecting the presence of specific antigens A buffer containing unrelated protein is
used to block free sites in the wells
and hormones such as human chorionic
gonadotropins.
Remove buffer and wash plate
During diagnosis the sample suspected
Detection
to contain the antigen is immobilized on the Enzyme conjugated detection antibody
surface of an ELISA plate (Fig. 10.6). The binds antigen
antibody specific to this antigen is added
and allowed to react with the immobilized Remove buffer and wash plate
antigen. The anti-antibody is linked to an
Readout
appropriate enzyme like peroxidase. The Substrate is catalyzed by the enzyme to
unreacted anti-antbody is washed away generate colored readout
and the substrate of the enzyme (hydrogen

peroxidase) is added with certain reagents
such as 4-chloronaphthol. The activity of the
enzyme yields a coloured product indicating
the presence of the antigen. The intensity
of the colour is directly proportional to
the amount of the antigen. ELISA is highly
sensitive and can detect antigens in the range
of a nanogram.
Enzyme-linked Substrate Product

Detection Antibody
Target
Antigen
Capture
Antibody
Fig. 10.6 Enzyme Linked ImmunoSorbent Assay

advantages of not requiring radioisotopes or each primer by copying the single stranded
a radiation counting apparatus. template. At the end of incubation both single
PCR (Polymerase Chain Reaction) template strands will be made partially double
The polymerase chain reaction (PCR) stranded. The new strand of each double
is an invitro amplification technique used stranded DNA extends to a variable distance
for synthesising multiple identical copies downstream. These steps are repeated again
(billions) of DNA of interest. The technique and again to generate multiple forms of the
was developed by Kary Mullis (Nobel desired DNA. This process is also called DNA
laureate, 1993) in the year 1983. amplification (Fig. 10.8).
Denaturation, renaturation or The PCR technique can also be used

primer annealing and synthesis or primer for amplifications of RNA in which case
extension, are the three steps involved in it is referred to as reverse transcription
PCR (Fig. 10.7). The double stranded DNA PCR (RT-PCR). In this process the RNA
of interest is denatured to separate into two molecules (mRNA) must be converted to
individual strands by high temperature . This complementary DNA by the enzyme reverse
is called denaturation. Each strand is allowed transcriptase. The cDNA then serves as the
to hybridize with a primer (renaturation or template for PCR.
primer annealing). The primer template is PCR In Clinical Diagnosis
used to synthesize DNA by using Taq – DNA The specificity and sensitivity of PCR
polymerase. is useful for the diagnosis of inherited
During denaturation the reaction disorders (genetic diseases), viral diseases,
mixture is heated to 950 C for a short time to bacterial diseases, etc., The diagnosis and
denature the target DNA into single strands treatment of a particular disease often
that will act as a template for DNA synthesis. requires identifying a particular pathogen.
Annealing is done by rapid cooling of the Traditional methods of identification involve
mixture, allowing the primers to bind to the culturing these organisms from clinical
sequences on each of the two strands flanking specimens and performing metabolic and
the target DNA. During primer extension or other tests to identify them. The concept
synthesis the temperature of the mixture is behind PCR based diagnosis of infectious
increased to 750C for a sufficient period of diseases is simple – if the pathogen is present
time to allow Taq DNA polymerase to extend in a clinical specimen its DNA will be present.
5’ 3’
3’ 5’
5’ 3’
Nucleotide
5’ 3’
5’ 3’ Denaturation Annealing Extension

3’ 5’
3’ 5’
DNA primer 3’ 5’
Original
DNA
5’ 3’
3’ 5’
Fig. 10.7 Steps involved in PCR

As a technique which can amplify even
Targeted sequence
5’
minute quantities of DNA from any source,
3’
5’ 3’ like hair, mummified tissues, bones or any
Heat, cool, add fossilized materials.
primers to get
ssDNA that
primers anneal to
PCR technique can also be used in the
5’ 3’ 3’ 5’
field of forensic medicine . A single molecule
of DNA from blood stains, hair, semen of
Primer Primer an individual is adequate for amplification
Add Taq polymerase, by PCR. The amplified DNA is used to
dGTP, dCTP, dATP, dTTP
to synthesize develop DNA fingerprint which is used as an
complimentary strand
important tool in forensic science.Thus, PCR
3’ 5’ 3’ 5’ is very useful for identification of criminals.
5’ 3’ 5’ 3’
PCR is also used in amplification of specific
Repeat cycle DNA segment to be used in gene therapy.
25 to 75 times
Fig. 10.8 Polymerase chain reaction 10.5 Transgenic Animals

In early days selective breeding
Its DNA has unique sequences that can be methods were carried out to improve the
detected by PCR, often using the clinical genetic characteristics of live stock and
specimen (for example, blood, stool, spinal other domestic animals. With the advent of
fluid, or sputum) in the PCR mixture. PCR modern biotechnology it is possible to carry
is also employed in the prenatal diagnosis out manipulations at the genetic level to get
of inherited diseases by using chorionic the desired traits in animals. Transgenesis
villi samples or cells from amniocentesis. is the process of introduction of extra
Diseases like sickle cell anemia, β-thalassemia (foreign/exogenous) DNA into the genome
and phenylketonuria can be detected by of the animals to create and maintain stable
PCR in these samples. cDNA from PCR is a heritable characters. The foreign DNA
valuable tool for diagnosis and monitoring that is introduced is called the transgene
retroviral infections – e.g., Tuberculosis by and the animals that are produced by DNA
Mycobacterium tuberculosis. manipulations are called transgenic animals
Several virally induced cancers, like or the genetically engineered or genetically
cervical cancer caused by Papilloma virus modified organisms.
can be detected by PCR. Sex of human beings The various steps involved in the
and live stocks, embryos fertilized invitro can production of transgenic organisms are
be determined by PCR by using primers and • Identification and separation of desired
DNA probes specific for sex chromosomes. gene.
PCR technique is also used to detect sex-
• S election of a vector (generally a virus) or
linked disorders in fertilized embryos.
direct transmission.
Applications of PCR • Combining the desired gene with the vector.
The differences in the genomes of • Introduction of transferred vector
two different organisms can be studied by into cells, tissues, embryo or mature
PCR. PCR is very important in the study of individual.
evolutions, more specifically phylogenetics.

• D
emonstration of integration and
expression of foreign gene in transgenic
tissue or animals. Transgenic animals such
as mice, rat, rabbit, pig, cow, goat, sheep
and fish have been produced (Fig. 10.9). Human
gene E
Egg
Uses Of Transgenesis donor
• T
ransgenesis is a powerful tool to study Egg
gene expression and developmental

Micro injection of
processes in higher organisms. human gene
• T
ransgenesis helps in the improvement of
genetic characters in animals.Transgenic
animals serve as good models for
understanding human diseases which
help in the investigation of new treatments
for diseases.Transgenic models exist for Development
within a host goat
many human diseases such as cancer,
Alzheimer’s, cystic fibrosis, rheumatoid
arthritis and sickle cell anemia.
Transgenic
• T
ransgenic animals are used to produce goat
proteins which are important for medical Milk from
and pharmaceutical applications. transgenic goat
• T
ransgenic mice are used for testing the
safety of vaccines. Fig. 10. 9 Production of transgenic
animals
• T
ransgenic animals are used for testing
toxicity in animals that carry genes which as a microorganism, plant cell or animal cell,
make them sensitive to toxic substances and are often more difficult to characterize than
than non-transgenic animals exposed small molecule drugs. Through recombinant
to toxic substances and their effects are DNA technology it is possible to produce these
studied. biological products on demand. There are
many types of biological products approved
• T
ransgenesis is important for improving
for use -they are, therapeutic proteins,
the quality and quantity of milk, meat,
monoclonal antibodies and vaccines. Health
eggs and wool production in addition to
care and pharmaceutical industries have been
testing drug resistance.
revolutionised by biotechnological proteins.
10.6 Biological products and their Hormones and antibodies are produced
commercially, primarily for the medical
uses
industry. Recombinant hormones like Insulin,
A biological product is a substance
Human growth hormone, Recombinant
derived from a living organism and used for
vaccines and recombinant proteins like human
the prevention or treatment of disease. These
alpha lactalbumin are available today.
products include antitoxins, bacterial and
viral vaccines, blood products and hormone Animals are used as bioreactors to produce
extracts. These products may be produced desirable proteins. Antibodies are substances
through biotechnology in a living system, such that react against the disease causing antigens

and these can be produced using transgenic
animals as bioreactors. Monoclonal antibodies,
which are used to treat cancer, heart disease
and transplant rejection are produced by this Udder cell Egg from B
technology. Natural protein adhesives are from A
non toxic, biodegradable and rarely trigger

Nucleus
an immune response, hence could be used Nucleus
Remove
to reattach tendons and tissues, fill cavities in nucleus from
Fuse cells egg
teeth, and repair broken bones.
10.7 Animal Cloning

Cloning is the process of producing
genetically identical individuals of an organism
either naturally or artificially. In nature many Culture in
organisms produce clones through asexual oviduct tissue
reproduction.
Implant 6 day old
Cloning in biotechnology refers to the embryo in surrogate
process of creating copies of organisms or copies
of cells or DNA fragments (molecular cloning).
Blastocyst
Dolly was the first mammal (Sheep)
clone developed by Ian Wilmut and Campbell
in 1997. Dolly, the transgenic clone was
developed by the nuclear transfer technique
and the phenomenon of totipotency.
Totipotency refers to the potential of a cell
Dolly
to develop different cells, tissues, organs and
finally an organism. Fig. 10. 10 Cloning of dolly
The mammary gland udder cells (somatic
the process of fertilization (Fig. 10.10).
cells) from a donor sheep (ewe) were isolated
and subjected to starvation for 5 days. The Advantages and Disadvantages Of Cloning
udder cells could not undergo normal growth Animals
cycle, entered a dormant stage and became • O ffers benefits for clinical trials and medical
totipotent. An ovum (egg cell) was taken research. It can help in the production of
from another sheep (ewe) and its nucleus was proteins and drugs in the field of medicine.
removed to form an enucleated ovum. The • Aids stem cell research.
dormant mammary gland cell/udder cell and • Animal cloning could help to save endangered
the enucleated ovum were fused. The outer species.
membrane of the mammary cell was ruptured
• A
nimal and human activists see it as a threat
allowing the ovum to envelope the nucleus.
to biodiversity saying that this alters evolution
The fused cell was implanted into another
which will have an impact on populations and
ewe which served as a surrogate mother. Five
the ecosystem.
months later dolly was born. Dolly was the
first animal to be cloned from a differentiated • The process is tedious and very expensive.
somatic cell taken from an adult animal without • It can cause animals to suffer.

• R
eports show that animal surrogates were environmental catastrophies. Although many
manifesting adverse outcomes and cloned are concerned about the possible risk of genetic
animals were affected with disease and have engineering, the risks are in fact slight and the
high mortality rate. potential benefits are substantial.
• It might compromise human health through
10.9 Regulations in Biotechnology
consumption of cloned animal meat.
Regulations apply to the production, sale
• C
loned animals age faster than normal
and use of biotech products and genetically
animals and are less healthy than the parent
modified organisms. GMOs are carefully
organism as discovered in Dolly.
tested and documented before the products are
• C
loning can lead to occurrence of genetic available. GMOs should be labelled and used
disorders in animals. according to instructions. These regulations are
• M
ore than 90% of cloning attempts fail to designed to protect the people, living organisms
produce a viable offspring. and the environment. The Biotechnology
Regulatory Authority of India (BRAI) is a
Ian Wilmut and Campbell proposed regulatory body in India for uses of
removed 277 cells from biotechnology products including GMOs. The
the udder of an adult Genetic Engineering Approval Committee
sheep and fused those (GEAC), a body under the Ministry of
cells with 277 unfertilised Environment, forests and climate change
egg cells from which the nuclear material (India) is responsible for approval of
was removed. After culturing the resulting genetically engineered products in India. If
embryos for 6 days , they implanted 29 the bill is passed the responsibility will be
embryos into the surrogate mother's womb taken over by the Environmental Appraisal
and only one Dolly was produced. Panel, a subdivision of the BRAI. The bill
also proposes setting up an inter ministerial
A gene ‘knock out’ is a genetically governing body to oversee the performance
engineered organism that carries one or of BRAI and a National Biotechnology
more genes in its chromosomes that have Advisory Council of stakeholders to
been made inoperative. provide feedback on the use of, import and
manufacture of biotechnology products and
10.8 Ethical Issues organisms in the society. The regulatory
Biotechnology has given to the society cheap body is an autonomous and statutory
drugs, better friuts and vegetables, pest resistant agency to regulate the research, transport,
crops, indigenious cure to diseases and lot of import and manufacture of biotechnology
controversy. This is mainly because the major products and organisms.
part of the modern biotechnology deals with GEAC is assisted by the State
genetic manipulations. People fear that these Biotechnology Co-ordination Committee
genetic manipulations may lead to unknown (SBCC) and District Level committee (DLC).
consequences. The major apprehension The most important committees are The
of recombinant DNA technology is that Institutional Biosafety Committee (IBSC),
unique microorganisms either inadvertently responsible for the local implementation of
or deliberately for the purpose of war may guidelines; Review Committee on Genetic
be developed that could cause epidemics or Manipulation (RCGM) is responsible

Industrial licensing under
1. The Recombinant DNA Advisory Advisory the Industrial (Development and
Committee (RDAC) Regulation) Act, 1951 is compulsory
2. Institutional Biosafety Committee for bulk drugs produced by the use
(IBSC) of recombinant DNA technology.
3. Review Committee on Genetic
Being a signatory to the Trade
Manipulation (RCGM) Approval
Related Intellectual Property Rights
4. Genetic Engineering Approval
(TRIPS) Agreement of WTO,
Committee (GEAC)
India has amended its legislations
5. State Biotechnology Coordination
pertaining to intellectual property
Committee (SBCC)
Monitoring through various legislations including
6. District Level Committee (DLC)
Patents (Amendment) Act, 1999.
Biopiracy can be defined as “the 10.10 Possible threats of Genetically

use of bioresources by multinational Modified Organisms
companies and other organisations
Genetically Modified Organisms (GMOs)
without proper authorization from the
also called Genetically Engineered organisms
countries and the people concerned
(GEOs) are created to play a role in agriculture,
without compensatory payment”.
forestry, aquaculture, bioremediation and
Bioethics is the study of the ethical environmental management in developed and
issues emerging from the advances in developing countries. However, deliberate
Biology and medicine. It is also a moral or inadvertent release of GMOs into the
discernment as it relates to the medical environment could have negative ecological
policy and practice. effects under certain circumstances.
for issuing permits and the GEAC is The possible risks of GMOs
responsible for monitoring the large scale
and commercial use of transgenic materials. Creating new or more vigorous pests and
pathogens. Worsening the effects of existing
The biotechnology industry is governed
pests through hybridization with related
by different enactments depending on their
transgenic organisms.
relevance / applicability on a case to case
basis. “Recombinant DNA safety guidelines, • Harming non-target species such as soil
1990” were released by the Department of organisms, non-pest insects, birds and
Biotechnology (DBT) which cover areas of other animals.
research involving genetically engineered • Disrupting biotic communities including
organisms and these guidelines were agro ecosystems.
further revised in 1994. • Irreparable loss or changes in species
RCGM under the DBT comprises diversity or genetic diversity within species.
representatives of DBT, Indian Council • Creating risks for human health.
for Medical Research, Indian Council for The release of GMOs into the environment
Agricultural research and Council for Scientific could also have far reaching consequences. This
and Industrial Research. is because the living GMOs proliferate, persist,

Risks of GMOs
Environmental Health Agricultural
Proteins transcribed and
Toxins in pest-resistant
translated from transferred
GMOs could negatively GMOs with pest toxins could increase
genes could cause allergic
impact non-target evolution of resistance in certain pest
reactions in humans or other
organisms and harm populations.
animals – currently GM foods
ecosystems.
are not properly labeled.
Cross-species pollination Antibiotic resistance genes

could spread herbicide used as markers during Big biotech companies hold monopolistic
resistance genes and gene transfer could spread legal rights (patents) over GM seeds.
create 'super-weeds'. to pathogenic bacteria.
Biodiversity could be
negatively affected by Transferred genes GMOs do present two major
destruction of pests, could mutate and cause agricultural problems in the forms of
weeds, and even unexpected risks. pesticide- and herbicide-resistance.
competing plants.
disperse and sometimes may transfer their DNA 1986 for the manufacture, use, import, export
into other organisms. GEOs could also displace and storage of hazardous micro organisms
the existing organism and create new species and genetically engineered organisms, cells
which may cause severe environmental damage. etc., These guidelines are implemented and
Due to these risks the regulatory authorities monitored by the Institutional Biosafety
are very careful in permitting the field trials of Committees (IBSCs), the Review Committee on
GMOs into the environment. Genetic Manipulation (RCGM) and the Genetic
Engineering Approval Committee (GEAC) of
10.11 Biosafety Guidelines the Ministry of Environment and Forest.
Due to the growing concerns arising from Intellectual Property Rights (IPR) and
Genetically Modified Organisms (GMOs) Protection (IPP)
throughout the globe the WHO has built an
The physical objects like household
informal working group on biosafety in 1991.
goods or land or properties of a person and
This group prepared the ‘voluntary code for
the ownership and rights on these properties
the release of organisms into the environment’.
is protected by certain laws operating in the
ICGEB (International Centre for Genetic
country. This type of physical property is
Engineering and Biotechnology) has played a
tangible; but the transformed microorganisms,
significant role in issues related to biosafety
and the environmentally sustainable use of plants, animals and technologies for the
biotechnology. The main ‘topic of concern’ production of commercial products are
related to the release of GMO’s are risks for exclusively the property of the intellectuals. The
human health, environment, and agriculture discoverer or inventor has complete rights on his
which is found on the website of ICGEB. property or invention. The rights of intellectuals
are protected by laws framed by a country. The
In India, DBT has evolved ‘rDNA safety
guidelines’ to exercise powers conferred intellectual property is an intangible asset. Legal
through the Environmental Protection Act rights or patents provide an inventor only a

temporary monopoly on the use of an invention, invention for a defined period (usually 20
in return for disclosing the knowledge to the years). It is a legal document safeguarding
others who may use the knowledge to develop the rights and privileges of an inventor /
further inventions and innovations. invention. The purpose of patenting in
The laws are formulated from time to biotechnology ensures fair financial returns
time at national and international levels. for those who have invested finances, ideas,
Development of new crop varieties is also an time and hard work for an invention.
intellectual property right. It is protected by The following criteria must be satisfied for
‘plant breeders rights’ (PBRs). PBRs recognize patenting :
the fact that farmers and rural communities • The invention must be novel and useful;
have contributed to the creation, conservation,
• T
he product must be inventive and
exchange and knowledge of genetic and
reproducible;
species utilization of genetic diversity. IPR
• T
he patent application should provide the
and IPP are granted by the Government to
full description of the invention and the
plant breeders for producing a specific plant
invention must be patentable.
variety that is new and never existed before.
IPR is protected by different ways like
patents, copyrights and trade marks. The first living organism
that was patented was a
Patents genetically engineered
The science of biotechnology involves species of bacteria -
the production of enormous number of Pseudomonas putida in
commercial products of economic importance. 1980 which was genetically engineered by
The inventions include biotechnology Ananda Mohan Chakrabarty in 1971.
products and processes. The products include
living entities like micro organisms, animals,
General agreement of tariffs and trade
plants, cell lines, cell organelles, plasmids and
(GATT) and trade related IPRs (TRIPs)
genes and naturally occurring products like
GATT was framed in 1948 by developed
primary and secondary metabolites produced
countries to settle dispute, among the countries
by living systems e.g. alcohol, antibiotics.
regarding share of world trade. The benefits
of GATT was enjoyed only by developed
Thomas Alva Edison was the only scientist in countries. In 1988 US congress enacted a
the world with more than 1000 patents to his law ‘the omnibus trade and competitiveness
credit. act’ (OTCA) which gave powers to US to
investigate the laws related to trade.
The biotechnological processes
involve isolation, purification, cultivation, Geographical indication (GI)
bioconversion of novel, innovative, simple A geographical indication is a name or
and cost effective processes, and creation of sign used on products which correspond to
biotechnological products. a specific geographical origin and possess
A patent is a Government issued qualities or a reputation that are due to that
document that allows the person for an origin. Geographical indications are typically
exclusive right to manufacture, use or sell an used for agricultural products, food products,

handicrafts and industrial products. Darjeeling systems, living organisms or derivatives thereof,
tea was the first GI tagged product in India in to make or modify products or processes for
2004-05. In Tamilnadu, Kancheepuram silk, specific use”. In 1919, Hungarian agricultural
Coimbatore wetgrinder, Thanjavur paintings, engineer Karl Ereky coined the term
Madurai Malli and Temple jewellery of Biotechnology. Biotechnology includes two
Nagercoil are GI tagged. major technologies, Genetic engineering and
Chemical engineering.
Copyright
The protection of authorships of published Biotechnology has application in four
work comes under copyrights of IPRs. Copyright major industrial areas, including health
protection is given for form of expressions care (medical) agriculture, industrial and
of ideas. For example the authors, editors, environment.Biotechnology techniques are
publishers or both the publisher/ editor of a book used in the field of medicine for diagnosis,
have copyrights. The content of the book cannot prevention and treatment of different diseases.
be reproduced or reprinted without written Production of recombinant hormones,
permission from copyright holders. Patents and recombinant clotting factor VIII and
trade secrets provide protection for the basic recombinant interferons have helped in the
knowhow but copyright protects the expressed treatment of diseases. Recombinant vaccines
materials in printed, video recorded or taped
have been used to prevent various diseases.
forms. In the field of biotechnology the data
The recombinant vaccines are of three types-
base of DNA sequences or any published forms,
subunit recombinant vaccines, attenuated
photomicrographs, etc., are subject to copyright.
recombinant vaccines and gene recombinant
Trade marks vaccines.
Any specific symbol or words to identify Genetic defects could be corrected by a process
a particular product or process of a company called Gene therapy. It is of two types somatic cell
constitute trademark. This enables the public gene therapy and germline gene therapy.
to distinguish between a trader’s goods from
Stem cells are undifferentiated cells found
similar goods of other traders
in multicellular organisms. These cells are of
Biotechnology as an independent two types -Embryonic stem cells and adult stem
discipline has drawn world wide attention from cells. Stem cells have the ability to regenerate
the Governments and the corporate world damaged and diseased organs. Recombinant
because of its limitless applications. It is looked DNA technology, Polymerase chain reaction
upon as a panacea for treating diseases and and Enzyme Linked Immunosorbent Assay
genetic disorders. The global demand of the are techniques that are reliable and help in early
biotechnological products is on the increase. diagnosis.
It is the science for the future with solutions
Transgenesis is the process of introduction
to many of the problems related to health,
of a foreign gene into the genome of animals to
agriculture, environment and industries.
create and maintain stable heritable characters.
Summary A biological product is a substance derived
Biotechnology is defined as “any from a living organism and used for the
technological application that uses biological prevention or treatment of diseases.

Cloning is the process of producing 4. GEAC stands for
genetically identical individuals of an organism a) Genome Engineering Action Committee
either naturally or artificially. b) Ground Environment Action Committee
c) Genetic Engineering Approval Committee
Advances in Biotechnology and their d) Genetic and Environment Approval
applications are most frequently associated Committee
with controversies, ethical issues and concerns.
5. H
ow many amino acids are arranged in the
Statutory bodies are constituted to monitor
two chains of Insulin?
and approve the biotechnological processes
a) Chain A has 12 and Chain B has 13
and products.
b) Chain A has 21 and Chain B has 30 amino
Genetically modified organisms can play acids
a positive role in sustainable agriculture, c) Chain A has 20 and chain B has 30 amino
forestry, aquaculture, bioremediation and acids
environmental management in developed and d) Chain A has 12 and chain B has 20 amino
acids.
developing countries. Biosafety guidelines
have been formulated by many countries for 6. P
CR proceeds in three distinct steps governed
DNA recombinant manipulations. by temperature, they are in order of
a) Denaturation, Annealing, Synthesis
b) Synthesis, Annealing, Denaturation
Evaluation
c) Annealing, Synthesis, Denaturation
1. T
he first clinical gene therapy was done for d) Denaturation, Synthesis, Annealing
the treatment of
7. Which one of the following statements is true
a) AIDS
regarding DNA polymerase used in PCR?
b) Cancer
a) It is used to ligate introduced DNA in
c) Cystic fibrosis
recipient cells
d) SCID
b) It serves as a selectable marker
2.
Dolly, the sheep was c) It is isolated from a Virus
obtained by a technique d) It remains active at a high temperature.
known as
8. ELISA is mainly used for
a) Cloning by gene transfer
a) Detection of mutations
b) Cloning without the help of gametes b) Detection of pathogens
c) Cloning by tissue culture of somatic cells c) Selecting animals having desired traits
d) Cloning by nuclear transfer d) Selecting plants having desired traits
3.
The genetic defect adenosine deaminase 9. Transgenic animals are those which have
deficiency may be cured permanently by
a) Enzyme replacement therapy a) Foreign DNA in some of their cells
b) periodic infusion of genetically engineered b) Foreign DNA in all their cells
lymphocytes having ADA cDNA c) Foreign RNA in some of their cells
c)
administering adenosine deaminase d) Foreign RNA in all their cells
activators 10. Recombinant Factor VIII is produced in
d) introducing bone marrow cells producing the ------- cells of the Chinese Hamster
ADA into embryo at an early stage of a) Liver cells b) blood cells
development.

c) ovarian cells d) brain cells. 20. If a person thinks he is infected with HIV,
due to unprotected sex, and goes for a blood
11. Vaccines that use components of a test. Do you think a test such as ELISA will
pathogenic organism rather than the whole help? If so why? If not, why?
organism are called
21. Explain how ADA deficiency can be
a) Subunit recombinant vaccines corrected?
b) attenuated recombinant vaccines 22. What are DNA vaccines?
c) DNA vaccines 23. Differentiate between Somatic cell gene
d) conventional vaccines. therapy and germline gene therapy.
12. Mention the number of primers required in 24. What are stem cells? Explain its role in the
each cycle of PCR. Write the role of primers field of medicine.
and DNA polymerase in PCR. Name the
25. What are the possible risks of GMOs?
source organism of the DNA polymerase
used in PCR. 26. One of the applications of biotechnology is
‘gene therapy” to treat a person born with a
13. How is the amplification of a gene sample of
hereditary disease.
interest carried out using PCR?
i) What does “gene therapy” mean?
14. W
hat is genetically engineered Insulin?
ii) Name
the hereditary disease for which
15. Explain how “Rosie” is different from a
the first clinical gene therapy was used.
normal cow.
iii)
Mention the steps involved in gene
16. How was Insulin obtained before the
therapy to treat this disease.
advent of rDNA technology? What were the
problems encountered? 27. PCR is a useful tool for early diagnosis of an
Infectious disease. Elaborate.
17. ELISA is a technique based on the
principles of antigen-antibody reactions. 28. What are recombinant vaccines?. Explain
Can this technique be used in the molecular the types.
diagnosis of a genetic disorder such as 29. Explain why cloning of Dolly, the sheep
Phenylketonuria? was such a major scientific breakthrough?
18. Gene therapy is an attempt to correct a 30. Mention the advantages and disadvantages
Genetic defect by providing a normal gene of cloning.
into the individual. By this the function
31. Explain how recombinant Insulin can be
can be restored. An alternate method
produced.
would be to provide gene product known
as enzyme replacement therapy, which 32. Explain the steps involved in the production
would also restore the function. Which of recombinant hGH.
in your opinion is a better option? Give
reasons for your answer.
19. W
hat are transgenic animals? Give
examples.

ICT CORNER
Applications of biotechnology Science for a
better life
A Transgenic fly. Come let us create

and use
Procedure :
Step -1: Type the URL or scan the QR code to open the activity page and click “Click to enter
the lab” to begin.
Step -2: Click wherever the cursor symbol becomes as “Hand” symbol as that would lead for
the next step.
Step -3 Follow the instructions for all the six steps “Prepare DNA to Examine Light Output”.
Step – 4 : Explore the “Use Transgenic flies” a dialog box option found below the lab area to
know uses.
Step 4
Applications of biotechnology Science for a better life URL:

http://media.hhmi.org/biointeractive/vlabs/transgenic_fly/index.html?_
ga=2.234689054.1812412497.1546851037-264360672.1545143882

*Allow flash player

11
2
UNIT
UNIT--VI
Organisms
Reproductive
and
Population
CHAPTER
Save nature – save our future

Chapter
Chapter Outline
Outline
11.1. Organism and its Environment
11.2. Habitat
11.3. Major Abiotic Components or Factors
11.4. Concept of Biome and Distribution
11.5. Responses to abiotic factors
T he word ‘ecology’ is derived from the
Greek term ‘oikos’, meaning ‘house’
and logos, meaning ‘study’. Thus, the study
11.6. Adaptations of the environmental ‘house’ includes all
11.7. Populations the organisms in it and all the functional
11.8. Population attributes processes that make the house habitable.
11.9. Population age distribution
The study of ecology encompasses
11.10. Growth models / Curves
different levels-organism, population,
11.11. Population regulation
11.12. Population interactions community, ecosystem, etc., In ecology, the
term population, originally coined to denote
a group of people is broadened to include
Learning Objectives
groups of individuals of any one kind of
To gain knowledge / insight about: organism. Community in the ecological sense
➢ The local and geographical distribution (designated as ‘biotic community’) includes
- abundance of organisms.
all the populations occupying a given area.
➢ Temporal changes in the occurrence,
abundance and activities. The community (Biotic) and the non-living
➢ Interrelationship between environment (Abiotic) function together as
organism in population an ecological system (or) ecosystem. Biome
and communities. is a term in wide use for a large regional or
➢ Structural adaptation and sub continental system characterized by a
functional adjustment
major vegetation type. The largest and most
of organisms to their physical
environment. nearly self-sufficient biological system is
➢ The evolutionary development of all often designated as the Ecosphere, which
these interrelations. includes all the living organisms of the Earth,
➢ Population growth, models, regulation. interacting with the physical environment
➢ Animal associations – intraspecific, to regulate their distribution, abundance,
interspecific. production and evolution.
189

11.1 Organism and its environment (respiration), air sacs (floatation) and kidneys
Every living organism has its own (excretion).
specific surrounding, medium or environment Niche (or) Ecological Niche
with which it continuously interacts and As every organism has its unique habitat,
develops suitable adaptations for survival so also it has an ecological niche which includes
there. Environment is a collective term which the physical space occupied by an organism
includes the different conditions in which an and its functional role in the community.
organism lives or is present. The common and The ecological niche of an organism not only
influencing factors in any environment are light, depends on where it lives but also includes the
temperature, pressure, water, salinity. These are sum total of its environmental requirements.
collectively referred to as Abiotic components. Charles Elton (1927) was the first to
Environments are variable and dynamic, in use the term ‘niche’ as the functional status
which temperature changes and light changes of an organism in its community. Groups
are diurnal and seasonal. These influence the of species with comparable role and niche
organisms inhabiting them. An organism’s dimensions within a community are termed
growth, distribution, number, behavior and ‘guilds’. Species that occupy the same niche
reproduction is determined by the different in different geographical regions, are termed
factors present in the environment. ‘ecological equivalents’.
Many animals share the same general
11.2 Habitat habitat. But their niches are well defined. The
A habitat can be considered as the ‘address’ life style of an individual population in the
of the organism. The collection of all the habitat habitat is known as its niche. For example,
areas of a species constitutes its geographical crickets and grasshoppers are closely related
range. Organisms in a habitat interact with each insects that live in the same habitat, yet
other and can be part of trophic levels to form they occupy different ecological niches. The
food chains and food webs. grasshopper is very active during daylight. It
Examples: In a xerophytic habitat, the can usually be found on a plant, feeding on the
camel is able to use water efficiently and plant parts. Although the cricket lives in the
effectively for evaporative cooling through their same field, it is quite different. During the day,
skin and respiratory system. They excrete highly the cricket hides under leaves or plant debris
concentrated urine and can also withstand and is usually inactive. It is active at night time
dehydration upto 25% of the body weight. The (nocturnal). The cricket and the grasshopper
hoofs and hump are also suitable adaptations do not interfere with each other’s activities in
for survival in this dry sandy environment. the same habitat. Thus, niche of an organism
In an aquatic media, maintaining can be defined as the total position and
homeostasis and osmotic balance is a challenge. function of an individual in its environment.
So, marine animals have appropriate adaptations In a pond ecosystem, where Catla, Rohu
to prevent cell shrinkage. While freshwater and Mrigal are present, the ecological niche of
organisms have suitable adaptations to withstand the Catla is a surface feeder, Rohu is a column
bursting of their cells. Apart from this, organisms feeder and Mrigal is a bottom feeder. Their
such as fish have a wide range of adaptations mouths are designed to suit their niche and
like fins (locomotion), streamlined body hence have different positions and functions in
(aerodynamic), lateral line system (sensory), gills their habitat. (Fig.11.1)
Organisms and populations 190

6RODU The metabolism of organisms is regulated
UDGLDWLRQ
by enzymes which are temperature sensitive. In
many organisms, determination of sex and sex
3KRWRV\QWKHVLV
ratio, maturation of gonads, gametogenesis and
6XUIDFH
IHHGHU reproduction is influenced by temperature. In
&DWOD
LV
certain environments, the size and colouration
VLV
RUDXWRO\V
QGRUDXWRO\
3K\WRSODQNWRQ 0DFURSK\WHV
of animals are influenced by temperature. Birds
1XWULHQWV ([FUHWLRQDQG
([FUHWLRQD
and mammals attain greater body size in colder
&ROXPQ
IHHGHU5RKX
=RRSODQNWRQ
regions than warmer regions (Bergmann’s rule).

Warm blooded animals, living in colder climates,
1XWULHQWV
%HQWKRV
%RWWRP
IHHGHU0ULJDO
tend to have shorter limbs, ears and other
0LFURELDOGHFRPSRVLWLRQ
appendages when compared to the members of
Fig.11.1 Types of feeders (niche) in pond ecosystem the same species in warmer climates (Allen’s
rule). In some aquatic environments, an inverse
relationship between water temperature and
11.3 Major Abiotic Components fish meristic characters is observed - lower the
or Factors temperature, more the vertebrae (Jordon’s rule).
The abiotic factors include the chemical
Bergman's rule
and physical factors which influence or affect Bergman's rule is an eco geographic principle
organisms and their functioning in their that states that within broadly distributed
taxoncmic clade, populations and
environment. The common abiotic factors are: species of larger size are found in
colder and of smaller
Temperature size are in warmer
regions.
Temperature or degree of hotness and
coldness is an essential and variable factor in
any environment. It influences all forms of life
by affecting many vital activities of organisms
like metabolism, behaviour, reproduction,
7KH$OOHQ5XOH
development and even death in the Biosphere. )URPWKHQRUWKHUQDUFWLFKDUH/DUFWLFXVWKURXJKWKHPRUH
The minimum and maximum temperature of an VRXWKHUO\GHVHUWMDFNUDEELW/DOOHQLKDUHVVKRZSURJUHVVLYHO\
ORQJHUH[WUHPLWLHVOHJV HDUVDQGOHDQHUERGLHV
environment regulates the survival of a cell.
van’t Hoff ’s rule

van’t Hoff proposed that, with the
D/HSXV E/DPHULFDQXV F/FDOLIRPLFXV G/DOOHQL
increase of every 10ºC, the rate of metabolic DUFWLFXV
activity doubles or the reaction rate is

Temperature influences the distribution
halved with the decrease of 10ºC. This rule
of organisms. The tropics have higher diversity
is referred as the van’t Hoff ’s rule. The effect
and density of populations, when compared to
of temperature on the rate of reaction is
expressed in terms of temperature coefficient temperate and polar regions.
or Q10 value. The Q10 values are estimated
taking the ratio between the rate of reaction Adaptations to temperature
at XºC and rate of reaction at (X-10ºC). In Adaptation to temperature is essential
the living system the Q10 value is about 2.0. for the survival of the species/organisms.
If the Q10 value is 2.0, it means 10ºC increase Organisms which can survive a wide range of
and the rate of metabolism doubles. temperature are referred to as Eurytherms
191 Organisms and populations

(cat, dog, tiger, human). Eurythermy can be calories) and duration (length of day) of light
an evolutionary advantage: adaptations to cold are considered significant for organisms.
temperatures (cold-eurythemy) are seen as Light influences growth, pigmentation,
essential for the survival of species during ice migration and reproduction. The
ages. In addition, the ability to survive in a
intensity and frequency of light influences
wide range of temperatures increases a species'
metabolic activity, induce gene mutations
ability to inhabit other areas, an advantage
(UV, X- rays). Light is essential for vision. This
for natural selection. Eurythermy is an aspect of
thermoregulation in organisms. is proved by the poorly developed or absence
of eyes in cave dwelling organisms. Diapause is
Those organisms which can tolerate only a
also influenced by light in animals. Gonads of
narrow range of temperature are Stenotherms
(Fish, Frogs, Lizards and Snakes). birds become more active with increasing light
Over the course of time, by evolution,
animals of different ecological habitats have Phototaxis: The movement of
developed different variations and adaptations organism in response to light, either towards
to temperature changes. It enabled them to the source of light as in Moths (positive
survive in different habitats and develop niches. phototaxis) or away from light (Euglena,
In case of extreme temperatures, organisms have Volvox, earthworm (negative phototaxis).
adapted by forming heat resistant spores, cysts Phototropism: The growth or
(Entamoeba), antifreeze proteins (Arctic fishes). orientation of an organism in response
Hibernation (winter sleep) and Aestivation to light, either towards the source of light
(Summer sleep) are useful adaptations to
(positive phototropism) as seen in Sunflower,
overcome extreme winters and summers. In
or a way from light (negative phototropism)
certain conditions, migration is an appropriate
as in case of the root of plants.
adaptation to overcome extreme temperatures
and resultant water and food scarcity. (Fig 11.2). Photokinesis: A change in the speed
of locomotion (or frequency of turning)
Light in a motile organism or cell which is made
It is an important and essential abiotic in response to a change in light intensity is
factor. Ecologically, the quality (wavelength or called Photokinesis. It involves undirected
colour), the intensity (actual energy in gram random movement in response to light.
6WHQRWKHUPDO 6WHQRWKHUPDO
ROLJRWKHUPDO (XU\WKHUPDO SRO\WKHUPDO
2SWLPXP
$FWLYLW\
2SWLPXP 2SWLPXP
0LQLPXP 0D[LPXP 0LQLPXP 0D[LPXP
7HPSHUDWXUH
Fig. 11.2 Types of Organisms based on temperature tolerance

in summer. Light influences the locomotion freeze, while below the surface, water will be
and movement of lower animals. in liquid form, sustaining life (Fig. 11.3).
Û&
WATER
Û&
Life on earth began in the seas and water ,&(
is essential for the survival of all forms of life. Û&

Û&
About three-fourth of the earth’s surface is Û&
:DWHU
covered with water (hydrosphere). Water is Û&

Û&
found in three states: gaseous, liquid, and solid.
There are two types of water on Earth.
They are the Fresh water (rivers, lakes, ponds) Fig. 11.3 Thermal zones in cold water bodies
and the Salt water (seas and oceans). Based on • Water is considered as the Universal solvent.
the dissolved salts, water can be hard water It is the main medium by which chemical
(sulphates/nitrates of Calcium/Magnesium) constituents are transported from abiotic
or soft water. If hardness can be removed by components to the living components of an
boiling, it is temporary hard water, and if boiling ecosystem.
does not help, it is permanent hard water.
• Water has high surface tension. This allows
Essential properties of water pollen, dust, and even water striders to
•• Water is one of the main agents in remain at the surface of a water body even
Pedogenesis (soil formation). though they are denser than the water.
•• It is the medium for several different

ecosystems.
Soil
It is a mixture of organic matter, minerals,
•• It is present as moisture in the atmosphere gases, liquids and organisms that together
and the outer layers of the lithosphere and is support life. The soil zone is known as
uneven in distribution on the earth. Pedosphere. Soil is formed from rocks which
•• Water is heavier than air and imparts greater are the parent materials of soil, by weathering
buoyancy to the aquatic medium. This and is called embryonic soil (Pedogenesis).
enables organism to float at variable levels. It has four major functions-
•• Water has high heat capacity and latent heat, •• medium for plant growth
due to which it can withhold large amounts •• means for water storage and purification
of heat. Thus, oceans and lakes tend to
•• modifier of earth’s atmosphere
maintain a relatively constant temperature,
•• habitat for many organisms, which in turn
and the biosphere is relatively thermostable.
modify the soil
•• Water is physically unique because it is less
Soil is formed of many horizontal layers called
dense as a solid (ice) than as a liquid.
as Soil Profile.
•• When water freezes (0⁰C), it contracts. The
maximum density of liquid water occurs at Properties of Soil
4ºC. Below that, it expands markedly. This 1. Texture of soil – The texture of soil is
enables ice to float on the top of water bodies. determined by the size of the soil particles.
Hence, only the surface of water bodies will The types of soil include sand, silt and clay
on the basis of their size differences.

2. Porosity – The space present between soil Relative humidity is the amount of water
particles in a given volume of soil are called vapour present in air and is expressed as a
pore spaces. The percentage of soil volume percentage of the amount needed for saturation
occupied by pore space or by the interstitial at the same temperature Relative humidity is
spaces is called porosity of the soil. expressed as a percentage; a high percentage
3. Permeability of soil-The characteristic means that the air-water mixture is more
of soil that determines the movement of humid at a given temperature. Humidity is
water through pore spaces is known as soil measured with a Hygrometer.
permeability. Soil permeability is directly
dependent on the pore size. Water holding Altitude
capacity of the soil is inversely dependent This factor is mainly the elevation or gradient
on soil porosity. and it affects temperature and precipitation in
an ecosystem or biome. As altitude increases,
4. Soil Temperature-Soil gets its heat energy
temperature and density of oxygen decreases.
from solar radiation, decomposing organic
Higher altitudes usually receive snow instead of
matter, and heat from the interior of earth.
rain because of low temperature.
Soil temperature effects the germination
of seeds, growth of roots and biological Animals are known to modify their
activity of soil-inhabiting micro-and macro- response to environmental changes (stress) in
organisms. reasonably short time spans. This is known as
Acclimatization. This is observed when people
5. Soil water- In soil, water is not only important
who have moved from the plains to higher
as a solvent and transporting agent, but also
altitudes show enhanced RBC count within a
maintains soil texture, arrangement and
few days of settling in their new habitat. This
compactness of soil particles, making soil
helps them cope with lower atmospheric oxygen
habitable for plants and animals.
and higher oxygen demand.
Wind
Wind is the natural movement of air of any 11.4 Concept of biome and their
velocity from a particular direction. The two distribution
main causes are differential heating between Biomes are large regions of earth that
the equator and the poles and the rotation have similar or common vegetation and
of the planet (Coriolis effect). Wind helps to climatic conditions. They play a crucial role
transport pollen grains, seeds, and even flight in sustaining life on Earth. They are defined
by their soil, climate, flora and fauna. Biomes
of birds. While it is the source of wind energy,
have distinct biological communities that
it also causes erosion. Wind speed is measured
have been formed in response to a shared
with an Anemometer.
physio-chemical climate. Biomes are seen to
even spread across continents. Thus, it can be
Humidity observed that a biome is a broader term than
Moisture in the form of invisible vapor habitat. Any biome can comprise a variety of
in the atmosphere is called humidity. which habitats. Factors such as temperature, light,
is generally expressed in terms of absolute water availability determine what type of
humidity, relative humidity or specific humidity. organisms and adaptations are observed in a
Absolute humidity is the total mass of water biome (Fig. 11.4).
vapour present in a given volume or mass of air.
It does not take temperature into consideration.

Tropical Rain Forest
Temperate Forest
Desert
Tundra
Taiga (Boreal forest)
Grassland
Savana / Tropical Grassland
Freshwater
Marine
Ice
Fig. 11.4 Biomes and their geographical distribution
Aquatic Biomes: They occupy about 71% of the

biosphere. The aquatic biome is home to millions of
$UFWLF
aquatic organisms like fishes. The climate of coastal
OG
&R
7XQGUD
zones are influenced by aquatic bodies. (Fig. 11.6).
XUH
6XEDUFWLF Aquatic biomes of earth

UDW
SH
1. Freshwater (Lakes, ponds, rivers)

HP
7DLJD
JW
2. Brackish water (Estuaries / Wetlands)

VLQ
UHD
7HPSHUDWH
F
7HPSHUDWH 7HPSHUDWH
3. Marine (Coral reefs, pelagic zones and
'H
IRUHVW JUDVVODQG 'HVHUW

abyssal zones)
7URSLFDO
Terrestrial biomes
W
+R
5DLQIRUHVW 6DYDQQD 'HVHUW These are large communities of plants and

:HW
'HFUHDVLQJPRLVWXUH
'U\
animals that occupy a distinct region. They
include grassland, tundra, desert, tropical
Fig. 11.5 Biomes can be broadly classified
rainforest, and deciduous and coniferous
as Aquatic biomes and Terrestrial biomes
forests. Terrestrial biomes are distinguished
Characters of a biome primarily by their predominant vegetation,
•• Location, Geographical position (Latitude, and are mainly determined by climate, which
Longitude) in turn, determines the organisms inhabiting
•• Climate and physiochemical environment them. These include the keystone species and
•• Predominant plant and animal life indicator species which are unique to their
•• Boundaries between biomes are not always respective biomes. The terrestrial biomes are a
sharply defined. Transition or transient source of food, O2 and act as CO2 sink, apart
zones are seen as in case of grassland and from the climate regulatory role. (Fig. 11.7).
forest biomes. (Fig. 11.5)

Ocean Coral reefs Rivers Mangroves Lakes
Fig. 11.6 Aquatic Biomes
30◦N
Tropic of
Cancer
Equator
Tropic of
Capricom
30◦S
Tropical forest Savana Desert Chaparral Temperate grassland Tundra

Temperate broadleaf forest Northen conifores forest High mountains Polar ice
Fig. 11.7 The distribution of major terrestrial biomes
Major Biomes of the Earth •• Dwarf willows, birches, mosses, grasses,
Tundra biome, Taiga biome, Grassland sedges are the flora here.
biome, Alpine biome, Forest biome and Desert •• Reindeer, arctic hare, musk ox, lemmings
biome. are important Tundra herbivores. Some
important carnivores are the arctic fox,
TUNDRA BIOME arctic wolf, bobcat and snowy owl. Polar
•• This is the almost treeless plain in the bears live along coastal areas.
northern parts of Asia, Europe and North
America. •• Because of the severe winters, many of the
animals are migratory. For example, the
•• Winters are long with little daylight,
many shore birds and waterfowl such as
Summers are short, with long daylight
ducks and geese, nest in the Tundra during
hours.
the summer and migrate south for the winter.
•• Precipitation is less than 250 mm per year.
It is a zone of permafrost.

hare and predatory pine martens. Important
Historically biomes are predators include the timber wolf, grizzly bear,
known to move as climate black bear, bobcat and wolverines. (Fig. 11.8)
changes. A classic example
is the Sahara Desert, which
years ago was supposed to
be a lush landscape with river flowing
through it. Accordingly, appropriate
fauna like Hippos, Giraffes, Crocodiles
lived amid abundant trees. Over course
of time the climate dried out. It has now
become the planets largest desert. The Fig. 11.8 Taiga biome
animals have migrated out to adjacent GRASSLAND BIOME
regions with more favourable conditions. •• Grasslands occur in temperate and in the
(Source: National Geography) tropical regions.
•• They have hot summers, cold winters, and
Characteristics of Tundra: irregular rainfall.
••Extremely cold climate •• Often they are characterized by high winds.
••Low biotic diversity •• The low irregular rainfall is the factor which
makes the difference between a temperate
••Simple vegetation structure
deciduous forest and a temperate grassland.
••Limitation of drainage
•• Herbivores like antelope, bison, wild horse,
••Short season of growth and reproduction jack rabbit, ground squirrel and prairie dogs
••Energy and nutrients in the form of dead are abundant.
organic material •• Predators include coyotes, foxes, hawks and
snakes.
••Large population oscillations
•• In India, fauna of grasslands includes
TAIGA BIOME Elephant, Gaur, Rhino, Antelope.
•• The Taiga is 1300-1450 km wide zone south •• Flora of grasslands include purple needle
of the Tundra. grass, wild oats, foxtail, ryegrass and buffalo
•• This area has long and cold winters. grass (Fig. 11.9).
•• Summer temperature ranges from 10⁰ C to 21⁰ C.
•• Precipitation ranges about 380-1000 mm
annually.
•• The Taiga is a forest of coniferous trees such
as spruce, fir and pine. This is a major source
for the logging industry.
•• Important migratory herbivores include
moose, elk, deer and reindeer. Moose and
reindeer migrate to the Taiga for winter and to
the Tundra for summers. The common smaller Fig. 11.9 Grassland biome
mammals are herbivorous squirrels, snowshoe

Alpine biome •• Precipitation is evenly distributed
•• The alpine zone (zone between timber line throughout the year with annual rainfall
and snow zone) includes in the descending exceeding 2000 mm.
order, a sub-snow zone immediately below •• Soil is nutrient-poor and acidic.
the snow zone, a meadow zone in the centre Decomposition is rapid and soils are subject
and a shrub zone which gradually merges to heavy leaching.
into the timber zone.
•• Tree canopy is multilayered and continuous,
•• The snow zone of Himalayas lies over allowing little light penetration.
5100m above mean sea level and alpine
zone exists at a height of 3600m. From an •• Flora is highly diverse: one square kilometer
ecological view point, the zone above the may contain as many as 100 different tree
limits of tree growth (timber line) exhibits species. Trees are 25-35 m tall, with buttressed
extreme environmental conditions which trunks and shallow roots, mostly evergreen,
greatly influence the biota of this region. with large dark green leaves. Common
vegetation are orchids, bromeliads, vines
•• Alpine zone of Himalayas is characterized
(lianas), ferns, mosses, and palms.
by sparseness of animal groups. Many
invertebrates of alpine zone are predatory •• They are characterized by the greatest
and occur in lakes, streams and ponds. diversity of fauna which includes birds, bats,
Among fishes, amphibians and vertebrates small mammals, and insects.
are totally lacking and reptilian fauna is Based on the seasonal distribution of rainfall,
greatly impoverished. the types of tropical forests are
•• Flora of alpines includes alpine phacelia,
•• Evergreen rainforest: no dry season.
bear grass, bristlecone pine, moss campion,
polylepis forest, pygmy bitterroot, and •• Seasonal rainforest: short dry period in a
wild potato. very wet tropical region.
•• Semi evergreen forest: longer dry season
Forest biomes (the upper tree storey consists of deciduous
Forest is a broad term used to describe trees, while the lower storey is still evergreen).
areas where there are a large number of trees
•• Moist/dry deciduous forest (monsoon): the
(Fig. 11.10). The forest biomes include a
length of the dry season increases further as
complex assemblage of different kinds of biotic
rainfall decreases (all trees are deciduous).
communities. The major forest biomes are the
Tropical forests and the Temperate forests. More than half of earth’s tropical forests
have already been destroyed.
Tropical forest
•• They occur near the equator (between
latitudes 23.5⁰ at north and 23.5⁰ at south).
•• The major characteristic of tropical forests is
their distinct seasons. Only two seasons are
present (rainy and dry). Winter is absent.
The length of daylight is about 12 hours and
varies little.
•• The average annual temperature ranges
between 20° C and 25° C. Fig. 11.10 Forest biome

Temperate forest
Only scattered remnants of original
•• These forests occur in eastern North temperate forests remain today.
America, northeastern Asia and western
and central Europe. Desert biomes
•• Have well-defined seasons with a distinct •• Deserts cover about one fifth of the earth's
winter. Moderate climate and a growing surface and occur where rainfall is >500
season of 140-200 days during 4-6 frost- mm/year.
free months distinguish temperate forests. •• Rainfall is usually very low and/or
•• Annual temperature varies from -30° C to concentrated in short bursts between
30° C. long rainless periods. Evaporation rates
•• Precipitation (750-1500 mm) is distributed regularly exceed rainfall rates.
evenly throughout the year. •• Soils are course-textured, shallow, rocky
•• Soil is fertile, enriched with decaying litter. or gravely with good drainage and have no
subsurface water. The finer dust and sand
•• Canopy is moderately dense and
particles are blown elsewhere, leaving
allows light to penetrate, resulting in
heavier pieces behind. Sand dunes are
well-developed and richly diversified
common.
understorey vegetation and stratification
of animals. •• Mean annual temperatures range from
20-25° C. The extreme maximum ranges
•• Flora is characterized by 3-4 tree species
from 43.5 - 49° C. Minimum temperatures
per km2. Trees have broad leaves that are
sometimes drop to -18° C. Based on the
lost annually such as oak, hickory, beech,
temperature range, deserts can be Hot
hemlock, maple, basswood, cottonwood,
deserts and Cold deserts.
elm, willow, and spring-flowering herbs.
•• Hot deserts such as the Sahara of North
•• Fauna consists of squirrels, rabbits, skunks, Africa and the deserts of the southwestern
birds, deer, mountain lion, bobcat, timber U.S., Mexico, Australia and India (Thar
wolf, fox, and black bear. desert) occur at low latitudes.
Based on seasonal distribution of rainfall, the •• Hot deserts have a considerable amount
types of temperate forests are of specialized vegetation (xerophytes),
•• Moist conifer and evergreen broad-leaved aloe, agave, Opuntia species, Euphorbia
forests: wet winters and dry summers. royleana as well as specialized vertebrate
•• Dry conifer forests: dominate higher and invertebrate animals.
elevation zones; low precipitation. •• Soils often have abundant nutrients
because they need only water to become
•• Mediterranean forests: precipitation is
very productive and have little or no
concentrated in winter (<1000 mm /year).
organic matter.
•• Temperate coniferous forests: mild
•• Only animals which can tap available water
winters, high annual precipitation (> 2000
or capable of storing sufficient water and
mm /year).
withstand the heat can survive in the desert.
•• Temperate broad-leaved rainforests: The animals include small nocturnal (active
mild, frost-free winters, high precipitation at night) carnivores. The dominant animals
(> 1500 mm/year), evenly distributed
throughout the year.

are burrowers and have cursorial, fossorial is between -2° C and 4° C and the mean
and saltatorial adaptations. summer temperature is between 21° C and
•• The animals stay inactive in protected 26° C.
hideaways during the hot day and come •• Winters receive quite a bit of snow. The
out to forage at dusk, dawn or at night, mean annual precipitation ranges from 150-
when the desert is cooler. 250 mm.
•• The dominant animals of warm deserts are •• The soil is heavy, silty and salty.
reptiles and small mammals. The Indian
Spiny-tailed lizard, the blackbuck, the •• Widely distributed animals are jack rabbits,
white-footed fox are the common fauna kangaroo rats, kangaroo mice, pocket mice,
of the Thar deserts. There are also insects, grasshopper mice, antelope and ground
arachnids and birds (Fig. 11.11). squirrels.
11.5 Responses To Abiotic Factors

Every living organism responds to
its environment. There are various ways
by which organisms respond to abiotic
conditions. Some organisms can maintain
constant physiological and morphological
conditions or undertake steps to overcome
Fig. 11.11 Desert biome the environmental condition, which in itself
is a response (Fig. 11.12).
Rainfall is lowest in
the Atacama Desert of &RQIRUPHUV
Chile, where it averages 5HJXODWRUV
3DUWLDOUHJXODWRUV
less than 15 mm. Some
,QWHUQDOOHYHO
years are even rainless.

Inland Sahara also receives less than
15 mm rainfall a year. Rainfall in
American deserts is higher — almost
280 mm a year.
•• Cold deserts are characterized by cold ([WHUQDOOHYHO

winters with snowfall and high overall Fig. 11.12 Organisms’ response to
rainfall throughout the winter and environmental stressors
occasionally over the summer. The types of responses observed are
•• They occur in the Antarctic, Greenland •• Regulate: Some organisms are able to
and the Nearctic realm, parts of USA and maintain homeostasis by physiological
in parts of western Asia and the Ladakh means which ensures constant body
region in India. temperature, ionic / osmotic balance.
•• They have short, moist, and moderately Birds, mammals and a few lower vertebrate
warm summers with fairly long, cold and invertebrate species are capable of such
winters. The mean winter temperature regulation.

•• Conform: Most animals cannot maintain to survive freezing climates. Some of the
a constant internal environment. Their most attractive adaptations in nature occur
body temperature changes with the for reasons of crypsis (e.g. camouflage) and
ambient temperature. In aquatic animals mimicry. Cryptic animals are those which
like fishes, the osmotic concentration of camouflage perfectly with their environment
the body fluids changes with that of the and are almost impossible to detect. Certain
ambient water osmotic concentration. Such reptiles and insects such as chameleons and
animals are called Conformers. In case of stick insects show this type of adaptation,
extreme condition, the inhabitants relocate which helps in prey capture or to evade from
themselves as in migration. predators. Likewise, horse legs are suitable
•• Migrate: Organisms tend to move away for fast running and adapted for grasslands
temporarily from a stressful habitat to a and similar terrestrial environments.
new, hospitable area and return when the
stressful period is over. Birds migrate from b) Behavioural adaptations
Siberia to Vedanthangal in Tamilnadu to Action and behaviour of animals are
escape from the severe winter periods. instinctive or learned. Animals develop certain
behavioural traits or adaptations for survival.
•• Suspend: In certain conditions, if the
Fleeing from a predator, hiding during sleep,
organisms is unable to migrate, it may avoid
seeking refuge from climate change or moving
the stress by becoming inactive. This is seen
to find different food sources are all behavioral
commonly in bears going into hibernation
adaptations. The two most characteristic forms
during winter. Some snails and fish go
of behavioral adaptations are migration and
into aestivation to avoid summer related
courtship. Migration allows the animals to find
problems like heat and desiccation. Some
better resources or evade threat. Courtship is
lower animals suspend a certain phase of their
a set of behavioral patterns to find a mate to
life cycle, which is referred to as diapause.
reproduce. Most nocturnal animals remain
underground or inactive during daytime. This
11.6 Adaptations
is a modification of their feeding and activity
In biology, adaptation is a
pattern or habit or behaviour.
dynamic evolutionary process
that fits organisms to their
environment and enhancing Ethology is the scientific study of animal
their evolutionary fitness. behaviour, under natural conditions.
Adaptations can be a phenotypic or adaptive
trait with a functional role in each individual c) Physiological adaptations
organism that is maintained and has These are adaptations of organisms
been evolved by natural selection. The adaptive that help them to live and survive in their
traits may be structural adaptation, behavioural environment with unique niches. Example:
adaptation and physiological adaptation. Lions have sharp canines to hunt and tear
meat and a digestive system suitable for
a) Structural adaptations
digesting raw meat. The two most well-known
The external and internal structures of
physiological adaptations are hibernation and
animals can help them to adapt better to their
aestivation. These are two different types of
environment. Some of the most common
examples are mammals growing thicker fur inactivity where the metabolic rate slows down

so much that the animal can survive without 4. Some animals obtain their water
eating or drinking. Aquatic medium and requirement from food as partial
terrestrial habitats have their own respective replacement of water lost through
environmental conditions. Hence organisms excretion.
have to evolve appropriate adaptations to select 5. Birds make nests and breed before the
suitable habitats and niches. rainy season as there is availability of
abundant food. But during drought
Adaptations of aquatic animals birds rarely reproduce.
1. The pectoral fins and dorsal fins act as 6. Camels are able to regulate water
stabilizers or balancers and the caudal effectively for evaporative cooling
fin helps in changing the direction as a through the skin and respiratory system
rudder. and excrete highly concentrated urine,
2. Arrangement of body muscles in the and can also withstand dehydration up
form of bundles (myotomes) help in to 25% of their body weight.
locomotion. 11.7 Populations
3. Stream lined structure helps in the swift Population is defined
movement of the animals in water. as any group of organisms
4. Respiration by gills making use of gases of the same species which
dissolved in water. can interbreed among
5. Presence of air-bladders filled with air themselves, and occupy a particular space
for buoyancy. and function as part of a biotic community.
6. Presence of lateral-line system. They A population has various properties like
function as rheoreceptors which is population density, natality (birth rate),
helpful in echolocating objects in water. mortality (death rate), age distribution, biotic
7. Integuments rich in mucous glands are potential, dispersion and ‘r’, ‘K’ selected
protected by scales. growth forms. A population possesses genetic
8. Maintain water and ionic balance in its characteristics that are directly related to
body with excretory structures. their adaptiveness, reproductive success, and
persistence in their habitats over time. Life
Adaptations of terrestrial animals history of an organism is an important part
1. Earthworms, land Planarians secrete a of this attribute. The population has a definite
mucus coating to maintain a moist situation structure and function that can be described
for burrowing, coiling, respiration, etc., with reference to time.
2. Arthropods have an external covering
over the respiratory surfaces and well- 11.8 Population Attributes
developed tracheal systems.
Population density
3. In vertebrate skin, there are many
cellular layers besides the well protected The density of a population refers to
respiratory surfaces that help in its size in relation to unit of space and time.
preventing loss of water. Population density is the total number of that
species within a natural habitat. The size of

the population can be measured in several Birth rate (b) = number of birth per unit time
ways, including abundance (absolute number average population
in population), numerical density (number Mortality
of individuals per unit area (or) volume) and Mortality is the population decline
biomass density (biomass per unit area (or) factor and is oppposite to natality. Mortality
volume). The population density of a species can be expressed as a loss of individuals in
can also be expressed with reference to the unit time or death rate. Generally, mortality
is expressed as specific mortality, that is, the
actual area of habitat available to the species
number of members of an original population
(ecological density - Table 11.1). When the size
dying after the lapse of a given time. The crude
of individuals in the population is relatively death rate of a population can be calculated
uniform then density is expressed in terms of by the equation.
number of individuals (numerical density).
Death rate (d)= number of deaths per unit time
average population
Natality
Populations increase because of The rate of mortality (death) is determined
natality. Natality is equivalent to birth rate by density. Mortality is high at high density
because of the hazards of overcrowding,
and is an expression of the production of new
increased predation and spread of disease.
individuals in the population by birth, hatching,
Mortality rates vary among species and
germination (or) fission. The two main aspects of
are correlated and influenced by a number
reproduction, namely fertility and fecundity play
of factors such as destruction of nests, eggs
a significant role in a population. Natality rate
or young by storms, wind, floods, predators,
may be expressed in crude birth rate number of
accidents and desertion by parents.
organisms born per female per unit time.
Table 11.1 Indices of density
S.No. Indices of Density Keys
It is usually expressed as the number of individuals per unit

1 Population density
area or volume. Eg.100 trees per acre
It is the size of a population in relation to the numbers per unit

2 Crude density
of total space. Eg.1000 fish in a pond.
It is the size of a population in relation to the numbers per
unit of habitat space. (Available area or volume that can be
3 Ecological density
colonized by a population). Eg. 1000 fish in the volume of
water in the pond.
These are time relative indices which can show the changes in
number (increase and decrease) with respect to time. Number
4 Relative abundance
of birds of a species spotted per hour in an unit area over a
specified time.

$JH'LVWULEXWLRQ
$JHVWUXFWXUH
3RVWUHSURGXFWLYHDJH
5HSURGXFWLYHDJH
3UHUHSURGXFWLYHDJH
,QFUHDVLQJSRSXODWLRQ 6WDEOHSRSXODWLRQ 'HFUHDVLQJSRSXODWLRQ
Fig. 11.13 Age distribution pyramids
Population Dispersion Both emigration and immigration are

Populations have a tendency to disperse initiated or triggered by weather and other
or spread out in all directions, until some abiotic and biotic factors.
barriers are reached. This is observed by the
migration of individuals into (Immigration)
11.9 Population Age Distribution:
or out (Emigration) of the population area. The proportion of the age groups
(pre- reproductive, reproductive and post
Migration reproductive) in a population is its age distribution
Migration is a peculiar and unique kind of attribute. This determines the reproductive status
mass population movement from one place to of the population at the given time and is an
another and back. To avoid the severe winter indicator of the future population size.
cold, Siberian cranes migrate from Siberia
to Vedanthangal in Tamil Nadu and return Usually a rapidly growing population will
back in spring. Some fishes are known to have larger proportion of young individuals. A
migrate from sea to fresh water (anadromous stable population will have an even distribution
migration, Salmon) and some from fresh of various age classes. A declining population
water to sea (catadromous migration, Eel). tends to have a larger proportion of older
individuals (Fig. 11.13).
Emigration
Under natural conditions, emigration 11.10 Growth Models / Curves
usually occurs when there is overcrowding. This Populations show characteristic growth
is regarded as an adaptive behavior that regulates patterns or forms. These patterns can be plotted
the population in a particular site and prevents and termed as J-shaped growth form and
over exploitation of the habitat. Further, it leads S-shaped growth form (Sigmoid form).
to occupation of new areas elsewhere.
J shaped growth form:
Immigration When a population increases rapidly in an
It leads to a rise in population levels. If exponential fashion and then stops abruptly due
the population increases beyond the carrying to environmental resistance or due to sudden
capacity, it can result in increased mortality appearance of a limiting factor, they are said
among the immigrants or decreased to exhibit J-shaped growth form. Many insects
reproductive capacity of the individuals. show explosive increase in number during the

rainy season followed by their disappearance at Table 11.2 Differences between r- selected
the end of the season (Fig. 11.14). and K selected species
Biotic Environmental Carrying r selected species K selected species
potential resistance capacity
Smaller sized Larger sized
organisms organisms
Population
Produce many Produce few

offspring offspring
J curve S curve
Late maturity with
Mature early extended parental
care
0
Time Short life
Long life expectancy
Fig. 11.14 J shaped and S shaped expectancy
growth curves
Each individual Can reproduce
reproduces only more than once in
Biotic potential once or few times in lifetime
It is the maximum reproductive their life time
capacity of an organism under optimum Most individuals
environmental conditions. Only few reach
reach maximum life
Carrying capacity adulthood
span
The maximum number of organism that
a region can support without environmental Unstable
Stable environment,
degradation is called carrying capacity. environment,
density dependent
Environmental resistance density independent
Is the sum total of the environmental
limiting factors, both biotic and abiotic, 11.11 Population Regulation
which together act to prevent the biotic
The inherent tendency of all animal
potential of an organism from being realized.
populations is to increase in number. But it does
not increase indefinitely. Once the carrying
capacity of the environment is reached,
S-Shaped growth form (sigmoid population numbers remain static or fluctuate
growth) depending on environmental conditions. This is
Some populations, as in a population of regulated by many factors which are
small mammals, increase slowly at first then 1. Density independent – Extrinsic factors
more rapidly and gradually slow down as 2. Density dependent - Intrinsic factors
environmental resistance increases whereby
Extrinsic factors include availability of space,
equilibrium is reached and maintained. Their shelter, weather, food, etc. Intrinsic factors
growth is represented by S shaped growth include competition, predation, emigration,
curve. immigration and diseases.

11.12 Population Interaction AMENSALISM (--, 0): This is the ecological
Organisms belonging to different interaction in which an individiual species
populations interact for food, shelter, mating harm another without obtaining benefit, large
or for other necessities. Interaction may be powerful animals harm weak animals. eg.,
intra specific (interaction within the members animals destroyed at the feet of elephants
of same species) or inter specific (among MUTUALISM (+, +): It is the type of interaction
organisms of different species). where both species benefit from the interaction.
Intra specific association is observed for all Mutualism may be facultative when the species
livelihood processes like feeding, territoriality, involved are capable of existence independent of
breeding and protection. one another, or obligate, when the relationship
is imperative of the existence of one or both
Interspecific associations or interactions
species. Examples:
can be:
•• Certain bacteria in the caeca and intestine
Neutral: where different species live together
of herbivores aid in the digestion of
but do not affect each other.
cellulose. In return the host provides
Positive: it is a symbiotic relationship in which
suitable environment for the growth of the
no organism in association is harmed and either
bacteria.
one or both may be benefitted. It is of two types
•• The cross pollination of flowers by insects
– Mutualism and Commensalism.
and birds seeking nectar and pollen which
Negative: One or both of the interacting
is of great importance in agriculture.
organisms will be affected as in case of
•• Small birds cleaning the teeth of crocodiles.
competition, predation, parasitism.
Here the birds gets food and the teeth of
The common types of interspecific inter
crocodile is cleaned.
actions are:
Table 11.3 Analysis of two species population interactions

SN. TYPES OF SPECIES SPECIES GENERAL NATUE OF EXAMPLES
NO. INTERATION 1 2 INTERACTION
1 Amensalism -- 0 The most powerful animal or Cat and Rat
large organisms inhibits the
growth of other lower organisms
2 Mutualism + + Interaction favorable to both Between
and obligatory crocodile and
bird
3 Commensalism + 0 Population 1, the commensal Sucker fish on
benefits, while 2 the host is not shark
affected
4 Competition -- -- Direct inhibition of each species Birds compete
by the other with squirrels
for nuts and
seeds.
5 Parasitism + -- Population 1, the parasite, Ascaris and
generally smaller than 2, the host tapeworm
in human
digestive tract.
6 Predation + -- Population 1, the predator, Lion predatory
generally larger than 2, the prey on deer

• The hermit crab carries along on its shell mates or other resources. When resources are in
a Sea anemone (a sedentary coelenterate). more than adequate to meet the demands of the
The crab is protected from its enemies by organisms seeking them, competition does not
the stinging cells of the anemone while the occur, but when inadequate to satisfy the need of
anemone gets its food (Fig. 11.15). the organisms seeking them, the weakest, least
adapted, or least aggressive individuals are often
forced to face challenges. This phenomenon is
known as the competitive exclusion principle
of Hardin.
DEGREE OF COMPETITION - Competition

Fig. 11.15 Sea anemone on hermit crab;
is usually keen between individuals of the same
Crocodile and bird
species (intraspecific competition) because
COMMENSALISM (+, 0): This defines the they have identical requirements for food,
interaction in which two or more species are mates, and so on. Interspecific competition
mutually associated in activities centering occurs where different species require at least
on food and one species at least, derives some resource materials or conditions in
benefit from the association while the common. The severity of competition depends
other associates are neither benefited nor on the extent of similarity or overlap in the
harmed. The concept of commensalism has requirements of different individuals and the
been broadened in recent years, to apply shortage of the supply in the habitat as birds
to coactions other than those centering on compete with squirrels for nuts, and seeds;
food such as cover, support, production, and insects and ungulates compete for food in
locomotion. Examples: grasslands (Fig. 11.17).
• Barnacles attached to Whales travel
thousands of miles collecting and filtering
food from the moving water. The whales
are not affected by the barnacles.
• Egrets usually are present near cattle. They
catch insects which are disturbed by the
cattle. The bird benefits, while the cattles
are not affected (Fig. 11.16).
Fig. 11.17 Owls competing for food
PARASITISM (+, --): It is a kind of harmful
interaction between two species, wherein
one species is the ‘parasite’ and the other its
‘host’. The parasite benefits at the expense
of the host. A parasite derives shelter, food
Fig. 11.16 Egrets near cattle; barnacles on whale
and protection from the host. Parasites
COMPETITION (--, --): It refers to the type of exhibit adaptations to exploit their hosts.
interaction in which individuals of a species The parasites may be viral parasites (plant
or members of different species vie for limited / animal viruses), microbial parasites (e.g.,
availability of food, water, nesting space, cover, bacteria / protozoa / fungi), phytoparasites

(plant parasites) and zooparasites (animal Specialized predators are those adapted to
parasites such as Platyhelminthes, nematodes, hunt only a few specific species. Lion and
arthropods). Parasites may inhabit or attach to deer exhibit predator – prey relationship,
the surface of the host (Ectoparasites - Head where the Lion is the predator and the deer is
lice, Leech) or live within the body of the the prey. This type of interaction helps in the
host (endoparasites – ascaris, tapeworm). The transfer of energy up the trophic levels and is
endoparasites usually live in the alimentary an essential strategy in population regulation
tract, body cavities, various organs or blood or (Fig. 11.18).
other tissues of the host.
Parasites may be permanent or temporary. Summary

Temporary parasites spend only a part of their Ecology is the study of the relationships
life cycle as parasites. For example, Glochidium of living organisms with the abiotic and
larva of Anadonia (fresh water mussel) attaches biotic components of their environment.
itself to the body of fish. Permanent parasites Temperature, Light, Water, Soil, Humidity,
spend their life completely dependent on Wind and Topographic factors are the important
their host organism. The common examples physical components of the environment to
of permanent parasites are Plasmodium, which the organisms are adapted in various
Entamoeba, Round worms, Pin worms, Tape ways. Maintenance of a constant internal
worms, etc., environment by the organisms contributes to
PREDATION (+, --): It is a form of interaction, optimal performance, but only some organisms
where one animal kills another animal for (regulators) are capable of homeostasis in the
food. Like parasitism, predation is important fact of changing external environment. Others
in community dynamics, but both differ in the simply conform. Many species have evolved
point that a predator tends to be larger than adaptations to avoid unfavourable conditions in
its prey, and it catches its prey from without, space or in time.
while a parasite is smaller than its host and Population ecology is an important area of
consumes it from within. ecology. A population is a group of individuals
of a given special sharing or competing for
similar resources in a defined geographical
area. Populations have attributes that individual
organisms do not, such as natality and bortality,
sex ratio and age distribution. The proportion
of different age groups of males and females
in a population is often presented graphically
as age pyramid, its shape indicated whether a
population is stationary, growing or declining.
Ecological effects of any factors on a

population are generally reflected in population
density. Population grow through births and
Fig. 11.18 Lion predating on deer immigration and decline through deaths and
By their hunting activities predators can emigration. When resources are unlimited,
be regarded as specialized or generalized. the growth is usually exponential but when

resources become progressively limiting the 7. Match the following and choose the correct
growth pattern turns logistic. In either case, combination from the options given below.
growth is ultimately limited by the carrying Column I Column II
capacity of the environment. The intrinsic rate A. Mutalism 1. Lion and deer
of natural increase is a measure of the inherent
B. Commensalism 2. Round worm and man
potential of a population to grow.
C. Parasitism 3. Birds compete with
Population of the same or different species squirrels for nuts
in a habitat do not live in isolation but interact D. Competition 4. Sea anemone on hermit
in many ways. These interactions may be intra crab
specific or interspecific. They may be positive,
E. Predation 5. Bernacles attached to
negative or neutral in nature.
Whales.
Dispersal
Evaluation: a) A- 4, B-5, C-2, D –3, E-1
1. All populations in a given physical area are b) A- 3, B-1, C-4, D – 2, E-5
defined as c) A- 2, B-3, C-1, D – 5, E-4
a) Biome b) Ecosystem d) A- 5, B-4, C-2, D – 3, E-1
c) Territory 8. The figure given below is a diagrammatic
d) Biotic factors representation of response of organisms
to abiotic factors. What do A, B and C
2. Organisms which can
represent respectively.
survive a wide range of
temperatuer are called
a) Ectotherms b) Eurytherms $
,QWHUQDOOHYHO
c) Endotherms d) Stenotherms %
3. The interaction in nature, where one gets &
benefit on the expense of other is...
a) Predation b) Mutualism
c) Amensalism d) Commensalism ([WHUQDOOHYHO
4. Predation and parasitism are which type of S. A B C

interactions? No.
a. Conformer Regulator Partial
a) (+,+) b) (+, O)
Regulator
c) (--, --) d) (+, --)
b. Regulator Partial Conformer
5. Competition between species leads to
Regulator
a) Extinction b) Mutation
c) Amensalism d) Symbiosis c. Partial Regulator Conformer
Regulator
6. Which of the following is an r-species
a) Human b) Insects d. Regulator Conformer Partial
c) Rhinoceros d) Whale Regulator

9. The relationship between sucker fish and 16. What is Acclimatisation?
shark is........... 17. What is Pedogenesis?
a) Competition b) Commensalism 18. What is Zero Stress?
c) Predation d) Parasitism. 19. What is soil permeability?
10. What type of human population is 20. Differentiate between Eurytherms and
represented by the following age pyramid? Stenotherms.
21. Explain hibernation and aestivation with
$JH'LVWULEXWLRQ
$JHVWUXFWXUH
examples.
3RVWUHSURGXFWLYHDJH
22. Give the diagnostic characters features of

5HSURGXFWLYHDJH
3UHUHSURGXFWLYHDJH
a Biome?
,QFUHDVLQJSRSXODWLRQ 6WDEOHSRSXODWLRQ 'HFUHDVLQJSRSXODWLRQ
23. Classify the aquatic biomes of Earth.
a) Vanishing population 24. What are the ways by which organisms
b) Stable population respond to abiotic factors?
c) Declining population 25. Classify the adaptive traits found in
d) Expanding population organisms.
26. Differentiate Natality and Mortality.
11. Which of the following is correct for
r-selected species 27. Differentiate J and S shaped curve.
a) L arge number of progeny with small size 28. Give an account of population regulation.
b) large number of progeny with large size 29. What is ecological density, crude density
and population density?
c) small number of progeny with small size
30. Give an account of the properties of soil.
d) small number of progeny with large size
31. Differentiate between Tundra and Taiga
12. Animals that can move from fresh water
Biomes.
to sea called as.....
32. List the adaptations seen in terrestrial
a) Stenothermal b) Eurythermal
animals.
c) Catadromous d) Anadromous
33. Describe Population Age Distribution.
13. Some organisms are able to maintain
34. Describe Growth Models/Curves.
homeostasis by physical means ...
35. Tabulate and analysis of two species
a) Conform b) Regulate
population interaction.
c) Migrate d) Suspend.
36. Explain parasitism with an example.
14. What is a Habitat?
37. Differentiate between predator and prey.
15. Define ecological niche.

Concept Map
2UJDQLVPDQG
3RSXODWLRQ
2UJDQLVP 3RSXODWLRQ
+DELWDWDQG 5HVSRQVHWR 3RSXODWLRQ 3RSXODWLRQ 3RSXODWLRQ 3RSXODWLRQ

$ELRWLFIDFWRUV %LRPH $GDSWDWLRQ
QLFKH DELRWLFIDFWRUV DWWULEXWHV JURZWKFXUYHV UHJXODWLRQ LQWHJUDWLRQ
- 'HQVLW\
7HPSHUDWXUH 7XQGUD &RQIRUP 0RUSKRORJLFDO 'HQVLW\ 0XWXDOLVP
JURZWKFXUYHV GHSHQGHQW
6 'HQVLW\
/LJKW 7DLJD 5HJXODWH 3K\VLRORJLFDO 1DWDOLW\ JURZWKFXUYHV &RPPHQVDOLVP
LQGHSHQGHQW
6RLO *UDVVODQG 0LJUDWH %HKDYLRXU 0RUWDOLW\ &RPSHWLWLRQ
:DWHU )RUHVW 6XVSHQG (PLJUDWLRQ 3DUDVLWLVP
$WPRVSKHULF
'HVHUW ,PPLJUDWLRQ 3UHGDWLRQ
KXPLGLW\
7RSRJUDSKLF
0LJUDWLRQ
IDFWRU
25-02-2019 18:43:23
ICT CORNER
Organisms and Population
How the fermentation takes place?

Lets us experiment it virtually
Procedure :
Step:-1: Type the URL or scan the QR code to open the activity page.
Step: -2 Click “Background Information” to know the general on “Population Genetics”.
Step:-3 Click “Tutorial” to learn the steps that aligned with the “experiment”.
Step – 4: Click “Run Experiments” on home page to test the experiment by altering the
variables under various parameters.
Step 4
Organisms and Population URL:

http://virtualbiologylab.org/ModelsHTML5/PopGenFishbowl/
PopGenFishbowl.html

*Allow flash player

12
UNIT - V
Biodiversity and
its conservation
CHAPTER
Nilgiri tahr is an endangered species in the
IUCN Red List of Threatened Species
due to hunting and poaching
Chapter outline
12.1
12.2
Biodiversity
Importance of biodiversity – Global
and India
A wide variety of living organisms including
plants, animals and micro-organisms with
whom we share this planet earth makes the world
12.3 Biogeographical regions of India a beautiful place to live in. Living organisms exist
12.4 Threats to biodiversity almost everywhere from mountain peaks to the
12.5. Causes of Biodiversity Loss ocean depths; from deserts to the rainforests.
12.6 IUCN They vary in their habit and behaviour, shape,
size and colour. The remarkable diversity of
12.7 Biodiversity and its conservation
living organisms forms an inseparable and
12.8 Restoration of degraded habitats
significant part of our planet, however, the ever
12.9 Biodiversity Act (BDA)
increasing human population is posing serious
threats to bio-diversity. In this chapter, we shall
discuss biodiversity – concepts, levels, magnitude
Learning objectives
and patterns, importance of biodiversity,
biogeographical regions of India, threats to
➢ Acquire knowledge about concept, biodiversity, causes of biodiversity loss, extinction,
level and patterns of biodiversity. and biodiversity conservation.
➢ Appreciate the magnitude
of India’s biodiversity. 12.1 Biodiversity
➢ Understand The 1992 UN Earth Summit defined
biogeographical regions
Biodiversity as the variability among living
and resources of India.
organisms from all sources, including
➢ Gain insight into the
terrestrial, marine and other aquatic ecosystems
threats to biodiversity.
➢ Understand the reasons/ and the ecological complexes of which they are
causes and effects of extinction. a part. This includes diversity within species,
➢ Create awareness to restore degraded between species and ecosystems of a region.
habitats and environment. It reflects the number of different organisms
➢ To be aware of the Biodiversity Act and their relative frequencies in an ecological
and its provisions. system and constitutes the most important
functional component of a natural ecosystem.
213

It helps to maintain ecological processes, Genetic diversity
create soil, recycle nutrients, influence climate,

degrade waste and control diseases. It provides
an index of health of an ecosystem.The survival
of human race depends on the existence and
wellbeing of all life forms (plants and animals) Genetic diversity in a whole population
in the biosphere.
Species diversity
12.1.1 Concept of biodiversity

The term biodiversity was introduced
by Walter Rosen (1986). Biodiversity is the
assemblage of different life forms. Each species
is adapted to live in its specific environments. Species diversity in a
coastal redwood ecosystem
The changes in climatic conditions are
reflected in the distribution and pattern of Ecosystem diversity
biodiversity on our planet. The number of
species per unit area declines as we move
from tropics towards the poles. The Tundra
and Taiga of northern Canada, Alaska,
northern Europe and Russia possess less than
12 species of trees. The temperate forests of Community and
the United states have 20-35 species of trees, ecosystem diversity
across the landscape
while the tropical forests of Panama have over of an entire region
110 species of trees in a relatively small area. Fig. 12.1 Three levels of biodiversity
formation of different races, varieties and
12.1.2 Levels of biodiversity
subspecies. Rouwolfia vomitaria, a medicinal
Edward Wilson popularized the term
plant growing in different ranges of the
‘Biodiversity’ to describe diversity at all levels
Himalayas shows differences in the potency
of biological organization from populations to
and concentration of the active ingredient
biomes. There are three levels of biodiversity
reserpine due to genetic diversity. Genetic
– Genetic diversity, Species diversity and diversity helps in developing adaptations to
Community/Ecosystem diversity (Fig. 12.1). changing environmental conditions.
Genetic diversity refers to the differences Species diversity refers to the variety
in genetic make-up (number and types of genes) in number and richness of the species in any
between distinct species and to the genetic habitat. The number of species per unit area at
variation within a single species; also covers a specific time is called species richness, which
genetic variation between distinct populations denotes the measure of species diversity. The
of the same species. Genetic diversity can Western Ghats have greater amphibian species
be measured using a variety of molecular diversity than the Eastern Ghats. The more
techniques. India has more than 50,000 genetic the number of species in an area the more is
variants of Paddy and 1000 variants of Mango. the species richness (Fig. 12.1a). The three
Variation of genes of a species increases with indices of diversity are - Alpha, Beta and
diversity in size and habitat. It results in the Gamma diversity
Biodiversity and its conservation 214

i. Alpha diversity: It is measured by counting described. Each year about 10-15 thousand
the number of taxa (usually species) within new species are identified and published
a particular area, community or ecosystem. worldwide, of which 75% are invertebrates. The
ii.
B eta diversity: It is species diversity number of undescribed species is undoubtedly
between two adjacent ecosystems and is much higher.
obtaining by comparing the number of India is very rich in terms of biological
species unique to each of the ecosystem. diversity due to its unique bio-geographical
iii. Gamma diversity refers to the diversity location, diversified climatic conditions and
of the habitats over the total landscape or enormous eco-diversity and geo-diversity.
geographical area. According to world biogeographic classification,
iii. Gamma diversity: It refers to the diversity India represents two of the major realms
of the habitats over the total landscape or (The Palearctic and Indo-Malayan) and three
geographical area. biomes (Tropical humid forests, Tropical Dry/
Deciduous forests and Warm Deserts/Semi
deserts). With only about 2.4% of the world’s
total land surface, India is known to have over
8 % of the species of animals that the world
holds and this percentage accounts for about
92,000 known species.
India is the seventh largest country in the
world in terms of area. India has a variety of
ecosystems, biomes with its varied habitats
like, hills, valleys, plateaus, sea shores,
Fig. 12.1a Species biodiversity mangroves, estuaries, glaciers, grasslands
Community/Ecosystem diversity is the and river basins. It also reflects different
variety of habitats, biotic communities, and kinds of climates, precipitation, temperature
ecological processes in the biosphere. It is the distribution, river flow and soil. India is one
diversity at ecosystem level due to diversity of of the 17 mega biodiversity countries of the
niches, trophic levels and ecological processes world and has ten biogeographic zones with
like nutrient cycles, food webs, energy flow characteristic habitat and biota.
and several biotic interactions. India with its
alpine meadows, rain forests, mangroves,
"The world is currently undergoing a very
coral reefs, grass lands and deserts has one of
rapid loss of biodiversity comparable
the greatest ecosystem diversity on earth.
with the great mass extinction events
12.1.3 Magnitude of biodiversity that have previously occurred only
five or six times in the earth's history."
Biodiversity is often quantified as the
- World Wildlife Fund
number of species in a region at a given time.
The current estimate of different species on
earth is around 8-9 million. However, we really 12.1.4 Patterns of biodiversity
don’t know the exact magnitude of our natural distribution
wealth. This is called the ‘The Taxonomic The distribution of plants and animals
impediment’. So far about 1.5 million species of is not uniform around the world. Organisms
microorganisms, animals and plants have been require different sets of conditions for their
215 Biodiversity and its conservation

optimum metabolism and growth. Within
this optimal range (habitat) a large number
and type of organisms are likely to occur,
grow and multiply. The habitat conditions are
determined by their latitudes and altitudes.
MSL.171.91m
Latitudinal and altitudinal gradients:

Temperature, precipitation, distance from the
equator (latitudinal gradient), altitude from sea
level (altitudinal gradient) are some of the factors
that determine biodiversity distribution patterns.
The most important pattern of biodiversity is Mean Sea Level (MSL) is an average
latitudinal gradient in diversity. This means level of the surface of one or more of
that there is an increasing diversity from the Earth’s oceans (or seas) from which
poles to equator. Diversity increases as one heights such as elevations may be
moves towards the temperate zones and reaches measured.
the maximum at the tropics. Thus, tropics
As we travel by train we notice names
harbour more biodiversity than temperate or
of stations on big yellow signboards
polar regions, especially between the latitudes
on which is usually written how much
of 23.5⁰N and 23.5⁰S (Tropic of Cancer to the
elevated that place is compared to MSL.
Tropic of Capricorn). Harsh conditions exist in
temperate areas during the cold seasons while For example, Erode junction is about
very harsh conditions prevail for most of the year 171 meters above MSL.
in polar regions.
Columbia located near the equator (0⁰) has
but also for supporting both variety and
nearly 1400 species of birds while New York at
number of organisms.
41⁰N has 105 species and Greenland at 71⁰N
has 56 species. India, with much of its land area • The temperatures vary between 25⁰C to
in the tropical latitudes, is home for more than 35⁰C, a range in which most metabolic
1200 species of birds. Thus it is evident that the activities of living organisms occur with
latitude increases the species diversity. ease and efficiency.
Decrease in species diversity occurs as • The average rainfall is often more than
one ascends a high mountain due to drop in 200 mm per year.
temperature (temperature decreases @ 6.5⁰ C
• Climate, seasons, temperature, humidity,
per Km above mean sea level)
photoperiods are more or less stable and
The reasons for the richness of encourage both variety and numbers.
biodiversity in the Tropics are:
• Rich resource and nutrient availability.
• Warm tropical regions between the tropic
of Cancer and Capricorn on either side
Species - Area relationships
of equator possess congenial habitats for
German Naturalist and Geographer
living organisms.
Alexander von Humboldt explored the
• Environmental conditions of the tropics wilderness of south American jungles and
are favourable not only for speciation found that within a region the species richness
increased with increasing area but upto a

certain limit. The relationship between species of flora and fauna including microorganisms.
richness and area for a wide variety of taxa These organisms can inhabit different
(angiosperm plants, birds, bats, freshwater ecosystems with varying conditions like the
fishes) turned out to be the rectangular Rainforests, Coral reefs, Grasslands, Deserts,
hyperbola. On a logarithmic scale, the Tundra and the Polar ice caps. This variety
relationship is a straight line described by the (Biodiversity) is essential for the wellbeing of
equation. our planet and sustenance of life as a whole.
log S = log C + Z log A The importance of biodiversity can be viewed
and measured as
where
a) Ecosystem services b) Biological
S = Species richness
resources c) Social benefits of biodiversity
A = Area
Z = Slope of the line (regression The organization and functioning
coefficient) of ecosystems world over is effected and
C = Y-intercept dependent on biodiversity and its richness.
The major functional attributes are:
• continuity of nutrient cycles or
S=CAz biogeochemical cycles (N2, C, H2O, P, S
cycles)
• soil formation, conditioning or
(S) Species richness
a le maintenance of soil health (fertility) by

sc
l og soil microbial diversity along with the
g- log S = log C + Z log A
lo different trophic members
• increases ecosystem productivity and
provide food resources
(A) Area (S) • act as water traps, filters, water flow
Fig. 12.2 Species - Area relationship on regulators and water purifiers (forest
log scale cover and vegetation)
• climate stability (forests are essential for
Regression coefficient Z generally has a rainfall, temperature regulation, CO2
value of 0.1-0.2 regardless of taxonomic group absorption, which in turn regulate the
or region. However, in case of the species – density and type of vegetation)
area relationship in very large areas like entire
• forest resource management and
continents, the slope of the line appears to be
sustainable development
much steeper (Z-value in the range of 0.6-
1.2). For example, in case of the fruit eating • maintaining balance between biotic
(frugivorous) birds and mammals in the tropical components
forests of different continents, the slope is found • cleaning up of pollutants – microbes
to be a steeper line of 1.15 (Fig. 12.2) are the biggest degraders of molecules
including many anthropogenic ones
12.2 Importance of biodiversity – which are present in effluents, sewage,
Global and India garbage and agro-chemicals
Biodiversity is the variety of life on earth. • ecological stability – the varieties and
That is, it is the number of different species richness of species contribute to ecological

stability and survival of species. Biodiverse fauna include Chiru and Black-rocked
regions are reservoirs of biological Crane.
resources like food resources, gene pool, 2. Himalayas: The entire mountain chain
genetic resource, medicinal resources, running from north-western to north-
bio-prospecting eastern India, comprising a diverse range
• to provide unique aesthetic value and hot of biotic provinces and biomes and covers
spots for Ecotourism. Along with forest 7.2% of the country’s landmass. The
resources and wildlife it has commercial common fauna of the Himalayan ranges,
significance are the wild sheep, mountain goats, shrew,
• an indicator of the health of the ecosystem. snow leopard and panda, many of which
Endemism is a crucial indicator of are endangered.
richness. 3. Indian Desert: The extremely arid area
west of the Aravalli hill range, comprising
The interrelationship both the salty desert of Gujarat and the
and interdependence of sand desert of Rajasthan. It comprises
all living components 6.9% of the country’s land-mass. Wild
in a system can be seen ass is endemic to this region. It is also
from the example of the the habitat for the Indian Bustard, camel,
fruit bats of Guam (South East Asia). The foxes and snakes, many of which are
fruit bats are a delicacy here, and hence endangered.
their population has dwindled which is 4. Semi – Arid Zones: This zone is between
not surprising. What is surprising is that the desert and the Deccan plateau,
local fruit production has got affected including the Aravalli hill range covering
as it was identified that the bats served 15.6% of the country’s landmass. Fauna
as pollinators. Hence there is a need for found here are nilghai, blackbuck, four
conservation of diversity as that could horned antelopes, sambar, chital and
avert such situations. spotted deer which are herbivores along
with predators like Asiatic lion, tiger,
leopard and jackal.
12.3 Biogeographical regions of
5. Western Ghats: Western Ghats, are
India
mountain ranges along the west coast of
As per the international ‘biome’ type
India, extending over almost 1,500km
of classification based upon climate, fauna
from Sat Pena in south Gujarat to the
and flora and the soil conditions, India can
southernmost tip of Kerala. The annual
be divided into ten different biogeographic
rainfall is about 2000 mm. This zone has
zones, (Fig. 12.3) namely:
large populations of Nilgiri tahr (State
1. Trans Himalayan Region: An extension animal of Tamil Nadu), Nilgiri langur,
of the Tibetan plateau, high-altitude cold tiger, leopard, and Indian elephant.The
desert in Ladakh (J&K) and Lauhala Spiti grizzled squirrel and lion tailed macaque
(H.P) comprising 5.7% of the country’s are endemic to this region.
landmass. The mountains of this region
6. Deccan Peninsula: This covers much
have the richest wild sheep and goat
of the southern and south-central
community in the world, renowned for its
plateau with a predominantly deciduous
quality wool and wool products. Other

Trans-Himalaya
Himalaya
Semi arid
Gangetic plains
Desert
North east
Deccan peninsula
Coastal
Western ghats
Island
Fig. 12.3 Biogeographical regions of India
vegetation and 4.3% of the country’s the Himalayan foothills. Fauna includes
landmass. It is known for deciduous rhinoceros, elephant, buffalo, swamp
forests, thorn forests and pockets of semi deer, hog-deer.
ever green forests. Fauna found here are 8. North-East India: The plains and non-
Chital, Sambhar, Nilghai, elephant, sloth Himalayan hill ranges of north eastern
bear, black buck and barking deer. It is the India are home to a wide variety of
catchment area of major Indian rivers like vegetation. With 5.2% of the country’s
Godavari, Tapti, Narmada and Mahanadi. landmass, this region represents the
7. Gangetic Plains: These plains are transition zone between the Indian,
relatively homogenously defined by the Indo-Malayan and Indo-Chinese bio-
Ganges river system and occupy about geographical regions and is the meeting
11% of the country’s landmass. This point of the Himalayan Mountains and
region is very fertile and extends up to

peninsular India. The North-East is Some of the other threats include
thus the biogeographical ‘Gateway’ for specialised diet, specialized habitat
much of India’s fauna and flora and also requirement, large size, small population
biodiversity hotspot (Eastern Himalaya), size, limited geographic distribution and
which includes the Indian rhinoceros, high economic or commercial value. Large
leopard and golden langur. mammals by virtue of their size require
9. Coastal Region: Coastal region of India larger areas to obtain the necessities of
with sandy beaches, mud flats, coral reefs, life - food, cover, mates than do smaller
mangroves constitutes 2.5% of the total mammals. Individual home range of Lion
geographical area. The coastline from can be about 100 square Km. Mammals have
Gujarat to Sundarbans is estimated to be specialized dietary needs such as carnivores,
5423km long. Apart from this a total of 25 frugivores and the need to forage over much
islets constitute the Lakshadweep, which larger areas than general dietary herbivores
are of coral origin and have a typical reef and omnivores. Mammals also have low
lagoon system, rich in biodiversity. The reproductive output other than small rodents.
fauna includes native crabs, turtles and
tunas
12.5 Causes of biodiversity loss
10. Andaman and Nicobar Islands:The The major causes for biodiversity decline are:
Andaman and Nicobar Islands in the • Habitat loss, fragmentation and
Bay of Bengal have highly diverse set of destruction (affects about 73% of all
biomes, constituting 0.3% of the total species)
geographical area. They are centers of high
endemism and contain some of India’s • Pollution and pollutants (smog, pesticides,
finest evergreen forests and support a herbicides, oil slicks, GHGs)
wide diversity of corals. Fauna includes
• Climate change
Narcondam hornbills of the Andamans
and the South Andaman Krait. • Introduction of alien/exotic species
• Over exploitation of resources (poaching,

12.4 Threats to biodiversity
indiscriminate cutting of trees, over
Even though India is one of the 17 identified fishing, hunting, mining)
mega diverse countries of the world, it faces lots
of threats to its biodiversity. • Intensive agriculture and aquacultural
practices
Apart from natural causes, human
activities, both directly and indirectly are today’s • Hybridization between native and non-
main reason for habitat loss and biodiversity native species and loss of native species
loss. Fragmentation and degradation due to • Natural disasters (Tsunami, forest fire,
agricultural practices, extraction (mining, earth quake, volcanoes)
fishing, logging, harvesting) and development
(settlements, industrial and associated • Industrialization, Urbanization,
infrastructures) leads to habitat loss and infrastructure development, Transport –
fragmentation leads to formation of isolated, Road and Shipping activity, communication
small and scattered populations and as towers, dam construction, unregulated
endangered species.

tourism and monoculture are common area
of specific threats Where are the Sparrows?
• Co-extinction Common Sparrows are going extinct
because of mindless urbanization. They
Habitat Loss
are losing not just their natural habitats
Development of human society is but also the essential human touch they
inevitable. Natural habitats are destroyed need and thrive upon. The population of
for the purpose of settlement, agriculture, sparrows is dwindling due to the use of
mining, industries and construction of packed food, insecticides in farming and
highways. As a result species are forced to changing lifestyles, and match box-styled
adapt to the changes in the environment or architecture resulting in an inadequate
move to other places. If not, they become availability of food and shelter for the birds.
victim to predation, starvation, disease and Unlike pigeons that can make nests on
eventually die or results in human animal ledges, sparrows need cavities to build their
conflict. nests.
Over population, urbanization,

industrialization and agricultural Habitat fragmentation
advancements require additional land, Habitat fragmentation is the process
water and raw materials every year. This is where a large, continuous area of habitat is
made possible only through fragmentation both, reduced in area and divided into two or
or destruction of natural habitats by filling more fragments. Fragmentation of habitats
wetlands, ploughing grasslands, cutting down like forest land into crop lands, orchard lands,
trees, forest, desilting rivers, constructing plantations, urban areas, industrial estates,
transport and transit systems has resulted in the
transport ways, caving mountains, extracting,
destruction of complex interactions amongst
ores, changing the course of rivers and filling
species, (food chain and webs) destruction of
of seashore.
species in the cleared regions, annihilation of
The most dramatic example of habitat species restricted to these habitats (endemic)
loss comes from the tropical rainforests 14% of and decreased biodiversity in the habitat
the earth’s land surface once covered by these fragments. Animals requiring large territories
tropical forests, is not more than 6% now. The such as mammals and birds are severely
Amazon rainforest, a vast area, harbouring affected. The elephant corridors and migratory
millions of species, also called “Lungs of the routes are highly vulnerable. The dwindling
planet”is destroyed and being replaced for of many well-known birds (sparrows) and
agriculture and human settlements. 90% of animals can be attributed to this.
New Zealand’s wetlands have been destroyed
Over exploitation:
and cleared for cultivating soya beans and
We depend on nature for our basic needs
raising grass for beef cattle. Kodaikanal
such as food and shelter. However, when
and Nilgiri hills of Tamil Nadu have been
the need becomes greed, it leads to over
destroyed rapidly for human occupancy. Loss
exploitation of natural resources. Excessive
of habitat results in annihilation of plants,
exploitation of a species, reduces the size of
microorganisms and forcing out animals its population to such a level that it becomes
from their habitats.

vulnerable to extinction. Dodo, passenger Global Climate changes
pigeon and Steller’s sea cow have become Industrialization is a major contributor
extinct in the last 200-300 years due to over to climate change and a major threat to
exploitation by humans. Overfishing due to biodiversity. Energy drives our industries,
population pressure leads to many marine fish which is provided by burning of fossil fuels.
(populations) declining around the world. This increases the emission of CO2, a GHG,
leading to climate change. Due to large scale
Exotic species invasion: deforestation, the emitted CO2 cannot be
Exotic species (non-native; alien) are absorbed fully, and its concentration in the
organisms often introduced unintentionally air increases. Climate change increases land
or deliberately for commercial purpose, as and ocean temperature, changes precipitation
biological control agents and other uses. They patterns and raises the sea level. This
often become invasive and drive away the local inturn results in melting of glaciers, water
species and is considered as the second major inundation, less predictability of weather
cause for extinction of species. Exotic species patterns, extreme weather conditions,
have proved harmful to both aquatic and outbreak of squalor diseases, migration of
terrestrial ecosystems. animals and loss of trees in forest. Thus,
Tilapia fish (Jilabi kendai) (Oreochromis climate change is an imminent danger to the
mosambicus) introduced from east coast of existing biodiversity (Fig. 12.4).
South Africa in 1952 for its high productivity
Human
into Kerala’s inland waters, became invasive, Anthropogenic Ecosystem
due to which the native species such as Puntius GHG and Aerosol
Emissions
Services
dubius and Labeo kontius face local extinction. Climate

Land-use
Change
Impacts
Amazon sailfin catfish is responsible for
destroying the fish population in the wetlands Climate
Impacts
Climate Biodiversity
of Kolkata. The introduction of the Nile Perch, a Climate
Regulation
predatory fish into Lake Victoria in East Africa
led to the extinction of an ecologically unique Biogenic
Ecosystem
Function
GHG and Aerosol
assemblage of more than 200 nature species Emissions
of cichlid fish in the lake. Biogeochemical

Cycles
African apple snail (Achatina fulica) is the
Fig. 12.4 Links between biodiversity,
Links between Biodiversity, Climate Change and Human Well-being
most invasive among all alien fauna in India. climate change and human well - being
This mollusc was first reported in the Andaman
Shifting or Jhum cultivation (Slash-
and Nicobar Islands. It is now found across the
and-burn agriculture)
country and threatens the habitat of several
In shifting cultivation, plots of natural
native species. Moreover it is becoming a
tree vegetation are burnt away and the cleared
vicious pest in vegetable farms.
patches are farmed for 2-3 seasons, after
Exotic earthworms compete for food with which their fertility reduces to a point where
native varieties and deplete their population in crop production is no longer profitable. The
soil. Papaya Mealy Bug (Paracoccus marginatus) farmer then abandons this patch and cuts
is native of Mexico and Central America, is down a new patch of forest trees elsewhere
believed to have destroyed huge crops of papaya for crop production.This system is practiced
in Assam, West Bengal and TamilNadu. in north-eastern regions of India. When vast

areas are cleared and burnt, it results in loss of Intensive agriculture:
forest cover, pollution and discharge of CO2 Spread of agriculture is sometimes at
which in turn attributes to loss of habitat and the cost of wetlands, grasslands and forests.
climate change which has an impact on the Intensive agriculture is based on a few high
faunal diversity of that regions. yielding varieties. As a result, there is reduction
in the genetic diversity. It also increases
Coextinctions vulnerability of the crop plants to sudden attack
Coextinction of a species is the loss of by pathogens and pests. There are only few
a species as a consequence of the extinction varieties of traditional paddy strains today due
of another. (Eg., orchid bees and forest trees to use to hybrid varieties in Tamil Nadu.
by cross pollination). Extinction of one will
automatically cause extinction of the other. Forestry
Another example for co-extinction is the There is a tendency to grow economically
connection between Calvaria tree and the important and viable trees like Teak, Sandal,
extinct bird of Mauritius Island, the Dodo. The Oak, Sal in forests resulting in loss of other
forest trees.
Calvaria tree is dependent on the Dodo bird
for completion of its life cycle. The mutualistic
Natural threats
association is that the tough horny endocarp of
These include spontaneous jungle fires,
the seeds of Calvaria tree are made permeable
tree fall, land slide, defoliation by insects or
by the actions of the large stones in bird's locust attack.
gizzard and digestive juices thereby facilitating
easier germination. The extinction of the Dodo 12.5.1 Loss of biodiversity
bird led to the imminent danger of the Calvaria Species have been evolving and dying
tree coextinction. out (extinction) ever since the origin of life.
However, species are now becoming extinct at
Pollution a faster rate. This is destabilizing the ecological
Pollutants and pollution are a major stability and the distribution of biological
cause for biodiversity loss. Excessive use of diversity on earth. Human activities greatly
fertilisers, pesticides and heavy metals have contribute to the loss of biodiversity. Natural
polluted the land, ground and surface water resources such as land, water and organisms
bodies. There is a tendency of pesticide are indiscriminately exploited by human
biomagnification which results in high beings.
concentrations at higher trophic levels According to the Convention of
which has resulted in drastic decline in the Biological Diversity, direct and indirect
population of fish eating birds and falcons. human activities have a detrimental effect
Run off from fertilizer rich fields causes on biodiversity. Direct human activities like
nutrient enrichment of water bodies leading to change in local land use, species introduction
eutrophication. Mercury, arsenic, cadmium, or removal, harvesting, pollution and climate
change contribute a greater pressure on loss of
chromium poisoning has led to depletion of
biodiversity. Indirect human drivers include
biotic resources in vulnerable ecosystems.
demographic, economic, technological,
Death of vulture population is attributed to
cultural and religious factors.
the veterinary medicine Diclofenac, which is
responsible for the thinning of the egg shells.

Even though new species are being Islands (and Myanmar, Thailand, Vietnam,
discovered, there is little hope for adding Laos, Cambodia and Southern China)
new species through speciation into the d. Sundalands: includes Nicobar group
biodiversity treasure. Monsoon failure, global of Islands (and Indonesia, Malaysia,
warming, depletion in ozone layer, landslides Singapore, Brunei, Philippines)
in hilly states, pollution are a few indirect
effects of human activities which results in 12.5.3 Endangered organisms
the loss biodiversity. IUCN Red List (2004) A species that has been categorized as
documents the extinction of 784 species in very likely to become extinct is an Endangered
the 500 years. species. Endangered (EN), as categorized by the
It is estimated that the current rate of International Union for Conservation of Nature
biodiversity loss is 100 to 1000 times higher (IUCN) Red List, is the second most severe
than the naturally occurring extinction rate conservation status for wild populations in the
and is still expected to grow in the future. IUCN's scheme after Critically Endangered
This loss of biodiversity has a immense (CR).
impact on plant animal and human life. The In 1998 there were1102 animal and 1197
negative effects include dramatic influence on plant species in the IUCN Red List. In 2012,
the food web. Even reduction in one species the list features 3079 animal and 2655 plant
can adversely affect the entire food chain species as endangered (EN) worldwide.
which further leads to an overall reduction
in biodiversity. Reduced biodiversity leads 12.5.4 Extinction:
to immediate danger for food security by Species is considered extinct when none
reducing ecosystem services. of its members are alive anywhere in the
world. If individuals of a species remain alive
12.5.2 Hotspots only in captivity or other human controlled
Hotspots are areas characterized with high conditions, the species is said to be extinct in
concentration of endemic species experiencing the wild. In both of these situations, the species
unusual rapid rate of habitat modification loss. would be considered globally extinct. A species
Norman Myers defined hot spots as “regions in considered to be locally extinct when it is no
that harbour a great diversity of endemic species longer found in an area it once inhabited but is
and at the same time, have been significantly still found elsewhere in the wild.
impacted and altered by human activities.” In the 450 million years of life on Earth,
A hotspot is a region that supports at least there had been 5 mass extinctions, which had
1500 endemic vascular plant species (0.5% of eliminated at least 50% of the species of flora
the global total) has lost more than 70% of its and fauna on the globe.
original vegetation. There are 35 biodiversity The extinction of species is mainly
hotspots in the world. India is home to four due to drastic environmental changes and
biodiversity hotspots (as per ENVIS). They are population characteristics.
a. Himalaya (the entire Indian Himalayan There are three types of Extinctions
region)
i. Natural extinction is a slow process
b. Western Ghats of replacement of existing species with
c. Indo-Burma: includes entire North-eastern better adapted species due to changes in
India, except Assam and Andaman group of environmental conditions, evolutionary

changes, predators and diseases. A small use of natural resources. It was established in
population can get extinct sooner than 1948 and located at Gland VD, Switzerland. It is
the large population due to inbreeding involved in data gathering and analysis research,
depression (less adaptivity and variation). field projects and education on conservation,
ii. Mass extinction: The earth has experienced sustainable development and biodiversity.
quite a few mass extinctions due to IUCN’s mission is to influence, encourage and
environmental catastrophes. A mass assist societies throughout the world to conserve
extinction occurred about 225 million years nature and to ensure that any use of natural
ago during the Permian, where 90% of shallow resources is equitable and ecologically sustainable.
water marine invertebrates disappeared. It influences governments and industries
through partnerships by providing information
iii. Anthropogenic extinctions These are and advice. The organization collects, compiles
abetted by human activities like hunting, and publishes the IUCN red list of threatened
habitat destruction, over exploitation, species and their conservation status in the
urbanization and industrialization. Some world. It plays a vital role in the implementation
examples of extinctions are Dodo of of several international conventions on nature
Mauritius and Steller’s sea cow of Russia. conservation and biodiversity.
Amphibians seem to be at higher risk of
extinction because of habitat destruction. Red Data Book
The most serious aspect of the loss of Red Data book or Red list is a catalogue
biodiversity is the extinction of species. The of taxa facing risk of extinction. IUCN –
unique information contained in its genetic International Union of Conservation of Nature
material (DNA) and the niche it possesses are and Natural Resources, which is renamed as
lost forever. WCU – World Conservation Union (Morges
Switzerland) maintains the Red Data book.
One more species goes extinct... The concept of Red list was mooted in 1963.
The purpose of preparation of Red List are:
• To create awareness on the degree of threat
to biodiversity
• Identification and documentation of
species at high risk of extinction
• Provide global index on declining
George the tree snail (Achatinella biodiversity
apexfulva) died on January 1, 2019, at
• Preparing conservation priorities and help
the age of 14. He was the last snail of his
in conservation of action
species, and is emblematic of the loss of
native Hawaiian molluscs. • Information on international agreements
on conservation of biological diversity
12.6 IUCN Red list has eight categories of species

i) Extinct ii) Extinct in wild iii) Critically
The International Union for Conservation
Endangered iv) Endangered v) Vulnerable
of Nature (IUCN) is an organization working in
vi) Lower risk vii) Data deficiency viii) Not
the field of nature conservation and sustainable
evaluated.

12.7 Biodiversity and its i) In-situ conservation
conservation ii) Ex-situ conservation
The natural resources 12.7.1 In-situ Conservation
of the Earth, including air, (Conservation in the natural habitat):
water, land, flora and fauna This is the conservation of genetic
of natural ecosystems must resources through their protection within
be safeguarded for the a natural or manmade ecosystem in which
benefit of the present and they occur. It is conservation and protection
future generations through careful planning of the whole ecosystem and its biodiversity
and management, as appropriate – Principle at all levels in order to protect the threatened
of the Stockholm Declaration, 1972. species.
The large-scale loss of biodiversity and Maximum protection of biodiversity

its global impact makes conservation the hotspots regions with very high levels of
need of the hour. species richness. Although all the biodiversity
hotspots together cover less than 2 percent of
Conservation of biodiversity is protection the earth land area, the number of species they
and scientific management of biodiversity harbour is extremely high and protection of
so as to maintain it at its optimum level and these hotspots could reduce the ongoing mass.
derive sustainable benefits for the present as
Protected Areas:
well as future generations. It aims to protect
These are biogeographical areas where
species from extinction and their habitats and
biological diversity along with natural and
ecosystems from degradation.
cultural resources is protected, maintained
General strategies in conservation and managed through legal measures.
protected areas include national parks, wild
• identify and protect all threatened species life sanctuaries, community reserves and
• identify and conserve in protected areas biosphere reserves. World Conservation
the wild relatives of all the economically monitoring centre has recognized 37,000
important organisms protected areas world-wide. India has about
771 protected areas covering 162099 km2
• identify and protect critical habitats for comprising of National Parks (104), Wild Life
feeding, breeding, nursing, resting of each Sanctuaries (544), biosphere reserves (18)
species and several sacred groves.
• resting, feeding and breeding places of National Parks (NP):
the organisms should be identified and It is a natural habitat that is notified by
protected the state government to be constituted as a
National Park due to its ecological, faunal,
• Air, water and soil should be conserved on
floral, geomorphological, or zoological
priority basis
association of importance. No human activity
• Wildlife Protection Act should be is permitted inside the national park except
implemented the activities permitted by the Chief Wildlife
Warden of the state under the conditions given
There are two aspects of conservation
in CHAPTER IV, of the Wildlife Protection
strategies (Fig. 12.3)
Act (WPA) 1972 (Table 12.1).

and biodiversity and where activities like
Project Tiger: The Government of India
development, forestry, poaching, hunting,
launched the ‘Project Tiger’ in 1973 to
grazing and cultivation are not permitted.
protect our national animal. From 9 tiger
They are large areas of scenic and national
reserves since its inception, the Project
beauty maintained for scientific educational
Tiger coverage has increased to 50 at
and recreational use. They are not used
present. Project Tiger is an ongoing
for commercial extraction of resources.
Centrally Sponsored Scheme of the
Kaziranga National park is a protected area
Ministry of Environment and Forests,
for the one Horned Rhinoceros in Assam.
providing central assistance to the states
for tiger conservation in designated tiger Wild Life Sanctuaries (WLS):
reserves. Project Tiger was launched in the Any area other than the area comprised with
Jim Corbett National Park, Uttarakhand any reserve forest or the territorial waters can be
in1973. The project ensures a viable notified by the State Government to constitute as a
population of Bengal tigers in their natural sanctuary if such area is of adequate ecological, faunal,
habitats, protecting them from extinction floral, geomorphological, natural or zoological
and preserving areas of biological significance. This is for the purpose of protecting,
importance as a natural heritage. endangered factual species. Some restricted human
activities are allowed inside the Sanctuary area
The National Tiger Conservation
details of which are given in CHAPTER IV, of the
Authority (NTCA) is a statutory body of Wildlife Protection Act (WPA) 1972. Ecoturism is
the Ministry, created under the Wildlife permitted, as long as animal life is undistrubed.
(Protection) Act, 1972. India holds There are 544 existing wildlife sanctuaries in
over half the world’s tiger population. India covering an area of 118,918 km2, which is 3.62
According to the latest tiger census report % of the geographical area of the country (National
released on 20th January 2015 by NTCA, Wildlife Database, 2017).
the current tiger population is estimated Sanctuaries are tracts of land where wild
at 2,212. There are 50 tiger reserves in the animals and fauna can take refuge without being
country. hunted or poached. Other activities like collection
of forest products, regulated harvesting of timber,
Table 12.1 National Parks in Tamil Nadu private ownership of land are permitted. Periyar
National Parks Year of wild life sanctuary in Kerala is famous for the Indian
District(s)
in Tamil Nadu establishment Tiger and Asiatic Elephant (Table 12.2).
Guindy NP 1976 Chennai Table 12.2 Wild life sanctuaries in Tamil Nadu
Gulf of Mannar Ramanathpuram
1980
Marine NP and Tuticorin Prominent WLS Year of
Districts
Indira Gandhi in Tamil Nadu establishment
1989 Coimbatore
(Annamalai) NP Vedanthangal
Mudumalai NP 1990 Nilgiris 1936 Chengalpet
Lake Birds WLS
Mukurthi NP 1990 Nilgiris
Mudumalai WLS 1942 Nilgiris
There are 104 existing national parks Point Calimere
1967 Nagapattinam
in India covering an area of 40,501 km2, WLS
Indira Gandhi
which is 1.23% of the geographical area of
(Annamalai) 1976 Coimbatore
the country (National Wildlife Database, WLS
Aug. 2018). National Park is an area which is Mundanthurai
1977 Tirunelveli
strictly reserved for the betterment of wildlife WLS

THE MADRAS CROCODILE BANK TRUST Biosphere Reserve (BR):
Biosphere Reserve (BR) is an international
The Madras Crocodile Bank Trust and Centre
designation by UNESCO for representative
for Herpetology was the brain child of the
parts of natural and cultural landscapes
legendary Romulus Whitaker and a handful
extending over large area of terrestrial or
of like-minded conservation visionaries, who
coastal/ marine ecosystems or a combination
began work on the facility in 1976. It aimed to
thereof. BRs are designated to deal with the
save India’s dwindling crocodilian population.
conservation of biodiversity, economic and
The mission is to promote the conservation
social development and maintenance of
of reptiles and amphibians and their habitats
associated cultural values. Biosphere Reserves
through education, scientific research and
are thus special environments for both people
capture breeding. The crocodile bank remains a
and nature and are living examples of how
world leader in the field of frontline conservation
human beings and nature can co-exist while
and the preservation of natural landscapes. The
respecting each other’s needs. The Biosphere
Crocodile Bank currently consists of a large
Reserve Programme is guided by UNESCO’s
reptile park near Chennai and several field
Man and Biosphere (MAB) programme, as
projects located throughout the subcontinent
India is a signatory to the landscape approach
reaching as far as the Nicobar Islands. About
supported by MAB programme. The scheme
half a million people visit the bank every year,
called Biosphere Reserve was implemented
making it one of the most popular tourist
by the Government of India in 1986. There
attractions along the East Coast Road.
are 18 Biosphere Reserves in the country.
Arignar Anna Zoological Park, Vandalur of installing CCTV Cameras for both visitors
Arignar Anna Zoological Park is spread and animal management under the name
over an area of 602 hectares. of Reserve of Zoo e-Eye. 24 x 7 Animal Live Streaming
Forest at Vandalur, Chennai. It is one of the was introduced for the benefit of the visitors
largest zoo in South East Asia in terms of for the first time in the world. Vandalur Zoo
area. The Zoological Park exhibits different Mobile Application was introduced to provide
classes of animals – it has around 2500 wild services to the visitors like facility to book
animals of nearly 180 species which includes tickets, Zoo navigation, Animal information
Mammals, Birds and Reptiles. 34 years since in text and audio format. Digital payments at
its establishment, the Zoological Park has ticket counters are also available.
emerged as a successful ex-situ conservation The Zoo school has been involved
centre and a captive breeding centre for many in education and outreach programmes.
endangered species like Royal Bengal Tiger, One such successful programme is ‘Zoo
Lion Tailed Macaque, Nilgiri Langur, Gray Ambassador’ which is been conducted for
Wolf, etc., school children. In the year 2018, more than
The Zoo has many attractive features like 400 students were trained and titled as Zoo
Butterfly Park, Childrens Park, Walk Through Ambassadors. The Zoo also has a Rescue
Aviary, Lion & Deer Safari, Forest Museum, Centre which accommodates rescued wild
Interpretation centre, etc., which attracts animals and treats them to come out of stress.
more than 21 lakh visitors every year. The Source: Director, Arignar Anna Zoological
Zoo has strengthened its protection by means Park, Vandalur, Chennai

Agasthyamalai (Karnataka - Tamil Nadu - Table 12.3 Difference between Insitu and Exsitu
Kerala), Nilgiri (Tamil Nadu - Kerala), Gulf of Conservation
Insitu Conservation Exsitu Conservation
Mannar (Tamil Nadu) are the BRs notified in
It is the on-site This is a conservation
Tamil Nadu
conservation or the strategy which involves
Sacred Groves conservation of genetic placing of threatened
resources in natural animals and plants in
A sacred grove or sacred woods are any
populations of plant or special care locations
grove of trees that are of special religious
animal species. for their protection.
importance to a particular culture. Sacred It is the process of It helps in recovering
groves feature in various cultures throughout protecting an endangered populations or
the world. plant or animal species in preventing their
its natural habitat, either extinction under
12.7.2 Ex-Situ Conservation by protecting or restoring simulated conditions
It is conservation of selected rare plants/ the habitat itself, or by that closely resemble
animals in places outside their natural homes. It defending the species their natural habitats.
includes offsite collections and gene banks. from predators.
National Parks, Zoological parks and
Offsite Collections: Biosphere Reserve, Wild Botanical gardens
They are live collections of wild and Life Sanctuaries form are common exsitu
domesticated species in Botanical gardens, insitu conservation conservation
Zoological parks, Wildlife safari parks, Arborata strategies. programs.
(gardens with trees and shrubs). The organisms 12.7.3 Role of WWF and CITES
are well maintained for captive breeding World Wild Fund for Nature (WWF) is
programmes. As a result, many animals which an international non-governmental charitable
have become extinct in the world continue to be trust founded in 1961, with headquarters at
maintained in Zoological Parks. As the number Gland, Vaud, Switzerland. It aims at wildness
increases in captive breeding, the individuals preservation and the reduction of human impact
are selectively released in the wild. In this way on the environment. It was formerly named the
the Indian crocodile and gangetic dolphin have World Wildlife Fund. The living planet report is
been saved from extinction. being published every two years by WWF since
Gene Banks: 1998.
The vision of WWF is to conserve nature and
Gene banks are a type of biorepository
reduce the most pressing threats to the diversity
which preserve genetic materials. Seeds of
of life on Earth by conserving the world’s most
different genetic strains of commercially
ecologically important regions, protect and
important plants can be stored in long periods
restore species and their habitats, strengthen
in seed banks, gametes of threatened species
local communities’ ability to conserve the natural
can be preserved in viable and fertile condition
resources they depend upon and to ensure that
for long periods using cryopreservation
the value of nature is reflected in decision made
techniques.
by individuals, communities, governments and
However, it is not economically feasible
businesses.
to conserve all biological wealth and all the
ecosystems. The number of species required CITES:
to be saved from extinction far exceeds the
The Convention on International Trade
conservation efforts.
in Endangered Species (CITES) of wild fauna

and flora, also known as the Washington FREEP is conducting pilot eco-
Convention, is a multilateral treaty to protect development programmes in the Kalakad-
endangered plants and animals. It was drafted from Mundanthurai Tiger Reserve (KMTR) in Tamil
a resolution adopted from a meeting of members Nadu. The reserve contains a unique and varied
of the IUCN in 1963 and opened for signature in array of flora ranging from thorn and dry
1973. It came into force during July 1975. teak to tropical evergreen, and supports a rich
It aims to ensure that international trade in variety of birds and mammals, including tigers,
specimens of wild animals and plants should not leopards and elephants.The last tiger refuge in
be a threat to the survival of the species in the Tamil Nadu, the KMTR is one of 50 sites covered
wild. It accords varying degrees of protection to under the Indian Government’s Project Tiger, a
more than 35,0000 species of animals and plants. programme receiving international assistance
to enhance tiger habitat.
ZOOLOGICAL SURVEY OF INDIA Over 100 villages are now participating in
The Zoological Survey of India (ZSI) the KMTR project. Communities and individual
was established in 1916 to promote survey, farmers have planted fuelwood and fodder
exploration and research leading to the plantations. Some villagers have installed cow
advancement in our knowledge of various dung-based gas plants for home fuel needs and
aspects of biodiversity of our country. are using fuel-saving pressure cookers and more
The objectives of ZSI are: efficient wood-burning stoves (smokeless chulas).
• Exploration,
Survey, Inventorying and Loans for a wide array of alternative income-
Monitoring of faunal diversity in various generating activities such as dairy and poultry
states, ecosystems and protected areas of farming, tailoring, coconut leaf weaving, and
India. setting up tea and dry goods shops are made
• Periodic
review of the status of available. Thus, the eco-development programme
threatened and endemic species. at the KMTR is rapidly coming to be seen as a
• Preparation
of Red Data Book and model for conserving biodiversity through local
Fauna of India. participation.
•
Biological studies on selected
important species.
CONVENTION ON BIOLOGICAL
• Maintenance
and Development of
DIVERSITY (CBD)
National Zoological Collections.
The United Nations convention on
12.8 Restoration of Degraded Biological Diversity, known as CBD in
short, was signed by India and 172 other
Habitat
nations on December 29, 1993. The CBD
Biodiversity conservation through eco
was an attempt to establish an international
development – an Indian case study
program for conserving and using the
The Forestry Research Education and
world’s biological resources. This historical
Extension Project FREEP (A World Bank
treaty recognizes the “sovereign right of
Initiative) in India is employing a strategy called
nation over their genetic resources” and
‘eco development’ which enlists local commodities
considers “appropriate access to genetic
in the preservation of biodiversity. The strategy
resources.” The treaty also takes into account
involves developing alternate resources and sources
the “fair and equitable sharing” of benefits
of income for those who depend on the protected
arising from the use of genetic resources.
natural habitat (forest) for their livelihood.

12.9 Biodiversity Act (BDA) Summary:
The Convention on Biological Diversity Biodiversity is the variety of all life on Earth,
(CBD) is a United Nations initiative to protect encompassing genetic, species and ecosystem
Biodiversity and encourage the sustainable diversity. Today’s biodiversity is the fruit of billions
use of natural resources. The convention was of years of evolution, shaped by natural processes
held in 1992 at the ‘Earth Summit’ in Brazil. and, increasingly, by the influence of humans. To
India is a signatory of the CBD. The Biological date, about two million species have been identified
Diversity Act, 2002 is an Act of the Parliament on Earth.
of India for preservation of biological Biodiversity supplies a large number of goods
diversity in India, and provides mechanism and services that sustain human life, including
for equitable sharing of benefits arising out the provision of food, fuel and building materials;
of the use of traditional biological resources purification of air and water; stabilization and
and knowledge. The Act was enacted to meet moderation of the earth’s climate; moderation
the obligations under Convention on Biological of floods, droughts, temperature extremes and
Diversity (CBD), to which India is a party. wind forces; generation and renewal of soil health;
The National Biodiversity Authority (NBA) maintenance of genetic resources as inputs to crop
was established by the Central Government in varieties and livestock breeds, medicines, and other
2003 to implement India’s Biological Diversity products; and cultural, recreational and aesthetic
Act (2002). The NBA is a Statutory Body and it benefits.
performs facilitative, regulatory and advisory Over the past few hundred years, biodiversity
functions for the Government of India on issues has faced major challenges, including a growing
of conservation, sustainable use of biological demand for biological resources caused by
resources and fair and equitable sharing of population growth and increased consumption.
benefits arising out of the use of biological This increased exploitation of biological resources
resources. The Headquarters of the NBA is has resulted in the loss of species at levels currently
situated in Chennai. estimated to be 100 times faster than the natural
rate of loss prior to significant human intervention.
Though many species were lost and new ones
Fresh water, wildlife, food and
formed, it is likely we will lose all this natural
climate are things which are not just ‘Nice
wealth in less than two centuries, if the present rate
to have’ …. they are ‘Need to have’. These
of biodiversity losses persist.
are things indispensable for the survival of
mankind….. together, we can protect LIFE The biodiversity and its conservation is the
on our planet – including our own. important global issue of international concern.
Recognition of this problem has made scientists and
policy makers to work and develop mechanisms
to document, conserve and sustainably use
biodiversity.
The younger generation should be made to
realize the critical state of biodiversity today and
volunteer to protect and conserve it, so as to enable
the future generations get to enjoy the benefits of
Nature.

Evaluation b) Both Assertion and Reason are true but
1. Which of the following Reason is not the correct explanation of
regio n has maximum Assertion.
biodiversity c) Assertion is true , but Reason is false.
a) Taiga d) Both Assertion and Reason are false.
10. Define endemism.
b) Tropical forest
11. How many hotspots are there in India?
c) Temperate rain forest d)Mangroves
Name them.
2. Conservation of biodiversity within their
12. What are the three levels of biodiversity?
natural habitat is
13. Name the active chemical found in the
a) Insitu conservation
medicinal plant Rauwolfia vomitoria. What
b) Exsitu conservation
type of diversity it belongs to?
c) In vivo conservation
14. “Amazon forest is considered to be the lungs
d) In vitro conservation
of the planet”-Justify this statement.
3. Which one of the following is not coming 15. ‘Red data book’-What do you know about it?
under insitu conservation 16. Extinction of a keystone species led to loss
a) Sanctuaries b) Natural parks of biodiversity – Justify.
c) Zoological park d) Biosphere reserve 17. Compare and Contrast the insitu and exsitu
4. Which of the following is considered a conservation.
hotspots of biodiversity in India 18. What are called endangered species? Explain
a) Western ghats b) Indo-gangetic plain with examples.
c) Eastern Himalayas d) A and C 19. Why do we find a decrease in biodiversity
5. The organization which published the red distribution, if we move from the tropics
list of species is towards the poles?
20. What are the factors that drive habitat loss?
a) WWF b) IUCN c) ZSI d) UNEP
21. Where are biodiversity hotspots normally
6. Who introduced the term biodiversity? located? Why?
a) Edward Wilson b) Walter Rosen 22. Why is biodiversity so important and
c) Norman Myers d) Alice Norman worthy of protection?
23. Why do animals have greater diversification
7. Which of the following forests is known as
than plant diversity?
the lungs of the planet earth?
24. Alien species invasion is a threat to endemic
a) Tundra forest
species – substantiate this statement.
b) Rain forest of north east India
25. Mention the major threats to biodiversity
c) Taiga forest
caused by human activities. Explain.
d) Amazon rain forest
26. What is mass extinction? Will you encounter
8. Which one of the following are at high risk
one such extinction in the near future.
extinction due to habitat destruction
Enumerate the steps to be taken to prevent it.
a) Mammals b) Birds 27. In north eastern states, the jhum culture is a
c) Amphibians d) Echinoderms major threat to biodiversity – substantiate.
9. Assertion: The Environmental conditions 28. List out the various causes for biodiversity
of the tropics are favourable for losses.
speciation and diversity of organisms. 29. How can we contribute to promote
Reason: The climate seasons, temperature, biodiversity conservation?
humidity and photoperiod are more or less 30. ‘Stability of a community depends upon its
stable and congenial. species diversity’ Justify the statement.
a) Both Assertion and Reason are true 31. Write a note on i) Protected areas, ii) Wild
and Reason explains Assertion correctly. life sanctuaries, iii) WWF.

Concept Map
,PSRUWDQFH
RIELRGLYHUVLW\
7KUHDWVWR 3DWWHUQVRI
ELRGLYHUVLW\ ELRGLYHUVLW\
0DJQLWXGH
&DXVHVRI RI
ELRGLYHUVLW\ ELRGLYHUVLW\
%LRGLYHUVLW\ +RWVSRWV
/RVVRI
ELRGLYHUVLW\
/HYHORI
ELRGLYHUVLW\
(QGDQJHUHG
RUJDQLVP
&RQFHSWVRI
ELRGLYHUVLW\
([WLQFWLRQ
Red data
Hotspots book Offsite Gene
conservation banks
Protected
National areas IUCN CITES
parks INSITU EXSITU
conservation Govt WWF conservation
Organisations
Sanctuaries Biosphere in conservation
reserves
Biodiversity conservation

ICT CORNER
BIO DIVERSITY AND ITS
CONSERVATION
Let us go out for an virtual exhibition,

to know about 30 endangered animals.
Procedure :
Step -1: Type the URL or scan the QR code to open the activity page. Click “Explore the
exhibition” to start the exhibition.
Step -2: Find the species name below the figure (Ex: Helmeted Hornbill). Find a grey dot right
next to the name. Click the same to know about its extinction.
Step -3: Click “<” on the left top of this page to play a video about the same species. Click “x” to
run to the homepage.
Step – 4 : On the left “ top first” option to load all the species. Middle square in a circle is for slide
show of all the species.
Step -5: On the right of the page, find ^ and down button to move on from one to the next.
Step 4
BIO DIVERSITY AND ITS CONSERVATION URL:

http://www.species-in-pieces.com/

*Allow flash player

13
UNIT - V
Environmental
Issues
CHAPTER
Chapter Outline
13.1 Pollution
13.2 Air Pollution
13.3 Water Pollution Environment is my prime teacher
13.4 Noise Pollution - Masanabu Fukuoka
13.5 Agrochemicals
13.6 Biomagnification
13.7 Eutrophication
13.8 Organic Farming and its
Implementation
13.9 Solid Waste Management
A clean environment is very necessary
to live a peaceful and healthy life. But
our environment is getting dirty day by day
13.10 Global Environment Change
13.11 Impact on Specific Ecosystem because of our negligence. Earth is currently
13.12 Ozone Depletion facing a lot of environmental concerns like air
13.13 Deforestation
13.14 Ecosan Toilets pollution, water pollution, and noise pollution,
13.15 Peoples Participation in Conservation global warming, acid rain, biomagnification,
of Forests eutrophication, deforestation, waste disposal,
ozone layer depletion and climate change.
Over the last few decades, the exploitation of
Learning Objectives our planet and degradation of our environment
have gone up at an alarming rate. As our
•• Gain knowledge about our environment and its actions have not been in favour of protecting
importance.
•• Get to know about the effects and after effects of this planet, we have seen natural disasters
human activities on climate and ecosystem. striking us more often in the form of flash
•• Realize the need and importance of forests. floods, tsunami and cyclones.
•• Know about eco-friendly practices
for pollution mitigation. “Every individual should be environmentally
•• Acquire insights into solutions to aware, regardless of whether they work with
environmental problems. environmental issues or not.”
•• Understand the need for peoples’
participation in environmental
protection. 13.1 Pollution
•• Know about the global level Pollution is any undesirable change in the
conventions on climate change.
physical, chemical and biological characteristics
•• Understand the importance of clean environment.
of the environment due to natural causes and
human activities. The agents which cause
pollution are called pollutants. Pollution is
235

classified according to the types of environment continue to accumulate (biomagnification).
that is affected. They are mainly air, water and Toxic elements like lead, mercury, cadmium,
soil pollution. chromium and nickel are such common
pollutants.
13.1.1 Classification of Pollutants
In terms of eco-system, pollutants can 13.2 Air Pollution
be classified into two basic groups – Non- Earth is surrounded by a gaseous envelope
degradable and degradable. Based on the time which is called atmosphere. The gaseous
taken to breakdown into their ingredients, blanket of the atmosphere acts as a thermal
degradable pollutants are classified as rapidly insulator and regulates the temperature of
degradable (non-persistent) and slowly the earth by selectively absorbing The UV
degradable (persistent). rays of solar radiation. The adverse effects
a) Rapidly degradable or non-persistent of pollution include depletion of Ozone
pollutants: These can be broken down by by Chlorofluorocarbons or CFCs, used as
natural processes. Domestic sewage and refrigerants and global warming by elevated
vegetable waste are examples of such pollutants. CO2 (industries, deforestation, and partial
b) Slowly degradable or persistent combustion).
pollutants: These are pollutants that remain The alterations or changes in the composition
in the environment for many years in an of the earth’s atmosphere by natural or human
unchanged condition and take decades or activities (anthropogenic factors) are referred as
longer to degrade, as in the case of DDT. Air Pollution. Pollutants include the abundant
c) Non-degradable pollutants: These presence of solid, liquid or gaseous substances
cannot be degraded by natural processes. produced by human or natural activity. The
Once they are released into the environment, nature and concentration of a pollutant
they are difficult to be eliminated and determines the severity of detrimental effects
Pollutant emissions
Lightning Fertilizer
Wildfires Volcanoes Oil & Gas Cities Industry, power plants, Airplanes, Cars, Trucks,
Sewage treatment Buses and Three & Two wheelers
Natural Area Stationary Mobile
Fig. 13.1 Sources of air pollution.

Environmental Issues 236

on organisms and human health. Along with •• Area sources – agricultural - wood /
atmospheric factors (humidity, precipitation, stubble burning, fireplaces
wind, air currents, altitude) prevailing at a place •• Natural sources – wind-blown dust,
and time, its effects can be far reaching and wildfires, volcanoes (Fig. 13.1).
catastrophic.
13.2.2 Effects of Air Pollution
Air pollutants can be •• Affects all organisms as they depend on the
• discharge of dusts or particulate matter atmosphere for respiration.
(PM: 2.5 ,10) •• Causes irritation in the throat, nose, lungs
• discharge of gases (SO2, NO2, CO, CO2) and eyes. It causes breathing problems and
Carbon monoxide (CO) is produced mainly aggravates existing health conditions such
due to incomplete combustion of fossil fuels. as emphysema and asthma.
Automobiles are major causes of CO pollution
•• Contaminated air reduces the body’s
in large cities and towns Automobile exhausts,
defense mechanism and decreases the
fumes from factories, emission from power
body’s capacity to fight other infections
plants, forest fires and burning of fire-wood
in the respiratory system.
contribute to CO pollution.
•• Frequent exposure to polluted air increases
With rapid urbanization, major amount of the risk of cardiovascular diseases.
carbon dioxide and sulphur dioxide (SO2) is Breathing air that is filled with fine
released in the atmosphere. From automobiles, particulate matter can induce hardening of
aeroplanes, power plants and other human the arteries, triggering cardiac arrhythmia
activities that involving the burning of fossil or even a heart attack.
fuels (coal, oil etc.,) CO2 is the main pollutant
•• People who exercise outdoors can
that is leading to global warming.
sometimes be susceptible to adverse effects
Nitrogen oxides are also major air of air pollution because it involves deeper
pollutants. Fossil fuel combustion and and faster breathing. Hence it is advisable to
automobiles exhausts are the source of walk or jog in the mornings in places with
nitrogen oxides. Sulphur dioxide and nitrogen ample tree cover.
oxides are the major causes of acid rain.
•• Gas leaks can be lethal or affect the quality
Particulate matters are tiny particles of
of air in the affected area.
solid matter suspended in a gas or liquid.
•• CO in the atmosphere interferes with O2
Combustion of fossil fuels, fly ash produced
transport since haemoglopin has greater
in thermal power plants, forest fires, asbestos
affinity for carbon monoxide. At low
mining units, cement factories are the main
concentration it causes headache and
sources of particulate matter pollution.
blurred vision. In higher concentration, it
13.2.1 Sources can lead to coma and death.
The main sources of air pollution are:
•• Transport sources (Fig13.1) – cars, buses, ameer, an App provides
S
airplanes, trucks, trains hourly updates on the
•• Stationary sources – power plants, National Air Quality Index
incinerators, oil refineries, industrial (AQI) published by CPCB.
facilities, and factories
237 Environmental Issues

13.2.3 Other notable effects of Air 13.2.4 Control of Air Pollution
Pollution Certain measures help to remove pollutants,
Smog is a type of air pollution caused by reduce their presence or prevent their entry into
tiny particles in the air. The word comes from the atmosphere.
a mixture of the words smoke and fog . •• Trees are the best remedy for urban
Today, smog generally refers to photochemical particulate and gaseous pollution
smog, which is created when sunlight reacts •• Forests act as carbon sinks and lungs of
with nitrogen oxides and volatile organic the planet
compounds found in fossil fuel emissions
•• Catalytic converters in vehicles help to
from automobiles, factories, and power plants.
reduce polluting gases drastically
These reactions create ground-level ozone and
•• Diesel exhaust filters in automobiles cuts
particulate matter, reducing visibility. Smog
particulates
can make breathing more difficult, especially
for people with asthma. •• Electrostatic precipitators reduce release
of industrial pollutants.
Smog also affects plants and animals.
It damages crops as well as causes health •• Cost effective air pollution treatment
problems in pets, farm animals and human systems like indoor plants and high
beings. Smog has also been known to cause performance biofilters can improve
corrosive damage to buildings and vehicles. indoor air quality.
Peroxyacetyl nitrate (PAN) is a secondary
pollutant present in photochemical smog. It The Taj Mahal, a UNESCO world
is thermally unstable and decomposes into heritage site, is facing deterioration and
peroxyethanol radicals and nitrogen dioxide damage by industrial gases due to several
gas causing eye irritation. industrial units around Agra. The white
Global warming: Increase in the marble has decolorized to yellow.
concentrations of greenhouse gases such as
CO2, methane, nitrous oxide, CFCs, and ozone
13.2.5 Legal Protection
causes greenhouse effect, warming of the •• The Air (Prevention and Control of
earth, resulting in sea level rise, submerging of Pollution) Act was enacted in 1981 and
islands and sea shores of various parts of the amended in 1987 for the prevention,
world. control and abatement of Air pollution in
India.
Ozone depletion: Thinning of the
stratospheric ozone layer is known as ozone •• Traffic Emissions Standards: The
depletion. Such depletion causes the ‘ozone Government has decided to enforce Bharat
hole’, resulting in poor screening of the Stage VI norms from 2020.
harmful UV rays and increase in incidences of •• The Green Bench and the National Green
skin cancer. Some of the common agents that Tribunal (NGT) give judicial safeguard to
deplete ozone are CFCs. environmental protection.
Acid rain: Acid rain is a form of precipitation Steps taken by the Central and the State
that contains acidic components, such as governments in India:
sulfuric acid or nitric acid. It damages trees, •• Road traffic rationing, encourage public
crops and harms marine animals (coral reefs) transport, carpooling.
and induces corrosion.

•• Increase green cover alongside roads 13.3 Water Pollution
(planting avenue trees).
13.3.1 Quality of Water
•• Promoting Swachh Bharat Abhiyan
Water is essential for life and for the health of
•• Enactment and Enforcement of stricter
the environment. As a valuable natural resource,
environmental laws
it comprises marine, estuarine, freshwater (river
•• Maintenance of air standards by proper and lakes) and groundwater environments that
enforcement and monitoring stretch across coastal and inland areas. Water has
two dimensions that are closely linked: quantity
Average human and quality. Water quality is commonly defined
consumption of Oxygen by its physical, chemical, biological and aesthetic
per day = 550 L (appearance and smell) characteristics. A
Cost of 2.75 L Oxygen healthy environment is one in which the water
cylinder = ₹ 6500 quality supports a rich and varied community of
Cost of 550 L of oxygen from tree organisms and protects public health.
= ₹ 13,00,000
13.3.2 Water Pollution
-----------------------------------------
Water pollution occurs when there is a
Oxygen production by one healthy
change in the chemical, physical or biological
tree per year =1,00,375 L
quality of water that has harmful effect(s) on
Cost of 2.75 L oxygen cylinder living organisms that consume it or live in it.
= ₹ 6500 Water pollution adversely affects water
Cost of 1,00,375 L of oxygen from one bodies due to the large amounts of natural
tree /year = ₹ 23,72,50,000 or man-made materials let into it. When it
becomes unfit for its intended use, water is
•• Reducing carbon emissions considered polluted.
•• Encourage use of renewable energy
13.3.3 Sources of Water Pollution
•• Limiting the sale of firecrackers and
developing eco-friendly crackers Even though water bodies or sources can be
polluted by natural causes, water pollution is
•• Make Environmental Impact Assessment
usually caused by human activities. There are
mandatory
three main types of sources: point sources,
Air Quality Index (AQI) is a number used non-point sources, leaks and spills.
by government agencies to communicate to the
Point sources: Discharge of pollutants at
public how polluted the air is at a given time.
specific locations through pipelines or sewers
Air Quality Index into the water body. Factory effluents, sewage,
AQI Air Pollution Level Colour underground mines, oil wells, oil tankers
and agriculture are common point sources
0-50 Good
(Fig. 13.2 a).
51-100 Moderate
Non-point sources: Sources that cannot be
101-150 Unhealthy for Sensitive Groups
traced to a single site of discharge like acid
151-200 Unhealthy
rain, dumping of the plastics in water bodies,
201-300 Very Unhealthy agriculture chemical run off are common
301+ Hazardous examples (Fig. 13.2 b).

(a) containing waste water, sometimes in
toxic concentrations. These discharges
can affect temperatures of the water
bodies as well as dissolved oxygen level.
3. Agricultural wastes include fertiliser and
pesticide runoff from agricultural fields,
food processing waste, tree and saw dust
(b) from logging operations and bacteria
from sewage or livestock operations.
Water pollutants reach water bodies like
rivers, streams and the marine system by
precipitation, run-off and the groundwater by
seepage or percolation.
13.3.4 Effect of Water pollution on

(c) Ecosystems
1. Destruction of ecosystems: Ecosystems,
especially aquatic systems, can be
severely affected or destroyed by water
pollution.Water pollutants affect existing
niches and habitats and the survival of
organisms. Soil fertility is affected and the
system becomes uninhabitable.
Fig 13.2 Sources of water pollution
2. Disruption of food-chains: Water
Leaks and Spills: This occurs mostly due to pollution disrupts the natural food chains
ship collision, off shore oil rigs, oil leakages as well as food webs. Pollutants such as
and discharges into sea (Fig. 13.2 c). lead and cadmium are taken up by primary
Sources of water pollution can also be classified consumers where they can be lethal or
in three ways. They are municipal wastes, get stored. Later, when these animals are
industrial wastes, and agricultural wastes. consumed by secondary consumers, the
food chain can get disrupted at any trophic
Sources of water pollution level or result in enhanced concentration
of these pollutants (biomagnification).
Hot water from industries when released
Municipal Industrial Agricultural into the water bodies affects aquatic
wastes wastes wastes density and diversity.
13.3.5. Effect of Water pollution on

1. Municipal waste water is from homes and Organisms
commercial establishments. 1. Water pollution can be lethal to aquatic
2. Industrial discharge (effluents) may organisms and others that depend on
contain varieties of compounds such these water bodies.
as heavy metals (cadmium, chromium, Accidental oil spills from tanker ships can
lead), and organic / inorganic chemicals cause substantial environmental damage. Oil

spreads on the water surface, prevents the 13.3.6 Control Measures
entry of light and oxygen into the water. This 1. Right to clean water is a fundamental right
increases BOD and COD, resulting in mass under the Indian Constitution.
death of organisms and degradation of water 2. Water (Prevention and Control of
quality. It also clogs fish gills and the feathers Pollution) Act, 1974, sections 17 to 40
of aquatic birds. prohibit the pollution of a stream or well
by disposal of polluting matter.
On January 28, 2017, two cargo ships
collided off the Ennore coast in Chennai 3. The Central/State Pollution Control
causing oil to spill into the sea. Due to wave Boards have the power to advise the
action and the southern current, the spill central/state government on various
spread over to 34 km down south affecting matters concerned with the prevention
the coast. Beach sand also got spoiled by and control of pollution of water.
the oil sludge. It took more than a thousand 4. The Ministry of Environment, Forest and
volunteers to clean the oil sludge. Climate Change (MoEFCC) is the nodal
agency of the Central Government for
2. Humans and other organisms can get the planning, promotion, co-ordination
affected by diseases such as hepatitis and and for overseeing the implementation
typhoid by consuming contaminated of India’s environmental and forestry
water and food. Excess of fluoride in policies and programmes.
drinking water causes fluorosis. In many
poor nations, outbreak of water borne Prevention
diseases and epidemics are a result of •• Regulate or control of pollutant(s)
contaminated water and poor or absence discharge at the point of generation.
of water treatment processes. •• Wastewater can be pretreated by scientific
3. Water pollution can cause eutrophication methods before discharge to municipal
due to nutrient enrichment. This causes treatment sources.
algal blooms which affect the quality •• Setting up of Sewage Treatment Plants
of water bodies (Fig. 13.3). Red tides, if (STP) and Effluent Treatment Plants (ETP).
occur, can be lethal to aquatic organisms. •• Regulate or restrict the use of synthetic
fertilisers and pesticides.
•• Public awareness and peoples’ involvement
is essential.
Assessment by CPCB
The number of polluted stretches in
India’s rivers has increased to 351 from
302 (in 2006), and the number of critically
polluted stretches – where water quality
indicators are the poorest – has gone up
Fig. 13.3 Algal bloom
to 45 from 35 (Source: The Hindu, 17
September, 2018).

Case study •• Peptic ulcer, severe head ache,
Namami Gange (National Mission memory loss.
for Clean Ganga) Programme is an •• Marine animals are affected by noise
Integrated Conservation Mission approved pollution from offshore activities and port
as the ‘Flagship Programme’ of the Union activities.
Government in June 2014 with a budget •• Fire crackers frighten animals. Birds are
outlay of 20,000 crores to accomplish the often affected by increased air traffic.
twin objectives of effective abatement of
13.4.3 Control
pollution, conservation and rejuvenation of
•• Planting trees in and around noise sources
River Ganga.
is an effective solution for noise pollution
13.4 Noise Pollution as plants are known to absorb noise and
Sound that is unwanted and undesirable or bring down sound levels.
can disrupts one’s quality of life is called as Noise. •• Regular servicing and tuning of
When there is lot of ‘noise’ in the environment, automobile engines can effectively reduce
it is termed as Noise Pollution. The intensity of noise pollution by vehicles and machinery.
noise is meaured in decibels (dB). •• Workers should be provided with ear plugs
and earmuffs at work sites that generate
13.4.1 Sources of Noise Pollution high noise levels.
Vehicle engines, air horns, audio video •• Lubrication of machinery and regular
systems, trains, low flying aircrafts, factory servicing minimizes noise levels.
machines, sirens, motors, drillers and •• Regulations should be imposed to restrict
crushers, compressor machines, crackers, the usage of loudspeakers in crowded
explosives, modern supersonic transports are areas and public places.
the common sources of noise pollution.
13.4.4 Legal Protection
The threshold of pain is about 120 db.
Article 48-A and Article 51-A of the
World Health Organization has proposed that
Constitution of India, Noise Pollution
noise must be recognized as a major threat to (Regulation and Control) Rules 2000, and
human well-being. This is applicable for all Tamil Nadu State Environment Policy
living organisms. 2017 are some of the legal relief from noise
pollution.
13.4.2 Effect of Noise Pollution
According to Noise Pollution (Regulation
•• According to the USEPA (United States
and Control) Rules, 2000, the permissible
Environmental Protection Agency) there
limit of noise in areas categorized as
are direct links between noise and health. commercial is 65 decibels (dB) during day
Heart disease, high blood pressure, stress and 55 dB during night.
related illness, sleep disruption, hearing
loss (deafness), and productivity loss are
13.5 Agrochemicals
the problems related to noise pollution. Chemicals which are used in agriculture for
growth of plants and pest control are called
•• Increased stress and tension, nervousness,
agrochemicals or agrichemicals.
irritability, anxiety, depression and panic
attacks.

Overuse of agrochemicals have been observed
to generate residues that cause nutrient 13.6 Biomagnification
imbalance, and Food chains are components of all
•• May kill beneficial bacteria and soil ecosystems. Producers and consumers form
organisms. trophic levels in a chain through which energy
•• Can cause eutrophication in water bodies. flow is carried out by the process of eating and
being eaten. Usage, storage and transformation
•• Affect aquatic animals and their
of food and biomolecules by metabolism are a
productivity.
normal process. Degradation or breakdown is
•• Pesticide containing water, even in trace
an essential part of any food chain and hence all
quantities is unfit for human consumption.
naturally occurring substances are degradable.
•• Particles (aerosols) and residues of these
chemicals cause air pollution. Biomagnification of DDT
•• Inhalation of contaminated air can cause When non-degradable substances enter the food
respiratory problems. chain, they do not get metabolized or broken
•• Consumption can lead to poisoning, side down or expelled and instead get transferred up
effects and after effects. the tropic levels of the food chain. During this
•• Chemicals can cause skin rashes and process, they show an increase in concentration
irritation of eyes. which is referred to as biomagnification. This
•• Many of these chemicals are reported to results in increased toxicity and may even be
be carcinogenic. lethal. This phenomenon is well established for
mercury and DDT. Figure 13.4 schematically
•• They can trigger hormonal disorders and
shows biomagnification of DDT in an aquatic
neurotoxicity.
food chain where the concentration of DDT is
•• Beneficial insects and animals can be enhanced at successive trophic levels.
affected.
Magnification of
1. M
osquito Repellents DDT concentration
DEET (n-n-diethylnetatoluamide)
and allethrin used in mosquito coils Fish-eating
birds 10,000,000
may cause itching, burning, tingling
sensation or numbness. Large
fish 1,000,000
2. C
olony collapse syndrome in Honey
bees due to pesticides/herbicides can
Small
lead to destruction of hives and lower fish
100,000
agricultural productivity. !!Remember

bees are Nature’s best pollinators!!
Zooplankton 10,000
Producer
1000
(Phytoplankton)
1
Water
1
Fig. 13.4 Biomagnification

13.7 Eutrophication animal wastes. Realizing the importance of
When run-off from land clean potable water, the Government passed the
containing nutrients reaches Water (Prevention and Control of Pollution)
water bodies like lakes, it Act in 1974, which made it mandatory to treat
results in dense growth of wastewater in treatment plants. The treatment
plant life. This phenomenon can be carried out by three ways:
is called Eutrophication. 1. Physical methods
Natural aging of lakes also 2. Chemical methods
leads to nutrient enrichment of its water. In a 3. Biological methods
lake, the water is cold and clear (oligotrophic
1.
Physical methods of wastewater
stage), supporting little life. With time, streams
draining into the lake introduce nutrients such treatment
as nitrates and phosphates, which encourage Wastewaters containing insoluble
the growth of aquatic organisms. Aquatic substances or colloids are treated through
plants and animal life grow rapidly, and organic processes such as flotation, sedimentation,
remains begin to be deposited on the lake filtration and centrifugal separation.
bottom (mesotrophic stage) (Fig. 13.5).
2.
Chemical methods of Wastewater
Pollutants from anthropogenic activities treatment
like effluents from the industries and homes Chemical methods of wastewater treatment
can radically accelerate the aging process. include:
This phenomenon is known as Cultural or •• Generation of insoluble solids.
Accelerated Eutrophication.
•• Produce an insoluble gas.
Nutrients stimulate the growth of algae, water •• Produce biologically degradable substances
hyacinth and can cause clogging of canals, rivers from a non-biodegradable substance.
and lakes as well as, displacing native plants. It •• Oxidize or reduce to produce a non-
causes unsightly foam and unpleasant odours, objectionable substance.
and deprives the water of dissolved oxygen. 3.
Biological methods of Wastewater
13.7.1 Integrated Wastewater treatment
Management (1)
Bioremediation of wastewater includes
Wastewater Treatment the aerobic treatment (oxidation ponds,
aeration lagoons) and anaerobic treatment
Wastewater or sewage originates from (anaerobic bioreactors, anaerobic
domestic waste waters, industrial wastes and lagoons).
Fig. 13.5 Stages of Eutrophication


(2) Phytoremediation of wastewater includes
constructed wetlands, Root Zone
Wastewater Treatment (RZWT), and
Decentralized Waste Water Treatment
System (DEWATS) (Fig. 13.6 a).
G. Nammalvar was a supporter and expert of

organic farming. He was an agricultural scientist,
environmental activist celebrated for his work
on spreading Ecological farming & Organic
farming. He was against the use of chemical
fertilisers and pesticides. He trained hundreds of
farmers in natural farming. Nammalvar was the
Fig .13.6 (a) DEWATS system at Auroville
author of several Tamil and English books on
natural farming, pesticides & fertilisers and was
featured in magazines & television programs. He
founded the Nammalvar Ecological Foundation
for Farm Research and Global Food Security
Trust or simply Vaanagam at Karur, Tamilnadu.
He developed social forest at Ammankurai and
the Kolunji Ecological Farm in Pudukottai.
He and his friends made a 10-acre barren land
(b) RZWT system at Aravind Eye Hospital into fertile cultivable land in the dry Pudukottai
Case Study: Auroville, located in South India district. He planted 52 varieties of trees in
near Puducherry has been experimenting the same waste land extending in 20 acres.
with natural wastewater recycling systems His organization ‘Kudumbam’ preserves and
(Fig:13.6a). Such treatment plants have regenerates hundreds of native flora and fauna,
in order to ensure a sustainable livelihood.
now also been implemented in Aravind Eye
Hospital, Puducherry (Fig.13.6 b) and the 13.9 Solid Waste Management
Chennai Mathematical Institute, Siruseri IT
Every day, tonnes of solid wastes are disposed
Park, Chennai.
off at landfill sites. This waste comes from
13.8 Organic Farming and Its homes, offices, industries and various other
Implementation agricultural related activities. These landfill
It is a method of farming system which sites produce foul smell if waste is not stored
primarily aims at cultivating the land and raising and treated properly. When hazardous wastes
crops in such a way, so as to keep the soil alive and like pesticides, batteries containing lead,
in good health by use of organic wastes (crop, cadmium, mercury or zinc, cleaning solvents,
animal and farm wastes, aquatic wastes) and radioactive materials, e-waste and plastics are
other biological materials along with beneficial mixed up with paper and other scraps and
microbes (biofertilizers) to release nutrients to burnt, they produce gases such as dioxins.
crops for increased sustainable production in These gases are toxic and carcinogenic. These
an eco-friendly pollution free environment. pollute the surrounding air, ground water
and can seriously affect the health of humans,

wildlife and our environment. The following Solid Waste management includes the
are major sources of solid waste (Table 13.1). activities and actions required to manage waste
from its inception to its final disposal. This
includes the collection, transport, treatment and
disposal of waste, together with monitoring and
regulation of the waste management process. It
is all about how solid waste can be changed and
used as a valuable resource.
Case Study: The Corporation of Chennai
Dr. Sultan Ahmed Ismail is an Indian soil
looks after clearance and management of solid
biologist and ecologist from Tamil Nadu.
His work has centered on techniques waste in Chennai. Every day around 5400
for recycling biodegradable waste into Metric Tonnes (MT) of garbage is collected
fertiliser using varieties of earthworms, from the city. Door to door collection of garbage
and on soil bioremediation. is done in most zones apart from sweeping,
Dr. Ismail received a D.Sc. in Zoology collecting, and storing the waste in the specified
from the University of Madras for his bins. At present garbage generated in Chennai
research on the role of earthworms in is dumped at two sites. Proposals are there for
soil ecology and waste management. remediation of the existing landfill or scientific
He works on vermicomposting as a closure and to have integrated waste processing
sustainable ecological practice. He has facilities with waste to energy plants as one of
been instrumental in introducing as well the components at the existing Kodungaiyur
as spreading awareness on environmental and Perungudi sites.
issues, solid waste management,
vermicomposting, organic farming, 13.9.1 Waste management practices
vermitech and waste management to a) Source segregation
several educational institutions, industries b) Composting
and organic farmers in India and abroad. 1. Aerobic 2. Anaerobic
Table 13.1 Major sources of solid waste

Waste category Source
Food wastes, plastics, paper, glass, leather, cardboard, metals, yard wastes,
Residential
ashes, tires, batteries, old mattresses
Industrial Packaging wastes, ashes, chemicals, cans, plastics, metal parts
Thin and thick plastics, food wastes, metals, paper, glass, wood,
Commercial
cardboard materials
Institutional Wood, paper, metals, cardboard materials, electronics
Construction Steel materials, concrete, wood, plastics, rubber, copper wires, dirt and glass.
and Demolition
Agriculture Agricultural wastes, spoiled food, pesticide containers
Syringes, bandages, used gloves, catheter, urine bags, drugs, paper,
Biomedical
plastics, food wastes, sanitary napkins and diapers, chemicals.
Electronic items like used TVs, transistors, tape recorders, computer cabinets,
E-Waste
mother boards, CDs, cassettes, mouse, wires, cords, switches., chargers.

c) Vermicomposting objective of treatment activities for longer-
d) Biogas generation lived radioactivity. The waste is contained
e) Incineration in corrosion resistant containers and
transported to disposal sites. Leaching of
13.9.2 Radioactive waste heavy metals and radionuclides from these
Radioactive wastes are generated during sites is a problem of growing concern.
various operations of the nuclear power plant.
Radioactive waste can be in gas, liquid or solid Control and Management
form, and its level of radioactivity can vary. The Three ways are employed to manage nuclear
waste can remain radioactive for a few hours or wastes
several months or even hundreds of thousands •• Spent Fuel Pools - The spent fuel
of years. Depending on the level and nature of discharged from the reactors is temporarily
radioactivity, radioactive wastes can be classified stored in the reactor pool. The Spent fuel
as exempt waste, Low and Intermediate level rods are used in stored cooling ponds.
waste and High Level Waste. They protect the surroundings from
radiation and absorb the heat generated
Radioactive waste management during radioactive decay.
Radioactive waste management involves
•• Vitrification method – This prevents
the treatment, storage, and disposal of liquid,
reaction or degradation of nuclear waste
airborne, and solid effluents from the nuclear
for extended periods of time and encased
industry.
in dry cement caskets.
•• Geological Repositories - A deep
The Three Mile Island
geological repository is a nuclear waste
(Pennsylvania, United
repository excavated deep within a
States), Chernobyl
stable geologic environment. It is suited
(Pripyat, Ukraine) and
to provide a high level of long-term
Fukushima Daiichi
isolation and containment without future
(Ōkuma, Japan) are nuclear disasters
maintenance. In India at Tarapur and
the world has seen in the recent period.
Kalpakkam, a wet storage facility of Spent
Fuel is the main mode of storage.
Methods of disposal of radioactive
wastes are 13.9.3 Medical waste
1. Limit generation - Limiting the generation Any kind of waste that contains infectious
of waste is the first and most important material generated by hospitals, laboratories,
consideration in managing radioactive wastes. medical research centers, Pharmaceutical
2. Dilute and disperse - For wastes having low companies and Veterinary clinics are called
radioactivity, dilution and dispersion are medical wastes.
adopted. Medical wastes contain body fluids like blood,
3. Delay and decay - Delay and decay is urine, body parts and other contaminants,
frequently an important strategy because culture dishes, glasswares, bandages, gloves,
much of the radioactivity in nuclear discarded needles, scalpels, swabs and tissues.
reactors and accelerators is very short lived. Management: The safe and sustainable
4. Concentrate and confine process - management of biomedical waste is the social
Concentrating and containing is the

and legal responsibilities of people working in can lead to adverse human health effects and
healthcare centers. environmental pollution.
Waste disposal: Involved by incineration, Recycling and disposal of e-waste may
chemical disinfection, autoclaving, encapsulation, involve significant risk to the health of workers
microwave irradiation are methods of waste and communities in developed countries
disposals. Final disposal includes landfill and and great care must be taken to avoid unsafe
burying as per norms inside premises. exposure in recycling operations and leaking
13.9.4 E-Waste of materials such as heavy metals from landfills
Electronic waste or e-waste describes and incinerator ashes.
discarded electrical electronic devices as well 13.9.5 Plastic Waste – Solutions and
as any refuse created by discarded electronic Remedies
devices and components and substances Plastics are low molecular weight organic
involved in their manufacture or use. Their polymers that are non-degradable in the natural
disposal is a growing problem because electronic environment. They are used in several items,
equipment frequently contains hazardous
including cars, bulletproof vests, toys, hospital
substances. In a personal computer, for example,
equipment, carry bags and food containers.
there may be lead (Pb) in the cathode ray tube
Packaging materials used in supermarkets, retail
(CRT) and soldering compound, mercury
outlets, manufacturing industries, households,
(Hg) in switches and housing, and cobalt (Co)
hotels, hospitals, restaurants and transport
in steel components, among other equally
companies are major contributors to plastic
toxic substances. E-wastes are basically PCB
waste generation. Plastic waste constitutes a
(Polychlorinated biphenyl) based, which are
non-degradable (Fig.13.7). major part of municipal solid waste.
• Remedies: ‘4R’- Refuse, Reduce, Reuse

and Recycle mantra is the best available
remedy for plastic waste pollution.
• Tamil Nadu State government successfully
implemented the ban on single use
plastics from 1st January 2019.
13.10 Global Environment Change

Green House Effect and Global warming
Natural environment and climate are dynamic
and keep changing over course of time. But with
human population growth, industrialization
and associated anthropological activities the
changes are more pronounced and impactful
Fig.13.7 Types of E-wastes in a much shorter time span, thus resulting in
drastic Global environmental change.
Used electronics which are destined for Large-scale changes of global environment can
reuse, resale, salvage, recycling, or disposal lead to hazards, which may include climate
are also considered e-waste. Unauthorised change, stratospheric ozone depletion, changes
processing of e-waste in developing countries

in ecosystems due to loss of biodiversity, changes precipitation patterns could be affected.
in hydrological systems and the supplies of Extreme wet and dry conditions can be
freshwater, land degradation, urbanization, and expected (flooding and desertification).
stress on food-producing systems. Coastal areas shall become more vulnerable
Greenhouse gases (GHG) water vapour, to storm surges as sea level rises. Plant and
carbon dioxide, methane, nitrous oxide, animal species will migrate or disappear in
ozone and some artificial chemicals such as response to climate change.
chlorofluorocarbons (CFCs) causes greenhouse •• Global warming can directly affect the
effect. The absorbed energy warms the flora and fauna. This could also result in
atmosphere and the surface of the Earth. shortage of food and even lead to food
crisis; and affect the health of the people
Major International Environmental and organisms.
Conventions
1972:
UN conference on Human Climate change threatens Nilgiri Tahr:
environment, Stockholm, Sweden The endangered wild goat could lose
1972: UN environment programme approximately 60 % of its habitat, starting
(UNEP), Stockholm, Sweden from the 2030s. (The Hindu, 12.08.2018)
1987: Montreal Protocol, Vienna
1989: Intergovernmental panel on climate The UNO has several measures to control
change, Geneva, Switzerland. or reduce pollution. Through various
1992: Earth summit, Rio de Janeiro. conventions organized by UNO, the countries
Agenda 21, otherwise called Rio assured to take steps to control or reduce
conference, Brazil emissions by factories and automobiles.
1997: Kyoto Protocol, Japan
2002: World Summit on Sustainable 13.11. Impact on Specific
Development, Johannesburg, South Ecosystems
Africa
13.11.1 Marine Ecosystem
2003: World climate change conference,
The marine ecosystem (Fig. 13.8) is the source
Moscow, Russia
of fish, see weeds and other marine products.
2012: UN Conference on Sustainable
Development, Rio de Janeiro With the advent of intensive fishing by using
2015: UN Sustainable Development giant nets and mechanized boats, fish catch
Summit, New York has dropped significantly.
2016: Montreal Protocol amendment at
Kigali, Rwanda
2017: The COP23 climate change summit
in Bonn, Germany
2018: UN climate change conference,
Katowice, Poland
•• The large-scale global warming will have

significant impact on people and nature.
Fig. 13.8: Marine ecosystem
As global average temperatures rise,

13.12 Ozone Depletion can result from free radicals and reactive
At about 15 and 30 kilometers from the oxygen and photons can damage the DNA
ground level, the earth’s atmosphere has a itself.
thin layer of ozone, which absorbs ultraviolet Control: Ozone layer depletion can be
sunlight. Ozone is found in the layer of the controlled by
atmosphere called the Stratosphere. It acts as (1) Phase down or ban the use of CFCs
a protective covering that absorbs ultraviolet (CFC free refrigerants).
(UV) radiation from the sun. The ozone (2) Minimizing the use of chemicals such as
molecule (O3) consists of three oxygen atoms. halons and halocarbons.
It is formed when atmospheric oxygen (O2)
(3)
Creating awareness about ozone
on exposure to solar radiation breaks into two
depleting agents.
oxygen atoms; each atom then joins up with
a single oxygen atom. The ozone molecule is Ozone hole (in purple colour), is the area
unstable. It soon decays again to form molecular above Antarctica, where the ozone layer is
oxygen. This cycle is a continuous process in the thinnest.
the upper reaches of the stratosphere.
World Ozone Day

September 16 has been designated by the
United Nations as the International Day for
the Preservation of the Ozone Layer.
The ozone layer was discovered in 1913
by the French physicists Charles Fabry and
Henri Buisson.
Causes and effects of ozone layer

depletion Ozone depletion around Polar region
Causes: Ozone layer depletion mainly occurs Ozone thickness is given in Dobson unit
by anthropogenic actions. (see carefully the scale shown in colour from
The excessive release of chlorine and violet to red). The ozone hole over Antarctica
bromine from man-made compounds such as develops each year between late August and
chlorofluorocarbons (CFCs) causes ozone layer early October.
depletion. CFCs, methyl chloroform, carbon Courtesy: NASA
tetrachloride, hydrochlorofluorocarbons,
hydrobromofluorocarbons and methylbromide
are found to have direct impact on the depletion 13.13 Deforestation
of the ozone layer. These are categorized as Deforestation is the destruction of forests
ozone-depleting substances (ODS). in order to clear the land and make it
Effects: UV rays may penetrate deep into the available for other uses. Forests cover about
skin and can lead to premature skin aging and 30 percent of the world’s landmass. But due
wrinkling of skin; suppression of the immune to deforestation it is estimated that the earth
system, skin cancer (melanoma) and chronic loses 18.7 million acres of forests per year. In
effects leading to eye damage. DNA damage 2016, global tree cover loss reached a record
of 29.7 million hectares.

Common methods of deforestation are
Amrita Devi was a brave lady from Khejarli
burning trees and clear cutting.
Village of Jodhpur District, Rajasthan.
13.14 People’s Participation in She sacrificed her life to maintain Bishnoi
Conservation of Forests Dharma. In 1730, Maharaja Abhay Singh,
ruler of Marwar, Rajasthan state wanted to
People’s participation is vital in forest log green Khejri (Prosopis cineraria) trees
conservation, especially those living in them to burn lime for the construction of his new
or close to the forest. This is referred to as palace. Since there was a lot of greenery in
Community forestry, which varies widely in the Bishnoi villages even in the middle of
legal, political and cultural settings and the Thar Desert, the king ordered his men to
term covers a wide range of experiences and get the wood from Khejri trees. When she
practices. came to know about the cutting of trees
by the King’s men, she and many others
The Bishnois, who are known conservators
had hugged the Khejri trees to save from
of their forest, were inspiration to many cutting. But king’s men killed Amrita Devi
people’s participatory movements for along with more than 363 other Bishnois.
Environmental protection in India. The It was a Tuesday, black Tuesday in Khejarli.
Chipko movement resisted the destruction This incident took place to save trees and is
of forests of India in the 1970s. Sunderlal recorded in India’s history.
Bahuguna was the leader of this movement.
People in the movement hugged the trees,
and prevented felling of trees by contractors.
The ‘Forest man of India’, Jadav Payeng
who created 1,360 acres of dense and defiant
forest was born in Arunasapori (a river island
on the Brahmaputra). He had just completed
his Class X exams in1979 when he started to To commemorate her bravery, the
sow the seeds and shoots on the eroded island Government of Rajasthan and Madhya
covered with sand and silt. Thirty-six years Pradesh have initiated the prestigious state
later he had converted the once unproductive level award named as ‘Amrita Devi Bishnoi
Smriti Award’ for excellent contribution to
land into a forest. Payeng’s forest is now home
the protection and conservation of wildlife.
to five Royal Bengal tigers, over a hundred
deer, wild boar, vultures, and several species
of birds. For his remarkable initiative, the
13.15 Ecosan Toilets
About 150 liters of wastewater at an average
Jawaharlal Nehru University invited Payeng
is generated by an Indian individual daily, and
in 2012 on Earth Day and honoured him with a large amount of it is generated from toilets.
the title of the ‘Forest Man of India’. Later, the Ecological sanitation (EcoSan) is a sustainable
President APJ Abdul Kalam felicitated him system for handling human excreta by using
with a cash award in Mumbai. The same year, dry composting toilets. EcoSan toilets not
he received the ‘Padma Shri’. only reduce wastewater generation but also
The Indian Constitution also stresses on generate the natural fertiliser from recycled
human excreta, which forms an excellent
the importance of the role of the People in
substitute for chemical fertilisers. This
protecting their environment.
method is based on the principle of recovery

and recycling of nutrients from excreta to average global temperature, are deleterious to
create a valuable supply for agriculture. living organisms. Increased risks of skin cancer,
‘EcoSan’ toilets are being used in several parts mutations and other disorders are potential
of India and Sri Lanka. threats.
Summary Earth summits, Conventions on climate
change, developing of protocols and creation of
Degrading natural environments, depleting
emission standards and control are some of the
natural resources, pollution, vulnerability to
steps taken by governments towards protecting
large scale environmental changes and hazards
our environment and conserve for today and the
are the core Environmental issues of today.
future generations.
Air pollution by fossil fuel burning and other
anthropological activities like industrialization Evaluation
is reaching alarming levels and affecting human 1. Right to Clean Water is a
health and testing the survival of sensitive species. fundamental right, under
Domestic and industrial sewage, and the Indian Constitution
agricultural run-off are the most common reasons a) Article 12 b) Article 21
for pollution of water bodies, resulting in reduced
c) Article 31 d) Article 41
dissolved oxygen and increased Biochemical
Oxygen demand of water bodies. Eutrophication 2. With which of the following, the Agenda 21’
and algal blooms are regular occurrences today. of Rio Summit, 1992 is related to?
Industrial wastewaters are often rich in toxic a) Sustainable development
chemicals, heavy metals and organic compounds b) Combating the consequences of
which harm living organisms and may even population
result in death of aquatic life. c) Mitigation norms of Green House
Noise pollution is a threat to human and Gases (GHGs) emission.
other animals. It can affect health and disturb d) Technology transfer mechanism to
peaceful habitats. Agrochemicals and its usages developing countries for ‘clean-energy’
cause many ill effects in human beings, other production.
organisms and soil. Agrochemicals can also
3. Which among the following awards
cause biomagnification. The solution is to revert
instituted by the Government of India for
to non-chemical farming (use of biofertilisers,
individuals or communities from rural areas
biopesticides, protect pollinators) practices.
that have shown extraordinary courage and
Generation of municipal wastes and their safe dedication in protecting Wildlife?
disposal are major issues faced by communities
a) Indira Gandhi Paryavaran Puraskar
today. Solid wastes create environmental
b) Medini Puruskar Yojana
problems and must be disposed-off in safe ways.
Disposal of solid wastes, radioactive wastes and c) Amrita Devi Bishnoi Award
e-wastes requires further efforts and research. d) Pitambar Pant National Award
Solid wastes like plastic can be combated by 4. The ‘thickness’ of Stratospheric Ozone layer
practicing the 4R - refuse, reduce, reuse and is measured in/on:
recycle. Ecosan toilets are some of the universally a) Sieverts units b) Dobson units
accepted eco-friendly practices.
c) Melson units d)Beaufort Scale
Green house effect and depletion of ozone
5. Which among the following is the most
layer are aggravated by emissions of carbon
abundant Green-House-Gas (GHG) in the
dioxide, methane, nitrous oxide and CFCs and
earth’s atmosphere?
deforestation. Melting of ice caps, rising sea
levels, change in rainfall patterns, increase in a) Carbon dioxide b) Water Vapour

c) Sulphur Dioxide d) Tropospheric Ozone 14. Expand (i) CFC (ii) AQI (iii) PAN
6. As per 2017 statistics, the highest per capita 15. What is SMOG and how it is harmful for us?
emitter of Carbon dioxide in the world is 16. List all the wastes that you generate, at home,
a) USA b) China school or during your trips to other places.
c) Qatar d) Saudi Arabia Could you very easily reduce the generation
of these wastes? Which would be difficult or
7. The use of microorganism metabolism to
rather impossible to reduce?
remove pollutants such as oil spills in the
water bodies is known as 17. Discuss the causes and effects of global
warming. What measures need to be taken
a) Biomagnification b) Bioremediation
to control global warming?
c) Biomethanation d) Bioreduction
18. What would Earth be like without the
8. The Ozone Day is observed every year on greenhouse effect?
September 16 as on this day in 1987 the
19. Write notes on the following:
___________was signed for launching
efforts to arrest the depletion of the fragile a. Eutrophication
ozone layer in the stratosphere that prevents b. Algal Bloom
the harmful ultra-violet rays of the sun from 20. What effect can fertilizer runoff have on an
reaching the earth. Fill the correct word in aquatic ecosystem?
blank. 21. How can we control eutrophication?
a) Montreal Protocol b) Geneva Protocol 22. Why does ozone hole form over Antarctica?
c) Kyoto Protocol d)Nagoya Protocol 23. Mention the causes of enhanced use of
9. Which among the following always ultraviolet radiation.
decreases in a Food chain across tropic 24. Discuss the role of women in protection and
levels? conservation of forests.
a) Number b)Accumulated chemicals 25. Discuss the role of an individual to reduce
c) Energy d) Force environmental pollution.
10. In the E-waste generated by the Mobile 26. How does recycling help reduce pollution?
Phones, which among the following metal 27. What is the primary purpose of the Kyoto
is most abundant? Protocol?
a) Copper b) Silver 28. In what way Peyang conserves the forest?
c) Palladium d) Gold 29. Discuss briefly the following :
11. The Hydrochlorofluorocarbons (HCFCs) a. Catalytic converter
are the compounds which have the b. Greenhouse gases
following molecules:
c. Ecosan
a) Hydrogen b) Carbon
30. What are some solutions to toxic dumping
c)Chlorine d)Fluorine in our oceans?
12. SMOG is derived from : 31. Describe how deforestation might
a) Smoke b) Fog contribute to global warming.
c) Both A and B d) Only A 32. How does forest conservation help to reduce
13. Excess of fluoride in drinking water air pollution?
causes:
a) Lung disease b) Intestinal infection
c) Fluorosis d) None of the above

Glossary Canopy – The canopy is the above ground
portion of a plant community or crop, formed
Abiogenesis – The emergence by the collection of individual plant crowns.
of life forms emerging from
non-living chemical systems. Carcinogens– Substance causing cancer
In contrast with spontaneous Cardiac arrhythmia– Any variation from the
generation, abiogenesis is not normal rhythm in the heartbeat.
a process that biologists think continues in a
particular environment, such as a planet or moon, Carrier – An individual heterozygous for a
once a living system has emerged. recessive gene that is not expressed
Acidogenesis – Conversion of simple organic Catastrophic– Something or substance that

materials into acetate, H2 and CO2 by acidogenic involves or causes a sudden terrible disaster.
bacteria.
Changes in animals over time in response to
Algal bloom – Presence of large amounts of changing environmental factors /conditions.
nutrients in waste water causing excessive growth Adaptations help develop physiological, behavioral
of planktonic algae. and structural / functional traits which increase
the chances of survival of the organisms.
Allergy - A hypersensitivity reaction that can
involve various deleterious effects. Chemical oxygen demand - A measure of the
oxygen required to oxidize soluble and particulate
Anthropogenic causes– Problems created organic matter in water.
by human
Cirrhosis - Scarring of the liver that impairs its
Anthropology – The study of differences and functioning.
similarities, both biological and cultural, in human
populations. Anthropology is concerned with Co-dominance – In a heterozygote, the dominant
typical biological and cultural characteristics of and recessive allele is capable of phenotypic
human populations in all periods and in all parts expression.
of the world.
Coacervates – are the microscopic spontaneously
Antisense DNA– It is the non coding strand formed spherical aggregates of lipid molecules
complementary to the coding strand in double that are held together by electrostatic forces and
stranded DNA. The antisense strand serves as a that may have been precursor of cells. They are
template for mRNA synthesis. the cluster of molecular aggregates in colloidal
form which are bounded by a membrane
Apoptosis– Is a form of programmed cell death and grows by absorbing molecules from the
that occurs in multicellular organisms. environment. Oparin believed that life developed
Attenuated – reduced in virulence. from coacervates.
Autoradiography – It is the use of X-ray or Cytolysis - Destruction of cells

photographic film to detect radioactive materials. Cursorial – A cursorial organism is one
Bacteriophages– Viruses which infect bacterial that is adapted specifically to run. Cursorial
cells. organisms are typically adapted to long-
distance running at high speeds, rather than
Biogeography - The scientific study of the animals with high acceleration over short
geographic distribution of organisms.
Glossary 254
TN_GOVT_XII_Glossary.indd 254 25-02-2019 18:48:41

distances; thus, a cheetah is considered Euchromatin – Euchromatin is a tightly packed
cursorial, while a leopard is not. form of chromatin that is enriched in genes, and
is often under active transcription.
Denaturing – Denaturing means separation or
splitting of the double helix into single stands Eutrophication - Excessive richness of nutrients
by breaking hydrogen bonds between the two in a lake or other water bodies frequently due to
strands. run of fertilizers from the land causing dense
growth of plant life.
Dendritic cells - Professional antigen presenting
cells that have long membrane processes Fibroids – Fibroids are abnormal growths
formed on the outside, inside or in the walls of
Diapedesis - The movement of blood cells
the uterus.
(leucocytes) out of the circulatory system and
towards the site of tissue damage or infection Foetus – Developmental stage extending
accompanying inflammation. from the ninth week of development
to birth.
Dinosaurs - a term coined by Sir Richard Owen
for giant extinct reptiles. Group of animals that Fossorial – Fossorial (from Latin fossor,
have bird-like and lizard-like facial appearance meaning "digger") is an animal adapted
(Mesozoic). to digging which lives primarily, but not
solely, underground. Some examples are
Distribution – The occurrence of different
badgers, naked mole-rats, clams, and mole
organisms in a given area and the way they are
salamanders.
distributed in their space, specific time and
utilization of their resources. ]Galaxy – a specific arrangement of stars.
DO – Dissolved Oxygen is the amount of Gene bank-A facility established for the ex-situ
gaseous oxygen (O2) dissolved in the water. Conservation of individuals, seeds, tissues or
reproductive cells .
Ecotourism - Travel undertaken to witness sites
or regions of unique natural ecological quality Gene pool – the total gene content of a whole
the provision of services to facilitate such travel. species.
El Nino– Unusual warming of surface waters in Genetic drift – an alteration in the gene
the eastern tropical Pacific Ocean. frequency.
Emphysema– A serious medical condition that Geology – the study of origin and structure of
occurs when the lungs become larger and do not Earth.
work properly, causing difficulty in breathing.
Glaciers– A large mass of ice that moves slowly.
Endemism-The phenomenon in which the
Group of individuals of the same species living
organisms are exclusively restricted to a given
in a given area at a given time and reproduce
area.
among themselves.
Endometriosis – An abnormal condition in
Haemophilia – A medical condition in which
which endometrial tissue that normally lines
the ability of the blood to clot is severely
the uterus grows outside .
reduced, causing the patient to bleed severely
Eohippus – ancestor of modern horse. from even a slight injury.
255 Glossary

Haemozoin - Toxic malarial pigment that average change in other species population or
causes malaria fever. ecosystem process.
Hallucination - The sensation of seeing, hearing Locus – The particular point on the chromosome
or sensing something that does not exist. at which the gene for a given trait occurs.
Heterochromatin – Heterochromatin is a Macrophage - A large, leucocyte derived from a

tightly packed form of DNA or condensed monocyte that functions in phagocytosis,
DNA.
Malt - Mucosal Associated Lymphoid Tissue
Homeostasis– It is the state of steady internal collective terms for secondary lymphoid organs
conditions maintained by living things. located along various mucous membrane
surfaces including Peyer’s patches, tonsils,
Immune reaction – The production of
appendix
antibodies in response to antigens
Mast cell - A bone marrow derived cell
Interferon - An antiviral protein produced
from virally infected fibroblasts and leucocytes Menarche – Starting of the first menstrual
induces antiviral state in uninfected cells. period.
Intersex – An individual showing a combination Merozoite -

A trophozoite of Plasmodium
of male and female characteres. found in RBC or liver cells.
Intra-Uterine Insemination (IUI)-Processed Methanogenesis – Conversion of acetate, H2

sperm sample is infused into the uterus, by and CO2 into methane by methane producing
passing the vagina. Intracytoplasmic sperm bacteria
injection (ICSI)-injection of a sperm directly Molecular biology – The branch of biology
into the ovum. which attempts to interpret biological events
Intra uterine transfer (IUT)-Transfer of in terms of the physico chemical properties of
molecules in a cell.
embryo with more than 8 celled blastomeres
into the uterus. Molecular pharming – Production of active
pharmaceutical substances in genetically
In vitro fertilization (IVF)- Fertilization
moldified organisms
outside the body in the laboratory.
Mould – an impression of a complete organism
In vivo fertilization -fusion of gametes within
or a part of it in the rock that surrounds it.
the female
Multple sclerosis– is a demyelinating disease in
Inflammation - e.g., Vaginitis- inflammation
which the insulating covers of nerve cells in the
in the vagina, urethritis- inflammation in the
brain and spinal cord are damaged.
urethra,endocervicitis- inflammation inside
the cervix, epididymitis - inflammation in the Mutation – sudden and inheritable changes.
epididymis, prostatitis - inflammation in the
Narcotic -
A powerful drug that produced,
prostate gland
relaxed, dreamy state, derived from Opium
Keystone species-A species whose loss from plant.
an ecosystem would cause a greater than
Glossary 256

Nascent RNA – Nascent RNA is an immediately Planetesimals - Planetesimals are the
formed RNA. In this RNA no post transcriptional fundamental building blocks of the planets as
modification had occured. well as the ancestors of asteroids and comets.
NBOD – Nitrogenous BOD Polypeptide chain– It consists of smaller

subunits or amino acids that are linked together.
Nk cells - Natural Killer cells that kill infected
They are the building blocks of proteins.
and tumor cells.
Postpartum – Period of life following childbirth.
Nondisjunction – Nondisjunction is the
failure of homologous chromosomes or sister Precursor– A substance from which another is
chromatids to separate properly during cell formed, especially by metabolic reaction
division
Primer – A short oligonucleotide that hybridizes
NPK fertilizers– Fertilizers with Nitrogen (N), the template strand and gives a 3’ – OH end for the
Phosphorus (P) and Potassium (K). initiation of nucleic acid synthesis.
Nucleosome – A morphologically repeating Probe – The probe is a single stranded DNA

unit of DNA containing 190 base pairs of DNA molecule that is ‘complementary’ to the gene of
folded together with eight histone molecules. interest in a sample under study.
Null cell - A small population of peripheral Pseudopodia – Blunt temporary protoplasmic

blood lymphocytes that lack the membrane projections found in Amoeba or in some amoeba-
markers characteristic of B and T cells. Natural like cells.
killer cells are included in this group. Psychoactive drug - A chemical substance that
Number of individuals in a population within a acts on brain and affects the mind and behaviour
defined unit of space and time. of user.
Ontogeny – life history of an individual. Puberty – Period of reproductive maturity

Pyrolysis– Decomposition brought about by high
Oocyte – The encysted zygote of Plasmodium
temperatures.
Operon – A cluster of genes whose expression
Recombinant– A cell or organism whose genetic
is controlled by a single operator.
complement results from recombination
Panspermia – units of life in the forms of spores.
Redia – Larva in the life cycle ofmost trematodes.
Permafrost – Any ground that remains Rheoreceptors – They are receptors in fish
completely frozen (32°F (0°C) or colder) for and some amphibians that respond to water
at least two years straight. These permanently currents.
frozen grounds are most common in regions
with high mountains and in Earth’s higher Saltation – single step large mutation.
latitudes near the North and South Poles. Satellite DNA – Short highly repeated
Phenotypic plasticity - the ability of one genotype eukaryotic DNA sequences, usually clustered in
to produce more than one phenotype when heterochromatin and generally not transcribed
exposed to different environments. Saltatorial – Saltatorial is an animal adapted to
Phylogeny – recalling of ancestral history. leaping. They have large, muscular hindlimbs and
sometimes, reduced forelimbs. A few example
257 Glossary

for jumpers in the animal kingdom include fleas, Transgene– The target gene responsible for the
froghoppers, grasshoppers, and frogs. development of transgenic organism.
Schizogony - The process of multiple fission, in Trophozoite stage – In Plasmodium life cycle,

which one organism divides to produce many cryptomerozoites in the RBC become round and it
daughter cells. modifies into a young trophozoite.
Schizont – The trophozoite of Plasmodium grows Umbilical cord – Structure bearing arteries and
in size to form the schizont. veins connecting the placenta and the foetus.
Selection – choosing the better adapted alleles Variations – dissimilarity between the members of
from the mixed population. the same species.
Sewage - Domestic waste water containing various Vitrification– Transformation of a substance into
solid and liquid waste materials including human a glass.
excreta. Volatility– A liquid or substance is one that will
Single cell protein (SCP) – A protein derived from quickly change into a gas.
a culture of single celled organisms used especially Withdrawal symptoms - The reactions
as a food supplement. experienced by an addict after he/she stops using
SOD– Sediment Oxygen Demand is the rate at drugs.
which dissolved oxygen is removed from the water Woolly mammoth – A hairy relative of modern
column during the decomposition of organic elephant that lived in cold climates.
matter in streambed or lakebed sediments.
Zoogeography – study of details with the
Solubilisation – Dissolving the feed stock in water geographical distribution of animals.
to make a slurry for anaerobic digestion.
Zygote intra fallopian transfer-(ZIFT)
Speciation – formation of new species from the transfer of zygote or embryo with 8 or
pre-existing ones. less than 8 celled blastomeres into the
Structural gene – A gene coding for the structure fallopian tube.
of a protein.
Taq DNA polymerase– is a thermostable
DNA polymerase obtained from thermophilic
bacterium Thermus aquaticus. It helps in the
synthesis of DNA.
Glossary 258

References • Doan, T., Melvold, R., Viselli, S. and
Waltenbaugh, C. (2008). Lippincott’s
• Ahluwalia KB., (1895), Genetics, wiley Illustrated Reviews: Immunology.
eastern Ltd Published by Wolters Kluwer (India) Pvt.
• Ananthanaryan, R and JayaramPaniker, Ltd., New Delhi.
C.K. (2009). Text book of Microbiology, • Dodson O. Dodson, 1661, Evolution
University Press (India) Pvt. Ltd. 8th process and product, Dodson University,
Edition. Australia.
• Barucha, E. (2004). Textbook for • Dubey. R.C and Maheswari., D.K (2010),
Environmental Studies, New Delhi: A text book of Microbiology, Revised
University Grants Commission edition, S. Chand & Company Ltd.
• Benjamin, E., Coico, R and Sunshine, • Edward J. Kormondy Concepts of Ecology
G. (2000). Immunology.A short course. – Fourth edition Publised by Ashoke K.
Fourth Edition.Wiley-Liss, Wiley and Ghosh, PHI Learning (P) Ltd.
Sons, Inc., Publication.
• Ekambaranatha Ayyar and Anantha
• Bose, A.K. (1999). Legal Control of Water Krishnan, (1987), Manual of Zoology, Vol
Pollution in India. Indian Institute of II Chordata , 5th Edition S.Viswanathan
Management, Kolkata. Publishers and Printers Pvt. Ltd.,
• Brooker/Widmaier, 2014, Evolution, • Farrugia. A and R. Blundell (2007). In
Second Edition, Prime books publishers, vitro Fertilisation and Other Artificial
USA. Reproductive Technology Methods-
• Chaudhary Sushil, 2000, Pioneer Review Paper. International Journal
Refresher Course in Biology, Dhanpat Rai of Molecular Medicine and Advance
& Co, Delhi. Sciences 3 (1): 16-23, 2007.
• Clary DP., (2010), Molecular biology, Ap • Fukuoka, M. (2009). The One-Straw

cell press. Revolution: An Introduction to Natural
Farming, New York Review of Books,
• Climate change and global warming. New York.
(2015). ENVIS centre for Himalayan
Ecology, Uttarakhand. • Futuyma Douglas J 2008, Evolution,
Second Edition, Prime books publishers,
• Dabady, K & Tulk, P. (2015). Agrochemicals USA.
and their Impact on Human Health,
McGill University, Canada. • Gangane. S.D(2012), Human genetics, 4th
edition Elsevier publications India Ltd
• Daniel L. Hartl., (2011), Essential
Genetics. A genomics perspective fifth • Gaya Pandey, 2010, Bio-cultural
edition, Jones and Bartlett Publishers. Evolution, Concept publishing company
Pvt, New Delhi.
• Dhami P.S and Mahindru R.C 1698, A text
book of Biology, Pradeep publications, • Getchell, Pippin and Varnes, Perspectives
Jalandhar. on Health, New edition, Mcdougal Littell.
259 References
TN_GOVT_XII_ Reference.indd 259 25-02-2019 18:49:32

• Goldsby, R.A., Kindt, T.J., Osborne, B.A. • Jordan E.L and Verma P.S.,(2010),
and Kuby, J. (2003). Immunology.Fifth Invertebrate Zoology, 14th Edition, S.
Edition.W.H.Freeman and Company. Chand & Company Ltd.,
New York.
• Joseph, B. (2009). Environmental Studies,
• Goodwin TM, Montoro MN, Muderspach McGraw Hill Education (India) Pvt. Ltd.,
L, Paulson R, Roy R.(2010). Management New Delhi.
of Common Problems in Obstetrics and
• Kardong Kenneth V 2005, Biological
Gynecology, 5th Edition, Dec 2010, Wiley-
Evolution, Washington State University,
Blackwell. ISBN: 978-1-444-39034-6
USA.
• Gopalakrishnan T.S ,Dr. Itta Sambaswaiah
• Klug W.S and Cummings M.R., Concept
1684, Dr Kamalakara Rao A.P (Three
of Genetics, Seventh Edition. Chepter 5
Author book) Principles of organic
evolution, 7th Edition Himalaya • Kotpal R.L., (2016), Modern Text Book
Publishing House, Chennai. Of Zoology- Invertebrates, 11th Edition,
Rastogi Publications.
• Guyton. AC. and I.E. Hall. (2000).
Endocrinology and Reproduction. In • Kotpal R.L., (2012), Modern Text Book Of
Schmitt, W., R. Gruliow and A Norwitz. Zoology- Vertebrates(Diversity - II), 3rd
(Eds.). Text book of Medical Physiology. Edition, Rastogi Publications.
W.B. Saunders Company. pp: 916-941.
• Leonard B. Radinsky, 2000, Evolution of
• Hall J. E. , 202, 13th Edition. In Guyton Vertebrates Second Edition, John Wiley
and Hall Textbook of Medical Physiology; and Sons, New York.
Reed Elsevier India Pvt. Ltd.,
• MacKenzie, S.H. (1996). The Ecosystem,
• Helen Kreuzer and Adrianne Massey Island Press, CA (USA).
(2005) Biology and Biotechnology-
• Marieb E. N. and Hoehn K, 2011, 8th
Science , Applications and Issues, ASM
Edition. In. Anatomy and Physiology;
Press, American Society for Microbiology.,
Pearson Education Inc.,
Washington DC
• Mudaliar A.L and Krishna Menon M.K,
• Herren, Ray V (2005), Introduction
202, 12th Edition. In. Clinical Obstetrics;
to Biotechnology: An Agricultural
Universities Press (India) Pvt. Ltd.
Revolution, Thomson-Delmar Learning
Inc., NY. • Muthayya NM, 2010, 4th Edition. In.
Human Physiology; Jaypee Brothers
• Ichhpujani R.L and Rajesh Bhatia (1994),
Medical Publishers (P) Ltd.
Microbiology for Nurses, First edition,
Jaypee brothers Medical Publishers (P) Ltd. • National Population Education project,
Adolescence Education in Schools,
• Jones M, Fosbery M, Gregory J and
NCERT, New Delhi.
Taylor D., (2014), Bridge international. AS
and A level biology course book, Fourth • R. C. Dubey (2003) A Textbook of
edition, Cambridge University Press. Biotechnology, S. Chand and Company
LTD., New Delhi.
References 260

• Randhawa SS (2006), a text book • Ugene P.Odum, Gray W. Barrett
of genetics, 3rd edition, pee vee Fundamental of Ecology – Fifth edition,
publications Ltd. 2005. Cengage Learning India (p) Ltd.
• Ridley Mark, 2004, Evolution, • VamanRao C. (2017). Immunology.

Third edition Blackwell publishing, Narosa Publishing House Pvt. Ltd., Third
Malden, USA. Edition.
• Roitt(2001). Immunology. Harcourt • Verma P.S., Agarwal V.K. Environmental

Publishers limited. Sixth edition. Biology – S.Chand & Company Ltd.
• S.N.Chary Ecology – Environmental • Verma PS and Agarwal VK., (2008),

Studies, First Edition 2008, Published by Genetics, Ninth Revised multicolor
Rajiv Beri for Macmillan India Ltd. edition, S.Chand & Company Ltd.
• Sekar, P. & Mathivanan, J. (2008). • William J. Thieman and Michael A

Environmental Education, Neminatha Palladino (2004), Introduction to
Pathippagam, Polur. Biotechnology, Pearson Education Inc.,
and Dorling Kingsley Publishing Inc.,
• Sharma P.D. Ecology and Environment
New Delhi, India
12th edition – 12th Revised edition,
Rastogi publication.
• Silverthorn, D.U(2016). Human

Physiology.An integrated approach.
Pearson Education Limited. Seventh
Edition.
• Stiling, P. (2012). Ecology: Global

Insights & Investigations, McGraw-Hill
Companies Inc., New York.
• Tamarin RH (2007), Principles of

genetics, 7th edition, tata Mcgraw hill
publication Ltd.
• Tamil Nadu State Environment Policy

– 2017, Department of Environment,
Government of Tamil Nadu, Chennai -
600 015.
• Tortora.J and Funk.R., (2008),

Microbiology an Introduction, 9th
edition, Pearson Education in South Asia.
• U. Satyanarayana Biotechnology, Books

and Allied (P) Ltd., Kolkata
261 References

MCQs for Higher Studies
Chapter 1 - Reproduction in Organisms Chapter 2 - Human Reproduction
1. “Nothing lives forever, but life continues”. What 1. Select the incorrect statement. [NEET 2016, phase I]
does it mean? [AIPMT 1995] a) LH and FSH trigger ovulation in ovary
a) Older dies but new ones are produced by b) LH and FSH decrease gradually during the
reproduction follicular phase
b) N othing can produce without death c) LH triggers secretion of androgens from the Leydig cells.
c) Death has nothing to do with the continuation of d) FSH stimulates the sertoli cells which help in
life spermiogenesis
d) Parthenogenesis is must for sexual reproduction 2. Identify the correct statement on ‘inhibitin’
2. A
few statements describing certain features of [NEET 2016, phase I]
reproduction are given below. Select the options that a) is produced by granulose cells in ovary and
are true for both sexual and asexual reproduction inhibits the secretion of FSH
from the options given: b) is produced by granulose cells in ovary and inhibits
i. Gametic fusion takes place the secretion of LH
ii. Transfer of genetic material takes place c) is produced by nurse cells in testes and inhibits the
iii. Reduction division takes place secretion of LH
iv. Progeny have some resemblance with parents d) inhibits the secretion of LH, FSH and prolactin.
a) i and ii b) ii and iii 3.
Several hormones like hCG, hPL, oestrogen and
c) ii and iv d) i and ii progesterone are produced by [NEET 2016, phase I ]
3. A
few statements with regard to sexual reproduction a) ovary b) placenta
are given below: c) fallopian tube d) pituitary
i. Sexual reproduction does not always require two 4. Match column I with column II and select the correct
individuals option using the codes given below
ii. Sexual reproduction generally involves gametic [NEET 2016, phase I]
fusion Column I Column II
iii. Meiosis never occurs during sexual reproduction A. Mons pubis 1.Embryo formation
iv. External fertilization is a rule during sexual
B. Antrum 2. Sperm
reproduction
Choose the correct statements from the options C. Trophectoderm 3. Female external genitalia
below: D. Nebenkem 4. Graafian follicle
a) i and iv b) i and ii
A B C D
c) ii and iii d) i and iv
a) 3 4 2 1
4.
Given below are a few statements related to external
b) 3 4 1 2
fertilization. Choose the correct statements:
c) 3 1 4 2
i. The male and female gametes are formed and
d) 1 4 3 2
released simultaneously
5. Which one of the following is not the function of
ii. Only a few gametes are released into the medium
placenta? (NEET, 2013)
iii. Water is the medium in a majority of organisms
a) To facilitate supply of oxygen and nutrients to embryo
exhibiting external fertilization
b) To secrete oestrogen
iv. Offspring formed as a result of external
c) To facilitate the removal of carbondioxide and
fertilization have better chance of survival than
material from embryo
those formed inside the organism
d) T o secrete oxytocin during parturition
a) iii and iv b) i and iii
6.
The testes in human are situated outside the
c) ii and iv d) i and iv
abdominal cavity inside a pouch called scrotum. The
5. Which
of the following statements, support the view purpose served is for [AIPMT 2011]
that elaborate sexual reproductive process develops a) escaping any possible compression by the visceral organs.
much later in the organic evolution? b) providing more space for the growth of epididymis.
i) Lower groups of organisms have simpler body design c) providing a secondary sexual feature for exhibiting
ii)Asexual reproduction is common in lower groups the male sex
iii) Asexual reproduction is common in higher d) maintaining the scrotal temperature lower than
groups of organisms internal body temperature
iv)The high incidence of sexual reproduction is in 7.
Hormones secreted by placenta to maintain
angiosperms and vertebrates. pregnancy are [NEET,2018]
a) i, ii and iii b) i, iii and iv a) hCG, hPL, progesterone, estrogen
c) i, ii, and iv d) ii, iii and iv b) hCG, hPL, estrogen, relaxin, oxytocin
MCQs for Higher Studies 262
Competitive Questions for Higher studies NEW.indd 262 25-02-2019 18:55:28

c) hCG, hPL, progesterone, prolactin b) Out of one pair factors one is dominant and the
d) hCG,
progesterone, estrogen, glucocorticoids other recessive
8. Match and select the correct option [NEET, 2018] c) Alleles do not show any blending and both the
Column I Column II characters recover as such in F2 generation
d) Factors occur in pairs
a. Proliferative phase 1. Breakdown of
3. ABO blood groups in humans are controlled by the
endometrium lining
gene I. It has three alleles – IA, IB and i. Since there
b. Secretory phase 2. Follicular phase are three different alleles, six different genotypes are
possible. How many phenotypes can occur?
c. Menstruation 3. Luteal phase
[AIPMT PRE 2010]
a b c
a) Three b) One c) Four d) Two
A) 3 2 1
4. Which one of the following symbols and its
B) 2 3 1
representation, used in human pedigree analysis is
C) 1 3 2
correct? [AIPMT PRE 2010]
D) 3 1 2
a) □ =○=Mating between relatives
b) ○ =Unaffected male
Chapter 3 - Reproductive Health c) □ =Unaffected female
1. Which of the following is a hormone releasing d) ◊=Male affected
Intrauterine Device (IUD)? [AIPMT 2014] 5. Which one of the following conditions correctly
a) Multiload 375 b) LNG-20 describes the manner of determining the sex in the
c) Cervical cap d) Vault given example? [AIPMT PRE 2011]
2. Assisted reproductive technology, IVF involves the a) XO type of sex chromosomes determine male
transfer of [AIPMT 2014] sex in grasshopper
a) Ovum into the fallopian tube b) XO condition in humans as found in Turner
b) Zygote into the fallopian tube syndrome, determines female sex
c) Zygote into the uterus c) Homozygous sex chromosomes(XX) produce
d) Embryo with 16 blastomeres into the fallopian tube male in Drosophila
3. In context of amniocentesis, which of the following d) Homozygous sex chromosomes(ZZ) determine
statements is incorrect? [NEET-I, 2016] female sex in birds
a) It is usually done when a woman is between 14-16 6. A normal-visioned man whose father was blind,
weeks pregnant marries a woman whose father was also colour
b) It is used for prenatal sex determination blind. They have their first child as a daughter. What
c) It can be used for detection of Down syndrome are the chances that this child would be colour blind?
d) It can be used for detection of Cleft palate [AIPMT PRE 2012]
4. Which of the following approach does not give the a) 100% b) 0% c) 25% d) 50%
defined action of contraceptive? [NEET-I, 2016] 7. Which of the following statements is not true of two
a) Barrier methods Prevent fertilization genes that show 50 per cent recombination frequency
[AIPMT 2013]
b) Intra uterine Increases phagocytosis of sperms,
a) The genes may be on different chromosomes
devices suppresses sperm motility and
b) The genes are tightly linked
fertilizing capacity of sperms
c) The genes show independent assortment
c) Hormonal Prevent retard entry of sperms, d) If the genes are present on the same chromosome
contraceptives prevent ovulation and fertilization 8. A pleiotropic gene: [RE-AIPMT 2015]
d) Vasectomy Prevents spermatogenesis a) Is a gene evolved during Pliocene
b) Controls a trait only in combination with another gene
Chapter 4 - Principle of Inheritance and Variation c) Controls multiple traits in an individual
1. The fruit fly Drosophila melanogaster was found d) Is expressed only in primitive plants
to be very suitable for experimental verification of 9. A gene showing codominance has: [RE-AIPMT 2015]
chromosomal theory of inheritance by Morgan and a) Alleles tightly linked on the same chromosome
his colleagues because [AIPMT MAINS 2010] b) Alleles that are recessive to each other
a) It reproduces parthenogenetically c) Both alleles independently expressed in the
b) A single mating produces two young flies heterozygote
c) S maller female is easily recognizable from large male d) One allele dominant on the other
d) It completes the life cycle in about two weeks 10. Pick out the correct statements: [NEET-I, 2016]
2. Which one of the following cannot be explained on a) Haemophilia is a sex-linked recessive disease
the basis of Mendel’s Law of Dominance? b) Down’s syndrome is due to aneuploidy
[AIPMT PRE 2010] c) Phenylketonuria is an autosomal recessive gene disorder
a) The discrete unit controlling a particular character d) Sickle cell anaemia is an X-linked recessive gene
is called a factor disorder
263 MCQs for Higher Studies

a) A and D are correct b) B and D are correct c) Prove semiconservative nature of DNA replication
c) A,C and D are correct d) A ,B and C are correct d) Polymerises in the 5’ to 3’direction and explain 3’
to 5’ DNA replication
Chapter 5 - Molecular Genetics 8. During translation initiation in prokaryotes, a GTP
1. The
association of histone H1 with a nucleosome molecules is needed in [AIPMT 2003]
indicates (NEET 2017) a) association of 30s, mRNA with formyl met tRNA
a) Transcription is occurring b) association of 50s subunit of ribosome with
b) DNA replication is occurring initiation complex
c) The DNA is condensed into chromatin fibre c) formation of formyl met tRNA
d) The DNA double helix is exposed d) binding of 30s subunit of ribosome with mRNA.
2. Which of the following is not required for any of 9. Reverse transcriptase is
the techniques of DNA fingerprinting available at a) RNA dependent RNA polymerase
present? [NEET 2016] b) DNA dependent RNA polymerase
a) Zinc finger analysis c) DNA dependent DNA polymerase
b) R estriction enzymes d) R NA dependent DNA polymerase
c) D NA-DNA hybridization 10. Escherichia coli fully labeled with N14 medium. The
d) polymerase chain reaction two strands of DNA molecules of the first generation
3. Satellite DNA is important because it [AIPMT 2015] bacteria have
a) codes for proteins needs in cell cycle a) Different density and do not resemble parent DNA
b) shows high degree of polymorphism in population b) Different density but resemble parent DNA
and also the same degree of polymorphism in c) Same density and resemble parent DNA
an individual, which is heritable from parents to d) Same density but do not resemble parents DNA
children Chapter 6 - Evolution
c) Does not code for protein and is same in all
1. The wings of a bird and of an insect are
members of the population.
a) homologous structure and represent convergent
d) Codes for enzymes needed for DNA replication.
evolution
4. The diagram shows an important concept in the
b) homologous structure and represent divergent evolution
genetic implication of DNA. Fill in the blanks A to C.
c) analogous structure and represent convergent
(NEET 2013)
evolution
A B C
d) analogous structure and represent divergent evolution
DNA ----→mRNA ---------→protein -proposed by---
2. Which one of the following statement is correct?
a) A- trancscription, B- replication C-James Watson
a) stem cells are specialized cells
b) A- trancscription, B- trancscription, C-Erwin
a) there is no evidence of the existence of gills during
c) A- trancscription, B- tranlation, C-Francis Crick
embryogenesis of mammals
d) A- trancscription, B- extension, C-Rosalind
b) all plant and animal cells are totipotent
Frankin
c) Ontogeny repeats phylogeny
5. Select the two statements out of the four (I –IV) given
3. In Hardy-Weinberg equation, the frequency of
below about lac operon. [AIPMT 2010]
heterozygous individual is represented by
i. Glucose or galactose may bind with the repressor
a) P2 b) 2pq c) pq d) q2
and inactive it.
4. The correct order in Era is
ii. In the absence of lactose, the repressor binds
a) Palaeozoic---- Archaeozoic --- Coenozoic
with the operator region
b) Archaeozoic ---Palaeozoic------ Proterozoic
iii. The z-gene codes for permease.
c) Palaeozoic--- Mesozoic ----- Coenozoic
iv. This was elucidated by Francois Jacob and
d) Mesozoic ---- Archaeozoic---- Proterozoic
Jacques monod.
5. The most apparent change during the evolutionary
The correct statements are
history of Homo sapiens is raced in (AIPMT 2010)
a) i and ii b) i and iii c) ii and iv d) i and ii
a) loss of body hair
6. Which one of the following pairs of codons is
b) walking upright
correctly matched with their function or the single
c) shortening of jaws
for the particular amino acid? [AIPMT 2008]
d) remarkable increase in the brain size.
a) GUU, GCU – Alanine
6. The process by which organisms with different
b) UAG, UGA – Stop codon
evolutionary history evolve similar phenotypic
c) AUG, ACG - start/methionine
adaptations in response to a common environmental
d) UUA, UCA – Leucine
challenge is called (AIPMT 2013)
7. The Okazaki fragments in DNA chain growth
a) Natural selection
(AIPMT 2007)
b) Convergent evolution
a) Result in transcription
c) Non-random evolution
b) Polymerise in the 3’ to 5’ direction and forms
d) Adaptive radiation Human health and diseases
replication fork

Chapter 7 & 8 - Human Health and Diseases and Immunology a) Ancylostoma duodenale
1. Select the correct statement from the given below. b) Enterobius vermicularis
[AIPMT 2010] c) Trichimella spiralis
a) Barbiturates when given to criminals make them d) Ascaris lumbricoides
tell the truth 8. The active form of Entamoeba histolytica feeds upon:
b) Morphine is often given to persons who have [AIPMT 2015]
under gone surgery as a pain killer a) Erythrocytes, mucosa and submucosa of colon
c) Chewing tobacco lowers blood pressure and heart rate b) Mucosa and submucosa colon only
d) Cocaine is given to patients after surgery as it c) Food in intestine
stimulates recovery d) Blood only
2. Match the following [AIPMT 2008] 9. Which one of the following statements is correct with
Column I Column II respect to AIDS? [AIPMT PRE 2010]
a) The HIV can be transmitted through eating food
A) Amoebiasis i) Treptonema pallidum
together with an infected person.
B) Diphtheria ii) Use only sterilized food
b) Drug addicts are least susceptible to HIV infection.
and water
c) AIDS patients are being fully cured 100 percent
C) Cholera iii) DPT vaccine
with proper care and nutrition.
D) Syphilis iv) Use oral rehydration d) The causative HIV retrovirus enters helper
therapy
T-lymphocytes thus reducing their numbers.
A B C D
10. Select the correct statement with respect to diseases
a) i ii iii iv
and immunization [AIPMT MAINS 2011]
b) ii iv i iii
a) If due to some reason B and T lymphocytes are
c) ii I iii iv
damaged, the body will not produce antibodies
d) ii iii iv i
against a pathogen
3. If a person shows production of interferons in his
b) Injection of dead/inactivated pathogens caused
body, the chances are that he has got an infection of
passive immunity
a) Typhoid b) Measles
c) Certain protozoans have been used in mass
c) Tetanus d) Malaria
production of hepatitis B vaccine.
4. A person suffering from a disease caused by
d) Injection of snake antivenom against snake bite is
Plasmodium, experiences recurring chill and fever at
an example of active immunization.
the time when? [AIPMT MAINS 2010]
11. Which one of the following statements is correct with
a) The sporozoites released from RBC’s are being
respect to immunity? [AIPMT MAINS 2012]
rapidly killed and broken down inside spleen
a) The antibodies against small pox pathogen are
b) The trophozoites reach maximum growth and give
produced by T – lymphocytes
out certain toxins.
b) Antibodies are protein molecules each of which
c) The parasite after its rapid multiplication inside
has four light chains.
RBC’s reptures them, releasing the stage to enter
c) Rejection of a kidney graft is the function of B –
fresh RBC’s
lymphocytes.
d) The microgametocytes and megagametocytes are
d) Preformed antibodies need to be injected to
being destroyed by the WBC’s
treat the bite by a viper snake.
5. Where will you look for the sporozoites of the
12. Which one of the following is not a property of
material parasite? [AIPMT PRE 2011]
cancerous cells whereas the remaining three are?
a) Red blood corpuscles of humans suffering from malaria.
[AIPMT PRE 2012]
b) Spleen of infected humans
a) They compete with normal cells for vital nutrients
c) Salivary glands of freshy moulted female anopheles
b) They do not remain confined in the area of formation
mosquito.
c) They divide in an uncontrolled manner
d) Saliva of infected female anopheles mosquito.
d) They show contact inhibition
6. Which one of the following organisms is scientifically
13. At which stager HIV infection does one usually show
and correctly named, correctly printed according
symptoms of AIDS? [AIPMT 2014]
to the International Rules of Nomenclature and
a) Within 15 days of sexual contact with an infected
correctly described? [AIPMT MAINS 2012]
person
a) Plasmodium falciparum – a protozoan causing
b) When the infected retro virus enters host cells
the most serious type of malaria.
c) When HIV damages large number of helper T-
b) Felis tigris – The Indian tiger is well protected in
Lymphocytes
Gir forests.
d) When the viral DNA is produced by reverse
c) E. Coli – The full name is Entamoeba coli, a
transcriptase
commonly occurring bacterium in human intestine.
14. Match each disease with its correct type of vaccine
7. Which of the following endoparasites of humans
[AIPMT 2015]
does show vivipaity? [AIPMT 2015]

a)Tuberculosis i) harmless virus 5. During sewage treatment, biogas are produced which
includes [AIPMT 2015]
b)Whooping cough ii) inactivated toxin a) Methane, hydrogen sulphide, carbon dioxide
c)Diphtheria iii) killed bacteria b) Methane, oxygen, hydrogen sulphide
d)Polio iv) harmless bacteria c) Hydrogen sulphide, methane, sulphur dioxide
a) b) c) d) d) Hydrogen sulphide, nitrogen, methane
a) (ii) (i) (iii) (iv) 6. What gases are produced in anaerobic sludge
b) (iii) (ii) (iv) (i) digesters? [AIPMT 2014]
c) (iv) (iii) (ii) (i) a) Methane and CO2 only
d) (i) (ii) (iv) (iii) b) Methane, hydrogen sulphide and CO2
15. Which of the following is correct regarding AIDS c) Methane, hydrogen sulphide and O2
causative agent HIV? [NEET-II, 2016] d) Hydrogen sulphide and CO2
a) HIV is enveloped virus that contains two e) Consumption of organic matter in the water is
identical molecules of single-stranded RNA and higher by the microbes
two molecules of reverse transcriptase 7. Match the following list of microbes and their
b) HIV is unenveloped retrovirus importance: [RE-AIPMT 2015]
c) HIV does not escape but attacks the acquired a)Saccharomyces (i)Production of
immune response cerevisiae immunosuppressive agents
d HIV is enveloped virus containing one molecule of b)Monasus purpureus (ii)Ripening of Swiss cheese
single – stranded RNA and one molecule of reverse
c)Trichoderma (iii)Commercial
transcriptase
polysporum production of ethanol
Chapter 9 - Microbes in Human Welfare d)Propionibacterium (iv)Production of blood-
shermanii cholesterol lowering agents.
1. When domestic sewage mixes with river water
e) (iv) (iii) (ii) (i)
[AIPMT MAINS 2010]
f) (iv) (ii) (i) (iii)
a) Small animals like rat will die after drinking river water
g) (iii) (i) (iv) (ii)
b) The increased microbial activity releases
h) (iii) (iv) (i) (ii)
micronutrients such as iron.
8. Which of the following is wrongly matched in the
c) The increased microbial activity uses up
given table? [NEET – I, 2016]
dissolved oxygen.
d) The river water is still suitable for drinking as Microbe Product Application
impurities are only about 0.1 per cent (a)Trichoderma Cyclosporin A Immunosuppressive
2. Select the correct statement from the following. polysporum drug
[AIPMT PRE 2010] (b)Monascus Statins Lowering of blood
a) Biogas is produced by the activity of aerobic purpureus cholesterol
bacteria on animal waste. (c) Streptococcus Sterptockinase Removal of clot
b) Methanobacterium is an aerobic bacterium found from blood vessel
in rumen of cattle. (d)Clostridium Lipase Removal of oil
c) Biogas, commonly called gober gas, is pure methane. butylicum stains
d) Activated sludge-sediment in settlement tank 9. Match Column – I with Column – II and select the
of sewage treatment plant is a right source of correct options using the codes given below:
aerobic bacteria. [NEET – II, 2016]
3. Read the following four statements (A to D): Column I Column II
[AIPMT MAINS 2012] A.Citric acid 1. Trichoderma
a) Colostrums is recommended for the new born B.Cyclosporin A 2. Clostridium
because it is rich in antigen. C.Statins 3. Aspergillus
b) Chikungunya is caused by a gram negative
D.Butyric acid 4. Monoscus
bacterium.
a) A:3, B:1, C:4, D:2
c) Tissue culture has proved useful in obtaining
virus-free plants. b) A:1, B:4, C:2, D:3
d) Beer is manufactured by distillation of fermented c) A:3, B:4, C:1, D:2
grape juice d) A:3, B:1, C:2, D:4
How many of the above statements are wrong?
a) Three b) Four c) One d) Two Chapter 10 - Biotechnology and Its Application
4. Which of the following are likely to be present in 1. Genetic engineering has been successfully used for
deep sea water? [AIPMT 2013] producing [AIPMT RE 2010]
a) Archaebacteria b) Eubacteria a) Transgenic mice for testing safety of polio
c) Blue – green algae d) Saprophytic fungi vaccine before used in humans.

b) Transgenic models for studying new treatments A) A bacterium B) Plasmid
for certain cardiac diseases. C) Plasmodium D) Bacteriophage
c) Transgenic cow Rosie which produces high fat a) (A), (B) and (D) only b) (A) only
milk for making ghee. c) (A) and (C) only d) (B) and (D) only
d) Animals like bulls for farm work as they have 8. Which one of the following palindromic base
super power. sequences in DNA can be easily cut at about the
2. Some of the characteristics of Bt cotton are middle by some particular restriction enzyme?
[AIPMT RE 2010] [AIPMT PRE 2010]
a) Long fibre and resistance to aphids a) 5’ – CGTTCG – 3’ 3’ –ATGGTA -5’
b) Medium yield, long fibre and resistance to beetle pests. b) 5’-GATATG -3’ 3’ CTACTA -5’
c) High yields and production of toxic protein c) 5’ –GAATTC – 3’ 3’ – CTTAAG-5’
crystals which kill dipteran pests. d) 5’ –CACGTA -3’ 3’ –CTCAGT -5’
d) High yield and resistance to bollworms 9. Restriction endonucleases are enzymes which
3. Bacillus thuringiensis forms protein crystals which [AIPMT PRE 2010]
contain insecticidal protein. This protein a) Make cuts at specific positions within the DNA
[AIPMT MAINS 2010] molecule.
a) Binds with epithelia cells of midgut of the insect b) Recognize a specific nucleotide sequence for
pest ultimately killing it. binding of DNA ligase.
b) Is coded by several genes including the gene cry. c) Restrict the action of the enzyme DNA polymerase.
c) Is activated by acid pH of the foregut of the insect d) Remove nucleotides from the ends of the DNA
pest. molecule.
d) Does not kill the carrier bacterium which is itself 10. Stirred – tank bioreactors have been designed for
resistant to this toxin. [AIPMT PRE 2010]
4. Read the following four statements (A to D) about a) Addition of preservatives of the product
certain mistakes in two of them. [AIPMT MAINS 2011] b) Purification of the product
a) The first transgenic buffalo, Rosie produced milk c) Ensuring anaerobic conditions in the culture vessel
which was human alpha – lactalbumin enriched. d) Availability of oxygen throughout the process
b) Restriction enzymes are used in isolation of DNA 11. There is a retriction endonuclease called EcoRI. What
from other macromolecules. does ‘co’ part in it stand for? [AIPMT PRE 2011]
c) Downstream processing is one of the steps of a) Coelom b) Coenzyme
rDNA technology c) Coli d) Colon
d) Disarmed pathogen vectors are also used in 12. Which one is true state regarding DNA polymerase
transfer of rDNA into the host. used in PCR? [AIPMT PRE 2012]
Which of the two statements have mistakes? a) It is used to ligate introduced DNA in recipient cells.
a) B and C b) C and D b) It serves as selectable marker
c) A and C d) A and B c) It is isolated from a virus.
5. The colonies of recombinant bacteria appear white d) It remains active at high temperature.
in contrast to blue colonies of non-recombinant 13. For transformation, micro-particles coated with
bacteria because of [AIPMT 2013] DNA to be bombarded with gene gun are made up of
a) Non-recombinant bacteria containing β-galactosidase. [AIPMT PRE 2012]
b) Insertional inactivation of α-galactosidase in non- a) Silver or Platinum b) Platinum or Zinc
recombinant bacteria. c) Silicon or Platinum d) Gold or Tungsten
c) Insertional inactivation of α-galactosidase in
recombinant bacteria. Chapter 11 - Organisms and Population
d) Inactivation of glycosidase enzyme in recombinant
bacteria 1. Which one of the following is most appropriately
6. Which body of the Government of India regulates defined? [AIPMT MAINS 2010]
GM research and safety of introducing GM organism a) Host is an organism which provides food to
for public services? [AIPMT 2015] another organism.
a) Bio-safety committee b) Amensalism is a relationship in which one species
b) Indian council of agricultural research is benefited whereas the other is unaffected.
c) Genetic engineering approval committee c) Predator is an organism that catches and kills
d) Research committee on Genetic manipulation other organism for food.
7. In genetic engineering, a DNS segment (gene) of d) Parasite is an organism which always lives inside
interest is transferred to the host cell through a the body of other organism and may kill it.
vector. Consider the following four agents (A to D) 2. Study the four statements (1 to 4) given below and select
in this regard and select correct option about which the two correct ones out of them. [AIPMT PRE 2010]
one or more of these can be used as vector/vectors. a) A lion eating a deer and a sparrow feeding on grain
[AIPMT MAIN 2010] are ecologically similar in being consumers.

b) Predator star fish Pisaster helps in maintaining 9. When does the growth rate of a population following
species diversity of some invertebrates. the logistic model equal zero? The logistic model is
c) Predators ultimately lead to the extinction of prey given as dN/dt=rN(1-N/K): [NEET – I, 2016]
species. a) When N/K is exactly one
d) Production of chemicals such as nicotine, b) When N nears the carrying capacity of the habitat
strychnine by the plants is metabolic disorders. c) When N/K equals zero
The two correct statements are d) When dearth rate is greater than birth rate
a) (B) and (C) b) (C) and (D)
c) (A) and (D) d) (A) and (B) Chapter 12 - biodiversity and conservation
3. Which two of the following changes ( 1 to 4) usually 1. Select the correct statement about biodiversity
tend to occur in the plain dwellers when they move to [AIPMT MAINS 2012]
high altitudes(3500 m or more)? [AIPMT PRE 2010] a) Large scale planting of Bt cotton has no adverse
A) Increase in red blood cell size effect on biodiversity.
B) Increase in red blood cell production b) Western Ghats have a very high degree of species
C) Increased breathing rate richness and endemism
D) Increase in thrombocyte count c) Conservation of biodiversity is just a fad pursued
a) (B) and (C) b) (C) and (D) by the developed countries.
c) (A) and (D) d) (A) and (B) d) The desert areas of Rajasthan and Gujarat have a
4. Consider the following four conditions (A-D) and very high level of desert animal species as well as
select the correct pair of them as adaptation to numerous rare animals.
environment in desert lizards. [AIPMT PRE 2011] 2. Sacred groves are specially useful in[AIPMT MAINS 2012]
The conditions: a) Preventing soil erosion
A) Burrowing in soil to escape high temperature. b) Year-round flow of water in rivers
B) Losing heat rapidly from the body during high c) Conserving rare and threatened species
temperature d) Generating environmental awareness
C) Bask in sun when temperature is low
D) Insulating body due to thick fatty dermis.
3. The highest number of species in the world is
a) (A) and (C) b) (B) and (D) represented by [AIPMT PRE 2012]
c) (A) and (B) d) (C) and (D) a) Fungi b) Mosses c) Algae d) Lichens
5. People who have migrated from the planes to an area 4. Which of the following is not used for ex situ plant
adjoining Rohtang Pass about six months back conservation? [AIPMT PRE 2012]
[AIPMT PRE 2012] a) Field gene banks b) Seed banks
a)Have more RBC’s and their haemoglobin has a c) Shifting cultivation d) Botanical gardens
lower binding affinity to O2. 5. In which of the following both pairs have correct
b) Are not physically fit to play games like football
combination? [AIPMT 2015]
c) Suffer from altitude sickness with symptoms like
a) In situ conservation: National Park
nausea, fatigue, etc.
Ex situ conservation: Botanical Garden
d) Have the usual RBC count but then haemoglobin
b) In situ conservation: Cryopreservation
has very high binding affinity to O2.
6. A biologist studies the population of eats in a barn.
Ex situ conservation: Wildlife Sanctuary
He found that the average natality was 250, average c) In situ conservation: Seed Bank
mortality is 240, immigration is 20 and emigration to be Ex situ conservation: National park
30. The net increase in population is [AIPMT 2013] d) In situ conservation: Tissue culture
a) 10 b) 15 c) 05 d) Zero Ex situ conservation: Sacred groves
7. An association of individuals of different species 6. Cryopreservation of gametes of threatened species
living in the same habitat and having functional in viable and fertile condition can be referred to
interaction is: [RE-AIMPT 2015] as [AIPMT 2015]
a) Biotic community b) Ecosystem a) In situ conservation of biodiversity
c) Population d) Ecological niche b) Advanced ex situ conservation of biodiversity
8. Gause’s principle of competitive exclusion states c) In situ conservation by sacred groves
that: [NEET – I, 2016] d) In situ cryo-conservation of biodiversity
a) More abundant species will exclude the less
abundant species through competition 7. The species confined to a particular region and not
b) Competition for the same resources excludes found elsewhere is termed as [RE-AIPMT 2015]
species having different food preferences a) Alien b) Endemic c) Rare d) Keystone
c) No two species can occupy the same niche 8. Which of the following National Parks is home to
indefinitely for the same limiting resources the famous musk deer or hangal? [NEET-II, 2016]
d) Larger organisms exclude smaller ones through a) Bandhavgarh National Park, Madhya Pradesh
competition b) Eaglenest Wildlife Sanctuary, Arunachal Pradesh

c) Dachigam National Park, Jammu & Kashmir 7. A scrubber in the exhaust of a chemical industrial
d) Keibul Lamjao National Park, Manipur plant removes
a) Gases like sulphur dioxide.
Chapter 13 - Environmental Issues b) Particulate matter of the size 5 micrometer or
1. DB is a standard abbreviation used for the above.
quantitative expression of [AIPMT PRE -2010] c) Gases like ozone and methane
d) Particulate matter of the size 2.5 micrometer or less
a)The density of bacteria in a medium
b) A particular pollutant 8. Rachel Carson’s famous book ‘Silent Spring’ is related
c) The dominant bacillus in a culture to [AIPMT-2015]
d) A certain pesticide a) Pesticide pollution
b) Noise Pollution
2. Which one of the following expanded forms of the
c) Population explosion
following acronyms is correct? [AIPMT PRE-2011] d) Ecosystem management
a)UNEP United Nations Environmental Policy 9. Which of the following is not one of the primary health
b)EPA Environmental Pollution Agency risks associated with greater UV radiation through
c)IUCN International Union for Conservation the atmosphere due to depletion of stratospheric
of Nature and Natural Resources ozone? [AIPMT-2015]
a) Increased skin cancer
d)IPCC International Penal for climate Change b) Reduced immune system
3. In an area where DDT had been used extensively c) Damage to eyes
the population of birds declined significantly d) Increased liver cancer
because 10. Increase in the concentration of the toxicant at
[AIPMT PRE-2012] successive trophic levels is known as [RE AIPMT-2015]
a) Birds stopped laying eggs a) Biodeterioration
b) Earthworms in the area got eradicated. b) Biotransformation
c) Cobras were feeding exclusively on birds. c) Biogeochemical cycling
d) Many of the birds eggs, laid, did not hatch. d) Biomagnifications
4. Which one of the following is a wrong statement? 11. A river with an inflow of domestic sewage rich in
AIPMT PRE-2012] organic waste may result in: [NEET-I, 2016]
a) Most of the forests have been lost in tropical areas. a) Drying of the river very soon due to algal bloom
b) Ozone in upper part of atmosphere is harmful b) Increased population of aquatic food web organisms
to animals. c) An increased production of fish due to
c) Greenhouse effect is natural phenomenon biodegradable nutrients
d)
Eutrophication is a natural phenomenon in d) Death of fish due to lack of oxygen
freshwater bodies. 12. A lake which is rich in organic waste may result in
5. Measuring Biochemical Oxygen Demand (BOD) is a [NEET-II, 2016]
method used for [AIPMT PRE-2012] a) Drying of the lake due to algal bloom
a) Estimating the amount of organic matter in b) Increased population of fish due to lots of nutrients
sewage water. c) Mortality of fish due to lack of oxygen
b) Working out the efficiency of oil driven automobile d) Increases population of aquatic organisms due to
engines. minerals
c) Measuring the activity of saccharomyces cerevisiae 13. The highest DDT concentration in aquatic food
in producing curd on a commercial scales chain shall occur in [NEET-II, 2016]
d) Working out the efficiency of RBCs about their a) Seagull b) Crab
capacity to carry oxygen c) Cell d) Phytoplankton
6. Kyoto Protocol was endorsed at [AIPMT -2013]
a) CoP-3 b) CoP-5
c) CoP-6 d) CoP-4

Zoology – Class XII
List of Authors and Reviewers
Advisory Committee Members Subject Expert and Coordinator Domain Experts
and Chair person Dr. S. Shameem Dr. P. Sarala
Associate Professor, Department of Zoology,
Dr. Sultan Ahmed Ismail Deputy Director
State Council of Educational Research and Training, Quaid-e-Millath College for Women, Chennai.
Scientist Chennai.
Ecoscience Research Foundation, Chennai. Dr. Sumit Rose
Dr. P.K. Kaleena Coordinators Associate Professor, Department of Zoology,
Presidency College, Chennai.
Associate Professor, Dr. V.T. Shanthi Dr. B. Meena
Department of Zoology, Senior Lecturer,
Presidency College, Chennai. District Institute of Education and Tranning, Tirur.
Presidency College, Chennai.
Mrs. B. Selvi Dr. E. Malathi
Content Writers Assistant Professor,
SCERT, Chennai.
Queen Mary’s College, Chennai.
Mr. M. Mayilsamy
Senior Lecturer, Prospects of Zoology Reviewers
District Institute of Education and Tranning,
Krishnagiri.
Dr. T. Sankara Saravanan Dr. Dinesh Kumar
Deputy Director Reader, NCERT, New Delhi.
Dr. P. Sekar Tamil Nadu Textbook and Educational
Assistant Professor Services Corporation, Chennai. Dr.Vareishang Tangu
Govt. Institute of Advanced Assistant Professor in Zoology
Study in Education (Autonomous), Translators RIE NCERT, Mysore.
Saidapet, Chennai.
Dr. S. Muthazhagu Dr. Chitralekha Ramachandran
Dr. S. Ganesapandian Associate Professor (Rtd.) Professor (Rtd.),
Head Master A.A Govt. Arts College, Cheyyar. Stella Mary's College, Chennai.
Government Higher Secondary School,
Kadukkai Valasai, Ramanathapuram Dist. Mr. M. Sivaguru Ms. Hemamalini Akundy
Assistant HOD., Salwan Public School,
Dr. J. Savarimuthu Michael Head Master
Sri Ramakrishna Vidyasala Higher Secondary School, Gurgaon.
P.G. Assistant in Zoology Chidambaram, Cuddalore.
Carmel Higher Secondary School, Content Readers
Nagercoil, Kanyakumari Dist. Mr. S. Maheswaran
Dr. Mazher Sulthana
Mr. Alen Godfrey R. Jose Head Master
Govt. Boys Higher Secondary School, Associate Professor in Zoology (Rtd.),
P.G. Assistant in Zoology Presidency College, Chennai.
Sayal Gudi, Ramanathapuram Dist.
M.C.C Mat.Higher Secondary School,
Chetpet, Chennai. Mr. V. Rajendran Dr. R. Saravanan
Assistant Professor in Zoology
Mr. L. Sivan pillai P.G. Assistant in Zoology
Government Higher Secondary School,
Dr. Ambedkar Govt. Arts College,
P.G. Assistant in Zoology Vyasarpadi, Chennai.
Aragalur, Salem Dist.
Bharath Senior Secondary School,
Mr. S. Natarajan Dr. N. Sarojini
Adyar, Chennai. Assistant Professor in Zoology
P.G. Assistant in Zoology,
Mrs. P. Sophia Selvakumari Model School, Kolli Hills, Namakkal Dist.
Bharathi Women’s College, Chennai.
P.G. Assistant in Zoology Mr. K. Senthil Vel Mr. S. Munusamy
Bentinck Higher Secondary School for Girls, P.G.Assistant in Zoology Head Master. (Rtd.),
Vepery, Chennai. A.S. Govt. Higher Secondary School, GHSS., Velachery, Chennai.
Mr. K.P. Muthuswamy Sholavandan, Madurai Dist.
P.G. Assistant in Zoology
C.S.M.A. Higher Secondary School,
Mr. S.P. Sabarinathan Art and Design Team
P.G.Assistant in Zoology
M.M. Kovilur, Dindigul Dist. Govt. Higher Secondary School, Illustrators
Mr. V. Elangovan Sengurichi, Dindugul Dist. Gopu Rasuvel
P.G. Assistant in Zoology Mr. G. Kirubananthan N. Prabhakar
Sir M. Ct. M. Higher Secondary School, P.G. Assistant in Zoology Murugesan Veeraiyan
Pursawalkam, Chennai. Govt. Higher Secondary School, Santhanakrishnan
Mr. M. William Vijayraj Anakaputhur, Kanchipuram District.
Vimal Shanmugam
P.G. Assistant in Zoology
Dr. P. S. S. Mpl. Higher Secondary School,
ICT Coordinators Layout In-House
Kanchipuram.
Rajesh Thangappan
Mr. N. Senthil Kumar R.Kamesh C. Prasanth
SGT., Govt. Primary School,
PG Assistant in Zoology
Govt Boys Higher Secondary School,
Pinjanur, Cuddalore Dist. Petchimuthu
Thalaivasal, Salem District. Santhiyagu Stephen
Mrs. Reena Alfred QR Management Team P. Prasanth
Principal R. Mathan Raj
Alpha Higher Secondary School,
J.F. Paul Edwin Roy, B.T, Pakkirisamy Annadurai
PUMS -Rakkipatty, Salem.
CIT, Saidapet, Chennai.
M. Murugesan, B.T, Wrapper Design
Mr. R. Perumal Pums. Pethavelankottagam, Kathir Arumugam
Principal Muttupettai, Thiruvarur.
Velammal Vidhyashram, In-House QC
Surapet, Chennai. V. Padmavathi, B.T, Manohar Radhakrishnan
GHS, Vetriyur,
Ariyalur. Arun Kamaraj P.
Co-ordination
Ramesh Munisamy
This book has been printed on 80 G.S.M. Elegant Maplitho paper.
Printed by offset at:
270
Authors pages.indd 270 25-02-2019 19:48:46

Notes
271

Notes
272

Xii STD - Zoology English Medium Combined 26.02.2019-1 PDF

Uploaded by

Copyright:

Available Formats

Xii STD - Zoology English Medium Combined 26.02.2019-1 PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Xii STD - Zoology English Medium Combined 26.02.2019-1 PDF

Uploaded by

Copyright:

Available Formats

GOVERNMENT OF TAMIL NADU

HIGHER SECONDARY SECOND YEAR

A publication under Free Textbook Programme of Government of Tamil Nadu

Department of School Education

front pages 1.indd 1 25-02-2019 18:15:02

First Edition - 2019

NOT FOR SALE

State Council of Educational Research

Printing & Publishing

Tamil NaduTextbook and Educational

front pages 1.indd 2 25-02-2019 18:15:02

Let's use the QR code in the text books ! How ?

E-book Assessment DIGI links

front pages 1.indd 3 25-02-2019 18:15:02

Chapter Outline Presents a complete overview of the chapter

Goals to transform the classroom processes into

Amazing facts, Rhetorical questions to lead students

Directions are provided to students to conduct activities

Infographics Visual representation of the lesson to enrich learning .

HOW TO USE Superfluous information about a personality or day to

To motivate the students to further explore the content

ICT To enhance digital Science skills among students

Conceptual diagram that depicts relationships between

Glossary Explanation of scientific terms

Evaluation Assess students to pause, think and check their understanding

References List of related books for further details of the topic

Web links List of digital resources

front pages 1.indd 5 25-02-2019 18:15:02

Scholarship for Biology Students

front pages 1.indd 6 25-02-2019 18:15:02

Pharmacy Colleges: • Vellore Govt. Medical College, Vellore

front pages 1.indd 7 25-02-2019 18:15:03

List of Tamilnadu Agricultural Salim Ali Centre for Ornithology

front pages 1.indd 8 25-02-2019 18:15:03

Paramecium are capable of both sexual and

1.1. Modes of reproduction

TN_GOVT_XII_Zoology_chapter1.indd 1 25-02-2019 18:17:54

Simple irregular Binary Fission in Amoeba Contractile

Micronucleus Oral groove

Macronucleus Micronucleus New

TN_GOVT_XII_Zoology_chapter1.indd 2 25-02-2019 18:17:55

Chromatids Nucleolar Nuclear

Fig. 1.3 Longitudinal binary fission in Euglena

Fig. 1.4 Multiple Fission in Plasmodium

TN_GOVT_XII_Zoology_chapter1.indd 3 25-02-2019 18:17:55

Fig. 1.5 Multiple fission in encysted Amoeba

TN_GOVT_XII_Zoology_chapter1.indd 4 25-02-2019 18:17:56

Nucleus Spore case

Fig. 1.7 Sporulation in Amoeba

Fig. 1.9 Budding in Hydra

TN_GOVT_XII_Zoology_chapter1.indd 5 25-02-2019 18:17:57

developed embryos from the primary host

Fig. 1.11 Apolysis in Taenia solium

Regen­e ration is regrowth in the injured

TN_GOVT_XII_Zoology_chapter1.indd 6 25-02-2019 18:17:58

TN_GOVT_XII_Zoology_chapter1.indd 7 25-02-2019 18:17:58

Natural parthenogenesis may be of

TN_GOVT_XII_Zoology_chapter1.indd 8 25-02-2019 18:17:58

TN_GOVT_XII_Zoology_chapter1.indd 9 25-02-2019 18:17:58

Regene ration is regrowth in the injured

6SHUPDWRJRQLD Q )RHWDO Q 2RJRQLD

structure is largely 3ULPDU\ Q 3ULPDU\RRF\WH