Toda et al.

Journal of Genetic Engineering and Biotechnology (2020) 18:1

https://doi.org/10.1186/s43141-019-0015-2
Journal of Genetic Engineering
and Biotechnology

SHORT COMMUNICATIONS Open Access

Development of specific primers for

Fusarium oxysporum causing damping off
of Lilium formolongi
Takeshi Toda1* , Shun Hanesaka1, Kuniaki Shishido2, Shin-ichi Fuji1 and Hiromitsu Furuya1

Abstract
Primers specific for the hypothetical forma specialis of Fusarium oxysporum were designed to amplify DNA from this
pathogenic fungus that infects plants including lilies. The F. oxysporum sequence between the transposal elements
han and hop was used for primer design. Three primer pairs designed from this region were confirmed as specific
for 24 isolates of F. oxysporum pathogenic to lilies, except for one pathogenic isolates as extraordinary. No amplification
was observed from F. oxysporum non-pathogenic to lily, from 12 forma specialis, and 14 fungi and oomycetes
concerned with Liliaceae plants. We propose that specific primers designed from this region will be useful to
detect isolates of F. oxysporum that are pathogenic to lilies.
Keywords: Lilium formolongi, Transposable element, Forma specialis specific

Introduction ribosomal DNA sequences and housekeeping genes

Lilium formolongi, known as “Shin-Teppo Yuri” in among forma specialis are very similar [2, 3]. Najafiniya
Japanese, is a lily generated from a cross between L. and Sharma [4] reported that random amplified poly-
longiflorum and L. formosanum, and has been grown on morphic DNA markers were available for designing the
an open-field system in Japan. The flowers of this plant specific primer for F. oxysporum f. sp. cucumerinum.
are harvested within 1 year after seeding and replanted Also, several reports suggested that the region within or
every 2 years. Recently, stunted stem growth has been next to transposable elements are useful to design forma
frequently observed at the second cropping season in specialis- or race-specific primers; impla in F. oxysporum
northern Japan. Stunted lilies have yellow or brownish f. sp. dianthi [5], and the region between han and skippy
leaves and yellow or brown roots. Fusarium-like fungi in F. oxysporum f. sp. fragariae [6]. In this study, the
have been isolated from the roots of lily plants. These primer pairs were designed from the regions between
isolates were identified as Fusarium oxysporum based on transposable elements for the specific detection of F.
their morphology, and pathogenicity was confirmed by oxysporum pathogenic to lilies.
an inoculation of the seedlings [1].
Fusarium oxysporum, including non-pathogenic var-
Materials and methods
ieties, exists ubiquitously in soil. Therefore, a prompt
Isolates of F. oxysporum were obtained from the
detection technique for pathogenic F. oxysporum is de-
roots of Lilium formolongi grown at Fukushima Pre-
sirable. The detection of pathogenic fungi using poly-
fecture in Japan. Among seven isolates, pathogenicity
merase chain reaction (PCR) is a popular technique for
on lily plants was confirmed for four isolates by
rapid diagnosis. However, it is difficult to design specific
Hanesaka et al. [1], named as lily isolates (Table 1).
primers for F. oxysporum forma specialis because their
Tester isolates of F. oxysporum described below were
used to confirm the specificity of designed primers.
* Correspondence: [email protected] An isolate of F. oxysporum f. sp. lilii (CBS 130322)
1
Department of Bioproduction Science, Faculty of Bioresource Science, Akita was provided by the Westerdijk Fungal Biodiversity
Prefectural University, 241-438 Kaidobata-Nishi, Shimoshinjo-Nakano, Akita
010-0195, Japan Institute (Utrecht, the Netherlands). One isolate of
Full list of author information is available at the end of the article F. oxysporum f. sp. cucumerinum isolate and two
© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made.
Toda et al. Journal of Genetic Engineering and Biotechnology (2020) 18:1 Page 2 of 6

Table 1 Isolates of Fusarium oxysporum obtained from lily used in this study and amplifications by different primer pairs
Isolate Pathogenicity Host Origin Designed primer pairs
no. to lily plants
F1/R12) F1/R2 F2/R1 F2/R2 F3/R1 F3/R2
A1–4 + 1) Lily Fukushima, Japan + 3) + + ± + +
A2–4 + Lily Fukushima, Japan + + + ± + +
A2–5 + Lily Fukushima, Japan + + + ± + +
D2–1 + Lily Fukushima, Japan + + + ± + +
A2–3 – Lily Fukushima, Japan – – – – – –
D1–1 – Lily Fukushima, Japan – – – – – –
D2–4 – Lily Fukushima, Japan – – – – – –
Ff-3 + Lily Fukushima, Japan ± NT ± NT + NT
Ff-9 + Lily Fukushima, Japan + NT + NT + NT
Ff-10 + Lily Fukushima, Japan + NT + NT + NT
Ff-13 + Lily Fukushima, Japan + NT + NT + NT
Ff-18 + Lily Fukushima, Japan ± NT ± NT + NT
Ff-24 + Lily Fukushima, Japan + NT + NT + NT
Ff-31 + Lily Fukushima, Japan ± NT ± NT + NT
Ff-33 + Lily Fukushima, Japan ± NT ± NT + NT
Fc-58 + Lily Fukushima, Japan + NT ± NT + NT
Fc-59 + Lily Fukushima, Japan + NT ± NT + NT
Fc-61 + Lily Fukushima, Japan + NT ± NT + NT
Fc-62 + Lily Fukushima, Japan + NT ± NT + NT
Fc-65 + Lily Fukushima, Japan + NT + NT + NT
Fc-66 + Lily Fukushima, Japan ± NT ± NT + NT
Fc-69 + Lily Fukushima, Japan + NT ± NT + NT
Fc-70 + Lily Fukushima, Japan + NT ± NT + NT
Fc-72 + Lily Fukushima, Japan + NT ± NT + NT
Fc-74 + Lily Fukushima, Japan + NT ± NT + NT
Fc-77 + Lily Fukushima, Japan + NT + NT + NT
Fc-78 + Lily Fukushima, Japan + NT + NT + NT
Ff-4 – Lily Fukushima, Japan – NT – NT – NT
Ff-4 – Lily Fukushima, Japan – NT – NT – NT
Ff-3 – Lily Fukushima, Japan – NT – NT – NT
Ff-7 – Lily Fukushima, Japan – NT – NT – NT
Ff-8 – Lily Fukushima, Japan – NT – NT – NT
Ff-11 – Lily Fukushima, Japan – NT – NT – NT
Ff-12 – Lily Fukushima, Japan – NT – NT – NT
Ff-16 + Lily Fukushima, Japan – NT – NT – NT
1)
Pathogenicity to lilies was shown by Hanesaka et al. (2014); +: virulent to lily; −: non-virulent; NT not tested
2)
Pairs of Lhs-F1, -F2, -F3, -R1, and -R2 are listed
3)
+ amplified products were observed, ± faint products were observed, − no amplification was observed

isolates of F. oxysporum f. sp. fragariae were ob- Project of the National Agriculture and Food Re-
tained in Japan. F. oxysporum f. sp. lycopersici race search Organization in Tsukuba, Japan (Table 2).
1, f. sp. lycopersici race 2, f. sp. melonis, f. sp. tuli- Additionally, 14 isolates of soilborne fungi and
pae, f. sp. gladioli, f. sp. asparagi, f. sp. radicis-lyco- oomycetes, reported as pathogenic to lily or possibly
persici, f. sp. raphani, f. sp. spinaciae, f. sp. dianthi, concerned with Liliaceae plants, were used for con-
and f. sp. rapae were provided by the Genebank firming the primers’ specificity (Tables 1 and 2).
Toda et al. Journal of Genetic Engineering and Biotechnology (2020) 18:1 Page 3 of 6

Table 2 Isolates of Fusarium oxysporum, soilborne fungi, and oomycetes used in this study and amplifications by different primer
pairs
Species of isolates Host plants Origin Others Designed primer pairs
F1/R12) F1/R2 F2/R1 F2/R2 F3/R1 F3/R2
F. oxysporum f.sp. lilii Lily Netherlands CBS 130322 1)
+ 3) + + – + +
F. oxysporum f.sp. gladioli Gladiolus Japan MAFF305610 – – – – – –
F. oxysporum f.sp. tulipae Tulip Japan MAFF235105 – – – – – –
F. oxysporum f.sp. cucumerinum Cucumber Aomori, Japan – – – – ― – –
F. oxysporum f.sp. lycopersici r.1 Tomato Japan MAFF103037 – – – – – –
F. oxysporum f. sp. lycopersici r.2 Tomato Japan MAFF238899 – – – – – –
F. oxysporum f.sp. melonis Melon Japan MAFF239211 – – – – – –
F. oxysporum f.sp. melonis Melon Japan MAFF305544 – – – – – –
F. oxysporum f.sp. fragariae Strawberry Akita, Japan No. 1 – – – – – –
F. oxysporum f.sp. fragariae Strawberry Akita, Japan No. 2 – – – – – –
Fusarium oxysporum f. sp. radicis-lycopersici Tomato Japan MAFF103044 – – – – – –
Fusarium oxysporum f. sp. raphani Radish Japan MAFF103057 – – – – – –
Fusarium oxysporum f. sp. spinaciae Spinach Japan MAFF103059 – – – – – –
Fusarium oxysporum f. sp. dianthi Carnation Japan MAFF103072 – – – – – –
Fusarium oxysporum f. sp. rapae Turnip leaf Japan MAFF240321 – – – – – –
Botrytis tulipae Tulip Japan MAFF245223 – – – – – –
Botrytis sp. Korean ginseng Japan – – – – – – –
Rhizopus stolonifer Pandanus sp. Japan MAFF238790 – – – – – –
Cylindrocarpon destructans Strawberry Japan MAFF306591 – – – – – –
Penicillium sp. Ornithogalum sp. Japan – – – – – – –
Rhizoctonia solani AG-4 Unknown Japan – – – – – – –
Sclerotium rolfsii Tomato Japan – – – – – – –
Calonectoria ilicicola Soybean Japan – – – – – – –
Verticillium dahliae Egg plant Japan – – – – – – –
Phytophthora nicotianae Chinese chive Japan MAFF238148 – – – – – –
Phytophthora cactorum Strawberry USA MAFF306274 – – – – – –
Phytophthora sojae Soybean Japan MAFF235802 – – – – – –
Pythium dissotocum Rice Japan – – – – – – –
Pythium spinosum Cucumber Japan – – – – – – –
1)
CBS: isolate was provided from Westerdijk Fungal Biodiversity Institute (previously Centraalbureau voor Schimmelcultures, the Netherlands). MAFF isolates were
provided from the Genebank of the National Agriculture and Food Research Organization (Tsukuba, Japan)
2)
Pairs of Lhs-F1, -F2, -F3, -R1, and -R2 are listed
3)
+ amplified products were observed, ± faint products were observed, − no amplification was observed

Isolates were incubated on potato dextrose agar hanFC/RC, hopFC/RC, implaFC/RC, hornetFC/RC, and
medium at 25 °C for 3 days in the dark, and then trans- skippyFC/RC designed by Suga et al. [6]. PCR amplifica-
ferred onto potato dextrose broth (PDB) for another 3 tion was carried out using 1 ng of DNA in a 20 μl reac-
days. Mycelia were harvested by filtration, washed with tion mixture with 200 μM each of dNTP, 1 μM of the
sterile distilled water, blotted dry, and transferred into 2 primer pairs, 1× PCR buffer, and 0.5 U AmpliTaq Gold
ml tube. Mycelia in the tubes were ground with metal (Applied Biosystems, Foster City, CA). Amplification
bar by a bubble crasher (Taitech Co., Ltd., Japan). DNA using the DNA Thermal Cycler (ParkinElmer, Waltham,
was extracted based on the PEX method [7]. MA, USA) was done for 1 cycle of 10 min at 95 °C,
PCR was used to amplify five transposons, han, hop, followed by 35 cycles of 95 °C for 1 min, 55 °C for 1 min,
impla, hornet, and skippy, using primers hanF/R, hopF/ and 72 °C for 3 min, with a final 10 min at 72 °C. Ampli-
R, implaF/R, hornetF/R, and skippyF/R, and the region fication was observed by electrophoresis on 2% agarose
between two transposable elements using primer pairs gels in Tris-acetate EDTA buffer. The agarose gels were
Toda et al. Journal of Genetic Engineering and Biotechnology (2020) 18:1 Page 4 of 6

stained with ethidium bromide (10 mg/ml) and visual- DNA sequence of this product from isolate A2–1 was
ized under UV transillumination. The success of PCR deposited in Genebank (accession no. LC387464). This
was confirmed by the presence or absence of fragments sequence was not matched with any sequences based on
from the DNA of F. oxysporum. blastn suit search in National Center for Biotechnology
Amplified products from lily isolates were selected Information. Several PCR products by other primers
when the size of fragments was distinguished from other were amplified from lily isolates, but the sizes were not
isolates, and used for sequencing reactions using a Big- distinguished from other F. oxysporum. In addition,
Dye Terminator kit and a 3700XL Genetic Analyzer there were no useful sequences in five transposons be-
(Applied Biosystems). The sequences amplified by these tween lily isolates and other tester F. oxysporum.
products were used to design the primers, and PCR with Five regions within the sequence amplified by primer
designed primers was used to confirm the specificity for pair hopRC/hanFC were used to design the primers.
lily isolates. Three regions, Lhs-F1 (TTGAGACTTTGGGGAGGG
Pathogenicity test of lily seedlings was done using an AGATTT), -F2 (GCTTTGGACTTGAGACTTTGGGG
additional 27 isolates obtained from lily roots (Table 1). A), and -F3 (CTGCCTTGACTATCTCTAA GCTTT),
The mycelia of 27 isolates grown on PDB were collected were used for forward primers, while Lhs-R1 (GTAGCC
and adjusted as 2.5 g. Mycelia were homogenized with TACAGCTATCT AT) and -R2 (TCTACCAAATCTAT
100 ml of sterilized distilled water, mixed with 450 g of CTACA) were for reverse primers. The primer pairs
soil (Super mix A, Sakata, Japan), and placed into pots. Lhs-F1/R1, F1/R2, F2/R1, F2/R2, and F3/R1 amplified
Five lily seedlings grown for 8 weeks (Murakami seed, single products with approximately 350 bp from lily iso-
Ibaragi, Japan) were planted in each pot containing lates and F. oxysporum f. sp. lilii (CBS 130322) (Fig. 2
infested soil, and an additional five lily seedlings for con- and Table 1), while no products were obtained from
trol were also planted in non-infested soil. These pots other isolates (Tables 1 and 2).
were incubated at 22–27 °C for 4 weeks. When two to Pathogenicity test resulted that 21 isolates among 28
five lily seedlings were dead or showed stunting with yel- additional isolates were confirmed as pathogenic, and rei-
low leaves, isolates inoculated into that pot were consid- solation was confirmed from the roots of grown lily. Amp-
ered pathogenic to lilies. When no stunting was lification by primer pairs Lhs-F1/R1, F2/R1, and F3/R1
observed or only one seedling was stunted, isolates were was obtained from the 20 isolates (Table 2). From these,
considered not pathogenic. These isolates were also used three primer pairs detected about 95% of F. oxysporum
for PCR with designed primers. pathogenic to lily. Pathogenic isolate Ef16 would not be
lily isolate; however, it was low frequency as less than 5%.
Results and discussion Although these primers are still imperfect for preliminary
A single 550 bp product was amplified from some lily identification of pathogenic F. oxysporum, inoculation test
isolates using primer pair hopRC/hanFC (TTATTC indicated that these primer pairs can consistently amplify
GCACGACCGGTGGTG/ GAACCCTCCAACATTCAA the fragments of pathogenic isolates. Therefore, these pri-
CA), and a product with 550 bp was not amplified from mer pairs are useful for quick diagnosis of this soilborne
non-pathogenic or other isolates of F. oxysporum (Fig. 1). lily disease or monitoring the pathogens in commercial

Fig. 1 Amplified products obtained by the primer pair hopRC/hanFC. Lanes 1–4: lily isolates of Fusarium oxysporum pathogenic to lilies; lanes 5–7:
non-pathogenic isolates of F. oxysporum obtained from lily roots; lane 8–14: tester isolates of F. oxysporum; lane 15: negative control. Marker used
was 100 ladder marker
Toda et al. Journal of Genetic Engineering and Biotechnology (2020) 18:1 Page 5 of 6

Fig. 2 Amplified products obtained by the primer pair Lhs-F1/R1. Lanes 1–4: lily isolates of Fusarium oxysporum pathogenic to lilies; lane 5: F.
oxysporum f. sp. lilii; lanes 6–13: tester isolates of F. oxysporum; lane 14: negative control. Marker used was 100 ladder marker

fields, as it is difficult and time-consuming to identify or Abbreviations

specify the pathogens in the soil. F. oxysporum: Fusarium oxysporum; f. sp.: Forma specialis; PCR: Polymerase
chain reaction; DNA: Deoxyribonucleic acid; CBS: Westerdijk Fungal
Pathogenicity to lilies has been observed from F. oxy- Biodiversity Institute (previously Centraalbureau voor Schimmelcultures, the
sporum f. sp. lilii, f. sp. gladioli, and f. sp. tulipae [8]. We Netherlands); MAFF: Isolates provided from the Genebank of the National
herein observed amplification by three primer pairs from Agriculture and Food Research Organization (Tsukuba, Japan); PDB: Potato
dextrose broth; VCG: Vegetative compatibility group
tester F. oxysporum f. sp. lilii, but not from f. sp. gladioli or
f. sp. tulipae. Baayen et al. [8] reported that tester isolate
Acknowledgements
CBS130322 of F. oxysporum f. sp. lilii was not pathogenic We thank Sarah Williams, PhD, from Edanz Group (www.edanzediting.com)
in their experiment and that this isolate was different Vege- for editing a draft of this manuscript.
tative Compatibility Group (VCG) from other F. oxysporum
f. sp. lilii. It is possible that this isolate would reduce the Authors’ contributions
pathogenicity to lily by long-time incubation, and that sev- TT and SH designed the primers and analyzed the specificity of primers for
eral different VCGs were categorized into the same forma lily isolates. KS examined the pathogenicity test. All authors read approved
the manuscript.
specialis within F. oxysporum [8]. We therefore suggest that
F. oxysporum lily isolates obtained from lilies grown in
Funding
Japan would be close to F. oxysporum f. sp. lilii. This manuscript was not supported by the funding.
In summary, because transposable elements exist ran-
domly in the genome of F. oxysporum, we considered
Availability of data and materials
that several of these or related regions would be unique All data generated or analyzed during this study are included in this
to forma speciales. Therefore, we designed primers spe- published article.
cific for the hypothetical forma specialis of F. oxysporum
that is pathogenic to lilies following the methodology of Ethics approval and consent to participate
[6]. Specific primers were identified in the sequence be- Not applicable.
tween the two transposable elements han and hop, and
the specificity of three primer pairs was confirmed using Consent for publication
Not applicable.
F. oxysporum lily isolates causing stunting of lily seed-
lings (Table 2). These primer combinations will be useful
for the direct detection of amplified fragments obtained Competing interests
The authors declare that they have no competing interests.
from pathogenic F. oxysporum in lily roots, although fu-
ture studies should confirm the possibility of quick de- Author details
1
tection. Additionally, these primers will help to clarify Department of Bioproduction Science, Faculty of Bioresource Science, Akita
Prefectural University, 241-438 Kaidobata-Nishi, Shimoshinjo-Nakano, Akita
whether isolates of F. oxysporum obtained from lily roots 010-0195, Japan. 2Fukushima Prefecture Office, 2-16 Sugitsuma-cho,
or the soil are pathogenic to lilies. Fukushima 960-8670, Japan.
Toda et al. Journal of Genetic Engineering and Biotechnology (2020) 18:1 Page 6 of 6

Received: 9 August 2019 Accepted: 21 November 2019

References
1. Hanesaka S, Shishido K, Toda T, Fuji S, Furuya H (2014) Clarifying factor of
replant failure on Lilium x formolongi in Fukushima prefecture and useful
assay of fungal community in roots. Jpn J Phytopatol 80:266 (In Japanese
Abstract)
2. Geiser DM, del Mar Jimenez-Gasco M, Kang S, Makalowska I, Veeraraghavan
N, Ward TJ, Zhang N, Kuldau GA, O’Donnell K (2004) FUSARIUM-ID v. 1.0: A
DNA sequence database for identifying Fusarium. Eur J Plant Pathol 110:
473–479
3. Hirano Y, Arie T (2009) Variation and Phylogeny of Fusarium oxysporum
Isolates Based on Nucleotide Sequences of Polygalacturonase Genes.
Microbes Environ 24:113–120
4. Najafiniya M, Sharma P (2011) Specific PCR-based marker for detection of
pathogenic groups of Fusarium oxysporum f.sp. cucumerinum in India. J
Genet Eng Biotechnol 9:29–24
5. Chiocchetti A, Bernardo I, Daboussi MJ, Garibaldi A, Gullino ML, Langin T,
Migheli Q (1999) Detection of Fusarium oxysporum f. sp. dianthi in carnation
tissue by PCR amplification of transposon insertions. Phytopathology 89:
1169–1175
6. Suga H, Hirayama Y, Morishita M, Suzuki T, Kageyama K, Hyakumachi M
(2013) Development of PCR primers to identify Fusarium oxysporum f. sp.
fragariae. Plant Dis 97:619–625
7. Nakahara K, Hataya T, Uyeda I (1999) A simple, rapid method of nucleic acid
extraction without tissue homogenization for detecting viroids by
hybridization and RT-PCR. J Virol Methods 77:47–58
8. Baayen RP, Forch MG, Waalwijk C, Bonants PJM, Loffler HJM, Roebroeck EJA
(1998) Pathogenic, genetic and molecular characterisation of Fusarium
oxysporum f.sp. lilii. Eur J Plant Pathol 104:887–894

Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.