MICROBIOLOGY Available online at

INDONESIA http://jurnal.permi.or.id/index.php/mioline
ISSN 1978-3477, eISSN 2087-8575 DOI: 10.5454/mi.14.1.2
Vol.14, No.1, March 2020, p 7-16

The Utilization of Auto-Inducible Plyb Promoter and Media Optimization for Cell
Density-Dependent Expression of Recombinant Thermoalkalophilic Xylanase in
Bacillus subtilis DB104
*
HANIYYA, DINI ACHNAFANI, MARIA ULFAH, NIKNIK NURHAYATI, AND IS HELIANTI
Center for Bioindustrial Technology-Agency of Assessment and Application of Technology (BPPT), Building 611/614,
LAPTIAB-BPPT, PUSPIPTEK Area, Setu, South Tangerang, 15314, Indonesia.

Strong promoters are one of the fundamental aspects to increase the level of gene expression, and one of
approach to improve the recombinant enzyme productivity so that the efficiency of production cost for enzyme
production in industrial scale can be reached. Here we assessed the application of a cell density-dependent
promoter and media optimation to promote cell growth and protein expression of Bacillus subtilis without excess
usage of inducers. An auto-inducible Pylb promoter that is potential to provide inducer-free enzyme production
was cloned and introduced into xylanase recombinant system in B. subtilis DB104 by PCR cloning and protoplast
transformation. A 200 bp target gene was successfully inserted in between xynCM1 ORF -coding for B.
halodurans CM1 xylanase- and its native promoter sequence at the upstream region. The disruption of the native
promoter was intended to replace the native promoter with Pylb. Recombinant xylanase gene under Pylb was
successfully expressed in B. subtilis DB104 and the enzyme was produced at stationary phase. Different media
with various concentrations of glucose and nitrogen were used to optimize recombinant xylanase expression. It
achieved a higher level of xylanase expression compared to wild-type Bacillus and recombinant xylanase with
native promoter expressed in B. subtilis in media containing a 2-fold recipe of LB media thus leads to increase cell
density and xylanase expression (81.461 U mL-1).

Key words: auto-inducible, Bacillus subtilis DB104, Pylb, xylanase

Promotor yang kuat adalah salah satu aspek mendasar untuk meningkatkan tingkat ekspresi gen, dan salah
satu pendekatan untuk meningkatkan produktivitas enzim rekombinan sehingga efisiensi biaya produksi enzim
pada skala industri dapat tercapai. Di dalam studi ini aplikasi promotor yang bergantung pada kepadatan sel tanpa
penggunaan induser secara berlebihan dari induser dan optimasi media untuk mendorong pertumbuhan sel dan
ekspresi enzim xilanase di Bacillus subtilis telah dilakukan. Promotor Pylb yang auto inducible berpotensi untuk
menyediakan produksi enzim bebas-induktor telah dikloning dan dimasukkan ke dalam sistem rekombinan
xilanase di B. subtilis DB104 via kloning PCR dan transformasi protoplas. Gen target sepanjang 200 bp berhasil
disisipkan di antara xynCM1 ORF –yang mengkodekan B. halodurans CM1 xylanase- dan promotor asli.
Gangguan promotor asli dimaksudkan untuk menggantikan promotor asli dengan promoter Pylb. Gen xilanase
rekombinan di bawah Pylb berhasil diekspresikan dalam B. subtilis DB104 dan enzim diproduksi pada fase
stasioner. Media yang berbeda dengan berbagai konsentrasi glukosa dan nitrogen digunakan untuk
mengoptimalkan ekspresi xilanase rekombinan. Tingkat ekspresi xilanase yang lebih tinggi daripada B. subtilis
non rekombinan ataupun B. subtilis rekombinan yang mengandung gen xilanase alkalotermofilik dengan
promoter asli ditemukan di dalam media yang mengandung resep LB 2 kali lipat dari media LB sehingga
mengarah pada peningkatan kepadatan sel dan ekspresi xilanase (81,461 U mL-1).

Kata kunci: auto-inducible, Bacillus subtilis DB104, Pylb, xilanase

In gene expression, promoters are known as one of 2019). It is suggested that choosing the promoters that
the key factors to have an important role in defining are suitable for our target genes should be done wisely
where the gene transcription starts. It is in the upstream to obtain the desired level of expression (Schumann
on an open reading frame near the transcription site 2007; Wenzel et al. 2011; Einav and Philipp 2019).
starts and comprises a set of sequence that has There are many types of promoters used in
recognizable patterns. The strength of the promoters heterologous protein expression system of
would likely affect RNA polymerase binding and recombinant host from Bacillus genus, that is
therefore can contribute to the enhancement of target constitutive promoters, inducer-specific promoters,
gene expression (Mekler et al. 2012; Einav and Philipp and auto-inducible promoters (Schumann 2007; Yu et
al. 2015), among which induced-promoters are the
*Corresponding author: Phone: +62-21-7560694; Fax: +62-
most commonly used to date. However, these inducible
21-7566922; Email: [email protected] promoters are not cost-efficient in the context of
8 HANIYYA ET AL. Microbiol Indones

industrial application because of the requirement of recombinant clones was still almost 4 times lower than
certain chemicals and compounds to be added in the the wild-type B. halodurans CM1. The expenses of
process. For example Pxyl, one of the most used in using xylan or raw corncob as inducers also rise
industry, needs xylose as its inducers (Yu et al. 2015; concerns both in terms of cost-efficiency and
Meyers et al. 2019). Native inducible-promoter of convenience of upstream and downstream processes.
genes encoding enzymes also needs its substrate to The utilizing an auto-inducible promoter from B.
produce high-level protein production, such as xylan subtilis is very much necessary to upgrade the
for xylanase (Gupta et al. 2008; Ulfah et al. 2011; recombinant protein production system in B. subtilis
Helianti et al. 2018) and skim milk for protease (Ulfah DB104. Hence, the current study aimed to clone and
et al. 2011; Cu et al. 2015). Since the usage of utilize Pylb promoter for cell density-dependent
constitutive promoter can generate toxic protein that expression of thermoalkalophic xylanase originally
can be lethal for the host, this leads us to consider the from B. halodurans and the strategy with optimized
advantage of auto-inducible promoters which can media. Media optimization was also a highlight in our
ideally facilitate efficient production process at low study since it was very critical for cell growth and
cost with an optimum condition (Yu et al. 2015; therefore played as an important factor in determining
Meyers et al. 2019; Trung et al. 2019). Pylb promoter efficiency.
Several highly-efficient non-inducible promoters
in Bacillus subtilis had been identified by Yu et al. MATERIALS AND METHODS
(2015), among them was Pylb which strongly
promoted β-galactosidase expression and showed Strains, Cultivation, and DNA Extraction.
significant superiority from the rest of selected Eschericia coli DH5α was used only as cloning host
promoters. This promoter was not only actively and B. subtilis DB104 was engineered for subcloning
expressing reporter gene bgaB during stationary phase and recombinant protein production. The wild-type
but also boosting a higher activity of β-galactosidase strains were grown in default condition at 37 ˚C, 150
up to 5000 times. Hence, this Pylb promoter is potential rpm for overnight in LB media (0.5% yeast extract, 1%
to be used for overexpressing other recombinant gene NaCl, and 1% peptone). The recombinant strains were
product with no inducer needed (Yu et al. 2015) also cultivated in stated condition using LB media with
-1
especially one which utilizes B. subtilis as cell factory. respective antibiotics (100 µg mL ampicillin and 5 µg
-1
B. subtilis DB104 is a Gram-positive bacterium mL erythromycin) unless stated otherwise.
that is generally recognized as a safe (GRAS) non- Whole genomic DNA of B. subtilis DB104 was
toxic organism (Westers et al. 2004; Watzlawick and extracted using extraction kit from Thermo Fisher
Altenbuchner 2011). Along with members of Bacillus Scientific. According to its protocol for Gram-positive
genera, its ability to secrete protein into extracellular bacteria, an overnight culture was collected and treated
sphere and grow in mesophilic condition at 37 ˚C in with 180 µL Gram-positive bacteria lysis buffer which
minimum media with various carbon and nitrogen consists of 20 mM Tris-HCl pH 8.0, 2 mM EDTA, and
source (Wenzel et al. 2011; Mageshwaran et al. 2014] 20 mg mL-1 of lysozyme. After incubation at 37 °C for
has attracted scientists to use them as recombinant host 30 min, 200 µL of Lysis Solution and 20 µL of
in large-scale production as they cover more than one- Proteinase K were added to the suspension to perform
third of industrial enzyme (Meissner et al. 2015; cell lysis and protein removal. The sample was
Watzlawick and Altenbuchner 2019]. On top of that, B. incubated at 56 °C while vortexing to ensure a uniform
subtilis DB104 has alkaline protease gene deleted suspension until the cells were completely lysed (about
(ΔaprA3), allowing them to secrete less protease and 30 min). To obtain purified genomic DNA, 20 µL
therefore the target protein will have lower RNAse was added to the suspension and followed with
denaturation risk (Kawamura and Doi 1984) and it also the addition of 400 µL 50% ethanol. The prepared
might be more suitable to express genes from the same lysate was then transferred to the filtered column and
Gram-positive bacteria than E. coli. washed by Wash Buffer I and Wash Buffer II of each
Our recent work has been focused on utilize native contained pure ethanol. Before DNA elution was
promoter for expression of xynCM1 gene in B. subtilis performed, the column was spun at maximum speed
DB104. Whilst it could enhance the enzyme (12,000 ×g) for 3 min to dry. Genomic DNA was
production in the host compared to the native B. subtilis obtained after a 5-min incubation step with 200 µL
DB104 (Haniyya et al. 2019), the productivity of Elution Buffer. All centrifugation was done at
Volume 14, 2020 Microbiol Indones 9

6,000—8,000 ×g except for the drying process. 1-minute incubation of 600 µL Wash Buffer followed
Isolation of Pylb Promoter. The Pylb promoter and the purified DNA was eluted at last with 50 µL
was amplified from gDNA of B. subtilis DB104 by a set Elution Buffer.
of primers based on work of Yu et al. (2015) but Construction of Plasmid for Xylanase Gene
modified for restriction-free cloning by the addition of Expression with Mega Primer Approach. The
backbone sequences in 5' or 3' overhangs in both recombinant plasmid was constructed through
primer F1 and R1 (Table 1). Genomic DNA was restriction-free cloning by PCR insertion of Pylb gene
isolated using GeneJET Genomic DNA Purification into pSKE194.natprom-alkxynCM1-inlip as template
Kit [#K072, Thermo Fisher Scientific, Waltham, plasmid. The insertion was occurred between native
USA]. The Pylb gene was amplified by PCR in a 50 µL promoter and xynCM1 gene to replace upstream region
reaction mixture composed of 10 µL 5× HF Buffer, 1 as gene promoter. There were two megaprimers used in
µL 10 mM dNTPs, 2.5 µL of 10 µM forward and the experiment (Fig 1), the purified Pylb as the targeted
reverse primers, 1.5 µL 100% DMSO, 5 µL template gene and xynCM1 gene to assist the annealing process
gDNA, 0.625 µL Phusion HiFi DNA Polymerase of targeted gene into the template (Ulrich et al. 2012;
[Thermo Fisher Scientific, Waltham, USA], and Mathieu et al. 2014). The assisting-gene were
26.875 µL nuclease-free water to bring the total amplified by the method described in previous study
volume of 50 µL. After a swift initial denaturation of 98 (Helianti et al. 2018).
˚C for 30 s, amplification was performed in 30 cycles of PCR was performed in a 50 µL reaction mixture
10 s at 98 ˚C, 15 s at 72 ˚C, and 30 s at 72 ˚C, followed composed of 10 µL 5× HF Buffer, 1 µL 10 mM dNTPs,
by a final extension at 72 ˚C for 5 min to ensure the 1.5 µL 100% DMSO, 25 ng plasmid template, 100 ng
fragment elongation. The 256 bp fragment of Pylb gene purified Pylb target gene, 100 ng purified xynCM1
was then purified using GeneAid Gel/PCR DNA assisting-gene, 0.5 µL Phusion HiFi DNA Polymerase
Fragments Kit [DF100, Geneaid Biotech, New Taipei [Thermo Fisher Scientific, Waltham, USA], and 34 µL
City, Taiwan] by mixing it with 250 µL DF Buffer prior nuclease-free water to bring the total volume of 50 µL.
to sample transfer into DF column by centrifugation at A quick initial denaturation was performed at 98 ˚C for
14,000 ×g for 30 s. The wash step with the addition and 30 s and followed by 30 cycles gene amplification

Fig 1 The process of megaprimer-assisted cloning.

 10 HANIYYA ET AL. Microbiol Indones

Table 1 List of primers used in the study

Primer Sequence Usage
F1 5’- Pylb cloning
GCATTTTACTTTGCTACGAAAGGAGAATTTGTGAAAAGACCAACGGA
GCCT CCG-3’
R1 5’- Pylb cloning
GGTTTTCTAAACAGTGTAATCATACAAATCTCCCCCTTTGTTGTTTC -
3’
F2 5’-ATGATTACACTGTTTAGAAAACCTTTTG -3’ xynCM1 isolation
R2 5’- GTATCGATAATTCTCCAGTAAGCAGGTTTC -3’ xynCM1 isolation
F3 5’-CCAAGCTTATTTCAATGAGTATTG -3’ Recombinant ver ification
R3 5’-GTTGACTTGGCTGCTGTACAGAAG -3’ Recombinant verification
1

consisted of 10 s at 98 ˚C, 30 s at 54 ˚C, and 5.5 min at into 20 ml of Pennasay broth [Difco, Detroit, USA]
72 ˚C. At last, a final extension was wrapped at 72 ˚C until the OD600 reached 0.4—0.6. The cell was
for 10 min to ensure the fragment elongation. A harvested using centrifugation at 3800 rpm, 4 ˚C, for 15
recombinant DNA was obtained and purified by min [Gyrozen Centrifuge, 50 ml rotor]. The protoplasts
GeneAid Gel/PCR DNA Fragments Kit [DF100, were formed after 2-h incubation at 37 ˚C in SMMP
Geneaid Biotech, New Taipei City, Taiwan] with the solution (0.5 M sucrose, 0.02 M maleic acid, 0.02 M
method described previously prior to recombinant MgCl2.6H2O, and 3.5% Pennasay powder) containing
verification. freshly-added 2 mg mL-1 lysozyme [Sigma-Aldrich, St.
The verification was again performed by PCR Louis, USA]. It went under several steps of washing
using F3 and R3 primers (Table 1). The reaction mix in before a final 1.5 mL of SMMP solution was gently
a total volume of 20 µL was simply composed by 4 µL added to resuspend cell pellets for plasmid
5× MyTaq Reaction Buffer, 1 µL 10 µM F3 and R3 transformation.
primers, 1.5 µL purified recombinant DNA, 0.25 µL The DNA plasmid was prepared using a double-
MyTaq HS DNA Polymerase [Bioline, London, UK], strength SMM solution (1 M sucrose, 0.04 M maleic
and 12.25 µL ddH2O. A 30-cycles PCR was done under acid, and 0.04 M MgCl2.6H2O) about 1:1 ratio of DNA
the condition: initial denaturation at 95 ˚C for 1 min, and solution volume in a total of 50 μl. All of DNA
denaturation at 95 ˚C for 15 s, annealing at 50 ˚C for 15 mixture was added to 0.5 ml protoplast suspension
s, extension at 72 ˚C for 15 s, and final extension at 72 before the addition of 1.5 ml 40% PEG6000 in SMM
˚C for 10 min. Solution (0.5 M sucrose, 0.02 M maleic acid, and 0.02
After it was verified, in-vitro ligation was M MgCl2.6H2O). The suspension was incubated for 2
proceeded by the incubation of 2 µL 10× T4 DNA min at room temperature. About 5 ml of SMMP
Ligase, 16 µL PCR product, and 1 µL T4 Solution was added prior to cell separation by
Polynucleotide Kinase [Promega, Madison, USA] at centrifugation at 2900 rpm, 4 ˚C, for 10 min. The cell
37 ˚C for 30 min. After the first incubation finished, 1 pellet was resuspended by 1 ml of SMMP Solution
µL T4 DNA Ligase [Thermo Fisher, Waltham, USA] once again and incubated at 37 ˚C for 1.5 h with 100
was added and the incubation was prolonged at room rpm agitation. About 500 µL of cell suspension was
temperature for 30 min. To eliminate non-recombinant spread on DM3 agar (0.5 M sodium succinate, 0.5%
-1
parental plasmid, 0.5 U µL DpnI was added before the casamino acid, 0.5% yeast extract, 0.35% K2HPO4,
reaction was transformed into E. coli DH5α competent 0.15% KH2PO4, 0.5% glucose, 0.02 M MgCl2.6H2O,
cells. Verification of recombinant strains was done 0.01% BSA, and 1% agar) containing 5 µg/ml
using both PCR (which the reaction described erythromycin and the growth of recombinant colonies
previously) and plasmid digestion with MfeI. could be seen after 2 days incubation at 37 ˚C. We then
Subcloning to B. subtilis DB104 and selected the positive recombinant colonies by
Recombinant Verification. Plasmid transformation in performing colony PCR and plasmid extraction for
Bacillus was conducted using protoplasting method Bacillus as described by Voskuil and Chambliss
proposed by Chang and Cohen (1979). To make (1995). Recombinant xylanase activity was checked
Bacillus competent cells, the wild-type B. subtilis qualitatively by measuring the ratio of clear zone
DB104 strain was grown in LB media at 37 ˚C, 150 diameter to bacterial colony diameter (in cm) after 24 h
rpm, for overnight as a starter culture. It was inoculated of incubation on LB agar pH 7 and pH 9 in the presence
Volume 14, 2020 Microbiol Indones 11

of 2% (w/v) beechwood xylan. Non-recombinant B. media-based were used containing 1% and 5% (w/v)
subtilis DB104 was used as negative control. glucose for each variation.
Plasmid Extraction of Recombinant B. subtilis Xylanase Assay. Xylanase activity was assayed
DB104. The erythromycin-resistant transformant B. using dinitrosalicylic acid (DNS) to measure reducing
subtilis DB104 were selected and cultured in LB media sugar produced from xylan hydrolysis (Bailey et al.
containing erythromycin (5 µg mL-1) under 37 °C at 1992; Miller 1959) in triplicate with some
150 rpm agitation. Plasmid isolation performed with modifications. Crude enzyme was obtained from
SET buffer (Voskuil and Chambliss 1993) after culture supernatant after centrifugation at 12000 rpm at
centrifugation at 12,000 rpm at 4 °C for 5 min to obtain 4 °C for 5 min. 50 µL of supernatant was added to 450
cell pellet. The cell pellet resuspended in 200 µL in µL xylan substrate containing 0.5% (w/v) beechwood
SET buffer (25% sucrose, 0.05 M EDTA, 0.05 M Tris- xylan in 0.5 M Tris-HCl buffer pH 9. The reaction takes
HCl pH 8) containing 5 mg mL-1 lysozyme and place at 70 °C for 5 min at 300 rpm using a
incubated at 37 °C for 10 min. 0.2 N NaOH and 1% thermoshaker. After incubation, 750 µL of DNS
SDS was added to the suspension and flipped until reagent (1% dinitrosalicylic acid, 0.2% phenol, 0.05%
clear. 5 M of cold KCOOH was added and sodium sulfite, 1% sodium hydroxide, and 20% (w/v)
homogenized, then centrifuged. 650 µL of cold potassium sodium tartrate) was added immediately. As
phenol:chloroform:isoamyl-alcohol (25:24:1) was for blank, 50 µL of sample was added after DNS
added to 750 µL of supernatant and homogenized by addition. All the samples and blanks were boiled for 5
vortexing at full speed. Aqueous phase from the min and let cool to room temperature. 250 µL of water
suspension was obtained by centrifugation. 620 µL of was added, homogenized, and reducing sugar released
aqueous phase was obtained and 620 µL of was measured at 540 nm. Standard curve obtained from
chloroform:isoamyl-alcohol (24:1) was added to xylose suspension ranging from 0; 0.2; 0.4; 0.6; 0.8;
suspension and homogenized by vortexing at full and 1 mg mL-1 using the same protocol. Xylanase
speed. The suspension was then centrifuged and 550 activity stated in Unit (U) defined as the amount of
µL of aqueous phase was moved to new microtube. 550 enzyme releasing 1 µmol of reducing sugar per minute
µL of cold isopropanol was added, homogenized, and under appropriate assayed condition.
centrifuged. 1 mL of alcohol 70% was added to the
pellet and centrifuged at 12000 rpm at 4 °C for 5 min. RESULTS
The pellet DNA was then resuspended in ddH2O with
-1
RNAse (20 µg mL ). Pylb Cloning and Verification. DNA fragment of
Growth Curve Observation and Media 256 bp coding for Pylb promoter was integrated into
Formulation. Recombinant B. subtilis DB104 pSKE194-natprom-alkxynCM1-inlip by PCR cloning
harboring pSKE194-Pylb-alkxynCM1-inlip was resulting an 8757 bp recombinant plasmid (Fig 2A).
cultured overnight in 10 mL of LB media in the The insertion can occur because of the presence of 56
presence of 5 µg mL-1 erythromycin under 37 °C at 150 bp of overlapping region in both ends of Pylb fragments
rpm agitation. Two percent of the culture was then used so that they annealed into the backbone and promoting
to inoculate 100 mL of fresh LB media containing the the formation of new recombinant plasmid in the next
same antibiotic under 37 °C at 150 rpm agitation for 24 cycle of amplification. As depicted in the figure, the
h. Samples were taken every 2 h to observe bacterial gene cassette was constructed of three genes with the
cell density by measuring OD600 then plotted against position of Pylb promoter between the native promoter
time to obtain bacterial growth curve. and xynCM1 gene. The flanking regions of lipase locus
Media optimization strategy used to achieve high- at both 5' and 3' ends were intended for further
cell density with modification in yeast extract and experiments with chromosomal integration and could
glucose concentration. Several media used were based be used for the verification of positive recombinants
on LB and SOC media. LB media (1% tryptone, 0.5% (Fig 2B).
yeast extract, 1% NaCl) and 2X LB media with 2-fold The positive recombinants of E. coli DH5α and B.
-1
concentration recipe containing 5 µg mL subtilis DB104 were confirmed by PCR using F3 and
erythromycin [Sigma-Aldrich, St. Louis, USA] were R3 primer set and proved to be harboring the targeted
used. Soybean flour media used as an alternative gene Pylb (200 bp) within a 2061 bp gene cassette (Fig
source of nitrogen containing 1.89% (w/v) soybean 3C). This result was also supported by MfeI digestion
flour and 1% NaCl. For glucose optimization, SOC which cut the plasmid into two fragments of 7456 bp
12 HANIYYA ET AL. Microbiol Indones

(a)

lip native promoter xynCM1 lip

Pylb
(b)
Fig 2 The constructed plasmid and gene cassette of Pylb. (a) The whole construct of recombinant plasmid
pSKE194-Pylb-alkxynCM1-inlip (8757 bp) and its features; (b) A 2061 gene cassette containing 200 bp
Pylb fragment.

and 1301 bp after 1-hour incubation at 37 ˚C that were Growth Curve and Media Optimization to
notably delineated from the negative one. According Achieve High Cell-Density. The growth curve of
to the vector map, MfeI digestion of recombinant recombinant xylanase-producing B. subtilis was
plasmid generated 2 fragments of 1.3 and 7.5 kb, while investigated to determine when the enzyme was highly-
control with lack of target gene formed smaller bands of produced. Growth curve observed in LB media for 24 h
1.1 and 7.5 kb corresponding to the result (Fig 3D). with B. subtilis DB104 wild-type as control bacteria
Three out of four potential B. subtilis DB104 (Fig 5). Both wild-type and recombinant B. subtilis
transformants were identified as positive clones, entered the log phase after 2 h of cultivation and the
however, only one clone (R3) was carried out for recombinant B. subtilis reached the cell density peak
further experiments of protein expression and media after 9 h, while wild-type strain entered the stationary
formulation. phase after 11 h. B. subtilis wild-type reached higher
Qualitative Assay of Xylanase. Qualitative assay cell density than recombinant B. subtilis. Based on the
of xylanase produced by recombinant B. subtilis growth curve, samples were taken at 5 h (log phase), 9 h
performed in LB xylan media pH 7 and pH 9 to detect (late log phase), 14 h (stationary phase), and 24 h (late
alkaline xylanase and compared to B. subtilis DB104 stationary phase) after inoculation to determine
wild-type. Clear zone ratio 2.00 surrounding xylanase activity.
recombinant B. subtilis colony in LB media pH 9 (Fig All samples taken from recombinant and wild-type
4D) showed alkaline xylanase activity and no distinct B. subtilis exhibit xylanase activity measured by DNS
clear zone observed in LB media pH 7 (Fig 4C). As method. Both supernatant from recombinant and wild-
control, B. subtilis DB104 wild-type grown on LB type bacteria shows higher level of enzyme expression
media pH 7 (Fig 4A) showed distinct xylanase activity taken from 24-h supernatant culture (Table 2).
around the colony with clear zone ratio 1.40, while no Moreover, recombinant xylanase (R3) performed 2.5-
-1
clear zone detected in LB media pH 9 (Fig 4B). fold higher level of enzyme expression (23.874 U mL )
Volume 14, 2020 Microbiol Indones 13

(a) (b)

(c) (d)
Fig 3 The insertion and verification of Pylb gene. (a) PCR amplification of 1) 256 bp Pylb gene and its N) negative
control from B. subtilis DB104; (b) PCR amplification of 1) 1191 bp assisting-fragments xynCM1 from
gDNA of B. halodurans CM1; (c) Colony PCR verification of positive clones harboring pSKE194-Pylb-
alkxynCM1-inlip with its N) negative control of pSKE194-natprom-alkxynCM1-inlip (no inserted Pylb
gene); and (d) MfeI digestion of 1) positive recombinant plasmid and its N) negative control after 1-hour
incubation at 37 ˚C.

Fig 4 Qualitative assay of xylanase from B. subtilis DB104 wild-type grown on LB in the presence of 2% (w/v) of
beechwood xylan pH 7 (A); LB-xylan pH 9 (B); recombinant B. subtilis harboring pSKE194-Plyb-
alkxynCM1-inlip grown on LB-xylan pH 7 (C) and LB-xylan pH 9 (D).

Fig 5 B. subtilis DB104 growth curve in LB media at 37 °C. Wild-type B. subtilis (▲) showed higher peak cell
density than Pylb promoter-dependent recombinant xylanase (■).
14 HANIYYA ET AL. Microbiol Indones

Table 2 Xylanase activity measured by DNS method from supernatant culture of wild-type and recombinant B.
subtilis DB104
Xylanase activity (U mL -1)
Time (-hour)
R3 wild-type
5 6.664 4.911
9 10.499 6.328
14 18.080 8.769
24 23.874 9.435
1

Table 3 Cell density (OD 600 ) and xylanase activity (U mL -1 ) of recombinant B. subtilis from different media
compared to controls

xynCM1 xynCM1
wild-type
with native promoter with Pylb promoter
Media
Activity Activity Activity
OD600 OD600 OD600
(U mL-1) (U mL-1) (U mL-1)
LB 1.905 2.871 2.205 26.944 2.710 21.598
2X LB 5.050 20.600 5.680 73.192 5.025 81.461
Soybean flour media - 3.978 - 13.995 - 31.299
SOC 7.040 29.436 6.250 22.504 5.720 60.893
SOC (with 1% glucose) 3.645 15.207 2.335 10.949 2.930 19.304
SOC (with 5% glucose) 3.995 61.551 3.980 28.937 4.365 47.937
SOB (with starter SOC) 5.965 3.294 4.525 24.508 2.200 24.766
1
-1
than wild-type xylanase from B. subtilis (9.435 U mL ). xylanase under Pylb promoter control remains the
It also reached almost 4 times higher than log-phase highest activity among others.
-1
recombinant xylanase (6.664 U mL ). S O C m e d i a w e r e u s e d w i t h d i ff e r e n t
To determine the effect of both carbon and nitrogen concentrations of glucose (1% and 5%) and compared
supplementation in media, yeast extract and glucose to original SOC media (20 mM of glucose). Biomass
were used for B. subtilis growth with LB media and yield from high glucose content in SOC media
SOC media as the base media (Table 3). Not only measured by cell density (OD600) revealed a decreasing
xylanase activity, cell density was also measured by cell density compared to original SOC media.
spectrophotometer at 600 nm (OD600). The expression Meanwhile, wild-type and recombinant B. subtilis
of recombinant xylanase produced by clone R3 grown in SOB media with SOC media as former media
harbouring Pylb promoter was compared with wild- starter exhibited higher cell density compared to excess
type B. subtilis and recombinant B. subtilis carrying the glucose media, even though it did not surpass the cell
same xylanase gene but with the native promoter as density from original SOC media. Recombinant
controls (Table 3). xylanase under Pylb promoter control produced in SOC
LB media with a 2-fold recipe (2X LB) used as the media with original concentration of glucose (20 mM)
first step to determine the effect of higher content of showed highest xylanase activity also among other
yeast extract addition on the B. subtilis growth. Cell variety of SOC media.
density at stationary phase was increased 2-fold higher
than other bacteria grown on LB media, with OD600 DISCUSSION
5.025 for recombinant B.subtilis harbouring Pylb
promoter. Recombinant xylanase under Pylb promoter The Pylb gene (256 bp) from B. subtilis was
control reached the highest result in enzyme activity successfully inserted into the plasmid by the assistance
(81.461 U mL-1), almost 4-fold higher than grown on of megaprimer of the same 1191 bp xylanase gene that
LB media. It is also higher than xylanase produced by was already incorporated in it. The cloning method this
wild-type B. subtilis xylanase (20.600 U mL-1) and study used was slightly different from the original RF
recombinant xynCM1 with native promoter (73.192 U cloning in which only one megaprimer (as targeted
mL-1). Soybean flour media as an alternative source to gene) needed (Mathieu et al. 2014). In our experiment
supply nitrogen requirement in B. subtilis growth gave we used two megaprimers, one was our Pylb gene which
no better result in maintaining high activity of possessed flanking regions of homology with the
recombinant xylanase, even though recombinant assisting-gene so that in the first cycle of PCR both
Volume 14, 2020 Microbiol Indones 15

could anneal as one joint-fragment (total size of 1447 media did not enhance biomass yield and xylanase
bp). This leads to relatively easier insertion of joint- expressed from recombinant B. subtilis was not higher
fragment into the plasmid even in low annealing than in original SOC media with 20 mM glucose. It
temperature because the assisting-gene has extended turned out that excess energy source in media (usually
homologous region with the vector at 5' end. No carbon source) exhibited a high rate of carbon
additional pair of primers was used in the reaction for consumption and low energetic growth efficiency. High
cloning, resulting linear amplification not exponential carbon source in the growth of microorganisms
(Ulrich et al. 2012; Mathieu et al. 2014). generates uncoupling of anabolism and catabolism thus
Pylb promoter is an auto-inducible promoter which lead to variety of energy spilling reaction and metabolic
promotes gene expression from late log phase to shifting in electron pathway to less efficient called
stationary phase with no requirements of inducer (Yu et overflow metabolism (Dauner et al. 2001). In contrast,
al. 2015). Insertion of this promoter is necessary to energy limitation generates catabolism coupling to
upgrade recombinant xylanase production from anabolism so higher biomass is achieved (Russel and
recombinant B. subtilis DB104. This bacteria itself Cook. 1995). From this research, maintaining glucose
(wild-type) performed xylanase activity from encoded concentration at certain amount while increasing
gene in its chromosome (Helianti et al. 2016) and nitrogen content might be able to express a higher level
observed in pH 7, while recombinant xylanase from B. of recombinant xylanase with Pylb promoter control in
subtilis harbouring pSKE194-Pylb-alkxynCM1-inlip B. subtilis DB104.
performed alkaline xylanase as the gene originated from
alkalothermophilic B. halodurans CM1 (Wibowo et al. REFERENCES
2016). This was confirmed by qualitative assay of
recombinant xylanase which shown xylanase activity Bailey MJ, Biely P, Poutanen K. 1992. Interlaboratory testing
from recombinant bacteria in xylan plate media pH 9. of methods for assay of xylanase activity. J Biotechnol.
In addition, recombinant xylanase were produced in 23(3):257-270. doi: 10.1016/0168-1656(92)90074-J.
increasing activity corresponding to bacterial growth Cui H, Wang L, Yu Y. 2015. Production and characterization of
curve and highly produced in stationary phase (24 h alkaline protease from a high yielding and moderately
after inoculation). halophilic strain of SD11 marine bacteria. J Chem. doi:
As stated above, gene expression under Pylb 10.1155/2015/79830.
promoter highly expressed along with increasing cell Chang S, Cohen SN. 1979. High frequency transformation of
density (Yu et al. 2015). In order to obtain a higher cell Bacillus subtilis protoplasts by plasmid DNA. Mol Gen
density, media composition needs to be optimized. B. Genet MGG. 168(1):111-115. doi:
10.1007/BF00267940.
subtilis biomass obtained at the end of the logarithmic
phase increased following the increasing quantities of Dauner M, Storni T, Sauer UW. 2001. Bacillus subtilis
yeast extract added to the media. Specific growth rate of metabolism and energetics in carbon-limited and excess-
carbon chemostat culture. J Bacteriol. 183(24):7308-
B. subtilis supplemented with 0.8% (w/v) of yeast
7317. doi: 10.1128/JB.183.24.7308-7317.2001.
extract increased up to 6-fold and no further significant
change above that quantity (Romero-Garcia et al. Einav T, Phillips R. 2019. How the avidity of polymerase
binding to the–35/–10 promoter sites affects gene
2009). In this research, 2X LB media contained 1%
expression. Proc Natl Acad Sci. 116(27):13340-5. doi:
(w/v) of yeast extract and only produced a 2-fold
10.1073/pnas.1905615116.
increase in cell density. The presence of yeast extract
Gupta U, Kar R. 2008. Optimization and scale up of cellulase
was confirmed to affect B. subtilis growth and increase
free endo xylanase production by solid state fermentation
xylanase activity if a certain amount of yeast extract on corn cob and by immobilized cells of a thermotolerant
were added. Furthermore, recombinant xylanase under bacterial isolate. Jordan J Biol Sci (JJBS). 1(3):3129 -
Pylb promoter control constantly expressed at a higher 3134.
level compared to other xylanases even if the media Haniyya, Mulyawati L, Nurhayati N, Helianti I. 2019.
were switched to an alternative source of nitrogen. Utilization of thermo-sensitive plasmid for chromosomal
Glucose supplementation on batch fermentation of integration of Bacillus halodurans CM1 thermo-
B. subtilis obtained higher cell dry weight, with alkalophilic xylanase gene with its native promoter in
optimum glucose concentration identified as 3.07% Bacillus subtilis DB104. J Chem Biol Phys Sci.
(w/v) (Zhong et al. 2014). According to the results in 9(3):1319-1331. doi: 10.24214/jcbps.B.9.3.141931.
this experiment, excess carbon source in modified Helianti I, Ulfah M, Nurhayati N, Suhendar D, Finalissari AK,
16 HANIYYA ET AL. Microbiol Indones

Wardani AK. 2016. Production of xylanase by 10.1016/S0065-2164(07)62006-1.

recombinant Bacillus subtilis DB104 cultivated in Trung NT, Hung NM, Thuan NH, Canh NX, Schweder T,
agroindustrial waste medium. HAYATI J Biosci. Jürgen B. 2019. An auto-inducible phosphate-controlled
23(3):125-131. doi: 10.1016/j.hjb.2016.07.002. expression system of Bacillus licheniformis. BMC
Helianti I, Ulfah M, Noer S, Nurhayati N, Saefudin E. 2018. Biotechnol. 19(1):3. doi: 10.1186/s12896-018-0490-6.
Cloning and expression of alkalophilic xylanase gene Ulfah M, Helianti I, Wahyuntari B, Nurhayati N. 2012.
from an Indonesia local Bacillus halodurans CM1 in Characterization of a new thermoalkalophilic xylanase-
Escherichia coli and its application on deinking process producing bacterial strain isolated from Cimanggu hot
of waste paper. Malaysian J Microbiol. 1(7):655-662. spring, West Java, Indonesia. Microbiol Indones. 5(3):7.
doi: 10.21161/mjm.114217. doi: 10.5454/mi.5.3.7.
Kawamura F, Doi RH. 1984. Construction of a Bacillus Ulrich A, Andersen KR, Schwartz TU. 2012. Exponential
subtilis double mutant deficient in extracellular alkaline megapriming PCR (EMP) cloning—seamless DNA
and neutral proteases. J Bacteriol. 160(1):442-444. insertion into any target plasmid without sequence
Mageshwaran V, Inmann F, Holmes LD. 2014. Growth constraints. PLOS ONE 8(9):1-8. doi:
kinetics of Bacillus subtilis in lignocellulosic carbon 10.1371/journal.pone.0053360.
sources. Int J Microbiol Res. 6:570-574. Voskuil MI, Chambliss GH. 1993. Rapid isolation and
Mathieu J, Alvarez E, Alvarez PJJ. 2014. Recombination- sequencing of purified plasmid DNA from Bacillus
assisted megaprimer (RAM) cloning. MethodsX. subtilis. Appl Environ Microbiol. 59(4):1138-1142.
1(2014):23-29. doi: 10.1016/j.mex.2014.05.001. Watzlawick H, Altenbuchner J. 2019. Multiple integration of
Meissner L, Kauffmann K, Wengeler T, Mitsunaga H, the gene ganA into the Bacillus subtilis chromosome for
Fukusaki E, Büchs J. 2015. Influence of nitrogen source enhanced β-galactosidase production using the
and pH value on undesired poly (γ-glutamic acid) CRISPR/Cas9 system. AMB Express. 9(1):158. doi:
formation of a protease producing Bacillus licheniformis 10.1186/s13568-019-0884-4.
strain. J Ind Microbiol Biotechnol. 42(9):1203-15. doi: Wenzel M, Müller A, Siemann-Herzberg M, Altenbuchner J.
10.1007/s10295-015-1640-7. 2011. Self-inducible Bacillus subtilis expression system
Mekler V, Minakhin L, Kuznedelov K, Mukhamedyarov D, for reliable and inexpensive protein production by high-
Severinov K. 2012. RNA polymerase-promoter cell-density fermentation. Appl Environ Microbiol.
interactions determining different stability of the 77(18):6419-6425. doi: 10.1128/AEM.05219-11.
Escherichia coli and Thermus aquaticus transcription Westers L, Westers H, Quax WJ. 2004. Bacillus subtilis as cell
initiation complexes. Nucleic Acids Res. 40(22):11352- factory for pharmaceutical proteins: a biotechnological
11362. doi: 10.1093/nar/gks973. approach to optimize the host organism. Biochim
Meyers A, Furtmann C, Gesing K, Tozakidis IE, Jose J. 2019. Biophys Acta. 1694(1-3):299-310. doi:
Cell density‐dependent auto‐inducible promoters for 10.1016/j.bbamcr.2004.02.011.
expression of recombinant proteins in Pseudomonas Wibowo S, Helianti I, Suryani A, Wahyuntari B. 2016.
putida. Microbial Biotechnol. 12(5):1003-1013. doi: Application of response surface method in optimization
10.1111/1751-7915.13455. of medium composition for xylanase production by
Miller GL. 1959. Use of dinitrosalicylic acid reagent for Bacillus halodurans CM1 in submerged fermentation.
determination of reducing sugar. Anal Chem. 31(3):426- Microbiol Indones. 10(3):5. doi: 10.5454/mi.10.3.5.
431. doi: 10.1021/ac60147a030. Yu X, Xu J, Liu X, Chu X, Wang P, Tian J, Wu N, Fan Y. 2015.
Romero-Garcia S, Hernández-Bustos C, Merino E, Gosset G, Identification of a highly efficient stationary phase
Martinez A. 2009. Homolactic fermentation from promoter in Bacillus subtilis. Sci Rep. 5:18405. doi:
glucose and cellobiose using Bacillus subtilis. Microbial 10.1038/srep18405.
Cell Factories. 8(1):23. doi: 10.1186/1475-2859-8-23. Zhong J, Zhang X, Ren Y, Yang J, Tan H, Zhou J. 2014.
Russell JB, Cook GM. 1995. Energetics of bacterial growth: Optimization of Bacillus subtilis cell growth effecting
balance of anabolic and catabolic reactions. Microbiol jiean-peptide production in fed batch fermentation using
Mol Biol Rev. 59(1):48-62. central composite design. Electron J Biotechnol.
Schumann W. 2007. Production of recombinant proteins in 17(3):132-136. doi: 10.1016/j.ejbt.2014.04.010.
Bacillus subtilis. Adv Appl Microbiol. 62:137-89. doi: