Molecular Basis of Inheritance HW3
Molecular Basis of Inheritance HW3
Molecular Basis of Inheritance HW3
3. A bacterial colony containing DNA made up of 100% N15 nitrogen bases is allowed to replicate in a
medium containing N14 bases. After one round of replication the result would be
4. Cistron is
b) The functional unit of DNA molecule that codes for a particular gene product
5. Read the statements given below and identify the incorrect statement.
b) introns
c) exons
d) cistrons
a) RNA polymerase II
b) RNA primase
d) RNA polymerase I
a) AUGUUAAUAGACGAGUAGCGACGAUGU
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG
iv) The large subunit attaches to the small subunit and the initiator tRNA fits in the P-site
vi) The activated amino acid tRNA complex attaches the initiation codon on mRNA
11. Select the incorrect statement out of the five given below about lac operon when Lactose is present
in the medium.
13. Match the entries in column I with those of column II and choose the correct answer.
Column I Column II
(1) A - N, B- Q, C- P, D- R, E- M, F - O
(2) A - P, B - R, C - M, D -O, E - N, F – Q
(3) A - Q, B - O, C - M, D - R, E - P, F – N
(4) A - N, B - O, C - M, D - R, E - P, F - Q
15. Match the names of scientists in column I with their achievements in column II and choose the
correct answer given below
Column I Column II
a) R S P T Q
b) R S Q T P
c) R Q P T S
d) R T S P Q
16. Which of the statements give below is correct with respect to frameshift mutation
d) insertions or deletions of a number of nucleotides in a DNA sequence that is not divisible by three.
17. The transcription initiation factor associated with the RNA polymerase holoenzyme in prokaryotes is
(a) β (b) ω (c) σ (d) α
19. If the sequence of bases in DNA is TACCGACCA, then the sequence of codons on the transcript will
be
Column I Column II