jmb

J. Microbiol. Biotechnol. (2019), 29(6), 839–844

https://doi.org/10.4014/jmb.1904.04022 Research Article

Special Topic - Biocatalysis

Synthesis of Methylated Anthranilate Derivatives Using Engineered

Strains of Escherichia coli S
Hye Lim Lee1†, Song-Yi Kim1†, Eun Ji Kim1, Da Ye Han1, Bong-Gyu Kim2, and Joong-Hoon Ahn1*
1
Department of Integrative Bioscience and Biotechnology, Bio/Molecular Informatics Center, Konkuk University, Seoul 05029, Republic of Korea
2
Department of Forest Resources, Gyeongnam National University of Science and Technology, Jinju 52725, Republic of Korea

Received: April 15, 2019

Revised: May 27, 2019 Anthranilate derivatives have been used as flavoring and fragrant agents for a long time.
Accepted: June 3, 2019
Recently, these compounds are gaining attention due to new biological functions including
First published online antinociceptive and analgesic activities. Three anthranilate derivatives, N-methylanthranilate,
June 4, 2019 methyl anthranilate, and methyl N-methylanthranilate were synthesized using metabolically
*Corresponding author engineered stains of Escherichia coli. NMT encoding N-methyltransferase from Ruta graveolens,
Phone: +82-2-45-3764; AMAT encoding anthraniloyl-coenzyme A (CoA):methanol acyltransferase from Vitis labrusca,
Fax: +82-2-3437-6106;
E-mail: [email protected] and pqsA encoding anthranilate coenzyme A ligase from Pseudomonas aeruginosa were cloned
†
and E. coli strains harboring these genes were used to synthesize the three desired compounds.
These authors contributed
equally to this work.
E. coli mutants (metJ, trpD, tyrR mutants), which provide more anthranilate and/or S-adenosyl
methionine, were used to increase the production of the synthesized compounds. MS/MS
S upplementary data for this analysis was used to determine the structure of the products. Approximately, 185.3 µM
paper are available on-line only at
http://jmb.or.kr. N-methylanthranilate and 95.2 µM methyl N-methylanthranilate were synthesized. This is the
first report about the synthesis of anthranilate derivatives in E. coli.
pISSN 1017-7825, eISSN 1738-8872

Copyright © 2019 by Keywords: Anthranilate, N-methyltransferase, anthraniloyl-coenzyme A (CoA):methanol

The Korean Society for Microbiology
and Biotechnology acyltransferase, metabolic engineering

Introduction have shown antidepressant-like activity [9]. Isopropyl N-

methylanthranilate has antinociceptive activity [5]. A recent
Anthranilate (2-aminobenzoic acid) has long been used report speculated that methyl N-methylanthranilate has
for the synthesis of diverse compounds including perfumes, analgesic activity [10]. Usually, alkylated N-methylanthranilates
pharmaceuticals, and insect repellents [1]. Biologically, it is have a methyl or ethyl group attached to anthranilate
an intermediate of tryptophan biosynthesis [2] and alkaloids through N-methylation and/or ester formation with a
[3]. carboxyl group.
Alkylated N-methylanthranilates have been used as Methyl anthranilate is one of the ingredients of Concord
flavoring and fragrant agents [4, 5]. Methyl N-methyl- grape and contributes to the flavor of wines produced from
anthranilate, a flavoring compound, was discovered from a this variety of grapes [11]. In addition, methyl anthranilate
variety of grape and Choisya ternata Kunth; it has been used has been used as a bird repellent for crop protection [12, 13].
in the cosmetic industry. Ethyl N-methylanthranilate also Biological synthesis of these anthranilates has been
has similar properties. Alkylate anthranilates such as studied in some plants. N-Methylanthranilate is synthesized
methyl anthranilate and ethyl anthranilate are natural from anthranilate by an enzyme anthranilate N-methyl
compounds that are responsible for flavor and fragrance transferase (NMT), which uses S-adenosyl methionine
[6]. They are also known to be insect repellent and to have (SAM) as a methyl group donor. NMT from Ruta graveolens
antipathogenic effects [7, 8]. Additional biological activities has been cloned [14]. Moreover, biosynthesis of methyl
of these anthranilate derivatives have been found; Methyl anthranilate was studied in Vitis labrusca and anthraniloyl-
N-methylanthranilate and isopropyl N-methylanthranilate coenzyme A (CoA):methanol acyltransferase (AMAT),

June 2019 ⎪ Vol. 29 ⎪ No. 6

840 Lee et al.

AMAT, AY705388). Primer sequences for NMT were 5’-ATGGAT

CCGATGGGTTCTTTATCGGAATCC-3’ as a forward primer and
5’-ATGCGGCCGCCTACTTGAAGAACTCCATGA-3’ as a reverse
primer (restriction enzyme sites for BamHI at the forward primer
and NotI at the reverse primer are underlined). The PCR product
was sequenced and subcloned into the corresponding site of pET-
Duet1 vector (pE-NMT). 5’-AAGTCGACATGGCATCATCGTCGT
CTCC-3’ (SalI site is underlined.) and 5’-AAGCGGCCGCTTAGG
GCATGGATGTAATTAACAGC-3’ (NotI site is underlined.) were
used as forward and reverse primers for AMAT, respectively.
AMAT gene was subcloned into SalI/NotI site of pCDFduet
vector (pC-AMAT). trpEG from E. coli was cloned using PCR. 5’-
ATGGATCCCATGCAAACACAAAAACCGACT-3’ and 5’ATC
TCGAGTTACAGAATCGGTTGCAGCGTG-3’ were used as the
forward and the reverse primers, respectively. BamHI and XhoI
site was introduced into the forward primer and the reverse
primer, respectively. The resulting PCR product was sequenced
and subcloned into the second cloning site (BglII/XhoI) of pE-
Fig. 1. Scheme for the synthesis of anthranilate derivatives (N- NMT to produce pE-NMT-trpEG.
methyl anthranilate, methyl anthranilate, ethyl anthranilate, PqsA gene was cloned by PCR using genomic DNA of
methyl N-methylanthranilate, and ethyl N-methylanthranilate). Pseudomonas aeruginosa as a template. Following primers were
used; 5’-ATCATATGTCCACATTGGCCAACCTGACCG-3’ (NdeI
site is underlined) and 5’CATCTCGAGTCAACATGCCCGTTC
which is responsible for the formation of methyl anthranilate, CTCCGG3’ (XhoI site is underlined). The resulting PCR product
has also been cloned [15]. AMAT uses diverse alcohols as was subcloned into NdeI/XhoI site of pC-AMAT and the
an alkyl group donor and anthraniloyl-CoA as an alkyl resulting construct was named pC-AMAT-pqsA.
group acceptor. The attachment of coenzyme A (CoA) to
anthranilate is mediated by pqsA from Pseudomonas aeruginosa Production of Methylated Anthranilates
[16]. The combination of these genes would make it possible N-Methylanthranilate was synthesized using E. coli harboring
to synthesize various anthranilate derivates. either pE-NMT or pE-NMT-trpEG. E. coli transformants were
grown and gene expression was induced as described in Song et
Escherichia coli has been widely used to synthesize
al. [18]. Cells were harvested by centrifugation and resuspended
natural compounds [17] because precursors for the synthesis
in M9 medium containing 100 μM anthranilate, 50 μg/ml ampicillin,
of various compounds and cofactors such as SAM, CoA,
and 1 mM IPTG. The reaction was carried out for 24 h. Synthesis
and nucleotide sugars can be easily provided in the of N-methylanthranilate using various E. coli strains was carried
medium, and manipulation of metabolic pathways is out the same as above except that anthranilate was not added.
straightforward. E. coli synthesizes anthranilate, which can Methyl anthranilate was synthesized using E. coli harboring pC-
be used for the synthesis of various anthranilate derivatives AMAT-pqsA. After harvesting cells, they were resuspended using
(Fig. 1). By introducing NMT, AMAT, and pqsA into E. coli M9 medium containing 100 μM anthranilate, 5% alcohol (methanol,
and engineering E. coli metabolic pathways, we synthesized ethanol, isopropanol, or butanol), 50 μg/ml spectinomycin, and
three anthranilate derivates. 1 mM IPTG. Culture filtrate was extracted with ethyl acetate and
the organic layer was dried and dissolved in DMSO. The dissolved
sample was analyzed using high-performance liquid chromato-
Materials and Methods
graphy (HPLC) [19]. N-Methylanthranilate was detected at
250 nm. Methyl anthranilate, ethyl anthranilate, and methyl N-
Nucleic Acid Manipulation
methylanthranilate were detected at 354 nm. Standard deviation
Ruta graveolens and Concord grape (Vitis labrusca) were
and mean were calculated based on triplicate experiments. The
purchased from a local market and total RNA was isolated using a
structure of N-methylanthranilate was determined using nuclear
Plant Total RNA Isolation Kit (Qiagen, US). The isolated RNA was
magnetic resonance spectroscopy (NMR) [20]; 1H NMR (400 MHz,
used as template for reverse transcription-polymerase chain
DMSO-d6): δ 7.77 (dd, J = 7.9, 1.5 Hz, 1H), 7.37 (td, J = 7.8, 1.6 Hz,
reaction (RT-PCR). Anthranilate N-methyltransferase (NMT) and
1H), 6.67 (d, J = 8.4 Hz, 1H), 6.54 (t, J = 7.4 Hz, 1H), 2.83 (s, 3H).
anthranilate methyltransferase (AMAT) were cloned from R.
MS/MS analysis was carried out as previously described [21].
graveolens and V. labrusca, respectively. Primers were designed
Mass spectra were acquired in the positive ionization mode.
based on the published nucleotide sequences (NMT, DQ884932.1;

J. Microbiol. Biotechnol.
 Biological Synthesis of Anthranilate Derivatives 841

Synthesis of anthranilate from glucose was carried out as

described previously [18]. For the synthesis of alkyl anthranilate,
alcohol was provided at the final concentration of 5% (v/v). And,
the cells were grown at 30oC at 180 rpm for 24 h.

Results and Discussion

Synthesis of N-Methylanthranilate
N-methylanthranilate is synthesized from anthranilate
in a reaction catalyzed by NMT. To synthesize N-
methylanthranilate, E. coli strain B1 was fed with anthranilate
and the culture filtrate was analyzed. As shown in Fig. 2,
the reaction product had the same retention time as N-
methylanthranilate. The structure of this reaction product
was analyzed by NMR and it was confirmed to be N- Fig. 2. Synthesis of N-methylanthranilate using E. coli harboring
methylanthranilate. NMT.
Anthranilate is an intermediate for the synthesis of A, anthranilate standard; B, N-methylanthranilate standard; C, the
tryptophan; however, it is also a substrate for NMT. The reaction product from E. coli harboring NMT.
production of N-methylanthranilate can be increased by
engineering anthranilate production. We examined the the conversion of chorismate to anthranilate. The resulting
production of N-methylanthranilate from glucose. As strain B2 produced 16.6 mg/l N-methylanthranilate. Then,
expected, the strain B1 synthesized approximately 1.6 mg/l we used E. coli tyrR and trpD double mutant (B-DR in
N-methylanthranilate without feeding anthranilate. In Table 1). TyrR is a negative regulator of transcription
order to increase the production, we next overexpressed and its deletion resulted in the activation of the first step
trpEG gene encoding anthranilate synthase that catalyzes of shikimate pathway [22]. TrpD encodes anthranilate

Table 1. Plasmids and strains used in the present study.

Plasmids or E. coli strains Relevant properties or genetic markers Source
Plasmids
pETDuet f1 ori, Ampr Novagen
pE-NMT pETduet + NMT from Ruta graveolens
pE-trpEG pETduet + trpEG from Escherichia coli This study
pE-trpEG-NMT pETduet + trpEG from Escherichia coli + NMT from R. graveolens This study
pC-AMAT-pqsA pCDFduet+ AMAT from Vitis labrusca + pqsA from Pseudomonas aeruginosa This study

Strains
BL21 (DE3) F- ompT hsdSB(rB- mB-) gal dcm lon (DE3)
B-DR BL21(DE3) ΔtrpD/ΔtyrR This study
B-DRM BL21(DE3) ΔtrpD/ΔtyrR/ΔMetJ This study
B1 BL21 (DE3) harboring pE-NMT This study
B2 BL21 (DE3) harboring pE-trpEG-NMT This study
B3 BL21 (DE3) harboring pE-trpEG and pC-AMAT-pqsA This study
B4 BL21 (DE3) harboring pC-AMAT-pqsA This study
B-DR1 B-DR harboring pE-trpEG-NMT This study
B-DRM1 B-DRM harboring pE-trpEG-NMT This study
B-MMA1 E. coli BL21 harboring pE-trpEG-NMT and pC-AMAT-pqsA This study
B-MMA2 E. coli B-DR harboring pE-trpEG-NMT and pC-AMAT-pqsA This study

June 2019 ⎪ Vol. 29 ⎪ No. 6

842 Lee et al.

Fig. 3. Synthesis of N-methylanthranilate from glucose using

various E. coli strains.

Fig. 4. Production of methyl anthranilate and ethyl

phosphoribosyl transferase, which converts anthranilate into anthranilate using E. coli strain B3.
N-(5’-phosphoribosyl)-anthranilate [1]. The strain B-DR1 A, methyl anthranilate standard (S1); B, ethyl anthranilate standard
synthesized 18.4 mg/l N-methylanthranilate. Furthermore, (S2); C, reaction product (P1) after feeding methanol; D, reaction
we engineered the strain for the production of methyl product (P2) after feeding ethanol. mAU: milli absorption unit.
group donor. SAM serves as a methyl group donor. MetJ is
a repressor of SAM synthesis and it inhibits the production
of SAM using a feedback mechanism [23]. Therefore, we had the same HPLC retention time as that of the standards
made MetJ deletion mutant in order to make more SAM methyl anthranilate and ethyl anthranilate, respectively
available for the synthesis of N-methylanthranilate. (Table 1). (Fig. 4). The molecular masses of the products from the
The resultant triple mutant strain (B-DRM1, Table 1) reactions involving methanol and ethanol were 152.0698
produced approximately 29.1 mg/l N-methylanthranilate and 166.0854 Da, respectively (Figs. S1 and S3). These
(Fig. 3). We detected unreacted anthranilate in all the E. coli agreed with the predicted molecular masses of methyl
strain. Although both anthranilate and SAM are critical for anthranilate and ethyl anthranilate, respectively. Furthermore,
N-methylanthranilate production, conversion of anthranilate the two compounds synthesized when methanol or ethanol
into N-methylanthranilate was slower than the synthesis of were fed showed the MS/MS fragmentation patterns
anthranilate. matching with methyl anthranilate or ethyl anthranilate,
respectively (Figs. S1 and S3). These results indicated that
Synthesis of Alkyl Anthranilate the strain B3 synthesized methyl anthranilate and ethyl
We tested the synthesis of alkyl anthranilates such as anthranilate. Ethanol was the best substrate followed by
methyl anthranilate and ethyl anthranilate. This reaction is methanol and isopropanol. Only a small amount of
catalyzed by two enzymes. Anthranilate is converted into isopropanol reacted with anthranilate (data not shown).
anthraniloyl-CoA by anthranilate-CoA ligase and then it is This result was in contrast with the enzymatic reaction
converted into alkyl anthranilate by AMAT. Which alkyl result [15], in which isopropanol was the best followed by
group is attached to anthranilate depends on the alcohol ethanol and methanol. This might be due to the different
used. In order to supply more anthranilate, trpEG was permeability of each alcohol into E. coli. Isopropanol was
overexpressed in E. coli. Three genes (trpEG, pqsA, and less permeable than the other two alcohols, which limited
AMAT) were introduced into E. coli and the transformants the supply of isopropanol for the synthesis of the isopropyl
(B3) were grown in the presence of 2% of methanol, anthranilate.
ethanol, propanol, isopropanol, or butanol. B3 fed with
methanol, ethanol, or isopropanol showed a new peak in Synthesis of Methyl N-Methylanthranilate
HPLC, which had a different retention time than that of Next, we synthesized methyl N-methylanthranilate.
anthranilate. Reaction products from methanol and ethanol Synthesis of methyl N-methylanthranilate can be achieved

J. Microbiol. Biotechnol.
 Biological Synthesis of Anthranilate Derivatives 843

In order to test this, methyl anthranilate was fed to E. coli

cells harboring pE-NMT. We found that only 10% of
methyl anthranilate was converted into methyl N-methyl
anthranilate (data not shown). On the other hand, when
N-methylanthranilate along with methanol was fed to E. coli
harboring pC-AMAT-pqsA, most of the N-methylanthranilate
was converted into methyl N-methylanthranilate. These
results indicated that the strain B-MMA1 synthesized more
methyl N-methylanthranilate; less synthesis of anthranilate
in the strain B-MMA1 led to the conversion of the
synthesized anthranilate into N-methylanthranilate or methyl
anthranilate, and then these were converted to methyl
N-methylanthranilate, although some methyl anthranilate
still remained.
We determined the optimal concentration of alcohol
Fig. 5. Synthesis of methyl N-methylanthranilate in E. coli. (methanol or ethanol) to maximize the synthesis of methyl
A, standard methyl anthranilate; B, standard methyl N- N-methylanthranilate and ethyl N-methylanthranilate. We
methylanthranilate; C, the reaction product from B, MMA1; D, the fed 1%, 3%, 5%, 8%, or 10% alcohol along with N-methyl
reaction product from B, MMA2. mAU: milli absorption unit. anthranilate to E. coli strain B4. The synthesis of alkyl N-
methylanthranilate increased until 5% alcohol was added.
At the concentrations higher than 8 %, the synthesis of
by two routes; the choice depends on the compound first alkyl N-methylanthranilate decreased. This might be due
synthesized, N-methylanthranilate or methyl anthranilate. to the toxic effects of alcohol on E. coli.
Two constructs, pE-trpEG-NMT and pC-AMAT-pqsA were To increase the synthesis of methyl N-methylanthranilate,
transformed into E. coli BL21 (B-MMA1) and B-DR (B- we divided the whole synthesis pathway into two steps; we
MMA2). The synthesis of methyl N-methylanthranilate synthesized N-methylanthranilate using B-DRM1 (Table 1)
was examined in each transformant after feeding methanol. in the first step and then the filtrate of this culture
Both transformants successfully synthesized a new along with methanol was fed to E. coli strain B4 in the
compound that had the same HPLC retention time as that second step to synthesize methyl N-methylanthranilate
of methyl N-methylanthranilate (Fig. 5). The molecular from N-methylanthranilate. Approximately 29.1 mg/l N-
mass of the synthesized compound was 166.0854 Da, which methylanthranilate (approximately 192.6 µM) was synthesized
corresponds with that of methyl N-methylanthranilate. using B-DRM1. The resulting supernatant was mixed with
Also, the MS/MS fragmentation pattern of the synthesized E. coli BL21 harboring pC-AMAT-pqsA along with 5%
compound matched with that of methyl N-methylanthranilate methanol or ethanol. All the N-methylanthranilate was
(Fig. S2). Taken together, methyl N-methylanthranilate was converted into the corresponding alkyl N-methylanthranilate;
successfully synthesized in both the E. coli strains. however, approximately 95.2 µM methyl N-methylanthranilate
Moreover, when ethanol was fed to these strains, ethyl N- could be detected because methyl N-methylanthranilate is
methylanthranilate was synthesized (Fig. S4). volatile.
Notably, B-MMA1 synthesized more methyl N- We successfully synthesized anthranilate derivatives (N-
methylanthranilate than B-MMA2. B-MMA2 accumulated methylanthranilate, methyl anthranilate, ethyl anthranilate,
unreacted products such as N-methylanthranilate and methyl N-methylanthranilate, and ethyl N-methylanthranilate)
methyl anthranilate. B-MMA2 produced more anthranilate, using engineered E. coli strains. Methyl (ethyl) anthranilate
which could be a substrate for either NMT or AMAT. The and methyl (ethyl) N-methylanthranilate were volatile and
conversion to N-methylanthranilate was faster than that to the estimated final yields of these compounds were
methyl anthranilate as shown in Fig. 5D. It was likely somewhat lower than their actual yields. This is the first
that methyl anthranilate was not converted into methyl report of the synthesis of these anthranilate derivatives in
N-methylanthranilate and inhibited the conversion of E. coli and opens a way to synthesize flavoring compounds
N-methylanthranilate into methyl N-methylanthranilate. using engineered E. coli strains.

June 2019 ⎪ Vol. 29 ⎪ No. 6

844 Lee et al.

Acknowledgments 10. Correa E, Quiñones W, Echeverri F. 2016. Methyl-N-

methylanthranilate, a pungent compound from Citrus reticulata
This work was funded by a grant from the Next- Blanco leaves. Pharm. Biol. 54: 569-571.
Generation BioGreen 21 Program (PJ01326001), Rural 11. Fuleki, T. 1972. Changes in the chemical composition of
Concord grapes grown in Ontario during ripening in the
Development Administration, Republic of Korea.
1970 season. Can. J. Plant Sci. 52: 863-868.
12. Avery ML, Decker DG, Humphrey JS, Aronov E, Linscombe SD,
Conflict of Interest Way MO. 1995. Methyl anthranilate as a rice seed treatment
to deter birds. J. Wildl. Manag. 59: 50-56.
The authors have no financial conflicts of interest to 13. Cummings JL, Avery ML, Pochop PA, Davis Jr. JE, Decker DG,
declare. Krupa HW, et al. 1995. Evaluation of a methyl anthranilate
formulation for reducing bird damage to blueberries. Crop.
References Prot. 14: 257-259.
14. Rohde B, Hans J, Martens S, Baumert A, Hunziker P,
1. Balderas-Hernández VE, Sabido-Ramos A, Silva P, Cabrera- Matern U. 2008. Anthranilate N-methyltransferase, a branch-
Valladares N, Hernández-Chávez G, Báez-Viveros JL, et al. point enzyme of acridone biosynthesis. Plant J. 53: 541-553.
2009. Metabolic engineering for improving anthranilate 15. Wang J, De Luca V. 2005. The biosynthesis and regulation
synthesis from glucose in Escherichia coli. Microb. Cell Fact. of biosynthesis of Concord grape fruit esters, including
8: 19. ‘foxy’ methylanthranilate. Plant J. 44: 606-619.
2. Radwanski ER, Last RL.1995. Tryptophan biosynthesis and 16. Coleman JP, Hudson LL, McKnight SL, Farrow JM, Calfee
metabolism: biochemical and molecular genetics. Plant Cell MW, Lindsey CA, et al. 2008. Pseudomonas aeruginosa PqsA is
7: 921-934. an anthranilate-coenzyme A ligase. J. Bacteriol. 190: 1247-1255.
3. Kutchan TM. 1995. Alkaloid biosynthesis-The basis for 17. Jeandet P, Vasserot Y, Chastang T, Courot E. 2013.
metabolic engineering of medicinal plants. Plant Cell 7: Engineering microbial cells for the biosynthesis of natural
1059-1070. compounds of pharmaceutical significance. BioMed Res. Int.
4. Pillet J, Chambers AH, Barbey C, Bao Z, Plotto A, Bai J, et 2013: 13.
al. 2017. Identification of a methyltransferase catalyzing the 18. Song MK, Lee SJ, Kang YY, Lee Y, Mok H, Ahn J-H. 2017.
final step of methyl anthranilate synthesis in cultivated Biological synthesis and anti-inflammatory activity of
strawberry. BMC Plant Biol. 17: 147. arylalkylamine. Appl. Biol. Chem. 60: 597-602.
5. Radulović NS, Miltojević AB, McDermott M, Waldren S, 19. Lee SJ, Sim GY, Kang H, Yeo WS, Kim B-G, Ahn J-H. 2018.
Parnell JA, Pinheiro MMG, et al. 2011. Identification of a Synthesis of avenanthramides using engineered Escherichia
new antinociceptive alkaloid N-methylantranilate from the coli. Microb. Cell Fact. 17: 46.
essential oil of Choisya ternate Kunth. J. Ethnopharmacol. 135: 20. Choo HJ, Kim EJ, Kim SY, Lee Y, Kim B-G, Ahn J-H. 2018.
610-619. Microbial synthesis of hydroxytyrosol and hydroxysalidroside.
6. Moio L, Etievant PX. 1995. Ethyl anthranilate, ethyl cinnamate, Appl. Biol. Chem. 61: 295-301.
2,3-dihydrocinnamate, and methyl anthranilate: four important 21. Kim M, Kim H, Lee W, Lee Y, Kwon SW, Lee J. 2015.
odorants Identified in Binot Noir Wines of Burgundy. Am. J. Quantitative shotgun proteomics analysis of rice anther
Enol. Viticult. 46: 392-398. proteins after exposure to high temperature. Int. J. Genomics
7. Chambers AH, Evans SA, Folta KM. 2013. Methyl anthranilate 2015: 238704.
and γ-decalactone inhibit strawberry pathogen growth and 22. Pittard AJ, Davidson BE. 1991. TyrR protein of Escherichia
achene germination. J. Agri. Food Chem. 61: 12625-12633. coli and its role as repressor and activator. Mol. Microbiol.
8. Clark L, Shah PS, Mason JR. 1991. Chemical repellency in 5: 1585-1592.
birds: relationship between chemical structure and avoidance 23. Shoeman R, Redfield B, Coleman T, Greene RC, Smith AA,
response. J. Exp. Zool. 260: 310-322. Brot N, et al. 1985. Regulation of methionine synthesis in
9. Radulović NS, Miltojević AB, Randjelović PJ, Stojanović NM, Escherichia coli: effect of metJ gene product and S-
Boylan F. 2013. Effects of methyl and isopropyl N- adenosylmethionine on the expression of the metF gene.
methylanthranilates from Choisya ternata Kunth (Rutaceae) Proc. Natl. Acad. Sci. USA 82: 3601-3605.
on experimental anxiety and depression in mice. Phytother.
Res. 27: 1334-1338.

J. Microbiol. Biotechnol.