Base Editing of Hematopoietic Stem Cells Rescues Sickle Cell Disease in Mice

HHS Public Access
Author manuscript
Nature. Author manuscript; available in PMC 2022 January 01.
Author Manuscript
Published in final edited form as:

Nature. 2021 July ; 595(7866): 295–302. doi:10.1038/s41586-021-03609-w.
Base editing of hematopoietic stem cells rescues sickle cell

disease in mice
Gregory A. Newby#1,2,3, Jonathan S. Yen#4,*, Kaitly J. Woodard#4, Thiyagaraj
Mayuranathan#4, Cicera R. Lazzarotto4, Yichao Li4, Heather Sheppard-Tillman5, Shaina N.
Porter5, Yu Yao4, Kalin Mayberry4, Kelcee A. Everette1,2,3, Yoonjeong Jang4, Christopher J.
Podracky1,2,3, Elizabeth Thaman7, Christophe Lechauve4, Akshay Sharma8, Jordana M.
Author Manuscript
Henderson9, Michelle F. Richter1,2,3, Kevin T. Zhao1,2,3, Shannon M. Miller1,2,3, Tina

Wang1,2,3, Luke W. Koblan1,2,3, Anton P. McCaffrey9, John F. Tisdale10, Theodosia A.
Kalfa6,11, Shondra M. Pruett-Miller5, Shengdar Q. Tsai4, Mitchell J. Weiss4,*, David R.
Liu1,2,3,*
1MerkinInstitute of Transformative Technologies in Healthcare, Broad Institute of Harvard and
MIT, Cambridge, Massachusetts, USA
2Department of Chemistry and Chemical Biology, Harvard University, Cambridge, Massachusetts,
USA
3Howard Hughes Medical Institute, Harvard University, Cambridge, Massachusetts, USA
4Department of Hematology, St. Jude Children’s Research Hospital, Memphis, Tennessee, USA
5Department of Cell and Molecular Biology, St. Jude Children’s Research Hospital, Memphis,
Author Manuscript
Tennessee, USA
6Department of Pathology, St. Jude Children’s Research Hospital, Memphis, Tennessee, USA
7Divisionof Hematology, Cancer and Blood Diseases Institute, Cincinnati Children’s Hospital
Medical Center, Cincinnati, Ohio, USA
*
Correspondence to: D.R.L. ([email protected]), M.J.W. ([email protected]), J.S.Y. ([email protected]).
Contributions
G.A.N., J.S.Y., K.J.W., T.M., C.R.L., Y.L., H.S-T., S.N.P., Y.Y., K.M., K.A.E., Y.J, C.J.P., E.T., C.L., and A.K. conducted experiments
and analyzed data. J.M.H, M.F.R, K.T.Z, S.M.M, T.W., L.W.K., and J.F.T. prepared materials and provided conceptual assistance,
G.A.N., J.S.Y., K.J.W, M.J.W., and D.R.L. wrote the manuscript with input from all authors. J.S.Y., A.P.M., T.A.K., S.Q.T., S.M.P.-M.,
Author Manuscript
M.J.W., and D.R.L. supervised this study.

Competing interests
Authors have filed patent applications on base editing through the Broad Institute. D.R.L. is a consultant and equity owner of Beam
Therapeutics, Prime Medicine, and Pairwise Plants, companies that use genome editing. M.J.W. is on advisory boards for Cellarity
Inc., Novartis, and Forma Therapeutics, and is an equity owner of Beam Therapeutics. A.S. is a consultant for Spotlight Therapeutics
and his institution receives clinical trial support for the conduct of sickle cell disease gene editing trials from Vertex Pharmaceuticals,
CRISPR Therapeutics, and Novartis. J.S.Y is an equity owner of Beam Therapeutics. The authors declare no competing non-financial
interests.
Data Availability
HTS sequencing files can be accessed using the NCBI SRA (PRJNA725249).
Code Availability
The code used to conduct off-target quantification and the statistical analysis is available here: https://github.com/tsailabSJ/
MKSR_off_targets.
Supplementary Information is available in the online version of the paper.
Newby et al. Page 2
8Department of Bone Marrow Transplantation and Cellular Therapy, St Jude Children’s Research
Author Manuscript
Hospital, Memphis, Tennessee, USA

9TriLink BioTechnologies, San Diego, California, USA
10Molecular and Clinical Hematology Branch, National Heart, Lung, and Blood Institute/National
Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda,
Maryland, USA
11Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, Ohio, USA
# These authors contributed equally to this work.
Summary
Sickle cell disease (SCD) is caused by a mutation in the β-globin gene HBB1. We used a custom
adenine base editor (ABE8e-NRCH)2,3 to convert the SCD allele (HBBS) to Makassar β-globin
Author Manuscript
(HBBG), a non-pathogenic variant4,5. Ex vivo delivery of mRNA encoding base editor with a
targeting guide RNA into hematopoietic stem and progenitor cells (HSPCs) from SCD patients
resulted in 80% HBBS-to-HBBG conversion. Sixteen weeks after transplantation of edited human
HSPCs into immunodeficient mice, HBBG frequency was 68% and bone marrow reticulocytes
demonstrated a 5-fold decrease in hypoxia-induced sickling, indicating durable editing. To assess
the physiological effects of HBBS base editing, we delivered ABE8e-NRCH and guide RNA into
HSPCs from a humanized SCD mouse6, followed by transplantation into irradiated mice. After
sixteen weeks, Makassar β-globin represented 79% of β-globin protein in blood and hypoxia-
induced sickling was reduced 3-fold. Mice receiving base-edited HSPCs showed rescue of
hematologic parameters to near-normal levels and reduced splenic pathology compared to
unedited controls. Secondary transplantation of edited bone marrow confirmed durable editing of
long-term hematopoietic stem cells and revealed that ≥20% HBBS-to-HBBG editing is sufficient
Author Manuscript
for phenotypic rescue. Base editing of human HSPCs avoided p53 activation and larger deletions
observed following Cas9 nuclease treatment. These findings suggest a one-time autologous
treatment for SCD that eliminates pathogenic HBBS, generates benign HBBG, and minimizes
undesired consequences of double-strand DNA breaks.
Sickle-cell disease is an autosomal recessive disorder caused by mutation of HBB, which

normally encodes adult β-globin (βA) (Fig. 1a). At low oxygen concentrations, the mutant β-
globin (βS) causes hemoglobin polymerization within red blood cells (RBCs), resulting in
characteristic sickle-shaped RBCs and a cascade of hemolysis, inflammation, and
microvascular occlusions. Symptoms include anemia, severe acute and chronic pain,
immunodeficiency, multi-organ failure and early death1. While allogeneic hematopoietic
stem cell (HSC) transplantation can cure SCD, optimally matched donors are usually not
Author Manuscript
available and the procedure can result in graft rejection or graft-versus-host disease
(Supplementary References).
Ex vivo modification of autologous HSCs to circumvent the deleterious effects of the SCD
mutation underlies several experimental therapies7–9 (Supplementary References).
Approaches showing early clinical promise include ectopic expression of an anti-sickling β-
like globin gene by lentiviral vectors10 or induction of fetal hemoglobin (HbF) by

Newby et al. Page 3
suppression11 or Cas9-mediated disruption12 of BCL11A. Lentiviral vectors carry risks of

Author Manuscript
insertional mutagenesis, however, and may not effectively suppress the expression of
pathological βS. Genetic manipulation to induce HbF expression does not eliminate βS, and
when mediated by double-stranded DNA breaks (DSBs), carries risks associated with
uncontrolled mixtures of indels, translocations, loss of large chromosomal segments,
chromothripsis, and p53 activation13–18 (Supplementary References). Cas9 nuclease-
mediated homology-directed repair (HDR) can correct HBBS but is difficult to achieve
efficiently in repopulating HSCs19,20 and also requires DSBs. Eliminating the root cause of
SCD by converting the HBBS allele to a benign variant without introducing DSBs could
overcome these limitations.
Adenine base editors (ABEs) convert targeted A•T base pairs to G•C in living cells without
requiring DSBs or donor DNA templates, and with minimal indel formation2. In SCD, the
GAG (Glu) codon encoding amino acid 6 of β-globin is mutated to GTG (Val). While
Author Manuscript
adenine base editing cannot revert this mutation, it can convert the pathogenic codon to
GCG (Ala), resulting in a naturally occurring, non-pathogenic variant termed Hb-Makassar
(HBBG)3–5,21,22 (Fig. 1a).
We generated a novel ABE (ABE8e-NRCH) that converts the SCD allele to the non-
pathogenic HBBG Makassar allele with minimal non-silent bystander edits in patient CD34+
HSPCs. Edited HSPCs were durable after engraftment in mice, with an HBBG frequency of
68% 16 weeks after transplantation and markedly reduced sickling in derived erythroid cells.
To assess phenotypic rescue, we edited HSPCs from a mouse SCD model6 in which
endogenous β-globin genes were replaced by human HBBS and transplanted these edited
HSPCs into irradiated adult recipient mice. Primary and secondary transplantation of edited
mouse HSPCs confirmed editing in long-term HSCs and restored hematologic parameters to
Author Manuscript
near-normal levels. These findings highlight autologous ex vivo base editing and
transplantation of HSCs as a potential one-time treatment for SCD.
Results
HBBS base editing in HSPCs
The HBBS mutation can be targeted by base editing using a phage-assisted continuous
evolution (PACE)-generated Cas9-NRCH3 that recognizes a CACC protospacer-adjacent
motif (PAM) (Fig. 1a). Separately, we used PACE to evolve TadA-8e, a deoxyadenosine
deaminase that supports high base editing efficiencies2. We combined TadA-8e with Cas9-
NRCH nickase to generate ABE8e-NRCH. Co-delivery of ABE8e-NRCH and the HBBS-
targeting single guide RNA (sgRNA) to homozygous HBBS HEK293T cells by plasmid
Author Manuscript
lipofection achieved 58% HBBS-to-HBBG conversion (Extended Data Fig. 1a).
Next, we used ABE8e-NRCH to edit human HSPCs ex vivo via electroporation of either the
ABE8e-NRCH+sgRNA ribonucleoprotein (RNP) or ABE8e-NRCH mRNA with sgRNA.
ABE8e-NRCH RNP electroporated into plerixafor-mobilized peripheral blood CD34+
HSPCs cells from three SCD patient donors resulted in 44±5.9% HBBS-to-HBBG editing,
1,2±0.33% indels, and <0.5% other missense alleles after 6 days. Electroporating ABE8e-
NRCH mRNA and sgRNA into the same cells resulted in 80±2.1% HBBS-to-HBBG

Newby et al. Page 4
conversion, 2.8±0.50% indels, and <2% other missense bystander alleles (Fig. 1b, Extended
Author Manuscript
Data Fig. 1b–c). Thus, introduction of ABE8e-NRCH RNP or mRNA using a clinically
relevant delivery method can convert HBBS to HBBG in HSPCs efficiently and with few
byproducts.
SCD patient HSPCs edited with ABE8e-NRCH mRNA or RNP were differentiated ex vivo
into late-stage erythroid precursors (Extended Data Fig. 2, Supplementary Table 1).
Quantification of β-like globin proteins by high-performance liquid chromatography
(HPLC) showed that unedited SCD patient cells contained 87±1.3% βS and no detectable βG
(Extended Data Fig. 3), while base-edited cells contained 72±3.0% βG and 17±3.0% βS, a
5.1-fold decrease of the pathogenic βS protein (Fig. 1c). These findings show that ABE8e-
NRCH-mediated editing of HBBS results in substantial production of βG and concomitant
loss of βS protein.
Author Manuscript
To assess the effects of editing on sickling, purified reticulocytes from ex vivo differentiation
of unedited or ABE8e-NRCH-edited SCD patient CD34+ cells were incubated in 2% O2.
Editing reduced sickling frequency from 47.7% to 16.3%, (Fig. 1d–e), confirming that
HBBS-to-HBBG conversion reduces sickling. Reticulocytes differentiated from cells treated
with ABE8e-NRCH RNP showed similar results but with lower efficiencies (Fig. 1c–e).
To determine whether base editing alters erythropoiesis, we used flow cytometry to track the
expression of cell-surface maturation markers CD49d, CD235a, and Band3 and used a
Hoechst stain to track enucleation. No differences in the expression of these markers were
observed between edited and unedited cells (Extended Data Fig. 2), suggesting that editing
with ABE8e-NRCH does not alter erythropoiesis.
Genome-wide off-target analyses

Author Manuscript
We used both computational and experimental methods to extensively characterize off-target

editing from ABE8e-NRCH and sgRNA treatment (Fig. 1f and Supplementary Discussion).
The Cas-OFFinder algorithm23 identified 140 NRCH PAM-containing human genomic sites
containing three or fewer mismatches to the target protospacer. We also performed CIRCLE-
seq24, a highly sensitive experimental off-target identification method, to detect where Cas9-
NRCH, complexed with the HBBS-targeting sgRNA, cleaves purified human genomic DNA
in vitro. CIRCLE-seq identified 601 candidate off-target sites (Supplementary Table 2). The
140 sites nominated by Cas-OFFinder and the 601 sites nominated by CIRCLE-seq shared
only 16 sites in common.
Of the 725 candidate off-target sites, 697 were amenable to multiplex targeted DNA
sequencing in SCD patient CD34+ HSPCs treated with ABE8e-NRCH (Supplementary
Author Manuscript
Discussion). We detected point mutations consistent with adenine base editing at 7.8%
(54/697) of the sequenced sites. All 54 verified sites were candidates identified by CIRCLE-
seq; five were also identified by Cas-OFFinder (Fig. 1f, Extended Data Figs. 4–5,
Supplementary Table 2), highlighting the importance of experimental identification of off-
target sites. Off-target activity fell predominantly in intergenic and intronic regions. One off-
target site was in the promoter region of CCDC85B and four were in exons (Fig. 1g), all of

Newby et al. Page 5
which led to silent mutations (Supplementary Table 2). Off-target sites in UTRs were all
Author Manuscript
>500 bp from any coding region.
As anticipated, off-target editing from RNP was lower than that of mRNA, likely due to
shorter duration of exposure or lower editing activity2 (Fig. 1h, Extended Data Figs. 4–5).
Indel frequencies were <2% at all off-target sites (Extended Data Fig. 5). Collectively, these
findings from extensive genome-wide off-target analyses of ABE8e-NRCH base-edited SCD
patient HSPCs did not reveal off-target mutations of anticipated clinical relevance.
Transplantation of human HSPCs into mice

We next examined whether delivery of ABE8e-NRCH into SCD patient CD34+ cells can
convert HBBS to HBBG in HSCs that repopulate bone marrow in an animal. CD34+ HSPCs
from three SCD patients were edited by electroporation of ABE8e-NRCH and sgRNA in
RNA or RNP forms. After 24 hours, the resulting six sets of edited HSPCs and a set of
Author Manuscript
unedited control cells from each donor were each transplanted via tail-vein injection into 3-5
immunodeficient NOD B6.SCID II2rγ−/−KitW41/W41 (NBSGW) mice25. Sixteen weeks after
infusion, when persisting human cells are thought to be generated from bone marrow-
repopulating HSCs capable of sustaining a hematopoietic system25, we extracted bone
marrow for analysis (Fig. 2a).
The disruption of targeted genes through DSBs or deletion can alter engraftment and
maintenance of certain lineages (Supplementary References). To determine how base editing
HBBS affects differentiation potential and lineage survival, we assessed the human
hematopoietic lineages present in recipient mouse bone marrow after transplantation. Flow
cytometry using an anti-human CD45 antibody revealed ~70% human cells in bone marrow
from all animals (Fig. 2b). Flow cytometry to quantify the relative abundances of human B-
Author Manuscript
cells (CD19+), myeloid cells (CD33+), T-cells (CD3+), and erythroid cells (CD235a+)
revealed equivalent proportions of each lineage in mice receiving unedited or edited cells
(Fig. 2c, 2d, Supplementary Fig. 1), indicating that the engraftment and differentiation
potential of CD34+ cells was not altered by base editing.
To examine the possibility of skewed hematopoiesis from base editing, we used human
lineage-specific antibodies to purify donor-derived mononuclear cells (“total bone marrow”;
CD45+), B-cells (CD19+), myeloid cells (CD33+), HSPCs (CD34+) and erythroblasts
(CD235a+) from mouse bone marrow (Supplementary Fig.1). HTS of the targeted genomic
region revealed that all isolated populations contained the HBBS-to-HBBG edit at similar
frequencies (68±6.6%–69±5.7%, Fig. 2e), suggesting that this allele proportion was
maintained in HSCs and in their differentiated progeny. Collectively, these results indicate
Author Manuscript
that ABE8e-NRCH-mediated conversion of HBBS to HBBG in repopulating HSCs does not

impede their engraftment or multipotency.
Human CD235a+ erythroblasts and reticulocytes isolated from the bone marrow of two mice
transplanted with ABE-treated or untreated SCD patient cells were purified by magnetic-
activated cell sorting (MACS) (Extended Data Fig. 6) and subjected to single-cell RNA-seq
to determine clonal editing outcomes. An average of 46.5% of cells were edited in only one
HBBS allele, 40.6% were edited in both alleles, and 12.9% of cells were unedited (Fig. 2f).

Newby et al. Page 6
Base editing decreased the fraction of βS from 96±0.28% of total β-like globin protein to
40±2.3% in CD235a+ cells. βG was undetectable in unedited cells but accounted for
Author Manuscript
58±2.8% of β-like globin after base editing (Fig. 2g). Human erythroid cells derived from
edited HSPCs showed a 5-fold reduction in sickling compared to unedited control cells (Fig.
2h–i). Editing using RNP resulted in similar effects but was less efficient (Extended Data
Fig. 7). Collectively, these data indicate that base-edited SCD donor-derived HSCs can
repopulate the hematopoietic system and generate erythroid cells with greatly reduced
propensity for hypoxic sickling.
Transplantation of mouse HSPCs into mice

Studying the physiological rescue of SCD phenotypes by transplantation of human cells into
mice is difficult due to the short lifetime of circulating human RBCs in mice25. To evaluate
physiological phenotypes, we edited Lin− HSPCs from the Townes SCD mouse model in
which endogenous adult α- and β-like globin genes are replaced by human globin genes,
Author Manuscript
resulting in SCD phenotypes6. Mice harboring one normal and one SCD HBB allele
(HBBA/S) model heterozygous “sickle-cell trait,” which is largely asymptomatic in this
mouse model (Supplementary Table 3) and in humans.
We electroporated ABE8e-NRCH RNP into HBBS/S HSPCs from Townes mice followed by
transplantation into irradiated adult recipient mice 24 hours later. Unedited HBBS/S and
HBBA/S HSPCs were used as disease and healthy controls, respectively. Since donor mice
cells express CD45.2, while recipient cells express CD45.1, they are distinguishable by
allele-specific antibodies (Fig. 3a, Supplementary Table 1)6. We collected blood at 6, 10, 14,
and 16 weeks post-transplantation to track engraftment and β-globin content.
CD45.2 expression revealed that donor engraftment was >90% in all mice 10 weeks post-
Author Manuscript
transplantation (Extended Data Fig. 8a). Engraftment of edited and control donor HSPCs
progressed similarly, suggesting that editing did not alter transplanted HSC fitness. Pre-
transplantation HBBS-to-HBBG editing efficiency measured 3 days after electroporation was
53±4.5% (Fig. 3b). Editing levels in genomic DNA from whole blood in animals 16 weeks
post-transplantation showed 44±11% HBBG allele frequency. As we observed with human
HSPCs (Fig. 2e), the modest decrease in HBBG allele frequency after 16 weeks of
engraftment could arise if repopulating HSCs are less amenable to electroporation or base
editing than other cell types within the HSPC population. A clonal analysis of colonies from
bone marrow cells after mouse sacrifice revealed that 40±15% of cells were edited in both
HBBS alleles, and 36±12% in only one allele, while 24±3.2% of cells were unedited
(Extended Data Fig. 8b).
Author Manuscript
To measure the effect of base editing on hemoglobin composition in circulating RBCs, we

analyzed peripheral blood cell lysates from each time point. On average, βG made up
75-82% of total β-like globin protein in mice receiving edited HBBS/S HSPCs, with little
fluctuation throughout the experiment (Fig. 3c). The enrichment of βG over the observed
editing efficiency (79% vs. 44% at 16 weeks) likely reflects the increased lifetime of βG-
containing RBCs. We also found no difference in oxygen binding in blood from mice
receiving unedited HBBS/S cells, HBBA/S cells, or edited HBBS/S cells 14 weeks after

Newby et al. Page 7
transplantation, suggesting that βG-containing hemoglobin binds oxygen normally

Author Manuscript
(Extended Data Fig. 8c).
Rescue of SCD in transplanted mice

Complete blood counts were performed on mice transplanted with edited (n=6) or unedited
(n=6) mouse HBBS/S HSPCs, as well as mice transplanted with unedited HBBA/S cells
(n=2) and non-transplanted mice with an HBBA/S genotype (n=5) serving as two types of
healthy controls (Fig. 3d–g, Supplementary Table 3). Compared to healthy controls, mice
that received unedited mouse HBBS/S HSPCs showed disruptions in total hemoglobin
concentration and cell counts of reticulocytes, RBCs, and white blood cells (WBC) (Fig. 3d–
g), abnormalities consistent with hemolytic anemia and inflammation in SCD patients6.
Importantly, transplantation of base-edited HBBS/S HSPCs rescued the hematological
defects of SCD, restoring all tested blood parameters to levels similar to those of healthy
Author Manuscript
controls (Fig. 3d–g).
To assess the consequence of base editing on circulating RBC morphology, we analyzed

blood from mice 16 weeks after transplantation (Extended Data Fig. 9a). Expected
morphological abnormalities were observed among RBCs of mice that received unedited
HBBS/S cells, including abundant oblong sickle forms, polychromasia reflecting
reticulocytosis, and fragmentation. RBCs of mice transplanted with HBBS-to-HBBG edited
HSPCs showed a reduction in all pathologic morphologies and were more similar to RBCs
of healthy HBBA/S controls. Separately, blood was incubated in 2% O2 to induce sickling
(Extended Data Fig. 9b–c). RBCs from mice transplanted with unedited HBBS/S HSPCs
showed 86.3±3.0% sickling, compared to 29.8±6.5% sickling in RBCs from mice
transplanted with base-edited HBBS/S HSPCs, a 2.9-fold decrease. These data establish that
transplantation of edited HBBS/S HSPCs leads to durable production of RBCs that are
Author Manuscript
resistant to sickling both in vivo and in vitro after exposure to hypoxia.
Enlarged spleen is a hallmark symptom of young SCD patients and mouse models6. The
average spleen mass of mice receiving edited HBBS/Scells was 0.22±0.043 g, compared to
0.39±0.016 g in mice receiving unedited HBBS/S cells and 0.11±0.007 g in mice receiving
HBBA/S cells (Extended Data Fig. 9d). Average spleen mass was thus restored by 61%
towards that of healthy controls in animals receiving base edited HSPCs (Fig. 3h). RBC
pooling and extramedullary erythropoiesis in the spleen were also largely corrected in mice
receiving edited HBBS/S cells (Extended Data Fig. 9e). Taken together, the persistence of
ABE8e-NRCH-mediated HBBS-to-HBBG editing in bone marrow-repopulating HSCs and
the partial or complete rescue of every examined SCD phenotype suggest that ex vivo base
editing of HBBS in HSPCs followed by transplantation can alleviate SCD.
Author Manuscript
Secondary transplant dose-dependent rescue

We performed secondary transplantations to confirm editing of long-term repopulating
HSCs and determine the level of HBBS-to-HBBG base editing required to rescue SCD
hematological abnormalities. Following primary transplantation of mouse HSPCs described
above, bone marrow extracted from one recipient mouse had an HBBG allele frequency of
39%. This bone marrow was mixed at ratios of 0:100, 20:80, 40:60, 60:40, 80:20, and 100:0

Newby et al. Page 8
with bone marrow from a mouse that had been transplanted 16 weeks earlier with unedited
HBBS/S Lin− HSPCs. Each mixture was transplanted separately into three irradiated
Author Manuscript
C57/BI6 mice (Fig. 4a). Sixteen weeks after secondary transplantation, peripheral blood was
collected to assess engraftment (Fig. 4b), HBBG allele frequency and hematologic
phenotypes.
Mice receiving mixtures containing ≥60% marrow from the recipients of edited HSCs
maintained HBBG allele frequencies of >20% following secondary transplant (Fig. 4c). In
these mice, βG protein represented >70% of all β-like globins in blood (Fig. 4d), and
hematologic parameters were similar to those of healthy HBBA/S and HBBA/A mice (Fig.
4e–h). Together, these results demonstrate durable base editing of long-term repopulating
mouse HSCs and show that an HBBG allele frequency of ~20% in engrafted cells is
sufficient to rescue hematologic phenotypes, a threshold substantially exceeded by the base
editing strategy in this study.
Author Manuscript
Effects of nuclease and ABE treatment

Induction of HbF via Cas9 nuclease-mediated disruption of an erythroid BCL11A enhancer
is in clinical trials for the treatment of SCD and β-thalassemia12. Nuclease-mediated DSBs
have been reported to stimulate DNA damage responses that can enrich oncogenic cells16,18,
and to cause large DNA deletions or rearrangements that are difficult to detect by standard
amplicon sequencing14,15. To compare DNA damage responses following ABE8e-NRCH or
Cas9 treatment in HSPCs, we performed reverse transcription and droplet digital PCR
(ddPCR) to measure CDKN1 (P21) expression, a readout of the p53-mediated DNA damage
response (Extended Data Fig. 10a). We assessed untreated cells, cells electroporated with
ABE8e-NRCH mRNA and sgRNA, cells electroporated with Cas9 nuclease RNP targeting
the BCL11A enhancer, or cells electroporated with no cargo. HSPCs from a healthy donor
Author Manuscript
were used and thus the sgRNA delivered with ABE8e-NRCH was altered by one nucleotide
to match the wild-type HBB locus.
Nuclease-treated cells showed 2.7-fold higher average CDKN1 transcript levels 6 hours after
treatment, and 4.2-fold higher levels after 48 hours, compared to control cells electroporated
with no cargo (Extended Data Fig. 10a). In contrast, cells treated with base editor did not
induce CDKN1 transcription beyond that of the no-cargo control cells. Six days after
electroporation, DNA sequencing revealed 84±1.8% indels at the BCL11A locus in Cas9
RNP-treated cells and 64±5.2% adenine base editing at HBB protospacer position 9 in
ABE8e-NRCH treated cells (Extended Data Fig. 10b).
To detect long deletions or rearrangements at the targeted loci that may be missed by
Author Manuscript
standard amplicon sequencing14,15, we conducted ddPCR to quantify the amount of each

target genomic locus 6 days after electroporation. Primers and probes for BCL11A were
designed to hybridize outside the range of deletions previously described for Cas9-mediated
editing at this locus, so only longer deletions or DNA rearrangements should cause apparent
target locus loss. No change in HBB allele quantification was observed following base editor
treatment (Extended Data Fig. 10c), but BCL11A allele quantification decreased by 14%
following Cas9 nuclease treatment (Extended Data Fig. 10d) relative to non-targeted ACTB,
suggesting long deletions or rearrangements occurred in at least 14% of BCL11A alleles.

Newby et al. Page 9
This frequency is consistent with recent findings in edited human embryos26. Together, these
results are concordant with previous findings14 and suggest that base editor treatment of
Author Manuscript
human HSPCs causes less p53 pathway stimulation and fewer large target site perturbations
than Cas9 nuclease treatment.
Discussion
We describe a bespoke ABE that directly converts the major SCD allele to a β-globin variant
that is non-pathogenic, even in homozygous4 or hemizygous21 form. This base editing
strategy occurred efficiently (up to 80% editing in HSPCs and 68% in bone marrow-
repopulating HSCs), with minimal bystander edits or indels, and yielded non-sickling RBCs
without disruption of globin gene regulation or hematopoiesis.
Several approaches for autologous therapies to treat SCD are being tested in the
Author Manuscript
clinic7,8,10–12. It is not yet known which strategy is safest or most effective. However, the
base editing approach demonstrated here offers several potential advantages. First,
elimination of the disease-causing mutation by precise HBBS-to-HBBG editing may reduce
RBC sickle hemoglobin concentration, the primary determinant of pathogenic hemoglobin
polymerization, more effectively than lentiviral β-like globin expression or induction of
HbF, both of which leave HBBS alleles intact. While the latter approaches can decrease the
fraction of βS in erythroid progeny by 30-70%27,28, we achieved even greater βS reduction
in erythroid populations by base editing HBBS.
Second, base editing largely avoids DSBs generated by nucleases, which lead to
uncontrolled mixtures of indels at the target site as well as large deletions, translocations,
chromosomal loss, chromothripsis, and p53 DNA damage response activation13–18
(Supplementary References). Treatment of HSPCs with ABE8e-NRCH did not lead to
Author Manuscript
detected p53 response or large deletions, in contrast to treatment with Cas9 nuclease
(Extended Data Fig. 10).
Third, base editing does not require DNA delivery, a requirement for gene therapy or HDR.
The introduction of DNA can lead to toxicity and insertional mutagenesis (Supplementary
References). In contrast, base editing using mRNA or RNP directly converts pathogenic
HBBS into a non-pathogenic allele with no exogenous DNA requirement.
We examined potential undesired consequences of base editing HSPCs. Base editors can
cause bystander editing of nearby nucleotides. In this study, minimal non-synonymous
bystander edits were observed (<2%) due to careful positioning of the bespoke ABE at a
CACC PAM3 (Fig. 1a, Extended Data Fig. 1c). Spurious editing of RNA can occur29 but is
Author Manuscript
short-lived when base editor mRNA or RNP is used, and did not appear to affect
repopulation, viability, or differentiation of HSCs. Off-target base editing can also occur29,
although on-target and off-target base editing in the same cell results in multiple point
mutations that are less likely to be genotoxic than multiple DSBs from on- and off-target
nuclease activity29. Of the 54 identified sites with observed off-target ABE8e-NRCH base
editing in an extensive analysis of 697 computationally and experimentally nominated sites,
no missense mutations or other off-target edits of anticipated consequence were found.

Newby et al. Page 10
Nevertheless, the safety and therapeutic potential of this approach may be further improved
Author Manuscript
by testing alternative deaminase and Cas9 variants shown to minimize Cas-dependent and
Cas-independent off-target base editing, optimizing editing agent dosage, or optimizing
delivery methods2 (Supplementary References). Although HBBG is a naturally occurring
benign variant, further studies are required to better understand the effects of this allele in
combination with HBBS (Supplementary Discussion).
The ex vivo delivery procedure used in this study resembles methods currently used for HSC
editing in clinical trials12. The ABEs were electroporated as mRNA or RNP to minimize the
duration of exposure to the editing agent, reducing off-target editing compared to DNA
delivery2. HSCs were edited using a single electroporation and transplanted into adult
animals after 24 hours to minimize the duration of in vitro culture that can lead to the loss of
HSC engraftment and multipotency. The phenotypic rescue observed following secondary
transplantation of varying proportions of edited and unedited bone marrow establishes that
Author Manuscript
the observed base editing efficiencies substantially exceed the gene correction threshold
needed for therapeutic benefit. Base-edited patient-derived CD34+ cells thus provide a
promising basis for a one-time autologous SCD therapy.
Methods
HEK293T cell culture and editing
HEK293T cells (ATCC CRL-3216) modified to contain the sickle cell allele3 were cultured
in Dulbecco’s modified Eagle’s medium (Corning) supplemented with 10% fetal bovine
serum (ThermoFisher Scientific) and maintained at 37 °C with 5% CO2. Cells were verified
to be free of mycoplasma by PCR test in growth media. Plasmid transfection of base editors
in HEK293T cells has been previously described30–32. HEK293T cells were seeded for
Author Manuscript
plasmid transfection at 20,000 cells per well on 96-well poly-D-lysine plates (Corning) in
the same culture medium. Cells were transfected 24-30 h after plating with 0.5 μL
Lipofectamine 2000 (ThermoFisher Scientific) using 200 ng base editor plasmid and 66 ng
guide RNA plasmid following manufacturer’s instructions. The plasmid encoding the new
ABE8e-NRCH generated for this study was deposited in AddGene (ID# 165416). Cells were
cultured for 3 days following lipofection, then washed with PBS (ThermoFisher Scientific).
Genomic DNA was extracted after removing PBS by addition of 50 μL freshly prepared
lysis buffer (10 mM Tris-HCl, pH 7.5, 0.05% SDS, 25 μg/mL proteinase K (ThermoFisher
Scientific)) directly into each transfected well. The mixture was incubated at 37 °C for 1 h
then heat inactivated at 80 °C for 30 min. One microlitre of this lysate was used as a PCR
template for high-throughput sequencing.
Author Manuscript
High-throughput sequencing of the HBB SCD locus in HEK293T cells

High-throughput sequencing (HTS) of genomic DNA was performed as previously
described 30,31. Primers for amplification of the HBB SCD locus in HEK293T cells were:
GAN162F: 5’-
ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNAGGGTTGGCCAATCTACTC
CC-3’ GAN163R: 5’-
TGGAGTTCAGACGTGTGCTCTTCCGATCTGTCTTCTCTGTCTCCACATGCC-3’.

Underlined sequences represent adapters for Illumina sequencing. Following Illumina

Author Manuscript
barcoding, PCR products were pooled and purified by electrophoresis with a 2% agarose gel
using a Monarch DNA Gel Extraction Kit (New England Biolabs), eluting with 30 μL H2O.
DNA concentration was quantified with Qubit dsDNA High Sensitivity Assay Kit
(ThermoFisher Scientific) and sequenced on an Illumina MiSeq instrument (single-end read,
250–300 cycles) according to the manufacturer’s protocols. Alignment of fastq files and
quantification of editing frequency was performed using CRISPResso233 in batch mode with
a window width of 34 nucleotides.
ABE8e-NRCH mRNA
ABE8e-NRCH mRNA was transcribed in vitro from PCR product using full substitution of
N1-methylpseudouridine for uridine. mRNA was capped co-transcriptionally using
CleanCap AG analog (TriLink Biotechnologies) resulting in a 5’ Cap 1 structure. In vitro
Author Manuscript
transcription reaction was performed as previously described34 with the following changes;
16.5 mM magnesium acetate and 4 mM CleanCap AG were used as the final concentration
during transcription, and mRNAs were purified using RNeasy kit (QIAgen). Mammalian-
optimized UTR sequences (TriLink) and a 120 base poly A tail were included in the
transcribed PCR product.
ABE8e-NRCH protein
RNP delivery of genome editing agents has been previously described and established to
decrease off-target editing activity compared to DNA delivery2,35–39. ABE8e-NRCH protein
was codon optimized for bacterial expression and cloned into the protein expression plasmid
pD881-SR (Atum, Cat. No. FPB-27E-269). This plasmid has been deposited on AddGene
(ID# 165417). The expression plasmid was transformed into BL21 Star DE3 competent cells
Author Manuscript
(ThermoFisher, Cat. No. C601003). Colonies were picked for overnight growth in terrific
broth (TB)+25ug/mL kanamycin at 37 °C. The next day, 2 L of pre-warmed TB were
inoculated with overnight culture at a starting OD600 of 0.05. Cells were shaken at 37 °C for
about 2.5 hours until the OD600 was ~1.5. Cultures were cold shocked in an ice-water slurry
for 1 hour, following which L-rhamnose was added to a final concentration of 0.8% to
induce. Cultures were then incubated at 18 °C with shaking for 24 hours to express protein.
Following induction, cells were pelleted and flash-frozen in liquid nitrogen and stored at −80
degrees. The next day, cells were resuspended in 30 mL cold lysis buffer (1 M NaCl, 100
mM Tris-HCl pH 7.0, 5 mM TCEP, 10% glycerol, with 5 tablets of cOmplete, EDTA-free
protease inhibitor cocktail tablets (Millipore Sigma, Cat. No. 4693132001). Cells were
passed three times through a homogenizer (Avestin Emulsiflex-C3) at ~18,000 psi to lyse.
Cell debris was pelleted for 20 minutes using a 20,000 g centrifugation at 4 °C. Supernatant
Author Manuscript
was collected and spiked with 40 mM imidazole, followed by a 1-hour incubation at 4 °C

with 1 mL of Ni-NTA resin slurry (G Bioscience Cat. No. 786-940, prewashed once with
lysis buffer). Protein-bound resin was washed twice with 12 mL of lysis buffer in a gravity
column at 4 °C. Protein was eluted in 3 mL of elution buffer (300 mM imidazole, 500 mM
NaCl, 100 mM Tris-HCl pH 7.0, 5 mM TCEP, 10% glycerol). Eluted protein was diluted in
40 mL of low-salt buffer (100 mM Tris-HCl, pH 7.0, 5 mM TCEP, 10% glycerol) just before
loading into a 50 mL Akta Superloop for ion exchange purification on an Akta Pure25
FPLC. Ion exchange chromatography was conducted on a 5 mL GE Healthcare HiTrap SP

HP pre-packed column (Cat. No. 17115201). After washing the column with low-salt buffer,
Author Manuscript
the diluted protein was flowed through the column to bind. The column was then washed in
15 mL of low salt buffer before being subjected to an increasing gradient to a maximum of
80% high salt buffer (1 M NaCl, 100 mM Tris-HCl, pH 7.0, 5 mM TCEP, 10% glycerol)
over the course of 50 mL, at a flow rate of 5 mL per minute. 1-mL fractions were collected
during this ramp to high-salt buffer. Peaks were assessed by SDS-PAGE to identify fractions
containing the desired protein, which were concentrated first using an Amicon Ultra 15-mL
centrifugal filter (100-kDa cutoff, Cat. No. UFC910024), followed by a 0.5-mL 100-kDa
cutoff Pierce concentrator (Cat. No. 88503). Concentrated protein was quantified using a
BCA assay (ThermoFisher, Cat. No. 23227).
Isolation and culture of CD34+ human hematopoietic stem and progenitor cells (HSPCs)
Circulating G-CSF–mobilized human mononuclear cells were obtained from deidentified
Author Manuscript
healthy adult donors (Key Biologics, Lifeblood). Plerixafor-mobilized CD34+ cells from
patients with SCD were collected according to the protocol “Peripheral Blood Stem Cell
Collection for Sickle Cell Disease Patients” (ClinicalTrials.gov identifier NCT03226691),
which was approved by the human subject research institutional review boards at the
National Institutes of Health and St. Jude Children’s Research Hospital. We complied with
all relevant ethical regulations and all participants provided informed consent. Enrichment of
CD34+ cells was performed by immunomagnetic bead selection using a CliniMACS Plus or
AutoMACS instrument (Miltenyi Biotec). CD34+ cells were maintained in stem cell culture
media: X-VIVO-10 (Lonza, BEBP02-055Q) media supplemented with 100 ng/μL human
SCF (R&D systems, 255-SC/CF), 100 ng/μL human TPO (R&D systems, 288-TP/CF) and
100 ng/μL human Flt-3 ligand (R&D systems, 308-FK/CF). Cells were seeded and
maintained at a density of between 0.5-1x106 cells/mL.
Author Manuscript
RNP and mRNA electroporation in human HSPCs

Electroporation was performed with an ATX MaxCyte electroporator using electroporation
program HSC3. The modified synthetic sgRNA contained 2′-O-methyl modifications in the
first three and last three nucleotides, and phosphorothioate bonds between the first three and
last three nucleotides40 and was purchased from BioSpring. CD34+ HSPCs were thawed 48
hours before electroporation. mRNA and sgRNA were mixed at a 1:1 weight ratio prior to
electroporation. RNPs were formed at a 1:1.5 ratio of ABE and Makassar sgRNA, and
incubated for 20 minutes at room temperature prior to electroporation. mRNA/sgRNA were
electroporated at 200 μg/mL of mRNA and RNP were electroporated at a final concentration
of 9 μM of protein per reaction. 20-40 million cells/mL were electroporated in 100 μL of
Maxcyte Buffer in OC-100 cartridges for transplantation into NBSGW animals.
Author Manuscript
Electroporated cells were recovered in stem cell culture media composed of X-VIVO 10
media including cytokines (Flt-3 ligand, SCF, and TPO). Cells were maintained in culture at
a density between 0.5-1x106 per mL. Genomic DNA was extracted on culture day 6 using
QuickExtract buffer (Lucigen Cat. No. QE09050) then analyzed by HTS for editing
efficiency.

High-throughput sequencing of the HBB SCD locus in blood cells

Author Manuscript
After editing, the HBB SCD locus was amplified from genomic DNA with oligonucleotide
primers: Forward.LF: 5’-
CTACACGACGCTCTTCCGATCTTGGCCAATCTACTCCCAGGAGCAGG-3’ Reverse.
LR: 5’-CAGACGTGTGCTCTTCCGATCTTCAAAGAACCTCTGGGTCCAAGGGT-3’
Underlined sequences represent adapters for Illumina sequencing. Following Illumina
barcoding, PCR products were pooled and HTS was conducted using a MiSeq or MiniSeq
(Illumina). Sequences were analyzed by joining paired reads and analyzing amplicons for
indels or the desired test sequence using CRIS.py41. Indels were reported as the number of
reads without the WT amplicon length.
Erythroid cell culture

Erythroid differentiation of CD34+ cells was performed using a 3-phase protocol42,43. Phase
Author Manuscript
1 (days 1–7): IMDM (Thermo Fisher Scientific, 12440061) with 2% human blood type AB
plasma (SeraCare, 1810-0001), 3% human AB serum (Atlanta Biologicals, S40110) 1%
penicillin/streptomycin (Thermo Fisher Scientific, 15070063), 3 units/mL heparin (Sagent
Pharmaceuticals, NDC# 25021-401-02), 3 units/mL EPO (Amgen, EPOGEN NDC #
55513-144-01), 200 μg/mL holo-transferrin (Millipore Sigma, T0665, 10 ng/mL human SCF
(R&D systems, 255-SC/CF), and 1 ng/mL human interleukin IL-3 (R&D systems, 203-IL/
CF). Phase 2 (days 8–14): Phase 1 medium without IL-3. Phase 3 (days 15–21): Phase 2
medium without SCF and with holo-transferrin concentration increased to 1 mg/mL. Cells
were maintained daily at a density of 0.1 x 106/mL (phase 1), 0.2 x 106/mL (phase 2) and
1.0 x 106/mL (phase 3)
Erythroblast maturation was monitored by immuno-flow cytometry for the cell surface
Author Manuscript
markers CD235a (BD Pharmingen Cat. No. 559943, 1:100 dilution), CD49d (BioLegend
Cat. No. 304304, 1:20 dilution), and Band3 (Gift from X. An, 1:100 diltuion)
(Supplementary Table 1). To quantify erythroblast enucleation, 1.5–5 × 105 CD34+-derived
erythroid cells were incubated with Hoechst 33342 (Millipore Sigma Cat. No. B2261,
1:1000 dilution) for 20 min at 37 °C, fixed with 0.05% glutaraldehyde, and permeabilized
with 0.1% Triton X-100.
Hemoglobin quantification
High-performance liquid chromatography (HPLC) quantification of individual globin chains
was performed using reverse-phase columns on a Prominence HPLC System (Shimadzu
Corporation). The eluted proteins were identified by light absorbance at 220 nm using a
diode array detector. For quantification of globin content from erythroid cells derived from
in vitro differentiation of human CD34+ cells, the relative amounts of different β-like globin
Author Manuscript
proteins were calculated from the area under the 220-nm peak and normalized according to
the DMSO control. They are expressed as a fraction of the total β-like globins including
normal β (βA ) sickle β (βS), Makassar β (βG), γ, and δ-globin.
In vitro sickling assay

Erythroid cells were incubated with Hoechst 33342 (Millipore Sigma Cat. No. B2261,
1:1000 dilution) for 20 mins at 37°c, Hoechst negative population were sorted using a

SH800 (Sony Biotechnologies). Sorted cells (0.5-1.0 x 105 cells) were seeded into 12 or 96
Author Manuscript
well plate with 1mL or 0.1mL of phase 3 ED media under hypoxic conditions (2% O2) for
24 h. The IncuCyte® S3 Live-Cell Analysis System (Sartorius) with a 20× objective was
used to monitor cell sickling, with images captured after 8 hours. The percentage of sickling
was measured by manual counting of sickled cells versus normal cells based on morphology.
For each sickling assay, >300 cells per condition were counted by researchers blinded to that
condition. For mouse transplantation studies, mouse blood was diluted (1:5000) in RPMI
media and seeded in 6 well plate with 3 mL of RPMI media before imaging in IncuCyte S3.
CIRCLE-seq off-target editing analysis

Genomic DNA from HEK293T cells was isolated using Gentra Puregene Kit (QIAGEN)
according to manufacturer’s instructions. CIRCLE-seq was performed as previously
described24,44. Briefly, purified genomic DNA was sheared with a Covaris S2 instrument to
Author Manuscript
an average length of 300 bp. The fragmented DNA was end repaired, A tailed and ligated to
a uracil-containing stem-loop adaptor, using KAPA HTP Library Preparation Kit, PCR Free
(KAPA Biosystems). Adaptor ligated DNA was treated with Lambda Exonuclease (NEB)
and E. coli Exonuclease I (NEB) and then with USER enzyme (NEB) and T4 polynucleotide
kinase (NEB). Intramolecular circularization of the DNA was performed with T4 DNA
ligase (NEB) and residual linear DNA was degraded by Plasmid-Safe ATP-dependent
DNase (Lucigen). In vitro cleavage reactions were performed with 250 ng of Plasmid-Safe-
treated circularized DNA, 90 nM of Cas9-NRCH protein, Cas9 nuclease buffer (NEB) and
90 nM of synthetic chemically modified sgRNA (BioSpring), in a 100 μl volume. Cleaved
products were A tailed, ligated with a hairpin adaptor (NEB), treated with USER enzyme
(NEB) and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos
for Illumina (NEB), using Kapa HiFi Polymerase (KAPA Biosystems). Libraries were
Author Manuscript
sequenced with 150 bp paired-end reads on an Illumina MiSeq instrument. CIRCLE-seq

data analyses were performed using open-source CIRCLE-seq analysis software and default
recommended parameters (https://github.com/tsailabSJ/circleseq).
CasOFFinder off-target editing analysis

Computational prediction of NRCH PAM-containing potential off-target sites with minimal
mismatches relative to the intended target site (three or fewer mismatches overall, or two or
fewer mismatches allowing G:U wobble base pairings with the guide RNA) was performed
using CasOFFinder 23,45
Targeted amplicon sequencing by rhAmpSeq

On- and off-target sites identified by CIRCLE-seq and CasOFFinder were amplified from
Author Manuscript
genomic from CD34+ donors using rhAMPSeq system (IDT), with primers listed in
Supplementary Table 2. Sequencing libraries were generated according to manufacturer’s
instructions and sequenced with 151-bp paired-end reads on an Illumina NextSeq
instrument.

Quantification of base editing efficiency at evaluated off-target sites

Author Manuscript
The A•T-to G•C editing frequency for each position in the protospacer was quantified using
CRISPRessoPooled (v2.0.41) with quantification_window_size 10,
quantification_window_center −10, base_editor_output, conversion_nuc_from A,
conversion_nuc_to G. The genomic features of all off-target sites were initially annotated
using HOMER (v4.10)46. HOMER does not offer high resolution at regions near junctions
between annotations, so confirmed off-target sites were inspected individually and annotated
using the NCBI Genome Data Viewer. Both HOMER annotations and annotation by
inspection are shown in Supplementary Table 2. The editing frequency for each site was
calculated as the ratio between the number of reads containing the edited base (i.e., G) in a
window from position 4 to 10 of each protospacer (where the NRCH PAM is positions
21-24) within which adenine base editing efficiency is typically maximal29, and the total
number of reads. To calculate statistical significance of off-target editing for the ABE8e-
Author Manuscript
NRCH mRNA or RNP treatments compared to control samples, we applied a Chi-square test
for each of four samples (two donors, each with two replicates). The 2x2 contingency table
was constructed based on the number of edited reads and the number of unedited reads in
treated and control groups. FDR was calculated using the Benjamini/Hochberg method. The
54 reported significant off-targets were called based on: (1) FDR < 0.05 and (2) difference in
editing frequency between treated and control > 0.5% for at least one treatment. The custom
code used to conduct off-target quantification and the statistical analysis is available to
download from this website: https://github.com/tsailabSJ/MKSR_off_targets.
Ethical approval for studies involving mice

All studies utilizing mice were approved by the St. Jude Children’s Research Hospital
Institutional Animal Care and Use Committee under Protocol 579 entitled “Genetic Models
Author Manuscript
for the Study of Hematopoiesis”. Mice were maintained in the St. Jude Children’s Research
Hospital Animal Resource Center according to recommendations in the Guide for the Care
and Use of Laboratory Animals of the National Institutes of Health.
Transplantation of gene-edited CD34+ HSPCs into NOD.Cg-KitW-41J Tyr+ Prkdcscid

Il2rgtm1Wjl/ThomJ (NBSGW) mice
NBSGW mice were purchased from The Jackson Laboratory (stock no. 026622). Cells were
cultured 48 hours after thawing before electroporation, then cultured 24 additional hours
before xenotransplanation. Minimization of time in culture is helpful to maintain
repopulating stem cells47. Base edited or control CD34+ cells were administered at a dose of
0.2×106 per mouse with an IP injection of 10 mg/kg of busulfan (Busulfex; PDL BioPharm)
48 hours before infusion48 or 0.5×106 per mouse with no busulfan preconditioning by tail-
Author Manuscript
vein injection in female mice aged 7-9 weeks. Chimerism post-transplantation was evaluated
at 16-17 weeks in the bone marrow at the time of euthanasia. Cell lineage composition was
determined in the bone marrow by using cell type-specific antibodies (Supplementary Table
1), and lineages were analyzed using the Attune NxT flow cytometer (ThermoFisher) and
sorted using an Aria III cell sorter (BD Biosciences). The antibodies used were: anti-mouse
CD45 (BD Pharmingen Cat. No. 561088, 1:40 dilution), anti-human CD45 (BD Horizon
Cat. No. 564047, 1:20 dilution), anti-human CD33 (BD Biosciences Cat. No. 333946, 1:20

dilution), anti-human CD3 (BD Pharmingen Cat. No. 557832, 1:20 dilution), anti-human
Author Manuscript
CD19 (BD Biosciences Cat. No. 349209, 1:20 dilution), anti-human CD34 (BD Pharmingen
Cat. No. 561440, 1:20 dilution), anti-human CD235a (BD Pharmingen Cat. No. 551336,
1:20 dilution). CD34+ HSPCs or CD235a+ erythroblasts were isolated with magnetic beads,
using the human-specific CD34 MicroBead Kit UltraPure (Miltenyi Biotec Inc., catalog #
130-100-453) and CD235a (glycophorin A) MicroBeads, human, (Miltenyi Biotec Inc.,
catalog # 130-050-501).
Single cell RNA-seq to determine clonal editing outcomes in human CD235a+ cells
CD235a+ cells were sorted from the bone marrow of mice 16 weeks after
xenotransplantation of patient-derived CD34+ HSPCs into NBSGW mice using FACS.
Sorted cells were than analyzed using the Chromium Next GEM Single Cell 5’ Reagent Kit
V2 (dual index) (10x Genomics 1000263) and sequenced on an Illumina NovoSeq following
Author Manuscript
the manufacturer’s protocol. Reads were mapped to hg38 using cellranger (v5.0.1). The
allelic editing was analyzed using the 10x Genomics’ Vartrix tool (v1.1.19) to identify the
genotypes (A/A, A/G, or G/G) at the disease-causing nucleotide, chr11:5227002, with the
following parameters: --out-variants --primary-alignments --umi --out-barcodes --ref-matrix
-s coverage. Cells were filtered out if <100 reads mapped to the first exon of HBB. A cell
was assigned to A/A or G/G if all reads contain the A allele or the G allele, respectively. A
cell was assigned to A/G if at least 100 reads contain the A allele and 100 reads contain the
G allele. The average number of reads per cell mapped to HBB per cell was 3385. 339 cells
from mouse 1 and 274 cells from mouse 2 were included in the analysis.
Base editing and transplantation of Townes Mouse SCD HSPCs

Townes SCD mice were purchased from The Jackson Laboratory (Stock# 013071). This
Author Manuscript
strain harbors the human a-globin locus (HBA1) in place of the orthologous mouse loci
Hba1 and Hba2, and the human γ-globin (HBG1) and β-globin (HBBS or HBBA) loci in
place of the endogenous mouse loci Hbb-b1 and Hbb-b2. Bone marrow mononuclear cells
were obtained by flushing femurs, tibias, hip bones and humeri with IMDM (10% FBS)
followed by RBC lysis (ACK Lysing Buffer). Mixed male and female lineage marker
negative (Lin−) cells enriched for HSPCs were purified by immuno-magnetic bead selection
using the Mouse Lineage Cell Depletion Kit (Miltenyi, 130-090-858). Lin− cells were
cultured in Lineage Negative Media: StemSpan SFEM supplemented with mSCF (100 ng/
μL), mlL-3 (10 ng/μL), mlL-11 (100 ng/μL), hFLT3 ligand (100 ng/μL) and PenStrep (1X)
for 24 hours prior to base editing. Pilot studies indicated that mouse HSPCs were edited
more efficiently with RNP compared to base editor mRNA. Further optimization may reveal
the reason for this or yield improved electroporation methods for mRNA. Ribonucleoprotein
Author Manuscript
complex was generated by incubating ABE8e-NRCH with targeting sgRNA at

concentrations of 2.25 μM base editor and 6.75 μM gRNA (1:3 ratio) in T buffer (total
volume 50 μL) for 30 minutes at room temperature. Electroporation was performed using the
ThermoFisher Neon Transfection System with 100-μL tips in buffer E2 at 1700 pulse
voltage, 20 pulse width, 1 pulse.
Following electroporation, cells were cultured overnight in Lineage Negative Media,

followed by transplantation via tail-vein injection of 106 cells into lethally irradiated (1,125

cGy delivered as a single dose), 8- to 12-week-old female C57BI/6 PepBoy (CD45.1)

Author Manuscript
recipients. For analysis following transplantation peripheral blood was collected from the
retro-orbital sinus using heparinized micro-hematocrit capillary tubes at 6, 10, 14, and 16
weeks after transplantation to determine the fraction of engrafted donor cells and
hemoglobin content. Mice were sacrificed for necropsy at 16 weeks post-transplantation.
Complete blood counts CBCs were performed using a FORCYTE veterinary hematology
analyzer. CBC measurements were collected from untransplanted HBBA/S mice at 4-6
months of age. Blood smears were prepared using modified Romanowsky methanolic
staining and eosin and thiazin methods. Engraftment was determined by flow cytometry for
mouse anti-CD45.1-PE (BD Pharmingen Cat. No. 553776, 1:50 dilution) and mouse anti-
CD45.2-FITC (BE Pharmingen Cat. No. 561874, 1:50 dilution). Mouse illustrations were
adapted from BioRender.com.
Author Manuscript
Colony forming assay and analysis of clonal editing outcomes

Lin− cells were purified from the bone marrow of three mice 16 weeks after transplantation
using immuno-magnetic bead selection with the Mouse Lineage Cell Depletion Kit
(Miltenyi, 130-090-858). For each animal, 500 Lin− cells were plated in triplicate in
methylcellulose (STEMCELL Technologies, Methocult GF M3434) incubated at 37 °C.
After 12 days, 30-35 colonies per mouse were picked and washed in PBS before prior to
lysis. HTS analysis was performed on all colony lysates and allelic editing for each colony
was classified based on editing percentages.
Oxygen binding measurements

Hemoglobin-oxygen equilibrium curves (OECs), to determine the oxygen binding affinity of
HbA, HbS and HbG, were obtained using the Hemox Analyzer (TCS Scientific, New Hope,
Author Manuscript
PA). Mouse blood or was added to the analysis buffer containing Hemox solution (pH 7.4 at
37 °C), Additive-A (BSA-20), and anti-foaming agent (AFA-25) according to the
manufacturer’s protocol. Each sample was oxygenated at 37 °C using compressed air and
then deoxygenated with compressed N2, while subjected to continuous dual-wavelength
spectrophotometry to determine the oxyhemoglobin to deoxyhemoglobin ratio along with
continuous measurement of the oxygen partial pressure. OECs and p50 values were
generated by the TCS Hemox Analysis Software.
Secondary transplantation of Townes mouse SCD HSPCs

Whole bone marrow from a single female Makassar base-edited mouse and a female mouse
receiving unedited HBBS/S cells were collected and RBCs were lysed using ACK Lysing
Author Manuscript
Buffer. Varying ratios of cells from the two mice (0:100, 20:80, 40:60, 60:40, 80:20, and
100:0) were mixed and resuspended in PBS. Two million cells per recipient were injected
into irradiated female C57BI/6 PepBoy (CD45.1) recipients (1,125 cGy). Three mice were
injected per ratio of bone marrow cells. For analysis following transplantation, peripheral
blood was collected from the retro-orbital sinus using heparinized micro-hematocrit
capillary tubes. Complete blood counts CBCs were performed using a FORCYTE veterinary
hematology analyzer. Mouse illustrations were adapted from BioRender.com.

Cas9 nuclease purification

Author Manuscript
3xNLS-SpCas9 plasmid28 was transformed into BL21 (DE3) competent cells

(MilliporeSigma, 702353) and grown in Terrific Broth (TB) media at 37 °C until the density
reached OD600=2.4-2.8. Cells were induced with 0.5 mM isopropyl β-D-1-
thiogalactopyranoside (IPTG) per liter for 20 hours at 20 °C. Cell pellets were lysed in 25
mM Tris, pH 7.6, 500 mM NaCl, 5% glycerol by homogenization and centrifuged at 20,000
rpm for 1 hour at 4 °C. Cas9 was purified by Nickel-NTA resin and treated with TEV
protease (1 mg TEV per 40 mg of protein) and benzonase (100 units/mL, Novagen 70664-3)
overnight at 4 °C. Subsequently, Cas9 was purified using a size exclusion column
(Amersham Biosciences HiLoad 26/60 Superdex 200 17-1071-01) followed by a 5-mL SP
HP ion exchange column (GE 17-1151-01) according to the manufacturer’s instructions.
Proteins were dialyzed in 20 mM Hepes buffer pH 7.5 containing 400 mM KCI, 10%
glycerol, and 1 mM TCEP buffer. Contaminants were removed using a Toxin Sensor
Author Manuscript
Chromogenic LAL Endotoxin Assay Kit (GenScript, L00350). Purified proteins were
concentrated and filtered using Amicon ultrafiltration units with a 30-kDa MWCO
(MilliporeSigma, UFC903008) and an Ultrafree-MC centrifugal filter (MilliporeSigma,
UFC30GV0S). Protein fractions were further assessed using TGX stain-free 4-20% SDS-
PAGE (Biorad, 5678093) and quantified by BCA assay.
Reverse transcription digital droplet PCR to assess CDKN1 expression

Healthy donor CD34+ HSPCs were electroporated with ABE8 NRCH mRNA+sgRNA
targeting the HBB locus. In parallel, 3xNLS Cas9 nuclease RNP complexed with sgRNA
targeting the BCL11A erythroid-specific enhancer was used to compare base editor to
nuclease strategies. Cells electroporated without ABE8e-NRCH or 3xNLS Cas9 were used
as a control (“electroporation, no cargo”), and as a separate control, cells were cultured
Author Manuscript
without electroporation (“not electroporated”). mRNA and sgRNA were mixed at a 1:1 mass
ratio prior to electroporation. RNPs were formed at a 1:1.5 ratio of Cas9 and sgRNA, and
incubated for 20 minutes at room temperature to complex prior to electroporation. mRNA
+sgRNA complexes were electroporated at 200 μg/mL of mRNA. Cas9 RNP was
electroporated at a final concentration of 4 μM protein.
Guide RNA sequences were: BCL11A-targeting guide sequence: 5’-

CUAACAGUUGCUUUUAUCAC-3’ Healthy HBB-targeting guide sequence: 5’-
UUCUCCUCAGGAGUCAGGUG-3’ After electroporation, RNA was extracted from 100K
cells at several time points (0, 6, 12, 24, and 48 hrs) using the RNeasy Plus Mini Kit
(QIAGEN; Cat. No. #74136) and RNA concentrations were determined by Nanodrop
(Thermo Scientific). Genomic DNA was extracted on day 6 post-electroporation using
Author Manuscript
QuickExtract buffer then analyzed by HTS to determine editing efficiency.
One-step reverse transcription digital droplet PCR (RT-ddPCR) on extracted RNA was used
to determine CDKN1 (p21) mRNA expression levels, upregulation of which indicates an
active p53-mediated DNA damage response49. Ribonuclease P/MRP subunit p30 (RPP30)
was used as reference control. 3 ng of RNA was mixed with reverse transcriptase, 300 mM
DTT, and Supermix in One-Step RT-ddPCR advanced kit for probes (Bio-Rad, Hercules,
CA, USA), CDKN1 primers/probe (Bio-Rad, 10031252; Assay ID: dHsaCPE5052298), and

RPP30 primers/probe (Bio-Rad, 10031255; Assay ID: dHsaCPE5038241) according to the

Author Manuscript
manufacturer’s protocol. After making droplets using an Automated Droplet Generator (Bio-
Rad), thermocycling was performed as follows: 50 °C for 60 min, 95 °C for 10 min, then 40
cycles consisting of 95 °C for 30 sec followed by 55 °C for 1 min. Following the cycles, a
final incubation was conducted at 98 °C for 10 min. Droplets were read using QX200 (Bio-
Rad, 1864001) and data were analyzed using QuantaSoft (Bio-Rad).
Assessing target site disruption using digital droplet PCR

DNA from 100,000 CD34+ HPSCs were extracted using an Agencourt DNAdvance kit
(Beckman Coulter Cat. No. A48705) according to manufacturer’s instructions. DNA
concentrations were determined by Nanodrop (Thermo Scientific). Digital droplet PCR was
used to determine change in abundance of target loci. 50-150 ng of DNA was added to a
reaction mixture containing ddPCR Supermix for Probes (Bio-Rad, 1863026), HindIII-HF
Author Manuscript
(0.25 units/μL, New England BioLabs, R3104L), ACTB primers and probes (900 nM each
primer, 250 nM probe, Primers:
ACTB-Forward: 5’-ACACTGTGCCCATCTAC-3’
ACTB-Reverse: 5’-AATGTCACGCACGATTTC-3’
Probe: 5’-/5HEX/CGGGACCTG/ZEN/ACTGACTACCTCAT/3IABkFQ/−3’), and either

HBB primers and probes (900 nM each primer, 250 nM probe, Primers:
HBB-Forward: 5’-GCCACACCCTAGGGTTG-3’
HBB-Reverse: 5’-GGGAAAATAGACCAATAGGCAG-3’
Author Manuscript
Probe: 5’-AGGGCTGGGCATAAAAGTCAG-3’ or BCL11A primers and probes (900 nM

each primer, 250 nM probe, Primers:
BCL11A-Forward: 5’-TCTTAGACATAACACACCAGG-3’
BCL11a-Reverse: 5’-GTCTGCCAGTCCTCTTC-3’
Probe: 5’-TCAATACAACTTTGAAGCTAGTCTAGTG-3’) according to the manufacturer’s

protocol.
Forward primers for amplification of HBB and BCL11A also contained the Illumina adapter
at the 5’ end: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN. Reverse primers
for amplification of HBB and BCL11A also contained the Illumina adapter at the 5’ end:
Author Manuscript
TGGAGTTCAGACGTGTGCTCTTCCGATCT. Primers and probes for HBB were

positioned to distinguish the target from the homologous HBD gene. Droplets were
generated using a QX200 Manual Droplet Generator (Bio-Rad, 186-4002). Digital droplet
PCR was performed as follows: 95 °C for 10 min, then 50 cycles of 94 °C for 30 seconds,
59.5 °C for 2 min. Following the cycles, a final incubation was conducted at 98 °C for 10
min. Droplets were read by a QX200 Droplet Reader (Bio-Rad, 1864001) and data were
analyzed using QuantaSoft (Bio-Rad).

Extended Data
Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 1. Optimization in HEK293T cells, viability and recovery following
human SCD patient HSPC editing, and allelic editing outcomes.
(a) Plasmids encoding the HBBS-targeting sgRNA and either ABE7.10-NRCH or ABE8e-
NRCH were transfected by lipofection into HEK293T cells. Editing efficiency was
measured after 3 days by high-throughput DNA sequencing (HTS). Unedited cells were not
lipofected. (b) Two days after electroporation into human patient HSPCs of base editor
mRNA and sgRNA, or electroporation of ribonucleoprotein (RNP), cell number and
viability were measured using a Chemometec Nucleocounter-3000. Acridine orange was
used to stain the total cell number and DAPI was used to stain dead, permeabilized cells.
The percent viability was calculated as the DAPI stained cells divided by the acridine orange
cells within each sample. The percent recovery was normalized to the cell count of the
unedited sample. Unedited cells were not electroporated, (c) Six days after electroporation
of SCD patient HSPCs, genomic DNA was extracted and the target HBB locus was PCR
Author Manuscript
amplified and sequenced using an Illumina instrument. The sequencing analysis program
CRIS.py was used to identify and quantify the resulting alleles. All alleles above a threshold
of 0.2% frequency are shown. Below this threshold, variant alleles appear with greatest
frequency in the untreated control sample, suggesting they do not arise from base editor
treatment. Nucleotides altered from the endogenous sequence are shown in blue. Rare
cytosine base editing was observed at <1% frequency, as has been previously described as a

possible outcome from adenine base editing50. Bar values and error bars reflect mean±SD,
Author Manuscript
n=3.
Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 2. Erythroid differentiation of edited SCD patient CD34+ HSPCs.
Representative, immuno-flow cytometry for erythroid maturation stage markers42,43 at
culture days 7 and 14. Top: gating strategy to identify single cells expressing the erythroid
marker hCD235a. Bottom: gating strategy to track the progress of erythroid maturation

based on expression of CD49D and Band3 in hCD235a+ cells. SSC-A: Side scatter area.
Author Manuscript
SSC-W: Side scatter width. FSC-A: Forward scatter area.

Author Manuscript
Author Manuscript
Extended Data Figure 3. Reverse-phase high performance liquid chromatography (HPLC)

analysis of erythroid cells derived from in vitro differentiation of edited SCD patient CD34+
HSPCs.
Reverse-phase HPLC chromatograms of erythroid cell lysates at culture day 18, with β-like
globins and their associated fractions marked near the associated peak. Data from the most
efficiently edited donor is shown. Red arrows indicate the start and end of globin chain
peaks.
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 4. Off-target base editing associated with ABE8e-NRCH conversion of
Author Manuscript
HBBS to HBBG Makassar in sickle cell disease patient CD34+ hematopoietic stem and
progenitor cells.
CIRCLE-seq read counts obtained for each verified off-target site and the alignment of each
site to the guide sequence are shown. Bar graphs show the percentage of sequencing reads
containing A•T-to-G•C mutations within protospacer positions 4-10 at on-and off-target sites
in genomic DNA samples from patient CD34+ HSPCs treated with ABE8e-NRCH mRNA,
protein, or untreated controls (n=4). Note that the mutation frequency shown is summed
across all reads with one or more A•T-to-G•C mutations in this window. Sequencing errors

therefore accumulate in control samples compared to standard sequencing error frequencies

Author Manuscript
for a single nucleotide. Bar values and error bars reflect mean±SD.
Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 5. Off-target indel formation associated with ABE8e-NRCH conversion of
HBBS to HBBG Makassar in sickle cell disease patient CD34+ hematopoietic stem and
progenitor cells.
Bar graph showing the percentage of sequencing reads containing alleles harboring indels at
on-and off-target sites in genomic DNA samples from patient CD34+ HSPCs treated with

ABE8e-NRCH mRNA, protein, or untreated controls (n=4). Bar values and error bars reflect
Author Manuscript
mean±SD.
Author Manuscript
Author Manuscript
Extended Data Figure 6. Flow cytometry analysis of human donor-derived erythroid CD235a+
cells after transplantation.
(a) Human CD235a+ erythroid cells were purified by immuno-magnetic bead selection and
analyzed by flow cytometry for the indicated erythroid maturation markers42,43, (b)
Author Manuscript
Enucleated reticulocytes were assessed by the cell-permeable DNA stain Hoechst 33342 and
the erythroid marker CD235a.

Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 7. Engraftment of ABE8e-NRCH RNP-treated SCD patient CD34+

Author Manuscript
HSPCs after transplantation into immunodeficient mice.

CD34+ HSPCs from three HBBS/S SCD patient donors were electroporated with ABE8e-
NRCH RNP using a single guide RNA (sgRNA) targeting the SCD mutant codon, followed
by transplantation of 2-5x105 treated cells into NBSGW mice via tail-vein injection. Mice
were sacrificed and analyzed 16 weeks after transplantation, (a) Experimental workflow, (b)
Engraftment measured by the percentage of human donor CD45+ cells (hCD45+ cells) in
recipient mouse bone marrow, (c) Human B-cells (hCD19+), myeloid cells (hCD33+), and

T-cells (hCD3+) cells in recipient mouse bone marrow, shown as percentages of the total
hCD45+ population. (d) Human erythroid precursors (hCD235a+) in recipient mouse bone
Author Manuscript
marrow shown as percentage of total human and mouse CD45−cells. (e) On-target (A7, Fig.
1a) editing efficiencies in human donor CD34+ cell-derived lineages purified from recipient
bone marrow by fluorescence-activated cell sorting. Erythroid, myeloid, B-cell, and HSPC
human lineages were collected using antibodies that recognize hCD235a, hCD33, hCD19,
and hCD34+, respectively. Statistical significance was assessed by one-way ANOVA to
compare groups; “ns”, not significant. (f) Percentages of β-like globin proteins determined
by reverse-phase HPLC analysis of human donor-derived reticulocytes isolated from
recipient mouse bone marrow. (g) Representative phase contrast images of human
reticulocytes purified from bone marrow and incubated for 8 hours in 2% O2. Nine images
of >50 cells per image were collected per sample. Scale bar=50 μm. (h) Quantification of
sickled cells calculated by counting images after incubation for 8 hours in 2% O2 such as in
Author Manuscript
(g). More than 300 randomly selected cells per sample were counted by a blinded observer.
n=14 total mice analyzed in panels b-f; triangle, square, and circle symbols represent
samples from three different SCD CD34+ HSPC donors. Negative control data is shared with
Figure 2. Bar values and error bars reflect mean±SD. Statistical significance between treated
and untreated samples was assessed by a two-tailed Student’s t-test; “ns”, not significant.
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 8. Engraftment of transplanted Townes mouse HSPCs, clonality of editing
outcomes, and oxygen binding affinity of blood.
(a) Donor cell engraftment measured by flow cytometry assessing the percentage of
CD45.1+ cells among peripheral blood mononuclear cells (PBMCs). (b) Bone marrow from
three mice transplanted with edited mouse HSPCs was plated at low density in
methylcellulose. After 14 days of culture, 30 to 35 individual colonies per mouse were
picked into cell lysis buffer and the edited locus was amplified by PCR and sequenced by
HTS. Colonies were categorized by whether they contained no editing, a monoallelic edit, or
a biallelic edit. (c) Blood was drawn from mice at week 14 after transplantation.
Hemoglobin oxygenation was measured using a Hemox Analyzer (TCS Scientific) across a
continuous declining gradient of oxygen pressure to assess whether HBBS-to-HBBG editing
Author Manuscript
led to altered hemoglobin-oxygen binding. Bar values and error bars reflect mean±SD.

Author Manuscript
Author Manuscript
Author Manuscript
Extended Data Figure 9. Adenine base editing of the sickle cell disease β-globin allele (HBBS) to
Author Manuscript
the Makassar variant (HBBG) reduces erythrocyte sickling and splenic pathologies in mice.
Mice were treated as described in Fig. 3a. Blood and spleen were analyzed sixteen weeks
after transplantation of Lin− mouse HSPCs containing human HBB alleles, (a)
Representative images of blood smears. One blood smear image was collected per mouse.
Scale bar=25 μm. (b) Representative phase contrast images of peripheral blood incubated for
8 hours in 2% O2. Nine images of >50 cells per image were collected per sample. Scale
bar=50 μm. (c) Quantification of sickled cells. More than 300 randomly selected cells were

counted by a blinded observer. (d) Mass of dissected spleens. (e) Histological sections of
Author Manuscript
spleens of recipient mice 16 weeks after transplantation. Splenic pathologies in mice that
received unedited donor HBBS/S HSCs include excessive extramedullary erythropoiesis and
vascular congestion indicated by RBC pooling (bright red color) resulting in expansion of
red pulp (RP), reduction in white pulp sizes (WP), and splenomegaly. Images were taken at
10x magnification and were processed, stained and photographed at the same time under
identical conditions. Three images of each spleen were collected from different parts of the
organ for each mouse. Scale bar=100 μm. Unedited HBBS/S: n=6 mice; edited HBBS/S: n=6
mice; HBBA/S: n=2 mice. Plotted values and error bars reflect mean±SD, with individual
values shown as dots. Statistical significance was assessed using one-way ANOVA, with
Šidák’s multiple comparisons test of the edited HBBS/S values compared to each other group
to calculate p-values.
Author Manuscript
Author Manuscript
Author Manuscript

Extended Data Figure 10. Comparison of DNA damage response and loss of target allele
amplification consistent with large deletion or DNA rearrangement in HSPCs following
Author Manuscript
treatment with Cas9 nuclease or with adenine base editor.

HSPCs from a healthy human donor were electroporated in triplicate with Cas9 nuclease
RNP targeting the BCL11A erythroid-specific enhancer, ABE8e-NRCH mRNA and an
sgRNA targeting the wild-type HBB locus, or no cargo as a control. An additional set of
control cells was not electroporated, (a) CDKN1 transcription levels, a measure of the p53-
mediated DNA damage response49, were quantified by droplet digital PCR (ddPCR) after
reverse transcription, and were normalized to CDKN1 levels before electroporation (n=3).
(b) Editing efficiencies at the targeted genomic loci in HSPCs were measured by HTS 6
days after electroporation. Adenine base editing at the synonymous bystander position 9 of
the HBB protospacer is shown for ABE8e-NRCH. (c, d) The indicated target sites were
amplified and quantified by ddPCR to measure the fraction of missing alleles consistent with
larger deletions, translocations, or other chromosomal rearrangements that result in loss of
Author Manuscript
the ability to be amplified by PCR. PCR amplification of a non-targeted ACTB site was used
to normalize each sample. Each DNA sample was assessed in triplicate (n=9). Plotted values
and error bars reflect mean±SD, with individual values in bar graphs shown as dots.
Statistical significance between edited and unedited samples was assessed by a two-tailed
Student’s t-test; “ns”, not significant.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgements
We are grateful to the SCD patients who contributed samples for this study. We are grateful for helpful discussions
Author Manuscript
with Daniel Gao and other members of our laboratories. We thank Mary O’Reilly for assistance with Adobe
Illustrator. This work was supported by US National Institutes of Health awards U01 AI142756, RM1 HG009490,
R01 EB022376, R35 GM118062 (D.R.L.) and P01 HL053749 (M.J.W. and S.Q.T.), the Bill and Melinda Gates
Foundation (D.R.L.), the Howard Hughes Medical Institute (D.R.L.), the St. Jude Collaborative Research
Consortium (D.R.L, S.M.P.-M., S.Q.T and M.J.W.), the Doris Duke Foundation (for aspects of this study that did
not utilize mice, M.J.W., S.Q.T. and A.S.), the American Lebanese Syrian Associated Charities (A.S. and M.J.W.)
and the Assisi Foundation of Memphis (M.J.W.). G.A.N. was supported by a Helen Hay Whitney Postdoctoral
Fellowship and the HHMI. A.S. was supported by a Scholar Award by the American Society of Hematology. L.W.K
and K.A.E. acknowledge NSF GRFP fellowships.
References
1. Piel FB, Steinberg MH & Rees DC Sickle Cell Disease. N Engl J Med 377, 305, doi:10.1056/
NEJMc1706325 (2017).
2. Richter MF et al. Phage-assisted evolution of an adenine base editor with improved Cas domain
compatibility and activity. Nat Biotechnol 38, 883–891, doi:10.1038/s41587-020-0453-z (2020).
[PubMed: 32433547]
Author Manuscript
3. Miller SM et al. Continuous evolution of SpCas9 variants compatible with non-G PAMs. Nat
Biotechnol 38, 471–481, doi:10.1038/s41587-020-0412-8 (2020). [PubMed: 32042170]
4. Sangkitporn S, Rerkamnuaychoke B, Sangkitporn S, Mitrakul C & Sutivigit Y Hb G Makassar (beta
6:Glu-Ala) in a Thai family. J Med Assoc Thai 85, 577–582 (2002). [PubMed: 12188388]
5. Blackwell RQ, Oemijati S, Pribadi W, Weng MI & Liu CS Hemoglobin G Makassar: beta-6 Glu
leads to Ala. Biochim Biophys Acta 214, 396–401 (1970). [PubMed: 5509617]
6. Wu LC et al. Correction of sickle cell disease by homologous recombination in embryonic stem
cells. Blood 108, 1183–1188, doi:10.1182/blood-2006-02-004812 (2006). [PubMed: 16638928]

7. Leonard A, Tisdale J & Abraham A Curative options for sickle cell disease: haploidentical stem cell
transplantation or gene therapy? Br J Haematol 189, 408–423, doi:10.1111/bjh.16437 (2020).
Author Manuscript
[PubMed: 32034776]
8. Magrin E, Miccio A & Cavazzana M Lentiviral and genome-editing strategies for the treatment of
beta-hemoglobinopathies. Blood 134, 1203–1213, doi:10.1182/blood.2019000949 (2019).
[PubMed: 31467062]
9. Zeng J et al. Therapeutic base editing of human hematopoietic stem cells. Nat Med 26, 535–541,
doi:10.1038/s41591-020-0790-y (2020). [PubMed: 32284612]
10. Ribeil JA et al. Gene Therapy in a Patient with Sickle Cell Disease. N Engl J Med 376, 848–855,
doi:10.1056/NEJMoa1609677 (2017). [PubMed: 28249145]
11. Esrick EB et al. Post-Transcriptional Genetic Silencing of BCL11A to Treat Sickle Cell Disease. N
Engl J Med, doi:10.1056/NEJMoa2029392 (2020).
12. Frangoul H et al. CRISPR-Cas9 Gene Editing for Sickle Cell Disease and beta-Thalassemia. N
Engl J Med, doi:10.1056/NEJMoa2031054 (2020).
13. Zuccaro MV et al. Allele-Specific Chromosome Removal after Cas9 Cleavage in Human Embryos.
Cell 183, 1650–1664 e1615, doi:10.1016/j.cell.2020.10.025 (2020). [PubMed: 33125898]
Author Manuscript
14. Song Y et al. Large-Fragment Deletions Induced by Cas9 Cleavage while Not in the BEs System.
Mol Ther Nucleic Acids 21, 523–526, doi:10.1016/j.omtn.2020.06.019 (2020). [PubMed:
32711379]
15. Kosicki M, Tomberg K & Bradley A Repair of double-strand breaks induced by CRISPR-Cas9
leads to large deletions and complex rearrangements. Nat Biotechnol, doi:10.1038/nbt.4192
(2018).
16. Haapaniemi E, Botla S, Persson J, Schmierer B & Taipale J CRISPR-Cas9 genome editing induces
a p53-mediated DNA damage response. Nat Med 24, 927–930, doi:10.1038/s41591-018-0049-z
(2018). [PubMed: 29892067]
17. Ihry RJ et al. p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells. Nat Med 24,
939–946, doi:10.1038/s41591-018-0050-6 (2018). [PubMed: 29892062]
18. Enache OM et al. Cas9 activates the p53 pathway and selects for p53-inactivating mutations. Nat
Genet 52, 662–668, doi:10.1038/s41588-020-0623-4 (2020). [PubMed: 32424350]
19. Wilkinson AC et al. Cas9-AAV6 gene correction of beta-globin in autologous HSCs improves
Author Manuscript
sickle cell disease erythropoiesis in mice. Nat Commun 12, 686, doi:10.1038/s41467-021-20909-x
(2021). [PubMed: 33514718]
20. Dever DP et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells.
Nature 539, 384–389, doi:10.1038/nature20134 (2016). [PubMed: 27820943]
21. Viprakasit V, Wiriyasateinkul A, Sattayasevana B, Miles KL & Laosombat V Hb G-Makassar
[beta6(A3)Glu-->Ala; codon 6 (GAG-->GCG)]: molecular characterization, clinical, and
hematological effects. Hemoglobin 26, 245–253, doi:10.1081/hem-120015028 (2002). [PubMed:
12403489]
22. Chu SH et al. Rationally Designed Base Editors for Precise Editing of the Sickle Cell Disease
Mutation. CRISPR J 4, 169–177, doi:10.1089/crispr.2020.0144 (2021). [PubMed: 33876959]
23. Bae S, Park J & Kim JS Cas-OFFinder: a fast and versatile algorithm that searches for potential
off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30, 1473–1475, doi:10.1093/
bioinformatics/btu048 (2014). [PubMed: 24463181]
24. Tsai SQ et al. CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-Cas9
nuclease off-targets. Nat Methods 14, 607–614, doi:10.1038/nmeth.4278 (2017). [PubMed:
Author Manuscript
28459458]
25. McIntosh BE et al. Nonirradiated NOD,B6.SCID Il2rgamma−/− Kit(W41/W41) (NBSGW) mice
support multilineage engraftment of human hematopoietic cells. Stem Cell Reports 4, 171–180,
doi:10.1016/j.stemcr.2014.12.005 (2015). [PubMed: 25601207]
26. Alanis-Lobato G et al. Frequent loss-of-heterozygosity in CRISPR-Cas9–edited early human
embryos. PNAS 202004832, doi:10.1073/pnas.2004832117 (2021).
27. Demirci S et al. betaT87Q-Globin Gene Therapy Reduces Sickle Hemoglobin Production,
Allowing for Ex Vivo Anti-sickling Activity in Human Erythroid Cells. Mol Ther Methods Clin
Dev 17, 912–921, doi:10.1016/j.omtm.2020.04.013 (2020). [PubMed: 32405513]

28. Wu Y et al. Highly efficient therapeutic gene editing of human hematopoietic stem cells. Nat Med
25, 776–783, doi:10.1038/s41591-019-0401-y (2019). [PubMed: 30911135]
Author Manuscript
29. Anzalone AV, Koblan LW & Liu DR Genome editing with CRISPR-Cas nucleases, base editors,
transposases and prime editors. Nat Biotechnol 38, 824–844, doi:10.1038/s41587-020-0561-9
(2020). [PubMed: 32572269]
References cited in Methods and Extended Data figure legends

30. Komor AC, Kim YB, Packer MS, Zuris JA & Liu DR Programmable editing of a target base in
genomic DNA without double-stranded DNA cleavage. Nature 533, 420–424, doi:10.1038/
nature17946 (2016). [PubMed: 27096365]
31. Gaudelli NM et al. Programmable base editing of A*T to G*C in genomic DNA without DNA
cleavage. Nature 551, 464–471, doi:10.1038/nature24644 (2017). [PubMed: 29160308]
32. Huang TP, Newby GA & Liu DR Precision genome editing using cytosine and adenine base editors
in mammalian cells. Nat Protoc 16, 1089–1128, doi:10.1038/s41596-020-00450-9 (2021).
[PubMed: 33462442]
Author Manuscript
33. Clement K et al. CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat
Biotechnol 37, 224–226, doi:10.1038/s41587-019-0032-3 (2019). [PubMed: 30809026]
34. Vaidyanathan S et al. Uridine Depletion and Chemical Modification Increase Cas9 mRNA Activity
and Reduce Immunogenicity without HPLC Purification. Mol Ther Nucleic Acids 12, 530–542,
doi:10.1016/j.omtn.2018.06.010 (2018). [PubMed: 30195789]
35. Rees HA et al. Improving the DNA specificity and applicability of base editing through protein
engineering and protein delivery. Nat Commun 8, 15790, doi:10.1038/ncomms15790 (2017).
[PubMed: 28585549]
36. Doman JL, Raguram A, Newby GA & Liu DR Evaluation and minimization of Cas9-independent
off-target DNA editing by cytosine base editors. Nat Biotechnol 38, 620–628, doi:10.1038/
s41587-020-0414-6 (2020). [PubMed: 32042165]
37. Zuris JA et al. Cationic lipid-mediated delivery of proteins enables efficient protein-based genome
editing in vitro and in vivo. Nat Biotechnol 33, 73–80, doi:10.1038/nbt.3081 (2015). [PubMed:
25357182]
38. Rees HA & Liu DR Base editing: precision chemistry on the genome and transcriptome of living
Author Manuscript
cells. Nat Rev Genet 19, 770–788, doi:10.1038/s41576-018-0059-1 (2018). [PubMed: 30323312]
39. Vakulskas CA et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables
efficient gene editing in human hematopoietic stem and progenitor cells. Nat Med 24, 1216–1224,
doi:10.1038/s41591-018-0137-0 (2018). [PubMed: 30082871]
40. Hendel A et al. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human
primary cells. Nat Biotechnol 33, 985–989, doi:10.1038/nbt.3290 (2015). [PubMed: 26121415]
41. Connelly JP & Pruett-Miller SM CRIS.py: A Versatile and High-throughput Analysis Program for
CRISPR-based Genome Editing. Sci Rep 9, 4194, doi:10.1038/s41598-019-40896-w (2019).
[PubMed: 30862905]
42. Hu J et al. Isolation and functional characterization of human erythroblasts at distinct stages:
implications for understanding of normal and disordered erythropoiesis in vivo. Blood 121, 3246–
3253, doi:10.1182/blood-2013-01-476390 (2013). [PubMed: 23422750]
43. Traxler EA et al. A genome-editing strategy to treat beta-hemoglobinopathies that recapitulates a
mutation associated with a benign genetic condition. Nat Med 22, 987–990, doi:10.1038/nm.4170
Author Manuscript
(2016). [PubMed: 27525524]

44. Lazzarotto CR et al. Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq.
Nat Protoc 13, 2615–2642, doi:10.1038/s41596-018-0055-0 (2018). [PubMed: 30341435]
45. Hwang GH, Kim JS & Bae S Web-Based CRISPR Toolkits: Cas-OFFinder, Cas-Designer, and
Cas-Analyzer. Methods Mol Biol 2162, 23–33, doi:10.1007/978-1-0716-0687-2_2 (2021).
[PubMed: 32926375]
46. Heinz S et al. Simple combinations of lineage-determining transcription factors prime cis-
regulatory elements required for macrophage and B cell identities. Mol Cell 38, 576–589,
doi:10.1016/j.molcel.2010.05.004 (2010). [PubMed: 20513432]

47. Kumar S & Geiger H HSC Niche Biology and HSC Expansion Ex Vivo. Trends Mol Med 23, 799–
819, doi:10.1016/j.molmed.2017.07.003 (2017). [PubMed: 28801069]
Author Manuscript
48. Leonard A et al. Low-Dose Busulfan Reduces Human CD34(+) Cell Doses Required for
Engraftment in c-kit Mutant Immunodeficient Mice. Mol Ther Methods Clin Dev 15, 430–437,
doi:10.1016/j.omtm.2019.10.017 (2019). [PubMed: 31890735]
49. Karimian A, Ahmadi Y & Yousefi B Multiple functions of p21 in cell cycle, apoptosis and
transcriptional regulation after DNA damage. DNA Repair (Amst) 42, 63–71, doi:10.1016/
j.dnarep.2016.04.008 (2016). [PubMed: 27156098]
50. Kim HS, Jeong YK, Hur JK, Kim JS & Bae S Adenine base editors catalyze cytosine conversions
in human cells. Nat Biotechnol 37, 1145–1148, doi:10.1038/s41587-019-0254-4 (2019). [PubMed:
31548727]
Author Manuscript
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Figure 1. Adenine base editing converts sickle cell disease β-globin (HBBS) to benign Makassar
β-globin (HBBG) in patient CD34+ HSPCs.
CD34+ cells from three SCD patient donors were electroporated with ABE8e-NRCH mRNA
or RNP using an sgRNA targeting the SCD mutant HBB codon. (a) The edited region of
HBB with the target A at protospacer position 7 shown in blue along with potential
Author Manuscript
bystander edits in green (silent), brown (silent), and red (non-silent). (b) Editing efficiencies
by HTS at target and bystander adenines, and indels after 6 days in stem-cell culture media
following electroporation. (c) Proportion of β-like globin proteins by HPLC of reticulocyte
lysates after 18 days in differentiation media following electroporation. (d) Representative
phase-contrast images of reticulocytes derived from unedited or edited donor HSPCs
incubated 8 hours in 2% O2. Nine images of >50 cells each were collected per sample. Scale
bar=50 μm. (e) Quantification of sickled reticulocytes from counting >300 randomly

selected cells by a blinded observer from images as in (d). (f) Venn diagram showing
Author Manuscript
candidate off-target sites nominated by Cas-OFFinder and CIRCLE-seq, and nominated sites
for which off-target editing was observed by targeted DNA sequencing in SCD patient
CD34+ cells electroporated with ABE8e-NRCH mRNA. (g) Predicted genomic features of
validated off-target sites. TTS, ≤1 kb from the transcription termination site; UTR,
untranslated region. (h) ABE8e-NRCH-treated HSPCs from two different SCD patient
donors were sequenced at 697 potential off-target sites. The histogram shows the number of
validated off-target base editing sites binned by average percentage of sequencing reads for
each site with any A•T-to-G•C mutations in protospacer nucleotides 4-10. Bar values in (b),
(c), and (e) and error bars reflect mean±SD of three independent biological replicates, with
individual values shown as dots.
Author Manuscript
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Figure 2. Engraftment of ABE8e-NRCH mRNA-treated SCD patient CD34+ HSPCs after

Author Manuscript
transplantation into immunodeficient mice.

CD34+ HSPCs from three HBBS/S SCD patient donors were electroporated with ABE8e-
NRCH mRNA and sgRNA targeting the SCD mutant HBB codon. 2-5x105 treated cells
were transplanted into NBSGW mice via tail-vein injection. Mice were analyzed 16 weeks
after transplantation. (a) Experimental workflow. (b) Engraftment measured by percentage
of human CD45+ (hCD45+) cells in recipient mouse bone marrow. (c) Human B-cells
(hCD19+), myeloid cells (hCD33+), and T-cells (hCD3+) cells in recipient mouse bone

marrow shown as percentages of the hCD45+ population. (d) Human erythroid precursors
(hCD235a+) in recipient mouse bone marrow shown as percentage of human and mouse
Author Manuscript
CD45− cells, (e) HBBS-to-HBBG editing efficiencies in human donor CD34+ cell-derived
lineages from recipient bone marrow. Erythroid, myeloid, B-cell, and HSPC human lineages
were collected using antibodies that recognize hCD235a, hCD33, hCD19, and hCD34,
respectively, (f) Clonal editing outcomes determined by single-cell 5’ RNA-seq in CD235a+
cells from the bone marrow of two edited mice. (g) Proportions of β-like globin proteins by
HPLC of human donor-derived reticulocytes isolated from recipient mouse bone marrow. (h)
Representative phase-contrast images of human reticulocytes from bone marrow incubated 8
hours in 2% O2. Nine images of >50 cells each were collected per sample. Scale bar=50 μm.
(i) Quantification of sickled cells as in Fig. 1e. n=14 mice receiving edited cells and n=13
mice receiving unedited cells in b-e, g, and i. Triangle, square, and circle symbols represent
HSPCs from three different SCD donors. Plotted values and error bars reflect mean±SD.
Author Manuscript
Statistical significance was assessed by one-way ANOVA in i and by two-tailed Student’s t-

test elsewhere; “ns”, not significant.
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Figure 3. HBBS-to-HBBG base editing alleviates pathology in a mouse model of SCD.

(a) Lineage negative (Lin−) HSPCs from the bone marrow of Townes SCD mice (CD45.2,
human HBBS/S) were electroporated with ABE8e-NRCH and sgRNA RNP or not
electroporated, then transplanted into irradiated CD45.1 C57BI/6 recipient mice. Unedited
HBBA/S HSPCs from Townes sickle-cell trait mice transplanted into irradiated CD45.1
C57BI/6 mice, and non-transplanted HBBA/S Townes mice were used as healthy controls.
Author Manuscript
(b) HBBS-to-HBBG editing efficiency in cells cultured 3 days after electroporation (pre-
transplant) or in PBMCs collected 16 weeks post-transplant. ns, not significant by two-tailed
Student’s t-test. (c) Percentage of βG among β-like globin proteins by RP-HPLC analysis of
blood. (d-g) Hematologic indices 16 weeks post-transplant. Statistical significance was
assessed using one-way ANOVA, with Šidák’s multiple comparisons test to calculate p-
values. Differences among edited HBBS/S, transplanted HBBA/S, and non-transplanted
HBBA/S mice were not significant. Bar values and error bars reflect mean±SD of n=6 mice

(unedited HBBS/S, edited HBBS/S), n=2 mice (HBBA/S), or n=5 mice (non-transplanted
HBBA/S). (h) Spleens were imaged from each mouse 16 weeks after transplantation with
Author Manuscript
Townes mouse HSPCs. Representative images are shown.

Author Manuscript
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Figure 4. Secondary transplantation reveals HBBS-to-HBBG base editing requirements for

hematological correction.
(a) Bone marrow from a CD45.1 C57/BI6 mouse 16 weeks after primary transplantation
with ABE8e-NRCH RNP-edited Lin− HSPCs from Townes SCD mice (CD45.2, HBBS/S)
was mixed in varying proportions with bone marrow from a C57/BI6 mouse 16 weeks after
transplantation with unedited HBBS/S HSPCs from a Townes SCD mouse. For each of six
Author Manuscript
bone marrow mixtures, secondary transplantations of 2x106 cells were performed into three
irradiated CD45.1 C57BI/6 recipient mice. Peripheral blood was analyzed after 16 weeks.
(b) Engraftment measured by percentage of PBMCs with CD45.1. (c) HBBS-to-HBBG
editing efficiency in PBMCs. (d) Percentage of βG among β-like globin proteins by HPLC
and (e-h) hematologic indices plotted against HBBG allele frequency measured for each
mouse. Parameters from non-transplanted HBBA/S (brown line) and HBBA/A (black line)
Townes mice were assessed as healthy controls. One-phase decay fits are shown in (d), (f),

(g), and (h), and a linear fit in (e). Bars values and error bars reflect mean±SD of n=3 mice.
Author Manuscript
Dots represent different mice. Colors in (c-h) match the key in (b).
Author Manuscript
Author Manuscript
Author Manuscript

Base Editing of Hematopoietic Stem Cells Rescues Sickle Cell Disease in Mice

Uploaded by

Copyright:

Available Formats

Base Editing of Hematopoietic Stem Cells Rescues Sickle Cell Disease in Mice

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Base Editing of Hematopoietic Stem Cells Rescues Sickle Cell Disease in Mice

Uploaded by

Copyright:

Available Formats

HHS Public Access

Published in final edited form as:

Base editing of hematopoietic stem cells rescues sickle cell

Henderson9, Michelle F. Richter1,2,3, Kevin T. Zhao1,2,3, Shannon M. Miller1,2,3, Tina

M.J.W., and D.R.L. supervised this study.

Hospital, Memphis, Tennessee, USA

Sickle-cell disease is an autosomal recessive disorder caused by mutation of HBB, which

Nature. Author manuscript; available in PMC 2022 January 01.

suppression11 or Cas9-mediated disruption12 of BCL11A. Lentiviral vectors carry risks of

lipofection achieved 58% HBBS-to-HBBG conversion (Extended Data Fig. 1a).

Nature. Author manuscript; available in PMC 2022 January 01.

Genome-wide off-target analyses

We used both computational and experimental methods to extensively characterize off-target

Nature. Author manuscript; available in PMC 2022 January 01.

>500 bp from any coding region.

Transplantation of human HSPCs into mice

that ABE8e-NRCH-mediated conversion of HBBS to HBBG in repopulating HSCs does not

Nature. Author manuscript; available in PMC 2022 January 01.

Transplantation of mouse HSPCs into mice

To measure the effect of base editing on hemoglobin composition in circulating RBCs, we

Nature. Author manuscript; available in PMC 2022 January 01.

transplantation, suggesting that βG-containing hemoglobin binds oxygen normally

(Extended Data Fig. 8c).

Rescue of SCD in transplanted mice

controls (Fig. 3d–g).

To assess the consequence of base editing on circulating RBC morphology, we analyzed

resistant to sickling both in vivo and in vitro after exposure to hypoxia.

Secondary transplant dose-dependent rescue

Nature. Author manuscript; available in PMC 2022 January 01.

Effects of nuclease and ABE treatment

standard amplicon sequencing14,15, we conducted ddPCR to quantify the amount of each

Nature. Author manuscript; available in PMC 2022 January 01.

Nature. Author manuscript; available in PMC 2022 January 01.

High-throughput sequencing of the HBB SCD locus in HEK293T cells

Nature. Author manuscript; available in PMC 2022 January 01.

Underlined sequences represent adapters for Illumina sequencing. Following Illumina

was collected and spiked with 40 mM imidazole, followed by a 1-hour incubation at 4 °C

Nature. Author manuscript; available in PMC 2022 January 01.

RNP and mRNA electroporation in human HSPCs

Nature. Author manuscript; available in PMC 2022 January 01.

High-throughput sequencing of the HBB SCD locus in blood cells

Erythroid cell culture

In vitro sickling assay

Nature. Author manuscript; available in PMC 2022 January 01.

CIRCLE-seq off-target editing analysis

sequenced with 150 bp paired-end reads on an Illumina MiSeq instrument. CIRCLE-seq

CasOFFinder off-target editing analysis

Targeted amplicon sequencing by rhAmpSeq

Nature. Author manuscript; available in PMC 2022 January 01.

Quantification of base editing efficiency at evaluated off-target sites

Ethical approval for studies involving mice

Transplantation of gene-edited CD34+ HSPCs into NOD.Cg-KitW-41J Tyr+ Prkdcscid

Nature. Author manuscript; available in PMC 2022 January 01.

Base editing and transplantation of Townes Mouse SCD HSPCs

complex was generated by incubating ABE8e-NRCH with targeting sgRNA at

Following electroporation, cells were cultured overnight in Lineage Negative Media,

Nature. Author manuscript; available in PMC 2022 January 01.

cGy delivered as a single dose), 8- to 12-week-old female C57BI/6 PepBoy (CD45.1)

Colony forming assay and analysis of clonal editing outcomes