pubs.acs.

org/JACS Article

Assessing Readability of an 8‑Letter Expanded Deoxyribonucleic

Acid Alphabet with Nanopores
Christopher A. Thomas, Jonathan M. Craig, Shuichi Hoshika, Henry Brinkerhoff, Jesse R. Huang,
Sarah J. Abell, Hwanhee C. Kim, Michaela C. Franzi, Jessica D. Carrasco, Hyo-Joong Kim,
Drew C. Smith, Jens H. Gundlach, Steven A. Benner, and Andrew H. Laszlo*
Cite This: https://doi.org/10.1021/jacs.3c00829 Read Online
See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

ACCESS Metrics & More Article Recommendations *

sı Supporting Information

ABSTRACT: Chemists have now synthesized new kinds of DNA

Downloaded via UNIV ROVIRA I VIRGILI on April 10, 2023 at 16:06:04 (UTC).

that add nucleotides to the four standard nucleotides (guanine,

adenine, cytosine, and thymine) found in standard Terran DNA.
Such “artificially expanded genetic information systems” are today
used in molecular diagnostics; to support directed evolution to
create medically useful receptors, ligands, and catalysts; and to
explore issues related to the early evolution of life. Further
applications are limited by the inability to directly sequence DNA
containing nonstandard nucleotides. Nanopore sequencing is well-
suited for this purpose, as it does not require enzymatic synthesis,
amplification, or nucleotide modification. Here, we take the first
steps to realize nanopore sequencing of an 8-letter “hachimoji”
expanded DNA alphabet by assessing its nanopore signal range using the MspA (Mycobacterium smegmatis porin A) nanopore. We
find that hachimoji DNA exhibits a broader signal range in nanopore sequencing than standard DNA alone and that hachimoji single-
base substitutions are distinguishable with high confidence. Because nanopore sequencing relies on a molecular motor to control the
motion of DNA, we then assessed the compatibility of the Hel308 motor enzyme with nonstandard nucleotides by tracking the
translocation of single Hel308 molecules along hachimoji DNA, monitoring the enzyme kinetics and premature enzyme dissociation
from the DNA. We find that Hel308 is compatible with hachimoji DNA but dissociates more frequently when walking over C-
glycoside nucleosides, compared to N-glycosides. C-glycocide nucleosides passing a particular site within Hel308 induce a higher
likelihood of dissociation. This highlights the need to optimize nanopore sequencing motors to handle different glycosidic bonds. It
may also inform designs of future alternative DNA systems that can be sequenced with existing motors and pores.

■ INTRODUCTION
DNA has long been seen to be the defining core of Terran life,
requirements to support Darwinian evolution,9 a polyelec-
trolyte backbone and a size−shape regular building block that
constant in its structure, and perhaps also unique among fits into an “aperiodic crystal.” Hachimoji duplexes adopt the
familiar A and B helical forms seen in standard DNA.10
molecules able to store, transmit, and evolve information.
Artificial genetic systems meeting these structural requirements
However, recent exploratory microbiology has discovered
can be used to evolve high-affinity aptamers,8,11−14 enable
forms of life that use DNA built from nucleotides different
highly multiplexed PCR,15,16 and are used in commercial
from adenine (A), guanine (G), cytosine (C), and thymine
diagnostic kits testing for severe acute respiratory syndrome
(T).1,2 Separately, synthetic chemists have created artificial
coronavirus 2,17 Middle East respiratory syndrome-coronavi-
genetic systems containing additional nonstandard nucleotides
rus,18 dengue virus,19 murine norovirus,20 and others.21
designed to add base pairs using molecular recognition systems
Synthesizing hachimoji NAs using solid-phase chemistry has
that exploit hydrogen bonding3,4 or hydrophobic interac-
now been developed to the point where it is routine.6,22,23
tions.5,6 One such system has been used to create a semi-
However, commercial “next-generation” deep sequencing
synthetic life form.7
Hachimoji (Japanese meaning “eight letter”) nucleic acid
(NA) is an 8-letter artificial genetic system consisting of four Received: January 20, 2023
synthetic nucleotides (P, Z, B, and S) along with the four
standard nucleotides (A, C, G, and T). These form orthogonal
base pairs (A/T, G/C, P/Z, and B/S) that follow both
Watson−Crick pairing rules: hydrogen bonding and size
complementarity (Figure 1A).8 These meet the two structural

© XXXX American Chemical Society https://doi.org/10.1021/jacs.3c00829

A J. Am. Chem. Soc. XXXX, XXX, XXX−XXX
Journal of the American Chemical Society pubs.acs.org/JACS Article

Figure 1. (A) The eight-letter hachimoji genetic system consists of the four standard DNA bases (A, T, C, and G) and the four additional
nonstandard bases (P, Z, B, and S) that form four orthogonal Watson−Crick pairs through hydrogen bond complementarity. (B) A single MspA
nanopore (yellow) is embedded in a lipid bilayer. A single DNA molecule bound to a Hel308 helicase (green) is drawn into the pore by an electric
field. The ion current through the pore is modulated by the bases in the pore constriction and is measured to both sequence the strand and monitor
the progression of a Hel308 molecule along the DNA template. The applied voltage V can be a constant offset (Figures 2A and 3) or a periodic
waveform (Figure 2B, C). (C) Raw data trace of a hachimoji DNA template. Because Hel308 walks 3′ to 5′ along the DNA, we observe effects of
the nonstandard nucleotides first in ion current as they pass through the pore, then in enzyme behavior as they pass through the Hel308 helicase.

platforms are not designed to sequence hachimoji NAs. are pulled into the pore by the electric field until the enzyme
Accordingly, the sequences of such DNA are presently rests on the rim of the pore. The enzyme controls NA motion
determined by transliteration strategies that convert hachimoji through the pore by translocating along the strand in discrete
nucleotides into standard nucleotides following predictable steps. The bases in the narrowest part of the pore
pathways.24 This has, for example, enabled deep sequencing 6- (constriction) block the ion current in a sequence-dependent
letter GACTZP DNA molecules that have been evolved to manner, enabling nanopore sequencing28,44−46 and providing a
bind cancer cells,25 block the action of toxins,11 and cleave precise measurement of the enzyme’s position on the NA
RNA with sequence specificity.26 Other conceivable sequenc- template over time.47,48
ing approaches might include mass spectrometry7 and Here, we set out to address challenges that might arise when
sequencing by hybridization.27 attempting to sequence hachimoji DNA with nanopores. Since
Nanopore sequencing 28 is an attractive option for hachimoji bases have chemical structures similar to standard
sequencing nonstandard DNA. It has single-molecule bases, it is not obvious that nanopore signals from P, Z, S, and
sensitivity and does not require polymerases that can amplify B would be sufficiently distinguishable from standard base
hachimoji sequences. The success of nanopore sequencing in signals to allow sequencing.
detecting base modifications such as methylated cytosine,29−33 Further, the measured ion current in nanopore sequencing is
base adducts,34,35 and base isomers such as pseudouridine36,37 the result of current blockages by 4−6 consecutive bases in or
is auspicious. Beyond NAs, nanopore techniques are being near the pore constriction (referred to as k-mers).45,46
developed for peptide sequencing.38,39 Nanopore sequencing Therefore, decoding sequences requires current values
has been applied to the 6-letter artificial genetic system associated with various k-mers to be sufficiently distinguish-
containing a non-Watson−Crick pair between two hydro- able. The difficulty of nanopore sequencing scales exponen-
phobic nucleotides, termed dTPT3−dNaM.40,41 Recent tially with the number of base letters in a genetic alphabet (e.g.,
computational efforts have hinted at potential hachimoji a 6-base k-mer model requires decoding 4096 unique k-mers
nucleotide sensing with solid-state nanopores.42 for a 4-letter alphabet and 262,144 k-mers for an 8-letter
In standard nanopore strand sequencing,28,43,44 a single alphabet). Sequencing of such an alphabet requires empirical
nanoscale pore (nanopore) is inserted into a membrane and measurements of each k-mer in multiple sequence contexts to
forms the sole electrical connection between two electrolyte develop a current-to-sequence model, requiring significant
reservoirs (Figure 1B). A voltage applied across the membrane laboratory time and resources for library construction and
establishes an ion current through the pore, which is measured. analysis. In addition, the ion current levels of these k-mers will
Negatively charged NA molecules coupled to a motor enzyme have significant overlap with one another within the limited
B https://doi.org/10.1021/jacs.3c00829
J. Am. Chem. Soc. XXXX, XXX, XXX−XXX
Journal of the American Chemical Society pubs.acs.org/JACS Article

Figure 2. (A) Histograms of constant-voltage conductance caused by translocation of DNA substrates containing 16 nucleotide homopolymers of
each hachimoji base (excluding G). Homopolymers of P and Z give the lowest and highest conductance signals, respectively, evidence that the
hachimoji system has an expanded nanopore signal range relative to the standard alphabet. (B) Variable-voltage consensus patterns of hachimoji
single-base substitutions within a pseudorandom sequence. The sequence of conductance−voltage curves from variable-voltage nanopore
sequencing contains more sequence information than the sequence of current levels produced from constant-voltage sequencing.40,46 (C)
Confusion matrix of our base-calling algorithm’s accuracy shows that hachimoji single-base substitutions are distinguishable with high confidence
using variable-voltage nanopore sequencing. Reads are only included in base calling if they align to one of the consensus patterns with a confidence
greater than 90%.

dynamic range of the nanopore ion current, possibly making alphabets. The motor enzyme is proprietary, highly optimized
unique k-mer discrimination intractable. for sequencing of canonical bases, and cannot be easily
For these reasons, sequencing of base modifications in DNA modified or optimized for expanded DNA alphabets. Further,
(e.g., methylation) and RNA (e.g., pseudouridine) has often ONT from time to time changes its enzymes and pores to
relied on comparisons of nanopore signals to similar reads of optimize standard-base sequencing and that change may
unmodified NAs rather than de novo detection of the modified impact the reading of nonstandard nucleotides in an
nucleotide.29,30,37 The “k-mer explosion” created by the unpredictable way.
expansion of the DNA alphabet necessitates novel nanopore For these reasons, we chose to investigate the feasibility of
technologies capable of extracting additional signal features sequencing hachimoji DNA with variable-voltage sequencing
beyond the average ion current, such as variable-voltage on the MspA (Mycobacterium smegmatis porin A) nanopore.
sequencing.40,46 Additionally, nanopore sequencing of non- We both measured the nanopore ion current conductance of
standard nucleotides requires an enzyme capable of processing hachimoji DNA and tracked the translocation of the Hel308
them without introducing sequencing errors. motor enzyme (commonly used in nanopore sequenc-
Prior to the significant investment required in building a ing38,40,41,46) to assess enzyme/hachimoji compatibility. We
nanopore k-mer model for hachimoji DNA, we must assess also demonstrated proof-of-concept hachimoji reference
whether the four added nucleotides have a distinguishable sequencing by distinguishing single-base substitutions of each
effect on the nanopore signal. We must also assess their hachimoji base with high confidence using variable-voltage
compatibility with sequencing motor enzymes. The Oxford
nanopore sequencing.
Nanopore Technologies (ONT) sequencing devices are
commercially available and have a high throughput, long
reads, and high accuracy.49 Despite these advantages, ONT
platforms use only ion current data from a single applied
■ MATERIALS AND METHODS
Pore Establishment. A single M2-NNN-MspA nanopore was
voltage, limiting their utility for sequencing expanded established in a 1,2-di-O-phytanyl-sn-glycero-3-phosphocholine

C https://doi.org/10.1021/jacs.3c00829
J. Am. Chem. Soc. XXXX, XXX, XXX−XXX
Journal of the American Chemical Society pubs.acs.org/JACS Article

Figure 3. (A) Hel308 survival functions from multiple single-molecule traces as a function of position along a DNA template containing a
homopolymer of hachimoji bases and glycoside analogs. C-glycoside nucleosides are associated with higher dissociation (low survival) upon
translocation by Hel308. Hel308 steps along the DNA template from 3′ to 5′ in steps approximately half a nucleotide in length. (B) Chemical
structures of additional nucleotides used to further test the effects of glycosidic character. Bases are connected to the DNA backbone (red arrow)
through a C−C bond in C-glycosides, while N-glycosides are connected through a N−C bond. (C) Probability of Hel308 dissociation as a function
of position on hachimoji mixed sequences. High dissociation occurs in windows of approximately four (top) and eight bases (bottom), matching the
distribution of C-glycosides (S and Z underlined) within the sequences. Aligning the dissociation probability to sequence enables coarse-grained
localization of the dissociation site to 17 or 18 nucleotides upstream of the pore constriction.

(DOPHPC) lipid bilayer using methods that have been well 18-carbon spacer. This complement was used for each sequence in
established.50,51 Lipids were ordered from Avanti Polar Lipids. this study.
DNA Preparation. AEGIS phosphoramidites (Firebird Biomo- Proteins. Hel308 from Thermococcus gammatolerans EJ3 (acces-
lecular Sciences LLC. www.firebirdbio.com) were used in the solid- sion number WP_015858487.1) and M2-NNN MspA (accession
phase oligonucleotide synthesis on an ABI 394 instrument to make number CAB56052.1) were expressed using standard techniques
the nonstandard DNA molecules. Oligonucleotides were purified by using in-house facilities.
10% denatured PAGE and then desalted on a C18 Sep-Pak cartridge. Nanopore Experiment. Negatively charged DNA molecules
A complementary DNA strand was annealed to the template DNA coupled to a Hel308 helicase are captured by the electric field near the
strand to give the template a free 5′ end and an 8-base 3′ overhang. pore. At the beginning of a read, the 5′ end of the DNA template is
Hel308 binds to this 8-base overhang and can begin to unwind drawn into the pore until Hel308 comes to rest on the pore rim. As
dsDNA in solution, meaning that a nanopore read can start at any only ssDNA fits through the pore constriction, the complement strand
location along the DNA molecule, although most reads begin near the is sheared from the template strand, leaving only ssDNA (Figure S1).
start (3′ end) of the DNA sequence. Hel308 bound to the DNA will translocate from 3′ to 5′ in discrete
The DNA sequences for the template strands are listed in Table S1. steps approximately half a nucleotide in length,47 drawing the ssDNA
The DNA sequence for the complementary strand is 5′ out of the pore. While in principle it is possible for the 3′ end of the
CCTGCATGAGTTGTCTGCCGTGXXXX/chol/ 3′, where /chol/ DNA to feed into the pore, no such events were observed. To prevent
is a cholesterol tag to facilitate binding of the DNA to the bilayer to accumulation of ADP in bulk, we perfused new reagents into the cis
increase the interaction rate of DNA with the nanopore and “X” is an well every 45 min. In some experiments, we replaced the constant

D https://doi.org/10.1021/jacs.3c00829
J. Am. Chem. Soc. XXXX, XXX, XXX−XXX
Journal of the American Chemical Society pubs.acs.org/JACS Article

applied voltage with a periodic voltage waveform (200 Hz triangle excluded from base calling reads used to construct the
wave, 100 mV peak-to-peak offset to 150 mV) which repeatedly consensus patterns (50 reads each), as well as reads with a
stretches and relaxes DNA within the pore vestibule, “flossing” the maximum consensus alignment confidence less than 90% (low
DNA in the constriction by ± 0.5 nt, much faster than a typical confidence reads occupy 6% of our data). We achieved an
Hel308 step (∼10 Hz). This produces a sequence of conductance−
voltage curves which contain more sequence information than current accuracy >90% for all bases except for S (89.8%) (Figure 2C).
levels produced from constant-voltage nanopore sequencing.40,46 Translocation on Consecutive C-Glycoside Nucleo-
Data Acquisition. Data were acquired with custom LabVIEW sides Increases Premature Hel308 Dissociation from
software on an Axopatch 200B amplifier at 50 kHz and downsampled DNA. While measuring the conductance of hachimoji
by averaging to 5 kHz. In variable-voltage experiments, we applied a homopolymers, we observed that many of the reads terminated
200 Hz, 100 mV peak-to-peak triangle waveform in addition to a mid-sequence after processing only ∼10 nucleotides. Consid-
constant 150 mV offset. In constant-voltage experiments, we applied a ering that the measured processivity (average number of
constant 180 mV offset. A summary of all collected data can be found nucleotides translocated in a single binding event) of Hel308 is
in Table S2.
about 1000 nt on genomic DNA,46 this was interpreted as
Raw Data Analysis. In variable-voltage experiments, we processed
the raw data as described in Section S1 and Figure S2.40,46 In evidence of premature Hel308 dissociation from the DNA
constant-voltage experiments, ion current versus time raw traces were strand. As each nanopore sequencing read is a single-molecule
processed and compiled into consensus patterns as described in record of a motor enzyme’s activity,47,50 we tracked Hel308
Figure S3.47,48,50,52 Dwell-times and probability of backward step were molecules as they translocated on the hachimoji templates and
determined by aligning ion-current segments to the consensus measured the position at which Hel308 dissociates from the
sequence (Figure S4).48,53 Position of helicase dissociation was strand (Figure S8). We observed that Hel308 dissociated more
determined through the same alignment strategy. Survival functions often on homopolymers of S and Z compared to the rest of the
and dissociation probabilities were calculated from these positions templates (Figures 3A and S9). S and Z are connected to the
(Section S2). Homopolymer conductances were analyzed as
described in Section S3.
deoxyribose sugar by a carbon−carbon bond (C-glycoside),
while P, B, A, T, C, and G are connected to the deoxyribose

■ RESULTS
Large Dynamic Range for and Single-Base Substitu-
sugar by a carbon−nitrogen bond (N-glycoside).
To test the hypothesis that the C-glycoside character of S
and Z influences Hel308 dissociation, we measured Hel308
tions Are Distinguishable. We first measured the dissociation on DNA templates of identical design as described
conductance signal of seven hachimoji ssDNA templates above but with homopolymer regions consisting of the
containing a 16 nt region of homopolymer A, T, C, P, Z, B, nucleotides pseudothymidine (C-glycoside analogue of T,
or S passed through the MspA nanopore under a constant “pseudoT”), pseudoisocytidine (C-glycoside analogue of C,
applied voltage (Figures 2A, S5 and S6). Homopolymer G was “pseudoisoC”), and isocytidine (N-glycoside analogue of S,
omitted because of its tendency to form robust secondary “isoC”) (Figure 3B). Again, C-glycosides resulted in higher
structures, though we did opt to include homopolymer B Hel308 dissociation (Figure 3A), indicating that the C- versus
despite its own tendency to form quadruplex and pentaplex N-glycosidic status of the nucleotide appears to be a key
secondary structures.54,55 These structures may be resolved by determinant of this feature of the Hel308-DNA strand
the electrostatic force across the pore during measurement, interaction.
though they may still contribute to larger noise and wider Measurements of Hel308 dissociation may be sensitive to
conductance distribution relative to the other homopolymers. the quality of the DNA templates as helicase dissociation may
The 3′-nitrogen of the Z heterocyclic ring is known to have a be influenced by known solid-phase synthesis error modes
pKa of 7.826 in free solution, very close to the pH used in these such as DNA fragments or DNA chemical adducts. To rule out
experiments (pH 8). We speculate that protonation of Z may template impurity as the main source of our dissociation
be related to the wide conductance distribution measured for results, we conducted liquid chromatography−mass spectrom-
homopolymer Z, as protonation kinetics are known to be etry (LCMS) analysis of a subset of our DNA templates
observable as noise in nanopore experiments.56 (Section S5 and Figure S10). This measurement indicated that
Homopolymer P gave the lowest measured conductance of 19 ± 9% of our DNA molecules were expected to have one or
the alphabet (0.22 ± 0.01 nS), while homopolymer Z gave the more impurities that might affect Hel308’s processivity (Table
highest (0.68 ± 0.03 nS). The expanded conductance signal S3). This is well below the rate of Hel308 C-glycoside
range compared to the standard alphabet is encouraging for dissociation in which 50−80% of reads ended prematurely and
further sequencing applications, as it suggests that hachimoji k- suggests that the glycosidic composition of bases in our DNA
mers may be spread out over a larger range of conductance and templates is the primary cause of the observed differences in
thus easier to distinguish. the survival curves.
We next generated a single-stranded DNA hachimoji In the same experiments characterizing Hel308 dissociation,
reference library with each template having a 65-mer sequence we also measured Hel308’s dwell time and the probability of
identical across templates except for a single nucleotide which backward stepping on the hachimoji DNA templates. We have
contained one of the eight hachimoji bases. We constructed a previously measured these kinetic observables of Hel308 on
variable-voltage consensus conductance pattern for each of the standard DNA and have found that they are highly dependent
templates by averaging the patterns of 50 randomly selected on the underlying ssDNA sequence.53,57,58 Unsurprisingly, the
variable-voltage reads (Figure 2B). We used a previously nonstandard hachimoji nucleotides also distinctly affect these
developed base calling algorithm40 to align each read to all Hel308 kinetic observables, with Z and B bases eliciting longer
eight consensus patterns, generating a likelihood that the read dwell times in most sequence contexts and P and B causing
corresponds to each consensus (Section S4 and Figure S7). A more backward steps (Figure S11). C-glycosides do not
read is thus base-called by determining the consensus uniquely cause longer dwell times and/or more frequent
alignment that produced the maximum confidence. We backsteps in Hel308 compared to N-glycosides, ruling out the
E https://doi.org/10.1021/jacs.3c00829
J. Am. Chem. Soc. XXXX, XXX, XXX−XXX
Journal of the American Chemical Society pubs.acs.org/JACS Article

alternate hypothesis that increased time spent on the DNA limited set of possible sequences need be considered, e.g., a
template with a constant dissociation rate is ultimately the particularly prevalent base substitution or an abasic residue
cause of the high fraction of dissociations observed on C- which results from a particular DNA repair pathway.40 That
glycosides. the nanopore system shown here can distinguish among 8
Translocation over Different PZBS Sequence Con- separate hypotheses with high confidence suggests that it can
texts Hints at the Location of the DNA-Hel308 Contact be readily applied to probe hachimoji DNA extracted from live
Causing Dissociation. To further probe the C-glycoside cells.
dissociation mechanism, we measured Hel308 dissociation Denser patterns of hachimoji nucleotides will increase the
over DNA templates of identical design to those already combinatorial complexity of nanopore signals and will likely
described but with their homopolymer region replaced with a require new innovations to extract more information from the
16-nt mixed region composed of various combinations of P, Z, NA sequence. These include variable-voltage sequencing,
B, and S. Of particular interest is the sequence with a region frequency-domain analysis,58 as well as future work to
composed of dinucleotide repeats of each of the four incorporate motor enzyme kinetics as an additional independ-
nonstandard nucleotides in the pattern: 5′-(ZZSSPPBB)x2- ent signal into base-calling algorithms. For example, here
3′. The dissociation probability of Hel308 on this sequence is Hel308 shows strong sequence-dependent kinetics in response
markedly higher over two separate four-nucleotide windows, to hachimoji bases (Figure S11). As noncovalent nanopore-
with the two windows separated by approximately four target interactions may affect the measured signal, one
nucleotides (Figure 3C). This behavior is consistent with the possibility is to design nanopores that interact with specific
four-nucleotide-long C-glycoside windows present in the bases (such as the nitro group on Z), thus enhancing the
sequence, separated by four nucleotides of N-glycosides. current response in a base specific manner.60 Sequencing and
Hel308 dissociation on the sequence comparison of unmodified and transliterated NAs could also
5′-ZZZZSSSSPPPPBBBB-3′ also shows high dissociation be used to glean additional information from the DNA.24
over a roughly eight-nucleotide window, consistent with the By tracking the position along the strand where Hel308
C-glycoside distribution of the sequence. The dissociation dissociates, we found that Hel308 is partially compatible with
probability was related to the sequence at a distance 17 or 18 hachimoji nucleotides, translocating without issue on P and B
nt away from the pore constriction in both DNA templates, bases while retaining reasonable processivity on sparsely
corresponding to the DNA sequence within Hel308, consistent distributed S and/or Z bases. We also found compelling
with previous studies.53 As Hel308 is known to contact DNA evidence that the glycosidic character of nucleosides is a major
over a span of ∼14 nucleotides,59 this suggests that the site(s) predictor of premature Hel308 strand dissociation, with C-
within Hel308 that most influences C-glycoside dissociation is glycosides promoting more dissociation relative to N-glyco-
localized and only contacts 1 or 2 nucleotides instead of being sides. We speculate that this could be due to the C-glycosides
distributed throughout the helicase. This also suggests that adopting a different sugar pucker,10,61 a phenomenon in which
future work involving site-directed mutagenesis may be capable the conformation of the deoxyribose sugar switches from C2′-
of improving Hel308 survival on C-glycosides. endo to C3′-endo, decreasing the distance between neighboring
phosphate groups along the DNA backbone.62 We speculate
■ DISCUSSION
These data show that the MspA nanopore system can detect
that this may be an underlying mechanism by which Hel308
discriminates between DNA and RNA in vivo as DNA and
and accurately distinguish all eight hachimoji bases and that the RNA exhibit C2′-endo to C3′-endo pucker, respectively.63
nanopore conductance signal from hachimoji homopolymers By mutating Hel308 near the position where we localize the
occupies a larger dynamic range of conductance than the dissociation effect, we may be able to optimize Hel308 for use
standard DNA alphabet. This increased dynamic range means in C-glycoside nanopore sequencing. While the C-glycoside
that additional information can be gleaned from the nanopore effect will hinder nanopore sequencing of S/Z-rich hachimoji
signal despite the added difficulties of sequencing 8-letter templates actuated by wild type Hel308, the stochastic Hel308
DNA. In particular, the high currents produced by Z and low C-glycoside dissociation rate of 12%-per-nucleotide (Figure
currents produced by P suggest that de novo sequencing of a 6- S9) currently allows for sequencing strands with sparse S and Z
letter alphabet including A, C, G, T, P, and Z is a tractable composition or short sections (<20 nt) of S and Z. More work
problem. is needed to determine the mechanism of dissociation and
Further, by distinguishing hachimoji single-base substitutions whether other motor enzymes used for nanopore sequencing
with high confidence, these data show the feasibility of possess similar dissociation behavior. This work may also
simultaneous direct detection of hachimoji nucleotides sparsely provide useful constraints in the development of future
distributed within natural DNA. These are exactly the kinds of artificial genetic systems compatible with existing NA
sequences generated by laboratory in vitro evolution (LIVE) processing enzymes.
applied to hachimoji libraries. Here, the binding specificity and
enzyme catalytic activity of aptamers and aptazymes can be
greatly increased compared to standard NAs through the
■
*
ASSOCIATED CONTENT
sı Supporting Information
addition of only a few nonstandard hachimoji nucleoti- The Supporting Information is available free of charge at
des.8,11−14,26 This is one of many current and near-future https://pubs.acs.org/doi/10.1021/jacs.3c00829.
applications of hachimoji NAs with sparse incorporation of
nonstandard hachimoji nucleotides. Extended materials and methods; DNA sequences used;
Natural DNA includes additional non-canonical bases such nanopore experimental overview and data summary;
as methylated nucleotides or lesions such as abasic residues variable-voltage nanopore data analysis and feature
which also manifest as ion current shifts in nanopore extraction; generating a consensus; overview of nano-
sequencing data. However, for many applications, only a pore kinetic analysis; characterizing Hel308 strand

F https://doi.org/10.1021/jacs.3c00829
J. Am. Chem. Soc. XXXX, XXX, XXX−XXX
Journal of the American Chemical Society pubs.acs.org/JACS Article

dissociation; measuring the conductances of hachimoji supported by the National Institutes of Health under the
homopolymers; full conductance traces of nonstandard Director’s award number [R01GM128186]. The content is
base homopolymers and standard base homopolymers; solely the responsibility of the authors and does not necessarily
base calling single-base substitutions; visualization of the represent the official views of the National Institutes of Health.
single-base substitution base calling algorithm; measur- Notes
ing mid-strand dissociation of Hel308; Hel308 dissoci- The authors declare the following competing financial
ation probability over homopolymers; LCMS analysis interest(s): S.A.B. owns Firebird Biomolecular Sciences,
and quality control; LC chromatograms and mass which makes various hachimoji reagents available for sale.
spectrums of hachimoji DNA samples; molar percentage The authors declare no other competing financial interests.
of adducted or truncated DNA; and sequence-depend- The data underlying this article are available in figshare and
ent effects of hachimoji DNA on Hel308 kinetics (PDF) c a n b e a c c e s s e d w i t h h t t p s : / / fi g s h a r e . c o m / s /
1a23062119aa22f33de2.
■ AUTHOR INFORMATION
Corresponding Author ■ ACKNOWLEDGMENTS
Andrew H. Laszlo − Department of Physics, University of We thank Sinduja K. Marx for expressing and purifying
Washington, Seattle, Washington 98195, United States; Hel308.
orcid.org/0000-0002-7853-0533; Phone: (206) 685-
2428; Email: [email protected]
Authors
■ REFERENCES
(1) Pezo, V.; Jaziri, F.; Bourguignon, P.-Y.; Louis, D.; Jacobs-Sera,
Christopher A. Thomas − Department of Physics, University D.; Rozenski, J.; Pochet, S.; Herdewijn, P.; Hatfull, G. F.; Kaminski,
P.-A.; Marliere, P. Noncanonical DNA Polymerization by Amino-
of Washington, Seattle, Washington 98195, United States; adenine-Based Siphoviruses. Science 2021, 372, 520−524.
orcid.org/0000-0003-2434-5049 (2) Zhou, Y.; Xu, X.; Wei, Y.; Cheng, Y.; Guo, Y.; Khudyakov, I.;
Jonathan M. Craig − Department of Physics, University of Liu, F.; He, P.; Song, Z.; Li, Z.; Gao, Y.; Ang, E. L.; Zhao, H.; Zhang,
Washington, Seattle, Washington 98195, United States Y.; Zhao, S. A Widespread Pathway for Substitution of Adenine by
Shuichi Hoshika − Foundation for Applied Molecular Diaminopurine in Phage Genomes. Science 2021, 372, 512−516.
Evolution, Alachua, Florida 32615, United States (3) Benner, S. A. Understanding Nucleic Acids Using Synthetic
Henry Brinkerhoff − Department of Physics, University of Chemistry. Acc. Chem. Res. 2004, 37, 784−797.
Washington, Seattle, Washington 98195, United States (4) Hirao, I.; Ohtsuki, T.; Fujiwara, T.; Mitsui, T.; Yokogawa, T.;
Jesse R. Huang − Department of Physics, University of Okuni, T.; Nakayama, H.; Takio, K.; Yabuki, T.; Kigawa, T.; Kodama,
Washington, Seattle, Washington 98195, United States K.; Yokogawa, T.; Nishikawa, K.; Yokoyama, S. An Unnatural Base
Pair for Incorporating Amino Acid Analogs into Proteins. Nat.
Sarah J. Abell − Department of Physics, University of Biotechnol. 2002, 20, 177−182.
Washington, Seattle, Washington 98195, United States (5) Henry, A. A.; Romesberg, F. E. Beyond A, C, G and T:
Hwanhee C. Kim − Department of Physics, University of augmenting nature’s alphabet. Curr. Opin. Chem. Biol. 2003, 7, 727−
Washington, Seattle, Washington 98195, United States 733.
Michaela C. Franzi − Department of Physics, University of (6) Hikida, Y.; Kimoto, M.; Yokoyama, S.; Hirao, I. Site-Specific
Washington, Seattle, Washington 98195, United States Fluorescent Probing of RNA Molecules by Unnatural Base-Pair
Jessica D. Carrasco − Department of Physics, University of Transcription for Local Structural Conformation Analysis. Nat. Protoc.
Washington, Seattle, Washington 98195, United States 2010, 5, 1312−1323.
Hyo-Joong Kim − Foundation for Applied Molecular (7) Malyshev, D. A.; Dhami, K.; Lavergne, T.; Chen, T.; Dai, N.;
Evolution, Alachua, Florida 32615, United States Foster, J. M.; Corrêa, I. R.; Romesberg, F. E. A Semi-Synthetic
Organism with an Expanded Genetic Alphabet. Nature 2014, 509,
Drew C. Smith − Department of Physics, University of 385−388.
Washington, Seattle, Washington 98195, United States (8) Hoshika, S.; Leal, N. A.; Kim, M.-J.; Kim, M.-S.; Karalkar, N. B.;
Jens H. Gundlach − Department of Physics, University of Kim, H.-J.; Bates, A. M.; Watkins, N. E.; SantaLucia, H. A.; Meyer, A.
Washington, Seattle, Washington 98195, United States J.; DasGupta, S.; Piccirilli, J. A.; Ellington, A. D.; SantaLucia, J.;
Steven A. Benner − Foundation for Applied Molecular Georgiadis, M. M.; Benner, S. A. Hachimoji DNA and RNA: A
Evolution, Alachua, Florida 32615, United States Genetic System with Eight Building Blocks. Science 2019, 363, 884−
887.
Complete contact information is available at: (9) Benner, S. A. Rethinking Nucleic Acids from Their Origins to
https://pubs.acs.org/10.1021/jacs.3c00829 Their Applications. Philos. Trans. R. Soc., B 2023, 378, 20220027.
(10) Hoshika, S.; Shukla, M. S.; Benner, S. A.; Georgiadis, M. M.
Funding Visualizing “Alternative Isoinformational Engineered” DNA in A- and
C.A.T., S.H., S.J.A., M.C.F., J.D.C., J.H.G., S.A.B., and A.H.L. B-Forms at High Resolution. J. Am. Chem. Soc. 2022, 144, 15603−
were supported by an Opportunity Fund through the 15611.
Technology Development Coordinating Center at Jackson (11) Biondi, E.; Lane, J. D.; Das, D.; Dasgupta, S.; Piccirilli, J. A.;
Laboratories (National Human Genome Research Institute Hoshika, S.; Bradley, K. M.; Krantz, B. A.; Benner, S. A. Laboratory
[U24HG011735]). Hachimoji chemistry was developed under Evolution of Artificially Expanded DNA Gives Redesignable Aptamers
That Target the Toxic Form of Anthrax Protective Antigen. Nucleic
a grant from the National Science Foundation [MCB- Acids Res. 2016, 44, 9565−9577.
1939086] and a grant from the National Institutes of General (12) Zhang, L.; Yang, Z.; Le Trinh, T.; Teng, I.-T.; Wang, S.;
Medical Sciences [1R01GM141391-01A1]. J.M.C., J.R.H., and Bradley, K. M.; Hoshika, S.; Wu, Q.; Cansiz, S.; Rowold, D. J.;
H.C.K. were supported by the National Institutes of Health, McLendon, C.; Kim, M.-S.; Wu, Y.; Cui, C.; Liu, Y.; Hou, W.;
National Human Genome Research Institute Stewart, K.; Wan, S.; Liu, C.; Benner, S. A.; Tan, W. Aptamers against
[R01HG005115]. Research reported in this publication was Cells Overexpressing Glypican 3 from Expanded Genetic Systems

G https://doi.org/10.1021/jacs.3c00829
J. Am. Chem. Soc. XXXX, XXX, XXX−XXX
Journal of the American Chemical Society pubs.acs.org/JACS Article

Combined with Cell Engineering and Laboratory Evolution. Angew. (31) Rand, A. C.; Jain, M.; Eizenga, J. M.; Musselman-Brown, A.;
Chem., Int. Ed. 2016, 55, 12372−12375. Olsen, H. E.; Akeson, M.; Paten, B. Mapping DNA Methylation with
(13) Kimoto, M.; Yamashige, R.; Matsunaga, K.; Yokoyama, S.; High-Throughput Nanopore Sequencing. Nat. Methods 2017, 14,
Hirao, I. Generation of High-Affinity DNA Aptamers Using an 411−413.
Expanded Genetic Alphabet. Nat. Biotechnol. 2013, 31, 453−457. (32) Schreiber, J.; Wescoe, Z. L.; Abu-Shumays, R.; Vivian, J. T.;
(14) Biondi, E.; Benner, S. A. Artificially Expanded Genetic Baatar, B.; Karplus, K.; Akeson, M. Error Rates for Nanopore
Information Systems for New Aptamer Technologies. Biomedicines Discrimination among Cytosine, Methylcytosine, and Hydroxyme-
2018, 6, 53. thylcytosine along Individual DNA Strands. Proc. Natl. Acad. Sci.
(15) Yang, Z.; Chen, F.; Chamberlin, S.; Benner, S. A. Expanded 2013, 110, 18910−18915.
Genetic Alphabets in the Polymerase Chain Reaction. Angew. Chem., (33) Wescoe, Z. L.; Schreiber, J.; Akeson, M. Nanopores
Int. Ed. 2010, 49, 177−180. Discriminate among Five C5-Cytosine Variants in DNA. J. Am.
(16) Yang, Z.; Durante, M.; Glushakova, L. G.; Sharma, N.; Leal, N. Chem. Soc. 2014, 136, 16582−16587.
A.; Bradley, K. M.; Chen, F.; Benner, S. A. Conversion Strategy Using (34) Nookaew, I.; Jenjaroenpun, P.; Du, H.; Wang, P.; Wu, J.;
an Expanded Genetic Alphabet to Assay Nucleic Acids. Anal. Chem. Wongsurawat, T.; Moon, S. H.; Huang, E.; Wang, Y.; Boysen, G.
2013, 85, 4705−4712. Detection and Discrimination of DNA Adducts Differing in Size,
(17) Yang, Z.; Benner, S. A. Compositions for the Multiplexed Regiochemistry, and Functional Group by Nanopore Sequencing.
Detection of Viruses. U.S. Patent 20,220,162,600 A1, 2020. Chem. Res. Toxicol. 2020, 33, 2944−2952.
(18) Yaren, O.; Glushakova, L. G.; Bradley, K. M.; Hoshika, S.; (35) Ma, F.; Yan, S.; Zhang, J.; Wang, Y.; Wang, L.; Wang, Y.;
Benner, S. A. Standard and AEGIS Nicking Molecular Beacons Detect Zhang, S.; Du, X.; Zhang, P.; Chen, H.-Y.; Huang, S. Nanopore
Amplicons from the Middle East Respiratory Syndrome Coronavirus. Sequencing Accurately Identifies the Cisplatin Adduct on DNA. ACS
J. Virol. Methods 2016, 236, 54−61. Sens. 2021, 6, 3082−3092.
(19) Glushakova, L. G.; Bradley, A.; Bradley, K. M.; Alto, B. W.; (36) Fleming, A. M.; Mathewson, N. J.; Howpay Manage, S. A.;
Hoshika, S.; Hutter, D.; Sharma, N.; Yang, Z.; Kim, M.-J.; Benner, S. Burrows, C. J. Nanopore Dwell Time Analysis Permits Sequencing
A. High-Throughput Multiplexed XMAP Luminex Array Panel for and Conformational Assignment of Pseudouridine in SARS-CoV-2.
Detection of Twenty Two Medically Important Mosquito-Borne ACS Cent. Sci. 2021, 7, 1707−1717.
Arboviruses Based on Innovations in Synthetic Biology. J. Virol. (37) Tavakoli, S.; Nabizadeh, M.; Makhamreh, A.; Gamper, H.;
Methods 2015, 214, 60−74. McCormick, C. A.; Rezapour, N. K.; Hou, Y.-M.; Wanunu, M.;
(20) Yaren, O.; Bradley, K. M.; Moussatche, P.; Hoshika, S.; Yang, Rouhanifard, S. H. Semi-Quantitative Detection of Pseudouridine
Z.; Zhu, S.; Karst, S. M.; Benner, S. A. A Norovirus Detection Modifications and Type I/II Hypermodifications in Human MRNAs
Architecture Based on Isothermal Amplification and Expanded
Using Direct Long-Read Sequencing. Nat. Commun. 2023, 14, 334.
Genetic Systems. J. Virol. Methods 2016, 237, 64−71. (38) Brinkerhoff, H.; Kang, A. S. W.; Liu, J.; Aksimentiev, A.;
(21) Glushakova, L. G.; Sharma, N.; Hoshika, S.; Bradley, A. C.;
Dekker, C. Multiple Rereads of Single Proteins at Single−Amino Acid
Bradley, K. M.; Yang, Z.; Benner, S. A. Detecting Respiratory Viral
Resolution Using Nanopores. Science 2021, 374, 1509−1513.
RNA Using Expanded Genetic Alphabets and Self-Avoiding DNA.
(39) Yan, S.; Zhang, J.; Wang, Y.; Guo, W.; Zhang, S.; Liu, Y.; Cao,
Anal. Biochem. 2015, 489, 62−72.
J.; Wang, Y.; Wang, L.; Ma, F.; Zhang, P.; Chen, H.-Y.; Huang, S.
(22) Yang, Z.; Hutter, D.; Sheng, P.; Sismour, A. M.; Benner, S. A.
Single Molecule Ratcheting Motion of Peptides in a Mycobacterium
Artificially Expanded Genetic Information System: A New Base Pair
Smegmatis Porin A (MspA) Nanopore. Nano Lett. 2021, 21, 6703−
with an Alternative Hydrogen Bonding Pattern. Nucleic Acids Res.
2006, 34, 6095−6101. 6710.
(23) Ogawa, A. K.; Wu, Y.; McMinn, D. L.; Liu, J.; Schultz, P. G.; (40) Ledbetter, M. P.; Craig, J. M.; Karadeema, R. J.; Noakes, M. T.;
Romesberg, F. E. Efforts toward the Expansion of the Genetic Kim, H. C.; Abell, S. J.; Huang, J. R.; Anderson, B. A.; Krishnamurthy,
Alphabet: Information Storage and Replication with Unnatural R.; Gundlach, J. H.; Romesberg, F. E. Nanopore Sequencing of an
Hydrophobic Base Pairs. J. Am. Chem. Soc. 2000, 122, 3274−3287. Expanded Genetic Alphabet Reveals High-Fidelity Replication of a
(24) Yang, Z.; Chen, F.; Alvarado, J. B.; Benner, S. A. Amplification, Predominantly Hydrophobic Unnatural Base Pair. J. Am. Chem. Soc.
Mutation, and Sequencing of a Six-Letter Synthetic Genetic System. J. 2020, 142, 2110−2114.
Am. Chem. Soc. 2011, 133, 15105−15112. (41) Craig, J. M.; Laszlo, A. H.; Derrington, I. M.; Ross, B. C.;
(25) Zhang, L.; Wang, S.; Yang, Z.; Hoshika, S.; Xie, S.; Li, J.; Chen, Brinkerhoff, H.; Nova, I. C.; Doering, K.; Tickman, B. I.; Svet, M. T.;
X.; Wan, S.; Li, L.; Benner, S. A.; Tan, W. An Aptamer-Nanotrain Gundlach, J. H. Direct Detection of Unnatural DNA Nucleotides
Assembled from Six-Letter DNA Delivers Doxorubicin Selectively to DNaM and D5SICS Using the MspA Nanopore. PLoS One 2015, 10,
Liver Cancer Cells. Angew. Chem., Int. Ed. 2020, 59, 663−668. No. e0143253.
(26) Jerome, C. A.; Hoshika, S.; Bradley, K. M.; Benner, S. A.; (42) de Souza, F. A. L.; Sivaraman, G.; Fyta, M.; Scheicher, R. H.;
Biondi, E. In vitro evolution of ribonucleases from expanded genetic Scopel, W. L.; Amorim, R. G. Electrically Sensing Hachimoji DNA
alphabets. Proc. Natl. Acad. Sci. 2022, 119, No. e2208261119. Nucleotides through a Hybrid Graphene/h-BN Nanopore. Nanoscale
(27) Lee, K. H.; Hamashima, K.; Kimoto, M.; Hirao, I. Genetic 2020, 12, 18289−18295.
Alphabet Expansion Biotechnology by Creating Unnatural Base Pairs. (43) Cherf, G. M.; Lieberman, K. R.; Rashid, H.; Lam, C. E.;
Curr. Opin. Biotechnol. 2018, 51, 8−15. Karplus, K.; Akeson, M. Automated Forward and Reverse Ratcheting
(28) Manrao, E. A.; Derrington, I. M.; Laszlo, A. H.; Langford, K. of DNA in a Nanopore at 5-Å Precision. Nat. Biotechnol. 2012, 30,
W.; Hopper, M. K.; Gillgren, N.; Pavlenok, M.; Niederweis, M.; 344−348.
Gundlach, J. H. Reading DNA at Single-Nucleotide Resolution with a (44) Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.
Mutant MspA Nanopore and Phi29 DNA Polymerase. Nat. Characterization of Individual Polynucleotide Molecules Using a
Biotechnol. 2012, 30, 349−353. Membrane Channel. Proc. Natl. Acad. Sci. 1996, 93, 13770−13773.
(29) Laszlo, A. H.; Derrington, I. M.; Brinkerhoff, H.; Langford, K. (45) Laszlo, A. H.; Derrington, I. M.; Ross, B. C.; Brinkerhoff, H.;
W.; Nova, I. C.; Samson, J. M.; Bartlett, J. J.; Pavlenok, M.; Gundlach, Adey, A.; Nova, I. C.; Craig, J. M.; Langford, K. W.; Samson, J. M.;
J. H. Detection and Mapping of 5-Methylcytosine and 5- Daza, R.; Doering, K.; Shendure, J.; Gundlach, J. H. Decoding Long
Hydroxymethylcytosine with Nanopore MspA. Proc. Natl. Acad. Sci. Nanopore Sequencing Reads of Natural DNA. Nat. Biotechnol. 2014,
U.S.A. 2013, 110, 18904−18909. 32, 829−833.
(30) Simpson, J. T.; Workman, R. E.; Zuzarte, P. C.; David, M.; (46) Noakes, M. T.; Brinkerhoff, H.; Laszlo, A. H.; Derrington, I.
Dursi, L. J.; Timp, W. Detecting DNA Cytosine Methylation Using M.; Langford, K. W.; Mount, J. W.; Bowman, J. L.; Baker, K. S.;
Nanopore Sequencing. Nat. Methods 2017, 14, 407−410. Doering, K. M.; Tickman, B. I.; Gundlach, J. H. Increasing the

H https://doi.org/10.1021/jacs.3c00829
J. Am. Chem. Soc. XXXX, XXX, XXX−XXX
Journal of the American Chemical Society pubs.acs.org/JACS Article

Accuracy of Nanopore DNA Sequencing Using a Time-Varying Cross

Membrane Voltage. Nat. Biotechnol. 2019, 37, 651−656.
(47) Derrington, I. M.; Craig, J. M.; Stava, E.; Laszlo, A. H.; Ross, B.
C.; Brinkerhoff, H.; Nova, I. C.; Doering, K.; Tickman, B. I.; Ronaghi,
M.; Mandell, J. G.; Gunderson, K. L.; Gundlach, J. H. Subangstrom
Single-Molecule Measurements of Motor Proteins Using a Nanopore.
Nat. Biotechnol. 2015, 33, 1073−1075.
(48) Craig, J. M.; Laszlo, A. H.; Brinkerhoff, H.; Derrington, I. M.;
Noakes, M. T.; Nova, I. C.; Tickman, B. I.; Doering, K.; de Leeuw, N.
F.; Gundlach, J. H. Revealing Dynamics of Helicase Translocation on
Single-Stranded DNA Using High-Resolution Nanopore Tweezers.
Proc. Natl. Acad. Sci. U.S.A. 2017, 114, 11932−11937.
(49) Wang, Y.; Zhao, Y.; Bollas, A.; Wang, Y.; Au, K. F. Nanopore
Sequencing Technology, Bioinformatics and Applications. Nat.
Biotechnol. 2021, 39, 1348−1365.
(50) Laszlo, A. H.; Derrington, I. M.; Gundlach, J. H. MspA
Nanopore as a Single-Molecule Tool: From Sequencing to SPRNT.
Methods 2016, 105, 75−89.
(51) Butler, T. Z.; Pavlenok, M.; Derrington, I. M.; Niederweis, M.;
Gundlach, J. H. Single-Molecule DNA Detection with an Engineered
MspA Protein Nanopore. Proc. Natl. Acad. Sci. U.S.A. 2008, 105,
20647−20652.
(52) LaMont, C. H.; Wiggins, P. A. The Development of an
Information Criterion for Change-Point Analysis. Neural Comput.
2016, 28, 594−612.
(53) Craig, J. M.; Laszlo, A. H.; Nova, I. C.; Brinkerhoff, H.; Noakes,
M. T.; Baker, K. S.; Bowman, J. L.; Higinbotham, H. R.; Mount, J. W.;
Gundlach, J. H. Determining the Effects of DNA Sequence on Hel308
Helicase Translocation along Single-Stranded DNA Using Nanopore
Tweezers. Nucleic Acids Res. 2019, 47, 2506−2513.
(54) Seela, F.; Wei, C.; Melenewski, A. Isoguanine Quartets Formed
by d(T4isoG4T4): Tetraplex Identification and Stability. Nucleic Acids
Res. 1996, 24, 4940−4945.
(55) Chaput, J. C.; Switzer, C. A DNA pentaplex incorporating
nucleobase quintets. Proc. Natl. Acad. Sci. 1999, 96, 10614−10619.
(56) Bezrukov, S. M.; Kasianowicz, J. J. Current Noise Reveals
Protonation Kinetics and Number of Ionizable Sites in an Open
Protein Ion Channel. Phys. Rev. Lett. 1993, 70, 2352−2355.
(57) Laszlo, A. H.; Craig, J. M.; Gavrilov, M.; Tippana, R.; Nova, I.
C.; Huang, J. R.; Kim, H. C.; Abell, S. J.; deCampos-Stairiker, M.;
Mount, J. W.; Bowman, J. L.; Baker, K. S.; Higinbotham, H.;
Bobrovnikov, D.; Ha, T.; Gundlach, J. H. Sequence-Dependent
Mechanochemical Coupling of Helicase Translocation and Unwind-
ing at Single-Nucleotide Resolution. Proc. Natl. Acad. Sci. 2022, 119,
No. e2202489119.
(58) Craig, J. M.; Mills, M.; Kim, H. C.; Huang, J. R.; Abell, S. J.;
Mount, J. W.; Gundlach, J. H.; Neuman, K. C.; Laszlo, A. H.
Nanopore Tweezers Measurements of RecQ Conformational
Changes Reveal the Energy Landscape of Helicase Motion. Nucleic
Acids Res. 2022, 50, 10601−10613.
(59) Büttner, K.; Nehring, S.; Hopfner, K.-P. Structural Basis for
DNA Duplex Separation by a Superfamily-2 Helicase. Nat. Struct. Mol.
Biol. 2007, 14, 647−652.
(60) Li, M.-Y.; Ying, Y.-L.; Yu, J.; Liu, S.-C.; Wang, Y.-Q.; Li, S.;
Long, Y.-T. Revisiting the Origin of Nanopore Current Blockage for
Volume Difference Sensing at the Atomic Level. JACS Au 2021, 1,
967−976.
(61) Davis, D. R. Stabilization of RNA Stacking by Pseudouridine.
Nucleic Acids Res. 1995, 23, 5020−5026.
(62) Saenger, W.; Hunter, W. N.; Kennard, O. DNA Conformation
Is Determined by Economics in the Hydration of Phosphate Groups.
Nature 1986, 324, 385−388.
(63) Rich, A. The Double Helix: A Tale of Two Puckers. Nat. Struct.
Mol. Biol. 2003, 10, 247−249.

I https://doi.org/10.1021/jacs.3c00829
J. Am. Chem. Soc. XXXX, XXX, XXX−XXX