Introduction to Traditional and Modern Biotechnology

Differentiate traditional biotechnology and modern biotechnology

LEARNING OBJECTIVES:

1. Compare traditional from modern biotechnology.

2. Analyze the procedures and examples of traditional biotechnology present in the society
3. Present current news concerning latest innovation of biotechnology.

Activity 1
READING COMPREHENSION

Biotechnology is defined as manipulation of DNA components to achieve a desirable

product. It involves modifying of biological systems and conducting processes to produce
products and provide services. It comes from the Greek
words bios meaning life and technikos meaning involving human knowledge and skills.
In simple terms, biotechnology is the use of living organisms by humans. It is the science for
our century and it involves biology, chemistry, physics, engineering, computers and
information technology to develop new tools and products.
We can distinguish between traditional and modern biotechnology. Traditional biotechnology
refers to ancient ways of using living organisms to make new products or modify existing
ones. An example of traditional biotechnology is what human beings have been doing for
centuries: cloning plants. Each time a little branch is cut off from a plant and placed in soil to
grow a new plant, cloning occurs. Over the past 30 years, biologists have increasingly applied
the methods of physics, chemistry and mathematics in order to gain precise knowledge, at the
molecular level, of how living cells make these substances. By combining this newly-gained
knowledge with the methods of engineering and science, what has emerged is the concept of
biotechnology which embraces all of the above-mentioned disciplines. With modern
biotechnology we are not only doing the physical manipulation at the visual level but also at
the molecular level. In modern molecular biotechnology, we select the desired characteristic
at the molecular level and add it to the organism's genetic makeup. Whereas traditional
biotechnology exploits the potential of processes performed by living organisms, such as
fermentation, modern biotechnology manipulates the genes of organisms and inserts them
into other organisms to acquire the desired trait. However, both traditional and modern
biotechnology shares the same foundation: the use of living organisms to enhance crops,
fuels, medical treatments and other tools to help humans.
Humans have spent thousands of years selecting and cultivating the best traits that nature
offers and now, with the help of biotechnology, nanotechnology and other sciences, we are
able to improve these traits at the atomic level and develop safe and beneficial crops, medical
treatments, biofuels and household products. Contemporary use of the term
biotechnology includes genetic engineering as well as bioengineering that are the application
of engineering principles in the fields of biology and medicine.
Name: Date:
Year and Section:

Differentiate traditional biotechnology and modern biotechnology

A. Directions: Answer the following questions based on facts that you read about
biotechnology.

1. What is biotechnology?

2. What is the difference between modern and traditional biotechnology?

3. What does modern biotechnology do?

4. What are the sciences involved in biotechnology?

5. What are the advantages of modern biotechnology?

B. Write a short phrase and explanation about the advantages and disadvantages of
biotechnology and the problems of manipulation of genes.
Name: Date:
Year and Section:

Differentiate traditional biotechnology and modern biotechnology

Activity 2

Directions: Make a research and present current news or articles concerning latest innovation
of biotechnology. Please indicate the source or reference, and the date of the article of your
research. Write your comment about the article on the space provided below.

Comments:

Introduction to Traditional and Modern Biotechnology

Differentiate traditional biotechnology and modern biotechnology

LEARNING OBJECTIVES:

1. Discuss the process of household traditional biotechnology products.

2. Classify household products of traditional biotechnology techniques.
3. Innovate your own traditional biotechnology product.

What is Traditional Biotechnology?

It refers to classical ways of using living organisms to make new products or modify existing
ones.

What are some examples of traditional biotechnology products?

Some examples are vinegar (acetobacter), soy sauce (Aspergillus oryzae) and patis (fish
sauce), beer, wine, and cheese, pandesal”, and “nata de coco”. Most of the products of
tradional biotechnology were produced via fermentation.

FERMENTATION It involves a microbial process where enzymes produced by

microorganisms catalyze the transformation of organic compounds.
It derived from the Latin word “fervere” which means “to boil”.

It was observed that the addition of yeast to fruit juices or cereal grains during bread-
making produce bubblingfrom carbon dioxide production.
The trapped carbon dioxide causes the bread to rise. In beer and wine making, yeast
converts sugar to alcohol. It is believed that fermented food products were produced
initially by accident

TIMELINE OF THE DISCOVERY OF TRADITIONAL BIOTECHNOLOGY

PRODUCTS

YEAR DISCOVERY AND DEVELOPMENT

4000 BC The Chinese already use lactic acid producing bacteria for making
yogurt, use molds for making cheese, and acetic acid bacteria for
making wine vinegar.
Between 5000 to 9000 Milk from animals has been used for cheese makers. Now, the
BC same technology is used for making cheese. Cheese makers
inoculate the milk with lactic acid bacteria and add enzyme
“chymosin”, also called rennet to curdle the casein.
1500 BC It is believed that fermented dough has been discovered y accident
when some dough was not baked immediately, underwent
 spontaneous fermentation and when baked, produced a lighter,
expanded, and more palatable bread.

1680 Dutch biologist and microscopist Anton van Leewenhoek

examined samples of fermenting beer through and observed yeasts
under the microscope.
1800 Brewers are already producing alcohol on a large scale. Brewers
had accumulated enough knowledge to use pure yeast cultures in
the fermentation process.

1837 The connection was made between yeast cell activity (observed by
Leewenhoek) and alcohol fermentation.
1876 Louis Pasteur, a French Chemist established that yeast and other
microbes are linked to fermentation and described that yeast
convert sugar into ethanol and carbon dioxide.
1911 Brewers already measure the amount of acid during mashing to
better control quality of beer.
1950s-1960s Microbial production of antibiotics and amino acids occurred in
response to the need for antibacterial cure during World War II.

Activity 3

Directions: Answer what is being asked. Write your answer on the space provided before
each number.

1. It is a Latin word which means “to boil”.

2. It involves a microbial process where enzymes produced by
microorganisms catalyze the transformation of organic compounds.
3. It is a microorganism present in the production of beer and wine.
4. Refers to ancient ways of using living organisms to make new products or
modify existing ones.
5-6. These are by-products of the fermentation with the use of yeast wherein
these microorganisms convert sugar into these two compounds.

Activity 4

Directions: Choose the correct year of the discovery and development of the products of
traditional biotechnology. Choose from the choices below.

7. Fermented dough has been discovered by accident.

8. Chinese already use lactic acid producing bacteria for making yogurt, use
molds for making cheese, and acetic acid bacteria for making wine
vinegar.
9. Milk from animals has been used for cheese makers.
10. Brewers are already producing alcohol on a large scale.
 11. Dutch biologist and microscopist Anton van Leewenhoek examined
samples of fermenting beer through and observed yeasts under the
microscope.
12. Louis Pasteur, a French Chemist established that yeast and other microbes
are linked to fermentation.
13. The connection was made between yeast cell activity (observed by
Leewenhoek) and alcohol fermentation.
14. Microbial production of antibiotics and amino acids occurred in response
to the need for antibacterial cure during World War II.
15. Brewers already measure the amount of acid during mashing to better
control quality of beer.

4000 BC 1500 BC 1800 1680 1876 1837 1911 5000-9000 BC 1950-1960

ACTIVITY 5

List down five household traditional biotechnology products and make a research on how they are
produced.

HOUSEHOLD PRODUCTS PROCESS

Food Preservation Rubric

Direction: Using any available and low cost raw materials, prepare your own dish or
dessert that we can classify as product of traditional biotechnology. Please be
guided by the rubric below:

CRITERIA 5 4 3

Appearance The product looks The product looks The product does not
appealing and less appealing and look good.
presentable. less presentable.
Cost The raw materials The raw materials are The raw materials are
cost only minimal quite expensive. expensive.
amount
Preparation and The product is The product is The product is
Presentation presented excellently presented quite good presented poorly with
with complete but with incomplete incomplete
explanation of the explanation of the explanation of the
process. process. process.

Introduction to Traditional and Modern Biotechnology

Differentiate traditional biotechnology and modern biotechnology

LEARNING OBJECTIVES:

1. Discuss the definition and description of modern biotechnology.

2. Analyze the importance of some modern biotechnology products especially during
pandemic times.
3. Make a research about the useful product of modern biotechnology and how it helps the
society.

Modern biotechnologies involve making useful products from whole organisms or parts of
organisms, such as molecules, cells, tissues and organs. Recent developments in
biotechnology include genetically modified plants and animals, cell therapies and
nanotechnology. It also includes the development of different apparatus that helps in the
discovery of diseases.

What are some applications of modern biotechnology?

1. DNA Profiling

It is the process where a specific DNA pattern, called a profile, is obtained from a person or
sample of bodily tissue to identify the probable origin of a body fluid sample associated with
a crime or crime scene, to reveal family relationship, and to identify disaster victims.

2. DNA Cloning

It is used to create a large number of copies of a gene or other piece of DNA. The cloned
DNA can be used to work out the function of the gene, investigate a gene’s characteristics
(size, expression, tissue distribution), look at how mutations may affect a gene’s function,
and make large concentrations of the protein coded for by the gene

3. Transgenesis

It is a mode of experimentation involving insertion of a foreign gene into the genome of an

organism, followed by germ-line transmission of the gene and analysis of the resulting
phenotype in the progeny.

4. Genome Analysis

These are the techniques needed to determine and compare the genetic sequence (e.g. DNA in
the chromosomes and mitochondria).

5. Stem Cells
These are cells that have not differentiated. They are unique because they can divide and
grow for a long period of time without becoming a particular type of cell.

6. Xenotransplantation

It is when living cells, tissues or organs are transplanted between species. To be successful in
humans, xenotransplants must overcome issues of transplant rejection, cross-
species infection and ethics.

ACTIVITY 6

Answer the following question:

1. What is modern biotechnology?

2. What are some examples of modern biotechnology that are present in our country?
3. What are the hindrances of using modern biotechnology in human? Why?
4. During pandemic, what is the importance or role of using biotechnology? Be specific and
citing the product or process that involves application of modern biotechnology.

ACTIVITY 7

Read an article or news about COVID-19 wherein a product of biotechnology is being

discussed or mentioned. Write it in a short bond paper. Don’t forget to cite your reference and
date of the article or news.

Introduction to Traditional and Modern Biotechnology

 Differentiate traditional biotechnology and modern biotechnology

OBJECTIVES:

1. Discuss the role of yeast on the preparation of biotechnology products

2. Explain the properties of yeast on fermentation.
3. Make a research about wine and explain the importance of using yeast on its fermentation.

YEAST
What is yeast?

It is a pure biological fermentation agent bread, indispensable for the production of steamed
bread, buns and other fermented pasta. It contains the essential amino acids, B vitamins, trace
elements, carbohydrates, and a variety of bio-active substances. Yeast is a kind of invisible
unicellular microorganism, whose shape is round, oval, or rod and whose size varies with
different yeast species. With the development of modern science and technology, people are
able to breed species for different purposes for industrial production.

What are the characteristics of yeast?

As yeast is a microorganism, it is bound to need some living conditions. If we grasp its

characteristics, we can make it service the baking industry better. The main factors that affect
yeast fermentation include the nutrients, temperature, pH value, and humidity. Yeast nutrients
are mainly carbohydrate, and yeast can only use monosaccharidine in the fermentation
process.

Importance of yeast on fermentation:

 improves the nutritional value of the fermented foods

Nutrients in Yeast

Ingredient Protein Fat Calcium Iron VB1 VB2 Pantothenic Niacin

Content 45% 4-7% 100mg/100g 18mg/100g 7mg/100g 3mg/100g 3-9mg/100g 56.8mg/100g

 It increases the flavor of fermented food

The fermentation of the yeast dough, producing amino acids, oligosaccharides, esters,
alcohols, acids and other substances, makes the bread pure and soft.

 It improves the production efficiency and saves the cost

Due to the high purity of yeast, there is little acidic substances produced in the dough
fermentation process, so this naturally eliminates the trouble caused by alkali.
DNA
Discuss DNA Discovery Timeline

Learning Objectives

1. Discuss the history of DNA.

2. Explain how the discovery of DNA affects the current society.
3. Trace the timeline of the discovery of DNA.

DNA Timeline and Discovery

Important People on the Discovery and Development of DNA

In 1928, British bacteriologist Frederick Griffith conducted a series of

experiments using Streptococcus pneumoniae bacteria and mice.
Griffith wasn't trying to identify the genetic material, but rather, trying
to develop a vaccine against pneumonia. In his experiments, Griffith
used two related strains of bacteria, known as R and S. The R bacteria
were nonvirulent, meaning that they did not cause sickness when
injected into a mouse while S bacteria is a virulent one (capable of
causing disease). As part of his experiments, Griffith tried injecting
Source: https://en.wikipedia.org/ mice with heat-killed S bacteria that is, S bacteria that had
wiki/Frederick_Griffith been (heated to high temperatures, causing the cells to die).
Unsurprisingly, the heat-killed S bacteria did not cause disease in mice. The experiments took
an unexpected turn, however, when harmless R bacteria were combined with harmless heat-
killed S bacteria and injected into a mouse. Not only did the mouse develop pnenumonia and
die, but when Griffith took a blood sample from the dead mouse, he found that it contained
living S bacteria.

Image modified from "Griffith experiment," by Madeleine Price Ball

Griffith then discovered that a factor in heat-killed, disease-causing bacteria can “transform”
harmless bacteria into ones that can cause disease
 Oswald Avery was one of the first molecular biologists and a pioneer
in immunochemistry, but he is best known for his discovery in 1944,
with his co-workers Colin MacLeod and Maclyn McCarty, that
DNA is the material of which genes and chromosomes are made.
It was said that Avery was the most deserving scientist not to
receive the Nobel Prize for his work.

Source:en.wikipedia.org/wiki/Oswald_Avery

In 1951 and 1952, Alfred Hershey and Martha Chase conducted a

series of experiments at the Carnegie Institute of Washington in Cold
Spring Harbor, New York, that verified genes were made of
deoxyribonucleic acid, or DNA. Hershey and Chase performed their
experiments, later named the Hershey-Chase experiments, on viruses
that infect bacteria, also called bacteriophages. The experiments
followed decades of scientists’ skepticism about whether genetic
material was composed of protein or DNA. The most well-known
Source:amazingbiotech. Hershey-Chase experiment, called the Waring Blender experiment,
blogspot.com provided concrete evidence that genes were made of DNA. The Hershey-
Chase experiments settled the long-standing debate about the composition of genes, thereby
allowing scientists to investigate the molecular mechanisms by which genes function in
organisms.

In 1950, Erwin Chargaff proposed two main rules in his lifetime

which were appropriately named Chargaff's rules. The first and best
known achievement was to show that in natural DNA the number
of guanine units equals the number of cytosine units and the number
of adenine units equals the number of thymine units. In human DNA,
for example, the four bases are present in these percentages: A=30 %
and T=30%; G=20% and C=20%.

https://en.wikipedia.org/wiki/Erwin_Chargaff

In the early 1950s two scientists, Rosalind Franklin and

Maurice Wilkins, studied DNA using x-rays. Franklin produced an x-
ray crystallography that allowed two other researchers, James Watson
and Francis Crick to work out the 3D structure of DNA. The structure of
DNA was found to be a double helix. X-ray crystallography is a
technique used to determine the atomic and molecular structure of a
crystal, in which the crystalline structure causes a beam of incident X-
Source: www.timetoast.com rays to diffract into many specific directions.
The discovery in 1953 of the double helix, the
twisted-ladder structure of deoxyribonucleic
acid (DNA), by James Watson and Francis Crick marked a milestone in
the history of science and gave rise to modern molecular biology,
which is largely concerned with understanding how genes control the
chemical processes within cells. In short order, their discovery yielded
ground-breaking insights into the genetic code
Source:cshlarchieves.blogspot.com and protein synthesis. During the 1970s
and 1980s, it helped to produce new and powerful scientific
techniques, specifically recombinant DNA research, genetic
engineering, rapid gene sequencing, and monoclonal antibodies,
techniques on which today's multi-billion dollar biotechnology industry
is founded. Major current advances in science, namely genetic
fingerprinting and modern forensics, the mapping of the human
genome, and the promise, yet unfulfilled, of gene therapy, all have their
origins in Watson and Crick's inspired work.

ACTIVITY 8

Directions: Write a brief description and explanation of the discovery of the following
scientist:

1. Frederick Griffith

2. Oswald Avery

3. Alfred Hershey and Martha Chase

4. Erwin Chargaff

5. Maurice Wilkins and Rosalind Franklin

6. James Watson and Francis Crick

Activity 9

Answer the following questions:

1. What theory did these scientists provide evidence for?

2. Which three scientists directly contributed evidence for the discovery of the role of DNA?
Why?

3. How did the earlier scientists and their contributions directly affect the discoveries of
later scientists on the benefit of society?

4. If there is 29% units present in guanine, how much percentage is present in adenine,
cytosine, and thymine?
 DEOXYRIBONUCLEIC ACID

Define DNA and its structure

LEARNING OBJECTIVES

1. Define DNA and discuss its structure

2. Analyze the importance of DNA human on human growth.
3. Create a simple and low cost DNA model.

What is DNA?

 It is a complex molecule which carries the genetic code.

 It is a self-replicating material present in nearly all living

organisms as the main constituent of chromosomes.

The Sugars in the Backbone of DNA

The backbone of DNA is

based on a repeated pattern of
a sugar group and a phosphate
group.
Deoxyribose is a modified
form of another sugar called
ribose.
Ribose is the sugar in the
backbone of RNA, ribonucleic
Source:biologyeducare.com
acid.

Deoxy is ribose which has lost an oxygen atom - "de-oxy“ ribose

The thing about deoxyribose or ribose is how the carbon atoms in

the ring are numbered:

Source:biologyeducare.com

You read 3' or 5' as "3-prime" or "5-prime".

Source:biologyeducare.com
Attaching a Phosphate Group

The other repeating part of

the DNA backbone is a
phosphate group. A
phosphate group is attached
to the sugar molecule in
place of the -OH group on
the 5' carbon.

Attaching a Base and Making a Nucleotide

. These bases attach in

place of the -OH group on
the 1' carbon atom in the
sugar ring

What we have produced is

known as a nucleotide. Source:quizlet.com

. The nitrogen and

hydrogen atoms shown in

blue on each molecule

show where these

molecules join on to the

deoxyribose.
In each case, the hydrogen
is lost together with the -OH
group on the 1' carbon atom
Source:Biologyeducare.com
of the sugar. This is a
condensation reaction - two
For example, here is what the nucleotide containing cytosine would look like:
 Source:biologyeducare.com

A DNA strand is simply a string of nucleotides joined together.

Joining up lots of these gives

you a part of a DNA chain.
The diagram below is a bit
from the middle of a chain.
Notice that the individual
bases have been identified by
the first letters of the base
names. (A = adenine, etc).
Notice also that there are two
different sizes of base.
Adenine and guanine are
bigger because they both
have two rings. Cytosine and
thymine only have one ring
each.

Joining the Two DNA Chains Together

An adenine on one chain is

always paired with a thymine on
the second chain. And a guanine
on one chain is always paired
with a cytosine on the other one.

The two chains run in opposite directions, and the right-hand chain is
essentially upside-down.
The genetic code in genes is always written in the 5' to 3' direction along a
chain.
Always remember: Smaller base is always paired with a bigger one.

What is the Formula of each base?

Adenine – (C5H5N5) Thymine(C5H5N2O2)

Cytosine(C4H5N3O) Guanine(C5H5N5O)
Name: Date:
Year and Section:

Define DNA and its structure

ACTIVITY 10

Directions: Answer the following questions.

1. What do the acronym DNA stands for?

2. Two scientists are given credit for discovering the structure of DNA. Who are those?

3. DNA is a polymer, which means that is made up of many repeating single units (monomers). What
are the monomers called?

4. The backbone of the DNA molecule is made up of two components. What are these?

5. There are four different variations of these monomers. What are the names of those bases?

6. What is the importance of DNA on any living organism?

7. Base on the structure of DNA, do you think we are complex organism? Why?

8. Use the image at the right to complete the following:

a. Circle a nucleotide. (4)

b. Label the sugar and the phosphate.

c. Label the bases that are not already labelled.

 DNA MODEL RUBRIC

POINTS INDICATOR
5 Submitted on time, with complete parts,
clean, attractive, and presentable
4 Submitted on time, with complete parts but
not presentable

3 Submitted late, with complete parts but

presentable

2 Submitted late, with incomplete parts and not

presentable

1 NOT SUBMITTED
 DNA Replication

Analyze the process of DNA replication and how does it help on the
transmission of traits

LEARNING OBJECTIVES

1. Discuss the process of DNA replication.

2. Explain how DNA replication helps on the transmission of traits from parents to offspring.
3. Illustrate and explain the process of DNA replication

What is DNA replication?

 biological process of producing two identical replicas of DNA from one

original DNA molecule. This process occurs in all living organisms and is the basis
for biological inheritance.

Why DNA needs to replicate?

 Biological process of producing two identical replicas of DNA from one original
DNA molecule. This process occurs in all living organisms and is the basis for
biological inheritance.
 DNA, found within the nucleus, must be replicated in order to ensure that each new
cell receives the correct number of chromosomes.
 In eukaryotic cells, such as animal cells and plant cells, DNA replication occurs in
the S phase of interphase during the cell cycle.
 The process of DNA replication is vital for cell growth, repair, and reproduction in
organisms.

Double-stranded DNA consists of two spiral nucleic acid chains that are twisted into
a double helix shape. This twisting allows DNA to be more compact.
In order to fit within the nucleus, DNA is packed into tightly coiled structures
called chromatin. Chromatin condenses to form chromosomes during cell division. Prior to
DNA replication, the chromatin loosens giving cell replication machinery access to the DNA
strands.

DNA REPLICATION STEPS

STEP 1 Replication Fork Formation

Before DNA can be replicated, the double stranded molecule must be “unzipped” into two
single strands. In order to unwind DNA, these interactions between base pairs must be
broken. This is performed by an enzyme known as DNA helicase.
 DNA helicase disrupts the hydrogen bonding between base pairs to separate the
strands into a Y shape known as the replication fork. This area will be the template
for replication to begin.

Source:teachmephysiology.com
It is directional in both strands, signified by a 5' and 3' end. This notation signifies which side
group is attached the DNA backbone.
The 5' end has a phosphate (P) group attached, while the 3' end has a hydroxyl (OH) group
attached.

Source:teachmephysiology.com
This directionality is important for replication as it only progresses in the 5' to 3' direction.
However, the replication fork is bi-directional; one strand is oriented in the 3' to 5'
direction (leading strand) while the other is oriented 5' to 3' (lagging strand).

STEP 2 Primer Binding

The leading strand is the simplest to replicate. Once the DNA strands have been separated, a
short piece of RNA called a primer binds to the 3' end of the strand.

Source:teachmephysiology.com
 The primer always binds as the starting point for replication. Primers are generated by the
enzyme DNA primase.

STEP 3 Elongation

Enzymes known as DNA polymerases are responsible creating the new strand by a process
called elongation.

Source:teachmephysiology.com

The lagging strand begins replication by binding with multiple primers. Each primer is only
several bases apart.

DNA polymerase then adds pieces of DNA, called Okazaki fragments, to the strand between
primers.

Source:commommedia.org
 STEP 4 Termination

Once both the continuous and discontinuous strands are formed, an enzyme
called exonuclease removes all RNA primers from the original strands.

Source:teachmephysiology.com

These primers are then replaced with appropriate bases. Another exonuclease “proofreads”
the newly formed DNA to check, remove and replace any errors.

Another enzyme called DNA ligase joins Okazaki fragments together forming a single
unified strand.

Source:teachmephysiology.com

The ends of the linear DNA present a problem as DNA polymerase can only add nucleotides
in the 5′ to 3′ direction. The ends of the parent strands consist of repeated DNA sequences
called telomeres.
Telomeres act as protective caps at the end of chromosomes to prevent nearby chromosomes
from fusing.

A special type of DNA polymerase enzyme called telomerase catalyzes the

synthesis of telomere sequences at the ends of the DNA. Once completed,
the parent strand and its complementary DNA strand coils into the
familiar double helix shape.
In the end, replication produces two DNA molecules, each with one strand
from the parent molecule and one new strand.

Enzymes that participate in the eukaryotic DNA replication process:

DNA helicase unwinds and separates double stranded DNA as it moves along the
DNA. It forms the replication fork by breaking hydrogen bonds
between nucleotide pairs in DNA.

DNA primase a type of RNA polymerase that generates RNA primers. Primers are
short RNA molecules that act as templates for the starting point of
DNA replication.

DNA polymerases synthesize new DNA molecules by adding nucleotides to leading and
lagging DNA strands.

Topoisomerase unwinds and rewinds DNA strands to prevent the DNA from becoming
tangled or supercoiled.

Exonucleases group of enzymes that remove nucleotide bases from the end of a DNA
chain.

DNA ligase joins DNA fragments together by forming phosphodiester bonds

between nucleotides.

Please visit https://www.youtube.com/watch?v=bKIpDtJdK8Q for further explanation

Name: Date:
Grade and Section:
Analyze the process of DNA replication and how does it help on the transmission of traits.

ACTIVITY 11

Directions: Answer the following questions based on the process of DNA replication.

1. Why does DNA need to replicate?

2. During replication, in which direction are new nucleotides added?

3. What is the difference between lagging and leading strand?

4. What enzyme is responsible for “unzipping” the DNA double helix?

5. Which enzyme is responsible on hydrogen bonding between nucleotides in a

new DNA molecule?

6. Below is a single strand of DNA. Below each letter write the complementary strand of
DNA.
A–T–G–C–G–G–C–G–A–T–T–T–A–A–G–C

7. Describe the origin of each strand of the new double helices created after DNA replication.

8. Why do you think DNA replication important to the growth and development of a multi-
cellular organism?

9. What do you think would happen if the process occurred incorrectly?

10. DNA replication is for biological inheritance? What do you mean by this phrase? How
does it transfer traits?

11. At the back of your answer sheet, illustrate and explain the summary of DNA replication.

DNA Transcription

Analyze the process of DNA replication, transcription, and translation

and how does it help on the growth and transmission of traits.
LEARNING OBJECTVES

1. Discuss the process of DNA transcription.

2. Explain how DNA transcription helps on producing proteins and how these proteins affect
the growth and genetic transmission of parents to offspring.
3. Transcribe the DNA sequence

What is DNA Transcription?

 It is the first step in gene expression.

 It involves copying a gene's DNA sequence to make an RNA molecule.
 It is performed by enzymes called RNA polymerases, which link nucleotides to form
an RNA strand (using a DNA strand as a template).
 It has three stages: initiation, elongation, and termination.

Overview of Transcription
Transcription is the first step in gene expression, in which information from a gene is used to
construct a functional product such as a protein. The goal of transcription is to make a RNA
copy of a gene's DNA sequence.

For a protein-coding
gene, the RNA copy,
or transcript, carries the
information needed to
build a polypeptide
(protein or protein
subunit). Eukaryotic
transcripts need to go
through some processing
steps before translation
into proteins.

RNA polymerase The main enzyme involved in transcription is RNA polymerase, which
uses a single-stranded DNA template to synthesize a complementary
strand of RNA. Specifically, RNA polymerase builds an RNA strand in
the 5' to 3' direction, adding each new nucleotide to the 3' end of the
strand.
 STAGES OF TRANSCRIPTION

Initiation

RNA polymerase binds to a sequence of DNA called the promoter, found near the beginning
of a gene. Each gene (or group of co-transcribed genes, in bacteria) has its own promoter.
Once bound, RNA polymerase separates the DNA strands, providing the single-stranded
template needed for transcription.

Elongation

One strand of DNA, the template strand, acts as a template for RNA polymerase. As it
"reads" this template one base at a time, the polymerase builds an RNA molecule out of
complementary nucleotides, making a chain that grows from 5' to 3'. The RNA transcript
carries the same information as the non-template (coding) strand of DNA, but it contains the
base uracil (U) instead of thymine (T).

Termination

Sequences called terminators signal that the RNA transcript is complete. Once they are
transcribed, they cause the transcript to be released from the RNA polymerase. An example
of a termination mechanism involves formation of a hairpin in the RNA.
 Visit https://www.youtube.com/watch?v=ocAAkB32Hqs

Questions:

1. Why does DNA needs to be transcribed?

2. What are the enzymes involve in DNA transcription?

3. What is the role of transcription in producing proteins? How these proteins affect the DNA
transmission and human growth?

ACTIVITY 12

Directions: Transcribe the DNA sequence into messenger RNA.

DNA gene: ATCGATATACATACGACATAAT

mRNA transcript:

DNA gene: ATTATACCGCATTACT GATAAT

mRNA transcript:

DNA gene: ATATGGCGCATATAGCTAGCAT

mRNA transcript:
DNA Translation

Analyze the process of DNA replication, transcription, and translation

and how does it help on the growth and transmission of traits.

LEARNING OBJECTVES

1. Discuss the process of DNA translation.

2. Analyze the proteins produced after each translation.
3. Transcribe and translate the DNA into proteins

The bone, skin, and muscle you see are made up of cells. And each of those cells contains
many millions of. As a matter of fact, proteins are key molecular "building blocks" for every
organism on Earth. Basically, a gene is used to build a protein in a two-step process.

Step 1: Transcription

 Here, the DNA sequence of a gene is "rewritten" in the form of RNA. In eukaryotes,
the RNA is processed to make the final product, called a messenger RNA or mRNA.

Step 2: Translation
 In this stage, the mRNA is "decoded" to build a protein (or a chunk/subunit of a
protein) that contains a specific series of amino acids.

The Genetic Code

During translation, a cell “reads” the information in a messenger RNA (mRNA) and uses it to
build a protein. In an mRNA, the instructions for building a polypeptide are RNA nucleotides
(As, Us, Cs, and Gs) read in groups of three. These groups of three are called codons.

There are 61 codons for amino acids, and each of them is "read" to specify a certain amino
acid out of the 20 commonly found in proteins. One codon, AUG, specifies the amino acid
methionine and also acts as a start codon to signal the start of protein construction.

There are three more codons that do not specify amino acids. These stop codons, UAA,
UAG, and UGA, tell the cell when a polypeptide is complete. All together, this collection of
codon-amino acid relationships is called the genetic code, because it lets cells “decode” an
mRNA into a chain of amino acids.

Two types of molecules with key roles in translation are tRNAs and ribosomes:

1. Transfer RNAs (tRNAs)

 Transfer RNAs, or tRNAs, are molecular "bridges" that connect mRNA codons to the
amino amino acids they encode. One end of each tRNA has a sequence of three
nucleotides called an anticodon, which can bind to specific mRNA codons. The other
end of the tRNA carries the amino acid specified by the codons.
 Source:khanacademy.org
2. Ribosomes

 Ribosomes are the structures where polypeptides (proteins) are built. They are made
up of protein and RNA (ribosomal RNA, or rRNA). Each ribosome has two subunits,
a large one and a small one, which come together around an mRNA—kind of like the
two halves of a hamburger bun coming together around the patty.

 The ribosome provides a set of handy slots where tRNAs can find their matching
codons on the mRNA template and deliver their amino acids.

STEP 1 Initiation

In initiation, the ribosome assembles around the mRNA to be read with the first tRNA
(carrying the amino acid methionine, which matches the start codon, AUG). This
setup, called the initiation complex, is needed in order for translation to get started.

STEP 2 Elongation

Elongation is the stage where the amino acid chain gets longer. In elongation, the
mRNA is read one codon at a time, and the amino acid matching each codon is added
to a growing protein chain.

Each time a new codon is exposed, A matching tRNA binds to the codon
The existing amino acid chain (polypeptide) is linked onto the amino acid of the
tRNA via a chemical reaction. The mRNA is shifted one codon over in the ribosome,
exposing a new codon for reading

STEP 3 Termination

It is the stage in which the finished polypeptide chain is released. It begins when a
stop codon (UAG, UAA, or UGA) enters the ribosome, triggering a series of events
that separate the chain from its tRNA and allow it to drift out of the ribosome.

CODON CHART
 Source:khanacademy.org

Name: Date:
Grade and Section:

Analyze the process of DNA replication, transcription, and translation

and how does it help on the growth and transmission of traits.

ACTIVITY 13

Directions: Decode to unlock the hidden word.

DNA Replication
 T A C C A G C C C A A G A T T

Transcription

Translation

Ala-G Phe-M
Cys-N Pro-I
Glu-W Stop-P
Gly-A Tyr-S
Ile-T Val-H
Lys-F Met-C

MUTATION

Explain how mutation in DNA affects an individual.

LEARNING OBJECTIVES:

1. Discuss and define mutation.

2. Explain how different kind of mutations occurs in human.
3. Write the different type of mutations based on the alteration of genetic codes.
Questions:

1. What can you say about the picture?

2. Is it really possible that such indifferences or abnormalities occur?

3. What scientific basis best explain such abnormalities?

4. Is it possible to human? Why?

What is mutation?

 Mutation is a change in DNA, the hereditary material of life. An organism's DNA

affects how it looks, how it behaves, and its physiology. So a change in an organism's
DNA can cause changes in all aspects of its life.

Types of Mutation

1. Substitution

A substitution is a mutation that exchanges one base for another (i.e., a change in a single
"chemical letter" such as switching an A to a G)
 Example:

2. Insertion

Insertions are mutations in which extra base pairs are inserted into a new place in the DNA.

Example:

3. Deletion

Deletions are mutations in which a section of DNA is lost, or deleted.

Example:

4. Frameshift

Since protein-coding DNA is divided into codons three bases long, insertions and deletions
can alter a gene so that its message is no longer correctly parsed. These changes are called
frameshifts.

Example:

What are some examples of mutation in human?

Uner Tan

Most obvious property

is that people who
suffer from it walk on
all fours

Lesch–Nyhan
Syndrome

It results in an
overproduction of uric
 Lobster Claw

Caused by a mutation
in chromosomes 10, 7,
3, or 2

Name: Date:
Grade and Section:

Explain how mutation in DNA affects an individual.

Activity 14

There are several types of mutation:

DELETION (a base is lost/deleted)
INSERTION (an extra base is added/inserted)
 Deletion & insertion may cause what’s called a FRAMESHIFT mutation, meaning
the reading “frame" changes, thus changing the amino acid sequence from this point
forward
SUBSTITUTION (one base is substituted for another)
 If a substitution changes the amino acid, it’s called a MISSENSE mutation
 If a substitution does not change the amino acid, it’s called a SILENT mutation
  If a substitution changes the amino acid to a “stop,” it’s called a NONSENSE
mutation

Directions: Complete the boxes below. Classify each as Deletion, Insertion or Substitution
AND as either
frameshift, missense, silent or nonsense (Hint: Deletion & Insertion will always be
frameshift).

Original DNA Sequence: T A C A C C T T G G C G A C G A C T…

mRNA Sequence:
Amino Acid Sequence:

Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T…

What’s the mRNA sequence? (
amino acid sequence?
Will there likely be effects? What type of mutation is this?
________________________________

Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T…

What’s the mRNA sequence? (
amino acid sequence?
Will there likely be effects? What type of mutation is this?
________________________________

Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T…

What’s the mRNA sequence? (
amino acid sequence?
Will there likely be effects? What type of mutation is this?
________________________________

Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T…

What’s the mRNA sequence? (
amino acid sequence?
Will there likely be effects? What type of mutation is this?
_________________________________
JOURNAL RUBRIC

3 2 1 0
Capitalization Writer makes no Writer makes 5- Writer makes 11- Writer makes
and Punctuation mistake. 10 mistakes 15 mistakes more than 15
mistakes
Effective Writer Writer Writer Writer’s
Written communicates communicates communicates communication
Communication thoughts in a thoughts in a thoughts in a showed no
clear and understandable somewhat organization and
organized manner, but organized not clear.
manner organization manner, but ideas
could have been were not very
better clear

Reflection and Writer Writer Writer Writer

Thoughts demonstrates demonstrates demonstrates demonstrates
deep some minimal nounderstanding
understanding of understanding of understanding of of the topic
the topic the topic the topic

SCORE: