Human Immunology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

www.ashi-hla.org

journal homepage: www.elsevier.com/locate/humimm

Association of CTLA4 exon-1 polymorphism with the tumor necrosis

factor-a in the risk of systemic lupus erythematosus among South
Indians
Shiva Krishna Katkam a, Konda Kumaraswami b, Yedluri Rupasree a, Kalluri Thishya a, Liza Rajasekhar b,
Vijay Kumar Kutala a,⇑
a
Department of Clinical Pharmacology and Therapeutics, Nizam’s Institute of Medical Sciences (NIMS), Hyderabad, Telangana, India
b
Department of Rheumatology, Nizam’s Institute of Medical Sciences (NIMS), Hyderabad, Telangana, India

a r t i c l e i n f o a b s t r a c t

Article history: Cytotoxic T lymphocyte associated-antigen (CTLA4) is a potential negative regulatory molecule of T-cells
Received 23 August 2015 and associated with several autoimmune diseases. Several reports from different ethnic groups showed
Revised 31 October 2015 that the polymorphisms of the CTLA4 gene have been associated with autoimmune diseases including
Accepted 12 November 2015
SLE. Therefore, we aimed to investigate the +49 A/G polymorphism in South Indian SLE patients and
Available online xxxx
its association with disease aetiology and serological markers. A total of 534 samples were genotyped
for the +49 A/G polymorphism in exon 1 of the CTLA-4 gene through PCR-RFLP method. We found signif-
Keywords:
icant association of genotype and allele frequencies with +49 A/G polymorphism in SLE patients. The fre-
Systemic lupus erythematosus
Cytotoxic T lymphocyte associated antigen 4
quency of the +49 A/G polymorphism rs231775 ‘GG’ genotype was significantly higher in patients with
Tumor necrosis factor alpha SLE (12.32%) than those in healthy control subjects (4.6%) (OR: 1.797; 95% CI 1.264–2.554; p = 0.001). The
Polymorphism frequency of mutant allele ‘G’ also found to be significantly higher in cases (36.01%) than controls
Restriction fragments length polymorphism (24.92%) (OR: 1.695, 95% CI: 1.298–2.214, p < 0.001). We observed significant increase in serum TNF-a,
Autoimmune disease interferon-a, IL-10 and IL-12 in SLE cases compared to controls. We also found a significant association
of serum TNF-a, interferon-a, IL-10 and IL-12 with SLE phenotypes. In addition there was a significant
increase in serum TNF-a level in ‘‘GG” genotype SLE subjects suggesting that it might play a major role
in the advancement of SLE disease.
Ó 2015 Published by Elsevier Inc. on behalf of American Society for Histocompatibility and
Immunogenetics.

1. Introduction immunoglobulin gene superfamily and it is mostly expressed by

CD4+, CD8+ T cells and detected significant quantities at 48 ± 72 h
Systemic lupus erythematosus (SLE) is a clinically diverse, post activation of the T cells [3,4]. T cells play a pivotal role in
humoral autoimmune disorder and its unique features include SLE pathophysiology by regulating the B cells and cytokine produc-
the production of large quantities of autoantibodies. SLE is a com- tion [4]. Abnormal signals in T cells may lead to defective pheno-
plex autoimmune disease with unknown aetiology and with an type and function which may potentially contribute to disease
incidence of 3 per 100,000 in female patients [1]. SLE affects vari- pathogenesis [2]. CTLA4 is a key molecule for negative regulator
ous parts of the body including the joints, skin, kidneys and brain of T cell receptor (TCR) activation and immunological tolerance
[2]. Genetic, hormonal and environmental factors may contribute and implicated in both the cellular and the humoral immune
to SLE, but still the aetiology and mechanism of the disease are responses and mediates antigen-specific apoptosis [5,6].
unknown. Cytotoxic T lymphocyte associated-antigen 4 (CTLA4) The CTLA-4 has major contribution in patients with a variety of
is a structural homologue of CD28 (31%), belongs to the autoimmune diseases including systemic lupus erythematosus,
rheumatoid arthritis, autoimmune thyroid disease, multiple sclero-
sis, systemic sclerosis, and myasthenia gravis [7,8]. A defective
⇑ Corresponding author at: Department of Clinical Pharmacology and Therapeu- CTLA4 causes abnormal T-cell activation in SLE patients even
tics, Nizam’s Institute of Medical Sciences (NIMS), Punjagutta, Hyderabad, though it is highly expressed in SLE patients compared with
Telangana, India
autoimmune rheumatic diseases and healthy controls [9]. Massive
E-mail address: [email protected] (V.K. Kutala).

http://dx.doi.org/10.1016/j.humimm.2015.11.002
0198-8859/Ó 2015 Published by Elsevier Inc. on behalf of American Society for Histocompatibility and Immunogenetics.

Please cite this article in press as: S.K. Katkam et al., Association of CTLA4 exon-1 polymorphism with the tumor necrosis factor-a in the risk of systemic
lupus erythematosus among South Indians, Hum. Immunol. (2015), http://dx.doi.org/10.1016/j.humimm.2015.11.002
2 S.K. Katkam et al. / Human Immunology xxx (2015) xxx–xxx

lymphocyte proliferation, fatal multi organ tissue destruction, tis- (a) CTLA4 Exon1 Forward: 50 TCCATGGATTGGCTTGTTTT30 ,
sue destruction, splenomegaly, lymphadenopathy, and elevated (b) CTLA4 Exon1 Reverse primer: 50 CACTGCCTTTGACTGCT
serum immunoglobulin with the features of autoimmunity were GAA30 .
observed in CTLA4-deficient mice [10–14]
CTLA4 is a transmembrane glycoprotein consisting of 186 Amplification of the CTLA4 Exon1 was done using an Emerald
amino acid residues, with leader peptide encoded by exon-1, PCR master mix (TaKaRa) according to the manufacture protocol
ligand binding domain encoded by exon-2, transmembrane and reactions were carried out in the Eppendorf AG (Germany)
domain encoded by exon-3 and cytoplasmic tail encoded by thermo cycler. The thermal cycling parameters were as follows:
exon-4 [15,16]. Genetic association studies on Exon-1 +49 A/G initial denaturation at 94 °C for 5 min, followed by 38 cycles of
polymorphism of CTLA4 gene in different population have been denaturation at 94 °C for 1 min, annealing at 59 °C for 30 s, elonga-
conducted for its association with SLE. The +49 A/G is a non- tion at 72 °C for 1 min and final elongation at 72 °C for 10 min. PCR
synonymous substitution of amino-acid Thr17 to Ala17 in the lea- products were checked on 2% agarose gel and amplicons with good
der sequence of the protein which will be later processed in the concentration were selected for RFLP method.
endoplasmic reticulum. This variation can affect the processing of
CTLA4 in endoplasmic reticulum and consequence in a less effec- 2.4. Restriction fragment length polymorphism
tive glycosylation at N-glycosylation sites in the protein and
reduced expression of membrane CTLA4 protein [17]. Therefore, The CTLA4 +49 A/G polymorphism was investigated by PCR-
this exon-1 +49 A/G polymorphism might have a functional signif- RFLP analysis using the enzyme BbvI (NEB) at 37 °C overnight
icance for disease susceptibility and progression. Reports from the (with the reaction mixture of 3 ll PCR product, 1 unit of 1 ll
previous studies revealed that the subjects with homozygous enzyme, 1.3 ll Cut smart buffer, 4.7 ll H2O) followed by gel elec-
mutant GG (Ala/Ala) deliberate reduced up-regulation of CTLA4 trophoresis on 2% agarose gel. Upon restriction digestion with BbvI
[17–20]. Henceforth studying CTLA4 polymorphisms and its asso- enzyme the homozygous mutant ‘‘GG” genotype produces two
ciation with serological markers in SLE may be important in under- bands (307 bp and 159 bp), heterozygous ‘‘GA” will yield three
standing its association with the disease mechanism. Therefore, in bands (466 bp, 307 bp and 159 bp).Genotyping was further con-
the current study, we investigated the +49 A/G functional variant firmed in 20% of the samples by direct sequencing method and
in Indian SLE patients and also studied its association with the clin- found 100% concordance.
ical manifestations and serum auto-antibodies and cytokine levels.
2.5. Insilco prediction analysis
2. Methods
Secondary structure of signal peptide was predicted using
2.1. Study subjects PSIPRED Protein Sequence Analysis workbench (http://bioinf.cs.
ucl.ac.uk/psipred/) and signal sequences from different species
For this study, we have enrolled 534 subjects which includes were aligned with human CTLA4 using Clustal W programme avail-
211 SLE patients (M:F, 10:201) and 323 (M:F, 19:304) age, gender able in BioEdit 7.0.5.3 sequence alignment editor [22] to find any
and ethnicity-matched healthy controls from Nizam’s Institute of conservation in leader peptide across the species.
Medical Sciences (NIMS), Hyderabad, India. The American College
of Rheumatology (ACR) criteria 1997 was followed for the clinical 2.6. Statistical analyses
diagnosis of SLE [21]. Cases with allergic inflammatory disorders
other than SLE were excluded from the study. Subjects with no his- We tested for Hardy–Weinberg equilibrium (HWE) among SLE
tory of any allergic or inflammatory disorder were enrolled as con- patients and healthy controls using v2-test. The genotype and
trols. Blood samples were collected from each subject in 5 ml EDTA allele frequencies were analysed by simple gene counting. The
tube and also in 5 ml in plain vacutainer for the collection of chi-square, odds ratio, and 95% confidence interval [CI] values were
serum. Serum was separated after centrifugation at 3000 rpm for calculated using the online tool Vassar Stats Calculator [www.
10 min and aliquoted and stored at
20 °C until analysis. The study faculty.vassar.edu/lowry/VassarStats.html]. Spearman correlation
was approved by the ethics committee of Nizam’s Institute of (r) was calculated using graphpad prism version 4.00. p < 0.05
Medical Sciences (NIMS), EC/NIMS/1298/2012 Hyderabad, India. was considered as statistically significant.
The informed consent was obtained from all the subjects.

3. Results
2.2. Serum auto-antibodies and cytokine determination
As shown in Table 1, there was no statistical significance in the
Auto-antibodies like anti-nuclear, anti-dsDNA, anti-cardiolipin age between and controls was observed. The clinical manifesta-
(IgG), hypo-complementemia, SSB (La) (IgG), SSA (Ro) (IgG), RNP tions in SLE cases showed that 47.87% of the patients were with
(IgG) were determined by using commercially available ELISA kits molar rashes, 53.93% of them showed oral ulcers which are charac-
from CALBIOTECH (CA, USA), and serum levels of interferon-a, terised by clinical features of the SLE disease, 84.24% of patients
TNF-a, IL-10, IL-12 were measured by commercially available were positive for anti-nuclear antibody and 75.15% of the patients
ELISA kits (Boster Biological Tech Ltd, USA) as per the manufac- were positive for anti-dsDNA antibodies. 48.01% of the patients
turer’s protocol. exhibited with Lupus nephritis (Table 1).
The genotype distribution of CTLA4 polymorphism in cases and
2.3. DNA extraction and genotyping controls was in accordance with the Hardy–Weinberg equilibrium
(HWE) (p > 0.05) (Table 2). Significant genotype and allelic differ-
Genomic DNA was isolated from all the samples using the stan- ences were observed between the cases and controls. The data
dard phenol–chloroform extraction protocol. The reference geno- were evaluated using both dominant and recessive model to find
mic sequence of CTLA4 was retrieved from the Ensembl database association the +49 A/G polymorphism with the disease. Both
(ENSG00000163599). The following Primers were employed for genotype and allele frequencies showed significant association
PCR-RFLP method. with the SLE disease. 12.32% SLE patients exhibit complete mutant

Please cite this article in press as: S.K. Katkam et al., Association of CTLA4 exon-1 polymorphism with the tumor necrosis factor-a in the risk of systemic
lupus erythematosus among South Indians, Hum. Immunol. (2015), http://dx.doi.org/10.1016/j.humimm.2015.11.002
 S.K. Katkam et al. / Human Immunology xxx (2015) xxx–xxx 3

Table 1 significant increase in TNF-a in patients carrying ‘‘GG” genotype as

Demographic characteristics, clinical and serological phenotypes in SLE cases and compared to wild ‘‘AA” genotype. The increase in IL-10 and IL-12 in
controls.
patients with GG genotype was not statistically significant as com-
Variables SLE patients Controls pared to wild type.
Sex (male:female) 10:201 19:304 The spearman rank correlation analysis was performed to study
Age (mean ± SD), years 27.6 ± 10.00 25.36 ± 9.82 the association between TNF-a, INF-a, IL-10, IL-12 and SLE pheno-
Disease duration, years 4.11 ± 2.5 NA types. As shown in Table 3, TNF-a is positively associated with dis-
Clinical manifestations Frequency (%) coid lupus, photosensitivity, alopecia, lupus nephritis, myocarditis,
Malar rash 47.87 Nil and psychosis, whereas it is negatively correlated with haemolytic
Discoid lupus 24.24 Nil
Photosensitivity 24.24 Nil
anemia, leucopenia and hypertension whereas IFN-a is positively
Oral ulcers 53.93 Nil associated with discoid lupus, haemolytic anemia, hypertension,
Alopecia 24.84 Nil seizure and negatively correlated with thrombocytopenia and leu-
Arthritis 80 Nil copenia. Similarly, IL-10 is positively associated with photosensi-
Lupus nephritis 48.01 Nil
tivity, oral ulcers, alopecia and arthritis, malar rash, where as it is
Heamolytic anemia 20 Nil
Thrombocytopenia 9.6 Nil negatively associated with thrombocytopenia. On the other hand,
Leucopenia 12.12 Nil IL-12 was found to be positively associated with photosensitivity,
Pericarditis/myocarditis/endocarditis 23.63 Nil haemolytic anemia, thrombocytopenia and myocarditis and nega-
Pulmonary hypertension/emboli/hemorrhage 3.03 Nil tively associated with oral ulcers, leukopenia, seizures and
Seizures 10.09 Nil
psychosis.
Psychosis 6.6 Nil
Hypocomplementemia 40.6 Nil The Insilco secondary structure prediction of the human signal
Immunological parameters Frequency (%)
peptide revealed that the nonsynonymous Thr17Ala was located
Antinuclear antibody 84.24 Nil at the conserved position in the loop region of the signal sequence.
Anticardiolipin antibody 9.09 Nil Alignment of the signal sequences from different species was
AntidsDNA antibodies 75.15 Nil observed to be conserved (Fig. 3).
SSA ab 41.6 Nil
SSB ab 13.6 Nil
RNP/Sm 43.1 Nil
4. Discussion

The CTLA4 is essential regulatory molecule for T-helper cell and

majorly functions in two ways one is by competing with CD28 for
genotype (GG), whereas in controls a frequency of 4.6% was B7 on antigen presenting cell and second is by sending direct intra-
observed. A significant association was detected using dominant cellular inhibitory signals through its cytoplasmic tail [23]. The
model (AG + GG) (OR: 1.7971; 95% CI 1.264–2.554; p < 0.001). intracellular cytoplasmic tail of CTLA4 is highly conserved across
The recessive model (AA + AG) also revealed a significant associa- the species and its discrepancy expression in T cell transcriptional
tion with (OR: 2.885; 95% CI 1.489–5.589; p < 0.0001) the SLE dis- or translational modifications in its expression may have severe
ease. We also observed significant differences in the frequency of immunological consequences [24]. CTLA4 has major contribution
‘A’ allele and ‘G’ allele between groups. The mutant allele ‘G’ was in the cytokine production and proliferation, inhibition of cell cycle
higher in cases (36.01%) than the controls (24.92%), whereas the progression and transcription factors NF-kB, NF-AT, AP-1 and mod-
wild type allele ‘A’ was higher in controls (75.07%) than the SLE ulates composition and cell surface expression of lipid rafts [25].
patient (63.98%). The mutant ‘G’ allele showed a significant associ- Regulation of CTLA4 surface expression is vital to balance both pos-
ation with SLE (OR: 1.695; 95% CI: 1.2985–2.2149. p < 0.0001) itive and negative signals for protection against immune responses
(Table 2). There was no significant association of CTLA polymor- to maintain immunological tolerance and preventing autoimmu-
phism with the clinical and auto-antibodies were observed (data nity. CTLA4 exon 1 +49 A/G polymorphism has damaging effect
not shown). on processing in endoplasmic reticulum and leading to reduced
Compared to controls, in SLE cases there was significant surface expression [17].
increase in the serum levels of TNF-a, interferon-a, IL-10, and In view of this, several case-control studies have been con-
IL-12 was observed (Fig. 1). Further, the data in SLE cases were seg- ducted in different populations to investigate the association of
regated based on CTLA4 genotype. As shown in Fig. 2, there was a CTLA4 exon 1 +49 A/G polymorphism with SLE and yielded mixed

Table 2
Distribution of CTLA4 + A/G genotypes and alleles among SLE cases and healthy controls.

Genotype AA AG GG v2 HWE p-value

SLE (N) = 211(%) 85(40.28) 100(47.39) 26(12.32) 0.17 0.6801
Controls (N) = 323(%) 177(54.79) 131(40.55) 15(4.64) 2.27 0.1319
Model Frequency (%) Odds ratio (CI at 95%) p-value
Dominant Model Cases Controls 1.7971(1.2642–2.5546) 0.0010*
AA 85(40.28) 177(54.79)
AG + GG 126(59.71) 146(45.15)
Recessive Model 2.8858(1.4898–5.5897) 0.0014*
AA + AG 185(87.67) 308(95.35)
GG 26(12.32) 15(4.64)
Allele 1.6959(1.2985–2.2149) <0.0001*
A 270(63.98) 485(75.07)
G 152(36.01) 161(24.92)
*
p value <0.05 was considered as significant, CI-confidence interval, OR-odds Ratio, HWE-Hardy–Weinberg equilibrium, v2-chi square value.

Please cite this article in press as: S.K. Katkam et al., Association of CTLA4 exon-1 polymorphism with the tumor necrosis factor-a in the risk of systemic
lupus erythematosus among South Indians, Hum. Immunol. (2015), http://dx.doi.org/10.1016/j.humimm.2015.11.002
4 S.K. Katkam et al. / Human Immunology xxx (2015) xxx–xxx

(A) (B)
150
* 150
*
125 125
TNF-α (pg/ml)

INF-α (pg/ml)
100 100

75 75

50 50

25 25

0
0 Controls Cases
Controls Cases

(C) (D)

100 60

* *
75
IL-10 (pg/ml)

IL-12 (pg/ml) 40

50

20
25

0 0
Controls Cases
Controls Cases

Fig. 1. Serum levels of (A) TNF-a, (B) Interferon-a, (C) IL-10, (D) IL-12 levels in cases and controls. All values are expressed as mean ± SD. *p < 0.0001 vs control.

(A) (B)

(C) (D)

Fig. 2. Serum (A) TNF-a, (B) Interferon-a, (C) IL-10, (D) IL-12 levels based on CTLA4 genotype distributions in SLE patients. All values are expressed as mean ± SD. *p < 0.05 vs
AA wild type.

Please cite this article in press as: S.K. Katkam et al., Association of CTLA4 exon-1 polymorphism with the tumor necrosis factor-a in the risk of systemic
lupus erythematosus among South Indians, Hum. Immunol. (2015), http://dx.doi.org/10.1016/j.humimm.2015.11.002
 S.K. Katkam et al. / Human Immunology xxx (2015) xxx–xxx 5

Table 3
Association of cytokines with SLE phenotypes.

Variables TNF-a INF-a IL-10 IL-12

(r) p (r) p (r) p (r) p
Malar rash
0.06 0.19 0.06 0.19 0.04 0.38 0.002 0.96
Discoid LUPUS 0.18 0.0001$ 0.10 <0.01⁄
0.02 0.66 0.02 0.66
Photosensitivity 0.11 <0.01⁄ 0.06 0.19 0.31 0.0001$ 0.24 0.0001$
Oral ulcers 0.009 0.84
0.009 0.84 0.26 0.0001$
0.10 <0.01⁄
Alopecia
0.11 <0.01⁄ 0.03 0.51 0.10 <0.01⁄
0.17 0.0001$
Arthritis
0.03 0.51 0.04 0.38 0.10 <0.01⁄ 0.0001 1.000
Lupus nephritis 0.10 <0.01⁄ 0.03 0.51 0.003 0.94
0.02 0.66
Hemolytic anemia
0.10 <0.01⁄ 0.16 0.0001$ 0.04 0.38 0.10 <0.01⁄
Thrombocytopenia 0.05 0.27
0.14 0.001⁄⁄
0.16 0.0001$ 0.24 0.0001$
Leucopenia
0.32 0.0001$
0.24 0.0001$
0.08 0.078
0.12 0.001⁄⁄
Myocarditis 0.17 0.0001$
0.04 0.38 0.05 0.27 0.27 0.0001$
Hypertension
0.10 <0.01⁄ 0.23 0.0001$
0.04 0.38
0.008 0.86
Seizures
0.04 0.38 0.20 0.0001$ 0.06 0.19
0.15 0.0001$
Psychosis 0.10 <0.01⁄
0.05 0.27
0.03 0.51
0.19 0.0001$

TNF-a-Tumor necrosis factor alpha; INF-a = Interferon alpha; IL-10 = Interleukin-10; IL-12 = Interleukin-10, r = Spearman rank correlation coefficient.
Significant values were highlighted in bold. ⁄p < 0.01; $p < 0.0001 vs SLE phenotypes.

Fig. 3. Sequence alignment of CTLA4 signal peptide region in different species.

results; three studies showing significant association, weak associ- Table 4

ation in one study whereas other eleven studies have showed no Studies on CTLA4 exon 1 + 49 from different ethnic populations.
association [26–40] (Table 4). In a study by Pullmann et al. in the
Study Population Ethnicity Out come
Slovakia population (European) showed a significant association
Devaraju et al. [26] South Indian Asian Significant
with GG homozygotes (17.6%) in SLE patients compared to controls
Tamils association
(5.3%) and the frequency of the G allele was significantly higher in Kimkong et al. [27] Thai Asian No association
SLE patients (35.8%) than in controls (25.7%) group [39]. Ahmed Ulker et al. [28] Turkey Asian No association
et al. have evaluated CTLA-4 exon 1 gene polymorphism in the Chua et al. [29] Malaysia Asian No association
Japanese patients (Asian) and established a significant association Imen Sfar et al. [30] Tunisia African No association
Barreto et al. [31] Portugal European No association
with GG genotype (p = 0.006) and G allele (p = 0.003) [34]. Also
Aguilar et al. [32] Spain European No association
recent report on South Indian Tamils (Asian) found that CTLA4 Hudson et al. [33] Korea Asian No association
+49 A > G polymorphism is a potential genetic risk factor for lupus Ahmed et al. [34] Japan Asian Significant
susceptibility (p = 0.0001) [26]. Meta-analysis from different association
lee et al. [35] Korea Asian No association
studies have also shown that the association of CTLA4 49A/G
Liu et al. [36] China Asian No association
polymorphism with SLE, especially in Asian population, [41–43], D’Alfonso et al. [37] Italy European No association
indicating that our results corroborate with the previous results Matsushita et al. [38] Japan Asian Weak association
and reconfirm the genetic susceptibility +49 A/G polymorphism Pullmann et al. [39] Slovakia European Significant
with the SLE. association
Heward et al. [40] United Kingdom European No association
Also, we compared the genotype frequencies (AA, AG and GG)
with the clinical manifestations like oral ulcers, malar rash, discoid
rash, photosensitivity, arthritis, pericarditis, pleurisy, haematolog-
ical, renal and neurologic involvement, ANA and anti-dsDNA, SSA
ab, SSB ab, RNP/Sm positivity of SLE patients to explore and asso- In fact, different genetic polymorphisms in the CTLA-4 gene
ciate with the disease, but we could not find any association with have been investigated SLE patients including +49 A > G
SLE. This clearly indicates that this polymorphism does not influ- (rs231775),
1722 T > C (rs733618),
1661 A > G (rs 4553808),
ence either clinical phenotypes. These results are consistent with and
318 C > T (rs5742909) in different ethnic backgrounds
observations made by Devaraju et al. in South Indian ethnical [29,32–34,44]. Among these polymorphisms, the +49 A > G was
Tamil population [26]. the most extensively studied one in the association with SLE risk

Please cite this article in press as: S.K. Katkam et al., Association of CTLA4 exon-1 polymorphism with the tumor necrosis factor-a in the risk of systemic
lupus erythematosus among South Indians, Hum. Immunol. (2015), http://dx.doi.org/10.1016/j.humimm.2015.11.002
6 S.K. Katkam et al. / Human Immunology xxx (2015) xxx–xxx

due to its significant functional impact on the protein expression a significant association of mutant ‘GG’ genotype with increased
[17]. TNF-a level in SLE subjects as compared to that in the ‘AA’ geno-
The association of CTLA4 polymorphism with serological phe- type which may further enhance the disease risk.
notype was studied in other autoimmune diseases and yielded
mixed results. In one of the study from the Mexican population Funding
RA patients carrying the +49 A > G polymorphism had shown asso-
ciation with rheumatoid arthritis, no relationship was observed Department of Biotechnology, Government of India No. BT/
with clinical characteristics [45], in contrast, another study on PR4582/MED/12/547/2012.
the Dutch patients did show a significant association of CTLA4
+49 A > G polymorphism with serological phenotype, anti-
citrullinated protein antibody (ACPA) in RA patients [46]. In Author contributions
patients of Type 1 diabetes with autoimmune thyroid disease,
the variant allele ‘G’ allele group was reported to have high titre L.Z. performed clinical investigations and contributed samples.
of autoantibodies to the glutamic acid decarboxylase (GAD) anti- V.K.K. provided research material. S.K.K., K.K., Y.R. conducted
body (Ab) [47]. Likewise, in Type I diabetic patients carrying +49 experiments and analyzed the data. S.K.K., K.K., Y.K., V.V.K. wrote
A/G polymorphism was demonstrated to have significantly high the manuscript.
levels of interleukin-2, 10, TNF-a and interferon-c, and on the
other hand, individuals carriers of GG genotype were shown to Conflict of interest statement
have high titres of anti-GAD65 antibodies [48]. Consistence to
the reported literature, in our present study, we also observed a The authors have no conflicts of interest to declare.
significant increase in serum TNF-a, interferon-a, IL-10 and IL-12
in patients with SLE as compared to healthy controls. Further, Acknowledgment
Spearman’s rank correlation coefficient analysis indicates that
these cytokines were significantly associated with SLE phenotypes. We acknowledge the financial support from the Department of
In addition, we also observed that there was a significant increase Biotechnology (No. BT/PR4582/MED/12/547/2012) Government of
in TNF-a level in patients carrying ‘‘GG” genotype as compared to India. We thank all the patients for participation in the study.
wild ‘‘AA” genotype. Since the presence of mutant ‘‘GG” variant
allele results in decreased CTLA4 expression on T cells, influencing
References
abnormal T cell activation [17], and is aggravated by increased
TNF-a levels is observed in the present study. An increased level [1] S. Bernatsky, L. Joseph, C.A. Pineau, R. Tamblyn, D.E. Feldman, A.E. Clarke, A
of TNF-a was well known in SLE subjects and associated with population-based assessment of systemic lupus erythematosus incidence and
disease activity [49–52]. TNF-a signalling eventually activates prevalence–results and implications of using administrative data for
epidemiological studies, Rheumatology (Oxford) 46 (12) (2007) 1814–1818.
the NF-kB which in turn triggers the pro-inflammatory genes such [2] V.R. Moulton, G.C. Tsokos, Abnormalities of T cell signaling in systemic lupus
as interleukin-1ß, IL-6, IL-8 which have substantial local inflamma- erythematosus, Arthritis Res. Ther. 17 (2) (2011) 207.
tory process, tissue injury and disease progression [53]. [3] K.D. McCoy, I.F. Hermans, J.H. Fraser, G. Le Gros, F. Ronchese, Cytotoxic T
lymphocyte-associated antigen 4 (CTLA-4) can regulate dendritic cell-induced
activation and cytotoxicity of CD8(+) T cells independently of CD4(+) T cell
help, J. Exp. Med. 189 (7) (1999) 1157–1162.
4.1. Functional significance of +49 A/G polymorphism
[4] D.M. Sansom, CD28, CTLA-4 and their ligands: who does what and to whom?,
Immunology 101 (2) (2000) 169–177
The signal peptide constitutes N-terminal region of 20 amino [5] M.F. Liu, H.S. Liu, C.R. Wang, H.Y. Lei, Expression of CTLA-4 molecule in
peripheral blood T lymphocytes from patients with systemic lupus
acids, middle hinge region of 12 amino acids flanked by helix-
erythematosus, J. Clin. Immunol. 18 (6) (1998) 392–398.
breaking proline and a small polar C-terminal region including [6] J.G. Gribben, G.J. Freeman, V.A. Boussiotis, P. Rennert, C.L. Jellis, E. Greenfield,
the recognition site for signal peptide cleavage (Fig. 3). Amino acid et al., CTLA4 mediates antigen-specific apoptosis of human T cells, Proc. Natl.
sequence of signal peptide of the CTLA4 is well conserved across Acad. Sci. U.S.A. 92 (3) (1995) 811–815.
[7] A. Ghaderi, CTLA4 gene variants in autoimmunity and cancer: a comparative
the species which signifies its functional importance. The alanine review, Iran J. Immunol. 8 (3) (2011) 127–149.
substitutes a hydrophobic amino acid in a highly conserved posi- [8] O.P. Kristiansen, Z.M. Larsen, F. Pociot, CTLA-4 in autoimmune diseases–a
tion, occupied by a polar serine or threonine residue. Suzana Anjos general susceptibility gene to autoimmunity?, Genes Immun 1 (3) (2000) 170–
184.
et al. found that the mutation of T17A is present in the signal pep- [9] E.C. Jury, F. Flores-Borja, H.S. Kalsi, M. Lazarus, D.A. Isenberg, C. Mauri, et al.,
tide is majorly effecting intracellular trafficking of the CTLA4 which Abnormal CTLA-4 function in T cells from patients with systemic lupus
will eventually decrease the surface expression of CTLA4 [17]. Also, erythematosus, Eur. J. Immunol. 40 (2) (2010) 569–578.
[10] E.A. Tivol, F. Borriello, A.N. Schweitzer, W.P. Lynch, J.A. Bluestone, A.H. Sharpe,
less effective processing in endoplasmic reticulum of CTLA4 has Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan
aberrant glycosylation at N78 and N110 sites [24]. Ala/Ala (GG tissue destruction, revealing a critical negative regulatory role of CTLA-4,
Genotype) homozygotes express one-third less CTLA4 on the sur- Immunity 3 (5) (1995) 541–547.
[11] P. Waterhouse, J.M. Penninger, E. Timms, A. Wakeham, A. Shahinian, K.P. Lee,
face of their T-cells than Thr/Thr (AA Genotype) homozygotes.
et al., Lymphoproliferative disorders with early lethality in mice deficient in
Altogether in our study, 12.32% SLE patients exhibit homozygous CTLA4, Science 270 (5238) (1995) 985–988.
mutant genotype (GG) which may influence the immune response [12] W. Stohl, N. Jacob, W.J. Quinn 3rd, M.P. Cancro, H. Gao, C. Putterman, et al.,
Global T cell dysregulation in non-autoimmune-prone mice promotes rapid
and affecting susceptible for SLE disease indicating its significant
development of BAFF-independent, systemic lupus erythematosus-like
role in the pathogenesis of autoimmune diseases, particularly in autoimmunity, J. Immunol. 181 (1) (2008) 833–841.
SLE. Further functional characterization of this polymorphism [13] M.C. Brunner, C.A. Chambers, F.K. Chan, J. Hanke, A. Winoto, J.P. Allison, CTLA-
may help in understanding the disease mechanism, pathophysiol- 4-Mediated inhibition of early events of T cell proliferation, J. Immunol. 162
(10) (1999) 5813–5820.
ogy and disease progression. [14] C.A. Chambers, T.J. Sullivan, J.P. Allison, Lymphoproliferation in CTLA-4-
deficient mice is mediated by costimulation-dependent activation of CD4+ T
cells, Immunity 7 (6) (1997) 885–895.
5. Conclusion [15] M.K. Oaks, K.M. Hallett, Cutting edge: a soluble form of CTLA-4 in patients with
autoimmune thyroid disease, J. Immunol. 164 (10) (2000) 5015–5018.
[16] H. Ueda, J.M. Howson, L. Esposito, J. Heward, H. Snook, G. Chamberlain, et al.,
The results of our current study replicated and established asso- Association of the T-cell regulatory gene CTLA4 with susceptibility to
ciation of the CTLA4 polymorphism with SLE and further suggested autoimmune disease, Nature 423 (6939) (2003) 506–511.

Please cite this article in press as: S.K. Katkam et al., Association of CTLA4 exon-1 polymorphism with the tumor necrosis factor-a in the risk of systemic
lupus erythematosus among South Indians, Hum. Immunol. (2015), http://dx.doi.org/10.1016/j.humimm.2015.11.002
 S.K. Katkam et al. / Human Immunology xxx (2015) xxx–xxx 7

[17] S. Anjos, A. Nguyen, H. Ounissi-Benkalha, M.C. Tessier, C. Polychronakos, A [37] S. D’Alfonso, M. Rampi, D. Bocchio, G. Colombo, R. Scorza-Smeraldi, P.
common autoimmunity predisposing signal peptide variant of the cytotoxic T- Momigliano-Richardi, Systemic lupus erythematosus candidate genes in the
lymphocyte antigen 4 results in inefficient glycosylation of the susceptibility Italian population: evidence for a significant association with interleukin-10,
allele, J. Biol. Chem. 277 (48) (2002) 46478–46486. Arthritis Rheum. 43 (1) (2000) 120–128.
[18] M. Mäurer, S. Loserth, A. Kolb-Mäurer, A. Ponath, S. Wiese, N. Kruse, et al., A [38] M. Matsushita, N. Tsuchiya, M. Shiota, T. Komata, K. Matsuta, K. Zama, et al.,
polymorphism in the human cytotoxic T-lymphocyte antigen 4 (CTLA4) gene Lack of a strong association of CTLA-4 exon 1 polymorphism with the
(exon 1 +49) alters T-cell activation, Immunogenetics 54 (1) (2002) 1–8. susceptibility to rheumatoid arthritis and systemic lupus erythematosus in
[19] H. Ueda, J.M. Howson, L. Esposito, J. Heward, H. Snook, G. Chamberlain, et al., Japanese: an association study using a novel variation screening method,
Association of the T-cell regulatory gene CTLA4 with susceptibility to Tissue Antigens 54 (6) (1999) 578–584.
autoimmune disease, Nature 423 (6939) (2003 May 29) 506–511. [39] R. Pullmann Jr, J. Lukác, M. Skerenová, J. Rovensky, J. Hybenová, V. Melus, et al.,
[20] T. Kouki, Y. Sawai, C.A. Gardine, M.E. Fisfalen, M.L. Alegre, L.J. DeGroot, CTLA-4 Cytotoxic T lymphocyte antigen 4 (CTLA-4) dimorphism in patients with
gene polymorphism at position 49 in exon 1 reduces the inhibitory function of systemic lupus erythematosus, Clin. Exp. Rheumatol. 17 (6) (1999) 725–729.
CTLA-4 and contributes to the pathogenesis of Graves’ disease, J. Immunol. 165 [40] J. Heward, C. Gordon, A. Allahabadia, A.H. Barnett, J.A. Franklyn, S.C. Gough,
(11) (2000) 6606–6611. The A-G polymorphism in exon 1 of the CTLA-4 gene is not associated with
[21] M.C. Hochberg, Updating the American College of Rheumatology revised systemic lupus erythematosus, Ann. Rheum. Dis. 58 (3) (1999) 193–195.
criteria for the classification of systemic lupus erythematosus, Arthritis [41] J. Liu, H.X. Zhang, CTLA-4 polymorphisms and systemic lupus erythematosus:
Rheum. 40 (9) (1997) 1725. a comprehensive meta-analysis, Genet. Test Mol. Bioma. 17 (3) (2013) 226–
[22] T.A. Hall, BioEdit: a user-friendly biological sequence alignment editor and 231.
analysis program for Windows 95/98/NT, Nucleic Acids Symp. Ser. 41 (1999) [42] J.X. Zhai, L.W. Zou, Z.X. Zhang, W.J. Fan, H.Y. Wang, et al., CTLA-4
95–98. polymorphisms and systemic lupus erythematosus (SLE): a meta-analysis,
[23] F.S. Hodi, Cytotoxic T-lymphocyte-associated antigen-4, Clin. Cancer Res. 13 Mol. Biol. Rep. 40 (9) (2013) 5213–5223.
(18) (2007) 5238–5242. [43] Y.H. Lee, J.B. Harley, S.K. Nath, CTLA-4 polymorphisms and systemic lupus
[24] W.A. Teft, M.G. Kirchhof, J. Madrenas, A molecular perspective of CTLA-4 erythematosus (SLE): a meta-analysis, Hum. Genet. 116 (5) (2005) 361–367.
function, Annu. Rev. Immunol. 24 (2006) 65–97. [44] A. Taha Khalaf, J.Q. Song, T.T. Gao, X.P. Yu, T.C. Lei, CTLA-4 gene polymorphism
[25] E. Valk, C.E. Rudd, H. Schneider, CTLA-4 trafficking and surface expression, and the risk of systemic lupus erythematosus in the Chinese population, J.
Trends Immunol. 29 (6) (2008) 272–279. Biomed. Biotechnol. 2011 (2011) 167395.
[26] P. Devaraju, R. Gulati, B.K. Singh, C.B. Mithun, V.S. Negi, The CTLA4 +49 A/G [45] J.F. Muñoz-Valle, Y. Valle, J.R. Padilla-Gutiérrez, I. Parra-Rojas, H. Rangel-
(rs231775) polymorphism influences susceptibility to SLE in South Indian Villalobos, M Vázquez del Mercado, The +49 A > G CTLA-4 polymorphism is
Tamils, Tissue Antigens 83 (6) (2014) 418–421. associated with rheumatoid arthritis in Mexican population, Clin. Chim. Acta
[27] I. Kimkong, J. Nakkuntod, S. Sae-Ngow, T. Snabboon, Y. Avihingsanon, N. 411 (9–10) (2010) 725–728.
Hirankarn, Association between CTLA-4 polymorphisms and the susceptibility [46] N.A. Daha, F.A. Kurreeman, R.B. Marques, G. Stoeken-Rijsbergen, W. Verduijn,
to systemic lupus erythematosus and Graves’ disease in Thai population, Asian T.W. Huizinga, et al., Confirmation of STAT4, IL2/IL21, and CTLA4
Pac. J. Allergy Immunol. 29 (3) (2011) 229–235. polymorphisms in rheumatoid arthritis, Arthritis Rheum. 60 (5) (2009)
[28] M. Ulker, V. Yazisiz, N. Sallakci, A.B. Avci, S. Sanlioglu, O. Yegin, et al., CTLA-4 1255–1260.
gene polymorphism of exon 1(+49 A/G) in Turkish systemic lupus [47] M. Mochizuki, S. Amemiya, K. Kobayashi, K. Kobayashi, Y. Shimura, T. Ishihara,
erythematosus patients, Int. J. Immunogenet. 36 (4) (2009) 245–250. et al., Association of the CTLA-4 gene 49 A/G polymorphism with type 1
[29] K.H. Chua, S.M. Puah, C.H. Chew, S.Y. Tan, L.H. Lian, Study of the CTLA-4 gene diabetes and autoimmune thyroid disease in Japanese children, Diabetes Care
polymorphisms in systemic lupus erythematosus (SLE) samples from 26 (3) (2003) 843–847.
Malaysia, Ann. Hum. Biol. 37 (2) (2010) 274–280. [48] B.F. Pérez, D.E. Codner, B.B. Angel, N.I. Balic, P.E. Carrasco, +49 A/G genetic
[30] Imen Sfar, Tarak Dhaouadi, Henda Krichen, Asma Elbeldi, Leila Abdelmoula, polymorphism of cytotoxic T lymphocyte associated antigen 4 (CTLA-4) in
Mouna Makhlouf, Genotyping CTLA-4 exon 1 (+49 A/G) and HLA-DRB1 type 7 diabetes: association with autoantibodies and cytokines, Rev. Med. Chil.
polymorphisms and susceptibility to systemic lupus and rheumatoid 137 (3) (2009) 321–328.
arthritis in Tunisian population, J. Med.Genet. Genomics 2 (1) (2010) 008–017. [49] C.P. Maury, A.M. Teppo, Tumor necrosis factor in the serum of patients with
[31] M. Barreto, E. Santos, R. Ferreira, C. Fesel, M.F. Fontes, C. Pereira, et al., Evidence systemic lupus erythematosus, Arthritis Rheum. 32 (1989) 146–150.
for CTLA4 as a susceptibility gene for systemic lupus erythematosus, Eur. J. [50] A. Studnicka-Benke, G. Steiner, P. Petera, J.S. Smolen, Tumour necrosis factor
Hum. Genet. 12 (8) (2004) 620–626. alpha and its soluble receptors parallel clinical disease and autoimmune
[32] F. Aguilar, B. Torres, J. Sánchez-Román, A. Núñez-Roldán, M.F. González- activity in systemic lupus erythematosus, Br. J. Rheumatol. 35 (1996) 1067–
Escribano, CTLA4 polymorphism in Spanish patients with systemic lupus 1074.
erythematosus, Hum. Immunol. 64 (10) (2003) 936–940. [51] C. Gabay, N. Cakir, F. Moral, P. Roux-Lombard, O. Meyer, J.M. Dayer, et al.,
[33] L.L. Hudson, K. Rocca, Y.W. Song, J.P. Pandey, CTLA-4 gene polymorphisms in Circulating levels of tumor necrosis factor soluble receptors in systemic lupus
systemic lupus erythematosus: a highly significant association with a erythematosus are significantly higher than in other rheumatic diseases and
determinant in the promoter region, Hum. Genet. 111 (4–5) (2002) 452–455. correlate with disease activity, J. Rheumatol. 24 (1997) 303–308.
[34] S. Ahmed, K. Ihara, S. Kanemitsu, H. Nakashima, T. Otsuka, K. Tsuzaka, et al., [52] E.M. Davas, A. Tsirogianni, I. Kappou, D. Karamitsos, I. Economidou, P.C. Dantis,
Association of CTLA-4 but not CD28 gene polymorphisms with systemic lupus Serum IL-6, TNFalpha, p55 srTNFalpha, p75srTNFalpha, srIL-2alpha levels and
erythematosus in the Japanese population, Rheumatology (Oxford) 40 (6) disease activity in systemic lupus erythematosus, Clin. Rheumatol. 18 (1999)
(2001) 662–667. 17–22.
[35] Y.H. Lee, Y.R. Kim, J.D. Ji, J. Sohn, G.G. Song, Polymorphisms of the CTLA-4 exon [53] L.J. Zhu, X. Yang, X.Q. Yu, Anti-TNF-alpha therapies in systemic lupus
1 and promoter gene in systemic lupus erythematosus, Lupus 10 (9) (2001) erythematosus, J. Biomed. Biotechnol. 2010 (2010) 465898.
601–605.
[36] M.F. Liu, C.R. Wang, L.C. Lin, C.R. Wu, CTLA-4 gene polymorphism in promoter
and exon-1 regions in Chinese patients with systemic lupus erythematosus,
Lupus 10 (9) (2001) 647–649.

Please cite this article in press as: S.K. Katkam et al., Association of CTLA4 exon-1 polymorphism with the tumor necrosis factor-a in the risk of systemic
lupus erythematosus among South Indians, Hum. Immunol. (2015), http://dx.doi.org/10.1016/j.humimm.2015.11.002