Heliyon 8 (2022) e09532

Contents lists available at ScienceDirect

Heliyon
journal homepage: www.cell.com/heliyon

Research article

UHPLC-MS/MS and QRT-PCR profiling of PGP agents and Rhizobium spp. of

induced phytohormones for growth promotion in mungbean (var. Co4)
Chaitanya S. Mogal a, Vanrajsinh H. Solanki b, Rohan V. Kansara b, Sanjay Jha c, *, Susheel Singh b,
Vipulkumar B. Parekh d, B.K. Rajkumar e
a
Department of Plant Molecular Biology and Biotechnology, Navsari Agricultural University, Navsari, 396450, Gujarat, India
b
Food Quality Testing Laboratory, N. M. College of Agriculture, Navsari Agricultural University, Navsari, 396450, Gujarat, India
c
ASPEE Shakilam Biotechnology Institute, Navsari Agricultural University, Surat, 395007, Gujarat, India
d
Department of Basic Science and Humanities, ACHF, Navsari Agricultural University, Navsari, 396450, Gujarat, India
e
Main Cotton Research Station, Navsari Agricultural University, Surat, 395007, Gujarat, India

A R T I C L E I N F O A B S T R A C T

Keywords: In present study, five potential strains with different plant growth promotion (PGP) characteristics were used. By
ARF gene considering various PGP properties of different bacterial strains, several treatments based on various combina-
ERF-IF gene tions were developed and studied on mungbean (var. Co4). The quantification of the phytohormones was per-
GAI gene
formed on ultrahigh-performance liquid chromatograph coupled to heated electrospray ionization tandem mass
Mungbean
PGPR consortia
spectrometry (UHPLC/HESI-MS/MS). Indole 3-acetic acid (IAA) and Indole 3-butyric acid (IBA) were quantified
qRT-PCR in positive ionization mode while Gibberellic acid (GA3) and salicylic acid (SA) were quantified in negative
Rhizobium spp. ionization mode. Among all the treatments two penta combinations of consortia 1 (Rhizobium þ Azospirillum þ
UHPLC-MS/MS Pseudomonas þ Bacillus spp. þ Bacillus licheniformis) and consortia 2 (Rhizobium þ Azotobacter þ Pseudomonas þ
Bacillus spp. þ Bacillus licheniformis) were found most effective. Higher amount of IAA (1.043 μg g1), IBA (0.036
μg g1), GA3 (1.999 μg g1) and SA (0.098 μg g1) Fresh weight (FW) were found in treated adolescent root
tissues of consortia 2 as compared to consortia 1. Moreover, transcriptional level of the plant hormones were 2–4
fold higher in the relative gene expression study of three genes: ARF (Auxin responsive factors), ERF-IF (Ethylene-
responsive Initiation Factors) and GAI (Gibberellic-Acid Insensitive) in consortia 2, on the 15th, 30th and 45th day
using quantitative real time-Polymerase chain reaction (qRT-PCR). Furthermore, Yield attributing characters like,
the number of nodules plant1, number of pods plant1, weight of nodule and seed yield plant1 were also
increased as compared to the control. As a result, the current research elucidated that penta combinations con-
sortium of Rhizobium sp. and rhizobacteria can be developed as a single delivery system biofertilizer for enhancing
mungbean productivity.

1. Introduction et al., 2017). Auxins, gibberellins, cytokinins, ethylene, and abscisic acid
are some of the phytohormones that PGPR can produce to mediate plant
Plants and microorganisms are known to interact; the rhizosphere is a cell enlargement, division, and extension in both symbiotic and
critical area that stimulates crop development and increases yield. The non-symbiotic roots (Goswami et al., 2016).
rhizosphere is a complex and combative habitat for plant–microbe in- Pulses are important food crops with high protein content that are
teractions aimed at extracting necessary major and minor nutrients from frequently utilised in mass feeding, but per acre production is extremely
nutrient resources. In recent years, several plant growth promoters have low. There is need to synchronise the process of colonisation and survival
been identified, including Pseudomonas, Azospirillum, Azotobacter, Kleb- for successful plant growth promoting rhizobacteria (PGPR) interactions
siella, Serratia, Enterobacter, Bacillus, and Paenibacillus (Muresu et al., with legumes, since rhizobia and bradyrhizobia commonly persist in the
2008; Gururani et al., 2013; Kumari et al., 2018). Plant growth pro- plant rhizosphere, which highlights the necessity to supplement with
moting rhizobacteria (PGPR) promotes plant growth by producing phy- Plant growth promoting (PGP) agents (Joshi and Bhatt 2011; Andy et al.,
tohormones, nitrogen fixation, and phosphorus solubilization (Tabassum 2020).

* Corresponding author.
E-mail address: [email protected] (S. Jha).

https://doi.org/10.1016/j.heliyon.2022.e09532
Received 25 February 2022; Received in revised form 21 March 2022; Accepted 20 May 2022
2405-8440/© 2022 The Author(s). Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
C.S. Mogal et al. Heliyon 8 (2022) e09532

The presence of PGP bacteria in the rhizosphere is known to promote chosen pulse shrub mungbean (var. Co4). The plants were grown in pots
root hair development, shoot and root growth, plant hormone regulation, for 70–75 day's and adolescent roots and mature fresh nodules were
root colonisation, nitrogen fixation, pathogen suppression and mineral harvested at 35th day.
solubilization these all are important steps for the beneficial bacteria-plant
reciprocity (Lucas et al., 2009; Gopalakrishnan et al., 2010; Deshwal and 2.2. Chemicals and reagents
Kumar 2013). Researchers are focused on creating a more effective
Rhizobium consortium with other PGP agents (Naseri and Hemmati 2017). Authenticated materials of Indole 3-acetic acid (IAA), Indole 3-
Several researches have been done over the last few decades to demon- butyric acid (IBA), Gibberellic acid (GA3), and salicylic acid (SA) with
strate the efficacy of co-inoculation of Rhizobium with PGPRs on legumes a purity of 99.9% were procured from Sigma-Aldrich Pvt. Ltd. Sodium
(Naseri and Younesi 2021). A wide range of PGPRs, including Bacillus and chloride, sodium sulphate, magnesium sulphate, sodium acetate, chlo-
Pseudomonas species, are widely found in the rhizosphere of legume and roform and isopropanol (all from Merck in Darmstadt, Germany),
non-leguminous crops (Muresu et al., 2008; Abbasi et al., 2010; Okazaki acetonitrile, methanol, acetone and water (all MS-grade) were from
et al., 2016; Khati et al., 2018). Simultaneously, co-inoculation of bacterial Darmstadt (Germany). The primary secondary amines (PSA) were pur-
species such as Rhizobium sp., Azotobacter sp., Pseudomonas sp., Bacillus sp. chased fromSupelco Sigma Aldrich (Germany). The polyvinylidene
has evidenced a various benefits in plants and cultivation systems (Korir difluoride (PVDF) syringe filters (diameter: 0.22 μm) were obtained from
et al., 2017; Kalantari et al., 2018). Thermo Scientific, USA.
Phytohormones are class of naturally occurring, organic compounds
which, at low concentrations, stimulate physiological processes. Despite 2.3. Standard preparation
being a minor component of the metabolome, phytohormones serve a
critical function in the regulation of germination, growth and develop- Stock solutions (2 mg L1) of all four phytohormones were prepared in
ment (Tian et al., 2020). However, it is uncertain how volatile organic amber coloured volumetric flask (50mL) by using methanol and kept at -20
compounds (i.e. phytohormones) impact on plant growth. They are 
C. The intermediate standard (250 μg L1) was prepared by using stock
generated by PGPRs and stimulate the density and length of root hairs, solutions and then sequentially diluted with methanol: water (80:20, v/v)
resulting in an overall increase in a plant's root surface area, as well as to to achieve concentrations of 100, 50, 25, 10, 5, 2.5 and 1 μg L1.
directly promote plant development by activating plant defence systems,
which leads to enhanced nutrient absorption and growth (Tsegaye et al., 2.4. Apparatus
2017; Liu et al., 2018). Certain phytohormones, including auxin,
gibberellin (GA) and salicylic acid (SA), play critical role in the mainte- A heavy-duty variable speed homogenizer (SRK Instruments,
nance of stem-cell systems in shoot meristems and have complicated Gujarat), centrifuge (Eppendorf, Germany) and Turbovap (Caliper life
functional relationship (Xiong et al., 2020). science, PerkinElmer, USA) were used to process the plant samples. The
At the cellular level, auxin responses are influenced by auxin response IAA, IBA, GA3 and SA were determined using an LCMS-QqQ (Triple
factors (ARF genes) that are identified based on their ability to bind to Quadrupole), TSQ Quantum Access Max® equipped with a UHPLC
promoter elements that confer auxin responsive gene. ARF genes are (Thermo Scientific, USA). In addition, the relative gene expression of
transcription factors that bind to TGTCTC-containing auxin response el- three genes ARF (Auxin responsive factors), ERF-IF (Ethylene-responsive
ements (AuxREs) present in the promoters of primary/early auxin Initiation Factors) and GAI (Gibberellic-Acid Insensitive) were studied
response genes and mediate auxin response (Li et al., 2016). The ERF-IF using the CFX96 quantitative real time PCR System (qRT-PCR) from
gene (Ethylene response factor) is activated by the binding of EIN3/EIL in Biorad, USA.
the main ethylene response element (ERE) located in the promoter of
ERF-IF, which is engaged in the ethylene signal transduction pathway 2.5. Characterization of microbes used and their maintenance
and functions as a positive regulator of ethylene response in different
cropping system (Zemlyanskaya et al., 2018). With increased under- Five well-known PGPR bacteria viz., Rhizobium spp. LSMR1, Azoto-
standing of inorganic fertilizer-based agricultural techniques, it has bacter chroococcum, Azospirillum brasilense, Pseudomonas fluorescens and
become critical to search for region-specific imminent microbial in- Bacillus spp were obtained from the Department of Agriculture Microbi-
oculants to obtain desirable crop yield (Ramesh et al., 2014). The ability ology, University of Agricultural Science (UAS, Bangalore). These bac-
to optimise the effectiveness of the bean-Rhizobium symbiosis for agri- teria were grown on Yeast Extract Mannitol Agar (YEMA), Azotobacter
cultural sustainability will require a thorough study of agro-ecological Agar, Azospirillum Medium w/o Agar, Pikovskaya Agar and Nutrient
variables regulating rhizobial nodule growth during the growing sea- Agar medium (Himedia, India). All microbes used in the experiments
son (Tabandeand and Naseri, 2019). were subjected to morphological, biochemical, plant growth promoting
Numerous PGP agents as well as Rhizobium spp. have been found to characterization and taxonomic identification based on their 16S rRNA
have strong plant growth promoting effects in soil, but the molecular gene sequence accession number (available at https://www.ncbi.nlm.nih
mechanism by which most of these bacteria interact with plants is un- .gov, National Center for Biotechnology Information, USA) (Table 1).
known. This was the first attempt to quantify phytohormones with a
combination of PGPR and a specific Rhizobium spp., using UHPLC-MS/ 2.6. Experimental setup
MS (Ultra-high performance liquid chromatography tandom mass spec-
trometry) due to its high sensitivity, efficacy and low detection limits as Soil of Pulses and Castor Research Unit farm (20 550 53.700 N
compared to other spectroscopic techniques as well as quantitative real 72 530 41.100 E) was collected, sieved through a 10mm mesh sieve and


time-Polymerase chain reaction (qRT-PCR) profiling in mungbean (var. autoclaved properly. The soil was placed in 5 kg polythene-lined clay
Co4) for yield attributing characters and growth promotion by activating pots. The pot experiment was carried out with thirteen treatments of a
phytohormones related genes for better nutrient acquisition. distinct mixture of PGPR (1  108 ml) in mungbean, as mentioned in
Table 2. Mungbean (var. Co4) seeds were treated with a recognised
2. Materials and methods standard culture @ 10 ml kg1 seed and dried in a shed for 30 min before
planting. The dosages of single bio-inoculants were lowered in the
2.1. Plant material combination of culture treatments such that the total volume of the
culture remained constant, i.e. 10 ml kg1 of seed in seed treatment. Ten
The Mega Seed Pulses and Castor Research Unit, Navsari Agricultural prepped seeds and control (uninoculated seeds) were planted in each
University, Navsari 396450, Gujarat, India, provided certified seeds of container. Three plants were kept in each container after the first leaf

2
C.S. Mogal et al. Heliyon 8 (2022) e09532

Table 1. Biochemical characters of PGP agents and Rhizobium spp.

Characteristic of the test organism Rhizobium spp. Pseudomonas fluorescens Bacillus spp. Azotobacter chroococcum Azospirillum brasilense
Gram's reaction -ve -ve þve -ve -ve
Shape Rods Rods Rods Rods Rods
Pigment - þ - - -
Pigment colour Translucent Fluorescent green off-white White off-White
Starch hydrolysis þve þve þve þve þve
Catalase production þve þve þve þve þve
Methyl red test -ve -ve -ve -ve -ve
Nitrate reduction þve þve þve þve þve
IAA Production (μg/ml) 73.32 92.71 92.49 96.68 99.06
GA Production (μg/ml) 83.3 101.1 103.4 110.3 102.1
Nitrogenase activity (n moles C2H4/h1 culture1) 679.26 – – 645.48 600.02
Accession numbers 16S rRNA gene KR072691 KF054767.1 JF513170.1 HQ018746.1 HQ018756.2
1 1
þve positive, -ve negative, IAA Indole 3- acetic acid, GA3 Gibberellic acid, μg/ml microgram per ml, n moles C2H4/h culture nano moles ethylene per hour per culture,
Accession numbers of 16S rRNA gene sequence were obtained from NCBI (https://www.ncbi.nlm.nih.gov).

2.8. LC-MS/MS analysis

Table 2. Treatments details for pot experiment with PGP agents and Rhizobium
spp.
UHPLC coupled with heated electrospray ionization tandem mass
No. Treatment Details spectrometry (UHPLC/HESI-MS/MS) system was used to analyze phy-
T1 Absolute control tohormones IAA, IBA, GA3 and SA. The optimization of parameters on
T2 Seed þ Rhizobium spp. (1  108 ml) @ 10 ml/kg seeds UHPLC and MS/MS of all four phytohormones were studied in both
T3 Seed þ Azotobacter chroococcum (1  108/ml) @ 10 ml/kg seeds positive and negative ion modes (Table 3). The LCQUAN™ 2.9 QF1
T4 Seed þ Azospirillum brasilense (1  108/ml) @ 10 ml/kg seeds software was used to process the data. The phytohormones limit of
T5 Seed þ Pseudomonas fluorescence (1  108/ml) @ 10 ml/kg seeds detection (LOD) was defined as the lowest sample concentration that
T6 Seed þ Bacillus spp.(1  108/ml) @ 10 ml/kg seeds could be detected (signal-to-noise ratio ¼ 3). The limit of quantification
T7 Seed þ Azospirillum þ Rhizobium (1  108/ml) @ 10 ml/kg seeds (LOQ) was defined as the lowest sample concentration that can be
T8 Seed þ Azotobacter þ Rhizobium (1  108/ml) @ 10 ml/kg seeds determined quantitatively with sufficient precision and accuracy (signal-
T9 Seed þ Pseudomonas þ Rhizobium (1  108/ml) @ 10 ml/kg seeds
to-noise ratio ¼ 10). The various concentrations (especially in the linear
T10 Seed þ Bacillus spp. þ Rhizobium (1  108/ml) @ 10 ml/kg seeds
dynamic range) were recorded to determine the analytical method's limit
of detection (LOD) and limit of quantitation (LOQ). The recovery of
T11 Seed þ Bacillus licheniformis (1  108/ml) @ 10 ml/kg seeds
T12 Seed þ Consortia 1 (T2þT3þT5þT6þT11) (1  108/ml) @ 10 ml/kg seeds
T13 Seed þ Consortia 2 (T2þT4þT5þT6þT11) (1  108/ml) @ 10 ml/kg seeds

Table 3. Optimized parameters of phytohormones on UHPLC-MS/MS.

fully unfolded. As a control, uninoculated seeds were planted. The all Parameters IAA IBA GA3 SA
PGPR and Rhizobium spp. strains were used for experimentation during
MS Parameters
Rabi season for two years 2017–18 and 2018–19. Randomizations of pots
 Source of ionization: Heated Electrospray Ionization (HESI)
were done as per completely randomised design (CRD).
 Capillary voltage: 4500V
 Ion mode Positive Positive Negative Negative
2.7. Sample extraction and cleanup
 Vaporizer temperature: 350  C
 Sheath gas (N2): 48 arbitrary unit
The samples were processed and evaluated at the Food Quality
 Aux gas (N2): 18 arbitrary unit
Testing Laboratory NAU, Navsari, Gujarat, India. For aldolesecent roots,
sample was evaluated using the modified QuEChERs (Quick, Easy,  Capillary temperature: 325  C

Cheap, Effective, Rugged, and Safe) method (AOAC 2007).  Tube lens: 52V 60V 62V 30V

The adolescent root samples of mungbean (var. Co4) were minced  Precursor ion (m/z) 176.0 204.0 345.1 137.0
and homogenised using a heavy duty variable homogenizer and a  Product ion (m/z): 77.2 (40) 130 (40) 143.1 (42) 59.5 (42)
 Collision energy (eV) 130.1 (17) 186.1 (17) 239.1 (19) 109.0 (19)
representative sample (15  0.1 g) was taken in 50 mL capacity poly-
propylene centrifuge tubes. Then 1% acetic acid in acetonitrile (15 mL) UHPLC Parameters

was added as an entracting solvent to the sample and placed in a deep  Column: Hypersil Gold® C18 column 150  4:6 mm;
5 μm particle size
freeze for 20–30 min. Therafter, MgSO4 (6.0 g) and sodium acetate (1.5
 Mobile Phase: Solvent A: Water with 0:1 % formic acid
g) were added and shaken for 1.0 min. The contents were centrifuged at
Solvent B: Methanol with 0:1 % formic acid
2205 g for 2.0 min. Later, the supernatant (6.0 mL) was transferred into
 Flow: Gradient
15 mL polypropylene tubes containing anhydrous MgSO4 (0.9 g) and PSA
 Flow rate: 0.3 ml/min
(0.3 g), vortexed for 1.0 min and centrifuged at 1125 g for another 2.0
 Gradient profile: (t (min), %A): (0, 95), (1, 95), (3, 55), (9, 90),
min. For further analysis, an aliquot (2.0 mL) was transferred to 15 mL
(13, 95), (15, 95)
capacity test tubes and evaporated to dryness with nitrogen gas using
 Retention time (RT) 6.2 min 6.6 min 6.0 min 6.4 min
TurboVap. Before being injected into the appropriate instrument, the

samples were filtered through syringe filters (0.22 μm pore size) (Saran V volts, C degree Celsius, (m/z) mass-to-charge ratio, IAA Indole 3- acetic acid,
et al., 2020). IBA Indole 3-butyric acid, GA3 Gibberellic acid, SA salicylic acid.

3
C.S. Mogal et al. Heliyon 8 (2022) e09532

Table 4. Description of primers for qRT-PCR analysis.

Sr. Gene name Gene Function Primer sequence (50 -30 ) GC content (%) cDNA amplicon length (bp)
No
Indigenous genes
1. β-Actin F Makes up the structural framework inside cells TTCGCAGCAACAAACAT 41.2 371
2. β-Actin R TAAGCGGTGCCTCGGTAAGAAG 54.5
3. VrTUBF Plays a critical role in directing the deposition of CTTGACTGCATCTGCTATGTTCAG 45.8 422
cellulose microfibrils during plant cell wall formation.
4. VrTUB R CCAGCTAATGCTCGGCATACTG 54.5
Relative genes
5. ARF F Regulate gene expression in auxin signalling transduction GGAAGATCCTGTGTGAGGTTATG 47.8 140
6. ARF R CTCCTCAGTAGAGCCGTTATCT 50
7. ERF-IF F Acts as a positive regulator of ethylene response in plants TCCATCGCCTGATCCCTTTG 55 210
8. ERF-IF R GAAGCAAGCAAACCAAGCCA 50
9. GAI F Transcriptional activator or co-activator of GA signaling GGATCCAAATCCCAACCTATCC 50 245
10. GAI R GTACTCGCGCTTCATGATCTC 52.4

β-TUB Beta tubulin, ARF Auxin response factor, ERF-IF Ethylene response factor, GAI Gibberellic acid insensitive receptor, F Forward.
Primer, R Reverse Primer, GC Guanine Cytosine content, bp base pair.

phytohormones was used to assess the accuracy and precision (Kansara pulverised in liquid nitrogen using a sterile pestle and mortar for each
et al., 2021). sample. Then the powder was transferred to a 1.5 ml tight-capped
centrifuge tube with 1 ml TRIzolTM reagent and incubated for 5 min at
2.9. Quantitative analysis through quantitative real time-PCR (qRT-PCR). room temperature. After vigorously shaking for 15 s, a double amount of
chloroform (0.2 ml) was added and incubated at room temperature for
2.9.1. RNA extraction 2–3 min.
The transcriptional level was examined in adolescent root tissues of Microcentrifuge tubes were left at room temperature for 10 min
mungbean (var. Co4) on the 15th, 30th and 45th day after treatment. Total before being centrifuged at 12000 rpm at 4  C for 15 min. The super-
RNA was isolated from each treatment's adolescent root samples using a natant was removed and the RNA pellet was washed with 1 ml of 75%
modified TRIzolTM (Invitrogen, USA) method. About 0.1 g roots were ethanol for 5 min at 4  C at 7500 rpm. Pellets were air dried until the

Figure 1. Optimization of chromatographic separation of plant hormones on UHPLC-MS/MS. Linearity and chemical structure of (a) Indole-3-acetic acid-IAA, (b)
Indole-3-byutric acid-IBA, (c) Gibberellic Acid-GA3 and (d) Salicylic Acid-SA.

4
C.S. Mogal et al. Heliyon 8 (2022) e09532

Figure 2. UHPLC–MS/MS chromatograms of plant hormones (A) Indole Acetic Acid, (a1) at standard 0.001 ppm, (a2) in control, (a3) Consortia 1 and (a4) Consortia
2; (B) Indole Butyric Acid, (b1) at standard 0.001 ppm, (b2) in control, (b3) Consortia 1 and (b4) Consortia 2; (C) Gibberellic Acid, (c1) at standard 0.001 ppm, (c2) in
control, (c3) Consortia 1 and (c4) Consortia 2; (D) Salicylic Acid, (d1) at standard 0.001 ppm, (d2) in control, (d3) Consortia 1 and (d4) Consortia 2.

Table 5. Quantification of phytohormones in mungbean on UHPLC-MS/MS.

Sr. No. Treatments IAA (μg g1 FW) IBA (μg g1 FW) GA3 (μg g1 FW) SA (μg g1 FW)
1. Absolute control 0.003  0.048 0.005  0.049 0.786  0.048 0.008  0.047
2. Rhizobium spp. 0.005  0.042 0.007  0.044 0.922  0.043 0.016  0.045
3. Azospirillum 0.027  0.055 0.006  0.056 1.040  0.057 0.043  0.058
4. Azotobacter 0.033  0.052 0.004  0.051 1.546  0.053 0.047  0.054
5. Pseudomonas 0.038  0.053 0.008  0.055 1.644  0.054 0.053  0.052
6. Bacillus spp. 0.049  0.044 0.018  0.048 1.749  0.047 0.055  0.046
7. Azospirillum + Rhizobium 0.052  0.048 0.018  0.049 1.793  0.051 0.060  0.052
8. Azotobacter + Rhizobium 0.323  0.055 0.019  0.058 1.872  0.057 0.064  0.056
9. Pseudomonas + Rhizobium 0.836  0.056 0.033  0.061 1.902  0.058 0.078  0.060
10. Bacillus spp. + Rhizobium 0.386  0.054 0.032  0.058 1.887  0.059 0.068  0.057
11. Bacillus licheniformis 0.413  0.063 0.028  0.065 1.953  0.068 0.079  0.062
12. Consortia 1 0.979  0.065 0.033  0.048 1.980  0.064 0.085  0.058
13. Consortia 2 1.043  0.057 0.036  0.056 1.999  0.059 0.098  0.053

Data are mean  standard deviation (), Consortia 1(T2 + T4+ T5 + T6 + T11), Consortia 2 (T2 + T3+ T5 + T6 + T11), IAA Indole 3- acetic acid, IBA Indole 3-butyric
acid, GA3 Gibberellic acid, SA salicylic acid, FW Fresh weight.

5
C.S. Mogal et al. Heliyon 8 (2022) e09532

ethanol evaporated before being dissolved in 25 μl of Diethyl pyrocar- respectively. The gene-specific primers (ARF, ERF-IF and GAI) were
bonate (DEPC, Invitrogen, USA) treated water. For 10 min, tubes were chosen in accordance with Tao et al. (2009) and Hao et al. (2011), PCR
maintained at 60  C in a dry bath. To assess the quality of the isolated amplification was carried out in a 25 μl reaction volume containing 12.5
RNA, it was put onto a 1 % agarose gel (Sambrook and Russell, 2001; μl Top Taq master mix (QIAGEN), 0.5 M per primer, 10.5 μl nuclease-free
Solanki, 2016; Srivashtav et al., 2019). water and 1 μl genomic DNA/cDNA (80 ng).
Initial denaturation at 94  C for 3 min was followed by 35 cycles of
2.9.2. Gene profiling denaturation at 94  C for 30 s, annealing at 55–61  C for 30 s and
Three phytohormones genes (ARF, ERF-IFand GAI) were screened extension at 72  C for 1 min, with a final extension at 72  C for 10 min.
using genomic DNA and cDNA from adolescent root samples of mung- On 2.5% agarose gel, the amplified products were resolved. The reaction
bean (var. Co4). In quantitative real time-PCR (qRT-PCR) experiment, was carried out with the DyNAmo Colorflash SYBR green qPCR kit and
gene-specific primers were employed to amplify a set of mungbean ROX as a passive reference dye (Thermo Scientific, USA). Each 20 μl
phytohormones and housekeeping genes, and their details are presented reaction volume comprised 80 ng cDNA, 200 nM Forward (F) and
in Table 4. For indigenous primers, VrTUB and β-Actin primers were Reverse (R) primers, and 2x Master mixes. In 96-well optical reaction
chosen in accordance with Chang et al. (2010) and Sairam et al. (2009) skirted plates, samples were initially denatured by heating at 95  C for 3

Figure 3. qRT-PCR analysis (a) Screening of reference genes and validated based on size by 1 kb gene ladder (L) [Lane L: 1 kb ladder; Lane 1–6: Beta-tubulin (VrTUB
size: 422 bp); Lane 7–12: β-Actin, size: 371 bp]; (b) PCR product of relative genes ARF, ERF-IF, GAI. [Lane L: 1 kb ladder; Lane 1–6: Auxin response factor (ARF gene,
size: 140bp); Lane 7–12: Ethylene response factor (ERF-IF gene, size: 210 bp); Lane 13–18: Gibberellic acid insensitive receptor (GAI gene, size: 245 bp)].

6
C.S. Mogal et al. Heliyon 8 (2022) e09532

min, followed by a 40-cycle amplification and quantification protocol presented as the mean of three replications standard deviation (SD) of
consisting of denaturation (95  C for 10 s), annealing (56  C for 10 s) and at least three repetitions of each experiment and they were analysed
extension (70  C for 20 s) (Thermo Scientific, USA). using analysis of variance (one-way ANOVA).
To verify amplification of a single product, a melting curve study was
performed. For each primer pair, a PCR without a template served as a 3. Results and discussion
control. Melting curve analysis (60–95  C) after 40 cycles confirmed the
specificity of amplicons. For quantitative real-time PCR analysis, three 3.1. Method validation
biological replicates were employed for each sample, and three technical
replicates were examined for each biological replication. The linearity studies of all four phytohormones (i.e. IAA, IBA, GA3 and
SA) at different levels (0.001, 0.005, 0.010, 0.025, 0.050 and 0.100 μg
2.10. Statistical analysis g1) in 9:1 v/v methanol: water on LC-MS/MS showed a linear response.
The correlation coefficient (R2, n ¼ 5) values of IAA, IBA, GA3 and SA
Completely Randomised Design (CRD) was used to carry out the pot were 0.998, 0.997, 0.999 and 0.998, respectively (Figure 1 a, b, c and d).
experiment. The advanced SPSS 16.0 software was used for all statistical The obtained values were in accordance with the acceptable limit of R2 
analyses and calculations of experimental data. All statistical results were 0.99. The sensitivity of the analytical method was measured in terms of

Figure 4. Fold expression level of responsive genes (a) Auxin response factor (ARF gene), (b) Ethylene response factor (ERF-IF gene), (c) Gibberellic acid Insensitive
receptor (GAI gene) in mungbean; 15D: 15th Day, 30D: 30th Day, 45D: 45th Day.

7
C.S. Mogal et al. Heliyon 8 (2022) e09532

limit of detection (LOD) and limit of quantification (LOQ), with a proper jasmonates, salicylic acid and strigolactone (SL) were demonstrated to
signal-to-noise ratio considered. The derived values of LODs and LOQs promote plant growth. Furthermore, ethylene is thought to be multi-
were for IAA (0.001 and 0.002 μg g1), IBA (0.001 and 0.002 μg g1), functional phytohormones that control growth. Phytohormones gener-
GA3 (0.003 and 0.007 μg g1) and SA (0.200 and 0.006 μg g1). All of the ated by PGPRs enhance the density and length of root hairs, resulting in
results of recoveries and RSDs were obtained within the acceptable an increase in a plant's root surface area (Tsegaye et al., 2017). This
criteria of SANTE guidelines (SANTE, 2017), i.e. recovery (70–120 %) improves its nutrient and water absorption.
and RSD (20 %).
3.3. Influence of inoculation on relative gene expression of target genes
3.2. Determination of phytohormones on LC-MS/MS
The relative expression analysis of three genes i.e. ARF (Auxin
Precursor and product ions for IAA (176.0 and 77.2, 130.1 m/z), IBA response factors), ERF-IF (Ethylene-responsive Initiation Factors) and
(204.0 and 130.0, 186.1 m/z), GA3 (345.1 and 143.1, 239.1 m/z), and SA GAI (Gibberellic-Acid Insensitive), at transcriptional level were per-
(137.0 and 59.5, 109.0 m/z) were optimized (Table 3). These main formed in the juvenile root tissues of mungbean (var. Co4) on 15th, 30th
product ions were used to identify and quantify phytohormones (IAA, and 45th day after treatment, using qRT-PCR technique. Using a 1 kb gene
IBA, GA3 and SA) from adolescent root tissues. Considering the peak ladder, reference genes were screened and verified based on size. The
shape and its resolution from the sample noise, the chromatographic highly stable Actin gene was chosen for gene expression data normali-
conditions were contrived by optimizing the mobile phases and column zation based on its NormFinder stability value (Fig.3a and 3b).
conditions as per Table 3.
For the UHPLC-MS/MS analysis of all four phytohormones, MS-grade 3.3.1. Auxin response factor (ARF)
methanol and water, acidified with 0.1 % formic acid was used to achieve As compared to control on 15thday old mungbean adolescent root
the high-resolution peak of the target compound. The use of acidified tissue, 5.12 folds increase in ARF gene expression is reported in treatment
mobile phase, particularly aqueous methanol over aqueous acetonitrile, T13. While second highest expression (4.96 folds) of ARF gene was re-
has significantly decreased baseline noise and increased the ionization ported in treatment T12 on 30th day after treatment as compared to
efficiency of the phytohormones (Kite et al., 2007). The chromatograms control (Figure 4a). An increase in ARF gene expression was observed by
of a standard solutions of IAA (6.2 min), IBA (6.6 min), GA3 (6.0 min) and Stearns et al. (2012) in the plants which have an association with ACC
SA (6.4 min) with retention time (RT) were established under the deaminase producing bacteria and suggesting that, in the absence of
aforementioned circumstances (Figure 2 a1, b1, c1 and d1). All four ethylene, ARF signalling can progress may have an impact on plant IAA
phytohormones were found to be linear in the range of 0.003–1.998 μg biosynthesis induction. The production of IAA by the bacteria induces
g1. ACC synthase, which this ethylene may interact with plant auxin response
The multiple treatments trials were carried out on mungbean (var. signalling to repress bacterially induced auxin effects in the plant (Glick
Co4) and the highest concentration of IAA, IBA, GA3 and SA in adolescent et al., 1999).
root tissue were obtained 1.043, 0.036, 1.999, and 0.098 μg g1 FW in
treatment T13 Consortia 2 (Table 5). When compared to the absolute 3.3.2. Ethylene response initiation factor (ERF-IF)
control, treatment T12 Consortia 1 was observed with second highest As compared to control on 15th, 30th and 45th day old mungbean root
concentration of all four phytohormone among all the different treat- tissue, the expression of ERF-IF gene (ethylene response initiation factor)
ments (Table 5 and Figure 2 a2-a4, b2-b4, c2-c4 and d2-d4). was found well balanced (Figure 4b). ERF- IF activated by the binding of
Plant growth is stimulated by the presence of phytohormones, which EIN3/EIL in the primary ethylene response element (PERE) present in the
impact the endogenous mechanism of plants. Iqbal et al. (2017) revealed promoter of ERF1 which is involved in ethylene signal transduction
similar findings in which phytohormones such as auxin, ethylene, pathway and acts as a positive regulator of ethylene response in rice

Table 6. Effect of different treatments on yield attributing characters of mungbean under pot condition.

Sr. No. Treatments Yield attributing characters

NNP NPP WNP Fw (g) SYP (g)

Ya Yb P Ya Yb P Ya Yb P Ya Yb P
1. Control 8.07 8.05 8.06 19.73 18.92 19.33 0.59 0.55 0.57 2.74 3.05 2.90
2. Rhizobium spp. 9.99 9.67 9.83 21.73 20.65 21.19 0.96 0.87 0.91 2.94 3.33 3.13
3. Azospirillum 9.17 9.15 9.16 20.73 19.49 20.11 0.71 0.68 0.70 2.86 3.18 3.02
4. Azotobacter 9.42 9.40 9.41 21.07 19.84 20.45 0.73 0.71 0.72 2.92 3.22 3.07
5. Pseudomonas 9.82 9.57 9.69 23.07 20.68 21.87 0.72 0.75 0.73 3.76 3.65 3.71
6. Bacillus spp. 8.66 9.09 8.88 20.73 19.26 20.00 0.69 0.70 0.69 2.84 3.14 2.99
7. Azospirillum + Rhizobium 10.41 9.97 10.19 22.07 21.04 21.55 0.94 0.89 0.92 3.12 3.44 3.28
8. Azotobacter + Rhizobium 10.48 9.80 10.14 22.73 21.43 22.08 1.10 1.06 1.08 3.15 3.61 3.38
9. Pseudomonas + Rhizobium 10.69 10.84 10.76 24.27 21.69 22.98 1.17 1.13 1.15 3.76 3.87 3.82
10. Bacillus spp.+ Rhizobiu 10.11 9.73 9.92 22.07 21.67 21.87 0.89 0.86 0.88 3.03 3.39 3.21
11. Bacillus licheniformis 8.59 8.65 8.62 20.73 19.24 19.99 0.68 0.70 0.69 2.82 3.12 2.97
12. Consortia 1 12.85 11.50 12.18 24.73 22.60 23.67 1.52 1.50 1.51 3.82 4.08 3.95
13. Consortia 2 15.85 14.84 15.35 25.73 23.76 24.75 1.60 1.58 1.59 4.47 4.57 4.52
SEM 0.074 0.101 0.071 0.239 0.176 0.150 0.010 0.006 0.003 0.016 0.023 0.020
C. D. (P ¼ 0.05) 0.21 0.29 0.20 0.68 0.50 0.43 0.03 0.02 0.01 0.05 0.07 0.06

NNP Number of nodules plant1, NPP Number of pods plant1, WNP Weight of nodules plant1(g), SY Seed yield plant1(g), Fw Fresh weight (g).
Ya Year 2017–18, Yb Year 2018–19, P Pooled data, Consortia 1(T2 + T4+ T5 + T6 + T11), Consortia 2 (T2 + T3+ T5 + T6 + T11).
SEM: Standard error of mean, C. D: Critical difference (n ¼ 3).

8
C.S. Mogal et al. Heliyon 8 (2022) e09532

Figure 5. Yield attributing characters, no of nodules per plant of mungbean. (a) variety: Co-4, (b) Control, (c) Rhizobium, (d) Azospirillum, (e) Azotobacter, (f)
Pseudomonas, (g) Bacillus spp., (h) Consortia 1 (i) Consortia 2.

(Alonso and Stepanova, 2004). It is well known that ethylene plays a role 3.3.3. Gibberellic acid insensitive (GAI) receptor
in the initiation of root hairs and induce the emergence of adventitious In case of GAI receptor expression, all treatments showed increase in
roots in rice at the same time the over expression of OsERF exhibit short gene expression after 30thday of sawing. Treatments T13 and T12 showed
root, coiled primary root and slightly short shoot phenotype and elevated 3.87 and 3.26 fold increase in GAIexpression as compare to control, after
response to exogenous ethylene but also improved the tolerance to 45 day (Figure 4c). Fu et al. (2001) found high-level expression of GAI
stresses (Mao et al., 2005; Ito et al., 2006). In the present study, caused dwarfism and reduced GA3 responses. SLR1 a GAI gene, whose
expression of ethylene response initiation factor (ERF-IF) gene found no high level expression negatively regulate the plant responses to GA
variations in mungbean roots on penetration of microorganism. (Ikeda et al., 2001; Itoh et al., 2002).

9
C.S. Mogal et al. Heliyon 8 (2022) e09532

3.4. Influence of inoculation on yield attributing characters Vanrajsinh H. Solanki: Performed the experiments; Analyzed and
interpreted the data; Wrote the paper.
As compared to the uninoculated control, all the treatments signifi- Rohan V. Kansara: Performed the experiments; Wrote the paper.
cantly increased nodulation prominence and seed yield plant1 (Table 6). Sanjay Jha: Conceived and designed the experiments; Analyzed and
Pre-sowing inoculation of mungbean seeds with penta combination interpreted the data.
Consortia 2 (T13: Rhizobium þ Azotobacter þ Pseudomonas þ Bacillus spp. Susheel Singh: Analyzed and interpreted the data; Contributed re-
þ Bacillus licheniformis) demonstrated the highest nodulation status in agents, materials, analysis tools or data; Wrote the paper.
terms of a number of nodule plant1 (Figure 5) and the highest seed yield Vipulkumar B. Parekh; Rajkumar B. K.: Contributed reagents, mate-
plant1 in both rabi seasons (Year, 2017–2018 and 2018–2019), followed rials, analysis tools or data.
by penta combination Consortia 1 (T12: Rhizobium þ Azospirillum þ
Pseudomonas þ Bacillus spp. þ Bacillus licheniformis). Pooled analysis of Funding statement
two seasons (Table 6) revealed that inoculation with penta combination
Consortia 2 resulted in substantially more nodules plant1 (15.35) This research did not receive any specific grant from funding agencies
(Figure 5), pods plant1 (24.75), fresh weight of nodules plant1 (1.59 g) in the public, commercial, or not-for-profit sectors and proceed further
and seed yield plant1 (4.52) than other treatments and the uninoculated with the article.
control (Table 6 and Figure 5). However, the penta combination inocu-
lation with Consortia 1 was only comparable in nodules plant1 (12.18) Data availability statement
and pods plant1 (23.67) (Table 6).
Tri and Tetra combinations of rhizobacteria tested in a single medium Data will be made available on request.
exhibited more diverse PGP characteristics than a single inoculant in
wheat (Kumar et al., 2021). Single inoculations with Rhizobium, PSB, or Declaration of interests statement
PGPR were found less efficient than combined inoculations. Rhizobium
and PSMs (Aspergillus awamorii and Pseudomonas striata) as dual in- The authors declare no conflict of interest.
oculants increased chickpea grain production in the field (Andy et al.,
2020). Valverde et al. (2006) demonstrated that co-inoculation of Pseu- Additional information
domonas jessenii PS06 and Mesorhizobium ciceri C-2/2 improves chickpea
nodulation, growth, and seed production in both greenhouse and outdoor No additional information is available for this paper.
trials. Similarly, Mesorhizobium and PGPR were able to significantly
improve nodulation and root and shoot dry matter in chickpea (Verma Acknowledgements
et al., 2010; Verma and Yadav, 2012). The enhanced yield of mungbean
in combination inoculation might be due to plant growth stimulation. Authors give thanks to the Unit Head of the Mega Seed, Pulses and
Furthermore, PGPRs are known to produce a range of secondary me- Castor Research Unit, Navsari Agricultural University, Gujarat, India, for
tabolites, which may be contributed significantly to plant defence and providing mungbean seeds. Authors are privileged by the excellent co-
production. ordination and laboratory facility available at Food and Quality Testing
PGPRs are also known to increase levels of flavonoid-like compounds Laboratory (FQTL) and Forest Biotechnology Laboratory in ASPEE Col-
in legume roots, which may be an additional role in nodule development lege of Horticulture and Forestry, NAU, Navsari, Gujarat, India.
during seed bacterization (Sharma et al., 2005). PGPR and PSB are
known to promote Biological Nitrogen Fixation (BNF) by increasing References
nodulation and inhibiting the growth of harmful microorganisms in the
root system. At the blooming stage, similar drift was seen for all growth Abbasi, M.K., Manzoor, M., Tahir, M.M., 2010. Efficiency of rhizobium inoculation and P
fertilization in enhancing nodulation, seed yield, and phosphorus use efficiency by
metrics compared to the uninoculated control. field grown soybean under hilly region of rawalakot Azad Jammu and Kashmir,
Pakistan. J. Plant Nutr. 33 (7), 1080–1102.
4. Conclusions Alonso, J.M., Stepanova, A.N., 2004. The ethylene signaling pathway. Science 306
(5701), 1513–1515.
Andy, A.K., Masih, S.A., Gour, V.S., 2020. Isolation, screening and characterization of
Based on the findings, it is possible to infer that these standard known plant growth promoting rhizobacteria from rhizospheric soils of selected pulses.
strains of plant growth promoting rhizobacteria (PGPR) have the ca- Biocatal. Agric. Biotechnol. 27, 101685.
Method AOAC, 2007. Official Methods of Analysis 2007 01, Pesticide Residues in Foods
pacity to be utilized as biofertilizers agents. The unique capability of by Acetonitrile Extraction and Partitioning with Magnesium Sulfate, 2007.
different isolates in the consortia has attributed plant growth promotion. Chang, J., Li, S., Shih, Y., Wang, R., Chung, P., Ko, Y., 2010. Molecular characterization of
In mungbean (var. Co4), penta combination of Consortia 2 (T2 þ T4þ T5 Mungbean (Vigna radiata L.) starch branching enzyme I. J. Agric. Food Chem. 58
(19), 10437–10444.
þ T6 þ T11) and Consortia 1 (T2 þ T3þ T5 þ T6 þ T11) were the most
Deshwal, V.K., Kumar, P., 2013. Effect of salinity on growth and PGPR activity of
robust in terms of growth promotion, yield and yield attributing char- pseudomonads. J. Acad. Indus. Res. 2, 353–356.
acteristics via modulating phytohormones and improved nutrient uptake Fu, X., Sudhakar, D., Peng, J., Richards, D.E., Christou, P., Harberd, N.P., 2001.
over the control (T1). Furthermore, it induces the gene expression of the Expression of arabidopsis GAI in transgenic rice represses multiple gibberellin
responses. Plant Cell 13 (8), 1791–1802.
Auxin response factor (ARF) at the same time the auxin redistribution is Glick, B.R., Patten, C.L., Holguin, G., Penrose, D.M., 1999. Biochemical and Genetic
controlled by stimulating plants growth and lateral initiation in plant Mechanisms Used by Plant Growth Promoting Bacteria.
shoots and roots. Thus, the utilization of PGPR in pulses could provide Gopalakrishnan, S., Humayun, P., Kiran, B.K., Kannan, I.G., Vidya, M.S., Deepthi, K.,
Rupela, O., 2010. Evaluation of bacteria isolated from rice rhizosphere for biological
alternative platform to farmers minimize modern agriculture challenges. control of charcoal rot of sorghum caused by Macrophomina phaseolina (Tassi) Goid.
World J. Microbiol. Biotechnol. 27 (6), 1313–1321.
Declarations Goswami, D., Thakker, J.N., Dhandhukia, P.C., 2016. Portraying mechanics of plant
growth promoting rhizobacteria (PGPR): a review. Cogent. Food Agric. 2, 1127500.
Gururani, M.A., Upadhyaya, C.P., Baskar, V., Venkatesh, J., Nookaraju, A., Park, S.W.,
Author contribution statement 2013. Plant growth-promoting Rhizobacteria enhance abiotic stress tolerance in
solanum tuberosum through inducing changes in the expression of ROS-scavenging
enzymes and improved photosynthetic performance. J. Plant Growth Regul. 32 (2),
Chaitanya S. Mogal: Conceived and designed the experiments; Per- 245–258.
formed the experiments; Analyzed and interpreted the data; Wrote the Hao, Z., Wang, L., He, Y., Liang, J., Tao, R., 2011. Expression of defense genes and
paper. activities of antioxidant enzymes in rice resistance to rice stripe virus and small
Brown planthopper. Plant Physiol. Biochem. 49 (7), 744–751.

10
C.S. Mogal et al. Heliyon 8 (2022) e09532

Ikeda, A., Ueguchi-Tanaka, M., Sonoda, Y., Kitano, H., Koshioka, M., Futsuhara, Y., Ramesh, A., Sharma, S.,K., Sharma, M.,P., Yadav, N., Joshi, O.,P., 2014. Inoculation of
Matsuoka, M., Yamaguchi, J., 2001. Slender rice, a constitutive gibberellin response zinc solubilizing Bacillus aryabhattai strains for improved growth, mobilization and
mutant, is caused by a null mutation of the slr1 gene, an Ortholog of the height- biofortification of zinc in soybean and wheat cultivated in Vertisils of central India.
regulating gene gai/RGA/Rht/D8. Plant Cell 13 (5), 999–1010. Appl. Soil Ecol. 73, 87–96.
Iqbal, N., Khan, N.A., Ferrante, A., Trivellini, A., Francini, A., Khan, M.I., 2017. Ethylene Sairam, R.,K., Dharmar, K., Chinnusamy, V., Meena, R.,C., 2009. Waterlogging-induced
role in plant growth, development and senescence: interaction with other increase in sugar mobilization, fermentation, and related gene expression in the roots
phytohormones. Front. Plant Sci. 8. of mung bean (Vigna radiata). J. Plant Physiol. 166, 602–616.
Ito, Y., Katsura, K., Maruyama, K., Taji, T., Kobayashi, M., Seki, M., Shinozaki, K., Sambrook, J., Russell, D., 2001. Molecular Cloning: A Laboratory Manual, third ed., 32.
Yamaguchi-Shinozaki, K., 2006. Functional analysis of rice DREB1/CBF-type Cold Spring, Harbor Laboratory Press. Cold Spring Harbor, NY.
transcription factors involved in cold-responsive gene expression in transgenic rice. SANTE, 2017. Guidance Document on Analytical Quality Control and Method Validation
Plant Cell Physiol. 47 (1), 141–153. Procedures for Pesticide Residues Analysis in Food and Feed.
Itoh, H., Ueguchi-Tanaka, M., Sato, Y., Ashikari, M., Matsuoka, M., 2002. The gibberellin Saran L., P., Singh, S., Solanki H., V., Devi, G., Kansara V., R., Manivel, P., 2020.
signaling pathway is regulated by the appearance and disappearance of slender Identification of potential accessions of Asparagus racemosus for root yield and
RICE1 in nuclei. Plant Cell 14 (1), 57–70. shatavarin IV content. Heliyon e05674.
Joshi, P., Bhatt, A.B., 2011. Diversity and function of plant growth promoting Sharma, V., Kumar, V., Archana, G., Kumar, G.,N., 2007. Substrate specificity of glucose
rhizobacteria associated with wheat rhizosphere in North Himalayan Region. Int. J. dehydrogenase (GDH) of Enterobacter asburiae PSI3 and rock phosphate solubilization
Environ. Sci. Technol. 1 (6), 1135–1143. with GDH substrates as C sources. Can. J. Microbiol. 51, 477–482.
Kalantari, S., Marefat, A., Naseri, B., Hemmati, R., 2018. Improvement of bean yield and Solanki, V.H., 2016. Study on Fusarium Oxysporum F. Sp. Lycopersici and Tomato (Solanum
Fusarium root rot biocontrol using mixtures of Bacillus, Pseudomonas and lycoipersicum) Interaction: Molecular and Biochemical Perspectives, PhD Thesis.
Rhizobium. Trop. Plant Pathol. 43 (6), 499–505. Navsari Agricultural university, Navsari, Gujarat, India.
Kansara, R.V., Solanki, V.H., Singh, S., Chauhan, D., 2021. Persistence, dissipation Srivashtav, V., Jha, S., Parekh, V., 2019. Overexpression of LmgshF from Listeria
behaviour and dietary risk assessment of a combi-product of chlorantraniliprole and monocytogenes in indica rice confers salt stress tolerance. Russ. J. Plant Physiol. 66,
λ-cyhalothrin in/on pigeonpea (Cajanus cajan L.). Heliyon 7 (4), e06377. 911–921.
Khati, P., Parul, B., Nisha, P., Kumar, R., Sharma, A., 2018. Effect of nanozeolite and plant Stearns, J.C., Woody, O.,Z., McConkey, B.,J., Glick, B.,R., 2012. Effects of bacterial ACC
growth promoting rhizobacteria on maize. 3 Biotech. 8, 141. deaminase on Brassica napus gene expression. Mol. Plant Microbe Interact. J. 25 (5),
Kite, G.,C., Ported, E.,A., Simmonds, M.,S.,J., 2007. Chromatographic behaviour of 668–676.
steroidal saponins studied by high-performance liquid chromatography–mass Tabandeand, L., Naseri, B., 2019. How strongly rhizobial nodulation is associated with
spectrometry. J. Chromatogr. 1148, 177–183. bean cropping system? J. Plant Protect. Res. 60, 176–184.
Korir, H., Mungal, N.,W., Thuita, M., Hamba, Y., Masso, C., 2017. Co-inoculation effect of Tabassum, B., Khan, A., Tariq, M., Ramzan, M., Khan, M.S.I., Shahid, N., et al., 2017.
rhizobia and plant growth promoting rhizobacteria on common bean growth in a low Bottlenecks in commercialisation and future prospects of PGPR. Appl. Soil Ecol. 121,
phosphorus soil. Front. Plant Sci. 8, 1–10. 102–117.
Kumar, A., Maurya, B.,R., Raghuwanshi, R., 2021. The microbial consortium of Tao, R.,X., Hao, Z.,N., Wang, L.,P., 2009. Expression patterns of hormonal genes and
indigenous rhizobacteria improving plant health, yield and nutrient content in wheat antioxidant defence responses in a cowpea variety. Physiol. Mol. Plant Pathol. 74,
(Triticum aestivum). J. Plant Nutr. 44, 13. 167–174.
Kumari, P., Meena, M., Gupta, P., Dubey, K., Gopal, N., Upadhyay, R.,S., 2018. Plant Tian, P., Razavi, B.,S., Zhang, X., Wang, Q., Blagodatskaya, E., 2020. Microbial growth
growth promoting rhizobacteria and their bio-priming for growth promotion in and enzyme kinetics in rhizosphere hotspots are modulated by soil organics and
mungbean (Vigna radiata (L.). Biocatal. Agric. Biotechnol. 7, 125–135. nutrient availability. Soil Biol. Biochem. 141, 107662.
Li, S.,B., Xie, Z.,Z., Hu, C.,G., Zhang, J.,Z., 2016. A review of auxin response factors (ARFs) Tsegaye, Z., Assefa, F., Beyene, D., 2017. Properties and application of plant growth
in plants. Front. Plant Sci. 7, 47. promoting rhizobacteria. Int. J. Curr. Trends Pharmacobiol Med. Sci. 2 (1), 30–43.
Liu, H., Xiong, W., Zhang, R., 2018. Continuous application of different organic additives Valverde, A., Burgos, A., Fisella, T., Rivas, R., Velaz-quez, E., Rodriguez-Barrueco, C.,
can suppress tomato disease by inducing the healthy rhizospheric microbiota through Cervantes, E., Chamber, M., Lgual, J.,M., 2006. Diferential effects of coinoculation
alterations to the bulk soil microflora. Plant Soil 423, 229–240. with Psuedomonas jesseni PS06 (a phosphate solubilizing bacteria) and Mesorhizobium
Lucas, J.A., Solano, B.R., Montes, F., Ojeda, J., Megias, M., Manero, F.J.G., 2009. Use of ciceri C-2/2 strain on the growth and seed yield of chickpea under greenhouse and
two PGPR strains in the integrated management of blast disease in rice (Oryza sativa) field conditions. Plant Soil 287, 43–50.
in Southern Spain. Field Crop. Res. 114, 404–410. Verma, J.,P., Yadav, J., 2012. Evaluation of plant growth promoting rhizobacteria and
Mao, C., Wang, S., Jia, Q., Wu, P., 2005. OsEIL1, a rice homolog of the Arabidopsis EIN3 their effect on plant growth and grain yield of chickpea (Cicer aretinum L.) under
regulates the ethylene response as a positive component. Plant Mol. Biol. 61, 141–152. sustainable agriculture production. Int. J. Eng. Sci. Res. Technol. 2 (9), 51–57.
Muresu, R., Polone, E., Sulas, L., Baldan, B., 2008. Co-existence of predominantly non- Verma, J.,P., Yadav, J., Tiwari, K.,N., 2010. Application of Rhizobium sp. BHURC01and
culturable rhizobia with diverse, endophytic bacterial taxa within nodules of wild plant growth promoting rhizobacteria on nodulation, plant biomass and yield of
legumes. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Ecol. 63, 383–400. chickpea (Cicer arietium L.). Int. J. Agric. Res. 5, 148–156.
Naseri, B., Hemmati, R., 2017. Bean root rot management: recommendations based on an Xiong, Y.,W., Li, X.,W., Wang, T.,T., Gong, Y., Zhang, C.,M., Xing, K., Qin, S., 2020. Root
integrated approach for plant disease control. Rhizosphere 4, 48–53. exudates-driven rhizosphere recruitment of the plant growth-promoting
Naseri, B., Younesi, H., 2021. Beneficial microbes in biocontrol of root rots in bean crops: rhizobacterium Bacillus flexus KLBMP 4941 and its growth-promoting effect on the
a meta-analysis (1990–2020). Physiol. Mol. Plant Pathol. 116, 101712. coastal halophyte Limonium sinense under salt stress. Ecotoxicol. Environ. Saf. 28
Okazaki, S., Tittabutr, P., Teulet, A., 2016. Rhizobium–legume symbiosis in the (194), 110374.
absence of Nod factors: two possible scenarios with or without the T3SS. ISME J. 10, Zemlyanskaya, E.,V., Omelyanchuk, N.,A., Ubogoeva, E.,V., Mironova, V.,V., 2018.
64–74. Deciphering auxin-ethylene crosstalk at a systems level. Int. J. Mol. Sci. 19, 4060.

11