Rice Improvement: Jauhar Ali Shabir Hussain Wani Editors

Jauhar Ali
Shabir Hussain Wani Editors
Rice
Improvement
Physiological, Molecular Breeding and
Genetic Perspectives
Rice Improvement
Jauhar Ali • Shabir Hussain Wani
Editors
Rice Improvement
Physiological, Molecular Breeding
and Genetic Perspectives
Editors
Jauhar Ali Shabir Hussain Wani
Hybrid Rice Breeder, Senior Scientist II, Assistant Professor/Scientist, Mountain
Leader, Hybrid Rice Breeding Cluster, Research Centre for Field Crops
Head, Hybrid Rice Development Sher-e-Kashmir University of Agricultural
Consortium (HRDC) Sciences and Technology
International Rice Research Institute (IRRI) Kashmir, Jammu and Kashmir, India
Metro Manila, Philippines
This book is an open access publication.

ISBN 978-3-030-66529-6 ISBN 978-3-030-66530-2 (eBook)
https://doi.org/10.1007/978-3-030-66530-2
© The Editor(s) (if applicable) and The Author(s) 2021, Corrected Publication 2021
Open Access This book is licensed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits use, sharing,
adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit
to the original author(s) and the source, provide a link to the Creative Commons license and indicate if
changes were made.
The images or other third party material in this book are included in the book's Creative Commons
license, unless indicated otherwise in a credit line to the material. If material is not included in the book’s
Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the
permitted use, you will need to obtain permission directly from the copyright holder.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this book
are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the
editors give a warranty, expressed or implied, with respect to the material contained herein or for any
errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional
claims in published maps and institutional affiliations.
This Springer imprint is published by the registered company Springer Nature Switzerland AG
The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland
Dedicated to the 60th Anniversary of the
International Rice Research Institute
(IRRI) and to the global rice research
community.
Foreword
Rice is one of the most significant cereal crops globally, intertwined with food and
human culture. Ninety percent of the rice produced and consumed in Asia is linked
to poverty. Rice is a model crop for geneticists, physiologists, and biotechnologists.
The recent advances in their areas got a boost from the sequenced 3000 rice genomes
that are placed in the public domain for exploitation and will provide greater depth
and a more complete picture of the genetic information. A deeper understanding of
rice physiology, molecular breeding, and genetics could pave the way for more
sustainable varietal products for the benefit of humanity, particularly for those living
in the developing world. On this subject, the editors of this book have attempted to
highlight rice research advances in the fields of physiology, molecular breeding, and
genetics, with a focus on increasing productivity, improving biotic and abiotic stress
tolerance, and improving the nutritional quality of rice. This book offers a balanced
set of chapters after the authors in the opening chapter give an overview of the
advances in genetics and breeding of rice. It is widely understood that increasing
plant biomass and its efficient translocation to the sink hold the key to increasing
grain yield. Another chapter targets the strategies for engineering photosynthesis for
enhanced plant biomass production. It is vital to use the green traits concerning
multiple abiotic and biotic stresses, including water- and nutrient-use efficiencies.
Breeding of climate-resilient rice varieties could effectively provide insurance to
rice farmers to combat against climatic turbulence. Hybrid rice technology is
becoming the most viable option to meet global food security concerns as it assures
a 20–25% yield advantage over the best inbred varieties. It faces two major chal-
lenges for its wide-scale adoption. First, heterosis per se needs to be attractive for
farmers by assuring them a stable yield advantage of >25% over inbred varieties
besides addressing market requirements. Second, the higher hybrid rice seed repro-
ducibility (>3 t/ha) and decreased production costs should be attractive to the seed
industry. In this regard, two-line hybrid rice breeding is reclaiming attention to
make rice hybrids more heterotic and more efficient for hybrid seed production.
This two-line hybrid technology is likely to reach farmers in a big way at an afford-
able cost. In recent times, irrigation water scarcity for agriculture, particularly for
rice, requires the development of water-use-efficient and drought-tolerant rice culti-
vii
viii Foreword
vars. Understanding drought physiology and developing drought-tolerant varieties

are the need of the hour. Recently, the COVID-19 pandemic showed a massive
shortage of labor for transplanted rice that has sparked interest in adopting direct-
seeded rice (DSR) in many parts of India and other rice-producing countries.
However, systematic breeding for DSR is still in its infancy. The development of
DSR varieties with the appropriate set of traits such as anaerobic germination, her-
bicide tolerance, weed competitiveness, effective germination under deeper seed
placement, and uniform seedling establishment can help improve and popularize
this technology. The use of DSR varieties and associated genetics and management
technologies is going to improve rice cultivation with less water without losing
grain yield. Also, there will be a considerable decrease in greenhouse gas emissions
and a decrease in global warming to some extent. Increasing global temperatures
are going to cause havoc to agriculture in particular, and breeding heat-tolerant
varieties is going to be a challenging task while sustaining current yield rates.
Global climatic aberrations are causing more areas to experience cold spells, par-
ticularly in temperate regions, where higher rice productivity is attained. Breeding
for rice varieties with tolerance of low-temperature stress is another important
objective to be fulfilled. Many parts of the world are facing toxic elements such as
arsenic entering into the food system. In many places in Eastern India and
Bangladesh, rice is being cultivated in arsenic-polluted environments. It is impor-
tant for breeders to develop suitable rice varieties that would restrict arsenic from
entering into rice grain and straw, thereby making this rice safer for human con-
sumption and straw for cattle.
Likewise, breeding for tolerance against insect pests and diseases is an area of
much concern, especially under the changing climatic scenario that is triggering the
evolution of new pathogen strains and leaving rice more susceptible than ever.
Molecular approaches to breed varieties with insect pest and disease resistance are
essential and provide an opportunity for using broad-spectrum resistance genes.
However, with the recent advances in genome editing tools, it will be relatively
easier to incorporate tolerance by understanding the molecular basis of this toler-
ance. To maximize the genetic gains, researchers are attempting to speed up breed-
ing in many crops. Recent technological innovations promise to accelerate the
growth and life cycle of the rice crop considerably to allow four generations per
year. Interestingly, another powerful alternative technology is doubled haploids
(DH), which could fix segregating lines in less than 6 months. Scaling up of the DH
approach is one of the most important approaches and using new genetic technolo-
gies around this could be a game changer for future breeding programs.
Rice is often linked to poverty in many parts of the world, where it constitutes the
primary source of calories. Hidden hunger arises when essential nutrients such as
zinc and iron are missing from a staple diet. Therefore, an increased effort is required
for the biofortification of rice varieties with adequate concentrations of zinc and
iron by mainstreaming rice breeding itself.
Foreword ix
I would like to congratulate the editors of this book for bringing out a valuable
collection of chapters concerning the most important aspects of rice research. This
book will serve as a vital reference tool of benefit to rice scientists, students, policy-
makers, and other researchers in academia and industry.
Gurdev S. Khush FRS

Member US National Academy of Sciences
Adjunct Professor Emeritus
University of California,
Davis, CA 95616 USA
Former Head, Plant Breeding Genetics and Biotechnology, IRRI

Los Baños, Philippines
Preface
The global human population is rapidly increasing. This is placing enormous pres-
sure on all available natural resources needed to feed 9.7 billion people by 2050,
which poses a severe threat of hunger and chaos to all of humanity in the coming
decades. The food security situation will become worse with global climatic aberra-
tions. Rice, among the staple cereal crops, could be much affected, especially in
Asia, where more than 90% of the crop is produced and consumed. Rice production
and productivity need to be augmented even though we have limited land, water,
and chemical inputs. The challenge is to develop climate-resilient rice varieties that
will provide insurance for the farmers growing them, and in a sustainable manner.
Most biotic and abiotic stresses are complex in nature. Because of the quantitative
mode of inheritance and tolerance traits being governed by genes with minor effects,
this limits their accelerated and precise improvement using conventional plant
breeding methods. With the recent developments in whole-genome sequencing,
molecular marker technology, and high-throughput phenotyping methods, it is now
possible to develop breeding products in less time and in a more efficient manner.
New breeding strategies involving genomic selection and accelerated breeding
approaches are being adopted. Concerted efforts are being made at various leading
rice research institutes worldwide to tackle the abovementioned drawbacks in rice
production, productivity, nutritional quality, and resilience to various biotic and abi-
otic stresses. Through this volume on Rice Improvement: Physiological, Molecular
Breeding and Genetic Perspectives, an effort is made to put all the state-of-the-art
technological accomplishments in rice physiology, molecular breeding, and genet-
ics in one basket. We have included chapters from leading authors from various
international institutes recognized for their rice improvement work. The chapters
cover advances in rice genetics and breeding, and deep insights into rice physiology
to increase assimilates and efficient partitioning of the photosynthates. Detailed
chapters cover Green Super Rice breeding technology, advances in two-line hybrid
rice technology, and breeding of direct-seeded rice. Water is soon going to be the
scarcest resource; therefore, another chapter covers growing rice with less water.
Breeding for climate resilience is a universal goal among rice scientists globally;
therefore, other chapters explain the development of rice with climate resilience
xi
xii Preface
against heat, drought, cold, and heavy metal stress, written by subject matter experts.
Molecular breeding for biotic stress tolerance such as disease and insect pest resis-
tance is broadly discussed. Also, speeding up the fixation of segregating materials
through doubled haploids is well covered to maximize genetic gains. Last but not
least, the objective of breeding rice for high grain iron and zinc is dealt with com-
prehensively in two chapters discussing recent updates on micronutrient biofortifi-
cation of iron and zinc in rice to decrease malnutrition in women and children. This
book will serve as a comprehensive reference material for rice researchers, teachers,
and graduate students involved in rice improvement through physiological, molecu-
lar, and genomic approaches for yield improvement and tolerance aiming for cli-
mate resilience and increased nutritional quality. We express our sincere thanks and
gratefulness to our esteemed authors. Without their determined efforts, this book
project would not have been possible. We are also grateful to the Bill & Melinda
Gates Foundation for providing funding for this project, from which this book will
be an open access publication for the benefit of the scientific community and stu-
dents. We would like to kindly thank Ms. Kristine Alexis Arellano for providing
secretarial support for this book. We also acknowledge all the reviewers who helped
to improve the chapters. We would like to thank Bill Hardy for meticulously editing
all the chapters. We appreciate Springer Nature and its editorial staff for timely
completing the production process for this book.
Metro Manila, Philippines Jauhar Ali

Kashmir, Jammu and Kashmir, India Shabir Hussain Wani
Contents

Advances in Genetics and Breeding of Rice: An Overview�� 1
E. A. Siddiq and Lakshminarayana R. Vemireddy

Strategies for Engineering Photosynthesis for Enhanced
Plant Biomass Production �� 31
Wataru Yamori

Green Super Rice (GSR) Traits: Breeding and Genetics for Multiple
Biotic and Abiotic Stress Tolerance in Rice �� 59
Jauhar Ali, Mahender Anumalla, Varunseelan Murugaiyan,
and Zhikang Li

Advances in Two-Line Heterosis Breeding in Rice via the
Temperature-Sensitive Genetic Male Sterility System �� 99
Jauhar Ali, Madonna Dela Paz, and Christian John Robiso

Growing Rice with Less Water: Improving Productivity
by Decreasing Water Demand�� 147
Balwant Singh, Shefali Mishra, Deepak Singh Bisht, and Rohit Joshi

Crop Establishment in Direct-Seeded Rice: Traits, Physiology,
and Genetics �� 171
Fergie Ann Quilloy, Benedick Labaco, Carlos Casal Jr, and Shalabh Dixit

Genetics and Breeding of Heat Tolerance in Rice�� 203
Changrong Ye, Xiaolin Li, Edilberto Redoña, Tsutomu Ishimaru,
and Krishna Jagadish

Genetics and Breeding of Low-Temperature Stress
Tolerance in Rice�� 221
Sofi Najeeb, Anumalla Mahender, Annamalai Anandan,
Waseem Hussain, Zhikang Li, and Jauhar Ali
xiii
xiv Contents

Arsenic Stress Responses and Accumulation in Rice�� 281
Varunseelan Murugaiyan, Frederike Zeibig, Mahender Anumalla,
Sameer Ali Siddiq, Michael Frei, Jayaseelan Murugaiyan,
and Jauhar Ali

Molecular Approaches for Disease Resistance in Rice �� 315
Mohammed Jamaloddin, Anumalla Mahender, C. Guru Gokulan,
Chintavaram Balachiranjeevi, A. Maliha, Hitendra Kumar Patel,
and Jauhar Ali

Molecular Approaches for Insect Pest Management in Rice �� 379
Jagadish S. Bentur, R. M. Sundaram, Satendra Kumar Mangrauthia,
and Suresh Nair

Doubled Haploids in Rice Improvement: Approaches,
Applications, and Future Prospects�� 425
Sanghamitra Samantaray, Jauhar Ali, Katrina L. C. Nicolas,
Jawahar Lal Katara, Ram Lakhan Verma, C. Parameswaran,
B. N. Devanna, Awadhesh Kumar, Byomkesh Dash,
and Sudhansu Sekhar Bhuyan

Zinc-Biofortified Rice: A Sustainable Food-Based Product
for Fighting Zinc Malnutrition �� 449
Mark Ian C. Calayugan, B. P. Mallikarjuna Swamy, Chau Thanh Nha,
Alvin D. Palanog, Partha S. Biswas, Gwen Iris Descalsota-Empleo,
Yin Myat Myat Min, and Mary Ann Inabangan-Asilo

Biofortification of Rice Grains for Increased Iron Content �� 471
Jerlie Mhay Matres, Erwin Arcillas, Maria Florida Cueto-Reaño,
Ruby Sallan-Gonzales, Kurniawan R. Trijatmiko,
and Inez Slamet-Loedin
Correction to: Crop Establishment in Direct-Seeded Rice:

Traits, Physiology, and Genetics �� C1
Index�� 487
Abstract
Rice remains the staple food source for a majority of the global population and
especially in Asia where 90 percent of rice is grown and consumed. Human popula-
tion is rapidly increasing and by 2050, it is expected to reach 9.7 billion; therefore
the demand for increased rice production needs to be met from ever reducing
resources like land, water, and chemical inputs. In addition to the escalating demand,
the changing climate scenario has increased several production constraints multi-
fold that includes abiotic and biotic stresses. Rice researchers worldwide have been
continuously making research efforts to provide technological solutions to counter
the above challenges. Among them, the ‘green super rice’ breeding strategy has
been successful for leading the development and release of multiple abiotic and
biotic stress tolerant rice varieties for both favorable and unfavorable environments.
Recent advances in plant molecular biology and biotechnologies have led to the
identification and use of thousands of genes involved in biotic and abiotic stress
tolerances over the last decade, which have opened up new vistas for increased rice
production. Many of these are the regulatory genes regulating stress responses (e.g.,
transcription factors and protein kinases) and functional genes that guard and main-
tain the cell (e.g., enzymes for generating protective metabolites and proteins).
These genes are primarily used to augment the stress tolerance pathways in rice. In
addition, numerous quantitative trait loci (QTLs) associated with elevated stress
tolerance have been cloned, resulting in the detection of considerably imperative
genes for biotic and abiotic stress tolerance. Also, the molecular understanding of
the genetic basis of traits such as N and P use is allowing rice researchers to engi-
neer nutrient use efficient rice varieties, which would result in higher yields with
lower inputs. Further, knowledge of the biosynthesis of micronutrients in rice per-
mits genetic engineering of metabolic pathways to enhance the availability of
micronutrients. Advances in genome sequencing tools have led to the improvement
in rice molecular markers, their number was significantly increased, their physical
order was deciphered, and closeness to annotated genes was valuable to forecast
xv
xvi Abstract
gene-trait associations. Rice genome sequencing efforts over time will be rapidly
scaled from the currently available 3000 to 10,000 genomes with the advancement
of low cost third-generation sequencing techniques. This book on rice emphasizes
on the quarters of rice science that are predominantly applicable to crack the fore-
most limitations on rice production. It would bring out the advances in rice research
in the fields of physiology, molecular breeding, and genetics, especially with a focus
on increasing productivity, improving biotic and abiotic stress tolerance, and nutri-
tional quality of rice.
Advances in Genetics and Breeding
of Rice: An Overview
E. A. Siddiq and Lakshminarayana R. Vemireddy
Abstract Rice (Oryza sativa L.) is life for more than half of the human population
on Earth. In the history of rice breeding, two major yield breakthroughs or leaps
occurred, which phenomenally revolutionized rice breeding: the Green Revolution
in the 1960s and hybrid technology in the 1970s. However, the fruits of these tech-
nologies have not spread globally to all rice-growing areas, especially African coun-
tries, for diverse reasons. It is estimated that at least 50% more rice yield is needed
to feed the anticipated nine billion people by 2050. This clearly warrants another
breakthrough in rice. It is apparent that the currently used conventional and molecu-
lar marker-assisted methods need to be updated with multi-pronged approaches
involving innovative cutting-edge technologies for achieving the next breakthrough
in rice. Here, we attempt to discuss the exciting avenues for the next advances in
rice breeding by exploiting cutting-edge technologies.
Keywords Rice · Green revolution · Hybrid rice · Multi-pronged approaches ·

Gene editing
1 Introduction
Rice is the source for more than 20% of the total calorie intake for more than half of
the world population. More than 90% of it is produced and consumed in Asia.
Chronically food-deficit Asia became self-sufficient in this crop by the early 1980s
following the introduction and extensive adoption of high-yielding varieties with
dwarf plant type starting in the mid-1960s. To sustain this self-sufficiency, it is esti-
mated that the global rice requirement by 2050 will be 70% more than what is pro-
duced now (Fig. 1). Meeting such a huge demand projection sustainably in the face
E. A. Siddiq
Institute of Biotechnology, Professor Jayashankar Telangana State Agricultural University,
Hyderabad, India
L. R. Vemireddy (*)
Department of Genetics and Plant Breeding, SV Agricultural College, Acharya NG Ranga
Agricultural University (ANGRAU), Tirupati, Andhra Pradesh, India
© The Author(s) 2021 1

J. Ali, S. H. Wani (eds.), Rice Improvement,
https://doi.org/10.1007/978-3-030-66530-2_1
2 E. A. Siddiq and L. R. Vemireddy
9
8 Next breakthrough ???
7
6
Yield (t/ha)
5
4
3
2
1
0
1970 1980 1990 2000 2010 2020 2030 2040 2050
Years
Fig. 1 Rice yield trends and demand projections toward 2050
of the shrinking favorable growth of the 1970s and 1980s, especially for natural
resources such as arable land, irrigation water, and genetic resources, is the most
challenging task ahead. This situation warrants the discovery of novel gene sources
and innovative breeding-selection strategies to develop varieties that would enable
the world to meet this challenge.
Systematic breeding for the improvement of Asian rice (Oryza sativa L.),
although begun more than a century ago, has been witnessing rapid advances for the
past 60 years, with landmark achievements in both applied and mission-oriented
basic research. In keeping with the objective of this publication, “Molecular and
physiological breeding strategies toward sustained self-sufficiency in rice,” this
introductory chapter offers an overview of the significant achievements made dur-
ing this period.
2 First Breakthrough: The Green Revolution
Raising the ceiling for genetic yield had been the major breeding objective until the
1950s, when Chinese breeders succeeded with the first-ever dwarf variety, Guang-
Chang-Ai, using the spontaneous dwarf mutant Ai-zi-zhan (Huang 2001), followed
by Taichung (Native)-1 in Taiwan using yet another spontaneous dwarf mutant,
Dee-Gee-Woo-Gen. Impressed with its yield performance and period-bound matu-
rity, the International Rice Research Institute (IRRI), using the same dwarfing gene
source in a cross with tropical japonica variety Peta, developed the miracle yielder,
IR8, by the mid-1960s. The extensive adoption of this variety and its derivatives
heralded Asia’s Green Revolution. Dwarf stature, inherited as a simple recessive
trait, together with a set of favorable physiological traits such as increased leaf area
Advances in Genetics and Breeding of Rice: An Overview 3
index (LA1), photo-insensitivity, higher harvest index, and higher fertilizer respon-
siveness, enabled rice breeders worldwide to develop hundreds of “IR8 plant type”
varieties combining the desired maturity range and grain quality. Thus, the DGWG
dwarfing gene (sd1) provides short stature in more than 90% of the high-yielding
dwarf varieties being planted globally in the past 50 years. The dwarf varieties
developed for the relatively risk-free irrigated ecosystem are not adapted to rainfed
upland and lowland ecosystems, which account for more than 45% of global rice
area (Mackill et al. 1996). Efforts to raise the genetic yield of temperate japonica
and African rice varieties through the same plant type strategy employing the
DGWG dwarfing gene, however, did not succeed except for limited success achieved
through variety Tongil in South Korea. Understanding that germplasm of indica
origin would not be of help to achieve the plant type goal, the United States and
Japan used dwarfing gene sources of spontaneous and induced origin identified in
the respective germplasm. Designated as sd2 and sd3, and found to be non-allelic to
sd1 of DGWG, they have been extensively employed in breeding for higher genetic
yield in American and Japanese varieties.
3 Second Breakthrough: Hybrid Rice Technology
Ever since the first yield breakthrough achieved through dwarf plant type varieties,
keeping in view the need to meet huge future demand projections, especially under
limited scope for horizontal growth, breeders have been looking for strategies that
would enable them to make a second yield breakthrough. The search took place amid
reservations that the chances of finding one such strategy would be difficult as the
physiological limit for genetic yield in terms of sink-source equilibrium had already
been reached through dwarf varieties. However, this notion was soon proved wrong
when Chinese breeders succeeded in the commercial exploitation of hybrid vigor in
self-pollinated rice in the late 1970s. Of the more than 20 different cytoplasmic male
sterility (CMS) sources, researchers discovered only Wild Abortive (WA), suiting
indica rice, and Boro Tai (BT) in japonica rice, which are widely used for commer-
cial hybrid seed production (Li and Yuan 2000; Fuji and Toriyama 2009). More than
90% of the hybrids cultivated in China are based on WA cytosterility (Sattari et al.
2007). The yield advantage of about 15% over the best high-yielding dwarf varieties
marked the second major yield breakthrough. The adoption of hybrid technology
exceeding 18 million ha in a short period of 10–12 years enabled China to add
20 million tons annually to its rice production. Sadly, this proven technology could
not be replicated sufficiently in countries outside China. Among the reasons for the
slow adoption of the technology, the still unsatisfactory yield advantage, inconsistent
yield performance, less acceptable grain quality, and non-suitability of many variet-
ies for the long wet season in countries such as India and Bangladesh are important.
Given the recent successes achieved in parental line improvement, some of these
deficiencies could be rectified in future hybrids and thereby the pace of adoption of
the technology is expected to increase in the coming years.
With the less attractive yield advantage being one of the major limitations against
hybrid rice, various breeding strategies have been attempted across countries to
raise yield vigor. Among them, the shift from excessively depending on intra-
subspecific combinations (indica/indica or japonica/japonica) to inter-subspecific
(indica/tropical japonica or indica/japonica) combinations has been rewarding.
The persistent sterility characteristic in indica/japonica hybrids has been overcome
following the discovery and use of sterility neutralizing wide compatibility gene
(WCG) loci. Using an early discovered WCG such as Sn5 obtained from traditional
varieties such as Dular, Keta Nanga, and others, many indica-japonica hybrids
(Liangyou Pei9, Xieyou 9308, etc.) with yield surpassing that of intra-subspecific
hybrids have been developed. Success achieved in overcoming the sterility problem
in inter-subspecific hybrids through the use of WCG loci prompted rice geneticists
to search for more such genes, leading to the discovery of as many as 50 loci for
hybrid fertility. Of these, some were identified in inter-subspecific crosses of
O. sativa while others were found in crosses between O. sativa and other species of
the genus Oryza (Ouyang et al. 2009). Among the loci causing female sterility in
inter-subspecific hybrids, S5 is a major locus (Song et al. 2005). The locus with
three alleles—indica allele S5-i, japonica allele S5-j, and neutral allele S5-n—has
been mapped on chromosome 6 (Yanagihara et al. 1995). The tightly linked flanking
markers of the S5 gene, RM253 and RM276, have been found quite valuable in
developing appropriate parents for producing sterility-free inter-subspecific hybrids
(Singh et al. 2006; Siddiq and Singh 2005). Pyramiding of S5-n and f5-n genes was
also demonstrated to cumulatively improve percentage seed-setting in indica-
japonica hybrids (Mi et al. 2016). Priyadarshi et al. (2017) successfully introgressed
a major gene for wide compatibility (S5n) into the maintainer line IR58025B through
marker-assisted breeding.
Yet another development toward strengthening hybrid rice technology has been
hybrid seed production by environment-sensitive genic male sterility (EGMS) using
a two-line approach as an alternative to conventional cytoplasmic male sterility
using three-line breeding. This was possible following the discovery of photoperiod-
sensitive male sterility (PGMS) gene sources such as NK58s, PMS1, PMS3, and
TMS5, and their non-sensitive gene sources such as Annong IS, Norin12, SA2, and
F61 (Siddiq and Ali 1999; Ali 1993; Ali et al. 1995). Dispensing with the need for a
male sterility maintainer line, the EGMS system enables the use of a large number
of varieties as male parents and thereby increases the probability of identifying
more heterotic hybrids. Finding the two-line breeding strategy more efficient and
economical in the past three decades, many EGMS system–based two-line hybrids
with higher yield, improved grain quality, and resistance to major biotic stresses
have been released for commercial planting in China. Now, approximately three mil-
lion ha are planted to two-line hybrids in China. It is a good sign that interest is
growing for the two-line approach in countries such as Vietnam and in multinational
seed companies such as RiceTec Inc. Many of the TGMS lines, including SA2 and
F61 identified in India, have been linked with robust microsatellite markers enabling
the rapid development of inter-subspecific hybrids (Reddy et al. 2000; Hussain
et al. 2011).
4 Next Breakthrough: Strategies
After the grand success of the first and second breakthroughs, in the form of semi-
dwarf varieties and hybrid technology, the yield levels of rice have almost reached
stagnation. However, the basic understanding of trait inheritance has been enhanced
tremendously with the advances in cutting-edge molecular technologies. The next
breakthrough requires a multipronged approach involving diverse disciplines and
methods (Fig. 2). The following are some of the concepts or pilot studies that have
potential to achieve the next breakthrough in rice yield improvement.
4.1 Enrichment of the Rice Gene Pool
The most important prerequisite for progressive crop improvement is the availabil-
ity of genetic variability. Most crop plants are endowed with rich variability and rice
is no exception. Wild/weedy species, landraces, modern cultivars, induced mutants,
etc. constitute the major source of variability. Despite such rich diversity, more than
80% of current rice cultivars owe their making to a few parental lines. Strong sexual
barriers make it difficult to introgress genes of interest from distant relatives and the
possibility of introducing undesirable traits into cultivars via linkage drag dissuaded
breeders all along from resorting to the strategy of wide hybridization. As a result,
85–90% of the variability remains unused in landraces and wild/weedy relatives.
Given the rising need for additional/novel variability to meet the unfolding chal-
lenges, strategies to bring out the hidden genes in distant rice gene pools and induce
variation are inevitable. Whereas association mapping, sequence-based mapping,
etc. have been found rewarding in bringing out still undiscovered variability lying in
the natural gene pool, induced (CRISPR) and inserted (activation tagging) muta-
gens could help generate novel variability (Wei et al. 2013).
4.2 iscovery and Stacking of Yield Genes Hidden in Wild/

D
Weedy Species
Wild-weedy gene pools are rich reservoirs of gene sources for breeders looking to
progressively improve crop plants and rice is no exception. Aside from finding and
using several Mendelian genes largely governing resistance to biotic stresses, the
search for genes/QTLs governing polygenically controlled yield and its major com-
ponents began on the assumption that many of these genes/QTLs might not have
been captured in modern varieties during the course of evolution of rice and they
could still remain in the wild gene pool (Xiao et al. 1996). If they could be identified
by QTL mapping and the harmonious ones stacked in the current high-yielding
varieties by marker-assisted breeding, genetic yield could be further increased. This
First breakthrough 6
Introduction of semidwarf varieties
Green Revolution
Second breakthrough
Hybrid rice technology
Strategies Cutting-edge tools

Enrichment of the NGS-based QTL mapping
gene pool
Marker-assisted breeding
Exploitation of
wild species/Landraces
Genomic selection
Designing of Next
plant architecture breakthrough
Genome editing
Exploring
alternate dwarf genes
SNP Chips
Engineering
starch biosynthesis
High throughput
Enhancing the phenotyping
photosynthesis
E. A. Siddiq and L. R. Vemireddy
Fig. 2 Strategies and cutting-edge tools to achieve the next breakthrough in rice yield enhancement
followed the successful mapping and validation of two yield QTLs, yld 1.1 and yld
2.1, in O. rufipogan by the marker-associated QTL approach by Cornell University,
USA (Xiao et al. 1996). Worldwide interest was aroused among rice geneticists to
search for more and more yield genes/QTLs in wild/weedy relatives and primitive
cultivars, resulting in the identification of many promising yield QTLs in O. rufipo-
gan, O. nivara, and landraces (Marri et al. 2005; Kaladhar et al. 2008; Swamy and
Sarla 2008; Sudhakar et al. 2012; Swamy et al. 2011, 2012, 2014). This pioneering
work culminated in the development of higher-yielding varieties such as Jefferson
using yld2.1 from O. rufipogan (Imai et al. 2013), DRR Dhan 40 involving yield
genes/QTLs derived from O. nivara (Haritha et al. 2017), and the high-yielding
salinity-tolerant IET21943 based on a yield QTL from O. rufipogon (Ganeshan
et al. 2016) (Table 1).
4.3 Designing of Plant Architecture or Ideotype Breeding
On the strength of findings from simulation modeling, IRRI physiologists believed

that the potential yield of 10 t/ha achieved through dwarf varieties could be further
increased by 25% (Dingkuhn et al. 1991) through enhancement of biomass/unit
area without altering the harvest index (≈45%). This prompted IRRI breeders to
conceptualize and tailor a morpho-physiologically more efficient new plant type
(NPT) suited to high-density planting. Characterized by less profuse tillering habit,
long and upright top leaves, heavy panicles, and robust and active root system, the
Table 1 List of wild species/landraces used for trait enhancement in rice

Donor species Recipient species Trait transferred Reference
Oryza rufipogon Oryza sativa Yield Xiao et al. (1996)
O. glumaepetula O. sativa Yield Brondani et al. (2002)
O. grandiglumis O. sativa Yield Ahn et al. (2003)
O. rufipogon O. sativa Yield Liang et al. (2004)
Landrace (FR13A) O. sativa (Swarna) Submergence tolerance Xu et al. (2006)
O. nivara O. sativa (Swarna) Yield and contributing Swamy and Sarla
(IRGC81848) traits (2008)
O. nivara (KDML O. sativa BPH resistance (Bph3) Jairin et al. (2010)
105) (Rathuheenathi)
Landrace (Basmati O. sativa Fragrance and amylase Yi et al. (2009)
370) (Manawthukha) content
O. rufipogon (IRGC O. sativa Blast resistance Hirabayashi and Sato
104814) (Koshihikari) (2010)
Landrace (FL 478) O. sativa (AS 996) Salt tolerance Luu et al. (2012)
O. rufipogon (Coll-4) O. sativa (B 29-6) Blast resistance (Pi9) Ram and Majumder
(2007)
Landrace (Tetep) O. sativa (PRR78) Blast resistance (Pi54) Singh et al. (2012)
O. meridionalis O. sativa Blast resistance (Pi-cd) Fujino et al. (2019)
NPT lines developed at IRRI have been reported to yield 11–12 t/ha vis-à-vis
13–14 t/ha reportedly achieved by Chinese breeders in indica/tropical japonica
hybrids in the further improved NPT background (Yuan and Fu 1995).
4.4 Designing of Shoot and Panicle Architecture
Evidence suggests that, by altering shoot and panicle architecture, genetic yield can
be substantially increased. Shoot architecture includes traits that affect plant height
and leaf length, width, and thickness, whereas panicle architecture involves traits
that affect panicle number, panicle length, number of grains per panicle, and grain
weight. With precise information available on the mapping positions of QTLs and
access to many cloned genes for the key traits, it is now possible to design the archi-
tecture of the rice plant by pyramiding appropriate QTLs/genes. The genes that
control grain number (Gn1a, Ghd7, DEP1, and WFP), grain weight (GS3 and
GW2), grain filling (GIF1), grain size (GS3 and GW5), and panicle number (DEP1
and WFP) are fortunately located on different chromosomes, which would enable
combining favorable genes/QTLs easily into elite varietal backgrounds.
Earlier, many researchers showed that pyramiding of multiple yield-related
genes enhanced yield significantly. Ashikari et al. (2005) were successful in increas-
ing grain number by 45% and decreasing plant height by 20% by combining the
grain number QTL (Gn1a) and the semi-dwarfing gene (sd1) by a pyramiding strat-
egy. Later, Ando et al. (2008) reported that a pyramided near-isogenic line (NIL)
containing two QTLs (qSBN1 for secondary branch number on chromosome 1 and
qPBN6 for primary branch number on chromosome 6) developed by introgressing a
QTL from Habataki (indica) into Sasanishiki (japonica) produced more spikelets
than the independent NIL harboring the QTLs qSBN1 and qPBN6. Further, this
pyramided line (qSBN1 + qPBN6) showed 4–12% higher yield than the recurrent
parent Sasanishiki because of greater translocation of carbohydrates from stem to
panicle (Ohsumi et al. 2011). Wang et al. (2012a, b) also demonstrated that the pyra-
mid line (qHD8 + GS3) had higher yield potential, longer grains, and more suitable
heading date than the recipient parent, Zhenshan97.
In addition to gene pyramiding with the aid of marker technology, some success-
ful attempts have been made to increase yield through genetic engineering of plant
architecture traits. One such effort employed light-regulated overexpression of the
Arabidopsis phytochrome A gene by Cornell University (Garg et al. 2006).
Phytochromes are a family of red/far red light-absorbing photoreceptors, which
control plant development and plant metabolic activities. The group demonstrated
that, by splicing the Arabidopsis PHY A gene into rice by employing light-regulated
tissue-specific rbc promoter, plant stature could be altered by further decreasing the
height of the already semi-dwarf variety and simultaneously increasing the number
of productive tillers, resulting in significantly higher yield than for the control vari-
ety. In another study, Wang et al. (2015) reported that transgenic rice plants express-
ing the Arabidopsis phloem-specific sucrose transporter (AtSUC2), which loads
sucrose into the phloem under control of phloem protein2 promoter (pPP2), showed
16% higher grain yield than the wild type in field trials. Park et al. (2017) demon-
strated overexpression of the gene OsGS to improve redox homeostasis by enhanc-
ing the glutathione pool, which resulted in greater tolerance of environmental
stresses in addition to higher grain yield and total biomass.
4.5 Modification of Root Architecture
Genetic improvement of the root system is important for developing tailor-made

varieties tolerant of abiotic stresses. A deeper, thicker, and more branched root sys-
tem with high root to shoot ratio is usually preferred for plants to withstand drought
stress. Although drought tolerance has been extensively investigated for the past few
decades, an in-depth study to understand its genetics and breeding behavior has
hardly been attempted because of its complex nature and the tedious work involved
in phenotyping of the root system. However, it is known that rice germplasm is rich
in variability for root traits and that the root system and related traits are governed
by many genes with small effects, often regarded as QTLs. Now, more than 600
QTLs have been identified for various root-related traits (www.gramene.org). Of the
162 functionally characterized root-related genes, most are annotated as being
related to transport and transcriptional or hormonal regulation. The vast majority
(98%) of these genes have been identified through reverse-genetic approaches and,
of these, only three (PSTOL1, DRO1, and Bet1) identified based on natural allelic
variation affecting phenotype. Despite such a large number of QTLs available, only
two related to nutrient uptake, PSTOL1 at the Pup1 locus (Chin et al. 2010) and the
root length QTL qRL6.1 that governs nitrate uptake from deeper soil layers (Obara
et al. 2010), have been used.
The recent development of several non-invasive 2D and 3D root imaging systems
has enhanced our ability to accurately observe and quantify architectural traits in
complex whole-root systems. Coupled with the powerful marker-based genotyping
and sequencing platforms currently available, root phenotyping technologies lend
themselves to large-scale genome-wide association studies, and can speed up the
identification and characterization of the genes and pathways involved in root sys-
tem development.
4.6 Green Super Rice for Sustainable Performance
As a massive breeding effort placing emphasis on developing ecologically and eco-

nomically sustainable varieties in high-yield backgrounds for resource-poor rice
farmers in Asia and Africa, the Green Super Rice (GSR) Project was launched
jointly by the Bill & Melinda Gates Foundation, Chinese Academy of Agricultural
Sciences, and IRRI. The breeding strategy consists of developing advanced
backcross populations involving selected popular high-yielding varieties (40–50)

chosen from major rice-growing countries as recurrent parents and around 500 vari-
eties with traits of unique adaptive value as donors. Advanced backcross genera-
tions (BC2F2) are then screened under targeted stress conditions for transgressive
segregants exceeding the respective parents and local checks in their trait perfor-
mance. This is followed by pyramiding of complex trait-specific non-allelic QTLs
of promise derived from different donor sources into country-specific popular vari-
eties such as IR64, BR11, BG300, and Huang-Hua-Zhan. The recovery of promis-
ing lines in large numbers is attributed to the harmonious complementation of
genetic networks for complex traits, which otherwise are incomplete in both parents
(Ali et al. 2012). While the breeding emphasis of the GSR strategy is for developing
eco-friendly/farmer-friendly varieties/hybrids, the massive exercise is bound to pro-
duce as well super-yielding varieties/hybrids.
4.7 Physiological Breeding Approaches
Exploring Alternative Sources of Dwarfing Genes Given the experience with

maize (corn) in the United States, that genetic uniformity for even one gene would
make any crop plant vulnerable to a sudden outbreak of any pest, rice breeders have
been apprehensive of such an eventuality due to the widespread and excessive use
of the dwarfing gene sd1 in rice breeding, thus warranting diversification of the
dwarfing gene. In rice, as many as 192 dwarfing genes are known. They include
both dominant/semi-dominant and recessive inheritance: D53, Ssi1, Sdd(t), Dx,
TID1, LB4D, Slr-f, D-h, d13, Sdt97, etc. (http://shigen.nig.ac.jp/rice/oryzabase).
Dwarf mutants characterized at the molecular level have been found for their short
stature as a result of defective signal transduction molecules such as heterotrimeric-
G protein (Ueguchi-Tanaka et al. 2000), homeobox-like OSH15 (Sato et al. 1999),
brassinosteroids (Yamamuro et al. 2000), and various GA biosynthesis genes
(Sasaki et al. 2002; Itoh et al. 2004).
The sd1 gene-based modern semi-dwarf varieties, aside from being short in stat-
ure, are associated with some pleiotropic effect on other traits that reportedly include
decreased spikelet number and grain weight (Murai et al. 2002), decreased root length
(Lafitte et al. 2007), and poor response to applied nutrients (Zhang et al. 2013). Yet
other research underway is looking for a novel allele of sd1 that would be devoid of
such negative effects on yield components and thereby help develop a dwarf plant
type variety with still higher potential yield. Differing from the traditional tall-statured
native varieties, wherein the GA pathway remains intact vis-à-vis the modern semi-
dwarf varieties, wherein the GA pathway has been suppressed (GA-repressed), an
allele of sd1 or some other height-reducing genetic mechanism that would affect the
GA pathway (GA-independent) might help to find a new yield threshold. A novel and
valuable dwarfing gene, asd-1 (alternate semi-dwarf gene), was identified on chromo-
some 1 employing a QTL-seq approach (Gopalakrishna et al. 2017).
Engineering of Starch Biosynthesis The first yield breakthrough achieved in

semi-dwarf rice took place through partitioning of photosynthate in favor of grains
while the second occurred through an NPT variety that enabled an increase in bio-
mass by manipulating crop geometry but not by enhanced photosynthesis. Recent
findings reveal the possibilities of redirecting biosynthetic pathways through recom-
binant DNA technology enabling plants to produce more or altered quality of natu-
ral products such as starch, protein, and lipids. It is now possible to manipulate
source-sink equilibrium either by overexpression of endogenous or heterologous
enzymes or by down-regulation of endogenous enzymes by using gene silencing
techniques.
Manipulation of ADP glucose pyrophosphorylase (ADPGPPase), the key rate-
limiting allostearic enzyme in the biosynthetic pathway of starch, for instance, is
regarded as a potential strategy to improve yield and starch quality in cereal crops.
This enzyme catalyzes glucosyl phosphate into ADP glucose, which is the precursor
of starch. Down-regulation of the gene encoding the enzyme by an antisense RNA
approach resulting in a drastic decrease in its activity as well as starch accumulation
was the first report to establish the crucial role of the enzyme in starch biosynthesis
(Lin et al. 1988). The observed increase in starch yield due to antisense inhibition of
resident ADPGPPase proved the key regulatory function of the enzyme. Following
this report, many researchers explored the possibility of raising yield in other crops
by manipulating the enzyme. Believing that natural variability in sink components
would be a reflection of the varied behavior of the enzyme, an effort was made to
study the extent of variability in the nature of the enzyme in rice. The findings
revealed enzyme activity (total and specific), its response to effectors (activator
3PGA and inhibitor Pi), gene expression (transcription), and starch synthesis (total
and rate of accumulation) to vary with the genotype and stage of development of the
endosperm. Overall evaluation suggests that the highest yielding varieties and
highly heterotic hybrids are the most promising in nearly all respects of the enzyme
behavior (Devi et al. 2010). More intensive further study of wild/weedy species and
ecotypes from different rice ecosystems might result in valuable sources for effi-
cient ADPGPPase for exploitation by even conventional recombination breeding.
Enhancement of Photosynthesis Enhancement of photosynthetic efficiency could
be one of the potential means for raising the yield ceiling in rice. In C3 rice, CO2 is
assimilated into a 3-carbon compound by the enzyme ribulose-1,5-bisphosphate
carboxylase/oxygenase (Rubisco). This enzyme also catalyzes oxidation of RuBP
in a wasteful process known as photorespiration, which results in a loss of as much
as 25% of the previously fixed carbon. At temperatures above 30 °C, which are typi-
cal of tropical rice-growing areas, the rate of oxygenation increases substantially
and this considerably decreases the photosynthetic efficiency of C3 plants by up to
40% (Ehleringer and Monson 1993). On the contrary, C4 plants have very much
decreased rates of photorespiration and thus are adapted to thrive in hot and dry
environments; this offers valuable insights for yield improvement strategies. Rice
with a C4 photosynthesis mechanism would have increased photosynthetic effi-
ciency while using scarce resources such as land, water, and fertilizer (specifically
nitrogen) more effectively (Hibberd et al. 2008). As it would perform well under
high temperature and require less water and nitrogen, C4 rice would benefit varied
rice ecosystems, including marginal lands. Engineering the photosynthetic pathway
of C3 rice into a C4 plant is quite a challenging and time-consuming task. The main
challenge of converting the photosynthetic pathway of a C3 plant into that of a C4
plant lies in decreasing photorespiration and modifying the leaf canopy (anatomy).
IRRI, through an ambitious collaborative project (International C4 Rice Consortium)
involving advanced countries/laboratories, is engaged in converting C3 rice into a C4
plant by introducing appropriate genes from maize and other C4 plant species. The
C4 pathway genes such as CA (carbonic anhydrase), PEPC (phosphoenolpyruvate
carboxylase), PPDK (PEP carboxykinase), NADP-ME (NADP-dependent malic
enzyme), and NADP-MDH (NAD-dependent malate dehydrogenase) cloned from
maize are being engineered into rice. Also, the transporters that were overexpressed
in the C4 metabolic pathway such as 2-oxoglutarate/malate transporter (OMT1),
dicarboxylate transporter1 (DiT1), dicarboxylate transporter2 (DiT2), PEP/phos-
phate transporter (PPT1), mesophyll envelope protein (MEP), and triose-phosphate
phosphate translocator (TPT) and that were identified through proteomics of maize
bundle sheath and mesophyll cells (Friso et al. 2010) were transformed into rice.
Models show that increased water and nitrogen use efficiencies from this engineer-
ing effort could result in yield increases of 30% to 50% (Karki et al. 2013). Wang
et al. (2017a, b), in their theoretical analysis of biochemical and anatomical factors,
demonstrated that integrating a C4 metabolic pathway into rice leaves with a C3
metabolism and mesophyll structure may lead to increased photosynthesis under
current ambient CO2 concentration. Also, they concluded that the partitioning of
energy between C3 and C4 photosynthesis and the partitioning of Rubisco between
mesophyll and bundle sheath cells would be decisive factors controlling photosyn-
thetic efficiency in an engineered C3–C4 leaf.
In yet another attempt to enhance photosynthesis and thereby genetic yield,
Ambavaram et al. (2014) identified a master regulator, HYR (HIGHER YIELD
RICE), a transcription factor associated with photosynthetic carbon metabolism
(PCM). It directly activates the photosynthetic pathway genes and other down-
stream genes involved in PCM and yield stability under drought and high-
temperature environmental stress conditions. Haritha et al. (2017) reported wild
introgressions from O. rufipogon to increase the photosynthetic efficiency of KMR3
rice lines.
4.8 Defending Against Biophysical Stresses
Hardly any crop plant is challenged by diverse biotic and abiotic stresses as rice is.
The crop is vulnerable to more than one dozen pathogens and as many insect pests,
many of which exist in virulent/viruliferous races/biotypes. As for abiotic stresses,
diverse stressful water regimes in rainfed lowlands, moisture-deficit rainfed uplands,
coastal saline and inland sodic soils, temperature extremes, etc. constitute the major
stresses, covering 45% of the world’s rice area. Climate change is yet another threat
to agriculture in general and rice in particular.
Breeding for Resistance to Biotic Stresses Since the introduction of high-yielding
semi-dwarf varieties, diseases and insect pests have been increasingly causing
severe yield losses year after year. Among pathogens, blast, bacterial leaf blight,
sheath blight, and Rice Tungro Virus (RTV), and insect pests yellow stem borer,
brown planthopper, leaf folder, and gall midge are the most devastating. Management
of these pests has been largely through resistance breeding, taking advantage of
race-/biotype-specific resistance genes identified in the gene pool and the adoption
of rational gene deployment strategies. Frequent breakdown of resistance in multi-
racial/multi-biotype pests has made pest management all the more difficult and
challenging.
Breeding for Resistance against Diseases Rice blast caused by the fungus
Magnaporthe oryzae is the most widespread and devastating disease of rice. Existing
in as many as 30 races, it has been managed for many decades mainly by resistance
breeding using more than 100 resistance genes identified in the rice gene pool.
Nevertheless, the disease is still a challenge because of the frequent breakdown of
resistance warranting the need for varieties with broad-spectrum resistance.
Pyramiding of genes matching region-specific races was chosen as the strategy to
manage the problem and molecular marker technology has been found handy in this
effort. Following the pioneering attempts to introgress resistance genes (Pi1, Pi-5,
Piz, and Pita) by marker-assisted backcross breeding into varieties such as Co39
(Hittalmani et al. 2000), IR50 (Narayanan et al. 2002), and Zhenshan 97A (Liu et al.
2003), this strategy is being adopted globally to make varieties stable against the
disease.
Bacterial leaf blight (BLB), caused by Xanthomonas oryzae pv. oryzae (Xoo), is
the most serious disease worldwide and it causes yield losses up to 70%. Based on
analyses of phenotypic responses to Xoo races and molecular mapping results, 41
genes (29 dominant and 12 recessive) conferring resistance to the disease have been
registered in the Oryzabase database (www.shigen.nig.ac.jp/rice/oryzabase/gene/
list). Additionally, some R genes/alleles have been generated by mutation breeding.
They include nine isolated genes (Xa1, xa5, xa13, Xa21, Xa23, xa25, Xa26/Xa3,
Xa27, and xa41) and nine fine-mapped genes (Xa2, Xa4, Xa7, Xa22, Xa30, Xa33,
Xa38, Xa39, and Xa40) (www.shigen.nig.ac.jp/rice/oryzabase/gene/list). In addi-
tion to such Mendelian genes, QTLs for resistance have been reported. Many
pathotype-specific resistance genes linked to molecular markers have been success-
fully used for selective improvement of popular high-yielding quality rice varieties
such as BPT5204 (Samba Mahsuri) introgressed with Xa21, xa13, and xa5
(Sundaram et al. 2008) and Pusa Basmati-1 introgressed with Xa21 and xa13
(Joseph et al. 2004). The strategy of marker-assisted introgression of dominant
genes (Xa4, Xa7, and Xa21) against BLB has been extended as well to the parental
lines of popular hybrids (Borines et al. 2000; Zhang et al. 2006). Recently, Hajira
et al. (2016) developed a single-tube, functional marker-based multiplex PCR assay
for simultaneous detection of the major BLB resistance genes Xa21, xa13, and xa5
in rice. Pyramiding diverse resistance genes against any disease is considered a

promising strategy for ensuring broad-spectrum resistance and slowing down the
breakdown of resistance. As for the choice of gene sources, many of those accessed
from wild/weedy germplasm appear to be of multi-racial/multi-pathotype resis-
tance. For instance, Xa21, which provides resistance to as many as 30 pathotypes
and shows synergism with country-/region-specific critical resistance genes, is from
O. longistaminata, an African A-genome species, while Xa30 and Xa31, offering
resistance to many pathotypes, are from O. nivara, and Xa34 is from O. rufipogon.
Better understanding of the molecular mechanisms underlying bacterial pathogen-
esis that has revealed the role of several factors facilitating infection and progres-
sion of the disease might pave the way in the near future to the development of an
effective and environmentally safe strategy to manage BLB.
Rice Tungro Virus (RTV), the most dreaded disease induced by mixed infection
of Rice Tungro Bacilliform Virus (RTBV) and Rice Tungro Spherical Virus (RTSV),
is transmitted by green leafhopper. Screening of a large number of rice germplasm
accessions reveals many traditional varieties to be resistant to RTSV and only a few
to RTBV (Shim et al. 2015). RTSV resistance is a recessive trait controlled by a
translation initiation factor4 gamma (eIF4G) located on chromosome 7 (Lee et al.
2010). A few years ago, an RTSV resistance gene was transferred to japonica rice
by marker-assisted selection (Shim et al. 2015). Initially, the disease was managed
by host-plant resistance breeding using a few accessions as donors. Recent studies
show that the RNA interference (RNAi) technique would be more effective and
could be used to develop virus-resistant transgenic rice. Le et al. (2015) generated
transgenics capable of producing small interfering RNA specific against RTSV
sequences. In order to develop transgene-based resistance against RTBV, Valarmathi
et al. (2016) used the ORF IV gene by RNA-interference in rice variety Pusa
Basmati-1, and the transgene was subsequently introgressed into ASD 16, a variety
popular in southern India, by marker-assisted breeding.
Against sheath blight (ShB), which was once a minor disease but is now a major
one, no source of resistance has as yet been found. However, as many as 50 QTLs
with moderate resistance have been mapped. Several studies have reported candi-
date genes for resistance such as chitinase, glucanase, glutathione S-transferase, and
kinase protein to be within the mapped QTL region (Yadav et al. 2015). Although
most of the sheath blight resistance QTLs identified so far are of only limited effect
on ShB, reports showing an expected level of resistance were not uncommon. For
instance, Zuo et al. (2007) reported introgression of the QTL qSB-11LE to decrease
grain loss by 10.71% in the background of variety Lemont under severe disease
conditions in field trials. Pinson et al. (2005) predicted qSB-9TQ and qSB-3TQ to
decrease crop loss due to the disease by 15% when introduced into the same variety.
Wang et al. (2012a, b) found pyramiding of diverse sheath blight resistance QTLs
such as qSB9-2 and qSB12-1 to increase resistance. Interestingly, Zuo et al. (2014)
reported that pyramiding of the QTLs qSB-9TQ and TAC1TQ, governing stem borer
resistance and tiller angle (TA), respectively, improved resistance to ShB. Thus, in
the absence of R genes, pyramiding of ShB moderate resistance QTLs and of other
QTLs governing unrelated traits/stresses could be worth attempting as an alternative
strategy to manage the disease, as reported by Zuo et al. (2014). In addition to such
host resistance-based strategies, a transgenic approach through inhibition of chitin

metabolism in fungi such as Rhizoctonia solani, by expression of rice chitinase,
could be a strategy for controlling the disease. Karmakar et al. (2017) demonstrated
that transgenics overexpressed with constructs pyramided with two genes, OsCHI11
(chitinase gene) and AtNPR1 (Arabidopsis NPR1), were superior to a single-gene
cassette in enhancing sheath blight tolerance.
Breeding for Resistance against Insect Pests Rice hosts more than one dozen
insect pests, of which stem borer, brown planthopper, white backed planthopper,
leaf folder, and gall midge cause serious yield losses. The host-plant resistance
available in abundance against all the major insect pests and their biotypes with the
exception of stem borer and leaf folder has enabled breeders to manage them so far
by sequentially releasing resistant varieties matching newly emerging biotypes.
Nevertheless, the emergence of newer and increasingly viruliferous biotypes requir-
ing matching resistance gene sources, occurrence of more than one pest/biotype in
any given region, and still no way to find resistance gene sources against yellow
stem borer and leaf folder have made insect pest management a challenging task.
Given the limitations of the conventional breeding-selection approaches, more
rational gene deployment such as molecular marker-aided resistance gene pyramid-
ing and introgression of novel alien genes by recombinant DNA technology are now
employed/contemplated for effective management of insect pest problems. Many of
the insect pest-/biotype-specific resistance genes have been mapped and linked to
closely placed markers. For engineering resistance, many different insecticidal pro-
teins and molecules known to be highly selective in their action against a given pest,
causing no harm to non-target organisms, are being experimented with. Among the
widely used genes encoding insecticidal proteins/molecules against rice insect
pests, endotoxin crystal proteins of Bacillus thuringiensis, digestive enzyme-
specific protease inhibitors, plant lectins, α amylase inhibitors, insect chitinases,
and insecticidal viruses are important. Of these, Bt toxin genes (cry IA, cry IB, cry
IC, etc.) and protease inhibitors (cowpea serine P1) against stem borer and lectin
protein gene (gna, asa lectin) against hoppers have been reported to be effective.
Advances made in managing various insect pests are presented hereunder.
Yellow stem borer (Scirpophaga incertulas) (Walker) is the most important
insect pest globally in rice-producing areas. As there are no strong host-resis-
tance gene sources against it, genetic engineering approaches have been attempted
and found promising. Datta et al. (1996) and Nayak et al. (1997) were the first to
report transformation of rice with the Bt gene against yellow stem borer. Since
then, several workers have successfully engineered rice with different Bt genes
(cry IA(b), cry IA(c), and cry IAb) alone as well as in fusion forms against the
pest. Liu et al. (2016) pyramided two foreign genes, cry1Ac driven by rice Actin
I promoter and lysine-rich protein (LRP) driven by endosperm-specific
GLUTELIN1 (GT1) promoter, into elite indica cultivar 9311. In the pyramided
line, cry1Ac has been found to efficiently express in leaves and stems against
striped stem borer (Chilo suppressalis Walker) under laboratory conditions and
against rice leaf folder (Cnaphalocrocis medinalis Guenee) under field
conditions. Despite such success stories elsewhere, including in China, Spain,

Pakistan, etc., Bt rice is yet to be deregulated for commercial planting.
Brown planthopper (BPH), Nilaparvata lugens Stål, has been a threat to rice
production in Asia since the advent of high-yielding varieties. Experience with its
management shows host-plant resistance to be the most efficient and sustainable
strategy. As of now, 31 BPH resistance genes have been identified in cultivars and
wild species and all except bph5 and bph8 have been mapped to various chromo-
somes of rice. To date, 13 BPH resistance genes (Bph14, Bph3, Bph15, Bph26/2,
bph29, Bph18, Bph9/1/7/10/21, and Bph32) have been identified and characterized
via a map-based cloning approach (Jing et al. 2017). Many of the genes have been
introduced alone or in combination into modern rice varieties/parental lines of
hybrids by marker-assisted selection. Wang et al. (2017a, b) pyramided Bph6 and
Bph9 into elite restorer line 93-11, while Fan et al. (2017) developed three broad-
spectrum BPH-resistant restorer lines by pyramiding big-panicle gene Gn8.1, BPH
resistance genes Bph6 and Bph9, and fertility restorer genes Rf3, Rf4, Rf5, and Rf6
through molecular marker-assisted breeding.
Besides the gene pyramiding strategy to develop broad-spectrum hopper-resistant
varieties, genetic engineering approaches have been attempted. For instance,
Nagadhara et al. (2004) successfully engineered Chaitanya variety with gna lectin
protein and another variety with onion/garlic lectin (asa lectin) (Saha and Majumder
2006). To develop durable resistance against BPH, green leafhopper, and white-
backed planthopper, ASACI and GNA protein genes have been pyramided by cross-
ing single-gene-based transgenic lines. The lines developed so far have been found
to surpass in their level of resistance in all three hoppers vis-à-vis single-gene-based
transgenics (Rao et al. 1998).
Asian rice gall midge (GM) (Orseolia oryzae Wood-Mason) is a serious pest in
rice-growing countries, especially in China, India, and Sri Lanka. To date, 11 GM
resistance genes (Gm1, Gm2, gm3, Gm4, Gm5, Gm6, Gm7, Gm8, Gm9, Gm10, and
Gm11(t)) have been identified and characterized. As for their pyramiding to realize
broad-spectrum resistance against more than one biotype, Nair et al. (2011) demon-
strated that stacking of Gm1 with any one of the genes in group II, which exclude
Gm4 and Gm7, would confer resistance to five biotypes (GMB1, GMB2, GMB3,
GMB5, and GMB6). To cover all the biotypes, at least three genes, preferably Gm1,
Gm2, and Gm4, would be required.
Rice leaffolder (RLF) (Cnaphalocrocis medinalis Guenee) is another major
insect pest. Developing RLF-resistant lines in rice through conventional breeding
has been a challenge due to the non-availability of a host-plant resistance gene.
Alternatively, genetic engineering has been attempted by introducing heterologous
insecticidal genes. Manikandan et al. (2016) succeeded in developing transgenic
rice resistant to the pest with codon optimized synthetic cry2AX1 gene fused with a
rice chloroplast transit peptide sequence. In another report, Chakraborty et al.
(2016) demonstrated that transgenic rice expressing the cry2AX1 gene conferred
resistance to multiple lepidopteran pests, including RLF. Pradhan et al. (2016) also
reported transgenic rice expressing vegetative insecticidal protein (Vip) of Bacillus
thuringiensis to show broad insecticidal properties.
Breeding for Tolerance of Abiotic Stresses Among abiotic stresses that severely
depress productivity, drought, submergence, and salinity are important. The plant’s
ability to withstand such stresses results from the cumulative effects of a network of
physiological and biochemical functions. Negative effects of abiotic stresses include
broadly stress-imposed homeostasis imbalance, disruption of growth and metabolic
activities, and generation of cell-damaging reactive oxygen species (ROS). At the
molecular level, plants under abiotic stresses adapt to the conditions by triggering a
cascade of events that start with stress perception and end with the expression of a
battery of genes of adaptive response. Adaptation at the molecular level is through
restoration of homeostasis (ion and osmotic gradient), control of damage, and
detoxification of ROS. Knowledge of the genetics governing these stresses is a pre-
requisite for finding solutions to the problem. Unlike resistance to biotic stresses
that largely follows a Mendelian mode of inheritance, tolerance of abiotic stresses
is quite complex and polygenically controlled. Added to the inadequate knowledge
of genetics, a lack of reliable and reproducible screening/selection techniques has
made breeding all the more challenging, despite having sources of resistance in the
rice gene pool. As a result, more than 60% of the global rice area, especially in the
rainfed ecosystem does not have as yet high-yielding varieties ideally suited to this
harsh environment. For the past 15 years, advances in plant molecular biology have
provided breeders with a variety of genomic tools and resources capable of over-
coming the technological constraints that have been impeding progress in finding
genetic solutions to such stresses.
Of the estimated huge future rice demand, most production has to come from
rainfed lowland and upland rice ecosystems, where drought is the major yield con-
straint. Unlike the irrigated ecosystem, no truly high-yielding varieties are adapted
to drought stress. In drought-prone parts of the world, farmers have no option but to
grow traditional low-yielding but well-adapted varieties. All efforts to develop high-
yielding drought-tolerant varieties by using traditional drought-tolerant varieties as
donor sources proved a futile exercise. This is largely on account of the genetically
complex nature of drought tolerance and dependence on phenotype-based selection.
Major indices of tolerance QTLs now mapped and linked to robust markers have
made genotype-based selection and pyramiding of varieties with tolerance QTLs
easy and efficient.
Several QTLs relating to different parameters of drought tolerance such as
osmotic adjustment, cell membrane stability, relative water content, root character-
istics, and stress recovery as well as yield per se under stress have been mapped and
linked to robust markers. Among the traits that govern drought tolerance, the direct
measure of grain yield under drought rather than its component traits is promising.
As of now, a large number of QTLs governing grain yield under drought (DTY)
have been identified, such as qDTY12.1, qDTY3.1, qDTY6.1, qDTY2.2, and qDTY9.1.
The various combinations of these DTY QTLs resulted in an average yield advan-
tage of 300–500 kg/ha under stress conditions. For instance, the major-effect QTL
qDTY12.1 has been introgressed into Vandana and it has a yield advantage of about
500 kg/ha over its donor parent under reproductive-stage stress (Kumar et al. 2014).
Similar success has been achieved by introgressing the QTL qDTYs into drought-
susceptible mega-variety IR64 (Swamy and Kumar 2013). Two QTLs (qDTY3.2
and qDTY12.1) with large effects for grain yield under drought have been trans-
ferred into Sabitri, a popular variety of Nepal, through marker-assisted breeding
(Dixit et al. 2017). Many more QTLs have been identified for yield under drought
conditions and they are being transferred to the background of popular high-yielding
varieties such as Swarna, IR64, Vandana, Sabitri, TDK1, Anjali, Samba Mahsuri,
MRQ74, MR219, Jinmibyeo, Gayabyeo, Hanarumbyeo, and Sangnambatbyeo by
marker-assisted breeding at IRRI and other centers. Besides these DTY QTLs, Uga
et al. (2013) reported that the QTL Deeper Rooting 1 (DRO1) increased root growth
angle in rice, leading to higher yield under drought conditions.
Given the availability of many novel genes conferring high tolerance of the stress
along with efficient transformation-regeneration protocols in place, genetic engi-
neering for drought tolerance has been found to be a distinct possibility. Candidate
genes used with some success in rice are trehalose (tps) cloned from Arabidopsis,
trehalose-6-phosphate synthase, and trehalose-6-phosphate phosphatase (tps1) from
yeast, pyrroline carboxylate synthase (P5cb) from Vigna aconitifolia, chloroplast
glutamine synthetase (GS2) from rice, and choline oxidase (glycine-betaine synthe-
sis) (cod A) from Arthrobacter globiformis. Among the regulatory genes, DRE
binding protein (dreb1α), calcium-dependent protein kinase (OsCDPK7), and those
identified with cellular-level tolerance such as helicases (PDH45) and APZ/ERF
family DREB transcription factors are important (Saijo et al. 2000; Sahoo et al.
2012; Rashid et al. 2012).
Although many sources of tolerance of salt stress are available in native germ-
plasm such as SR26B, Nona Bokhra, and Pokkali, efforts to combine the desired
level of tolerance in high-yield backgrounds by conventional breeding yielded no
tangible results. Convinced of the potential of molecular marker-assisted breeding
and gene transfer technology, possibilities have been explored to find genetic solu-
tions to the problem. As no single QTL/gene could provide the desired level of tol-
erance, pyramiding of genes for tolerance-related morpho-physiological features
(Na and Cl exclusion, K uptake, N/K ratio, and tissue tolerance) and biochemical
pathways (glyoxalase, abscisic acid, proline, glycine-betaine, and polyamine) has
been employed. More than 80 salt-tolerance QTLs with large effects have been
mapped so far. Of these, Saltol mapped in Pokkali is a major one and it has already
been transferred to high-yielding varieties such as BR11, BRRI dhan28, IR64, and
AS996 (Babu et al. 2017).
The genetic engineering strategy is based on genes/enzymes involved in the
pathways of (a) osmosis homeostatic balance, wherein ion and osmatic gradient are
restored; (b) detoxification by scavenging of ROS; and (c) stress damage control
restoring growth and metabolic activities. Transgenics with relevant salt-tolerance
genes obtained from various sources have been reported to adapt well to and survive
in saline soils. Many important genes conferring salt tolerance belong to the salt
overly sensitive (SOS) pathway. Of the several candidate and regulatory genes over-
expressed in rice, calcium-dependent protein kinase (Os CDPK), a transcription
factor, choline oxidase (cod A) involved in glycine-betaine synthesis, chloroplast
glutamine synthetase (GS2), pyrroline carboxylate synthetase, etc. are some of the
successfully employed sources. Expression of two genes of the glyoxalase pathway,
glyI and glyII, preferably together, has been shown to confer tolerance of salinity
(Singla-Pareek et al. 2006). Overexpression of several stress-induced genes, includ-
ing helicases, has been shown to provide tolerance of the stress in rice. Sahoo et al.
(2012) have demonstrated pea DNA helicase 45 to promote salinity tolerance in
IR64 with higher yield.
Flash floods causing submergence are the major yield-depressing factor in rain-
fed shallow lowland rice. Depending on the growth stage and period under water,
crop damage could vary from 10 to 100%. Unlike traditional tall varieties such as
FR13A and FR43B, which are known to adapt to submergence, short-statured high-
yielding varieties suffer the most, even when the period of submergence is not even
a few days. Hence, farmers in the rainfed lowland ecosystem prefer traditional vari-
eties, not minding their low productivity. Despite years of effort to breed submer-
gence tolerance into high-yield backgrounds using FR13A-like donor sources, no
progress could be made. This was largely due to the lack of precise knowledge of
the genetics of submergence tolerance per se and of the morpho-physiological
parameters that govern it and the non-reliability of phenotype-based selection under
stress conditions. The major QTL identified in flood-tolerant landrace FR13A and
designated as Sub1, which explains 70% of the phenotypic variance, was mapped
onto chromosome 9. A joint international effort involving NRRI and NDUAT in
India, BRRI in Bangladesh, University of California-Davis in the United States, and
IRRI began for the characterization and use of the QTL in marker-assisted breeding
for developing submergence-tolerant varieties. Dissection of the QTL revealed it to
be a cluster of three genes encoding ethylene responsive factors designated as
Sub1A, Sub1B, and Sub1C. Of these, Sub1A was identified as the key gene confer-
ring tolerance of submergence. Two alleles of Sub1A, Sub1A-1 (tolerance specific)
and Sub1A-2 (intolerance specific) were identified with a single nucleotide poly-
morphism changing proline to serine (Septiningsih et al. 2009). Swarna selectively
introgressed with Sub1A was formally released for general cultivation as Swarna-
Sub1A in India (Odisha, Uttar Pradesh, etc.), Bangladesh, the Philippines, and
Indonesia. The Sub1A gene has also been deployed into Thai fragrant rice Khao
Dawk Mali 105 and rice restorer line Wanhui 6725 (Luo et al. 2016). This was prob-
ably the first example of a biotech product ever developed for abiotic stress condi-
tions by marker-assisted breeding in rice.
Enrichment of Nutritive Quality Enrichment of nutritive quality is as important
as yield enhancement on account of people in Asia depending on rice for a sizable
part of their nutritional requirement. Because about one-half of the global popula-
tion is suffering from one or more nutrient deficiency–related health disorders and
more than three million children die each year because of malnutrition, there is a
need and urgency to pay due attention to the nutritive quality in rice.
Among the nutritional limitations of rice, low protein content (PC) is the fore-
most. Nevertheless, the need to raise the protein content received no serious atten-
tion from breeders after experiencing early failures. Following the identification of
high-protein donor sources, despite the complex inheritance and the earlier reported
negative relationship between yield and protein content, breeders have started
believing that high protein content could be combined with high yield. By using
ARC10075 as a donor, CR Dhan310 (IET24780) with PC of 11% and rich in threo-
nine and lysine content has been developed and released for general cultivation in
India (Mahender et al. 2016). Although many efforts have been made for developing
marker-assisted breeding for high PC, success has so far been eluded. Xu et al.
(2017) were successful in developing transgenic rice with enhanced high-quality
protein content by expressing the AmA1 gene from Amaranthus sp.
Vitamin deficiency–related health disorders are widespread in third world coun-
tries. Vitamin A deficiency causing vision impairment is especially rampant. In the
absence of exploitable natural variability, in all food grains except maize, alternative
strategies have to be found. Professor Ingo Potrykus of the Federal Institute of Plant
Sciences, Switzerland, jointly with Professor Peter Beyer of the University of
Freiburg, Germany, succeeded in raising β carotene content by an ingenious genetic
engineering strategy. The strategy lay in restoring three critical genes that are miss-
ing in the isoprenoid pathway of carotene synthesis by accessing them from daffodil
(phytoene synthase (psy), phytoene desaturase (pds), and lycopene cyclase (lyc)),
and the bacterium Erwinia uredovora (carotene desaturase, crt1) (Ye et al. 2000).
So, the transformed rice popularly known as Golden rice, although a great scientific
achievement, accumulates far less (1.6 mg/g) beta carotene. Understanding that it
was due to the use of relatively less efficient daffodil gene psy encoding phytoene
synthase, the multinational biotech company Syngenta succeeded in increasing the
content of β carotene by several fold (37 mg/g) by using the psy gene cloned from
maize (Paine et al. 2005). Sadly, the Golden rice developed close to 20 years ago has
yet to be deregulated for commercial planting because of regulatory hurdles.
As for mineral nutrients, iron and zinc are the most crucial as their deficiency is
the main cause of malnutrition. Modern high-yielding varieties are low in these two
mineral nutrients. On average, Fe content in polished rice is 2 mg/kg vis-à-vis the
recommended dietary intake for humans of 10–15 mg/kg. In the case of Zn, males
within the age bracket of 15–74 years require on average 12–15 mg/day vis-à-vis
68 mg/day required for females (Mahender et al. 2016). Conventional breeding for
developing Fe-enriched rice has not progressed to the desired extent due to limited
variability for Fe content in polished rice. Evaluation of more than 20,000 rice
accessions from Asia, Latin America, and the Caribbean for Fe and Zn content
revealed a maximum of only 8 mg/kg in polished grains. This is because most of the
Fe and Zn are concentrated in the aleurone and sub-aleurone layers of rice kernels,
and is lost upon polishing. Taking advantage of Zn-rich donor sources, under the
HarvestPlus project, the Bangladesh Rice Research Institute in collaboration with
IRRI developed and released two Zn-enriched (19 and 24 mg/kg) varieties. The
Indian Institute of Rice Research, Hyderabad, has as well succeeded in developing
three rice varieties (DRR Dhan 45, DRR Dhan 48, and DRR Dhan 49) with high Zn
content: 22.3, 20.91, and 26.13 mg/kg, respectively (Rao et al. 2020). Many low to
moderate Zn QTLs have now been mapped in the germplasm. In addition, genome-
wide association mapping and QTL mapping enabled the identification of several
loci associated with grain Fe and Zn content (Norton et al. 2014; Swamy et al. 2018;
Calayugan et al. 2020).
Transgenic approaches to enhance Fe content in rice grains were first explored
more than a decade ago. Since then, attempts have been made to increase Fe content
in rice endosperm by overexpressing the genes involved in Fe uptake from soil and
those involved in translocation from aerial parts to grains. Among these studies, a
concomitant increase in Fe and Zn content in rice grains was obtained by overex-
pression or activation of NAS (nicotianamine synthase) genes, either in solo or in
combination with other transporters or Fe storage genes. Constitutive expression of
OsNAS2 has been reported to result in increased Fe content (19 mg/kg) and Zn con-
centration (76 mg/kg) in polished rice grains (Johnson et al. 2011).
4.9 Selective Modification of Traits by Gene Editing
Aside from the marker-assisted introgression of genes of interest discussed in the

foregoing, an alternative genetic engineering approach for selectively transforming
crops with targeted genes has opened up yet another molecular strategy known as
genome editing. Genome editing tools such as TALENs (Transcription Activator-
Like Effector Nucleases) and CRISPR/Cas9 (Clustered Regularly Interspaced Short
Palindromic Repeats) enable selective interchange of genes of interest. Considered
as a non-transgenic method, products thereby are devoid of any foreign material in
their final product DNA. Employing these techniques, targeted gene editing for
important traits is on the rise. TALENs, for instance, have been used for enhancing
seed storability and herbicide resistance in rice by precisely editing the LOX3 gene
(Ma et al. 2015) and acetolactate synthase gene (OsALS) (Li and Liu 2016), respec-
tively. Likewise, CRISPR/Cas9 has been used to manipulate traits such as herbicide
resistance (Xu et al. 2014), yield components (Li et al. 2016), blast resistance (Wang
and Wang 2016), TGMS line development (Zhou et al. 2016), stomatal development
(Yin and Biswal 2017), and modifying amylose content (Sun et al. 2017; Perez et al.
2019) (Table 2).
5 Conclusions
For predominantly rice-consuming Asia to emerge and remain a food-/nutrition-

secure continent, sustained self-sufficiency is crucial. Meeting future demand pro-
jections sustainably is the challenging task in the face of shrinking natural
resources—arable land area, irrigation water, genetic variability—and the inevitable
adverse effects of climate change. For the next breakthrough to meet future food
demand projections, it seems imperative to exploit advanced cutting-edge tools,
which enables development of high yielding, nutrient rich and input-use-efficient
designer rice varieties.
Table 2 Targeted editing of important genes employing genome editing techniques

Gene editing
Trait Targeted gene method Reference
Herbicide resistance (resistance to BEL CRISPR-Cas9 Xu et al.
bentazon and sulfonylurea system (2014)
herbicides)
Improvement of seed storability LOX3 TALENs Ma et al.
(2015)
Regulators of grain number, panicle Gn1a, DEP1, GS3, CRISPR/Cas9 Li et al.
architecture, grain size, and plant and IPA1 system (2016)
architecture
Herbicide resistance Acetolactate TALENs Li and Liu
synthase gene (2016)
(OsALS)
Blast resistance OsERF922 CRISPR/Cas9 Wang and
Wang (2016)
TGMS line development TMS5 CRISPR/Cas9 Zhou et al.
(2016)
Stomatal development EPFL9 CRISPR/Cas9 Yin et al.
and CRISPR/ (2017)
Cpf1
High amylose content SBEI and SBEII CRISPR/Cas9 Sun et al.
(2017)
Low amylase content GBSS CRISPR/Cas9 Perez et al.
(2019)
References
Ahn SN, Kwon SJ, Suh JP, Kang KH, Kim HJ, Hwang HG, Moon HP (2003) Introgression for
agronomic traits from O grandiglumis into rice, O sativa. In: Mew TW, Brar DS, Peng S,
Dawe D, Hardy B (eds) Rice science: innovations and impact for livelihood. International Rice
Research Institute (IRRI), Los Baños, pp 265–274
Ali J (1993) Studies on temperature sensitive genic male sterility and chemical induced steril-
ity towards development of two-line hybrids in rice (Oryza sativa L.). PhD thesis, Indian
Agricultural Research Institute, New Delhi
Ali J, Siddiq EA, Zaman FU, Abraham MJ, Ahmed IM (1995) Identification and characterization
of temperature-sensitive genic male sterile sources in rice (Oryza sativa L). Indian J Genet
55:243–259
Ali J, Xu JL, Gao Y, Fontanilla M, Li Z (2012) Enhanced productivity across different rice ecolo-
gies through green super Rice (GSR) breeding strategy. International Dialogue on Designer
Rice for Future, ICRISAT, Hyderabad, 9–10 July 2012
Ambavaram MMR, Basu S, Krishnan A, Ramegowda V, Batlang U, Rahman L, Baisakh N, Pereira
A (2014) Coordinated regulation of photosynthesis in rice increases yield and tolerance to envi-
ronmental stress. Nat Commun 5:5302. https://doi.org/10.1038/ncomms6302
Ando T, Yamamoto T, Shimizu T et al (2008) Genetic dissection and pyramiding of quantitative
traits for panicle architecture by using chromosomal segment substitution lines in rice. Theor
Appl Genet 116(6):881–890. https://doi.org/10.1007/s00122-008-0722-6
Ashikari M, Sakakibara H, Lin S, Yamamoto T, Takashi T, Nishimura A, Angeles ER, Qian Q,
Kitano H, Matsuoka M (2005) Cytokinin oxidase regulates rice grain production. Science
309(5735):741–745. https://doi.org/10.1126/science.1113373
Babu NN, Krishnan SG, Vinod KK, Krishnamurthy SL, Singh VK, Singh MP, Singh R, Ellur RK,
Rai V, Bollinedi H, Bhowmick PK, Yadav AK, Nagarajan M, Singh NK, Prabhu KV, Singh AK
(2017) Marker aided incorporation of Saltol, a major QTL associated with seedling stage salt
tolerance, into Oryza sativa ‘Pusa Basmati 1121’. Front Plant Sci 8:41. https://doi.org/10.3389/
fpls.2017.00041
Borines LM, Veracruz CM, Redoña ED, Hernandez JF, Natural MP, Raymundo AD, Leung H
(2000) Marker aided pyramiding of bacterial blight resistance genes in maintainer lines for
hybrid rice production. International Rice Research Institute Conference Abstract 4:162
Brondani C, Rangel PHN, Brondani RPV, Ferreira ME (2002) QTL mapping and introgression of
yield-related traits from Oryza glumaepatula to cultivated rice (Oryza sativa L.) using micro-
satellite makers. Theor Appl Genet 104:1192–1203
Calayugan MIC, Formantes AK, Amparado A et al (2020) Genetic analysis of agronomic traits and
grain iron and zinc concentrations in a doubled haploid population of rice (Oryza sativa L.). Sci
Rep 10:2283. https://doi.org/10.1038/s41598-020-59184-z
Chakraborty M, Reddy PS, Mustafa G, Rajesh G, Narasu VM, Udayasuriyan V, Rana D (2016)
Transgenic rice expressing the cry2AX1 gene confers resistance to multiple lepidopteran pests.
Transgenic Res 25(5):665–678. https://doi.org/10.1007/s11248-016-9954-4. Epub 2016 Mar 26
Chin HJ, Lu X, Haefele SM, Gamuyao R, Ismail AM, Wissuwa M, Heuer S (2010) Development
and application of gene-based markers for the major rice QTL Phosphate uptake 1 (Pup1).
Theor Appl Genet 120:1073–1086
Datta K, Torrizo L, Oliva N, Alam MF, Wu C, Abrigo E, Vasquez A, Tu J, Quimia C, Alejar M,
Nicola Z, Khush GS, Datta SK (1996) Production of transgenic rice by protoplast, biolistic and
Agrobacterium systems. In: Proceedings of the fifth international symposium on rice molecular
biology. Yi Sein Publishing Co., Taipei, pp 159–167
Devi T, Anjana N, Sarla B, Siddiq EA, Sirdeshmukh R (2010) Activity and expression of adenos-
ine diphosphate glucose pyrophosphorylase in developing rice grains: varietal differences and
implications on grain filling. Plant Sci 178:123–129
Dingkuhn M, Penning de Vries FWT, De Datta SK, van Laar HH (1991) Concepts for a new
plant type for direct seeded flooded tropical rice. Selected papers from the International Rice
Research conference, Seoul, Korea, 27–31 August 1990
Dixit S, Yadaw RB, Mishra KK, Kumar A (2017) Marker-assisted breeding to develop the drought-
tolerant version of Sabitri, a popular variety from Nepal. Euphytica 213:184
Ehleringer JR, Monson RK (1993) Evolutionary and ecological aspects of photosynthetic pathway
variation. Annu Rev Ecol Syst 24:411–439
Fan F, Li N, Chen Y, Liu X, Sun H, Wang J, He G, Zhu Y, Li S (2017) Development of elite BPH-
resistant wide-spectrum restorer lines for three and two line hybrid rice. Front Plant Sci 8:986.
https://doi.org/10.3389/fpls.2017.00986
Friso G, Majeran W, Huang MS, Sun Q, van Wijk KJ (2010) Reconstruction of metabolic path-
ways, protein expression, and homeostasis machineries across maize bundle sheath and meso-
phyll chloroplasts: large-scale quantitative proteomics using the first maize genome assembly.
Plant Physiol 152:1219–1250
Fuji S, Toriyama K (2009) Suppressed expression of Retrograde-Regulated Male Sterility restores
pollen fertility in cytoplasmic male sterile rice plants. Proc Natl Acad Sci U S A 106:9513–9518.
https://doi.org/10.1073/pnas.0901860106
Fujino K, Hirayama Y, Obara M, Ikegaya T (2019) Introgression of the chromosomal region with
the Pi-cd locus from Oryza meridionalis into O. sativa L. during rice domestication. Theor
Appl Genet 132:1981–1990
Ganeshan P, Jain A, Parmar B, Rao AR, Sreenu K, Mishra P, Mesapogu S, Subrahmanyam D,
Ram T, Sarla N, Rai V (2016) Identification of salt tolerant rice lines among interspecific BILs
developed by crossing Oryza sativa × O. rufipogon and O. sativa × O. nivara. Aust J Crop Sci
10(2):220–228
Garg AK, Sawers RJ, Wang H et al (2006) Light-regulated overexpression of an Arabidopsis phyto-
chrome A gene in rice alters plant architecture and increases grain yield. Planta 223(4):627–636.
https://doi.org/10.1007/s00425-005-0101-3
Gopalakrishna K, Vemireddy LR, Srividhya A, Nagireddy R, Jena SS, Gandikota M, Patil S,

Veeraghattapu R, Deborah DAK, Reddy GE, Shake M, Dasari A, Ramanarao PV, Durgarani
CV, Neeraja CN, Siddiq EA, Sheshumadhav M (2017) QTL-Seq-based genetic analysis iden-
tifies a major genomic region governing dwarfness in rice (Oryza sativa L.). Plant Cell Rep
37(4):677–687. https://doi.org/10.1007/s00299-018-2260-2
Hajira SK, Sundaram RM, Laha GS, Yugander A, Balachandran SM, Viraktamath BC, Sujatha
K, Balachiranjeevi CH, Pranathi K, Anila M, Bhaskar S, Abhilash V, Mahadevaswamy HK,
Kousik M, Dilip Kumar T, Harika G, Rekha G (2016) A single-tube, functional marker-based
multiplex PCR assay for simultaneous detection of major bacterial blight resistance genes
Xa21, xa13 and xa5 in rice. Rice Sci 23(3):144–151
Haritha G, Vishnukiran T, Yugandhar P, Sarla N, Subrahmanyam D (2017) Introgressions from
Oryza rufipogon increase photosynthetic efficiency of KMR3 rice lines. Rice Sci 24(2):85–96
Hibberd JM, Sheehy JE, Langdale JA (2008) Using C4 photosynthesis to increase the yield of
rice: rationale and feasibility. Curr Opin Plant Biol 11(2):228–231. https://doi.org/10.1016/j.
pbi.2007.11.002
Hirabayashi H, Sato H (2010) Development of introgression lines derived from Oryza rufipogon
and O. glumaepatula in the genetic background of japonica cultivated rice (O. sativa L.) and
evaluation of resistance to rice blast. Breed Sci 60:604–612
Hittalmani S, Parco A, Mew TV, Zeigler RS, Huang N (2000) Fine mapping and DNA marker-
assisted pyramiding of the three major genes for blast resistance in rice. Theor Appl Genet
100:1121–1128
Huang Y (2001) Rice ideotype breeding of Guangdong Academy of Agricultural Sciences in retro-
spect. Guangdong Agric Sci 3:2–6. (in Chinese)
Hussain AJ, Ali J, Siddiq EA, Gupta VS, Reddy UK, Ranjekar PK (2011) Mapping of tms8 gene
for temperature-sensitive genic male sterility (TGMS) in rice (Oryza sativa L.). Plant Breed
131(1):42–47
Imai I, Kimball JA, Conway B et al (2013) Validation of yield-enhancing quantitative trait loci
from a low-yielding wild ancestor of rice. Mol Breed 32:101–120
Itoh H, Tatsumi T, Sakamoto T, Otomo K, Toyomasu T, Kitano H, Ashikari M, Ichihara S,
Matsuoka M (2004) A rice semidwarf gene, Tan-Ginbozu (D35), encodes the gibberel-
lin biosynthesis enzyme, ent-kaurene oxidase. Plant Mol Biol 54(4):533–547. https://doi.
org/10.1023/B:PLAN.0000038261.21060.47
Jairin J, Sansen K, Wongboon W, Kothcharerk J (2010) Detection of a brown planthopper resis-
tance gene bph4 at the same chromosomal position of Bph3 using two different genetic back-
grounds of rice. Breed Sci 60:71–75. https://doi.org/10.1270/jsbbs.60.71
Jing S, Zhao Y, Du B, Chen R, Zhu L, He G (2017) Genomics of interaction between the brown
planthopper and rice. Curr Opin Insect Sci 19:82–87
Johnson AAT, Kyriacou B, Callahan DL, Carruthers L, Stangoulis J, Lombi E et al (2011)
Constitutive overexpression of the OsNAS gene family reveals single-gene strategies for
effective iron- and zinc-biofortification of rice endosperm. PLoS One 6(9):e24476. https://doi.
org/10.1371/journal.pone.0024476
Joseph M, Gopalakrishnan S, Sharma RK, Singh VP, Singh AK, Singh NK, Mohapatra T (2004)
Combining bacterial blight resistance and basmati quality characteristics by phenotypic and
molecular marker-assisted selection in rice. Mol Breed 13(4):377–387
Kaladhar K, Swamy BPM, Babu AP, Reddy CS, Sarla N (2008) Mapping quantitative trait loci
for yield traits in BC2F2 population derived from Swarna x O. nivara cross. Rice Genet Newsl
24:34–36. https://doi.org/10.1093/jhered/esr145
Karki S, Rizal G, Quick WP (2013) Improvement of photosynthesis in rice (Oryza sativa L.) by
inserting the C4 pathway. Rice 6:28. https://doi.org/10.1186/1939-8433-6-28
Karmakar S, Molla KA, Das K, Sarkar SN, Datta SK, Datta K (2017) Dual gene expression cas-
sette is superior than single gene cassette for enhancing sheath blight tolerance in transgenic
rice. Sci Rep 7:7900. https://doi.org/10.1038/s41598-017-08180-x
Kumar A, Dixit S, Ram T, Yadaw RB, Mishra KK, Mandal NP (2014) Breeding high-yielding
drought-tolerant rice: genetic variations and conventional and molecular approaches. J Exp Bot
65(21):6265–6278. https://doi.org/10.1093/jxb/eru363
Lafitte HR, Guan YS, Shi Y, Li ZK (2007) Whole plant responses, key processes, and adaptation to
drought stress: the case of rice. J Exp Bot 58:169–175
Le DT, Chu HD, Sasaya T (2015) Creation of transgenic rice plants producing small interfering
RNA of Rice tungro spherical virus. GM Crops Food 6(1):47–53
Lee J-H, Muhsin M, Atienza GA, Kwak D-Y, Kim S-M, De Leon TB, Angeles ER, Coloquio E,
Kondoh H, Satoh K et al (2010) Single nucleotide polymorphisms in a gene for translation ini-
tiation factor (eIF4G) of rice (Oryza sativa) associated with resistance to Rice tungro spherical
virus. Mol Plant-Microbe Interact 23:29–38
Li T, Liu B (2016) TALEN-mediated homologous recombination produces site-directed DNA base
change and herbicide-resistant rice. J Genet Genomics 43:297–305
Li JM, Yuan LP (2000) Hybrid rice: genetics, breeding, and seed production. Plant Breed Rev
17:15–158
Li M, Li X, Zhou Z et al (2016) Reassessment of the four yield-related genes Gn1a, DEP1, GS3,
and IPA1 in rice using a CRISPR/Cas9 system. Front Plant Sci 7:377. https://doi.org/10.3389/
fpls.2016.00377
Liang F, Deng Q, Wang Y et al (2004) Molecular marker-assisted selection for yield-enhancing
genes in the progeny of “9311×O. rufipogon” using SSR. Euphytica 139:159–165
Lin TP, Caspar T, Somerville CR, Preiss J (1988) Isolation and characterization of a starchless
mutant of Arabidopsis thaliana (L.) Heynh lacking ADP glucose pyrophosphorylase activity.
Liu SP, Li X, Wang CY, Li XH, He YQ (2003) Improvement of resistance to rice blast in Zhenshan
97 by molecular marker-aided selection. Acta Bot Sin 45:1346–1350
Liu X, Zhang C, Li X, Tu J (2016) Pyramiding and evaluation of both a foreign Bacillus thuringi-
ensis and a Lysine-rich protein gene in the elite indica rice 9311. Breed Sci 66(4):591–598
Luo Y, Ma T, Zhang A, Ong KH, Li Z, Yang J, Yin Z (2016) Marker-assisted breeding of the
rice restorer line Wanhui 6725 for disease resistance, submergence tolerance and aromatic fra-
grance. Rice (N Y) 9:66. https://doi.org/10.1186/s12284-016-0139-9
Luu T, Huyen N, Cuc LM, Ismail AM, Ham LH (2012) Introgression of the salinity tolerance QTL
Saltol into AS996, the elite rice variety of Vietnam. Am J Plant Sci 3:981–987
Ma L, Zhu F, Li Z et al (2015) TALEN-based mutagenesis of lipoxygenase LOX3 enhances
the storage tolerance of rice (Oryza sativa) seeds. PLoS One 10(12):e0143877. https://doi.
Mackill DJ, Coffman WR, Garrity DP (1996) Rainfed lowland rice improvement. International
Rice Research Institute, Los Baños
Mahender A, Anandan A, Pradhan SK et al (2016) Rice grain nutritional traits and their enhance-
ment using relevant genes and QTLs through advanced approaches. Springerplus 5:2086.
https://doi.org/10.1186/s40064-016-3744-6
Manikandan R, Balakrishnan N, Sudhakar D, Udayasuriyan V (2016) Transgenic rice plants
expressing synthetic cry2AX1 gene exhibit resistance to rice leaffolder (Cnaphalocrosis medi-
nalis). 3 Biotech 6(1):10
Marri PR, Sarla N, Vemireddy LR, Siddiq EA (2005) Identification of yield enhancing quantitative
trait loci (QTLs) from Oryza rufipogon of Indian origin. BMC Genet 6:33
Mi J, Li G, Huang J, Yu H, Zhou F, Zhang Q, Ouyang Y, Mou T (2016) Stacking S5-n and f5-n to
overcome sterility in indica-japonica hybrid rice. Theor Appl Genet 129(3):563–575. https://
doi.org/10.1007/s00122-015-2648-0. Epub 2015 Dec 24
Murai M, Takamure I, Sato S, Tokutome T, Sato Y (2002) Effects of the dwarfing gene originating
from ‘Dee-geo-woo-gen’ on yield and its related traits in rice. Breed Sci 52:95–100
Nagadhara D, Ramesh S, Pasalu IC et al (2004) Transgenic rice plants expressing the snowdrop
lectin gene (gna) exhibit high-level resistance to the whitebacked planthopper (Sogatella fur-
cifera). Theor Appl Genet 109(7):1399–1405. https://doi.org/10.1007/s00122-004-1750-5
Nair S, Bentur JS, Sama VSAK (2011) Mapping gall midge resistance genes: towards durable
resistance through gene pyramiding. In: Muralidharan K, Siddiq EA (eds) Genomics and crop
improvement: relevance and reservations. Institute of Biotechnology, ANGR Agricultural
University, Hyderabad, pp 256–264
Narayanan NN, Baisakh N, Vera Cruz N, Gnananmanickam SS, Datta K, Datta SK (2002)
Molecular breeding for the development of blast and bacterial blight resistance in rice cv. IR50.
Crop Sci 42:2072–2079. https://doi.org/10.2135/cropsci2002.2072
Nayak P, Basu D, Das S et al (1997) Transgenic elite indica rice plants expressing CryIAc delta-
endotoxin of Bacillus thuringiensis are resistant against yellow stem borer (Scirpophaga incer-
tulas). Proc Natl Acad Sci U S A 94(6):2111–2116. https://doi.org/10.1073/pnas.94.6.2111
Norton GJ, Douglas A, Lahner B, Yakubova E, Guerinot ML, Pinson SRM et al (2014) Genome
wide association mapping of grain arsenic, copper, molybdenum and zinc in rice (Oryza sativa
L.) grown at four international field sites. PLoS One 9:e89685. https://doi.org/10.1371/journal.
pone.0089685
Obara M, Tamura W, Ebitani T, Yano M, Sato T, Yamaya T (2010) Fine-mapping of qRL6.1, a
major QTL for root length of rice seedlings grown under a wide range of NH4+ concentrations
in hydroponic conditions. Theor Appl Genet 121:535–547
Ohsumi A, Takai T, Ida M, Yamamoto T, Arai-Sanoh Y, Yano M, Ando T, Kondo M (2011)
Evaluation of yield performance in rice near-isogenic lines with increased spikelet number.
Field Crops Res 120:68–75. https://doi.org/10.1016/j.fcr.2010.08.013
Ouyang Y, Chen J, Ding J, Zhang Q (2009) Advances in the understanding of inter-subspecific
hybrid sterility and wide-compatibility in rice. Chin Sci Bull 54:2332–2341
Paine JA, Shipton CA, Chaggar S et al (2005) Improving the nutritional value of golden rice
through increased provitamin A content. Nat Biotechnol 23:482–487
Park S-I, Kim Y-S, Kim J-J, Mok J-E, Kim Y-H, Park H-M, Kim I-S, Yoon H-S (2017) Improved
stress tolerance and productivity in transgenic rice plants constitutively expressing the Oryza
sativa glutathione synthetase OsGS under paddy field conditions. J Plant Physiol 215:39–47
Pérez L, Soto E, Farré G, Juanos J, Villorbina G, Bassie L, Medina V, Serrato AJ, Sahrawy M,
Rojas JA, Romagosa I, Muñoz P, Zhu C, Christou P (2019) CRISPR/Cas9 mutations in the
rice Waxy/GBSSI gene induce allele-specific and zygosity-dependent feedback effects on
endosperm starch biosynthesis. Plant Cell Rep 38(3):417–433. https://doi.org/10.1007/
s00299-019-02388-z. Epub 2019 Feb 4. PMID: 30715580.
Pinson SRM, Capdevielle FM, Oard JH (2005) Confirming QTLs and finding additional loci con-
ditioning sheath blight resistance in rice using recombinant inbred lines. Crop Sci 45:503–510.
https://doi.org/10.2135/cropsci2005.0503
Pradhan S, Chakraborty A, Sikdar N, Chakraborty S, Bhattacharyya J, Mitra J, Manna A, Dutta
Gupta S, Sen SK (2016) Marker-free transgenic rice expressing the vegetative insecticidal pro-
tein (Vip) of Bacillus thuringiensis shows broad insecticidal properties. Planta 244(4):789–804.
https://doi.org/10.1007/s00425-016-2535-1. Epub 2016 May 10
Priyadarshi R, Arremsetty HPS, Singh AK, Khandekar D, Ulaganathan K, Shenoy V (2017)
Molecular stacking of wide compatibility gene, S5n and elongated uppermost internode (eui)
gene into IR58025B, an elite maintainer line of rice. J Plant Biochem Biotechnol 26(4):425–435
Ram T, Majumder ND (2007) Introgression of broad-spectrum blast resistance gene(s) into cul-
tivated rice (Oryza sativa ssp. indica) from wild rice O. rufipogon. Curr Sci 92(2):225–230
Rao KV, Rathore KS, Hodges TK, Fu X, Stoger E, Sudhakar D, Williams S, Christou P, Bharathi
M, Brown DP, Powell KS, Spence J, Gatehouse AM, Gatehouse JA (1998) Expression of snow-
drop lectin (GNA) in transgenic rice plants confers resistance to rice brown planthopper. Plant
J 15(4):469–477
Rao SD, Neeraja CN, Madhu Babu P, Nirmala B, Suman K, Rao LVS, Surekha K, Raghu P,
Longvah T, Surendra P, Kumar R, Babu VR, Voleti SR (2020) Zinc biofortified rice variet-
ies: challenges, possibilities, and progress in India. Front Nutr 7:26. https://doi.org/10.3389/
fnut.2020.00026
Rashid M, Guangyuan H, Guangxiao Y, Hussain J, Xu Y (2012) AP2/ERF transcription factor in

rice: genome-wide canvas and syntenic relationships between monocots and eudicots. Evol
Bioinformatics Online 8:321–355. https://doi.org/10.4137/EBO.S9369
Reddy O, Siddiq E, Sarma N et al (2000) Genetic analysis of temperature-sensitive male sterility
in rice. Theor Appl Genet 100:794–801. https://doi.org/10.1007/s001220051354
Saha P, Majumder P (2006) Transgenic rice expressing Allium sativum leaf lectin with enhanced
resistance against sap-sucking insect pests. Planta 223:1329–1343
Sahoo RK, Gill SS, Tuteja N (2012) Pea DNA helicase 45 promotes salinity stress tolerance in
IR64 rice with improved yield. Plant Signal Behav 7(8):1042–1046
Saijo Y, Hata S, Kyozuka J, Shimamoto K, Izui K (2000) Overexpression of a single Ca2+-
dependent protein kinase confers both cold and salt/drought tolerance on rice plants. Plant
J 23:319–327
Sasaki A, Ashikari M, Ueguchi-Tanaka M, Itoh H, Nishimura A, Datta S, Ishiyama K, Saito T,
Kobayashi M, Khush GS, Kitano H, Matsuoka M (2002) Green revolution: a mutant gibberellin-
synthesis gene in rice. Nature 416(6882):701–702. https://doi.org/10.1038/416701a
Sato Y, Sentoku N, Miura Y, Hirochika H, Kitanoc H, Matsuoka M (1999) Loss-of-function muta-
tions in the rice homeobox gene OSH15 affect the architecture of internodes resulting in dwarf
plants. EMBO J 18(4):992–1002. https://doi.org/10.1093/emboj/18.4.992
Sattari M, Kathiresan A, Gregorio G, Hernandez JE, Nas TM, Virmani SS (2007) Development and
use of a two-gene marker-aided selection system for fertility restorer genes in rice. Euphytica
153:35–42
Septiningsih EM, Pamplona AM, Sanchez DL, Neeraja CN, Vergara GV, Heuer S, Ismail AM,
Mackill DJ (2009) Development of submergence-tolerant rice cultivars: the Sub1 locus and
beyond. Ann Bot 103(2):151–160. https://doi.org/10.1093/aob/mcn206
Shim J, Torollo G, Angeles-Shim RB, Cabunagan RC, Choi I-R, Yeo U-S, Ha W-G (2015) Rice
tungro spherical virus resistance into photoperiod-insensitive japonica rice by marker-assisted
selection. Breed Sci 65:345–351. https://doi.org/10.1270/jsbbs.65.345
Siddiq EA, Ali J (1999) Innovative male sterility systems for exploitation of hybrid vigour in crop
plants: 1. Environment sensitive genetic male sterility system. PINSA B65(6):331–350
Siddiq EA, Singh S (2005) Wide-compatibility system for yield enhancement of tropical rice
through intersubspecific hybridization. Adv Agron 87:157–209
Singh SP, Sundaram RM, Biradar SK, Ahmed MI, Viraktamath BC, Siddiq EA (2006) Identification
of simple sequence repeat markers for utilizing wide-compatibility genes in inter-subspecific
hybrids in rice (Oryza sativa L.). Theor Appl Genet 113:509–517. https://doi.org/10.1007/
s00122-006-0316-0
Singh VK, Singh A, Singh SP, Ellur RK, Choudhary V, Sarkel S, Singh D, Krishnan SG, Nagarajan
M, Vinod KK, Singh UD, Rathore R, Prashanthi SK, Agrawal PK, Bhatt JC, Mohapatra T,
Prabhu KV, Singh AK (2012) Incorporation of blast resistance into ‘PRR78’, an elite Basmati
rice restorer line, through marker assisted backcross breeding. Field Crops Res 128:8–16
Singla-Pareek SL, Yadav SK, Pareek A, Reddy MK, Sopory SK (2006) Transgenic tobacco over-
expressing glyoxalase pathway enzymes grow and set viable seeds in zinc-spiked soils. Plant
Physiol 140(2):613–623. https://doi.org/10.1104/pp.105.073734
Song X, Qiu S, Xu C, Li X, Zhang Q (2005) Genetic dissection of embryo sac fertility, pollen
fertility, and their contributions to spikelet fertility of intersubspecific hybrids in rice. Theor
Appl Genet 110:205–211
Sudhakar T, Panigrahy M, Lakshmanaik M, Babu AP, Reddy CS, Anuradha K, Swamy BPM, Sarla
N (2012) Variation and correlation of phenotypic traits contributing to high yield in KMR3:
Oryza rufipogon introgression lines. Int J Plant Breed Genet 6:69–82
Sun YW, Jiao GA, Liu ZP, Zhang X, Li JY, Guo XP, Du WM, Du JL, Francis F, Zhao YD, Xia LQ
(2017) Generation of high-amylose rice through CRISPR/Cas9-mediated targeted mutagenesis
of starch branching enzymes. Front Plant Sci 8:298. https://doi.org/10.3389/fpls.2017.00298
Sundaram RM, Vishnupriya MR, Biradar SK, Laha GS, Reddy AG, Rani NS, Sarma NP, Sonti RV
(2008) Marker assisted introgression of bacterial blight resistance in Samba Mahsuri, an elite
indica rice variety. Euphytica 160(3):411–422
Swamy BPM, Kumar A (2013) Genomics-based precision breeding approaches to improve
drought tolerance in rice. Biotechnol Adv 31(8):1308–1318. https://doi.org/10.1016/j.
biotechadv.2013.05.004
Swamy BPM, Sarla N (2008) Yield-enhancing quantitative trait loci (QTLs) from wild species.
Biotechnol Adv 26(1):106–120
Swamy BPM, Kaladhar K, Ramesha MS, Viraktamath BC, Sarla N (2011) Molecular mapping of
QTLs for yield and yield-related traits in Oryza sativa cv. Swarna × O. nivara (IRGC81848)
backcross population. Rice Sci 18(3):178–186
Swamy BPM, Kaladhar K, Shobharani N, Prasad GSV, Viraktamath BC, Reddy GA, Sarla N
(2012) QTL analysis for grain quality traits in 2 BC2F2 populations derived from crosses
between Oryza sativa cv. Swarna and 2 accessions of O. nivara. J Hered 103(3):442–452
Swamy BPM, Kaladhar K, Reddy GA, Viraktamath BC, Sarla N (2014) Mapping and introgres-
sion of QTL for yield and related traits in two backcross populations derived from Oryza sativa
cv. Swarna and two accessions of O. nivara. J Genet 93(3):643–654
Swamy BPM, Descalsota GIL, Nha CT, Amparado A, Inabangan-Asilo MA, Manito C, Tesoro F,
Reinke R (2018) Identification of genomic regions associated with agronomic and biofortifica-
tion traits in DH populations of rice. PLoS One 13(8):e0201756
Ueguchi-Tanaka M, Fujisawa Y, Kobayashi M, Ashikari M, Iwaski Y, Kitano H, Matsuoka M
(2000) Rice dwarf mutant d1, which is defective in the alpha subunit of the heterotrimeric G
protein, affects gibberellin signal transduction. Proc Natl Acad Sci U S A 97(21):11638–11643.
https://doi.org/10.1073/pnas.97.21.11638
Uga Y, Sugimoto K, Ogawa S et al (2013) Control of root system architecture by DEEPER
ROOTING 1 increases rice yield under drought conditions. Nat Genet 45:1097–1102
Valarmathi P, Kumar G, Robin S, Manonmani S, Dasgupta I, Rabindran R (2016) Evaluation of
virus resistance and agronomic performance of rice cultivar ASD 16 after transfer of trans-
gene against Rice tungro bacilliform virus by backcross breeding. Virus Genes 52(4):521–529.
https://doi.org/10.1007/s11262-016-1318-x. Epub 2016 Mar 16
Wang F, Wang C (2016) Enhanced rice blast resistance by CRISPR/Cas9-targeted mutagenesis of
the ERF transcription factor gene OsERF922. PLoS One 11(4):1–18
Wang Y, Pinson SRM, Fjellstrom RG, Tabien RE (2012a) Phenotypic gain from introgression of
two QTL, qSB9-2 and qSB12-1 for rice sheath blight resistance. Mol Breed 30:293–303
Wang P, Xing Y, Li Z et al (2012b) Improving rice yield and quality by QTL pyramiding. Mol
Breed 29:903–913. https://doi.org/10.1007/s11032-011-9679-2
Wang L, Lu Q, Wen X, Lu C (2015) Enhanced sucrose loading improves rice yield by increasing
grain size. Plant Physiol 169:2848–2862
Wang S, Tholen D, Zhu X-G (2017a) C4 photosynthesis in C3 rice: a theoretical analysis of bio-
chemical and anatomical factors. Plant Cell Environ 40:80–94
Wang Y, Jiang W, Liu H, Zeng Y, Du B, Zhu L, He G, Chen R (2017b) Marker assisted pyramiding
of Bph6 and Bph9 into elite restorer line 93-11 and development of functional marker for Bph9.
Rice (N Y) 10(1):51. https://doi.org/10.1186/s12284-017-0194-x
Wei F-J, Droc G, Guiderdoni E, Hsing YC (2013) International consortium of rice mutagenesis:
resources and beyond. Rice (N Y) 6(1):39
Xiao J, Grandillo S, Ahn SN, McCouch SR, Tanksley SD, Li J, Yuan L (1996) Genes from wild
rice improve yield. Nature 384:223–224
Xu K, Xia X, Fukao T, Canlas P, Maghirang-Rodriguez R, Heuer S et al (2006) Sub1A is an ethyl-
ene response factor-like gene that confers submergence tolerance to rice. Nature 442:705–708
Xu R, Li H, Qin R, Wang L, Li L, Wei P et al (2014) Gene targeting using the Agrobacterium
tumefaciens mediated CRISPR-Cas system in rice. Rice 7:5. https://doi.org/10.1186/
s12284-014-0005-6
Xu R, Qin R, Li H, Li D, Li L, Wei P et al (2017) Generation of targeted mutant rice using a

CRISPR-Cpf1 system. Plant Biotechnol J 15:713–717. https://doi.org/10.1111/pbi.12669
Yadav S, Anuradha G, Kumar RR, Vemireddy LR, Sudhakar R, Donempudi K, Venkata D, Jabeen
F, Narasimhan YK, Marathi B, Siddiq EA (2015) Identification of QTLs and possible candidate
genes conferring sheath blight resistance in rice (Oryza sativa L.). Springerplus 4:175
Yamamuro C, Ihara Y, Wu X, Noguchi T, Fujioka S, Takatsuto S, Ashikari M, Kitano H, Matsuoka
M (2000) Loss of function of a rice brassinosteroid insensitive1 homolog prevents internode
elongation and bending of the lamina joint. Plant Cell 12(9):1591–1606
Yanagihara S et al (1995) Molecular analysis of the inheritance of the S-5 locus, conferring
wide compatibility in indica/japonica hybrids of rice (Oryza sativa L.). Theor Appl Genet
90:182–188
Ye X, Al-Babili S, Klöti A, Zhang J, Lucca P, Beyer P, Potrykus I (2000) Engineering the pro-
vitamin A (β-carotene) biosynthetic pathway into (carotenoid free) rice endosperm. Science
287:303–305
Yi M, Nwe KT, Vanavichit A, Chaiarree W, Toojinda T (2009) Marker assisted backcross breed-
ing to improve cooking quality traits in Myanmar rice cultivar Manawthukha. Field Crops Res
113:178–186
Yin X, Biswal AK, Dionora J, Perdigon KM, Balahadia CP, Mazumdar S, Chater C, Lin HC,
Coe RA, Kretzschmar T, Gray JE, Quick PW, Bandyopadhyay A. (2017) CRISPR-Cas9 and
CRISPR-Cpf1 mediated targeting of a stomatal developmental gene EPFL9 in rice. Plant Cell
Rep. 36(5):745–757. https://doi.org/10.1007/s00299-017-2118-z.
Yuan LP, Fu XQ (1995) Technology of hybrid rice production. FAO, Rome
Zhang J, Li X, Jiang G, Xu Y, He Y (2006) Pyramiding of Xa7 and Xa21 for the improvement
of disease resistance to bacterial blight in hybrid rice. Plant Breed 125:600–605. https://doi.
org/10.1111/j.1439-0523.2006.01281.x
Zhang F, Jiang Y-Z, Yu S-B, Ali J, Paterson AH, Khush GS, Xu J-L, Gao Y-M, Fu B-Y, Lafitte R,
Li Z-K (2013) Three genetic systems controlling growth, development and productivity of rice
(Oryza sativa L.): a reevaluation of the ‘Green Revolution’. Theor Appl Genet 126:1011–1024
Zhou H, He M, Li J, Chen L, Huang Z, Zheng S, Zhu L, Ni E, Jiang D, Zhao B, Zhuang C (2016)
Development of commercial thermo-sensitive genic male sterile rice accelerates hybrid rice
breeding using the CRISPR/Cas9-mediated TMS5 editing system. Sci Rep 6:37395. https://
doi.org/10.1038/srep37395
Zuo SM, Yin YJ, Zhang L, Zhang YF, Chen ZX, Pan XB (2007) Breeding value and further mapping
of a QTL qSB-11 conferring the rice sheath blight resistance. Chin J Rice Sci 21(2):136–142
Zuo M, Zhu YJ, Yin YJ, Wang H, Zhang YF, Chen ZX, Gu SL, Pan XB (2014) Comparison and
confirmation of quantitative trait loci conferring partial resistance to rice sheath blight on chro-
mosome 9. Plant Dis 98(7):957–964
Open Access This chapter is licensed under the terms of the Creative Commons Attribution 4.0
adaptation, distribution and reproduction in any medium or format, as long as you give appropriate
credit to the original author(s) and the source, provide a link to the Creative Commons license and
indicate if changes were made.
The images or other third party material in this chapter are included in the chapter's Creative
Commons license, unless indicated otherwise in a credit line to the material. If material is not
included in the chapter's Creative Commons license and your intended use is not permitted by
statutory regulation or exceeds the permitted use, you will need to obtain permission directly from
the copyright holder.
Strategies for Engineering Photosynthesis
for Enhanced Plant Biomass Production
Wataru Yamori
Abstract Crop productivity would have to increase by 60–110% compared with

the 2005 level by 2050 to meet both the food and energy demands of the growing
population. Although more than 90% of crop biomass is derived from photosyn-
thetic products, photosynthetic improvements have not yet been addressed by
breeding. Thus, it has been considered that enhancing photosynthetic capacity is
considered a promising approach for increasing crop yield. Now, we need to iden-
tify the specific targets that would improve leaf photosynthesis to realize a new
Green Revolution. This chapter summarizes the various genetic engineering
approaches that can be used to enhance photosynthetic capacity and crop productiv-
ity. The targets considered for the possible candidates include Rubisco, Rubisco
activase, enzymes of the Calvin–Benson cycle, and CO2 transport, as well as photo-
synthetic electron transport. Finally, it describes the importance of considering
ways to improve photosynthesis not under the stable environmental conditions
already examined in many studies with the aim of improving photosynthetic capac-
ity, but under natural conditions in which various environmental factors, and espe-
cially irradiation, continually fluctuate.
Keywords Calvin–Benson cycle · CO2 assimilation · CO2 transport · Electron

transport · Photosynthesis · Rubisco
1 Introduction
Crop productivity would have to increase by 60–110% compared with the 2005
level by 2050 to meet both the food and energy demands of the growing population
(Tilman et al. 2011; Alexandratos and Bruinsma 2012). At the same time, the CO2
concentration in the atmosphere is increasing and is predicted to reach 550 μmol/
mol by 2050 (IPCC 2013; Ballantyne et al. 2012), which will lead to an increase in
air temperature. Thus, it is considered that approaches designed to improve plant
W. Yamori (*)
Institute for Sustainable Agro-Ecosystem Services, Graduate School of Agricultural and Life
Sciences, The University of Tokyo, Tokyo, Japan
e-mail: [email protected]

https://doi.org/10.1007/978-3-030-66530-2_2
32 W. Yamori
biomass and crop yield should take account of global climate change and the pre-
dicted future environmental conditions.
It has been reported that in most cases leaf photosynthetic rate does not correlate
positively with grain yield (Richards 2000). Some critical reviews suggest that
improving photosynthesis would not be a useful strategy for enhancing crop pro-
ductivity (Gu et al. 2014; Sinclair et al. 2004). However, a meta-analysis of several
studies on elevated CO2 experiments in various crops has indicated that any strategy
for increasing photosynthesis can enhance crop yield (Ainsworth et al. 2008).
Similarly, it has been proposed that altering photosynthetic electron transport rates
by manipulating the cytochrome b6/f complex can improve both the photosynthetic
capacity and crop yield of transgenic plants (Yamori et al. 2016a; Fig. 1). Enhancing
photosynthetic capacity in plants is now considered a promising approach for
increasing crop yield and decreasing the atmospheric concentration of CO2, which
is the primary component of greenhouse gases.
This chapter summarizes the various genetic engineering approaches that can be
used to enhance photosynthetic capacity and plant production. The targets consid-
ered for the possible candidates include Rubisco, Rubisco activase, enzymes of the
Calvin–Benson cycle, and CO2 transport, as well as photosynthetic electron
Fig. 1 Relationship
Total plant dry weight
between CO2 assimilation R2 = 0.67

rate at a CO2 concentration 45
of 390 μmol/mol, total
plant dry weight at the
(g/plant)
final stage, and grain yield 30

in rice. Wild type: open
triangles; transgenic plants
that contain variable 15
amounts of Rieske FeS
protein in the cytochrome
b6/f complex from 10 to
100% of wild-type levels:
0
filled circles. The 24 0 10 20 30
regression lines are shown
R2 = 0.68
Grain yield
(g/plant)
16
0
0 10 20 30
CO2 assimilation rate
(μmol/m2/s)
Strategies for Engineering Photosynthesis for Enhanced Plant Biomass Production 33
transport. Finally, it describes the importance of considering ways to improve pho-

tosynthesis not under the stable environmental conditions already examined in
many studies with the aim of improving photosynthetic capacity, but under natural
conditions in which various environmental factors, and especially irradiation, con-
tinually fluctuate.
2 Improving Rubisco Performance
2.1 Rubisco Kinetics
Rubisco (ribulose-1,5-bisphosphate carboxylase/oxygenase) is an enzyme involved

in the first step of CO2 fixation in photosynthesis (Fig. 2). Rubisco has a low cata-
lytic efficiency and can only fix approximately two to four CO2 molecules per sec-
ond per active site in higher C3 plants. Thus, 20–30% of the nitrogen in the leaves of
C3 plants is invested in Rubisco to compensate for its low activity (Spreitzer and
Salvucci 2002). There is a strong positive correlation between leaf Rubisco content
and photosynthetic rate (Evans 1989; Makino et al. 1997; Wright et al. 2004), indi-
cating that Rubisco would be rate-limiting as regards photosynthesis at the current
CO2 concentration. Rubisco can fix CO2 in photosynthesis and O2 in photorespira-
tion (Fig. 2). Photosynthetic CO2 fixation produces two molecules of phosphoglyc-
erate (PGA) for every carbon fixed, while photorespiration produces one PGA and
one phosphoglycolate (PGO). PGO must be recycled to PGA, with a loss of CO2
and NH3 via a photorespiratory pathway. Although the released CO2 may be re-fixed
by the chloroplasts and the NH3 re-assimilated in the leaves (Morris et al. 1988;
Busch et al. 2013), photorespiration is considered to be a wasteful reaction. Thus, it
may be possible to improve photosynthetic efficiency by modifying Rubisco in
plants to increase catalytic activity and/or decrease oxygenation rate.
In plants, Rubisco usually consists of two types of protein subunit: a chloroplast-
encoded large subunit, which contains the active site, and nuclear-encoded small
subunits. The introduction of Rubisco variants with high specificity values such as
that from C4 plants and cyanobacteria into plants could improve the photosynthetic
efficiency of crop plants. Previously, transgenic tobacco plants expressing Flaveria
bidentis (C4) and F. pringlei (C3) Rubisco large subunit chimeras revealed that the
substitution of methionine-309 with isoleucine is responsible for increases in the
carboxylation rate of Rubisco (Whitney et al. 2011). However, the CO2 assimilation
rate and plant growth were lower in transgenic plants than in wild-type plants since
transformants decreased the Rubisco content of the former compared with the latter.
Lin et al. (2014) successfully produced transgenic tobacco plants with functional
Rubisco by replacing the Rubisco with the large and small subunit genes found in
cyanobacterium. The transgenic plants increased the CO2 assimilation rate per
Rubisco content, but they grew more slowly than wild-type plants. Thus, although
mutated forms of Rubisco protein have been achieved in tobacco plants, the
34
Stomata CO2
Leaf
HCO3 - HCO3- Cell
Sugars C4 acid CO2pump
C4 cycle
C3 acid
HCO3-
Starch
CO2
O2
RuBP
SBPase Rubisco
activase
Calvin-Benson CO2
cycle PGO
PGA Photorespiratory
Rubisco CO2 bypass
NAPDH, ATP
Electron transport Chloroplast
Fig. 2 Strategies for engineering photosynthesis for enhanced plant biomass production. The targets considered for the possible candidates include Rubisco
catalysis, Rubisco activase, photorespiratory bypass, stomatal opening, introduction of C4 cycle, introduction of CO2 pump from cyanobacteria, Calvin–Benson
cycle, and electron transport
W. Yamori
site-directed mutagenesis of Rubisco has as yet been largely unsuccessful (Furbank

et al. 2015). If the replacement of the Rubisco variants of C3-type Rubisco (i.e., a
low catalytic turnover rate for Rubisco, kcat, and a low Michaelis–Menten constant,
Km; a high Km for CO2 indicates low CO2 affinity) with C4-type or cyanobacteria-
type Rubisco variants (i.e., high kcat and high Km) is successful, the transgenic C3
plants could enhance their photosynthetic efficiency and plant growth toward the
high-CO2 world of the near future.
Although the evidence from transplastomic studies of Rubisco indicates that the
catalytic variability resides within its large subunit, the importance of its small sub-
units to Rubisco catalysis has also attracted attention. Recent success has demon-
strated that the introduction of a C4-Rubisco small subunit (rbcS) gene from sorghum
into rice successfully produced chimeric Rubisco with a greater kcat in transgenic
rice (Ishikawa et al. 2011). This breakthrough could provide future ways to engineer
Rubisco in various important crops such as wheat and rice.
2.2 Photorespiration Bypass
Rubisco is a dual-function enzyme that fixes CO2 or O2, and these functions are
known as photosynthesis and photorespiration, respectively. While photosynthesis
results in a net fixation of CO2, the photorespiratory pathway requires ATP and
releases previously fixed CO2 (Fig. 3). The photorespiration rate is affected by the
concentration of CO2 in the chloroplast (Cc) relative to the O2 concentration, and
increases with increasing temperature. At current atmospheric CO2 concentrations
and a temperature of 30 °C, the rate of photorespiratory CO2 release from the mito-
chondria is approximately 25% of the CO2 assimilation rate (Sage et al. 2012).
Thus, lowering photorespiratory flux could alleviate the decrease in photosynthetic
efficiency in C3 plants. However, manipulations aimed at blocking the photorespira-
tory pathway had detrimental effects on plant growth (Kozaki and Takeba 1996;
Walker et al. 2016). Nonetheless, advances have been made for engineering plants
that can make better use of the CO2 released from photorespiration via photorespira-
tory bypasses (Carvalho et al. 2012; Kebeish et al. 2007; Maier et al. 2012;
Peterhansel et al. 2013).
To date, three different strategies have been designed to bypass photorespiration
in C3 plants (Fig. 3). The first pathway was engineered using Escherichia coli
encoded genes from the glycerate pathway that convert glycolate to glycerate and
release CO2 within the chloroplast (Kebeish et al. 2007; Peterhansel et al. 2013).
Transgenic plants engineered with this pathway decreased photorespiration and
enhanced photosynthesis, resulting in improved plant growth (Kebeish et al. 2007).
With the second approach, transgenic plants engineered with a glycolate catabolic
cycle designed to oxidize glycolate to CO2 in chloroplasts (Fig. 3) displayed higher
photosynthetic rates and greater plant growth (Maier et al. 2012; Peterhansel et al.
2013). These observations show that shifting glycolate metabolism from the photo-
respiratory pathway via peroxisome and mitochondria to the chloroplast is
36 W. Yamori
Chloroplastic glycerate bypass

Chloroplastic glycolate oxidation bypass
Peroxisomal glycerate bypass
Calvin-Benson ADP ATP

Bypass 2 cycle
PGA glycerate
NADH CO2 10 CO2 NAD+
7
+ acetyl-CoA RuBP NADH 6b
NAD
Tartronate
pyruvate CoA O2 semialdehyde
PGO 4c
CO2 9
8 1 NAD+ NADH CO2
NADH malate 2a
glyoxylate glycolate glyoxylate
NAD+ H2O H 2O 2 O 2 2a Bypass 1
2b
Chloroplast
glycolate glycerate
2b O2
2a NAD+
H 2O H2 O2 CO2 Bypass 3 NADH 6a
glyoxylate Tartronate hydroxypyruvate
Glu 4c semialdehyde 4d
3
2-OG NH 5
3
Peroxisome glycine serine
4a CO2 4b NH3
glycine serine
NAD+ NADH
Mitochondrion
Fig. 3 Schematic diagram of photorespiration in plants (black), with three bypasses to minimize
photorespiratory expenses engineered in plants (red, blue, green). Enzymatic reactions or metabo-
lite transport steps are indicated by arrows. (1) phosphogycolate phosphatase, (2a) glycolate oxi-
dase, (2b) catalase, (3) glyoxylate/glutamate aminotransferase, (4a) glycine decarboxylase, (4b)
serine hydroxymethyl transferase, (4c) glyoxylate carboligase, which catalyzes the decarboxyl-
ation of glyoxylate and ligation to a second molecule of glyoxylate to form tartronate semialde-
hyde, (4d) hydroxypyruvate isomerase, (5) serine/glyoxylate aminotransferase, (6a)
hydroxypyruvate reductase in photorespiration, (6b) tartronic semialdehyde reductase, (7) glycer-
ate kinase, (8) malate synthase, (9) NADP-malic enzyme, (10) pyruvate dehydrogenase. Rubisco
ribulose-1,5-bisphosphate carboxylase/oxygenase; RuBP ribulose-1,5-bisphosphate; PGA phos-
phoglycerate; PGO phosphoglycolate
beneficial for plants and can enhance photosynthesis. The third bypass was created
by short-circuiting the original C2 cycle to avoid NH3+ release and to prevent energy
loss in its refixation (Carvalho et al. 2012). The glyoxalase in peroxisomes can be
converted to hydroxypyruvate by introducing glyoxylate carboligase and hydroxypy-
ruvate isomerase from E. coli into the plant peroxisomes, and feeding them back to
the C2 cycle (Fig. 3) (Carvalho et al. 2012; Peterhansel et al. 2013). However, in
transgenic plants, the photorespiratory cycle has not yet been completely bypassed
and the short-circuiting led to damage of the photosynthetic apparatus and thus
deleterious phenotypes (Carvalho et al. 2012).
Facilitating photorespiratory flux through the overexpression of subunits of gly-
cine decarboxylase (GDC), which produces CO2 by the photorespiratory process,
could be another approach for improving photorespiration (Timm et al. 2016). GDC
comprises four proteins, three enzymes (P-protein, T-protein, and L-protein), and a
small lipoylated protein known as H-protein, which has no catalytic activity and
interacts with the other proteins. The overexpression of either GDC-H protein or
GDC-L protein in Arabidopsis thaliana resulted in increases in CO2 assimilation
rate and plant biomass (Timm et al. 2012, 2015, 2016). Additionally, the overex-
pression of GDC-H contributed to greater plant growth in tobacco (Nicotiana taba-
cum) in both a controlled environment and under field conditions (Lopez-Calcagno
et al. 2018). Although the underlying mechanism responsible for these effects has
not been fully elucidated, it has been proposed that the Calvin–Benson cycle is
stimulated by the increase in GDC activity, resulting in a decrease in the steady-
state levels of photorespiratory metabolites.
3 Improving Thermotolerance of Rubisco Activase
The Rubisco catalytic sites must be activated to fix CO2 (Fig. 2). This requires the
carbamylation of a lysine residue at the Rubisco catalytic site, allowing the binding
of Mg2+ and ribulose-1,5-bisphosphate (RuBP). Rubisco activase facilitates carba-
mylation and the maintenance of Rubisco activity by removing inhibitors such as
tight-binding sugar phosphates from the Rubisco catalytic sites in an ATP-dependent
manner (Spreitzer and Salvucci 2002; Portis Jr 2003; Parry et al. 2008).
In many plant species, the Rubisco activation state decreases at high tempera-
tures (Crafts-Brandner and Salvucci 2000; Salvucci and Crafts-Brandner 2004a;
Yamori et al. 2006b, 2014; Yamori and von Caemmerer 2009). Rubisco deactivation
at high temperature could have occurred because Rubisco activase is insufficiently
active to keep pace with the faster rates of Rubisco inactivation at high temperature
due to its thermolability (Salvucci and Crafts-Brandner 2004b). A decrease in
Rubisco activase content resulted in decreases in photosynthetic rate at high tem-
perature when using mutants/transgenic plants in Arabidopsis (Salvucci et al. 2006),
rice (Yamori et al. 2012), and tobacco (Yamori and von Caemmerer 2009). Also, the
overexpression of Rubisco activase from maize into rice stimulated the Rubisco
activation state and photosynthetic rate at high temperature (Yamori et al. 2012).
Moreover, transgenic Arabidopsis expressing thermotolerant Rubisco activase iso-
forms generated by either gene shuffling technology (Kurek et al. 2007) or chimeric
Rubisco activase constructs (Kumar et al. 2009) improved photosynthesis, biomass
production, and seed yield. In addition, the introduction of Rubisco activase from
cotton into a cool-season species such as Camelina resulted in improvement in the
thermotolerance of photosynthesis (Carmo-Silva and Salvucci 2012). This is also
supported by a recent report stating that genes encoding thermostable Rubisco
38 W. Yamori
activase from a wild relative (Oryza australiensis) were overexpressed in domesti-

cated rice (O. sativa), leading to an improvement in plant growth and seed yield in
rice under heat stress (Scafaro et al. 2018). Taken together, Rubisco activase activity
would constitute a major limiting factor for photosynthesis under high temperature
and engineering Rubisco activase would be an efficient way to improve crop yield
under high temperatures. The structure of Rubisco activase has already been deter-
mined, providing insight into its interactions with Rubisco (Stotz et al. 2011) and its
counterpart CbbX in red algae (Mueller-Cajar et al. 2011). This structural informa-
tion coupled with the knowledge of regulation in Rubisco activase will help to
improve its thermostability and catalytic properties.
4 Increasing CO2 Concentration Around Rubisco
Photosynthesis in C3 plants is limited by the large drawdown in CO2 concentrations

from the atmosphere to the Rubisco catalytic sites in chloroplasts. The CO2 diffu-
sion conductance responsible for this drawdown is attributed to the stomatal pores
and the paths across the mesophyll from the cell surface to the Rubisco catalytic
sites in chloroplasts (Evans et al. 2009). Increasing CO2 concentration in chloro-
plasts and thereby minimizing photorespiration is therefore a promising target in
terms of increasing photosynthetic rate in crops. CO2 diffusion to the chloroplast
can be influenced by modifying conductance through the stomata (stomatal conduc-
tance) to the intercellular air space, either by increasing stomatal density (Tanaka
et al. 2013) or by preventing stomatal closure (Kusumi et al. 2012; Yamori et al.
2020). Both approaches would result in increases in photosynthetic rate at the cost
of higher transpiration rates and lower water-use efficiency.
An alternative approach addresses the other major diffusion conductance route
for CO2 from the intercellular air space into the mesophyll cell chloroplasts (meso-
phyll conductance). In contrast to modifying stomatal conductance, increasing
mesophyll conductance does not negatively affect water-use efficiency. The resis-
tance of the cell wall (25–50%) and chloroplast (24–76%) accounts for most of the
total resistance (Evans et al. 2009), meaning that CO2 diffusion can potentially be
improved by modifying plants so that they have smaller mesophyll cells (i.e., a
higher surface area of the chloroplasts is exposed to intercellular air spaces, Sc) with
thinner cell walls (Terashima et al. 2011). The second important component of
mesophyll conductance involves CO2 diffusion through the plasma and chloroplast
membranes (Evans et al. 2009), and several approaches are being developed to
increase CO2 concentration in chloroplasts in C3 plants by increasing membrane
permeability for CO2. Aquaporins that are permeable to CO2 are proteins that assist
CO2 diffusion through the membranes by providing pores through which CO2 can
be channeled (Kaldenhoff 2012). It has been shown that disruption to the aquaporin
AtPIP1;2 gene limits CO2 transport across the membrane (Heckwolf et al. 2011),
while the overexpression of different aquaporin genes results in increased gm (Hanba
et al. 2004; Flexas et al. 2006). Furthermore, it has been shown that the expression
of an aquaporin in A. thaliana stimulates CO2 flux through a mesophyll membrane

(Uehlein et al. 2012).
Once CO2 is transferred to the cytosol, it is partially converted into HCO3− to
facilitate its diffusion into the chloroplast, and the HCO3− is then dehydrated back
to CO2 by carbonic anhydrase to maintain a high CO2 flux through the chloroplast
membrane. Thus, carbonic anhydrase plays a role in facilitating the diffusion of CO2
in the chloroplast stroma by interconverting between CO2 and HCO3− (Evans et al.
2009). It has been suggested that the amount of carbonic anhydrase found in plants
somewhat limits conductance in the stroma of C3 crops, and thus there would be a
possibility to improve this aspect by molecular engineering (Tholen and Zhu 2011).
A substantial increase in the CO2 concentration around Rubisco to enhance pho-
tosynthesis and water-use efficiency has been expected as the result of the installa-
tion of a carbon concentrating mechanism (CCM) in C3 plants (Fig. 4). Cyanobacteria
have evolved a CCM in which Rubisco is encapsulated in a cellular compartment
known as a carboxysome (Price et al. 2011). In carboxysomes, CO2 concentration is
enriched by up to 1000-fold, thus significantly decreasing the photorespiration rate.
Chloroplast
Cell wall
H+
Na+
CO2 pump
bicA
sbtA
Na+
HCO3 -
HCO3-
CA O2 Peroxisome
CA
Rubisco
CO2
CO2 CO2 CO2
Carboxysome
stomata
aquaporin
CO2
Mitochondrion
Intercellular
air space Cytosol
Fig. 4 Schematic diagram of mechanisms for concentrating CO2 around Rubisco. The diagram
shows CO2 transfers from the outside to the intercellular air space through the stomatal pore and
the CO2 diffuses through the cell wall and plasma membrane into the cytosol. Aquaporins assist the
CO2 diffusion into the cytosol of the mesophyll cell through the membranes by providing pores
through which CO2 can be channeled. Introducing a cyanobacterial HCO3− transporter (e.g., bicA
and sbtA) into the chloroplast envelope could improve CO2 transport. The introduction of a
Rubisco- and carbonic-anhydrase-containing compartment, such as the carboxysome, could fur-
ther increase the CO2 concentration around Rubisco, resulting in minimization of the photorespira-
tion rate. (The figure is adapted from Price et al. (2011) and Yamori et al. (2016b))
40 W. Yamori
To incorporate CCM from cyanobacteria into C3 plants, the following distinct fea-
tures need to be addressed: (1) CO2 and HCO3− transport mechanism and (2) func-
tional carboxysome assembly. Incorporating cyanobacterial HCO3− transporters
into the chloroplast envelope of C3 plants would provide a parallel route for inor-
ganic carbon to enter the chloroplast, in addition to the diffusion of dissolved CO2
(Price et al. 2011, 2013). To date, five different inorganic carbon transport mecha-
nisms have been identified in cyanobacteria (Price et al. 2011, 2013). A previous
study showed that overexpressing the ictB gene, an HCO3− transporter in cyanobac-
teria, in A. thaliana and N. tabacum plants contributed more to increases in photo-
synthesis and water-use efficiency than in the wild type (Lieman-Hurwitz et al.
2003). Furthermore, the overexpression of the ictB gene in soybeans led to increases
in mesophyll conductance, photosynthesis, and plant productivity in both ambient
and elevated CO2 environments under both greenhouse and field conditions (Hay
et al. 2017). It is now considered that a fully functional CCM in C3 plants would
require the introduction of HCO3− transporters, adjustments in the expression of
chloroplast carbonic anhydrase to allow HCO3− accumulation, and the establish-
ment of a Rubisco- and carbonic-anhydrase-containing compartment, such as a car-
boxysome (Price et al. 2011, 2013). Recently, well-assembled carboxysome
structures were successfully expressed in plants (Long et al. 2018). Incorporation of
cyanobacterial Rubisco large and small subunit genes along with genes for carboxy-
some structural proteins could improve Rubisco catalytic properties, but decrease
total Rubisco content, resulting in lower photosynthetic rates and growth than in
tobacco wild-type (Long et al. 2018). Since the incorporation of CCM into crops
has been expected to improve crop yields, efforts toward transplantation are
under way.
C4 plants evolved CCM in two types of photosynthetic cells, where CO2 is ini-
tially fixed in the mesophyll cells by the enzyme phosphoenolpyruvate carboxylase
(PEPC) to produce a C4 acid. The organic acid diffuses to the bundle-sheath cells,
where it is decarboxylated, resulting in significantly increased CO2 concentrations
around Rubisco. Currently, considerable efforts are under way to incorporate the
features of the complex C4 pathway into C3 crops such as rice (Covshoff and Hibberd
2012; von Caemmerer et al. 2012). Challenges associated with this approach include
morphological adjustments, such as the establishment of a Kranz(-like) anatomy, as
well as the introduction of C4 biochemistry into C3 leaves. The benefits of the intro-
duction of the C4 photosynthetic pathway would include higher yield as well as
improved nitrogen-use efficiency and water-use efficiency.
5 Enhancing Activity of Calvin–Benson-Cycle Enzymes
The Calvin–Benson cycle uses ATP and NADPH from photosynthetic electron
transport to fix CO2 in carbon skeletons that are mainly used for sucrose and starch
production (Fig. 2). The Calvin–Benson cycle also supplies intermediates to many
other pathways in the chloroplast, including the shikimate pathway for the
biosynthesis of amino acids, lignin, isoprenoid, and precursors for nucleotide

metabolism and cell wall synthesis. This cycle comprises 11 different enzymes,
catalyzes 13 reactions, and is initiated by Rubisco (Raines 2003). Four of the 11
enzymes are regulated by thioredoxins: glyceraldehyde 3-phosphate dehydrogenase
(GAPDH), fructose 1,6-bisphosphatase (FBPase), sedoheptulose-1,7-bisphospha-
tase (SBPase), and phosphoribulokinase (PRK). Two of the 11 enzymes catalyze
reversible reactions: aldolase and transketolase.
Previous studies have demonstrated that moderate reductions in Calvin–Benson-
cycle enzymes such as SBPase and fructose 1,6-bisphosphate aldolase (FBPA)
induce significant decreases in photosynthetic rate and plant growth, indicating that
these enzymes would limit photosynthesis (Ding et al. 2016; Haake et al. 1998,
1999; Harrison et al. 1998, 2001; Lawson et al. 2006; Ölcer et al. 2001; Raines
2003; Raines and Paul 2006; Raines et al. 1999; Hatano-Iwasaki and Ogawa 2012).
Furthermore, the disruption of the chloroplastic FBPase was also shown to nega-
tively affect photosynthetic rate (Kossmann et al. 1994; Rojas-González et al. 2015;
Sahrawy et al. 2004). These results strongly suggest that photosynthetic CO2 fixa-
tion could be improved by increasing the activity of individual Calvin–Benson-
cycle enzymes. Evidence supporting this hypothesis was provided by transgenic
tobacco plants overexpressing SBPase (Lefebvre et al. 2005; Tamoi et al. 2006),
FBPase (Tamoi et al. 2006), the cyanobacterial bifunctional SBPase/FBPase
(Miyagawa et al. 2001), or FBPA (Uematsu et al. 2012). These single manipulations
resulted in increases in photosynthetic rate and plant growth. Recently, SBPase has
been receiving a lot of attention, and its role in determining carbon flux in the
Calvin–Benson cycle under natural environmental conditions has been revealed.
Transgenic tobacco plants overexpressing SBPase from A. thaliana exhibited an
enhanced photosynthetic rate and biomass production when grown under free-air
CO2 enrichment (FACE) conditions at a CO2 concentration of 585 μmol/mol
(Rosenthal et al. 2011). Moreover, the expression of cyanobacterial bifunctional
FBPase/SBPase increases photosynthetic rate in soybeans grown under field condi-
tions and prevents yield losses under high-CO2 and high-temperature conditions
(Köhler et al. 2016). In addition, transgenic lines with increased SBPase exhibited
improvement of leaf photosynthesis, total biomass, and seed yield in wheat under
greenhouse conditions (Driever et al. 2017). Taken together, the manipulation of
SBPase could increase photosynthetic capacity and could be an efficient way to
improve photosynthetic rate and crop yield, especially in a future high-CO2 world.
6 nhancing Electron Transport Rate

E
in Thylakoid Membranes
ATP and NADPH generated during photosynthetic electron transport in thylakoid

membranes are used to power photosynthetic carbon reduction. In a future high-
CO2 world, CO2 assimilation rate would be limited by the RuBP regeneration rate in
the Calvin–Benson cycle (Farquhar et al. 1980), which in turn will be limited by
42 W. Yamori
chloroplast electron transport capacity (Yamori et al. 2011). The cytochrome b6/f
complex has a unique role in chloroplast electron transport (Fig. 5) as it can act in
both linear electron transport (production of ATP and NADPH) and cyclic electron
transport (ATP generation only). There is a strong linear relationship between chlo-
roplast electron transport rate and cytochrome b6/f complex content at any leaf tem-
perature (Yamori et al. 2011). Thus, this could be a suitable target for genetic
manipulation to improve photosynthesis and thus plant yield.
Previous experiments with antisense lines have shown that even a moderate
decrease in the amounts of chloroplastic ferredoxin NADP(H) oxidoreductase
(FNR), which catalyzes the terminal reaction of the photosynthetic electron trans-
port chain by transferring electrons from reduced ferredoxin to NADP+, has a nega-
tive impact on photosynthetic rate under both low and high light conditions
(Hajirezaei et al. 2002). However, the overexpression of FNR (Rodriguez et al.
NADPH
Stroma NADP+
(pH ≒ 8)
FNR
Fd
PS II Plasto Cyt PS I
quinone b6/f
Plasto
cyanin
ATP
H 2O O2 + H+ H+ ATP
synthase
Lumen H+
(pH ≒ 6) ADP
H+
KEA3
Best1/
VCCN1
TPK3
K+ K+ Cl-
Fig. 5 Schematic diagram of electron transport in thylakoid membranes. Electron transport,

driven by the excitation of photosystem I (PS I) and photosystem II (PS II), results in the reduction
of NADP+ to NADPH and the accumulation of protons in the thylakoid lumen. The resulting pro-
ton motive force (pmf), which constitutes ∆pH across the thylakoid membrane as well as mem-
brane potential (Δψ), is used to produce ATP through ATP synthase. Linear electron transport
generates both ATP and NADPH, whereas cyclic electron transport produces ATP without produc-
ing NADPH. Several ion channels, such as the thylakoid K+ channel TPK3, K+ efflux antiporters
KEA, and Cl− channel Best1/VCCN1, would adjust Δψ and ΔpH and function to fine-tune pmf
and thus electron transport via pH-dependent NPQ. PS II: photosystem II, Cyt b6f, cytochrome b6/f
complex, PS I: photosystem I, Fd: ferredoxin. FNR: ferredoxin-NADP+ reductase
2007) or ferredoxin (Yamamoto et al. 2006) did not increase photosynthesis or plant
growth in tobacco, irrespective of growth light conditions. Electron transfer between
the cytochrome b6/f complex and photosystem I is mediated by plastocyanin in
higher plants, whereas, in many algae, it is mediated by cytochrome c6. Variations
in plastocyanin levels have been reported to coincide with variations in photosyn-
thetic electron transport activity (Burkey 1994; Burkey et al. 1996; Schöttler et al.
2004), leading to the conclusion that plastocyanin pool size could limit photosyn-
thetic electron transport. It has been reported that the introduction of a parallel elec-
tron carrier between the cytochrome b6/f complex and photosystem I through the
expression of an algal cytochrome c6 gene in A. thaliana improved electron trans-
port rate, leading to improved plant growth (Chida et al. 2007). An analysis of
knockout plants for two homologous plastocyanin isoforms (PETE1 and PETE2) in
A. thaliana showed that plastocyanin content can be significantly decreased with no
apparent changes in photosynthetic rate, suggesting that the concentration of plas-
tocyanin does not limit photosynthetic electron transport rate (Pesaresi et al. 2009).
However, the overexpression of either PETE1 or PETE2 results in an increase in
biomass production (Pesaresi et al. 2009). Thus, there is still a discrepancy between
the experimental knockout data and the overexpression lines.
It was also shown in antisense studies that decreasing Rieske FeS protein content
resulted in a decrease in cytochrome b6/f complex level, leading to a decrease in
photosynthetic electron transport, plant biomass, and seed yield in tobacco and rice
(Price et al. 1998; Yamori et al. 2016a). These findings identified the cytochrome
b6/f complex as a limiting step in electron transport and would suggest that the over-
expression of Rieske FeS protein could be a suitable target for increasing photosyn-
thesis and yield. This has been proven by recent work showing that the overexpression
of Rieske FeS protein had a substantial and significant impact on electron transport,
plant biomass, and seed yield in Arabidopsis plants (Simkin et al. 2017).
Other reports have documented an enhancement in plant biomass realized by the
genetic manipulation of photosynthetic electron transport. In plant cells, NADP is
mainly located in the chloroplast, where NADP+ functions as the final electron
acceptor of the photosynthetic electron transport chain (Wigge et al. 1993). NAD
kinase regulates the NAD(H)/NADP(H) balance through its catalysis of NAD phos-
phorylation in the presence of ATP (Kawai and Murata 2008). In A. thaliana, one of
the NADK isoforms localized in the chloroplast (NADK2; Chai et al. 2005) cata-
lyzes a key step in the regulation of NAD/NADP ratio (Kawai and Murata 2008).
The overexpression of chloroplastic NADK2 from Arabidopsis plants into rice suc-
ceeded in enhancing electron transport and CO2 assimilation rates (Takahara
et al. 2010).
In situations in which the electron transport rate is limited by the amount of
available light that can be absorbed by the plant, increased light harvesting might
enhance photosynthetic rate and plant productivity. Land plants use chlorophyll a
and b, which absorb light at wavelengths of 400–700 nm. Chlorophyll d, which is
used by Acaryochloris (Miyashita et al. 1996), and chlorophyll f, which was discov-
ered in the cyanobacterial communities of stromatolites (Chen et al. 2010), have
red-shifted absorption spectra that enable their host organisms to perform oxygenic
44 W. Yamori
photosynthesis at the much longer wavelengths of 700–750 nm, which are inacces-
sible to other organisms. Introducing these chlorophylls into higher plants to sup-
plement or replace the existing chlorophylls could potentially increase the amount
of usable photon flux by up to 19% (Chen and Blankenship 2011). The up-regula-
tion of Arabidopsis chlorophyllide a oxygenase (CAO), involved in chlorophyll b
biosynthesis, in tobacco has been shown to increase electron transport rate, CO2
assimilation, and plant biomass (Biswal et al. 2012). In addition, plants with a muta-
tion in TAP38, an enzyme involved in the dephosphorylation of the light harvesting
complex of photosystem II, exhibited an increased photosynthetic electron flow,
leading to improved plant growth under low-light conditions (Pribil et al. 2010). In
the same manner, facilitation of the chloroplast accumulation response, which
shows that chloroplasts accumulate along periclinal cell walls at low light, led to
improved leaf photosynthesis and plant biomass production in A. thaliana (Gotoh
et al. 2018). Since the photosynthetic electron transport chain provides energy and
reducing equivalents for the reduction of fixed CO2 to carbohydrates in the Calvin–
Benson cycle as well as for nitrogen assimilation and other processes, the genetic
manipulation of photosynthetic electron transport could be a candidate for improv-
ing the entire photosynthetic system, and thus plant yield.
7 I mproving Photosynthetic Performance Under Fluctuating

Light in Natural Environments
Research into finding ways to increase crop yield has focused on improving steady-
state photosynthesis. However, leaves in natural plant canopies experience a highly
variable light environment over the course of a day because of changes in cloud
cover and overshadowing canopy cover (Fig. 6; Yamori 2016). By contrast, trans-
genic plants have not yet been used to clarify the limiting step of non-steady-state
photosynthesis, and thus few studies address the improvement of non-steady-state
photosynthesis. When light intensity is increased suddenly after a prolonged period
of low light or darkness, photosynthetic rate increases gradually over several min-
utes and approaches a steady state (Pearcy 1990; Yamori 2016). This phenomenon
has been termed “photosynthetic induction,” and it is typically divided into three
limiting phases: (1) electron transport systems; (2) activation of Calvin-cycle
enzymes, especially Rubisco; and (3) CO2 diffusion into the chloroplast (Fig. 6).
The first of these three phases is often completed within 1–2 min of increases in
irradiance, the second requires 5–10 min, and the third could take 10–30 min to
reach a steady-state (Pearcy 1990). The slow induction results in a time lag between
the changes in irradiance and those in the photosynthetic rate. This delay may cause
damage to the photosynthetic apparatus and eventually decrease plant productivity
if excess energy accumulates during repeated fluctuations in light intensity (Murchie
and Niyogi 2011; Tikkanen et al. 2012; Yamori 2016; Yamori et al. 2016c). Daily
photosynthetic rates under fluctuating light conditions can be up to 20–35% lower
1200 High light

Light intensity
(μmol/m2/s)
900
1. Electron transport
Limiting Factor
600
2. Calvin-Benson
300
3. CO2 diffusion
0
0 3 6 9 12
20
Photosynthetic rate
Photosynthetic rate
(μmol/m2/s)
15
10 Photosynthetic
Induction
5
0
0 3 6 9 12
Time (min)
Time (hours)
Fig. 6 Representative responses of photosynthetic rate under field light conditions. The natural
light fluctuations were mimicked in portable photosynthesis systems (LI-6400XT), and the photo-
synthetic rates at a CO2 concentration of 400 μmol/mol were measured under these light condi-
tions. Three arrows in the right figure indicate major biochemical processes limiting photosynthetic
induction with different time courses
than the optimal photosynthetic rates under constant light (Naumburg and Ellsworth
2002; Taylor and Long 2017). Therefore, characterization of the mechanisms that
regulate photosynthetic responses to fluctuating light intensities may lead to
improved photosynthetic induction and crop yield under natural conditions (Tanaka
et al. 2019). The following section summarizes the various genetic engineering
approaches that can be used to enhance photosynthesis under fluctuating light con-
ditions (Fig. 7).
7.1 Electron Transport
Photosynthetic electron transport systems consist of linear and cyclic electron trans-
port around photosystem I (Fig. 7). Linear electron transport generates both ATP
and NADPH for a Calvin–Benson cycle, photorespiration, and other metabolisms.
On the other hand, cyclic electron transport produces ATP without producing
NADPH to balance the ATP/NADPH production ratio and is now considered to be
46
Fig. 7 Strategies for engineering steady-state and non-steady-state photosynthesis. The possible targets would be (1) Rubisco catalysis; (2) Rubisco activase;
(3) photorespiratory bypass; (4) stomatal opening; (5) introduction of C4 cycle; (6) introduction of CO2 pump from cyanobacteria; (7) light-induced activation
of enzymes in the Calvin–Benson cycle by ferredoxin-thioredoxin (TRX) system; (8) electron transport including cyclic electron flow via PGR5-PGRL1 and
W. Yamori
NDH complex, flavodiiron protein (Flv), and various ion channels/transporters across chloroplast envelopes and thylakoid membranes (i.e., Best1/VCCN1,
TPK3, KEA3); and (9) thermal dissipation of excess absorbed light via the protonation of PsbS protein and the activation of a xanthophyll cycle
essential in providing protection from photodamage via the thermal dissipation of

excess absorbed light (NPQ, non-photochemical quenching) (Yamori and Shikanai
2016). There are two cyclic electron flows around photosystem I: the main pathway
depends on PGR5/PGRL1 proteins and the minor pathway depends on a chloroplast
NADH dehydrogenase-like (NDH) complex. It has been shown in rice that PGR5/
PGRL1-dependent cyclic electron transport is a key regulator of rapid photosyn-
thetic responses to high light intensity under fluctuating light, and that both PGR5/
PGRL1-dependent and NDH-dependent cyclic electron transport have physiologi-
cal roles for photoprotection in sustaining photosynthesis and plant growth in rice
under repeated light fluctuations (Yamori et al. 2016c). In cyanobacteria, pseudo-
cyclic electron transport by flavodiiron protein (Flv) mediates the photoreduction of
O2 to H2O and is essential for photosystem-I photoprotection in fluctuating light
(Allahverdiyeva et al. 2013). Recent work indicated that the introduction of the Flv
gene from moss (Physcomitrella patens) into Arabidopsis and rice led to the
enhancement of cyclic electron transport, resulting in successful improvement of
the resistance of photosynthetic machinery under fluctuating light conditions
(Fig. 7; Yamamoto et al. 2016; Wada et al. 2018).
NPQ can be activated and relaxed within minutes and is a highly regulatory pro-
cess involving multiple factors, such as the protonation of PsbS protein and the
activation of a xanthophyll cycle that converts the pigment violaxanthin (V) to
antheraxanthin (A) and zeaxanthin (Z) (for a review, see Yamori and Shikanai 2016).
In tobacco, the simultaneous overexpression of PsbS, violaxanthin de-epoxidase,
and zeaxanthin epoxidase increases the rate of NPQ relaxation, which subsequently
increases growth under fluctuating light in field conditions (Fig. 7; Kromdijk et al.
2016). Thus, plant productivity and crop yield appear to be highly dependent on
NPQ under fluctuating light conditions in nature.
It has been reported that ion channels/transporters across chloroplast enve-
lopes and thylakoid membranes play fundamental roles in the regulation of pho-
tosynthetic electron transport (Figs. 5 and 7; Finazzi et al. 2015). Photosynthetic
electron transport is coupled with proton translocation across the thylakoid
membrane, resulting in the formation of transmembrane H+ concentration (ΔpH)
and electrical potential (ΔΨ) gradients. Although both ΔpH and Δψ contribute
to ATP synthesis as a proton motive force (pmf), only the ΔpH component can
activate the PsbS- and xanthophyll-cycle-dependent NPQ while down-regulat-
ing electron transport during the plastoquinol oxidation step at the cytochrome
b6/f complex (photosynthetic control, Kramer et al. 2003; Yamori and Shikanai
2016). Recent evidence suggests that several ion channels, such as the thylakoid
K+ channel TPK3, K+ efflux antiporter KEA3, and Cl− channel Best1/VCCN1,
adjust electron transport and functions in photoprotective mechanisms (Figs. 5
and 7; Carraretto et al. 2013; Kunz et al. 2014; Duan et al. 2016; Herdean et al.
2016). The knockout of Best1/VCCN1, which leads to an influx of Cl− into the
lumen, resulted in disturbance of the pmf components, resulting in a decreased
rate of NPQ induction (Duan et al. 2016; Herdean et al. 2016). These data sug-
gest that a Cl− influx into the lumen would fine-tune pmf and allow the plant to
adjust photosynthesis to variable light. On the other hand, TPK3 effluxes K+
48 W. Yamori
from the thylakoid lumen to the stroma and partially dissipates ΔΨ to allow
more H+ to enter the lumen and thus enables a significant ΔpH to be formed,
thus balancing photoprotection and photochemical efficiency (Carraretto et al.
2013). Moreover, KEA3 effluxes H+ with the counter influx of K+, exchanging
Δψ for ΔpH, which is critical for photosynthetic acclimation after transitions
from high to low light (Kunz et al. 2014; Armbruster et al. 2014). The activity
of KEA3 accelerates the down-regulation of pH-dependent NPQ after transi-
tions to low light, leading to the faster recovery of high photosystem II quantum
efficiency and increased CO2 assimilation. The overexpression of KEA3 accel-
erates the relaxation of photoprotective energy-dependent quenching after tran-
sitions from high to low light in Arabidopsis and tobacco (Armbruster et al.
2016). Thus, the KEA3 function is critical in terms of realizing high photosyn-
thetic efficiency under fluctuating light. Taken together, these findings under-
score the potential for accelerating NPQ relaxation once light intensity is
decreased so as not to decrease the efficiency of light energy use under light-
limiting conditions in improving photosynthetic efficiency under fluctuating
light in field conditions (Fig. 7).
7.2 Activation of Calvin-Cycle Enzymes, Especially Rubisco
Rubisco must be activated by Rubisco activase to catalyze CO2 assimilation in the

Calvin–Benson cycle (Fig. 7). A positive relationship has been observed between
Rubisco activase content and the speed of the photosynthetic induction response in
A. thaliana (Mott et al. 1997), tobacco (Hammond et al. 1998; Yamori and von
Caemmerer 2009), and rice (Masumoto et al. 2012; Yamori et al. 2012). Thus, it is
considered that the Rubisco activation state could be a limiting factor for the induc-
tion response to a sudden increase in light intensity. In most species, Rubisco acti-
vase is present in two isoforms: redox-regulated α-isoform and redox-insensitive
β-isoform (Portis Jr 2003). In transgenic Arabidopsis plants containing only the
β-isoform, photosynthetic induction after a transition from low to high light was
faster than in the wild type, as Rubisco activase activity was constitutively high and
independent of irradiance (Carmo-Silva and Salvucci 2013; Kaiser et al. 2016).
Furthermore, the overexpression of β-isoform from maize in rice led to an improve-
ment in photosynthetic induction via the rapid regulation of the Rubisco activation
state by Rubisco activase following an increase in light intensity and/or the mainte-
nance of a high Rubisco activation state under low light (Yamori et al. 2012). Taken
together, modifying the concentration of Rubisco activase and its composition could
be used to improve photosynthetic performance and plant growth under fluctuating
light conditions.
Thioredoxins are ubiquitous enzymes in chloroplasts, and the thioredoxin sys-
tems are responsible for the light-induced activation of enzymes in the Calvin–
Benson cycle, including GAPDH, FBPase, SBPase, and PRK (Thormählen et al.
2017); ATP synthesis (Hisabori et al. 2013); malate-oxaloacetate shuttle
(Miginiac-Maslow et al. 2000); and starch metabolism (Thormählen et al. 2013).

There are two plastid thioredoxins systems: (1) the ferredoxin-thioredoxin sys-
tem, which consists of ferredoxin-thioredoxin reductase (FTR) and multiple thio-
redoxins, and (2) the NADPH-dependent thioredoxin reductase (NTRC) system,
which contains a complete thioredoxin system (Fig. 7). Recent reports focusing
on the overexpression of chloroplast thioredoxin components in plants support the
concept of the high impact of thioredoxins on plant fitness. Transgenic tobacco
lines overexpressing thioredoxin f, one of the thioredoxin families, showed a large
increase in plant biomass and starch content, which was further stimulated by an
increase in light intensity (Sanz-Barrio et al. 2013). The overexpression of the
endogenous NTRC gene in Arabidopsis also increased plant growth under moder-
ate light intensity (Toivola et al. 2013). Furthermore, a recent study showed that
both ferredoxin-dependent thioredoxin m, one of the thioredoxin families, and
NADPH-dependent NTRC are indispensable for photosynthetic acclimation in
fluctuating light intensities (Nikkanen et al. 2016; Thormählen et al. 2017). Thus,
it is highly possible that thioredoxin-mediated redox regulation allows the activa-
tion state of these enzymes to be modulated in response to fluctuating light in field
conditions.
7.3 CO2 Diffusion into the Chloroplast
The diffusion of CO2 to the Rubisco catalytic sites in the chloroplast is mediated
by both stomatal and mesophyll conductance (Fig. 7). Under naturally fluctuating
environmental conditions, stomatal responses are much slower than photosyn-
thetic responses. Manipulating stomatal conductance so that it responds more
quickly to irradiance could greatly enhance photosynthesis and water-use effi-
ciency in fluctuating irradiance (Lawson and Blatt 2014; Vialet-Chabrand et al.
2017). Removal of the stomatal limitation could increase photosynthetic induc-
tion in aba2-1 Arabidopsis mutant, which impaired ABA synthesis and thus
showed constitutively high stomatal conductance (Kaiser et al. 2016). Moreover,
SLAC1-deficient rice mutant, which knocked out an anion channel protein in the
plasma membrane of stomatal guard cells, constitutively opened stomata and con-
tributed to higher photosynthetic rates more than the wild type in naturally fluctu-
ating light (Yamori et al. 2020). Papanatsiou et al. (2019) induced a synthetic,
light-gated K+ channel in guard cells in Arabidopsis and succeeded in facilitating
stomatal opening under light exposure and closing after irradiation, leading to
greater plant growth in fluctuating light. Furthermore, several Arabidopsis mutants
with stay-open stomata and the PATROL1 (proton ATPase translocation control 1)
overexpression Arabidopsis line with faster stomatal opening responses exhibited
higher photosynthetic rates and plant growth in fluctuating light than the wild
type, whereas those lines showed similar photosynthetic rates and plant growth in
constant light (Shimadzu et al. 2019; Kimura et al. 2020). Taken together,
50 W. Yamori
enhancing stomatal conductance could result in better use of plant photosynthetic

capacity in naturally fluctuating light.
In addition to stomatal conductance, mesophyll conductance could place a large
diffusional limitation on photosynthesis. The extent to which mesophyll conduc-
tance limits photosynthesis under fluctuating light is largely unknown, although it
has been reported that mesophyll conductance could impose a major limitation to
photosynthesis during the steady state. Mesophyll conductance can vary within
minutes, and is affected by changes in irradiance, CO2, and temperature (Flexas
et al. 2007, 2008, 2012; Tazoe et al. 2011; Tholen et al. 2008; Yamori et al. 2006a),
making it a potentially important process. Recently, we succeeded to characterize
induction both of mesophyll conductance and stomatal conductance after a step
change in light from darkness to high or low light and showed that mesophyll con-
ductance would impose a smaller limitation to photosynthesis under fluctuating
light conditions, but both of mesophyll conductance and stomatal conductance
would contribute to the limitation of photosynthesis during induction (Sakoda et al.
2021). Relevant factors that might contribute to variations in mesophyll conduc-
tance are carbonic anhydrase and aquaporins.
8 Future Prospects
The present rate of increase in crop yields is insufficient to keep pace with the rapid
increase in the global population. Thus, the development of crops with higher yield
by improving photosynthesis is essential if we are to meet future food and energy
demands. Therefore, suitable approaches must be explored for generating more effi-
cient plants with higher yield. Enhancement of leaf photosynthetic capacity would
provide one attractive way of achieving increases in crop yield since plant growth
depends largely on photosynthesis. In this review, we have highlighted crucial tar-
gets that could be manipulated to enhance crop productivity (Fig. 7). To date,
research into finding new ways to increase crop yield has focused on improving
steady-state photosynthesis. However, leaves in natural plant canopies experience a
highly variable light environment over the course of a day. Thus, the improvements
in photosynthesis and yield observed in model plants grown in constant growth
chambers may not be completely transferrable to crop species under field condi-
tions. Therefore, an understanding of the key factors operating in natural environ-
ments and responsible for increases in yield is essential if we are to achieve the
maximum yield potential.
Furthermore, improving photosynthesis to increase food production ultimately
means maximizing the photosynthetic efficiency of the crop canopy rather than that of
an individual plant. One approach would be to alter the plant architecture and bio-
chemistry and thus distribute irradiation more evenly throughout the canopy in order
to achieve the highest conversion efficiency of solar radiation to biomass. Recent
genome editing technologies have been progressing and they will enable easier and
more precise manipulation of the photosynthesis process in crops. Our understanding
of photosynthesis will help us to achieve our goal of sustainable food production.
References
Ainsworth EA, Leakey ADB, Ort DR, Long SP (2008) FACE-ing the facts: inconsistencies and
interdependence among field, chamber and modeling studies of elevated CO2 impacts on crop
yield and food supply. New Phytol 179:5–9
Alexandratos N, Bruinsma J (2012) World agriculture towards 2030/2050: the 2012 revision. ESA
Working paper No. 12-03. FAO, Rome
Allahverdiyeva Y, Mustila H, Ermakova M, Bersanini L, Richaud P, Ajlani G, Battchikova N,
Cournac L, Aro EM (2013) Flavodiiron proteins Flv1 and Flv3 enable cyanobacterial growth
and photosynthesis under fluctuating light. Proc Natl Acad Sci U S A 110:4111–4116
Armbruster U, Carrillo LR, Venema K, Pavlovic L, Schmidtmann E, Kornfeld A, Jahns P, Berry
JA, Kramer DM, Jonikas MC (2014) Ion antiport accelerates photosynthetic acclimation in
fluctuating light environments. Nat Commun 5:5439
Armbruster U, Leonelli L, Correa Galvis V, Strand D, Quinn EH, Jonikas MC, Niyogi KK (2016)
Regulation and levels of the thylakoid K+/H+ antiporter KEA3 shape the dynamic response of
photosynthesis in fluctuating light. Plant Cell Physiol 57:1557–1567
Ballantyne AP, Alden CB, Miller JB, Tans PP, White JWC (2012) Increase in observed net carbon
dioxide uptake by land and oceans during the last 50 years. Nature 488:70–72
Biswal AK, Pattanayak GK, Pandey SS, Leelavathi S, Reddy VS, Govindjee, Tripathy BC (2012)
Light intensity-dependent modulation of chlorophyll b biosynthesis and photosynthesis by
overexpression of chlorophyllide a oxygenase in tobacco. Plant Physiol 159:433–449
Burkey KO (1994) Genetic variation of photosynthetic electron transport in barley: identification
of plastocyanin as a potential limiting factor. Plant Sci 98:177–187
Burkey KO, Gizlice Z, Carter TE (1996) Genetic variation in soybean photosynthetic electron
transport capacity is related to plastocyanin concentration in the chloroplast. Photosynth Res
49:141–149
Busch FA, Sage TL, Cousins AB, Sage RF (2013) C3 plants enhance rates of photosynthesis by
reassimilating photorespired and respired CO2. Plant Cell Environ 36:200–212
Carmo-Silva AE, Salvucci ME (2012) The temperature response of CO2 assimilation, photochemi-
cal activities and RuBisCO activation in Camelina sativa, a potential bioenergy crop with lim-
ited capacity for acclimation to heat stress. Planta 236:1433–1445
Carmo-Silva AE, Salvucci ME (2013) The regulatory properties of RuBisCO activase differ
among species and affect photosynthetic induction during light transitions. Plant Physiol
161:1645–1655
Carraretto L, Formentin E, Teardo E, Checchetto V, Tomizioli M, Morosinotto T, Giacometti GM,
Finazzi G, Szabó I (2013) A thylakoid-located two-pore K+ channel controls photosynthetic
light utilization in plants. Science 342:114–118
Carvalho J, Madgwick P, Powers S, Keys A, Lea P, Parry M (2012) An engineered pathway for
glyoxylate metabolism in tobacco plants aimed to avoid the release of ammonia in photorespi-
ration. BMC Biotechnol 11:111
Chai MF, Chen QJ, An R, Chen YM, Chen J, Wang XC (2005) NADK2, an Arabidopsis chloro-
plastic NAD kinase, plays a vital role in both chlorophyll synthesis and chloroplast protection.
Plant Mol Biol 59:553–564
Chen M, Blankenship RE (2011) Expanding the solar spectrum used by photosynthesis. Trends
Plant Sci 16:427–431
Chen M, Schliep M, Willows RD, Cai Z-L, Neilan BA, Scheer H (2010) A red-shifted chlorophyll.
Science 329:1318–1319
Chida H, Nakazawa A, Akazaki H, Hirano T, Suruga K, Ogawa M, Satoh T, Kadokura K, Yamada
S, Hakamata W et al (2007) Expression of the algal cytochrome c6 gene in Arabidopsis
enhances photosynthesis and growth. Plant Cell Physiol 48:948–957
Covshoff S, Hibberd JM (2012) Integrating C4 photosynthesis into C3 crops to increase yield
potential. Curr Opin Biotechnol 23:209–214
52 W. Yamori
Crafts-Brandner SJ, Salvucci ME (2000) Rubisco activase constrains the photosynthetic potential
of leaves at high temperature and CO2. Proc Natl Acad Sci U S A 97:13430–13435
Ding F, Wang M, Zhang S, Ai X (2016) Changes in SBPase activity influence photosynthetic
capacity, growth, and tolerance to chilling stress in transgenic tomato plants. Sci Rep 32741
Driever SM, Simkin AJ, Alotaibi S, Fisk SJ, Madgwick PJ, Sparks CA, Jones HD, Lawson T, Parry
MAJ, Raines CA (2017) Increased SBPase activity improves photosynthesis and grain yield
in wheat grown in greenhouse conditions. Philos Trans R Soc Lond B Biol Sci 372:20160384
Duan Z, Kong F, Zhang L, Li W, Zhang J, Peng L (2016) A bestrophin-like protein modulates
the proton motive force across the thylakoid membrane in Arabidopsis. J Integr Plant Biol
58:848–858
Evans JR (1989) Photosynthesis and nitrogen relationships in leaves of C3 plants. Oecologia 78:9–19
Evans JR, Kaldenhoff R, Genty B, Terashima I (2009) Resistances along the CO2 diffusion path-
way inside leaves. J Exp Bot 60:2235–2248
Farquhar GD, von Caemmerer S, Berry JA (1980) A biochemical model of photosynthetic CO2
assimilation in leaves of C3 species. Planta 149:78–90
Finazzi G, Petroutsos D, Tomizioli M, Flori S, Sautron E, Villanova V, Rolland N, Seigneurin-
Berny D (2015) Ions channels/transporters and chloroplast regulation. Cell Calcium 58:86–97
Flexas J, Ribas-Carbó M, Hanson DT, Bota J, Otto B, Cifre J, McDowell N, Medrano H, Kaldenhoff
R (2006) Tobacco aquaporin NtAQP1 is involved in mesophyll conductance to CO2 in vivo.
Plant J 48:427–439
Flexas J, Diaz-Espejo A, Galmés J, Kaldenhoff R, Medrano H, Ribas-Carbo M (2007) Rapid varia-
tions of mesophyll conductance in response to changes in CO2 concentration around leaves.
Plant Cell Environ 30:1284–1298
Flexas J, Ribas-Carbó M, Diaz-Espejo A, Galmés J, Medrano H (2008) Mesophyll conductance to
CO2: current knowledge and future prospects. Plant Cell Environ 31:602–621
Flexas J, Barbour MM, Brendel O, Cabrera HM, Carriquí M, Diaz-Espejo A, Douthe C, Dreyer
E, Ferrio JP, Gago J, Gallé A, Galmés J, Kodama N, Medrano H, Niinemets Ü, Peguero-
Pina JJ, Pou A, Ribas-Carbó M, Tomás M, Tosens T, Warren CR, Gallé A (2012) Mesophyll
diffusion conductance to CO2: an unappreciated central player in photosynthesis. Plant Sci
193–194:70–84
Furbank RT, Quick WP, Sirault XR (2015) Improving photosynthesis and yield potential in cereal
crops by targeted genetic manipulation: prospects, progress and challenges. Field Crops Res
182:19–29
Gotoh E, Suetsugu N, Yamori W, Ishishita K, Kiyabu R, Fukuda M, Higa T, Shirouchi B, Wada
M (2018) Chloroplast accumulation response enhances leaf photosynthesis and plant biomass
production. Plant Physiol 178:1358–1369
Gu J, Yin X, Stomph TJ, Struik PC (2014) Can exploiting natural genetic variation in leaf photo-
synthesis contribute to increasing rice productivity? A simulation analysis. Plant Cell Environ
37:22–34
Haake V, Zrenner R, Sonnewald U, Stitt M (1998) A moderate decrease of plastid aldolase activ-
ity inhibits photosynthesis, alters the levels of sugars and starch, and inhibits growth of potato
plants. Plant J 14:147–157
Haake V, Geiger M, Walch-Liu P, Engels C, Zrenner R, Stitt M (1999) Changes in aldolase activ-
ity in wild-type potato plants are important for acclimation to growth irradiance and carbon
dioxide concentration, because plastid aldolase exerts control over the ambient rate of photo-
synthesis across a range of growth conditions. Plant J 17:479–489
Hajirezaei M-R, Peisker M, Tschiersch H, Palatnik JF, Valle EM, Carrillo N, Sonnewald U (2002)
Small changes in the activity of chloroplastic NADP+-dependent ferredoxin oxidoreductase
lead to impaired plant growth and restrict photosynthetic activity of transgenic tobacco plants.
Plant J 29:281–293
Hammond ET, Andrews TJ, Mott KA, Woodrow IE (1998) Regulation of Rubisco activation in
antisense plants of tobacco containing reduced levels of Rubisco activase. Plant J 14:101–110
Hanba YT, Shibasaka M, Hayashi Y, Hayakawa T, Kasamo K, Terashima I, Katsuhara M (2004)
Overexpression of the barley aquaporin HvPIP2;1 increases internal CO2 conductance and CO2
assimilation in the leaves of transgenic rice plants. Plant Cell Physiol 45:521–529
Harrison EP, Willingham NM, Lloyd JC, Raines CA (1998) Reduced sedoheptulose-1,7-
bisphosphatase levels in transgenic tobacco lead to decreased photosynthetic capacity and
altered carbohydrate accumulation. Planta 204:27–36
Harrison EP, Olcer H, Lloyd JC, Long SP, Raines CA (2001) Small decreases in SBPase cause a
linear decline in the apparent RuBP regeneration rate, but do not affect Rubisco carboxylation
capacity. J Exp Bot 52:1779–1784
Hatano-Iwasaki A, Ogawa K (2012) Biomass production is promoted by increasing an aldolase
undergoing glutathionylation in Arabidopsis thaliana. Int J Dev Biol 6:1–8
Hay WT, Bihmidine S, Mutlu N, Le Hoang K, Awada T, Weeks DP, Clemente TE, Long SP (2017)
Enhancing soybean photosynthetic CO2 assimilation using a cyanobacterial membrane protein,
ictB. J Plant Physiol 212:58–68
Heckwolf M, Pater D, Hanson DT, Kaldenhoff R (2011) The Arabidopsis thaliana aquaporin
AtPIP1;2 is a physiologically relevant CO2 transport facilitator. Plant J 67:795–804
Herdean A, Teardo E, Nilsson AK, Pfeil BE, Johansson ON, Ünnep R, Nagy G, Zsiros O, Dana S,
Solymosi K, Garab G (2016) A voltage-dependent chloride channel fine-tunes photosynthesis
in plants. Nat Commun 7:11654
Hisabori T, Sunamura E, Kim Y, Konno H (2013) The chloroplast ATP synthase features the char-
acteristic redox regulation machinery. Antioxid Redox Signal 19:1846–1854
IPCC (2013) Annex II: climate system scenario tables. In: Prather M, Flato G, Friedlingstein P
et al (eds) Climate change 2013: the physical science basis. Contribution of Working Group I
to the fifth assessment report of the Intergovernmental Panel on Climate Change. Cambridge
University Press, Cambridge
Ishikawa C, Hatanaka T, Misoo S, Miyake C, Fukayama H (2011) Functional incorporation of
sorghum small subunit increases the catalytic turnover rate of RuBisCO in transgenic rice.
Kaiser E, Morales A, Harbinson J, Heuvelink E, Prinzenberg AE, Marcelis LFM (2016) Metabolic
and diffusional limitations of photosynthesis in fluctuating irradiance in Arabidopsis thaliana.
Sci Rep 6:31252
Kaldenhoff R (2012) Mechanisms underlying CO2 diffusion in leaves. Curr Opin Plant Biol
15:276–281
Kawai S, Murata K (2008) Structure and function of NAD kinase and NADP phosphatase: key
enzymes that regulate the intracellular balance of NAD(H) and NADP(H). Biosci Biotechnol
Biochem 72:919–930
Kebeish R, Niessen M, Thiruveedhi K, Bari R, Hirsch HJ, Rosenkranz R, Stäbler N, Schönfeld B,
Kreuzaler F, Peterhänsel C (2007) Chloroplastic photorespiratory bypass increases photosyn-
thesis and biomass production in Arabidopsis thaliana. Nat Biotechnol 25:593–599
Kimura H, Hashimoto-Sugimoto M, Iba K, Terashima I, Yamori W (2020) Improved stomatal
opening enhances photosynthetic rate and biomass production in fluctuating light. J Exp Bot
71:2339–2350
Köhler IH, Ruiz-Vera UM, VanLoocke A, Thomey ML, Clemente T, Long SP, Ort DR, Bernacchi
CJ (2016) Expression of cyanobacterial FBP/SBPase in soybean prevents yield depression
under future climate conditions. J Exp Bot 68:715–726
Kossmann J, Sonnewald U, Willmitzer L (1994) Reduction of the chloroplastic fructose-1,6-
bisphosphatase in transgenic potato plants impairs photosynthesis and plant growth. Plant J
6:637–650
Kozaki A, Takeba G (1996) Photorespiration protects C3 plants from photooxidation.
Nature 384:557
Kramer DM, Cruz JA, Kanazawa A (2003) Balancing the central roles of the thylakoid proton
gradient. Trends Plant Sci 8:27–32
Kromdijk J, Głowacka K, Leonelli L, Gabilly ST, Iwai M, Niyogi KK, Long SP (2016) Improving
photosynthesis and crop productivity by accelerating recovery from photoprotection. Science
354:857–861
Kumar A, Li C, Portis AR Jr (2009) Arabidopsis thaliana expressing a thermostable chimeric
Rubisco activase exhibits enhanced growth and higher rates of photosynthesis at moderately
high temperatures. Photosynth Res 100:143–153
54 W. Yamori
Kunz HH, Gierth M, Herdean A, Satoh-Cruz M, Kramer DM, Spetea C, Schroeder JI (2014)
Plastidial transporters KEA1, -2, and -3 are essential for chloroplast osmoregulation, integrity,
and pH regulation in Arabidopsis. Proc Natl Acad Sci U S A 111:7480–7485
Kurek I, Chang TK, Bertain SM, Madrigal A, Liu L, Lassner MW, Zhu G (2007) Enhanced ther-
mostability of Arabidopsis rubisco activase improves photosynthesis and growth rates under
moderate heat stress. Plant Cell 19:3230–3241
Kusumi K, Hirotsuka S, Kumamaru T, Iba K (2012) Increased leaf photosynthesis caused by ele-
vated stomatal conductance in a rice mutant deficient in SLAC1, a guard cell anion channel
protein. J Exp Bot 63:5635–5644
Lawson T, Blatt MR (2014) Stomatal size, speed, and responsiveness impact on photosynthesis
and water use efficiency. Plant Physiol 164:1556–1570
Lawson T, Bryant B, Lefebvre S, Lloyd JC, Raines CA (2006) Decreased SBPase activity alters
growth and development in transgenic tobacco plants. Plant Cell Environ 29:48–58
Lefebvre S, Lawson T, Zakhleniuk OV, Lloyd JC, Raines CA, Fryer M (2005) Increased
sedoheptulose-1,7-bisphosphatase activity in transgenic tobacco plants stimulates photosyn-
thesis and growth from an early stage in development. Plant Physiol 138:451–460
Lieman-Hurwitz J, Rachmilevitch S, Mittler R, Marcus Y, Kaplan A (2003) Enhanced photosyn-
thesis and growth of transgenic plants that express ictB, a gene involved in HCO3− accumula-
tion in cyanobacteria. Plant Biotechnol J 1:43–50
Lin MT, Occhialini A, Andralojc PJ, Parry MAJ, Hanson MR (2014) A faster Rubisco with poten-
tial to increase photosynthesis in crops. Nature 513:547–550
Long BM, Hee WY, Sharwood RE, Rae BD, Kaines S, Lim YL, Nguyen ND, Massey B, Bala S,
von Caemmerer S, Badger MR (2018) Carboxysome encapsulation of the CO2-fixing enzyme
Rubisco in tobacco chloroplasts. Nat Commun 9:3570
Lopez-Calcagno PE, Fisk S, Brown KL, Bull SE, South PF, Raines CA (2018) Overexpressing
the H-protein of the glycine cleavage system increases biomass yield in glasshouse and field
grown transgenic tobacco plants. Plant Biotechnol J 17(1):141–151. https://doi.org/10.1111/
pbi.12953
Maier A, Fahnenstich H, von Caemmerer S, Engqvist MKM, Weber APM, Fluegge U-I, Maurino
VG (2012) Transgenic introduction of a glycolate oxidative cycle into A. thaliana chloroplasts
leads to growth improvement. Front. Plant Sci 3:38
Makino A, Sato T, Nakano H, Mae T (1997) Leaf photosynthesis, plant growth and nitrogen allo-
cation in rice under different irradiances. Planta 203:390–398
Masumoto C, Fukayama H, Hatanaka T, Uchida N (2012) Photosynthetic characteristics of anti-
sense transgenic rice expressing reduced levels of Rubisco activase. Plant Prod Sci 15:174–182
Miginiac-Maslow M, Johansson K, Ruelland E, Issakidis-Bourguet E, Schepens I, Goyer A,
Lemaire‐Chamley M, Jacquot J‐P, Le Maréchal P, Decottignies P (2000) Light-activation of
NADP-malate dehydrogenase: a highly controlled process for an optimized function. Physiol
Plant 110:322–329
Miyagawa Y, Tamoi M, Shigeoka S (2001) Overexpression of a cyanobacterial fructose-1,6-/
sedoheptulose- 1,7-bisphosphatase in tobacco enhances photosynthesis and growth. Nat
Biotechnol 19:965–969
Miyashita H, Ikemoto H, Kurano N, Adachi K, Chihara M, Miyachi S (1996) Chlorophyll d as a
major pigment. Nature 383:402–402
Morris PF, Layzell DB, Canvin DT (1988) Ammonia production and assimilation in glutamate
synthase mutants of Arabidopsis thaliana. Plant Physiol 87:148–154
Mott KA, Snyder GW, Woodrow IE (1997) Kinetics of Rubisco activation as determined from gas-
exchange measurements in antisense plants of Arabidopsis thaliana containing reduced levels
of Rubisco activase. Aust J Plant Physiol 24:811–818
Mueller-Cajar O, Stotz M, Wendler P, Hartl FU, Bracher A, Hayer-Hartl M (2011) Structure and
function of the AAA+ protein CbbX, a red-type Rubisco activase. Nature 479:194–199
Murchie EH, Niyogi KK (2011) Manipulation of photoprotection to improve plant photosynthesis.
Naumburg E, Ellsworth DS (2002) Short-term light and leaf photosynthetic dynamics affect esti-
mates of daily understory photosynthesis in four tree species. Tree Physiol 22:393–401
Nikkanen L, Toivola J, Rintamäki E (2016) Crosstalk between chloroplast thioredoxin systems in
regulation of photosynthesis. Plant Cell Environ 39:1691–1705
Ölcer H, Lloyd JC, Raines CA (2001) Photosynthetic capacity is differentially affected by reduc-
tions in sedoheptulose-1,7-bisphosphatase activity during leaf development in transgenic
tobacco plants. Plant Physiol 125:982–989
Papanatsiou M, Petersen J, Henderson L, Wang Y, Christie JM, Blatt MR (2019) Optogenetic
manipulation of stomatal kinetics improves carbon assimilation, water use, and growth.
Science 363:1456–1459
Parry MAJ, Keys AJ, Madgwick PJ, Carmo-Silva AE, Andralojc PJ (2008) Rubisco regulation: a
role for inhibitors. J Exp Bot 59:1569–1580
Pearcy RW (1990) Sunflecks and photosynthesis in plant canopies. Annu Rev Plant Physiol Plant
Mol Biol 41:421–453
Pesaresi P, Scharfenberg M, Weigel M, Granlund I, Schroder WP, Finazzi G, Rappaport F, Masiero
S, Furini A, Jahns P, Leister D (2009) Mutants, overexpressors, and interactors of Arabidopsis
plastocyanin isoforms: revised roles of plastocyanin in photosynthetic electron flow and thyla-
koid redox state. Mol Plant 2:236–248
Peterhansel C, Blume C, Offermann S (2013) Photorespiratory bypasses: how can they work? J
Exp Bot 64:709–715
Portis AR Jr (2003) Rubisco activase: Rubisco’s catalytic chaperone. Photosynth Res 75:11–27
Pribil M, Pesaresi P, Hertle A, Barbato R, Leister D (2010) Role of plastid protein phosphatase
TAP38 in LHCII dephosphorylation and thylakoid electron flow. PLoS Biol 8:e1000288
Price GD, von Caemmerer S, Evans JR, Siebke K, Anderson JM, Badger MR (1998) Photosynthesis
is strongly reduced by antisense suppression of chloroplastic cytochrome bf complex in trans-
genic tobacco. Funct Plant Biol 25:445–452
Price GD, Badger MR, von Caemmerer S (2011) The prospect of using cyanobacterial bicarbonate
transporters to improve leaf photosynthesis in C3 crop plants. Plant Physiol 155:20–26
Price GD, Pengelly JJL, Forster B, Du J, Whitney SM, von Caemmerer S, Badger MR, Howitt SM,
Evans JR (2013) The cyanobacterial CCM as a source of genes for improving photosynthetic
CO2 fixation in crop species. J Exp Bot 64:753–768
Raines CA (2003) The Calvin cycle revisited. Photosynth Res 75:1–10
Raines CA, Paul MJ (2006) Products of leaf primary carbon metabolism modulate the develop-
mental programme determining plant morphology. J Exp Bot 57:1857–1862
Raines CA, Lloyd JC, Dyer TA (1999) New insights into the structure and function of
sedoheptulose-1,7-bisphosphatase; an important but neglected Calvin cycle enzyme. J Exp
Bot 50:1–8
Richards RA (2000) Selectable traits to increase crop photosynthesis and yield of grain crops. J
Exp Bot 51:447–458
Rodriguez RE, Lodeyro A, Poli HO, Zurbriggen M, Palatnik JF, Tognetti VB, Tschiersch H,
Hajirezaei MR, Valle EM, Carrillo N (2007) Transgenic tobacco plants overexpressing chlo-
roplastic ferredoxin-NADP(H) reductase display normal rates of photosynthesis and increased
tolerance to oxidative stress. Plant Physiol 143:639–649
Rojas-González JA, Soto-Súarez M, García-Díaz Á, Romero-Puertas MC, Sandalio LM, Mérida
Á, Thormählen I et al (2015) Disruption of both chloroplastic and cytosolic FBPase genes
results in a dwarf phenotype and important starch and metabolite changes in Arabidopsis thali-
ana. J Exp Bot 66:2673–2689
Rosenthal D, Locke A, Khozaei M, Raines C, Long S, Ort D (2011) Over-expressing the C3 pho-
tosynthesis cycle enzyme sedoheptulose-1-7 bisphosphatase improves photosynthetic carbon
gain and yield under fully open air CO2 fumigation (FACE). BMC Plant Biol 11:123
Sage RF, Sage TL, Kocacinar F (2012) Photorespiration and the evolution of C4 photosynthesis.
Annu Rev Plant Biol 63:19–47
56 W. Yamori
Sakoda K, Yamori W, Groszmann M, Evans JR (2021) Stomatal, mesophyll conductance, and

biochemical limitations to photosynthesis during induction. Plant Physiology
Sahrawy M, Avila C, Chueca A, Canovas FM, Lopez-Gorge J (2004) Increased sucrose level and
altered nitrogen metabolism in Arabidopsis thaliana transgenic plants expressing antisense
chloroplastic fructose-1,6-bisphosphatase. J Exp Bot 55:2495–2503
Salvucci ME, Crafts-Brandner SJ (2004a) Relationship between the heat tolerance of photosyn-
thesis and the thermal stability of Rubisco activase in plants from contrasting thermal environ-
ments. Plant Physiol 134:1460–1470
Salvucci ME, Crafts-Brandner SJ (2004b) Inhibition of photosynthesis by heat stress: the activa-
tion state of Rubisco as a limiting factor in photosynthesis. Physiol Plant 120:179–186
Salvucci ME, DeRidder BP, Portis AR (2006) Effect of activase level and isoform on the thermo-
tolerance of photosynthesis in Arabidopsis. J Exp Bot 57:3793–3799
Sanz-Barrio R, Corral-Martinez P, Ancin M, Segui-Simarro JM, Farran I (2013) Overexpression
of plastidial thioredoxin f leads to enhanced starch accumulation in tobacco leaves. Plant
Biotechnol J 11:618–627
Scafaro AP, Atwell BJ, Muylaert S, Van Reusel B, Alguacil Ruiz G, Van Rie J, Gallé A (2018) A
thermotolerant variant of Rubisco activase from a wild relative improves growth and seed yield
in rice under heat stress. Front Plant Sci 9:1663
Schöttler MA, Kirchhoff H, Weis E (2004) The role of plastocyanin in the adjustment of the photo-
synthetic electron transport to the carbon metabolism in tobacco. Plant Physiol 136:4265–4274
Shimadzu S, Seo M, Terashima I, Yamori W (2019) Whole irradiated plant leaves showed faster
photosynthetic induction than individually irradiated leaves via improved stomatal opening.
Front Plant Sci 10:1512
Simkin AJ, McAusland L, Lawson T, Raines CA (2017) Over-expression of the Rieske FeS protein
increases electron transport rates and biomass yield. Plant Physiol 175:134–145
Sinclair TR, Purcell LC, Sneller CH (2004) Crop transformation and the challenge to increase
yield potential. Trends Plant Sci 9:70–75
Spreitzer RJ, Salvucci ME (2002) Rubisco: structure, regulatory interactions, and possibilities for
a better enzyme. Annu Rev Plant Biol 53:449–475
Stotz M, Mueller-Cajar O, Ciniawsky S, Wendler P, Hartl FU, Bracher A, Hayer-Hartl M (2011)
Structure of green-type RuBisCO activase from tobacco. Nat Struct Mol Biol 18:1366–1370
Takahara K, Kasajima I, Takahashi H, Hashida SN, Itami T, Onodera H, Toki S, Yanagisawa S,
Kawai-Yamada M, Uchimiya H (2010) Metabolome and photochemical analysis of rice plants
overexpressing Arabidopsis NAD kinase gene. Plant Physiol 152:1863–1873
Tamoi M, Nagaoka M, Miyagawa Y, Shigeoka S (2006) Contribution of fructose-l,6-bisphosphatase
and sedoheptulose-l,7-bisphosphatase to the photosynthetic rate and carbon flow in the Calvin
cycle in transgenic plants. Plant Cell Physiol 47:380–390
Tanaka Y, Sugano SS, Shimada T, Hara-Nishimura I (2013) Enhancement of leaf photosynthetic
capacity through increased stomatal density in Arabidopsis. New Phytol 198:757–764
Tanaka Y, Adachi S, Yamori W (2019) Natural genetic variation of the photosynthetic induction
response to fluctuating light environment. Curr Opin Plant Biol 49:52–59
Taylor SH, Long SP (2017) Slow induction of photosynthesis on shade to sun transitions in wheat
may cost at least 21% of productivity. Philos Trans R Soc Lond B Biol Sci 372:20160543
Tazoe Y, von Caemmerer S, Estavillo GM, Evans JR (2011) Using tunable diode laser spectros-
copy to measure carbon isotope discrimination and mesophyll conductance to CO2 diffusion
dynamically at different CO2 concentrations. Plant Cell Environ 344:580–591
Terashima I, Hanba YT, Tholen D, Niinemets Ü (2011) Leaf functional anatomy in relation to
photosynthesis. Plant Physiol 155:108–116
Tholen D, Zhu XG (2011) The mechanistic basis of internal conductance: a theoretical analysis of
mesophyll cell photosynthesis and CO2 diffusion. Plant Physiol 156:90–105
Tholen D, Boom C, Noguchi K, Ueda S, Katase T, Terashima I (2008) The chloroplast avoidance
response decreases internal conductance to CO2 diffusion in Arabidopsis thaliana leaves. Plant
Cell Environ 31:1688–1700
Thormählen I, Ruber J, von Roepenack-Lahaye E, Ehrlich S, Massot V, Huemmer C, Tezycka J,

Issakidis-Bourguet E, Geigenberger P (2013) Inactivation of thioredoxin f1 leads to decreased
light activation of ADP-glucose pyrophosphorylase and altered diurnal starch turnover in
leaves of Arabidopsis plants. Plant Cell Environ 36:16–29
Thormählen I, Zupok A, Rescher J, Leger J, Weissenberger S, Groysman J, Orwat A, Chatel-
Innocenti G, Issakidis-Bourguet E, Armbruster U et al (2017) Thioredoxins play a crucial role
in dynamic acclimation of photosynthesis in fluctuating light. Mol Plant 10:168–182
Tikkanen M, Grieco M, Nurmi M, Rantala M, Suorsa M, Aro EM (2012) Regulation of the pho-
tosynthetic apparatus under fluctuating growth light. Philos Trans R Soc Lond B Biol Sci
367:3486–3493
Tilman D, Balzer C, Hill J, Befort BL (2011) Global food demand and the sustainable intensifica-
tion of agriculture. Proc Natl Acad Sci U S A 108:20260–20264
Timm S, Florian A, Arrivault S, Stitt M, Fernie AR, Bauwe H (2012) Glycine decarboxylase con-
trols photosynthesis and plant growth. FEBS Lett 586:3692–3697
Timm S, Wittmiss M, Gamlien S, Ewald R, Florian A, Frank M, Wirtz M et al (2015) Mitochondrial
dihydrolipoyl dehydrogenase activity shapes photosynthesis and photorespiration of
Arabidopsis thaliana. Plant Cell 27:1968–1984
Timm S, Florian A, Fernie AR, Bauwe H (2016) The regulatory interplay between photorespira-
tion and photosynthesis. J Exp Bot 67:2923–2929
Toivola J, Nikkanen L, Dahlström KM, Salminen TA, Lepistö A, Vignols F, Rintamäki E (2013)
Overexpression of chloroplast NADPH-dependent thioredoxin reductase in Arabidopsis
enhances leaf growth and elucidates in vivo function of reductase and thioredoxin domains.
Front Plant Sci 4:389
Uehlein N, Sperling H, Heckwolf M, Kaldenhoff R (2012) The Arabidopsis aquaporin PIP1;2
rules cellular CO2 uptake. Plant Cell Environ 35:1077–1083
Uematsu K, Suzuki N, Iwamae T, Inui M, Yukawa H (2012) Increased fructose 1,6-bisphosphate
aldolase in plastids enhances growth and photosynthesis of tobacco plants. J Exp Bot
63:3001–3009
Vialet-Chabrand SRM, Matthews JSA, McAusland L, Blatt MR, Griffiths H, Lawson T (2017)
Temporal dynamics of stomatal behavior: modeling and implications for photosynthesis and
water use. Plant Physiol 174:603–613
von Caemmerer S, Quick WP, Furbank RT (2012) The development of C4 rice: current progress
and future challenges. Science 336:1671–1672
Wada S, Yamamoto H, Suzuki Y, Yamori W, Shikanai T, Makino A (2018) Flavodiiron protein
substitutes for cyclic electron flow without competing CO2 assimilation in rice. Plant Physiol
176:1509–1518
Walker BJ, VanLoocke A, Bernacchi CJ, Ort DR (2016) The costs of photorespiration to food
production now and in the future. Annu Rev Plant Biol 67:107–129
Whitney SM, Sharwood RE, Orr D, White SJ, Alonso H, Galmés J (2011) Isoleucine 309 acts as
a C4 catalytic switch that increases ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco)
carboxylation rate in Flaveria. Proc Natl Acad Sci U S A 108:14688–14693
Wigge B, Krömer S, Gardeström P (1993) The redox levels and subcellular distribution of pyridine
nucleotides in illuminated barley leaf protoplasts studied by rapid fractionation. Physiol Plant
88:10–18
Wright IJ, Reich PB, Westoby M, Ackerly DD, Baruch Z et al (2004) The worldwide leaf econom-
ics spectrum. Nature 428:821–827
Yamamoto H, Kato H, Shinzaki Y, Horiguchi S, Shikanai T, Hase T, Endo T, Nishioka M, Makino
A, Tomizawa K, Miyake C (2006) Ferredoxin limits cyclic electron flow around PSI (CEF-
PSI) in higher plants: stimulation of CEF-PSI enhances non-photochemical quenching of Chl
fluorescence in transplastomic tobacco. Plant Cell Physiol 47:1355–1371
Yamamoto H, Takahashi S, Badger MR, Shikanai T (2016) Artificial remodelling of alternative
electron flow by flavodiiron proteins in Arabidopsis. Nat Plants 2:16012
58 W. Yamori
Yamori W (2016) Photosynthetic response to fluctuating environments and photoprotective strate-

gies under abiotic stress. J Plant Res 129:379–395
Yamori W, Shikanai T (2016) Physiological functions of cyclic electron transport around photosys-
tem I in sustaining photosynthesis and plant growth. Annu Rev Plant Biol 67:81–106
Yamori W, von Caemmerer S (2009) Effect of Rubisco activase deficiency on the temperature
response of CO2 assimilation rate and Rubisco activation state: insights from transgenic
tobacco with reduced amounts of Rubisco activase. Plant Physiol 151:2073–2082
Yamori W, Noguchi K, Hanba YT, Terashima I (2006a) Effects of internal conductance on the
temperature dependence of the photosynthetic rate in spinach leaves from contrasting growth
temperatures. Plant Cell Physiol 47:1069–1080
Yamori W, Suzuki K, Noguchi K, Nakai M, Terashima I (2006b) Effects of Rubisco kinetics and
Rubisco activation state on the temperature dependence of the photosynthetic rate in spinach
leaves from contrasting growth temperatures. Plant Cell Environ 29:1659–1670
Yamori W, Takahashi S, Makino A, Price GD, Badger MR, von Caemmerer S (2011) The roles of
ATP synthase and the cytochrome b6/f complexes in limiting chloroplast electron transport and
determining photosynthetic capacity. Plant Physiol 155:956–962
Yamori W, Masumoto C, Fukayama H, Makino A (2012) Rubisco activase is a key regulator of
non-steady-state photosynthesis at any leaf temperature and, to a lesser extent, of steady-state
photosynthesis at high temperature. Plant J 71:871–880
Yamori W, Hikosaka K, Way DA (2014) Temperature response of photosynthesis in C3, C4 and CAM
plants: temperature acclimation and temperature adaptation. Photosynth Res 119:101–117
Yamori W, Kondo E, Sugiura D, Terashima I, Suzuki Y, Makino A (2016a) Enhanced leaf photo-
synthesis as a target to increase grain yield: insights from transgenic rice lines with variable
Rieske FeS protein content in the cytochrome b6/f complex. Plant Cell Environ 39:80–87
Yamori W, Irving LJ, Adachi S, Busch FA (2016b) Strategies for optimizing photosynthesis with
biotechnology to improve crop yield. In: Pessarakli M (ed) Handbook of photosynthesis, 3rd
edn. Taylor & Francis, Boca Raton, pp 741–759
Yamori W, Makino A, Shikanai T (2016c) A physiological role of cyclic electron transport around
photosystem I in sustaining photosynthesis under fluctuating light in rice. Sci Rep 6:20147
Yamori W, Kusumi K, Iba K, Terashima I (2020) Increased stomatal conductance induces rapid
changes to photosynthetic rate in response to naturally fluctuating light conditions in rice. Plant
Green Super Rice (GSR) Traits: Breeding
and Genetics for Multiple Biotic
and Abiotic Stress Tolerance in Rice
Jauhar Ali, Mahender Anumalla, Varunseelan Murugaiyan, and Zhikang Li
Abstract The frequent fluctuations in global climate variability (GCV), decreases in

farmland and irrigation water, soil degradation and erosion, and increasing fertilizer
costs are the significant factors in declining rice productivity, mainly in Asia and Africa.
Under GCV scenarios, it is a challenging task to meet the rice food demand of the grow-
ing population. Identifying green traits (tolerance of biotic and abiotic stresses, nutrient-
use efficiency, and nutritional grain quality) and stacking them in high-yielding elite
genetic backgrounds is one promising approach to increase rice productivity. To this
end, the Green Super Rice (GSR) breeding strategy helps to pool multi-stress-tolerance
traits by stringent selection processes and to develop superior GSR cultivars within a
short span of 4–5 years. In the crossing and selection process of GSR breeding, selective
introgression lines (SILs) derived from sets of early backcross BC1F2 bulk populations
through both target traits and non-target traits were selected. Genotyping of SILs with
high-density SNP markers leads to the identification of a large number of SNP markers
linked with the target green traits. The identified SILs with superior trait combinations
were used for designed QTL pyramiding to combine different target green traits. The
GSR breeding strategy also focused on nutrient- and water-use efficiency besides
environment-friendly green features primarily to increase grain yield and income returns
for resource-poor farmers. In this chapter, we have highlighted the GSR breeding strat-
egy and QTL introgression of green traits in rice. This breeding strategy has successfully
dissected many complex traits and also released several multi-stress-tolerant varieties
with high grain yield and productivity in the target regions of Asia and Africa.
J. Ali (*) · M. Anumalla

Rice Breeding Platform, International Rice Research Institute (IRRI),
Los Baños, Laguna, Philippines
V. Murugaiyan
Plant Nutrition, Institute of Crop Sciences and Resource Conservation (INRES), University
of Bonn, Bonn, Germany
Z. Li
National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop
Science, Chinese Academy of Agricultural Sciences (CAAS), Beijing, China

https://doi.org/10.1007/978-3-030-66530-2_3
60 J. Ali et al.
Keywords Green traits · Molecular breeding strategies · QTLs and genes ·

Multiple-stress tolerance · Green super rice varieties
1 Introduction
Food security is a global challenge for plant researchers to increase crop productiv-
ity, especially under changing climatic conditions. Rice (Oryza sativa L.) is one of
the staple food crops for more than half of the world population. More than 95% of
global rice is produced and consumed by the top 10 rice-producing countries
(Fig. 1). China consumes about 143 million metric tons (MMT), followed by India
(103 MMT), with these being the two most populated countries (https://www.
statista.com). The rapid growth of population is estimated to reach 9.7 billion by
2050, and this would have a direct bearing on the demand side of global food
(United Nations 2019). Worldwide, more than 800 million people are affected by
malnutrition, thus hindering sustainable development programs, and food demand
is expected to increase by 59–98% by 2050 (Elferink and Schierhorn 2016). Apart
from this great challenge, increased global climate variability (GCV) (abiotic
stresses: drought, salinity, low/high temperature, submergence/flooding; and biotic
stresses: blast, bacterial leaf blight, brown planthopper, etc.) and decreasing natural
resources (NRS) (e.g., decreased availability of irrigation water, labor scarcity, ara-
ble land reduction, and soil nutrient deficiency and toxicity) are the foremost factors
that slow the pace toward food security for the global population. As per the predic-
tion of the Intergovernmental Panel on Climate Change (IPCC), Earth’s global sur-
face temperature is expected to surge by 1.4–5.8 °C by 2100 (Fahad et al. 2019),
Fig. 1 Estimated growth of population in the top 10 rice-producing countries

Green Super Rice (GSR) Traits: Breeding and Genetics for Multiple Biotic and Abiotic… 61
thereby resulting in a decrease in precipitation in the subtropics and a possible rise

in the frequent occurrences of extreme climatic events. However, these two major
factors, GCV and NRS, would have direct or indirect effects on crop growth and
significantly decrease crop yield (Pandey et al. 2017). Accordingly, more than 90%
of arable lands are prone to one or more than two combinations of stresses, which
cause up to 70% yield losses in the major food crops (Ray et al. 2015; Fahad et al.
2017; Tigchelaar et al. 2018). To provide nutrition and food security by 2050, it has
been projected that crop yield must be increased by 1%, 0.9%, and 1.6% annually
for rice, wheat, and maize, respectively (Fischer and Edmeades 2010). Thus, current
grain yield levels are insufficient to sustain the rapid growth of the human popula-
tion. The production of the principal crops (rice, maize, and wheat) has to increase
by ~42%, ~67%, and ~38%, respectively, by 2050 to meet this demand (Ray et al.
2013). As compared to cereals, rice is the only major staple food crop to have more
nutritional and health benefits for increasing rice consumption; it also has sensitiv-
ity to the major biotic and abiotic stress factors. Therefore, to overcome the chal-
lenges of growing GCV and decreasing NRS, the development of superior rice
cultivars with higher grain yield and multiple-stress tolerance is necessary to pro-
vide a kind of crop insurance besides increasing the income of poor farmers across
mainly Asian and African countries.
Multiple abiotic stresses greatly influence crop productivity and have adverse
effects on plant growth and development (Fahad et al. 2017; Cohen and Leach 2019).
For example, drought is a major constraint in rice production and approximately
42 million hectares of rice in Asia suffer significant yield losses from varying amounts
of drought stress at the different crop growth stages (Saikumar et al. 2016; Sandhu and
Kumar 2017; Mukamuhirwa et al. 2019). Besides drought, soil salinity and alkalinity
are also devastating factors that cause significant yield losses of rice crops at the veg-
etative and reproductive stages. Globally, about 20% of the cultivable land and 33%
of irrigated agricultural areas are afflicted by salinity stress (Shrivastava and Kumar
2015). Thus, it is crucial to identify stress-tolerant rice varieties to maintain productiv-
ity and meet global food security needs. Beyond abiotic stresses, sustainable rice pro-
duction has become one of the top priorities in developing and adopting eco-friendly
rice varieties with low input-use efficiency. In the majority of the developed countries,
farmers have been using considerably more fertilizer to increase their crop yield.
According to Cheng et al. (2007), rice production in China has to be increased by 14%
by 2030 to meet the food requirements of its rapidly growing population. In Jiangsu
Province, farmers are applying 300–350 kg N/ha to achieve high yield for rice crops
(Sui et al. 2013), which is 90% more than the global average N application (Chen
et al. 2014a) . The excess amounts of nutrient fertilizer also cause the accumulation of
higher salt concentration in the soil. This further decreases water and nutrient absorp-
tion, leading to several changes in physiological processes as leaf dehydration
decreases photosynthesis efficiency, decreases grain micronutrients, and also causes
severe environmental pollution (Kreuzwieser and Gessler 2010; Panda et al. 2012;
Guo et al. 2017; Ali et al. 2018b). Even in China, the excessive amounts of fertilizer
application in paddy lands to boost yield are no longer a viable option, especially
under increasing fertilizer costs. This is further driving the search for rice cultivars
62 J. Ali et al.
with high nutrient-use efficiency that are required for sustainable rice production and
increasing grain yield under optimal and suboptimal rates of fertilizer dosage. Thus, it
is essential to develop rice varieties with high nutrient-use efficiency to maximize
yield and productivity with the best agronomic management options such as judicious
stage-specific dosages of fertilizer application. Further, it is essential to develop high-
yielding, multiple-stress-tolerant rice varieties with combinations of several green
traits such as tolerance of/resistance to drought, salinity, high/low temperature, flood-
ing, blast, bacterial blight, tungro, brown planthopper, and stem borer, along with
water-use efficiency. These multi-stress-tolerant varieties also need to meet market
segment requirements such as duration, grain shape, and quality preferences. Recently,
the incorporation of desirable nutrients for improved grain quality such as iron and
zinc in multi-stress-tolerant cultivars has become necessary in rice improvement pro-
grams to ensure food security and overcome hidden hunger (Ali et al. 2020; Yu
et al. 2020).
2 Green Super Rice
During the past two decades, breeders and biotechnologists have been working on
various biotic and abiotic stress tolerances with a focus on increasing crop yield.
This is possible by modifying the plant architecture and introgressing the target
traits into the desired background through conventional and marker-assisted breed-
ing approaches (Mehta et al. 2019; Oladosu et al. 2019; Gautam et al. 2020; Muthu
et al. 2020). Complex abiotic stress tolerances such as drought and salinity tolerance
are polygenic, and may have a negative association with grain yield components and
might also interact with genetic and physiological mechanisms of similar traits
(Guojun et al. 2009). Also, choosing the right donors for different target traits is
challenging. In most cases, the abiotic stress-tolerant rice varieties are developed by
crossing with tolerant landraces. However, concern exists regarding the difficulty in
breaking undesirable linkages through conventional breeding approaches, which
often represent a time-consuming process for selecting and fixing desirable lines,
with limited success (Zhou et al. 2010; Wang et al. 2013). These developed tolerant
rice varieties are low to moderate yielding under irrigated and rainfed conditions. In
light of this apprehension, the Green Super Rice (GSR) breeding strategy began in
2008 at IRRI to efficiently develop lines with multiple-stress tolerance and more
nutrient- and water-use efficiency with high genetic gains for various targeted eco-
systems. The development of superior rice varieties with the GSR breeding approach
under decreased rates of fertilizer, pesticide, and irrigation water, grown in marginal
environments and producing fewer greenhouse gas emissions, and with improved
grain nutrient elements (Zhang 2007; Wing et al. 2018), is described in Fig. 2. GSR
breeding aims to develop stable high-yielding GSR rice varieties with several green
traits suitable to be grown under lower input conditions in irrigated and rainfed
areas of Asian and African countries.
Fig. 2 A schematic representation of the Green Super Rice (GSR) breeding program for the devel-
opment of green traits and increasing grain yield with improved grain quality. (a) The drastic
changes in climatic variations, degradation of natural resources, and increasing global population
are the major driving forces for increasing food demand by about 42% by 2050. (b) To ensure food
security against these challenges, the GSR concept was proposed in 2005, and its major focus was
to develop novel rice varieties with green traits, which included tolerance of multiple stresses
(biotic and abiotic), high nutrient-use efficiency, fewer inputs of fertilizer, and water-saving. The
combination of green traits and the GSR breeding concept provided an environment-friendly and
natural resource–saving dimension. (c) The major target of GSR breeding is to develop new GSR
cultivars through the integration of an advanced genomics platform for determining the genomic
regions for green traits and further disseminating promising cultivars for specific target regions to
improve the income of resource-poor farmers. (d) As of now, many QTLs have been identified
using the GSR breeding strategy, and several genes have been functionally characterized and
cloned for increasing the tolerance of abiotic stresses (Ali et al. 2020; Yu et al. 2020). These identi-
fied QTLs and genes provide abundant genetic information for the development of novel GSR
varieties
Integrating advanced genomics and stringent phenotypic selection in the GSR

breeding strategy helped to identify promising rice varieties besides understanding
the molecular genetics and physiological mechanisms underlying trait expression
(Wing et al. 2018; Ali et al. 2020; Yu et al. 2020). This breeding strategy played a
significant role in the quick introgression of the desired target traits with the highest
precision and with less or no genetic drag.
2.1 GSR Breeding and Population Development
The concept of GSR and its breeding strategy followed a systematic breeding effort
and advanced genotyping approaches for developing varieties with significantly
improved tolerance of multiple biotic and abiotic stresses, along with improved
nutrient- and water-use efficiency. A schematic view of the backcross GSR breeding
technology for developing early backcross-selective introgression lines (EB-SILs)
64 J. Ali et al.
appears in Fig. 3. The development of several promising stress-tolerant rice culti-

vars that withstand drought, salinity, and flooding through a selective introgression
breeding approach started at IRRI in 1998 (Li et al. 2005; Ali et al. 2006; Lafitte
et al. 2006). These early efforts helped in the development of the GSR breeding
strategy to breed varieties with multiple biotic and abiotic stress tolerance. Starting
in 2009, IRRI focused on developing cultivars with multiple abiotic stress tolerance
Fig. 3 IRRI-Green Super Rice early backcross breeding strategy to develop rice varieties with
multiple-stress tolerance, resource-use efficiency, and high yield with market-required grain qual-
ity. (a) The selected donors were crossed with HHZ and WTR-1 and later selfed to create 16 BC1F2
bulk populations. These backcrossed lines were used in three rounds of phenotypic selection under
different environments and selected lines with better performance were evaluated in the different
targeted ecosystems. (b) Identified promising trait-specific selective introgression lines with more
than one target green trait were used for the designed QTL pyramiding to combine various desir-
able traits into one single line. The blue-colored circles indicated in the schematic diagram were
used to show the different genotyping technologies used to identify genomic regions associated
with green traits in GSR breeding populations. (IRG, irrigated conditions; DSF, drought stress in
field conditions; BDS, biotic-stress phenotypic screening; RFD, rainfed environment; SAL, salinity
at the seedling stage at 18 d/sm (deciSiemens per metre); COL, cold stress; LIP, low inputs (with-
out any fertilizer, pesticide, or herbicide); ARG, anaerobic germination (direct-seeded and imme-
diately submerged in water for 21 days and maintained at 10-cm water depth); SBM, submergence
for 21 days at 14 days of seedling stage
through an innovative GSR breeding strategy to benefit poor and smallholder farm-
ers (Ali et al. 2012). The concept of a GSR breeding program primarily involved
two fundamental steps: first, developing superior EB-SILs; second, identifying suit-
able SILs to develop designed QTL pyramiding (DQP) lines. These two approaches
helped to develop GSR varieties with multiple biotic and abiotic stress tolerance
without compromising on grain yield, grain appearance, and cooking quality
parameters.
The GSR breeding program at IRRI initially focused on identifying and explor-
ing genetic variation and further selecting ~500 elite EB-SILs in an elite and widely
adaptable Chinese variety, Huang-Hua-Zhan (HHZ), background with 16 donors
from the mini-core collection of rice germplasm and a part of the 3000 Rice
Genomes Project. These parental varieties underwent whole-genome sequencing to
identify genomic variations. In the IRRI GSR breeding program, two additional
elite recipients, Weed Tolerant Rice-1 (WTR-1) and TME80518, were used for
developing EB-SILs (Ali et al. 2012, 2013b, 2018a). In this GSR breeding program,
the BC1F2 populations were derived from crosses between the recipients (HHZ,
WTR-1, and TME80518) and the 16 donors at IRRI. The F1s derived from the HHZ
background were again backcrossed with HHZ and subsequently selfed, and the
progenies bulked to generate a total of 16 BC1F2 bulk populations. These bulk popu-
lations were screened over three rounds of selection for different abiotic stresses
(drought, salinity, submergence, and low-input fertilizer) and biotic stresses (blast,
bacterial leaf blight, and tungro), and in normal irrigated conditions. This led to the
identification of a total of 1333 trait-specific SILs from the HHZ background, 2232
SILs from the WTR-1 background, and 1408 SILs from the TME80518 background.
The developed SILs were phenotyped across different stress and non-stress con-
ditions and genotyped with SSR and high-density SNP markers. The phenotypic
and marker data generated using SSR and SNP analysis allowed us to identify the
donor QTLs associated with target abiotic and biotic stress tolerance/resistance and
yield in the SILs. Then, the best SILs were selected as parents based on both their
superior phenotypes and complementary donor alleles for designed QTL pyramid-
ing (DQP) to develop better GSR varieties that combine various target traits from
two or more donors. These promising SILs showed high tolerance vis-à-vis the
respective tolerant checks IR74371-70-1-1, FL478, IR49830, and PSBRc82 under
normal and stress conditions. Through these DQP approaches, a total of 2023 pyra-
miding lines (PDLs) from the HHZ background and 661 PDLs from the WTR-1
background were developed and found superior to the checks for all of the traits
studied (Ali et al. 2013a, 2020; Li and Ali 2017). The selected 564 EB-SILs derived
from the genetic background of WTR-1 as recipient parents and 11 donor parents
were sequenced using tunable genotyping-by-sequencing (tGBS) technology.
Table 1 provides the list of donors and recipients used. These SILs developed
through early backcross breeding were more advantageous in terms of high allelic
diversity, which comprised multiple donor parents. As compared with the biparental
mapping population, these SILs provide more precise QTL detection and fine-
mapping of candidate genes for biotic and abiotic stress tolerance (Ali et al. 2017,
2018a). A total of 102 loci were identified from the 11 populations, and they contain
66 J. Ali et al.
Table 1 List of donors used in the GSR breeding program

S.
no. Parent Rice variety Origin Key features
1 DP OM1723 Vietnam Long panicle, salinity and drought tolerance
2 DP Phalguna India Fine-grain type, resistance to blast and gall midge
disease
3 DP IR50 Philippines Resistance to insects and diseases, superior grain
quality
4 DP IR64 Philippines High yield, tolerance of lodging, blast resistance,
long slender grain
5 DP Teqing China High yield, tolerance of nitrogen deficiency and
zinc deficiency
6 DP PSBRc66 Philippines High amylose content
7 DP CDR22 India Strong restoring ability and high combining ability,
resistance to blast
8 DP PSBRc28 Philippine High yield, resistance to blast, moderate resistance
to brown planthopper, bacterial leaf blight, green
leafhopper, and stem borer
9 DP Yue-Xiang- China Wide adaptation and high harvest index
Zhan
10 DP Khazar Iran Tolerance of salinity, zinc deficiency, and anaerobic
germination
11 DP OM1706 Vietnam Tolerance of salinity, anaerobic germination, and
submergence, resistance to brown planthopper
12 DP IRAT352 CIAT Tolerance of low pH and aluminum toxicity
13 DP Zhong 413 China High yield, wide compatibility, restoring ability
14 DP R644 China Resistance to brown planthopper
15 DP IR58025B Philippines Popular wild-abortive elite maintainer
16 DP Bg304 Sri Lanka Tolerance of salinity and zinc deficiency, high yield
of red rice, resistance to glyphosate and gall midge,
blast, and bacterial leaf blight diseases
17 RP Huang-Hua- China Chinese indica variety with high yield and wide
Zhan adaptability, superior grain quality, moderate
tolerance of salt and drought stresses, long panicle
18 DP Haoannong China Long panicle, tolerance of low-temperature stress
19 DP Cheng-Hui 448 China Excellent restorer line, salinity tolerance
20 DP Feng-Ai-Zan China High yield
21 DP Y-134 China Tolerance of submergence and anaerobic
germination, resistance to brown planthopper
22 DP Zhong 413 China High yield, wide compatibility, restoring ability
23 DP Khazar Iran High yield, blast resistance, moderate resistance to
stem borer, mild aroma
24 DP BG 300 Sri Lanka Drought tolerance, resistance to brown planthopper,
gall midge, blast, and bacterial leaf blight
25 DP OM 997 Vietnam Drought tolerance, resistance to blast
26 DP Basmati-385 Pakistan Tolerance of zinc deficiency
(continued)
Table 1 (continued)
S.
no. Parent Rice variety Origin Key features
27 DP M 401 United Premium grain quality, large kernel, tolerance of
States low nitrogen, good yield, late maturity
28 DP X 21 Vietnam High yield, disease resistance
29 RP Weed Tolerant China High yield, widely adapted rice variety
Rice-1
120 deleterious SNPs, with a range of one to four SNPs per loci. These loci can
substitute the amino acid, and this leads to changes in the functional proteins in
either positive or negative regulations (Ali et al. 2018a). Interestingly, the donors of
SILs have a different introgression frequency of alleles in the recipient genomic
regions and are mainly attributed to the severe selection pressure under abiotic
stress conditions. With the availability of tGBS marker information with the GSR
breeding approach, several genetic loci have been identified through the various
linkage-based mapping methods. This innovative approach assured the develop-
ment of new rice varieties that were tolerant of multiple stresses.
3 Genetics of Green Traits
In the GSR breeding program, the critical genetic determinants of various abiotic
stress tolerances can be identified through QTL mapping approaches. As of now, the
details of the identified QTLs and breeding materials are listed in Table 2. In many
instances, advancement in the identification of stress-tolerance genes and QTLs that
determine the trait has led to insights into the specific physiological and molecular
mechanisms in response to various biotic and abiotic stresses (Wing et al. 2018; Yu
et al. 2020). The highlights of the green traits associated with genetic information
that confers stress tolerance and adaptive strategies provide valuable information
for crop improvement.
3.1 Drought Tolerance
Drought is a complex trait. Understanding its mechanisms in terms of plant-water

relationship traits, molecular breeding strategies, and dissecting the molecular genet-
ics of QTLs and deployment in the breeding pipeline are the key steps for the develop-
ment of drought-tolerant rice varieties. For drought improvement, it is essential to use
advanced genomics and omics platforms that provide an opportunity for the mining of
trait-specific allele functions. Identifying and developing drought-tolerant rice culti-
vars mainly depends on two major factors: prospecting for donors and effective
Table 2 List of QTLs and putative candidate genes for green traits in the Green Super Rice breeding program
68
Putative
Breeding Polymorphic Number candidate
Traits Genotyping Parents (RP/DP) strategy SNPs of QTLs genes Chromosomes Reference
Weed-competitive SNP array WTR-1/Y-134 EB-SILs 677 43 13 1, 2, 3, 5, 6, 7, 9, 10, Dimaano et al.
ability 11, and 12 (2020)
Arsenic tolerance SNP array WTR-1/ EB-SILs 704 9 25 1, 2, 5,6, 8, and 9 Murugaiyan et al.
Haoannong (2019)
Nutrient-use tGBS WTR-1/ EB-SILs 1174 13 90 1, 2, 3, 4, 5, 9, 10, Mahender et al.
efficiency Haoannong and 12 (2019)
WTR-1/ EB-SILs 1110 4 30 4, 5, 6, and 8
Cheng-Hui 448
WTR-1/Zhong 413 EB-SILs 834 2 – 1,11
Nutrient-use SNP array WTR-1/ EB-SILs 704 49 – 1, 2, 3, 4, 5, 6, 7, 8, Jewel et al. (2019)
efficiency Haoannong 9, 10, 11, and 12
Low-temperature SNP array WTR-1/ EB-SILs 704 82 16 1, 2, 3, 4, 5, 6, 7, 8, Najeeb et al.
stress (LTS) Haoannong 9, 10, 11, and 12 (2020)
tolerance
Salt tolerance tGBS WTR-1/Khazar DQP 9244 6 87 1, 2, and 4 Pang et al. (2017b)
and BG 300/
WTR-1
Brown planthopper SNP array Huang-Huan- EB-SILs 702 1 71 1 Balachiranjeevi
resistance Zhan/Khazar et al. (2019)
Low-nitrogen KASP and HHZ/Teqing, DQP 3162 7 – 1, 2, and 3 Feng et al. (2018)
WGS CDR22, and
OM1723
Drought tolerance KASP HHZ/Teqing, DQP 3162 9 – 2, 3, 5, 6, 8, and 12 Feng et al. (2018)
CDR22, and
OM1723
SNP array single nucleotide polymorphism array, WGA whole-genome sequence, DQP designed QTL pyramiding, EB-SILs early backcross-derived selective
J. Ali et al.
introgression lines, KASP competitive allele-specific PCR

phenotypic evaluation methods required for crossing programs and a successful selec-
tion scheme. However, improving drought tolerance in rice varieties has had slow
progress due to the complexity of the trait and some associated undesirable character-
istics, including low grain yield and a lack of preferable nutritional grain quality traits
(Swamy and Kumar 2013; Kumar et al. 2014). With pre-breeding activity and marker-
assisted breeding approaches, several drought-tolerant lines have been developed and
further used in breeding programs for improving lines with multiple-stress tolerance
(Singh et al. 2016; Ali et al. 2017; Pang et al. 2017a; Gautam et al. 2020; Kumar et al.
2020). However, improving yield potential under drought environments is limited due
to the intensity, duration, and timing of drought stress. Important are the establishment
of efficient phenotypic screening protocols and using precise phenotypic selection
criteria (Ouk et al. 2006; Oladosu et al. 2019). From the recent developments in vari-
ous molecular breeding strategies, precise high-throughput phenotypic technologies
have been identified for promising traits such as grain yield, and morpho-physiologi-
cal component traits have shown moderate to high heritability under drought stress
conditions (Tuberosa 2012; Kumar et al. 2014; Swain et al. 2014; Ali et al. 2017;
Sahebi et al. 2018; Yadav et al. 2019). Several researchers have used direct selection
of GY, along with considering other secondary traits using molecular and genomic
approaches (Oladosu et al. 2019). The results led to the identification of the QTLs and
genes that are associated with these traits. Discovering these QTLs/genes that are
responsible for tolerance traits is essential for developing crops with tolerance through
marker-assisted selection or genetic engineering approaches. To this end were identi-
fied the major-effect drought tolerance QTLs from drought-tolerant rice varieties Apo
(qDTY1.1, qDTY2.1, qDTY3.1, and qDTY6.1), Way Rarem (qDTY12.1), Nagina 22 and
Dhagaddeshi (qDTY1.1), and Vandana (qDTY2.3 and qDTY3.2) (Bernier et al. 2007;
Venuprasad et al. 2009; Vikram et al. 2011, 2015; Ghimire et al. 2012; Dixit et al.
2014). With the marker-assisted introgression approach, grain yield QTLs with major
and consistent effects (qDTY1.1, qDTY2.1, qDTY2.2, qDTY3.1, qDTY3.2, qDTY6.1, and
qDTY12.1) on chromosomes 1, 2, 3, 6, and 12 have been validated, deployed into
drought breeding programs, and successfully improved drought-susceptible rice
mega-varieties (Kumar et al. 2014, 2017b, 2020; Singh et al. 2016; Sandhu and Kumar
2017). However, the locally adapted high-yielding commercial mega-varieties show a
sensitive reaction to other biotic and abiotic stresses. These improved tolerant rice
varieties have not been able to show a similar yield performance in varied agroecosys-
tems. Introgression of these major QTLs/genes in a different combination using a
marker-assisted selection approach provides an opportunity to increase desirable phe-
notypic traits and thereby improve grain yield. Still, pyramiding of these major QTLs/
genes has not been fully exploited due to G × E interaction of this complex trait epis-
tasis, and pleiotropy could have negative/positive effects on the trait of interest (Li
1998; Yano et al. 2003; Xu and Crouch 2008). As a consequence, it has been tough to
make significant genetic improvements in grain yield under drought stress through
conventional breeding methods. Therefore, the development of large-scale phenotypic
screening, marker-assisted breeding strategies, and advanced genotyping technolo-
gies has significantly accelerated varietal improvement programs on drought toler-
ance. Further, the identification of QTLs/genes affecting grain yield could result in
70 J. Ali et al.
yield improvement and stability under drought stress. In comparison to the classical
breeding and genetic mapping approaches, the GSR breeding strategy used SILs and
designed QTL pyramiding approaches in the development of multiple-stress-tolerant
rice varieties for improving grain yield under stress conditions.
The GSR breeding strategy has three significant advantages: first, the selected few
SILs require lesser costs in both genotyping and phenotyping; second, the strategy
significantly increased the power in detecting the genomic regions of QTLs/genes;
third, the selected lines mostly carried the beneficial alleles of QTLs (Ali et al. 2017).
Based on the DQP approach, Feng et al. (2018) identified a total of nine drought toler-
ance QTLs on chromosomes 2, 3, 5, 6, 8, and 12 using a segregation distortion
approach. These QTLs were detected from the three different genetic backgrounds of
trait-specific SILs, which were generated from the 63 SILs from the cross
HHZ × Teqing, 68 SILs from the cross HHZ × CDR22, and 75 SILs from the cross
HHZ × OM1723 (Ali et al. 2017). The major significant QTLs on chromosomes 3, 5,
and 8 were closely associated with the earlier reports of grain yield QTLs and seed
fertility QTLs under drought stress. Similarly, researchers exploited the genotypic
information on EB-SILs derived from the 11 donors crossed with recurrent parent
WTR-1, which comprised a total of 564 diverse SILs used for identifying synony-
mous and non-synonymous deleterious polymorphic SNPs (Ali et al. 2018b). Of
these, the significant locus Os01g01689 on chromosome 1 possessed a G/A deleteri-
ous SNP altering an amino acid from Ala to Thr in the background of Haoannong and
Y-134. This locus was associated with abiotic stress tolerance. This innovative breed-
ing strategy addresses the GCV challenge and allows poor farmers to benefit from the
use of stress-tolerant and high-yielding rice varieties under limited resources.
Therefore, genotyping the EB-SILs and DQP populations helped to identify several
promising genomic regions for complex traits and assisted in molecular marker devel-
opment and genomic applications in molecular breeding programs.
3.2 Salinity Tolerance
More than 20% of global agricultural land is affected by salinity, especially in the
coastal regions of South and Southeast Asian countries. Salinity is mainly caused by
the drastic changes in the climatic events that are significantly associated with
increases in salinity in the soil. During crop growth stages, the accumulated Na+ and
Cl− concentrations in plants lead to inhibiting cell expansion and photosynthetic
activity, followed by changes in physiological and molecular pathways in roots for
the uptake of water and nutrients, leading to cytotoxic effects. Mainly, the accumu-
lation of these elements can be processed through osmotic and ionic stresses, which
can activate the formation of reactive oxygen species (ROS) and cause leaf damage
or plant death. Thus, developing rice varieties with salinity tolerance is a prominent
approach to resolve the salinity problem. However, progress in developing salinity-
tolerant rice varieties has been slow because of the complexity of the salinity toler-
ance trait, and this has involved multiple physiological and biochemical pathways.
As of now, several researchers had worked on the complex traits using advanced
genomic-assisted breeding tools in traditional molecular breeding strategies and
sequencing at the whole-genome level. In the past two decades, >700 QTLs and 200
genes have been reported for salinity tolerance at different growth stages (Rahman
et al. 2017; van Oort 2018) (http://archive.gramene.org/). Most of these genes and
QTLs are associated with different traits such as salt injury score, shoot and root
growth, fresh and dry weight of shoot and root, Na+ and K+ content in shoot and
root, grain yield, and chlorophyll content. The genomic regions of these QTLs and
genes are involved in the different physiological and molecular mechanisms such as
ionic equilibrium, osmotic adjustment, transcription regulation, and signaling path-
way (Molla et al. 2015; Pradhan et al. 2015; Gimhani et al. 2016; Kumar et al.
2017a). However, the identified genomic regions have a more significant interval
gap because they employ a low density of molecular markers and possibly because
of epistatic QTLs and environmental interaction. It’s possible to have hundreds of
genes in those QTL positions, which makes it difficult to track the genetic pathways.
The recent development of genotyping technologies provided robust genotyping
information and can remarkably reduce chromosomal intervals and also help in
identifying accurately predicted gene functions related to the target traits. Dissecting
these complex traits and identifying superior tolerant lines, the GSR breeding pro-
gram began an integrated molecular breeding strategy to identify genome-wide
trait-specific introgression lines (ILs) through the DQP approach. Using high-
density SNP markers of tGBS technology, three significant QTLs, qSES2, qSES4
(qChlo4), and qChlo1, were mapped, and this further narrowed down the list of
genes through the use of grandparent genotypic information (Pang et al. 2017b). As
a result of this approach, 13, 34, and 40 candidate genes were identified in the QTLs
regions, respectively. Pang et al. (2017b) carried out functional analyses of the can-
didate genes for the salinity-tolerance QTLs to infer two, five, and six genes as the
most likely candidates of qSES2, qSES4 (qChlo4), and qChlo1, respectively. This
combination of high-density SNP markers with parent and grandparent information
could be a potential approach for identifying the right genes for desired target traits
in rice. With this strategy, several high-yielding, multi-stress-tolerant rice varieties
such as NSIC Rc480, NSIC Rc534, NSIC Rc 390, NSIC Rc 392, NSIC Rc 554, and
NSIC Rc 556 were developed and released for cultivation under saline conditions
(Guan et al. 2010; Ali et al. 2017; Yu et al. 2020).
3.3 Submergence Tolerance
Submergence is an essential factor that limits rice yield over 15 million ha in rainfed
lowland regions of Asia (Septiningsih et al. 2009). Rice is known to adapt well to
flooded conditions, but most rice cultivars become vulnerable upon complete sub-
mergence. Complete submergence of rice plants, particularly under turbid water,
causes severe damage through decreased respiration and photosynthesis (Ella et al.
2003; Bailey-Serres et al. 2010). Submergence tolerance is an important trait that
72 J. Ali et al.
could help rice plants to overcome flooding with a water head of 1 m for 14 days at
the active tillering stage. The genetics of submergence tolerance from FR13A
showed a high heritability and was governed by both major genes and some quanti-
tative trait loci (QTLs) (Suprihatno and Coffman 1981; Nandi et al. 1997;
Sripongpangkul et al. 2000; Toojinda et al. 2003). Xu et al. (2006) used FR13A for
cloning Sub1A, a major QTL on chromosome 9, which is a transcription factor con-
cerning ethylene responsiveness. Sub1A-1, one of the alleles at Sub1A, was found to
be essential for submrgence tolerance in several semi-dwarf varieties (Septiningsih
et al. 2009). Ali et al. (2006) demonstrated that progenies with submergence toler-
ance were identified consistently in most BC populations derived from sensitive
parents. This suggested the presence of hidden genetic diversity for submergence
tolerance in the primary gene pool of rice. Wang et al. (2015) determined the genetic
basis of submergence tolerance in rice and facilitated the simultaneous improve-
ment of submergence tolerance in rice. In their study, they characterized the
genome-wide responses of 162 SILs with submergence tolerance from 12 BC popu-
lations using SSR markers that helped in the dissection of the hidden diversity and
transgressive segregation. Their results provided insights into the genetic basis of
submergence tolerance of rice and demonstrated a novel strategy for simultaneous
improvement and genetic dissection of complex traits using the approach of selec-
tive introgression (Li et al. 2005). The genome-wide responses of donor alleles to
strong phenotypic selection for submergence tolerance can be understood with three
key findings from Wang et al. (2015). First, they found significant over-introgression
of the donor alleles at 295 loci in 167 functional genetic units (FGUs) across the rice
genome. Second, they observed significantly increased homozygosity or “loss of
heterozygosity” genome-wide. Third, pronounced non-random associations
between or among the detected submergence tolerance loci led to the discovery of
putative genetic networks (multi-loci structures) underlying submergence tolerance
in rice. Further, their results suggested that submergence tolerance of rice is con-
trolled by large numbers of loci involved in multiple positively regulated signaling
pathways (Wang et al. 2015). It is essential here to understand that the restoration of
one or more of these broken pathways in the BC progenies by genetic complemen-
tation from the introgressed functional donor alleles at submergence tolerance loci
provided an appropriate explanation for the transgressive segregation of submer-
gence tolerance and this could be extended to other complex traits in rice. The GSR
breeding strategy developed several promising salinity-tolerant materials such as
NSIC Rc480, GSR 5, and GSR11. Yorobe et al. (2016) found that the mean differ-
ence in net farm income between GSR and non-GSR varieties was positive and
significant and gave farmers an income advantage of USD 230.90/ha for GSR vari-
ety users. In their study, Yorobe et al. (2016) found that, with a high occurrence of
flooding in the wet season, the use of GSR varieties assured rice farmers of a posi-
tive net farm income.
3.4 Nutrient-Use Efficiency
Nutrient-use efficiency (NUE) is one of the most critical traits for increasing
yield and productivity by using nutrients such as nitrogen (N), phosphorus (P),
and potassium (K) to increase NUE. During the Green Revolution (GR) period
in the 1960s and post-GR, yield increased significantly, and this was primarily
achieved with a higher input dosage of fertilizer, pesticide, and water (Ali et al.
2018b). Recently, Hawkesford and Griffiths (2019) mentioned that only 33% of
global N is recovered from harvested grain, while the remaining N is a signifi-
cant pollutant and a colossal waste of resources. A higher amount of fertilizer
application can lead to a substantial imbalance in nutrient availability in the
soil, increase the risk of pests and diseases, and not be cost-effective for poor
farmers (Chen et al. 2014a, b; Rahman and Zhang 2018). Regarding environ-
mental safety and the use of low inputs in farmers’ fields, the GSR breeding
team started a program at IRRI to identify nutrient-use-efficient breeding lines
that could obtain higher grain yield under integrated nutrient management tech-
niques. This was the first initiative in the NUE breeding program at IRRI (Jewel
et al. 2018) and it was reported as a unique and systematic breeding approach
through the selection of SILs with higher NUE through the early backcross
breeding program. SILs were selected in four consecutive seasons under differ-
ent nutrient fertilizer combinations of N, P, and K dosages. Five promising SILs
(Nue-115, Nue-114, Nue-112, Nue-229, and Nue-230) were identified with
higher grain yield and nutrient-use efficiency. These SILs could provide valu-
able information for rice breeding programs. The genetics of NUE (Mahender
et al. 2019) identified a total of 19 QTLs that were associated with three agro-
nomic traits by using tGBS technology. These major QTLs were located on
chromosomes 2, 5, 8, 9, and 12. The genomic regions of these QTLs were co-
localized with earlier reports of low nitrogen and phosphorus conditions.
Importantly, in silico analysis of these QTL positions suggested that several key
candidate genes played a major role in the various molecular and physiological
pathways in response to abiotic stress tolerance and also maintenance of the
homeostasis mechanism under low-input conditions. Similarly, Jewel et al.
(2019) detected a total of 49 main-effect QTLs under six nutrient conditions.
These QTLs explained a phenotypic variance range from 20.25 to 34.68%. They
were located on all 12 chromosomes, except on chromosomes 7, 11, and 12.
Among them, four hotspot QTLs were identified on chromosomes 3, 5, 9, and
11. Interestingly, 22 QTLs for partial factor productivity and four QTLs for
agronomic efficiency were detected as novel under –P and 75 N conditions.
Several genes and transporters were located in the interval regions of these
QTLs, and they were involved in nutrient uptake and transporting mechanisms
from soil to plants. Therefore, the hotspot regions of QTLs and genes may offer
significant value for marker-assisted selection and pyramiding of multiple QTLs
for improving NUE in rice.
74 J. Ali et al.
3.5 Weed-Competitive Ability Traits
Threats such as GCV, rising labor shortages, decreasing arable land, and the increas-
ing prices of fertilizer and pesticide are the major contributors to the decrease in rice
production (Singh et al. 2013). To overcome these constraints, shifting from the
manual rice transplanting system to direct-seeded rice (DSR) is the most promising
approach to improve rice sustainability (Chauhan and Abugho 2013; Mahender
et al. 2015). It has numerous benefits, mainly in decreasing water use by 35–75%,
decreasing labor demand, shortening crop duration, mitigating methane gas emis-
sions, and lowering the cost of cultivation (Mahender et al. 2015; Dimaano et al.
2017). However, vigorous growth of weeds is one of the most complicated biologi-
cal constraints in the DSR system to attaining optimal grain yield (Antralina et al.
2015; Chauhan et al. 2015a, b; Jabran and Chauhan 2015). Several options such as
tillage operations and herbicide application are available to control weeds, but these
are laborious and costly (Rahman et al. 2012). Globally, more than USD 100 billion
are lost annually because of weed control (Appleby et al. 2002). Therefore, develop-
ing a breeding strategy for weed-competitive (WC) rice varieties is a critical solu-
tion for decreasing tillage operations, hand weeding, and herbicide inputs in the
DSR system. WC ability is a complex trait, and it interacts with several agro-
morphological traits (Chauhan et al. 2015a; Raj and Syriac 2017). Thus, it is essen-
tial to understand the trait interactions and mechanisms that confer WC ability, and
this could be useful for speeding up the breeding activities for developing WC rice
cultivars. Recently, as a part of the GSR breeding program at IRRI, Chauhan et al.
(2015b) and Dimaano et al. (2017) followed a systematic breeding effort to identify
WC ability traits related to early seed germination (ESG) and early seedling vigor
(ESV). The breeding materials were developed from the four early generations of
backcross populations derived from one common recipient parent, Weed Tolerant
Rice-1 (WTR-1), and four donors, Y134, Zhong 143, Khazar, and Cheng Hui-448.
These SILs were evaluated over three rounds of selection in upland weed-free,
upland weedy, and lowland weedy conditions. Among the total SILs, five (G-6-
L2-WL-3, G-6-RF6-WL-3, G-6-L15-WU-1, G-6-Y16-WL-2, and G-6-L6-WU-3)
were found to be promising in lowland weedy conditions, whereas four SILs (G-6-
Y7-WL-3, G-6-Y6-WU-3, G-6-Y3-WL-3, and G-6-Y8-WU-1) were found to have
the highest grain yield under upland weedy conditions (Dimaano et al. 2017). The
primary requirements for the DSR system to be successful are the following: unifor-
mity and speed of germination rate and early seedling growth are significantly asso-
ciated with robust and vigorous crop growth and a better crop establishment, which
can influence WC ability (Cui et al. 2002; Foolad et al. 2007; Diwan et al. 2013;
Dang et al. 2014). These traits can provide support for traits attributed to efficient
root growth that can help in the absorption of more nutrients (Farooq et al. 2011;
Matsushima and Sakagami 2013; Singh et al. 2015; Khan et al. 2016). For the
molecular genetics of WC rice cultivars, a total of 43 QTLs were mapped on all 12
chromosomes, except on chromosomes 4 and 8, by using 677 high-quality SNP
markers (Dimaano et al. 2020). Interestingly, 29 novel genetic loci were associated
with ESG and ESV traits on chromosomes 1, 3, 5, 6, 7, 10, 11, and 12. The hotspot
regions of chromosomes 11 and 12 were associated with multiple traits (Dimaano
et al. 2020). Many of these QTLs were co-localized in previous reports, which are
related to germination rate, germination index, germination percentage, and germi-
nation time in different genetic backgrounds of mapping populations (Mahender
et al. 2015). In addition, some critical genes located in the co-localized hotspot
regions can influence the regulation of various physiological functions such as chlo-
roplast development, photosynthesis, hybrid sterility, seed development, and seed-
ling lethality during plant growth stages (Gothandam et al. 2005; Matthus et al.
2015; Sharma and Pandey 2016; Yu et al. 2016). Therefore, the hotspot regions with
co-localized QTLs and genes may have a more significant role in the improvement
of weed-competitiveness, mainly in African and Asian countries, to decrease rice
production costs.
3.6 ow-Temperature Stress Tolerance at Different Crop

L
Growth Stages
Rice is one of the most sensitive among the cereal crops to low-temperature stress
(LTS)/cold stress (CS), mainly at the germination to booting stage, which can cause
a significant yield decrease due to reduced germination rate and seedling growth,
high spikelet sterility, delay in flowering, and lower grain filling (Ranawake et al.
2014; Schläppi et al. 2017; Shakiba et al. 2017; Najeeb et al. 2020). The drastic
changes in GCV in rice-growing areas mainly in the tropical, subtropical, and tem-
perate regions had severe effects from low-temperature stress during the critical
stages of seedling growth and pollen abortion at the booting stage, leading to grain
yield decreases (Ye et al. 2009; Jena et al. 2010; Sun et al. 2018). LTS mainly inhib-
its sugar accumulation in the pollen and further leads to male sterility, which is
regulated by the invertase enzyme through the hormone abscisic acid (ABA) path-
ways that transport sugar to the tapetum. The results of these mechanisms decrease
invertase amounts in susceptible rice varieties, leading to lower pollination (Oliver
et al. 2007). This situation warrants the development of LTS-tolerant varieties
through a systematic breeding effort to increase rice production in 25 countries,
including the major rice-producing countries (Cruz et al. 2013; Zhang et al. 2017).
Therefore, to minimize yield losses under LTS, particularly in cold-affected regions,
it is crucial to identify potential donors to improve LTS tolerance. LTS tolerance
breeding for widely adapted and high-yielding rice cultivars is needed to meet
future food demand worldwide.
Information on the genomic regions of QTLs and genes governing tolerance of
LTS is limited for different growth stage-specific traits in rice due to its complex
nature, and this significantly influences QTL × environment interactions. Up to now,
several studies have been reported for QTL mapping for LTS. Recently, Najeeb et al.
(2020) reviewed the genetics of LTS tolerance QTLs in rice. A total of 239 and 339
76 J. Ali et al.
QTLs were identified on 12 chromosomes using genome-wide association studies and

biparental mapping populations, respectively (http://archive.gramene.org). However,
mapping of the sensitive stage, especially at the reproductive phase of a complex trait,
involves multiple genes, environment interactions, and difficulties in phenotypic
screening. Despite these large numbers of QTLs for LTS, a few of them were studied
for fine-mapping and cloning. Based on the public domain and rice database, a total
of 38 candidate genes were functionally characterized for LTS tolerance. Importantly,
four genes on chromosome 1 (OsCOIN, OsGSK1, OsGH3-2, and OsMYB3R-2), two
genes on chromosome 6 (OsiSAP8 and OsbZIP52,) and a single gene on chromosome
4 (OsCAF1B) and chromosome 11 (OsAsr1) were significantly associated with LTS
tolerance in the seedling and reproductive stage in rice. In contrast, breeding strategies
for LTS tolerance remained a slow process by conventional methods because most of
the QTL mapping methods could not explain G × E interaction well and appropriate
statistical and advanced breeding strategies were lacking. Improvement of LTS toler-
ance at the reproductive stage is needed through a selective introgression method
(Liang et al. 2018). A population was derived from BC2F4 onward using five donors
and a japonica (Geng) recipient parent that were screened over three rounds to select
under LTS conditions at the reproductive stage. This approach helped in dissecting the
complex trait of LTS tolerance and developed trait-specific introgression lines. A total
of 17 QTLs were identified using five different populations of EB-SIL derived from
five different donors into a common recipient parent. Further, multi-locus probability
tests and linkage disequilibrium results showed that a total of 46 functional genetic
units were distributed across the rice genome for cold tolerance. Studies showed the
presence of strong epistasis and power of the statistical approach for the development
of selective introgressions for simultaneous improvement and genetic dissection of
complex traits. Zhu et al. (2015) used an inter-connected breeding (IB) population
comprising 497 SILs derived from eight BC families with the same recipient parent
for identifying and fine-mapping QTLs for LTS tolerance at the booting stage. A total
of 41,754 high-quality SNPs were obtained through the re-sequencing of the IB popu-
lation. Phenotyping was conducted under field conditions in 2 years and three loca-
tions. Association analysis identified six QTLs for LTS tolerance on chromosomes 3,
4, and 12. The stably expressed QTL qCT-3-2 was fine-mapped and narrowed down
to approximately 192.9 kb on the reference genome (Zhu et al. 2015). The QTL
qCT-3-2 is essential for developing varieties with LTS tolerance at the booting stage,
which are in high demand in temperate and high-altitude rice production regions.
GWAS applied to an IB population allowed better integration of gene discovery and
breeding. QTLs can be mapped in high resolution and quickly used for breeding.
3.7 Grain Quality
Improvement of grain quality traits (grain appearance, cooking and eating quality)
is a major concern in rice breeding programs. Earlier rice breeding efforts over the
past few decades primarily focused on increasing grain yield potential as the
primary target in the major Asian rice-growing countries, and most of the high-
yielding and popular rice varieties had poor grain quality traits (Custodio et al.
2019). Approximately one-third of the global population is suffering from nutri-
tional deficiency, mainly caused by inferior grain quality traits such as low protein
content and lack of vitamins and minerals (Balyan et al. 2013). Therefore, to meet
the global food demand, it is essential to keep nutritional quality traits integrated
well in our breeding programs. Consumer acceptance and their preferred grain traits
are major factors that influence different markets across the globe. For instance,
grain appearance traits such as long and slender grain shape are mostly preferred in
countries such as India, Vietnam, the United States, and most Asian countries,
whereas northern China, Korea, and Japan prefer short and round rice grains
(Unnevehr et al. 1985; Cuevas et al. 2016). Improvement in grain quality is for a
complex trait involving many traits such as milling efficiency, grain appearance
(size and shape), and cooking and eating quality (apparent amylose content, gelati-
nization temperature, gel consistency). Many of these grain quality component
traits are highly complex and quantitative in nature and are significantly influenced
by environmental factors. In a global view, grain shape traits need to be understood,
matching market and consumer preferences and needing to be adequately addressed
in breeding programs for different target regions. Several researchers have identified
many critical genetic loci and candidate genes for grain quality traits (Yun et al.
2014; Balakrishnan et al. 2016; Pang et al. 2016; Wang et al. 2017; Mogga et al.
2018; Kavurikalpana and Shashidhara 2018; Wing et al. 2018; Bazrkar-khatibani
et al. 2019; Calayugan et al. 2020; Zhang et al. 2020). Mahender et al. (2016)
reviewed grain nutritional traits and associated genetic information on QTLs and
genes in rice. More than 400 QTLs have been reported for these grain quality traits,
including grain appearance and cooking and nutritional properties (Mahender et al.
2016; Bazrkar-khatibani et al. 2019).
As of now, 28 major genes are involved in controlling grain shape and 65 genes
are associated with eating quality traits in rice (http://qtaro.abr.affrc.go.jp/).
Importantly, the natural variation of eating quality genes such as ALK and WAXY on
chromosome 6, Badh-2 on chromosome 8, and LOX-3 on chromosome 3 regulates
cooking quality traits and encodes the strong component in rice fragrance (Chen
et al. 2008; Shirasawa et al. 2008; Gao et al. 2011; Venu et al. 2011; Wang et al.
2017). Similarly, overexpression of the six genes (OASA2, BiP, OASA1D, OsAAT1,
OsAAT2, OsISA1, and OsISA2) on chromosomes 1, 2, 3, 5, and 8 significantly
increased amino acid content and seed storage protein content in rice grain (Zhou
et al. 2009; Saika et al. 2011; Utsumi et al. 2011). Recent successful GSR breeding
strategies help to a great extent to understand the various green traits that include
grain quality and biotic and abiotic stress tolerance genes that have been cloned (Yu
et al. 2020). These include the critical genes OsAAP6 on chromosome 1, OsGRF4
on chromosome 2, three genes (GNP1, lgy3, and GL3) on chromosome 3, two genes
(Chalk5 and GW5) on chromosome 5, two genes (W7 and OsSPL13) on chromo-
some 7, and a single gene (OsOTUB1) on chromosome 8 associated with grain
quality traits, and some of these genes are significantly associated with yield-
attributed traits and NUE traits (Li et al. 2018). Recently, Mahender et al. (2019)
78 J. Ali et al.
identified 19 QTLs for agro-morphological traits under different dosages of nutrient

fertilizer. Interestingly, one of the major QTLs for leaf chlorophyll content on chro-
mosome 2 and in the same genomic region co-localized with the nitrate transporter
OsNPF7.2 and GROWTH-REGULATOR FACTOR 4 (OsGRF4). These hotspot
genomic regions play a vital role in the interaction of GRF4 and DELLA proteins
that are involved in multiple gene regulation related to grain quality traits and that
also maintain homeostatic coordination of nitrogen and carbon metabolism
(Serrano-Mislata et al. 2017; Li et al. 2018; Xing et al. 2018).
3.8 Biotic Stress Tolerance
Rice grain yield declined globally by more than 52% because of various biotic
stresses such as insect pests (brown planthopper, green rice leafhopper, and yellow
stem borer) and diseases (bacterial leaf blight, blast, sheath blight, and tungro).
Yield was severely affected in the rice-growing countries of Asia and Africa (Van
Oort and Zwart 2018). These biotic stresses significantly cause annual crop losses
that threaten global food security. According to the estimation of Roy-Barman and
Chattoo (2005), global yield losses annually are equivalent to the quantity required
to feed 60 million people. Worldwide, fungal disease alone is estimated at 14% of
the annual rice yield decline. Hence, significant changes in GCV lead to increased
extreme weather patterns and this combined with increasing air temperatures are the
leading causes of the spread of disease into different areas, which has also differed
from region to region and from one agroecology to another (Anderson et al. 2004;
Agrios 2005). Therefore, exploiting the diverse resources of rice germplasm and
understanding the host-plant resistance mechanism at molecular genetics and cel-
lular levels will provide a viable option to manage this disease vis-à-vis the applica-
tion of various pesticides. For better management of biotic stresses, integrative
strategies are required for the selection of resistant rice varieties, and identifying
QTLs and genes to understand the genetics of resistance from advanced genotyping
technologies and pathogen races. This will deliver valuable information for the
development of future climate-smart rice varieties.
Recent progress in QTL and gene/allele identification technologies, marker-
assisted selection (MAS), and advanced genomic techniques has been used to
develop disease and insect resistance in rice. The molecular genetics of the resis-
tance to the various pathogens has been well documented through conventional or
molecular marker-assisted breeding strategies. Therefore, the use of this disease
resistance and insect resistance in genomic regions of QTLs and genes provides the
most cost-effective and prominent approach for decreasing pesticide use. To date,
more than 100 genes for blast resistance, 40 genes for bacterial blight resistance, 34
genes for brown planthopper resistance, 11 genes for general insect resistance, and
6 genes for sheath blight resistance have been identified on different chromosomes
(http://qtaro.abr.affrc.go.jp/). Further, some of these genes have been isolated and
functionally characterized (http://qtaro.abr.affrc.go.jp/). However, the two major
diseases (blast and BLB) frequently affect crop yield and decrease it in most rice-
growing regions worldwide. These cloned genes are providing valuable sources to
understand the interaction between the disease and host, pathogen mechanism, and,
further, as a means to enhance resistance mechanisms in the various backgrounds
using marker-assisted breeding and genetic engineering approaches. However,
breakdown of the resistance of a single gene has also been identified after 2 or
3 years. This indicates changes in the frequency of pathotypes or the emergence of
new ones through mutations and other mechanisms. Therefore, to develop broad-
spectrum resistance in rice varieties by stacking multiple resistance genes or QTLs
into a single rice variety seeks to provide resistance to a wide range of races as
compared to one or two gene combinations.
Pyramiding of multiple resistance genes is a useful molecular breeding strategy
for the expression simultaneously of more than one gene to achieve durable resis-
tance against desired target diseases, and it also needs to prevent or delay the break-
down of resistance (Shinada et al. 2014; Feng et al. 2018; Kumar et al. 2018; Liu
et al. 2020). Ashkani et al. (2015) have reviewed different successful molecular
breeding schemes and gene pyramiding strategies to improve biotic disease resis-
tance genes in rice. Notably, Ji et al. (2016) used a gene pyramiding strategy to
develop restorer lines with resistance to multiple diseases: blast (Pita, Pi1, and Pi2),
bacterial blight (Xa23 and xa5), and brown planthopper (Bph3). Therefore, restorer
lines are useful in hybrid rice breeding programs. In the GSR breeding program,
several biotic disease-resistance QTLs and cloned genes have been used in develop-
ing novel GSR breeding materials. Pi2, Xa23, Bph14, and Bph15 genes have been
mainly introgressed into different GSR lines. Recently, a novel gene, Bph38(t),
identified on chromosome 1 explained phenotypic variation of 35.9% in a backcross
population derived from a cross of HHZ and Khazar (Balachiranjeevi et al. 2019).
The development of molecular mapping and functional genomics of insect resis-
tance revealed that most of the BPH resistance genes were clustered together in
specific regions on different chromosomes (3, 4, 6, and 12), except for bph5, bph8,
and BPH22(t) to BPH24(t). For example, 8 genes were located in the 19.1–24.4 Mb
region on chromosome 12 and 12 genes in the 4.1–8.9 Mb region on chromosome 4
(Du et al. 2020). These clustered genes provide a valuable resource for identifying
specific alleles and interaction of the different genes that are involved in the molecu-
lar and physiological pathways for the insect resistance mechanism in rice.
4 olecular Genetics and Breeding Strategies to Combine

M
Multiple Stresses
To develop rice varieties with multiple stress tolerance along with superior grain
yield and quality, breeders are exploring different breeding strategies. However,
limited progress has been made in this direction through conventional breeding
approaches, which are lengthy and laborious processes. Recently available genotyp-
ing technologies such as SNP chips, genotyping by sequencing (GBS), and
80 J. Ali et al.
whole-genome sequencing (WGS) have led to the identification of major-effect

QTLs associated with the complex abiotic stresses such as drought, salinity, and
flooding in rice (Guo et al. 2014; Wang et al. 2017; Ali et al. 2018b; Le Nguyen et al.
2019; Yadav et al. 2019). The identification of molecular markers tightly associated
with a trait is valuable for marker-assisted selection. The marker-assisted breeding
efforts that began at IRRI led to the identification of a major QTL, Sub1, derived
from FR13A, an Indian landrace; qDTY1.1 and qDTY2.1 from drought-tolerant geno-
type Apo; qDTY12.1 from Way Rarem; and Saltol identified from Pokkali, which
showed large effects across different genetic backgrounds. Deployment of these
QTLs in molecular breeding strategies paved the way for the development and
release of rice varieties such as Swarna-Sub1, Samba Mahsuri-Sub1, Swarna-Sub1,
DRR Dhan-50, and CR Dhan 802, which are suitable for different ecosystems
(Bhandari et al. 2019). Most of the rice-growing areas in the rainfed environment in
South and Southeast Asia are frequently affected by multiple abiotic stresses even
within the same cropping season near the coastal areas. Therefore, developing new
breeding materials that could tolerate multiple stresses and also provide higher
grain yield is essential for global food security.
Over the past decade, there have been only a few significant reports on pyramid-
ing QTLs for stacking multiple traits in the different backgrounds of popular high-
yielding rice varieties through MAS approaches. The identified superior and stable
lines across different environments and having acceptable grain quality traits are
promoted for release in different countries. Pyramiding of the major biotic and abi-
otic stress-tolerance QTL combinations has been used in different breeding strate-
gies for developing rice varieties with multiple-stress tolerance (Zhu et al. 2015;
Dixit et al. 2017; Pang et al. 2017b; Feng et al. 2018; Kumar et al. 2018). Recently,
Muthu et al. (2020) developed an improved White Ponni, a popular high-yielding
rice variety with significant tolerance against drought, salinity, and submergence by
introgressing major-effect QTLs (qDTY1.1, qDTY2.1, Saltol, and Sub1) through a
marker-assisted backcross breeding approach. However, the innovative Green Super
Rice breeding strategy successfully demonstrated that a high genetic diversity exists
within the primary gene pool for improving multiple-stress-tolerance traits, espe-
cially for rainfed environments (Ali et al. 2006, 2017). Stringent simultaneous phe-
notypic selection by screening under multiple abiotic stresses in the early generations
has a major advantage in developing trait-specific backcross inbred lines with sig-
nificantly improved tolerance. This provides an opportunity for the discovery of
genes/QTLs underlying the target and non-target traits. With the GSR breeding
strategy within the span of 7 years, a total of 27 IRRI-bred GSR varieties were
released, and more than 104 rice varieties have been nominated for national coop-
erative yield trials from three recipient parents and 16 donors. These varieties are
now being cultivated on more than 2.7 million ha on a seed distribution basis alone
for farmers in Asia and Africa (Ali et al. 2017; Feng et al. 2018; Yu et al. 2020). The
integration of advanced genotyping technology such as SNP genotyping array and
tGBS in the GSR breeding program provides a high-quality SNP calling accuracy
with a low percentage of missing rates across populations. This genotyping infor-
mation from SNPs is an excellent source for understanding the genetics of green
traits and can be used for dissecting many complex traits by using marker-trait asso-
ciation studies (Wing et al. 2018; Feng et al. 2018). Among the various breeding
populations, the early backcross-selective introgression lines (EB-SILS) and
designed QTL pyramiding (DQP) approach have proven to be an effective strategy
for dissecting complex traits such as drought, salinity, and low-temperature stress
tolerance; arsenic toxicity tolerance; and nutrient-use efficiency (Dimaano et al.
2017; Pang et al. 2017b; Ali et al. 2018b; Feng et al. 2018; Mahender et al. 2019;
Murugaiyan et al. 2019; Najeeb et al. 2020). So far, more than 3200 genes have been
listed in Oryzabase, and they were associated with a wide range of stress-tolerance
mechanisms in biotic and abiotic stresses (https://shigen.nig.ac.jp/rice/oryzabase/).
More than 1800 genes were functionally characterized and deposited in the Q-TARO
(QTL Annotation Rice Online) database (http://qtaro.abr.affrc.go.jp/). Of these,
cloned rice genes associated with tolerance of multiple biotic stresses (diseases and
insect pests) and abiotic stresses (drought, salinity, flooding, anaerobic germination,
low nutrient-use efficiency) and also grain quality traits (for eating) are a vital con-
cern in GSR breeding. The availability of rice genome annotation and functionally
characterized genes from these two databases are highlighted in Fig. 4. The main
focus of green traits involves the genes governing them: 104 for drought tolerance,
95 for salinity tolerance, 60 for low-input tolerance, 52 for cold tolerance, and 8 for
submergence tolerance. These are also referred to as green genes, and they mostly
represent resource-saving and environment-friendly approaches. As a result of the
molecular genetics of green traits in the GSR breeding program, a total of 225 QTLs
and 332 candidate genes have been identified on 12 chromosomes, and, trait-wise,
each is explained in Table 2 and Fig. 2.
Fig. 4 Distribution of cloned genes in rice. (a) The important genes associated with green traits
were highlighted across the 12 chromosomes using a Phenogram plot. (b) Traits were associated
with the number of genes functionally characterized and these genes provide a valuable resource
for understanding the complex nature of stress tolerance and adaptive traits. (Source: https://
orygenesdb.cirad.fr/data.html and http://qtaro.abr.affrc.go.jp/)
82 J. Ali et al.
In the genomic region of these QTL positions, a large number of candidate genes
were identified through the in silico database and many of them have known func-
tions related to green traits. Also, a few of them have unknown functions. The com-
prehensive literature survey and rice genomic database showed that genes such as
OsCOIN, OsDREB2A, OsGSK1, and OsDREB1F on chromosome 1; OsGS1;2,
OsMYB2, and ZFP182 on chromosome 3; OsTPS1 on chromosome 5; OsDREB1C
and OsiSAP8 on chromosome 6; OsDREB1B and OsDREB1A on chromosome 9;
and OsNAC5 on chromosome 11 are responsible for the multiple stress-tolerance
mechanism. These genes act in ABA signaling pathways, hormonal regulation,
accumulation of sugar and other compatible solutes such as proline, and also many
other developmental and physiological processes involved in the regulation of the
multiple stress-tolerance mechanism. Most of the multiple stress-tolerance gene
expression is induced by ABA, and it depends on the presence of a cis-acting ele-
ment referred to as ABA-responsive element (ABRE). These ABA-independent and
dependent signaling pathways are involved in stress responses including drought,
cold, heat, and cold. However, certain genomic regions on chromosome 1
(33.16–33.97 Mb; 40.15–41.90 Mb), chromosome 3 (11.07–11.75 Mb;
35.01–35.56 Mb), and chromosome 9 (21.13–21.98 Mb) played a significant role in
the biotic and abiotic stress-tolerance pathways. They mainly played a role in major
ABA signaling pathways and other stress signal transduction mechanisms in regu-
lating stress tolerance and crosstalk between the other transcription factors to
enhance gene regulation against multiple stresses. These overlapping stress-
tolerance genes and transcription factors regulating similar stress-tolerance signal-
ing pathways exist besides the crosstalk among the biotic and abiotic stresses.
However, the hotspot genomic regions of cloned genes and their validation with
earlier reports will provide an improved understanding of the molecular and physi-
ological mechanisms in response to stress tolerance to help in the improvement of
grain yield and quality traits in rice.
4.1 issecting the Stress-Regulated Mechanisms for Multiple

D
Stress Tolerance
Simultaneous exposure to a single or multiple biotic and abiotic stresses strongly

affects crop production, mainly in the rice-growing countries of Asia and Africa. In
most of the rice-growing regions in the rainfed environment, drought stress is a
major factor affecting about 23 million hectares in Southeast Asia and, combined
with biotic stresses such as diseases and insects, along with rising temperatures,
could further significantly decrease grain yield (Aghamolki et al. 2014; Bahuguna
et al. 2018). The response of the plant’s tolerance mechanism and adaptive strate-
gies toward multiple stresses are significantly limited. It is crucial to understand this
at the genomics and metabolic levels because of non-additive interactions, extensive
overlaps, and crosstalk between stress-response signaling pathways, and also the
interactions between transcription factors (TFs) and cis-elements on the promoters
of target genes (Kissoudis et al. 2014; Verma and Deepti 2016). Generally, the com-
bination of biotic and abiotic stress impacts depends on two factors: the host toler-
ance/susceptibility mechanism and the interaction of plant-microbial reactions,
which influence stress responses to plants. However, a few common morpho-
physiological traits such as leaf wilting, tiller number, harvest index, root growth
pattern, and chlorophyll content have been identified in the case of both drought and
bacterial infections. They further decrease the photosynthetic machinery and dimin-
ish grain yield (Pandey et al. 2017). Importantly, the central role of hormonal bal-
ance and interaction is the critical controller of genes that play a significant role in
regulating the stress-tolerance genes that are involved in different molecular and
physiological mechanisms for multiple stresses. Hormonal interaction is regulated
by ethylene, ABA, salicylic acid, jasmonic acid, cytokinin, and brassinosteroid.
They, in turn, regulate several growth development traits. They also connect to the
multiple stress signaling pathways to regulate stress-responsive gene expression
(Vemanna et al. 2019). The receptor of these hormones regulates the various TF
families such as NAC, AP2/ERF, bZIP, and MYC, which have altered the stress
response to biotic and abiotic stresses (Huang et al. 2011; Li et al. 2018). However,
integration of the omics approach has provided more profound insights into the
molecular mechanisms for a better understanding of the multiple stress-responsive
candidate genes. Further, this helped in the functional characterization of each gene
that is involved in the stress signaling and tolerance mechanisms for abiotic and
biotic stress adaptation.
Recently, Vemanna et al. (2019) reviewed comprehensive information on cross-
talk signaling and multiple stress-tolerance mechanisms in rice. The overlapping
stress-tolerance mechanisms and transcriptional responses in combined stresses are
quite complex and interact with several biological processes. There are few reports
on a meta-analysis using transcriptome data, and they found certain common
genomic regions shared with multiple or individual stress tolerances. This indicates
that, in response to stress tolerance, several hormonal signaling pathways are over-
lapping and cross-talking. Interestingly, Zhang et al. (2016) identified a total of 178
genes that were commonly expressed in drought and bacterial pathogen infections
from the transcriptome analysis. However, some genes play specific functional and
opposite roles in biotic and abiotic stresses. For example, one of the CDPK family
proteins, OsCPK12, regulates drought, salinity, and cold stress tolerance, but it is a
negative regulator for blast resistance (Asano et al. 2012; Fang et al. 2019). Similarly,
the WRKY transcription factor family of WRKY71 is responsible for increasing the
tolerance of bacterial infections, whereas the overexpression of WRKY45 showed
susceptibility. Universal stress-tolerance proteins such as ABC transporters play a
vital role in the development of stress tolerance in both biotic and abiotic stresses.
In the GSR breeding strategy, Murugaiyan et al. (2019) identified a robust QTL for
arsenic tolerance on chromosome 1 and found a multi-drug resistance-associated pro-
tein (OsMRP2), which belongs to the subfamily of ABC transporters. It is mainly
involved in the vacuolar sequestration of toxic metabolites (Brunetti et al. 2015). In
the GSR breeding program, we primarily focused on dissecting complex abiotic traits.
The rice crop is susceptible to cold stress, which adversely affects the crop at various
84 J. Ali et al.
growth stages, causing significant yield decreases mainly in temperate, tropical, and
subtropical rice-growing regions. Similary, Najeeb et al. (2020) identified low-tem-
perature stress-tolerance QTLs and found some promising genomic regions that were
involved in the multiple stress-tolerance mechanism in rice. For instance, the major
QTL on chromosome 5 had a possible candidate gene, Os05g49970, encoding trans-
lation initiation factor-2 (eIF2). These genes are involved in several cellular and meta-
bolic processes in the early growth developmental stages, hormonal signaling
pathways in plant defense mechanisms, and tolerance of various abiotic stresses
(Martínez-Silva et al. 2012; Mutuku et al. 2015). Likewise, on chromosome 6, two
genes (Os06g17220 and Os06g48300) were involved in major ABA-dependent sig-
naling pathways and were responsible for sucrose-synthetic activity during anoxia
conditions (Lasanthi-Kudahettige et al. 2007; Bhatnagar et al. 2017). Zhang et al.
(2011) had attempted to integrate contemporary knowledge of signal transduction
pathways with the principles of quantitative and population genetics to illustrate the
genetic networks underlying complex traits using a model established upon the one-
way functional dependency of downstream genes on upstream regulators depicting
the principle of hierarchy. The mutual functional dependence among related genes
was determined as the functional genetic units (FGUs). Interestingly, both simulated
and real data suggested that complementary epistasis contributes significantly to
quantitative trait variation and obscures the phenotypic effects of many “downstream”
loci in pathways. Downstream FGUs were more vulnerable to loss of function than
their upstream regulators; however, this vulnerability was compensated by different
FGUs of similar functions (Zhang et al. 2011). Dissecting the complex trait of nutri-
ent-use efficiency under low-input conditions (Mahender et al. 2019) identified a key
regulator as F-box protein and calcium-dependent protein kinase on chromosome 2.
These genomic regions played a major role in carbon and nitrogen metabolism and
also maintained the homeostatic coordination of other enzymatic activities. The inte-
grated approaches of omics and gene network analysis could play a crucial role in
understanding stress tolerance in combined or individual stress-tolerance mechanisms
in rice. These strategies need to be assessed more to gain deeper insights into dissect-
ing the complexity and expanding the knowledge on each specific role of stress-
responsive genes and transcription factors. Placing all the outputs from these strategies
together could help to understand the unique and shared molecular and physiological
pathways and possibly increase the adaptation to multiple abiotic and biotic stress
factors.
4.2 reeding Products Combining Tolerance

B
of Multiple Stresses
Maintaining genetic diversity in breeding programs is a critical component, and it

provides an excellent opportunity for breeders to develop novel and improved culti-
vars with desirable target traits in their breeding program. The GSR breeding pro-
gram contains two interlinked breeding strategies: selective introgression lines
(SILs) and the designed QTL pyramiding (DQP) strategy. First is to develop multi-
trait-specific SILs from several BC1F2 bulk populations derived from a few highly
adapted recipient parents and 10–15 donor parents with three rounds of multiple-
stress screening. This results in the development of EB-SILs, and these high-
yielding, multi-stress-tolerant BC1F5 SILs then undergo two seasons of preliminary
yield trials and advanced yield trials to identify superior lines simultaneously across
drought, low-input, and irrigated conditions. The superior SILs that outyield the
standard checks under different conditions are shortlisted for global multi-location
trials. Superior multi-trait-specific SILs are crossed with another IL with comple-
mentary traits from within the same recipient/donor combination or different
donors. Such a designed cross based on genotypic and phenotypic information is
referred to as a DQP approach. This has played a vital role in increasing grain yield,
improving tolerance of abiotic and biotic stresses, and using fewer inputs such as
fertilizer and pesticide. This breeding strategy began in 2008 at IRRI and was used
to create breeding materials that involved 500 elite rice varieties that belong to the
mini-core collection and are part of the 3000 Rice Genomes Project (Ali et al. 2012).
Among these, only three recipient parents, Huanghuazhan (HHZ), Weed Tolerant
Rice-1 (WTR-1), and TME80518, and 16 donors were fully used for the EBBP and
DQP approach to identify promising GSR materials with multiple abiotic and biotic
stress tolerance (Ali et al. 2012, 2013b, 2018a) (Fig. 3). The BC1F2 populations
underwent three rounds of precise phenotypic screening under drought, salinity,
submergence, low-chemical-input, and normal irrigated conditions. This led to
identifying 845 trait-specific SILs that outperformed the tolerant checks and these
were further evaluated under multi-environment locations in Asian and African
countries. As of now, a total of 66 GSR breeding materials have been registered in
China and 59 GSR breeding materials have been released across Asian and African
countries (Fig. 5). More than 90 GSR rice varieties were nominated in national
cooperative yield trials from 2016 to 2018. The released varieties showed consis-
tency in higher grain yield under low inputs (fertilizer and pesticide) and tolerance
of multiple biotic and abiotic stresses. For instance, Yorobe et al. (2016) assessed
the impact of GSR varieties and evaluated the income of farmer-users per hectare.
Based on the survey data and fixed-effect model approach, farmer income increased
significantly compared with that of farmers using conventional inbred varieties
(non-GSR materials) with the frequent occurrence of flood and submergence condi-
tions (Yorobe et al. 2014; Kodama et al. 2019). In addition, the net farm income
advantage with GSR is quite high under increasing percentiles of rainfall. Several
GSR varieties outperformed the local checks (Table 2). One GSR line (IRIS
179-880151) in data from two seasons for 2 years showed a 10% yield advantage
vis-à-vis the local check variety and also had tolerance of drought, salinity, and
submergence (Ali et al. 2013a). Similarly, multiple-stress-tolerant lines such as
GSR IR1-12-D10-S1-D1, GSR IR1-5-S10-D1-D1, and GSR IR1-8-S12-Y2-D1
performed well under different environments and had a higher grain yield advantage
of 25% to 40% over the drought-tolerant checks (Marcaida III et al. 2014). Another
recent example of the potential impact of GSR varietal performance is found in the
sub-Saharan African region of Mozambique, which is one of the major rice
86 J. Ali et al.
Fig. 5 Achievements of GSR breeding program and released GSR varieties across the globe. (a)
Map showing the number of released GSR varieties highlighted country-wise. (b) In a span of
6 years, the total number of GSR varieties released and nominated in national cooperative yield
trials across Asia and Africa
exporters. Kodama (2019) conducted a farm-level survey in three regions (Gaza,

Sofala, and Nampula) and used an endogenous switching regression (ESR) model
to assess GSR varieties among smallholder rice farmers and smallholder rice pro-
ducers. Interestingly, smallholders carry out about 90% of the rice production in this
region, and average yield is 1.0–1.2 t/ha in rainfed systems and 2.8–3.5 t/ha in nor-
mal irrigated conditions. This region is more prone to abiotic stresses, and mainly to
the variability and duration of rainfall. With the adoption of GSR varieties, Kodama
(2019) noticed a significant yield advantage, about ten times higher for smallholder
farmers than for smallholder rice producers adopting non-GSR varieties. This indi-
cates the strong and positive yield advantage and tolerance of multiple stresses
across Asian and African countries that benefit poor farmers’ income. This provides
a great opportunity for GSR varieties to provide more rice and help alleviate poverty
across the major rice-growing countries.
4.3 evelopment of Rice Hybrids

D
with Multiple-Stress Tolerance
Hybrid rice breeding is one of the major core components for ensuring global food
security. From a historical perspective, two milestones have been reached in enhanc-
ing grain yield. The first was by developing semi-dwarf rice varieties through the
incorporation of the semi-dwarf (sd1) gene in rice breeding at IRRI in the early
1960s and the second was by the use of heterosis in hybrid rice (Yuan 2017). The
potential of these two strategies was shown by rice grain yield increasing by about
30% with the semi-dwarf gene and a 15–20% yield increase with the use of hetero-
sis in the major rice-producing areas of China (Peng et al. 2009). Currently, there
are three approaches for increasing hybrid vigor: the cytoplasmic male sterility/
fertility restoration (CMS/Rf) locus, environment-sensitive genic male sterility, and
apomixis (Birchler et al. 2006; Bar-Zvi et al. 2017; Xie et al. 2019). At IRRI, we
began developing climate-smart rice hybrids by adopting EB-SILs and using the
DQP approach in separate restorer and maintainer backgrounds (Ali et al. 2020).
The promising rice varieties that are tolerant of multiple stresses and possess higher
grain yield and superior grain quality traits were considered for parental selection
based on the fertility restoration locus and possession of desirable floral character-
istics. Based on genotyping results, the GSR lines positive for fertility restoration
loci Rf3 and Rf4 will be considered as restorers and those entirely negative for those
loci as maintainers. More than 100 restorer lines with a strong general combining
ability, tolerance of multiple stresses, and having preferable grain quality have been
bred from using the promising lines from the GSR breeding program. These climate-
smart parental lines are essential for complementing the introgression of QTLs and
genes with green traits into the F1s. Hybrid rice-related traits governing wide com-
patibility, floral traits that promote outcrossing, and seed reproducibility are impor-
tant for parental line-breeding besides addressing the market requirements of the
target regions. Further, by selecting the maximum genetic distance between the
parental lines from diverse heterotic pools, this helped to identify promising high-
yielding climate-resilient hybrid rice combinations. Recently, genomic hybrid
breeding has emerged using whole-genome markers to predict future hybrids. Only
the superior predicted hybrids are then field-evaluated and later released as new
hybrid cultivars based on their actual performance in the target conditions. This
approach offers an opportunity to select truly superior hybrids at limited cost. Cui
et al. (2019) used genomic best linear unbiased prediction to predict hybrid perfor-
mance using an existing rice population of 1495 hybrids. Further, a replicated ten-
fold cross-validation showed that the prediction ability on ten agronomic traits
ranged from 0.35 to 0.92 (Cui et al. 2019). By keeping this population of 1495
hybrids, it can be used to predict hybrids from seemingly unrelated parents. Machine
learning algorithms and artificial intelligence are also being employed for predict-
ing the best hybrid combinations at IRRI using genomic and historical hybrid yield
trial data.
88 J. Ali et al.
5 Conclusions
Identifying the promising genomic regions of QTLs and genes that are associated
with the green traits that are involved in multiple-stress tolerance mechanisms will
be adapted to increase rice yield in the future. The Green Super Rice breeding strat-
egy using EB-SILs and DQP, along with combined advanced genomic technologies,
significantly improved the development of rice varieties with multiple-stress toler-
ance. This breeding strategy also helped to identify promising QTLs and genes that
were associated with the green traits related to higher grain yield, tolerance of abi-
otic and biotic stresses, low-input use of fertilizer and pesticide, and superior grain
quality. These resource-saving and environment-friendly features have been well
exploited under the GSR breeding strategy. The stress-tolerance mechanism of
these combined or individual stresses that triggers a network of signaling pathways
at the plant cell level needs to be studied in detail. The crosstalk of these biotic and
abiotic stresses could reveal similar pathways for maintaining the cellular mecha-
nism for tolerance. Omics approaches should occupy the core component in breed-
ing and trait development activities for identifying multiple-stress tolerance, and
this would remain the primary target trait in the next generation of crop breeding
programs.
References
Aghamolki MTK, Yusop MK, Oad FC et al (2014) Heat stress effects on yield parameters of
selected rice cultivars at reproductive growth stages. J Food Agric Environ 12:741–746
Agrios GN (2005) Plant pathology, 5th edn. Elsevier Academic Press, Burlington, pp 79–103
Ali AJ, Xu JL, Ismail AM et al (2006) Hidden diversity for abiotic and biotic stress tolerances in
the primary gene pool of rice revealed by a large backcross breeding program. Field Crops Res
97:66–76
Ali J, Xu JL, Gao YM et al (2012) Green super rice (GSR) technology: an innovative breeding
strategy-achievements & advances. In: The 12th SABRAO congress on plant breeding towards
2025: challenges in a rapidly changing world. Chiang Mai, Thailand. pp 16–17
Ali J, Xu JL, Gao YM et al (2013a) Breeding for yield potential and enhanced productivity across
different rice ecologies through green super rice (GSR) breeding strategy. In: Muralidharan K,
Siddiq EA (eds) International dialogue on perception and prospects of designer rice. Society
for Advancement of Rice Research, Hyderabad, pp 60–68
Ali N, Paul S, Gayen D et al (2013b) RNAi mediated down regulation of myo-inositol-3-phosphate
synthase to generate low phytate rice. Rice 6:12. https://doi.org/10.1186/1939-8433-6-12
Ali J, Xu J-L, Gao Y-M et al (2017) Harnessing the hidden genetic diversity for improving mul-
tiple abiotic stress tolerance in rice (Oryza sativa L.). PLoS One 12:e0172515. https://doi.
Ali J, Aslam UM, Tariq R et al (2018a) Exploiting the genomic diversity of rice (Oryza sativa L.):
SNP-typing in 11 early-backcross introgression-breeding populations. Front Plant Sci 9:1–10.
Ali J, Jewel ZA, Mahender A et al (2018b) Molecular genetics and breeding for nutrient use effi-
ciency in rice. Int J Mol Sci 19:1762. https://doi.org/10.3390/ijms19061762
Ali J, Mahender A, Prahalada GD et al (2020) Genomics-assisted breeding of climate-smart

inbred and hybrid rice varieties. In: Kole C (ed) Genomic designing of climate-smart
cereal crops. Springer, Cham, Springer Nature Switzerland AG, pp 1–43. https://doi.
org/10.1007/978-3-319-93381-8_1
Anderson PK, Cunningham AA, Patel NG et al (2004) Emerging infectious diseases of plants:
pathogen pollution, climate change and agrotechnology drivers. Trends Ecol Evol 19:535–544
Antralina M, Istina IN, Simarmata T (2015) Effect of difference weed control methods to yield of
lowland rice in the SOBARI. Procedia Food Sci 3:323–329
Appleby AP, Müller F, Carpy S (2002) Weed control. Ullmann’s encyclopedia of industrial chem-
istry. Wiley, Weinheim
Asano T, Hayashi N, Kobayashi M et al (2012) A rice calcium-dependent protein kinase OsCPK12
oppositely modulates salt-stress tolerance and blast disease resistance. Plant J 69:26–36
Ashkani S, Rafii MY, Shabanimofrad M et al (2015) Molecular breeding strategy and challenges
towards improvement of blast disease resistance in rice crop. Front Plant Sci 6:886
Bahuguna RN, Gupta P, Bagri J et al (2018) Forward and reverse genetics approaches for com-
bined stress tolerance in rice. Indian J Plant Physiol 23:630–646
Bailey-Serres J, Fukao T, Ronald P et al (2010) Submergence tolerant rice: SUB1’s journey from
landrace to modern cultivar. Rice 3:138–147
Balachiranjeevi CH, Prahalada GD, Mahender A et al (2019) Identification of a novel locus,
BPH38 (t), conferring resistance to brown planthopper (Nilaparvata lugens Stal.) using early
backcross population in rice (Oryza sativa L.). Euphytica 215:185
Balakrishnan D, Subrahmanyam D, Badri J et al (2016) Genotype × environment interactions
of yield traits in backcross introgression lines derived from Oryza sativa cv. Swarna/Oryza
nivara. Front Plant Sci 7:1–19. https://doi.org/10.3389/fpls.2016.01530
Balyan HS, Gupta PK, Kumar S et al (2013) Genetic improvement of grain protein content and
other health-related constituents of wheat grain. Plant Breed 132:446–457
Bar-Zvi D, Lupo O, Levy AA, Barkai N (2017) Hybrid vigor: the best of both parents, or a genomic
clash? Curr Opin Syst Biol 6:22–27
Bazrkar-Khatibani L, Fakheri BA, Hosseini-Chaleshtori M et al (2019) Genetic mapping and vali-
dation of quantitative trait loci (QTL) for the grain appearance and quality traits in rice (Oryza
sativa L.) by using recombinant inbred line (RIL) population. Int J Genomics 2019:3160275.
https://doi.org/10.1155/2019/3160275
Bernier J, Kumar A, Ramaiah V et al (2007) A large effect QTL for grain yield under reproductive-
stage drought stress in upland rice. Crop Sci 47:507–516. https://doi.org/10.2135/
cropsci2006.07.0495
Bhandari A, Jayaswal P, Yadav N et al (2019) Genomics-assisted backcross breeding for infus-
ing climate resilience in high-yielding green revolution varieties of rice. Indian J Genet 79(1
Suppl):160–170
Bhatnagar N, Min M-K, Choi E-H et al (2017) The protein phosphatase 2C clade A protein
OsPP2C51 positively regulates seed germination by directly inactivating OsbZIP10. Plant Mol
Biol 93:389–401
Birchler JA, Yao H, Chudalayandi S (2006) Unraveling the genetic basis of hybrid vigor. Proc Natl
Acad Sci U S A 103:12957–12958
Brunetti P, Zanella L, De Paolis A et al (2015) Cadmium-inducible expression of the ABC-type
transporter AtABCC3 increases phytochelatin-mediated cadmium tolerance in Arabidopsis. J
Exp Bot 66(13):3815–3829. https://doi.org/10.1093/jxb/erv185
Calayugan MIC, Formantes AK, Amparado A et al (2020) Genetic analysis of agronomic traits
and grain iron and zinc concentrations in a doubled haploid population of rice (Oryza sativa
L.). Sci Rep 10:1–14
Chauhan BS, Abugho SB (2013) Weed management in mechanized-sown, zero-till dry-seeded
rice. Weed Technol 27:28–33
Chauhan BS, Awan TH, Abugho SB, Evengelista G (2015a) Effect of crop establishment methods
and weed control treatments on weed management, and rice yield. Field Crops Res 172:72–84
90 J. Ali et al.
Chauhan BS, Opeña J, Ali J et al (2015b) Response of 10 elite “Green Super Rice” genotypes to
weed infestation in aerobic rice systems. Plant Prod Sci 18:228–233. https://doi.org/10.1626/
pps.18.228
Chen S, Yang Y, Shi W et al (2008) Badh2, encoding betaine aldehyde dehydrogenase, inhib-
its the biosynthesis of 2-acetyl-1-pyrroline, a major component in rice fragrance. Plant Cell
20(7):1850–1861
Chen X, Cui Z, Fan M et al (2014a) Producing more grain with lower environmental costs. Nature
514:486–489
Chen L, Lin L, Cai G et al (2014b) Identification of nitrogen, phosphorus, and potassium deficien-
cies in rice based on static scanning technology and hierarchical identification method. PLoS
One 9:e113200. https://doi.org/10.1371/journal.pone.0113200
Cheng SH, Zhuang JY, Fan YY et al (2007) Progress in research and development on hybrid rice:
a super-domesticate in China. Ann Bot 100:959–966
Cohen SP, Leach JE (2019) Abiotic and biotic stresses induce a core transcriptome response in
rice. Sci Rep 9:1–11
Cuevas RP, Pede VO, McKinley J et al (2016) Rice grain quality and consumer preferences: a case
study of two rural towns in the Philippines. PLoS One 11:e0150345
Cui K, Peng S, Xing Y et al (2002) Molecular dissection of seedling-vigor and associated physi-
ological traits in rice. Theor Appl Genet 105:745–753
Cui Y, Li R, Li G et al (2019) Hybrid breeding of rice via genomic selection. Plant Biotechnol J
18:57–67
Custodio MC, Cuevas RP, Ynion J et al (2019) Rice quality: how is it defined by consumers, indus-
try, food scientists, and geneticists? Trends Food Sci Technol 92:122–137
da Cruz RP, Sperotto RA, Cargnelutti D et al (2013) Avoiding damage and achieving cold toler-
ance in rice plants. Food Energy Secur 2:96–119. https://doi.org/10.1002/fes3.25
Dang X, Thi TGT, Dong G et al (2014) Genetic diversity and association mapping of seed vigor in
rice (Oryza sativa L.). Planta 239:1309–1319
Dimaano NGB, Ali J, Cruz PCSS et al (2017) Performance of newly developed weed-competitive
rice cultivars under lowland and upland weedy conditions. Weed Sci 65:798–817. https://doi.
org/10.1017/wsc.2017.57
Dimaano NGB, Ali J, Mahender A et al (2020) Identification of quantitative trait loci govern-
ing early germination and seedling vigor traits related to weed competitive ability in rice.
Euphytica 216:159. https://doi.org/10.1007/s10681-020-02694-8
Diwan J, Channbyregowda M, Shenoy V et al (2013) Molecular mapping of early vigour related
QTLs in rice. Res J Biol 1:24–30
Dixit S, Singh A, Cruz MTS et al (2014) Multiple major QTL lead to stable yield performance of
rice cultivars across varying drought intensities. BMC Genet 15:16
Dixit S, Singh A, Sandhu N et al (2017) Combining drought and submergence tolerance in rice:
marker-assisted breeding and QTL combination effects. Mol Breed 37:143
Du B, Chen R, Guo J, He G (2020) Current understanding of the genomic, genetic, and molecular
control of insect resistance in rice. Mol Breed 40:24
Elferink M, Schierhorn F (2016) Global demand for food is rising. Can we meet it? Harv Bus
Rev 7:2016
Ella ES, Kawano N, Osamu H (2003) Importance of active oxygen scavenging system in the recov-
ery of rice seedlings after submergence. Plant Sci 165:85–93
Fahad S, Bajwa AA, Nazir U et al (2017) Crop production under drought and heat stress: plant
responses and management options. Front Plant Sci 8:1147
Fahad S, Adnan M, Noor M et al (2019) Major constraints for global rice production. In: Advances
in rice research for abiotic stress tolerance. Elsevier, Amsterdam, pp 1–22
Fang WB, Yong CL, Hua CS et al (2019) Impaired function of the calcium-dependent protein
kinase, OsCPK12, leads to early senescence in rice (Oryza sativa L.). Front Plant Sci 10:52
Farooq M, Siddique KHM, Rehman H et al (2011) Rice direct seeding: experiences, challenges
and opportunities. Soil Tillage Res 111:87–98
Feng B, Chen K, Cui Y et al (2018) Genetic dissection and simultaneous improvement of drought
and low nitrogen tolerances by designed QTL pyramiding in rice. Front Plant Sci 9:306. https://
doi.org/10.3389/fpls.2018.00306
Fischer RA, Edmeades GO (2010) Breeding and cereal yield progress. Crop Sci 50:S-85
Foolad MR, Subbiah P, Zhang L (2007) Common QTL affect the rate of tomato seed germination
under different stress and nonstress conditions. Int J Plant Genomics 2007:97386. https://doi.
org/10.1155/2007/97386
Gao Z, Zeng D, Cheng F et al (2011) ALK, the key gene for gelatinization temperature, is a modi-
fier gene for gel consistency in rice. J Integr Plant Biol 53:756–765
Gautam T, Saripalli G, Kumar A et al (2020) Introgression of a drought insensitive grain yield
QTL for improvement of four Indian bread wheat cultivars using marker assisted breeding
without background selection. J Plant Biochem Biotechnol 29:1–12. https://doi.org/10.1007/
s13562-020-00553-0
Ghimire KH, Quiatchon LA, Vikram P et al (2012) Identification and mapping of a QTL (qDTY1.1)
with a consistent effect on grain yield under drought. Field Crops Res 131:88–96
Gimhani DR, Gregorio GB, Kottearachchi NS, Samarasinghe WLG (2016) SNP-based discovery
of salinity-tolerant QTLs in a bi-parental population of rice (Oryza sativa). Mol Gen Genomics
291:2081–2099
Gothandam KM, Kim E-S, Cho H, Chung Y-Y (2005) OsPPR1, a pentatricopeptide repeat protein
of rice, is essential for the chloroplast biogenesis. Plant Mol Biol 58:421–433
Guan YS, Serraj R, Liu SH et al (2010) Simultaneously improving yield under drought stress and
non-stress conditions: a case study of rice (Oryza sativa L.). J Exp Bot 61:4145–4156. https://
doi.org/10.1093/jxb/erq212
Guo L, Gao Z, Qian Q (2014) Application of resequencing to rice genomics, functional genomics
and evolutionary analysis. Rice 7:4. https://doi.org/10.1186/s12284-014-0004-7
Guo J, Hu X, Gao L et al (2017) The rice production practices of high yield and high nitrogen use
efficiency in Jiangsu, China. Sci Rep 7:2101
Guojun P, Shuqiang C, Chengyan S et al (2009) Study on relationship between resistance to blast
and yield traits in early japonica rice in cold region [J]. Chin Agric Sci Bull 19
Hawkesford MJ, Griffiths S (2019) Exploiting genetic variation in nitrogen use efficiency for
cereal crop improvement. Curr Opin Plant Biol 49:35–42
Huang XS, Luo T, Fu XZ et al (2011) Cloning and molecular characterization of a mitogen-
activated protein kinase gene from Poncirus trifoliata whose ectopic expression confers
dehydration/drought tolerance in transgenic tobacco. J Exp Bot 62:5191–5206. https://doi.
org/10.1093/jxb/err229
Jabran K, Chauhan BS (2015) Weed management in aerobic rice systems. Crop Prot
78:151–163
Jena KK, Kim SM, Suh JP, Kim YG (2010) Development of cold-tolerant breeding lines using
QTL analysis in rice. Second Africa Rice Congr 22–26
Jewel Z, Ali J, Pang Y et al (2018) Developing Green Super Rice varieties with high nutrient
use efficiency by phenotypic selection under varied nutrient conditions. Crop J 7(3):368–377.
https://doi.org/10.20944/preprints201807.0216.v1
Jewel ZA, Ali J, Mahender A et al (2019) Identification of quantitative trait loci associated with
nutrient use efficiency traits, using SNP markers in an early backcross population of rice
(Oryza sativa L.). Int J Mol Sci 20:900. https://doi.org/10.3390/ijms20040900
Ji Z, Yang S, Zeng Y et al (2016) Pyramiding blast, bacterial blight and brown planthopper resis-
tance genes in rice restorer lines. J Integr Agric 15:1432–1440
Kavurikalpana TS, Shashidhara N (2018) Validation of molecular markers linked to grain quality
traits in rice (Oryza sativa L.). Int J Curr Microbiol Appl Sci 7:1897–1902
Khan FA, Narayan S, Bhat SA, Maqbool R (2016) Vermipriming: a noble technology for seed
invigouration in rice (Oryza sativa L.). SKUAST J Res 18:124–129
92 J. Ali et al.
Kissoudis C, van de Wiel C, Visser RGF, van der Linden G (2014) Enhancing crop resilience to
combined abiotic and biotic stress through the dissection of physiological and molecular cross-
talk. Front Plant Sci 5:207
Kodama W, Pede VO, Mishra AK, Cabrera ER (2019) Assessing the benefits of Green Super Rice
in Sub-Saharan Africa: evidence from Mozambique. Selected paper prepared for presentation
at the 2019 Agricultural & Applied Economics Association Annual Meeting, Atlanta, Georgia,
July 21–23. 23 p
Kreuzwieser J, Gessler A (2010) Global climate change and tree nutrition: influence of water avail-
ability. Tree Physiol 30:1221–1234
Kumar A, Dixit S, Ram T et al (2014) Breeding high-yielding drought-tolerant rice: genetic
variations and conventional and molecular approaches. J Exp Bot 65:6265–6278. https://doi.
org/10.1093/jxb/eru363
Kumar A, Sandhu N, Yadav S et al (2017a) Rice varietal development to meet future challenges.
In: The future rice strategy for India. Elsevier, Amsterdam, pp 161–220
Kumar M, Gho Y-S, Jung K-H, Kim S-R (2017b) Genome-wide identification and analysis of
genes, conserved between japonica and indica rice cultivars, that respond to low-temperature
stress at the vegetative growth stage. Front Plant Sci 8:1120
Kumar A, Sandhu N, Dixit S et al (2018) Marker-assisted selection strategy to pyramid two or
more QTLs for quantitative trait-grain yield under drought. Rice (N Y) 11:35
Kumar A, Sandhu N, Venkateshwarlu C et al (2020) Development of introgression lines in
high yielding, semi-dwarf genetic backgrounds to enable improvement of modern rice
varieties for tolerance to multiple abiotic stresses free from undesirable linkage drag. Sci
Rep 10:1–13
Lafitte HR, Li ZK, Vijayakumar CHM et al (2006) Improvement of rice drought tolerance through
backcross breeding: evaluation of donors and selection in drought nurseries. Field Crops Res
97:77–86. https://doi.org/10.1016/j.fcr.2005.08.017
Lasanthi-Kudahettige R, Magneschi L, Loreti E et al (2007) Transcript profiling of the anoxic rice
coleoptile. Plant Physiol 144:218–231
Le Nguyen K, Grondin A, Courtois B, Gantet P (2019) Next-generation sequencing accelerates
crop gene discovery. Trends Plant Sci 24:263–274
Li Z (1998) Molecular analysis of epistasis affecting complex traits. In: Molecular dissection of
complex traits. CRC Press, Boca Raton, pp 119–130
Li Z, Ali J (2017) Breeding green super rice (GSR) varieties for sustainable rice cultivation. In:
Sasaki T (ed) Achieving sustainable cultivation of rice, vol 1 edn. Burleigh Dodds Science
Publishing, Cambridge, pp 131–152
Li ZK, Fu BY, Gao YM et al (2005) Genome-wide introgression lines and their use in genetic
and molecular dissection of complex phenotypes in rice (Oryza sativa L.). Plant Mol Biol
59:33–52. https://doi.org/10.1007/s11103-005-8519-3
Li S, Tian Y, Wu K et al (2018) Modulating plant growth–metabolism coordination for sustainable
agriculture. Nature 560:595. https://doi.org/10.1038/s41586-018-0415-5
Liang Y, Meng L, Lin X et al (2018) QTL and QTL networks for cold tolerance at the reproductive
stage detected using selective introgression in rice. PLoS One 13:e0200846
Liu C, Ding S, Zhang A et al (2020) Development of nutritious rice with high zinc/selenium and
low cadmium in grains through QTL pyramiding. J Integr Plant Biol 62:349–359
Mahender A, Anandan A, Pradhan SK (2015) Early seedling vigour, an imperative trait for direct-
seeded rice: an overview on physio-morphological parameters and molecular markers. Planta
241:1027–1050
Mahender A, Anandan A, Pradhan SK, Pandit E (2016) Rice grain nutritional traits and their
enhancement using relevant genes and QTLs through advanced approaches. Springerplus
5(1):2086. https://doi.org/10.1186/s40064-016-3744-6
Mahender A, Ali J, Prahalada GD et al (2019) Genetic dissection of developmental responses of

agro-morphological traits under different doses of nutrient fertilizers using high-density SNP
markers. PLoS One 14(7):e0220066
Marcaida M III, Li T, Angeles O et al (2014) Biomass accumulation and partitioning of newly
developed Green Super Rice (GSR) cultivars under drought stress during the reproductive
stage. Field Crops Res 162:30–38. https://doi.org/10.1016/j.fcr.2014.03.013
Martínez-Silva AV, Aguirre-Martínez C, Flores-Tinoco CE et al (2012) Translation initiation fac-
tor AteIF(iso)4E is involved in selective mRNA translation in Arabidopsis thaliana seedlings.
PLoS One 7(2):e31606. https://doi.org/10.1371/journal.pone.0031606
Matsushima K-I, Sakagami J-I (2013) Effects of seed hydropriming on germination and seedling
vigor during emergence of rice under different soil moisture conditions. Am J Plant Sci 4:1584.
https://doi.org/10.4236/ajps.2013.48191
Matthus E, Wu LB, Ueda Y et al (2015) Loci, genes, and mechanisms associated with tolerance to
ferrous iron toxicity in rice (Oryza sativa L.). Theor Appl Genet 128:2085–2098. https://doi.
org/10.1007/s00122-015-2569-y
Mehta S, Singh B, Dhakate P et al (2019) Rice, marker-assisted breeding, and disease resistance.
In: Wani SH (ed) Disease resistance in crop plants. Springer, Cham, pp 83–111
Mogga M, Sibiya J, Shimelis H et al (2018) Diversity analysis and genome-wide association stud-
ies of grain shape and eating quality traits in rice (Oryza sativa L.) using DArT markers. PLoS
One 13:e0198012
Molla KA, Debnath AB, Ganie SA, Mondal TK (2015) Identification and analysis of novel salt
responsive candidate gene based SSRs (cgSSRs) from rice (Oryza sativa L.). BMC Plant
Biol 15:122
Mukamuhirwa A, Persson Hovmalm H, Bolinsson H et al (2019) Concurrent drought and tem-
perature stress in rice—a possible result of the predicted climate change: effects on yield
attributes, eating characteristics, and health promoting compounds. Int J Environ Res Public
Health 16:1043
Murugaiyan V, Ali J, Mahender A et al (2019) Mapping of genomic regions associated with arsenic
toxicity stress in a backcross breeding populations of rice (Oryza sativa L.). Rice 12:61
Muthu V, Abbai R, Nallathambi J et al (2020) Pyramiding QTLs controlling tolerance against drought,
salinity, and submergence in rice through marker assisted breeding. PLoS One 15:e0227421
Mutuku JM, Yoshida S, Shimizu T et al (2015) The WRKY45-dependent signaling pathway is
required for resistance against Striga hermonthica parasitism. Plant Physiol 168:1152–1163
Najeeb S, Ali J, Mahender A et al (2020) Identification of main-effect quantitative trait loci (QTLs)
for low-temperature stress tolerance germination- and early seedling vigor-related traits in rice
(Oryza sativa L.). Mol Breed 40:10
Nandi S, Subudhi PK, Senadhira D et al (1997) Mapping QTLs for submergence tolerance in rice
by AFLP analysis and selective genotyping. Mol Gen Genet 255(1):1–8
Oladosu Y, Rafii MY, Samuel C et al (2019) Drought resistance in rice from conventional to molecu-
lar breeding: a review. Int J Mol Sci 20:3519. https://doi.org/10.3390/ijms20143519
Oliver SN, Dennis ES, Dolferus R (2007) ABA regulates apoplastic sugar transport and is a poten-
tial signal for cold-induced pollen sterility in rice. Plant Cell Physiol 48:1319–1330
Ouk M, Basnayake J, Tsubo M et al (2006) Use of drought response index for identification of
drought tolerant genotypes in rainfed lowland rice. Field Crops Res 99:48–58
Panda BB, Sharma S, Mohapatra PK, Das A (2012) Application of excess nitrogen, phosphorus,
and potassium fertilizers leads to lowering of grain iron content in high-yielding tropical rice.
Commun Soil Sci Plant Anal 43:2590–2602
Pandey P, Irulappan V, Bagavathiannan MV, Senthil-Kumar M (2017) Impact of combined abiotic
and biotic stresses on plant growth and avenues for crop improvement by exploiting physio-
morphological traits. Front Plant Sci 8:537
94 J. Ali et al.
Pang Y, Ali J, Wang X et al (2016) Relationship of rice grain amylose, gelatinization temperature
and pasting properties for breeding better eating and cooking quality of rice varieties. PLoS
One 11:e0168483
Pang Y, Chen K, Wang X et al (2017a) Recurrent selection breeding by dominant male sterility
for multiple abiotic stresses tolerant rice cultivars. Euphytica 213:268. https://doi.org/10.1007/
s10681-017-2055-5
Pang Y, Chen K, Wang X et al (2017b) Simultaneous improvement and genetic dissection of salt
tolerance of rice (Oryza sativa L.) by designed QTL pyramiding. Front Plant Sci 8:1275.
Peng S, Tang Q, Zou Y (2009) Current status and challenges of rice production in China. Plant
Prod Sci 12:3–8
Pradhan A, Naik N, Sahoo KK (2015) RNAi mediated drought and salinity stress tolerance in
plants. Am J Plant Sci 6:1990
Rahman KM, Zhang D (2018) Effects of fertilizer broadcasting on the excessive use of inorganic
fertilizers and environmental sustainability. Sustainability 10:759
Rahman M, Juraimi AS, Suria J et al (2012) Response of weed flora to different herbicides in
aerobic rice system. Sci Res Essays 7:12–23
Rahman MA, Bimpong IK, Bizimana JB et al (2017) Mapping QTLs using a novel source of
salinity tolerance from Hasawi and their interaction with environments in rice. Rice 10(1):47.
https://doi.org/10.1186/s12284-017-0186-x
Raj SK, Syriac EK (2017) Weed management in direct seeded rice: a review. Agric Rev 38:41–50.
https://doi.org/10.18805/ag.v0iOF.7307
Ranawake AL, Manangkil OE, Yoshida S et al (2014) Mapping QTLs for cold tolerance at ger-
mination and the early seedling stage in rice (Oryza sativa L.). Biotechnol Biotechnol Equip
28:989–998. https://doi.org/10.1080/13102818.2014.978539
Ray DK, Mueller ND, West PC, Foley JA (2013) Yield trends are insufficient to double global crop
production by 2050. PLoS One 8:e66428
Ray DK, Gerber JS, MacDonald GK, West PC (2015) Climate variation explains a third of global
crop yield variability. Nat Commun 6:1–9
Roy-Barman S, Chattoo BB (2005) Rice blast fungus sequenced. Curr Sci 89:930
Sahebi M, Hanafi MM, Rafii MY et al (2018) Improvement of drought tolerance in rice (Oryza
sativa L.): genetics, genomic tools, and the WRKY gene family. Biomed Res Int 2018:3158474
Saika H, Oikawa A, Matsuda F et al (2011) Application of gene targeting to designed mutation
breeding of high-tryptophan rice. Plant Physiol 156:1269–1277
Saikumar S, Varma CMK, Saiharini A et al (2016) Grain yield responses to varied level of moisture
stress at reproductive stage in an interspecific population derived from Swarna/O. glaberrima
introgression line. NJAS Wageningen J Life Sci 78:111–122
Sandhu N, Kumar A (2017) Bridging the rice yield gaps under drought: QTLs, genes, and their use
in breeding programs. Agronomy 7:27. https://doi.org/10.3390/agronomy7020027
Schläppi MR, Jackson AK, Eizenga GC et al (2017) Assessment of five chilling tolerance traits and
GWAS mapping in rice using the USDA mini-core collection. Front Plant Sci 8:957. https://
doi.org/10.3389/fpls.2017.00957
Septiningsih EM, Pamplona AM, Sanchez DL et al (2009) Development of submergence-tolerant
rice cultivars: the Sub1 locus and beyond. Ann Bot 103(2):151–160
Serrano-Mislata A, Bencivenga S, Bush M et al (2017) DELLA genes restrict inflorescence meri-
stem function independently of plant height. Nat Plants 3:749
Shakiba E, Edwards JD, Jodari F et al (2017) Genetic architecture of cold tolerance in rice (Oryza
sativa) determined through high resolution genome-wide analysis. PLoS One 12:1–22. https://
doi.org/10.1371/journal.pone.0172133
Sharma M, Pandey GK (2016) Expansion and function of repeat domain proteins during stress and
development in plants. Front Plant Sci 6:1218
Shinada H, Iwata N, Sato T, Fujino K (2014) QTL pyramiding for improving of cold tolerance at
fertilization stage in rice. Breed Sci 63:483–488. https://doi.org/10.1270/jsbbs.63.483
Shirasawa K, Takeuchi Y, Ebitani T et al (2008) Identification of gene for rice (Oryza sativa) seed
lipoxygenase-3 involved in the generation of stale flavor and development of SNP markers for
lipoxygenase-3 deficiency. Breed Sci 58(2):169–176
Shrivastava P, Kumar R (2015) Soil salinity: a serious environmental issue and plant growth pro-
moting bacteria as one of the tools for its alleviation. Saudi J Biol Sci 22:123–131
Singh K, Kumar V, Saharawat YS et al (2013) Weedy rice: an emerging threat for direct-seeded rice
production systems in India. J Rice Res 1:1–6. (open access)
Singh H, Jassal RK, Kang JS et al (2015) Seed priming techniques in field crops: a review. Agric
Rev 36:251–264
Singh R, Singh Y, Xalaxo S et al (2016) From QTL to variety-harnessing the benefits of QTLs for
drought, flood and salt tolerance in mega rice varieties of India through a multi-institutional
network. Plant Sci 242:278–287
Sripongpangkul K, Posa GBT, Senadhira DW et al (2000) Genes/QTLs affecting flood tolerance
in rice. Theor Appl Genet 101(7):1074–1081
Sui B, Feng X, Tian G et al (2013) Optimizing nitrogen supply increases rice yield and nitrogen
use efficiency by regulating yield formation factors. Field Crops Res 150:99–107
Sun J, Yang L, Wang J et al (2018) Identification of a cold-tolerant locus in rice (Oryza sativa L.)
using bulked segregant analysis with a next-generation sequencing strategy. Rice 11:24
Suprihatno B, Coffman WR (1981) Inheritance of submergence tolerance in rice (Oryza sativa L.).
SABRAO J 13(2):98–108
Swain P, Anumalla M, Prusty S et al (2014) Characterization of some Indian native land race rice
accessions for drought tolerance at seedling stage. Aust J Crop Sci 8:324–331
Swamy BPM, Kumar A (2013) Genomics-based precision breeding approaches to improve
drought tolerance in rice. Biotechnol Adv 31:1308–1318. https://doi.org/10.1016/j.
quaint.2017.02.033
Tigchelaar M, Battisti DS, Naylor RL, Ray DK (2018) Future warming increases probability of
globally synchronized maize production shocks. Proc Natl Acad Sci U S A 115:6644–6649
Toojinda T, Siangliw M, Tragoonrung S et al (2003) Molecular genetics of submergence tolerance
in rice: QTL analysis of key traits. Ann Bot 91(2):243–253
Tuberosa R (2012) Phenotyping for drought tolerance of crops in the genomics era. Front Physiol
3:347. https://doi.org/10.3389/fphys.2012.00347
United Nations (2019) World population prospects 2019: highlights. United Nations Department
of Economic and Social Affairs, New York
Unnevehr LJ, Juliano BO, Perez CM (1985) Consumer demand for rice grain quality in
Southeast Asia. International rice research conference, International Rice Research
Institute, pp 15–23
Utsumi Y, Utsumi C, Sawada T et al (2011) Functional diversity of isoamylase oligomers: the
ISA1 homo-oligomer is essential for amylopectin biosynthesis in rice endosperm. Plant
Physiol 156:61–77
Van Oort PAJJ (2018) Mapping abiotic stresses for rice in Africa: drought, cold, iron toxicity,
salinity and sodicity. Field Crops Res 219:55–75. https://doi.org/10.1016/j.fcr.2018.01.016
Van Oort PA, Zwart SJ (2018) Impacts of climate change on rice production in Africa and causes
of simulated yield changes. Glob Chang Biol 24(3):1029–1045
Vemanna RS, Bakade R, Bharti P et al (2019) Cross-talk signaling in rice during combined drought
and bacterial blight stress. Front Plant Sci 10:193
Venu RC, Sreerekha MV, Nobuta K et al (2011) Deep sequencing reveals the complex and coor-
dinated transcriptional regulation of genes related to grain quality in rice cultivars. BMC
Genomics 12:190. https://doi.org/10.1111/j.1551-2916.2005.00910.x
Venuprasad R, Dalid CO, Del Valle M et al (2009) Identification and characterization of large-
effect quantitative trait loci for grain yield under lowland drought stress in rice using bulk-
segregant analysis. Theor Appl Genet 120:177–190
Verma AK, Deepti S (2016) Abiotic stress and crop improvement: current scenario. Adv Plants
Agric Res 4:149
96 J. Ali et al.
Vikram P, Swamy BPM, Dixit S et al (2011) qDTY 1.1, a major QTL for rice grain yield under
reproductive-stage drought stress with a consistent effect in multiple elite genetic backgrounds.
BMC Genet 12:89
Vikram P, Swamy BPM, Dixit S et al (2015) Drought susceptibility of modern rice varieties:
an effect of linkage of drought tolerance with undesirable traits. Sci Rep 5:1–18. https://doi.
org/10.1063/1.4791353
Wang Y, Zhang L, Nafisah A et al (2013) Selection efficiencies for improving drought/salt tol-
erances and yield using introgression breeding in rice (Oryza sativa L.). Crop J 1:134–142.
https://doi.org/10.1016/j.cj.2013.07.006
Wang W, Fu B, Ali J et al (2015) Genome-wide responses to selection and genetic networks under-
lying submergence tolerance in rice. Plant Genome 8(2):1–13
Wang X, Pang Y, Zhang J et al (2017) Genome-wide and gene-based association mapping for rice
eating and cooking characteristics and protein content. Sci Rep 7:1–10. https://doi.org/10.1038/
s41598-017-17347-5
Wing RA, Purugganan MD, Zhang Q (2018) The rice genome revolution: from an ancient grain
to Green Super Rice. Nat Rev Genet 19:505–517. https://doi.org/10.1038/s41576-018-0024-z
Xie Y, Shen R, Chen L, Liu Y-G (2019) Molecular mechanisms of hybrid sterility in rice. Sci China
Life Sci 62(6):737–743
Xing Y, Guo S, Chen X et al (2018) Nitrogen metabolism is affected in the nitrogen-deficient
rice mutant esl4 with a calcium-dependent protein kinase gene mutation. Plant Cell Physiol
59:2512–2525
Xu Y, Crouch JH (2008) Marker-assisted selection in plant breeding: from publications to practice.
Crop Sci 48:391–407
Xu K, Xu X, Fukao T et al (2006) Sub1A is an ethylene-response-factor-like gene that confers
submergence tolerance to rice. Nature 442(7103):705–708
Yadav S, Sandhu N, Singh VK et al (2019) Genotyping-by-sequencing based QTL mapping for
rice grain yield under reproductive stage drought stress tolerance. Sci Rep 9:1–12
Yano M, Lin HX, Takeuchi Y et al (2003) Marker-assisted dissection and pyramiding of complex
traits in rice. In: Mew TW et al (eds) Rice Science: Innovations and Impact for Livelihood.
IRRI, pp 257–263
Ye C, Fukai S, Godwin I et al (2009) Cold tolerance in rice varieties at different growth stages.
Crop Pasture Sci 60:328–338
Yorobe J, Pede V, Rejesus R et al (2014) Yield and income effects of the Green Super Rice (GSR)
varieties: evidence from a fixed-effects model in the Philippines. Selected paper prepared for
presentation at the Agricultural & Applied Economics Association’s 2014 Annual Meeting,
Minneapolis, MN, July 27–29, 2014. 31 p. https://doi.org/10.1063/1.1609251
Yorobe JM, Ali J, Pede VO et al (2016) Yield and income effects of rice varieties with tolerance
of multiple abiotic stresses: the case of green super rice (GSR) and flooding in the Philippines.
Agric Econ 47:1–11
Yu Y, Zhao Z, Shi Y et al (2016) Hybrid sterility in rice (Oryza sativa L.) involves the tetratrico-
peptide repeat domain containing protein. Genetics 203:1439–1451
Yu S, Ali J, Zhang C et al (2020) Genomic breeding of Green Super Rice varieties and their deploy-
ment in Asia and Africa. Theor Appl Genet 133:1427–1442
Yuan LP (2017) Progress in super-hybrid rice breeding. Crop J 5:100W102
Yun BB-W, Kim M-GM, Handoyo T, Kim KK-M (2014) Analysis of rice grain quality-associated
quantitative trait loci by using genetic mapping. Am J Plant Sci 5:1125. https://doi.org/10.4236/
ajps.2014.59125
Zhang Q (2007) Strategies for developing Green Super Rice. Proc Natl Acad Sci U S A
104:16402–16409. https://doi.org/10.1073/pnas.0708013104
Zhang F, Zhai HQ, Paterson AH et al (2011) Dissecting genetic networks underlying complex
phenotypes: the theoretical framework. PLoS One 6(1):e14541
Zhang F, Zhang F, Huang L et al (2016) Overlap between signaling pathways responsive to

Xanthomonas oryzae pv. oryzae infection and drought stress in rice introgression line revealed
by RNA-seq. J Plant Growth Regul 35:345–356. https://doi.org/10.1007/s00344-015-9538-1
Zhang Z, Li JJJ, Pan Y et al (2017) Natural variation in CTB4a enhances rice adaptation to cold
habitats. Nat Commun 8:1–13. https://doi.org/10.1007/BF01337500
Zhang J, Guo T, Yang J et al (2020) QTL mapping and haplotype analysis revealed candidate genes
for grain thickness in rice (Oryza sativa L.). Mol Breed 40:1–12
Zhou Y, Cai H, Xiao J et al (2009) Over-expression of aspartate aminotransferase genes in rice
resulted in altered nitrogen metabolism and increased amino acid content in seeds. Theor Appl
Genet 118:1381–1390
Zhou Z, Li H, Sun Y et al (2010) Effect of selection for high yield, drought and salinity tolerances
on yield-related traits in rice (Oryza sativa L.). Acta Agron Sin 36:1725–1735
Zhu Y, Chen K, Mi X et al (2015) Identification and fine mapping of a stably expressed QTL for
cold tolerance at the booting stage using an interconnected breeding population in rice. PLoS
Advances in Two-Line Heterosis Breeding
in Rice via the Temperature-Sensitive
Genetic Male Sterility System
Jauhar Ali, Madonna Dela Paz, and Christian John Robiso
Abstract Hybrid rice technology is a viable strategy to increase rice production

and productivity, especially in countries with limited cultivable land for agriculture
and irrigation water, along with costlier chemical inputs. The three-line hybrid rice
technology adoption rate is slowing down because of restricted heterosis per se, the
availability of better combining ability in cytoplasmic male sterile lines, lower
hybrid seed reproducibility, and limited market acceptability of hybrids. Two-line
heterosis breeding could overcome these shortcomings. However, the wide-scale
adoption and use of two-line hybrid rice technology are possible through systematic
research and breeding efforts to develop temperature-sensitive genetic male sterile
(TGMS) lines with low (<24 °C) critical sterility temperature point, which is dis-
cussed in this chapter. Research on the genetics, breeding, grain quality, and resis-
tance to insect pests and diseases for TGMS line development and physiological
characterization is also discussed. In addition, the identification and validation of
natural sites for TGMS self-seed multiplication and hybrid rice seed production
through GIS mapping and climatic data analytical tools are also tackled. The devel-
opment of high-yielding two-line rice hybrids and improvement in hybrid rice seed
reproducibility could help in their wide-scale adoption.
Keywords Temperature-sensitive genetic male sterile (TGMS) lines · Critical

sterility temperature point (CSTP) · Physiological characterization · Genetics ·
Rice
J. Ali (*) · M. Dela Paz · C. J. Robiso

Rice Breeding Platform, International Rice Research Institute, Los Baños, Philippines

https://doi.org/10.1007/978-3-030-66530-2_4
100 J. Ali et al.
1 Introduction
Global rice production in 2018 was 782 million tons from 167.1 million hectares
with an average productivity of 4.68 t/ha (FAOSTAT 2020). However, production
needs to keep pace with the increasing food demand in the coming decades, espe-
cially when the global human population is predicted to reach 9.73 billion by 2050
(Worldometer 2020). Increasing rice production under declining resources such as
cultivable land and irrigation water and costlier agricultural inputs will become a
great challenge in the coming decades. Furthermore, climate change is going to
increase the pressure on stable and sustainable rice production.
Hybrid rice technology is a viable approach to increase rice production under
limited resources and climate change. This technology took roots as early as 1964 in
China, and around the same time, international scientific communities were discuss-
ing its prospects, especially in India, the United States, and the Philippines (Carnahan
et al. 1972; Swaminathan et al. 1972; Athwal and Virmani 1972). However, it was
China under Professor Yuan Longping that demonstrated hybrid rice technology on
a commercial scale in 1976 with requisite cytoplasmic male sterile (CMS), main-
tainer, and restorer lines. This early success led China to expand hybrid rice signifi-
cantly to reach 16.7 million ha, accounting for 57% of the country’s rice area.
Hybrid rice now accounts for more than 65% of China’s total national rice produc-
tion. In recent years, the average productivity of rice in China has been 6.45 t/ha:
7.50 t/ha for hybrid rice and 6.15 t/ha for conventional rice. The increased produc-
tion of hybrid rice each year provides food for more than 70 million people (Yuan
2014). The International Rice Research Institute (IRRI) made a significant effort to
deploy hybrid rice technology outside China by sharing the requisite hybrid rice
parental lines directly to both the public and private sectors. Parental lines devel-
oped by IRRI have been used quite extensively in the release of several commercial
hybrids from the private and public arenas in India, Nepal, Pakistan, Vietnam, the
Philippines, Bangladesh, and Indonesia. IRRI has directly released 17 hybrids in the
Philippines alone.
Despite the enormous research and extension efforts that have gone into hybrid
rice from the early 1990s, especially in Asia, hybrid rice area is growing slowly.
Among the major reasons for the slow growth is, first, the available level of hetero-
sis or hybrid rice yield advantage over the best checks is from 15% to 20%. Second,
hybrid rice seed reproducibility is still below 2 t/ha for most hybrids outside China,
besides being cumbersome and expensive, which is not attractive to the private seed
industry to adopt the technology on a wide scale. Third, hybrids do not possess the
required amount of disease and insect pest resistance in the target regions. Fourth,
the grain quality of hybrids does not meet market needs, and decreased head rice
recovery is keeping farmers from adopting hybrid rice. In addition, the rapid rise in
labor wages in India and China is causing the seed industry to look for alternative
approaches to decrease the cost of hybrid rice seed and make it more efficient based
on parental line improvement to entice farmers to adopt hybrid rice and benefit. In
this regard, the Hybrid Rice Development Consortium (HRDC) at IRRI is consider-
Advances in Two-Line Heterosis Breeding in Rice via the Temperature-Sensitive... 101
ing these factors and developing market-oriented parental materials. Ongoing

hybrid rice research at IRRI seeks to improve the levels of outcrossing and hybrid
seed reproducibility, especially by developing newer CMS lines. The HRDC has
been sharing these improved materials with both the public and private sectors in an
aggressive manner since 2016. Currently, the area of hybrid rice outside China is
approximately 8 million ha, and pushing hybrid rice technology is vital to overcome
its shortcomings. In this context, it is crucial to revisit other alternative technologies
such as two-line hybrid rice technology for efficient seed production and increased
heterosis.
2 he Emergence of Two-Line Hybrid Rice Technology

T
with a Historical Perspective
Two-line hybrid breeding began with the discovery of a photoperiod-sensitive

genic male sterile (PGMS) mutant, Nongken 58S, in Hubei Province, China,
which remains male sterile under long-day conditions (>13.45 h) or fertile under
shorter day (<13 h) conditions (Shi 1981, 1985; Shi and Deng 1986). Likewise,
the discovery of thermosensitive genic male sterility (TGMS) that renders the
plant male sterile at higher mean temperatures and reverts it to fertility at lower
mean temperatures allowed significant development of the technology. Several
TGMS sources of spontaneous or induced origin were discovered such as Annong
S-1 and Anxiang S (Tan et al. 1990; Lu et al. 1994) in China, Norin PL 12
(Maruyama et al. 1990, 1991) in Japan, IR32364 at IRRI (Virmani and Voc 1991),
and SM 5, F61, and SA 2 in India (Ali 1993; Ali et al. 1995; Hussain et al. 2012;
Reddy et al. 2000) (Table 1). Moreover, photo-thermosensitive genic male steril-
ity systems were also discovered, for which researchers found the interaction of
photoperiod and temperature that governs male sterility-fertility alteration. Based
on these three male sterility-fertility alteration systems involving photoperiod,
temperature, and photo-thermo interactions, Yuan (1987) put forward a new strat-
egy of hybrid rice breeding that did not involve a maintainer line, and it was called
the two-line method. Any fertile line with a dominant gene for this trait could be
used as a pollen parent to develop rice hybrids (Lu et al. 1994). Two-line hybrid
rice technology has several advantages over the three-line system, including a
wider range of germplasm resources as pollen parents, thus allowing opportuni-
ties to exploit higher heterosis and simpler procedures for breeding and hybrid
seed production (Ali et al. 2018; Chen et al. 2020).
In tropical conditions, day length differences are marginal, and therefore, the
TGMS system is more useful than the PGMS and PTGMS systems. Consistent
temperature differences are found at different altitudes and over different seasons in
the same location or region, which could be exploited for two-line hybrid rice devel-
opment. However, successful exploitation of this novel male sterility system relies
on knowledge of the fertility behavior of TGMS lines (Chandirakala et al. 2008).
Table 1 Origin and fertility-sterility transformation behavior of photoperiod-thermosensitive and temperature-sensitive male sterile sources in rice
102
Critical temp. and

photoperiod for inducing Sensitive stage
Place of sterility CFTP (days before
Source Ecotype Origin of gene development (h) (°C) (°C) heading) References
Photoperiod-thermosensitive genic male sterile (PTGMS) (interaction of h and °C)
02428 S – NK58S JAAS Li (2009)
108 S – NK58S/9022 NAAS Li (2009)
1541 S L-japonica YIAS 13.75–14.00 28.0 22.0 Lu et al. (1994); Li (2009)
1647 S – BAAS Li (2009)
2177 S indica AGAI
26 Zhai Zao indica Induced (R), China 12.00–14.00 23.0–25.0 Shen et al. (1994)
3008 S japonica NK58S/ HAC Li (2009)
31111 S L-japonica NK58S/31111 HAU 14.00–14.75 28.0 22.0 Li (2009)
31301-1S 28.0 24.0 Zhang et al. (1994)
3502 S L-japonica 7001S/Pecos AAAS 14 22.6 Li (2009)
3516 S L-japonica N5047S/(7001S/ AAAS 14 23.5 Li (2009)
Zhao107)
4008 S L-japonica 7001S/Reyan 2 AAAS 14 24.0 Li (2009)
5021 S – SDL of MS type. NAU and Li (2009)
S.mutant JAAS
5047 S 30.0 26.0 Zhang et al. (1994)
6334 S L-japonica HNU 13.75–14.00 24.0–30.0 Li (2009)
7001 S E-japonica NK58S/917 AAAS 13.50–14.0 30.0 22.0 Lu and Wang (1988); Lu et al.
(HuXuan19/ (1994); Zhang et al. (1994);
IR661//C57) Mou et al. (2003); Li (2009)
8087 S E-japonica 7001S/Zhao 107 AAAS 14 23.0 Li (2009)
8801 S indica HXAU
J. Ali et al.
Critical temp. and
8902 S indica WU 13.25–13.45 27.0–30.0
8906 S indica WU 13.25–13.45 26.0 24.0 Zhang et al. (1994)
89-7S 30.0 24.0 Zhang et al. (1994)
8912 S indica WU 13.25–13.45 30.0 26.0 Zhang et al. (1994)
9044 S japonica HAA 32 28.0 Zhang et al. (1994)
916 S – NK58S JAAS Li (2009)
AB0195 japonica WDAU
C407S japonica Eyi MR CAAS Li (2009)
CIS 28-10S indica S. mutant, China 12.00–14.00 Huang and Zhang (1991)
Double 8-2S L-japonica NK58S/Double WU 14.00–14.25 Li (2009)
8–2
EGMS japonica Induced (C), USA 13.00–14.00 Rutger and Schaeffer (1989)
HN5-2S indica 24.0 24.0 Zhang et al. (1994)
HS-1 indica HPGMR FU Lu et al. (1994)
HS-3 indica NK58S FAU 12.5 23.0c Mou et al. (2003)
J-3S – NK58S JAAS Li (2009)
K14 S indica GAU
K7 S indica GAU
K9 S indica GAU
Advances in Two-Line Heterosis Breeding in Rice via the Temperature-Sensitive...
Liuqianxin S – NK58S JAAS Li (2009)

M 201 japonica Induced (C), USA 12.00–14.00 Oard and Hu (1995)
M105 S – 60 Coγ radiating WU Li (2009)
105
103
(continued)
Table 1 (continued)
104
Critical temp. and

M901 S indica 26.0 24.0
MSr 54A(B) japonica S. mutant, China 13.00–14.00 Lu and Wang (1988)
N422 S japonica 7001S/lun hui 422
HHRRC, Li (2009)
CAU
N5047 S L-japonica NK58S/5047 HAAS 14.00–14.25 26.0–30.0 Lu et al. (1994); Li (2009)
N5088 S L-japonica NK58S/Nonghu26 HAAS 13.50–14.00 22.0–30.0 22.0 Zhang et al. (1994); Lu et al.
(1994)
N95076 S L-japonica 5088S/7001S HAAS 24.0 Li (2009)
N9643 S L-japonica NK58S/9643 HAAS >14.00 24.0 Li (2009)
Nongken58S L-japonica S. mutant from Hubei 13.75–14.00 30.0 24.0 Shi and Deng (1986); Zhang
NK58, China et al. (1994)
Pei’ai64S indica NK58S-derived, HHRRC 13.00–13.30 24.0 22.0 Yang et al. (2002)
China
Shuanggung S japonica HHRRC 32.0 28.0 Zhang et al. (1994)
Shuguang612S indica NK58S SAU 12.5 23.5c Lu et al. (1994) (T), Mou et al.
(2003) (P)
W6154 S indica HAAS 13.00–13.30 26.0 24.0
W7415 S indica HAAS 13.00–13.30 26.0 24.0
W91607S 26.0 24.0 Zhang et al. (1994)
W9593 S indica NK58S HAAS 13 23.5c Mou et al. (2003)
WD 1S L-japonica NK58S/WD1 WU 14.00–14.50 Li (2009)
Wuxiang S indica
(WXS)
X 88 japonica >13.75 10–25 Lu et al. (1994)
J. Ali et al.
Critical temp. and
Zhenong 1S L-japonica NK58S ZAAS Li (2009)
Temperature-sensitive male sterile (TGMS) (°C)
9201 indica 560 S FU Lu et al. (1994)
1103 S indica HPGMR WU Lu et al. (1994)
1356 S indica Annong S-1 HHRR – 24.5c Mou et al. (2003)
3418 S indica HPGMR AAAS Lu et al. (1994)
545 S indica Hunan
5460 S indica Induced (R), China Fujian 28.0–26.0 Yang et al. (1990)
6442S indica HPGMR JAAS Lu et al. (1994)
810 S indica AnnongS-1 AJAU, – 24.0c Mou et al. (2003)
Annong S-1 indica S. mutant Hunan 30.2–27.0 Tan et al. (1990)
Anxiang S indica Annong S HHRRC Lu et al. (1994)
ATG-1 indica
C815 S indica
Dianxin 1A japonica CMS Yunan 20.0–23.0 Lu et al. (1994)
DRR 1S DRR 30.0 Ramakrishna et al. (2006)
F 61 indica Induced mutation IARI 22.0–30.9 19 Ali et al. (1995)
(C) India
GD 2S indica HPGMR GDAAS Lu et al. (1994)
Guangzhan63S indica NK58S-derived,

China
H 89-1 japonica Induced (R), Japan 31.0–28.0 Maruyama et al. (1991)
(continued)
105
Table 1 (continued)
106
Critical temp. and

Hengnong S-1 indica Cross breeding, Hunan 29.0–30.0 Lu et al. (1994)
China
ID24 29.5–25.9 10–14 Sanchez and Virmani (2005)
IR32364-20-1- indica Induced (R), IRRI IRRI 32.0–24.0 Virmani and Voc (1991)
3-2B
IR38949 indica Introgression from IRRI 30.0–24.0 Virmani (1992)
Norin PL12
IR68298 Introgression from IRRI 31.5–27.1 11–17 Sanchez and Virmani (2005)
Norin PL12
Norin PL12
IR68945 indica Introgression from IRRI 30.0–24.0 15–21 Virmani (1992); Sanchez and
Norin PL12 Virmani (2005)
Norin PL12
IR73827-23S IRRI 35.9 19 Ramakrishna et al. (2006)
Norin PL12
IV A indica Cross breeding, 24.0–28.0 Zhang et al. (1991)
China
J207S indica S. mutant, China 31.0- > 31.0 Jia et al. (2001)
JP 2 indica S. mutant, India IARI 23.0–33.9 19 Ali et al. (1995)
JP 24A indica CMS, India IARI 23.0–33.8 Ali (1993)
J. Ali et al.
Critical temp. and
JP 8-1A-12 indica Breeding IARI 20.0–30.9 20.0– 23 Ali et al. (1995)
population, India 24.0
KS 1S indica HPGMR GAAS Lu et al. (1994)
N8 S indica Hunan
Norin PL12 japonica Irradiation with 20 kr of gamma 21.4–29.4 9–16 Lopez et al. (2000); Sanchez
rays, Japan and Virmani (2005)
R 59TS indica Induced (R), China Fujian Yang et al. (1990)
SA 2 indica Induced mutation IARI 20.0–31.7 17 Ali et al. (1995)
(C) India
SE21S indica NK58S FAU – 23.0c Mou et al. (2003)
SM 3 indica S. mutant, India 22.0–32.0 22 Ali et al. (1995)
SM 5 indica S. mutant, India 22.0–32.3 24 Ali et al. (1995)
TianfengS indica AnnongS-1 GZAAS, – 24.5 c Mou et al. (2003)
TGMS 74S indica TNAU 34.2 23.0 Rajesh et al. (2017)
TNAU 19S indica TNAU 20.0–30.0 24.0– Manonmani et al. (2016)

26.0
TNAU 27S indica TNAU 25.95 25.83 26-Jan Sasikala et al. (2015)
(continued)
107
Table 1 (continued)
108
Critical temp. and

TNAU 39S indica TNAU 20.0–30.0 24.0– Manonmani et al. (2016);
26.0 Kadirimangalam et al. (2017)
TS 09 12 indica TNAU 26.45 25.78 26-Jan Sasikala et al. (2015)
TS6 indica Spontaneous TNAU 26.7 25.5 Latha et al. (2005)
mutant
TS16 indica Norin PL 12 IRRI 24.8 24.6 11-Jan Latha et al. (2005, 2010)
(IR68945-433-4-
14)
(IR68949-11-5-
31)
TS29 indica Spontaneous TNAU 25.6 25.3 11-Jan Latha et al. (2005, 2010)
mutant
(IR68942-1-6-13-
13-4)
J. Ali et al.
Critical temp. and
TS47 (IR68298- indica Norin PL 12 IRRI 35.3 25.2 26-Jan Latha et al. (2005, 2010)
11-16-3 B)
W6111 S indica Hubei
W91607 S indica HPGMR HAAS Lu et al. (1994)
W9451 S indica HPGMR HAAS Lu et al. (1994)
Xiang125S indica Annong S-1 HHRRC – 23.5c Mou et al. (2003)
Xiangling628S indica
Xianquang indica Breeding 24.0–30.0 Cheng et al. (1995)
population, China
XinanS indica Si et al. (2012)
Y58S indica
Zhu1S indica Yang et al. (2000)
Reverse thermo-sensitive genic male sterile
(rTGMS)
JP38 indica S. mutant, India IARI 24.0–30.5 Ali (1993)
Dianxin 1A japonica China Yunnan 22c Yiming (1988); Zhang et al.
(1991)
IVA indica China Yunnan 24c 27.0
26 Zhaizao india Mutant, China >23c Shen et al. (1994)
J207S Jia et al. (2001)
Reverse photoperiod-sensitive genic male sterile (rPGMS)

YiD1S B3/Hongjiang China Gao (1991)
(continued)
109
Table 1 (continued)
110
Critical temp. and

IVA indica From cross Yunnan Zhang et al. (1991); Virmani
breeding et al. (2003)
N10S Li et al. (1991)
N13S Li et al. (1991)
go543S Yang and Zhu (1996)
DiannongS-2 Jiang et al. (1997)
D38S Joseph et al. (2011)
D52S Joseph et al. (2011)
GAAS Guangxi Academy of Agricultural Sciences, GDAAS Guangdong Academy of Agricultural Sciences, GZAAS Gangzhou Academy of Agricultural
Sciences, TNAU Tamil Nadu Agricultural University, HAAS Hubei Academy of Agricultural Sciences, JAAS Jiangxi Academy of Agricultural Sciences, AAAS
Anhui Academy of Agricultural Sciences, HHRRC Hunan Hybrid Rice Research Center, IARI Indian Agricultural Research Institute, WU Wuhan University,
SAU Sichuan Agricultural University, FU Fujian University, FAU Fujian Agricultural University, GAU Guangxi Agricultural University, AJAU An-Jiang
Agricultural University, HAU Huazhong Agricultural University, HAC Hubei Agricultural College, AGAI Anhui Guangde Agricultural Institute, YIAS Yichang
Institute of Agricultural Sciences, ZAAS Zheijiang Academy of Agricultural Sciences, L late, E early, S spontaneous, SDL short day length, CDL critical day
length, CSP critical sterility point, CFP critical fertility point, R irradiation, C chemical mutagens. Several introgressed forms from Nongken 58S and Annong
S-1 developed by Yang (1997) and Mou et al. (1998) not included here
J. Ali et al.
In this regard, to address tropical Asian markets, IRRI is refocused on developing

two-line hybrid rice technology with usable TGMS parental lines. The two-line
hybrid rice approach via TGMS holds great promise as it does away with one step
of outcrossing of parental line production, thus directly bringing down seed costs.
Although the two-line system is well established, especially in Vietnam and the
Philippines, expansion to other regions remains a challenge because of the lack of
TGMS lines with a low critical sterility temperature point (CSTP) of 24 °C. Such
low CSTP of TGMS lines could be a game changer in tropical Asia vis-à-vis earlier
discovered TGMS lines with CSTP of >27 °C. Currently, the annual planting area
of two-line hybrid rice in China has surpassed 5 million ha, while fully exploiting
heterosis in rice (Chen et al. 2020). With recent research advances, TGMS-based
two-line hybrid rice breeding is poised to replace three-line hybrid rice technology
over the next decade (Ali et al. 2018).
3 dvantages and Disadvantages of the TGMS System

A
in the Tropics
The TGMS-based two-line system has several advantages over the three-line sys-
tem. First, hybrid seed production is less cumbersome as TGMS does not require
maintainers and seed can be self-multiplied under fertility-conducive low-tempera-
Fig. 1 TGMS system for the production of two-line rice hybrids

112 J. Ali et al.
ture conditions (Fig. 1). Second, there is a higher probability of identifying the het-
erotic pool and market-oriented hybrids, as any nonTGMS parent is a potential
pollen parent. Third, the current CMS three-line system is primarily based on a
single source of wild abortive (WA) cytoplasm that continues to pose a constant
threat because of the adverse effects associated with it. However, the two-line
approach also has certain shortcomings, such as the adverse effect of low-tempera-
ture fluctuations due to sudden/unforeseen weather changes that could trigger self-
seeds in hybrid seed production plots. In addition, the higher temperature fluctuations
in self-seed multiplication plots could result in lower self-seed yields of the TGMS
lines. Therefore, the right choice of locations based on historical agrometeorologi-
cal data is essential to identify ideal places for hybrid rice seed production and self-
seed multiplication.
4 Physiological Characterization of the TGMS Trait
Homozygous and true-breeding TGMS lines need to be physiologically character-

ized, especially for CSTP and CFTP, besides determining the temperature-sensitive
stage for sterility-fertility alteration. The deployment of TGMS lines needs to match
the target location requirements. Furthermore, precise information on these two
indices is essential for choosing an appropriate source for the development of two-
line hybrids (Ali et al. 1995).
4.1 Determination of CSTP and CFTP
The determination of CSTP and CFTP is essential for characterizing TGMS lines
for their proper exploitation in target regions. CSTP pertains to the lowest mean
temperature among the temperatures inducing sterility, while the highest mean tem-
perature causing fertility is considered as the CFTP (Chandirakala et al. 2008; Latha
and Thiyagarajan 2010; Sasikala et al. 2015; Kadirimangalam et al. 2017). The
tracking technique (Ali et al. 1995) was used to identify the CSTP and CFTP based
on the sensitive stage of a line. Using this method, the CSTP is determined by
obtaining the lowest among the maximum temperatures of the three tracking dates
coinciding with the sensitive stage of the three panicles that caused complete pollen
sterility. At the same time, the CFTP is the temperature range in which the plants
produced a higher proportion of fertile and unaborted sterile (partially stained) pol-
len. Further studies by Vinodhini et al. (2019) considered the lowest value of the
mean maximum temperature during the sensitive stage to determine the CSTP of a
TGMS line. Viraktamath and Virmani (2001) proved that the maximum temperature
is what influences the expression of fertility-sterility alteration of TGMS lines in
tropical countries. Moreover, Kadirimangalam et al. (2017) identified TGMS lines
with a CSTP at a mean temperature of above 29 °C. It is essential to understand that
a given TGMS gene varies for its CSTP and CFTP when transferred to different
genetic backgrounds (Sasikala et al. 2015). The fertility of PTGMS rice lines is
affected by both temperature and light duration. Usually, PTGMS rice lines tend to
produce low purity of hybrid seeds because of selfing at a low temperature
(23–24 °C) in seed production. The spikelets of PTGMS lines during anthesis could
not normally open at high temperature (HT, ≥35 °C), thereby severely decreasing
hybrid seed yields (Chen et al. 2020). This, along with other factors, makes PTGMS
unfavorable for use in tropical conditions. However, PTGMS materials may still be
useful in temperate conditions where day length is more crucial.
4.1.1 haracterization Under Controlled-Temperature Screening

C
Conditions
Sterile single-plant selections identified in a mutation population of the M2 genera-

tion or selections from segregating materials derived from TGMS × pollen parent
(PP) crosses need to be stubbled and screened at low temperature to check for fertil-
ity reversion in the new emerging panicles. The crosses need to be bagged, and the
generations correctly advanced under low-temperature facilities. At IRRI, the focus
is on TGMS traits with low CSTP; thus, screening of the stable mutants and fixed
materials is done under a phytotron in three mean temperature treatments (23, 24,
and 25 °C) to determine their critical temperature for sterility/fertility induction
(Fig. 2). This helped in identifying several TGMS lines with sterility at 24 °C and
above and fertility at 23 °C. A few sterile plants were also identified in all three
temperature conditions and are currently being evaluated for fertility reversion at
<22 °C. Wongpatsa et al. (2014) carried out a similar study using two TGMS lines
(KU-TGMS1 and KU-TGMS3) screened at the panicle initiation stage under growth
chambers using day/night temperature parameters of 26/22 °C, 26/20 °C, 24/18 °C,
and 22/20 °C, along with 11.5 h light/12.5 h dark periods and 75% relative humid-
ity. Their results suggest that night temperatures of 18–22 °C induced maximum
pollen viability and seed set. Furthermore, the highest seed rate was observed for
KU-TGMS3 under 24/18 °C, peaking at 33.63%. In conclusion, this revealed that
night temperature has a more significant effect on pollen viability than day
temperature.
4.1.2 Field Screening Through Sequential Seeding
The physiological characterization of fixed TGMS lines can also be carried out
through continuous seeding or sequential sowing. Sequential seeding is done in
such a way that flowering is observed throughout the year at the candidate target
sites to study pollen sterility and spikelet sterility (bagged and unbagged condi-
tions). Such studies help in evaluating the stability of promising TGMS lines and
determining the sterile phase window for hybrid rice seed production. Based on the
tracking method (Ali et al. 1995), one can determine the CSTP and the sensitive
114 J. Ali et al.
Fig. 2 Physiological characterization of TGMS lines in (a) plant growth facility bay, (b) cold-
water facility, and (c) reach-in chamber
stage for sterility. A study done by Ramakrishna et al. (2006) observed six TGMS
lines planted in three staggered sowing at intervals of 10 days. The lines were seen
over two different seasons, postrainy 2002 (October–December) for fertility rever-
sion with lower temperature range (25.5/16.1 °C) and prerainy 2003 (February–
April) for sterility reversion with higher temperature range (35.7/23.8 °C), especially
during the panicle initiation stage (Ramakrishna et al. 2006). Shuttle breeding of the
selected sterile plants from segregating materials and their stubbles then transfers
them to low-temperature conditions for obtaining self-seeds to advance the genera-
tions under low-temperature conditions. It would help to identify suitable TGMS
lines for such environments. At IRRI, the sterile plant stubbles are sent to Lucban
and Benguet in the Philippines for self-seed multiplication and generation advance-
ment. Likewise, researchers at Tamil Nadu Agricultural University, India, evaluated
TGMS lines in two sterility-inducing environments, Coimbatore and
Sathiyamangalam, during rabi season starting in December 2013 and 2014. The
same lines were stubble-planted and evaluated for pollen sterility in pollen fertility-
inducing environments during kharif season in July 2013 and 2014 at the Hybrid
Rice Evaluation Centre, Gudalur, a high altitude (1500 masl) with colder climate
(Manonmani et al. 2016). Latha and Thiyagarajan (2010) also recommended a high-
altitude area such as Gudalur for TGMS self-seed multiplication of lines such as
TS29, which was observed to have only 16 days of fertile phase during December
in Coimbatore. In Gudalur, TS29 had more than 60% pollen fertility and seed set
when the mean temperature was 22 °C (28/17 °C) and below from June to November.
4.2 etermination of the Critical Stage for Fertility-Sterility

D
Alteration
The critical stages of panicle development sensitive to temperature could be deter-

mined from the stages exhibiting a significant correlation with pollen sterility
(Chandirakala et al. 2008). The stamen pistil primordial stage, which is 15–24 days
before heading, was considered as the sensitive stage (Ali et al. 1995; Salgotra et al.
2012). Furthermore, Viraktamath and Virmani (2001) found 4–8 days after panicle
initiation as the most sensitive stage. For the lines that Latha and Thiyagarajan
(2010) had examined, those were sensitive to temperature from stamen pistil pri-
mordial differentiation to pollen ripening except for two lines that were sensitive
from the meiotic division of the pollen mother cell to pollen ripening. The sensitive
stages observed to vary with the four TGMS lines (TNAU 27S, TS 09 12, TS 09 15,
and TS 09 25) showed a significant amount of positive correlation between pollen
sterility and maximum and mean temperatures (Sasikala et al. 2015). The period of
partial sterility was considered as the phase of fertility transition (Ali et al. 1995;
Latha and Thiyagarajan 2010). Sanchez and Virmani (2005) observed differentia-
tion of secondary branch primordium and the filling stage of pollen, that is, 24 to
5 days before heading was considered a sensitive stage for temperature. The results
showed that the critical stage for most of the TGMS lines occurred during panicle
developmental stages and approximately 26 to 5 days before heading
(Kadirimangalam et al. 2017). Based on all these studies, we can demarcate the
critical stage for sterility expression from 5 to 26 days before heading that coincides
with the differentiation of secondary branch primordium and the filling stage of pol-
len. These sensitive days before heading also varied with early-, medium-, and late-
duration TGMS lines and depending on the synchronous flowering habit.
4.3 valuation of TGMS Lines for Sterility-Fertility Alteration

E
in Different Environments
TGMS-based two-line breeding programs require natural sites with low tempera-
tures in higher altitudes in the tropics that are essential for advancing generations of
selected TGMS lines. However, it will be worthwhile to select sterile plants with
low CSTP in the range of 23–25 °C as they are stable under high-temperature condi-
tions (28–30 °C) for sterility. A recent discovery at IRRI of A07 with low CSTP of
24 °C is an excellent example of this type of TGMS line (Ali et al. 2018). Regular
116 J. Ali et al.
self-seed multiplication of TGMS lines is carried out for their use in hybrid rice seed
production plots under high-temperature conditions. IRRI has two locations (Lucban
and Benguet) for self-seed multiplication in the Philippines. Multilocation trials for
two-line hybrid rice seed reproducibility trials are essential for understanding the
stability of the TGMS parental lines and their outcrossing features.
4.4 I mprovement of Outcrossing Traits in TGMS and Pollen

Parental Lines
Outcrossing is directly correlated as a function of floral morphology and flowering

behavior for the male-sterile parental line (Oka and Morishima 1967). The wider
angle of lemma and palea correlated with greater exsertion and surface area of the
stigma, leading to higher seed-set percentage. Visual phenotypic selection can be
used efficiently to identify higher seed-set potential (Ramakrishna et al. 2006;
Salgotra et al. 2012). According to the standards set by Chen et al. (2010), female
parents should possess a panicle exsertion rate of >70%, along with an excellent
outcrossing rate, early and short flowering span, and well-closed lodicules and lem-
mas after pollination. On the other hand, pollen parents should exhibit large anthers
and pollen quantity, pollen vigor, and vigorous growth ability (Chen et al. 2010).
Better panicle exsertion from the sheath in male-sterile lines would help increase
the number of spikelets for outcrossing than lines with incomplete panicle exsertion
(Rahul Roy and Kumaresan 2019; Abeysekera et al. 2003; Virmani 1994). The lines
with higher panicle exsertion percentage coupled with higher seed set and higher
spikelet fertility percentage influence outcrossing ability and could be well exploited
for the development of hybrid rice (Arasakesary et al. 2015).
Many of the traits for outcrossing in CMS, such as greater glume opening angle
and more stigma exsertion, lead to higher seed setting (Mahalingam et al. 2013),
which could be used as well for TGMS breeding. Outcrossing of relevant traits,
especially the longer feathery stigma protrusion on either side of the lemma-palea
and full glume opening, is highly attractive for increased pollination reception, ger-
mination, and seed set. Developing synchronous flowering habits in TGMS lines is
essential for successful seed production. At IRRI, a few long feathery stigma-pro-
truding types of TGMS lines with synchronous flowering patterns were successfully
identified (Fig. 3) (Ali et al. 2018). Similarly, at TNAU, the TGMS lines developed
through pedigree breeding, mutation breeding, and identification of spontaneous
mutants in the breeding material were addressing the market requirements for
medium duration, better agronomic characteristics, and excellent floral traits and
requirements such as high stigma exsertion, wider glume opening, and acceptable
grain quality characteristics such as medium slender grain type, etc. (Manonmani
et al. 2016). However, the outcrossing traits translating into higher hybrid seed
yields need to be verified under hybrid seed production geographies.
Fig. 3 Newly developed

TGMS line with long
feathery stigma
The floral traits of the pollen parents are also equally important to obtain higher
seed setting. The pollen parents need to be highly diverse from the TGMS parental
lines. At the same time, they need to possess floral traits similar to those of a restorer
in the three-line system, especially in terms of plant height, profuse tillering, heavy
pollen load, and pollen dehiscence. Moreover, the pollen parents should possess a
staggered flowering habit to provide good pollen dehiscence during hybrid seed
production. Consideration should be given to the synchrony of the timing of pollen
dehiscence of pollen parents. It should match the TGMS parent’s spikelet opening,
and stigma receptivity is essential. In addition, pollen parents need to possess all the
market-required traits such as appropriate grain shape and quality, abiotic stress
tolerance, and insect pest and disease resistance.
5 Genetics of TGMS Lines
The recent discovery of new low-CSTP TGMS lines that showed complete sterility
at a mean temperature of 24 °C has sparked renewed interest in two-line hybrid rice
technology. The genetics of the TGMS trait is essential for the exploitation of this
technology.
5.1 Identification of Genes Governing the TGMS Trait
A single recessive nuclear gene governs the TGMS trait in TGMS lines (Hussain
et al. 2012). So far, 13 TGMS genes and their alleles (tms1, tms2, tms3, tms4, tms5,
tms6, tms6(t), tms7(t), tms8, tms9, tms9-1, tms10, and tmsX) found in 5460S, Norin
PL 12, IR32364, SA 2, Annong S-1, SoKcho-MS, 0A15-1, UPRI-95-140TGMS,
F61, Zhu1S, Hengnong S-1, japonica cv. 9522, and Xian S, respectively, have been
identified based on their allelic relationship as well as molecular marker studies.
(Wang et al. 1995; Subudhi et al. 1997; Yamaguchi et al. 1997; Reddy et al. 2000;
Table 2 Molecular markers associated with EGMS genes in rice (modified from Ali et al. 2018)
118
Trait Gene Source Chromosome Closest flanking markers Distance (cM) Reference
TGMS tms1 5460S 8 RZ562-RG978 6.7 Wang et al. (1995)
tms2 Norin PL12 7 R643A-R1440 (D24156) 0.3 Yamaguchi et al. (1997)
Norin PL12 7 RM11-RM2 5.0, 16.0 Lopez et al. (2003)
KDML105 7 0s7g2690 15.4, 16.9 Pitnjam et al. (2008)
tms3 IR32364S 6 OPAC3640-OPAA7550 7.7, 10.0 Subudhi et al. (1997)
IR32364S 6 F18F, F18RM, F18FM/F18RM 2.7 Lang et al. (1999)
tms4 TGMS-VN1 2 E5/M12600 3.3 Dong et al. (2000)
SA2 9 RM257, EAA/MCAG 6.2, 5.3 Reddy et al. (2000)
tms5 Annong S-1 2 RM174, R394 0, 2.5 Jia et al. (2000)
Annong S-1 2 C365-1, G227-1 1.04, 2.08 Wang et al. (2003)
M105S 2 RM174 0 Nas et al. (2005)
Annong S-1 and Y58S 2 4039-1 and 4039-2 – Yang et al. (2007)
103S 2 RM3294, RM6378, RM7575 and RM71 – Hien and Yoshimura (2015)
Annong S-1 2 dCAPS-172 – Song et al. (2016)
IR68301S 2 RM12676, 2gAP0050058 Khlaimongkhon et al. (2019) New
tms6 Sokcho-MS 5 RM3351, E60663 0.1, 1.9 Lee et al. (2005)
tms6(t) 0A15-1 3 S187-770 1.3 Wang et al. (2004)
UPRI 95-140TGMS 3 – – Li et al. (2005)
G20S 10 RM3152, RM4455 3.0, 1.10 Liu et al. (2010)
tms7(t) UPRI 95-140TGMS 7 – – Li et al. (2005)
tms8 F61 11 RM21, RM224 4.3, 3.0 Hussain et al. (2012)
tms9 Zhu1S 2 Indel 37, Indel 57 0.12, 0.31 Sheng et al. (2013)
Zhu1S 2 Indel 91, Indel 101 – Sheng et al. (2015)
tms9-1 HengnongS-1 9 QY-9-19, QY-9-27 0.22, 0.07 Qi et al. (2014)
tms10 japonica cv. 9522 2 Os02g18320 Yu et al. (2017) New
tmsX XianS 2 RMAN81, RMX21 – Peng et al. (2010)
J. Ali et al.
Trait Gene Source Chromosome Closest flanking markers Distance (cM) Reference
PGMS/PTGMS pms1 32001S 7 RG477-RG511, RZ272 3.5–15.0 Zhang et al. (1994)
RG477/R277, R1807 0.1, 6.0 Liu et al. (2001)
pms1(t) Pei’ai64S 7 RM21242, YF11 0.2, 0.2 Zhou et al. (2011)
pms2 32001S 3 RG348, RG191 10.6, 7.0 Zhang et al. (1994)
pms3 Nongken 58S 12 RZ261/C751, R2708 5.5, 9.0 Mei et al. (1999)
Nongken 58S 12 LJ47 and LJ265 0 Lu et al. (2005), Ding et al. (2012)
pms4 Mian 9S 4 RM6659, RM1305 3.0, 3.5 Huang et al. (2008)
p/tms12-1 Pei’ai64S 12 PA301, PAIDL2 – Zhou et al. (2012)
ptgms2-1 Guangzhan63S 2 S2-40, S2-44 0.08, 0.16 Xu et al. (2011)
rTGMS rtms1 J207S 10 RM239-RG257 3.6, 4.0 Jia et al. (2001)
rPGMS rpms1 YiD1S 8 RM22980, RM23017 0.9, 1.8 Peng et al. (2008)
rpms2 YiD1S 9 RM23898, YDS926 0.9, 0.9 Peng et al. (2008)
rpms3(t) D52S 10 RM5271 and RM244 6.6, 4.6 Joseph et al. (2011)
csa Zhang et al. (2013)
119
120 J. Ali et al.
Jia et al. 2000; Wang et al. 2004; Lee et al. 2005; Li et al. 2005; Peng et al. 2010;
Hussain et al. 2012; Sheng et al. 2013; Qi et al. 2014; Yu et al. 2017) (Table 2).
The identified tms genes could be further exploited for developing TGMS pyra-
miding lines by using two to three tms genes for improving stability during the ste-
rility phase. However, only a few studies have been attempted on the pyramiding of
these alleles, studying them for improving the stability of the TGMS lines (Nas
et al. 2005). So far, 13 tms, seven pms, and three rtms genes have been identified
governing the EGMS trait that is spread across all 12 rice chromosomes.
The TGMS trait is governed by a single major gene and could have several modi-
fier genes that exist in different backgrounds. Therefore, it is crucial to characterize
the TGMS lines physiologically before their commercial exploitation. The TGMS
trait is much easier to transfer to other backgrounds through the marker-assisted
backcross (MABC) approach, and one has to take care of modifier genes as well that
may influence trait expression. In this context, it is essential to understand the
molecular function of the TGMS trait (Ding et al. 2012; Zhou et al. 2012; Wang
et al. 2013; Pan et al. 2014; Kim and Zhang 2017; Mishra and Bohra 2018).
Earlier studies on TGMS focused on the physiological aspects and how the gene
is phenotypically expressed in the population. However, the first genetic study to
confirm the location of the TGMS gene was begun by Wang et al. (1995) using an
F2 cross from a mutant TGMS line (5460S) and Hong Wan 52. Bulk segregant
analysis and QTL mapping using RAPD markers identified the first TGMS gene as
TGMS1.2, located within chromosome 8 (Wang et al. 1995). Succeeding genetic
studies are all compiled and given in Table 2 with the corresponding molecular
markers.
5.2 Molecular Mechanisms of the TGMS Trait
With the advent of new technologies in the field of genomics and transcriptomics,
Luo et al. (2020) confirmed the location of the tms gene, which was begun by Wang
et al. (1995), for the identification of tms1 on chromosome 8 using RFLP markers.
This transition from RFLP to SSRs and more recently with transcriptomics in con-
firming the tms1 loci led to the unraveling of the mechanism behind tms genes (Luo
et al. 2020). Furthermore, Pan et al. (2014) showed that, in line TGMS-Co27, male
sterility is based on the cosuppression of a UDP-glucose pyrophosphorylase gene
(Ugp1), and the underlying molecular mechanisms need to be unraveled. Zhou et al.
(2014) uncovered the molecular mechanism of rice tms5, which functions in RNase
ZS1-mediated UbL40 mRNA regulation during pollen development. Under permis-
sive (low) temperature conditions, the level of UbL40 mRNAs remains low in the
tms5 mutant plants, allowing the production of normal pollen. However, at restric-
tive (high) temperature, UbL40 mRNAs are not processed by RNase ZS1, which
leads to their high-level accumulation, causing male sterility (Zhou et al. 2014).
Wang et al. (2019) carried out a comparative quantitative proteomic analysis of the
anthers of TGMS line Annong S-1 grown at permissive (low) (21 °C) and restrictive
Fig. 4 Current breeding approaches for TGMS followed at IRRI
(high) temperatures (>26 °C). The restrictive high temperatures resulted in 89 dif-
ferentially accumulated proteins (DAPs) in the anthers as compared to permissive
low-temperature conditions. Out of the 89 DAPs, 46 had increased abundance and
43 had decreased abundance, which are distributed in most of the subcellular com-
partments of anther cells. Most have catalytic and binding molecular functions.
Moreover, the gene ontology analysis for biological processes done by Wang et al.
(2019) indicated that high-temperature induction caused the fertility-sterility con-
version. This mainly adversely affects the metabolism of protein, carbohydrate, and
energy and decreases the abundance of vital proteins closely related to defense and
stress. This further impedes the growth and development of the pollen and weakens
the overall defense and stress ability of Annong S-1.
Li et al. (2020) carried out RNA-Seq on rice TGMS lines at the microspore
mother cell and meiosis stages under sterile and fertile conditions that revealed
1070 differentially expressed genes found to be enriched in protein folding, protein
binding, regulation of transcription, transcription factor activity, and metabolic-
related processes. They showed that hub genes (such as UbL40s) were predicted to
interact with proteolysis-related genes and DNA-directed RNA polymerase subunit,
and heat shock proteins (HSPs) interacted with kinases to play significant roles in
regulating fertility alteration. Their study suggested that, besides UbL40s, DNA-
directed RNA polymerase subunit, kinases, and HSPs might be involved in TGMS
fertility alteration and could be applied for TGMS breeding (Li et al. 2020). Despite
several of these in-depth studies, the TGMS trait mechanism still needs to be unrav-
eled entirely for its immediate exploitation by breeders.
122 J. Ali et al.
6 Breeding of TGMS and Pollen Parental Lines
Two-line breeding strategies for TGMS are currently carried out using four
approaches: (a) the use of mutagenesis to induce new tms gene mutants from current
materials, (b) conventional crossing and pedigree selection, (c) introgression of cur-
rently identified tms genes into elite lines, and (d) pyramiding known tms genes
from different sources (Fig. 4). For each strategy, parental line selection remains the
most crucial part to ensure hybrid vigor and address market segment requirements.
6.1 Different Available Approaches to Breed TGMS Lines
6.1.1 Mutation Breeding for the Identification of TGMS Mutants
Mutation breeding for the development of TGMS lines was first reported by
Maruyama et al. (1991) for the development of Norin PL12 using gamma radiation.
Furthermore, Ali et al. (1995) developed and characterized several TGMS lines
using chemical and physical mutagens. Interestingly, Ali and Siddiq (1999) also
identified a spontaneous mutant (JP38s) that showed a reverse TGMS trait, behav-
ing as sterile at lower temperatures (<24 °C) and as fertile at higher temperatures
(>30.5 °C). IRRI began a mutation breeding program using chemical mutagens in
2015 to discover new TGMS mutants, which are currently being characterized. The
mutation populations in the M2 generation need to be screened under high-temper-
ature conditions to identify complete male sterility, and these are then stubbled and
taken to low-temperature conditions to check for fertility reversions. Depending
upon their seed settings in the stubbles, they are further generation advanced under
low-temperature conditions to fix the TGMS mutants quickly. Upon fixation, these
mutants are studied in different temperature regimes to characterize them physio-
logically (Ali et al. 1995, 2020 Unpublished).
.
6.1.2 Pedigree Breeding
It is also essential to breed new materials through crossing TGMS parents with elite
lines and selection in the F2 generation for male-sterile single plants under high-
temperature conditions. At IRRI, conventional crosses were made with the TGMS
line A07 as a pollinator and elite breeding materials as the female parents (Ali et al.
2018). After the initial cross in the F2 generation, the selected male-sterile single
plants in high-temperature regimes are then stubbled and selfed seeds are produced
under low-temperature conditions. These selected single plants are verified for the
presence of the tms5 gene across succeeding generations. Using this approach, a
new TGMS line with the tms5 gene will be developed (Ali et al. 2020 Unpublished).
6.1.3 Transfer from a Known TGMS Gene Source to Elite Lines
Another strategy for integrating TGMS in two-line hybrid rice is by introgression of

tms genes. At IRRI, the TGMS line A07 is used as a donor for introgressing the tms5
gene into elite breeding materials by two backcrosses and selecting the progenies in
BC2F2 onward for the tms5 gene. By using foreground markers and high-density
background SNP markers, introgression of the tms5 gene into elite materials is pos-
sible. However, it is essential to accurately characterize these materials upon fixa-
tion for their fertility-sterility alteration behavior.
6.1.4 Pyramiding TGMS Genes for Better Stability
Despite the independent successes in characterizing and isolating different TGMS

genes in rice, only a few studies have dealt with the additive effect and pyramiding
of different TGMS genes (Nas et al. 2005). Two- and three-gene pyramids con-
structed using the three TGMS donors, Norin PL 12 (tms2), SA2 (tgms), and
DQ200047-21 (tms5), possessing the RM11 allele of Norin PL 12, RM257 allele of
SA2, and RM174 allele of DQ200047-21 were selected. As expected, all selected
progenies were male-sterile in sterility-inducing conditions (Nas et al. 2005). The
pyramids developed from this effort were designated as IR80775-46 (with tms2 and
tms5) and IR80775-21 (with tms2, tgms, and tms5). Pyramiding tms genes is useful
to improve the stability of the TGMS line and to widen the sterility phase. Currently,
at IRRI, efforts are ongoing to pyramid tms2 and tms5 genes to understand the
mechanisms of the genes and to improve the stability of the TGMS trait. The current
Fig. 5 New IRRI stable TGMS lines with low critical sterility temperature point at 24 °C
124 J. Ali et al.
Table 3 TGMS lines developed at IRRI (modified from Ali et al. 2018)
S. no. TGMS line
1 A07
2 A32
3 A36
4 A37
5 IR75589-31-27-8-33-1 (TGMS)
6 IR68301-11-6-4-4-3-6-6 (TGMS)
7 IR73827-23-26-15-7 (TGMS)
8 IR73834-21-26-15-25-4 (TGMS)
9 IR75589-31-27-8-33 (TGMS)
10 IR77271-42-5-4-36 (TGMS)
Fig. 6 New IRRI stable TGMS line with low critical sterility temperature point. (Source: Ali et al.
2018)
TGMS pyramiding studies at IRRI used line A07 as a pollinator parent (Ali et al.
2020 Unpublished).
6.2 Rapid Fixation of Segregating TGMS Lines
Conventionally, generation advancement is accomplished by growing the plants

under natural low-temperature locations, for example, Lucban-Quezon (14.0805°N,
121.5427°E) and Tublay-Benguet (16.50805°N, 120.63524°E). This method
remains the most popular as it is the most cost-efficient and requires the least techni-
cal work. This method, however, has its disadvantages as well. First, the environ-
mental variables (temperature, humidity, and day length) at the location could cause
genetic purities, mainly if fluctuations occurred during the plant’s panicle initiation.
Second, it requires labor-intensive cultural management of the field to prevent pests
and diseases, especially under higher altitude locations in the tropics. Regardless of
the fixation method, marker-assisted selection (MAS) is integral to the generation
advancement of TGMS lines. MAS ensures the integrity of the tms gene and the
genetic purity of the TGMS lines across generations.
Pedigree breeding and generation advancement of desirable TGMS segregants
and mutants are challenging until the lines are correctly fixed. Recently, using new
techniques of speed breeding under rapid generation advancement (RGA) facilities
with specialized lighting, one can fix the segregating TGMS trait within 2–3 years,
and this can be put to use to develop hybrid combinations. The use of the RGA
method is a viable alternative to save on time and costs vis-à-vis field conditions.
RGA hastens the fixation of new lines by advancing single seeds per line from a
segregating population under controlled conditions (Collard et al. 2017). Instead of
the usual dry and wet seasons, RGA allows several generations of advancement in
a single season by growing the plants in trays instead of transplanting in the field to
facilitate faster growth. Generations of TGMS breeding lines are advanced at low
temperature (<22 °C) in plant growth facility (PGF) chambers. It is essential to
maintain the critical temperature and humidity necessary to induce pollen fertility
and self-seed setting in plants, thus requiring more labor costs, a PGF, and technical
expertise.
To speed up the fixation of TGMS traits in the mutants and segregants, one can
use a doubled-haploid (DH) approach. It is essential to identify the right segregants
and mutants for fixation through the DH approach (Fig. 5). Many times, the DH
TGMS lines, once fixed, may not be the ideal ones to match the market require-
ments. IRRI has previously developed four TGMS lines using DH technology: A07,
A36, A32, and A37 (Ali et al. 2018) (Table 3). Among them, A07 has already been
validated as highly stable and it has a low CSTP of 24 °C (Fig. 6).
Moreover, the tms gene present in this line (tms5) is the most extensively studied
tms gene and it is used in different breeding programs as well (Wang et al. 2003;
Nas et al. 2005; Yang et al. 2007; Kadirimangalam et al. 2019). Finally, DH technol-
ogy offers the best potential among the three approaches. The use of DH technology
126 J. Ali et al.
ensures the fastest method of fixing recombinant genotypes, encompassing six gen-
erations of population advancement typically required to fix the population in just a
single season (Yao et al. 2018). Moreover, the use of DHs eliminates the presence
of deleterious alleles and background noise, which are typically observed in a natu-
ral population.
6.3 Breeding Pollen Parents
Heterotic pool-based breeding of pollen parents, more diverse and distinct from the
TGMS pool, is required. These materials need to be improved within the pool and
avoid contamination from materials nearer the TGMS heterotic pool. Breeders need
to select for the target traits that help in pollen dehiscence, staggering flowering
characteristics, and heavy tillering to provide a continuous pollen supply.
Furthermore, the pollen parents need to address market segment needs so that the
hybrids developed fit well. Pedigree breeding, single seed descent with genomic
selection, along with RGA approaches could help to speed up the pollen parental
breeding process. Specific traits such as genes with resistance against major insect
pests and diseases that address market segment needs could be incorporated through
a marker-assisted backcross (MABC) breeding approach.
6.4 Two-Line indica/japonica Hybrids
The two-line system is ideal for exploiting indica/japonica hybrids as there is no

barrier for the identification of pollen parents, which could be any parent other than
the TGMS parent. The TGMS gene could preferably be in the indica parental back-
ground, and with the use of a wide-compatibility (WC) gene in any one of the par-
ents, one could develop indica/japonica hybrids. Shukla and Pandey (2008)
suggested brighter prospects of combining improved japonica and tropical japonica
germplasm having WC genes with indica TGMS lines for the exploitation of inter-
subspecific heterosis. Recently, with the discovery of reliable WC gene-based mark-
ers, ones such as S5 could be highly useful for selection to combine with tms
gene-based markers. At IRRI, the S5 gene from different sources is backcrossed into
TGMS line A07. Hybrid rice seed production of intersubspecific hybrids may be
challenging due to the varying timing of spikelet opening and pollination of the two
subspecies, especially in tropical environments. So, we need to carefully identify
parental lines from these two subspecies closer to each other.
7 Breeding Two-Line Hybrids
Two-line rice hybrids have higher heterosis than three-line rice hybrids as any
nonTGMS line could be used as a pollen parent, thus creating more extensive
opportunities. Unlike the three-line system, CMS requires only restorers with
restorer fertility (Rf) genes to restore fertility in the F1 hybrid. Thus, it is a much
narrower range within which heterosis needs to be exploited. On the other hand,
TGMS-based two-line hybrids open up more opportunities to use the intersubspe-
cific hybrids (indica/japonica) as the japonica subspecies has a low frequency of
restorer genes. At IRRI, all source nurseries are genotyped, and heterotic pools are
formed based on the genetic distances. Heterotic pool-based breeding is being fol-
lowed to identify the best combinations for the two-line hybrids. To improve the
heterotic pools, we have to make crosses within the pool. There is a need to maintain
different heterotic pools carefully and to avoid contamination from other heterotic
pools. To develop new heterotic hybrids, we can attempt crosses between dis-
tant pools.
Fig. 7 IR134554H, a multiple-stress-tolerant two-line rice hybrid developed at IRRI

Table 4 Performance of hybrids over the best inbreds and hybrids at IRRI-South Asia Hub, Hyderabad, in WS 2018, and at ISARC-Varanasi in kharif 2019
128
IRRI-South Asia Hub, Hyderabad (WS2018) ISARC Varanasi (kharif 2019)

Yield advantage (%) Yield advantage (%)
over check over check
Total Total Total Arize Sava127
Plant Panicle spikelets Spikelet grain US337 MTU1010 grain 6444Gold Pro
Days to height length Productive per fertility yield (comm. (best yield (hybrid (hybrid
Designation flowering (cm) (cm) tillers (no.) panicle (%) (kg/ha) hybrid) variety) (kg/ha) check) check)
IR134554 H 101 92 21 12 158 80 7767.0 10.0 21.0 7956.7 6.4 12.9
IR81958H 92 94 22 12 161 78 7638.0 8.0 19.0 7987.0 6.8 13.4
(Mestiso 77)
IR90872 H 95 88 22 18 173 79 7532.0 7.0 17.0 7606.0 1.7 8.0
IR81265H 92 84 23 16 199 84 7164.0 2.0 11.0 7704.7 3.1 9.4
(Mestiso 61)
IR82391H 95 88 21 13 163 78 6885.0 −2.0 7.0 7790.7 4.2 10.6
(Mestiso 68)
IR121020 H 87 78 20 13 153 79 6218.0 −12.0 −3.0 7040.7 −5.8 −0.1
IR106638 H 94 80 22 14 201 82 6153.0 −13.0 −4.0 7746.3 3.6 10.0
IR106616 H 90 85 22 12 221 83 6032.0 −14.0 −6.0 7676.0 2.7 9.0
IR81255H 91 83 21 16 199 81 5947.0 −16.0 −8.0 7818.3 4.6 11.0
(Mestiso 89)
IR82386H 93 82 22 13 168 68 5477.0 −22.0 −15.0 7927.0 6.0 12.5
(Mestiso 71)
DRR DHAN 83 81 21 13 157 76 3398.0 – – – – –
44
US 312 102 87 21 12 148 71 6881.0 −2.0 7.0 – – –
US 382 106 95 20 11 169 77 6756.0 −4.0 5.0 – – –
US 337 94 101 23 11 187 73 7051.0 0.0 10.0 – – –
MTU 1010 89 93 21 16 196 80 6436.0 −9.0 0.0 – – –
J. Ali et al.
IRRI-South Asia Hub, Hyderabad (WS2018) ISARC Varanasi (kharif 2019)
Yield advantage (%) Yield advantage (%)
over check over check
Total Total Total Arize Sava127
Plant Panicle spikelets Spikelet grain US337 MTU1010 grain 6444Gold Pro
Days to height length Productive per fertility yield (comm. (best yield (hybrid (hybrid
Designation flowering (cm) (cm) tillers (no.) panicle (%) (kg/ha) hybrid) variety) (kg/ha) check) check)
Arize 6129 – – – – – – – – – 7249.3 −3.0 2.9
Gold (hybrid
check)
VNR 2355 – – – – – – – – – 6636.0 −11.2 −5.8
Plus (hybrid
check)
Super Moti – – – – – – – – – 6617.3 −11.5 −6.1
(hybrid
check)
BPT 5204 – – – – – – – – – 6499.3 −13.1 −7.8
(inbred check)
Sarju 52 – – – – – – – – – 5559.3 −25.6 −21.1
(inbred check)
MTU 7029 – – – – – – – – – 6958.0 −6.9 −1.2
(inbred check)
Arize 6444 – – – – – – – – – 7476.7 0.0 6.1
Gold (hybrid
check)
Sava 127 pro – – – – – – – – – 7045.3 −5.8 0.0

(hybrid
check)
129
130 J. Ali et al.
7.1 Combining Ability Nurseries
The general combining ability (GCA) of an inbred is its average performance across
a series of hybrid combinations, and it is primarily due to the additive effects of
genes. The GCA effects of the parental lines help in the identification of suitable
parental lines (Chandirakala et al. 2012). The most promising TGMS lines devel-
oped in high combining ability backgrounds could be used to further identify and
validate their general combining ability. For this, a line × tester design could be used
to identify high GCA of lines. This also allows identifying combinations with high
specific combining ability that could be immediately exploited. A combining ability
nursery needs to be regularly created to identify TGMS lines with high GCA and
pollen parents from the breeding pipelines. Chen et al. (2010) stressed the impor-
tance of identifying PTGMS with high combining ability as this is the basis of
robust heterotic hybrid rice varieties. Cao and Zhao (2014) showed that successful
hybrids are directly determined by the combining ability of the sterile line, and
sterile lines with high GCA have higher chances to produce heterotic combinations.
In situations with poor GCA of TGMS lines, it is good to have pollen parents with
high GCA to develop heterotic hybrids. Shukla and Pandey (2008), with a broad set
of line × tester crosses, found that the parents with good GCA did not always pro-
duce the best hybrid combinations due to a lack of higher-order additive interaction,
and they suggested evaluating the specific combinations. They found TGMS line
365-8S to be the best general combiner for all six traits: grain yield, panicle length,
grain number per panicle, earliness in flowering, panicle number per plant, and
1000-grain weight.
7.2 Breeding Trials
Once hybrid combinations are identified, small-scale seed production either by

hand crosses or in field conditions should be sufficient to carry out an observation
yield trial (OYT). An OYT evaluation of the F1s under best management conditions
would allow the identification of good performing hybrids, and these should be
forwarded to an advanced yield trial (AYT) in a larger plot size with proper replica-
tions and the best market checks. Simultaneously, the AYT is screened for resis-
tances to insect pests and diseases. The highly performing hybrids should be
identified and sent for grain quality evaluation. Based on all the data, the best
hybrids need to be produced in large quantities and also evaluated for their hybrid
seed reproducibility for ensuring their success when screened in multienvironment
trials (METs). The best candidate hybrids tested under METs lay the foundation for
the identification of the best hybrids for a given target location and market segment.
IRRI conducted two demonstration trials in India to evaluate the performance of
some newly developed two-line hybrids. One hybrid (IR134554H) performed
exceedingly well at both Hyderabad and Varanasi (Table 4, Fig. 7).
Table 5 Market needs segment per region for hybrid rice
Yield
advantage Yield
Potential over best advantage Plant Key Key Producibility Key gaps in
Product Duration hybrid area Core target hybrid over best Check height defensive agronomic benchmark the present
Countries concept (days) (m ha) geography (%) OPV (%) variety (cm) traits traits Grain quality (yield/ha) products
India Mid-early 110–125 8 PUN, 5–8 15–20 MTU1010 110– Blast, neck High vigor, HRR: >3.0 t/ha, Lack of
segment HAR, CG, and US 120 blast,* BLB, >85% 55–65% staggering stress-tolerant
CU, JH, 312 BPH, false spikelet MRR: >70% <15 days materials,
MP, GJ, (inbred) smut,* stem fertility, AC: 18–24% producibility,
AS, UP, borer,* non-lodging, LS lodging,*
WB, KAR, drought cold tolerant false smut*
W, C, tolerant (seedling),
Assam MTU 1010 &
IET 4786
grain type,
fine grain
Bangladesh MS grain 125–140 4 Sylhet, 10 20 (>9.0 t/ BRRI 90– BLB, SB, High vigor, MS with >3.0 t/ha, Lack of
segment Dhaka, ha) dhan 100 BPH spikelet high amylose staggering stress-tolerant
(boro) Chittagong, 81(inbred) fertility, cold (>24%), <15 days materials
Rajshahi, BRRI tolerant, milling (salinity,
Ranpur, dhan 5 Jeerasail (>65%) drought, cold,
Khulna, (hybrid) grain type diseases,
Barisal (>85%) insects
Mid-early 115–120 2 Divisions 10 20 (>7.0 t/ BRRI 100– False smut,* High vigor, Slender grain >3.0 t/ha, Lack of
segment ha) dhan 49 110 BLB spikelet with high staggering stress-tolerant
(T. aman) (inbred) fertility, amylose <10 days materials
BRRI early, drought (>24%), (salinity,
Hybrid 6 tolerant, milling drought, cold,
(hybrid) BRRI dhan49 outturn submergence,
grain type (>65%) stagnation at
(>85%) 15–30-cm
depths,
diseases,
insects)
131
(continued)
Table 5 (continued)
132
Yield
advantage Yield
Potential over best advantage Plant Key Key Producibility Key gaps in
Product Duration hybrid area Core target hybrid over best Check height defensive agronomic benchmark the present
Countries concept (days) (m ha) geography (%) OPV (%) variety (cm) traits traits Grain quality (yield/ha) products
Philippines Mid-early 95–115 2 Region 1, 5 15–20 NSIC Rc ≥100 BLB, BPH, Stability, AC 17–24%, ≥2.5 t/ha Susceptible to
segment Region 3, 222 blast, stem more tillers, >55% HRR, SB, poor
Region (inbred) borer,* RTV, uniform grain >65% MRR, standability,
4A/4B Mestiso 3 non-lodging maturity, LS, less yield coupled
(hybrid) non-lodging, chalk, slight with GQ,
non- aroma BLB, BPH,
shattering low HRR,
susceptibility
to fungal
diseases
Indonesia Mid-late 120–130 2 Bali, ≥10 ≥20 Ciherang 90– Blast, neck More AC 18–22%, >2.5 t/ha, RSV-BPH,
segment Central (inbred) 115 blast,* BLB, productive low-med GT, staggering BLB, blast,
Java, East Hipa 18, BPH, false tillers, more soft GC, <10 days, drought
Java, Aceh, Hipa 20 smut,* stem filled grains, >50% HRR, high OCR
South (hybrid) borer,* lodging tol., >65% MRR, (>50%)
Sulawesi, drought wide <10%
Lampung tolerant, adaptability, chalkiness,
RTV, BPH, threshability good
RRSV/ palatability,
RGSV transluscent,
S-LS
Vietnam Medium > 2046.1 t/ha North 1–5 >20 Nhị Ưu 110– BLB, BPH Yield Intermediate >2.5 t/ha LS grain
segment 110–130 838, 120 AC, high hybrid with
Thien uu, HRR, low BLB, BPH,
BC 15 chalk SB traits
Early 85–105 1.4 mt South & 1–3 <20 (inbreds) 110– BLB, BPH Very early Intermediate >2.5 t/ha LS grain
segment (early/LS) Central TH3–3 120 AC, high hybrid with
(hybrid) HRR, low BLB & BPH
chalk traits
J. Ali et al.
7.3 Insect Pest and Disease Resistance
Two-line rice hybrid yield potential could be fully realized by incorporating resis-
tance to major diseases and insect pests (bacterial leaf blight (BLB), blast (BL),
false smut (FS), sheath blight (SHB), tungro, green leafhopper (GLH), brown plan-
thopper (BPH), stem borer, leaf folder, and gall midge). Most insect pest and dis-
ease resistances are governed by major genes and could be easily introgressed into
parental lines depending on market segment requirements. Two-line breeding offers
better opportunities to convert the TGMS parent to acquire disease and insect pest
resistance as compared to a CMS/maintainer parent, which is more cumbersome
and requires more time (Ali et al. 2018). In this regard, IRRI has developed a global
product concept addressing different market needs, which could be useful, require
fewer resources, and result in higher impact. Researchers at Huazhong Agricultural
University (HAU) introgressed Xa7, Xa21, and Xa23 genes into C815S, a popular
TGMS parental line, to develop five BLB-resistant cultivars: Hua1005S, Hua1002S,
Hua 1009S, Hua 1006S, and Hua1001S (Jiang et al. 2015). Two-line hybrids with
Xa23 showed a resistance reaction to seven Xanthomonas oryzae pv. oryzae (Xoo)
strains. Hua1006S was the most promising TGMS parent among them with a higher
degree of resistance based on Xa23 besides better plant type and grain quality fea-
tures (Jiang et al. 2015). Currently, at IRRI, introgression of BLB and blast resis-
tance genes into elite TGMS and pollen parental lines is carried out through
marker-assisted selection.
7.4 Grain Quality Considerations Addressing Market Needs
A wider array of heterotic two-line rice hybrids opens up better options for develop-
ing customized grain quality that caters to market needs (Table 5). IRRI’s two-line
rice hybrid Mestiso 61 with good grain quality matched the market needs of the
Philippines. It was successfully licensed to SL Agritech Company in the Philippines
with limited exclusivity for a 6-year period. However, it is still available for license
to the private seed industry for other countries under the Hybrid Rice Development
Consortium. This hybrid gave an average yield of 6.7 t/ha during the dry season and
6.4 t/ha during the wet season across the Philippines. The yield potential of this
hybrid was nearly 10 t/ha, with 55% head rice recovery and amylose content of
20.5%, ideally fitting Philippine market needs. We developed a strategy to breed and
customize grain quality as per market requirements (Allahgholipour et al. 2006;
Pang et al. 2016). In this approach, breeders identify good-quality lines that will
cater to the varied interests of consumers across rice-consuming countries by
screening the breeding materials for eating and cooking quality (ECQ) and keeping
the popularly preferred good-quality varieties as controls in the study. Furthermore,
work is ongoing to identify advanced rice breeding lines/cultivars with similar
apparent amylose content (AAC), gelatinization temperature (GT), and rapid vis-
134 J. Ali et al.
cosity analysis (RVA), properties like those of the popular high-quality rice variet-
ies, through simple cluster analysis. A two-line hybrid from China, Pei-Liang-you
1108, has relatively good ECQ, and through our study, we identified seven lines in
the HC21 cluster clade with similar AAC, GT, and RVA and hence with comparable
ECQ. Likewise, another two-line hybrid with good ECQ, Jin-ke-you651, allowed us
to identify 11 hybrid lines within the HC18 cluster clade that had similar AAC, GT,
and ECQ (Pang et al. 2016).
It is essential to develop rice hybrids with better ECQ that address market needs,
paving the way for the expansion and adoption of rice hybrids in Asia and Africa.
Higher hybrid rice yields have no value if they do not translate into higher percent-
age head rice recovery (>55%), leading to increased farmers’ income.
8 Seed Production Challenges
Two-line hybrid rice technology largely depends on the identification of TGMS

lines that need to be multiplied under low-temperature conditions, and hybrid rice
seed production requires a minimum of 2 weeks of stable high temperature to reach
the sterile phase. To achieve these two different aspects of seed production carefully,
we have different approaches to identify appropriate locations based on agrometeo-
rological data. However, this needs validation before large-scale seed production.
Key Challenges
• Addressing market requirements for different target places varies: for example,
long-duration hybrids for the Indian market segment may require a longer dura-
tion of TGMS and pollen parents.
• Identification and exploitation of hybrid rice seed production and TGMS self-
seed multiplication sites.
• Development of usable and stable TGMS parental lines matching market seg-
ment requirements.
• The relative heterosis of two-line rice hybrids needs to be superior to that of the
existing best three-line hybrids in the market.
• Two-line hybrid rice technology should assure lower seed costs on account of
better hybrid seed reproducibility rates of 3 t/ha and higher self-seed multiplica-
tion rates (>4.5 t/ha), making this seed feasible for use by farmers.
8.1 I dentification of Ideal Locations for Self-Seed

Multiplication of TGMS and Hybrid Rice Seed Production
TGMS-based two-line hybrid rice technology mainly depends on the identification

of suitable areas for both self–seed multiplication and hybrid rice seed production
(Table 6). Earlier, a systematic analysis of 50 years of agrometeorological data
helped in the identification of appropriate sites in India (Siddiq and Ali 1999).
Interestingly, the authors identified places located in India between 500 and 700 m
above sea level from May to September for both hybrid seed and self-seed multipli-
cation of the TGMS lines. Furthermore, through experimental validation, these
places were confirmed as suitable for hybrid rice seed production, TGMS seed mul-
tiplication, and locations ideal for both operations (Siddiq and Ali 1999).
Critical considerations for the choice of place could be the hills, coastal plains,
or interior plains, keeping within the physiological sterility limits of <40 °C to
>16 °C. The Two-line Hybrid Rice Research Station was established under Tamil
Nadu Agricultural University in the Nilgiris hills at 1200 m above sea level in a
place known as Gudalur as early as 1995 in India (Soundararaj et al. 2002). Male-
sterile TGMS selections at high temperatures at Trichy were made and immediately
sent as stubbles to Gudalur to allow their self-seed multiplication and generation
advancement. The most suitable time for matching the temperature conducive to
self-fertility was from June to November. Shuttle breeding helped to identify 15
highly stable TGMS lines with better stigma exsertion of 40–66%, and many are in
the pipeline. Nearly 800 ha of paddy lands are available for commercial self-seed
multiplication of promising TGMS lines (Soundararaj et al. 2002). In the Philippines,
Lucban, Nueva Vizcaya, and Benguet are all identified as highly suitable for self-
seed multiplication of TGMS lines. In Nueva Vizcaya, the mean temperature from
the beginning of October to the end of February in the next year is less than 22 °C,
making it a suitable place to reproduce TGMS line seed. The mean temperature at
Lucban from January to February was <23 °C, and so all the TGMS lines possessing
a CFTP of <23 °C could be multiplied at Lucban. The TGMS lines should be com-
pletely male sterile to ensure the safety of hybrid seed production. Interestingly, we
observed that the mean temperature at IRRI, Los Baños, was higher than 25 °C
almost all year. So, the CSTP of fertility-sterility alteration of TGMS lines in the
Philippines could be set at >24 °C for ensuring completely safe hybrid seed produc-
tion, especially from April to June.
Pollen of A07 was partially fertile to completely sterile at Lucban as observed
from 5 May to 17 June and completely sterile (with no pollen type) at Los Baños.
A07 possesses a lower CFTP to turn completely fertile at <24 °C. A07 seeds pro-
duced in Nueva Vizcaya are possible where lower temperature prevails as compared
to Lucban (Ali et al. 2020 Unpublished). Recently, with GIS technologies, IRRI has
successfully identified a suitable choice of sites for hybrid seed production and
TGMS self-seed multiplication based on 20 years of agrometeorological data. The
potential GIS maps for the Philippines, identifying the places suitable for self-seed
multiplication and hybrid rice seed production, are shown in Fig. 8. A map with a
0.08° spatial resolution and limited climatic data from 2010 to 2018 was used to
avoid results affected by climate change trends. The following assumptions were
used for locations selected based on temperature meeting a stable criterion for
28 days minimum each year, especially for hybrid seed production: (a) average
daily temperature of >28 °C and ≤36 °C and (b) a minimum temperature of
>24 °C. Likewise, for TGMS self-seed multiplication, a criterion of average tem-
perature of <24 °C and Tmin >16 °C was used.
136 J. Ali et al.
Table 6 Ideal locations for two-line hybrid seed production and TGMS self-seed multiplication
(modified from Ali et al. 2018)
Seed production operation Ideal places
Hybrid seed production India: Aduthurai, Trichy, Killikulum, Madurai, Karnal,
Delhi Philippines: Los Banos
TGMS seed production India: Aduthurai, Gudalur, Samalkota, Karnal;
Philippines: Lucban, Benguet, Nueva Vizcaya
Hybrid seed production & TGMS India: Aduthurai and Samalkota
seed multiplication
9 ide-Scale Adoption and Use of Two-Line Hybrid Rice

W
Technology
To achieve wide-scale adoption of two-line hybrid rice technology, we need ideal

TGMS lines that should possess a higher combining ability, outcrossing rate, and
market-desirable grain quality features along with insect and disease resistance
(Fig. 6). During the sterile induction phase, the plants must be 100% male sterile
with more than 99.5% pollen sterility and must behave stably under well-defined
fertility-sterility alteration conditions. Higher seed setting above 45% in the self-
seed multiplication phase is essential. Ideal TGMS lines should have lower CSTP
(24 °C) and lower CFTP (22 °C). However, researchers are still attempting to lower
the CSTP to 23 °C (mean temperature), which will render the TGMS lines highly
stable, especially during the sterile phase, and make them highly suitable for hybrid
rice seed production. The frequency of heterotic hybrids is much higher for two-line
hybrids than for three-line hybrids as any nonTGMS parent could be used as a pol-
len parent, thereby increasing hybrid breeding efficiency. Furthermore, as there is
no need for restorer genes in the male parents of two-line hybrids, this is highly
ideal for developing indica/japonica hybrids as most japonica lines do not possess
restorer genes. Since there is no need for a maintainer line for seed multiplication,
this makes seed production much simpler and highly cost-effective. Two-line
hybrids have obvious superiority over three-line hybrids for rice grain yield, quality,
and insect pest and disease resistance (Chen et al. 2010). In this regard, the best two-
line hybrids should address market segment requirements with a 30–35% yield
advantage over market check inbreds and with higher seed reproducibility rates
(>3 t/ha).
Two-line hybrid rice technology is feasible for tropical conditions for which the
temperature regimes are highly suitable for its exploitation. TGMS parental lines
with lower CSTP of 23 °C are highly essential for the success of this technology. At
IRRI, we are trying to reach 22 °C for CSTP, which is even more stable and would
ensure the wide-scale adoption of two-line hybrid rice technology. In this regard,
the Two-Line Hybrid Rice Study Group involving key hybrid rice seed companies
agreed to join hands in 2019 primarily to test-verify and validate potential TGMS
lines, pollen parents, and F1 hybrids in the target geographies. The study group will
be able to jointly confirm the strength of two-line hybrid rice technology, especially
Fig. 8 Suitability maps for hybrid rice seed production and self-seed multiplication of TGMS
lines for the Philippines developed by the IRRI GIS team
for its feasibility in South Asia. IRRI will continue to invest in this crucial technol-
ogy for bringing the benefits of two-line rice hybrids to the rice farmers in South
Asia. The accomplishment of this study group would ensure a lower cost of hybrid
seeds, higher heterosis of two-line hybrids, and potential combinations meeting the
market needs of the target regions. The success of two-line hybrid rice technology
in tropical Asia would shift the attention of hybrid rice development in China toward
South Asia, thus triggering widespread adoption of two-line rice hybrids.
10 Future Directions and Conclusions
The recent discovery of genome editing tools has opened up more opportunities to
correct the genes of interest, including the tms gene, and to make them more stable
and with precise expression. However, in many countries, genome editing is still
under the genetically modified (GM) domain, including the Philippines. Li et al.
(2019) introduced specific mutations into the TMS5, Pi21, and Xa13 genes in
Pinzhan intermediate breeding material using the CRISPR/Cas9 multiplex genome
editing system. They demonstrated multiplex gene editing by finding transgene-free
138 J. Ali et al.
homozygous triple tms5/pi21/xa13 mutants obtained in the T1 generation that dis-

played characteristics of TGMS with improved resistance to rice blast and bacterial
leaf blight. However, recent publications on editing the TMS5 gene and also achiev-
ing multiplex gene editing have increased our confidence to improve TGMS lines
(Barman et al. 2019; Li et al. 2019; Zhou et al. 2016).
Wang and Deng (2018) described the development and implementation of the
“third-generation” hybrid rice breeding system that is based on a transgenic
approach to propagate and use stable recessive nuclear male-sterile lines. Using this
approach, the male-sterile lines and hybrid rice produced using such a system are
nontransgenic and hold great promise to boost the production of hybrid rice and
other crops (Wang and Deng 2018).
To conclude, two-line hybrid rice technology primarily concentrates on the iden-
tification of proper TGMS parental lines with a lower CSTP (23 °C) and matching
market segment requirements. The hybrids developed out of these TGMS parental
lines should also meet market needs by achieving consumer and farmer acceptance
that includes duration, grain shape, grain quality, and insect pest and disease resis-
tance. Furthermore, these top-performing hybrids should have a high hybrid rice
seed reproducibility of >3 t/ha to allow the private sector to adopt them. Also, hybrid
rice seed costs would become relatively cheaper and enable farmers to invest in the
purchase of seeds. Two-line rice hybrids have several advantages over three-line
rice hybrids, and they could be easily upscaled once they match market needs. The
Two-line Study Group was formed in 2019 at IRRI to understand the fundamental
challenges for the wide-scale adoption of two-line hybrid rice technology and vali-
date the research efforts by IRRI to meet these challenges and make the technology
feasible. The study group is in the process of testing and verifying IRRI TGMS
materials in the target regions. Recent advances in the field of GIS and the precise
identification of suitable locations for hybrid rice seed production and TGMS self-
seed multiplication, especially in the tropical countries in Asia and Africa, have
given us the confidence to scale up two-line hybrid rice technology.
References
Abeysekera SW, Abeysiriwardana DS, Dehideniyz E (2003) Characteristics associated with out-
crossing rate of cytoplasmic male sterile (CMS) lines in rice under local conditions. Ann Sri
Lanka Dept Agric 5:1–6
Ali J (1993) Studies on temperature sensitive genic male sterility and chemical induced steril-
ity towards development of two line hybrids in rice (Oryza sativa L.). Dissertation, Indian
Agricultural Research Institute, New Delhi, India
Ali J, Siddiq E (1999) Isolation and characterization of a reverse temperature sensitive genic male
sterile mutant in rice. Indian J Genet 59(4):423–428
Ali J, Siddiq E, Zaman FU, Abraham MJ, Ahmed IM (1995) Identification and characterization
of temperature sensitive genic male sterile sources in rice (Oryza sativa L.). Indian J Genet
55(3):243–259
Ali J, Dela Paz M, Marfori CM, Nicolas KL (2018) Environment sensitive genic male sterility
(EGMS) based hybrid breeding in rice. In: Rao PV, Muralidharan K, Siddiq EA (eds) Modern
breeding strategies for crop improvement. Proceedings of one-day dialogue on 10 July 2017,
Professor Jayashankar Telangana State Agricultural University (PJTSAU), Rajendranagar,
Hyderabad, India, p 250
Allahgholipour MA, Ali AJ, Alinia F, Nagamine T, Kojima Y (2006) Relationship between rice
grain amylose and pasting properties for breeding better quality rice varieties. Plant Breed
125(4):357–362
Arasakesary SJ, Manonmani S, Pushpam R, Robin S (2015) New temperature sensitive genic
male sterile lines with better out-crossing ability for production of two line hybrid rice. Rice
Sci 22(1):49–52
Athwal DS, Virmani SS (1972) Cytoplasmic male sterility and hybrid breeding in rice. In: Rice
breeding. International Rice Research Institute, Los Baños, pp 615–620
Barman HN, Sheng Z, Fiaz S, Zhong M, Wu Y, Cai Y, Wang W, Jiao G, Tang S, Wei X, Hu P (2019)
Generation of a new thermo-sensitive genic male sterile rice line by targeted mutagenesis of
TMS5 gene through CRISPR/Cas9 system. BMC Plant Biol 19(1):109. https://doi.org/10.1186/
s12870-019-1715-0
Cao L, Zhao X (2014) Chinese experiences in breeding three-line, two-line and super hybrid rice.
In: Yan W (ed) Rice: germplasm, genetics and improvement. https://doi.org/10.5772/56821
Carnahan HL, Erikson JR, Tseng ST, Rutger JN (1972) Outlook for hybrid rice in the USA. In:
Rice breeding. International Rice Research Institute, Los Baños, pp 603–607
Chandirakala R, Kandasamy G, Thiyagarajan K (2008) Determination of fertility behaviour of
thermo sensitive genic male sterile lines in rice. Oryza 45(2):110–114
Chandirakala R, Kandasamy G, Thiyagarajan K (2012) Genetic variability and combining ability
for quality characters in two line hybrids in rice. Electron J Plant Breed 3(3):843–847
Chen LY, Xiao YH, Lei DY (2010) Mechanism of sterility and breeding strategies for photope-
riod/thermo-sensitive genic male sterile rice. Rice Sci 17(3):161–167. https://doi.org/10.1016/
S1672-6308(09)60012-3
Chen J, Xu Y, Fei K, Wang R, He J, Fu L, Shao S, Li K, Zhu K, Zhang W, Wang Z, Yang J (2020)
Physiological mechanism underlying the effect of high temperature during anthesis on spike-
let-opening of photo-thermo-sensitive genic male sterile rice lines. Sci Rep 10(2210):24–27.
https://doi.org/10.1038/s41598-020-59183-0
Cheng S, Sun Z, Si H, Zhuo L (1995) Response to photoperiod and temperature in photo-thermo
period sensitive genic male sterile line Xinguang S (Oryza sativa L. subsp. indica). Chin J Rice
Sci 9(2):87–91
Collard BCY, Beredo JC, Lenaerts B, Mendoza R, Santelices R, Lopena V, Verdeprado H,
Raghavan C, Gregorio GB, Via L, Demon M, Biswas PS, Iftekharuddaula KM, Rahman MA,
Cobb JN, Islam MR (2017) Revisiting rice breeding methods: evaluating the use of rapid gen-
eration advance (RGA) for routine rice breeding. Plant Prod Sci 20(4):337–352. https://doi.org
/10.1080/1343943X.2017.1391705
Ding JH, Lu Q, Yidan OY, Mao HL, Zhang PB, Yao JL, Xu CG, Li XH, Xiao JH, Zhang QF (2012)
A long noncoding RNA regulates photoperiod-sensitive male sterility, an essential component
of hybrid rice. Proc Natl Acad Sci U S A 109:2654–2659
Dong NV, Subudhi PK, Luong PN, Quang VD, Quy TD, Zheng HG, Nguyen HT (2000) Molecular
mapping of a rice gene conditioning thermosensitive genic male sterility using AFLP, RFLP
and SSR techniques. Theor Appl Genet 100(5):727–734
FAO (Food and Agriculture Organization of the United Nations) (2020) FAOSTAT database. FAO,
Rome. www.fao.org/faostat/en/#data. Accessed 13 Jul 2020
Gao YZ (1991) Discovery and preliminary study of short photoperiod sensitive male-sterile rice. J
Yichun Univ (Nat Sci) 1:1–5
Hien V, Yoshimura A (2015) Identifying map location and markers linked to thermosensitive genic
male sterility gene in 103S line. J Sci Dev 13(3):331–336
Huang QC, Zhang XT (1991) CIS 28-10s, a new indica photoperiod sensitive genic male sterile
rice. Int Rice Res Newsl 16(2):8–9
140 J. Ali et al.
Huang TY, Wang Z, Hu YG, Shi SP, Peng T, Chu XD, Liu DY (2008) Genetic analysis and primary
mapping of pms4, a photoperiod-sensitive genic male sterility gene in rice (Oryza sativa). Rice
Sci 15(2):153–156
Hussain A, Ali J, Siddiq E, Gupta V, Reddy U, Ranjekar P (2012) Mapping of tms8 gene for tem-
perature-sensitive genic male sterility (TGMS) in rice (Oryza sativa L.). Plant Breed 131:42–47
Jia J, Li C, Qu X, Wang Q, Deng Q, Weng M, Wang B (2000) Construction of genetic linkage
map and mapping of thermo-sensitive genic male sterile gene tms5 in rice. http://icgr.caas.net.
cn/973/abstract/bwang.htm
Jia JH, Zhang DS, Li CY, Qu XP, Wang SW, Chamarerk V, Wang B (2001) Molecular mapping
of the reverse thermo-sensitive genic male-sterile gene (rtms1) in rice. Theor Appl Genet
103(4):607–612
Jiang YM, Rong Y, Tao GX, Tang LJ (1997) Breeding of DiannongS2, a thermosensitive genic
male sterile line with new cytoplasm from japonica rice. Southwest Chin J Agric Sci 3:21–24
Jiang J, Mou T, Yu H, Zhou F (2015) Molecular breeding of thermo-sensitive genic male sterile
(TGMS) lines of rice for blast resistance using Pi2 gene. Rice 8(1):11. https://doi.org/10.1186/
s12284-015-0048-3
Joseph CA, Chen Z, Ma D, Zeng HL (2011) Analysis of short photoperiod-sensitive genic male
sterility and molecular mapping of rpms3(t) gene in rice (Oryza sativa L.) using SSR markers.
Genes Genomics 33:513–519. https://doi.org/10.1007/s13258-010-0074-x
Kadirimangalam SR, Kumar M, Saraswathi R, Mannonmani S, Raveendran M (2017) Study on
critical sages and critical sterility point of thermo-sensitive genic male sterile lines of rice
for two line hybrid production. Int J Curr Microbiol Appl Sci 6(5):2128–2135. https://doi.
org/10.20546/ijcmas.2017.605.238
Kadirimangalam SR, Hifzur R, Saraswathi R, Kumar M, Raveendran M, Robin S (2019) Fine
mapping and expression analysis of thermosensitive genic male sterility gene (tms) in rice
(Oryza sativa L.). Plant Gene 19:100186. https://doi.org/10.1016/j.plgene.2019.100186
Khlaimongkhon S, Chakhonkaen S, Pitngam K, Ditthab K, Sangarwut N, Panyawut N, Wasinanon
T, Mongkolsiriwatana C, Chunwongse J, Muangprom A (2019) Molecular markers and candi-
date genes for thermo-sensitive genic male sterile in rice. Rice Sci 26(3):147–156. https://doi.
org/10.1016/j.rsci.2018.08.006
Kim YJ, Zhang D (2017) Molecular control of male fertility for crop hybrid breeding. Trends Plant
Sci 23(1):53–65
Lang NT, Subudhi PK, Virmani SS, Brar DS, Khush GS, Li Z, Huang N (1999) Development
of PCR-based markers for thermosensitive genetic male sterility gene tms3 (t) in rice (Oryza
sativa L.). Hereditas 131(2):121–127
Latha R, Thiyagarajan K (2010) Fertility alteration behaviour of thermosensitive genic male sterile
lines in rice Oryza sativa L. Electron J Plant Breed 1(July):1118–1125
Latha R, Senthilvel S, Thiyagarajan K (2005) Critical temperature and stages of fertility alteration
in thermo-sensitive genic male sterile lines of rice. In: Poster papers of the 4th international
crop science congress, Brisbane, 2004
Lee DS, Chen LJ, Suh HS (2005) Genetic characterization and fine mapping of a novel
thermo-sensitive genic male-sterile gene tms6 in rice (Oryza sativa L.). Theor Appl Genet
111(7):1271–1277
Li CQ (2009) Accelerating the development of japonica hybrid rice in China. In: Xie F, Hardy
B (eds) Accelerating hybrid rice development. International Rice Research Institute, Laguna,
pp 267–289
Li RB, Pandey MP, Sharma P (2005) Inheritance of thermosensitive genic male sterility in rice
(Oryza sativa L.). Curr Sci 88(11):1805–1815
Li SF, Shen L, Hu P, Liu Q, Zhu XD, Qian Q, Wang KJ, Wang YX (2019) Developing disease-
resistant thermosensitive male sterile rice by multiplex gene editing. J Integr Plant Biol
61(12):1201–1205. https://doi.org/10.1111/jipb.12774
Li C, Tao RF, Li Y, Duan MH, Xu JH (2020) Transcriptome analysis of the thermosensitive genic
male-sterile line provides new insights into fertility alteration in rice (Oryza sativa). Genomics
112(3):2119–2129. https://doi.org/10.1016/j.ygeno.2019.12.006
Liu N, Shan Y, Wang FP, Xu CG, Peng KM, Li XH, Zhang QF (2001) Identification of an 85-kb
DNA fragment containing pms1 a locus for photoperiod-sensitive genic male sterility in rice.
Mol Gen Genomics 266:271–275
Liu X, Li X, Zhang X, Wang S (2010) Genetic analysis and mapping of a thermosensitive genic
male sterility gene, tms6(t), in rice (Oryza sativa L.). Genome 53(2):119–124
Lopez MT, Tojinda T, Vanavichit A, Tragoonrung S (2000) Introgression of thermosensitive
male sterility gene to aromatic Thai rice. In: Posters of the 4th International Rice Genetics
Symposium, International Rice Research Institute, Laguna, Philippines, 22–27 October 2000
Lopez MT, Toojinda T, Vanavichit A, Tragoonrung S (2003) Microsatellite markers flanking the
gene facilitated tropical TGMS rice line development. Crop Sci 43(6):2267–2271
Lu X, Wang J (1988) Fertility transformation and genetic behavior of Hubei photoperiod-sensi-
tive genic male sterile rice. In: Hybrid rice. International Rice Research Institute, Los Baños,
pp 129–138
Lu XG, Zhang ZG, Maruyama K, Virmani SS (1994) Current status of two-line method of hybrid
rice breeding. In: Virmani SS (ed) Hybrid rice technology: new developments and future pros-
pects. International Rice Research Institute, Manila, pp 37–49
Lu Q, Li XH, Guo D, Xu CG, Zhang Q (2005) Localization of pms3, a gene for photoperiod-
sensitive genic male sterility, to a 28.4-kb DNA fragment. Mol Gen Genomics 273(6):507–511
Luo Y, Tingchen M, Teo J, Luo Z, Li Z, Yang J, Yin Z (2020) Marker-assisted breeding of thermo-
sensitive genic male sterile line 1892S for disease resistance and submergence tolerance. Rice
Sci 27:89–98
Mahalingam A, Saraswathi R, Ramalingam J, Jayaraj T (2013) Genetics of floral traits in cyto-
plasmic male sterile (CMS) and restorer lines of hybrid rice (Oryza sativa L.). Pak J Bot
45(6):1897–1904
Manonmani S, Pushpam R, Robin S (2016) Stability of TGMS lines under different temperature
regimes for pollen sterility. J Rice Res 9(1):17–19
Maruyama K, Araki H, Amano E (1990) Enhancement of out-crossing habits of rice plant by muta-
tion breeding. Gamma Field Symp 29:11–25
Maruyama K, Araki H, Kato H (1991) Thermosensitive genetic male sterility induced by irradia-
tion. In: Rice genetics II. International Rice Research Institute, Manila, pp 227–235
Mei MH, Dai XK, Xu CG, Zhang QF (1999) Mapping and genetic analysis of genes for photo-
period-sensitive genic male sterility in rice using the original mutant Nongken 58S. Crop Sci
39:1711–1715
Mishra A, Bohra A (2018) Non-coding RNAs and plant male sterility: current knowledge and
future prospects. Plant Cell Rep:1–15
Mou TM, Xing-Gui L, Hoan NT, Virmani SS (2003) Two-line hybrid rice breeding in and outside
China. In: Virmani SS, Mao CX, Hardy B (eds) Hybrid rice for food security, poverty allevia-
tion, and environmental protection. Proceedings of the 4th international symposium on hybrid
rice, Hanoi, 14–17 May 2002. International Rice Research Institute, Manila, pp 31–52
Nas TMS, Sanchez DL, Diaz MGQ, Mendioro MS, Virmani SS (2005) Pyramiding of thermosen-
sitive genetic male sterility (TGMS) genes and identification of a candidate tms5 gene in rice.
Euphytica 145:67–75
Oard JH, Hu J (1995) Inheritance and characterization of pollen fertility in photoperiodically sen-
sitive rice mutants. Euphytica 82:17–23
Oka HT, Morishima H (1967) The ancestors of cultivated rice and their evolution. Department of
Applied Genetics, National Institute of Genetics, Japan. p 145
Pan Y, Li Q, Wang Z, Wang Y, Ma R, Zhu L, He G, Chen R (2014) Genes associated with ther-
mosensitive genic male sterility in rice identified by comparative expression profiling. BMC
Genomics 15(1):1114. https://doi.org/10.1186/1471-2164-15-1114
142 J. Ali et al.
Pang Y, Ali J, Wang X, Franje NJ, Revilleza JE, Xu J, Li Z (2016) Relationship of rice grain
amylose, gelatinization temperature and pasting properties for breeding better eating and
cooking quality of rice varieties. PLoS One 11(12):e0168483. https://doi.org/10.1371/journal.
pone.0168483
Peng HF, Zhang ZF, Wu B, Chen XH, Zhang GQ, Zhang ZM, Lu YP (2008) Molecular mapping of
two reverse photoperiod-sensitive genic male sterility genes (rpms1 and rpms2) in rice (Oryza
sativa L.). Theor Appl Genet 118(1):77–83
Peng HF, Chen XH, Lu YP, Peng YF, Wan BH, Chen ND, Wu B, Xin SP, Zhang GQ (2010) Fine
mapping of a gene for non-pollen type thermosensitive genic male sterility in rice (Oryza sativa
L.). Theor Appl Genet 120:1013–1020
Pitnjam K, Chakhonkaen S, Toojinda T, Muangprom A (2008) Identification of a deletion in
tms2 and development of gene-based markers for selection. Planta 228:813–822. https://doi.
org/10.1007/s00425-008-0784-3
Qi Y, Liu Q, Zhang L, Mao B, Yan D, Jin Q, He Z (2014) Fine mapping and candidate gene analy-
sis of the novel thermo-sensitive genic male sterility tms9-1 gene in rice. Theor Appl Genet
127(5):1173–1182
Rahul Roy R, Kumaresan D (2019) Genetic variability and association studies for yield and floral
traits in temperature sensitive male sterile lines (TGMS) of rice (Oryza sativa L). Electron J
Plant Breed 10(3):1200–1209. https://doi.org/10.5958/0975-928X.2019.00152.2
Rajesh T, Radhakrishnan VV, Pressana KK, Francies RM, Sreenivasan E, Ibrahim KK, Latha A
(2017) Critical stages of thermo-sensitive genic male sterile lines of rice in Kerala. ORYZA Int
J Rice 54(4):401–406. https://doi.org/10.5958/2249-5266.2017.00054.6
Ramakrishna S, Mallikarjuna SBP, Mishra B, Virakthamath BC, Illyas Ahmed M (2006)
Characterization of thermo sensitive genetic male sterile lines for temperature sensitivity, mor-
phology and floral biology in rice (Oryza sativa L.). Asian J Plant Sci 5(3):421–428. https://
doi.org/10.3923/ajps.2006.421.428
Reddy OUK, Siddiq EA, Sarma NP, Ali J, Hussain AJ, Nimmakayala P, Reddy AS (2000) Genetic
analysis of temperature-sensitive male sterility in rice. Theor Appl Genet 100(5):794–801
Rutger JN, Schaeffer GW (1989) An environmentally sensitive genetic male sterile mutant in rice.
In: Annual meeting of the American Society of Agronomy, Las Vegas, Nev., USA. Agron.
Abstr. p 98
Salgotra RK, Gupta BB, Ahmed MI (2012) Characterization of thermo-sensitive genic male sterility
(TGMS) rice genotypes: (Oryza sativa L.) at different altitudes. Aust J Crop Sci 6(6):957–962
Sanchez DL, Virmani SS (2005) Identification of thermosensitive genic male-sterile lines with low
critical sterility point for hybrid rice breeding. Philipp J Crop Sci 30:19–28
Sasikala R, Kalaiyarasi R, Paramathama M (2015) Influence of weather factors on fertility alter-
ation in thermosensitive genic male sterile lines of rice (Oryza sativa L.). Int J Trop Agric
33(2):773–779. https://doi.org/10.13140/RG.2.2.24654.41280
Shen Y, Gao M, Cai Q (1994) A novel environment induced genic male sterile (EGMS) mutant in
indica rice. Euphytica 76:89–96
Sheng Z, Wei X, Shao G, Chen M, Song J, Tang S, Chen L (2013) Genetic analysis and fine map-
ping of tms9, a novel thermosensitive genic male-sterile gene in rice (Oryza sativa L.). Plant
Breed 132(2):159–164
Sheng Z, Tang L, Shao G, Xie L, Jiao G, Tang S, Hu P (2015) The rice thermo-sensitive genic male
sterility gene tms9: pollen abortion and gene isolation. Euphytica 203(1):145–152
Shi MS (1981) Report on breeding and application of two-line system in later japonica. Hubei
Agric Sci 7:1–3
Shi MS (1985) The discovery and study of the photosensitive recessive male sterile rice (Oryza
sativa L. subsp. japonica). Sci Agric Sin 2:44–48
Shi MS, Deng JY (1986) The discovery, determination and utilization of Hubei photosensitive
genic male sterile rice (Oryza sativa L. subsp. japonica). Acta Genet Sin 13(2):107–112
Shukla SK, Pandey MP (2008) Combining ability and heterosis over environments for yield and
yield components in two-line hybrids involving thermosensitive genic male sterile lines in rice
(Oryza sativa L.). Plant Breed 127(1):28–32. https://doi.org/10.1111/j.1439-0523.2007.01432.x
Si HM, Fu YP, Liu WZ, Sun ZX, Hu GC (2012) Pedigree analysis of photoperiod thermo-sensitive
genic male sterile rice. Acta Agron Sin 38:394–407
Siddiq EA, Ali J (1999) Innovative male sterility systems for exploitation of hybrid vigour in
crop plants: environment sensitive genic male sterility system. Proc Indian Natl Sci Acad B
65:331–350
Song FS, Ni JL, Qian YL, Li L, Ni DH, Yang JB (2016) Development of SNP-based dCAPS mark-
ers for identifying male sterile gene tms5 in two-line hybrid rice. Genet Mol Res 15(3). https://
doi.org/10.4238/gmr.15038512
Soundararaj AK, Ali AJ, Thiyagarajan P, Arumugachamy S (2002) Prospects of two-line hybrid
rice breeding in Tamil Nadu, India. Int Rice Res Notes 27(1):1
Subudhi PK, Borkakati RP, Virmani SS, Huang N (1997) Identification of RAPD markers linked to
rice thermosensitive genetic male sterility gene by bulk segregant analysis. Rice Genet Newsl
12:228–231
Swaminathan MS, Siddiq EA, Sharma SD (1972) Outlook for hybrid rice in India. Rice breeding.
International Rice Research Institute, Laguna, pp 609–613
Tan ZC, Li YY, Chen LB, Zhou GQ (1990) Studies on ecological-adaptability of dual purpose line
Annong S-1. Hybrid Rice 3:35–38
Vinodhini M, Saraswathi R, Viswanathan PL, Raveendran M (2019) Studies on sterility behaviour
in thermo-sensitive genic male sterile lines of rice. Int J Chem Stud 7(6):55–61
Viraktamath BC, Virmani SS (2001) Expression of thermosensitive genic male sterility in rice
under varying temperature situations. Euphytica 122(1):137–143. https://doi.org/10.102
3/A:1012607608792
Virmani SS (1992) Transfer and induction of thermosensitive genic male sterile mutant in indica
rice. In: Proceedings of the second international symposium on hybrid rice, 21–25 April 1992.
International Rice Research Institute, Manila
Virmani SS (1994) Heterosis and hybrid rice breeding. Monographs on theoretical and applied
genetics. Springer, Berlin, 192 p
Virmani SS, Voc PC (1991) Induction of photo- and thermo-sensitive male sterility in indica rice.
Agron Abstr 119
Virmani SS, Sun ZX, Mou TM, Ali J, Mao CX (2003) Two-line hybrid rice breeding manual.
International Rice Research Institute, Los Banos, p 88
Wang H, Deng XW (2018) Development of the “third-generation” hybrid rice in China. Genomics
Proteomics Bioinformatics 16(6):393–396. https://doi.org/10.1016/j.gpb.2018.12.001
Wang B, Xu WW, Wang JZ et al (1995) Tagging and mapping the thermo-sensitive genic male-
sterile gene in rice (Oryza sativa L.) with molecular markers. Theor Appl Genet 91:1111–1114.
https://doi.org/10.1007/BF00223928
Wang YG, Xing QH, Deng QY, Liang FS, Yuan LP, Weng ML, Wang B (2003) Fine mapping of the
rice thermo-sensitive genic male-sterile gene tms5. Theor Appl Genet 107(5):917–921
Wang C, Zhang P, Ma Z, Zhang M, Sun G, Ling D (2004) Development of a genetic marker linked
to a new thermo-sensitive male sterile gene in rice (Oryza sativa L.). Euphytica 140(3):217–222
Wang K, Peng X, Ji Y, Yang P, Zhu Y, Li S (2013) Gene, protein, and network of male sterility in
rice. Front Plant Sci 4:92. https://doi.org/10.3389/fpls.2013.00092
Wang SY, Tian QY, Zhou SQ, Mao DD, Chen LB (2019) A quantitative proteomic analysis of the
molecular mechanism underlying fertility conversion in thermo-sensitive genetic male sterility
line AnnongS-1. BMC Plant Biol 19:65. https://doi.org/10.1186/s12870-019-1666-5
Wongpatsa U, Kaveeta L, Sriwongchai T, Khamsuk O (2014) Effects of temperature on male ste-
rility of two inbred lines of hybrid rice. Kasetsart J Nat Sci 48(4):525–533
Worldometer (2020). https://www.worldometers.info/world-population/#/table-forecast. Accessed
13 Jul 2020
144 J. Ali et al.
Xu J, Wang B, Wu Y, Du P, Wang J, Wang M, Liang G (2011) Fine mapping and candidate gene
analysis of ptgms2-1, the photoperiod-thermo-sensitive genic male sterile gene in rice (Oryza
sativa L.). Theor Appl Genet 122(2):365–372
Yamaguchi Y, Hirasawa H, Minami M, Ujihara A (1997) Linkage analysis of thermosensitive
genic male sterility gene, tms-2 in rice (Oryza sativa L.). Jpn J Breed 47(4):371–373
Yang QH, Zhu J (1996) Breeding of go543S, an indica PTGMS rice with its sterility induced by
short day-length and low temperature. Hybrid Rice 1:9–10
Yang RC, Wang NY, Mang K, Chau Q, Yang RR, Chen S (1990) Preliminary studies on applica-
tion of indica photo-thermo genic male sterile line 5460S in hybrid rice breeding. Hybrid Rice
1:32–34
Yang YZ, Tang PL, Yang WC, Liu AM, Chen YQ, Ling WB, Shi TB (2000) Breeding and utiliza-
tion of TGMS line Zhu1S in rice. Hybrid Rice 15(2):6–9
Yang ZY, Zhang GL, Zhang CH, Chen JJ, Wang HQ, Zhang JJ, Yan Z (2002) Breeding of fine qual-
ity PTGMS line Guangzhan 63S in medium indica rice. Hybrid Rice 17(4):4–6
Yang QK, Liang CY, Zhuang W, Jun Li J, Deng HB, Deng QY, Wang B (2007) Characterization
and identification of the candidate gene of rice thermo-sensitive genic male sterile gene tms5
by mapping. Planta 225:321–330
Yao L, Zhang Y, Liu C, Liu Y, Wang Y, Liang D, Liu J, Sahoo G, Kelliher T (2018) OsMATL
mutation induces haploid seed formation in indica rice. Nat Plants 4:530–533. https://doi.
org/10.1038/s41477-018-0193-y
Yiming J (1988) Studies on the effect of high temperature on fertility of the male sterile lines in
Dian-type hybrid rice [J]. J Yunnan Agric Univ 2000
Yu J, Han J, Kim YJ, Song M, Yang Z, He Y, Fu R, Luo Z, Hu J, Liang W, Zhang D (2017) Two
rice receptor-like kinases maintain male fertility under changing temperatures. Proc Natl Acad
Sci U S A 114(46):12327–12332. https://doi.org/10.1073/pnas.1705189114
Yuan LP (1987) Strategic assumption of hybrid rice breeding. Hybrid Rice 1:1–3
Yuan LP (2014) Development of hybrid rice to ensure food security. Rice Sci 21(1):1–2. https://
doi.org/10.1016/S1672-6308(13)60167-5
Zhang Z, Zeng H, Yang J, Yuan S, Zhang D (1994) Conditions inducing fertility alteration and eco-
logical adaptation of photoperiod-sensitive genic male-sterile rice. Field Crops Res 38(2):111–
120. https://doi.org/10.1016/0378-4290(94)90005-1
Zhang H, Xu CX, He Y, Zong J, Yang X, Si HM, Sun ZX, Hu JP, Liang WQ, Zhang DB (2013)
Mutation in CSA creates a new photoperiod-sensitive genic male sterile line applicable for
hybrid rice seed production. Proc Natl Acad Sci U S A 110:76–81
Zhou YF, Zhang XY, Xue QZ (2011) Fine mapping and candidate gene prediction of the photo-
period and thermo-sensitive genic male sterile gene pms1(t) in rice. J Zhejiang Univ Sci B
12(6):436–447
Zhou H, Liu Q, Li J, Jiang D, Zhou L, Wu P, Chen L (2012) Photoperiod-and thermo-sensitive
genic male sterility in rice are caused by a point mutation in a novel noncoding RNA that pro-
duces a small RNA. Cell Res 22(4):649–660
Zhou H, Zhou M, Yang Y et al (2014) RNase ZS1 processes UbL40 mRNAs and controls ther-
mosensitive genic male sterility in rice. Nat Commun 5:4884. https://doi.org/10.1038/
ncomms5884
Zhou H, He M, Li J, Chen L, Huang Z, Zheng S, Zhu L, Ni E, Jiang D, Zhao B, Zhuang C (2016)
Development of commercial thermo-sensitive genic male sterile rice accelerates hybrid rice
breeding using the CRISPR/Cas9-mediated TMS5 editing system. Sci Rep 6:37395. https://
doi.org/10.1038/srep37395
The images or other third party material in this chapter are included in the chapter’s Creative
included in the chapter’s Creative Commons license and your intended use is not permitted by
Growing Rice with Less Water: Improving
Productivity by Decreasing Water Demand
Balwant Singh, Shefali Mishra, Deepak Singh Bisht, and Rohit Joshi
Abstract Rice is a staple food for more than half of the global population. With the
increasing population, the yield of rice must correspondingly increase to fulfill the
requirement. Rice is cultivated worldwide in four different types of ecosystems,
which are limited by the availability of irrigation water. However, water-limiting
conditions negatively affect rice production; therefore, to enhance productivity
under changing climatic conditions, improved cultivation practices and drought-
tolerant cultivars/varieties are required. There are two basic approaches to
cultivation: (1) plant based and (2) soil and irrigation based, which can be targeted
for improving rice production. Crop plants primarily follow three mechanisms:
drought escape, avoidance, and tolerance. Based on these mechanisms, different
strategies are followed, which include cultivar selection based on yield stability
under drought. Similarly, soil- and irrigation-based strategies consist of decreasing
non-beneficial water depletions and water outflows, aerobic rice development,
alternate wetting and drying, saturated soil culture, system of rice intensification,
and sprinkler irrigation. Further strategies involve developing drought-tolerant
cultivars through marker-assisted selection/pyramiding, genomic selection, QTL
mapping, and other breeding and cultivation practices such as early planting to
follow escape strategies and decreasing stand density to minimize competition with
weeds. Similarly, the identification of drought-responsive genes and their
manipulation will provide a technological solution to overcome drought stress.
However, it was the Green Revolution that increased crop production. To maintain
the balance, there is a need for another revolution to cope with the increasing demand.
Keywords Aerobic rice · Drought · Molecular breeding · Oryza sativa ·

Transgenic · Water deficit
B. Singh · S. Mishra · D. S. Bisht

ICAR-National Institute for Plant Biotechnology, New Delhi, India
R. Joshi (*)
Division of Biotechnology, CSIR-Institute of Himalayan Bioresource Technology,
Palampur, Himachal Pradesh, India
Academy of Scientific & Innovative Research (AcSIR), Palampur, Himachal Pradesh, India

https://doi.org/10.1007/978-3-030-66530-2_5
148 B. Singh et al.
1 Introduction
More than 60% of the human population consumes rice (Joshi et al. 2018). An FAO
report that considered rice production and growth of the human population in the
past decade suggested the urgent need to increase rice production by 70% to fulfill
upcoming demand by 2050 (FAO 2018; Schroeder et al. 2013). In view of this
increased demand for rice production, an urgent need exists to study rice cultivation
practices. Basically, rice cultivation is grouped into four ecosystems: irrigated (50%
of the total rice grown), rainfed lowland (34%), rainfed upland (9%), and flood-
prone (7%) (IRRI 2014). Cultivation under the irrigated rice ecosystem is the most
productive and plays a significant role in meeting global food demand. However,
irrigated rice itself is strongly affected by water availability, irrigation patterns,
water quality, and the duration of water standing in the rice field during the growth
period (Joshi et al. 2018). The rainfed ecosystem has a higher opportunity for yield
improvement as it covers 43% of rice cultivation that still has limited yield potential.
The most common factors that limit rice production in the rainfed ecosystem are
irregular water supplies (i.e., severe drought, flood, and sometimes both in a single
cropping season) and infertile soil due to its acidic or saline nature. Such conditions
further complicate rice genetic improvement programs, which increases pressure on
the irrigated ecosystem (He et al. 2020).
In recent years, changes in environmental conditions imposed multiple abiotic
stresses that severely affect rice production in all ecosystems by strongly inhibiting
plant growth and development (Joshi et al. 2020). According to one estimate, to
produce 1 kg of rice, 2000–5000 L of water are required (Joshi et al. 2009; Caine
et al. 2019). The increased competition of accelerated urbanization and industrial
development further limit freshwater resources for rice production. Therefore, the
need for “more rice with less water” is the need of the hour for global food security
(Maneepitak et al. 2019; He et al. 2020). Thus, water availability is the key
requirement for rice cultivation in each of the rice ecosystems. This forces us to
develop new techniques of water management for rice cultivation that specifically
improve production in different ecosystems (Carracelas et al. 2019). Further, water
use can be managed either by cultivating water-stress-tolerant cultivars that can
yield more under less water availability or by managing soil conditions suitable for
growing rice under water-deficient conditions. Stress-tolerant cultivars can be
identified from crop germplasm resources so that stress tolerance can be transferred
into high-yielding cultivated varieties (Singh et al. 2015a,b; Mishra et al. 2016a, b).
Aerobic rice (AR) is one of the promising rice cultivation systems for managing
water and growing rice under water-limited conditions, thus decreasing water losses
by 27–51% and increasing water productivity by 32–88% (Nie et al. 2007; Joshi
et al. 2009). Aerobic rice varieties are usually grown in upland conditions in
unpuddled soil in non-flooded conditions, that is, unsaturated (aerobic) soil with
less water requirement (Bouman et al. 2006; Joshi and Kumar 2012). Under these
conditions, the cultivation of high-yielding aerobic rice genotypes may help to save
water. Other approaches that decrease water consumption are alternate wetting and
Growing Rice with Less Water: Improving Productivity by Decreasing Water Demand 149
drying of the field; saturated soil culture (SSC) that relies on forming farming beds,
separated by furrows in which a shallow depth of water is maintained; mid-season
drainage; delayed flooding; and sprinkler irrigation. Keeping this in mind, the
Indian Council of Agricultural Research-National Rice Research Institute (ICAR-
NRRI), India, has released promising rice varieties for cultivation in varying rice
ecosystems (https://crri.icar.gov.in/popular_var.pdf).
Water-limiting conditions are usually designated as drought and different plant
species respond in different ways to cope with drought conditions: avoidance,
tolerance, and escape (Turner 2003). These adaptation strategies include
physiological and metabolic adjustment by plants to minimize damage caused by
drought (IPCC 2001; Singh et al. 2015c). Escape is the capability of the plant to not
reach drought conditions but instead complete the life cycle before drought onset in
water-sufficient conditions (Boyer 1996; Joshi et al. 2014). This is of crucial
importance as it is related to early establishment of the crop, inhibition of stomatal
conductance, and water management. Thus, the goal is to have early flowering and
maturity along with rapid germination and seedling establishment. Avoidance is a
means to avoid the stress by maintaining ample water during the stress period
(Bodner et al. 2015; Urban et al. 2017). Plants achieve this by changing the shape
and decreasing the number and size of leaves. Plants also roll their leaves and
change their orientation to decrease absorption of radiation and prevent water loss
(Caine et al. 2019). Moreover, an increase in waxiness of leaves, root density, and
deep rooting enables plants to uptake water from depth for sustaining themselves
during adverse conditions (Ashraf et al. 2011; Joshi and Karan 2014). Cultivars that
have these traits are suitable for the rainfed cropping system (Bodner et al. 2015;
Korres et al. 2016). According to Levitt (1980), drought avoidance via an efficient
water uptake methodology is the best method to achieve higher yield. Additionally,
areas that are prone to frequent drought conditions should be cropped with cultivars
that are early maturing and have high vigor (Gouache et al. 2012). The tolerance
mechanism actually allows plants to survive and grow in stress conditions. This is
done by maintaining turgor through osmoregulation, producing antioxidants, and
accumulating compatible solutes (Joshi and Chinnusamy 2014).
2 urrent Rice Cultivars/Varieties Grown Under

C
Water-Limiting Conditions
Availability of water for irrigation is increasingly a limiting factor in attaining the

full-yield potential among many crops (Boyer 1982). Various techniques have been
devised and discovered to counteract the effects of water-limiting conditions and
climate changes by using acquired plant adaptations. The appropriate choice of
cultivar as per its adaptation to the rice ecosystem/local environment is important as
different varieties show different mechanisms to cope with drought (Turner 2003).
A field experiment using two rice genotypes, Hanyou 113 (HY113) and Yangliangyou
150 B. Singh et al.
6 (YLY6), under flooding and drought stress revealed that drought stress at the
reproductive stage strongly affects physiological traits, yield, and grain quality
(Yang et al. 2019). IRRI has successfully developed and released 17 high-yielding
drought-tolerant rice varieties, which include Sahod Ulan and Katihan (Philippines),
Hardinath and Sookha Dhan (Nepal), Sahbhagi Dhan (India), BRRI dhan
(Bangladesh), Inpago LIPI Go 1/2 (Indonesia), M’ZIVA (Mozambique), and UPIA3
(Nigeria) (Kumar et al. 2014). In India, Sahbhagi Dhan was reported to produce 4 t/
ha under normal conditions and 1–2 t/ha under severe drought conditions. Because
of its early maturity (105 days) and low irrigation requirements, farmers can save up
to USD 60 per crop (Basu et al. 2017). Similarly, in Nepal, drought-tolerant cultivar
Sookha Dhan 2 showed higher yield from an altitude of 1000–1600 masl (Dhakal
et al. 2020). Further, ICAR-NRRI has developed and released drought-tolerant rice
cultivar DRR-Dhan 45, which is moderately resistant to major diseases and pests
such as rice tungro viruses, sheath rot, and blast, with average yield of 6 t/ha
(Nirmala et al. 2016).
3 xisting Rice Cultivation Practices Under

E
Water-Deficit Conditions
Farmers practice a traditional way of cultivation and selection of cultivars as per

their natural adaptations toward changes in environmental conditions (Gala Bijl and
Fisher 2011). However, with rice cultivation, emphasis has been given to the
development of rice cultivation techniques that result in a lot of technological
options for cultivation to enhance production under water-limiting conditions
(Fig. 1). A cumulative approach of water management and cultivation of high-
yielding varieties that performed well under water-limiting conditions was supposed
to diminish the yield penalty. Therefore, water management practices, including
short-term, long-term, and anticipatory phenological adaptation measures, are
required before assessing the impact of water-limiting conditions, and they usually
aim at mitigating effects (Nguyen 2005; IPCC 2007). A study on phenological and
water-saving adaptation strategies of crop plants showing higher yield stability
under water-limiting conditions has further proved the utility of cumulative
approaches (Bodner et al. 2015).
3.1 Plant-Based Strategies
3.1.1 Selection of Cultivars/Varieties
The right choice of cultivar plays a significant role in rice cultivation under less
water because of specificity of the tolerance mechanism of a cultivar to drought:
tolerance, avoidance, and escape. Cultivar selection basically depends on
QTL
mapping
Genomic
selection
Marker-
assisted
selection
Reduced Marker-assisted
stand density backcrossing
Date of planting Marker-assisted

pyramiding
Selection of cultivars/ Marker-assisted recurrent

varieties Transgenic approaches selection
Plant based Sprinkler Saturated Aerobic rice Molecular breeding
irrigation soil culture development
Alternate wetting and System of rice
drying framework intensification
Reducing non-beneficial water
depletions and water outflows
Soil and irrigation based
Fig. 1 Different strategies to improve rice productivity by decreasing water demand
demography and availability of water for irrigation. Following an escape strategy,

plants complete their life cycle before drought onset in water-insufficient conditions
(Boyer 1996). Cultivars having early flowering and maturity date and also rapid
germination and establishment time completed their life cycle early and were
therefore selected for cultivation in rainfed upland, lowland, and typhoon-prone
coastal areas (Fukai et al. 1999). Areas that are prone to frequent drought conditions
should be cropped with cultivars that are early maturing and have high vigor
(Gouache et al. 2012; Bodner et al. 2015). Similarly, cultivars adapted for drought
avoidance traits such as decreasing size and number of leaves, leaf rolling, and an
increase in waxiness of leaves, density of root, and deep rooting are suitable for
cropping in the rainfed ecosystem (Farooq et al. 2009; Bodner et al. 2015; Korres
et al. 2016). Plants having a tolerance mechanism maintain turgor pressure through
osmotic adjustment via generating osmolytes and osmoprotectant and producing
antioxidants. In addition, the development of screening tools to identify drought
stress tolerance at the seedling stage is crucial for developing rice cultivars suitable
for water-limited environments. Thus, 100 tropical japonica rice genotypes were
studied under pot conditions for their drought tolerance and a cumulative drought
stress response index (CDSRI) was developed by combining individual response
indices of all the varieties that were found to be important for identifying tolerant
cultivars for early-season drought (Lone et al. 2019). Similarly, taking 15 rice
cultivars commonly grown in Mississippi (USA), early-season drought-tolerant
cultivars were selected by analyzing total drought response index (TDRI) (Singh
et al. 2017).
152 B. Singh et al.
3.1.2 Date of Planting
Planting date is related to the drought escape mechanism so as to escape drought

conditions and it is the most appropriate method of escape (Ding et al. 2020). Thus,
to avoid drought, optimization of sowing time as per water availability and demand
is crucial. Three reasons were found to be critical for early sowing in dry
environments (Bodner et al. 2015):
1. Climatic variations in evapotranspiration improve water-use efficiency of early-
planted cultivars because most of the developmental stages have to face decreased
water potential gradients.
2. Early sowing shifts sensitive stages (germination and reproductive stages) to
periods of better water availability.
3. Early-sown cultivars develop deeper roots and facilitate the drought avoidance
mechanism.
For long-term climatic changes, early sowing is a suitable solution (Ding et al.
2017) because of the availability of ample amounts of water and nutrients that will
improve canopy development, yield, and biomass production. In contrast, an
increase in canopy area will increase evapotranspiration (Lin et al. 2020). Therefore,
variations in biomass production per unit transpiration through adjustments in
planting dates will be beneficial for drought tolerance or drought escape. Although
early planting could enhance spikelet sterility caused by high temperatures (Jagadish
et al. 2015), by using early-maturing cultivars, both a drought and heat stress escape
strategy will be a beneficial approach (Mukamuhirwa et al. 2019).
3.1.3 Decreased Stand Density
A decrease in stand density focuses on a decrease in intraspecific competition and

improved water availability for a single plant and thus is a measure related to water
saving. Although decreased stand density also relates to higher evapotranspiration,
it is beneficial under certain conditions. An increase in soil evaporation by decreasing
plant density and/or widening row spacing depends on the prevalence of rainfall and
is more during intermittent drought than in a prolonged dry span. Besides
evaporation, decreased radiation interception due to scattered stands might diminish
growth and increase weed competition with crop plants such as wheat (Chen et al.
2008), rice (Rees and Khodabaks 1994), maize (Barbieri et al. 2012), barley
(McKenzie et al. 2005), sugar beet (Ehlers and Goss 2016), and sorghum (Buah and
Mwinkaara 2009). These have been investigated under different conditions and high
yield has been observed with low stand density.
3.2 Soil- and Irrigation-Based Strategies
Environmental changes will influence water accessibility, especially in rice in zones

where water is scarce. Expanded high-temperature environments diminish rice yield
amid the dry season when prevention measures are lacking. Water system alterations
or improvement of appropriate water system frameworks allow water reserves while
decreasing the yield penalty (Krishnan et al. 2011). The existing water-saving
technologies, for example, the alternate wetting and drying (AWD) water system,
SSC, and aerobic rice system, appear to be the most appropriate advances in current
rice research work (Joshi et al. 2018). With a deprived water system and poor
administration, rice production is more affected by climatic vagaries, especially in
tropical countries (Wassmann and Dobermann 2014). Improving technologies for
increasing water-use efficiency will provide long-term economic as well as
environmental benefits. This would also decrease soil salinization problems that
arise from irrigation (Wang et al. 2016).
3.2.1 Alternate Wetting and Drying
As indicated by Tuong (1999), by just considering evapotranspiration, 500–2000 kg

of water are required to produce 1 kg of rice, which gives 33–50% water profitability
(Bouman and Tuong 2001). The AWD technique primarily relies on water
management by alternately applying water in either flooded or non-flooded
conditions (Maneepitak et al. 2019). This alteration in watering the field has been
determined by a fixed number of non-flooded days, extent of soil potential,
appearance of cracks on the soil surface, symptoms shown by plants, and a drop in
water level below the soil surface (Pascual and Wang 2017; Sriphirom et al. 2019).
Further, in the AWD system, water is connected to non-flooded soil for a few days
after flooding recedes (Bouman et al. 2007). Soil type also influences the measure
of water reserves through AWD in contrast to customary flooded rice. In loamy and
sandy soils with deep groundwater tables, water input decreases by using AWD,
with a 20% yield decrease, in contrast to waterlogged cropping (Singh et al. 2002).
However, in soils with shallow groundwater tables, water input diminishes by
15–30%, accompanied by a noteworthy yield decrease (Carracelas et al. 2019).
Grain production in AWD is usually lower than in flooded rice. However, water-use
efficiency (the estimation of aggregate water used) in AWD is higher, based on
decreased water inputs (62%) and decreased yield (25%) (Bouman et al. 2007;
Wang et al. 2016). This shows the higher efficiency of AWD technology in
comparison to persistent overflowed rice production in connection with water use
per unit that results in a 24.6% increase in income from rice cultivation (Uddin and
Dhar 2020). In addition to decreased water loss, AWD has been reported to decrease
methane emissions from rice fields and decrease heavy metal accumulation in rice
grain (Carrijo et al. 2018; Wang et al. 2019; He et al. 2020).
154 B. Singh et al.
3.2.2 Saturated Soil Culture
In this system, soil is kept soaked as much as could reasonably be expected to bring
about a diminished hydraulic head to flooding. This diminishes water loss by
decreasing leakage and permeation streams (Borrell et al. 1997; Bouman et al.
2007). This shallow-water system of around 1 cm of water profoundly diminishes
water consumption from 10 to 25% in comparison with continuous flooding
(Bouman and Tuong 2001). This framework, in light of information from Tabbal
et al. (2002), transfers the superiority of wet-seeded rice to transplanted rice with
decreased rice yield under continuous flooding (i.e., 4% vs. 10%). Therefore, in
both wet-seeded and transplanted rice, the water profitability under SSC was found
to be higher than that in consistently flooded rice, in addition to the cost effectiveness
for farmers’ acceptability (Kima et al. 2014).
3.2.3 Aerobic Rice Development
Aerobic rice development is used to decrease water needs since the rice is grown as
an upland harvest with optimum yield and a supplementary water system just when
precipitation is inadequate (Joshi et al. 2018). In this system, rice cultivars were
sown in non-puddled and unsaturated (vigorous) soils (Bouman et al. 2007).
Vigorous rice cultivars have been achieved by consolidating the positive attributes
of upland rice with those of high-yielding flooded rice (Atlin et al. 2006). During
the mid- to late 1990s, early-maturing, oxygen-consuming, nitrogen-efficient, and
high-yielding aerobic rice cultivars were released, such as Han Dao 502, Han Dao
297, and Han Dao 277 (Yang et al. 2005; Joshi et al. 2018). These new cultivars
have 50–70% less water consumption than flooded rice due to their more extended
roots that encourage water retention and enhance air dissemination (Mitin 2009).
Under field conditions, these aerobic cultivars produce from 4.7–6.6 t/ha to 8.0–8.8 t/
ha under flooded conditions (Xue et al. 2008). In addition, rice cultivars bred for the
aerobic system must also be bred for competitive ability with weeds because of
enhanced weed problems as soon as flooding is removed (Korres et al. 2016). Thus,
the traits related to water and nutrient acquisition that affect weed-suppressive
ability of the crop include root surface area, water uptake rate, root length, and root
density (Korres et al. 2016).
3.2.4 Decreasing Non-beneficial Water Depletions and Water Outflows
A decrease in evaporation during different stages of development is achieved by

early canopy closure via either manipulating crop density or selecting rice cultivars
with good seedling vigor (Gouache et al. 2012; Bodner et al. 2015). These measures
also increase the competitive ability of the crop by decreasing transpiration from
weeds (Korres et al. 2016). In addition, other methods to control weeds include
using herbicides, manual or mechanical weeding, timely flooding, and land leveling,
which can help to diminish non-beneficial water losses that occur due to transpiration
by weeds (Rodenburg et al. 2011). Soil mulching is also an effective approach to
increase water productivity and decrease water inputs in rice, especially under non-
saturated aerobic soil conditions (Dittert et al. 2002). Puddling in clay soils (Tuong
et al. 2005) or soil compaction in sandy-loamy soils with clay content greater than
5% or shallow tillage before flooding was reported to be beneficial in decreasing
water outflows (Cabangon and Tuong 2000; Tuong et al. 2005).
3.2.5 System of Rice Intensification
To increase rice productivity, a climate-shrewd agroecological method is required to

increase rice yield by altering water, soil, plant, and supplement management. The
SRI philosophy depends on the following four fundamental rules that are connected
with each other: early, snappy, and sound plant foundation; decreased density of
plants; upgraded soil conditions through augmentation with organic supplements;
and controlled and decreased application of water (Uphoff 2004; SRI-Rice 2010).
In light of these standards, farmers can adjust prescribed SRI practices according to
their agroecological and financial conditions. Adjustments are frequently embraced
to handle changing soil conditions, climate designs, water control, work accessibility,
access to natural resources, and the choice to completely depend on organic farming
(Uddin and Dhar 2020). Notwithstanding flooded rice, SRI standards have been
connected to rainfed rice and to different harvests, for example, wheat, finger millet,
sugarcane, beets, and teff, demonstrating expanded profitability over current old
cropping practices. At the point when SRI standards are connected to different
products, we allude to it as the system of crop intensification or SCI. The advantages
of SRI included up to a 90% decrease in seed requirement, 20–100% or more
expanded yield, and up to half water reserves. SRI standards and practices have
been developed for rainfed rice and also for different harvests, with yield increments
and related financial advantages (Duttarganvi et al. 2014).
3.2.6 Sprinkler Irrigation
The majority of cultivated rice across the globe is grown under flooded conditions,
through which a huge amount of water is lost via deep percolation, seepage, surface
runoff, and evapotranspiration (Vories et al. 2013; Materu et al. 2018). Among the
various techniques developed for water-saving irrigation, mechanized sprinkler
irrigation systems are gaining attention among farmers in several countries because
of easy management of irrigation combined with improved water-use efficiency and
enhanced productivity (Kahlown et al. 2007; Spanu et al. 2009; Vories et al. 2017;
Kar et al. 2018; Mandal et al. 2019; Pinto et al. 2020). In comparison to 1168 mm
in flooded rice, a total depth of 414 mm can be achieved by sprinkler irrigation with
a 20–50% decrease in water consumption (Vories et al. 2013; Pinto et al. 2016;
Kumar et al. 2018). Additionally, sprinkler irrigation enables farmers to adopt soil
conservation techniques such as no-till farming and crop rotation (Pinto et al. 2020).
156 B. Singh et al.
4 Molecular Breeding for Rice Improvement
To attain global food security, a promising approach is to cope with drought by

developing drought-tolerant cultivars (Xiao et al. 2009). However, drought tolerance
is a complex trait that involves changes at developmental, physiological, biochemical,
and molecular levels (Joshi and Karan 2014). These changes involve alterations in
photosynthesis, osmotic adjustment, guard cell regulation, root growth, and
synthesis of specific proteins and antioxidants. In addition, breeders can attempt to
improve yield through improved harvest indices, manipulating transpiration rate,
and decreasing non-beneficial depletions (Tuong 1999; Bennett 2003). In this
regard, considerable progress has been made and several QTLs (Quantitative Trait
Loci) for drought-related traits that lead to improved grain yield under water-
limiting conditions have been identified and transferred into suitable varieties
through marker-assisted breeding (MAB). However, most of the studies were
conducted on biparental or multiparental populations that use only allelic variations
present within the selected parents. In addition, there is limited exploration of
genetic resources in identifying novel QTLs regulating drought-related traits
(Kumar et al. 2014; Pascual et al. 2016).
4.1 QTL Mapping
QTL mapping is the genetic association between the genotypic constituents of a

population and the trait of interest. Therefore, to map a QTL, it is mandatory to
develop a mapping population, genotype it, and make a linkage map out of it.
Mapped QTLs need to be identified by their robustness and contribution toward the
trait of interest by estimating an LOD score and phenotypic variation (PV). PV of
more than 10% was considered as a major QTL and less than that considered as a
minor QTL. Much progress has already been made toward identifying drought-
related traits and associated genetic factors, that is, QTLs/genes that demarcate
tolerant rice cultivars. Subsequently, identified genetic factors have been transferred
into high-yielding drought-susceptible rice varieties. Using rice genetic resources,
different QTLs targeting major drought-related traits, including yield under water-
limiting conditions, deep rooting, osmotic- and dehydration-responsive traits, etc.,
have been identified and transferred. For drought tolerance, several QTLs have been
identified, although only a few have a significant effect on rice under water-limited
conditions (Table 1). One of the QTLs for deep rooting has been identified from
japonica cultivar Kinandang Pantong (KP) (Uga et al. 2013). Multiple QTLs related
to yield under water-limiting conditions have been identified in different indica
cultivars and wild progenitors of cultivated rice Oryza rufipogon. Bernier et al.
(2007) identified a QTL on chromosome 12 (Qtl12.1) that accounted for about 50%
of the genetic variation and functionally reported an increased water uptake of
plants under drought stress. QTL qDTY3.1 had been identified from a cross between
Table 1 Drought tolerance QTLs mapped and used for rice breeding programs
Identification
QTL/gene QTL/gene method Cultivar/varietal group References
DRO1 Deep rooting Fine mapping Kinandang Patong Uga et al.
(KP)/japonica (2011, 2013)
DRO2 Deep rooting Fine mapping KP/japonica Uga et al.
(2013)
DRO3 Deep rooting Fine mapping KP/japonica Uga et al.
(2015)
QTL2, 9, and 11 Controlling Mapping Azucena/japonica Steele et al.
root traits (2006, 2007,
2013)
qtl12.1 Plant water Mapping Way Rarem Bernier et al.
uptake (2009)
qDTY2.3 and Grain yield Mapping Vandana/cross between Dixit et al.
qDTY3.2 under drought indica and cross product of (2012)
japonica and indica
qDTY1.1 Grain yield Mapping N22/aus Vikram et al.
under drought (2011)
qDTY2.2, Grain yield Mapping Aday Sel Swamy et al.
qDTY4.1, under drought (2013)
qDTY9.1, and
qDTY10.1
qDTY1.1 Grain yield Mapping Dhagaddeshi Ghimire et al.
under drought (2012)
qDTY2.1 and Grain yield in Mapping Apo (IR55423-01)/indica Venuprasad
qDTY3.1 lowland et al. (2009)
drought stress
Multiple root Multiple root Yuefu/japonica Li et al.
traits traits (2005)
Rooting Moroberekan/japonica Champoux
et al. (1995)
QTL (osmotic QTL (osmotic Co39/indica Lilley et al.
adjustment) adjustment) (1996)
Multiple QTLs Multiple QTLs Aus 276/aus Sandhu et al.
(2014)
Multiple QTLs Multiple QTLs O. rufipogon/wild Zhou et al.
(2009)
Polygenes/ Polygenes/ O. rufipogon/wild Hu et al.
multiple genes multiple genes (2011)
qRL6.1 Root length Gowda et al.
(2011)
tolerant variety Apo and susceptible variety Swarna showing a large effect on
drought tolerance (Venuprasad et al. 2009). Different studies identified multiple
DTY QTLs from different donor rice cultivars such as Dhagaddeshi, Apo, N22,
Aday Sel, Way Rarem, etc., and incorporated them into rice breeding programs for
improving drought tolerance in rice (Sandhu and Kumar 2017).
158 B. Singh et al.
4.2 Marker-Assisted Selection
Marker-assisted selection (MAS) is a practice to substitute phenotypic screening by

using molecular markers linked to particular loci. MAS precisely isolates the desired
genotype at particular marker loci from a population without being a phenotype
(Qing et al. 2019). MAS could be applied in various ways for crop improvement
programs such as the marker-assisted evaluation of breeding material, early-
generation selection, marker-assisted backcross breeding, gene pyramiding, and
combined MAS (Collard and Mackill 2008). Kumar et al. (2018) used early-
generation selection by combining both phenotyping and genotyping for the
selection of drought-tolerant progenies and subsequently incorporated them into
their breeding programs.
4.3 Marker-Assisted Backcrossing
Marker-assisted backcrossing (MABC) is an efficient genetic method to transfer a

locus controlling a trait of interest from wild relatives, landraces, and known trait-
specific genes from a genetic material into desired cultivars, called recurrent parents,
without altering their essential characteristics (Dixit et al. 2017). The MABC
scheme includes foreground selection, recombinant selection, and background
selection. Integrating linkage map information with a QTL map helps span the
markers in the target locus. Foreground selection was performed with peak markers,
which assisted in the selection of a linked gene/QTL in the progenies while flanking
markers of the target locus were used for recombinant selection. Foreground
selection was performed in each filial generation. Recombinant selection was
performed to minimize linkage drag and decrease the size of the target locus
containing the gene of interest in an elite background (Collard and Mackill 2008).
Background selection must be performed at later stages of breeding programs to
minimize cost and labor. After that, the BC2F2 or BC3 generation should be selected
for background selection (Ab-Jalil et al. 2018). This method is used to validate the
function of QTLs from identified genotypes by transferring them into different
genetic backgrounds (Ha et al. 2016). MABC is employed for transferring QTLs for
different drought stress-related traits such as qDTYs for yield under drought
conditions (Kumar et al. 2014); DRO1, DRO2, and DRO3 for deep rooting (Uga
et al. 2011, 2013, 2015); qRL6.1 for root length (Gowda et al. 2011); and QTL12.1
for plant water uptake (Bernier et al. 2009).
4.4 Marker-Assisted Pyramiding
Several morphological and physiological characters have been reported that con-
tributed to drought tolerance and each of the traits can be controlled by a QTL
(Sandhu et al. 2019). Moreover, individual QTLs can contribute to yield under
drought stress. Several important traits controlling drought tolerance are root traits,
plant morphology, and yield under drought stress, and QTLs for these have been
mapped (Muthu et al. 2020). Pyramiding of QTLs/genes is a widely followed
approach in disease resistance breeding. However, polygenic traits governed by
more than one gene within the identified QTLs are complex to integrate. A significant
amount of work has to be done for pyramiding multiple QTLs. A suitable approach
for integrating multiple QTLs is equally important. Sometimes, integrated multiple
QTLs may not work as they work independently. Nevertheless, the approach of
gene/QTL integration depends on the number of QTLs to be integrated, the presence
of QTLs in the same genetic backgrounds or different ones, the distance between
the QTL and flanking marker, the filial stage, and the recovered recurrent parent
genome (Shamsudin et al. 2016). Less breeding time is required if the QTLs to be
integrated are present in the same genetic background in the advanced filial
generation that recovered a higher proportion of recurrent parent genome. Genetic
parameters such as interaction between alleles, within QTLs, and with the genetic
background; pleiotropic effect of genes; and linkage drag of the introgressed loci
need to be addressed (Kumar et al. 2018). For analyzing positive effects of alleles
and other genetic effects, a large number of progenies need to be phenotyped and
genotyped, which may correspondingly increase with the complexity of the trait
(Kumar et al. 2018). Still, some success stories are present for MAP for drought,
including DTY QTLs qDTY2.2 + qDTY4.1 (Swamy et al. 2013); qDTY12.1 + qDTY3.1
(Shamsudin et al. 2016); qDTY3.2 and qDTY12.1 (Dixit et al. 2017); qDTY2.2, qDTY3.1,
and qDTY12.1 (Shamsudin et al. 2016); and root QTLs for drought tolerance, qRT6−2,
qRT11−7, qRT6−2, and qRT19−1+7 (Selvi et al. 2015).
4.5 Marker-Assisted Recurrent Selection
Marker-assisted recurrent selection (MARS) is basically increasing the frequency

of beneficial alleles with additive and small individual effects (Bankole et al. 2017).
Selection cycles started with parental selection (called the C0 cycle) and after that
three to four rounds of recurrent selection. Parental selection can be carried out
through genomic selection by calculating the genomic estimated breeding value
(GEBV) across all the lines in the original populations (C0). The best linear unbiased
predictor helps in predicting GEBV. Lines with the highest GEBVs were planted
and intercrossed. Thereafter, subsequent recombinant selection cycles (C1 to C3)
were performed based on recombination of selected associated markers (Grenier
et al. 2015; Sevanthi et al. 2019). While performing MARS, there is an increase in
the frequency of favorable alleles and this minimizes genetic drift (Bankole et al.
2017). Important points to be considered while performing MARS are allelic
interaction, genotype by environment interactions, functions of alleles in different
genetic backgrounds, and cost and time duration of performing MARS. In rice,
MARS is employed for incorporating DTY QTLs (qDTY1.1, qDTY2.1, qDTY3.1, and
qDTY11.1) into a Samba Mahsuri background (Sandhu et al. 2018).
160 B. Singh et al.
4.6 Genomic Selection
Genomic selection (GS) is a next-generation breeding strategy that ensures speedy

breeding and selection of desired genotypes for cultivar improvement. GS is
completed in two phases: training phase and breeding phase (Nakaya and Isobe
2012). The training population is used to predict genomic values; therefore, it is
genotyped as well as phenotyped. Based on this information, a breeding model is
developed to calculate the GEBVs of individuals in the testing population, which is
only genotyped. Based on the GEBVs, progenies are selected, thus increasing the
proportion of high-performing progenies in a population and increasing the breeding
gain (Shikha et al. 2017). GS has a greater relevance in cases of drought as its
phenotyping demands extensive field screening, cost, and labor (Cabrera-Bosquet
et al. 2012). While performing GS, genetic heterozygosity, and genotype × genotype
and genotype × environment interaction may affect the genomic prediction. There
is also a need for a model-based prediction of GE and GG interactions. For complex
traits such as drought, reaction norm model GEBV has greater accuracy than
conventional models (Mulder 2016). Similarly, molecular marker-based predictions
of crop traits are more accurate than pedigree-based predictions (Crossa 2012).
5 Transgenic Strategies
Transgenic studies have opened the door to the development of useful varieties that
are superior in various traits. Because of a complex trait, different gene families are
supposed to be upregulated or downregulated during drought stress. These genes
belong to transcription factors, kinases, late embryogenesis abundant (LEA)
proteins, osmoprotectants, and phytohormone families, and their transfer in different
genotypes showed improved drought tolerance (Joshi et al. 2016). NAC family
genes are responsive under drought stress (Nakashima et al. 2012) and overexpression
of OsNAC9 showed drought tolerance in transgenic plants in field trials (Redillas
et al. 2012). Other transcription factors such as AbEDT1 (Yu et al. 2016), SNAC1,
SNAC2, and OsNCED3 were upregulated in transgenic rice plants in response to
drought stress.
Kinases represent a diversely fractioning gene family and enhanced drought tol-
erance was reported in transgenic plants overexpressing calcium-dependent protein
kinase, including OsCPK4 (Campo et al. 2014), OsCDPK7 (Saijo et al. 2000), and
DcaCIPK9, -14, and -16 (Wan et al. 2019). Overexpression of OsCIPK12 showed
tolerance by increasing the accumulation of osmolytes such as proline and soluble
sugars. Receptor-like kinase (RLK) OsSIK1 aided in drought tolerance in transgenic
rice plants by an increased accumulation of peroxidase, catalase, and superoxide
dismutase and decreased stomatal density and decreased accumulation of H2O2
(Ouyang et al. 2010). Another enzyme of the RLK family, SIK2, also showed
drought tolerance in transgenic rice plants (Chen et al. 2013).
LEA proteins are stress inducible and play a significant role in protection under
stress conditions (Minh et al. 2019). Reports show enhanced tolerance of drought in
transgenic plants overexpressing OsLEA3-1 or OsLEA3-2 (Xiao et al. 2007; Duan
and Cai 2012). SNAC2 protein binds to the OsOAT promoter expressing ornithine
δ-aminotransferase (You et al. 2012) and overexpression of the OsOAT gene
enhanced the activity of δ-OAT in transgenic rice. This increased glutathione,
proline, and ROS-scavenging enzyme activity, resulting in drought tolerance.
Similarly, overexpression of the trehalose-6-phosphate synthase (OsTPS1) gene
expressing an enzyme in trehalose biosynthesis showed improved drought tolerance
in transgenic rice (Li et al. 2011). Using a fusion gene from Escherichia coli coding
for trehalose-6-phosphate synthase/phosphatase under the control of an ABA-
inducible promoter, we generated marker-free, high-yielding transgenic rice (in an
IR64 background) that can tolerate high pH (~9.9), high EC (~10.0 dS/m), and
severe drought (30–35% soil moisture content) (Joshi et al. 2020). Enhanced
tolerance was observed in transgenic rice overexpressing the OsPYL/RCA5 gene.
Expression of stress-responsive genes was increased, resulting in enhanced drought
tolerance (Kim et al. 2010). The isopentyltransferase gene (IPT), involved in
cytokinin synthesis, under control of a SAPK promoter, exhibited changes in the
expression of genes involved in hormone homeostasis and resource mobilization,
delay in stress response, and enhanced drought tolerance (Peleg et al. 2011). Further,
in the expression analysis of OsM4 and OsMB11 genes, we found these genes to be
highly expressed under drought and salinity stress conditions (Kushwaha et al.
2016). We also reported that transgenic rice constitutively overexpressing SaADF2
showed higher growth, relative water content, photosynthesis, and yield under
drought conditions than the wild type under drought stress conditions (Sengupta
et al. 2019).
6 Future Prospects
The current challenge is a sustainable increase in rice production corresponding to

demand. The development of high-yielding varieties resistant to diseases and insects
and tolerant of major abiotic stresses is essential for producing enough rice under
irrigated habitats. However, production is limited in upland and rainfed areas and
also under limited water availability. It was demonstrated earlier that farmers in
drought-prone areas accept the decrease in yield variability offered by new stress-
tolerant cultivars, and would be willing to pay a significant premium for these traits
(Arora et al. 2019). Therefore, it is important to work concurrently on both aspects:
the development of technology related to crop management and improvement of
rice varieties for yield under adverse conditions. Climate changes further compli-
cate the conditions for rice cultivation in these areas. This leads to intermittent rain-
fall, enhanced flash flooding, and sporadic drought, which adversely affect cultivated
soil. Secondary adverse effects on crop production due to climatic fluctuation are
changes in soil stature, enhanced soil salinity, and loss of genetic diversity. Therefore,
162 B. Singh et al.
to mitigate these effects, researchers seek to exploit existing genetic resources. In

the context of rice, ample germplasm accessions belong to different species and
have been conserved ex situ and more efforts are in progress. Improvement strate-
gies such as marker-assisted selection, marker-assisted backcrossing, marker-
assisted pyramiding, marker-assisted recurrent selection, and genomic selection
rely on QTL mapping, which itself relies on pre-breeding experiments. Pre-breeding
strategies for the selection of cultivars to incorporate into breeding cycles are major
components for succeeding in breeding programs. Further, transgenic approaches
have been applied for functional validation of genes, improving quality traits, and
developing resistant and tolerant cultivars. Thus, the development of rice cultivars
with improved water-use efficiency will offer significant economic and environ-
mental benefits toward the achievement of the Sustainable Development Goals.
Acknowledgments We gratefully acknowledge the director, CSIR-Institute of Himalayan

Bioresource Technology, Palampur, for providing the facilities to carry out this work. CSIR support
in the form of project MLP0201 for this study is highly acknowledged. This manuscript represents
CSIR-IHBT communication no. 4592.
References
Ab-Jalil M, Juraimi AS, Yusop MR, Uddin MK, Hakim MA (2018) Introgression of root trait
genes for drought tolerance to a Malaysian rice variety by marker-assisted backcross breeding.
Int J Agric Biol 20(1):119–126
Arora A, Bansal S, Ward PS (2019) Do farmers value rice varieties tolerant to droughts and floods?
Evidence from a discrete choice experiment in Odisha, India. Water Resour Econ 25:27–41
Ashraf M, Akram NA, Al-Qurainy F, Foolad MR (2011) Drought tolerance: roles of organic osmo-
lytes, growth regulators, and mineral nutrients. Adv Agron 111:249–296
Atlin GN, Lafitte HR, Tao D, Laza M, Amante M, Courtois B (2006) Developing rice cultivars for
high-fertility upland systems in the Asian tropics. Field Crops Res 97(1):43–52
Bankole F, Menkir A, Olaoye G, Crossa J, Hearne S, Unachukwu N, Gedil M (2017) Genetic gains
in yield and yield related traits under drought stress and favorable environments in a maize
population improved using marker assisted recurrent selection. Front Plant Sci 8:808
Barbieri P, Echarte L, Della Maggiora A, Sadras VO, Echeverria H, Andrade FH (2012) Maize
evapotranspiration and water-use efficiency in response to row spacing. Agron J 104(4):939–944
Basu S, Jongerden J, Ruivenkamp G (2017) Development of the drought tolerant variety
Sahbhagi Dhan: exploring the concepts commons and community building. Int J Commons
11(1):144–170
Bennett J (2003) Status of breeding for tolerance of water deficit and prospects for using molecular
techniques. In: Water productivity in agriculture: limits and opportunities for improvement.
CABI Publishing, Wallingford
Bernier J, Kumar A, Venuprasad R, Spaner D, Atlin GN (2007) A large-effect QTL for grain yield
under reproductive-stage drought stress in upland rice. Crop Sci 47:507–516
Bernier J, Kumar A, Venuprasad R, Spaner D, Verlukar S, Mandal NP, Sinha PK, Peeraju P, Dongre
PR, Mahto RN, Atlin GN (2009) Characterization of the effect of rice drought resistance qtl12.1
over a range of environments in the Philippines and eastern India. Euphytica 166:207–217
Bodner G, Nakhforoosh A, Kaul HP (2015) Management of crop water under drought: a review.
Agron Sustain Dev 35(2):401–442
Borrell A, Garside A, Fukai S (1997) Improving efficiency of water use for irrigated rice in a semi-
arid tropical environment. Field Crops Res 52(3):231–248
Bouman BAM, Tuong TP (2001) Field water management to save water and increase its productiv-
ity in irrigated lowland rice. Agric Water Manag 49:11–30
Bouman BA, Yang X, Wang H, Wang Z, Zhao J, Chen B (2006) Performance of aerobic rice variet-
ies under irrigated conditions in North China. Field Crops Res 97(1):53–65
Bouman BAM, Lampayan RM, Tuong TP (2007) Water management in irrigated rice: coping with
water scarcity. International Rice Research Institute, Los Baños
Boyer JS (1982) Plant productivity and environment. Science 218:443–448
Boyer SJ (1996) Advances in drought tolerance in plants. Adv Agron 56:187–218
Buah SS, Mwinkaara S (2009) Response of sorghum to nitrogen fertilizer and plant density in the
Guinea Savanna Zone. J Agron 8(4):124–130
Cabangon RJ, Tuong TP (2000) Management of cracked soils for water saving during land prepa-
ration for rice cultivation. Soil Tillage Res 56(1–2):105–116
Cabrera-Bosquet L, Crossa J, von Zitzewitz J, Serret MD, Luis Araus J (2012) High-throughput
phenotyping and genomic selection: the frontiers of crop breeding converge. J Integr Plant Biol
54(5):312–320
Caine RS, Yin X, Sloan J, Harrison EL, Mohammed U, Fulton T, Biswal AK, Dionora J, Chater CC,
Coe RA, Bandyopadhyay A (2019) Rice with reduced stomatal density conserves water and
has improved drought tolerance under future climate conditions. New Phytol 221(1):371–384
Campo S, Baldrich P, Messeguer J, Lalanne E, Coca M, San Segundo B (2014) Overexpression
of a calcium-dependent protein kinase confers salt and drought tolerance in rice by preventing
membrane lipid peroxidation. Plant Physiol 165(2):688–704
Carracelas G, Hornbuckle J, Rosas J, Roel A (2019) Irrigation management strategies to increase
water productivity in Oryza sativa (rice) in Uruguay. Agric Water Manag 222:161–172
Carrijo DR, Akbar N, Reis AF, Li C, Gaudin AC, Parikh SJ, Green PG, Linquist BA (2018) Impacts
of variable soil drying in alternate wetting and drying rice systems on yields, grain arsenic con-
centration and soil moisture dynamics. Field Crops Res 222:101–110
Champoux MC, Wang G, Sarkarung S, Mackill DJ, O’Toole JC, Huang N, McCouch SR (1995)
Locating genes associated with root morphology and drought avoidance in rice via linkage to
molecular markers. Theor Appl Genet 90(7–8):969–981
Chen C, Neill K, Wichman D, Westcott M (2008) Hard red spring wheat response to row spacing,
seeding rate, and nitrogen. Agron J 100(5):1296–1302
Chen LJ, Wuriyanghan H, Zhang YQ, Duan KX, Chen HW, Li QT, Lu X, He SJ, Ma B, Zhang WK,
Lin Q (2013) An S-domain receptor-like kinase, OsSIK2, confers abiotic stress tolerance and
delays dark-induced leaf senescence in rice. Plant Physiol 163(4):1752–1765
Collard BC, Mackill DJ (2008) Marker-assisted selection: an approach for precision plant breeding
in the twenty-first century. Philos Trans R Soc Lond B Biol Sci 363(1491):557–572
Crossa J (2012) From genotype x environment interaction to gene x environment interaction. Curr
Genomics 13(3):225–244
Dhakal S, Adhikari BB, Kandel BP (2020) Performance of drought tolerant rice varieties in differ-
ent altitudes at Duradada, Lamjung, Nepal. J Agric Nat Resour 3(1):290–300
Ding Y, Wang W, Song R, Shao Q, Jiao X, Xing W (2017) Modeling spatial and temporal
variability of the impact of climate change on rice irrigation water requirements in the
middle and lower reaches of the Yangtze River, China. Agric Water Manag 193:89–101
Ding Y, Wang W, Zhuang Q, Luo Y (2020) Adaptation of paddy rice in China to climate change:
the effects of shifting sowing date on yield and irrigation water requirement. Agric Water
Manag 228:105890
Dittert K, Shan L, Kreye C, Zheng XH, Xu YC, Lu XJ, Shen QR, Fan XL, Sattelmacher B (2002)
Saving water with ground cover rice production systems (GCRPS) at the price of increased
greenhouse gas emissions. In: Water-wise rice production. International Rice Research
Institute, Los Baños, pp 197–206
164 B. Singh et al.
Dixit S, Swamy BM, Vikram P, Ahmed HU, Cruz MS, Amante M, Atri D, Leung H, Kumar A
(2012) Fine mapping of QTLs for rice grain yield under drought reveals sub-QTLs conferring
a response to variable drought severities. Theor Appl Genet 125(1):155–169
Dixit S, Singh A, Sandhu N, Bhandari A, Vikram P, Kumar A (2017) Combining drought and
submergence tolerance in rice: marker-assisted breeding and QTL combination effects. Mol
Breed 37(12):143
Duan J, Cai W (2012) OsLEA3-2, an abiotic stress induced gene of rice plays a key role in salt and
drought tolerance. PLoS One 7(9):e45117
Duttarganvi S, Tirupataiah K, Yella RK, Sandhyrani K, Mahendra KR, Malamasuri K (2014) Yield
and water productivity of rice under different cultivation practices and irrigation regimes. In:
International symposium on integrated water resources management (IWRM–2014), February
2014, Kerala, India, pp 19–21
Ehlers W, Goss M (2016) Water dynamics in plant productions, 2nd edn. CABI Publishing,
Wallingford, 396
FAO (2018) FAOSTAT database collections. Food and Agriculture Organization of the United
Nations. Food outlook biannual report on global food markets. Rome. www.fao.org/faostat.
Accessed 2018
Farooq M, Wahid A, Lee DJ, Ito O, Siddique KHM (2009) Advances in drought resistance of rice.
Crit Rev Plant Sci 28:199–217
Fukai S, Pantuwan G, Jongdee B, Cooper M (1999) Screening for drought resistance in rainfed
lowland rice. Field Crops Res 64(1–2):61–74
Gala Bijl C, Fisher M (2011) Crop adaptation to climate change. CSA News Magazine 5–9
Ghimire KH, Quiatchon LA, Vikram P, Swamy BM, Dixit S, Ahmed H, Hernandez JE, Borromeo
TH, Kumar A (2012) Identification and mapping of a QTL (qDTY1.1) with a consistent effect
on grain yield under drought. Field Crops Res 131:88–96
Gouache D, Le Bris X, Bogard M, Deudon O, Pagé C, Gate P (2012) Evaluating agronomic
adaptation options to increasing heat stress under climate change during wheat grain filling in
France. Eur J Agron 39:62–70
Gowda VR, Henry A, Yamauchi A, Shashidhar HE, Serraj R (2011) Root biology and genetic
improvement for drought avoidance in rice. Field Crops Res 122(1):1–13
Grenier C, Cao TV, Ospina Y, Quintero C, Châtel MH, Tohme J, Courtois B, Ahmadi N (2015)
Accuracy of genomic selection in a rice synthetic population developed for recurrent selection
breeding. PLoS One 10(8):e0136594
Ha T, Khang DT, Tuyen PT, Toan TB, Huong NN, Lang NT, Buu BC, Xuan TD (2016) Development
of new drought tolerant breeding lines for Vietnam using marker-assisted backcrossing. Int Lett
Nat Sci 59:1–13
He G, Wang Z, Cui Z (2020) Managing irrigation water for sustainable rice production in China.
J Clean Prod 245:118928. http://www.knowledgebank.irri.org/submergedsoils/index.php/
rice-growing-environments/lesson-2
Hu BL, Fu XQ, Zhang T, Yong WA, Xia LI, Huang YH, Dai LF, Luo XD, Xie JK (2011) Genetic
analysis on characteristics to measure drought resistance using Dongxiang wild rice (Oryza
rufipogon Griff.) and its derived backcross inbred lines population at seedling stage. Agric Sci
China 10(11):1653–1664
IPCC (2001) Impacts, adaptation and vulnerability. In: Contribution of the working group II to
the third assessment report on the intergovernmental panel on climate change. Cambridge
IPCC (2007) Climate change 2007: the physical science basis. In: Solomon S, Qin D, Manning M,
Chen Z, Marquis M, Averyt KB, Tignor M, Miller HL (eds) Contribution of working group I
to the fourth assessment report of the intergovernmental panel on climate change. Cambridge
IRRI (2014) Standard evaluation system for rice, 5th edn. International Rice Research Institute,
Los Baños
Jagadish SV, Murty MV, Quick WP (2015) Rice responses to rising temperatures–challenges, per-
spectives and future directions. Plant Cell Environ 38(9):1686–1698
Joshi R, Chinnusamy V (2014) Antioxidant enzymes: defense against high temperature stress. In:
Oxidative damage to plants. Academic Press, New York, pp 369–396
Joshi R, Karan R (2014) Physiological, biochemical and molecular mechanisms of drought toler-
ance in plants. In: Gaur RK, Sharma P (eds) Molecular approaches in plant abiotic stress. CRC
Press, Boca Raton, pp 209–231
Joshi R, Kumar P (2012) Aerobic rice: an option for growing rice under limited water availability.
Indian Farming 62(2):11–14
Joshi R, Mani SC, Shukla A, Pant RC (2009) Aerobic rice: water use sustainability. Oryza 46(1):1–5
Joshi R, Ramanarao VM, Lee S, Kato N, Baisakh N (2014) Ectopic expression of ADP Ribosylation
Factor1 (SaARF1) from smooth cordgrass (Spartina alterniflora) confers drought and salt tol-
erance in transgenic rice and Arabidopsis. Plant Cell Tissue Organ Cult 117:17–30
Joshi R, Wani SH, Singh B, Bohra A, Dar ZA, Lone AA, Pareek A, Singla-Pareek SL (2016)
Transcription factors and plants response to drought stress: current understanding and future
directions. Front Plant Sci 7:1029
Joshi R, Singh B, Shukla A (2018) Evaluation of elite rice genotypes for physiological and yield
attributes under aerobic and irrigated conditions in tarai areas of western Himalayan region.
Curr Plant Biol 13:45–52
Joshi R, Sahoo KK, Singh AK, Anwar K, Pundir P, Gautam RK, Krishnamurthy SL, Sopory SK,
Pareek A, Singla-Pareek SL (2020) Enhancing trehalose biosynthesis improves yield poten-
tial in marker-free transgenic rice under drought, saline, and sodic conditions. J Exp Bot
71(2):653–668
Kahlown MA, Raoof A, Zubair M, Kemper WD (2007) Water use efficiency and economic feasi-
bility of growing rice and wheat with sprinkler irrigation in the Indus Basin of Pakistan. Agric
Water Manag 87(3):292–298
Kar I, Mishra A, Behera B, Khanda C, Kumar V, Kumar A (2018) Productivity trade-off with
different water regimes and genotypes of rice under non-puddled conditions in Eastern India.
Field Crops Res 222:218–229
Kim TH, Böhmer M, Hu H, Nishimura N, Schroeder JI (2010) Guard cell signal transduction
network: advances in understanding abscisic acid, CO2, and Ca2+ signaling. Annu Rev Plant
Biol 61:561–591
Kima AS, Chung WG, Wang YM (2014) Improving irrigated lowland rice water use efficiency
under saturated soil culture for adoption in tropical climate conditions. Water 6(9):2830–2846
Korres NE, Norsworthy JK, Tehranchian P, Gitsopoulos TK, Loka DA, Oosterhuis DM, Gealy DR,
Moss SR, Burgos NR, Miller MR, Palhano M (2016) Cultivars to face climate change effects
on crops and weeds: a review. Agron Sustain Dev 36(1):12
Krishnan P, Ramakrishnan B, Reddy KR, Reddy VR (2011) High-temperature effects on rice
growth, yield, and grain quality. Adv Agron 111:87–206
Kumar A, Dixit S, Ram T, Yadaw RB, Mishra KK, Mandal NP (2014) Breeding high-yielding
drought-tolerant rice: genetic variations and conventional and molecular approaches. J Exp
Bot 65(21):6265–6278
Kumar GS, Ramesh T, Subrahmaniyan K, Ravi V (2018) Effect of sprinkler irrigation levels on
the performance of rice genotypes under aerobic condition. Int J Curr Microbiol Appl Sci
3:1848–1852
Kushwaha HR, Joshi R, Pareek A, Singla-Pareek SL (2016) MATH-domain family shows response
toward abiotic stress in Arabidopsis and rice. Front Plant Sci 7:923
Levitt E (1980) Chapter 4. Drought avoidance. In: Levitt E (ed) Responses of plants to environ-
mental stresses, vol. 2 edn. Academic Press, New York, pp 93–103
Li Z, Mu P, Li C, Zhang H, Li Z, Gao Y, Wang X (2005) QTL mapping of root traits in a doubled
haploid population from a cross between upland and lowland japonica rice in three environ-
ments. Theor Appl Genet 110(7):1244–1252
166 B. Singh et al.
Li HW, Zang BS, Deng XW, Wang XP (2011) Overexpression of the trehalose-6-phosphate syn-
thase gene OsTPS1 enhances abiotic stress tolerance in rice. Planta 234(5):1007–1018
Lilley JM, Ludlow MM, McCouch SR, O’Toole JC (1996) Locating QTL for osmotic adjustment
and dehydration tolerance in rice. J Exp Bot 47(9):1427–1436
Lin BS, Lei H, Hu MC, Visessri S, Hsieh CI (2020) Canopy resistance and estimation of evapo-
transpiration above a humid cypress forest. Adv Meteorol 2020:4232138
Lone AA, Jumaa SH, Wijewardana C, Taduri S, Redoña ED, Reddy KR (2019) Drought stress
tolerance screening of elite American breeding rice genotypes using low-cost pre-fabricated
mini-hoop modules. Agronomy 9(4):199
Mandal KG, Thakur AK, Ambast SK (2019) Current rice farming, water resources and micro-
irrigation. Curr Sci 4:568–576
Maneepitak S, Ullah H, Paothong K, Kachenchart B, Datta A, Shrestha RP (2019) Effect of water
and rice straw management practices on yield and water productivity of irrigated lowland rice
in the Central Plain of Thailand. Agric Water Manag 211:89–97
Materu ST, Shukla S, Sishodia RP, Tarimo A, Tumbo SD (2018) Water use and rice productivity
for irrigation management alternatives in Tanzania. Water 10(8):1018
McKenzie RH, Middleton AB, Bremer E (2005) Fertilization, seeding date, and seeding rate for
malting barley yield and quality in southern Alberta. Can J Plant Sci 85(3):603–614
Minh BM, Linh NT, Hanh HH, Hien LT, Thang NX, Hai NV, Hue HT (2019) A LEA gene from
a Vietnamese maize landrace can enhance the drought tolerance of transgenic maize and
tobacco. Agronomy 9(2):62
Mishra S, Singh B, Panda K, Singh BP, Singh N, Misra P, Rai V, Singh NK (2016a) Association
of SNP haplotypes of HKT family genes with salt tolerance in Indian wild rice germplasm.
Rice 9(1):1–3
Mishra S, Singh B, Misra P, Rai V, Singh NK (2016b) Haplotype distribution and associa-
tion of candidate genes with salt tolerance in Indian wild rice germplasm. Plant Cell Rep
35(11):2295–2308
Mitin A (2009) Documentation of selected adaptation strategies to climate change in rice cultiva-
tion. East Asia Rice Working Group, Quezon City, Philippines
Mukamuhirwa A, Persson Hovmalm H, Bolinsson H, Ortiz R, Nyamangyoku O, Johansson E
(2019) Concurrent drought and temperature stress in rice—a possible result of the predicted
climate change: effects on yield attributes, eating characteristics, and health promoting com-
pounds. Int J Environ Res Public Health 16(6):1043
Mulder HA (2016) Genomic selection improves response to selection in resilience by exploiting
genotype by environment interactions. Front Genet 7:178
Muthu V, Abbai R, Nallathambi J, Rahman H, Ramasamy S, Kambale R, Thulasinathan T, Ayyenar
B, Muthurajan R (2020) Pyramiding QTLs controlling tolerance against drought, salinity, and
submergence in rice through marker assisted breeding. PLoS One 15(1):e0227421
Nakashima K, Takasaki H, Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K (2012) NAC transcrip-
tion factors in plant abiotic stress responses. Biochim Biophys Acta 1819(2):97–103
Nakaya A, Isobe SN (2012) Will genomic selection be a practical method for plant breeding? Ann
Bot 110(6):1303–1316
Nguyen NV (2005) Global climate changes and rice food security. FAO, Rome, pp 24–30
Nie L, Peng S, Bouman BAM, Huang J, Cui K, Visperas RM, Park HK (2007) Alleviation of soil
sickness caused by aerobic monocropping: growth response of aerobic rice to soil oven heat-
ing. Plant Soil 300:185–195
Nirmala B, Babu VR, Neeraja CN, Waris A, Muthuraman P, Rao DS (2016) Linking agriculture
and nutrition: an ex-ante analysis of zinc biofortification of rice in India. Agric Econ Res Rev
29:171–177
Ouyang SQ, Liu YF, Liu P, Lei G, He SJ, Ma B, Zhang WK, Zhang JS, Chen SY (2010) Receptor-
like kinase OsSIK1 improves drought and salt stress tolerance in rice (Oryza sativa) plants.
Plant J 62(2):316–329
Pascual VJ, Wang YM (2017) Utilizing rainfall and alternate wetting and drying irrigation for
high water productivity in irrigated lowland paddy rice in southern Taiwan. Plant Prod Sci
20(1):24–35
Pascual L, Albert E, Sauvage C, Duangjit J, Bitton BF, Desplat N, Brunel D, Le Paslier M, Ranc N,
Bruguier L, Chauchard B, Verschave P, Causse M (2016) Dissecting quantitative trait variation
in the resequencing era: complementarity of bi-parental, multi-parental and association panels.
Plant Sci 242:120–130
Peleg Z, Reguera M, Tumimbang E, Walia H, Blumwald E (2011) Cytokinin-mediated source/sink
modifications improve drought tolerance and increase grain yield in rice under water-stress.
Plant Biotechnol J 9(7):747–758
Pinto MA, Parfitt JM, Timm LC, Faria LC, Scivittaro WB (2016) Produtividade de arroz irrigado
por aspersão em terras baixas em função da disponibilidade de água e de atributos do solo. Pesq
Agropecu Bras 51(9):1584–1593
Pinto MA, Parfitt JM, Timm LC, Faria LC, Concenço G, Stumpf L, Nörenberg BG (2020) Sprinkler
irrigation in lowland rice: crop yield and its components as a function of water availability in
different phenological phases. Field Crops Res 248:107714
Qing D, Dai G, Zhou W, Huang S, Liang H, Gao L, Gao J, Huang J, Zhou M, Chen R, Chen W
(2019) Development of molecular marker and introgression of Bph3 into elite rice cultivars by
marker-assisted selection. Breed Sci 69(1):40–46
Redillas MC, Jeong JS, Kim YS, Jung H, Bang SW, Choi YD, Ha SH, Reuzeau C, Kim JK (2012)
The overexpression of OsNAC9 alters the root architecture of rice plants enhancing drought
resistance and grain yield under field conditions. Plant Biotechnol J 10(7):792–805
Rees DJ, Khodabaks MR (1994) The effects of seed source and crop density on rice grown on red
rice-infected land in Nickerie, Suriname
Rodenburg J, Meinke H, Johnson DE (2011) Challenges for weed management in African rice
systems in a changing climate. J Agric Sci 149(4):427–435
Saijo Y, Hata S, Kyozuka J, Shimamoto K, Izui K (2000) Over-expression of a single Ca2+-
dependent protein kinase confers both cold and salt/drought tolerance on rice plants. Plant J
23(3):319–327
Sandhu N, Kumar A (2017) Bridging the rice yield gaps under drought: QTLs, genes, and their use
in breeding programs. Agronomy 7(2):27
Sandhu N, Singh A, Dixit S, Cruz MT, Maturan PC, Jain RK, Kumar A (2014) Identification and
mapping of stable QTL with main and epistasis effect on rice grain yield under upland drought
stress. BMC Genet 15(1):63
Sandhu N, Dixit S, Swamy BM, Vikram P, Venkateshwarlu C, Catolos M, Kumar A (2018) Positive
interactions of major-effect QTLs with genetic background that enhances rice yield under
drought. Sci Rep 8(1):1626
Sandhu N, Dixit S, Swamy BP, Raman A, Kumar S, Singh SP, Yadaw RB, Singh ON, Reddy JN,
Anandan A, Yadav S (2019) Marker assisted breeding to develop multiple stress tolerant variet-
ies for flood and drought prone areas. Rice 12(1):8
Schroeder JI, Delhaize E, Frommer WB, Guerinot ML, Harrison MJ, Herrera-Estrella L, Horie
T, Kochian LV, Munns R, Nishizawa NK, Tsay YF (2013) Using membrane transporters to
improve crops for sustainable food production. Nature 497(7447):60–66
Selvi GS, Hittalmani S, Uday G (2015) Root QTL pyramiding through marker assisted selection
for enhanced grain yield under low moisture stress in rice (Oryza sativa L). Rice Res Open
Access 3:157
Sengupta S, Mangu V, Sanchez L, Bedre R, Joshi R, Rajasekaran K, Baisakh N (2019) An actin-
depolymerizing factor from the halophyte smooth cordgrass, Spartina alterniflora (Sa ADF
2), is superior to its rice homolog (OsADF 2) in conferring drought and salt tolerance when
constitutively overexpressed in rice. Plant Biotechnol J 17(1):188–205
Sevanthi AM, Prakash C, Shanmugavadivel PS (2019) Recent progress in rice varietal develop-
ment for abiotic stress tolerance. In: Advances in rice research for abiotic stress tolerance.
Woodhead Publishing, Sawston, pp 47–68
168 B. Singh et al.
Shamsudin NA, Swamy BM, Ratnam W, Cruz MT, Raman A, Kumar A (2016) Marker assisted
pyramiding of drought yield QTLs into a popular Malaysian rice cultivar, MR219. BMC Genet
17(1):30
Shikha M, Kanika A, Rao AR, Mallikarjuna MG, Gupta HS, Nepolean T (2017) Genomic selec-
tion for drought tolerance using genome-wide SNPs in maize. Front Plant Sci 8:550
Singh AK, Choudhury BU, Bouman BAM (2002) Effects of rice establishment methods on
crop performance, water use, and mineral nitrogen. In: Bouman BAM, Hengsdijk H, Hardy
B, Bindraban PS, Tuong TP, Ladha JK (eds) Water-wise rice production. International Rice
Research Institute, Los Baños, pp 237–246
Singh BP, Jayaswal PK, Singh B, Singh PK, Kumar V, Mishra S, Singh N, Panda K, Singh NK
(2015a) Natural allelic diversity in OsDREB1F gene in the Indian wild rice germplasm led to
ascertain its association with drought tolerance. Plant Cell Rep 34:993–1004
Singh N, Jayaswal PK, Panda K, Mandal P, Kumar V, Singh B, Mishra S, Singh Y, Singh R, Rai
V, Gupta A, Singh NK (2015b) Single-copy gene based 50 K SNP chip for genetic studies and
molecular breeding in rice. Sci Rep 5:11600
Singh B, Bohra A, Mishra S, Joshi R, Pandey S (2015c) Embracing new-generation ‘omics’ tools
to improve drought tolerance in cereal and food-legume crops. Biol Plant 59(3):413–428
Singh B, Reddy KR, Redoña ED, Walker T (2017) Screening of rice cultivars for morpho-
physiological responses to early-season soil moisture stress. Rice Sci 24(6):322–335
Spanu A, Murtas A, Ballone F (2009) Water use and crop coefficients in sprinkler irrigated rice.
Ital J Agron 4(2):47–58
Sriphirom P, Chidthaisong A, Towprayoon S (2019) Effect of alternate wetting and drying water
management on rice cultivation with low emissions and low water used during wet and dry
season. J Clean Prod 223:980–988
SRI-Rice (2010) SRI International Network and Resources Center, College of Agriculture and Life
Sciences. Cornell University, New York
Steele KA, Price AH, Shashidhar HE, Witcombe JR (2006) Marker-assisted selection to intro-
gress rice QTLs controlling root traits into an Indian upland rice variety. Theor Appl Genet
112(2):208–221
Steele KA, Virk DS, Kumar R, Prasad SC, Witcombe JR (2007) Field evaluation of upland rice
lines selected for QTLs controlling root traits. Field Crops Res 101(2):180–186
Steele KA, Price AH, Witcombe JR, Shrestha R, Singh BN, Gibbons JM, Virk DS (2013) QTLs
associated with root traits increase yield in upland rice when transferred through marker-
assisted selection. Theor Appl Genet 126(1):101–108
Swamy MBP, Ahmed HU, Henry A, Mauleon R, Dixit S, Vikram P, Tilatto R, Verulkar SB, Perraju
P, Mandal NP, Variar M (2013) Genetic, physiological, and gene expression analyses reveal that
multiple QTL enhance yield of rice mega-variety IR64 under drought. PLoS One 8(5):e62795
Tabbal DF, Bouman BA, Bhuiyan SI, Sibayan EB, Sattar MA (2002) On-farm strategies for
reducing water input in irrigated rice; case studies in the Philippines. Agric Water Manag
56(2):93–112
Tuong TP (1999) Productive water use in rice production: opportunities and limitations. J Crop
Prod 2:241–264
Tuong TP, Bouman BAM, Mortimer M (2005) More rice, less water. Plant Prod Sci 8(3):231–241
Turner NC (2003) Drought resistance: a comparison of two research frameworks. In: Saxena NP
(ed) Management of agricultural drought: agronomic and genetic options. Science Publishers
Inc., Enfield, pp 89–102
Uddin MT, Dhar AR (2020) Assessing the impact of water-saving technologies on boro rice farm-
ing in Bangladesh: economic and environmental perspective. Irrig Sci 14:1–4
Uga Y, Okuno K, Yano M (2011) Dro1, a major QTL involved in deep rooting of rice under upland
field conditions. J Exp Bot 62(8):2485–2494
Uga Y, Sugimoto K, Ogawa S, Rane J, Ishitani M, Hara N, Kitomi Y, Inukai Y, Ono K, Kanno N,
Inoue H (2013) Control of root system architecture by DEEPER ROOTING 1 increases rice
yield under drought conditions. Nat Genet 45(9):1097
Uga Y, Kitomi Y, Yamamoto E, Kanno N, Kawai S, Mizubayashi T, Fukuoka S (2015) A QTL

for root growth angle on rice chromosome 7 is involved in the genetic pathway of DEEPER
ROOTING 1. Rice 8(1):1–8
Uphoff N (2004) System of rice intensification responds to 21st century needs. Rice Today
42:42–43
Urban J, Ingwers MW, McGuire MA, Teskey RO (2017) Increase in leaf temperature opens sto-
mata and decouples net photosynthesis from stomatal conductance in Pinus taeda and Populus
deltoides x nigra. J Exp Bot 68(7):1757–1767
Venuprasad R, Dalid CO, Del Valle M, Zhao D, Espiritu M, Cruz MS, Amante M, Kumar A, Atlin
GN (2009) Identification and characterization of large-effect quantitative trait loci for grain
yield under lowland drought stress in rice using bulk-segregant analysis. Theor Appl Genet
120(1):177–190
Vikram P, Swamy BM, Dixit S, Ahmed HU, Cruz MT, Singh AK, Kumar A (2011) qDTY1.1, a
major QTL for rice grain yield under reproductive-stage drought stress with a consistent effect
in multiple elite genetic backgrounds. BMC Genet 12(1):89
Vories ED, Stevens WE, Tacker PL, Griffin TW, Counce PA (2013) Rice production with center
pivot irrigation. Appl Eng Agric 29(1):51–60
Vories E, Rhine M, Straatmann Z (2017) Investigating irrigation scheduling for rice using variable
rate irrigation. Agric Water Manag 179:314–323
Wan X, Zou LH, Zheng BQ, Wang Y (2019) Circadian regulation of alternative splicing of drought-
associated CIPK genes in Dendrobium catenatum (Orchidaceae). Int J Mol Sci 20(3):688
Wang Z, Zhang W, Beebout SS, Zhang H, Liu L, Yang J, Zhang J (2016) Grain yield, water and
nitrogen use efficiencies of rice as influenced by irrigation regimes and their interaction with
nitrogen rates. Field Crops Res 193:54–69
Wang Y, Wang L, Zhou J, Hu S, Chen H, Xiang J, Zhang Y, Zeng Y, Shi Q, Zhu D, Zhang Y (2019)
Research progress on heat stress of rice at flowering stage. Rice Sci 26(1):1–10
Wassmann R, Dobermann A (2014) Climate change adaptation through rice production in regions
with high poverty levels. J Semi-Arid Trop Agric Res 4(1):1–24
Xiao B, Huang Y, Tang N, Xiong L (2007) Over-expression of a LEA gene in rice improves drought
resistance under the field conditions. Theor Appl Genet 115(1):35–46
Xiao J, Zhuang Q, Liang E, Shao X, McGuire AD, Moody A, Kicklighter DW, Melillo JM (2009)
Twentieth-century droughts and their impacts on terrestrial carbon cycling in China. Earth
Interact 13(10):1–31
Xue C, Yang X, Bouman BA, Deng W, Zhang Q, Yan W, Zhang T, Rouzi A, Wang H (2008)
Optimizing yield, water requirements, and water productivity of aerobic rice for the North
China Plain. Irrig Sci 26(6):459–474
Yang XG, Bouman BAM, Wang HQ, Wang ZM, Zhao JF, Chen B (2005) Performance of temper-
ate aerobic rice under different water regimes in North China. Agric Water Manag 74:107–122
Yang X, Wang B, Chen L, Li P, Cao C (2019) The different influences of drought stress at the flow-
ering stage on rice physiological traits, grain yield, and quality. Sci Rep 9(1):1–2
You J, Hu H, Xiong L (2012) An ornithine δ-aminotransferase gene OsOAT confers drought and
oxidative stress tolerance in rice. Plant Sci 197:59–69
Yu LH, Wu SJ, Peng YS, Liu RN, Chen X, Zhao P, Xu P, Zhu JB, Jiao GL, Pei Y, Xiang CB (2016)
Arabidopsis EDT 1/HDG 11 improves drought and salt tolerance in cotton and poplar and
increases cotton yield in the field. Plant Biotechnol J 14(1):72–84
Zhou L, Chen L, Jiang L, Zhang W, Liu L, Liu X, Zhao Z, Liu S, Zhang L, Wang J, Wan J (2009)
Fine mapping of the grain chalkiness QTL qPGWC-7 in rice (Oryza sativa L.). Theor Appl
Genet 118(3):581–590
170 B. Singh et al.
Crop Establishment in Direct-Seeded Rice:
Traits, Physiology, and Genetics
Abstract The changing climate and water availability strongly affect the current state
of agricultural production. While the global temperature rises, the occurrence of extreme
climatic conditions becomes erratic. This current scenario has driven the development of
rice varieties and cultivation practices that require less water and favor mechanization.
Although puddled transplanted rice has been more widely used in the past, direct seed-
ing has been gaining popularity in recent years, especially due to its water- and labor-
saving features. This technique allows full crop establishment from seeds that were
directly sown in the field, thus avoiding puddling, transplanting, and maintaining stand-
ing water. Consequently, it offers promising positive environmental effects including
decreasing the release of greenhouse gases and increasing water-use efficiency.
Historically, rice varieties bred for transplanting are also used in direct seeding, which
limits the maximum yield potential of field trials. The success of direct seeding relies
strongly on the development of rice varieties with robust crop establishment. Anaerobic
germination, seed longevity, and early seedling vigor are the key traits required to
achieve this. This chapter expounds on the physiology, molecular mechanisms, genetics,
and relevance of the enumerated traits for direct seeding. A brief discussion of breeding
for rice varieties with improved germination under direct seeding is also provided.
Keywords Direct seeded rice · Anaerobic germination · Seed longevity · Early

seedling vigor
1 Introduction
Rice is grown on close to 160 million ha of land across the world, producing
700 million t of paddy. Notably, more than 90% of the worldwide rice supply is
cultivated and consumed in Asia (Fig. 1). A significant volume of this production is
The original version of this chapter was revised. The author sequence has now been updated.
The correction to this chapter is available at https://doi.org/10.1007/978-3-030-66530-2_15
F. A. Quilloy · B. Labaco · C. Casal Jr · S. Dixit ()

Rice Breeding Platform, International Rice Research Institute, Metro Manila, Philippines
e-mail: [email protected]; [email protected]; [email protected]; [email protected]
© The Author(s) 2021, Corrected Publication 2021 171

https://doi.org/10.1007/978-3-030-66530-2_6
172 F. A. Quilloy et al.
Fig. 1 2017 worldwide (a) milled rice production (tons) and (b) total rice consumption. (Data
retrieved from http://ricestat.irri.org:8080/wrs2/, June 2018)
contributed by small and marginal farm holdings that principally grow rice with
limited inputs under an unpredictable water supply. Rice can be categorized into
different types based on the topographical location where it is grown and the pre-
vailing ecosystem. Topographically, rice is grouped into five main classes: upland,
shallow lowland, mid-lowland, semi-deep, and deepwater ecosystems. Further,
these ecosystems are classified as irrigated or rainfed based on the availability of
irrigation water. In cases where water is maintained throughout most of the crop
growth period (80%), the area is classified as irrigated. However, rainfed areas are
Crop Establishment in Direct-Seeded Rice: Traits, Physiology, and Genetics 173
those where the sole water source is rainfall and ponded water availability is
uncertain.
The start of the Green Revolution led to a marked change in plant architecture
and cultivation practices that primarily suited highly productive irrigated environ-
ments. Several varieties of rice with promising yield potential and input responsive-
ness were developed and adapted across irrigated and rainfed rice-growing areas.
Although this was advantageous in increasing grain yield, the consequences of the
Green Revolution came with an environmental cost. As noted by Pingali (2012), the
policy underlying the Green Revolution prompted misguided overuse of fertilizer
and crop intensification in unbefitting environments. On a sizable scale, the environ-
ment is subjected to unintended consequences such as soil degradation, water-table
diminution, and chemical runoff, which ultimately contribute to the escalating cli-
mate change.
This review aims to summarize crop establishment practices in rice in relation to
climate change and water scarcity. We begin by describing the current state of cli-
mate change and the need for new crop management approaches to mitigate the
worsening conditions. The review then summarizes major crop establishment meth-
ods in rice and demonstrates their suitability to varying growth scenarios. Further,
the review discusses crop establishment in direct-seeded rice in detail covering rel-
evant traits with their underlying physiology and genetics. Finally, we briefly
describe the breeding approach to systematically include new traits in programs on
direct-seeded rice breeding.
2 Climate Change and Water Scarcity
The state of the environment strongly affects the world’s agricultural capacity (FAO
2016). Climate change and water scarcity are two developing stories that confound
the downside in agricultural production. Annually, a total of 3853 km3 of groundwa-
ter is withdrawn, 69% of which (i.e., 2769 km3) is used for agricultural irrigation
while 19% and 12% are allocated for industry and municipalities, respectively (FAO
2016). The repercussions of climate change are believed to drastically affect the
water and agricultural status of the world. Predictions suggest that climate change
can elicit an increase in temperature, a shift in the patterns of precipitation, the
occurrence of more extreme climatic events, and further water deficit (Barker 2009).
Climate is described as the environmental condition over a location in a span of
30 years. Temperature and precipitation are two of the most pressing factors that
regulate Earth’s climate. Remarkably, over the past 100 years, an average increase
of 0.74 °C has been recorded in the global surface temperature (IPCC 2007) as a
result of the increase in atmospheric methane, nitrous oxide, and other greenhouse
gases (GHGs). Since rainfall has a direct relationship with temperature, the amount
of annual rainfall scales up with temperature. In the past 100 years, there has been
an increase of 2% in overall precipitation; however, because this has large regional
discrepancies, the benefits have been limited (IPCC 2007). Moreover, the
occurrence of extreme climatic events is increasing and this leads to a decline in rice
production. Long-term experiments on rice yields coupled with crop simulation
models have reported that the yield decline can partly be attributed to the fluctuating
climatic conditions (Aggarwal 2008). Figure 2 illustrates the average yearly precipi-
tation across different countries in 2011. Notably, some of the major rice-producing
countries such as Vietnam, Myanmar, Thailand, the Philippines, Bangladesh, Nepal,
India, Burundi, and Nigeria also have the highest precipitation rates (Kreft et al.
2016). In India, for example, it was estimated that the variability in temperature and
rainfall would result in a 10–40% loss in agricultural production by 2080–2100
(Aggarwal et al. 2010). Projection models suggest that direct climate impacts on
maize, soybean, wheat, and rice production can account for losses of 400–1400 Pcal
(8–24% of the current total) (Elliott et al. 2014). As mentioned by Barker et al.
(1998), the world must develop and advocate for policies, investments, and infra-
structure that can adapt to the ever-changing climatic parameters.
Water scarcity is a state when water is insufficient to meet the demand of all sec-
tors of a particular place or demography. It has diverse origins, including decreasing
water tables, declining water quality, faulty irrigation systems, and growing water
competition from industrial and urban sectors (Bouman et al. 2007). It can be cate-
gorized into two major types: physical and economic water scarcity.
Physical water scarcity, in its simplest form, occurs when water resources are
depleted; hence, the water supply is not able to meet human and environmental
demand (Molden 2007; OCHA 2010). As further discussed by Molden (2007),
physical scarcity is commonly associated with, but not limited to, arid areas. It also
occurs in areas with an abundant water supply yet the resources (i.e., irrigation) are
allocated only to certain sectors.
Fig. 2 Average yearly precipitation (cm) across different countries. (Image retrieved from https://
nelson.wisc.edu, July 2018)
Economic water scarcity is due to the lack of capability to withdraw water given
that there is a sufficient amount of reserve (Molden 2007; OCHA 2010). This relates
to the lack of infrastructure to enable the withdrawal of water. However, this is also
linked to the inequitable allocation of infrastructure; hence, the water supply is lim-
ited to certain groups. Signs indicative of economic water scarcity are inadequate
infrastructure development, high cost of irrigation, fluctuating water availability,
flooding, and long-term drought. Therefore, it is important to address the proper
management of water resources to maximize water utility and prevent water
contamination.
Physical and economic water scarcities are widespread across different coun-
tries. As of 2016, it was revealed that about four billion people suffer from water
scarcity for at least 60 days in a year (Mekonnen and Hoekstra 2016). In Asia alone,
it is expected that per capita water availability will decline across different countries
by 2050 (Fig. 3). This decline could range from 1911 to 63,135 m3 for different
countries (Kumar and Ladha 2011). Several reasons are reported to be causing this
decline, such as booming population, decreasing water table, deteriorating water
quality, inept irrigation, and rising competition with nonagricultural sectors (Kaur
and Singh 2017).
It is estimated that approximately four billion people worldwide are constrained
by extreme water scarcity for blue water (fresh surface water and/or groundwater
that is extracted from the earth and not returned due to evaporation into the atmo-
sphere or incorporation into a product), of which more than half are from China and
India (Mekonnen and Hoekstra 2016), two of the highest rice-producing Asian
Fig. 3 Per capita water availability (in cubic meters) based on population growth rate among dif-
ferent rice-producing countries across 100 years (1950–2050). (Source: Kumar and Ladha 2011)
countries. Therefore, it can be expected that physical and economic water scarcities
are going to induce a sharp deterioration in agriculture’s portion of freshwater allo-
cation in Asia.
Water is also lost in the field throughout the cropping season because of factors
such as surface runoff, seepage, percolation, evaporation, and transpiration (Bouman
et al. 2007). However, only water loss through transpiration is considered to be pro-
ductive since this is useful for plant growth and development. Although 1432 L of
water are needed to produce 1 kg of rough rice (Rice Knowledge Bank 2017), only
about 10% of the total absorbed water is used by the plant for its development
(Chavarria and dos Santos 2012). To this end, a large portion of water input becomes
unused, leading to a loss in farmers’ investments. In the present-day scenario of water
scarcity, the puddled transplanted system of rice is becoming increasingly unsustain-
able. With more than 90% of global rice being cultivated and expended in Asia and the
large water requirements of conventional rice cultivation systems, it is evident that
water scarcity is going to severely affect rice production on the continent. The high
water requirement of puddled transplanted rice makes it more vulnerable to water
scarcity and demands more drastic changes in cultivation practices than in other crops.
3 Rice Establishment Methods
Historically, in Asia, direct seeding was a preferred cultivation practice over trans-
planting (Grigg 1974). Although transplanting was more labor- and input-intensive,
it provided a yield advantage and was later adopted due to the increased availability
of labor because of drastic population expansion. In the sections below, we describe
the two main cultivation practices popular in Asia.
3.1 Puddled Transplanted Rice
Transplanting 20–30-day-old seedlings in puddled soil is currently the most pre-

ferred practice in Asia. Puddling decreases water seepage by compacting the soil
during land preparation, which improves weed suppression, eases seedling estab-
lishment, and creates an anaerobic condition that increases soil nutrient availability
(e.g., zinc, iron, and phosphorus) (Fanish 2016). Puddling ensures high crop growth
and yield but it is not the most water- and labor-efficient option (Dixit et al. 2016).
Rice requires two to three times more water than other cereals (Barker et al. 1998),
especially when it is grown under puddled conditions lasting to about 80% of the
crop’s growth duration. Moreover, repeated puddling damages soil properties such
that the soil aggregates are dismantled, the permeability of the soil subsurface layers
decreases, and, at shallow depth, hard-pans are formed. Also, puddled transplanted
rice (PTR) requires longer crop duration due to the delay in plant maturity caused
by transplanting shock and nursery time. Although transplanting is favored by low
wages and adequate water supply, the decreasing labor and water availability in
most rice-growing regions in Asia requires a shift in cultivation practices to make
rice farming a sustainable and profitable enterprise.
3.2 Direct-Seeded Rice
The current climate and social scenarios in Asia have led to increased efforts in
developing rice varieties and cultivation practices requiring less water and favoring
mechanization. These include operations such as direct seeding and alternate wet-
ting and drying. Among all the water-saving technologies, dry direct seeding is the
most water-efficient and it favors mechanization, which reduces labor requirements.
Direct seeding is the crop establishment practice from seeds that were directly
sown in the field instead of transplanting seedlings grown from the nursery. It comes
mainly in three forms: dry direct-seeded rice (dry-DSR), wet direct-seeded rice
(wet-DSR), and water seeding. Kumar and Ladha (2011) described and differenti-
ated these methods based on field conditions. Dry-DSR involves broadcasting, dib-
bling, or drilling of dry seeds on unpuddled soil, which was either conventionally
tilled or not tilled at all. Meanwhile, wet-DSR is done by sowing pregerminated rice
seeds onto or into puddled soil and is known as aerobic and anaerobic wet-DSR,
respectively. Lastly, water seeding uses pregerminated seeds that are broadcast onto
the field with standing water. In this case, the field may be either puddled (wet-water
seeding) or unpuddled (dry-water seeding).
DSR is considered as an opportunity to advance rice production practices in
water-scarce areas into a high-water-use-efficient cultivation practice (Fanish 2016).
Through dry direct seeding, three basic field operations are avoided: puddling,
transplanting, and maintaining 4–5 cm of standing water throughout the season.
Further, PTR fields are one of the biggest sources of greenhouse gases, particularly
methane. As reported by Pathak et al. (2013), in the districts of Punjab, DSR
decreased total global warming potential by about 33%, from 2.0 to 4.6 t CO2 eq./
ha to 1.3–2.9 t CO2 eq./ha. In DSR, the production of both methane and carbon
dioxide was less than that in PTR. This shows the promising positive effects of DSR
on the environment.
DSR is also known for its water- and labor-saving attributes. It is reported to save
around 30% of water (Fanish 2016) and 11.2% of labor costs (Akhgari and Kaviani
2011). Apart from this, the labor requirement for DSR is spread out through the
season, promoting mechanization and the use of family labor instead of depending
on hired labor. This makes rice farming more profitable for farmers and also allows
continued operations throughout the season despite labor unavailability. Furthermore,
DSR saves the plants from transplanting injury; hence, the plants reach physiologi-
cal maturity in fewer days and this leads to early crop maturity.
In general, PTR varieties are also used in direct seeding. The unavailability of
proper varieties developed for direct seeding is a major constraint to exploiting its
maximum yield potential. Historically, previous approaches to the improvement of
crop establishment in DSR involved refining cultural practices rather than rice vari-
etal improvement. Ultimately, the success of DSR relies heavily on breeding for
varieties with anaerobic germination (AG) tolerance, seed longevity, early seedling
vigor, and the ability to germinate from deep soil.
4 Traits, Physiology, Genetics, and Breeding
4.1 Anaerobic Germination
Poor crop establishment remains a concern in areas that experience flooding after
sowing and where fields are not properly leveled (Ismail et al. 2009). Flooding
negatively affects germination and survival in most rice genotypes (Ismail et al.
2012). Conversely, it suppresses the growth of weeds and shrinks the cost of physi-
cal weeding and/or herbicide application. It is projected that approximately 30% of
the total cultivation cost is saved when weed emergence is suppressed by flood.
The ability of seeds to sprout, grow, and survive under low oxygen (hypoxia) or
very little to no oxygen (anoxia) is known as AG. This trait is a must-have for all
direct-seeded rice systems. The trait ensures risk mitigation at the early stages of the
crop and can be used as a weed control mechanism. The majority of the modern
high-yielding rice varieties do not show any germination underwater. However,
landraces that can maintain germination under flooded conditions have evolved in
various parts of rice-growing areas. Some examples of such tolerant landraces are
Khao Hlan On, Ma Zhan (red), Kalarata, Nanhi, and Khaiyan. Results of donor
identification studies have shown tolerant landraces spread across all major groups
of rice. However, indica and aus landraces have been used in genetic studies and
breeding programs more than the other groups so far. Khao Hlan On and Ma Zhan
(red) are currently used extensively as donors of the trait in breeding and marker-
assisted selection (MAS) programs at the International Rice Research Institute (IRRI).
4.1.1 Physiology and Molecular Mechanisms of AG
Rice is the only cereal that can withstand water submergence; hence, it grows even
under hypoxic conditions. In extreme conditions, submerged plants can experience
anoxia when subjected to prolonged flooding. Under anoxia, the plant shifts to an
alcoholic fermentation (AF) pathway rather than respiration for energy, in the form
of adenosine triphosphate (ATP). During AF, only two ATPs are being produced
vis-à-vis 38 ATPs are produced in aerobic respiration (Magneschi and Perata 2009).
Therefore, the plant is 19 times less efficient in ATP production when exposed to
anaerobic conditions. Notably, three common physiological responses allow rice
seedlings to survive under anaerobic conditions: (1) longer coleoptile, (2) greater
water imbibition, and (3) higher starch reserves.
According to Pradet and Bomsel, in 1978 (as cited by Kennedy et al. 1980), the
only plant organ that can grow under anoxia is the rice coleoptile. Through coleop-
tile elongation, the plant can gain access to aeration, which enables the germination
of the developing embryo (Ismail et al. 2012). Because of this, AG tolerance can be
indirectly measured using coleoptile length. Hsu and Tung (2015) referred to this
trait as the “anaerobic response index.” Alpi and Beevers (1983) demonstrated that
seedlings develop coleoptiles at a higher speed when subjected to low environmen-
tal O2 concentration. However, they further observed that, despite its greater length,
the coleoptile is thin and fragile with less fresh weight. This phenomenon can be
referred to as the snorkel effect, whereby anoxia induces the development of a hol-
low coleoptile to access a better-aerated environment (Kordan 1974). This provides
oxygen supply for the plant’s root and endosperm, which supports complete and
vigorous seedling establishment. Adachi et al. (2015) evaluated the germination of
tolerant (IR06F459) and intolerant (IR42) rice lines and revealed that the coleoptiles
of IR06F459 had significantly longer coleoptiles than those of IR42. IR06F459 is an
AG-tolerant line developed from backcrossing IR64 to Khao Hlan On. In addition,
Ismail et al. (2009) revealed that water stress during germination decreased shoot
and root length of intolerant genotypes by 81% and 68%, respectively (Fig. 4). This
was incomparable to the decrease of 61% in shoot length and 7% in root length of
the tolerant genotypes.
During flooding, seeds experience oxygen-limiting conditions. Under these con-
ditions, the plant requires above-normal tolerance of anoxia to exhibit strong seed
germination and growth (Ismail et al. 2009). In 1996, Yamauchi revealed that the
use of genotypes that can withstand anaerobic conditions could help improve seed-
ling establishment, weed control, and lodging resistance in DSR. Hence, the utility
of genotypes with high germination rate (i.e., coleoptile and mesocotyl elongation)
and seedling vigor under anaerobic conditions can curtail problems in crop estab-
lishment and even weed competition (Azhiri-Sigari et al. 2005). As revealed by
Ismail et al. (2009) in their evaluation of tolerant (Cody, Khaiyan, Nanhi, and Khan
Hlan On) and intolerant (FR13A, IR22, IR28, IR42, and IR64) genotypes, the
Fig. 4 Mean shoot and

root lengths of five
flooding-tolerant and five
flooding-sensitive
genotypes of rice measured
21 days after sowing under
control and flooded
(10 cm) conditions. Values
in parentheses are
percentage decreases in
length relative to the length
in the control. Vertical bars
indicate l.s.d. at p = 0.05.
(Source: Ismail et al. 2009)
Fig. 5 Percentage survival of two tolerant (Khao Hlan On and Ma Zhan (red)) and two intolerant
(IR64 and IR42) varieties after 7, 14, and 21 days of submergence (DAS) in 8 cm of water
survival of both groups decreased but there was a markedly larger decrease in the
survival of the intolerant genotypes (Fig. 5). Among these tolerant genotypes,
Khaiyan and Khao Hlan On displayed the highest survival rates, whereas the intol-
erant genotypes recorded a survival percentage of only about 5%.
The rapid germination of AG lines was credited by El-Hendawy et al. (2011) to
rapid water imbibition under submerged conditions. They evaluated 58 contrasting
genotypes, which showed a strong negative correlation (r = −0.46, p < 0.001)
between water uptake and germination time. Further, the authors performed cluster
analysis of the lines based on water content over different times of seed imbibition
and revealed that tolerant genotypes clustered together within the group, which was
characterized by rapid water uptake. Together, this suggests that high water uptake
can induce rapid seed germination under anoxia. A proposed mechanism of action
is that water uptake promotes sugar mobilization from the endosperm to the devel-
oping embryo (El-Hendawy et al. 2011), which provides energy for plant growth.
Apart from efficient water imbibition, carbohydrate content has the potential to
enable plant growth under water stress. Ella and Setter (1999) suggested that the
adverse effect of decreased ATP supply during AF is relieved when more carbohy-
drate is available for breakdown. As such, seeds with high starch content are deemed
more tolerant of AG than seeds with high fat content (Magneschi and Perata 2009).
Under anoxia, plant survival was found to be strongly correlated to starch content
(r = 0.73–0.88) (Ella and Setter 1999). However, starch cannot be used as it is;
hence, some also hypothesize the role of α-amylases, which are responsible for the
breakdown of starch into soluble sugar (El-Hendawy et al. 2011). Rice, among the
cereal crops under anoxia, is the only crop that expresses α-amylase mRNA (Perata
et al. 1992, 1993). Also, a rice seed grown under anoxia expresses the whole set of
enzymes needed for starch breakdown into its soluble forms (Ismail et al. 2009).
These amylases regulate starch degradation to glucose, which is needed in the
plants’ fermentative metabolism that is activated for ATP production under anoxia
(Septiningsih et al. 2013). Adachi et al. (2015) reported in their study that the
α-amylase activity in their tolerant line (IR06F459) was significantly higher than in
the intolerant line (IR42). This was also in agreement with the findings of Illangakoon
et al. (2016), for which the survival rates of their genotypes were positively corre-
lated with α-amylase activity (r = 0.79) and soluble sugar content (r = 0.74). Ismail
et al. (2009) reported that the soluble sugar concentration remained low for both
tolerant and intolerant genotypes until the tolerant genotypes had higher soluble
sugar at 4–8 days after sowing. These findings suggest that tolerant genotypes can
break down carbohydrate reserves in the seed and mobilize the resulting monosac-
charide, which can enable germination and growth under hypoxia. In 2015,
Kretzschmar et al. found that OsTPP7 was expressed in the germinating tissues of
a NIL-AG1 (tolerant) line while its expression was absent in IR64 (susceptible).
Given that OsTPP genes (i.e., OsTPP1 and OsTPP2) in rice convert trehalose-6-
phosphate (T6P) to trehalose, this mechanism can also be true for OsTPP7. Further
analysis revealed that trehalose and sucrose were 2.3-fold and 2.0-fold higher in
NIL-AG1 than in IR64. This suggests that OsTPP7 affects the conversion of T6P to
trehalose, which signals low sugar availability; consequently, the plant enables
starch mobilization from the endosperm reserve (source) to the coleoptile (sink).
Expression analysis, through RNA sequence (RNA seq), revealed that RAmy3D
was highly expressed in tolerant genotypes under anoxia (Ismail et al. 2009). RAmy3D
is a member of the Amy3 gene subfamily, which was found to be upregulated in rice
embryos under anoxia (Hwang et al. 1999). RAmy3D, unlike RAmy1A from the
Amy1 gene subfamily, lacks the gibberellic acid (GA)-responsive element in its pro-
moter region (Lu et al. 1998) and is important in oligosaccharide degradation
(Terashima et al. 1997). Under starvation, a glucose and sucrose receptor, RAmy3D,
is activated by protein kinase SnRK1A (Lu et al. 2007). Meanwhile, SnRK1A is stim-
ulated by calcineurin B-like protein kinase (CIPK15) under oxygen-limiting condi-
tions (Kudahettige et al. 2010). Additionally, the interaction of calcineurin B-like
proteins, such as CBL4 and CBL5, with CIPK15 under anoxia is viewed as a regulat-
ing mechanism in plant response during anoxia (Ho et al. 2017; Sadiq et al. 2011).
Although many other rice enzymes are downregulated during anoxia to inacti-
vate energy-conserving steps, pyruvate decarboxylase (PDC), alcohol dehydroge-
nase (ADH), and aldehyde dehydrogenase (ALDH) are active in genotypes tolerant
of anoxia (i.e., Khaiyan), as reported by Ismail et al. (2009). The upregulation of
these enzymes proposes enhanced alcohol fermentation during anoxia, which uses
nicotinamide adenine dinucleotide (NAD) for glycolysis and substrate-level phos-
phorylation (Saika et al. 2006; Shingaki-Wells et al. 2011). As a result, enough
energy and carbon are supplied to the developing coleoptile under anoxia. Moreover,
rice coleoptiles under anoxic conditions have been reported to exhibit a decrease in
pH, which also suggests alcoholic fermentation pathway activation. In 2009, Ismail
et al. showed that the concentration of ethylene increased significantly after only
3 days of imbibition. They also reported that the ethylene produced affects starch
hydrolysis through the reduction of abscisic acid (ABA) synthesis while upregulat-
ing the synthesis of and sensitivity to gibberellic acid (GA) of the internode tissue.
This enhances starch catabolite enzyme activity under stress, which enables
seedling growth and survival under AG. Further, ethylene promotes coleoptile
growth through cell expansion by regulating enzymes such as peroxidases, which
are responsible for cell wall rigidity. Peroxidase activity decreases the plant cell
wall’s lignin content and protein assembly (Waffenschmidt et al. 1993), which in
turn decreases its rigidity and permits cellular elongation. Figure 6 shows the pro-
posed mechanism of coleoptile elongation under anoxia as interpreted by Ismail
et al. (2009).
Other factors that are deemed responsible for cell expansion are a group of non-
enzymatic proteins called expansins, which can affect cell wall loosening. These
proteins attach at the cell wall interface between cellulose microfibrils and matrix
polysaccharides, which results in a disturbance of non-covalent bonds, enabling cell
wall loosening (McQueen-Mason and Cosgrove 1995). Thus far, EXPA2, EXPA4,
EXPA7, EXPB12, EXPA1, EXPB11, and EXPB17 were reported to be induced
during submergence stress (Juang et al. 2000; Lasanthi-Kudahettige et al. 2007;
Takahashi et al. 2011).
Fig. 6 Proposed mechanisms involved in enhancing germination and seedling growth under low-
oxygen stress in rice. (Source: Ismail et al. 2009)
4.1.2 Genetic Factors Underlying the AG Trait
Before evaluating the genetics behind AG, it was necessary to identify lines that can
germinate under very limited oxygen supply. The largest AG screening conducted
has been that of Angaji et al. in 2010. They screened 8000 rice accessions from the
IRRI Genetic Resources Center, which contains collections from gene bank acces-
sions, elite breeding lines, IR64 mutants, and introgression lines. However, only
0.23% (19 lines) showed greater than or equal to 70% survival, a subset of which is
present in Table 1. Nevertheless, Hsu and Tung (2017) evaluated gene expression in
six genotypes and discovered 3597 genes affected by water stress irrespective of the
plant’s genetic background, 5100 genes differentially affected across genotypes,
and 471 genes affected in a genotype-dependent manner. Hence, the different geno-
types are expected to display different degrees of tolerant response to anoxia.
Both quantitative trait loci (QTL) mapping and genome-wide association studies
(GWAS) are useful in identifying genomic regions underlying different phenotypic
traits. QTL mapping uses markers for a trait of interest, which can categorize the
sample population into genotypic groups (Sehgal et al. 2016), while GWAS link
common single nucleotide polymorphisms (SNPs) to phenotypic traits, which can
provide information on the association between particular genetic variants and phe-
notype (Pal et al. 2015). Table 2 summarizes the results of some of the previous
QTL mapping studies for AG tolerance using different rice landraces as sources.
In 2004, Jiang et al. evaluated 81 recombinant inbred lines (RILs) from a japon-
ica/indica cross, Kinmaze/DV85. Kinmaze germinates well under anoxia; hence, it
was used as the donor parent. These RILs were screened using 137 restriction frag-
ment length polymorphism (RFLP) markers and five QTLs were detected on chro-
mosomes 1, 2, 5, and 7. These QTLs explained phenotypic variation ranging from
Table 1 Rice accessions Cultivar Origin Survival (%)

tolerant of anaerobic
Khaiyan Bangladesh 90
germination together with
three sensitive checks, IR42, Ma-Zhan (red) China 90
IR64, and FR13A. Source: Kalongchi Bangladesh 90
Angaji et al. (2010) Sossoka Guinea 85
Kaolack Guinea 85
Dholamon 64-3 Bangladesh 80
Nanhi India 80
Khao Hlan On Myanmar 75
IR68552-100-1-2-2-2 NPT-IRRI 75
Cody USA 70
Liu-Tiao-Nuo China 70
IR64 (sensitive) 20
FR13A (sensitive) 20
IR42 (sensitive) 5
Table 2 Summary of QTLs detected for anaerobic germination identified from different studies
Locus Chr LOD R2 Donor Population Source
qAG-1 1 3.66 11.0 Khaiyan BILs Angaji (2008)
qAG-2 2 4.44 14.5 IR64
qAG-1-2 1 2.73 2.83 Khao Hlan On BILs Angaji et al. (2010)
qAG-3-1 3 2.55 2.78 Khao Hlan On
qAG-9-2 9 15.32 20.59 Khao Hlan On
qAG2.2 2 2.43 9.79 Nanhi F2 Baltazar et al. (2014)
qAG3 3 2.42 18.21 IR64
qAG7 7 13.93 14.06 Nanhi
qAG-1 1 3.25 12.1 Kinmaze RILs Jiang et al. (2004)
qAG-2 2 4.09 15.6 Kinmaze
qAG-5a 5 2.9 19.6 DV85
qAG-5b 5 2.61 16.6 DV85
qAG-7 7 2.74 10.5 Kinmaze
qAG-5 5 3.78 15.51 USSR5 F2 Jiang et al. (2006)
qAG-11 11 2.97 10.99 USSR5
qAG-2 2 3.7 9.3 Ma Zhan (red) F2:3 Septiningsih et al. (2013)
qAG-5 5 5.1 11.8 Ma Zhan (red)
qAG-7-1 7 16.5 26.7 Ma Zhan (red)
qAG-12 12 3.5 5.3 Ma Zhan (red)
10.5% to 19.6% of the shoot lengths. According to the calculated additive effects,
the positive effect of three QTLs (qAG-1, qAG-2, and qAG-7) was contributed by
Kinmaze. Meanwhile, AG tolerance conferred by qAG-5a and qAG-5b was improved
due to the recurrent parent, DV85.
Another set of rice lines was evaluated by Jiang et al. in 2006 using USSR5 and
N22 as parents. USSR5 is a japonica subspecies from the former Soviet Union
while N22 is an indica type. These were crossed and the generated F2 plants were
evaluated for survival under AG and then genotyped using 121 simple sequence
repeat (SSR) markers. Mapping revealed two QTLs on chromosomes 5 (qAG-5) and
11 (qAG-11) contributing to AG tolerance. Both QTLs were contributed by the
USSR5 allele, which accounted for 11.0–15.5% of the coleoptile length variation.
Four QTLs were identified by Angaji in 2008 from a cross using Khaiyan, an
aus-type tolerant variety from Bangladesh, as a donor. Khaiyan was crossed with
semi-dwarf nonaromatic indica lowland modern rice variety IR64, and the F1s were
backcrossed to IR64 to produce 150 BC2F2 lines. The identified QTLs are qAG-1,
qAG-2-2, qAG-11, and qAG-12, which explained 12.0–29.2% of the variation in
survival of the lines, while together these QTLs accounted for a total of 51.4% of
the phenotypic variation. However, based on the additive values, only the QTL
qAG-1 had the allele from Khaiyan, which increased AG tolerance.
Another promising donor for AG tolerance is Khao Hlan On, which is a tall aro-
matic japonica upland landrace from Myanmar used by Angaji et al. in their study
in 2010. They crossed Khao Hlan On with IR64 and the F1 progenies were back-
crossed and selfed to produce 423 BC2F2 lines. QTL mapping was done using 135
SSRs and one InDel marker. Five QTLs accounting for 17.9–33.5% of the variation
in percentage survival were detected from chromosomes 1 (qAG-1-2), 3 (qAG-3-1),
7 (qAG-7-2), and 9 (qAG-9-1 and qAG-9-2). Further, from the values of the additive
effects of the QTLs, it was inferred that AG tolerance was contributed by alleles
from Khao Hlan On.
More recently, in 2013, Septiningsih et al. used 118 SSR markers to assess AG
tolerance alleles from Ma-Zhan (red), a highly AG-tolerant landrace from China
with 90% survival (Angaji et al. 2010). Ma Zhan (red) was crossed with IR42 and
then backcrossed to produce BC2F3 families. The survival rates and genotype data
of 118 SSR markers in 175 families revealed six QTLs related to AG on chromo-
somes 2, 5, 6, and 7, accounting for 5.6–30.3% of the phenotypic variation. These
QTLs are qAG-2, qAG-5, qAG-6, qAG-7-1, qAG-7-2, and qAG-7-3. It must also be
noted that all five of these QTLs were donated by Ma Zhan (red). QTL qAG-7-2
explained the highest amount of phenotypic variation, amounting to 30.3% in inter-
val mapping (IM) and 31.7% in composite interval mapping (CIM), with LOD
scores of 13.7 and 14.5, respectively. This QTL was further evaluated to confirm its
presence and effect. The authors developed introgression lines bearing the homozy-
gous alleles of qAG-7-2 from Ma Zhan (red) and revealed that these introgression
lines have significantly higher survival (47.58 ± 4.72%) than the introgression lines
bearing homozygous IR42 alleles (16.67 ± 2.99%). Moreover, the results confirmed
the effect of the QTL, which rendered an additional 30% survival in line with the
homozygous allele of Ma Zhan (red). Given that Ma Zhan (red) still had the highest
survival rate (73.7 ± 14.19%) among all the lines analyzed, this suggests the effect
of other QTLs distributed widely in the rice genome to improve AG tolerance.
Hsu and Tung (2015) used both GWAS and QTL mapping to detect genomic
regions related to AG tolerance. A total of 144 RILs from a Nipponbare and IR64
cross were used in QTL mapping with 35,501 SNPs. The authors identified a peak
on chromosome 1 using both single marker analysis (SMA) and interval mapping
based on the linkage map of 355 SNPs filtered after Bonferonni correction with
α = 0.05. For GWAS, 153 accessions and 36,901 SNPs were used. This revealed
three genomic regions on chromosome 7 (25.12, 26.92, and 27.72 Mb); however,
the major QTL on chromosome 1, which was detected in QTL mapping, was not
identified using GWAS. Since this QTL on chromosome 1 cannot be tagged as a
rare variant based on haplotype analysis, it was proposed that the haplotype and
varietal relationships can account for the inconsistency in findings. As mentioned by
Kang et al. (2008), genetic association studies are confounded by population struc-
ture and relatedness, which can produce several false positives. However, Brachi
et al. (2011) noted that overcorrection for these factors can lead to false-negative
results.
Remarkably, some of the identified QTLs overlap across different studies. Some
of these are (1) qAG-2 detected by Jiang et al. (2004) and Septiningsih et al. (2013),
(2) qAG-7-2 by Angaji et al. (2010) and qAG-7-3 from Septiningsih et al. (2013),
and (3) qAG-1-2 from Angaji et al. (2010) and chromosome 1 QTL from Hsu and
Tung (2015). Further assessment should be done to detect whether these QTLs are
controlled by the same gene(s).
At present, two QTLs have been considered of prime importance for AG toler-
ance, AG1 (qAG-9-2) and AG2 (qAG-7-1) identified from Khao Hlan On and Ma
Zhan (red), respectively (Miro and Ismail 2013). In 2015, Kretzschmar et al. fine-
mapped QTL qAG-9-2 to a 50-kb region on chromosome 9. Based on Nipponbare
as the reference genome, this region encompasses four genes and one transposable
element. Contrasting this region to a de novo assembled IR64 sequence revealed a
20.9-kb deletion of AG1 spanning across LOC_Os09g20390/Os09g0369400
(OsTPP7) and a deletion of neighboring loci. Meanwhile, the QTL did not show any
structural variation against Nipponbare apart from a 4-kb deletion that is also pres-
ent in IR64.
4.2 Seed Longevity
The life cycle of seeds involves fertilization, dormancy, and germination. Bewley
(1997) defined seed dormancy as “the failure of an intact viable seed to completely
germinate under favorable conditions.” Associated with dormancy is seed longevity,
which is the ability of the seed to remain viable after harvesting, and this is usually
evaluated through seed germination ratio or percentage.
Seed longevity varies among different rice varieties as it is governed by both
genetic and nongenetic factors. Some notable nongenetic factors are ambient envi-
ronmental conditions during seed development, maturity at seed harvest, mechani-
cal damage, presence of pathogens, moisture content, and storage conditions after
harvest (Copeland and McDonald 1995). Seed longevity and viability usually
decrease when exposed to high temperature and moisture (Roberts 1961; McDonald
1999). Yamauchi and Winn (1996) reported that low seed longevity or seed aging is
a major issue in the establishment of seeds in anaerobic environments where direct
seeding is practiced. If seed longevity fails, crop establishment decreases and weed
pressure proliferates. Both scenarios can dramatically decrease crop yield; hence,
the importance of varieties tolerant of seed aging.
4.2.1 Physiology and Molecular Mechanisms Affecting Seed Longevity
Seeds battle aging through protection and repair. The seed protection mechanism
involves the development of a glassy cytoplasm, which limits cellular metabolic
activities and antioxidant production during seed storage to inhibit the buildup of
oxidized macromolecules that can diminish seed viability. Conversely, the seed
repair system exploits DNA glycosylases and methionine sulfoxide reductases,

which prevent damage accumulation in the DNA, RNA, and/or proteins during seed
imbibition (Sano et al. 2016).
Seed aging is oftentimes linked with the oxidation of nucleic acids, proteins, and
lipids (Bailly 2004), causing oxidative stress. This can be combated through passive
mechanisms, such as nonenzymatic reactive oxygen species (ROS)-scavenging sys-
tems, and active mechanisms, such as enzymatic ROS detoxification (Sano et al.
2016). In enzymatic responses, seeds rely on antioxidant enzymes such as superox-
ide dismutase, catalase, glutathione, ascorbate peroxidase, monodehydroascorbate,
dehydroascorbate, and glutathione reductase (Bailly 2004; Kumar et al. 2015). Petla
et al. (2016) also reported the role of the repair enzyme l-isoaspartyl
O-methyltransferase, overexpressed in transgenic rice, by restricting ROS accumu-
lation and by repairing homeostasis-disruptive isopartlyl residues in proteins.
Among the nonenzymatic responses, the most important antioxidants are tocoph-
erols or vitamin E, which prevents nonenzymatic lipid peroxidation. Vitamin
E-mediated free radical scavenging in rice decreases lipid membrane peroxidation,
which results in greater seed longevity (Hameed et al. 2014).
Goufo and Trindade (2013) enumerated other biochemical factors affecting the
longevity of rice seeds that include phenolic acid, flavonoids, coumarins, tannins,
and anthocyanins. For example, antioxidant polyphenols such as flavonoids in the
seed coat, embryo, and endosperm of Arabidopsis have been shown to increase seed
longevity (Debeaujon et al. 2000). It is worth noting that AG donor lines such as
Khao Hlan On have red pericarps, which may have putative roles in both seed lon-
gevity and AG tolerance.
Interest has increased in the epigenetic basis of the seed life cycle from fertiliza-
tion to dormancy until germination. van Zanten et al. (2013) reported that seeds
require epigenetic factors such as chromatin condensation to enable the transition
from seed dormancy to germination in Arabidopsis thaliana. These epigenetic mod-
ifications include condensation and methylation (Exner and Hennig 2008; Xiao
et al. 2006), which affect chromatin accessibility under stress. Xiao et al. (2006)
stated that mutated genes for DNA methylation result in nonviable seedlings and
improperly developed embryo in A. thaliana. Interestingly, using a drought-tolerant
barley variety, it was found that HvDME gene was highly expressed after 10 days
of drought stress (Kapazoglou et al. 2013). This gene codes for DNA glycolases,
which are responsible for DNA methylation affecting chromatin accessibility.
Recent work on the environmental effect on seed longevity likewise showed the
influence of the pretreatments of seed drying at 45–60 °C (Whitehouse et al. 2017).
It was revealed that this improves seed longevity in rice germplasm prior to storage.
Furthermore, environmental transgenerational changes such as warmer parental
growth environment affect the subsequent generation’s seed longevity in alpine
trees (Silene vulgaris) by providing transcripts of SvHSP17.4 and SvNRPD12
mRNAs to withstand heat stress (Mondoni et al. 2014). Moreover, the maternal
environment of rice might have a putative role in seed longevity as was shown in
barley (Nagel et al. 2015).
4.2.2 Genetic Factors Affecting Seed Longevity
Genome-wide association mapping in barley (Hordeum vulgare) showed that seed

longevity is inherently affected by genetics, maternal environment, and seed dete-
rioration while negating the effects of lipid-soluble tocochromanols, oil, and pro-
teins (Nagel et al. 2015). Studies of different rice genotypes have shown that
indica-type varieties have higher seed longevity than japonica-type (Chang 1991;
Ellis et al. 1992). Table 3 summarizes some of the QTLs identified from different
rice populations related to seed longevity.
In rice, three QTLs for seed longevity (qLG-2, qLG-4, and qLG-9) were detected
on chromosomes 2, 4, and 9, respectively, using backcross inbred lines from a
Nipponbare/Kasalath cross (Miura et al. 2002). QTL qLG-9 accounted for 59.5% of
the phenotypic variation, which has a larger effect than the phenotypic variation
effect of qLG-2 with 13.4% and qLG-4 with 11.6%. Further investigation by Sasaki
et al. (2005) detected 12 germination QTLs as indices of seed longevity. In the latter
study, qLG-9 was also detected and identified as RC9-2, which affected phenotypic
variation by 12.5–12.8%.
Sasaki et al. (2015) fine-mapped the putative gene located in qLG-9 using
advanced backcross progenies from the cross between japonica-type Nipponbare
and indica-type Kasalath. They found that the candidate genes in the region encode
for trehalose-6-phosphatase (Os09g039369400), TPP, and an unknown protein
(Os09g039369500). Notably, Kretzschmar et al. (2015) mapped a candidate gene in
the same region, which enhances anaerobic germination. This further affirms that
the gene for seed longevity can be used for marker-assisted selection (MAS) for the
breeding of aging tolerant rice for direct-seeded conditions to enable seedling ger-
mination and establishment even in anaerobic conditions.
4.3 Early Seedling Vigor
Seedling vigor reflects the plant’s potential to quickly emerge from the soil or water,
which is a relevant trait for crop establishment, especially for direct-seeded rice. It
is associated with germination and seedling growth, which enable good crop estab-
lishment and weed competition (Diwan et al. 2013). It is a complex trait that is
governed by several genetic factors that affect the physiological, morphological,
and biochemical processes of the plant.
4.3.1 Physiology and Molecular Mechanisms of Early Seedling Vigor
Some of the physiological traits that affect early seedling vigor are shoot length,
shoot fresh weight, number of tillers per plant, mesocotyl length, root fresh and dry
weight, germination rate, germination index, amylase activity, reducing sugar con-
tent, root activity, and chlorophyll content. Teng et al. (1992) evaluated the seedling
Table 3 Summary of major QTLs for seed longevity-related traits identified from different rice
populations
Trait QTL Chr LOD R2 Donor Population Reference
GECAP qMT- 7 4.8 11.6 Milyang 23 RILs Jiang et al.
SGC7.1 (2011)
qMT- 1 6.19 10.7 Tong 88-8
SGC1.1
qMT- 5 5.96 12.5 Milyang 23
SGC5.1
qMT- 7 6.76 12.5 Milyang 23
SGC7.2
qMT- 9 5.97 11.8 Milyang 23
SGC9.1
qDT- 2 7.5 12.4 Dasanbyeo RILs
SGC2.1
qDT- 3 5.79 15.6 Dasanbyeo
SGC3.1
qDT- 9 10.29 20.5 Dasanbyeo
SGC9.1
GEC qRC9-2 9 5.3 12.5 Milyang 23 RILs Sasaki et al.
qRC9-1 9 4.4 11.3 Milyang 23 (2005)
qRC9-2 9 5.4 12.8 Milyang 23
qSSnj-2-1 2 4.1 12.3 Nanjing35 BILs Lin et al. (2015)
GEP qSSn-5 5 5.3 15.0 N22
qSSn-6 6 4.1 13.6 N22
qSSn-9 9 4.3 13.1 N22
qSSn-1 1 4.9 11.3 N22
qSSn-9 9 6.8 13.7 N22
qSSn-1-1 1 4.2 9.9 N22
qLG-9 9 13.883 59.5 Kasalath BILs Miura et al.
(2002)
qSD-3 3 5.11 14.5 ZYQ8 DH Guo et al. (2004)
GER qSS4-1 4 4.99 18.68 Shennong 265 RILs Dong et al.
qSS12-2 12 10.0 44.3 Lijiangxing- (2017)
tuanheigui
qSS9-2 2 5.22 29.09 Shennong 265
qSS-6 6 6.74 14.45 Kasalath BILs Li et al. (2012)
qSS-9 9 5.36 10.63 Kasalath
SI qRGR-1 1 6.95 28.63 IR24 RILs Xue et al. (2008)
DH doubled haploids, RILs recombinant inbred lines, BILs backcross-derived inbred lines, GECAP
germination capability, GEC germination count, GEP germination percentage, GER germination
rate, SI storage index
growth of 38 rice varieties with differences in grain length, width, and weight. They
revealed that the most vigorous seedlings were those with larger embryos and
heavier endosperms.
Within the endosperm, the stored starch granules are composed of both amylose
and amylopectin. These starch granules were distinguished based on their glucose
residues (Huang et al. 2017). Amylose is made up of α-1,4-linked glucose residues;
hence, it can be broken down into maltose by amylases. Amylopectin, however, can-
not be split due to the presence of both α-1,4 and α-1,6 linkages. Starch hydrolysis
is an important step for ATP production and for the generation of carbon skeletons
for the development of new cellular components (Mitsui et al. 1996). Prior to pho-
toautotrophy, seedlings gain the energy required for plant development from the
breakdown of starch granules (i.e., amylose) in the endosperm (Cui et al. 2002b).
This is regulated by starch-hydrolyzing enzymes such as α-amylases, which facili-
tate the cleavage of α-1,4-glucan bonds of starch (Hakata et al. 2012). Notably, this
is considered as the first committed step in starch degradation.
α-Amylases are known to be initially expressed in the scutellar epithelial tissue
and in the aleurone layer; they are then subsequently secreted into the starchy endo-
sperm (Mitsui et al. 1996) to initiate starch breakdown. Therefore, at the seedling
stage, plant vigor can be accounted for by higher amylose content and amylase
activity, which provide the growing embryo with enough energy for development.
Huang et al. (2017) used two cultivars, Yuxiangyouzhan and Huanghuazhan, to
assess the morphophysiological traits governing seedling vigor. Yuxiangyouzhan
(96%) showed a higher germination percentage than Huanghuazhan (87%). It was
further revealed that Yuxiangyouzhan had higher seed amylose content and amylase
activity. Additionally, Huang et al. (2017) cited the utility of using cultivars with
thinner hulls, hence requiring less mechanical strength for coleoptile emergence.
4.3.2 Genetic Factors Affecting Early Seedling Vigor
Diwan et al. (2013) highlighted the importance of producing genotypes with early
seedling vigor due to economic and environmental concerns. To address this, it is
important to determine the genetics underlying seedling vigor. Several studies have
been conducted to identify QTLs related to early seedling vigor. Table 4 summa-
rizes some of the major QTLs related to early vigor that have been identified from
different studies. Anumalla et al. (2015) surmised that RM259 and RM84 of chro-
mosome 1; RM282, RM148, and RM85 of chromosome 3; RM26 of chromosome
5; and RM11 of chromosome 7 were the most promising markers for several seed-
ling vigor traits. Nagavarapu et al. (2017) validated eight of the previously identified
QTLs from different studies: qGR-1, qGP, and qGI-11 (Wang et al. 2010); RZ448
and RZ395 (Redoña and Mackill 1996); qFV-3-2, qFV-5-2, and qFV-10 (Zhou et al.
2007). The authors used 47 genotypes suitable for diverse ecosystems and estimated
seedling vigor traits, followed by QTL analysis. Among the eight QTLs used for
validation, six (qGR-1, qFV-10, qFV-3-2, qFV-5-2, qGP-6, and RZ395) were found
to be associated with some of the selected genotypes. QTL qGR-1 for germination
Table 4 Summary of major QTLs for early seedling vigor-related traits identified from different
rice populations
TraitQTL Chr LOD R2 Donor Population Reference
EUE qEMM1.1 1 – 43.0 – BILs Dixit et al. (2015)
qEUE3.1 3 11.3 18.6 Swarna BILs Singh et al. (2017)
qEUE3.2 3 6.49 11.2 Swarna
qEUE4.1 4 7.1 12.2 Swarna
qEUE5.1 5 11.0 18.3 Swarna
qEUE5.2 5 10.7 12.6 Swarna
qEUE6.1 6 7.4 12.5 Swarna
EV qEVV9.1 9 – 5.8 AUS276/3 BILs Sandhu et al. (2014)
qEVV9.1 9 – 6.4 AUS276/3
qEV3.1 3 4.13 7.2 Swarna BILs Singh et al. (2017)
qEV3.2 3 7.7 13.1 Swarna
qEV4.1 4 7.6 12.1 Swarna
qEV5.1 5 4.2 7.4 Swarna
qEV5.2 5 4.2 7.5 Swarna
qEV6.1 6 6.0 10.6 Swarna
GI qGI-7 7 4.3 13.9 Daguandao RILs Wang et al. (2010)
qGI-11 11 5.1 54.9 Daguandao
GEP qGP-4 4 5.7 12.7 IR28
qGP-6 6 5.3 24.0 Daguandao
qGP-8 8 4.3 12.2 Daguandao
GER qGR3-2 3 5.2 5.8 Zhenshan97 RILs Cui et al. (2002a)
qGR3-3 3 4.3 4.9 Minghui63
qGR5-1 5 15.9 17.4 Zhenshan97
qGR5-2 5 6.4 8.3 Minghui63
qGR6-1 6 5.1 5.6 Zhenshan97
qGR6-2 6 4.9 6.3 Zhenshan97
qGR3 3 9.69 31.3 Arroz da Terra BILs Fukuda et al. (2014)
qSV-3-2 3 5.4 14.7 Teqing RILs Zhang et al. (2005)
GRR qGR2 2 4.33 10.7 M-203 RILs Cordero-Lara et al. (2016)
qMel-1 1 5.4 15.9 Kasalath BILs Lee et al. (2012)
qMel-3 3 4.2 11.5 Kasalath
RAL qSV-1 1 11.9 22.6 Minghui63 RILs Xie et al. (2014)
qSV-5c 5 14.8 30.5 Zhenshan97
qSV-6a 6 5.33 12.6 Zhenshan97
qSV-6b 6 5.63 13.3 Zhenshan97
RODW qRDW5-1 5 19.4 24.1 Zhenshan97 RILs Cui et al. (2002a)
qRDW5-2 5 10.4 13.2 Zhenshan97
qRDW10-1 10 5.6 7.3 Zhenshan97
qRDW3.1 3 4.8 8.4 Moroberekan BILs Singh et al. (2017)
(continued)
Table 4 (continued)
ROHD qRHD8.1 8 – 6.6 AUS276/3 BILs Sandhu et al. (2014)
qRHD5.1 5 – 6.3 AUS276/3
qRHD1.1 1 – 6.3 AUS276/3
ROHL qRHL8.1 8 – 25.3 AUS276/3
qRHL1.1 1 – 4.1 AUS276/3
ROL qMRL1-1 1 9.8 11.4 Minghui63 RILs Cui et al. (2002a)
qMRL1-2 1 4.1 5.1 Zhenshan97
QSV-5a 5 5.5 10.9 Teqing RILs Zhang et al. (2005)
qSV-8-2 8 5.3 10.1 Teqing
qSV-6 6 4.9 13.2 Lemont
SERUE qSRUE4.4 4 4.15 14.6 IR26 RILs Cheng et al. (2013)
SEDW qFV-5-1 5 5.58 11.6 Teqing RILs Zhou et al. (2007)
qFV-10b 10 4.99 8.0 Teqing
SHE qCL11 11 4.2 14.8 Arroz da Terra BILs Fukuda et al. (2014)
qSV-5a 5 6.78 12.7 Zhenshan97 RILs Xie et al. (2014)
qSV-5b 5 6.53 14.9 Minghui63
qSV-8 8 6.03 13.4 Zhenshan97
qSV-11-1 11 13.0 28.8 Minghui63
qSV-11-2 11 5.27 13.4 Minghui63
qHES8 8 5.64 12.3 M-206 RILs Cordero-Lara et al. (2016)
qHES9 9 4.37 9.38 M-203
qHLS10 10 4.99 11.0 M-203
qHLS12 12 4.37 9.54 M-206
qPHS1 1 5.5 7.2 Dunghan Shali RILs Abe et al. (2012)
qPHS3-1 3 5.3 6.6 Dunghan Shali
qPHS3-2 3 17.5 26.2 Dunghan Shali
qPHS4 4 4.4 5.2 Dunghan Shali
qCSH2 2 5.2 16.6 Jileng F 2:3 Han et al. (2007)
qCSH12 12 4.68 17.9 Jileng
qFV-5-2 5 8.76 14.0 Teqing RILs Zhou et al. (2007)
qFV-10a 10 6.91 9.8 Teqing
qSHL5.2 5 5.0 8.8 Swarna BILs Singh et al. (2017)
QSV-5b 5 4.2 6.3 Teqing RILs Zhang et al. (2005)
qSV-7 7 5.9 10.7 Lemont
(continued)
Table 4 (continued)
SHDW qSDW4.2 4 7.06 16.8 IR26 RILs Cheng et al. (2013)
qSDW8.2 8 4.43 14.4 IR26
qSDW1-1 1 8.4 9.7 Zhenshan97 RILs Cui et al. (2002a)
qSDW3-1 3 7.2 8.2 Minghui63
qSDW5-1 5 7.9 8.6 Zhenshan97
qSDW9-1 9 5.7 6.2 Minghui63
qSV-3-1 3 4.4 6.3 Lemont RILs Zhang et al. (2005)
qSV-5 5 7.2 12.1 Teqing
qSDW3 3 8.24 32.2 Arroz da Terra BILs Fukuda et al. (2014)
SHFW qFW1 1 18.4 34.6 M-203 RILs Cordero-Lara et al. (2016)
qFW9 9 4.28 7.2 M-203
STL qSL3.1 3 4.0 7.0 Moroberekan BILs Singh et al. (2017)
qSL5.2 5 4.9 8.5 Moroberekan
DH doubled haploids, RILs recombinant inbred lines, BILs backcross-derived inbred lines, EUE
early uniform emergence, EV early vigor, GI germination index, GEP germination percentage,
GER germination rate, GRR growth rate, RAL radicle length, RODW root dry weight, ROHD root
hair density, ROHL root hair length, ROL root length, SERUE seed reserve use efficiency, SEDW
seedling dry weight, SHE seedling height, SHDW shoot dry weight, SHFW shoot fresh weight, STL
stem length
rate was detected in 12 genotypes; qFV-10 for seedling height under flooding in
eight genotypes; qFV-3-2 for coleoptile emergence under flooding, qFV-5-2 for
seedling height upon water draining, and RZ395 for mesocotyl elongation in three
genotypes; and qGP-6 for germination percentage in two genotypes. Notably, some
of the genotypes also showed multiple QTLs such as Dinesh with four and Pooja
Sabita and Vivekadhan 62 each with two. Furthermore, Abe et al. (2012) identified
OsGA20ox1 as a candidate gene for seedling vigor in rice. Using RILs from a cross
between Kekashi and Dinghan Shali, the authors identified a putative QTL on chro-
mosome 3, qPHS3-2, which affects 26.2% of the phenotypic variation in seedling
height. This QTL region was then introduced to NILs with a background of an elite
cultivar, Iwatekko. The region was fine-mapped into an 81-kb interval bearing the
OsGA20ox1 gene that is related to gibberellin biosynthesis. Their further analysis
revealed that both Dunghan Shali and the NILs had higher expression of OsGA20ox1
relative to Iwatekko, which suggests the utility of this gene for seedling vigor.
4.4 Breeding Rice with Improved Germination
Genetic studies on traits such as AG, seed longevity, and early seedling vigor have
shown high genetic variation between modern rice varieties, breeding lines, and
traditionally evolved cultivars. Systematic extraction of genes that confer stronger
germination from traditional varieties is required to develop high-yielding varieties
with good crop stand and improved weed competitiveness. With DSR covering a
larger proportion of rice area and quickly becoming an ask of the future, it is clear
that rice varieties have to evolve from their current state and reach much higher
tolerance of adverse conditions during seed germination. Although a large number
of DSR breeding programs target selection for early vigor, a thorough understand-
ing of this trait is most important to make genetic gains. For example, it is believed
that increased seed size allows better germination capacity. However, in the case of
rice, grain shape is an important seed quality and has to be kept in line with the
product requirements of specific environments. This limits the amount of improve-
ment for the trait as the best lines have to be selected within grain shape classes.
This may also lead to higher popularity of varieties with larger grains under
DSR. Similarly, grain pericarp color has been associated with higher AG tolerance
and seed longevity and this needs to be addressed through systematic genetic stud-
ies to be able to develop white rice with better germination and seed longevity. Trait
development and breeding methods must be combined systematically to be able to
leverage the advantage of alleles with major and minor effects.
Figure 7 shows a set of pipelines that allow a systematic flow of required traits
into a breeding program. Since most modern rice varieties are deficient in these
traits, the work begins in the trait development pipeline with the development of a
Fig. 7 Breeding program structure for systematically combining exotic traits in a breeding pro-
gram with minimum linkage drag
phenotyping protocol and donor identification. Once this is complete, adequate

mapping populations are to be developed that can support the identification of
robust QTLs. It is also to be kept in mind during this process that the recipient be
chosen correctly. Ideally, these recipients should have elite genetic backgrounds that
can be used in a breeding program in the future or those DSR-adapted breeding
lines or varieties that are deficient in these traits. Upon the identification of the
QTLs, screening a part of the mapping population in a few key locations can test
their effect in the target environments. This allows developing confidence in the
effect of the QTL and investment in further fine-mapping can be carried out. Fine-
mapped QTL regions and associated markers are delivered to the trait deployment
pipeline, which rapidly develops high-yielding NILs of a wide range of recipient
parents. Ideally, these should be the latest elite breeding lines from the variety
development pipeline. These NILs are entered into the pipeline and checked for
yield potential and trait performance across key testing sites. High-performing NILs
may be advanced for release as well as recycled into the crossing process to develop
the next generation of breeding lines. This cyclic process allows the rapid recycling
of high-performing lines as parents and allows building on the achieved genetic gain
to advance it further. Once released, the varieties developed through this pipeline
are managed through a seed systems team for adequate placement and deployment
in collaboration with national seed systems. This team also collects feedback and
provides it to the above pipeline so that any possible problems can be addressed in
the next wave of varieties. The improvement of breeding lines for seed germination-
related traits is important for both inbred programs and hybrid breeding programs.
Hybrids provide great potential for achieving high yields in direct-seeded environ-
ments. However, for hybrids to be successful in DSR, germination and seedling
survival must be high, and good crop stand be achieved with low seed rates to keep
seed costs down.
All three major groups of traits discussed previously should be targeted to be
able to improve germination under direct-seeded conditions. Although anaerobic
germination is one of the most important traits, it cannot provide the needed robust-
ness without other traits. Early seedling vigor helps to boost the effect of anaerobic
germination and leads to better tolerance. Vigorous and rapidly growing coleoptiles
can emerge from deeper soil layers efficiently and allow more uniform germination.
This is specifically helpful in cases where seeding is mechanized and field prepara-
tions are not adequate. Lastly, higher seed longevity helps in maintaining germina-
tion for relatively older seeds. In cases where farmers use their own seeds, the age
of seeds normally varies from 6 to 8 months. It is observed that although this dura-
tion does not affect germination to a large extent, it may have an effect on early
vigor and anaerobic germination. In some cases where seeds are not adequately
stored, germination may also become affected. It is observed, however, that genetic
variation exists for the trait and it can be harnessed to improve modern varieties
similar to the previous group of traits. In general, multiple donor lines for the three
groups of traits can be crossed to two to three elite recipient lines, each belonging to
a different grain shape group. This will allow the development of nested association
mapping populations with a common recipient parent within the grain shape group.
Trait development activities can then be undertaken to identify and fine-map robust
QTLs for each of the grain shape groups. Finally, the identified QTLs can be intro-
gressed singly or pyramided into the recipient lines and can be further deployed in
the breeding program as donor lines.
5 Conclusions
Globally, DSR systems are of high importance to sustain profitable rice production
under the current agricultural scenario. Declining water and labor resources are
driving rice away from the traditional transplanted system. DSR systems are profit-
able and more amenable to mechanization and are able to decrease water and labor
requirements considerably vis-à-vis transplanted systems. However, rice varieties
require a specific set of traits at various growth stages to be able to accumulate bio-
mass and produce yield. In the absence of such varieties, the full potential of direct-
seeded rice systems cannot be exploited. Further, the use of unsuitable rice varieties
makes these systems risky and vulnerable to crop failure. These result in a low
adoption of the technology despite its obvious benefits. Rice varieties containing
DSR adaptation traits are thus critical to success in these systems.
An important phase in DSR systems is crop establishment. Although the use of
high-yielding varieties is important, this will be futile if crop establishment fails.
This becomes even more important in the case of hybrid rice, for which adoption
depends on the minimization of seed rate and good crop establishment. Anaerobic
germination, seed longevity, and early seedling vigor are some traits relevant to crop
establishment under direct seeding. Anaerobic germination enables the embryo to
sprout and the seedling to survive during anoxia, which can occur upon seeding
when the field is intentionally or accidentally irrigated with water. Seed longevity
renders aging tolerance to seeds, such that the seeds remain viable under tempera-
ture or moisture changes for a longer period. Lastly, early seedling vigor enables the
growing seedlings to quickly emerge from the soil and/or water and gives them
strong early crop establishment and weed competition.
The physiology and genetics of the aforementioned traits have been studied in
the past; however, a lot remains to be unraveled to fully exploit these traits. Further,
there remains a need to use these traits in breeding programs to develop DSR-
specific varieties. This requires well-designed trait development, pre-breeding, and
breeding pipelines with set criteria to advance only the most robust of products. The
success of rice in DSR systems largely depends on the robustness of rice varieties at
early stages to avoid the risk of crop failure and weed competition. Developing rice
varieties with stronger germination capacity under varying conditions is one of the
most important factors that will determine success in this area.
References
Abe A, Takagi H, Fujibe T, Aya K, Kojima M, Sakakibara H et al (2012) OsGA20ox1, a candidate

gene for a major QTL controlling seedling vigor in rice. Theor Appl Genet 125:647–657
Adachi Y, Sugiyama M, Sakagami JI, Fukuda A, Ohe M, Watanabe H (2015) Seed germina-
tion and coleoptile growth of new rice lines adapted to hypoxic conditions. Plant Prod Sci
18:471–475
Aggarwal PK (2008) Global climate change and Indian agriculture: impacts, adaptation and miti-
gation. Indian J Agric Sci 78(11):911
Aggarwal PK, Kumar SN, Pathak H (2010) Impacts of climate change on growth and yield of rice
and wheat in the Upper Ganga Basin. WWF report. WWF, New Delhi, pp 1–44
Akhgari H, Kaviani B (2011) Assessment of direct seeded and transplanting methods of rice culti-
vars in the northern part of Iran. Afr J Agric Res 6(31):6492–6498
Alpi A, Beevers H (1983) Effects of O2 concentration on rice seedlings. Plant Physiol 71(1):30–34
Angaji S (2008) Mapping QTLs for submergence tolerance during germination in rice. Afr J
Biotechnol 7(15):2551–2558
Angaji S, Septiningsih EM, Mackill D, Ismail AM (2010) QTLs associated with tolerance of flood-
ing during germination in rice (Oryza sativa L.). Euphytica 172:159–168
Anumalla M, Anandan A, Pradhan S (2015) Early seedling vigour, an imperative trait for direct-
seeded rice: an overview on physio-morphological parameters and molecular markers. Planta
241(5):1027–1050
Azhiri-Sigari T, Gines H, Sebastian LS, Wade L (2005) Seedling vigor of rice cultivars in response
to seedling depth and soil moisture. Philipp J Crop Sci 30:53–58
Bailly C (2004) Active oxygen species and antioxidants in seed biology. Seed Sci Res 14:93–107
Baltazar M, Ignacio J, Thompson M, Ismail A, Mendioro M, Septiningsih E (2014) QTL mapping
for tolerance to anaerobic germination from IR64 and the aus landrace Nanhi using SNP geno-
typing. Euphytica 197(2):251–260
Barker T (2009) Climate change and EU labor markets. Employment in Europe 2009. EU, Brussels
Barker R, Dawe D, Tuong T, Bhuiyan S, Guerra L (1998) The outlook for water resources in the
year 2020: challenges for research on water management in rice production. In: Assessment
and Orientation Towards the 21st Century. Proceedings of 19th Session of the International
Rice Commission, Cairo, Egypt, 7–9 September 1998. FAO, Rome, pp 96–109
Bewley JD (1997) Seed dormancy and germination. Plant Cell 9:1055–1066
Bouman B, Lampayan R, Tuong T (2007) Water management in irrigated rice: coping with water
scarcity. International Rice Research Institute, Los Baños
Brachi B, Morris GP, Borevitz JO (2011) Genome-wide association studies in plants: the missing
heritability is in the field. Genome Biol 12:232
Chang TT (1991) Findings from a 28-year seed viability experiment. Int Rice Res Newsl 16:5–6
Chavarria G, dos Santos HP (2012) Plant water relations: absorption, trans-
port and control mechanisms. In: Monanaro G (ed) Advances in selected
plant physiology aspects. InTech, Rijeka. ISBN: 978-953-51-0557-2, https://
w w w. i n t e c h o p e n . c o m / b o o k s / a d va n c e s -i n -s e l e c t e d -p l a n t p h y s i o l o g y -a s p e c t s /
plant-water-relations-absorption-transport-and-control-mechanisms
Cheng X, Cheng J, Huang X, Lai Y, Wang L, Du W (2013) Dynamic quantitative trait loci analysis
of seed reserve utilization during three germination stages in rice. PLoS One 8:e80002
Copeland LO, McDonald MB (1995) Seed science and technology, 3rd edn. Chapman and Hall,
London, pp 181–220
Cordero-Lara KI, Kim H, Tai TH (2016) Identification of seedling vigor-associated quantitative
trait loci in temperate japonica rice. Plant Breed Biotechnol 4:426–440
Cui K, Peng S, Xing Y, Xu C, Yu S, Zhang Q (2002a) Molecular dissection of seedling-vigor and
associated physiological traits in rice. Theor Appl Genet 105:745–753
Cui K, Peng S, Xing Y, Yu S, Xu C (2002b) Molecular dissection of relationship between seedling
characteristics and seed size in rice. Acta Bot Sin 44(6):702–707
Debeaujon I, Léon-Kloosterziel KM, Koornneef M (2000) Influence of the testa on seed dormancy,
germination, and longevity in Arabidopsis. Plant Physiol 122(2):403–414
Diwan J, Channbyregowda M, Shenoy V, Salimath P, Bhat R (2013) Molecular mapping of early
vigour related QTLs in rice. Res J Biol 1:24–30
Dixit S, Grondin A, Lee CR, Henry A, Olds TM, Kumar A (2015) Understanding rice adaptation
to varying agro-ecosystems: trait interactions and quantitative trait loci. BMC Genet 16:86
Dixit S, Kumar A, Woldring H (2016) Water scarcity in rice cultivation: current scenario, pos-
sible solutions, and likely impact. In: Regional: development and dissemination of climate-
resilient rice varieties for water-short areas of South Asia and Southeast Asia. International
Rice Research Institute, Los Baños, pp 3–26
Dong XY, Fan SX, Liu J, Wang Q, Li MR, Jiang X, Liu ZY, Yin YC, Wang JY (2017) Identification
of QTLs for seed storability in rice under natural aging conditions using two RILs with the
same parent Shennong 265. J Integr Agric 16(5):1084–1092
El-Hendawy S, Sone C, Ito O, Sakagami J (2011) Evaluation of germination ability in rice seeds
under anaerobic conditions by cluster analysis. Res J Seed Sci 4(2):82–93
Ella ES, Setter TL (1999) Importance of seed carbohydrates in rice seedling establishment under
anoxia. Acta Hortic 504:209–216
Elliott J, Deryng D, Müller C, Frieler K, Konzmann M, Gerten D et al (2014) Constraints and
potentials of future irrigation water availability on agricultural production under climate
change. Proc Natl Acad Sci U S A 111(9):3239–3244
Ellis RH, Hong TD, Roberts EH (1992) The low-moisture-content limit to the negative logarith-
mic relation between seed longevity and moisture content in three subspecies of rice. Ann Bot
69(1):53–58
Exner V, Hennig L (2008) Chromatin rearrangements in development. Curr Opin Plant Biol
11(1):64–69
Fanish SA (2016) Enhancing resource use efficiency (RUE) under direct seeded rice (DSR) sys-
tem: a review. Am Eurasian J Agric Environ Sci 16(9):1534–1544
FAO (2016) AQUASTAT main database. Food and Agriculture Organization of the United Nations
(FAO), Rome. http://www.fao.org/nr/water/aquastat/data/query/index.html?lang=eng
Fukuda A, Kataoka K, Shiratsuchi H, Fukushima A, Yamaguchi H, Mochida H et al (2014) QTLs
for seedling growth of direct seeded rice under submerged and low temperature conditions.
Plant Prod Sci 17(1):41–46
Goufo P, Trindade H (2013) Rice antioxidants: phenolic acids, flavonoids, anthocyanins, proan-
thocyanidins, tocopherols, tocotrienols, c-oryzanol, and phytic acid. Food Sci Nutr 2:75–104
Grigg DE (1974) The agricultural systems of the world: an evolutionary approach. Cambridge
Guo L, Zhu L, Xu Y, Zeng D, Wu P, Qian Q (2004) QTL analysis of seed dormancy in rice (Oryza
sativa L.). Euphytica 140:155–162
Hakata M, Kuroda M, Miyashita T, Yamaguchi T, Kojima M, Sakakibara H et al (2012) Suppression
of alpha-amylase genes improves quality of rice grain ripened under high temperature. Plant
Biotechnol J 10(9):1110–1117
Hameed A, Rasheed A, Gul B, Khan MA (2014) Salinity inhibits seed germination of perennial
halophytes Limonium stocksii and Suaeda fruticosa by reducing water uptake and ascorbate
dependent antioxidant system. Environ Exp Bot 107:32–38
Han L, Qiao Y, Zhang S, Zhang Y, Cao G, Kim J, Lee K, Koh H (2007) Identification of quantita-
tive trail loci for cold response of seedling vigor traits in rice. J Genet Genom 34(3):239–246
Ho V, Tran A, Cardarelli F, Perata P, Pucciariello C (2017) A calcineurin B-like protein participates
in low oxygen signalling in rice. Funct Plant Biol 44(9):917–928
Hsu SK, Tung CW (2015) Genetic mapping of anaerobic germination-associated QTLs controlling
coleoptile elongation in rice. Rice (N Y) 8(1):1–12
Hsu SK, Tung CW (2017) RNA-Seq analysis of diverse rice genotypes to identify the genes con-
trolling coleoptile growth during submerged germination. Front Plant Sci 8:1–15
Huang M, Zhang R, Chen J, Cao F, Jiang L, Zou Y (2017) Morphological and physiological
traits of seeds and seedlings in two rice cultivars with contrasting early vigor. Plant Prod Sci
20(1):95–101
Hwang YS, Thomas B, Rodriguez R (1999) Differential expression of rice α-amylase genes during
seedling development under anoxia. Plant Mol Biol 40:911–920
Illangakoon T, Ella E, Ismail A, Marambe B, Keerthisena R, Bentota A et al (2016) Impact of
variety and seed priming on anaerobic germination-tolerance of rice (Oryza sativa L.) varieties
in Sri Lanka. Trop Agric Res 28(1):26–37
IPCC (2007) Climate change 2007: mitigation. In: Metz B, Davidson OR, Bosch PR, Dave R,
Meyer LA (eds) Working Group III contribution to the Fourth Assessment Report of the
Intergovernmental Panel on Climate Change (IPCC). Technical summary. IPCC, Geneva.
Chapters 3 (Issues related to mitigation in the long term context) and 11 (Mitigation from a
cross sectoral perspective)
Ismail AM, Ella ES, Vergara GV, Mackill DJ (2009) Mechanisms associated with tolerance to
flooding during germination and early seedling growth in rice (Oryza sativa). Ann Bot
103(2):197–209
Ismail AM, Johnson DE, Ella ES, Vergara GV, Baltazar AM (2012) Adaptation to flooding during
emergence and seedling growth in rice and weeds, and implications for crop establishment.
AoB Plants 2012:1–18
Jiang L, Hou MY, Wang CM, Wan JM (2004) Quantitative trail loci and epistatic analysis of seed
anoxia germinability in rice (Oryza sativa). Rice Sci 11(5–6):238–244
Jiang L, Liu S, Hou M, Tang J, Chen L, Zhai H et al (2006) Analysis of QTLs for seed low
temperature germinability and anoxia germinability in rice (Oryza sativa L.). Field Crop Res
98(1):68–75
Jiang W, Lee J, Jin YM, Qiao Y, Piao R, Jang SM, Woo MO, Kwon SW, Liu X, Pan HY, Du X, Koh
HJ (2011) Identification of QTLs for seed germination capability after various storage periods
using two RIL populations in rice. Mol Cell 31:385–392
Juang J, Takano T, Akita S (2000) Expression of α-expansin genes in young seedlings of rice
(Oryza sativa L.). Planta 211(4):467–473
Kang HM, Zaitlen NA, Wade CM, Kirby A, Heckerman D, Daly MJ, Eskin E (2008) Efficient con-
trol of population structure in model organism association mapping. Genetics 178:1709–1723
Kapazoglou A, Drosou V, Argiriou A, Tsaftaris AS (2013) The study of a barley epigenetic regula-
tor, HvDME, in seed development and under drought. BMC Plant Biol 13:172
Kaur J, Singh A (2017) Direct seeded rice: prospects, problems/constraints and researchable issues
in India. Curr Agric Res J 5(1):13–32
Kennedy RA, Barrett SC, Vander Zee D, Rumpho ME (1980) Germination and seedling growth
under anaerobic conditions in Echinochloa crus-galli (barnyard grass). Plant Cell Environ
3:243–248
Kordan HA (1974) Patterns of shoot and root growth in rice seedlings germinating under water. J
Appl Ecol 1(2):685–690
Kreft S, Eckstein D, Melchior I (2016) Global climate risk index 2017: who suffers most from
extreme weather events? Weather-related loss events in 2015 and 1996 to 2015. Germanwatch
Nord-Süd Initiative eV, Bonn
Kretzschmar T, Pelayo MF, Trijatmiko KR, Gabunada LM, Alam R, Jimenez R et al (2015) A
trehalose-6-phosphate phosphatase enhances anaerobic germination tolerance in rice. Nat
Plants 1(9):1–5
Kudahettige N, Pucciariello C, Parlanti S, Alpi A, Perata P (2010) Regulatory interplay of the
Sub1A and CIPK15 pathways in the regulation of α-amylase production in flooded rice plants.
Plant Biol 13(4):611–619
Kumar V, Ladha J (2011) Direct seeding of rice: recent developments and future research needs.
Adv Agron 111:297–413
Kumar SJ, Prasad SR, Banerjee R, Thammineni C (2015) Seed birth to death: dual functions of
reactive oxygen species in seed physiology. Ann Bot 116:663–668
Lasanthi-Kudahettige R, Magneschi L, Loreti E, Gonzali S, Licausi F, Novi G et al (2007)

Transcript profiling of the anoxic rice coleoptile. Plant Physiol 144(1):218–231
Lee HS, Sasaki K, Atsushi H, Ahn SN, Sato T (2012) Mapping and characterization of quantitative
trait loci for mesocotyl elongation in rice (Oryza sativa L.). Rice 5(1):13
Li L, Lin Q, Liu S, Liu X, Wang W, Hang NT, Liu F, Zhao Z, Jiang L, Wan J (2012) Identification
of quantitative trait loci for seed storability in rice (Oryza sativa L.). Plant Breed 131:739–743
Lin Q, Wang W, Ren Y, Jiang Y, Sun A, Qian Y, Zhang Y, He N, Hang NT, Liu Z, Li L, Liu L, Jiang
L, Wan J (2015) Genetic dissection of seed storability using two different populations with a
same parent rice cultivar N22. Breed Sci 65:411–419
Lu CA, Lim EK, Yu SM (1998) Sugar response sequence in the promoter of a rice α-amylase gene
serves as a transcriptional enhancer. J Biol Chem 273:10120–10131
Lu CA, Lin CC, Lee KW, Chen JL, Huang LF, Ho SL et al (2007) The SnRK1A protein kinase
plays a key role in sugar signaling during germination and seedling growth of rice. Plant Cell
19(8):2484–2499
Magneschi L, Perata P (2009) Rice germination and seedling growth in the absence of oxygen.
Ann Bot 103(2):181–196
McDonald MB (1999) Seed deterioration: physiology, repair and assessment. Seed Sci Technol
27:177–237
McQueen-Mason SJ, Cosgrove DJ (1995) Expansin mode of action on cell walls. Plant Physiol
107:87–100
Mekonnen MM, Hoekstra AY (2016) Four billion people facing severe water scarcity. Sci Adv
2(2):e1500323
Miro B, Ismail AM (2013) Tolerance of anaerobic conditions caused by flooding during germina-
tion and early growth in rice (Oryza sativa L.). Front Plant Sci 4:1–18
Mitsui T, Yamaguchi J, Akazawa T (1996) Physicochemical and serological characterization
of alpha-amylase isoforms and identification of their corresponding genes. Plant Physiol
110(4):1395–1404
Miura K, Lin SY, Yano M, Nagamine T (2002) Mapping quantitative trait loci controlling seed
longevity in rice (Oryza sativa L.). Theor Appl Genet 104:981–986
Molden D (2007) Water for food, water for life: a comprehensive assessment of water management
in agriculture. International Water Management Institute, London
Mondoni A, Orsenigo S, Donà M, Balestrazzi A, Probert RJ, Hay FR, Abeli T (2014)
Environmentally induced transgenerational changes in seed longevity: maternal and genetic
influence. Ann Bot 113(7):1257–1263
Nagavarapu T, Keshavulu K, Subba Rao LV, Sengguttuvel P, Maganti SM (2017) Validation of
seedling vigour QTLs in rice (Oryza sativa L.). Curr Trends Biotechnol Pharm 11(1):24–33
Nagel M, Kranner I, Neumann K, Rolletschek H, Seal CE, Colville L, Fernández-Marín B, Börner
A (2015) Genome-wide association mapping and biochemical markers reveal that seed ageing
and longevity are intricately affected by genetic background and developmental and environ-
mental conditions in barley. Plant Cell Environ 38(6):1011–1022
OCHA (2010) Water scarcity and humanitarian action: key emerging trends and challenges. In:
Policy Development and Studies Branch. Occasional policy briefing series No. 4. OCHA,
New York, NY. 15 p
Pal LR, Yu CH, Mount S, Moult J (2015) Insights from GWAS: emerging landscape of mecha-
nisms underlying complex trait disease. BMC Genomics 16(8):1–15
Pathak H, Sankhyan S, Dubey D, Bhatia A, Jain N (2013) Dry direct-seeding of rice for miti-
gating greenhouse gas emission: field experimentation and simulation. Paddy Water Environ
11:593–601
Perata P, Pozueta-Romero J, Akazawa T, Yamaguchi J (1992) Effects of anoxia on starch break-
down in rice and wheat seeds. Planta 188:611–618
Perata P, Geshi N, Yamaguchi J, Akazawa T (1993) Effect of anoxia on the induction of α-amylase
in cereal seeds. Planta 191:402–408
Petla BP, Kamble NU, Kumar M, Verma P, Ghosh S, Singh A, Rao V, Salvi P, Kaur H, Saxena
SC, Majee M (2016) Rice protein L-isoaspartyl O-methyltransferase isoforms differentially
accumulate during seed maturation to restrict deleterious isoAsp and reactive oxygen species
accumulation and are implicated in seed vigor and longevity. New Phytol 211(2):627–645
Pingali PL (2012) Green revolution: impacts, limits, and the path ahead. Proc Natl Acad Sci U S
A 109(31):12302–12308
Redoña E, Mackill D (1996) Mapping quantitative trait loci for seedling vigor in rice using RFLPs.
Rice Knowledge Bank (2017) How to manage water. http://www.knowledgebank.irri.org/
step-by-step-production/growth/water-management
Roberts EH (1961) The viability of rice seed in relation to temperature, moisture content, and
gaseous environment. Ann Bot 25(3):381–390
Sadiq I, Fanucchi F, Paparelli E, Alpi E, Bachi A, Alpi A et al (2011) Proteomic indentification of
differentially expressed proteins in the anoxic rice coleoptile. J Plant Physiol 168:2234–2243
Saika H, Matsumura H, Takano T, Tsutsumi N, Nakazono M (2006) A point mutation of Adh1
gene is involved in the repression of coleoptile elongation under submergence in rice. Breed
Sci 56:69–74
Sandhu N, Torres RO, Sta Cruz MT, Maturan PC, Jain R, Kumar A, Henry A (2014) Traits and
QTLs for development of dry direct-seeded rainfed rice varieties. Exp Bot 66(1):225–244
Sano N, Rajjou L, North HM, Debeaujon I, Marion-Poll A, Seo M (2016) Staying alive: molecular
aspects of seed longevity. Plant Cell Physiol 57(4):660–674
Sasaki K, Fukuta Y, Sato T (2005) Mapping of quantitative trait loci controlling seed longevity of
rice (Oryza sativa L.) after various periods of seed storage. Plant Breed 124:361–366
Sasaki K, Takeuchi Y, Miura K, Yamaguchi T, Ando T, Ebitani A, Higashitani T, Yamaya A, Yano
M, Sato T (2015) Fine mapping of a major quantitative trait locus, qLG-9, that controls seed
longevity in rice (Oryza sativa L.). Theor Appl Genet 128(4):769–778
Sehgal D, Singh R, Rajpal V (2016) Quantitative trait loci mapping in plants: concepts and
approaches. In: Rajpal VR, Rao SR, Raina SN (eds) Molecular breeding for sustainable crop
improvement. Springer International Publishing, Cham, pp 31–59
Septiningsih EM, Ignacio JI, Sendon PM, Sanchez DL, Ismail AM, Mackill DJ (2013) QTL map-
ping and confirmation for tolerance of anaerobic conditions during germination derived from
the rice landrace Ma-Zhan Red. Theor Appl Genet 126:1357–1366
Shingaki-Wells RN, Huang S, Taylor NL, Carroll AJ, Zhou W, Millar A (2011) Differential molec-
ular responses of rice and wheat coleoptiles to anoxia reveal novel metabolic adaptations in
amino acid metabolism for tissue tolerance. Plant Physiol 156:1706–1724
Singh UM, Yadav S, Dixit S, Ramayya P, Devi M, Raman K et al (2017) QTL hotspots for early
vigor and related traits under dry direct-seeded system in rice (Oryza sativa L.). Front Plant
Sci 8:286
Takahashi H, Saika H, Matsumura H, Nagamura Y, Tsutsumi N, Nishizawa NK et al (2011) Cell
division and cell elongation in the coleoptile of rice alcohol dehydrogenase 1-deficient mutant
are reduced under complete submergence. Ann Bot 108(2):253–261
Teng S, Vergara BS, Alejar AA (1992) Relationship of grain length, width, and weight to seedling
vigor in rice (Oryza sativa L.). Philipp J Crop Sci 17(1):17–20
Terashima M, Hosono M, Katoh S (1997) Functional roles of protein domains on rice α-amylase
activity. Appl Microbiol Biotechnol 47(4):364–367
Waffenschmidt S, Woessner JP, Beer K, Goodenough UW (1993) Isodityrosine cross-linking
mediates insolubilization of cell walls in Chlamydomonas. Plant Cell 5(7):809–820
Wang Z, Wang J, Bao Y, Wang F, Zhang H (2010) Quantitative trait loci analysis for rice seed vigor
during the germination stage. J Zhejiang Univ Sci B (Biomed and Biotechnol) 11:958–964
Whitehouse KJ, Hay FR, Ellis RH (2017) High-temperature stress during drying improves subse-
quent rice (Oryza sativa L.) seed longevity. Seed Sci Res 27(4):281–291
Xiao W, Custard KD, Brown RC, Lemmon BE, Harada JJ, Goldberg RB, Fischer RL (2006)
DNA methylation is critical for Arabidopsis embryogenesis and seed viability. Plant Cell
18(4):805–814
Xie L, Tan Z, Zhou Y, Xu R, Feng L, Xing Y et al (2014) Identification and fine mapping of quan-
titative trait loci for seed vigor in germination and seedling establishment in rice. J Integr Plant
Biol 56(8):749–759
Xue Y, Zhang SQ, Yao QH, Peng RH, Xiong AS, Li X, Zhu WM, Zhu YY, Zha DS (2008)
Identification of quantitative trait loci for seed storability in rice (Oryza sativa L.). Euphytica
164:739–744
Yamauchi M (1996) Development of anaerobic direct-seeding technology for rice in the tropics.
Crop research in Asia: achievements and perspectives. In: Proceedings of the 2nd Asian Crop
Science Conference, Fukui, Japan, pp 198–203
Yamauchi M, Winn T (1996) Rice seed vigor and seedling establishment in anaerobic soil. Crop
Sci 36(3):680–686
van Zanten M, Liu Y, Soppe WJ (2013) Epigenetic signalling during the life of seeds. In: Epigenetic
memory and control in plants. Springer, Berlin, pp 127–153
Zhang Z, Su L, Li W, Chen W, Zhu Y (2005) A major QTL conferring cold tolerance at the early
seedling stage using recombinant inbred lines of rice (Oryza sativa L.). Plant Sci 168:527–534
Zhou L, Wang J-K, Yi Q, Wang Y-Z, Zhu Y-G, Zhang Z-H (2007) Quantitative trait loci for seed-
ling vigor in rice under field conditions. Field Crop Res 100(2–3):294–301
The images or other third party material in this chapter are included in the chapter’s Creative
included in the chapter’s Creative Commons license and your intended use is not permitted by
Genetics and Breeding of Heat Tolerance
in Rice
Changrong Ye, Xiaolin Li, Edilberto Redoña, Tsutomu Ishimaru,

and Krishna Jagadish
Abstract Extreme weather events, especially heat waves, have become more fre-
quent with global warming. High temperature significantly affects world food secu-
rity by decreasing crop yield. Rice is intensively planted in tropical and subtropical
areas in Asia, where high temperature has become a major factor affecting rice
production. Rice is sensitive to high temperature, especially at booting and flower-
ing stages. Rice varieties tolerant of high temperature are rare, and only a few heat-
tolerant rice varieties have been identified. High temperature at booting and
flowering stages causes sterile pollen, decreased pollen shedding, and poor pollen
germination, which finally lead to a yield decrease. Heat-tolerant QTLs have been
identified in different studies, but new breeding lines with considerable heat toler-
ance have not been bred using identified heat-tolerance donors and QTLs. Research
on heat-tolerant donor identification, QTL mapping, gene cloning, and large-scale
phenotyping technology is important for developing heat-tolerant rice varieties.
Keywords Rice · Heat tolerance · Global warming · High temperature
C. Ye (*)
Center for Molecular Breeding Technology Invention and Development, Huazhi
Biotechnology Co. Ltd., Changsha, Hunan, China
X. Li
Institute of Food Crops, Yunnan Academy of Agricultural Sciences, Kunming, Yunnan, China
E. Redoña
Delta Research and Extension Center, Mississippi State University, Stoneville, MS, USA
T. Ishimaru
Hokuriku Research Station, Central Region Agricultural Research Center, National
Agriculture and Food Research Organization, Niigata, Japan
K. Jagadish
Department of Agronomy, Kansas State University, Manhattan, KS, USA

https://doi.org/10.1007/978-3-030-66530-2_7
204 C. Ye et al.
Global temperature has been increasing rapidly since the last century, and high tem-
perature has become a major factor affecting agricultural production. Rice is one of
the crops most affected by high temperature. Heat tolerance of rice has been studied
since the 1970s, but the progress attained has been quite slow. Evaluation of rice
heat tolerance at different growth stages revealed that flowering stage is the most
sensitive stage, and booting stage is the second most sensitive stage (Yang and
Heilman 1993; Yoshida et al. 1981). Thus, recent findings and future prospects on
heat tolerance of rice at these reproductive stages are the main focus in this review.
1 Climate Change and Global Warming
Climate change is the long-term change in weather patterns. Climate change is

caused by factors such as biotic processes, variations in solar radiation received by
Earth, plate tectonics, and volcanic eruptions. Certain human activities have been
identified as primary causes of ongoing climate change, often referred to as global
warming (Pachauri and Reisinger 2007).
Global warming is the long-term rise in the average temperature of Earth’s cli-
mate system. Climate proxies show that the temperature had been relatively stable
over 1000 or 2000 years before 1850. From 1880 to 2012, the global average (land
and ocean) surface temperature increased by 0.85 (0.65–1.06) °C. From 1906 to
2005, Earth’s average surface temperature rose by 0.74 ± 0.18 °C (Solomon et al.
2007). Since the early twentieth century, Earth’s mean surface temperature has
increased by 0.8 °C, with 0.6 °C of this hike occurring since 1980 (Jansen et al.
2007). Human influence has been the dominant cause of the observed warming
since the mid-twentieth century (IPCC 2013). The largest human influence has been
the emission of greenhouse gases (GHG) such as carbon dioxide, methane, and
nitrous oxide. The greenhouse effect is the process by which absorption and emis-
sion of infrared radiation by gases in a planet’s atmosphere warm its lower atmo-
sphere and surface. Global mean surface temperatures for 2081–2100, relative to
1986–2005, are likely to increase by 0.3–1.7 °C for the lowest and by 2.6–4.8 °C for
the highest GHG emission scenarios (IPCC 2013).
Global warming caused by human activities has become a major constraint for
agricultural development and crop production. Studies have shown that the annual
mean maximum and minimum temperatures increased by 0.35 and 1.13 °C for the
period 1979–2003 at the International Rice Research Institute, Los Baños,
Philippines (Peng et al. 2004). By 2080, most cropping areas in the world are likely
to be exposed to record average air temperature (Battisti and Naylor 2009).
Relatively small changes in mean temperature can result in disproportionately large
changes in the frequency of extreme events (Rosenzweig et al. 2001). These extreme
temperature events are likely to become more frequent with global warming (Tabaldi
et al. 2006). Of the 13 warmest years since 1880, 11 occurred from 2001 to 2011
(i.e., every year starting with 2001), while 2011 was the warmest La Niña year in
the period from 1950 to 2011 (NOAA 2011).
Genetics and Breeding of Heat Tolerance in Rice 205
Future climate change and associated impacts will differ from region to region.
Anticipated effects include increasing global temperature, rising sea level, changing
precipitation, and expansion of deserts in the subtropics (IPCC 2014). Other likely
changes involve more frequent extreme weather events such as heat waves, droughts,
heavy rainfall with floods, heavy snowfall, ocean acidification, and species extinc-
tions due to shifting temperature regimes. Effects significant to human beings are
the threat to food security from decreasing crop yields (Battisti and Naylor 2009).
2 Rice Production and Heat Damage
Rice is the most widely produced and consumed staple food for a large part of the
world’s human population, providing more than 20% of the calories. Rice is widely
planted around the world, with about 90% of the total production from Asia (south-
ern Asia 31.44%, East Asia 30.68%, Southeast Asia 27.75%, and West and Central
Asia 0.27%), 4.86% from the Americas, 4.39% from Africa, 0.57% from Europe,
and 0.04% from Oceania (data for 2016 from FAO statistics).
The world’s top rice producers are mainly in Asia. Many of these Asian countries
are located in the tropics and subtropics, where the temperature is high during the
rice crop season, including part of China, India, Indonesia, Bangladesh, Vietnam,
Myanmar, Thailand, the Philippines, Cambodia, Lao PDR, and Sri Lanka.
Temperature stress is a complex interaction of temperature intensity, duration,
rapidity, and plant growth stage. Damage from extreme high temperature is particu-
larly severe when it occurs at critical crop developmental stages, particularly the
reproductive period. Optimum temperature is 20–30 °C during the reproductive
stage, but temperatures surpassing 35 °C have critical negative effects on rice
growth. High daytime temperatures in some of the major tropical rice-growing
regions are already close to the threshold beyond which yield begins to decline
(Prasad et al. 2006; Wassmann et al. 2009a).
Rice has been cultivated in a wide range of climatic environments. High tem-
perature has more effects in the tropics and low-altitude valleys in some of the
temperate regions. Above 32 °C, spikelet sterility becomes a major factor affecting
rice yield, even if sufficient growth occurs in other yield components (Matthews
et al. 1995). Traditionally, farmers grow rice at optimal seasonal temperatures to
maximize grain yield. However, with the increase in the frequency of extreme tem-
perature events, climate change may increase the probability of overlapping peaks
of temperature and the flowering period, which diminishes final yield (Teixeira
et al. 2011).
Although there has been no systematic monitoring and evaluation of temperature
stress-induced yield losses worldwide, heat-vulnerable regions were geographically
mapped based on the critical temperatures at flowering stage (Jagadish et al. 2014;
Laborte et al. 2012; Wassmann et al. 2009a). Regional high-temperature damage
was observed in many tropical and subtropical countries, such as Pakistan, India,
Bangladesh, China, Thailand, Laos, Japan, Sudan, Australia, and the United States
206 C. Ye et al.
(Hasegawa et al. 2009; Ishimaru et al. 2016; Matsushima et al. 1982; Osada et al.
1973; Tian et al. 2009). Analysis of temperature and rice yield during 1992–2003 at
the International Rice Research Institute (IRRI) showed that rice grain yield declined
by 10% for each 1 °C increase in growing-season minimum temperature (Peng et al.
2004). Tian et al. (2009) reported that at least six severe heat events damaged the
rice crop in the past 50 years in China. Studies on the Yangtze River basin in China
showed that an estimated 3 million ha of rice were damaged and 5.18 million tons
of paddy rice were lost in 2003 because of a heat wave with the temperature above
38 °C lasting for more than 20 days (Li et al. 2004; Xia and Qi 2004; Yang et al.
2004). In Laos and southern India, the combined stress of heat and intense solar
radiation during daytime increases the spikelet sterility of local popular cultivars
when heading coincides with high temperatures (Ishimaru et al. 2016). In the record
hot summer of 2007, the percentage of spikelet sterility rose to 25% when the maxi-
mum daily temperature was around 38 °C in the temperate regions of Japan
(Hasegawa et al. 2011). High temperature after heading significantly decreased rice
grain quality in many rice-growing regions of Japan in 2010 (Morita et al. 2016).
Thus, heat stress at flowering is a real threat to sustained rice production not only in
tropical and subtropical regions but also in temperate regions.
The effect of extreme temperature events on crop production is likely to become
more frequent in the near future. Significant yield losses have also been predicted
by using different crop models. Short-term predictions indicated that, by 2030, rice
production in South Asia could decrease by up to 10% (Lobell et al. 2008). Medium-
to long-term predictions, that is, by 2080, estimated rice yields in developing coun-
tries to decrease by 10–25%, while yields in India could drop by 30–40% (Cline
2008). By 2100, rice and maize yields in the tropics are expected to decrease by
20–40% because of higher temperatures, without accounting for the decrease in
yields as a result of drought enhanced by temperature increases (Battisti and Naylor
2009). Spatial model simulation indicated that yield of boro rice in Bangladesh
could decrease by 20% and 50% by 2050 and 2070, respectively (Basak et al. 2010),
and, on average, rice yields could decline by up to 33% by 2081–2100 (Karim
et al. 2012).
Besides high day temperatures, night temperatures greater than 29 °C can
decrease spikelet fertility in rice with a subsequent decrease in seed set and grain
yield (Satake and Yoshida 1978; Ziska et al. 1996). The increase in night tempera-
ture from 27 to 32 °C decreased grain length and grain width, thereby decreasing
grain yield (Counce et al. 2005; Mohammed and Tarpley 2011; Morita et al. 2005).
3 Heat Tolerance of Rice
Heat tolerance is defined as the ability of the plant to grow and produce economic
yield at high temperature (Wahid et al. 2007). The developmental stage at which the
plant is exposed to heat stress determines the severity of the possible damage to the
crop (Wahid et al. 2007). High temperature causes injury to the rice plant at
different growth stages, such as poor germination, retarded seedling growth, leaf
yellowing, inhibited rooting and tillering, inhibited panicle initiation and develop-
ment, spikelet degeneration, disturbed pollen formation, poor panicle exsertion,
inhibited anther dehiscence and pollination, and poor grain filling and development
(Yang and Heilman 1993; Yoshida et al. 1981). Thus, heat tolerance is actually the
responses of different traits to high temperature at different growth stages, for exam-
ple, seedling growth or survival at the seedling stage, spikelet fertility at the repro-
ductive stage, and chalkiness of grains at the grain-filling stage (Ishimaru et al.
2009; Lanning et al. 2011). At the grain-filling stage, high temperature affects cel-
lular and developmental processes, leading to decreased fertility and grain quality
(Barnabas et al. 2008). Decreased grain weight, decreased grain filling, and higher
percentage of chalky grains are common effects of exposure to high temperature
during the ripening stage in rice (Osada et al. 1973; Yoshida et al. 1981). In addition,
increased temperature causes a serious decrease in grain size and amylase content
(Yamakawa et al. 2007; Zhu et al. 2005).
Rice is relatively tolerant of high temperatures during the vegetative phase
(Prasad et al. 2006; Yoshida et al. 1981), but is highly susceptible during the repro-
ductive phase, particularly at flowering stage (Jagadish et al. 2008; Matsui et al.
2001b). High temperature surpassing 35 °C during flowering stage increases pollen
and spikelet sterility, which leads to significant yield losses, low grain quality, and
low harvest index (Matsui et al. 1997a, b; Matsushima et al. 1982; Osada et al. 1973;
Prasad et al. 2006; Zhong et al. 2005). The response of spikelet fertility is a major
factor determining rice production under high-temperature conditions. Thus, spike-
let fertility at high temperature has been widely used as a screening index for heat
tolerance at the reproductive stage (Prasad et al. 2006).
Wide genetic variation exists in tolerance of heat stress (Matsui and Omasa
2002). Large cultivar variation exists in spikelet sensitivity to high-temperature
damage, and the primary cause of this cultivar variation in heat tolerance at flower-
ing is the number of viable pollen grains shed on the stigma, which is positively
correlated with basal anther dehiscence (Matsui 2009).
It has been suggested that indica varieties are more tolerant of higher tempera-
tures than japonica cultivars (Matsui et al. 2000; Satake and Yoshida 1978), although
heat-tolerant genotypes have been found in both subspecies (Matsui et al. 2001b;
Prasad et al. 2006).
Humidity also plays an important role in rice yield, as higher relative humidity
(RH) at the flowering stage at increased temperature affects spikelet fertility nega-
tively (Yan et al. 2010). Field observations in some high-yielding rice areas with a
drier climate and high temperatures (e.g., New South Wales and southern Iran) sug-
gested no significant increase in spikelet sterility even at temperatures above 40 °C
(Wassmann et al. 2009b). The fertility of spikelets at high air temperatures decreased
further with increased humidity (Matsui et al. 1997a; Nishiyama and Satake 1981).
An RH of 85–90% at the heading stage induced almost complete grain sterility in
rice at a day/night temperature of 35/30 °C (Abeysiriwardena et al. 2002). Increasing
both air temperature and RH significantly increased spikelet sterility, while high
temperature-induced sterility decreased significantly with decreasing RH. A
208 C. Ye et al.
reduction in sterility with decreased RH was more due to decreased spikelet tem-
perature than to air temperature. Thus, both air temperature and humidity are equally
important in determining pollen viability, splitting of anthers, pollen shedding, and
spikelet sterility in rice. The impact of RH should be considered when interpreting
the effect of high temperature on grain sterility.
Heat tolerance at flowering is often tested at 37.5–38.0 °C (with relative humid-
ity of 60–70%) to have a great contrast in spikelet fertility between susceptible and
tolerant genotypes (Mackill et al. 1982; Satake and Yoshida 1978; Ye et al. 2015b,
2012). At the booting stage, 38 °C is a threshold for most rice varieties. Similarly,
we confirmed that 37 °C is a threshold at flowering stage for most varieties. Above
this limit, pollen development will fail and spikelet fertility will decline signifi-
cantly (Ye et al. 2015b).
4 Heat-Tolerant Rice Genetic Resources
The response of rice to high temperatures differs according to the developmental

stage. High-temperature tolerance at one developmental stage may or may not nec-
essarily lead to tolerance during other stages (Wassmann et al. 2009a). Hence, the
effect of high temperature during different developmental stages has to be parti-
tioned and evaluated separately for assessing, identifying, and characterizing for
genetic manipulation of tolerance mechanisms (Wahid et al. 2007). Since flowering
stage is the most sensitive stage to high temperature, most screenings for heat-
tolerant germplasm were done at flowering stage.
Rice genetic resources tolerant of high temperature have been identified in both
indica (Matsui et al. 1997b) and japonica subspecies (Matsui et al. 2001b). N22 and
Dular are excellent sources of genes for heat tolerance (Manigbas et al. 2014).
Among the heat-tolerant varieties, N22, an Indian aus-type landrace, was identified
as one of the most heat-tolerant genotypes in both chamber and open-field experi-
ments (Jagadish et al. 2010a; Mackill et al. 1982; Manigbas et al. 2014; Poli et al.
2013; Prasad et al. 2006; Ye et al. 2012; Yoshida et al. 1981). N22 has been used as
a check variety for many studies on heat tolerance. Akitakomachi is the most toler-
ant genotype found among japonica rice (Matsui et al. 2001b).
A recent investigation using a representative set of popular cultivars grown
across highly vulnerable rice-growing regions of South and Southeast Asia, Latin
America, and West Africa concluded that most of the popular rice cultivars were
susceptible to heat stress at reproductive stages (Shi et al. 2015). More than 80% of
hybrid rice combinations in China are heat-susceptible, but some heat-tolerant com-
binations were found in hybrid rice (Hu et al. 2012; Zhou et al. 2009). The hybrid
rice Guodao 6 was considered as a heat-tolerant variety (Tao et al. 2008). An acces-
sion of wild rice, Oryza meridionalis Ng, was also identified as a heat-tolerant spe-
cies (Scafaro et al. 2010).
In japonica cultivars, Akitakomachi, Nipponbare, Hitomebore, and Todorokiwase
(Maruyama et al. 2013; Matsui et al. 2001b; Tenorio et al. 2013) are classified as
heat-tolerant genotypes. In indica cultivars, IR24, IR36, Ciherang, ADT36, BG90-2,

Dular, Huanghuazhan, AUS17, M9962, Sonalee, and AUS16 (Cao et al. 2008;
Cheabu et al. 2018; Maruyama et al. 2013; Shi et al. 2015; Tenorio et al. 2013) are
known as heat-tolerant genotypes. It is notable that Giza178, an Egyptian cultivar
developed from a japonica-indica cross, has considerable heat tolerance at booting
stage as well as flowering stage (Tenorio et al. 2013).
Varieties such as Agbede, Carreon, Dular, N22, OS4, P1215936, and Sintiane
Diofor have high spikelet fertility even at high temperatures (Yoshida et al. 1981).
The local Iranian landraces Anbori and Hoveaze (probably the same as Hoveyzeh)
are tolerant of high temperatures (Gilani et al. 2009). Cultivars KRN, Citanduy,
Belle patna, and BPB were tolerant of high-temperature treatment at the ripening
stage (Zakaria et al. 2002). An indica cultivar (HT54) from China was tolerant of
high temperature at both seedling and grain-filling stages. HT54 seedlings could
tolerate high temperature up to 48 °C for 79 h (Wei et al. 2013). New Rice for Africa
line 44 (NERICA-L-44) was also identified as heat tolerant at both vegetative and
reproductive stages (Bahuguna et al. 2015).
As part of IRRI’s initiative to develop improved breeding lines tolerant of high
temperature, studies were conducted to identify genetic donors of the heat-tolerance
trait from the IRRI Genebank. A series of trials were conducted using a set of 455
IRRI Genebank accessions coming from “hot”’ countries (Pakistan, India,
Afghanistan, Iran, and Iraq). However, few varieties (about 5%) showed some
degree of heat tolerance. Twenty-three accessions were selected as potential donors
for heat tolerance. Dular and Todorokiwase are tolerant at the booting stage, while
Milyang23 and IR2006-P12-12-2-2 are tolerant at the flowering stage. Giza178 is
tolerant at both booting and flowering stages. Darbari Roodbar, Larome, Mulai,
Giza178, IR2006-P-12-12-2-2, Milyang23, and Todorokiwase were tolerant of high
temperature in the field and growth chambers. Other potential donors identified
based on at least one trait were IR22, IR2307-247-2-2-3, IR6, IR8, MRC603-383,
Ganjay, Todorokiwase, Giza 178, Giza 159, and Toor Thulla (Tenorio et al. 2013).
The accessions with heat tolerance at booting and flowering stage are useful geno-
types for a breeding program to improve heat resilience in terms of spikelet sterility.
5 Physiology of Heat Tolerance in Rice
Flowering stage is the most susceptible to high temperatures, followed by booting

stage. High temperature is more injurious if it occurs just before or during anthesis
(Satake and Yoshida 1978). Exposure to 41 °C for 4 h at flowering caused irrevers-
ible damage and plants became completely sterile, whereas this high temperature
(41 °C) had no effect on spikelet fertility at 1 day before or after flowering (Yoshida
et al. 1981). The same study also found that pollination of heat-stressed stigmas
with unstressed pollen as well as self-pollination at 1 h before heat stress application
did not affect spikelet fertility. These analyses indicated that the heat-sensitive stage
is about 1 h before and after flowering. High temperature affects anther dehiscence,
210 C. Ye et al.
pollination, and pollen germination, which then leads to spikelet sterility and yield
loss (Yoshida et al. 1981). Exposure at anthesis even for just 1–2 h of high tempera-
ture may result in high spikelet sterility (Jagadish et al. 2007).
High temperature at booting stage mainly decreases the fertility of pollen grains,
while at flowering stage, it mainly decreases the number of pollens shedding on the
stigma and the germination of pollen grains. The decreased production of pollens at
elevated temperatures may be attributable to impaired cell division of the micro-
spore mother cells (Takeoka et al. 1992). The major causes of high temperature-
induced sterility were decreased pollen shedding and decreased viability of pollen
grains, resulting in a lower number of germinated pollen grains on the stigma
(Mackill et al. 1982; Satake and Yoshida 1978).
Among physiological processes occurring at anthesis, anther dehiscence is per-
ceived to be the most critical stage affected by high temperature (Matsui et al.
1997a, b, 2000, 2001a). Spikelet opening triggers rapid pollen swelling, leading to
anther dehiscence and pollen shedding from the anthers’ apical and basal pores
(Matsui et al. 2000). Increased basal pore length in a dehisced anther was found to
contribute significantly to successful pollination (Matsui and Omasa 2002). The
anthers of heat-tolerant cultivars dehisce more easily than those of susceptible cul-
tivars under high-temperature conditions (Mackill et al. 1982; Matsui et al. 1997a,
b, 2001b; Satake and Yoshida 1978). This is because of the tight closure of the loc-
ule by the cell layers, which delays locule opening and decreases spikelet fertility at
high temperature (Matsui and Omasa 2002).
In heat-tolerant cultivar N22, the dehiscence of anthers begins soon after the
glumes open and is completed when the anthers are still situated inside the glumes
on short filaments; thus, pollen grains of N22 could be easily shed onto stigma at
that time (Satake and Yoshida 1978). The heat-tolerant cultivar Nipponbare had
well-developed cavities in anthers and thick locule walls, which enabled easy rup-
ture of the septa in response to swelling of pollen (Matsui et al. 2001b).
Rice plants, when exposed to high temperatures during critical stages, can avoid
heat by maintaining their microclimate temperature below critical levels by efficient
transpiration cooling (Wassmann et al. 2009a). Lower relative humidity of 60% at
38 °C leads to a higher vapor pressure deficit, facilitating the plant in exploiting its
transpiration cooling ability (Jagadish et al. 2007). On the basis of the interaction
between high temperature and relative humidity, rice cultivation regions in the trop-
ics and subtropics can be classified into hot/dry and hot/humid regions. It can be
assumed that rice cultivation in hot/dry regions where temperatures may exceed
40 °C (e.g., Pakistan, Iran, and India) has been facilitated through unintentional
selection for efficient transpiration cooling under sufficient supply of water. An
exceptionally high temperature difference of 6.8 °C between crop canopy and ambi-
ent air temperature (34.5 °C) was recorded in the Riverina region of New South
Wales, Australia (Matsui et al. 2007). Rice pollen is extremely sensitive to tempera-
ture and relative humidity and loses its viability within 10 min of shedding (Matsui
et al. 1997a). Tolerant cultivar Shanyou63 showed a significantly slower decrease in
pollen activity, pollen germination, and rate of floret fertility vis-à-vis susceptible
cultivar Teyou559 at 39 °C (Tang et al. 2008).
The temperature inside the spikelet decreases with a reduction in relative humid-
ity, possibly because of the enhancement of transpiration at low relative humidity
(Weerakoon et al. 2008). This decrease in temperature inside the spikelet increases
the viability of pollen grains. Viable pollen grains absorb moisture and swell at
moderate to high relative humidity and create the required pressure for the rupture
of the septum, which helps in the deposition of pollen on stigma and thus produces
a fertilized spikelet (Weerakoon et al. 2008). The panicle temperature of Chinese
hybrid rice exceeded the ambient air temperature by 4 °C under humid and low
wind conditions and also caused a severe decrease in spikelet fertility (Tian
et al. 2010).
Cultivar NL-44 has high heat tolerance at both vegetative and reproductive
stages. NL-44 under extreme heat stress retained the ability to maintain higher chlo-
rophyll (relative greenness) and photosynthesis, a feature that could sustain its sur-
vival under severe heat stress during both the vegetative and reproductive stages.
NL-44 and the heat-tolerant check N22 consistently displayed lower membrane
damage and higher antioxidant enzyme activity across leaves and spikelets
(Bahuguna et al. 2015).
6 Genetics of Heat Tolerance in Rice
Heat tolerance is controlled by not only one major gene but also several genes.
The identification of quantitative trait loci (QTLs) is a promising approach to
dissect the genetic basis of heat tolerance. By using genetic resources with heat
tolerance at flowering, QTL mapping studies for heat tolerance (spikelet fertil-
ity) have been conducted on various rice populations at booting (Zhao et al.
2006) and flowering stages (Cao et al. 2003; Chen et al. 2008; Cheng et al. 2012;
Jagadish et al. 2010a; Xiao et al. 2011b; Ye et al. 2015b, 2012; Zhang et al.
2009, 2008). About 60 QTLs associated with heat tolerance at flowering stage
have been identified so far. For example, two major QTLs were identified on
chromosome 1 (qHTSF1.1) and chromosome 4 (qHTSF4.1) in an IR64/N22
population. These two major QTLs could explain 12.6% (qHTSF1.1) and 17.6%
(qHTSF4.1) of the variation in spikelet fertility at high temperature (Ye et al.
2012). Four QTLs were identified in an IR64/Giza178 population, two other
QTLs were identified in a Milyang23/Giza178 population, and five QTLs were
identified in the three-way cross population IR64//Milyang23/Giza178. Three
of these QTLs were identified in both biparental and three-way populations (Ye
et al. 2015b). Recently, two QTLs with high genetic effect (qSTIPSS9.1 and
qSTIY5.1/qSSIY5.2) were mapped in less than 400 kbp genomic regions
(Shanmugavadivel et al. 2017). QTLs for other heat tolerance-related traits such
as anther length, apical dehiscence length, basal dehiscence length, and percent-
age of longitudinal dehiscence (Tanveer et al. 2015) and pollen fertility (Xiao
et al. 2011a) were also detected.
212 C. Ye et al.
Among the several identified QTLs, the most promising QTLs for heat toler-
ance across different genetic backgrounds and locations have been identified on
chromosomes 1 and 4 (Jagadish et al. 2010a; Xiao et al. 2011b; Ye et al. 2015b,
2012). The heat-tolerant QTL (qHTSF4.1) on chromosome 4 was identified in
different populations of heat-tolerant rice varieties 996, N22, Milyang23, and
Giza178 (Raddatz et al. 2001; Xiao et al. 2011b; Ye et al. 2012). The QTL inter-
val was fine-mapped to 1.2 Mb. The heat tolerance (spikelet fertility) of the
near-isogenic line (NIL) carrying qHTSF4.1 increased consistently in all of the
backcross populations. In BC3F3, the spikelet fertility of plants with qHTSF4.1
(34.7 ± 14.2%) was significantly higher than in those without the QTL
(22.5 ± 7.9%) and in the recurrent parent IR64 (15.1 ± 6.3%), whereas, in BC5F2,
the spikelet fertility of plants with qHTSF4.1 (44.6 ± 13.1%) was significantly
higher than in plants without the QTL (27.1 ± 9.6%) and in the recurrent parent
IR64 (19.4 ± 8.4%) (Ye et al. 2015a).
Recently, a thermotolerance gene (TT1) in African rice (O. glaberrima) vari-
ety CG14 was identified and cloned (Li et al. 2015). Gene TT1 encodes an α2
subunit of the 26S proteasome involved in the degradation of ubiquitinated pro-
teins. Ubiquitylome analysis indicated that OgTT1 protects cells from heat stress
through more efficient elimination of cytotoxic denatured proteins and more
effective maintenance of heat-response processes than achieved with OsTT1.
Overexpression of OgTT1 was associated with markedly enhanced thermotoler-
ance in rice at seedling, flowering, and grain-filling stages (Li et al. 2015). A
gene for heat tolerance at seedling stage (OsHTAS) was also cloned and charac-
terized. OsHTAS encodes a ubiquitin ligase localized in the nucleus and cyto-
plasm. OsHTAS was responsive to multiple stresses and was strongly induced by
exogenous ABA. OsHTAS modulated hydrogen peroxide accumulation in shoots,
altered the stomatal aperture status of rice leaves, and promoted ABA biosynthe-
sis. The RING finger ubiquitin E3 ligase OsHTAS functions in leaf blades to
enhance heat tolerance through modulation of hydrogen peroxide-induced sto-
matal closure and is involved in both ABA-dependent and drought- and salt-tol-
erance-mediated pathways (Liu et al. 2016).
Reverse genetic approaches were also employed to identify the genes for heat
tolerance at anthesis. Expression analyses revealed that at least 13 genes were des-
ignated as high temperature-repressed genes in the anther. These genes were
expressed specifically in the immature anther, mainly in the tapetum at the micro-
spore stage, and downregulated after 1 day of high temperature. High temperatures
may disrupt some of the tapetum functions required for pollen adhesion and germi-
nation on the stigma (Endo et al. 2009).
A proteomic analysis compared proteins expressed in heat-stressed anthers from
three rice varieties with different temperature tolerances. The temperature-tolerant
rice genotype (N22) showed a higher accumulation of small heat shock proteins
(sHSP) than the temperature-sensitive rice genotype (Moroberekan). The moder-
ately tolerant rice genotype (IR64) showed intermediate sHSP accumulation. The
accumulation of sHSP may confer greater heat tolerance in N22 rice (Jagadish
et al. 2010b).
7 Breeding of Heat Tolerance in Rice
Breeding heat-tolerant rice is one of the most important strategies used to mitigate
the effects of climate change, particularly in the hot Asian countries where most rice
is grown. However, breeding rice varieties tolerant of high temperature has so far
received little attention as compared to other abiotic stresses such as drought and
salinity. After one comprehensive study in the early 1980s (Mackill 1981; Mackill
and Coffman 1983; Mackill et al. 1982), high-temperature tolerance of rice has been
treated only within region-specific breeding programs, with limited success. Using
identified genetic resources and QTLs to improve heat tolerance in rice varieties has
not been achieved.
QTLs for rice heat tolerance at flowering have been mapped on all chromosomes
by using various rice populations (Cao et al. 2003; Chen et al. 2008; Cheng et al.
2012; Jagadish et al. 2010a; Xiao et al. 2011b; Zhang et al. 2009, 2008). However,
the additive effect of each QTL is low. Introducing one or a few QTLs into a variety
may not sufficiently increase its heat tolerance. Therefore, it is necessary to validate
and characterize more QTLs and design SNP chips with QTL-linked markers to
accelerate selection and incorporation of multiple QTLs to improve the efficiency of
heat-tolerance breeding.
To mitigate heat-induced spikelet sterility, two strategies have been proposed.
One is to develop cultivars that shed larger numbers of pollen grains or produce pol-
len grains able to germinate at high temperatures. Another strategy is to breed culti-
vars that escape heat at flowering because of their early-morning flowering (EMF)
trait (Satake and Yoshida 1978). The EMF trait could be beneficial for decreasing
yield loss from rising temperatures. The use of germplasm with the EMF trait could
help to diminish anticipated yield losses caused by spikelet sterility at anthesis as a
result of expected global warming (Ishimaru et al. 2010).
Spikelets are highly susceptible to heat stress at flowering; however, they remain
fertile when flowering occurs 1 h prior to heat stress, because fertilization is com-
pleted within 1 h after flowering (Satake and Yoshida 1978). Shifting the time of
anthesis to early hours of the cooler morning will help plants to escape high-
temperature stress during processes of pollen shed, pollination, and fertilization and
can thus minimize sterility caused by high temperatures. It has been suggested that
there is a potential for genetic improvement to advance flowering to an earlier time
of day in current high-yielding cultivars (Nishiyama and Blanco 1980). The EMF
strategy has been used to produce introgression lines with the EMF trait transferred
from wild rice O. officinalis. EMF NILs carrying qEMF3 had earlier flower opening
time by 1.5–2.0 h than recurrent parents, which decreased heat-induced sterility at
flowering at elevated temperature. It was demonstrated that the shift in flower open-
ing time to early morning is effective for escaping from heat stress at flower opening
(Hirabayashi et al. 2015; Ishimaru et al. 2010). Pyramiding lines with QTLs for heat
tolerance (qHTSF4.1) and EMF (qEMF3) effectively improved heat tolerance at
flowering in both controlled and field conditions.
214 C. Ye et al.
The development of new heat-tolerant rice varieties is among the best approaches
to address changing climatic conditions in affected farming communities. Breeding
heat-tolerant rice began in 2010 in the Philippines to develop new rice genotypes
that could adapt to changing climatic and local farming conditions. By combining a
heat-tolerant donor parent, such as N22, with high-yielding and better cultivars,
selecting new genotypes with better adaptation to emerging climatic conditions is
possible (Manigbas et al. 2014).
To increase the heat tolerance of a rice variety named Improved White Ponni
(IWP), heat-tolerance QTLs qHTSF1.1 and qHTSF4.1 (Ye et al. 2012) were intro-
gressed from Nagina 22 into IWP through marker-assisted breeding. The progenies
harboring both qHTSF1.1 and qHTSF4.1 showed higher fertility percentages under
high-temperature stress at the flowering stage. The results confirmed that these
QTLs were responsible for maintaining membrane integrity and yield under
elevated-temperature conditions (Vivitha et al. 2017).
Moreover, recent studies showed that heat tolerance at flowering stage in rice is
controlled by recessive genes (Fu et al. 2015; Ye et al. 2015b, 2012). Thus, both
parents should possess high-temperature tolerance to develop heat-tolerant F1 com-
binations. Male parents play a more important role in heat-tolerant combinations
than female parents. The heat susceptibility of hybrid rice in China is mainly due to
the wide application of heat-susceptible restorer lines with high yield in three-line
hybrid rice breeding (Fu et al. 2015). Therefore, it is important to improve the heat
tolerance of both parents of hybrid rice combinations.
8 Future Prospects
Booting and flowering are the stages most sensitive to high temperature, which may
sometimes lead to significant sterility. Great variation exists among rice germplasm
in response to temperature stress. Flowering at cooler times of day, more pollen
viability, larger anthers, longer basal dehiscence, and the presence of long basal
pores are some of the phenotypic markers for high-temperature tolerance.
Replacement of heat-sensitive cultivars with heat-tolerant ones, adjustment of sow-
ing time, choice of varieties with a growth duration allowing avoidance of peak
stress periods, and exogenous application of plant hormones are some of the adap-
tive measures that will help to mitigate the forecast yield decrease due to global
warming (Shah et al. 2011). Staggered planting dates and short-duration varieties
are advocated as some of the options to escape from high-temperature stress.
Synchronizing critical growth stages with most favorable weather is another prac-
tice for avoiding extreme temperature. However, cultural practices alone are not
adequate and yield loss can be minimized further by combining such methods with
genetic improvement.
There is a continuous need to integrate disciplines, such as structural genomics,
transcriptomics, proteomics, and metabolomics, with plant physiology and plant
breeding (Varshney et al. 2005). By using the wide diversity of rice germplasm, we
will be able to explore the novel QTLs and alleles that are expected to have different
effects from the identified QTLs. However, conventional breeding still offers an
opportunity for significant and predictable incremental improvements in high-
temperature tolerance of new rice cultivars. Among the QTLs identified for rice heat
tolerance at flowering stage, even QTLs with a large effect can explain only approx-
imately 20% of the variation, and the additive effect of each QTL is low. Introducing
one or a few QTLs into a genetic background may not be sufficient to significantly
increase its heat tolerance. More heat-tolerance donors and QTLs need to be identi-
fied and used in our breeding programs.
Heat-induced spikelet sterility at flowering and early-morning flowering is diffi-
cult traits for precise phenotyping in large mapping populations. Future research
activities should be aimed at identifying and breeding heat-tolerant germplasm
accessions that exploit the variation in both genotypic and morphological charac-
ters. Several approaches should be actively exploited to improve heat tolerance in
current cultivars, including discovery and exploitation of new genes and alleles,
improved breeding efficiency, marker-assisted selection, and genetic modification
(Shah et al. 2011). Marker-assisted gene pyramiding and marker-assisted recurrent
selection can be used to improve breeding efficiency for heat tolerance. The cloning
of causal genes will unveil the complex genetic control of each trait under heat
stress. Further genetic efforts are required for the development of heat-resilient rice
varieties to cope with the challenges of climate change.
References
Abeysiriwardena DS, Ohba K, Maruyama A (2002) Influence of temperature and relative humidity
on grain sterility in rice. J Natl Sci Found Sri Lanka 30:33–41
Bahuguna RN, Jha J, Madan P, Shah D, Lawas ML, Khetarpal S, Jagadish S (2015) Physiological
and biochemical characterization of NERICA-L 44: a novel source of heat tolerance at the
vegetative and reproductive stages in rice. Physiol Plant 154:543–559
Barnabas B, Jager K, Feher A (2008) The effect of drought and heat stress on reproductive pro-
cesses in cereals. Plant Cell Environ 31:11–38
Basak J, Ali M, Islam MN, Rashid M (2010) Assessment of the effect of climate change on boro
rice production in Bangladesh using DSSAT model. J Civ Eng 38:95–108
Battisti DS, Naylor R (2009) Historical warning of future food insecurity with unprecedented
seasonal heat. Science 323:240–244
Cao L, Zhao J, Zhan X, Li D, He L, Cheng S (2003) Mapping QTLs for heat tolerance and cor-
relation between heat tolerance and photosynthetic rate in rice. Chin J Rice Sci 17:223–227
Cao YY, Duan H, Yang LN, Wang ZQ, Zhou SC, Yang J (2008) Effect of heat stress during meiosis
on grain yield of rice cultivars differing in heat tolerance and its physiological mechanism. Acta
Agron Sin 34:2134–2142
Cheabu S, Moung-Ngam P, Arikit S, Vanavichit A, Malumpong C (2018) Effects of heat stress at
vegetative and reproductive stages on spikelet fertility. Rice Sci 25:218–226
Chen Q, Yu S, Li C, Mou T (2008) Identification of QTLs for heat tolerance at flowering stage in
rice. Sci Agric Sin 41:315–321
Cheng L, Wang J, Uzokwe V, Meng L, Wang Y, Sun Y, Zhu L, Xu J, Li Z (2012) Genetic analysis of
cold tolerance at seedling stage and heat tolerance at anthesis in rice. J Integr Agric 11:359–367
216 C. Ye et al.
Cline W (2008) Global warming and agriculture. International Monetary Fund, Washington,
DC. http://www.imf.org/external/pubs/ft/fandd/2008/03/pdf/cline.pdf. Accessed 5 Aug 2018
Counce PA, Bryant RJ, Bergman CJ, Bautista RC, Wang YJ, Siebenmorgen TJ, Modenhauer KAK,
Meullenet J (2005) Rice milling quality, grain dimensions, and starch branching as affected by
high night temperatures. Cereal Chem 82:645–648
Endo M, Tsuchiya T, Hamada K, Kawamura S, Yano K, Ohshima M, Higashitani A, Watanabe
M, Kawagishi-Kobayashi M (2009) High temperatures cause male sterility in rice plants with
transcriptional alterations during pollen development. Plant Cell Physiol 50:1911–1922
Fu G, Zhang C, Yang Y, Xiong J, Yang X, Zhang X, Jin Q, Tao L (2015) Male parent plays a more
important role in heat tolerance in three-line hybrid rice. Rice Sci 22:116–122
Gilani AA, Siadat SA, Alami Saeed K, Bakhshandeh AM, Moradi F, Seidnejad M (2009) Effect of
heat stress on grain yield stability, chlorophyll content and cell membrane stability of flag leaf
in commercial rice cultivars in Khuzestan. Iranian J Crop Sci 11(1):82–100
Hasegawa T, Yoshimoto M, Kuwagata T, Ishigooka Y, Kondo M, Ishimaru T (2009) The impact of
global warming on rice production: lessons from spikelet sterility observed under the record
hot summer of 2007. NIAES annual report 2008. NIAES, Tsukuba, pp 23–25
Hasegawa T, Ishimaru T, Kondo M, Kuwagata T, Yoshimoto M, Fukuoka M (2011) Spikelet steril-
ity of rice observed in the record hot summer of 2007 and the factors associated with its varia-
tion. J Agric Meteorol 67:225–232
Hirabayashi H, Sasaki K, Kambe T, Gannaban RB, Miras MA, Mendioro MS, Simon EV,
Lumanglas PD, Fujita D, Takemoto-Kuno Y, Takeuchi Y, Kaji R, Kondo M, Kobayashi N,
Ogawa T, Ando I, Jagadish KS, Ishimaru T (2015) qEMF3, a novel QTL for the early-morning
flowering trait from wild rice, Oryza officinalis, to mitigate heat stress damage at flowering in
rice, O. sativa. J Exp Bot 66:1227–1236
Hu SB, Zhang YP, Zhu DF, Lin XQ, Xiang J (2012) Evaluation of heat resistance in hybrid rice.
Chin J Rice Sci 26:751–756
IPCC (2013) Climate change 2013: the physical science basis. Cambridge University Press,
Cambridge; New York, NY
IPCC (2014) Climate change 2014: impacts, adaptation and vulnerability: Part A: Global and sec-
toral aspects: Working Group II contribution to the IPCC Fifth Assessment report. Cambridge
Ishimaru T, Horigan AK, Ida M, Iwasawa N, San-Oh YA, Nakazono M, Nishizawa NK, Masumura
T, Kondo M, Yoshida M (2009) Formation of grain chalkiness and changes in water distribution
in developing rice caryopses grown under high-temperature stress. J Cereal Sci 50:166–174
Ishimaru T, Hirabayashi H, Ida M, Takai T, San-Oh YA, Yoshinaga S, Ando I, Ogawa T, Kondo
M (2010) A genetic resource for early-morning flowering trait of wild rice Oryza officinalis to
mitigate high temperature-induced spikelet sterility at anthesis. Ann Bot 106:515–520
Ishimaru T, Seefong X, Nallathambi J, Rajendran S, Yoshimoto M, Phoudalay L, Benjamin S,
Hasegawa T, Hayashi K, Gurusamy A, Muthurajan R, Jagadish S (2016) Quantifying rice
spikelet sterility in potential heat-vulnerable regions: field surveys in southern Laos and south-
ern India. Field Crop Res 190:3–9
Jagadish SVK, Craufurd PQ, Wheeler T (2007) High temperature stress and spikelet fertility in
rice. J Exp Bot 58:1627–1635
Jagadish SVK, Craufurd PQ, Wheeler T (2008) Phenotyping rice mapping population parents for
heat tolerance during anthesis. Crop Sci 48:1140–1146
Jagadish SVK, Cairns J, Lafitte R, Wheeler TR, Price AH, Craufurd PQ (2010a) Genetic analysis
of heat tolerance at anthesis in rice. Crop Sci 50:1633–1641
Jagadish SVK, Muthurajan R, Oane R, Wheeler TR, Heuer S, Bennett J, Craufurd PQ (2010b)
Physiological and proteomic approaches to address heat tolerance during anthesis in rice. J
Exp Bot 61:143–156
Jagadish SVK, Murty MVR, Quick W (2014) Rice responses to raising temperatures: challenges,
perspectives and future directions. Plant Cell Environ 38:1686–1698
Jansen E, Overpeck J, Briffa KR, Duplessy JC, Joos F, Masson-Delmotte V, Olago D, Otto-Bliesner
B, Peltier WR, Rahmstorf S, Ramesh R, Raynaud D, Rind D, Solomina O, Villalba R, Zhang
D (2007) Palaeoclimate. In: Solomon S, Qin D, Manning M, Chen Z, Marquis M, Averyt KB,
Tignor M, Miller HL (eds) Climate change 2007: the physical science basis. Contribution of
Working Group I to the Fourth Assessment report of the intergovernmental panel on climate
change. Cambridge University Press, Cambridge; New York, NY
Karim MR, Ishikawa M, Ikeda M, Islam M (2012) Climate change model predicts 33% rice yield
decrease in 2100 in Bangladesh. Agron Sustain Dev 32:821–830
Laborte A, Nelson A, Jagadish K, Aunario J, Sparks A, Ye C, Redoña E (2012) Rice feels the heat.
Rice Today 3:30–31
Lanning SB, Siebenmorgen TJ, Counce PA, Ambardekar AA, Mauromoustakos A (2011) Extreme
night time air temperatures in 2010 impact rice chalkiness and milling quality. Field Crop Res
124:132–136
Li C, Peng C, Zhao Q, Xie P, Chen W (2004) Characteristic analysis of the abnormal high tempera-
ture in 2003 midsummer in Wuhan City. J Centr China Normal Univ 38:379–381
Li X, Chao D, Wu Y, Huang X, Chen K, Cui L, Su L, Ye W, Chen H, Chen H, Dong N, Guo T,
Shi M, Feng Q, Zhang P, Han B, Shan J, Gao J, Lin H (2015) Natural alleles of a protea-
some α2 subunit gene contribute to thermotolerance and adaptation of African rice. Nat Genet
47:827–833
Liu J, Zhang C, Wei C, Liu X, Wang M, Yu F, Xie Q, Tu J (2016) The RING finger ubiquitin E3
ligase OsHTAS enhances heat tolerance by promoting H2O2-induced stomatal closure in rice.
Lobell DB, Burke MB, Tebaldi C, Mastrandrea MD, Falcon WP, Naylor RL (2008) Prioritizing
climate change adaptation needs for food security in 2030. Science 319:607–610
Mackill DJ (1981) Studies on the mechanism and genetics of high temperature tolerance in rice.
University of California-Davis, Davis, CA
Mackill DJ, Coffman W (1983) Inheritance of high temperature tolerance and pollen shedding in
a rice cross. Z Pflanzen 91:61–69
Mackill DJ, Coffman WR, Rutger J (1982) Pollen shedding and combining ability for high tem-
perature tolerance in rice. Crop Sci 22:730–733
Manigbas NL, Lambio LAF, Madrid LB, Cardenas C (2014) Germplasm innovation of heat toler-
ance in rice for irrigated lowland conditions in the Philippines. Rice Sci 21:162–169
Maruyama A, Weerakoon W, Wakiyama Y, Ohba K (2013) Effects of increasing temperatures on
spikelet fertility in different rice cultivars based on temperature gradient chamber experiments.
J Agron Crop Sci 199:416–423
Matsui T (2009) Floret sterility induced by high temperatures at the flowering stage in rice. Jpn J
Crop Sci 78:303–311
Matsui T, Omasa K (2002) Rice cultivars tolerant to high temperature at flowering: anther charac-
teristics. Ann Bot 89:683–687
Matsui T, Omasa K, Horie T (1997a) High temperature induced spikelet sterility of japonica rice at
flowering in relation to air humidity and wind velocity conditions. Jpn J Crop Sci 66:449–455
Matsui T, Namuco OS, Ziska LH, Horie T (1997b) Effects of high temperature and CO2 concentra-
tion on spikelet sterility in indica rice. Field Crop Res 51:213–219
Matsui T, Omasa K, Horie T (2000) High temperature at flowering inhibits swelling of pollen
grains, a driving force for thecae dehiscence in rice. Plant Prod Sci 3:430–434
Matsui T, Omasa K, Horie T (2001a) Comparison between anthers of two rice cultivars with toler-
ance to high temperature at flowering or susceptibility. Plant Prod Sci 4:36–40
Matsui T, Omasa K, Horie T (2001b) The differences in sterility due to high temperature during the
flowering period among japonica rice varieties. Plant Prod Sci 4:90–93
Matsui T, Kobayasi K, Yoshimoto M, Hasegawa T (2007) Stability of rice pollination in the field
under hot and dry conditions in the Riverina Region of New South Wales, Australia. Plant Prod
Sci 10:57–63
218 C. Ye et al.
Matsushima S, Ikewada H, Maeda A, Honda S, Niki H (1982) Studies on rice cultivation in the
tropics. I. Yielding and ripening responses of the rice plant to the extremely hot and dry climate
in Sudan. Jpn J Trop Agric 26:19–25
Matthews RB, Kropff MJ, Bachelet D, Laar HV (1995) Modelling the impact of climate change
on rice production in Asia. Springer, International Rice Research Institute, Berlin, Los Baños
Mohammed RA, Tarpley L (2011) Effects of night temperature, spikelet position and salicylic acid
on yield and yield-related parameters of rice plants. J Agron Crop Sci 197:40–49
Morita S, Yonemaru J, Takanashi J (2005) Grain growth and endosperm cell size under high night
temperatures in rice. Ann Bot 95:695–701
Morita S, Wada H, Matsue Y (2016) Countermeasures for heat damage in rice grain quality under
climate change. Plant Prod Sci 19:1–11
Nishiyama I, Blanco L (1980) Avoidance of high temperature sterility by flower opening in the
early morning. Jpn Agric Res Q 14:116–117
Nishiyama I, Satake T (1981) High temperature damage in the rice plant. Jpn J Trop Agric 25:14–19
NOAA (2011) State of the climate: global analysis for annual 2011. NOAA, Washington,
DC. http://www.ncdc.noaa.gov/sotc/global/2011/13. Accessed 6 Aug 2018
Osada A, Sasiprapa V, Rahong M, Dhammanuvong S, Chakrabandho H (1973) Abnormal occur-
rence of empty grains of indica rice plants in the dry hot season in Thailand. Proc Crop Sci Soc
Jpn 42:103–109
Pachauri RK, Reisinger A (2007) Climate change 2007: synthesis report. IPCC, Geneva
Peng S, Huang J, Sheehy JE, Laza RC, Visperas RM, Zhong X, Centeno GS, Khush GS, Cassman
KG (2004) Rice yields decline with higher night temperature from global warming. Proc Natl
Acad Sci U S A 101:9971–9975
Poli Y, Basava RK, Panigrahy M, Vinukonda VP, Dokula NR, Voleti SR, Desiraju S, Neelamraju
S (2013) Characterization of a Nagina22 rice mutant for heat tolerance and mapping of yield
traits. Rice 6:36
Prasad PVV, Boote KJ, Allen LH, Sheehy JE, Thomas J (2006) Species, ecotype and cultivar dif-
ferences in spikelet fertility and harvest index of rice in response to high temperature stress.
Field Crop Res 95:398–411
Raddatz G, Dehio M, Meyer TF, Dehio C (2001) PrimeArray: genome-scale primer design for
DNA-microarray construction. Bioinformatics 17:98–99
Rosenzweig C, Iglesias A, Yang XB, Epstein PR, Chivian E (2001) Climate change and extreme
weather events. Glob Change Hum Health 2:90–104
Satake T, Yoshida S (1978) High temperature induced sterility in Indica rice at flowering. Jpn J
Crop Sci 47:6–17
Scafaro AP, Haynes PA, Atwell B (2010) Physiological and molecular changes in Oryza meridi-
onalis Ng., a heat-tolerant species of wild rice. J Exp Bot 61:191–202
Shah F, Huang J, Cui K, Nie L, Shah T, Chen C, Wang K (2011) Impact of high-temperature stress
on rice plant and its traits related to tolerance. J Agric Sci 149:545–556
Shanmugavadivel PS, Mithra SVA, Prakash C, Ramkumar MK, Tiwari R, Mohapatra T, Singh
N (2017) High resolution mapping of QTLs for heat tolerance in rice using a 5K SNP array.
Rice 10:28
Shi W, Ishimaru T, Gannaban RB, Oane W, Jagadish S (2015) Popular rice cultivars show contrast-
ing responses to heat stress at gametogenesis and anthesis. Crop Sci 55:589–596
Solomon S, Qin D, Manning M, Chen Z, Marquis M, Averyt K, Tigno M, Miller H (2007) IPCC
AR4 WG1. Climate change 2007: the physical science basis. Cambridge University Press,
Cambridge
Tabaldi C, Hayhoe K, Arblaster J, Meehl G (2006) Going to the extremes. Climate Change
79:185–211
Takeoka Y, Mamun A, Wada T, Kaufman P (1992) Primary features of the effect of environmental
stress on rice spikelet morphogenesis. Dev Crop Sci 22:113–141
Tang RS, Zheng JC, Jin ZQ, Zhang DD, Huang YH, Chen L (2008) Possible correlation between
high temperature-induced floret sterility and endogenous levels of IAA, GAs and ABA in rice.
Plant Growth Regul 54:37–43
Tanveer T, Kobayashi Y, Koyama H, Matsui T (2015) QTL analyses for anther length and dehis-
cence at flowering as traits for the tolerance of extreme temperatures in rice. Euphytica
203:629–642
Tao L, Tan H, Wang X, Cao L, Song J, Chen S (2008) Effects of high-temperature stress on flower-
ing and grain-setting characteristics of Guodao 6. Acta Agron Sin 34:609–614
Teixeira E, Fischer G, Velthuizen H, Walter C, Ewert F (2011) Global hot-spots of heat stress on
agricultural crops due to climate change. Agric For Meteorol 170:206–215
Tenorio FA, Ye C, Redoña E, Sierra S, Laza M, Argayoso MA (2013) Screening rice genetic
resources for heat tolerance. SABRAO J Breed Genet 45:341–351
Tian X, Luo H, Zhou H, Wu C (2009) Research on heat stress of rice in China: progress and pros-
pect. Chin Agric Sci Bull 25:166–168
Tian X, Matsui T, Li S, Yoshimoto M, Kobayasi K, Hasegawa T (2010) Heat-induced floret sterility
of hybrid rice (Oryza sativa L.) cultivars under humid and low wind conditions in the field of
Jianghan basin, China. Plant Prod Sci 13:243–251
Varshney RK, Graner A, Sorrells M (2005) Genomics-assisted breeding for crop improvement.
Trends Plant Sci 10:621–630
Vivitha P, Raveendran M, Vijayalakshmi D (2017) Introgression of QTLs controlling spikelet fer-
tility maintains membrane integrity and grain yield in Improved White Ponni derived progenies
exposed to heat stress. Rice Sci 24:32–40
Wahid A, Gelani S, Ashraf M, Foolad M (2007) Heat tolerance in plants: an overview. Environ
Exp Bot 61:199–223
Wassmann R, Jagadish SVK, Heuer S, Ismail A, Redoña E, Serraj R, Singh RK, Howell G, Pathak
H, Sumfleth K (2009a) Climate change affecting rice production: the physiological and agro-
nomic basis for possible adaptation strategies. Adv Agron 101:59–122
Wassmann R, Jagadish SVK, Sumfleth K, Pathak H, Howell G, Ismail A, Serraj R, Redoña E,
Singh RK, Heuer S (2009b) Regional vulnerability of climate change impacts on Asian rice
production and scope for adaptation. Adv Agron 102:91–133
Weerakoon W, Maruyama A, Ohba K (2008) Impact of humidity on temperature-induced grain
sterility in rice. J Agron Crop Sci 194:135–140
Wei H, Liu J, Wang Y, Huang N, Zhang X, Wang L, Zhang J, Tu J, Zhong X (2013) A dominant
major locus in chromosome 9 of rice (Oryza sativa L.) confers tolerance to 48°C high tempera-
ture at seedling stage. J Hered 104:287–294
Xia M, Qi H (2004) Effects of high temperature on the seed setting percent of hybrid rice breed
with four male sterile lines. Hubei Agric Sci 2:21–22
Xiao Y, Pan Y, Luo L, Deng H, Zhang G, Tang W, Chen L (2011a) Quantitative trait loci associ-
ated with pollen fertility under high temperature stress at flowering stage in rice. Rice Sci
18:204–209
Xiao Y, Pan Y, Luo L, Zhang G, Deng H, Dai L, Liu X, Tang W, Chen L, Wang G (2011b)
Quantitative trait loci associated with seed set under high temperature stress at the flowering
stage in rice. Euphytica 178:331–338
Yamakawa H, Hirose T, Kuroda M, Yamaguchi T (2007) Comprehensive expression profiling of
rice grain filling-related genes under high temperature using DNA microarray. Plant Physiol
144:258–277
Yan C, Ding Y, Wang Q, Liu Z, Li G, Muhammad I, Wang S (2010) The impact of relative humid-
ity, genotypes and fertilizer application rates on panicle, leaf temperature, fertility and seed
setting of rice. J Agric Sci 148:329–339
Yang C, Heilman J (1993) Responses of rice to short term high temperature: growth development
and yield. J Agric Res China 42:1–11
Yang H, Huang ZQ, Jiang ZY, Wang X (2004) High temperature damage and its protective tech-
nologies of early and middle season rice in Anhui province. J Anhui Agric Sci 32:3–4
220 C. Ye et al.
Ye C, Argayoso M, Redoña E, Sierra S, Laza M, Dilla C, Mo Y, Thomson M, Chin J, Delaviña C,

Diaz G, Hernandez J (2012) Mapping QTL for heat tolerance at flowering stage in rice using
SNP markers. Plant Breed 131:33–41
Ye C, Tenorio F, Redoña E, Morales-Cortezano P, Cabrega G, Jagadish K, Gregorio G (2015a)
Fine-mapping and validating qHTSF4.1 to increase spikelet fertility under heat stress at flower-
ing in rice. Theor Appl Genet 128:1507–1517
Ye C, Tenorio F, Argayoso M, Laza M, Koh H, Redoña E, Jagadish K, Gregorio G (2015b)
Identifying and confirming quantitative trait loci associated with heat tolerance at flowering
stage in different rice populations. BMC Genet 16:41
Yoshida S, Satake T, Mackill D (1981) High temperature stress in rice. IRRI Res Pap Ser 67:1–15
Zakaria S, Matsuda T, Tajima S, Nitta Y (2002) Effect of high temperature at ripening stage on the
reserve accumulation in seed in some rice cultivars. Plant Prod Sci 5:160–168
Zhang T, Yang L, Jiang K, Huang M, Sun Q, Chen W, Zheng J (2008) QTL mapping for heat toler-
ance of the tassel period of rice. Mol Plant Breed 6:867–873
Zhang G, Chen L, Xiao G, Xiao Y, Chen X, Zhang S (2009) Bulked segregant analysis to detect
QTL related to heat tolerance in rice using SSR markers. Agric Sci China 8:482–487
Zhao Z, Zhang L, Xiao Y, Zhang W, Zhai H, Wan J (2006) Identification of QTLs for heat tolerance
at the booting stage in rice. Acta Agron Sin 32:640–644
Zhong L, Cheng F, Wen X, Sun X, Zhang G (2005) The deterioration of eating and cooking quality
caused by high temperature during grain filling in early-season indica rice cultivars. J Agron
Crop Sci 191:218–225
Zhou Y, Gong H, Li C, Hu C, Lin T, Sheng S (2009) Influence of thermal damage on seed-setting
rate of 67 indica hybrid rice combinations. Acta Agric Jiangxi 21:23–26
Zhu C, Xiao Y, Wang C, Jiang L, Zhai H, Wan J (2005) Mapping QTLs for heat tolerance during
grain filling in rice. Chin J Rice Sci 19:117–121
Ziska LH, Manalo PA, Ordonez R (1996) Intraspecific variation in the response of rice (Oryza
sativa L.) to increased CO2 and temperature: growth and yield response of 17 cultivars. J Exp
Bot 47:1353–1359
Genetics and Breeding of Low-
Temperature Stress Tolerance in Rice
Sofi Najeeb, Anumalla Mahender, Annamalai Anandan, Waseem Hussain,

Zhikang Li, and Jauhar Ali
Abstract Low-temperature stress (LTS) is one of the major abiotic stresses that
affect crop growth and ultimately decrease grain yield. The development of rice
varieties with low-temperature stress tolerance has been a severe challenge for rice
breeders for a long time. The lack of consistency of the quantitative trait loci (QTLs)
governing LTS tolerance for any given growth stage over different genetic back-
grounds of mapping populations under different low-temperature stress conditions
remains a crucial barrier for adopting marker-assisted selection (MAS). In this
review, we discuss the ideal location and phenotyping for agromorphological and
physiological parameters as indicators for LTS tolerance and also the traits associ-
ated with QTLs that were identified from biparental mapping populations and
diverse rice accessions. We highlight the progress made in the fields of genome
editing, genetic transformation, transcriptomics, and metabolomics to elucidate the
molecular mechanisms of cold tolerance in rice. The stage-specific QTLs and can-
didate genes for LTS tolerance brought out valuable information toward identifying
and improving LTS tolerance in rice varieties. We showed 578 QTLs and 38 func-
tionally characterized genes involved in LTS tolerance. Among these, 29 QTLs
Authors Sofi Najeeb, Anumalla Mahender, and Annamalai Anandan contributed equally to
this work.
S. Najeeb
Rice Breeding Innovation Platform, International Rice Research Institute (IRRI),
Mountain Research Centre for Field Crops, Khudwani, Sher-e-Kashmir University of
Agricultural Science and Technology (SKAUST), Kashmir, India
A. Mahender · W. Hussain · J. Ali (*)
Rice Breeding Innovation Platform, International Rice Research Institute (IRRI),
A. Anandan
Plant Breeding and Genetics Division, ICAR-National Rice Research Institute (NRRI),
Cuttack, Odisha, India
Z. Li
Institute of Crop Sciences/National Key Facility for Crop Gene Resources and Genetic
Improvement, Chinese Academy of Agricultural Sciences (CAAS), Beijing, P. R. China

https://doi.org/10.1007/978-3-030-66530-2_8
222 S. Najeeb et al.
were found to be colocalized at different growth stages of rice. The combination of

stage-specific QTLs and genes from biparental mapping populations and genome-
wide association studies provide potential information for developing LTS-tolerant
rice varieties. The identified colocalized stage-specific LTS-tolerance QTLs will be
useful for MAS and QTL pyramiding and for accelerating mapping and cloning of
the possible candidate genes, revealing the underlying LTS-tolerance mechanisms
in rice.
Keywords Low-temperature stress · Physiological indicators · Stage-specific

QTLs and genes · Breeding strategies · Genetic transformation
1 Introduction
Rice (Oryza sativa L.) is an important cereal crop, being the staple food for more
than half of the world’s population, providing 21% of global human per capita
energy (Nalley et al. 2017). Approximately one tenth of Earth’s arable land is
planted to rice, which is the primary source of food. The demand for this staple crop
has put more pressure on rice breeders and biotechnologists to intensify rice pro-
duction systems to enhance yield productivity under drastic changes in global cli-
matic variations (GCVs). Based on the projection of global population growth, rice
production must increase its annual yield by 1.2–1.5% in the coming decades to
ensure global food security (Seck et al. 2012).
Rice is grown globally in diverse ecosystems, ranging from a few meters below
sea level to as high as 2700 m above mean sea level (amsl). Despite rice originating
in the swampy areas of the tropics, it is susceptible to a wide range of abiotic stresses
(Ranawake and Nakamura 2011). Changes in GCVs have shifted the distribution of
temperature variability across the globe. These remarkable shifts have resulted in
more frequent low-temperature stress/cold stress events (chilling stress and freezing
stress) during the rice-growing season, especially in subtropical and temperate
regions, with consequent adverse effects on rice production. Low-temperature stress
(LTS) is one of the major abiotic stresses that significantly decrease rice grain yield
and is experienced by 10% of the total 130 million ha of rice (Mohanty et al. 2012).
For instance, rice farmers have suffered significant declines in grain yield ranging
from 0.5 to 2.5 t/ha in Australia, with an average yield income loss of USD 23.2 mil-
lion/year because of LTS (Farrell et al. 2001).
Low temperature affects the rice industry in Africa, Asia, Australia, Europe, and
South and North America. In the mountainous regions of South Korea, extremely
low temperatures severely damaged rice crops in 1980 and 1993, with grain yield
dropping by 26.0% and 9.2%, respectively, compared with the national average
yield during those years (Schiller et al. 2001). Also, severe grain yield losses due to
LTS conditions were reported in Italy, the United States (Board et al. 1980), and
Chile. In India, LTS occurs in about 60% of the rice area in the northeastern and
Genetics and Breeding of Low-Temperature Stress Tolerance in Rice 223
western hill states of the Himalayas, with cold stress caused by the cold irrigation
water from melted snow and low ambient air temperature. LTS also directly affects
crop duration, which increases relatively with cold temperature, thereby limiting to
a large extent the possibility of double cropping in areas where water control is pos-
sible (Matlon et al. 1998).
Rice cultivars vary prominently in their tolerance of LTS, with subspecies indica
more sensitive to LTS, while japonica cultivars are known to tolerate cold stress
(Kim and Tai 2013). The rice crop is relatively sensitive to temperatures below
15 °C, which causes varying effects across different crop growth stages such as
germination, seedling, vegetative, reproductive, and grain maturity (Andaya and
Mackill 2003a, b). Low temperatures directly affect the crop by causing slow growth
and decreased seedling vigor (Ali et al. 2006) as well as a delayed and lower per-
centage of germination (da Cruz and Milach 2000). At the seedling stage, manifes-
tations of cold stress include low numbers of seedlings, decreased tillering, increased
plant mortality, and induced nonuniform crop maturity (Zhang et al. 2014b). At the
vegetative stage, LTS increases the growth period as exhibited by leaf discoloration
or yellowing, leaf rolling or wilting, slowed growth, poor germination and seedling
establishment, and the presence of rotten and dead seedlings (Lone et al. 2018).
During flowering, the most sensitive stage, low temperature brings anomalies at
anthesis, resulting in the cessation of anther development, nonripening of pollen,
nonemergence of anthers from spikelets, improper anther dehiscence, pollen grains
remaining in anther loculi, poor pollen shedding, and failure of pollen to germinate
after reaching the stigmas (Suh et al. 2010; Shakiba et al. 2017).
LTS in both temperate and high-altitude rice-growing areas in the tropics and
subtropics causes damaging effects throughout the growth dynamics of the crop
(Ranawake and Nakamura 2015). The effect of LTS on different plant growth stages
(germination, seedling, and reproductive) is crucial. In addition, there is a need for
identifying an ideal location for phenotypic screening under LTS conditions, espe-
cially for agronomic, physiological, and biochemical traits to help in the develop-
ment of LTS-tolerant cultivars. The establishment of genetic and genomic resources
for LTS tolerance is a vital step toward the development of LTS-tolerant varieties.
Over the years, the genetic and physiological perspectives of cold tolerance have
been extensively studied, giving way to the development of a diverse set of criteria
for evaluating the cold-tolerance phenomenon in rice at different growth stages. The
rapid development of molecular markers and next-generation sequencing technol-
ogy tools such as bisulfite sequencing and whole-transcriptome shotgun sequencing
have been accelerated in many crop plants (Fig. 1). Several genomic regions have
been studied for LTS in rice using biparental mapping populations and association
mapping procedures. In this review, we have tried to organize and discuss the stage-
specific QTLs and candidate genes for LTS tolerance, which could be used in LTS-
tolerance rice varietal improvement programs. We also provide here the phenotypic
characterization of LTS-tolerance traits at different growth stages of rice and associ-
ated genomic regions from the literature along with the traits. We also cover genome
editing, genetic transformation, transcriptomics, and metabolomics tools for eluci-
dating the molecular mechanisms of LTS tolerance in rice.
2 henological, Physiological, and Biochemical Indicators

P
of LTS Tolerance at Different Developmental Stages
Screening for LTS in rice can be done at various growth stages (Table 1). In con-
trolled conditions, LTS screening can be achieved timely with precision; however, it
restricts the population in both sample size and number of samples. Thus, to screen
large-sized populations, LTS breeding programs have resorted to evaluating many
populations using cold water under field conditions (Snell et al. 2008). Such cold-
water screening under field conditions has been established in research stations in
Japan (Nagano 1998) and Korea (Lee 2001). The air temperature thresholds at the
reproductive stage for cold-sensitive and cold-tolerant varieties are 20 °C and 15 °C,
respectively (Satake 1976). Hence, high-elevation areas with low air and water tem-
peratures, especially in subtropical regions in Kunming, People’s Republic of China
(subsequently “China”), and in regions of Kashmir and Himachal Pradesh, India,
are ideal spots for screening for cold tolerance (Jiang et al. 2012). Natural cold-
screening hotspots that represent the target population of environments are vital for
the systematic screening of germplasm and segregating breeding materials. The
selection of such hotspots is crucial for the success of breeding and molecular
genetic studies.
Rice is quite sensitive to LTS, mainly in tropical and subtropical regions at dif-
ferent growth stages. The critical temperature of the germination and reproductive
stage at 15 and 17 °C has shown a significant impact on growth stage and yield
decrease. However, the optimum temperature required for rice cultivation ranges
from 25 to 35 °C (Yoshida 1981). The selection of LTS-tolerant rice varieties with a
short duration is the key requirement for decreasing LTS damage. The effects of
LTS in different growth stages, such as germination stage (GS), seedling stage (SS),
and reproductive stage (RS), have significant impacts on agromorphological changes
and yield component losses, especially in tropical zones. As compared to indica or
indica × japonica backgrounds, japonica rice varieties have shown a wide range of
LTS tolerance (da Cruz et al. 2013). The list of some LTS-tolerant rice varieties
provided in Table 2 spans different countries, and most of these varieties are japon-
ica type. However, some indica rice varieties also showed considerable LTS toler-
ance at the GS or SS (Biswas et al. 2017).
A few varieties have been proven to have a better performance for LTS in stage-
specific growth conditions: for instance, Jinheung, Nipponbare, RNR 18805, and
Italica Livorno for the GS (Miura et al. 2001; Fujino et al. 2004); M202, Lemont,
and AAV002863 for the SS (Andaya and Mackill 2003b; Lou et al. 2007); and
Norin PL8, Kirara397, RNR 17813, Akshaydhan, Taramati, WGL 44, Bhadrakali,
JGL 3844, and WGL 44 for the RS (Saito et al. 2001; Kuroki et al. 2009). However,
four rice varieties, B55, Banjiemang, Lijiangheig, and HSC55 from China and the
United States, showed a consistent tolerance in three different growth stages (GS,
SS, and RS) in rice (Basuchaudhuri 2014). For a further selection of LTS-tolerant
rice varieties, several screening methods have been proposed, along with their pros
and cons, for LTS-tolerant genotypes (Almeida et al. 2016). The selection of
Rice germplasm Traits Advanced genomic technologies C

Agro-morphological traits O
L
D
Gene cloning
Landraces and editing
T
HIGH-THROUGHPUT GENOME SEQUENCING

O
L
In silico tools E
Wild species
QTL discovery R
TRANSCRIPTOMICS
METABOLOMICS
Gene annotation A
EPIGENOMICS
PROTEOMICS
Haplotype analysis N
Mapping Association mapping
populations Use gene expression profiling
T
and Identifying candidate gene
G
E
Pre-breeding Functional marker development N
lines O
Introgression
T
Y
Mutants Marker-assisted selection P
Marker-assisted backcrossing
Genomic selection
E
S
Physio-biochemical traits
Fig. 1 Integration of high-throughput molecular approaches and phenotypic techniques to develop

stage-specific desirable cold-tolerant rice genotypes
promising rice genotypes under natural LTS might favor negative results because of
unpredictable climatic alterations in terms of stress intensity and duration of
LTS. However, using high-throughput screening techniques such as image analysis,
yield trait score, and robotics in controlled conditions of temperature, water, and air
might help to detect tolerant genotypes and could also elucidate the traits related to
morphological, biochemical, and yield-attributed traits during the plant growth
period (Yang et al. 2014). Earlier studies of Snell et al. (2008), Suh et al. (2010), and
Khatun et al. (2016) mentioned having developed reliable and straightforward
screening methodologies for the selection of LTS-tolerant rice genotypes by prepar-
ing specific tanks for imposing cold-water irrigation and using a phytotron cabinet
and low temperature in the glasshouse at different growth stages, which can provide
the critical component traits. The primary focus traits for the GS related to germina-
tion rate, germination index, coefficient of germination, coleoptile length, and radi-
cle length and also associated with early seedling vigor could be important traits for
the selection of LTS tolerance at the GS (Li et al. 2018). In the SS, leaf discolor-
ation, seedling survivability, leaf chlorophyll content, and estimation of the concen-
tration of osmoprotectants (spermine and glycine betaine) and trehalose accumulation
could be useful indicators to detect LTS at the SS (Han et al. 2004; Lou et al. 2007;
Suh et al. 2012). Similarly, seed-setting rate, pollen growth development, incom-
plete panicle exsertion, days to flowering, spikelet fertility, and grain yield are the
key traits for selection criteria at the RS (Ye et al. 2009; Jena et al. 2012; da Cruz
et al. 2013). However, the natural incidence of LTS is significantly influenced to
alter tolerance trait expression during phenotypic evaluation. Therefore, a
Table 1 Criteria for evaluating LTS tolerance at different growth stages in rice
Applied
temperature/
Stage Trait studied duration Stage of study References
Germination Germination 14 °C (7–17 days) Incubation of Han et al. (2006)
vigor = number of seed to
germinated grains/ germination up
total grains to 17 days
Seedling survival 2 °C for 3 days Germination to Zhou et al.
rate = (number of very early (2012)
surviving seedlings/ seedling stage
sprouted seeds) × 100
Coleoptile length 15 °C for 10 days Germination to Hou et al. (2003)
very early
seedling stage
Germination rate 15 °C for 10 days Germination to Chen et al.
very early (2006b)
seedling stage
Germination rate 5 °C for 10 days Seedling Pan et al. (2015)
survival rate
(SSR)
Germination 10 °C for 30 days Seedling stage Schläppi et al.
percentage (2017)
Germination 12 °C for 35 days Dark, cold Shakiba et al.
percentage incubator set for (2017)
35 days
Vegetative/ Changes in fresh 10 °C for 1–48 h 13 days after Bonnecarrère
seedling weight after cold germination et al. (2011)
treatment
Number of surviving 4 °C for 6 days – Zhang et al.
plants/total number (2011)
Survival rate after 10 °C for 3, 6, and – Bertin et al.
10 days of recovery 9 days (1996)
Survival rate after 4 °C for 6 days in – Koseki et al.
14 days of recovery dark (2010)
Seedling growth 9 °C for 3-leaf stage Andaya and
(visual scale: 1–9) 8–18 days Mackill (2003a,
b), Kim and Tai
(2011)
Seedling growth 8 °C for 3 days 3-leaf stage Wang et al.
(visual scale: 1–9) (2016)
(continued)
Table 1 (continued)
Applied
temperature/
Stage Trait studied duration Stage of study References
Reproductive Fertility/spikelet 12 °C for 6 days Flowering/ Sato et al. (2011)
stage fertility percentage and then in booting stage
greenhouse
conditions up to
maturity
Fertility/spikelet 18–19 °C/cold 2 months from Shirasawa et al.
fertility percentage deep irrigation panicle initiation (2012)
water to full heading
stage
Fertility/spikelet 17 °C water/air 20 DAT from Suh et al. (2010),
fertility percentage temperature for tillering to grain Jena et al. (2012)
10 days; irrigation maturity
water at 17 °C
Fertility/spikelet 17 °C for 7 days Flowering/ da Cruz et al.
fertility percentage at anthesis stage booting stage (2006a)
Fertility/spikelet 15.3–21.4 °C of Booting to Zhu et al. (2015)
fertility percentage air temperature at milking stage
booting stage
Percent panicle Night-time Dark, cold Shakiba et al.
sterility, number of temperature of incubator set for (2017)
panicles per plant, and 12 °C and daytime 35 days
seed weight per plant temperature of
27.3 °C
Relative seed-setting 15–19 °C Booting stage Pan et al. (2015)
rate
combination of advanced molecular marker technology and high-throughput screen-

ing technologies provides the best method for prospecting for LTS-tolerant
genotypes.
Several protocols exist to screen for cold tolerance/sensitivity in rice using dif-
ferent physiological and biochemical indicators. Two good indices of cold tolerance
are seedling survival percentage (SSP) after subjecting seedlings to different low-
temperature regimes (Morsy et al. 2007) and seedling chlorosis (Nagamine 1991).
Many researchers have used SSP to analyze the resistance of transgenic plants to
low temperatures (Chen et al. 2012; Huang et al. 2012). Nevertheless, the drawback
of information obtained from SSP is that it is neither reproducible under natural
conditions nor feasible for QTL studies. On the other hand, seedling chlorosis or the
decrease in chlorophyll and leaf yellowing induced by cold stress could be captured
by Soil Plant Analysis Development (SPAD) values to provide a more accurate
measurement of cold stress at the seedling stage over a visual score. This indicator
gives the direct association of the photosynthetic activity of the leaves, with low-
temperature intensity and duration, as one of the yardsticks to screen rice germ-
plasm and populations against cold stress (Hussain et al. 2018).
Table 2 List of popular LTS-tolerant rice varieties released in several countries

Rice varieties Country Remarks References
K39, K78 (Barkat), K332, Kohsar, India Popularly grown in Gupta et al.
Jhelum, Shalimar Rice 1, Shalimar Kashmir valley and high (2009)
Rice 2, Shalimar Rice 3, a few hills of Himachal
varieties of VL Dhan series, Pradesh, possessing a
Himalaya 1, Kanchan, Himali, and good degree of cold
Bhrigu Dhan tolerance
Yunlu 29, B55, Lijianghegu, and China Considerable cold Sivapalan
Banjiemang tolerance and remarkable (2013)
Viet Vietnam recovery from cold
damage
Jyoudeki and Tachiminori Japan Significant tolerance at Ye et al. (2009)
M103 and M104 U.S. booting/flowering stage,
HSC55 Hungary whereas HSC55 shows
considerable tolerance at
Quest Australia
all stages
Ambar-INIA, Quila 242002, and Chile Show considerable cold Donoso et al.
Quila 241304 tolerance at seedling (2015)
stage
Doongara, Illabong, and Langi Australia Possess significant cold Sivapalan
tolerance (2013)
Jinbubyeo, Junganbyeo, and Korea Show strong cold Wang et al.
SR30084-F8-156 tolerance at booting stage (2013b)
PR27137-CR153, Khazar, Hasani, Iran Possess cold tolerance at Pouramir
and Gil2 germination stage Dashtmian
et al. (2013)
L2825CA Uruguay Germination-stage Bonnecarrere
cold-tolerant japonica et al. (2015)
line
Avangard and Mustaqillik Uzbekistan Possess flowering-stage Suh et al.
Jinbu and Jungan Korea cold tolerance (2010), Jena
Giza 177 Egypt et al. (2012)
The accumulation of more dry matter and the functionality of photosystem-II

(PSII) provide quantitative information on plant performance under cold-stress con-
ditions (Gururani et al. 2015). An increase in the efficiency of PSII photochemistry
gives information on the structural and functional changes in the photosystem of
different plant types or transgenics, especially when the seedlings are exposed to
low temperatures (Bonnecarrère et al. 2011). A sudden drop in chlorophyll integrity
parameter and chlorophyll fluorescence (Fv/Fm) indicates a gas exchange decrease
caused by alterations in the photosynthetic system. Therefore, combined informa-
tion on gas exchange analysis and chlorophyll fluorescence is necessary to study the
photosynthetic process (Saad et al. 2012) under cold stress. The expression of the
AISAP gene of Aeluropus littoralis in rice confers broad tolerance of several abiotic
stresses through the maintenance of photosynthetic apparatus integrity (Saad et al.
2012), particularly for PSII. The AISAP gene has become the tool to precisely
evaluate for cold tolerance as it is related to final photosynthetic activity (da Cruz
et al. 2013).
Biochemical parameters such as electrolyte leakage (EL), proline (Pro), and
ascorbic acid (AA) were reported to be higher in sensitive variety IR50 than in resis-
tant cultivar M202 (Kim and Tai 2011). Lee et al. (1993) showed that the exogenous
application of abscisic acid (ABA) biosynthetic inhibitors resulted in low accumula-
tion and low survival of seedlings under cold stress. Breeding varieties that accumu-
late higher concentrations of osmoprotectants (spermine and glycine betaine) was
seen to be a strategy to overcome stresses (Yang et al. 1996), which has been proven
through the development of transgenic rice that accumulates higher glycine betaine
and shows resistance to LTS (Sakamoto and Murata 2002). Furthermore, the signifi-
cant induction in the expression of antioxidative enzymes such as catalase (CAT),
superoxide dismutase (SOD), and ascorbate peroxidase (APEX) under cold stress
(Kuk et al. 2003) explained the rate of cold tolerance (Morsy et al. 2007) by RNA
interference (RNAi) (Song et al. 2011) and in transgenic rice encoding Cu/Zn super-
oxide dismutase (sodC1) (Lee et al. 2009a, b).
The high tolerance of rice of cold stress could also be attributed to trehalose
accumulation (Ge et al. 2008). Song et al. (2011) also found that accumulated
amounts of trehalose can be used as an index for low-temperature tolerance/sensi-
tivity. Increased amounts of trehalose through the overexpression of the OsNAC5
gene in transgenic rice plants were found to result in improved PSII function under
abiotic stress conditions as it restricted damage due to photooxidation and exhibited
soluble carbohydrates 20% higher than in nontransgenic plants (Garg et al. 2002).
Similarly, at the reproductive stage, no sugar (sucrose and hexoses) accumulation
has been found in anthers of low temperature-tolerant lines, resulting in no pollen
grain sterility (Oliver et al. 2007). The overexpression of the gene OsAPXa (ascor-
bate peroxidase) in transgenic rice lines resulted in increased fertility under cold
stress (Sato et al. 2011). It is also reported that unsaturated fatty acid content is
related to plasma membrane stability at cold temperatures during the vegetative
stage. Tolerant genotypes exhibited an increase in the amount of linolenic acid and
a decrease in palmitic acid (da Cruz et al. 2010). Therefore, lipid peroxidation
(Zhang et al. 2012a), along with EL (Huang et al. 2012), can be used to evaluate
membrane lipid damage, which is an indirect assessment of cold tolerance.
Below the soil surface, roots play a crucial role under chilling stress, and root
hydraulic conductivity (Lpr) is found to be profoundly affected when the plants are
exposed to cold stress (Yamori et al. 2010). Murai-Hatano et al. (2008) found that
Lpr decreased when susceptible rice genotypes were exposed to a temperature of
15 °C and the decrease was linked to transmembrane proteins, such as the aquapo-
rins. These physiological and biochemical methods used for evaluating stress in rice
genotypes and transgenic rice plants have played a significant role in understanding
the crop’s mechanism of response against cold. However, most of these procedures
are destructive, time-consuming, and stage-specific and are also inadequate and
inappropriate for breeding programs involving the evaluation of many lines with
large sample sizes. Therefore, to better understand cold-tolerance mechanisms, it is
indispensable to study the phenomenon at the molecular level.
To improve the tolerance of rice of LTS, it is imperative to understand it at

the molecular and physiological levels. At changing temperatures, rice plants
modify their biological pathways, and molecular alterations occur within a dif-
ferent growth stage (Xiao et al. 2018; Ding et al. 2019). At different growth
stages of rice plants, the initial effects of LTS are a decline in plasma membrane
fluidity and transportation mechanism and alterations in physiological and met-
abolic activities, leading to disturbance of signaling processes (Ding et al.
2019). The cascades of the signaling process were followed by adjusting their
cellular metabolism by activating the plasma membrane transporters and alter-
ing the metabolic responses (Fig. 2). These changes occurred in the intracellular
levels by increasing abscisic acid concentrations via changes in growth hor-
mones such as auxin and gibberellins and cross talk between the ethylene and
salicylic acid signaling mechanism (Ghosh et al. 2016; Moraes De Freitas et al.
2016). These mechanisms have occurred through an alteration of membrane
fluidity and the rearrangement of the cytoskeleton by the influx of calcium,
which can trigger a downstream response to LTS tolerance by C-repeat binding
factor: CBF-dependent (C-repeat/drought-responsive element-binding factor-
dependent) and CBF-independent transcriptional pathways (Chinnusamy et al.
2010; Ma et al. 2015). Different growth stage-specific LTS-tolerance genes can
be classified into three major groups as transcription factors, protein kinase
genes, and functional genes, which may be involved in signal transduction path-
ways. Mainly, the CBF transcription factor regulates cold-responsive gene
(COR) expression by binding to the CRT/DRE element. The promoter sequence
of the CBF region is activated by the bHLH transcriptional activator of the
inducer of CBF expression (ICE), which can also induce the expression of CBF
genes toward LTS tolerance (Ito et al. 2006; Su et al. 2010). In addition to CBF
pathway-related transcription factors, two genes, FRO1 (FROSTBITE 1) and
OsFAD2, encode ferric reduction oxidase 1 and fatty acid desaturase 2, which
are involved in LTS-tolerance mechanisms by maintaining membrane fluidity
(Bevilacqua et al. 2015). The influx of calcium signals has also been associated
with nitric oxide, reactive oxygen species, and mitogen-activated protein
kinases, which can trigger the cascades of signaling pathways leading to LTS
tolerance (Yuan et al. 2018). LTS tolerance at the germination stage is an impor-
tant component trait for rapid seedling growth and uniform crop establishment,
especially in the direct-seeding production system. The overexpression of the
zeta class of glutathione S-transferases (OsGSTZ1) significantly improved ger-
mination rate and seedling growth under LTS (Takesawa et al. 2002). Similarly,
Jin et al. (2018) identified a novel zinc finger transcription factor (OsCTZFP8)
and it plays a key role in LTS tolerance at the reproductive stage in pollen fertil-
ity and seed setting along with yield per plant. Therefore, studying LTS-tolerance
mechanisms at specific growth stages is crucial and may provide a better under-
stating of key gene functions and their role in developing LTS-tolerant rice vari-
eties in future breeding programs.
Plasma membrane
Signal sensor receptors

Ion channels Inositol polyphosphates Histidine kinase Receptor-like kinase G-protein coupled receptor
1 ABA Ca+2 ROS GA

ZEP and
SG GA20ox3 6
NCED
ABRE CDPKs GA3ox1 PS
2 3 5 MAPKKK,
MAPK, and
OsMYB3R (GA4, and GA7)
OsSNAC1-5 C-8 hydroxylation OsCPT1 MAPK
pathways 4
DREB2A OsMYBS3 DREB1/CBF Reduced sugar
NACRS OsMKK10-2 OsTrx23 transport
ABA8ox1, CC, LG OsMKK4 PD
OsMKK6 GA interacts with GID1+DELLA
ABA8ox2
SC, LP, ABI3 and GM
MS, RWC DREB/CRT ABI5
PS
SOMNUS (SOM)
Activation/expression of stress inducible genes (RD22/RD29B/ERD1/RD29A)
Nucleus
mRNA
Tolerance of LTS
Fig. 2 Sequential steps involved in the triggering of the signaling cascades for low-temperature
stress (LTS) tolerance. Schematic representations of the LTS signal mostly processed by various
biological processes such as stress perceptions and physiological and molecular responses. (1) LTS
signaling initiated by ABA accumulation, and this is transduced to ABRE-containing NAC genes,
which regulate the expression of NACRS genes for tolerance of LTS (Hu et al. 2008). (2) The
higher concentration of ABA-induced pollen sterility occurs by increasing the expression of ABA
biosynthetic genes OsZFP1 and OSNCED3 that convert zeaxanthin to xanthoxin. The LTS-tolerant
plants were followed by ABA catabolism with a higher expression of two ABA-8-hydroxylase
genes and further reduced to ABA concentration in anthers via C-8 hydroxylation pathways (Ji
et al. 2011; Sharma and Nayyar 2016). (3) Increasing the influx of Ca2+ signals mediated by the
DREB-CRT/DRE pathway under LTS, which is transduced by calcium-dependent protein kinases
(CDPKs), and MYB family transcription factors induce the stress-responsive genes. OsMYB3R-2
regulates the LTS-tolerance mechanism at the seedling stage. OsMYB3R-2 may regulate through
OsCPT1, which is involved in the DREB/CBF pathway in rice (Su et al. 2010). (4) MYBS3 is a
single DNA-binding repeat MYB transcription factor, which mediates sugar signaling and also
tolerance of the LTS signaling pathway. Interestingly, MYBS3 has a distinct tolerance mechanism
with short- and long-term adaptation of LTS tolerance by repressing the DREB1/CBF pathway and
late and slow response to LTS tolerance. (5) The cascades of mitogen-activated protein kinase
consist of three components (MAPKKK, MAPKK, and MAPK) activated by an excess of reactive
oxygen species under LTS. Kumar et al. (2008) found that MAP kinases 4 and 6 are strongly regu-
lated by LTS and salt stress at the seedling stage. Cytosolic thioredoxin (OsTrx23) has a potential
negative regulator for MAPKs’ activity. (6) LTS can also decrease the endogenous levels of bioac-
tive gibberellic acid (GA) by the transcriptional repression of two bioactive GA synthesis genes
(GA20ox3 and GA3ox1) (Sharma and Nayyar 2016). GAs had cross-talk with other hormones to
regulate the stress-response mechanism. The signal cascades of GA interact with the receptor
GID1 (GA INSENSITIVE DWARF1) and GRAS family protein DELLA involved in pollen devel-
opment. The two TFs (ABI3 and ABI5) bind with DELLA complex proteins, which can promote
the expression of SOMNUS involved as a negative regulator of seed germination (Serrano-Mislata
et al. 2017; Li et al. 2018). The cross talk with auxin and jasmonic acid-biosynthetic genes plays a
major role in favoring germination under LTS. The LTS signaling and regulations of the expression
of TFs and gene responses are indicated by arrows. Each pathway relates to different traits under
LTS. These traits are SC stomata closure, LP lipid peroxidation, MS membrane stability, RWC rela-
tive water content, PS pollen sterility, CC cell cycle, LG leaf growth, SG seedling growth, GM
germination, PD pollen development
3 enes/QTLs Underlying LTS in Rice Detected by Linkage

G
Mapping and GWAS
For tolerance of LTS, information on the chromosomal location of QTLs and genes
is limited in different growth stage-specific traits in rice. We carried out a compre-
hensive literature survey, including a Gramene database (http://archive.gramene.
org) search, and aggregated 578 cold-specific QTLs associated with various growth
stages, including germination, seedling, and booting or reproductive stages. Among
these QTLs, 239 (41.3%) were mapped through genome-wide association studies
(GWAS), while 339 (58.7%) QTLs were identified from different types of biparen-
tal mapping populations, and detailed information is provided in Table 3. Based on
the distribution of the reported QTLs on the chromosomes, the highest number of
QTLs was noticed on chromosome 1 (65), followed by chromosome 7 (60), whereas
the lowest number of QTLs was noticed on chromosome 8 (35) (Fig. 3a).
Furthermore, based on the association of these QTLs with growth, stage-specific
traits were classified into 214 QTLs related to GS, 249 QTLs for SS, and 115 QTLs
for RS (Fig. 3b).
The physical positions of these stage-specific QTLs are depicted in Fig. 4. The
QTLs were classified as main-effect QTLs (M-QTLs), based on the phenotypic
variance explained by each QTL, which was ≥30%. Notably, five M-QTLs for
GS-related traits (including germination rate, germination percentage, and germina-
tion index) were found on chromosomes 2, 5, and 7 (Xu et al. 2008; Cui et al. 2018);
15 M-QTLs for SS related to shoot and root growth traits on chromosomes 4, 6, 7,
8, 11, and 12 (Andaya and Mackill 2003b; Wang et al. 2009; Ranawake et al. 2014;
Yu et al. 2018); and 13 M-QTLs for RS related to heading time, panicle weight,
spikelet fertility, and culm length on chromosomes 1, 2, 4, 7, and 10 (Dai et al.
2004; Kuroki et al. 2009; Wainaina et al. 2018) were identified. A total of 29 QTLs
were colocalized on all 12 chromosomes except on chromosomes 5 and 12 (Fig. 4
and Table 4). However, the colocalized stage-specific QTLs range from two to
seven. Interestingly, the highest numbers of GS- and SS-specific QTLs were colo-
calized in the 22.5 Mb genomic region on chromosome 7. Three combinations of
stage-specific QTLs (GS, SS, and RS) were identified on chromosome 10 in the
19.1 Mb region (Liu et al. 2013; Pan et al. 2015; Schläppi et al. 2017).
3.1 Germination Stage
Seed germination is of paramount interest for breeding varieties suitable for temper-
ate regions and high-elevation areas, but it is given a lower priority than traits such
as high yield and grain quality. To date, more than 200 QTLs (98 QTLs were identi-
fied from biparental mapping populations and 116 QTLs from GWAS) have been
mapped on the 12 chromosomes (Fig. 3). The phenotypic variance of these QTLs
ranges from 3.58% to 42.29%. The M-QTLs (≥30% PVE) for the GS were
Table 3 LTS-tolerance QTLs at different growth stages in rice

QTL
mapping Number PVE Number of lines
studies of QTLs ranges Chromosomes Stage (accessions/parents) References
RILs 9 10.5– 1, 2, 3, 5, 6, 7, 9, RS 191 lines (M-202/ Andaya and
16.8 and 12 IR50) Mackill
(2003a)
RILs 15 8.7– 1, 3, 4, 6, 8, 10, SS 191 lines (M-202/ Andaya and
41.7 11, and 12 IR50) Mackill
(2003b)
F2:3 6 7.2– 6, 8, 11, and 12 SS 151 lines (BR1/Hbj. Biswas et al.
14.9 BVI) (2017)
ILs 3 6.5– 1, 7, and 11 SS 240 lines (Xiushui 09/ Cheng et al.
9.5 IR2061) (2012)
F2 9 5.0– 1, 3, 4, 6, 7, 10, RS 250 lines Dai et al.
37.8 and 12 (Kunmingxiaobaigu/ (2004)
Towada)
RILs 12 9.1– 4, 6, and 9 SS 227 lines (Daguan dao/ Wang et al.
37.1 IR28) (2009)
BC1F5 2 5.5– 3 and 4 GS 122 lines (Livorno/ Fujino et al.
19.3 Hayamasari) (2004)
F2:3 12 5.6– 1, 2, 3, 5, 7, 9, SS 200 lines (Milyang 23/ Han et al.
42.9 11, and 12 Jileng 1) (2004)
DHs 5 11.8– 1, 2, 4, 10, SS 120 lines (TN1/ Ji et al.
21.5 and 11 Chunjiang 06) (2010b)
RILs 9 4.8– 2, 5, 7, 8, 11, GS 81 lines (Kinmaze/ Jiang et al.
33.5 and 12 DV85) (2008)
RILs 3 9.1– 1, 5, and 6 SS 81 lines (Kinmaze/ Jiang et al.
24.1 DV85) (2008)
RILs 6 6.3– 1, 4, 8, and 11 GS 124 lines (Changhui Jiang et al.
23.3 891/02428) (2017)
RILs 6 6.1– 1, 2, 4, 10, SS 123 lines (Jinbu/BR29) Kim et al.
16.5 and 11 (2014)
RILs 12 10.5– 1, 2, and 10 RS 114 lines (Kirara397/ Kuroki et al.
47.3 Hatsushizuku) (2009)
F2 1 26.6 8 RS 288 lines (Hokkai-PL9/ Kuroki et al.
Hokkai287) (2007)
CSSLs 4 24.3 2, 5, 6, and 10 GS 143 lines (Nipponbare/ Li et al.
Zhenshan97) (2011b)
RILs 5 6.8– 7, 9, and 12 GS 181 lines (USSR5/ Li et al.
12.1 N22) (2013)
BC1F1 2 – 1 RS 161 lines Li et al.
(3037/02428//3037) (1997)
F2 2 16.9– 12 RS 121 lines (3037/02428) Li et al.
19.4 (1997)
DHs 2 – 3 and 10 GS 193 lines (Zhenshan Lou et al.
97B/AAV002863) (2007)
(continued)
Table 3 (continued)
QTL
ILs 7 8.0– 1, 2, 5, 6, 7, SS 112 lines (IL112/ Liu et al.
20.0 and 10 Guichao2) (2013)
DHs 6 6.4– 1, 2, and 8 SS 193 lines (AAV002863/ Lou et al.
27.4 Zhenshan 97B) (2007)
BC1F9 5 10.1– 2, 4, 5, and 11 GS 98 lines (Nipponbare/ Miura et al.
14.9 Kasalath) (2001)
RILs 2 7.5– 1 and 4 SS 80 lines (Milyang23/ Park et al.
16.0 Hapcheonaengmi3) (2013)
RILs 4 5.8– 7, 8, and 11 GS 162 lines (HGKN/ Ranawake
9.3 Hokuriku-142) et al. (2014)
RILs 9 5.8– 2, 5, 6, 7, 8, SS 162 lines (HGKN/ Ranawake
35.6 and 11 Hokuriku-142) et al. (2014)
BC1F5 2 – 4 RS 117 lines (Kirara397/ Saito et al.
Norin-PL8//Kirara397) (1995)
F2 6 10.4– 1 and 3 GS 120 lines Satoh et al.
23.0 (Akitakomachi/ (2016)
Maratteli)
DHs 2 11.1– 4 and 9 GS 127 lines (ZYQ8/JX17) Teng et al.
12.6 (2001)
BC1F5 3 7.9– 7, 8, and 12 RS 77 lines (Suisei/ Shinada
19.2 Eikei88223) et al. (2013)
RILs 6 5.8– 3, 7, and 9 RS 153 lines Suh et al.
10.9 (IR66160-121-4-4-2/ (2010)
Geumobyeo)
BC1F5 11 3.9– 7 RS 264 lines (Lijing2/ Sun et al.
8.3 Towada) (2019)
F2 16 3.1–71 1, 3, 4, 6, 7, 8, RS 108 lines (Hananomai/ Wainaina
10, and 11 WAB56-104) et al. (2018)
RILs 2 5.9– 11 GS 227 lines (Daguan dao/ Wang et al.
8.5 IR28) (2011)
RILs 5 5.5– 3, 8, 11, and 12 SS 227 lines (Daguan dao/ Wang et al.
22.4 IR28) (2011)
F2 23 4.1– 3, 4, 5, 7, 9, 10, GS 517 lines Xu et al.
32.7 and 11 (Kunmingxiaobaigu/ (2008)
Towada)
F2 10 2.9– 1, 4, 5, and 10 RS 517 lines Xu et al.
14.8 (Kunmingxiaobaigu/ (2008)
Towada)
F3 7 – 1, 2, 5, 8, and 10 SS 10,800 lines (LPBG/ Z Yang et al.
Nipponbare) (2013b)
RILs 27 4.6– 2, 6, 7, 9, 11, GS 190 lines Yang et al.
42.0 and 12 (Dongnong422/ (2018)
Kongyu131)
(continued)
Table 3 (continued)
QTL
RILs 36 4.5– 2, 3, 6, 7, 9, 10, SS 190 lines Yang et al.
35.4 and 11 (Dongnong422/ (2018)
Kongyu131)
BILs 5 8.8– 4, 8, and 12 SS 202 lines (XB//XB/ Yu et al.
60.9 DWR) (2018)
RILs 15 5.0– 1, 6, 7, 8, 9, 11, SS 204 lines (LTH/SHZ-2) Zhang et al.
23.1 and 12 (2014c)
RILs 5 5.5– 3, 7, and 11 SS 269 lines (Lemont/ Zhi-Hong
29.8 Teqing) et al. (2005)
GWAS 17 5.2– 2, 3, 4, 5, 6, 8, 9, GS 174 Chinese rice Pan et al.
59.2 10, 11, and 12 accessions (2015)
GWAS 33 5.2– 1, 2, 3, 4, 5, 6, 7, RS 174 Chinese rice Pan et al.
59.2 8, 10, and 12 accessions (2015)
GWAS 67 3.8– 1, 2, 3, 4, 5, 6, 7, SS 295 Rice diversity Wang et al.
8.2 8, 9, 10, and 11 panel (2016)
GWAS 45 3.5– 1, 2, 3, 4, 5, 6, 7, GS 202 Rice mini-core Schläppi
11.9 8, 9, 10, 11, collections et al. (2017)
and 12
GWAS 54 – 1, 2, 4, 5, 6, 7, 8, GS 400 Rice diversity Shakiba
9, 10, 11, and 12 panel et al. (2017)
GWAS 23 3.1– 1, 2, 3, 4, 5, 6, SS 249 Chinese rice Zhang et al.
13.2 10, 11, and 12 accessions (2018)
identified on chromosome 2 (qLTG-2-1), chromosome 5 (qLTG-5-2.1 and

qLTG-5-2.2), and chromosome 7 (qGV7-1.1 and qGI7-1.2) (Xu et al. 2008; Yang
et al. 2018). With a comprehensive analysis of GS-QTLs, nine genetic regions on
eight chromosomes (Ch3: 17.2–17.8 Mb, Ch5: 21.5–21.6 Mb, Ch6: 5.4–6.2 Mb,
Ch7: 1.7–2.7 and 20.13–22.6 Mb, Ch9: 21.9–24.6 Mb, Ch10: 11.6–14.2 Mb, Ch11:
23.0–24.2 Mb, and Ch12: 7.0–7.1 Mb) had more than four GS-QTLs that were
colocalized. Recently, Yang et al. (2018) identified 12 and 23 QTLs for low-
temperature germinability (LTG) and cold tolerance at the seedling stage by using
recombinant inbred lines (RILs) that were derived from a backcross population of
Dongnong422 and Kongyu131. Interestingly, seven QTLs on chromosome 12 in the
7.1 Mb region and four QTLs on chromosome 7 in the 22.55 Mb region were colo-
calized, and they were associated with several GS traits such as germination time
and rate, mean length of incubation time, coefficient of germination, germination
value, mean daily germination, and germination index. Cloning and characteriza-
tion of the major QTL qLTG3-1, conferring more than 30% of the variation (Fujino
et al. 2004), revealed that this gene encodes for a protein of unknown function. At
the same time, a microarray analysis indicated that a complex metabolic and signal
70 QTLs from Bi-parental mapping populations QTLs from GWAS QTLs from both studies
Number of QTLs
60
50
40
30
20
10
0
35
Number of stage-specific
Germination stage Seedling stage Reproductive stage
30
25
QTLs
20
15
10
5
0
Fig. 3 Summary of QTL distributions by chromosome
pathway was involved (Fujino and Matsuda 2010). Genome-wide expression analy-
sis suggested that genes involved in defense responses were upregulated by qLTG3-1
and played a more general role in germination (Fujino et al. 2008), whereas correla-
tion with proteomics indicated its involvement in rice growth and adaptability
(Fujino and Sekiguchi 2011). With genome-wide association mapping studies, Pan
et al. (2015) identified significant 17 QTLs from the 174 mini-core collections of
Chinese rice accessions, 45 QTLs from the 202 Rice Mini-Core Collections
(Schläppi et al. 2017), and 54 QTLs from a global collection of 400 Rice Diversity
Panel 1 (Shakiba et al. 2017) that were detected under low-temperature germinabil-
ity in rice. Given these challenges and potential in the form of effective QTLs
(E-QTLs) with colocalization of QTLs, the development of molecular markers for
selection for LTG would significantly contribute to identifying and developing LTS-
tolerant varieties.
Fig. 4 Diagram of LTS-tolerance QTLs by comprehensive literature survey and Gramene data-
base (http://archive.gramene.org) in rice. On the right side, the numerical values in chromosome
bars indicate the position of QTLs and genes in Mb, and on the left side, those indicate the QTLs
for stage-specific and LTS-tolerance genes. A colored font represents the stage-specific QTLs
(green: germination; blue: seedling; and red: reproductive/booting stage) and genes for LTS toler-
ance (pink). The octagonal shapes and numerical values represent the two different stage-specific
QTLs that were colocalized in the same genetic region, and the square shape indicates the QTLs
and reported LTS-tolerance genes aligned together in the same genetic regions of chromosomes
3.2 Seedling Stage
Low-temperature stress severely affects the SS, causes slow growth, yellowing
symptoms on leaves, drying of leaves, and decreased early seedling vigor, and ulti-
mately leads to seedling death (Wang et al. 2011; Lone et al. 2018). Tolerance of
LTS at the SS is one of the key stages to ensure stable early seedling growth in
temperate and high-altitude regions. For the genetics of the SS, several researchers
Table 4 Colocalization of stage-specific QTLs for LTS tolerance

Number Position
Chromosome of QTLs QTLs Stage (Mb) Traits References
1 4 qPL-1, qPW-1, SS 4.5 Panicle length, Liu et al.
qSPA-1, and and panicle weight, (2013), Park
qCST1-2 RS chlorophyll et al. (2013),
content, and Wainaina
seedling cold et al. (2018)
tolerance
2 qCTSR1-1 and GS 22.9 Seedling survival Shakiba
qCTGERM1-6 and rate and cold et al. (2017),
SS tolerance at Zhang et al.
germination (2018)
2 qSCT1a and SS 40.1 18 days after Kim et al.
qLTRSSR1-1 and seedling cold (2014), Pan
RS tolerance and et al. (2015)
seed-setting rate
2 4 qCTS-2, GS 21.1 Cold tolerance at Lou et al.
qMLIT2-1, and seedling stage, (2007), Yang
qCG2-1.1, and SS mean length of et al. (2018)
qCG2-1 incubation time,
and coefficient of
germination
4 qCTGERM2-4, GS 21.8 Cold tolerance at Shakiba
qGV2-1, and germination, et al. (2017),
qRCL2-1, and SS germination value, Yang et al.
qRL2-2 relative (2018)
conductivity of
leaves, and root
length
3 3 qCTS3-8, SS 3.7 Cold tolerance at Pan et al.
qLTRSSR3-1, and and seedling stage and (2015),
qLTSSR3-1 RS seed-setting rate Wang et al.
(2016)
(continued)
Table 4 (continued)
Number Position
4 5 qGR-4_18d, GS 4.4 Germination rate Miura et al.
qGR-4_20d, after 18, 20, and (2001),
qGR-4_23d, 23 days of cold Wang et al.
qGI-4-1_20d, and stress, (2009)
qLTG4-1 germination
index, and
low-temperature
germination
2 qLTSS4-2 and GS 30.1 Low-temperature Pan et al.
qLTSSR4-1 and seedling (2015),
RS survivability and Schläppi
seed-setting rate et al. (2017)
2 qLTG-4 and GS 32.7 Germination rate Dai et al.
qCTB-1.4 and at 12 days and (2004), Xu
RS cold tolerance at et al. (2008)
booting stage
2 qNGR4 and GS 35.1 Germination rate Pan et al.
qLTSSvR4-1 and after 8 days of (2015), Jiang
SS cold stress and et al. (2017)
seedling survival
rate
6 2 qLTRSSR6-1 and RS 5.1 Seed-setting rate Pan et al.
qLTSSR6-1 (2015)
2 qCTGERM6-2 GS 6.2 Cold tolerance at Wang et al.
and qCTS6-2 and germination and (2016),
SS cold tolerance at Shakiba
seedling stage et al. (2017)
2 qSNP-6 and SS 21.7 Spikelet number Jiang et al.
qSCT-6 and and cold tolerance (2008),
RS at seedling stage Wainaina
et al. (2018)
(continued)
Table 4 (continued)
Number Position
7 2 qLTSS7-2 and GS 9.0 Low-temperature Ji et al.
qPSSR-7 and seedling (2010a, b),
RS survivability and Schläppi
percentage of seed et al. (2017)
set reduction ratio
in cold-water-
treated plot
2 q1-2IL, qRSLL, GS 9.5 First and second Ji et al.
and qLTG-7 and internode length, (2008), Sun
RS reciprocal et al. (2019)
secondary leaf
length, and
low-temperature
germinability
2 qCTB7 and GS 10.5 Percentage of Andaya and
qCTGERM7-1 and undeveloped Mackill
RS spikelets and cold (2003b),
tolerance at Shakiba
germination et al. (2017)
2 qPW-7 and SS 18.2 Panicle weight Wang et al.
qCTS7-3 and and cold tolerance (2016),
RS at seedling stage Wainaina
et al. (2018)
7 qGV7-1, qCG7-1, GS 22.5 Germination Yang et al.
qGI7-1, and value, coefficient (2018)
qMLIT7-1, SS of germination,
qRLcold7-1, germination
qRFW7-1, and index, root fresh
qRL7-1 weight, and root
length
2 qCTGERM7-5 GS 28.3 Cold tolerance at Schläppi
and qLTSSvR7-2 and germination and et al. (2017),
SS low-temperature Shakiba
seedling et al. (2017)
survivability rate
8 2 qCTS-8 and SS 0.7 Cold tolerance at Pan et al.
qLTSSvR8-1 seedling stage and (2015),
seedling Wang et al.
survivability rate (2016)
3 qLTRSSR8-1, RS 14.3 Relative Pan et al.
qLTSSR8-1, and seed-setting rate (2015)
qCTSSR8-1 and seed-setting
rate under cold
water
(continued)
Table 4 (continued)
Number Position
9 2 qIR-9, qIR-9, and GS 13.6 Imbibition rate at Wang et al.
qLTG-9 and 48 h 4 days after (2009), Li
SS imbibition and et al. (2013)
14th day of
germination
2 qGV9-1, GS 24.6 Germination value Yang et al.
qGV9-1.2, and and and crimp ratio of (2018)
qCRL9-1 SS leaves
10 4 qLTG-10, GS 14.2 Low-temperature Chen et al.
qLTG-10, germinability and (2006a), Xu
qLTG-10, and 12th and 13th day et al. (2008)
qSCT10 of germination
3 qCST10, GS, 19.1 Cold seedling Pan et al.
qLTG10-1, and SS, tolerance, (2015),
qLTRSSR10-1 and low-temperature Schläppi
RS germination, and et al. (2017)
relative seed-
setting rate
2 qLTG10-2 and GS 21.3 Low-temperature Kuroki et al.
qctb_2005-10 and germination and (2009),
RS cold tolerance at Schläppi
booting stage et al. (2017)
11 2 qLTSS11-1 and GS 5.7 Low-temperature Schläppi
qCL-11 and seedling et al. (2017),
RS survivability and Wainaina
culm length et al. (2018)
2 qLTG11.1 and GS 6.8 Low-temperature Wang et al.
qCTS11.1 and germinability and (2011)
SS cold tolerance at
seedling stage
2 qCTS11-6 and GS 19.9 Cold tolerance at Wang et al.
qGV11-1 and seedling stage and (2016), Yang
SS germination value et al. (2018)
GS germination stage, SS seedling stage, BS/RS booting/reproductive stage
have identified SS-specific QTLs using different genetic backgrounds of mapping

populations such as RILs, near-isogenic lines (NILs), introgression lines, doubled
haploids, and segregating F2 and F3 families (Biswas et al. 2017; Liang et al. 2018;
Sun et al. 2019). However, the genetic backgrounds of japonica donors as LTS-
tolerant cultivars have revealed that several QTLs and genes are controlling LTS
tolerance during the SS in rice. So far, more than 249 QTLs (both major and minor)
have been mapped on all of the rice chromosomes responsible for LTS tolerance at
the seedling stage (Table 3). Among the total QTLs, 159 were identified from
biparental mapping populations and 90 from GWAS. The phenotypic variance of

these QTLs ranges from 4.51% to 60.96%. Fifteen M-QTLs (≥30% PVE) were
identified on six different chromosomes: 4, 6, 7, 8, 11, and 12. However, only a few
of them were M-QTLs that were colocalized with different stage-specific QTLs. For
instance, qSCT4.2 (57.62% PVE) on chromosome 4 (22.3–26.91 Mb) was shared
with four QTLs (qRL-4-2_23d, q9d-4, qLTG-4-2, and qHD-4) for root length, per-
centage of plumule growth, germination rate, and heading date under LTS condi-
tions (Miura et al. 2001; Wainaina et al. 2018; Yu et al. 2018). Similarly, qSCT8
(60.96% PVE) on chromosome 8 (24.6–27.8 Mb) was shared with cold-tolerance
seedling-stage QTL qCTS8-1 (Andaya and Mackill 2003b), seed weight per plant
QTL qSWTCT8-4 (Shakiba et al. 2017), and seedling survival rate QTL qLTSSvR8-2
(Pan et al. 2015). Importantly, two M-QTLs (qCTS12a and qCTS12b) for cold-
induced wilting tolerance and cold-induced necrosis tolerance on chromosome 12
had PVE of 40.6% and 41.7% (Andaya and Mackill 2003b), respectively. The same
genetic region of 7.1–9.3 Mb overlapped with ten QTLs for GS- and RS-related
traits such as germination index, incubation time, coefficient of germination, and
seed-setting rate (Pan et al. 2015; Yang et al. 2018). Other two M-QTLs (qGAS12
and qSCT12.1) had PVE of 42.9% and 53.09%, respectively. These QTLs were
associated with the growth ability of seedlings at low temperatures (Han et al. 2004)
and seedling cold tolerance (Yu et al. 2018) on chromosome 12. The genetic region
of 24.2–25.0 Mb was shared with GS- and SS-specific QTL qCTS12.1 (Wang et al.
2011), qLTSS12-2 (Schläppi et al. 2017), and qSWTCT12 (Shakiba et al. 2017).
The seedling-stage QTLs (seven genetic regions on seven chromosomes) were
found to overlap with more than five SS-specific QTLs. The highest number of
QTLs was found to overlap in the 16.3–18.4 Mb region on chromosome 10 (12
QTLs), followed by 11 QTLs on chromosomes 2 and 11 (at 14.3–17.7 and
6.8–11.3 Mb), six QTLs on chromosome 3 (2.7–3.7 Mb) and chromosome 9
(1.1–4.8 Mb), and five QTLs on chromosome 7 (22.5–23.8 Mb) and chromosome
11 (24.9–25.4 Mb), respectively. However, two chromosomes (7 and 11) have sig-
nificant M-QTLs that are also colocalized with more than five QTLs. In a deeper
understanding of these two chromosomes, the M-QTL qCTS7(2) on chromosome 7
(20.0–20.9 Mb) had PVE of 35.3%, and it overlapped with two other QTLs (qCT-
GERM7-4 and qCTB-1.7) related to GS and RS (Dai et al. 2004; Ranawake et al.
2014; Shakiba et al. 2017). Another M-QTL, qCTS11(1)-2 on chromosome 11
(20.5–26.0 Mb), had PVE of 35.6% (Ranawake et al. 2014), the same region was
associated with a seed germination recovery rate QTL (qGRR11) (Jiang et al. 2017),
and two SS-specific QTLs (qCTS11-9 and qCTS11-10) were identified from the
GWAS analysis (Wang et al. 2016). Therefore, the combination of stage-specific
QTLs with GS, SS, and RS in the same genetic region could be a promising site for
identifying potential candidate genes for improving LTS tolerance in the seed-
ling stage.
3.3 Booting/Flowering Stage
Unlike the GS and SS, the RS is highly sensitive to LTS. Many traits, such as micro-
spore abortion, no anther dehiscence, high spikelet sterility, incomplete panicle
exsertion, delayed heading, and failure to produce pollen grains, are affected by
LTS in the RS (da Cruz et al. 2013; Liang et al. 2018). Several studies have detected
and mapped many major- and minor-effect QTLs responsible for LTS tolerance at
the booting/flowering stage using different genetic backgrounds of mapping popu-
lations (Table 3). So far, more than 100 QTLs have been mapped on all of the rice
chromosomes. The QTLs for tolerance at the RS showed that 81 QTLs from bipa-
rental mapping populations and 33 QTLs from GWAS were identified from the
comprehensive literature survey. The phenotypic variance of these QTLs ranges
from 2.94% to 71.0%. A total of 14 M-QTLs (≥30% PVE) were located on six dif-
ferent chromosomes (1, 2, 4, 7, 8, and 10). Saito et al. (1995) reported two QTLs on
chromosomes 3 and 4 responsible for cold tolerance at the booting stage from Norin
PL8. Saito et al. (2001) also reported two OTLs (Ctb-1 and Ctb-2) on chromosome
4 governing spikelet fertility under cold stress by using a set of NILs derived from
a cross between cold-tolerant rice variety Norin PL8 and cold-sensitive commercial
variety Kirara397 from northern Japan. By using cool-water irrigation (19 °C),
Kuroki et al. (2009) identified five QTLs for cold tolerance at the booting stage, four
QTLs for days to heading, and three QTLs for culm length on chromosomes 1, 2,
and 10. One of the major QTLs (qCTB.1) flanked by RM1003 and RM3482 on
chromosome 1 associated with cold tolerance at the booting stage was discovered
after 3 years of field trials at the National Agricultural Research Centre for Hokkaido
Region, Sapporo, Japan. Similarly, eight QTLs for the booting stage were identified
on chromosomes 1, 4, 5, 10, and 11 by using a set of NILs from a cold-tolerant
japonica landrace (Kunmingxiaobaigu) and cold-sensitive japonica cultivar
(Towada) (Xu et al. 2008). However, four QTLs (qCTB-1-1, qCTB-4-1, qCTB-5-1,
and qCTB-5-2) were detected in two different environments.
A total of nine genetic regions on chromosome 1 (28.6 and 36.6 Mb), chromo-
some 2 (21.5 Mb), chromosome 4 (24.5 Mb), chromosome 7 (8.1 and 18.1 Mb),
chromosome 8 (11.5 Mb), and chromosome 10 (9.2–9.6 and 20.0–25.2 Mb) were
associated with tolerance of RS traits such as heading time, booting stage, culm
length, spikelet fertility, spikelet number, and panicle weight (Dai et al. 2004;
Kuroki et al. 2009; Wainaina et al. 2018). The M-QTL (qCTB_1) on chromosome 1
for cold tolerance at the booting stage had PVE of 47.3% (Kuroki et al. 2009), and
it was close to the genetic region associated with SS-specific QTL qCTSR1-3
(36.9 Mb) (Zhang et al. 2018) and MYB transcription factor OsMYB3R-2 (36.1 Mb),
which is bound to the mitotic-specific activator during LTS tolerance (Ma et al.
2009). The overexpression of this gene significantly enhances the many transcripts
for G2/M phase-specific genes in response to cold stress. Another M-QTL (qSNP_1;
28.6 Mb) in the genetic region on the same chromosome overlapped with Osa-
MIR319a. In rice, the miR319 gene family comprises two genes, Osa-MIR319a and
Osa-MIR319b. Both of them are significantly involved in increasing leaf blade

width under cold tolerance (Yang et al. 2013a). The colocalization of stage-specific
QTLs on chromosome 2 is associated with nine QTLs (21.1–21.8 Mb) for GS- and
SS-specific QTLs (Lou et al. 2007; Shakiba et al. 2017; Yang et al. 2018). Similarly,
the M-QTL qPW-7 (PVE of 41%) on chromosome 7 overlapped with cold-tolerance
seedling-stage QTL qCTS7-3 (Wang et al. 2016). Six M-QTLs were associated with
tolerance of RS traits on chromosome 10. In the interval regions of M-QTLs, two
QTLs (qLTG10-2, 21.1 Mb; qCTGERM10-4, 22.3 Mb) and one DNA-binding
repeat MYB transcription factor (OsMYBS3, 22.1 Mb) are responsible for cold tol-
erance at the GS and SS (Su et al. 2010; Schläppi et al. 2017; Shakiba et al. 2017).
The overexpression of MYBS3 confers chilling tolerance, and it has also been asso-
ciated with MYBS3-mediated cold signaling pathways (Su et al. 2010). Taken
together, the stage-specific QTLs of different combinations of GS, SS, and RS and
associated candidate gene results could prove to be useful in breeding programs for
low temperature-tolerant rice lines. These M-QTLs along with colocalized stage-
specific QTLs have great potential for use in the future as their application through
marker-assisted selection will hasten the process of developing cold-tolerant rice
varieties for temperate and high-altitude ecosystems.
The LTS-tolerance QTLs mentioned above included a comparison of stage-specific
QTL positions across different genetic backgrounds of mapping population studies.
Such comparisons of stage-specific QTL positions are more informative. These QTLs
may harbor potential candidate genes related to LTS, thus providing valuable informa-
tion to develop LTS-tolerant rice cultivars. For this, the functionally characterized LTS-
tolerance genes were collected from the OGRO database (Overview of Functionally
Characterized Genes in Rice Online database) on the Q-TARO website (http://qtaro.
abr.affrc.go.jp/ogro). A total of 38 candidate genes were involved in LTS tolerance in
different parts of the rice plant. Specific gene functions for LTS tolerance and stages are
mentioned in Table 5 and are also mapped on the genetic map (Fig. 4). Among these
candidate genes, the majority of them were associated with the SS (25 genes), followed
by two genes for the RS. The remaining eight genes were for the SS and RS, two genes
for the GS and SS, and a single gene for the GS and RS. Functionally, the candidate
genes were involved in altering the various metabolic and physiological pathways in
different growth stages of LTS-tolerance mechanisms. Seven genetic regions on four
chromosomes (17.9 Mb on chromosome 1; 25.6 and 34.4 Mb on chromosome 3; 15
and 25.7 Mb on chromosome 5; and 23.9 and 26.3 Mb on chromosome 6) are colocal-
ized with candidate genes and QTLs. For example, OsSPX1 is colocalized with
qCTS6-5 at 23.9 Mb on chromosome 6. A previous study revealed that OsSPX1 plays
a key role in the cross talk between cold tolerance, phosphate homeostasis, and oxida-
tive stress tolerance in the SS (Wang et al. 2013a), and the cold tolerance QTL
(qCTS6-5) was mapped in the SS by using GWAS (Wang et al. 2016). Based on the
fine-tuning of the interval regions of the M-QTLs, several researchers have identified
many candidate genes for LTS tolerance. The M-QTLs and colocalized QTLs within
identified genetic regions, especially on chromosomes 1, 3, 5, 7, and 10, may be poten-
tial genomic regions to introgress into existing moderately LTS-tolerant genotypes or
mega-varieties to improve their rate of tolerance in marker-assisted breeding programs.
4 Molecular Mechanisms of LTS Tolerance
Several genes and transcription factors are involved in regulating the molecular
pathways related to alteration of physiological and metabolic compounds and, fur-
ther, reprogramming of their gene expression patterns against cold-stress tolerance
mechanisms (Fig. 2). During LTS response, multiple sensors and signaling elements
on the plasma membrane trigger the expression of COR (cold-responsive) genes via
increasing cytosolic Ca2+ levels. This increase in Ca2+ is mediated by the ligand-
activated Ca2+ channels. Further higher levels of Ca2+ in the cytosol lead to signal
amplification through phospholipids (Williams et al. 2005; Hashimoto and Komatsu
2007; Chinnusamy et al. 2010), which are sensed by calcium-binding proteins and
other transcription factors regulating the expression of LTS-tolerance genes, which
can ultimately lead to adaptation and survival during cold-stress conditions
(Shinozaki and Yamaguchi-Shinozaki 2000). However, the changes in various gene
expression patterns are governed by a signal cascade mechanism, which also trig-
gers the formation of plant hormones (abscisic acid, salicylic acid, and ethylene)
that may be involved in integrating various stress signal pathways and controlling
downstream stress responses. CBF (C-repeat/DREB [drought-responsive element-
binding factor]) regulon is a highly conserved cold-response pathway (Chinnusamy
et al. 2010). The ICE1–CBF transcriptional cascade plays a crucial role in cold
acclimation (Zhang et al. 2004). Constitutively expressed ICE1 (inducer of CBF
Expression 1) binds to the CBF promoter to activate cold-resistance genes, and
overexpressing ICE1 has significantly enhanced cold tolerance in Arabidopsis
(Chinnusamy et al. 2003). Similarly, ICE2 (At1g12860, a homolog of ICE1) over-
expression demonstrated enhanced freezing tolerance in Arabidopsis after cold
acclimation (Fursova et al. 2009). The report published showed that it interacts with
the alpha subunit of the sole heterotrimeric G protein, leading to a cytosolic Ca2+
signal or itself behaving as a cold-sensing calcium channel. A Ca2+ signal may be
mediated by CPKs and CBL-CIPKs, which in turn activate MAP kinases (Yang
et al. 2010). Phosphorylation of transcription factors such as that of CAMTAs and
ICE1/2 is supposed to be caused by activated MPKs, which in turn activate COR
genes (Zhu 2016).
Most COR genes carry C-repeats or DREBs (CCGAC cis-element) in their pro-
moters, which bind to CBFs to activate their expression (Chinnusamy et al. 2007).
The induction of CBF1, CBF2, and CBF3 precedes the COR genes in response to
cold stress. Constitutive overexpression studies in Arabidopsis revealed redundant
functional activities of CBF1, CBF2, and CBF3 and showed different functions in
cold acclimation (Gilmour et al. 2004). This was observed in the cbf2 T-DNA inser-
tion mutant with enhanced tolerance of freezing (with or without cold acclimation),
dehydration, and salt stress through increased expression of CBF1 and CBF3.
Furthermore, the cold-induced expression of CBF1 and CBF3 precedes that of
CBF2, revealing a temporal difference in CBF expression. These results indicate
that CBF1 negatively regulates CBF3 and CBF2 to optimize the expression of
downstream target genes (Doherty et al. 2009). Transgenic analysis of CBF1 and
Table 5 Functionally characterized LTS-tolerance genes and stages in rice
246
Position Gene
S. No. Chr (Mb) length Gene Cold treatment Stage Expression analysis Function References
1 chr01 0.21 4.41 kb OsCOIN 4 °C for 60, 72, SS Young root, stem, lamina, Cold-inducible zinc finger protein Liu et al.
and 84 h and leaf sheath, young panicle, for tolerance of cold, salt, and (2007)
RS mature panicle, stem drought
primordia, pedestal, and
stipital leaf
2 chr01 5.78 2.63 kb OsGSK1 4 °C in Yoshida SS Lamina joint in collar Glycogen synthase kinase3-like Koh et al.
nutrient solution and region, vascular bundles gene for stress signal-transduction (2007)
RS of coleoptile, and young pathways and in floral
panicle developmental processes
3 chr01 6.68 199 bp Osa- Initially, 12 °C SS Flag leaf Increased leaf blade width Yang et al.
MIR319b for 7 days and (2013a)
then at 4 °C for
4 days
4 chr01 17.91 5.21 kb OsMKK6 4 °C for 0, 1, 3, SS Leaves Oryza sativa MAPK kinase 6 for Kumar et al.
6, and 12 h tolerance of cold and salt (2008)
5 chr01 28.58 193 bp Osa- Initially, 12 °C SS Flag leaf Increased leaf blade width Yang et al.
MIR319a for 7 days and (2013b)
then at 4 °C for
4 days
6 chr01 32.22 3.75 kb OsGH3-2 4 °C with 14 h SS Shoot, root, leaf size, Modulation of abscisic acid and Greco et al.
light/10 h dark and calli, and low levels in auxin levels in response to (2012)
for 5 days RS panicles and stems stress-tolerance mechanisms of
cold and drought
7 chr01 36.13 5.66 kb OsMYB3R-2 2 °C at 0, 24, SS Root, internode, leaf, Encodes active transcription factor Ma et al.
48, 60, 72, and and lamina joint, leaf sheath, involved in higher transcript levels (2009)
84 h RS flower, and immature seed in G2/M phase
S. Najeeb et al.
Position Gene
8 chr01 38.40 2.49 kb SNAC2 3–8 °C for 48 h SS Root, stem, internodes, Stress-responsive NAC gene, Hu et al.
leaf sheath, and ligule specifically induced in guard cells (2008)
in response to cold and salt
9 chr01 38.40 2.49 kb OsNAC6 4 °C for 0–24 h SS 2-week-old rice leaves NAM-ATAF-CUC family 6 Nakashima
transcription factor, enhances et al. (2007)
tolerance of drought, cold, salt,
and also blast disease
10 chr01 42.73 838 bp OsDREB1F 4 °C for 0.5, 1, SS Young roots, young Dehydration-responsive element- Wang et al.
6, and 24 h leaves, mature roots, binding transcription factor 1F (2008)
mature leaves, spike, and
callus
11 chr02 20.17 988 bp ASR3 4 °C for 5 h SS Leaves and roots ABA-dependent stress-responsive Joo et al.
protein; induces drought- and (2013)
cold-tolerance mechanism
regulated by hormone and sugar
signals
12 chr02 26.77 4.02 kb OsTPP1 6–8 °C for 0 GS 2-week-old seedlings Trehalose-6-phosphate Ge et al.
and 20 min, 1, and phosphatase1 serves as sugar (2008)
3, 6, 12, 24, and SS storage and enhances tolerance of
Genetics and Breeding of Low-Temperature Stress Tolerance in Rice
72 h drought, cold, and salt stress,

without alteration of growth
13 chr02 29.73 5.03 kb OsFAD2 4 °C for 4 days GS Root, seed, stem, and leaf Fatty acid desaturase 2 is a key Shi et al.
and enzyme responsible for increasing (2012)
RS germination rate and grain yield
under LTS
(continued)
247
Table 5 (continued)
248
Position Gene
14 chr03 25.63 4.02 kb Osv1 20 °C for SS Pre-emerged immature Chloroplast-localized protein Zhang et al.
22 days leaves NUS1, actively involved in the (2011)
regulation of chloroplast RNA
metabolism and establishing the
plastid genetic system for cold
conditions
15 chr03 30.22 8.19 kb OsHOS1 10 °C for 0 h SS 2-week-old seedlings E3-ubiquitin ligase OsHOS1 gene Lourenço
(28 °C), 2 h involved in proteasome-mediated et al. (2013)
(10 °C), 5 h stress response to cold stress
(10 °C), and
24 h (10 °C)
16 chr03 34.42 853 bp ZFP182 4 °C for 4 days GS 2-week-old seedlings TFIIIA-type zinc finger protein182 Huang et al.
and promotes accumulation of various (2012)
SS osmolytes, which involves
multiple abiotic stress tolerance
17 chr03 11.53 5.7 kb OsCIPK03 4 °C for 0, 3, 6, SS 2-week-old seedlings Calcineurin B-like protein Xiang et al.
12, and 24 h significantly increased the amount (2007)
of proline and soluble sugar
accumulation in drought- and
cold-stress conditions
18 chr04 34.98 1.22 kb OsCAF1B 4 °C for 21 days SS 3-week-old seedlings of Rice carbon catabolite repressor 4 Chou et al.
and root, shoot, leaf, sheath, triggers the deadenylation (2014)
RS leaf base, leaf tip, panicle mechanism in the plant-P-body
axis, and spikelet and is linked with microtubules
19 chr05 2.22 1.04 kb OsLti6b 12 °C for RS Vascular tissues of Encodes for hydrophobic protein, Kim et al.
4 days, before filaments, anthers, ovaries, expressed in ovaries and stamens (2007)
heading of stamens, leaves, and of cold-treated flowers
5–10 days spikelets
S. Najeeb et al.
Position Gene
20 chr05 14.99 2.1 kb OsWRKY45 4 °C for 3–24 h. SS Leaves OsWRKY45 plays a major role in Tao et al.
ABA signaling and as a cross-talk (2011)
mechanism in biotic and abiotic
stresses
21 chr05 25.72 7.21 kb OsTPS1 4 °C for 0, 1, 2, SS 2-week-old seedlings Overexpression of TPS1 results in M Li et al.
4, 6, 12, and increasing trehalose and proline (2011b)
24 h concentration and regulates
stress-responsive genes for cold
and salt
22 chr05 28.62 2.25 kb OsRAN2 4 °C for 72 h SS 2-week-old seedlings Ran is a nuclear GTPase involved Chen et al.
in GTP hydrolysis mechanism and (2011)
mediates nuclear transport of RNA
and proteins in cell cycle and in
regulating cold tolerance
23 chr06 1.44 766 bp OsDREB1C 4 °C for 24 h SS 17-day-old seedlings Overexpression of the Ito et al.
dehydration-responsive element- (2006)
binding protein 1C significantly
improves tolerance of drought-,
cold-, and salt-stress conditions
24 chr06 23.88 4.53 kb OsSPX1 4 °C for 24 h SS 1-week-old seedlings SPX domain proteins are involved Wang et al.
in phosphate (Pi) signal (2013a)
transduction pathways and cross
talk between the oxidative
pathway and cold-stress
mechanism
(continued)
249
Table 5 (continued)
250
Position Gene
25 chr06 24.49 1.92 kb OsiSAP8 4 °C for 0, 2, 3, SS, 1-week-old seedlings SAP gene family protein transcript Kanneganti
4, 6, 12, 24, and and was detected at higher levels in and Gupta
48 h RS root and prepollination-stage (2008)
panicle and is significantly
expressed in multiple abiotic
stresses
26 chr06 26.28 5.77 kb OVP1 4 °C for 12 h SS 10-day-old seedlings Vacuolar HD-translocating Zhang et al.
inorganic pyrophosphatase 1 (2011)
involved in decreased
malondialdehyde content and
accumulation of more proline for
tolerance of cold
27 chr06 27.30 2.17 kb OsbZIP52/ 4 °C for 0, 0.5, SS, Roots, leaves from Overexpression of basic leucine Liu et al.
RISBZ5 1, 2, 4, 6, 12, and 2-week-old seedlings, and zipper 52 serves as negative (2012)
24, and 48 h RS stems, flag leaves, flowers, regulator of drought and cold
and developing seeds at stress
2 days after flowering and
at milk grain stage
28 chr07 18.72 8.48 kb CRTintP1 5 °C for 3 days SS Leaf sheaths Accumulation of these Komatsu
calreticulin-interacting proteins et al. (2007)
involved in signal transduction
mechanism in cold stress
29 chr08 2.18 3.5 kb OsDEG10 4 °C for 0, 24, SS 17-day-old seedlings Encodes small RNA-binding Park et al.
48, and 72 h. protein and plays a major role in (2009)
response to cold, salt, anoxia, and
photooxidative stress
S. Najeeb et al.
Position Gene
30 chr08 3.95 2.1 kb Oscrr6 20–35 °C for 0, SS 3-week-old seedlings Encodes an NDH-dependent Yamori et al.
24, 48, and 72 h cyclic electron flow and plays a (2011)
key role in physiological pathways
during photosynthesis and growth
development at low temperature
31 chr09 14.98 1.53 kb OsWRKY76 4 °C for 72 h SS 2-week-old seedlings Plays a dual role in promoting Yokotani
blast disease resistance and cold et al. (2013)
tolerance
32 chr09 20.40 922 bp OsDREB1A 4 °C for 24 h SS 17-day-old seedlings Overexpression of dehydration- Ito et al.
responsive element-binding (2006)
protein 1C significantly improves
tolerance of drought-, cold-, and
salt-stress conditions
33 chr09 21.31 1.35 kb OsPIP2 25 °C for 2 h SS Leaves and roots Represents plasma membrane Li et al.
intrinsic proteins that are involved (2008)
in water transport and maintenance
of the water balance in cells under
cold stress
34 chr10 2.90 1.37 kb OsPRP3 4 °C for 10 h RS Leaves and flowers Flower-specific proline-rich Gothandam
protein 3 enhances expression et al. (2010)

during cold stress
35 chr10 22.13 8.31 kb MYBS3 4 °C for 72 h SS 1-week-old seedlings Is a DNA-binding repeat MYB Su et al.
transcription factor and mediates (2010)
cold-signaling pathways
(continued)
251
Table 5 (continued)
252
Position Gene
36 chr11 3.28 971 bp OsAsr1 12 °C for SS Leaf, palea and lemma, Highly expressed with C-repeat/ Kim et al.
4 days, before and and anther dehydration responsive element- (2009)
heading RS binding factor 1; involved in cold
tolerance at vegetative and
reproductive stages
37 chr11 3.28 971 bp ASR1 4 °C for 5 h SS Leaves and roots ABA-dependent stress-responsive Joo et al.
protein; induces drought- and (2013)
cold-tolerance mechanism
regulated by hormone and sugar
signals
S. Najeeb et al.
CBF3 RNAi lines revealed that both CBF1 and CBF3 are required for the full set of
CBF regulon expression and freezing tolerance (Novillo et al. 2004). While respond-
ing to cold stress, ICE1 and calmodulin-binding transcription activators (CAMTAs)
bind to CBF3 and CBF2 promoters, respectively, to respond to their expression
(Doherty et al. 2009). Furthermore, in many cellular signaling pathways, particu-
larly in response to cold stress, protein phosphorylation is considered crucial, and it
predicts the involvement of one or more protein kinases to phosphorylate ICE1 to
help in CBF expression (Chinnusamy et al. 2007; Yang et al. 2010).
4.1 ignaling Pathways Leading to LTS Tolerance

S
from the Cloned Genes
Transgenic and gene expression analysis has helped to understand the physiological
mechanisms responsible for tolerance against various abiotic stresses, including
LTS, in plants (Gao et al. 2008; Moraes De Freitas et al. 2016). Using the OGRO
database on the Q-TARO website, we collected 38 candidate genes that have been
functionally characterized for LTS tolerance in different stages of the rice plant
(Table 5 and Fig. 4). Among the total number of genes, eight were involved in the
two stage-specific tolerance mechanisms of LTS. Four genes on chromosome 1
(OsCOIN, 0.2 Mb; OsGSK1, 5.7 Mb; OsGH3-2, 32.2 Mb; and OsMYB3R-2,
36.1 Mb), two genes on chromosome 6 (OsiSAP8, 24.4 Mb; and OsbZIP52,
27.3 Mb), and a single gene on chromosome 4 (OsCAF1B, 34.9 Mb) and chromo-
some 11 (OsAsr1, 3.2 Mb) were associated with tolerance at the SS and RS in rice.
The promising genetic regions of OsGH3-2 (Greco et al. 2012) and OsMYB3R-2
(Ma et al. 2009) showed clear evidence of seedling survival rate and seed-setting
rate under cold stress. The overexpression of OsGH3-2 significantly modulates
abscisic acid (ABA) and endogenous indole-2-acetic acid (IAA) homeostasis,
resulting in increased cold tolerance. Furthermore, two genes (OsTPP1 and
OsFAD2) on chromosome 2 and a single gene (OsZFP182) on chromosome 3 were
associated with the GS, SS, and RS. Expression analysis of OsTPP1 confers a toler-
ance mechanism for salt and cold by activating the transcriptional regulation path-
ways (Ge et al. 2008). The expression pattern of OsFAD2 under LTS in different
tissues in young seeds, stems, roots, and leaves plays a significant role in membrane
lipid desaturation and maintenance of the lipid balance in different photosynthetic
tissue (Shi et al. 2012). Meanwhile, overexpression of OsZFP182 in transgenic
lines showed an increasing accumulation of various osmolytes, which resulted in an
increase in tolerance of drought, cold, and salt (Huang et al. 2012).
On chromosomes 5 and 10, two genes (OsLti6b and OsPRP3) are associated
with the RS. OsLti6a and OsLti6b encode membrane proteins that contribute greatly
to membrane stability (Morsy et al. 2005; Kim et al. 2007). OsPRP3 is a novel
flower-specific prorich protein (PRP) that is significantly overexpressed in the RS
under LTS, mainly in flower development (Gothandam et al. 2010). The remaining
25 candidate genes are involved in LTS tolerance in the SS. The important upregu-
lated or overexpressed genes/TFs concerning their expression and function in dif-
ferent LTS stages and in cold stress conditions are described briefly in Table 5. The
overexpression of several TFs and protein kinases, such as OsISAP8, OsbHLH1,
OsDREB1/CBF, ROS-bZIP, SNAC2, OsCIPK12, OsNAC6, OsCOIN, OsMAPK5,
OsMYB4, and OsISAP1, confers LTS tolerance in the SS in rice (Mukhopadhyay
et al. 2004; Nakashima et al. 2007; Xiang et al. 2007; Kanneganti and Gupta 2008).
For tolerance in the RS, two cell wall acid invertase genes (OsINV1 and OsINV4)
and one vacuolar acid invertase gene (OsINV2) were associated with low tempera-
ture at the pollen developmental stage. Among these genes, OsINV4 is anther-
specific and is downregulated by cold treatment, consequently causing a disturbance
in hexose production and starch formation in the pollen grains in the tapetum cells.
However, no decrease in expression of OsINV4 vis-à-vis any sucrose accumulation
in the anthers and pollen grains in a cold-tolerant cultivar (R31) was observed after
cold treatment (Oliver et al. 2005). The OsMAPK5 gene codes for a protein involved
in kinase activity usually induced by ABA and various biotic and abiotic stresses.
OX lines for the OsMAPK5 gene exhibited increased tolerance of cold and other
stresses (Xiong and Yang 2003). Thus, LTS tolerance at specific growth stages
involved essential stress-responsive genes and TFs, which may be potential targets
in genetic improvement for LTS tolerance in rice. However, the constitutive overex-
pression of these genes has led to metabolic instability and yield penalty and, as
observed in so many experiments, has retarded growth under normal conditions, as
shown by transgenic plants (Gilmour et al. 2000; Ito et al. 2006; Nakashima et al.
2007). Using stress-inducible promoters such as the rd29A promoter instead of con-
stitutive promoters minimizes these side effects on plant growth (Kasuga et al.
2004). However, although the complex nature of the cold-tolerance phenomenon
has been explained by transgenic technology, as many genes/TFs have been
exploited and manipulated, its field utility is yet to be explored and assessed.
The important COLD1 gene of Nipponbare in the background of 93-11 exhibited
tolerance in the rice SS by encoding a GTPase-accelerating binding factor that regu-
lates G-protein signaling by sensing cold to trigger Ca2+ signaling for cold tolerance
(Ma et al. 2015). Five QTLs (on chromosomes 1, 2, 4, 6, and 8) were reported from
the cross between chilling-tolerant Nipponbare (japonica) and chilling-sensitive
93-11 (indica) cultivars at 4 °C of cold treatment. Among these QTLs, three
(COLD2, COLD4, and COLD5) were found genetically interacting with each other,
and together, they contributed PV of 16.8%, while COLD1 alone exhibited PV of
7.23%. Fine-mapping of COLD1 leads to the identification of sequential alterations
at the first exon (SNP1) and fourth exon (SNP2) and five substitutions in introns
(SNP3) in the 4.78-kb region of the COLD1j gene (LOC_Os04 g51180). The trans-
genic approach proved that the SNP2 allele (COLD1jap) had a significant overex-
pression compared to WT plants and suggested that COLD1 modulates chilling
tolerance in rice. Therefore, a good combination of stage-specific QTLs and cold-
tolerance genes could be helpful for developing LTS tolerance in rice. Despite the
detection of cold-tolerance genes and QTLs, to date, none of the LTS-tolerant vari-
eties were ever developed through marker-assisted backcrossing (MAB). This raises
two questions: first, are the discovered LTS tolerance-related QTLs and genes veri-
fiably useful for MAB? Second, is there a lack of training of LTS-tolerance rice
breeders to exploit the advances in molecular genetics of LTS tolerance? However,
a more reliable and reproducible QTL must be first identified to improve LTS toler-
ance through more breeder-friendly MAB approaches.
4.2 Genome-Wide Association Studies for LTS Tolerance
The recent development in high-throughput genome sequencing platforms, GWAS,

has become a powerful tool to exploit linkage disequilibrium to dissect traits and
identify the genomic regions associated with a trait of interest. GWAS have been
used in various research efforts such as drought, salinity, and deficiency and toxicity
tolerance to understand the trait associated with the whole-genome sequence of
genotypes using a diverse set of rice germplasm accessions. The sequencing of rice
genotypes is commonly classified into SNP array genotypes and resequenced SNP
genotypes. Zhang et al. (2018) identified high-quality filtered reads with a call rate
of 95% for 3867 SNP markers by genotyping 249 indica rice varieties using a 5K
SNP rice array for cold tolerance at the bud burst stage. GWAS for severity of dam-
age (SD) and seed survival rate (SR) revealed 47 SNP loci significantly associated
with SD and SR in cold treatment at 5 °C for 5 days. Among these SNPs, the major
QTL qCTSR1-2 on chromosome 1 overlapped with qCTSD1-2, which explains
13.2% of the total phenotypic variation. GWAS for germination and reproductive
stages that Shakiba et al. (2017) conducted with the Rice Diversity Panel 1 (RDP1),
which consisted of 400 O. sativa accessions belonging to five major subpopula-
tions, resulted in the identification of 42 loci associated with cold tolerance, and
several QTLs were colocalized with previously reported LTS-tolerance QTLs.
Recently, Xiao et al. (2018) identified a potential candidate locus (LOC_
Os10g34840) on chromosome 10, which is responsible for cold tolerance at the
seedling stage, by assessing the total diversity panel of 1033 rice accessions with
289,231 SNP markers. The loci at 18.58–18.65 Mb overlap with previously reported
cold-tolerance QTLs (Xiao et al. 2015), and, furthermore, they have been fine-
mapped and validated by quantitative expression analysis. Similarly, using specific
locus amplified fragment sequencing (SLAF-seq) technology, Song et al. (2018)
conducted GWAS with 150 accessions of rice landraces by using high-density SNPs
A total of 26 significant SNPs were associated with cold tolerance at the seedling
stage. These SNPs had PVE ranging from 26% to 33%, and among them, three
QTLs were colocalized with previously cloned genes such as OsFAD2, OsMYB2,
and OsCIPK03 related to LTS tolerance at the rice seedling stage (Yang et al. 2012).
Interestingly, Song et al. (2018) noticed a strong signal of trait-marker association
peaks on chromosome 1, with PVE of 27%. The expression profiling and bioinfor-
matics analyses reveal that a novel candidate gene (Os01g0620100) showed a sig-
nificant difference between the cultivars tolerant and sensitive to LTS because of the
polymorphism in the WD40 domain. Thus, Os01g0620100 is an important source
for developing LTS tolerance by using marker-assisted selection. A comprehensive

literature survey of GWAS for LTS tolerance resulted in a total of 239 QTLs distrib-
uted on all 12 chromosomes (Fig. 3). Among these, 116 QTLs for GS, 90 QTLs for
SS, and 33 QTLs for RS were reported by several researchers (Pan et al. 2015;
Wang et al. 2016; Sales et al. 2017; Schläppi et al. 2017; Shakiba et al. 2017; Singh
et al. 2017; Zhang et al. 2018). The highest number of QTLs was detected on chro-
mosome 2 (42), whereas the lowest number was detected on two chromosomes, 10
and 12 (14 QTLs). The physical position of each stage-specific QTL from GWAS
revealed that three major genetic regions on chromosome 1 (41.39–41.86 Mb),
chromosome 3 (3.03–3.76 Mb), and chromosome 6 (6.01–6.80 Mb) were colocal-
ized with more than four QTLs. Two QTLs (qCTGERM1-8 and qSWTCT1-2) for
GS and two other QTLs (qCTS1-4 and qCTS1-5) for SS stage-specific QTLs over-
lapped on chromosome 1 (Wang et al. 2016; Shakiba et al. 2017). Similarly, eight
QTLs (qCTS3-6, qCTS3-7, qCTSR3-1, qCTSD3-1, qCTS3-8, qLTRSSR3-1,
qLTSSR3-1, and qCTS3-9) detected on chromosome 3 for GS, SS, and RS were
colocalized (Pan et al. 2015; Wang et al. 2016; Zhang et al. 2018). Four QTLs asso-
ciated with three traits related to germination rate, cold tolerance at the seedling
stage, and plumule recovery growth after cold exposure were colocalized on chro-
mosome 6 for the GS and SS (Wang et al. 2016; Schläppi et al. 2017; Shakiba et al.
2017). Interestingly, five chromosomal regions at 30.1 Mb (chromosome 4), 5.1 Mb
(chromosome 6), 28.3 Mb (chromosome 7), 14.2 Mb (chromosome 8), and 27.3 Mb
(chromosome 12) were associated with the GS, and some RS-specific QTLs were
also aligned together in the same genetic regions. With a large number of QTLs for
stage-specific traits from GWAS information from the genome sequencing data,
high-throughput phenotyping and various statistical methods could provide benefi-
cial information for MAB programs and the discovery of potentially useful chilling-
tolerance genes/alleles. Furthermore, the combination of gene expression profiling
and omics technologies such as proteomics, metabolomics, epigenetics, and genome
editing tools will facilitate the confirmation of more candidate gene functions
in rice.
4.3 Transcriptomics Related to LTS Tolerance
Transcriptome sequencing has increased the accessibility of genomic resources in

various crops, including rice. Transcriptome analysis using microarray technologies
is one of the most powerful techniques that link sequence information directly to
functional genomics (Sinha et al. 2018) and immensely contributes to understand-
ing the specific tissue- or stress response-related genes in the molecular mecha-
nisms of biotic and abiotic stress tolerance. Comparative transcriptome analysis
provides a way to distinguish different genes that are regulated in stress tolerance in
comparison to expression patterns between the homologous genes in various crops
(Lee et al. 2019). In response to LTS tolerance, Yang and Poovaiah (2003) observed
that, at low temperatures, commonly upregulated genes were associated with Ca2+
signal transduction. Several genes such as Ca2+-dependent protein kinases, calmod-

ulin, mitogen-activated protein kinase 1, Ca-transporting ATPases, protein phospha-
tase 2C family proteins, and serine/threonine-protein kinases related to signal
transduction pathways were identified in the endoplasmic reticulum-phase of chill-
ing-stress tolerance (Yang et al. 2012; Zhang et al. 2012b). A key initial event that
occurs in cold-stress response is the induction of the AP2/EREBP TF family, which
includes CBF/DREB TFs, which are commonly induced within 30 min of cold
treatment in plants (Zhang et al. 2004; Ito et al. 2006). CBF/DREB genes have also
been shown to be gated by a circadian clock and to display cyclic behavior during
cold stress (Gilmour et al. 2004). Previously, Bai et al. (2015), working on the anther
transcriptome of photo-thermosensitive genic male sterile rice lines Y58S and P64S
under cold stress, identified some differentially expressed genes (DEGs) involved in
signal transduction, metabolism, transport, and transcriptional regulation. Among
these DEGs, more differentially expressed MYB (myeloblastosis) and three zinc
finger family TFs and signal transduction components such as calmodulin-/calcium-
dependent protein kinases were observed in the Y58S comparison group. LOC_
Os01g62410 (OsMYB3R-2), identified as an upregulated gene in Y58S, encodes for
an MYB domain protein activation TF that regulates the CBF pathway and cell
cycle progression during cold stress, resulting in increased cold tolerance (Ma et al.
2009). In a similar study, Su et al. (2010) reported the role of MYBS3 (LOC_
Os10g41200) in regulating signaling pathways at low temperature, suggesting that
MYB family members are good candidates for improving LTS tolerance in rice.
Furthermore, molecular evidence indicates that CBF responds early, and MYBS
late, to chilling stress, suggesting distinct pathways that function sequentially and
complementarily to promote short- and long-term cold-stress adaptation in rice.
Gene profiling on chilling-tolerant japonica rice incubated for 24 h at 10 °C revealed
that an “early response” regulatory network including ROS-bZIP1 plays a crucial
role in short-term adaptive responses (Yang et al. 2012). Moreover, several regula-
tory clusters, including bZIP factors acting on as1/ocs/TGA-like element-enriched
clusters, R2R3-MYB factors acting on MYB2-like element-enriched clusters, and
ERF factors acting on GCC-box/JAre-like element-enriched clusters, are involved
in early chilling response, and oxidative signaling by H2O2 is at the center of the
regulatory network (Yun et al. 2010).
Furthermore, genes involved in gibberellic acid (GA), indole-3-acetic acid
(IAA), and cytokinin biosynthesis responded to cold temperature in such a way that
their expression profiles were either downregulated or upregulated in cold-
susceptible and cold-tolerant rice varieties (Park et al. 2010). For example, the IAA
biosynthesis genes YUCCA1 and TAA 1:1 showed variety-specific regulation.
Among the genes involved in cytokinin biosynthesis and signaling, the expression
of LOG, HK1, and HK3 was significantly downregulated only in the cold-suscepti-
ble variety. Similarly, among the genes involved in ABA biosynthesis, neoxanthin
synthase (NSY), and ABA-aldehyde oxidase 3 (AAO3) were downregulated only in
the cold-tolerant variety. It is presumed that the levels of these bioactive hormones
are maintained relatively high at cold temperatures in cold-tolerant varieties, which
can help minimize the cold stress imposed on developing reproductive organs.
In a comparative transcriptome analysis of the shoots and roots of cold-tolerant

variety TNG67 and cold-sensitive variety TCN1, the expression of OsRR4 type-A
response regulators in roots of TNG67 was upregulated. The TFs OsIAA23, SNAC2,
OsWRKY1v2, 24, 53, 71, HMGB, OsbHLH, and OsMyb were expressed in the roots
or shoots of TNG67, and AP2/ERF in the shoots and roots of both varieties during
cold stress, making them good candidate genes for cold-stress tolerance in rice.
Also, phytohormone-related genes for ABA, polyamine, auxin, and jasmonic acid
were preferentially upregulated in the shoots and roots of the cold-tolerant geno-
type. Functional clustering of the majority of DEGs involved in early chilling
response showed their role in a complicated chilling-responsive regulatory network
such as phytohormone signaling, photosynthesis pathway, ribosome translation
machinery, and phenylpropanoid biosynthesis. The localization of the majority of
DEGs in chloroplasts suggests a link between chilling-stress tolerance in rice and
photosynthesis (Wang et al. 2016). This was observed in a comparative transcrip-
tome profiling of the common wild rice GXWR (China)-derived chilling-tolerant
chromosome segment substitution line.
4.4 Proteomics Related to LTS Tolerance
Proteins are the key components in the majority of cellular events; hence, investigat-
ing their structure, function, abundance, and interactions at a given time is advanta-
geous to “omics” studies. Protein translational and posttranslational regulations,
particularly of stressor-specific protein classes altered due to stress conditions, can
also be detected by proteomics, thereby rendering a complex phenomenon such as
the tolerance mechanisms for cold and other stresses well understood and addressed.
Two-dimensional gel electrophoresis (2-DE) or liquid chromatography coupled
with tandem mass spectrometry (LC-MS/MS) is used in protein extraction followed
by protein separation and identification (Wittmann-Liebold et al. 2006; Fournier
et al. 2007; Hashimoto and Komatsu 2007; Wang et al. 2013c).
Proteomic studies were undertaken pertaining to cold tolerance in rice seedlings
and anthers (Cui et al. 2005; Yan et al. 2006; Hashimoto and Komatsu 2007; Zhang
et al. 2014a; Lee et al. 2015). Comprehensive transcriptomic and proteomic analy-
ses in rice have illustrated that many genes and functional proteins are involved in
the crop’s chilling response (Hashimoto and Komatsu 2007; Nakashima et al. 2007;
Kanneganti and Gupta 2008; Oh et al. 2009; Lee et al. 2015). Furthermore, many
proteins, including otsA and otsB (trehalose synthesis), choline monooxygenase
(glycine betaine synthesis), and WFT1 and WFT2 (fructan synthesis) (Garg et al.
2002; Shirasawa et al. 2006), were found to be involved in the regulation of low-
temperature tolerance in rice. Using matrix-assisted laser desorption ionization-
time of flight mass spectrometry (MALDI-TOF MS), Cui et al. (2005) observed 60
protein spots progressively upregulated in response to LTS. These cold-responsive
proteins include four factors of protein biosynthesis, four molecular chaperones,
two proteases, eight enzymes involved in the biosynthesis of cell wall components,
and seven antioxidative enzymes and proteins linked to energy pathways as in sig-
nal transduction, besides two proteins of unknown function. In addition to these
proteins, chloroplast proteome is also subject to cold stress because of the localiza-
tion of identified proteins in the chloroplast. Other cold-responsive proteins are
sucrose synthase (Maraña et al. 1990), phenylalanine ammonia-lyase (Sanchez-
Ballesta et al. 2000), and ferritin (Kawamura and Uemura 2003). Proteins involved
in energy metabolism in the leaf blade were upregulated, while defense-related pro-
teins were downregulated or even disappeared when rice seedlings were exposed to
5 °C for 48 h (Hashimoto and Komatsu 2007). Hashimoto and Komatsu (2007) used
the 2D PAGE-based proteomics method for rice root plasma membrane and identi-
fied 12 cold-responsive proteins, including cold shock protein-1, which decreased
significantly under cold-stress conditions. Most of the cold-responsive proteins
associated with energy production, signal transduction, protein synthesis, and
defense were revealed by their functional characterization.
Proteins involved in phytohormone biosynthesis play a role in stress tolerance.
Asakura et al. (2004) found that GA-related proteins have increased expression dur-
ing rice seed germination. The elevated expression of GA receptor GID1L2 observed
in the resistant strain suggests the role played by GA in mediating the response to
cold temperature in the germinating embryo. The low-temperature germination of
the resistant rice line was associated with proteins involved in GA signaling, protein
trafficking, and ABA-mediated stress response compared with the susceptible
strain. Colebrook et al. (2014) also noticed that increased GA biosynthesis and GA
signaling were linked to stress tolerance. The elevated expression of TF HBP-1b
involved in the general mechanism of protein trafficking through a secretory path-
way and two proteins of unknown function, UPF0041 domain-containing protein
(LOC_Os07g26700.1) and the expressed protein (LOC_Osg09910.1), suggested
their possible role in seed germination or cold stress (Lee et al. 2015). Phosphorylation
of cellular proteins or protein kinase activation during the initial stage of cold accli-
mation has also been observed (Garbarino et al. 1991), and a fragment of RuBisCO
large subunit protein was phosphorylated to a greater extent than others in cold-
tolerant rice varieties using 2-DE analysis (Komatsu et al. 1999).
Gel-based protein separation has been used in proteomic studies, which has
resulted in the identification of only high-abundant proteins, leaving TFs, kinases,
and transport proteins belonging to low-abundant protein classes undetected.
Although advanced LC-based separation techniques have resulted in the detectabil-
ity of low-abundant proteins, phosphorylation, glycosylation, and oxidation caused
by posttranslational changes that are likely to be induced by stressors are yet to be
comprehensively explained with the use of these approaches. Also, metabolic pro-
cesses mediated by plant hormones as well as subcellular protein translocation and
protein-protein interactions are yet to be found associated with the cold-stress phe-
nomenon and tolerance mechanisms. To move forward with our knowledge on a
time-dependent response, new proteomic strategies, such as hydrogen-deuterium
exchange and surface plasmon resonance-MS, together with integrated cell biology
approaches such as immune precipitation and live imaging analysis, will be required.
4.5 Metabolomics Related to LTS Tolerance
Metabolites are the final response of a biological system to environmental changes

so that an aberrant metabolism is linked to the most predictive of phenotypes. The
successful application of metabolomics can provide a deeper insight into a plant’s
phenotypic response to abiotic stresses and can determine the pattern related to
stress tolerance. For example, in a targeted metabolite analysis of two rice geno-
types under LTS (13/12 °C), Morsy et al. (2007) observed that the chilling-tolerant
genotype exhibited accumulated galactose and raffinose, while the same sugars
were found to be decreasing in the chilling-sensitive variety. Also, a higher endog-
enous content of oxidative products and the presence of a more efficient reactive
oxygen species (ROS)-scavenging metabolism were found in the chilling-tolerant
genotype during chilling stress. Similarly, Arbona et al. (2013) studied photosyn-
thetic dysfunction and effectors of osmotic readjustment at primary metabolite lev-
els (sugars, amino acids, and Krebs cycle intermediates) and secondary levels
(antioxidants) and observed a relative accumulation of some primary or secondary
metabolites.
Most sugars have earlier been reported to function as osmoprotectants, nutrients,
and signaling molecules in rice (Guy et al. 2008; Ma et al. 2009). Similar studies
have been carried out in other crops (Urano et al. 2009; Bowne et al. 2012; Araújo
et al. 2013). In a comparative metabolomics study between the varieties LTH (cold-
tolerant japonica) and IR29 (cold-sensitive indica) under no-stress and chilling-
stress conditions (4 °C for 2, 8, 24, and 48 h, and recovery of 24 h), it was observed
that 82 of 106 metabolites exhibited significant differences and described 18.1% of
the total PV (Zhao et al. 2013). Of the total of 120 stress vs. control comparisons,
85 (71%) cases had significantly increased amino acid levels, whereas only 7 (6%)
cases had significantly decreased amino acid levels, which involved aspartic acid,
cysteine, glutamic acid, and glycine. Compared to IR29, LTH recorded more amino
acids that significantly increased at all times of the stress as well as considerably
higher levels of cysteine, isoleucine, phenylalanine, proline, serine, threonine, and
valine. This strongly suggests that differential amino acid accumulation is a general
feature of the variety in response to chilling stress at the seedling stage. Regarding
organic acids, 81 of 248 (33%) showed significantly decreased levels of LTH com-
pared to IR29, whereas only 24 (10%) cases had significantly increased levels.
Consistent decreased levels were obtained for four organic acids (oleic, quinic,
eicosanoic, and sinapic) across all times of the stress in both genotypes, implying
that energy production is remarkably inhibited in rice during chilling stress.
Furthermore, 34 of 304 (11%) cases showed significantly increased levels of some
sugars in LTH at later times of the stress, signifying that these late-accumulating
sugars may be associated with the cold tolerance of LTH. Zhang et al. (2016) per-
formed a comparative metabolomics study between japonica Nipponbare and
indica 93-11 at six times during chilling treatment and found that amino acid accu-
mulation occurred on a large scale and was consistent with the appearance of chill-
ing injury. The accumulation of antioxidation-related compounds appeared earlier
in Nipponbare than in 93-11 at the mid-treatment stage, whereas, during recovery, a

higher level of ROS was observed in Nipponbare. Furthermore, metabolites related
to stress tolerance and senescence were found to be induced/accumulated in
Nipponbare and 93-11, respectively.
The combinational approaches of genome and metabolome are more interesting
for phenotype prediction and are quite useful in breeding for stress tolerance.
Selection based solely on genetic markers is highly biased because the environment
profoundly influences most of the economic traits. The development of a metabolite
quantitative trait locus (mQTL) and metabolome-wide association studies (MWAS)
could be helpful in crop improvement by overcoming the problems emerging from
differing environmental conditions during selection. This field will take advantage
of the new plant genomes issued recently and of the modern and more powerful
metabolite profiling tools (Dumas 2012; Wei et al. 2018). Some useful results at the
metabolome level and the involvement of different metabolites in plant responses,
as discussed above, have provided more insight into the complexity of cold-stress
response. Even though this has extended our understanding of the molecular mecha-
nism of plant response to stresses, their reconfiguration under stresses is still quite
complex because of the involvement of multiple molecular pathways (Guy
et al. 2008).
5 Breeding Approaches for LTS Tolerance in Rice
Developing breeding strategies for LTS-tolerant rice varieties is still a challenge to

plant breeders because of the complex nature and lack of suitable rice varieties for
high-latitude regions, mainly in China, Japan, Australia, and Korea. Therefore,
identifying LTS-tolerance traits and breeding tolerant rice varieties are necessary
for these regions. Several researchers have proposed different strategies such as
adjusting sowing time, selecting suitable rice varieties with growth duration that
avoids the peak LTS periods, and replacing LTS-susceptible rice varieties (Ye et al.
2009). However, with rapid changes in GCVs and the expected population increases,
breeding for LTS tolerance and improving LTS-tolerance mechanisms are the criti-
cal factors to meet future global food demand.
5.1 I mproving LTS Tolerance by Conventional

Breeding Approaches
Cold tolerance is the ability of rice plants to sustain yield in the presence of low-
temperature stress (Shakiba et al. 2017). Genetic breeding has been used as the
approach to cope with low-temperature sensitivity. The indica subspecies are better
adapted to tropical environments such as India, China, and Indonesia, while
japonica cultivars have more adaptation under temperate climates such as those in
Japan, Korea, and Java, Indonesia (Takahashi 1984). It has been observed that
japonica genotypes are relatively better in tolerating a higher degree of cold stress
at the germination stage (Lee 2001; da Cruz and Milach 2004) as well as at the
vegetative and reproductive stages (Saito et al. 2004; da Cruz et al. 2006a; Zhang
et al. 2017; Xiao et al. 2018). However, some indica genotypes from high-latitude
regions may have moderate cold tolerance (Gautam et al. 2018). There are reports
of some javanica, an ecotype of japonica, being tolerant of cold (Sweeney and
McCouch 2007). Cold-tolerance genes from javanica cultivars such as Silewah,
Lambayeque 1, and Padi Labou Alumbis were introduced into several temperate
japonica breeding lines in Japan (Saito et al. 2004).
Selection under field conditions for cold tolerance in rice is unpredictable; hence,
for effective selection, robust screening protocols using strong selective agents such
as low temperature and the use of controlled air or low water temperature are highly
important (da Cruz et al. 2006b). The major limitation to evaluating large plant
populations in controlled-temperature environments is to provide enough space for
the material. Growth chambers and phytotron facilities lead to quicker and more
precise results; however, small-sample testing leads to a loss in effective population
size. To deal with these limitations, some rice breeding programs use cold water
under field conditions as a selection criterion, allowing the evaluation of many dif-
ferent populations and thousands of plants per population (Snell et al. 2008). Several
experimental stations in Japan (Okamoto et al. 1986; Horisue et al. 1988; Nagano
1998; Shinada et al. 2013), Bangladesh (Khatun et al. 2016), and Korea (Jeong et al.
1998) have successfully used cold water to screen rice breeding material for cold
tolerance. Different traits depend on the developmental stage, which is used as an
indicator to identify cold-tolerant/susceptible lines. Some correlation studies
revealed that varieties having germination and seedling tolerance under low-
temperature conditions might also be tolerant at the booting and flowering stages
(Ye et al. 2009). Inheritance and heritability of LTS tolerance at the germination
stage showed involvement of both additive and nonadditive gene actions, with the
latter component relatively more important for coleoptile length and coleoptile
growth decrease. In a similar kind of study, epistatic interaction (a nonadditive
effect) was found to be important for rice germination capacity at low temperature.
Some tolerance genes may be more important, whereas others are stage-specific. No
such genes have been demonstrated, which are responsible for cold tolerance over
all the stages.
Selection for cold-tolerant genotypes in rice has shown a greater success rate due
to high heritability estimates for low-temperature germinability (Sthapit and
Witcombe 1998; da Cruz et al. 2006b). The nature and magnitude of gene action
involved in different traits such as root and shoot length and plant stature are used
as indicators under cold stress, which helps in devising a breeding program for
developing cold-tolerant genotypes (Datta and Siddiq 1983; Kaw and Khush 1986;
Acharya 1987). Involvement of two major genes, Cts1 and Cts2, has been reported
at the vegetative stage responsible for cold tolerance and estimated through leaf yel-
lowing (Kwak 1984) and withering (Nagamine 1991). On the other hand, studies of
Andaya and Tai (2006) reported cold tolerance at the vegetative stage as a complex
trait involving multiple genes and, similarly, several major genes are involved in
cold tolerance at the reproductive stage. Studies on correlating cold tolerance with
morphological traits in temperate japonica varieties show that tolerance is governed
by four or more loci, which were shown to be linked to morphological marker genes
(Futuhara and Toriyama 1966). It has been reported that several cold-tolerant culti-
vars have already been released in different countries despite the complex genetic
basis and difficulties and limitations of selection for cold tolerance (da Cruz et al.
2013). These varieties may serve as a useful genetic repository rather than gene
donors to develop cold tolerance in new rice varieties, which are lacking the trait.
Much work on trait improvement resulted in 57% of the rice varieties in Korea hav-
ing tolerance, and they are highly tolerant of low temperatures (Lee 2001). Each
country developed its own strategy for breeding for cold tolerance. However, the
main advances have been obtained within japonica cultivars. Therefore, the chal-
lenge remains to develop indica-type cultivars with adequate cold tolerance for
high-latitude regions (Bierlen et al. 1997). An apparently simple solution could be
to cross indica genotypes with japonica ones to transfer genes for cold tolerance
from japonica. However, the differences between these two rice groups make it dif-
ficult to maintain desirable indica characteristics, such as the cooking quality needed
for consumer acceptance. Also, gene introgression from indica to japonica rice has
shown problems of high sterility and poor plant type with some linkage drag in the
progenies (Khush 2005). Furthermore, overcoming the major constraints associated
with conventional breeding for cold tolerance in rice has been of limited success
with gene transfer from wild relatives (Flowers and Yeo 1995). Another difficulty in
the selection of cold-tolerant varieties in field conditions is the lack of appropriate
selection pressure, which provides critical stress-environment control (Blum 1988).
Conventional breeding is an extremely slow process for generating varieties with
improved tolerance of stress conditions. In addition, incompatibility in wider
crosses along with limited germplasm resources for stress tolerance is a major limi-
tation encountered in conventional breeding. Therefore, integrating traditional
breeding programs with modern compatible molecular methods and elucidating the
genetic mechanisms of this complex phenomenon will improve precision and speed
in the development of genotypes with low-temperature tolerance.
5.2 Improving LTS Tolerance by Selective Introgression
The selective introgression breeding (SIB) strategy is a powerful tool for the simul-
taneous improvement of tolerance and also to dissect complex traits. This is based
on two approaches, such as developing a larger number of trait-specific introgres-
sion lines via early backcross breeding and using a marker-facilitated approach to
track the gene flow from donors to recipients. In addition to that, the selected early
backcross breeding population can be used for identifying the genomic regions for
the association of target traits of interest through QTL mapping (Pang et al. 2017;
Feng et al. 2018; Jewel et al. 2018). In the Green Super Rice (GSR) breeding pro-
gram, this SIB strategy has laid the foundation for a better molecular and genetic
understanding of complex traits in rice. This methodology provides more advan-
tages than classical QTL mapping methods, such as decreasing the cost in genotyp-
ing and phenotyping with selected lines, high statistical power to detect QTLs for
targeted traits, and the selected lines are expected to carry the beneficial alleles of
QTLs (Ali et al. 2017; Liang et al. 2018). By dissecting complex traits and develop-
ing trait-specific introgression lines, Liang et al. (2018) successfully identified cold-
tolerance QTLs on chromosomes 1, 2, 3, 4, 6, 9, 11, and 12. A total of 17 QTLs for
cold tolerance at the reproductive stage were detected in 84 cold-tolerant introgres-
sion lines (ILs) selected from five BC2F4 populations in a Chaoyou genetic back-
ground using a consensus linkage map. In addition, 310 random ILs from the same
BC populations were used for dissecting the genetic networks underlying cold toler-
ance by detecting QTLs and functional genetic units (FGUs). This study led to the
discovery of QTLs qCT3.12, qCT6.7, and qCT9.6 that were validated in random BC
populations. A QTL for LTG was fine-mapped by Shim et al. (2019) with the help
of two introgression lines, TR5 and TR20, which were crossed to common parent
Hwaseong to develop F2:3 populations. qLTG1 was located in a 167-kb region
between two SSR markers (RM10310 and RM10326) and was found to harbor 18
genes, with nine of them annotated with specific gene functions. The allelic effect at
the qLTG1 locus was contributed by Oryza rufipogon that was observed to increase
LTG and spikelets per panicle.
5.3 Improving LTS Tolerance by Genetic Transformation
Transgenic approaches can be used to improve cold tolerance in rice. These meth-
ods are promising, wherein improvement can be made through the introduction
from across trans-species or through the disruption of specific DNA sequences
using RNAi technology. Gene expression analysis has made clear the physiological
mechanisms responsible for tolerance against various abiotic stresses, including low
temperature, in plants (Gao et al. 2008; Pan et al. 2020; Xu et al. 2020). Several
chilling stress-responsive genes after their isolation and characterization have been
found to encode proteins that act as enzymes for the biosynthesis of osmoprotec-
tants. Transcription factors, especially those from the CBF/DREB1 family, play a
more important role (Wang et al. 2008; Zhang et al. 2009; Su et al. 2010). Using the
integrated approach of T-DNA-tagged rice plants and inverse PCR, many genes
involved with several metabolic pathways were detected and characterized at the
molecular level. When plants are exposed to cold stress, they show changes at the
gene expression level, and the products of cold-inducible genes may either directly
protect against cold stress or further regulate the expression of other genes
(Yamaguchi-Shinozaki and Shinozaki 2004; Chen et al. 2008; Su et al. 2010).
Several transgenic rice lines or overexpressed lines (OX) have been developed,
which are responsible for the overexpression of cold-inducible genes, usually
encoding TFs for the transcriptional regulation of these genes. The upregulated or
overexpressed important genes/TFs with respect to their function, cold stress condi-
tion, the phenotype of OX lines, and side effects in OX lines, if any, in comparison
to nontransformed (WT) plants, are described in Table 5. Overexpression of
OsCTZFP8 in transgenic rice exhibited more cold-tolerant phenotypes than non-
transgenic control plants by showing higher pollen fertility and seed-setting rate
(Jin et al. 2018). The significant overexpression of cold-responsive genes and TFs
suggests a practical utility of these genes at the field level requiring a systematic
assessment, and this needs further use in crop improvement.
5.4 Improving LTS Tolerance by Genome Editing
Emerging advanced genome editing tools (GETs) such as zinc-finger nucleases

(ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases
(MNs), and CRISPR/Cas (clustered regularly interspaced short palindromic repeats/
CRISPR-associated protein) play a greater role in the understanding of the various
biological functions by manipulating the desired target gene of interest and also
providing new opportunities to create genetic diversity in various crops (Vats et al.
2019; Wolter et al. 2019). However, these ZFNs, TALENs, and MNs are so expen-
sive in the cloning procedure, have low target specificity, and are time-consuming
and laborious, whereas the CRISPR/Cas system is a cheap, easy-to-design, and
unique tool for precise and efficient genome editing at the single-base level.
CRISPR/Cas9 involves mainly single-guided RNA (sgRNA) in contrast to ZFNs
and TALENs and provides mutagenesis at high frequency, thus increasing the num-
ber of recombination sites and target specificity in plant genomes (Jaganathan et al.
2018; Molla and Yang 2019). Currently, using this technology, several researchers
have targeted genome editing for biotic and abiotic stress tolerance and also grain
quality-related genes. Over the past decade, CRISPR/Cas9 has been widely used to
produce novel rice varieties with improved target traits such as grain weight, panicle
architecture, aroma, high amylose content, and tolerance of bacterial blight and
blast, drought, and cold (Mishra et al. 2018; Fiaz et al. 2019; Jun et al. 2019). For
instance, Li et al. (2016) edited four grain yield-related genes (Gn1a, DEP1, GS3,
and IPA1) and Xu et al. (2016) edited three genes related to grain weight (GW2,
GW5, and TGW6) using the CRISPR/Cas9 system. They noticed a significant
increase in phenotypic traits, such as increasing grain number and size, and dense
erect panicles. In response to cold stress in rice, the CRISPR/Cas9 system was used
to edit two TFs, TIFY1a (LOC_Os03g47970) and TIFY1b (LOC_Os03g52450), in
rice, revealing single-base-pair insertion and deletion and also long fragment dele-
tion. Thus, employing CRISPR/Cas9 technology to investigate the role of TIFY1a
and TIFY1b might reveal a novel pathway that controls cold adaptation in rice
(Huang et al. 2017). CBFs have been studied in response to cold tolerance through
genome editing, which has shown that CBF triple mutants were extremely sensitive
to cold acclimation-dependent freezing stress (Jia et al. 2016).
Breeding for LTS using conventional methods has met with limited success in
improving tolerant rice varieties because of the lack of efficient selection criteria,
the time-consuming work, and required expensive facilities for screening, and it
also involves a multigenic trait. Therefore, an alternative breeding strategy such as
genomic-assisted breeding and gene transformation technologies can provide a via-
ble option to improve LTS tolerance in rice. The ability of the CRISPR/Cas9 system
to generate transgene-free genome-modified plants, create site-specific and SNP
mutations, and make large-scale changes in chromosome structure at the single and
multicellular levels provides a comprehensive target trait mechanism and more
helpful breeding strategy to enhance biotic and abiotic stress tolerance in rice. The
successful editing of important genes related to improving grain yield and quality
traits has proven that this CRISPR/Cas9 technology could be a promising tool for
understanding the molecular and physiological functional aspects of genes and TFs
that influence target traits.
6 Conclusions and Future Prospects
This chapter has mainly focused on LTS-tolerance traits and associated genetics in
rice, which have significant importance in tropical and temperate regions across the
globe for increasing yield productivity and sustainability. The LTS tolerance-related
QTLs, genes, enzymes, and their interactions are involved in stress-tolerance mech-
anisms in different growth stages. In order to understand the interaction of genetics,
physiological and metabolic responses to plants need to be analyzed using a growth-
stage specific and precise phenotypic characterization. The LTS-tolerance trait asso-
ciated with QTLs and genes will be useful in designing molecular breeding strategies
for improving LTS tolerance in rice varieties. The combinational approaches of
genomics and metabolomics are more interesting for phenotype prediction and are
quite useful in breeding for stress tolerance. Selection based solely on genetic mark-
ers is highly biased because the environment profoundly influences most of the
economic traits. The development of a metabolomics quantitative trait locus and
metabolome-wide association studies could be helpful in crop improvement by
overcoming the problems emerging from differing environmental conditions during
selection. This field will take advantage of the new plant genomes issued recently
and of the modern and more powerful metabolite profiling tools (Dumas 2012; Wei
et al. 2018). Some useful results at the metabolome level and the involvement of
different metabolites in plant responses, as discussed above, have provided more
insight into the complexity of cold-stress response. Even though this has extended
our understanding of the molecular mechanisms of plant response to stresses, their
reconfiguration under stresses is still quite complex because of the involvement of
multiple molecular pathways (Guy et al. 2008).
However, in a breeding program for the development of LTS tolerance, advances
in omics-related technologies have led to the development of well-planned pheno-
typic experiments that offer deeper insight into gene function along with gene
effects on the phenotype in a specified biological context. There is a significant

positive correlation of LTS-tolerance traits among the different growth stages of
rice, and this suggests that rice varieties with high germination rate and early seed-
ling vigor-related traits under LTS conditions are also likely to be more tolerant in
the reproductive stage (Ye et al. 2009). It is reasonable to consider that LTS-tolerant
genotypes in the GS, SS, and RS may rely on the diverse genetic components of
QTLs and genes on different chromosomes that are ensuring LTS tolerance. The
rapid development of advanced genome sequencing and larger sets of polymorphic
SNPs help in identifying potential candidate genes. Based on the comprehensive
literature survey under LTS regarding GS-, SS-, and RS-specific traits and associ-
ated with fine-tuned and colocalized stage-specific QTLs (in GS and SS), the high-
est numbers of QTLs were located on chromosomes 1 and 7 (Pan et al. 2015;
Shakiba et al. 2017; Zhang et al. 2018; Sun et al. 2019).
Similarly, in three combinations of stage-specific QTLs (GS, SS, and RS) associ-
ated with multiple traits on chromosome 10 (Li et al. 2013; Pan et al. 2015; Schläppi
et al. 2017), seven genetic regions are colocalized with candidate genes and QTLs
on four chromosomes (1, 3, 5, and 6), and this provides insights into identifying the
candidate genes and developing functional allele-specific markers for improving
LTS tolerance in breeding programs. The concept of omics studies has amassed a
great deal of information at the transcript, protein, and metabolite levels to perceive
the tolerance mechanisms of plants under stress. To fully understand the complex
regulatory nature of plants against stresses, a highly coordinated approach such as
systems biology needs to be identified. Unfortunately, the integration of data out-
puts from phenomes, transcriptomes, proteomes, and metabolomes has been found
to be inefficient and ineffective yet, despite the marvelous progress shown in bioin-
formatics. However, future approaches need to integrate these through robust com-
puting platforms that should be able to predict the active biochemical and molecular
genetic networks to exploit LTS tolerance in rice breeding. This could potentially
lead to detecting and identifying master stress regulators to target the right biomark-
ers for improving rice LTS tolerance effectively.
Acknowledgments The authors would like to thank and acknowledge the Bill & Melinda Gates
Foundation for providing a research grant to ZL for the Green Super Rice project under ID
OPP1130530. We would also like to thank the Department of Agriculture, Philippines, for provid-
ing funds to JA under the Next-Gen project, and also thank and acknowledge IRRI Communications
for English language editing and anonymous internal reviewers for their valuable suggestions and
constructive comments that helped improve this manuscript.
References
Acharya S (1987) Genetic parameters and their implication in breeding cold tolerant varieties of
rice (Oryza sativa L.). Crop Improv 14:100–103
Ali AJ, Xu JL, Ismail AM et al (2006) Hidden diversity for abiotic and biotic stress tolerances in
the primary gene pool of rice revealed by a large backcross breeding program. Field Crop Res
97:66–76
Ali J, Xu J-L, Gao Y-M et al (2017) Harnessing the hidden genetic diversity for improving multiple
abiotic stress tolerance in rice (Oryza sativa L.). PLoS One 12:e0172515
Almeida DM, Almadanim MC, Lourenço T et al (2016) Screening for abiotic stress tolerance in
rice: salt, cold, and drought. In: Environmental responses in plants. Springer, New York, NY,
pp 155–182
Andaya V, Mackill D (2003a) QTLs conferring cold tolerance at the booting stage of rice using
recombinant inbred lines from a japonica × indica cross. Theor Appl Genet 106:1084–1090
Andaya VC, Mackill DJ (2003b) Mapping of QTLs associated with cold tolerance during the veg-
etative stage in rice. J Exp Bot 54:2579–2585. https://doi.org/10.1093/jxb/erg243
Andaya VC, Tai TH (2006) Fine mapping of the qCTS12 locus, a major QTL for seedling cold
tolerance in rice. Theor Appl Genet 113:467–475
Araújo WL, Trofimova L, Mkrtchyan G et al (2013) On the role of the mitochondrial 2-oxoglutarate
dehydrogenase complex in amino acid metabolism. Amino Acids 44:683–700
Arbona V, Manzi M, de Ollas C, Gómez-Cadenas A (2013) Metabolomics as a tool to investigate
abiotic stress tolerance in plants. Int J Mol Sci 14:4885–4911
Asakura T, Nakaizumi T, Hirose S et al (2004) Proteome analysis of the regulation of rice seed
germination. In: Plant and cell physiology. Oxford University Press, Oxford, pp s148–s148
Bai B, Wu J, Sheng W-T et al (2015) Comparative analysis of anther transcriptome profiles of two
different rice male sterile lines genotypes under cold stress. Int J Mol Sci 16:11398–11416
Basuchaudhuri P (2014) Cold tolerance in rice cultivation. CRC Press, Boca Raton, FL
Bertin P, Kinet JM, Bouharmont J (1996) Evaluation of chilling sensitivity in different rice vari-
eties: relationship between screening procedures applied during germination and vegetative
growth. Euphytica 89:201–210
Bevilacqua CB, Basu S, Pereira A et al (2015) Analysis of stress-responsive gene expression in
cultivated and weedy rice differing in cold stress tolerance. PLoS One 10:e0132100
Bierlen R, Wailes EJ, Cramer GL (1997) The mercosur rice economy. Ark Exp Stat Bull 954:1–58
Biswas PS, Khatun H, Das N et al (2017) Mapping and validation of QTLs for cold tolerance at
seedling stage in rice from an indica cultivar Habiganj Boro VI (Hbj.BVI). 3 Biotech 7:359.
https://doi.org/10.1007/s13205-017-0993-1
Blum A (1988) Plant breeding for stress environments. CRC Press, Boca Raton, FL. 223 p
Board JE, Peterson ML, Ng E (1980) Floret sterility in rice in a cool environment. 1. Agron J
72:483–487
Bonnecarrère V, Borsani O, Díaz P et al (2011) Response to photoxidative stress induced by cold
in japonica rice is genotype dependent. Plant Sci 180:726–732
Bonnecarrere V, Quero G, Monteverde E et al (2015) Candidate gene markers associated with cold
tolerance in vegetative stage of rice (Oryza sativa L.). Euphytica 203:385–398
Bowne JB, Erwin TA, Juttner J et al (2012) Drought responses of leaf tissues from wheat cultivars
of differing drought tolerance at the metabolite level. Mol Plant 5:418–429
Chen L, Qiaojun L, Sun ZX et al (2006a) QTL mapping of low temperature germinability in rice.
Zhongguo Shuidao Kexue 20:159–164
Chen L, Qiaojun L, Sun ZX et al (2006b) QTL mapping of low temperature on germination rate
of rice. Rice Sci 13:93–98
Chen JQ, Meng XP, Zhang Y et al (2008) Over-expression of OsDREB genes lead to
enhanced drought tolerance in rice. Biotechnol Lett 30:2191–2198. https://doi.org/10.1007/
s10529-008-9811-5
Chen NA, Xu Y, Wang XIN et al (2011) OsRAN2, essential for mitosis, enhances cold tolerance in
rice by promoting export of intranuclear tubulin and maintaining cell division under cold stress.
Plant Cell Environ 34:52–64
Chen J, Lin T, Xu H et al (2012) Cold-induced changes of protein and phosphoprotein expression
patterns from rice roots as revealed by multiplex proteomic analysis. Plant Omics 5:194
Cheng L, Wang J, Uzokwe V et al (2012) Genetic analysis of cold tolerance at seedling stage and
heat tolerance at anthesis in rice (Oryza sativa L.). J Integr Agric 11:359–367
Chinnusamy V, Ohta M, Kanrar S et al (2003) ICE1: a regulator of cold-induced transcriptome and

freezing tolerance in Arabidopsis. Genes Dev 17:1043–1054
Chinnusamy V, Zhu J, Zhu J-K (2007) Cold stress regulation of gene expression in plants. Trends
Chinnusamy V, Zhu JK, Sunkar R (2010) Gene regulation during cold stress acclimation in plants.
In: Plant stress tolerance. Springer, New York, NY, pp 39–55
Chou WL, Huang LF, Fang JC et al (2014) Divergence of the expression and subcellular localiza-
tion of CCR4-associated factor 1 (CAF1) deadenylase proteins in Oryza sativa. Plant Mol Biol
85:443–458. https://doi.org/10.1007/s11103-014-0196-7
Colebrook EH, Thomas SG, Phillips AL, Hedden P (2014) The role of gibberellin signalling in
plant responses to abiotic stress. J Exp Biol 217:67–75
da Cruz RP, Milach SCK (2000) Breeding for cold tolerance in irrigated rice. Ciência Rural
30:909–917
da Cruz RP, Milach SCK (2004) Cold tolerance at the germination stage of rice: methods of evalu-
ation and characterization of genotypes. Sci Agric 61:1–8
da Cruz RP, Milach SCK, Federizzi LC (2006a) Rice cold tolerance at the reproductive stage in a
controlled environment. Sci Agric 63:255–261
da Cruz RP, Milach SCK, Federizzi LC et al (2006b) Inheritance of rice cold tolerance at the ger-
mination stage. Genet Mol Biol 29:314–320
da Cruz RP, Duarte ITL, Cabreira C (2010) Inheritance of rice cold tolerance at the seedling stage.
Sci Agric (Piracicaba, Braz) 67:669–674. https://doi.org/10.1590/S0103-90162010000600008
da Cruz RP, Sperotto RA, Cargnelutti D et al (2013) Avoiding damage and achieving cold toler-
ance in rice plants. Food Energ Secur 2:96–119. https://doi.org/10.1002/fes3.25
Cui S, Huang F, Wang J et al (2005) A proteomic analysis of cold stress responses in rice seedlings.
Proteomics 5:3162–3172
Cui Y, Zhang F, Zhou Y (2018) The application of multi-locus GWAS for the detection of salt-
tolerance loci in rice. Front Plant Sci 9:1464
Dai L, Lin X, Ye C et al (2004) Identification of quantitative trait loci controlling cold tolerance at
the reproductive stage in Yunnan landrace of rice, Kunmingxiaobaigu. Breed Sci 54:253–258
Datta D, Siddiq EA (1983) Genetic analysis of cold tolerance at seedling phase in rice. Indian J
Genet Plant Breed 43:345–349
Ding Y, Shi Y, Yang S (2019) Advances and challenges in uncovering cold tolerance regulatory
mechanisms in plants. New Phytol 222:1690–1704
Doherty CJ, Van Buskirk HA, Myers SJ, Thomashow MF (2009) Roles for Arabidopsis CAMTA
transcription factors in cold-regulated gene expression and freezing tolerance. Plant Cell
21:972–984
Donoso G, Cabas P, Paredes M et al (2015) Cold tolerance evaluation of temperate rice (Oryza
sativa L. ssp. japonica) genotypes at seedling stage. Gayana Bot 72:1–13
Dumas M-E (2012) Metabolome 2.0: quantitative genetics and network biology of metabolic phe-
notypes. Mol BioSyst 8:2494–2502
Farrell T, Fox KM, Williams RL et al (2001) Temperature constraints to rice production in
Australia and Laos: a shared problem. In: Increased lowland rice production in the mekong
region. Australian Centre for International Agricultural Research, Canberra, ACT, pp 129–137
doi.org/10.3389/fpls.2018.00306
Fiaz S, Ahmad S, Noor MA et al (2019) Applications of the CRISPR/Cas9 system for rice grain
quality improvement: perspectives and opportunities. Int J Mol Sci 20:888
Flowers TJ, Yeo AR (1995) Breeding for salinity resistance in crop plants: where next? Funct Plant
Biol 22:875–884
Fournier ML, Gilmore JM, Martin-Brown SA, Washburn MP (2007) Multidimensional separations-
based shotgun proteomics. Chem Rev 107:3654–3686
Fujino K, Matsuda Y (2010) Genome-wide analysis of genes targeted by qLTG3-1 controlling

low-temperature germinability in rice. Plant Mol Biol 72:137
Fujino K, Sekiguchi H (2011) Origins of functional nucleotide polymorphisms in a major quan-
titative trait locus, qLTG3-1, controlling low-temperature germinability in rice. Plant Mol
Biol 75:1–10
Fujino K, Sekiguchi H, Sato T et al (2004) Mapping of quantitative trait loci controlling low-
temperature germinability in rice (Oryza sativa L.). Theor Appl Genet 108:794–799
Fujino K, Sekiguchi H, Matsuda Y et al (2008) Molecular identification of a major quantitative
trait locus, qLTG3-1, controlling low-temperature germinability in rice. Proc Natl Acad Sci U
S A 105:12623–12628. https://doi.org/10.1073/pnas.0805303105
Fursova OV, Pogorelko GV, Tarasov VA (2009) Identification of ICE2, a gene involved in cold
acclimation which determines freezing tolerance in Arabidopsis thaliana. Gene 429:98–103
Futuhara Y, Toriyama K (1966) Genetic studies on cool tolerance in rice: III. Linkage relations
between genes controlling cool tolerance and marker genes of NAGAO and TAKAHASHI. Jpn
J Breed 16:231–242
Gao JP, Chao DY, Lin HX (2008) Toward understanding molecular mechanisms of abiotic stress
responses in rice. Rice 1:36–51
Garbarino JE, Hurkman WJ, Tanaka CK, DuPont FM (1991) In vitro and in vivo phosphorylation
of polypeptides in plasma membrane and tonoplast-enriched fractions from barley roots. Plant
Physiol 95:1219–1228
Garg AK, Kim J-K, Owens TG et al (2002) Trehalose accumulation in rice plants confers high
tolerance levels to different abiotic stresses. Proc Natl Acad Sci U S A 99:15898–15903
Gautam A, Suresh J, Gudade BA et al (2018) Rice: grappling with cold under climatic changes,
global impact and counter strategies. Adv Res 13:1–9
Ge L-F, Chao D-Y, Shi M et al (2008) Overexpression of the trehalose-6-phosphate phosphatase
gene OsTPP1 confers stress tolerance in rice and results in the activation of stress responsive
genes. Planta 228:191–201
Ghosh T, Rai M, Tyagi W, Challam C (2016) Seedling stage low temperature response in tolerant
and susceptible rice genotypes suggests role of relative water content and members of OsSNAC
gene family. Plant Signal Behav 11:1–5. https://doi.org/10.1080/15592324.2016.1138192
Gilmour SJ, Sebolt AM, Salazar MP et al (2000) Overexpression of the Arabidopsis CBF3 tran-
scriptional activator mimics multiple biochemical changes associated with cold acclimation.
Gilmour SJ, Fowler SG, Thomashow MF (2004) Arabidopsis transcriptional activators CBF1,
CBF2, and CBF3 have matching functional activities. Plant Mol Biol 54:767–781
Gothandam KM, Nalini E, Karthikeyan S, Shin JS (2010) OsPRP3, a flower specific proline-rich
protein of rice, determines extracellular matrix structure of floral organs and its overexpression
confers cold-tolerance. Plant Mol Biol 72:125
Greco M, Chiappetta A, Bruno L, Bitonti MB (2012) In Posidonia oceanica cadmium induces
changes in DNA methylation and chromatin patterning. J Exp Bot 63(2):695–709
Gupta BB, Salgotra RK, Bali AS (2009) Status paper on rice in Jammu and Kashmir. Rice
Knowledge Management Portal (RKMP), Hyderabad. http://www.rkmp.co.in/
Gururani MA, Venkatesh J, Ganesan M et al (2015) In vivo assessment of cold tolerance through
chlorophyll-a fluorescence in transgenic zoysiagrass expressing mutant phytochrome A. PLoS
One 10:1–17. https://doi.org/10.1371/journal.pone.0127200
Guy C, Kaplan F, Kopka J et al (2008) Metabolomics of temperature stress. Physiol Plant
132:220–235
Han LZ, Qiao YL, Cao GL et al (2004) QTLs analysis of cold tolerance during early growth period
for rice. Rice Sci 11:245–250
Han LZ, Zhang YY, Qiao YL et al (2006) Genetic and QTL analysis for low-temperature vigor of
germination in rice. Acta Genet Sin 33:998–1006
Hashimoto M, Komatsu S (2007) Proteomic analysis of rice seedlings during cold stress.
Proteomics 7:1293–1302
Horisue N, Kunihiro Y, Higashi T et al (1988) Screening for cold tolerance of Chinese and Japanese
rice varieties and selection of standard varieties. Trop Agric Res Ser 21:76–87
Hou MY, Jiang L, Wang CM, Wan JM (2003) Detection and analysis of QTLs for low temperature
germinability in rice (Oryza sativa L.). Rice Genet Newsl 20:52–55
Hu H, You J, Fang Y et al (2008) Characterization of transcription factor gene SNAC2 conferring
cold and salt tolerance in rice. Plant Mol Biol 67:169–181
Huang J, Sun S, Xu D et al (2012) A TFIIIA-type zinc finger protein confers multiple abiotic stress
tolerances in transgenic rice (Oryza sativa L.). Plant Mol Biol 80:337–350
Huang X, Zeng X, Li J, Zhao D (2017) Construction and analysis of tify1a and tify1b mutants
in rice (Oryza sativa) based on CRISPR/Cas9 technology. J Agric Biotechnol 25:1003–1012
Hussain HA, Hussain S, Khaliq A et al (2018) Chilling and drought stresses in crop plants: impli-
cations, cross talk, and potential management opportunities. Front Plant Sci 9:393
Ito Y, Katsura K, Maruyama K et al (2006) Functional analysis of rice DREB1/CBF-type
transcription factors involved in cold-responsive gene expression in transgenic rice. Plant
Cell Physiol 47:141–153. https://doi.org/10.1093/pcp/pci230
Jaganathan D, Ramasamy K, Sellamuthu G et al (2018) CRISPR for crop improvement: an update
review. Front Plant Sci 9:985
Jena KK, Kim SM, Suh JP et al (2012) Identification of cold-tolerant breeding lines by quantitative
trait loci associated with cold tolerance in rice. Crop Sci 52:517–523
Jeong EG, Baek MK, Yea JD et al (1998) Screening of characters related to cold tolerance of
Korean leading rice varieties. RDA J Crop Sci 40:25
Jewel Z, Ali J, Pang Y et al (2018) Developing green super rice varieties with high nutrient use
efficiency by phenotypic selection under varied nutrient conditions. Crop J 7:368–377. https://
doi.org/10.1016/j.cj.2019.01.002
Ji SL, Jiang L, Wang YH et al (2008) QTL and epistasis for low temperature germinability in rice.
Acta Agron Sin 34:551–556
Ji H, Kim SR, Kim YH et al (2010a) Inactivation of the CTD phosphatase-like gene OsCPL1
enhances the development of the abscission layer and seed shattering in rice. Plant J 61:96–106.
https://doi.org/10.1111/j.1365-313X.2009.04039.x
Ji ZJ, Zeng YX, Zeng DI et al (2010b) Identification of QTLs for rice cold tolerance at plumule
and 3-leaf-seedling stages by using QTLNetwork software. Rice Sci 17:282–287. https://doi.
org/10.1016/S1672-6308(09)60028-7
Ji X, Dong B, Shiran B et al (2011) Control of abscisic acid catabolism and abscisic acid homeo-
stasis is important for reproductive stage stress tolerance in cereals. Plant Physiol 156:647–662
Jia Y, Ding Y, Shi Y et al (2016) The cbfs triple mutants reveal the essential functions of CBFs
in cold acclimation and allow the definition of CBF regulons in Arabidopsis. New Phytol
212:345–353
Jiang L, Xun M, Wang J, Wan J (2008) QTL analysis of cold tolerance at seedling stage in rice
(Oryza sativa L.) using recombination inbred lines. J Cereal Sci 48:173–179
Jiang Y, Cai Z, Xie W et al (2012) Rice functional genomics research: progress and implica-
tions for crop genetic improvement. Biotechnol Adv 30:1059–1070. https://doi.org/10.1016/j.
biotechadv.2011.08.013
Jiang N, Shi S, Shi H et al (2017) Mapping QTL for seed germinability under low temperature
using a new high-density genetic map of rice. Front Plant Sci 8:1–9. https://doi.org/10.3389/
fpls.2017.01223
Jin YM, Piao R, Yan YF et al (2018) Overexpression of a new zinc finger protein transcription fac-
tor OsCTZFP8 improves cold tolerance in rice. Int J Genom 23:5480617
Joo J, Lee YH, Kim Y et al (2013) Abiotic stress responsive rice ASR1 and ASR3 exhibit dif-
ferent tissue-dependent sugar and hormone-sensitivities. Mol Cell 35:421–435. https://doi.
org/10.1007/s10059-013-0036-7
Jun REN, Xixun HU, Kejian W, Chun W (2019) Development and application of CRISPR/Cas
system in rice. Rice Sci 26:69–76
Kanneganti V, Gupta AK (2008) Overexpression of OsiSAP8, a member of stress associated pro-

tein (SAP) gene family of rice confers tolerance to salt, drought and cold stress in transgenic
tobacco and rice. Plant Mol Biol 66:445–462
Kasuga M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K (2004) A combination of the
Arabidopsis DREB1A gene and stress-inducible rd29A promoter improved drought- and low-
temperature stress tolerance in tobacco by gene transfer. Plant Cell Physiol 45:346–350
Kaw RN, Khush GS (1986) Combining ability for low-temperature tolerance in rice. In: Rice
genetics I (in two parts). World Scientific, Singapore, pp 593–612
Kawamura Y, Uemura M (2003) Mass spectrometric approach for identifying putative plasma
membrane proteins of Arabidopsis leaves associated with cold acclimation. Plant J 36:141–154
Khatun H, Biswas PS, Hwang HG, Kim K-M (2016) A quick and simple in-house screening proto-
col for cold tolerance at seedling stage in rice. Plant Breed Biotechnol 4:373–378
Khush GS (2005) What it will take to feed 5.0 billion rice consumers in 2030. Plant Mol Biol 59:1–6
Kim S-I, Tai TH (2011) Evaluation of seedling cold tolerance in rice cultivars: a comparison of
visual ratings and quantitative indicators of physiological changes. Euphytica 178:437–447
Kim S-I, Tai TH (2013) Identification of SNPs in closely related Temperate Japonica rice cultivars
using restriction enzyme-phased sequencing. PLoS One 8:e60176
Kim S-H, Kim J-Y, Kim S-J et al (2007) Isolation of cold stress-responsive genes in the reproduc-
tive organs, and characterization of the OsLti6b gene from rice (Oryza sativa L.). Plant Cell
Rep 26:1097–1110
Kim S-J, Lee S-C, Hong SK et al (2009) Ectopic expression of a cold-responsive OsAsr1 cDNA
gives enhanced cold tolerance in transgenic rice plants. Mol Cell 27:449–458
Kim S-MM, Suh J-PP, Lee C-KK et al (2014) QTL mapping and development of candidate gene-
derived DNA markers associated with seedling cold tolerance in rice (Oryza sativa L.). Mol
Gen Genomics 289:333–343. https://doi.org/10.1007/s00438-014-0813-9
Koh S, Lee SC, Kim MK et al (2007) T-DNA tagged knockout mutation of rice OsGSK1, an ortho-
logue of Arabidopsis BIN2, with enhanced tolerance to various abiotic stresses. Plant Mol Biol
65:453–466. https://doi.org/10.1007/s11103-007-9213-4
Komatsu S, Karibe H, Hamada T, Rakwal R (1999) Phosphorylation upon cold stress in rice
(Oryza sativa L.) seedlings. Theor Appl Genet 98:1304–1310
Komatsu S, Yang G, Khan M et al (2007) Over-expression of calcium-dependent protein kinase
13 and calreticulin interacting protein 1 confers cold tolerance on rice plants. Mol Gen
Genomics 277:713
Koseki M, Kitazawa N, Yonebayashi S et al (2010) Identification and fine mapping of a major
quantitative trait locus originating from wild rice, controlling cold tolerance at the seedling
stage. Mol Gen Genomics 284:45–54
Kuk YI, Shin JS, Burgos NR et al (2003) Antioxidative enzymes offer protection from chilling
damage in rice plants. Crop Sci 43:2109–2117
Kumar K, Rao KP, Sharma P, Sinha AK (2008) Differential regulation of rice mitogen activated
protein kinase kinase (MKK) by abiotic stress. Plant Physiol Biochem 46:891–897. https://doi.
org/10.1016/j.plaphy.2008.05.014
Kuroki M, Saito K, Matsuba S et al (2007) A quantitative trait locus for cold tolerance at the boot-
ing stage on rice chromosome 8. Theor Appl Genet 115:593–600
Kuroki M, Saito K, Matsuba S (2009) Quantitative trait locus analysis for cold tolerance at the
booting stage in a rice cultivar, Hatsushizuku. Jpn Agric Res Q 43:115–121
Kwak TS (1984) Inheritance of seedling cold tolerance in rice. SABRAO J 16:83–86
Lee M-H (2001) Low temperature tolerance in rice: the Korean experience. In: ACIAR Proceedings
1998. ACIAR, Canberra, ACT, pp 109–117
Lee T, Lur H, Chu C (1993) Role of abscisic acid in chilling tolerance of rice (Oryza sativa L.)
seedlings. I. Endogenous abscisic acid levels. Plant Cell Environ 16:481–490
Lee DG, Ahsan N, Lee SH et al (2009a) Chilling stress-induced proteomic changes in rice roots.
J Plant Physiol 166:1–11
Lee SJ, Jeon US, Lee SJ et al (2009b) Iron fortification of rice seeds through activation of the
nicotianamine synthase gene. Proc Natl Acad Sci U S A 106:22014–22019. https://doi.
org/10.4324/9780203605912
Lee J, Lee W, Kwon S-W (2015) A quantitative shotgun proteomics analysis of germinated rice
embryos and coleoptiles under low-temperature conditions. Proteome Sci 13:27
Lee J, Heath LS, Grene R, Li S (2019) Comparing time series transcriptome data between plants
using a network module finding algorithm. Plant Methods 15:61
Li HB, Wang J, Liu AM et al (1997) Genetic basis of low-temperature-sensitive sterility in indica-
japonica hybrids of rice as determined by RFLP analysis. Theor Appl Genet 95:1092–1097
Li G, Zhang M, Cai W-M et al (2008) Characterization of OsPIP2;7, a water channel protein in
rice. Plant Cell Physiol 49:1851–1858. https://doi.org/10.1093/pcp/pcn166
Li HW, Zang BS, Deng XW, Wang XP (2011a) Overexpression of the trehalose-6-phosphate syn-
thase gene OsTPS1 enhances abiotic stress tolerance in rice. Planta 234:1007–1018. https://doi.
org/10.1007/s00425-011-1458-0
Li M, Sun P, Zhou H (2011b) Identification of quantitative trait loci associated with germination
using chromosome segment substitution lines of rice (Oryza sativa L.). Theor Appl Genet
123:411–420. https://doi.org/10.1007/s00122-011-1593-9
Li L, Liu X, Xie K et al (2013) qLTG-9, a stable quantitative trait locus for low-temperature ger-
mination in rice (Oryza sativa L.). Theor Appl Genet 126:2313–2322
and IPA1 in rice using a CRISPR/Cas9 system. Front Plant Sci 7:377
Li S, Tian Y, Wu K et al (2018) Modulating plant growth–metabolism coordination for sustainable
agriculture. Nature 560:595. https://doi.org/10.1038/s41586-018-0415-5
Liang Y, Meng L, Lin X et al (2018) QTL and QTL networks for cold tolerance at the reproductive
stage detected using selective introgression in rice. PLoS One 13:e0200846
Liu K, Wang L, Xu Y et al (2007) Overexpression of OsCOIN, a putative cold inducible zinc finger
protein, increased tolerance to chilling, salt and drought, and enhanced proline level in rice.
Planta 226:1007–1016. https://doi.org/10.1007/s00425-007-0548-5
Liu C, Wu Y, Wang X (2012) bZIP transcription factor OsbZIP52/RISBZ5: a potential negative
regulator of cold and drought stress response in rice. Planta 235:1157–1169
Liu F, Xu W, Song Q et al (2013) Microarray-assisted fine-mapping of quantitative trait loci for
cold tolerance in rice. Mol Plant 6:757–767
Lone JA, Khan MN, Bhat MA et al (2018) Cold tolerance at germination and seedling stages of
rice: methods of evaluation and characterization of thirty rice genotypes under stress condi-
tions. Int J Curr Microbiol App Sci 7:1103–1109
Lou Q, Chen L, Sun Z et al (2007) A major QTL associated with cold tolerance at seedling stage
in rice (Oryza sativa L.). Euphytica 158:87–94. https://doi.org/10.1007/s10681-007-9431-5
Lourenço T, Sapeta H, Figueiredo DD et al (2013) Isolation and characterization of rice (Oryza
sativa L.) E3-ubiquitin ligase OsHOS1 gene in the modulation of cold stress response. Plant
Mol Biol 83:351–363
Ma Q, Dai X, Xu Y et al (2009) Enhanced tolerance to chilling stress in OsMYB3R-2 transgenic
rice is mediated by alteration in cell cycle and ectopic expression of stress genes. Plant Physiol
150:244–256
Ma Y, Dai X, Xu Y et al (2015) COLD1 confers chilling tolerance in rice. Cell 160:1209–1221
Maraña C, García Olmedo F, Carbonero Zalduegui P (1990) Differential expression of two types
of sucrose synthase-encoding genes in wheat in response to anaerobiosis, cold shock and light.
Gene 88:167–172
Matlon P, Randolph T, Guei R (1998) Impact of rice research in West Africa. In: Impact of rice
research. International Rice Research Institute, Los Baños, pp 383–404
Mishra R, Joshi RK, Zhao K (2018) Genome editing in rice: recent advances, challenges, and
future implications. Front Plant Sci 9:1361
Miura K, Lin SY, Yano M, Nagamine T (2001) Mapping quantitative trait loci controlling low
temperature germinability in rice (Oryza sativa L.). Breed Sci 51:293–299
Mohanty S, Wassmann R, Nelson A et al (2012) Rice and climate change: significance for food
security and vulnerability. IRRI discussion paper series No. 49. International Rice Research
Institute, Los Baños. 14 p
Molla KA, Yang Y (2019) CRISPR/Cas-mediated base editing: technical considerations and prac-
tical applications. Trends Biotechnol 37:1121–1142
Moraes De Freitas GP, Basu S, Ramegowda V et al (2016) Comparative analysis of gene expres-
sion in response to cold stress in diverse rice genotypes. Biochem Biophys Res Commun
471:253–259. https://doi.org/10.1016/j.bbrc.2016.02.004
Morsy MR, Almutairi AM, Gibbons J et al (2005) The OsLti6 genes encoding low-molecular-
weight membrane proteins are differentially expressed in rice cultivars with contrasting sensi-
tivity to low temperature. Gene 344:171–180
Morsy MR, Jouve L, Hausman J-F et al (2007) Alteration of oxidative and carbohydrate metabo-
lism under abiotic stress in two rice (Oryza sativa L.) genotypes contrasting in chilling toler-
ance. J Plant Physiol 164:157–167
Mukhopadhyay A, Vij S, Tyagi AK (2004) Overexpression of a zinc-finger protein gene from rice
confers tolerance to cold, dehydration, and salt stress in transgenic tobacco. Proc Natl Acad Sci
U S A 101:6309–6314
Murai-Hatano M, Kuwagata T, Sakurai J et al (2008) Effect of low root temperature on hydraulic
conductivity of rice plants and the possible role of aquaporins. Plant Cell Physiol 49:1294–1305
Nagamine T (1991) Genic control of tolerance to chilling injury at seedling stage in rice, Oryza
sativa L. Jpn J Breed 41:35–40
Nagano K (1998) Development of new breeding techniques for cold tolerance and breeding of
new rice cultivars with highly cold tolerance, Hitomebore and Jyoudeki. In: Proceedings of
the International Workshop on Breeding and Biotechnology for Environmental Stress in Rice,
pp 143–148
Nakashima K, Tran LP, Van Nguyen D et al (2007) Functional analysis of a NAC-type transcrip-
tion factor OsNAC6 involved in abiotic and biotic stress-responsive gene expression in rice.
Plant J 51:617–630
Nalley L, Tack J, Durand A et al (2017) The production, consumption, and environmental impacts
of rice hybridization in the United States. Agron J 109:193–203. https://doi.org/10.2134/
agronj2016.05.0281
Novillo F, Alonso JM, Ecker JR, Salinas J (2004) CBF2/DREB1C is a negative regulator of
CBF1/DREB1B and CBF3/DREB1A expression and plays a central role in stress tolerance in
Arabidopsis. Proc Natl Acad Sci U S A 101:3985–3990
Oh SJ, Kim YS, Kwon CW et al (2009) Overexpression of the transcription factor AP37 in rice
improves grain yield under drought conditions. Plant Physiol 150:1368–1379
Okamoto E, Matsunaga K, Sasaki T (1986) Cold tolerant rice varieties in temperate district of
Japan. Tohoku Agric Res 39:35
Oliver SN, Van Dongen JT, Alfred SC et al (2005) Cold-induced repression of the rice anther-
specific cell wall invertase gene OSINV4 is correlated with sucrose accumulation and pollen
sterility. Plant Cell Environ 28:1534–1551
Oliver SN, Zhao X, Dennis ES, Dolferus R (2007) The molecular basis of cold-induced pollen
sterility in rice. In: Biotechnology and sustainable agriculture 2006 and beyond. Springer,
New York, NY, pp 205–207
Pan Y, Zhang H, Zhang D et al (2015) Genetic analysis of cold tolerance at the germination and
booting stages in rice by association mapping. PLoS One 10:e0120590. https://doi.org/10.1371/
journal.pone.0120590
Pan Y, Liang H, Gao L et al (2020) Transcriptomic profiling of germinating seeds under cold stress
and characterization of the cold-tolerant gene LTG5 in rice. BMC Plant Biol 20:1–17
Pang Y, Chen K, Wang X et al (2017) Simultaneous improvement and genetic dissection of salt tol-
erance of rice (Oryza sativa L.) by designed QTL pyramiding. Front Plant Sci 8:1275. https://
doi.org/10.3389/fpls.2017.01275
Park H, Soon I, Han J et al (2009) OsDEG10 encoding a small RNA-binding protein is involved
in abiotic stress signaling. Biochem Biophys Res Commun 380:597–602. https://doi.
org/10.1016/j.bbrc.2009.01.131
Park M, Yun K, Mohanty B et al (2010) Supra-optimal expression of the cold-regulated OsMyb4
transcription factor in transgenic rice changes the complexity of transcriptional network with
major effects on stress tolerance and panicle development. Plant Cell Environ 33:2209–2230
Park IK, Oh CS, Kim DM et al (2013) QTL mapping for cold tolerance at the seedling stage using
introgression lines derived from an intersubspecific cross in rice. Plant Breed Biotech 1:1–8.
https://doi.org/10.9787/PBB.2013.1.1.001
Pouramir Dashtmian F, Khajeh Hosseini M, Esfahani M (2013) Methods for rice genotypes cold
tolerance evaluation at germination stage. Int J Agric Crop Sci 5:2111
Ranawake AL, Nakamura C (2011) Cold tolerance of an inbred line population of rice (Oryza
sativa L) at different growth stages. Trop Agric Res Ext 14:25–33
Ranawake A, Nakamura C (2015) QTL analysis of dehydration tolerance at seedling stage in rice
(Oryza sativa L.). Trop Agric Res 15:98
Ranawake AL, Manangkil OE, Yoshida S et al (2014) Mapping QTLs for cold tolerance at ger-
mination and the early seedling stage in rice (Oryza sativa L.). Biotechnol Biotechnol Equip
28:989–998. https://doi.org/10.1080/13102818.2014.978539
Saad RB, Fabre D, Mieulet D et al (2012) Expression of the Aeluropus littoralis AlSAP gene in
rice confers broad tolerance to abiotic stresses through maintenance of photosynthesis. Plant
Saito K, Miura K, Nagano K et al (1995) Chromosomal location of quantitative trait loci for cool
tolerance at the booting stage in rice [Oryza sativa] variety ‘Norin-PL8’. Breed Sci 45:337–340
Saito K, Miura K, Nagano K et al (2001) Identification of two closely linked quantitative trait loci
for cold tolerance on chromosome 4 of rice and their association with anther length. Theor
Saito K, Hayano-Saito Y, Maruyama-Funatsuki W et al (2004) Physical mapping and putative
candidate gene identification of a quantitative trait locus Ctb1 for cold tolerance at the boot-
ing stage of rice. Theor Appl Genet 109:515–522. https://doi.org/10.1007/s00122-004-1667-z
Sakamoto A, Murata N (2002) The role of glycine betaine in the protection of plants from stress:
clues from transgenic plants. Plant Cell Environ 25:163–171
Sales E, Viruel J, Domingo C, Marqués L (2017) Genome wide association analysis of cold
tolerance at germination in temperate japonica rice (Oryza sativa L.) varieties. PLoS One
12:e0183416
Sanchez-Ballesta MT, Lafuente MT, Zacarias L, Granell A (2000) Involvement of phenylalanine
ammonia-lyase in the response of Fortune mandarin fruits to cold temperature. Physiol Plant
108:382–389
Satake T (1976) Sterile-type cool injury in paddy rice plants. In: Proceedings of the Symposium
on Climate and Rice. International Rice Research Institute (IRRI), Los Baños, pp 281–300
Sato Y, Masuta Y, Saito K et al (2011) Enhanced chilling tolerance at the booting stage in rice
by transgenic overexpression of the ascorbate peroxidase gene, OsAPXa. Plant Cell Rep
30:399–406
Satoh T, Tezuka K, Kawamoto T et al (2016) Identification of QTLs controlling low-temperature
germination of the East European rice (Oryza sativa L.) variety Maratteli. Euphytica
207:245–254. https://doi.org/10.1007/s10681-015-1531-z
Schiller JM, Linquist B, Douangsila K et al (2001) Constraints to rice production systems in Laos.
In: ACIAR Proceedings 1998. ACIAR, Canberra, ACT, pp 3–19
Schläppi MR, Jackson AK, Eizenga GC et al (2017) Assessment of five chilling tolerance traits and
GWAS mapping in rice using the USDA Mini-Core collection. Front Plant Sci 8:957. https://
doi.org/10.3389/fpls.2017.00957
Seck PA, Diagne A, Mohanty S, Wopereis MCS (2012) Crops that feed the world 7: rice. Food
Secur 4:7–24
Serrano-Mislata A, Bencivenga S, Bush M et al (2017) DELLA genes restrict inflorescence meri-

stem function independently of plant height. Nat Plants 3:749
Shakiba E, Edwards JD, Jodari F et al (2017) Genetic architecture of cold tolerance in rice (Oryza
sativa) determined through high resolution genome-wide analysis. PLoS One 12:1–22. https://
Sharma KD, Nayyar H (2016) Regulatory networks in pollen development under cold stress. Front
Plant Sci 7:402
Shi J, Cao Y, Fan X (2012) A rice microsomal delta-12 fatty acid desaturase can enhance resis-
tance to cold stress in yeast and Oryza sativa. Mol Breed 29:743–757. https://doi.org/10.1007/
s11032-011-9587-5
Shim K-C, Kim S, Le AQ et al (2019) Fine mapping of a low-temperature germinability QTL
qLTG1 using introgression lines derived from Oryza rufipogon. Plant Breed Biotechnol
7:141–150
Shinada H, Iwata N, Sato T, Fujino K (2013) Genetical and morphological characterization of
cold tolerance at fertilization stage in rice. Breed Sci 63:197–204. https://doi.org/10.1270/
jsbbs.63.197
Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low tem-
perature: differences and cross-talk between two stress signaling pathways. Curr Opin Plant
Biol 3:217–223
Shirasawa K, Shiokai S, Yamaguchi M et al (2006) Dot-blot-SNP analysis for practical plant
breeding and cultivar identification in rice. Theor Appl Genet 113:147–155
Shirasawa S, Endo T, Nakagomi K et al (2012) Delimitation of a QTL region controlling cold
tolerance at booting stage of a cultivar,‘Lijiangxintuanheigu’, in rice, Oryza sativa L. Theor
Singh BK, Sutradhar M, Singh AK, Mandal N (2017) Cold stress in rice at early growth stage: an
overview. Int J Pure Appl Biosci 5:407–419
Sinha SK, Amitha Mithra SV, Chaudhary S et al (2018) Transcriptome analysis of two rice varieties
contrasting for nitrogen use efficiency under chronic N starvation reveals differences in chlo-
roplast and starch metabolism-related genes. Genes (Basel) 9:1–22. https://doi.org/10.3390/
genes9040206
Sivapalan S (2013) Cold tolerance of temperate and tropical rice varieties. Frank Wise Institute of
Tropical Agriculture, Kununurra, WA. 4 p
Snell P, Johnston D, Ford R (2008) Cold tolerant rice varieties: a matter of need for Australia.
IREC Farm Newsl 177:4–5
Song S-Y, Chen Y, Chen J et al (2011) Physiological mechanisms underlying OsNAC5-dependent
tolerance of rice plants to abiotic stress. Planta 234:331–345
Song J, Li J, Sun J et al (2018) Genome-wide association mapping for cold tolerance in a core
collection of rice (Oryza sativa L.) landraces by using high-density single nucleotide poly-
morphism markers from specific-locus amplified fragment sequencing. Front Plant Sci 9:875
Sthapit BR, Witcombe JR (1998) Inheritance of tolerance to chilling stress in rice during germina-
tion and plumule greening. Crop Sci 38:660–665
Su CF, Wang YC, Hsieh TH et al (2010) A novel MYBS3-dependent pathway confers cold toler-
ance in rice. Plant Physiol 153:145–158. https://doi.org/10.1104/pp.110.153015
Suh JP, Jeung JU, Lee JI et al (2010) Identification and analysis of QTLs controlling cold tolerance
at the reproductive stage and validation of effective QTLs in cold-tolerant genotypes of rice
(Oryza sativa L.). Theor Appl Genet 120:985–995
Suh JP, Lee CK, Lee JH et al (2012) Identification of quantitative trait loci for seedling cold toler-
ance using RILs derived from a cross between japonica and tropical japonica rice cultivars.
Sun Z, Du J, Pu X et al (2019) Near-isogenic lines of japonica rice revealed new QTLs for cold
tolerance at booting stage. Agronomy 9(1):40. https://doi.org/10.3390/agronomy9010040
Sweeney M, McCouch S (2007) The complex history of the domestication of rice. Ann Bot
100:951–957
Takahashi N (1984) Differentiation of ecotypes in Oryza sativa L. In: Developments in crop sci-
ence. Elsevier, Amsterdam, pp 31–67
Takesawa T, Ito M, Kanzaki H et al (2002) Over-expression of ζ glutathione S-transferase in trans-
genic rice enhances germination and growth at low temperature. Mol Breed 9:93–101
Tao Z, Kou Y, Liu H et al (2011) OsWRKY45 alleles play different roles in abscisic acid signal-
ling and salt stress tolerance but similar roles in drought and cold tolerance in rice. J Exp Bot
62:4863–4874. https://doi.org/10.1093/jxb/err144
Teng S, Zeng D, Qian Q et al (2001) QTL analysis of rice low temperature germinability. Chin Sci
Bull 46:1800–1803
Urano K, Maruyama K, Ogata Y et al (2009) Characterization of the ABA-regulated global
responses to dehydration in Arabidopsis by metabolomics. Plant J 57:1065–1078
Vats S, Kumawat S, Kumar V et al (2019) Genome editing in plants: exploration of technological
advancements and challenges. Cell 8:1386
Wainaina CM, Makihara D, Nakamura M et al (2018) Identification and validation of QTLs for
cold tolerance at the booting stage and other agronomic traits in a rice cross of a Japanese
tolerant variety, Hananomai, and a NERICA parent, WAB56-104. Plant Prod Sci 21:132–143
Wang Q, Guan Y, Wu Y et al (2008) Overexpression of a rice OsDREB1F gene increases salt,
drought, and low temperature tolerance in both Arabidopsis and rice. Plant Mol Biol 67:589–602
Wang ZF, Wang JF, Wang FH et al (2009) Genetic control of germination ability under cold stress
in rice. Rice Sci 16:173–180. https://doi.org/10.1016/S1672-6308(08)60076-1
Wang Z, Wang F, Zhou R et al (2011) Identification of quantitative trait loci for cold tolerance dur-
ing the germination and seedling stages in rice (Oryza sativa L.). Euphytica 181:405
Wang C, Wei Q, Zhang K et al (2013a) Down-regulation of OsSPX1 causes high sensitivity to
cold and oxidative stresses in rice seedlings. PLoS One 8(12):e81849. https://doi.org/10.1371/
Wang J, Lin X, Sun Q, Jena KK (2013b) Evaluation of cold tolerance for japonica rice vari-
eties from different countries. Adv J Food Sci Technol 5:54–56. https://doi.org/10.19026/
ajfst.5.3311
Wang X, Han F, Yang M et al (2013c) Exploring the response of rice (Oryza sativa) leaf to gib-
berellins: a proteomic strategy. Rice 6:17
Wang D, Liu J, Li C et al (2016) Genome-wide association mapping of cold tolerance genes at the
seedling stage in rice. Rice 9:61. https://doi.org/10.1186/s12284-016-0133-2
Wei J, Wang A, Li R et al (2018) Metabolome-wide association studies for agronomic traits of rice.
Heredity (Edinb) 120:342
Williams ME, Torabinejad J, Cohick E et al (2005) Mutations in the Arabidopsis phosphoinositide
phosphatase gene SAC9 lead to overaccumulation of PtdIns(4,5)P2 and constitutive expression
of the stress-response pathway. Plant Physiol 138:686–700
Wittmann-Liebold B, Graack H, Pohl T (2006) Two-dimensional gel electrophoresis as tool for
proteomics studies in combination with protein identification by mass spectrometry. Proteomics
6:4688–4703
Wolter F, Schindele P, Puchta H (2019) Plant breeding at the speed of light: the power of CRISPR/
Cas to generate directed genetic diversity at multiple sites. BMC Plant Biol 19:176
Xiang Y, Huang Y, Xiong L (2007) Characterization of stress-responsive CIPK genes in rice
for stress tolerance improvement. Plant Physiol 144:1416–1428. https://doi.org/10.1104/
pp.107.101295
Xiao N, Huang W, Li A et al (2015) Fine mapping of the qLOP2 and qPSR2-1 loci associated with
chilling stress tolerance of wild rice seedlings. Theor Appl Genet 128:173–185
Xiao N, Gao Y, Qian H et al (2018) Identification of genes related to cold tolerance and a functional
allele that confers cold tolerance. Plant Physiol 177:1108–1123
Xiong L, Yang Y (2003) Disease resistance and abiotic stress tolerance in rice are inversely modu-
lated by an abscisic acid–inducible mitogen-activated protein kinase. Plant Cell 15:745–759
Xu L-M, Zhou L, Zeng Y-W et al (2008) Identification and mapping of quantitative trait loci for
cold tolerance at the booting stage in a japonica rice near-isogenic line. Plant Sci 174:340–347
Xu R, Yang Y, Qin R et al (2016) Rapid improvement of grain weight via highly efficient CRISPR/
Cas9-mediated multiplex genome editing in rice. J Genet Genom 43:529–532
Xu Y, Hu D, Hou X et al (2020) OsTMF attenuates cold tolerance by affecting cell wall properties
in rice. New Phytol 227:498. https://doi.org/10.1111/nph.16549
Yamaguchi-Shinozaki K, Shinozaki K (2004) Improving abiotic stress tolerance in crops. In The
8th International Symposium on the Biosafety of Genetically Modified Organisms, Montpellier,
France, 26–30 September, 2004, International Society for Biosafety Research, pp 134–136
Yamori W, Noguchi KO, Hikosaka K, Terashima I (2010) Phenotypic plasticity in photosynthetic
temperature acclimation among crop species with different cold tolerances. Plant Physiol
152:388–399
Yamori W, Sakata N, Suzuki Y et al (2011) Cyclic electron flow around photosystem I via chlo-
roplast NAD(P)H dehydrogenase (NDH) complex performs a significant physiological role
during photosynthesis and plant growth at low temperature in rice. Plant J 68:966–976. https://
doi.org/10.1111/j.1365-313X.2011.04747.x
Yan SP, Zhang QY, Tang ZC et al (2006) Comparative proteomic analysis provides new insights
into chilling stress responses in rice. Mol Cell Proteomics 5:484–496
Yang T, Poovaiah BW (2003) Calcium/calmodulin-mediated signal network in plants. Trends
Yang G, Rhodes D, Joly RJ (1996) Effects of high temperature on membrane stability and chlo-
rophyll fluorescence in glycinebetaine-deficient and glycinebetaine-containing maize lines.
Funct Plant Biol 23:437–443
Yang T, Shad Ali G, Yang L et al (2010) Calcium/calmodulin-regulated receptor-like kinase
CRLK1 interacts with MEKK1 in plants. Plant Signal Behav 5:991–994
Yang A, Dai X, Zhang W-H (2012) A R2R3-type MYB gene, OsMYB2, is involved in salt, cold,
and dehydration tolerance in rice. J Exp Bot 63:2541–2556
Yang C, Li D, Mao D et al (2013a) Overexpression of microRNA319 impacts leaf morphogenesis
and leads to enhanced cold tolerance in rice (Oryza sativa L.). Plant Cell Environ 36:2207–2218
Yang Z, Huang D, Tang W et al (2013b) Mapping of quantitative trait loci underlying cold toler-
ance in rice seedlings via high-throughput sequencing of pooled extremes. PLoS One 8:e68433
Yang W, Guo Z, Huang C et al (2014) Combining high-throughput phenotyping and genome-wide
association studies to reveal natural genetic variation in rice. Nat Commun 5:5087
Yang LM, Liu HL, Lei L et al (2018) Identification of QTLs controlling low-temperature
germinability and cold tolerance at the seedling stage in rice (Oryza sativa L.). Euphytica
214:13. https://doi.org/10.1007/s10681-017-2092-0
Ye C, Fukai S, Godwin I et al (2009) Cold tolerance in rice varieties at different growth stages.
Crop Pasture Sci 60:328–338
Yokotani N, Sato Y, Tanabe S et al (2013) WRKY76 is a rice transcriptional repressor playing
opposite roles in blast disease resistance and cold stress tolerance. J Exp Bot 64:5085–5097.
https://doi.org/10.1093/jxb/ert298
Yoshida S (1981) Fundamentals of rice crop science. International Rice Research Institute,
Los Baños
Yu S, Li M, Xiao Y et al (2018) Mapping QTLs for cold tolerance at seedling stage using an Oryza
sativa × O. rufipogon backcross inbred line population. Czech J Genet Plant Breed 54:59–64.
https://doi.org/10.17221/154/2016-CJGPB
Yuan P, Yang T, Poovaiah BW (2018) Calcium signaling-mediated plant response to cold stress.
Int J Mol Sci 19:3896
Yun KY, Park MR, Mohanty B et al (2010) Transcriptional regulatory network triggered by oxida-
tive signals configures the early response mechanisms of japonica rice to chilling stress. BMC
Plant Biol 10:16
Zhang X, Fowler SG, Cheng H et al (2004) Freezing-sensitive tomato has a functional CBF cold
response pathway, but a CBF regulon that differs from that of freezing-tolerant Arabidopsis.
Plant J 39:905–919
Zhang Y, Chen C, Jin XF et al (2009) Expression of a rice DREB1 gene, OsDREB1D, enhances
cold and high-salt tolerance in transgenic Arabidopsis. BMB Rep 42:486–492
Zhang J, Li J, Wang X, Chen J (2011) OVP1, a vacuolar H+-translocating inorganic pyrophospha-

tase (V-PPase), overexpression improved rice cold tolerance. Plant Physiol Biochem 49:33–38
Zhang T, Zhao X, Wang W et al (2012a) Comparative transcriptome profiling of chilling stress
responsiveness in two contrasting rice genotypes. PLoS One 7:e43274
Zhang Y, Xu Y, Yi H, Gong J (2012b) Vacuolar membrane transporters OsVIT1 and OsVIT2
modulate iron translocation between flag leaves and seeds in rice. Plant J 72:400–410
Zhang K, Liu H, Tao P, Chen H (2014a) Comparative proteomic analyses provide new insights into
low phosphorus stress responses in maize leaves. PLoS One 9:e98215. https://doi.org/10.1371/
Zhang Q, Chen Q, Wang S et al (2014b) Rice and cold stress: methods for its evaluation and
summary of cold tolerance-related quantitative trait loci. Rice 7:24. https://doi.org/10.1186/
s12284-014-0024-3
Zhang S, Zheng J, Liu B et al (2014c) Identification of QTLs for cold tolerance at seedling stage
in rice (Oryza sativa L.) using two distinct methods of cold treatment. Euphytica 195:95–104
Zhang J, Luo W, Zhao Y et al (2016) Comparative metabolomic analysis reveals a reactive oxygen
species-dominated dynamic model underlying chilling environment adaptation and tolerance
in rice. New Phytol 211:1295–1310
Zhang Z, Li JJJ, Pan Y et al (2017) Natural variation in CTB4a enhances rice adaptation to cold
habitats. Nat Commun 8:1–13. https://doi.org/10.1007/BF01337500
Zhang M, Ye J, Xu Q et al (2018) Genome-wide association study of cold tolerance of Chinese
indica rice varieties at the bud burst stage. Plant Cell Rep 37:529–539
Zhao WG, Chung JW, Kwon SW et al (2013) Association analysis of physicochemical traits on
eating quality in rice (Oryza sativa L.). Euphytica 191:9–21
Zhi-Hong Z, Li S, Wei L et al (2005) A major QTL conferring cold tolerance at the early seedling
stage using recombinant inbred lines of rice (Oryza sativa L.). Plant Sci 168:527–534. https://
doi.org/10.1016/j.plantsci.2004.09.021
Zhou L, Zeng Y, Hu G et al (2012) Characterization and identification of cold tolerant near-isogenic
lines in rice. Breed Sci 62:196–201
Zhu JK (2016) Abiotic stress signaling and responses in plants. Cell 167:313–324
Zhu Y, Chen K, Mi X et al (2015) Identification and fine mapping of a stably expressed QTL for
cold tolerance at the booting stage using an interconnected breeding population in rice. PLoS
Arsenic Stress Responses
and Accumulation in Rice
Varunseelan Murugaiyan, Frederike Zeibig, Mahender Anumalla,

Sameer Ali Siddiq, Michael Frei, Jayaseelan Murugaiyan, and Jauhar Ali
Abstract Rice (Oryza sativa L.) is one of the world’s most vital staple grains, and
90% of it is produced and consumed in Asia alone. It plays a significant role in the
entry of mineral nutrients into the food chain. Arsenic (As) is a toxic heavy metal
that threatens the major rice-growing regions in the world, particularly in Asia.
Arsenic is ubiquitously present in moderate concentrations in the environment
because of natural geological processes and anthropogenic impacts. However, rapid
industrialization and excessive use of arsenic-rich groundwater are further fueling
the increased arsenic concentration in agricultural topsoil. Arsenic accumulation in
rice plants has a significant adverse effect on plant, human, and livestock health.
Although arsenic contamination in rice is well documented, its interaction and
accumulation in rice are poorly understood. So far, no candidate genes or QTLs
associated with arsenic interaction are used in breeding programs for the development
of low-arsenic-accumulating rice varieties. The development and adaptation of new
low-arsenic-accumulating rice cultivars resilient to arsenic toxicity constitute safe
V. Murugaiyan · F. Zeibig
Rice Breeding Platform, International Rice Research Institute (IRRI), Los Baños, Philippines
Institute of Crop Sciences and Resource Conservation (INRES), University of Bonn,
Bonn, Germany
M. Anumalla
Rice Breeding Platform, International Rice Research Institute (IRRI), Los Baños, Philippines
S. A. Siddiq
University of Minnesota, Minneapolis, MN, USA
M. Frei
Institute of Crop Sciences and Resource Conservation (INRES), University of Bonn,
Bonn, Germany
Department of Agronomy and Plant Breeding, Justus Liebig University, Giessen, Germany
J. Murugaiyan
Department of Biotechnology, SRM University-AP, Amaravati, Andhra Pradesh, India
J. Ali (*)
Hybrid Rice Breeding Cluster, Hybrid Rice Development Consortium (HRDC), Rice
Breeding Platform, International Rice Research Institute (IRRI),

https://doi.org/10.1007/978-3-030-66530-2_9
282 V. Murugaiyan et al.
ways to mitigate arsenic contamination in rice. Recent scientific advances in rice

genetics, genomics, and physiology have opened up new opportunities to speed up
the process of developing low-arsenic-accumulating rice cultivars for the rapidly
growing human population.
Keywords Heavy metal · Arsenic contamination · Arsenic speciation ·

Phytotoxicity · Quantitative trait loci · Genes
1 Introduction
Rice (Oryza sativa L.) belongs to the grass family (Poaceae). Its domestication is
one of the most significant events in the history of human agricultural advancement
(Khush 1997; Molina et al. 2011; Huang et al. 2012a). It is one of the world’s vital
staple grains and plays a crucial role in the entry of mineral nutrients into the food
chain (Ali et al. 2018a). The presence of naturally occurring unwanted arsenic (As)
metalloid in flooded paddy soil poses a significant threat to rice production and
consumers who depend on rice as their primary staple food (Murugaiyan et al.
2019). A total of 23–25% of the total calories consumed by humans come through
the consumption of rice alone (Ashikari and Ma 2015; Yu et al. 2020). As the world
population is likely to increase further in the coming decades, keeping rice
production sustainable remains a crucial challenge (Ali et al. 2018a). Currently, rice
is planted on 166 million hectares worldwide, nurturing some four billion people
around the world, and the annual harvest of rice is worth ~USD 200 billion (GRiSP
2013). Rice is the primary cereal crop in Asia, where 90% of the world’s rice is
produced and consumed (Frei and Becker 2005; Molden 2013). Approximately
480 million metric tons of milled rice are produced annually; China and India alone
account for ∼50% of the rice produced and 90% of this rice production is consumed
domestically (Muthayya et al. 2014). Maintaining a favorable rice supply-demand
balance in the future depends mostly on the exploitation of the production capacity
of the rainfed ecosystem (Li and Ali 2017). On about 60% of the agricultural land
in Asia, rice is grown under rainfed conditions (Rao et al. 2015; Ali et al. 2018a).
The rainfed ecosystem is the dominant one in the low-income countries of Asia,
where demand for rice is projected to remain very high throughout this century (Li
and Ali 2017). Rice production in rainfed conditions is susceptible to a combination
of various biotic and abiotic stresses. Abiotic stresses are the primary factor
undesirably affecting crop growth and yield worldwide (Gao et al. 2007). Various
abiotic stresses limit rice production in rainfed environments, which comprise
35–45% of the global rice area (Wu et al. 2014; Li and Ali 2017). Critical abiotic
stresses including extreme temperature, drought, submergence, salinity, iron
toxicity, nutritional deficiencies, and heavy metal contamination are known to cause
severe losses in rice yield and in the quality of the seed produced (Messerschmidt
et al. 2002; Li and Ali 2017; Wu et al. 2017).
Arsenic Stress Responses and Accumulation in Rice 283
Large tracts of paddy soil are directly affected by heavy metal (arsenic, lead, and
cadmium) contamination, especially in India, China, and Bangladesh (Das et al.
2008; Chakraborti et al. 2013; Wu et al. 2016). Rice is conventionally produced in
flooded paddy fields, which can translocate the unwanted class I carcinogenic-
arsenic metalloid into the straw and grain (Sayan et al. 2012). An accumulation of
arsenic in the rice plant negatively affects plant performance and also threatens the
health of consumers and livestock (Carbonell-Barrachina et al. 2015). Himalayan
rivers carry arsenic from rock sediments to the densely populated rice-producing
regions of South and Southeast Asia, threatening the primary rice-growing belt of
Asia. In these areas, rice production is already threatened by climate change with
the frequent intrusion of saltwater in the Ganges-Brahmaputra deltaic regions, and
extended periods of drought also force farmers to depend on groundwater for
irrigating paddy fields (Murugaiyan et al. 2019). This groundwater is naturally
enriched because of arsenic-rich aquifers and it acts as an additional source of
arsenic in paddy fields. The long-term use of arsenic-rich groundwater for irrigating
rice crops has resulted in an increased concentration of arsenic in paddy topsoil,
with up to 83 mg As/kg being reported in some parts of Bangladesh and the Indian
subcontinent (Suriyagoda et al. 2018). Without intervention, this concentration will
tend to increase in the coming decades because of the significant dependence on
groundwater for rice production. However, rice varieties suitable for growing in
arsenic-rich fields have not been developed. Despite this arsenic threat, the major
rice-growing countries in Asia need more food for their rapidly growing populations,
leaving scientists with the challenge of developing rice varieties that do not
accumulate arsenic in the grain and straw. These varieties also need to withstand
other abiotic stresses such as drought, salinity, and flooding. Because of global food
security and the increasing health-related concerns associated with arsenic exposure
through rice, it has become vital to understand arsenic toxicity, the interaction with
rice plants, and the physiological mechanisms associated with arsenic accumulation
in rice. Recent scientific advances, particularly in genetics, genomics, and crop
physiology, have opened up new opportunities to speed up the process of developing
highly adaptable rice cultivars that are safe and nutritious for meeting the future
food demand of the growing population.
2 Heavy Metal Contamination
Heavy metal contamination has become a significant limitation to sustainable crop

production. Particularly in rice, it poses a severe threat to human nutrition and food
security (Murugaiyan 2019). The presence of toxic heavy metals such as arsenic
(As), cadmium (Cd), lead (Pb), and mercury (Hg) in irrigated water systems
threatens not only the rice plant but also the populations that depend on rice for their
dietary supply. Additionally, feeding rice straw from contaminated paddy fields to
cattle leads to an additional entry of these elements into the human food chain.
Toxic heavy metals ubiquitously persist at moderate concentrations in the
environment because of natural weathering of rocks and minerals, and also through
anthropogenic impacts, and they tend to translocate in the food chain (Wu et al.
2016). In recent years, heavy metal contamination has increased significantly in
agricultural soil because of the frequent use of polluted irrigation water (Clemens
and Ma 2016). Various studies have reported that chronic exposure to heavy metals
is often associated with cancer and potentially causes neurotoxicity (Vahidnia et al.
2007). Heavy metals cause developmental neurotoxicity, which is concerning since
these developmental abnormalities are often irreversible (Mochizuki 2019).
2.1 Heavy Metal Interaction with the Biological System
In a biological system, the toxic effects of these metals may be similar even though
their sources are distinct (Fig. 1). Lead and cadmium share similar ionic size and
charge, which make them behave similarly in the biological system, especially
regarding their toxicity for the same or related molecular targets (Pohl et al. 2011).
In principle, lead and cadmium mimic essential ions such as calcium (Ca2+) and zinc
(Zn2+) and use their channels to get into the system (Jomova and Valko 2011). Lead
and cadmium exposure generally occurs as a result of industrial exposure. At the
same time, arsenic has been reported to occur naturally or as a contaminant, mainly
with irrigation water, and is often of geographic origin (Abernathy et al. 2001).
Toxic heavy metals in agricultural topsoil
Arsenic Lead Cadmium
Common Thiol-binding metals Similar ionic size and charge

feature
Action Binds to protein-containing Mimics Ca2+ and Zn2+ channels and

SH-rich amino acids replaces Ca2+ in enzymes
Antioxidant stress in Neurocognitive functional changes Amyotrophic lateral sclerosis

Neurotoxic and neurobehavioral effects
developing brain and encephalopathy
effect
Lead, cadmium, and arsenic contamination have been reported in drinking and irrigation
water and in dietary sources
Heavy metal contamination through drinking water and dietary sources leads to additive or
synergistic toxic responses in brain development
Fig. 1 Similarities between heavy metals and their interaction with the biological system
Arsenic and lead are known as thiol-binding metals. Hence, both are expected to
behave similarly and show similar targets and binding sites (Flora et al. 2011).
Arsenic and lead could bind to protein-containing sulfhydryl-rich amino acids such
as cysteine residue and could have the same toxic effect. When heavy metals are
ingested by humans, the nervous system is a primary target for several of them
(Sengupta and Bishayi 2002; Nordberg et al. 2005; Thomas 2013).
2.2 hronic Arsenic Exposure and Its Adverse Effects

C
on Human Health
Arsenic is a metalloid element. It is the 20th most abundant mineral in Earth’s

crust with an average concentration in sediments ranging from 5 to 10 mg/kg
(National Research Council (U.S.) Committee on Medical and Biological
Effects of Environmental Pollutants 1977). Chronic exposure to arsenic is
linked with myriad possible adverse health effects on humans, including skin
lesions, hypertension, cardiovascular disease, pulmonary disease, reproductive
and neurological dysfunctions, hematological changes, and malignancies of
skin and internal organs (Mandal and Suzuki 2002). Groundwater arsenic con-
tamination and its ill health effects in Southeast Asian countries came into the
limelight in 1984 when groundwater used for drinking purposes was directly
tainted by arsenic from natural sources (Garai et al. 1984; Duker et al. 2005).
A substantial part of the Ganga-Meghna-Brahmaputra plain, with an area of
569,749 km2 and population surpassing 500 million, was at risk of mass arsenic
poisoning (Das et al. 2008; Chakraborti et al. 2013). The World Health
Organization (WHO) has recommended <10μg/L concentration of arsenic in
drinking water as a safe limit (Muhammad et al. 2010; Kumar and Puri 2012).
However, high levels of arsenic contamination through groundwater and their
adverse impact on human health have been reported in many countries across
the world (Nriagu et al. 2007). The magnitude of this problem is of great con-
cern in Bangladesh, followed by India and China (Nickson et al. 2000; Mohan
and Pittman 2007; Guha Mazumder 2015; Tareq et al. 2015). Approximately
85–150 million people in India and Bangladesh are at immediate risk from
mass arsenic poisoning through contaminated drinking water (Hossain 2006).
Both long- and short-term exposure are hazardous and can lead to skin, blad-
der, lung, and prostate cancers, cardiovascular diseases, diabetes, and anemia,
as well as reproductive, developmental, immunological, and neurological
effects (Roy and Saha 2002; Ng 2005; Guha Mazumder 2008). Arsenicosis is a
chronic illness linked with drinking water with high concentrations of arsenic
over a long period and it commonly occurs in populations exposed to arsenic
contamination in their living environment (Mazumder 2003; Sun 2004; Kalia
and Flora 2005).
3 Arsenic Contamination in Paddy Soil
Arsenic-containing compounds were used widely in the early twentieth century as

pesticides and fungicides, which led to a high-arsenic load in agricultural topsoil
and water runoff (Mukherjee et al. 2017). Most arsenic exposures occur through
contaminated drinking and irrigation water sources. Arsenic is mainly found in
pesticides (lead arsenate, calcium arsenate, and sodium arsenite), herbicides
(monosodium arsenate and cacodylic acid and dimethyl arsenic acid), cotton
desiccants (arsenic acid), wood preservatives (zinc arsenate and chromium arsenate),
and semiconductors (gallium arsenide, indium arsenide, and aluminum gallium
arsenide). Arsenic is even used as a desiccant and defoliant in agriculture, and as a
by-product in the smelting process, particularly for gold and copper, from coal
residues (Järup 2003; Vaughan 2006; Chen et al. 2016). Rivers originating from the
higher Himalayas carry arsenic from their rock deposits to the densely inhabited
rice-growing regions of South and Southeast Asia, making the primary rice-growing
belt of Asia vulnerable to arsenic pollution (Shepherd et al. 2015; Lawson et al.
2016). Climate change is also threatening rice production in these areas. With the
frequent occurrence of drought and saltwater intrusion in the Ganges-Brahmaputra
deltas of India and Bangladesh, farmers increasingly tap groundwater resources for
irrigation (Laha 2017). This groundwater is an additional source of arsenic
discharged from the naturally abundant arsenic aquifers (Bondu et al. 2016).
Typically, 4–8 mg/kg of arsenic occur in flooded paddy soil, but the concentration
increases exponentially in paddy soil throughout the cropping season and can reach
83 mg As/kg in parts of Bangladesh and West Bengal regions of India (Abedin et al.
2002b; Zavala and Duxbury 2008). Evidence has emerged in recent years that
arsenic-enriched groundwater occurs commonly in other Asian countries, including
Cambodia, Myanmar, Pakistan, Nepal, Vietnam, and Japan (Fig. 2) (Smith et al.
2000; Das et al. 2008; Brammer and Ravenscroft 2009; Jiang et al. 2013). In the
early 1970s, the use of surface water was abandoned mainly in the Bengal delta in
response to severe health effects caused by pathogens, and this unexpectedly
resulted in the extensive use of arsenic-contaminated groundwater (Caldwell et al.
2003). Alluvial and deltaic environments are mainly characterized by reducing
conditions that cause a high-arsenic release in groundwater (Abernathy et al. 2001;
Lee et al. 2008). Arsenic-abundant groundwater is drawn from shallow (<100 m)
depths by domestic and irrigation wells in the Bengal basin aquifer system (Sultana
2013). It has been reported that groundwater from shallow tube wells (12–33 m)
contains very high amounts of arsenic. In contrast, the water from deep tube wells
(200–300 m) contains lower amounts of arsenic (<50μg/L) (Hossain 2006).
Subsurface mobilization of arsenic is mainly caused by a combination of chemical,
physical, and microbial factors, and various mechanisms have been proposed to
elucidate arsenic mobilization (Anawar et al. 2003; Amini et al. 2008). Among
those, the most widely accepted theories are pyrite oxidation and oxy-hydroxide
reduction (Hossain 2006). Arsenic dissolution and release in deltaic regions have
been modeled considering the contribution of microbes, organic matter, and paleo-
sol formation (Gorny et al. 2015).
Fig. 2 Worldwide distribution of arsenic-contaminated regions and showing contaminated regions

overlapping with major rice-growing belt. (Image modified from the British Geological Survey,
Safiuddin et al. 2011)
3.1 Arsenic Contamination in Rice
The chemical characteristics of arsenic in paddy soil are complex, as it exists in both
organic and inorganic forms, and it differs distinctly under flooded (anaerobic) and
non-flooded (aerobic) conditions (Meharg and Hartley-Whitaker 2002). The toxicity of
arsenic is associated with reduced soil conditions (flooded soils), which increase the
bioavailability of inorganic arsenic and uptake into rice (Zhao et al. 2010b; Islam et al.
2016). Rice is commonly grown in flooded soil under reduced conditions, in which it
assimilates inorganic arsenic into its grain, and this accumulation may adversely affect
the nutritional quality of the grain (Islam et al. 2016). Of the total arsenic present in rice
grain, inorganic arsenic constitutes approximately 54%. Also, grain arsenic content
increases with increased As concentration in paddy soil (Suriyagoda et al. 2018). Total
rice grain As concentration can vary from 0.011 to 0.82 mg/kg on average, depending
on location, contamination level, and rice cultivars used (Islam et al. 2016). In highly
contaminated areas, arsenic concentration can reach 1.7 mg/kg in rice grain, which is
ten times more than the limit allowed by the WHO in rice grain (Meharg and Rahman
2003). Arsenic content in the rice plant decreases in the order of roots > leaves > grain,
and in the rice grain, husk > bran polish > brown rice > raw rice > polished rice > cooked
rice (Suriyagoda et al. 2018). A study with a continuous inorganic arsenic treatment
showed an increased enrichment of up to 91.8 mg As/kg in the straw (Abedin et al.
2002c). About 30% of the total arsenic taken up by humans was contributed through
rice and rice products (Li et al. 2011). Furthermore, the straw that cattle feed on will
also accumulate arsenic in milk and meat, which are in turn consumed by humans,
leading to another route of arsenic exposure (Talukder et al. 2011).
3.2 Arsenic Speciation in the Rice Ecosystem
Arsenic metalloid is ubiquitously found in various inorganic and organic forms in

paddy soil. Inorganic arsenic compounds are considered to be highly toxic and they
enter into paddy soil through both natural and anthropogenic activities (Sturchio et al.
2013). The toxic effects of arsenic in rice plants depend on their species form, with
inorganic arsenic species being more extremely toxic than the organic form. The most
common inorganic species that occur in the rice ecosystem are arsenate(V) and
arsenite(III) (Fig. 3), while the most common organic species are monomethylarsonic
acid (MMA) and dimethylarsinic acid (DMA) (Abedin et al. 2002c; Tripathi et al.
2013). Among the inorganic species, trivalent arsenite(III) is considered to be more
mobile and toxic than pentavalent arsenate(V). In both oxidation states, it can combine
with methyl groups to form organic arsenic species (Vahter and Concha 2001).
However, the existence of organic species in paddy soil is significantly lower than that
of inorganic arsenic species. In anaerobic flooded-soil fields (submerged paddy fields),
the reduced form arsenite(III) dominates; in aerobic soil conditions, such as upland rice
fields, its oxidized form arsenate(V) dominates (Tripathi et al. 2013; Pandey et al. 2015).
3.3 I norganic Arsenic Interaction with Essential

Plant Nutrients
Rice plants do not possess naturally evolved arsenic transporters (Pandey et al.
2015). Instead, arsenic competes with chemically similar essential minerals to enter
the plant system (Wenzel and Alloway 2013). Arsenite(III) is physiochemically
Arsenate(V)
In aerobic soil conditions such as upland paddy
fields, oxidized form arsenate(V) dominates
Arsenite(III)
In anaerobic flooded soil conditions such as submerged

paddy fields, reduced form arsenite(III) dominates
prone, low soil

fertility, and soil acidity
with aerobic soil during
crop growth Drought-prone, alternating aerobic
to anaerobic soil of variable
frequency and duration
Favorable, shallow flooded

with anaerobic soil during
Flood-pro
crop growth Drought-/submergence-prone, ne
alternating aerobic to anaerobic soil
of variable frequency and duration
Submergence-prone, medium to very
deep flooding, aerobic to anaerobic soil
with combination of soil salinity and
mineral toxicity or deficiency in coastal
areas
Arsenate(V) Arsenite(III)
Fig. 3 Inorganic arsenic species found in rice-growing environments. (Adapted and modified
from Rice Almanac, 3rd edition, Maclean et al. 2002)
similar to silica (Si), and thus it competes with the Si-uptake pathway. Silica is not
considered an essential nutrient in many plant species. However, silica is uptaken
actively by the rice plant due to anaerobic respiration, and the silica content in the
rice stem and leaf ranges from 10% to 20% (Takahashi 1968; Ma and Takahashi
1990; Dobermann and Fairhurst 2000). Alternatively, arsenate(V) is physiochemically
similar to the essential mineral phosphorus (P) and uses P acquisition pathways to
enter the root system, and for efflux toward the xylem and various tissues (Clemens
2006; Zhao et al. 2009; Yang et al. 2018). Most rice genotypes possess a mechanism
to retain much of the toxic arsenic burden in the roots. However, a genotype-
dependent proportion of arsenic is translocated into the shoots and other tissues,
including grains of the rice plant (Carey et al. 2010; Pandey et al. 2015). Since
35–55% of rice is produced in irrigated conditions (Ali et al. 2018b), arsenite(III)
contributes to the dominant arsenic species loaded into rice plants (Zhao et al. 2010a).
4 rsenic-Induced Toxicity Symptoms During Different

A
Growth Stages of Rice
Enhanced uptake of arsenic will influence plant growth negatively. Arsenic toxicity
in rice plants triggers various symptoms that include lower seed germination rate,
poor seed establishment, lower photosynthetic rates, stunted plant growth, low
biomass production, sterility-related yield loss, and a physiological disorder referred
to as straighthead disease that was associated with arsenic toxicity (Fig. 4) (Rahman
et al. 2008; Zhao et al. 2013). Symptoms are often confounded with other soil-
related problems associated with rice (Abedin et al. 2002b; Rahman et al. 2008; Zhu
et al. 2008).
4.1 Germination Stage
Germination is one of the most delicate stages in a plant’s growth cycle. It can be
easily affected by abiotic stresses such as drought, salinity, and heavy metals (Rajjou
et al. 2012). In general, its starting point is defined with the imbibition of dry seed
via water uptake and its termination by radicle or coleoptile appearance (Bewley
1997). A unique feature of rice is the ability to germinate in anaerobic conditions in
which the coleoptile occurs first, followed by the radicle. During this process,
various complex physiological and biochemical processes take place, for example,
the synthesis and degradation of phytohormones, especially abscisic acid (ABA)
and gibberellic acid (GA), reactivation of metabolism, and hydrolyzation of starch
via enzymes for maintaining a source of energy (Seneviratne et al. 2019). He and
Yang (2013) summarized the three phases of germination and their ongoing
processes. During phase one, water is taken up rapidly into the seed, where the
biosynthesis of mRNA starts, followed by starch degradation. In phase 2, the
Germination Vegetative growth Reproductive growth

- Delayed or inhibited - Decreased plant height, root - Decreased tiller number
growth length, leaf number, and - Less productive tillers
- Mortality vigor - Poor grain filling
- Low dry matter - Lower biomass - Sterility-related yield loss
- Decreased root and - Decreased chlorophyll - Straighthead disease
shoot length content - Lower 1,000-grain weight
- Decreased leaf number - Leaf wilting, necrosis, and
and leaf blade width senescence
- Decreased chlorophyll
content
Low High Low High Low High

arsenic arsenic arsenic
Fig. 4 Arsenic-induced symptoms during the different growth stages in rice
reactivation of metabolism begins, involving starch hydrolysis, glycolysis, and

fermentation for mobilizing reserves, accompanied by amino acid biosynthesis,
non-functional protein degradation, and mitochondria assembly. In the third phase,
the conversion of carbohydrates to sugars begins, and the embryo is activated. The
last step is coleoptile emergence, which is accompanied by the onset of aerobic
respiration (He and Yang 2013). Especially in phase 1 and 3, water is taken up
rapidly (Bewley 1997). With the background of arsenic-contaminated water, this
implies that the seed and its emerging seedling confront arsenic stress. This may
lead to an interruption or alteration in the normal germination process (Seneviratne
et al. 2019). Germination of seeds was delayed or inhibited when the seeds were
grown in a nutrient solution with more than 5 ppm arsenic (Begum and Mondal
2019). When seedlings were grown in pots filled with arsenic-contaminated soil,
their mortality was observed at 40 mg/kg arsenite(III) in aerobic and anaerobic
conditions, but it was higher in the anaerobic treatment (Shah et al. 2014). Those
different observations could be explained by different experimental setups, different
growth media, or because two different varieties were tested in the studies: IET-4786
and BRRIdhan28. When the seeds were able to germinate, they showed lower dry
matter and decreased shoot and root length (Begum and Mondal 2019). A lower
number of leaves and a lower leaf blade width were also observed as a consequence
of arsenic treatment (Shaibur et al. 2006). Also, the chlorophyll content of seedling
leaves decreased, irrespective of whether the plants were treated with arsenate(V) or
arsenite(III) (Shaibur et al. 2006; Choudhury et al. 2011; Begum and Mondal 2019).
As a general observation, arsenite(III) treatment always caused more toxic symptoms
on seedlings than arsenate(V) (Shah et al. 2014; Begum and Mondal 2019).
4.2 Vegetative Growth
The same symptoms as for the seedlings keep occurring during the vegetative
growth phase of the rice plant. Decreased plant height was most commonly observed
(Abedin et al. 2002b; Shah et al. 2014; Dixit et al. 2016) as well as decreased root
length and vigor (Abedin et al. 2002a; Das et al. 2013). Symptoms resulted from a
change in IAA biosynthesis and transport, which is responsible for the formation of
auxin. Lower auxin content then influenced root development, especially of the
lateral roots (Ronzan et al. 2018). The resulting symptom of decreased biomass
(Abedin et al. 2002b) was caused by an alteration in photosynthesis (Tuli et al.
2010). Arsenic toxicity degenerated the membrane structure and therefore affected
the chloroplast as well as photosynthetic processes (Begum and Mondal 2019). The
leaves wilted and turned violet due to increased anthocyanin content (Hossain
2006). As a consequence, leaf tips and margins developed senescence and eventually
necrosis (Das et al. 2013). Because of these symptoms, a lower photosynthetically
active area occurred, which resulted in lower energy for the plant’s metabolism,
leading to decreased plant height and stunted growth.
4.3 Reproductive Growth
The changes in the metabolism of the rice plant described in the previous section led
to lower yield (Shah et al. 2014). Total yield loss was 80% when the soil contained
more than 60 mg As/kg, but a significant loss was observed from 15 mg As/kg (Das
et al. 2013). Yield decreased because of lower tiller number, which was observed in
a treatment of 40 mg/kg arsenite(III) in a pot study (Das et al. 2013; Shah et al. 2014).
This caused a lower number of filled and mature grains per panicle (Das et al. 2013).
Another physiological disorder that has been associated with arsenic toxicity is
straighthead disease. This physiological disorder produces sterile florets and
spikelets and thereby diminishes grain yield (Rahman et al. 2008). A study with
arsenate(V)-contaminated irrigation water showed rice plants with decreased plant
height and grain yield, explained by a lower number of filled grains and grain
weight, and lower root biomass. At the same time, there was a significant increase
in arsenic concentration in the root, straw, rice husk, and grain (Abedin et al. 2002b).
The leaves can wilt and turn violet because of increased anthocyanin content (Abbas
et al. 2018). Also, the chlorophyll content of seedling leaves decreased with both
arsenate(V) and arsenite(III). This observation explains the lower biomass and growth.
Finally, leaf tips and margins develop necrosis (Abedin et al. 2002c; Zhao et al.
2009). Roots show decreased biomass and lower root vigor. Grain yield decreases
with decreased tiller number, filled grains, and panicles due to the sterility of florets
and spikelets (Rao et al. 2011). Concerning metabolism, arsenic affects carbohydrate,
lipid, and protein metabolism (Finnegan and Chen 2012). More importantly, arsenic
can cause an increased formation of reactive oxygen species (ROS), exceeding the
level that can be scavenged, thus leading to oxidative damage in the plant. Hydrogen
peroxide (H2O2), and malondialdehyde (CH2(CHO)2) were the major ROS formed
when rice seedlings were exposed to arsenate(V) (Rao et al. 2011).
5 uantitative Trait Loci Associated with Arsenic Stress

Q
Tolerance in Rice
Arsenic toxicity, uptake, and accumulation in rice represent a quantitative trait gov-
erned by multiple loci (Dasgupta et al. 2004; Zhang et al. 2008; Murugaiyan et al.
2019). Genetic improvement by the selection of rice cultivars with a lower concen-
tration of arsenic in the edible parts is vital in the development of rice varieties
accumulating low arsenic (Norton et al. 2012; Duan et al. 2017). Even though rice
breeders have been particularly interested in developing cultivars accumulating low
arsenic for contaminated ecosystems, no promising loci have been functionally
characterized for use in their breeding programs. Identification of appropriate rice
cultivars and genetic mapping of chromosomal regions associated with a low-arse-
nic concentration constitute a practical methodology for diminishing the impact of
arsenic in rice.
Arsenic interaction with rice has remained well-documented over the past two
decades. Several QTLs have been reported in both vegetative tissues and grains
(Table 1). More than a decade ago, Dasgupta et al. (2004) proposed the first QTL
related to arsenate(V) uptake close to a phosphate (P) uptake QTL on chromosome 6
and named the region AsTol (Dasgupta et al. 2004). This region covers multiple
genes with various functions, and it needs to be fine-mapped to identify responsible
genes with potential for rice varieties accumulating low arsenic. Nonetheless,
chromosome 6 has been identified to harbor several QTLs related to arsenic toxicity,
even though these QTLs vary in their physical positions (Dasgupta et al. 2004;
Zhang et al. 2008; Norton et al. 2012; Kuramata et al. 2013; Liu et al. 2019;
Murugaiyan et al. 2019). QTLs on chromosome 6 were proposed to mediate arsenic
concentration in the grain of brown rice (Zhang et al. 2008) and the DNA
concentration of the grain (Kuramata et al. (2013). The previously mapped QTLs
were closely colocalized to a QTL that mediates leaf arsenic concentration (Norton
et al. 2010a). Recently, another QTL responsible for arsenic shoot content was
found by Murugaiyan et al. (2019) on chromosome 6. These results indicated that
the regions on chromosome 6 were involved in the uptake of arsenate(V). Several
genes on chromosome 6 were proposed to be involved in arsenite(III) transport: Lsi6

(OsNIP2;2) expressed at the grain-filling stage and plasma membrane intrinsic
protein (OsPIPI2;7) (Kuramata et al. 2013; Liu et al. 2019). Murugaiyan et al. (2019)
also identified a tolerance QTL (qRChlo1) on chromosome 1 for relative chlorophyll
content in a backcross-selected breeding population of rice, and qRChlo1 increased
the tolerance percentage of rice of arsenite(III) stress. However, none of these QTLs
and genes has been functionally characterized for use in breeding programs for the
development of varieties accumulating low arsenic. Chromosome 5 also contained
regions of interest. Norton et al. (2010a) found a QTL associated with arsenic
content in leaves on chromosome 5, but the soil at the study site had a low-arsenic
concentration (<1 ppm). Also, Murugaiyan et al. (2019) identified the same QTL
region on chromosome 5 for shoot arsenic concentration in a breeding population of
rice. A heavy metal-associated domain-containing protein (HMA) was suggested as
a candidate gene on chromosome 5. Those HMAs are associated with detoxifying
heavy metals by containing a metal-binding domain and they have already been
shown to help in the metal homeostasis of copper, zinc, lead, and cadmium
Table 1 QTLs reported in rice for arsenic tolerance and accumulation

Putative
Phenotyping As QTLs on
Reference under concentration Population used chromosome
Dasgupta et al. Hydroponic 1 mg As/kg Bala (indica) × Azucena 6
(2004) culture arsenate(V) (japonica) recombinant
system inbred lines
Zhang et al. (2008) Pot culture 1.27 mg As/kg CJ06 (japonica) × T1 2, 3, 6, 8
system (indica) doubled-
haploid population
Norton et al. Field 0.32 mg As/kg Bala (indica) × Azucena 1, 3, 5, 6
(2010a) conditions (japonica) recombinant
inbred lines
Norton et al. (2012) Field 73.8 mg As/kg Bala (indica) × Azucena 8, 10
conditions (japonica) recombinant
inbred lines
Kuramata et al. Field 1.4 mg As/kg 69 accessions from 6, 8
(2013) conditions World Rice Collection
Norton et al. (2014) Field 14 ± 0.3 mg As/ 312 accessions from 3, 5
conditions kg Rice Diversity Panel 1
Liu et al. (2019) Field 3000 mg As/kg 276 accessions from 1, 2, 4, 5, 9,
conditions global Rice Diversity 11, 12
Panel
Murugaiyan et al. Hydroponic 10 mg As/kg WTR1 (indica) × Hao- 1, 2, 5, 6, 8, 9
(2019) culture arsenite(III) an-nong (japonica)
system backcross recombinant
inbred breeding
population
Norton et al. (2019) Field 4.63 mg As/kg 266 Bengal Assam Aus 2, 3, 5, 7, 9
conditions Panel
(Murugaiyan et al. 2019). However, their metal-binding ability toward arsenic has
not been characterized in rice.
Besides chromosomes 6 and 5, chromosome 8 was found to harbor a few QTLs
that influence grain arsenic content, colocalizing with a locus affecting shoot
phosphorus concentration at the seedling stage of rice (Zhang et al. 2008; Norton
et al. 2012; Kuramata et al. 2013). Also, a QTL related to the trait days to heading
was found close to a QTL for grain arsenic content on chromosome 8, leading to the
assumption that a prolonged time of the vegetative phase could decrease grain
arsenic content (Norton et al. 2012). Furthermore, a QTL that mediated grain DNA
content was also localized on this chromosome (Kuramata et al. 2013). Chromosome
3 was also identified several times and was proposed to contain a QTL that
encompassed Lsi2, a transporter for arsenite(III) (Norton et al. 2012, 2019).
Nonetheless, it is also important to identify QTLs associated with arsenic uptake as
well as translocation, because, if no arsenic enters the plant or is safely stored, no
arsenic will reach the grain. QTLs mediating root arsenic concentration were located
on chromosomes 3 and 8 (Zhang et al. 2008; Murugaiyan et al. 2019). In order to
estimate arsenic uptake and metabolism, measuring root As content was claimed to
be a biased evaluation criterion due to arsenic residuals on the root surface (Zhang
et al. 2008). More QTLs contributing to shoot arsenic concentration were found on
chromosomes 2, 5, 6, and 9 (Zhang et al. 2008; Murugaiyan et al. 2019), and more
precisely for the arsenic concentration in leaves on chromosomes 1, 3, 5, and 6
(Norton et al. 2010a). The QTL on chromosome 2 covered 13 candidate genes,
including an H+ vacuolar pyrophosphatase, which is known to mediate changes in
the concentration of essential and toxic ions (Murugaiyan et al. 2019). However, the
QTLs mapped for arsenic tolerance in rice are not characterized for use in breeding
programs for the development of arsenic-safe varieties.
6 Arsenic Uptake in Rice
As previously stated, arsenite(III) is the predominant form of arsenic in paddy soils.

In order to develop rice varieties accumulating low arsenic, it is critical to understand
the uptake, translocation, and underlying physiology of arsenic interaction with rice
(Fig. 5). The uptake kinetics of both inorganic arsenic species were similar and
followed the Michaelis–Menten equation (Lou et al. 2009). At higher substrate
concentration, arsenite(III) had a higher uptake and was therefore assumed to have a
low-affinity uptake system (Abedin et al. 2002a). Arsenite(III) and arsenate(V) have
different ionic size and their uptake pathways differ (Zhao et al. 2013). Arsenite(III)
resembles the silica ion in diameter and comparable acid-ionization constant value
(pKa) (Jian et al. 2008). Arsenate(V) has a structure similar to the orthophosphate
anion and their second and third pKa values are similar (O’Day 2006). Dimethylarsinic
acid (DMA) and monomethylarsonic acid (MMA) are the most abundant forms of
organic arsenic in paddy soil. They were a result of arsenite methylation facilitated
by microorganisms (Wu et al. 2012). The uptake of organic arsenic species was the
only way for DMA and MMA to enter the rice plant since rice cannot methylate
arsenic in planta. Instead, methylation occurred in the presence of methylating
microorganisms in the rhizosphere (Lomax et al. 2012). Those microorganisms
need to contain the arsM (S-adenosylmethionine methyltransferase) gene in order to
methylate arsenic (Jia et al. 2013).
6.1 Arsenite Uptake
Two major transporters were identified for arsenite(III) uptake in rice (Fig. 6). These
transporters form part of the aquaporins family, belonging to the group of nodulin
26-like intrinsic membrane proteins (NIPs) in rice (Jian et al. 2008). The aquaporins
Lsi1 (OsNIP2;1) and Lsi2 were permeable only to arsenite(III) and usually mediated
silicon influx and efflux. They differed in location and thus in their function. Lsi1
Plant toxicity
Straighthead disease, stunted growth, chlorosis, and yield loss
Human health High arsenic in grain Cattle health
Class I
carcinogen High arsenic in Environmental Meat and dairy
straw pollution products
As-contaminated
drinking water Volatile As Cattle feed
As-high herbicide and
pesticide Burning Rice straw
f
As-contaminated
irrigation water OsHAC1.1&
Soil texture
Aerenchyma-O2 OsHAC1.2
Anthropogenic Redox potential
activities OsHAC4 Organic matter
Groundwater b Fe+2 to Fe+3 pH a
As-contamination Uptake As
Fe(OH)3) (Soil rhizosphere) AsV AsIII
e Fe
Plaque ROS d Solubility
c MMA
Involvement of
Fe, P, and Si Availability
transporters and DMA
phytohormones Epidermis, Exodermis, Cortex, Endodermis, Pericycle
Fig. 5 Factors influencing arsenic availability and transportation from soil to rice plants: (a) the
factors involved in solubility and available form of arsenic; (b) anaerobic conditions, rice roots of
aerenchyma release a part of the O2 to the rhizosphere complex; (c) formation of iron (Fe) plaques:
Fe2+ oxidized to Fe3+ on the root surface and subsequent reaction of sulfhydryl-containing short
peptides such as glutathione and phytochelatins binding to arsenic; (d) if more oxygen is released,
this also may oxidize arsenite(III) to arsenate(V), which is more strongly adsorbed to iron plaque; (e)
uptake of arsenate(V) is supported by various micronutrient transporters; (f) As-contaminated paddy
soil influenced by different external factors, and effects of consumption of food grain and drinking
water on human health
was responsible for the transport of arsenite(III) from the external solution to the root
cells. It was located and expressed on the outside of the exodermis and endodermis
close to the Casparian stripe. The transport was bidirectional, indicating that
arsenite(III) could also efflux to the external medium via Lsi1 (Zhao et al. 2010b).
However, there were more efflux transporters to be included (Zhao et al. 2010a).
Lsi2 mediated the efflux of arsenite(III) toward the xylem and formed the counterpart
of Lsi1 at the expression site. Lsi2 was expressed on the inner side of the plasma
membranes of the exodermis and endodermis. From there, arsenite(III) was released
into the cortex and stele. Lsi2 was considered to be more involved in the transport
and translocation of arsenite(III) from shoot to grain (Jian et al. 2008). In the stele of
primary roots and cell layers of lateral roots, more precisely in the plasma membrane,
the membrane protein OsNIP3;2 was expressed, which also belongs to the NIP
family. Arsenite(III) was also taken up and further transported through this protein
(Chen et al. 2017). Besides the NIPs, plasma membrane intrinsic proteins (PIPs) are
likely to play a role in arsenic homeostasis in rice. When exposed to elevated
arsenite(III) concentrations, the transcript concentrations in the roots were downregu-
lated in order to prevent an increased arsenic uptake (Mosa et al. 2012).
Fig. 6 Schematic representation of arsenic uptake and translocation in rice

6.2 Arsenate Uptake
Arsenate(V) is a chemical analog of phosphate ions and takes advantage of the phos-
phorus transport pathway. In the presence of phosphate, the uptake of arsenate(V)
was actively suppressed, whereas arsenite(III) was not (Abedin et al. 2002a). This
finding was a clear indicator that arsenate(V) used phosphorus transporters (Pht). On
a molecular level, the Pht family, comprising 13 genes, was associated with
phosphate transport in rice (Wang et al. 2016). Some of the transporter function
genes were investigated concerning arsenate(V) uptake. OsPT8 (OsPht1;8) mediated
phosphorus homeostasis and was also considered as a critical transporter for
arsenate(V) uptake in rice roots (Wang et al. 2016). A role for the uptake and
translocation of arsenate(V) in rice was demonstrated by expression analysis of the
OsPT4 transporter gene. The overexpression of this gene resulted in higher arsenic
accumulation when grown in arsenate(V) solution (Chao et al. 2014). Lsi1 also
played an essential role in the uptake of arsenate(V) since it was found that arsenite(III)
was effluxed through this channel when rice roots were exposed to arsenate(V) (Zhao
et al. 2010a).
7 Arsenic Translocation in Rice
The translocation of arsenic depends on its concentration, its capability of complex-

ation, and its sequestration as well as the xylem flow rate (Suriyagoda et al. 2018).
In general, the concentration of arsenic in rice decreases in the following order:
root > straw > husk > grain (Abedin et al. 2002b). Translocation of arsenic species
from root to shoot to grain also depends on the genotype and growth stage. In gen-
eral, grain arsenic content was found to be affected by genotype, year, and geno-
type × year interaction effects (Kuramata et al. 2013). A higher-yielding variety was
found to be capable of translocating more arsenic from root to shoot and also from
shoot to grain than traditionally grown landraces (Bhattacharya et al. 2010).
Genotypes that varied in grain arsenic accumulation were found to have different
arsenic content in all plant tissues (Duan et al. 2011). Furthermore, there was
evidence that translocation mainly took place at the active tillering stage (Das
et al. 2013).
7.1 Arsenite Translocation
The phloem plays a significant role in arsenic translocation from the vegetative tis-
sue to the grain. Arsenite(III) was translocated to the vegetative tissue, capable of
being remobilized and transported to the grain through the phloem (Fig. 7). An
explanation for this phloem loading might be a transfer of arsenic in the xylem
vessels into the phloem (Zhao et al. 2012). The phloem transferred 90% of arsenite(III)
and 55% of DMA to the grain (Carey et al. 2010). Inorganic arsenic was mostly
found in the caryopsis and transported during the grain-filling stage. DMA
accumulated in the caryopsis before flowering (Zhao et al. 2012). The mechanism
by which arsenite(III) is remobilized and further transported is not known yet. Arsenic
could be stored in the nodes and internodes of rice, where arsenic accumulation was
observed in the phloem companion cells. From there, translocation to the grain and
flag leaf was restricted. This capability of the nodes was explained by a higher
expression of Lsi2 and the formation of arsenite(III)-thiol compounds in the vacuole
(Chen et al. 2016). OsABCC1 was also included in the storage of arsenic in the
nodes by sequestering it in the vacuoles of the phloem companion cells (Song et al.
2014). The phytochelatin synthase OsPCS1 might play a supportive role in this
process, as it reduced arsenic grain contents when overexpressed (Hayashi et al.
2017). In the basal and upper nodes, the transcription factor OsARM1 (Arsenite
Responsive MYB 1) was strongly expressed in the phloem region when exposed to
high-arsenite(III) concentrations. It also showed high expression in the rachis and
spikelet and was likely to be involved in mediating uptake and root-to-shoot
translocation (Wang et al. 2017). Those findings indicate that translocation through
the phloem is more critical than translocation through the xylem.
7.2 Arsenate Translocation
It is widely assumed that arsenate(V) is directly reduced to arsenite(III) in the root.

Seyfferth et al. (2011) showed that oxidized arsenic species were the predominant
form in the xylem within a root cross-section. This was supported by the assumption
that the uptake of the two inorganic arsenic species occurred at different locations in
the root. However, genotype-dependent variation was also observed (Seyfferth et al.
2011). Another fact that disproved the reduction assumption was that straw contained
mostly arsenate(V) after growing in an arsenate(V) solution for 170 days (Abedin et al.
2002a). The high abundance of arsenate(V) could be explained by the limited capacity
of the reducing enzymes OsHAC1;1 and OsHAC1;2, thus not reducing arsenate(V)
AsV AsIII ? AsIII Lsi2

AsIII Lsi1 AsIII As
AsIII
AsIII AsV AsIII Vacuole
AsV AsIII AsIII OsNIP3;2 AsIII
Arsenite- Arsenite-thiol
AsIII OsPCS1 thiol OsABCC1
complex
AsV AsV OsPT8
AsV AsV Glutathione OsPCS2 complex
Glutaredoxin
AsIII OsHAC1;1
AsIII AsV OsPT4 AsV OsHAC1;2 As
III
AsV OsHAC4
AsV AsIII ?
Lsi1 AsV
AsIII AsV ? As
AsV
Fig. 7 Schematic representation of arsenic uptake and storage in a cell

anymore (Shi et al. 2016). Nonetheless, as soon as inorganic arsenic was in the
xylem, it became transported to the vegetative parts. Nodulin 26-like intrinsic
membrane proteins that were included in the translocation of arsenite(III) from root
to shoot included OsNIP1;1 and OsNIP3;3, which caused a decreased arsenic
concentration in shoot and xylem when overexpressed. OsNIP1;1 was expressed in
the basal stem at the seedling and tillering stages. At maturity, it was mostly
expressed in the roots, basal stem, nodes, and spikelets. In contrast, OsNIP3;3 was
expressed continuously in different tissues (Sun et al. 2018). For the transport of
arsenate(V) from root to shoot, the expression level of OsPT1 was investigated. It
was increased after different phosphate (P) and arsenate(V) treatments in seedlings,
which indicated its facilitating role for the transport (Kamiya et al. 2013).
OsWRKY28, a transcription factor of the WRKY family that is mostly involved in
stress tolerance, was found to contribute to the translocation of arsenate(V) from root
to shoot (Wang et al. 2017).
8 Arsenic Detoxification and Stress Responses in Rice
Arsenic does not have any known biological function within the rice plant, and
enhanced uptake triggers various defense mechanisms in the plant to mitigate the
negative impact of arsenic stress. Once arsenate(V) was taken up into the cell, it was
reduced to arsenite(III), which was the dominant form inside the plant tissue (Ali
et al. 2009). The reduction was a slow process mediated by glutaredoxin (Suriyagoda
et al. 2018). Enzymatic reduction of arsenate(V) was performed more likely by the
arsenate(V) reductase gene High Arsenic Content (HAC) (Chao et al. 2014). In rice,
OsHAC1;1, OsHAC1;2, and OsHAC4 played a significant role in this process (Shi
et al. 2016). They were most commonly expressed in the roots. OsHAC1;1 was
found in the epidermis, pericycle cells, and root hairs in the mature zone of roots.
OsHAC1;2 was most abundant in the epidermis, exodermis, outer layer of the
cortex, and endodermis cells (Shi et al. 2016). OsHAC4 was expressed in the root
epidermis and exodermis (Xu et al. 2017). By overexpression, knocking out, and
xylem sap analysis, it was established that they were included in the reduction of
arsenate(V) to arsenite(III) and in the efflux of arsenite(III) to the external medium (Shi
et al. 2016). Detoxification of the reduced arsenate(V) and the readily available
arsenite(III) was maintained by glutathione-based phytochelatins (PCs). Glutathione
acts as a precursor for PCs, and its role in arsenic tolerance was corroborated by a
study with a sulfur supplement treatment. It was pointed out that most of the
arsenate(V) remained in the root, promoting the importance of phytochelatins in
binding arsenic (Dixit et al. 2016). The same can be stated for arsenite(III), which
complexes with PCs, lowering its mobility from shoot to grain (Duan et al. 2011).
They are also referred to as arsenite(III)-thiol complexes. An essential contribution to
this mechanism was suggested for phytochelatin synthase OsPCS1 and OsPCS2,
whereby the former was more expressed in the roots under arsenite(III) treatment and
the latter was identified to be an essential isozyme controlling PC synthesis
(Yamazaki et al. 2018). Arsenite(III)-thiol complexes were transported from the

cytoplasm into the vacuole by a member of the C-type ATP-binding cassette (ABC)
transporter (OsABCC) family, OsABCC1 (Song et al. 2014). In the vacuole, the
complexes could be sequestered efficiently since the acidic pH of 5.5 stabilized
them (Ali et al. 2009; Suriyagoda et al. 2018). It was assumed that the same
transporters and detoxification mechanisms as in the root cell were used for storing
arsenic after relocation, but this is not well investigated yet (Zhao et al. 2010b).
Here, the same detoxification mechanism was used again to store arsenic in the
vacuole (Suriyagoda et al. 2018). A study with radioactively labeled arsenic during
the grain-filling stage showed that arsenite(III) was somewhat immobile in the xylem
within the rice plant, probably because of its complexation and sequestration (Zhao
et al. 2012). The silica pathway might not be used when translocating and unloading
arsenite(III) into the grain since silica mainly accumulated in the husk and not in the
grain (Norton et al. 2010b). However, the addition of silica decreased inorganic
grain arsenic content but increased DMA, by 59% and 33%, respectively (Li et al.
2009). In contrast, arsenate(V) was proposed to use the phosphorus pathway
throughout the whole transport and translocation (Norton et al. 2010b).
8.1 The Oxidative Stress Response in Rice
Concerning metabolism, carbohydrate-, lipid-, protein-, amino acid-, ascorbate-,

and aldarate-related pathways were affected by arsenic uptake (Abbas et al. 2018).
Membrane transport, cell growth, and death, as well as biodegradation were also
altered by showing an up- or down-regulation of gene function (Dubey et al. 2014).
When conducting a genome-wide expression study, several gene families were up-
and down-regulated when grown in arsenite(III), especially facilitating transporters,
stress-related genes, regulatory proteins, growth, and development, as well as
secondary metabolism. This finding indicated arsenite(III)-induced oxidative stress
(Chakrabarty et al. 2009). More importantly, arsenic triggers an increased formation
of reactive oxygen species (ROS) and therefore not all of them could be scavenged,
thus leading to plant damage. Hydrogen peroxide (H2O2) was an ROS that was
formed when rice seedlings were exposed to arsenate(V) (Choudhury et al. 2011).
Arsenite(III) was found to promote the development of different ROS, namely,
superoxide anion (O2•−) and H2O2, thus inducing lipid peroxidation in rice seedlings
(Mishra et al. 2011). To prevent an excessive amount of H2O2, seedling roots grown
in arsenate(V) solution increased ascorbate peroxidase (APX) activity, which reduced
H2O2 via the ascorbate-glutathione cycle (Dubey et al. 2014). For scavenging the
ROS occurring under arsenite(III), the concentrations of enzymatic antioxidants
superoxide dismutase (SOD), catalase (CAT), chloroplastic ascorbate peroxidase,
guaiacol peroxidase, monodehydroascorbate reductase, and glutathione reductase
increased. Higher concentrations of ascorbate and glutathione were found, and the
synthesis of phytochelatins and total acid-soluble thiols was enhanced in arsenic-
treated seedlings (Mishra et al. 2011). Besides ROS, altered RNase and protease
activity were also an indicator of stress. Their activity was inhibited by the presence
of arsenite(III), thus leading to high abundance of RNA and proteins. However, an
increase in proline was also reported (Choudhury et al. 2011). Proline is an osmolyte,
and its accumulation was usually found under salinity or drought stress (Amini et al.
2015). Under arsenic stress, its abundance led to the assumption that proline could
help to protect enzymes in the presence of arsenite(III) (Mishra and Dubey 2006).
The same can be reported for heat shock proteins (HSPs), generally formed under a
rapid temperature increase, water deficit, or salinity (Ponomarenko et al. 2013). In
the presence of arsenic, several HSP genes were upregulated (Chakrabarty
et al. 2009).
8.2 Root Plaque Formation as a Scavenger for Arsenic Stress
Despite anaerobic conditions in paddy fields, the rhizosphere can be aerobic due to
the semiaquatic characteristic of rice forming an aerenchyma when flooded. From
there, oxygen is released by the roots, forming an oxidation barrier. This leads to the
formation of iron plaque, visible by the reddish coating around the roots, caused by
a reoxidation of Fe(II) to Fe(III) (Becker and Asch 2005). Iron plaque is mostly
composed of lepidocrocite, goethite, and ferrihydrite (Seyfferth et al. 2011). It was
proposed that the same reoxidation mechanism and an additional formation of iron
plaque would decrease the uptake of arsenic (Lee et al. 2013). This hypothesis could
not be confirmed since the proportion of the newly formed arsenate(V) in a hydroponic
solution was very low (Liu et al. 2010). Rice genotypes with a higher radial oxygen
loss showed a higher formation of iron plaque. This led to a lower uptake of
arsenate(V) and hence to a lower concentration of total inorganic arsenic in the plant
(Wu et al. 2012). However, iron plaque distribution was not homogeneously
covering total roots. Indeed, young roots showed little iron plaque formation.
Therefore, iron plaque was assumed to be a bulk scavenger for arsenic since it was
absent in the main solute-uptake root area (Seyfferth et al. 2011). In general,
arsenate(V) was absorbed more than arsenite(III), and arsenite(III) was desorbed more
rapidly (Geng et al. 2017). Surprisingly, the formation of iron plaque enhanced
arsenite(III) uptake, but, in this experiment, the iron plaque was formed first and then
the plants were exposed to arsenite(III)/arsenate(V). This practice cannot be transferred
to natural field conditions (Liu et al. 2010). The addition of phosphorus increased
the uptake of arsenate(V) irrespective of iron plaque (Geng et al. 2005; Yang et al.
2020). This could be explained because phosphorus might have occupied the
sorption space at the iron plaque, thus releasing more arsenate(V).
In conclusion, iron plaque could act as a buffer for arsenate(V) uptake (Liu et al.
2010). Concerning a decreased arsenite(III) uptake, manganese (Mn) plaque was
shown to be more effective in capturing arsenite(III) than iron plaque as shown by the
lower shoot arsenic concentration. However, the control treatment without any
plaque formation also showed lower shoot arsenic concentration. Therefore, the role
of manganese plaque needs to be further investigated (Liu et al. 2010). In contrast
to the results identified by hydroponic studies, a microcosm study with a

contaminated soil from Bangladesh containing 14 mg As/kg dry weight showed that
iron plaque indeed prevented uptake, leading to lower shoot arsenic concentration
(Huang et al. 2012b).
9 State of Knowledge Gaps for Arsenic Accumulation in Rice
In the past two decades, some progress has been made in understanding the physi-
ological and molecular mechanisms of arsenic metabolism in rice. The regulation
and transportation of arsenic from soil to plants are associated with multiple factors:
soil texture, water availability, arsenic bioavailability, genotype used, arsenic inter-
actions with other heavy metals and essential minerals, rice ecosystem, microbial
interaction, physiological activities, and genotype-by- environment interactions
(Norton et al. 2012; Sahoo and Mukherjee 2014) (Fig. 5). Among these factors, the
selection of rice cultivars with low-arsenic content in grain and straw is the most
efficient and practical approach for decreasing arsenic contamination in rice. The
molecular genetic mechanisms of arsenic accumulation in the root, shoot, and grain
need to be understood clearly for designing efficient breeding strategies and devel-
oping elite breeding materials, which combine arsenic tolerance, low-arsenic
uptake, and high-grain yield.
Several experiments were conducted to understand the physiological mecha-
nisms underlying rice varieties accumulating low arsenic (Norton et al. 2012;
Murugaiyan et al. 2019). However, some of them show inconsistency and method-
ological errors, leading to wrong assumptions. Many studies focused on arsenate(V)
rather than arsenite(III) although arsenite(III) is the predominant form in paddy soils,
where the majority of rice is produced. Abedin et al. (2002a) were the first to elu-
cidate that arsenite(III) and arsenate(V) take advantage of different uptake mecha-
nisms in rice. After this finding, the focus should have been more toward elevated
arsenite(III) concentrations in rice experiments, which was not the case. When iden-
tifying the AsTol QTL on chromosome 6, 1 ppm of arsenate(V) was used (Dasgupta
et al. 2004). When investigating the accumulation in widely used cultivars in
Bangladesh, the soil was obtained from the Bangladesh Rice Research Institute
(BRRI) and enriched with arsenate(V) rather than arsenite(III). There, they found that
a hybrid variety accumulated the most arsenic in the straw at a treatment of
30 mg As/kg, using Na2HAsO4 · 7H2O. It was stated that the hybrid variety would
show a higher phytotoxicity and accumulation ability (Rahman et al. 2007). This
finding needs to be proven when the soil is enriched with arsenite(III) because, oth-
erwise, the hybrid could contain a more efficient phosphorus-uptake pathway,
which arsenate(V) took advantage of. When estimating the grain arsenic content
determined in different soil arsenic concentrations, arsenate(V) was used to enrich
the soil (Rahman et al. 2008). It cannot be clearly stated how important the differ-
ence between using arsenate(V) and arsenite(III) really is unless both forms are tested
in the same experiment. Another shortcoming, especially when finding QTLs, is
when a low-arsenic concentration is used. The concentration in the experiment

should simulate field conditions with typical concentrations of 4–8 mg/kg.
Therefore, a concentration of less than 1 ppm cannot lead to reliable results (Abedin
et al. 2002a; Norton et al. 2010a). Most of the published studies related to arsenic
uptake and accumulation were carried out in a hydroponics system or pot culture,
and these experiments need to be carried out in a contaminated field for better
understanding.
Rice production in the major rice-growing countries is shifting toward more effi-
cient technologies such as direct-seeded rice (DSR) and alternate wetting and dry-
ing (AWD) (Pathak et al. 2011; Richards and Sander 2014). It is essential to identify
suitable genotypes, genes, and QTLs associated with overcoming arsenic contami-
nation under these technologies. The presence of flooded water influences arsenic
speciation. It is crucial to use arsenate(V) for conducting experiments related to dry-
DSR conditions and arsenite(III) for wet-DSR conditions. So far, no experiment has
been conducted to observe the germination ability of rice under DSR conditions in
contaminated soils. AWD technology was proposed to decrease arsenic content in
rice. However, no studies have been conducted to observe how arsenic species acted
when applying AWD technology. Since arsenic translocation from soil depends on
flooding, it is understood that, during the wetting period, arsenite(III) dominates, and,
during the drying period, arsenate(V) dominates. However, no data were available to
validate this observation.
10 ossible Mitigation Strategies for Arsenic

P
Accumulation in Rice
Several novel methodologies in rice cooking provided promising results for a

decrease in arsenic content by using a continual flow of clean water over the raw
rice before cooking (Carey et al. 2015). Carey et al. (2015) stated that about 85% of
the inorganic arsenic was removed from the raw rice by using a continual flow of
clean cooking water. Several researchers also found that using a higher water-to-rice
ratio for cooking, followed by removal of the extra water (starch), significantly
decreased the arsenic in cooked rice (Sengupta et al. 2006; Stanton et al. 2015). For
instance, Sengupta et al. (2006) reported a decrease in arsenic by 57% by washing
the rice grain several times until the water looks transparent/clear, and a cooking
process with a 6:1 ratio of water to rice grain with draining of the excess water.
However, the effect of this procedure on the content of essential water-soluble
nutrients such as minerals or B-vitamins remains to be elucidated.
Selection of existing rice cultivars that are biologically restricted in terms of
arsenic accumulation in the grain offers great potential for use in breeding programs,
as some rice cultivars can accumulate 20–30-fold less arsenic than others
(Murugaiyan et al. 2019). The physiological pathways and molecular genetics of
arsenic accumulation in rice were linked to many QTLs and genes involved in the
uptake and translocation of arsenic in rice (Dasgupta et al. 2004; Tuli et al. 2010).
Still, a gap exists in identifying the candidate genes and allelic variants of the genes
governing low-arsenic content in rice grain. Using recent trends of allele mining and
haplotype breeding technologies can help to limit arsenic accumulation in the grain,
which is a prerequisite for breeding programs to develop low-arsenic-accumulating
rice cultivars (Murugaiyan et al. 2019). Hence, several strategies are possible to
decrease arsenic in rice grains, including the following:
1. Mitigation strategies related to rice cooking can help to decrease arsenic content
in the major staple food crop, rice. The ratio of rice grain for cooking, the amount
of water used for washing, cooking vessels, and duration of the cooking process
can decrease the arsenic in cooked rice (Carey et al. 2015).
2. Supplementation of mineral nutrient elements such as S, P, Fe, and Si can also
significantly diminish the accumulation of arsenic content in rice grain by
minimizing its uptake and transport in food crops. For instance, P and Si are
complementary in nature to arsenic in competing for uptake. Therefore, the
external application of these mineral nutrients decreases the chances of arsenic
uptake from the soil (Alkorta et al. 2004; Jian et al. 2008).
3. Water-saving technologies such as direct-seeded rice cultivation are viable,
immediate, and sustainable solutions for decreasing arsenic content in rice (Hu
et al. 2013; Abedin et al. 2002a). Talukder et al. (2011) reported that arsenic
uptake in rice plants (0.23–0.26 mg/kg) is lower with aerobic water management
than in anaerobic rice cultivation (0.60–0.67 mg/kg).
4. The identification of donors/selection of rice cultivars with low arsenic can mini-
mize the risk of arsenic associated with human diseases and be eco-friendly to
nature (Norton et al. 2012).
5. The development of breeding lines through the introgression of QTLs and genes
for low arsenic into elite rice cultivars can ensure high-grain yield and low-
arsenic content in cultivars suitable for cultivation in arsenic-contaminated soils
(Murugaiyan et al. 2019).
6. CRISPR/Cas9-based genome-editing tools can be useful for modifying crucial-
regulated genes (OsPht1:8, Lsi1, OsNRAMP1, and OsABCC1) for the interruption
or modification of genes that regulate pathways contributing to low-arsenic
accumulation in rice grain. Targeting the genes involved in the phloem transport
mechanism and nodes could be crucial for transporting to rice grain (Song et al.
2014). Thus, identifying phloem-localized transporters and their manipulation
will provide a promising approach toward decreasing arsenic accumulation
in grain.
11 Future Directions and Conclusions
The nature of arsenic being redox-active, highly toxic to organisms, and its ten-
dency to be methylated make it a complex and important mineral to study. Arsenic
uptake and metabolism in rice need to be placed in the broader context of
biogeochemical cycling of arsenic in the environment. Bioavailability and specia-

tion of arsenic in the soil are strongly dependent on environmental conditions, and
this knowledge is crucial as it determines the extent of arsenic accumulation by rice
and the consequences of arsenic contamination in the food chain. The widespread
arsenic contamination in the environment, the mobilization of arsenic into rice grain
even in soils with baseline arsenic concentrations, and the realization that excessive
arsenic accumulation in rice can present a health risk to humans have provided a
recent impetus in research on this subject. Therefore, significant progress has been
made in recent years to understand arsenic uptake, speciation, and detoxification in
plants. However, substantial knowledge gaps exist on the mechanisms of arsenic
sequestration in the vacuoles and for arsenic loading and unloading in xylem and
phloem. Still, there is a need to understand the regulation of arsenic accumulation in
grain and to unravel the pathways and enzymes responsible for arsenate(V) reduction
and methylation. Recent advances in the analytical techniques for arsenic speciation
are instrumental in enhancing our understanding of arsenic biogeochemical cycling
and plant metabolism. Combining these analytical tools with molecular genetics
and functional genomics should provide ample opportunities for unraveling the
mechanisms of arsenic transport, metabolism, and regulation.
References
Abbas G, Murtaza B, Bibi I et al (2018) Arsenic uptake, toxicity, detoxification, and speciation
in plants: physiological, biochemical, and molecular aspects. Int J Environ Res Public Health
15:59. https://doi.org/10.3390/ijerph15010059
Abedin MJ, Cotter-Howells J, Meharg AA (2002a) Arsenic uptake and accumulation in rice
(Oryza sativa L.) irrigated with contaminated water. Plant Soil 240:311–319. https://doi.org/1
0.1023/A:1015792723288
Abedin MJ, Cresser MS, Meharg AA et al (2002b) Arsenic accumulation and metabolism in rice
(Oryza sativa L.). Environ Sci Technol 36:962–968. https://doi.org/10.1021/es0101678
Abedin MJ, Feldmann J, Meharg AA (2002c) Uptake kinetics of arsenic species in rice plants.
Plant Physiol 128:1120–1128. https://doi.org/10.1104/pp.010733
Abernathy C, Chakraborti D, Edmonds JS et al (2001) Environmental health criteria for arsenic
and arsenic compounds. Environ health criteria 224. WHO, Geneva
Ali W, Isayenkov SV, Zhao FJ, Maathuis FJM (2009) Arsenite transport in plants. Cell Mol Life
Sci 66:2329–2339. https://doi.org/10.1007/s00018-009-0021-7
Ali J, Aslam UM, Tariq R et al (2018a) Exploiting the genomic diversity of rice (Oryza sativa L.):
SNP-typing in 11 early-backcross introgression-breeding populations. Front Plant Sci 9:849.
Ali J, Jewel ZA, Mahender A et al (2018b) Molecular genetics and breeding for nutrient use effi-
ciency in rice. Int J Mol Sci 19:1762. https://doi.org/10.3390/ijms19061762
Alkorta I, Hernández-Allica J, Becerril JM et al (2004) Recent findings on the phytoremediation of
soils contaminated with environmentally toxic heavy metals and metalloids such as zinc, cad-
mium, lead, and arsenic. Rev Environ Sci Biotechnol 3:71–90. https://doi.org/10.1023/B:RES
B.0000040059.70899.3d
Amini M, Abbaspour KC, Berg M et al (2008) Statistical modeling of global geogenic arsenic
contamination in groundwater. Environ Sci Technol 42:3669–3675. https://doi.org/10.1021/
es702859e
Amini S, Ghobadi C, Yamchi A (2015) Proline accumulation and osmotic stress: an overview of
P5CS gene in plants. Genet Agric Biotechnol Inst Tabarestan 3:44–55
Anawar HM, Akai J, Komaki K et al (2003) Geochemical occurrence of arsenic in groundwater of

Bangladesh: sources and mobilization processes. J Geochem Explor 77:109–131. https://doi.
org/10.1016/S0375-6742(02)00273-X
Ashikari M, Ma JF (2015) Exploring the power of plants to overcome environmental stresses. Rice
8:10. https://doi.org/10.1186/s12284-014-0037-y
Becker M, Asch F (2005) Iron toxicity in rice:conditions and management concepts. J Plant Nutr
Soil Sci 168:558–573
Begum M, Mondal S (2019) Relative toxicity of arsenite and arsenate on early seedling growth
and photosynthetic pigments of rice. Curr J Appl Sci Technol 33:1–5. https://doi.org/10.9734/
cjast/2019/v33i430087
Bewley JD (1997) Seed germination and dormancy. Plant Cell 9:1055–1066. https://doi.
org/10.1105/tpc.9.7.1055
Bhattacharya P, Samal AC, Majumdar J, Santra SC (2010) Accumulation of arsenic and its dis-
tribution in rice plant (Oryza sativa L.) in Gangetic West Bengal, India. Paddy Water Environ
8:63–70. https://doi.org/10.1007/s10333-009-0180-z
Bondu R, Cloutier V, Rosa E, Benzaazoua M (2016) A review and evaluation of the impacts of
climate change on geogenic arsenic in groundwater from fractured bedrock aquifers. Water Air
Soil Pollut 227:296. https://doi.org/10.1007/s11270-016-2936-6
Brammer H, Ravenscroft P (2009) Arsenic in groundwater: a threat to sustainable agricul-
ture in South and South-east Asia. Environ Int 35:647–654. https://doi.org/10.1016/j.
envint.2008.10.004
Caldwell BK, Caldwell JC, Mitra SN, Smith W (2003) Searching for an optimum solution
to the Bangladesh arsenic crisis. Soc Sci Med 56:2089–2096. https://doi.org/10.1016/
S0277-9536(02)00203-4
Carbonell-Barrachina Á, Munera-Picazo S, Cano-Lamadrid M et al (2015) Arsenic in your
food: potential health hazards from arsenic found in rice. Nutr Diet Suppl 7:1. https://doi.
org/10.2147/nds.s52027
Carey AM, Scheckel KG, Lombi E et al (2010) Grain unloading of arsenic species in rice. Plant
Physiol 152:309–319. https://doi.org/10.1104/pp.109.146126
Carey M, Jiujin X, Farias JG, Meharg AA (2015) Rethinking rice preparation for highly efficient
removal of inorganic arsenic using percolating cooking water. PLoS One 10:e0131608. https://
Chakrabarty D, Trivedi PK, Misra P et al (2009) Comparative transcriptome analysis of arsenate
and arsenite stresses in rice seedlings. Chemosphere 74:688–702. https://doi.org/10.1016/j.
chemosphere.2008.09.082
Chakraborti D, Rahman MM, Das B et al (2013) Groundwater arsenic contamination in Ganga-
Meghna-Brahmaputra plain, its health effects and an approach for mitigation. Environ Earth
Sci 70:1993–2008. https://doi.org/10.1007/s12665-013-2699-y
Chao DY, Chen Y, Chen J et al (2014) Genome-wide association mapping identifies a new arsenate
reductase enzyme critical for limiting arsenic accumulation in plants. PLoS Biol 12:e1002009.
https://doi.org/10.1371/journal.pbio.1002009
Chen WQ, Shi YL, Wu SL, Zhu YG (2016) Anthropogenic arsenic cycles: a research framework
and features. J Clean Prod 139:328–336. https://doi.org/10.1016/j.jclepro.2016.08.050
Chen Y, Sun SK, Tang Z et al (2017) The nodulin 26-like intrinsic membrane protein OsNIP3;2
is involved in arsenite uptake by lateral roots in rice. J Exp Bot 68:3007–3016. https://doi.
org/10.1093/jxb/erx165
Choudhury B, Chowdhury S, Biswas AK (2011) Regulation of growth and metabolism in rice
(Oryza sativa L.) by arsenic and its possible reversal by phosphate. J Plant Interact 6:15–24.
https://doi.org/10.1080/17429140903487552
Clemens S (2006) Toxic metal accumulation, responses to exposure and mechanisms of tolerance
in plants. Biochimie 88:1707–1719
Clemens S, Ma JF (2016) Toxic heavy metal and metalloid accumulation in crop plants and foods.
Annu Rev Plant Biol 67:489–512. https://doi.org/10.1146/annurev-arplant-043015-112301
Das B, Nayak B, Pal A et al (2008) Groundwater arsenic contamination and its health effects in the
Ganga-Meghna-Brahmaputra plain. In: Groundwater for sustainable development: problems,
perspectives and challenges. Routledge, London, pp 257–269
Das I, Ghosh K, Das DK, Sanya SK (2013) Assessment of arsenic toxicity in rice plants
in areas of West Bengal. Chem Speciat Bioavailab 25:201–208. https://doi.org/10.318
4/095422913X13785717162124
Dasgupta T, Hossain SA, Meharg AA, Price AH (2004) An arsenate tolerance gene on chromo-
some 6 of rice. New Phytol 163:45–49. https://doi.org/10.1111/j.1469-8137.2004.01109.x
Dixit G, Singh AP, Kumar A et al (2016) Reduced arsenic accumulation in rice (Oryza sativa
L.) shoot involves sulfur-mediated improved thiol metabolism, antioxidant system and
altered arsenic transporters. Plant Physiol Biochem 99:86–96. https://doi.org/10.1016/j.
plaphy.2015.11.005
Dobermann A, Fairhurst T (2000) Rice: nutrient disorders & nutrient management. http://books.
irri.org/9810427425_content.pdf
Duan GL, Hu Y, Liu WJ et al (2011) Evidence for a role of phytochelatins in regulating arse-
nic accumulation in rice grain. Environ Exp Bot 71:416–421. https://doi.org/10.1016/j.
envexpbot.2011.02.016
Duan G, Shao G, Tang Z et al (2017) Genotypic and environmental variations in grain cadmium
and arsenic concentrations among a panel of high-yielding rice cultivars. Rice 10:9. https://doi.
org/10.1186/s12284-017-0149-2
Dubey S, Shri M, Misra P et al (2014) Heavy metals induce oxidative stress and genome-wide
modulation in transcriptome of rice root. Funct Integr Genom 14:401–417. https://doi.
org/10.1007/s10142-014-0361-8
Duker AA, Carranza EJM, Hale M (2005) Arsenic geochemistry and health. Environ Int
31:631–641
Finnegan PM, Chen W (2012) Arsenic toxicity: the effects on plant metabolism. Front Physiol
Flora SJS, Pachauri V, Saxena G (2011) Arsenic, cadmium and lead. In: Reproductive and devel-
opmental toxicology. Elsevier, Amsterdam, pp 415–438
Frei M, Becker K (2005) Integrated rice-fish culture: coupled production saves resources. Nat
Resour Forum 29:135–143. https://doi.org/10.1111/j.1477-8947.2005.00122.x
Gao JP, Chao DY, Lin HX (2007) Understanding abiotic stress tolerance mechanisms: recent stud-
ies on stress response in rice. J Integr Plant Biol 49:742–750
Garai R, Chakraborty AK, Dey SB, Saha KC (1984) Chronic arsenic poisoning from tube-well
water. J Indian Med Assoc 82:34–35
Geng CN, Zhu YG, Liu WJ, Smith SE (2005) Arsenate uptake and translocation in seedlings of
two genotypes of rice is affected by external phosphate concentrations. Aquat Bot 83:321–331.
https://doi.org/10.1016/j.aquabot.2005.07.003
Geng A, Wang X, Wu L et al (2017) Arsenic accumulation and speciation in rice grown in arsa-
nilic acid-elevated paddy soil. Ecotoxicol Environ Saf 137:172–178. https://doi.org/10.1016/j.
ecoenv.2016.11.030
Gorny J, Billon G, Lesven L et al (2015) Arsenic behavior in river sediments under redox gradi-
ent: a review. Sci Total Environ 505:423–434. https://doi.org/10.1016/j.scitotenv.2014.10.011
GRiSP (Global Rice Science Partnership) (2013) Rice almanac, 4th edn. International Rice
Research Institute, Los Baños. 283 p
Guha Mazumder DN (2008) Chronic arsenic toxicity & human health. Indian J Med Res
128:436–447
Guha Mazumder DN (2015) Health effects of chronic arsenic toxicity. In: Handbook of arsenic
toxicology. Elsevier, Amsterdam, pp 137–177
Hayashi S, Kuramata M, Abe T et al (2017) Phytochelatin synthase OsPCS1 plays a crucial role
in reducing arsenic levels in rice grains. Plant J 91:840–848. https://doi.org/10.1111/tpj.13612
He D, Yang P (2013) Proteomics of rice seed germination. Front Plant Sci 4:246
Hossain MF (2006) Arsenic contamination in Bangladesh:an overview. Agric Ecosyst Environ

113:1–16. https://doi.org/10.1016/j.agee.2005.08.034
Hu P, Huang J, Ouyang Y et al (2013) Water management affects arsenic and cadmium accumula-
tion in different rice cultivars. Environ Geochem Health 35:767–778. https://doi.org/10.1007/
s10653-013-9533-z
Huang X, Kurata N, Wei X et al (2012a) A map of rice genome variation reveals the origin of
cultivated rice. Nature 490:497–501. https://doi.org/10.1038/nature11532
Huang Y, Chen Z, Liu W (2012b) Influence of iron plaque and cultivars on antimony uptake by and
translocation in rice (Oryza sativa L.) seedlings exposed to Sb(III) or Sb(V). Plant Soil 352:41–49.
https://doi.org/10.1007/s11104-011-0973-x
Islam S, Rahman MM, Islam MR, Naidu R (2016) Arsenic accumulation in rice: consequences of
rice genotypes and management practices to reduce human health risk. Environ Int 96:139–155.
https://doi.org/10.1016/j.envint.2016.09.006
Järup L (2003) Hazards of heavy metal contamination. Br Med Bull 68:167–182
Jia Y, Huang H, Zhong M et al (2013) Microbial arsenic methylation in soil and rice rhizosphere.
Environ Sci Technol 47:3141–3148. https://doi.org/10.1021/es303649v
Jian FM, Yamaji N, Mitani N et al (2008) Transporters of arsenite in rice and their role in arsenic
accumulation in rice grain. Proc Natl Acad Sci U S A 105:9931–9935. https://doi.org/10.1073/
pnas.0802361105
Jiang JQ, Ashekuzzaman SM, Jiang A et al (2013) Arsenic-contaminated groundwater and its
treatment options in Bangladesh. Int J Environ Res Public Health 10:18–46. https://doi.
org/10.3390/ijerph10010018
Jomova K, Valko M (2011) Advances in metal-induced oxidative stress and human disease.
Toxicology 283:65–87
Kalia K, Flora SJS (2005) Strategies for safe and effective therapeutic measures for chronic arsenic
and lead poisoning. J Occup Health 47:1–21
Kamiya T, Islam MR, Duan G et al (2013) Phosphate deficiency signaling pathway is a target of
arsenate and phosphate transporter OsPT1 is involved in As accumulation in shoots of rice. Soil
Sci Plant Nutr 59:580–590. https://doi.org/10.1080/00380768.2013.804390
Khush GS (1997) Origin, dispersal, cultivation and variation of rice. Plant Mol Biol 35:25–34
Kumar M, Puri A (2012) A review of permissible limits of drinking water. Indian J Occup Environ
Med 16:40–44. https://doi.org/10.4103/0019-5278.99696
Kuramata M, Abe T, Kawasaki A et al (2013) Genetic diversity of arsenic accumulation in rice and
QTL analysis of methylated arsenic in rice grains. Rice 6:1–10. https://doi.org/10.1186/193
9-8433-6-3
Laha M (2017) Irrigation and groundwater hazards in India. Trans Inst Indian Geogr 39:237–252
Lawson M, Polya DA, Boyce AJ et al (2016) Tracing organic matter composition and distribution
and its role on arsenic release in shallow Cambodian groundwaters. Geochim Cosmochim Acta
178:160–177. https://doi.org/10.1016/j.gca.2016.01.010
Lee JJ, Jang CS, Wang SW et al (2008) Delineation of spatial redox zones using discriminant
analysis and geochemical modelling in arsenic-affected alluvial aquifers. Hydrol Process
22:3029–3041. https://doi.org/10.1002/hyp.6884
Lee CH, Hsieh YC, Lin TH, Lee DY (2013) Iron plaque formation and its effect on arsenic
uptake by different genotypes of paddy rice. Plant Soil 363:231–241. https://doi.org/10.1007/
s11104-012-1308-2
Li Z, Ali J (2017) Breeding green super rice (GSR) varieties for sustainable rice cultivation.
In: Sasaki T (ed) Achieving sustainable cultivation of rice, vol 1. Burleigh Dodds Science
Publishing, Cambridge, pp 109–130
Li RY, Stroud JL, Ma JF et al (2009) Mitigation of arsenic accumulation in rice with water man-
agement and silicon fertilization. Environ Sci Technol 43:3778–3783. https://doi.org/10.1021/
es803643v
Li G, Sun GX, Williams PN et al (2011) Inorganic arsenic in Chinese food and its cancer risk.
Environ Int 37:1219–1225. https://doi.org/10.1016/j.envint.2011.05.007
Liu J, Cao C, Wong M et al (2010) Variations between rice cultivars in iron and manganese plaque
on roots and the relation with plant cadmium uptake. J Environ Sci 22:1067–1072. https://doi.
org/10.1016/S1001-0742(09)60218-7
Liu X, Chen S, Chen M et al (2019) Association study reveals genetic loci responsible for arsenic,
cadmium and lead accumulation in rice grain in contaminated farmlands. Front Plant Sci 10:61.
Lomax C, Liu WJ, Wu L et al (2012) Methylated arsenic species in plants originate from soil
microorganisms. New Phytol 193:665–672. https://doi.org/10.1111/j.1469-8137.2011.03956.x
Lou LQ, Ye ZH, Wong MH (2009) A comparison of arsenic tolerance, uptake and accumulation
between arsenic hyperaccumulator, Pteris vittata L. and non-accumulator, P. semipinnata L.: a
hydroponic study. J Hazard Mater 171:436–442. https://doi.org/10.1016/j.jhazmat.2009.06.020
Ma J, Takahashi E (1990) Effect of silicon on the growth and phosphorus uptake of rice. Plant Soil
126:115. https://doi.org/10.1007/BF00041376
Maclean J, Dawe DC, Hardy B, Hettel G (eds) (2002) Rice almanac, 3rd edn. International Rice
Research Institute, Los Baños
Mandal BK, Suzuki KT (2002) Arsenic round the world: a review. Talanta 58:201–235. https://doi.
org/10.1016/S0039-9140(02)00268-0
Mazumder DNG (2003) Chronic arsenic toxicity: clinical features, epidemiology, and treatment:
experience in West Bengal. J Environ Sci Health Part A Toxic Hazardous Subst Environ Eng
38:141–163. https://doi.org/10.1081/ESE-120016886
Meharg AA, Hartley-Whitaker J (2002) Arsenic uptake and metabolism in arsenic-resistant and nonre-
sistant plant species. New Phytol 154:29–43. https://doi.org/10.1046/j.1469-8137.2002.00363.x
Meharg AA, Rahman M (2003) Arsenic contamination of Bangladesh paddy field soils: implica-
tions for rice contribution to arsenic consumption. Environ Sci Technol 37:229–234. https://
doi.org/10.1021/es0259842
Messerschmidt M, Wagner A, Wong MW, Luger P (2002) Atomic properties of N2O4 based on its
experimental charge density. J Am Chem Soc 124:732–733. https://doi.org/10.1021/ja011802c
Mishra S, Dubey RS (2006) Inhibition of ribonuclease and protease activities in arsenic exposed
rice seedlings: role of proline as enzyme protectant. J Plant Physiol 163:927–936. https://doi.
org/10.1016/j.jplph.2005.08.003
Mishra S, Jha AB, Dubey RS (2011) Arsenite treatment induces oxidative stress, upregu-
lates antioxidant system, and causes phytochelatin synthesis in rice seedlings. Protoplasma
248:565–577. https://doi.org/10.1007/s00709-010-0210-0
Mochizuki H (2019) Arsenic neurotoxicity in humans. Int J Mol Sci 20:3418. https://doi.
org/10.3390/ijms20143418
Mohan D, Pittman CU (2007) Arsenic removal from water/wastewater using adsorbents: a critical
review. J Hazard Mater 142:1–53. https://doi.org/10.1016/j.jhazmat.2007.01.006
Molden D (2013) Water for food, water for life: a comprehensive assessment of water management
in agriculture. Routledge, London
Molina J, Sikora M, Garud N et al (2011) Molecular evidence for a single evolutionary origin
of domesticated rice. Proc Natl Acad Sci U S A 108:8351–8356. https://doi.org/10.1073/
pnas.1104686108
Mosa KA, Kumar K, Chhikara S et al (2012) Members of rice plasma membrane intrinsic pro-
teins subfamily are involved in arsenite permeability and tolerance in plants. Transgenic Res
21:1265–1277. https://doi.org/10.1007/s11248-012-9600-8
Muhammad S, Tahir Shah M, Khan S (2010) Arsenic health risk assessment in drinking water
and source apportionment using multivariate statistical techniques in Kohistan region, northern
Pakistan. Food Chem Toxicol 48:2855–2864. https://doi.org/10.1016/j.fct.2010.07.018
Mukherjee A, Kundu M, Basu B et al (2017) Arsenic load in rice ecosystem and its mitiga-
tion through deficit irrigation. J Environ Manag 197:89–95. https://doi.org/10.1016/j.
jenvman.2017.03.037
Murugaiyan V (2019) Genetic mapping of quantitative trait loci associated with arsenic tolerance
and accumulation in rice (Oryza sativa L.). Universitäts- und Landesbibliothek, Bonn
Murugaiyan V, Ali J, Mahender A et al (2019) Mapping of genomic regions associated with arse-
nic toxicity stress in a backcross-breeding populations of rice (Oryza sativa L.). Rice 12:61.
https://doi.org/10.1186/s12284-019-0321-y
Muthayya S, Sugimoto JD, Montgomery S, Maberly GF (2014) An overview of global rice produc-
tion, supply, trade, and consumption. Ann N Y Acad Sci 1324:7–14. https://doi.org/10.1111/
nyas.12540
National Research Council (US) Committee on Medical and Biological Effects of Environmental
Pollutants (1977) Distribution of arsenic in the environment. In: Arsenic: medical and biologic
effects of environmental pollutants. National Academies Press, Washington, DC, p 3
Ng JC (2005) Environmental contamination of arsenic and its toxicological impact on humans.
Environ Chem 2:146–160
Nickson RT, Mcarthur JM, Ravenscroft P et al (2000) Mechanism of arsenic release to ground-
water, Bangladesh and West Bengal. Appl Geochem 15:403–413. https://doi.org/10.1016/
S0883-2927(99)00086-4
Nordberg GF, Jin T, Hong F et al (2005) Biomarkers of cadmium and arsenic interactions. Toxicol
Appl Pharmacol 206:191–197. https://doi.org/10.1016/j.taap.2004.11.028
Norton GJ, Deacon CM, Xiong L et al (2010a) Genetic mapping of the rice ionome in leaves and
grain: identification of QTLs for 17 elements including arsenic, cadmium, iron and selenium.
Plant Soil 329:139–153. https://doi.org/10.1007/s11104-009-0141-8
Norton GJ, Islam MR, Duan G et al (2010b) Arsenic shoot-grain relationships in field grown rice
cultivars. Environ Sci Technol 44:1471–1477. https://doi.org/10.1021/es902992d
Norton GJ, Pinson SRM, Alexander J et al (2012) Variation in grain arsenic assessed in a diverse
panel of rice (Oryza sativa) grown in multiple sites. New Phytol 193:650–664. https://doi.
org/10.1111/j.1469-8137.2011.03983.x
Norton GJ, Douglas A, Lahner B, Yakubova E, Guerinot ML, et al (2014) Genome wide association
mapping of grain arsenic, copper, molybdenum and zinc in rice (Oryza sativa L.) grown at four
international field sites. PLoS One 9(2): e89685. https://doi.org/10.1371/journal.pone.0089685
Norton GJ, Travis AJ, Talukdar P et al (2019) Genetic loci-regulating arsenic content in rice grains
when grown flooded or under alternative wetting and drying irrigation. Rice 12:54. https://doi.
org/10.1186/s12284-019-0307-9
Nriagu JO, Bhattacharya P, Mukherjee AB et al (2007) Arsenic in soil and groundwater: an over-
view. In: Trace metals and other contaminants in the environment. Elsevier, Amsterdam, pp 3–60
O’Day PA (2006) Chemistry and mineralogy of arsenic. Elements 2:77–83. https://doi.org/10.2113/
gselements.2.2.77
Pandey S, Rai R, Rai LC (2015) Biochemical and molecular basis of arsenic toxicity and tolerance
in microbes and plants. In: Handbook of arsenic toxicology. Elsevier, Amsterdam, pp 627–674
Pathak H, Tewari A, Sankhyan S et al (2011) Direct-seeded rice: potential, performance and prob-
lems: a review. Curr Adv Agric Sci Int 3:77
Pohl HR, Roney N, Abadin HG (2011) Metal ions affecting the neurological system. Met Ions Life
Sci 8:247–262
Ponomarenko M, Stepanenko I, Kolchanov N (2013) Heat shock proteins. In: Brenner’s encyclo-
pedia of genetics, 2nd edn. Elsevier, Amsterdam, pp 402–405
Rahman MA, Hasegawa H, Rahman MM et al (2007) Arsenic accumulation in rice (Oryza sativa
L.) varieties of Bangladesh: a glass house study. Water Air Soil Pollut 185:53–61. https://doi.
org/10.1007/s11270-007-9425-x
Rahman MA, Hasegawa H, Rahman MM et al (2008) Straighthead disease of rice (Oryza
sativa L.) induced by arsenic toxicity. Environ Exp Bot 62:54–59. https://doi.org/10.1016/j.
envexpbot.2007.07.016
Rajjou L, Duval M, Gallardo K et al (2012) Seed germination and vigor. Annu Rev Plant Biol
63:507–533
Rao KP, Vani G, Kumar K et al (2011) Arsenic stress activates MAP kinase in rice roots and leaves.
Arch Biochem Biophys 506:73–82. https://doi.org/10.1016/j.abb.2010.11.006
Rao CS, Lal R, Prasad JVNS et al (2015) Potential and challenges of rainfed farming in India. Adv
Agron 133:113–181
Richards M, Sander BO (2014) Alternate wetting and drying in irrigated rice. J AHIMA. https://
doi.org/10.1016/j.techfore.2006.05.021
Ronzan M, Piacentini D, Fattorini L et al (2018) Cadmium and arsenic affect root development
in Oryza sativa L. negatively interacting with auxin. Environ Exp Bot 151:64–75. https://doi.
org/10.1016/j.envexpbot.2018.04.008
Roy P, Saha A (2002) Metabolism and toxicity of arsenic: a human carcinogen. Curr Sci 82:38–45
Safiuddin M, Shirazi SM, Yussof S (2011) Arsenic contamination of groundwater in Bangladesh: a
review. Int J Phys Sci 6:6791–6800. https://doi.org/10.5897/IJPS11.1300
Sahoo PK, Mukherjee A (2014) Arsenic fate and transport in the groundwater-soil-plant system: an
understanding of suitable rice paddy cultivation in arsenic-enriched areas. In: Recent trends in
modelling of environmental contaminants. Springer, New Delhi, pp 21–44
Sayan B, Kaushik G, Sushanta D et al (2012) Arsenic bioaccumulation in rice and edible plants
and subsequent transmission through food chain in Bengal basin: a review of the perspectives
for environmental health. Toxicol Environ Chem 94:429
Seneviratne M, Rajakaruna N, Rizwan M et al (2019) Heavy metal-induced oxidative stress
on seed germination and seedling development: a critical review. Environ Geochem Health
41:1813–1831. https://doi.org/10.1007/s10653-017-0005-8
Sengupta M, Bishayi B (2002) Effect of lead and arsenic on murine macrophage response. Drug
Chem Toxicol 25:459–472
Sengupta MK, Hossain MA, Mukherjee A et al (2006) Arsenic burden of cooked rice: tradi-
tional and modern methods. Food Chem Toxicol 44:1823–1829. https://doi.org/10.1016/j.
fct.2006.06.003
Seyfferth AL, Webb SM, Andrews JC, Fendorf S (2011) Defining the distribution of arsenic species
and plant nutrients in rice (Oryza sativa L.) from the root to the grain. Geochim Cosmochim
Acta 75:6655–6671. https://doi.org/10.1016/j.gca.2011.06.029
Shah AL, Naher UA, Hasan Z et al (2014) Influence of arsenic on rice growth and its mitiga-
tion with different water management techniques. Asian J Crop Sci 6:373–382. https://doi.
org/10.3923/ajcs.2014.373.382
Shaibur MR, Kitajima N, Sugawara R et al (2006) Physiological and mineralogical properties
of arsenic-induced chlorosis in rice seedlings grown hydroponically. Soil Sci Plant Nutr
52:691–700. https://doi.org/10.1111/j.1747-0765.2006.00085.x
Shepherd K, Hubbard D, Fenton N et al (2015) Policy: development goals should enable decision-
making. Nature 523:152–154. https://doi.org/10.1038/523152a
Shi S, Wang T, Chen Z et al (2016) OsHAC1;1 and OsHAC1;2 function as arsenate reductases
and regulate arsenic accumulation. Plant Physiol 172:1708–1719. https://doi.org/10.1104/
pp.16.01332
Smith AH, Lingas EO, Rahman M (2000) Contamination of drinking-water by arsenic in
Bangladesh: a public health emergency. Bull World Health Organ 78:1093–1103. https://doi.
org/10.1590/S0042-96862000000900005
Song WY, Yamaki T, Yamaji N et al (2014) A rice ABC transporter, OsABCC1, reduces arse-
nic accumulation in the grain. Proc Natl Acad Sci U S A 111:15699–15704. https://doi.
org/10.1073/pnas.1414968111
Stanton BA, Caldwell K, Congdon CB et al (2015) MDI Biological Laboratory Arsenic Summit:
approaches to limiting human exposure to arsenic. Curr Environ Health Rep 2:329–337. https://
doi.org/10.1007/s40572-015-0057-9
Sturchio E, Zanellato M, Minoia C, Bemporad E (2013) Arsenic: environmental contamination
and exposure. In: Arsenic: sources, environmental impact, toxicity and human health. A medi-
cal geology perspective. Nova Publishers, Hauppauge, NY, pp 3–38
Sultana F (2013) Water, technology, and development: transformations of development tech-
nonatures in changing waterscapes. Environ Plan D Soc Sp 31:337–353. https://doi.
org/10.1068/d20010
Sun G (2004) Arsenic contamination and arsenicosis in China. Toxicol Appl Pharmacol
198:268–271
Sun SK, Chen Y, Che J et al (2018) Decreasing arsenic accumulation in rice by overexpress-
ing OsNIP1;1 and OsNIP3;3 through disrupting arsenite radial transport in roots. New Phytol
219:641–653. https://doi.org/10.1111/nph.15190
Suriyagoda LDB, Dittert K, Lambers H (2018) Mechanism of arsenic uptake, translocation and
plant resistance to accumulate arsenic in rice grains. Agric Ecosyst Environ 253:23–37
Takahashi E (1968) Silica as a nutrient to the rice plant. Jpn Agric Res Q 3:1
Talukder ASMHM, Meisner CA, Sarkar MAR, Islam MS (2011) Effect of water management,
tillage options and phosphorus status on arsenic uptake in rice. Ecotoxicol Environ Saf
74:834–839. https://doi.org/10.1016/j.ecoenv.2010.11.004
Tareq SM, Islam SMN, Rahmam MM, Chowdhury DA (2015) Arsenic pollution in groundwater of
Southeast Asia: an overview on mobilization process and health effects. Bangladesh J Environ
Res 8:47–67
Thomas DJ (2013) The die is cast: arsenic exposure in early life and disease susceptibility. Chem
Res Toxicol 26:1778–1781
Tripathi P, Tripathi RD, Singh RP et al (2013) Arsenite tolerance in rice (Oryza sativa L.) involves
coordinated role of metabolic pathways of thiols and amino acids. Environ Sci Pollut Res
20:884–896. https://doi.org/10.1007/s11356-012-1205-5
Tuli R, Chakrabarty D, Trivedi PK, Tripathi RD (2010) Recent advances in arsenic accumulation
and metabolism in rice. Mol Breed 26:307–323. https://doi.org/10.1007/s11032-010-9412-6
Vahidnia A, Van Der Voet GB, De Wolff FA (2007) Arsenic neurotoxicity: a review. Hum Exp
Toxicol 26:823–832
Vahter M, Concha G (2001) Role of metabolism in arsenic toxicity. Pharmacol Toxicol 89:1–5.
https://doi.org/10.1111/j.1600-0773.2001.890101.x
Vaughan DJ (2006) Arsenic. Elements 2:71–75. https://doi.org/10.2113/gselements.2.2.71
Wang P, Zhang W, Mao C et al (2016) The role of OsPT8 in arsenate uptake and varietal differ-
ence in arsenate tolerance in rice. J Exp Bot 67:6051–6059. https://doi.org/10.1093/jxb/erw362
Wang FZ, Chen MX, Yu LJ et al (2017) OsARM1, an R2R3 MYB transcription factor, is involved
in regulation of the response to arsenic stress in rice. Front Plant Sci 8:1868. https://doi.
org/10.3389/fpls.2017.01868
Wenzel WW, Alloway BJ (2013) Chapter 9 Arsenic. Springer, Dordrecht
Wu C, Ye Z, Li H et al (2012) Do radial oxygen loss and external aeration affect iron plaque for-
mation and arsenic accumulation and speciation in rice? J Exp Bot 63:2961–2970. https://doi.
org/10.1093/jxb/ers017
Wu LB, Shhadi MY, Gregorio G et al (2014) Genetic and physiological analysis of tolerance to
acute iron toxicity in rice. Rice 7:8. https://doi.org/10.1186/s12284-014-0008-3
Wu X, Cobbina SJ, Mao G et al (2016) A review of toxicity and mechanisms of individual and
mixtures of heavy metals in the environment. Environ Sci Pollut Res 23:8244–8259. https://
doi.org/10.1007/s11356-016-6333-x
Wu LB, Ueda Y, Lai SK, Frei M (2017) Shoot tolerance mechanisms to iron toxicity in rice (Oryza
sativa L.). Plant Cell Environ 40:570–584. https://doi.org/10.1111/pce.12733
Xu J, Shi S, Wang L et al (2017) OsHAC4 is critical for arsenate tolerance and regulates arsenic
accumulation in rice. New Phytol 215:1090–1101. https://doi.org/10.1111/nph.14572
Yamazaki S, Ueda Y, Mukai A et al (2018) Rice phytochelatin synthases OsPCS1 and OsPCS2
make different contributions to cadmium and arsenic tolerance. Plant Direct 2:e00034. https://
doi.org/10.1002/pld3.34
Yang Y, Zhang A, Chen Y et al (2018) Impacts of silicon addition on arsenic fractionation in soils
and arsenic speciation in Panax notoginseng planted in soils contaminated with high levels
of arsenic. Ecotoxicol Environ Saf 162:400–407. https://doi.org/10.1016/j.ecoenv.2018.07.015
Yang Y, Hu H, Fu Q et al (2020) Phosphorus regulates As uptake by rice via releasing As into
soil porewater and sequestrating it on Fe plaque. Sci Total Environ 738:139869. https://doi.
org/10.1016/j.scitotenv.2020.139869
Yu S, Ali J, Zhang C et al (2020) Genomic breeding of green super rice varieties and their deploy-
ment in Asia and Africa. Theor Appl Genet 133:1427–1442
Zavala YJ, Duxbury JM (2008) Arsenic in rice: I. Estimating normal levels of total arsenic in rice
grain. Environ Sci Technol 42:3856–3860. https://doi.org/10.1021/es702747y
Zhang J, Zhu YG, Zeng DL et al (2008) Mapping quantitative trait loci associated with
arsenic accumulation in rice (Oryza sativa). New Phytol 177:350–356. https://doi.
org/10.1111/j.1469-8137.2007.02267.x
Zhao FJ, Ma JF, Meharg AA, McGrath SP (2009) Arsenic uptake and metabolism in plants. New
Phytol 181:777–794. https://doi.org/10.1111/j.1469-8137.2008.02716.x
Zhao FJ, Ago Y, Mitani N et al (2010a) The role of the rice aquaporin Lsi1 in arsenite efflux from
roots. New Phytol 186:392–399. https://doi.org/10.1111/j.1469-8137.2010.03192.x
Zhao FJ, McGrath SP, Meharg AA (2010b) Arsenic as a food chain contaminant: mechanisms
of plant uptake and metabolism and mitigation strategies. Annu Rev Plant Biol 61:535–559.
https://doi.org/10.1146/annurev-arplant-042809-112152
Zhao FJ, Stroud JL, Khan AA, McGrath SP (2012) Arsenic translocation in rice investigated using
radioactive 73As tracer. Plant Soil 350:413–420. https://doi.org/10.1007/s11104-011-0926-4
Zhao FJ, Zhu YG, Meharg AA (2013) Methylated arsenic species in rice: geographical variation,
origin, and uptake mechanisms. Environ Sci Technol 47:3957–3966. https://doi.org/10.1021/
es304295n
Zhu YG, Williams PN, Meharg AA (2008) Exposure to inorganic arsenic from rice: a global health
issue? Environ Pollut 154:169–171. https://doi.org/10.1016/j.envpol.2008.03.015
Molecular Approaches for Disease
Resistance in Rice
Mohammed Jamaloddin, Anumalla Mahender, C. Guru Gokulan,

Chintavaram Balachiranjeevi, A. Maliha, Hitendra Kumar Patel,
and Jauhar Ali
Abstract Rice production needs to be sustained in the coming decades, with

changing climatic conditions becoming more conducive to the prevalence of disease
outbreaks. Major rice diseases collectively cause enormous economic damage and
yield instability. Breeding for disease-resistant rice varieties could be one of the best
options to counter these disease outbreaks. Disease-screening protocols and newer
technologies are essential for effective phenotyping and would aid in gene discov-
ery and function. Understanding the genetics of disease mechanisms and stacking
of broad-spectrum disease-resistance genes could lead to faster development of rice
varieties with multiple disease resistance. New molecular breeding approaches are
discussed for the development of these varieties. The molecular biology of disease
resistance is now better understood and could be well manipulated for improved
resilience. Transgenic approaches for disease resistance are discussed. Genome-
editing tools for the development of disease-resistant rice varieties are thoroughly
discussed. The use of bioinformatics tools to speed up the process and to obtain a
better understanding of molecular genetics mechanisms of disease resistance is
explained.
Keywords Rice · Biotic diseases · Phenotypic screening · QTLs and genes ·

Breeding strategies · Genome editing
M. Jamaloddin · C. G. Gokulan · A. Maliha · H. K. Patel

Centre for Cellular and Molecular Biology (CCMB), Hyderabad, India
A. Mahender · C. Balachiranjeevi
J. Ali (*)
Hybrid Rice Breeding Cluster, Hybrid Rice Development Consortium (HRDC), Rice
Breeding Platform, International Rice Research Institute (IRRI),

https://doi.org/10.1007/978-3-030-66530-2_10
316 M. Jamaloddin et al.
1 Introduction
Rice (Oryza sativa L.) is a staple and the most crucial food security crop in the
world. It plays a vital role in the human diet and feeds more than 50% of the world’s
population (Rathna Priya et al. 2019). By 2050, global demand for rice is projected
to rise more than 40% to feed the rapidly growing world population (Milovanovic
and Smutka 2017). Despite impressive global increases in production from 289 mil-
lion tons in 1968 to 782 million tons in 2018, this quantum jump still has to keep
pace with demand for rice from the rising population (FAOSTAT 2020). At present,
rice cultivation throughout South Asia and in ASEAN countries is facing significant
threats because of a few major biotic stresses (Yugander et al. 2017). Approximately
52% of the global productivity of rice grain yield is severely damaged by biotic fac-
tors, of which nearly 31% is due to various diseases such as bacterial blight (caused
by Xanthomonas oryzae), blast (caused by Magnaporthe grisea), sheath blight
(caused by Rhizoctonia solani), and tungro disease (tungro bacilliform virus and
tungro spherical virus) (Park et al. 2008). Detailed information about the symptoms
caused by these major diseases, along with the favorable conditions required by
these pathogens and yield losses incurred, is presented in Table 1. The severity of
biotic stresses in rice production is increasing at a startling pace of late because of
rapid changes in climate (Jamaloddin et al. 2020). Changing climatic conditions are
contributing to the emergence of new virulent races and the occurrence of diseases
in new localities. Many diseases considered as minor thus far have become eco-
nomically significant in many rice-cultivating areas and are exacerbating their
impact (Anderson et al. 2004). According to Zhang et al. (2009), rice crops are
affected by around 70 pathogens, especially viruses, bacteria, fungi, and nematodes.
Estimated yield loss because of pathogens globally and as per hotspot range for rice
is 30% (24.6–40.9%) (Savary et al. 2019). Over the past 150 years, many rice dis-
eases have caused outbreaks and spread rapidly in different parts of the world. Rice
diseases were observed for the first time in different locations, such as bacterial
blight and sheath blight in Japan during 1884–1885 and 1910, respectively; false
smut in the United States during 1906; blast in Africa during 1922; rice tungro in the
Philippines during 1940; rice brown spot in India during 1942; bacterial leaf streak
in India during 1963; and rice yellow mottle disease in Kenya during 1966. These
diseases, along with a few newly emerging epidemics, are becoming a significant
threat to rice production.
Despite so many alternatives for crop protection, plant pathogens still pose a
challenge to agriculture. Several management practices have been adopted to
decrease their impact, such as chemical control, biological control, optimum fertil-
izer application, appropriate planting dates, and disease forecasting. However, not
all of these methods are environment-friendly and alone are not enough to control
the diseases completely. The present situation thus requires environment-friendly
and cost-effective modern technologies such as the development and cultivation of
disease-resistant cultivars. The development of these varieties using only conven-
tional breeding methods consumes a lot of time, land, and labor. In this context,
Molecular Approaches for Disease Resistance in Rice 317
Table 1 Key features of major diseases in rice

Favorable
Disease Pathogen Symptoms conditions Yield loss Reference
Blast Caused by the Early-stage Prolonged period 70–80% Jamaloddin
fungus symptoms appear free from moisture. et al.
Magnaporthe as white to High humidity (2020)
oryzae (Mo) gray-green lesions conditions. Gentle
with dark green or no wind at night.
specks. These soon Night temperatures
enlarge and from 17 to
spindle-shaped 22 °C. High rate of
lesions appear with fertilizer.
a gray center and
dark brown margin.
Bacterial Caused by Normally, disease Suitable Up to 50% Liu et al.
blight bacterium appears at heading temperature is (2014)
(BB) Xanthomonas stage, but can occur 25–30 °C. High
oryzae pv. early in severe humidity (above
oryzae (Xoo) conditions. Infected 70%), rain, and
plants’ young deep water. Severe
leaves change from winds, which cause
pale green to wounds. High rate
gray-green and roll of fertilizer.
up. As the disease
progresses, the
entire leaf may
eventually be
affected, becoming
whitish or grayish
and then dying.
Bacterial Caused by Plants can be There is a higher 8–32% Liu et al.
leaf bacterium affected from probability of (2014)
streak Xanthomonas maximum tillering developing it in
(BLS) oryzae pv. to panicle areas having weeds
oryzicola (Xoc) initiation. and stubbles
Symptoms appear harboring infection.
on leaf blades as Temperatures from
narrow, dark 25 to 34 °C with
greenish water- relative humidity
soaked interveinal >70% are more
streaks of various congenial.
lengths. Later,
these streaks
become light
brown to yellowish
gray.
(continued)
Table 1 (continued)
Favorable
Tungro Caused by Rice Infection can occur Viruses are Up to Bunawan
tungro during all growth transmitted by 100% et al.
bacilliform stages but mostly leafhoppers that (2014)
virus (RTBV) during the feed on tungro-
and rice tungro vegetative phase. infected plants.
spherical virus The tillering stage Leafhoppers are
(RTSV) is the most capable of
vulnerable. Leaves transmitting viruses
of infected plants to other plants
become yellow or within 5–7 days.
orange-yellow and
may also have
rust-colored spots.
Most of the
panicles are
entirely or partially
sterile with ill-filled
grains.
False Caused by the False smut can The disease can In severe Huang
smut fungus infect individual occur in areas with cases, et al.
Villosiclava rice grains. Only a high relative tillers will (2019)
virens few panicle grains humidity (>90%) be affected
(anamorph: are usually and temperature 85–100%.
Ustilaginoidea infected, and the ranging from 25 to
virens) remaining grains 35 °C. Rain and
are normal. A smut soils with high
ball appears at first nitrogen content
and grows also favor false
gradually up to smut. Wind can
1 cm. As fungi spread the fungal
growth intensifies, spores from plant to
the smut balls burst plant.
and become orange
and then later
yellowish green/
greenish black in
color.
(continued)
Table 1 (continued)
Favorable
Sheath Caused by the The fungus attacks Temperature from 20–60% Molla et al.
blight fungus the plants from 28 to 32 °C, high (2020)
Rhizoctonia tillering to heading rates of N fertilizer,
solani stage. Initial high seed rate or
symptoms appear low spacing, dense
on leaf sheaths near canopy, inoculum in
the water line in the soil or floating on
form of oval or the water, and
irregular greenish continuous
gray lesions. Later, cultivation of
lesions extend to high-yielding
the upper parts of varieties favor
the plants and disease
rapidly coalesce, development. The
covering entire crop is more
tillers from the vulnerable during
water line to the the rainy season.
flag leaf.
Sheath Caused by The sheath rot More prevalent 20–85% Peeters
rot fungus lesion starts at the during wet seasons et al.
Sarocladium uppermost leaf than dry seasons. (2020)
oryzae sheath consisting of High relative
young panicles humidity and
within. Early temperatures from
symptoms are 20 to 28 °C from
oblong to irregular heading to crop
lesions on the maturity. High rates
leaves with dark of N fertilizer
reddish brown application. Plant
margins and injuries and wounds
brownish gray caused by insects
throughout. The such as stem borers
disease can cause at the panicle
partial emergence initiation stage.
of panicles present
in the infected
sheaths. The
unmerged panicles
rot and turn dark
brown with a
whitish powdery
growth inside the
sheaths. Infected
panicles and grains
look sterile,
ill-filled, shriveled,
and discolored.
molecular markers come to the rescue of plant breeders by helping them decrease
the time between breeding and achieving the desired product. The discovery of
DNA markers led to a new tool in plant breeding called marker-assisted selection
(MAS), which is one of the widely used components of a discipline called molecu-
lar breeding. The application of DNA markers to plant breeding significantly
increased its efficiency and precision. MAS is now one of the most advanced meth-
odologies on hand for the transfer of one or more desired genes/genomic regions
into elite rice varieties in more durable combinations. Deploying a single R-gene
often leads to resistance breakdown in a short period as the pathogen evolves and
makes itself resistant to the action of the gene. Therefore, pyramiding of multiple
R-genes imparting resistance against different races of a pathogen through MAS is
an efficient way to attain long-term and broad-spectrum resistance. Although this is
an advanced method, it has some disadvantages. The main drawback of this approach
is that one parent, or even both parents, used in the breeding program may carry
quantitative trait loci (QTL) alleles that are either similar or exact to the ones pres-
ent in the elite germplasm accessions used in other breeding programs. In such a
situation, the QTL being introgressed may contribute only partially to the trait
improvement. In other cases, the impact of a QTL may differ based on the genetic
background as a result of interactions with other loci or epistasis (Holland 2001).
Moreover, there are many more important traits for which no genes have been
reported so far. In such situations in which a gene is not available in the gene pool,
researchers are forced to look outside the gene pool toward other genera or some-
times toward another kingdom to find the desired gene.
Genetic modification (GM) technology has been developed to make changes to
an organism’s genes to give it new traits that would not occur in nature or to elimi-
nate undesirable characteristics. GM technology using recombinant DNA technol-
ogy is useful for developing disease-resistant varieties but still has not reached
farmers because of a lack of public acceptance and political issues in many coun-
tries. Under these situations, researchers are left with an option to create mutations
in the gene pool with an expectation to generate variation for a trait not naturally
present in the gene pool.
Mutation breeding is helpful in creating novel mutants with genetic variations
for plant breeding and functional genomics. It could be used for rice crop improve-
ment programs. Mutation induction can be of advantage to produce cultivars with
desired characteristics within defined germplasm pools. Normally, gamma-rays
(γ-rays) and ethyl methane sulfonate (EMS) have been used extensively to develop
rice mutants. In rice, there have been reports of some important mutant collections
developed to carry out functional studies and Hirochika et al. (2004) made available
a list of the mutant libraries. Madamba et al. (2009) found a gamma-ray-induced
IR64 mutant, G978, that gave enhanced resistance to blast and bacterial blight. The
resistance was found to be quantitative and nonrace-specific against bacterial and
fungal pathogens. The mutation was shown to be inherited as a single recessive
gene, Bsdr1, and it caused a shorter stature relative to IR64 and was mapped as a
QTL to a 3.8-Mb region on chromosome 12. Comparison of the gene expression
profiles of the mutant and wild type showed the candidate gene to encode a U-box
domain-containing protein. The disrupted gene exhibited a loss of expression in the

mutant and cosegregated with the mutant phenotype (Madamba et al. 2009). These
techniques of causing mutations have a problem of creating more undesirable than
desirable phenotypes. In other words, these techniques result in random mutations
in the genome. The frequency of variations can be controlled but not in the genomic
region where they are desired to occur. To achieve a desirable outcome from these
experiments, a large population of mutants has to be screened, and this requires a lot
of time, space, and resources.
Ultimately, the new era of genome engineering technologies offers vast potential
for crop improvement as they allow site-specific modifications of DNA sequences
to be executed under laboratory conditions. The accessibility to vast genomic
resources and an easy-to-handle genome size make rice more amenable for GM
technologies. Advances in genomics and the development of various genome-
editing technologies using engineered site-specific nucleases (SSNs) have made the
application of genome engineering to crops easy. Among various SSNs, the
CRISPR/Cas9 system is commonly applied because of its simplicity, robustness,
and high efficiency (Wang et al. 2018). In comparison with other genome-editing
tools such as zinc-finger nucleases and transcription activator-like effector nucle-
ases (TALENs), this technique is versatile and simple (Ma et al. 2015b). This tech-
nology has been applied to agricultural crop plants with the aim of crop improvement.
Oliva et al. (2019) used the CRISPR-Cas9 system to introduce mutations in three
SWEET gene promoters to make robust and broad-spectrum bacterial blight-
resistant lines. There is still much scope for its use and application.
In the future, the challenge for scientists is not only to develop rice varieties for
specific diseases but also to select for horizontal resistance without altering other
desirable traits of elite rice varieties. A systematically designed experiment involv-
ing highly efficient molecular tools would make it possible to achieve this outcome.
Hence, the current chapter amalgamates details on the present status of the key
diseases that affect rice production, various molecular strategies for attaining dis-
ease resistance, and prospects of molecular breeding for disease resistance in rice.
2 henotypic Screening Techniques for Major Diseases

P
of Rice: Pathogen Inoculum, Plant Infection Assays,
and Disease Scoring
2.1 Bacterial Blight
Bacterial blight (BB), caused by Xanthomonas oryzae pv. oryzae (Xoo), targets the
seedling stage of rice, resulting in leaves turning grayish green and rolling up.
Usually, BB inoculation can be done in two ways, either in the field or in the green-
house. Many techniques are available to infect the plant with inoculum such as clip-
ping, needle prick, paint-brush, and spray methods. But the most preferable,
efficient, and feasible for inoculation is the clipping method (Jabeen et al. 2011).
Individually, collected Xoo strains are multiplied and stored on modified
Wakimoto’sagar (Sundaram et al. 2009) and the selected rice plants at 45-days-old
stage are clip-inoculated with a freshly prepared bacterial suspension (~108–9 cfu/
mL) by the following method given by Kauffman et al. (1973). In this method, 1–2-
cm tips of five leaves are clipped with scissors, after they were already dipped in
bacterial suspension culture, and disease score is recorded 2 weeks post-inoculation
both by visual scoring and by measuring the lesion length (LL) as per the Standard
Evaluation System (SES) scale of the International Rice Research Institute (IRRI
1996) (0–3 = resistant, 3–5 = moderately resistant (MR), 5–7 = moderately suscep-
tible (MS), and 7–9 = susceptible).
2.2 Blast Disease
The causal organism for blast disease is a fungus, Magnaporthe oryzae (Mo).
Symptoms of blast can appear during any developmental stage and on all parts of
the rice plant, including leaves, leaf collars, necks, panicles, pedicels, and seeds.
Standard screening protocols of rice varieties for susceptibility to rice blast are usu-
ally carried out by spraying the plant with conidial suspensions under greenhouse
and field conditions using local isolates of the pathogen (Takahashi et al. 2009).
However, for screening against exotic strains, quarantine restrictions are frequently
applied to control any escape of the pathogen into the surrounding environment (Jia
et al. 2003). In field conditions, artificial leaf blast disease screening usually takes
place in a Uniform Blast Nursery (UBN) (Jamaloddin et al. 2020). Applying an
excess rate of nitrogen fertilizer (150 kg N/ha) makes rice more vulnerable to
spreading blast infection. Artificial inoculation is done with a highly virulent blast
race (fungal conidial suspension at a concentration of 1 × 105 spores/mL) by spray-
ing on UBN beds 25–30 days after sowing (DAS). Later, the beds are covered with
polythene sheets during the night to create humid conditions for disease develop-
ment. The disease score is collected 10–15 days after infection, depending on the
severity of the infection on the susceptible check using the SES (IRRI 1996). In
in vitro conditions, spot inoculation and filter paper inoculation methods are used
for inoculation at the vegetative and reproductive stages of rice plants (Jia et al.
2003; Takahashi et al. 2009).
2.3 Sheath Blight
Sheath blight (ShB) disease is caused by a fungus, Rhizoctonia solani. The fungus
attacks the rice plant from tillering to heading stage. The early symptoms of sheath
blight involve oval circles on leaves just above the waterline. Various screening
methods have been developed to screen for ShB in greenhouse and field conditions.
Eizenga et al. (2002) delineated a growth-chamber screening technique for sheath

blight on Oryza spp. Later, Jia et al. (2003) developed the detached-leaf method. For
screening ShB under greenhouse conditions, three inoculation methods have been
described: liquid-cultured mycelia ball, mycelia suspension, and agar block. Out of
these, the liquid culture mycelia ball is a more efficient and better method for suc-
cessful inoculation (Park et al. 2008). Field screening at the reproductive stage is the
most commonly used method. But field trials require a lot of labor and a large
amount of seed material, inoculum, and high-humidity conditions for up to
3–5 months to complete the evaluations (Jia et al. 2007). Normally, screening of
selected material for ShB tolerance/susceptibility is done using a highly virulent
isolate of Rhizoctonia solani. Initially, ShB isolate is maintained on a potato dex-
trose agar (PDA, extract from 200 g/L of potato, 20 g/L of dextrose, and 20 g/L of
agar) plate and incubated at 28 °C in darkness. For plant inoculations, Typha stem
pieces (3–4 cm) are cut and autoclaved in plastic covers. This sterile Typha is inocu-
lated with a 5-mm mycelial plug of R. solani from a 3-day-old PDA plate and incu-
bated in the dark for 10 days at 28 °C. The colonized Typha pieces will be used for
inoculating the rice plants at a rate of three to four pieces per hill.
Disease phenotype will be scored 2 weeks after inoculation by measuring the
relative lesion height (RLH) as per the following formula:
RLH ( % ) = ( Lesion length / Plant height ) ´100
The IRRI (1996) phenotype scale is used to classify the plants based on their
disease severity index from 0 to 9.
2.4 Sheath Rot of Rice
Sheath rot (ShR) is a symptom that is observed in rice plants when infected by any
of the following pathogens: Sarocladium oryzae, Fusarium sp., Pseudomonas sp.,
and Cochliobolus lunatus. Other pathogens have been reported to cause similar
symptoms in rice (Bigirimana et al. 2015). Multiple screening techniques that are
being used for sheath rot disease resistance in rice include the mealybug inoculation
method, rice grain/hull inoculum, leaf piece inoculum, cotton swabbing of conidial
spores, spraying or injecting conidial suspension on the sheath, and detached til-
ler–based assays (Mahadevaiah et al. 2015; Samiyappan et al. 2003). The estab-
lished screening methods differ depending on the causal agent of ShR as well as the
growth stage of the plant. The pathogen is cultured on PDA plates for up to 14 days
at 28 °C (Panda and Mishra 2019). A study by Mahadevaiah et al. (2015) compared
multiple inoculation methods for Sarocladium oryzae during different growth stages
and observed that seed inoculation is a suitable screening method for screening for
disease resistance in young plants or early infection. In this method, the seeds are
soaked overnight in conidial suspension (105 spores/mL) and then germinated. The
number of germinated plants and lesion lengths 14 days after inoculation are scored.
For screening plants in peak vegetative to booting stage, foliar inoculation methods
were able to provide reliable and conclusive results 15 days after infection. For a
faster in vitro screening, the detached-tiller assay is recommended, in which the til-
lers are cut and placed on moist paper and inoculated with mycelial mats. Visible
lesions are observed as early as 3 days postinoculation (Samiyappan et al. 2003;
Mahadevaiah et al. 2017). Disease severity is estimated by measuring the area of the
sheath and/or leaf affected (Mahadevaiah et al. 2017). Pseudomonas fuscovaginae
also causes ShR in rice (Bigirimana et al. 2015). Adorada et al. (2013) reported and
recommended multiple screening techniques for screening ShR caused by P. fusco-
vaginae. The bacteria are cultured using King’s medium B initially for about 24 h.
For plant inoculations, the following methods were found to be effective: (1) pin-
pricking the upper leaf sheath using a needle dipped in bacterial suspension (107 cfu/
mL) and measuring disease severity 14 days postinoculation in plants at the booting
stage; (2) spraying the inoculum was found effective and is recommended for mass
screening for ShR resistance in plants at the booting stage; (3) for early-stage resis-
tance, soaking seeds in bacterial inoculum before germination is recommended,
followed by measuring the decrease in seedling height 10 days later (Adorada
et al. 2013).
2.5 False Smut
The fungus Ustilaginoidea virens causes false smut of rice. This fungus attacks the
developing panicles and leads to the formation of smutted balls (cottony flakes
around the grains). The fungus is generally cultured on potato sucrose agar plates or
potato sucrose broth for mass production of conidial suspension (Panguluri and
Kumar 2013). Screening for false smut is done during the booting stage of the plants
through the following methods. Spraying conidial suspension (5 × 104 spores/mL)
at the booting stage is one of the recommended ways for screening for false smut
(Kaur and Singh 2017). Another method involves injecting the conidial suspension
into the boot (Panguluri and Kumar 2013; Kaur 2014). It has been observed that
spraying spores has produced a higher disease incidence and this is suitable for
screening for resistant varieties (Kaur 2014). Disease severity is scored by calculat-
ing the percentages of infected tillers and infected grains per panicle and a score is
assigned as recommended by Rice SES (IRRI 2013; Chaudhari et al. 2019).
2.6 Tungro Disease of Rice
Rice tungro is caused by two viruses, RTBV (rice tungro bacilliform virus) and
RTSV (rice tungro spherical virus), and is transmitted by green leafhopper (GLH:
Nephotettix virescens (Dist.)). The viral infection is manifested by the stunted
growth of rice plants and yellowing of leaves (Anjaneyulu et al. 1982; Panguluri and
Kumar 2013). Nursery screening for tungro resistance in rice is carried out by let-
ting three to five viruliferous GLH per plant (20–30 days old) feed in a closed envi-
ronment and scoring the disease symptoms 14 days later as recommended by Rice
SES (Anjaneyulu et al. 1982; Sebastian et al. 1996).
2.7 Bacterial Leaf Streak
Bacterial leaf streak (BLS) of rice is caused by the bacterium Xanthomonas oryzae
pv. oryzicola (Xoc). BLS is manifested as water-soaked lesions on the leaf surface,
which can result in decreased photosynthesis and hence diminished yield (He et al.
2012). Screening for BLS resistance is mainly performed using either of two meth-
ods. For screening seedlings, bacteria are initially grown in peptone sucrose broth,
and a bacterial suspension from 108 to 109 cfu/mL is used for infiltrating the
expanded leaves using a needleless syringe. The disease symptoms are scored
14 days postinoculation (Ju et al. 2017). For field screening or screening older
plants, matured leaves are pin-pricked with needles that are dipped in bacterial inoc-
ulum on either side of the leaves. The lesions caused are measured 20 days postin-
oculation (Tang et al. 2000; Chen et al. 2006a, b; He et al. 2012). Disease severity
is scored as per Rice SES.
3 Genetics of Disease Resistance
Deployment of genes conferring host-plant resistance provides an economical,

durable, effective, and environmentally safe approach to combat plant diseases and
decrease yield losses (Fig. 1). Major resistance genes from different resistance
donors have been reported for various rice diseases. So far, more than 44 resistance
genes have been identified against bacterial blight (Kim and Reinke 2019). More than
100 distinctive blast-resistance genes have been reported on different rice chromosomes
and, out of these, 21 genes have been cloned (Devi et al. 2020). Two major sheath
blight QTLs (qShB9-2 and qSBR11-1) have been reported (Channamallikarjuna et al.
2010). But, thus far, genetic diversity for high resistance to/tolerance of ShB has not
been reported in either cultivated rice or its wild relatives; thus, cloning of genes for
ShB resistance is straggling (Bonman 1992). For bacterial leaf streak (BLS), no
major resistance genes (R-genes) have been identified and only a few QTLs have
been mapped. Out of these, qXO-2-1, qXO-4-1, and qXO-11-2 were showing resis-
tance to more than nine Xoc and Xoo strains (Bossa-Castro et al. 2018). In the case
of tungro disease, a resistance QTL was found in Indian landrace ARC 11554 and
was localized on chromosome 4 (Wang et al. 2016). False smut resistance in several
rice cultivars has been identified as a quantitative trait controlled by multiple genes
(Andargie et al. 2018; Han et al. 2020). But, to date, no rice variety has been identi-
fied to show complete resistance to false smut, whereas many cultivars exhibit
(a) Blast False smut Tungro Bacterial leaf blight Sheath blight
(Magnaporthe (Ustilaginoidea (Bacilli form and (Xanthomonas (Rhizoctonia solani)
oryzae) virens) spherical virus oryzae)
(b)
and wild rice germplasm
Diverse set of traditional
MAS/
MABC
GS/GE
Omics
QTL GWAS technology
mapping approach
Genome
sequencing
Target Introgression and transfer of QTLs/genes
traits
High grain yield
Identiication, validation, and ine-mapping
Trait discovery and deployment strategies
Fig. 1 (a) An illustration of the different biotic diseases in rice and (b) a funnel diagram represent-
ing the sources of valuable traits (tolerance of biotic diseases, yield components, and superior grain
quality) that exist in traditional and wild rice germplasm. Using various phenotypic screening
techniques and genome sequencing technologies can enable us to understand the molecular genet-
ics and physiological mechanisms of stress tolerance. The identified genomic regions of QTLs and
genes associated with the key traits play a vital role in understanding the interactions and further
improving disease tolerance and superior grain quality traits with the help of marker-assisted selec-
tion and genomic selection approaches for crop improvement
considerable differences in quantitative field resistance to the pathogen (Huang

et al. 2019). According to previous studies, the genetics of sheath rot disease resis-
tance was dissected by studying the segregating pattern in an F2 population
(Rajashekara et al. 2014; Mvuyekure et al. 2017) and recombinant inbred lines
(Graichen et al. 2010; Mahadevaiah et al. 2017). Some of these R-genes or loci have
been extensively used in MAS breeding programs, and some of them have been
fine-mapped and are undergoing cloning efforts. Detailed information on resistance
genes/QTLs for economically important rice diseases (i.e., bacterial blight, blast,
and sheath blight) appears in Tables 2, 3, and 4, respectively.
4 Breeding for Disease Resistance
Rice breeders have come up with many disease-resistant cultivars adapted to differ-
ent rice-growing regions worldwide by applying conventional breeding approaches.
Because of the dominance and epistasis effects of genes conferring resistance to a
few diseases, gene pyramiding through conventional breeding methods becomes a
challenge. Also, genes having similar responses to two or more races of a pathogen
are difficult to recognize and transfer by conventional approaches (Joseph et al.
2004; Sundaram et al. 2009; Rajpurohit et al. 2011). The exercise of breeding for
Table 2 List of bacterial blight-resistance genes/QTLs
Genes/ Resistance to Marker
S. No. QTLs Chr. Position (bp) Donor parent Inheritance Origin Xoo race Linked marker type References
1 Xa-1 4 31,638,099– Kogyoku, IRBB1 Dominant, Japan Japanese race-I Npb235 RFLP Yoshimura
31,644,795 cloned, and et al. (1998)
characterized
2 Xa-2 4 IRBB2 Dominant Vietnam Japanese HZR950-5 SSR Kurata and
race-II Yamazaki
(2006)
3 Xa-3/ 11 28,399,360– WaseAikoku 3, Dominant, Japan Chinese, C481S RFLP Xiang et al.
Xa-26 28,402,773 Minghui 63, IRBB3 cloned, and Philippine, and (2006)
characterized Japanese races
4 Xa-4 11 – TKM6, IRBB4 Dominant India Philippine Npb181 and RFLP Wang et al.
race-I RM224 and SSR (2001)
5 xa-5 5 437,010– IRBB5 Recessive, Bangladesh Philippine RG556 and CAPS Petpisit et al.
443,270 cloned, and races I, II, and RM122 and SSR (1977)
characterized III
Molecular Approaches for Disease Resistance in Rice
6 Xa-6/ 11 – Zenith Dominant U.S. Philippine Y68SSRA RFLP Sidhu et al.

xa-3 race-I (1978)
7 Xa-7 6 – DZ78 Dominant Bangladesh Philippine G1091, RFLP, Chen et al.
races RM205S2 SSR (2008)
8 xa-8 7 – PI231128 Recessive U.S. Philippine RM500, SSR Vikal et al.
races RM533 (2014)
9 Xa-9 11 – Khao Lay Nhay and Dominant Laos Philippine C4S1S RFLP Ogawa
Sateng races (1988)
10 Xa-10 11 22,203,734– Cas 209 Dominant, Senegal Philippine and M491/M419 RFLP, Kurata and
22,204,676 cloned, and Japanese races GAPS Yamazaki
characterized (2006)
(continued)
327
Table 2 (continued)
328

11 Xa-11 3 – IR8 Dominant Philippines Japanese races – – Kurata and
IB, II, IIIA, Yamazaki
and V (2006)
12 Xa-12 4 – Kogyoku, Java14 Dominant Japan Indonesian – – Ogawa et al.
race-V (1987)
13 xa-13 8 – BJ1, IRBB13 Recessive, India Philippine RG136, xal3p STS, Kurata and
cloned, and race-6 SSR Yamazaki
characterized (2006)
14 Xa-14 4 – TN1 Dominant Taiwan Philippine VAZ190B/ RFLP Kurata and
race 5 RG163 Yamazaki
(2006)
15 xa-15 – M41 mutant Recessive ND Japanese races – – Ogawa
(2008)
16 Xa-16 – Tetep Dominant Vietnam Japanese races – – Kurata and
Yamazaki
(2006)
17 Xa-17 – Asominori Dominant South Korea Japanese races – – Kurata and
Yamazaki
(2006)
18 Xa-18 – IR24, Miyang23, Dominant Philippines, Burmese races – – Kurata and
Toyonishiki Japan Yamazaki
(2006)
19 Xa-19 3 – XM5 (mutant of Recessive – Japanese races – – Kurata and
IR24) Yamazaki
(2006)
M. Jamaloddin et al.
20 Xa-20 – XM6 (mutant of Recessive – Japanese races – – Kurata and
IR24) Yamazaki
(2006)
21 Xa-21 11 20,802,924– O. longistaminata, Dominant, Africa, Mali Philippine and pTA248 STS Song et al.
20,806,518 IRBB21 cloned, and Japanese races (1995)
characterized
22 Xa-22(t) 11 Zhach anglong Dominant China Chinese races L363B/P143 RFLP Kurata and
Yamazaki
(2006)
23 Xa-23 11 22,203,734– O. ruipogon (CBB23) Dominant, China/ Indonesian – – Zhang et al.
22,204,676 cloned, and Cambodia races (2001)
characterized
24 xa-24 2 DV86 Recessive Bangladesh Philippine and – – Khush and
Chinese races Angeles
(1999)
25 xa-25/ 12 17,302,073– Minghui 63, HX-3 Recessive, China Chinese and – – Liu et al.
Xa25(t) 17,305,326 (somaclonal mutant cloned, and Philippine (2011)
of Minghui 63) characterized races
26 xa-26(t) 11 – Nep Bha Bong Recessive China Philippine C4S1S/ RFLP Lee et al.
races Y6855RA (2003)
27 Xa-27(t) 6 – O. minuta IRGC Dominant, Philippines Chinese strains M10S1, M1095 RFLP Gu et al.
101141, IRBB27 cloned, and and Philippine (2005)
characterized races 2–6
28 xa-28(t) 11 – Lota sail Recessive Bangladesh Philippine – – Lee et al.
race 2 (2003)
29 Xa-29(t) 1 – O. officinalis (B5) Dominant – Chinese races – – Tan et al.
(2004)
(continued)
329
Table 2 (continued)
330

30 Xa-30(t) 11 – O. ruipogon (Y238) Dominant India Indonesian – – Cheema et al.
races (2008)
31 xa-31(t) 4 – Zhach anglong Recessive China Chinese races – – Wang et al.
(2009)
32 xa-32(t) 11 – O. australiensis Recessive – Philippine RM27256, SSRs Zheng et al.
(introgression line races 27274 (2009)
C4064)
33 Xa-33 7 – Ba7 O. nivara Dominant Thailand Thai races RMWR7.1 and SSRs Hari et al.
7.6 (2013)
34 Xa-33(t) 6 – Ba7O. nivara Dominant Thailand Thai race RM20590 SSRs Korinsak
et al. (2009)
35 xa-34(t) 1 – Pin Kaset O. Recessive Sri Lanka Thai race RM493, SSRs Chen et al.
brachyantha RM446, (2011b)
RM10927,
RM10591
36 Xa-35(t) 11 – Oryza minuta (Acc. Dominant Philippines Philippine – – Guo et al.
No. 101133) races (2010)
37 Xa-36(t) 11 – C4059 Dominant China Philippine – – Miao et al.
races (2010)
38 Xa-38 4 – O. nivara Dominant – Indian Punjab RM17499, STS/ Bhasin et al.
IRGC81825 races RM459, SSR (2012)
RM317
39 Xa39 11 – FF329 Dominant – Chinese and RM21, RM206 STS/ Zhang et al.
Philippine SSR (2015)
races
40 Xa40(t) 11 – IR65482-7-216-1-2 Dominant – Korean BB RM27320, STS/ Kim et al.
races ID55, WA18-5 SSR (2015)
41 xa41(t) – – Rice germplasm Dominant – Various Xoo – – Hutin et al.
strains (2015)
42 xa42 3 – XM14, a mutant of Dominant – Japanese Xoo RM15189 SSR Busungu
IR24 races et al. (2016)
43 Xa-43 (t) 11 11,92,907– IR36(P8) Dominant – Korean BB – – Kim and
11,943,779 races Reinke
(2019)
44 Xa-44 (t) 11 11,964,077– R73571-3B-11-3- Dominant – Korean BB – – Kim (2018)
11,985,463 K3(P6) races
45 Xa-45(t) 8 26,737,175– O. glaberrima IRGC Recessive – Indian Punjab xa13 prom STS (Neelam
26,818,765 102600B races et al. 2020)
46 Xa46(t) 11 – Mutant line H 120 Dominant China Chinese Xoo RM26981– SSR Chen et al.
races RM26984 (2020)
Source: Revised and updated from Kou and Wang (2013)
331
Table 3 List of blast resistance genes/QTLs

Gene/ Position Position Donor rice Method of
S. No. QTL Chr. (bp) (cM) variety identification References
1 Pit 1 2,270,216– 9.08– Tjahaja Cloned Hayashi
3,043,185 12.17 and
Yoshida
(2009)
2 Pi27(t) 1 6,230,045– 24.29– IR64 (I) Mapped Sallaud
6,976,491 27.90 within et al.
21.6 cM (2003)
3 Pi24(t) 1 5,242,654– 20.97– Azuenca (J) QTL mapping Zhuang
5,556,378 22.22 et al.
(2002)
4 Pitp(t) 1 25,135,400– 100.54– Tetep Cosegregation Barman
28,667,306 117.49 marker was et al.
identified (2004)
5 Pi35(t) 1 33,000,000– 132.0– Hokkai 188 (J) Cloned Xu et al.
34,150,000 136.6 (2014)
6 Pi37 1 33,110,281– 132.44– St. No. 1 (J) Cloned Lin et al.
33,489,931 133.95 (2007)
7 Pi64 1 – – Yangmaogu (J) Cloned Ma et al.
(2015a)
8 Pid1(t) 2 21,875,000– 87.5– Digu Mapped Chen et al.
22,475,000 89.9 within (2004)
11.8 cM
9 Pig(t) 2 34,346,727– 137.38– Guangchang Mapped Zhou et al.
35,135,783 140.54 zhan (I) within (2004)
11.8 cM
10 Pitq5 2 37,625,000– 150.5– Teqing QTL mapping Tabien
39,475,000 157.9 et al.
(2002)
11 Piy1(t) 2 38,300,000– 153.2– Yanxian No. 1 Mapped Lei et al.
38,525,000 154.1 within 1.6 cM (2005)
12 Piy2(t) 2 38,300,000– 153.2– Yanxian No. 1 Mapped Lei et al.
38,525,001 154.1 within 3.0 cM (2005)
13 Pib 2 38,300,000– 153.2– Tohoku IL9 Cloned Wang et al.
38,525,000 154.1 (1999)
14 Pi25(t) 2 34,360,810– 137.44– IR64 (I) QTL mapping Wu and
37,725,160 150.90 Tanksley
(1993)
15 Pi14(t) 2 1–6,725,831 1.00– Maowangu Linkage Pan et al.
26.90 analysis using (1996)
isozyme
markers
16 Pi16(t) 2 1–6,725,831 1.00– Aus373 (I) Linkage Pan and
26.91 analysis using Tanisaka
isozyme (1997)
markers
(continued)
Table 3 (continued)
17 Pi68(t) 3 14,738– 9.30– INGR15002 QTL mapping Devi et al.
14,761 9.70 (2020)
18 Pi63/ 4 – – Kahei Cloned Xu et al.
Pikahei- (2014)
1(t)
19 pi21 4 5,242,654– 20.97– Owarihatamochi Cloned Fukuoka
5,556,378 22.22 et al.
(2009)
20 Pikur1 4 24,611,955– 98.44– Kuroka (J) Linkage Goto
33,558,479 134.23 analysis using (1988)
phenotypic
marker
21 Pi39(t) 4 26,850,000– 107.4– Chubu 111 (J) Mapped Liu et al.
27,050,000 108.2 within 0.3 cM (2007)
22 Pi(t) 4 2,270,216– 9.08– Tjahaja Linkage Causse
3,043,185 12.17 analysis using et al.
phenotypic (1994)
marker
23 Pi26(t) 5 8,751,256– 35.00– Gumei 2 (I) QTL mapping Wu and
11,676,579 46.70 Tanksley
(1993)
24 Pi23(t) 5 10,755,867– 43.02– Sweon 365 QTL mapping Ahn et al.
19,175,845 76.70 (1997)
25 Pi10 5 14,521,809– 58.08– Tongil Mapped Naqvi et al.
18,854,305 75.41 within 6.7 cM (1995)
26 Pi2 6 – – C101A51 Cloned Zhou et al.
(2006)
27 Pi22(t) 6 4,897,048– 19.50– Suweon365 (J) QTL mapping Ahn et al.
6,023,472 24.09 (1997)
28 Pi26(t) 6 8,751,256– 35.00– Azucena (J) QTL mapping Wu et al.
11,676,579 46.70 (2005)
744,329 2.97 within et al.
21.6 cM (2003)
30 Pi40(t) 6 16,274,830– 65.09– O. australiensis Mapped Jeung et al.
17,531,111 70.12 (W) within 1.8 cM (2007)
31 Piz 6 10,155,975– 40.60– Zenith (J) Mapped Ahn et al.
10,517,612 42.07 within (1996)
0.43 cM
32 Piz-t 6 14,675,000 58.70 Toride 1 Cloned Hayashi
et al.
(2006)
33 Pi9 6 10,386,510– 41.50– O. minuta (W) Cloned Qu et al.
10,389,466 41.55 (2006)
(continued)
Table 3 (continued)
34 Pi25 6 18,080,056– 72.32– Gumei 2 Cloned Chen et al.
19,257,588 77.03 (2011a)
35 Pid2 6 17,159,337– 68.63– Digu Cloned Chen et al.
17,163,868 68.65 (2006b)
36 Pigm(t) 6 10,367,751– 41.47– Gumei 4 Mapped Deng et al.
10,421,545 41.68 within 70 kb (2017)
37 Pi50 6 – – Er-Ba-zhan Cloned Su et al.
(EBZ) (2015)
38 Pid3-I1 6 – – MC276 Cloned Inukai
et al.
(2019)
39 Pi17(t) 7 22,250,443– 89.00– DJ 123 Mapped Pan et al.
24,995,083 99.90 within 1.8 cM (1996)
40 Pi36 8 2,870,061– 11.48– Q61 (I) Cloned Liu et al.
2,884,353 11.53 (2005)
41 Pi33 8 5,915,858– 23.66– IR64 (I) Mapped Berruyer
6,152,906 24.61 within 1.6 cM et al.
(2003)
42 Pizh 8 4,372,113– 17.48– Zhai-Ya-Quing8 QTL mapping Sallaud
21,012,219 84.04 (I) et al.
(2003)
16,241,105 64.96 within 0.7 cM et al.
(2003)
44 Pii2(t) 9 1,022,662– 4.09– Azucena Linkage Kinoshita
7,222,779 28.89 analysis using and
phenotypic Kiyosawa
markers (1997)
45 Pi5 9 7,825,000– 31.30– RIL125, Mapped Lee et al.
8,250,000 33.00 RIL249, RIL260 within 170 kb (2009)
(Moroberekan)
46 Pi3(t) 9 7,825,000– 31.3– Kan-Tao Linkage Causse
RFLP markers (1994)
47 Pi15 9 9,641,358– 38.56– GA25 (J) Mapped Pan et al.
9,685,993 38.74 within 0.7 cM (1996)
48 Pii 9 – – Hitomebore Cloned Takagi
et al.
(2013a)
49 Pi28(t) 10 19,565,132– 78.26– IR64 (I) QTL mapping Sallaud
22,667,948 90.67 et al.
(2003)
50 Pia 11 – – Aichi Asahi (J) Cloned Okuyama
et al.
(2011)
(continued)
Table 3 (continued)
51 PiCO39(t) 11 6,304,007– 25.21– CO39 (I) Cloned Cesari
6,888,870 27.55 et al.
(2013)
52 Pilm2 11 13,635,033– 54.54– Lemont QTL mapping Tabien
28,377,565 113.50 et al.
(2002)
53 Pi30(t) 11 441,392– 1.76– IR64 (I) QTL mapping Sallaud
6,578,785 26.31 et al.
(2003)
54 Pi7(t) 11 17,850,000– 71.40– RIL29 QTL mapping Wang et al.
21,075,000 84.30 (Moroberekan) (1994)
55 Pi34 11 19,423,000– 77.69– Chubu32 (J) QTL mapping Zenbayashi
19,490,000 77.96 et al.
(2002)
56 Pi38 11 19,137,900– 76.55– Tadukan (I) Mapped Gowda
21,979,485 87.91 within 20 cM et al.
(2006)
57 PBR 11 20,125,000– 80.5– St. No. 1 Mapped Fujii et al.
30,075,000 120.3 within (1995)
22.9 cM
58 Pb1 11 – – Modan Cloned Hayashi
et al.
(2010)
59 Pi44(t) 11 22,850,000– 91.40– RIL29 – Chen et al.
29,475,000 117.90 (Moroberekan) (1999)
60 Pik-h/ 11 24,761,902– 99.0– Tetep Cloned Sharma
Pi54 24,762,922 99.05 et al.
(2005b)
61 Pi1 11 26,498,854– 105.99– LAC23 (J) Mapped Hua et al.
28,374,448 113.49 within (2012)
11.4 cM
62 Pik-m 11 27,314,916– 109.25– Tsuyuake (J) Cloned Ashikawa
27,532,928 110.13 et al.
(2008)
63 Pi18(t) 11 26,796,917– 107.18– Suweon365 (J) Mapped using Ahn et al.
28,376,959 113.50 RFLP markers (1996)
64 Pik 11 27,314,916– 109.25– Kusabue (I) Cloned Zhai et al.
27,532,928 110.13 (2011)
65 Pik-p 11 K60 Cloned Yuan et al.
(2011)
66 Pik-s 11 27,314,916– 109.25– Shin 2 (J) Mapped Fjellstrom
27,532,929 110.15 within 2.7 cM et al.
(2004)
(continued)
Table 3 (continued)
67 Pik-g 11 27,314,916– 109.25– GA20 (J) Linkage Pan et al.
27,532,930 110.16 analysis to (1996)
other
resistance
genes
68 Pise1 11 5,740,642– 22.96– Sensho Linkage Goto
16,730,739 66.92 analysis using (1970)
phenotypic
markers
69 Pif 11 24,695,583– 98.78– Chugoku 31-1 QTL mapping Shinoda
28,462,103 113.84 (St. No. 1) et al.
(1971)
70 Mpiz 11 4,073,024– 16.29– Zenith (J) Linkage Goto
16,730,739 66.92 analysis using (1970)
phenotypic
markers
71 Pikur2 11 2,840,211– 11.36– Kuroka (J) Linkage Goto
18,372,685 73.49 analysis using (1988)
phenotypic
markers
72 Piisi 11 2,840,211– 11.36– Imochi Shirazu Linkage Goto
19,029,573 76.11 (J) analysis using (1970)
phenotypic
markers
73 Pike 11 Xiangzao 143 Cloned Chen et al.
(2015)
74 Pi24(t) 12 5,242,654– 20.97– Azuenca (J) QTL mapping Zhuang
5,556,378 22.22 et al.
(2002)
75 Pi62(t) 12 2,426,648– 9.70– Yashiro-mochi Mapped Wu et al.
18,050,026 77.00 (J), Tsuyuake within 1.9 cM (2008)
76 Pitq6 12 5,758,663– 23.00– Tequing (I) QTL mapping Tabien
7,731,471 30.92 et al.
(2002)
77 Pi6(t) 12 1–6,725,831 1–1.68 Apura (I) – McCouch
et al.
(1994)
78 Pi12 12 6,988,220– 27.95– Moroberekan (J) Linkage Inukai
RFLP markers (1996)
79 Pi21(t) 12 5,242,654– 20.94– Owarihata – Ahn et al.
5,556,378 22.22 mochi (J) (1997)
11,915,469 47.66 et al.
(2003)
(continued)
Table 3 (continued)
18,867,450 75.46 et al.
(2003)
82 Pi157 12 12,375,000– 49.5– Moroberekan Mapped Causse
15,550,000 62.2 within 9.5 cM et al.
(1994)
83 Pita 12 10,603,772– 42.41– Tadukan (I) Cloned Hayashi
10,609,330 42.43 et al.
(2006)
84 Pita-2 12 10,078,620– 40.31– Shimokita (J) Mapped Nakamura
13,211,331 52.84 within 4.0 cM et al.
(1997)
85 Pi19(t) 12 8,826,555– 35.30– Aichi Asahi (J) Linkage Iwata
13,417,088 53.67 analysis to (1996)
other
resistance
genes
86 Pi39(t) 12 – – Chubu 111 (J), Mapped Liu et al.
within 37 kb (2007)
87 Pi20(t) 12 12,875,000– 51.50– IR24 (I) Mapped Liu et al.
12,950,000 51.80 within 0.6 cM (2008)
88 PiGD-3(t) 12 13,950,000 55.80 Sanhuangzhan 2 QTL mapping Liu et al.
(2005)
89 Ptr 12 Katy Cloned Zhao et al.
(2018)
Source: Revised and updated from Tanweer et al. (2015)
disease resistance could never obtain a break because of the emergence of new
pathotypes, which could overcome the resistance. Advances in rice genomics pro-
vided tools such as molecular markers for plant breeders to effectively develop cul-
tivars with resistance against various diseases, which is an environment-friendly
alternative vis-à-vis the use of agrochemicals (Miah et al. 2013). Molecular markers
can be used to map and introgress one or more desired genes for biotic and abiotic
stress resistance from diverse gene pools (Suh et al. 2009). Marker-assisted selec-
tion for pyramiding desired genes without altering other quality characteristics of a
rice cultivar is crucial in rice improvement (Sundaram et al. 2008; Suh et al. 2009;
Shanti et al. 2010). As an added advantage, the availability of gene-linked molecular
markers for the resistance genes eases the identification of plants harboring two or
more R-genes at any growth stage without a bioassay (Sundaram et al. 2008; Shanti
et al. 2010; Bainsla and Meena 2016).
Three bacterial blight-resistance genes (xa5, xa13, and Xa21) were pyramided
into susceptible cultivar PR106 using MAS. The introgression lines were tested
against 17 Xoo isolates under both glasshouse and field conditions. The trials sug-
gested that the combination of genes provided broad-spectrum resistance against
Table 4 List of sheath blight-resistance genes/QTLs
338
Linked Type of Associated

S. No. QTLs Chr. markers Mapping population marker LOD character Remarks Reference
1 qshb1.1 1 RM151– 210 F2 SSR 10.7 Percentage 32 candidate genes Yadav et al.
RM12253 (ARC10531I × BPT-5204I) (70) relative lesion identified in the region (2015)
height qShB9.2
2 qshb7.1 7 RM81– 8.8
RM615
3 qshb7.2 7 RM10– 6.7
RM2169
4 qshb8.1 8 RM21792– 4.2
RM310
5 qSBL7 (E2) 7 D760– 190 F2 (Yangdao SSR 3.12 DR (disease Sheath blight resistance is Wen et al.
RM248 4I × LemontJ) (52) and rating) correlated with plant height (2015)
InDel
(128)
6 qSBPL-7 (E2) 7 D760– 5.07 LH (lesion height)
RM248
7 qSBD-12-2 (E1) 12 RM1246– 3.74 PL (percentage of
D1252 lesion height),
DR, LH
8 qHZaLH3 3 RM143– 116 DHs (TN1I × CJ06J) SSR No correlation was found Zeng et al.
RM514 (214) between LH and PH (2015)
10 qHZaLH6 6 WX–RM587
11 qHZaDR8 8 RM1376–
RM4085
13 qHZaDR9 9 RM444–
AGPSMA
14 qHZbDR5 5 RM3321–
RM3616
15 qSB-9TQ 9 CY-85 and 235CSSLs (BC6F3) InDel – ShB resistance Fine-mapped (146 kb Zuo et al.
Y86 (TeqingI (TQ) × LemontJ) and covering region), 12 genes (2014)
CAPS were annotated
(22)
16 qDR-4 4 RM1155– 155 RILs F8:11 SSR 2.71 DR Epistasis and Liu et al.
RM 5757 (RSB02 × HH1B) (163) LL (lesion length) QTL × environment (QE) (2014)
interaction were studied
17 qRLL-4 4 RM1155– 5.84 LH
RM5757
18 qRLH-4 4 RM1155– 4.77 Relative LL
RM5757 Relative LH
19 qSB-11LE 11 Z22-27C and 112CSSLs STS – ShB resistance Fine-mapped (79 kb Zuo et al.
Z23-33C (TeqingI × LemontJ (LE) and covering region), 11 genes (2013)
CAPS were annotated
20 qRTL3 3 RM570 BILs SSR 3.5 RTL (rate of Taguchi-

(JarjanI × KoshihikariJ) (151) tillers with Shiobara
lesions) et al.
(2013)
21 qRTL5 5 RM5784 4.3
22 qRTL6 6 RM1161 7.7
23 qRTL9 9 RM6251 3.1
24 qRTL3 3 RM16200 5.9
25 qRTL6 6 RM2615 2.9
26 qRTL12 12 RM7025 3.2
27 qRTL5 5 RM3286 3.1
28 qRTL6 6 RM6395 5.8
(continued)
339
Table 4 (continued)
340

29 qRTL9 9 RM3533 3.8
30 qShB2-1- 2 RM279– 216 RILs (Jasmine SSR 3.7 ShB resistance The major QTL qShB9-2 Liu et al.
RM71 85I × LemontJ) (199) was reconfirmed based on (2013)
the field data
31 ARqShB7-AR 7 RM5711– 4.0
RM2
32 qShB7 LA 7 RM5711– 6.0
RM2
33 qShB11-1- 11 RM7203– 3.2
RM536
34 TXqShB11-2-TX 11 RM536– 3.3
RM229
35 qShB6 (wild 6 RM3431– 252 Wild-1 and 253 Wild-2 SSR 7.8 ShB resistance Colocalization of qShB6 Eizenga
1-field 2009) RM3183 BC2F2 (131) with qDH1 and qShB1 with et al.
qPH1 revealed the influence (2013)
of heading date and plant
height on resistance
36 qShB6 (wild 6 RM253– (Oryzanivara × BengalJ (O. 21.2
2-field 2009) RM3431 sativa))
37 qShB6 6 RM253– 11.1
(wild2-field RM3431
2008)
38 qShB1 (wild 1 RM431– 4.7
2-field 2008) RM1361
39 qShB6-mc 6 RM3183– 3.3
(wild-1 RM541
microchamber)
40 qsbr_2.1 2 RM8254– 197 DHs SSR 3.4– SBF (sheath Nelson
RM8252 (MCR10277I × CocodrieJ) (111) 29.7 blight disease et al.
(2012)
41 qsbr_2.2 2 RM3857– 2.9– severity in field),
RM5404 37.8 SBI (disease
severity in
microchamber)
42 qsbr_12.1 12 RM3747– 49.1 SBM (disease
RM27608 severity in mist
chamber)
43 qSBR1 1 RM11229 217 core collection of SSR 9.5% Sheath blight Jia et al.
USDA (154) resistance (2012)
and
InDel
(1)
44 qSBR11 11 RM7203 1.9%
45 qSBR1-1, 1, 2 RM5389– 121 RIL (RSB03 × HH1B) SSR 3.2, DR Fu et al.
qSBR2-1 RM3825, (123) 3.1 LL (2011)
RM5340– LH
RM521
46 qSBR2-2 2 RM110– 5.2 Relative LL
osr14
47 qSBR2-3 2 RM7245– 3.3 Relative LH
RM5303
48 qSBR4 4 RM3288– 3.8
RM7187
(continued)
341
Table 4 (continued)
342

49 qSBR5-2 5 RM7446– 4.8
RM3620
50 qSBR7 7 RM1132– 3.3
RM473
51 qSBR8 8 RM8264– 4.2
RM1109
52 qSBR9 9 RM23869– 5.0
RM3769
53 qShB1 1 RM431– 251 DHs SSR 5.18– Sheath blight Xu et al.
(2007/2008) RM12017 (BaiyeqiuI × MaybelleJ) (227) 8.03 resistance (2011)
54 qShB2 (2008) 2 RM174– 3.96
RM145
55 qShB3 (2007) 3 RM135– 3.42
RM186
56 qShB5 (2007) 5 RM18872– 4.35
RM421
57 qShB1-2 (2020) 1 184 RILs (SH × DGWGI; 5.71 Blast resistance Goad et al.
BHA × DGWGI) (2020)
58 qShB4 (2020) 4 4.50
59 qSBR3.2 3 D311 or 219 RILs 3.3 Sheath blight Yuan et al.
RM282 (LemontJ × Yangdao4I) resistance (2019)
60 qSBR7.1 7 D709 or 3.7
D715
61 qSBR8.1 8 D804 SSR 1.8
62 qSBR9.2 9 D947 or 3.0
D948
63 qSBR9.3 9 D949 2.4
64 qSBR12.1 12 D1211 2.3
65 qSBR12.2 12 D1239 or 3.6
D1246
343
Fig. 2 Physical position of major biotic disease-resistance genes in rice. The chromosome left
side indicates the location of genes and the right side shows the names of genes collected from the
Q-TARO and Oryza base databases. The color indicates the genes related to various diseases such
as bacterial leaf blight (red color) and blast (blue color), and green color indicates insect resis-
tance in rice
the pathogen races predominant in the region (Singh et al. 2001). Recent advances
in DNA sequencing have made fine-mapping and characterization of the mapped
genes easier, thus contributing significantly to the use of MAS for the development
of resistant cultivars. The complete list of cloned genes was collected from Q-TARO
(http://qtaro.abr.affrc.go.jp/) and OryGenesDB (https://orygenesdb.cirad.fr/data.
html) (Fig. 2). These genes were mainly associated with bacterial blight and blast
resistance in rice. Interestingly, the regions on chromosomes 1, 4, and 5 were asso-
ciated with multiple resistance genes, and these genes were colocalized in the same
regions. These genomic regions play a major role in the resistance/tolerance mecha-
nisms for diseases. To date, there are 46 BB R-genes mapped from different sources,
out of which 29 are dominant, 12 are recessive, nine cloned, and nine fine-mapped
(Chen et al. 2020). More than 100 R-genes (Pi) have been reported, and around 500
QTLs were associated with blast resistance. However, only 25 Pi genes were cloned
and characterized (Sharma et al. 2012; Ashkani et al. 2015). Several R QTLs were
reported against bacterial leaf streak, but their study was limited to inheritance anal-
ysis (He et al. 2012).
4.1 MAS/MABB Foreground/Background Selection
To address the limitations of conventional breeding, molecular breeding through

MAS is among the most precise tools used to introgress multiple resistance genes
into an elite varietal background at one time. Plant breeders were already successful
in using this tool in developing resistant rice cultivars by deploying broad-spectrum

multiple-R-genes with the help of MAS (Huang et al. 1997; Sanchez et al. 2000;
Sundaram et al. 2008; Hari et al. 2013; Hajira et al. 2016; Balachiranjeevi et al.
2018; Swathi et al. 2019; Jamaloddin et al. 2020). In marker-assisted backcross
breeding (MABB), a combination of foreground selection and background selection
followed by continuous backcrossing can recover up to 99% of the recurrent parent
genome (RPG) (Tanksley et al. 1989). In foreground selection, gene-linked mark-
ers, or functional markers (SSRs, InDels, and SNPs), are applied to detect the asso-
ciated R-genes in the target population at any stage of plant growth. In contrast,
background selection applied by using polymorphic information (SSRs, SNPs)
between the donor and recurrent parents can estimate RPG recovery in each back-
cross generation at any plant growth stage (Singh et al. 2001). Recently, the Green
Super Rice (GSR) breeding strategy proved that one backcross followed by selfing
could recover more than 90% of the recurrent parent genome (Balachiranjeevi
et al. 2019).
4.2 Pyramiding Disease-Resistance Genes
Pyramiding of various biotic disease-resistance genes into a rice cultivar makes it a

good candidate for breeders to introgress the resistance into locally adapted variet-
ies that produce higher yield but are susceptible to diseases. The process of gene
pyramiding through conventional breeding alone becomes difficult because the
linkage between some undesirable traits is difficult to break even after repeated
backcrossing (Tanksley et al. 1989). Pyramiding of two or more resistance genes
renders the phenotypic assessment of rice genotypes ineffective as distinguishing
the effect of each individual gene precisely becomes difficult since each gene
imparts resistance to more than one race of the pathogen. Moreover, when a domi-
nant and a recessive allele are present, the effect of the recessive gene is concealed.
The availability of tightly linked markers for each of the resistance genes thus eases
the recognition of plants with multiple genes. Initially, in rice, Huang et al. (1997)
successfully introgressed four major BB resistance genes (Xa4, Xa5, Xa13, and
Xa21) and developed breeding lines with combinations of two, three, and four
genes. In an extension of this work, several research institutions in India and other
countries have studied the effectiveness of the pyramided genes against BB disease,
to which most of the popular varieties were susceptible. This research has opened
the gates in India to address the susceptibility of popular rice varieties such as
PR106 (Singh et al. 2001), Pusa Basmati-1 (Joseph et al. 2004), and Samba Mahsuri
(Sundaram et al. 2008) by pyramiding the BB R-genes (xa5, xa13, and Xa21) in the
initial phase of improvement. Later, the improvement of popular rice varieties and
parental lines continued mainly against BB (Xa21, Xa23, xa5, xa13, Xa4, Xa7,
Xa33, and Xa38) and blast disease (Pi genes Pi2, Pi9, Pi40, Pi54, Piz, and Pi1)
separately or by combining R-genes for both diseases (Gopalakrishnan et al. 2008;
Sundaram et al. 2009; Hari et al. 2013; Balachiranjeevi et al. 2015; Yugander et al.
2018; Rekha et al. 2018; Swathi et al. 2019; Jamaloddin et al. 2020). The possibility
of recombination between the gene of interest and the linked marker has led to the
selection of false-positive rice genotypes in the marker-assisted selection process,
which could be overcome by using gene-specific functional markers (Ingvardsen
et al. 2008). Many genetic markers, also called functional markers, have been iden-
tified for different disease-resistance genes in rice, such as BB-resistance genes xa5
(Iyer-Pascuzzi and McCouch 2007), xa13 (Chu et al. 2006), and Xa21 (Song et al.
1995). The gene-pyramided lines enable the conducting of quantitative analysis to
assess the effect of each gene and interactions between them and, most importantly,
enhancing the performance, stability, and longevity of genetic resistance.
4.3 Varieties Improved and Developed
Highly accepted varieties and parental lines were improved against multiple dis-
eases through MAS. For the first time, Huang et al. (1997) developed lines pyra-
mided with two, three, and four genes through MAS and tested their resistance
against BB. The resistance levels of introgressed lines showed an elevated resis-
tance compared with lines containing a single gene. Later, Singh et al. (2001)
improved Indian rice cultivar PR106 against BB through MAS by pyramiding xa5,
xa13, and Xa21 genes, followed by Joseph et al. (2004), who improved popular
basmati variety Pusa Basmati-1, and Sundaram et al. (2008) improved popular vari-
ety Samba Mahsuri for BB and reported more than 95% RPG recovery through
MABB. Through MAS, three blast genes (Pi1, Pi2, and Pi33) were introduced in
the background of popular Russian rice variety Kuboyar. The improved lines of
Kuboyar were used to develop blast-resistant hybrids by using them as hybrid
parental lines. Similarly, Hari et al. (2011) improved restorer line KMR3R for resis-
tance against BB by transferring the Xa21 gene along with Rf3 and Rf4 (restorer of
fertility) genes through MABB. Balachiranjeevi et al. (2015) imparted resistance to
a maintainer line (DRR17B) by introgressing Xa21 and Pi54 genes against BB and
blast disease, respectively.
4.4 Multiple Disease-Resistance Breeding Strategies
In breeding for disease resistance, multiple methodologies such as pedigree, modi-

fied bulk, single seed descent (SSD), doubled-haploid (DH), and MAB have been
used to develop resistant rice varieties (Mackill et al. 1996; Khush 2005; Collard
et al. 2013). In addition to these strategies, the GSR breeding program was one of
the successful strategies that involved vigorous phenotypic screening at early back-
cross stages (BC1F2 to BC1F4) combined with three successive rounds of stringent
selection for the best plant type to come up with climate-resilient rice varieties. This
strategy could develop homozygous inbred cultivars within a short span of 4–5 years
vis-à-vis 9–10 years with a conventional breeding program (Yu et al. 2020). The
GSR breeding strategy is carried out in three steps. The first is to develop early
backcross BC1F2 populations by crossing a widely adapted recipient variety with a
diverse set of donors. Second is to simultaneously do phenotypic screening of early
backcross-derived lines of BC1F2, BC1F3, and BC1F4 generations under the different
abiotic and biotic stress conditions in a rigorous manner to identify and select intro-
gression lines (ILs) tolerant of different stresses as compared to the tolerant and
susceptible checks. The third step is the mapping of genomic regions influenced by
particular climate fluctuations and their characterization to decode the molecular
and physiological basis of the identified genomic regions (Ali et al. 2017). Three
rounds of screening of populations from BC1F2 to BC1F4 for different diseases
simultaneously could help in the development of varieties with tolerance of multiple
biotic stresses. The GSR breeding strategy led to successful mapping of the Xa39
gene and deploying it in the background of Huang-Hua-Zhang (Zhang et al. 2015).
Further, through the designed QTL pyramiding approach, one could combine selec-
tive ILs carrying different biotic and abiotic stress-tolerance genes/QTLs derived
from different donors but having a common recipient parent. Similar to the GSR
breeding program, breeders have simultaneously pyramided multiple disease-
resistance genes (BB + blast) with different combinations such as Xa21 + Pi54,
Xa21 + Pi54 + Pi2, and xa5 + xa13 + Xa21 + Pi54 + Pi2 into the background of an
elite cultivar by employing MAS and MABB (Jiang et al. 2015; Jamaloddin et al.
2020). Recently, one of the successful breeding strategies (the GSR breeding pro-
gram) revealed lots of hidden genetic diversity for disease resistance through MAS
and also proved that RPG recovery could surpass 90% with one backcross followed
by selfing (Balachiranjeevi et al. 2019). Furthermore, Feng et al. (2018) reported
that pyramiding the detected QTLs effectively broadened the genetic base. Research
is being extended to dissect the detected QTLs in order to identify candidate genes
through functional validation using a map-based cloning approach.
5 Molecular Mechanisms of Disease Resistance
A wide variety of pathogens, including bacteria, fungi, and viruses, attacks crop
plants. Either a pathogen can successfully invade, leading to the development of
disease, or the plant can resist the pathogen using an active or passive form of resis-
tance. Different strategies have been developed by various pathogens to enter, infect,
and reproduce in plants. Pathogens are mainly classified as necrotrophs and bio-
trophs based on the method they use to invade, infect, and attack a plant (Oliver and
Ipcho 2004). Necrotrophic pathogens kill the host-plant tissue soon after they estab-
lish infection and then develop and feed on the dead tissue. Unlike these, biotrophic
pathogens require a live-host tissue for their growth and reproduction.
Specific defense mechanisms work effectively against biotrophs through a
hypersensitive response developed by rapid local cell death surrounding infection,
and this serves to hinder the growth and invasion of pathogens into other plant parts.
This mechanism arises when the first level of the defense mechanism is breached by
the pathogen (Zipfel and Felix 2005). Usually, most pathogens that infect plants,
such as fungi, harbor secretory proteins, which disrupt these barriers (Serrano et al.
2014). After the entry of the pathogen into the host cell, it is recognized by special
molecules called microbe-/pathogen-associated molecular patterns (MAMPs or
PAMPs), which include ergosterol, peptidoglycan, lipopolysaccharide, and bacte-
rial flagella in proteins. The innate immune system recognizes these proteins with
the help of host plasma membrane-bound receptors called pattern recognition
receptors (PRRs) to further obstruct the growth of infection, providing MAMP-
triggered immunity (MTI). PRRs also detect molecules that become released in the
host when the pathogens cause damage (damage-associated molecular patterns,
DAMPs). The binding of these components also triggers pattern-triggered immu-
nity (PTI) and downstream defense responses (Tena et al. 2011). Overall, the recog-
nition of PAMP/MAMP or DAMP results in the activation of PTI, triggering the
production of different reactive oxygen species (ROS), initiation of mitogen-
activated protein (MAP) kinase activity, and various transcription factor activation,
thus limiting the spread of pathogens completely (Nürnberger and Kemmerling 2009).
The widely accepted model of plant disease resistance is explained by a two-
level innate immune system. The two levels include PTI, which is usually a weak,
basal, and generic immune response, and the other is effector-triggered immunity
(ETI), which is a potent response and is specific to the pathogen in question (Jones
and Dangl 2006). PTI is mediated by the PRRs that recognize molecular patterns
associated with the pathogens or the resulting damage products (PAMPs or DAMPs).
On the other hand, ETI includes recognition of a pathogen-specific factor and results
in a severe and rapid form of immune response leading to localized cell death (also
known as a hypersensitive response or HR) to hinder the pathogen from spreading
any further. ETI is achieved by a gene-to-gene interaction and is thus specific to the
race of the pathogen. While PRRs mediate PTI, ETI is mediated by specific genes
that belong to the nucleotide-binding-leucine-rich repeat (NB-LRR) domain-
containing proteins, otherwise called resistance (R) genes. The recognition of cog-
nate ligands results in activation of signaling events that in turn results in the
generation of different forms of immune response such as callose and lignin deposi-
tion, production of antimicrobial compounds, induction of cell death, changes in
primary and secondary metabolic flux, and synthesis of secondary metabolites
depending on the type of elicitors. Other classifications of genes involved in disease
resistance include major resistance (MR) genes and defense-related genes (DR),
whose roles cannot be explained by the definition of PTI- and ETI-associated genes
(Ke et al. 2017). PTI is considered to be quantitative in nature, that is, multiple
genes function together to achieve immunity, also known as a QTL. ETI against a
pathogen strain is controlled by a single gene and is specific only to those strains
that contain the cognate avirulence (Avr) protein that the R-gene recognizes, thus
leading to a qualitative resistance. Studies in the past few decades established a
framework of how the resistance mechanisms act using model pathosystems. Along
this line, rice resistance to its major pathogens such as Xanthomonas oryzae ssp.,
Magnaporthe oryzae, and Rhizoctonia solani has been studied to a reasonable
extent. However, rice resistance to other pathogens still needs more investigation to
come to a consensus. This section summarizes the established mechanisms of dis-
ease resistance in rice.
Plant resistance is dictated by the type of resistance genes and a network of sig-
naling pathways (Chisholm et al. 2006). Broadly, the plant defense system can be
categorized into two classes: basal defense and specific defense. The basal defense
system is much more effective against necrotrophic pathogens (Singh et al. 2018).
Elicitors are molecules that induce a plant defense response at very low concentra-
tions (Thakur and Sohal 2013). The role of the basal defense system is to check the
entry of pathogens and provide immunity at the starting stage of infection. This
defense response involves membrane permeability, activating ion fluxes (Ca2+, K+,
H+), generating ROS, producing nitric oxide (NO), and phosphorylation/dephos-
phorylation of proteins by protein kinases and phosphatases. It also includes the
production of signaling molecules such as jasmonic acid (JA), salycilic acid (SA),
and ethylene (ET). These proteins are characteristic players in the regulation of
defense signal transduction cascades. These steps further trigger an array of signal-
ing that leads to the regulation of the expression of defense-related genes and the
stimulation of defense responses. These responses include cell-wall strengthening
(callose and lignin deposition), phytoalexin synthesis, and activation of kinase cas-
cades escorted by a hypersensitive response (Jones and Dangl 2006).
5.1 Resistance to Bacterial Blight
To date, 46 resistance genes have been identified to confer resistance to Xoo in rice.
Among them, 11 genes were cloned and functionally characterized. Some of the
resistance genes are quantitative in nature, whereas others confer qualitative resis-
tance (Ke et al. 2017; Jiang et al. 2020; Chen et al. 2020). The 11 cloned genes fall
under different classes of resistance genes: LRR-RLKs (leucine-rich repeat receptor-
like kinases), NB-LRR, a wall-associated kinase, executor R proteins, SWEET (sug-
ars will eventually be exported transporters) genes, and a transcription factor gamma
subunit protein. Three of the cloned resistance genes, Xa3/Xa26, Xa4, and Xa21,
code for kinases. Xa4 is a wall-associated kinase (Ke et al. 2017; Jiang et al. 2020)
that provides resistance to certain races of Xoo through cell-wall reinforcement.
Xa3/Xa26 and Xa21 are LRR-RLKs that recognize Xoo-associated molecules
AvrXa3 and sulphated RaxX, respectively. Xa21- and Xa3/Xa26-mediated resis-
tance has been found to be positively regulated by OsSERK2 (rice somatic embryo-
genesis receptor kinase 2). Nine genes were found to be regulating Xa21-mediated
resistance positively or negatively. Xa4-mediated resistance leads to the accumula-
tion of phytoalexins. Xa1, an NB-LRR, recognizes intact transcription activation-
like effectors (TALEs) from Xoo and thus leads to resistance. SWEET genes code
for sugar transporters and were identified to be targets of different Xoo TALEs,
thereby acting as susceptibility factors. Natural polymorphisms were identified in
the promoters of three SWEET genes, OsSWEET11/Os8N3/xa13, OsSWEET13/
xa25, and OsSWEET14/Os11N3/xa41, which promote their induction by cognate

TALEs, thus providing recessive resistance. Genes, including Xa10, Xa23, and
Xa27, are classified as executor R-genes as the expression of the respective resis-
tance alleles is induced by Xoo TALEs. These genes are characterized by the pres-
ence of multiple potential transmembrane domains whose expression induction
results in HR and thus resistance to Xoo. Another recessive resistance gene, xa5,
codes for transcription factor IIA gamma subunit 5 (TFIIAγ5) with valine to gluta-
mine mutation in the 39th position. The susceptible allele, Xa5, is hijacked by the
TALEs to induce the expression of other host susceptibility genes. The mutation
disrupts the ability of TALEs to bind to TFIIAγ5, thus leading to resistance (Ke
et al. 2017; Jiang et al. 2020).
5.2 Resistance to Bacterial Leaf Streak
To date, no major BLS-resistance genes have been identified. However, the xa5
gene was mapped to be a major resistance QTL for Xoc resistance. It was previ-
ously observed that TALEs from Xoc also hijack TFIIAγ5 for inducing host
susceptibility genes. In another study, Xo1, a resistance locus in an American
rice variety, was identified to be responsible for resistance to African Xoc strains
but not to Asian strains. Xa21 was identified to provide weak resistance to Xoc
through the recognition of Ax21, a quorum-sensing molecule produced by Xoc
(Jiang et al. 2020). Three major broad-spectrum resistance QTLs, qXO-2-1,
qXO-4-1, and qXO-11-2, were identified to confer resistance to Xoo and Xoc
(Bossa-Castro et al. 2018).
5.3 Resistance to Rice Blast
More than 100 resistance genes and 500 QTLs are known to be associated with
blast resistance in rice. However, to date, only 25 genes have been cloned (Li
et al. 2019b). These 25 cloned R-genes are called Pi genes. Of the 25 Pi genes,
22 encode NB-LRR family proteins. A majority of these R-genes trigger ETI,
thus leading to qualitative or race-specific resistance. So far, seven R-genes have
been identified to confer broad-spectrum resistance to blast: Pi7, Pi9, Pi21,
Pi50, Pi57, Pigm, and Ptr. Apart from canonical R-genes, so far, five defense-
related genes were also shown to confer resistance to blast: bsr-d1, bsr-k1,
spl11, spl33, and OsBBI1, Pi9, Pi50, Pigm, Ptr, and OsBBI1 are dominant resis-
tance genes or positive regulators of blast resistance, whereas the rest of them
are recessive resistance genes, in other words, their wild-type alleles negatively
regulate blast resistance (Li et al. 2019b).
5.4 Resistance to Sheath Blight
Information on the mechanisms that govern ShB resistance in rice is just being
uncovered. There are no reports on a single resistance gene that confers resistance
to ShB. However, many QTLs have been identified to be associated with ShB resis-
tance. Most of the QTLs were reported to provide a minor contribution to the resis-
tance phenotype, whereas two QTLs (qShB9-2 and qShB11-1) were found to
contribute more than 10% to ShB resistance. Sequence analyses revealed the pres-
ence of various defense-associated genes in these QTLs. qShB9-2 was identified in
many rice varieties that exhibit resistance to ShB. It was observed that qShB9-2
contains a β-1,3-glucanase, OsWAK91, and 12 other possible candidate genes. On
the other hand, the qShB11-1 interval was shown to have receptor-like kinases, a
lipase, and a tandem array of 11 chitinase genes. Tens of minor QTLs were found to
be associated with ShB resistance. Nevertheless, no information is available on the
gene(s) responsible for the resistance. Studies using resistant cultivars shed light on
the possible mechanisms by which rice fights Rhizoctonia solani. Various studies
showed changes in metabolic pathways, including primary and secondary metabo-
lites. Intermediates of glycolysis and tricarboxylic acid cycle were found to be accu-
mulated in rice post R.solani infection, indicating the possible involvement of
primary metabolism in response to the pathogen. Also, the accumulation of second-
ary metabolites such as phytoalexins, chlorogenic acid, polyphenols, and flavonoids
was reported to be higher in the tolerant varieties than in the susceptible varieties
postchitin treatment (Molla et al. 2020). ROS deregulation has been observed to
delay pathogen colonization in resistant cultivars (Oreiro et al. 2019).
5.5 Broad-Spectrum Resistance Genes
From a breeder’s point of view, a single locus/gene is more preferred as it would

permit easier introgression. Many defense-related genes have been identified to pro-
vide broad-spectrum resistance to either multiple races of a pathogen (vertical resis-
tance) or multiple pathogens altogether (horizontal resistance). Such responses are
quantitative in nature and hence can be highly durable and practical to keep infec-
tious diseases at bay. Several previous studies have been reported that the expres-
sion of defense-response genes (DR genes) such as rice germin-like proteins
(OsGLP) or a class of DR genes present in a QTL along with R genes is also most
probably associated with rice resistance, as knockdown of these genes escalated the
susceptibility against two major rice fungal diseases, blast and sheath blight
(Manosalva et al. 2009). OsPAL4 is reported to impart broad-spectrum resistance to
rice (Tonnessen et al. 2015). A LysM receptor-like kinase (RLS), OsCERK1, regu-
lates cytoplasmic OsRLCK176 and OsRLCK185 recognizes chitin and peptidogly-
cans activating immune signaling pathways in rice against blast and bacterial blight
diseases. OsSERK1, OsWAK25, OsWRKY45-1, OsWRKY45-2, OsWRKY13, OsDR8,
OsMPK6, OsPAL4, OsNH1, OsLYP4, OsBSR1, and OSK35 have all been shown to
regulate resistance to bacterial blight and rice blast positively. OsPAD4 and OsPAL4
positively regulate resistance to ShB, whereas OsWAK25 negatively regulates ShB
resistance (Ke et al. 2017). These genes, although identified in different studies,
play a highly connected role in helping rice fight the invading pathogens. More
comprehensive studies are needed to link the dots to construct a complete map of
rice resistance to diseases.
6 I mpact of Major Nutrient Fertilizers on Biotic Disease

Resistance in Rice
The rapidly increasing world population requires a sustainable nutritional global

food supply, which is a significant concern for crop production. Changing climatic
scenarios and decreasing natural resources suggest that there is a need to intensify
agricultural production using an efficient agronomic nutrient management (ANM)
system. Following efficient ANM technologies can enable us to understand and
mitigate the adverse impacts of stress, inadequate soil fertility status, pathogens,
and pests (Dordas 2008).
Several efficient screening technologies exist, such as smart water irrigation sys-
tems, integrated fertilizer applications, and disease biocontrol strategies, that have
been developed and adopted in different ecosystems to control various diseases in
rice (Bargaz et al. 2018). Among these, the rate of fertilizer used, judicious and
timely applications of nutrients, and availability of these nutrients play a crucial role
in plant growth and also in developing defense mechanisms against various pests
and diseases (Fageria et al. 2008; Sun et al. 2020). The management of nutrient
statuses in the soil, especially nitrogen (N), phosphorus (P), and potassium (K), is
an eco-friendly strategy to control different biotic stresses instead of frequent appli-
cation of pesticides. Globally, the efficiency of fertilizer use by the crop and the
correct rates of fertilizer applications are poorly studied. Earlier studies have indi-
cated that only 30–35% of N, 10–25% of P, and 35–50% of K are taken up by plants.
Particularly in China, the amount of fertilizer used has increased drastically from
270 to 350 kg/ha, which is more than 75% of the global average of fertilizer applica-
tion. This excessive amount of N fertilizer leads to leaching, which is a significant
cause of groundwater pollution and degradation of soil quality (Teng et al. 2016).
Developing sustainable agriculture is one of the major strategies to increase
global rice production. Application of nutrient fertilizer at the right rate and stage
and also microorganisms are the key factors in disease control. The essential nutri-
ent elements can decrease disease severity but also increase the severity of disease
incidence (Dordas 2008). Nitrogen is one of the key elements for plant growth and
development, which are involved in the major physiological and metabolic path-
ways related to N assimilation (Bolton and Thomma 2008; Mur et al. 2017). Plenty
of research has been conducted on the role of N and its interaction with disease
resistance and the results are inconsistent, with a poor understanding of the resis-
tance mechanisms in physiological and metabolic pathways. These differences may
be due to various stress signaling mechanisms caused by the different forms of N
(NH4+ and NO3−), the type of pathogen specificity, and the stage of N application
(Dordas 2008). However, several researchers have suggested that the correct time
application of fertilizers has been significantly increasing disease resistance and
decreasing the use of fungicides (Anderson 2002; Hervieux et al. 2002; Bhat et al.
2013). Recently, Sun et al. (2020) reviewed N applications and their critical role in
the defense mechanisms in various diseases such as blast, downy mildew, stem rot,
powdery mildew, leaf rust, stem rust, and rice blast diseases in plants. Balancing of
these nutrients is imperative to understand the cellular structure and composition,
which mainly affect plant defense mechanisms. For instance, high rates of N appli-
cation lead to a significant impact on susceptibility by decreasing the thickness of
cell-wall components (cellulose and lignin), whereas decreasing N applications lead
to an increase in lodging resistance by changes in stem lignification and secondary
cell-wall synthesis (Zhang et al. 2017b; Sun et al. 2018). Also, decreasing N fertil-
izer significantly increases the incidence of major insect pests, including brown
planthopper, leaffolder, and stem borer, the key insect pests in the major rice-
growing areas in Asian countries (Lu et al. 2007). Some reports have suggested that
N applications significantly influence the size of leaf blast lesions (Matsuyama
1973; Kaur et al. 1979). Sime et al. (2017) studied the different rates of nutrient
fertilizer application and their relation to blast disease. The combination of NPK
(20-10-10) at a rate of 200 kg/ha has a remarkable impact on decreasing blast dis-
ease in all phases of plant growth. Similarly, Reddy et al. (1979) reported an optimal
rate of N application (76 kg/ha) to maximize grain yield and also minimize disease.
One of the major diseases is bacterial leaf blight of rice, caused by Xanthomonas
oryzae, which increased significantly when a higher amount of N fertilizer (>100 kg/
ha) was applied, and yield decreased. Begum et al. (2011) reported that a balanced
application of nutrient fertilizers, including K, significantly decreased the percent-
age of BLB. The application of K fertilizer has dramatically decreased the intensity
of various infectious diseases such as BLB, sheath blight, and stem rot in rice, and
also in other cereal crops (Sharma et al. 2005a). Decreasing BLB severity by apply-
ing K topdressing is a viable approach just before disease-occurring stages and this
makes it possible to maximize grain yield and have lesser disease development.
Using slag-based silicon (Si) fertilizer in rice fields is an alternative approach to
control the major disease brown spot, which is caused by the fungus Bipolaris ory-
zae. This disease causes significant yield losses, mainly in tropical and subtropical
areas, where the frequent occurrences of heavy rainfall and high temperature are the
main factors in decreasing the Si content in highly weathered soils (Raven 2003).
The major role of these Si applications is to mediate resistance mechanisms through
the physiological and metabolic pathways that can lead to creating more pronounced
cell silicification in rice leaves, and the strong leaf epidermal surface might increase
the resistance to fungal penetration (Hayasaka et al. 2008; Sun et al. 2010; Ning
et al. 2014). These Si fertilizers provided clear evidence showing the importance of
increasing the thickness of the silicon layer in the epidermal cell walls that are
supposed to be the main site for conferring resistance to brown spot disease in rice.
Interestingly, Wu et al. (2017) experimented with the transcriptional responses in
two different nutrient fertilizers, Si and N concentrations, and their relation to BPH
infestation. These two elements had a trade-off mechanism in terms of resistance.
The interaction of these two elements clearly showed decreases in the expression of
Si transporters such as OsLsi1 and OsLsi2 under high rates of N application,
whereas, in the N transporters OsNRT1:1, OsGS2, OsFd-GOGAT, OsNADH-
GOGAT2, and OsGDH2, expression increased under a high rate of Si fertilizer. This
demonstrated that N and Si had antagonistic interactions in rice (Wu et al. 2017).
Similarly, Robichaux (2001) identified a significant decrease in the major disease
sheath blight, caused by the fungal pathogen Rhizoctonia solani, by adding calcium
silicate in greenhouse and field conditions. Rice grain yield is increased by almost
13% from the use of a calcium silicate application rate of 3.3 mg/ha and also a sig-
nificant decrease in ShB in different soil types. These results have proven that Si
fertilizer can diminish fungal disease severity by increasing the Si concentration in
rice leaves and boosting grain yield.
7 Genome-Editing Tools for Improving Disease Resistance
Diseases cause a considerable yield loss annually (Heinrichs and Muniappan 2017;
Mushtaq et al. 2019). Breeding for disease resistance has been pursued for a long
time. The traditional practice is to introgress disease resistance into elite cultivars
through breeding techniques. Although a successful method, it has its downside
(Zafar et al. 2020). The traditional way is time-, labor-, and resource-consuming
(Romero and Gatica-Arias 2019). With the arrival of the genomics era, identifying
disease-resistance genes has become highly efficient, and resistance alleles can be
identified at a single base resolution. With such a massive potential in hand and
constant improvement in various genome-editing (GE) tools such as site-specific
mutagenesis (SSM), meganucleases (MNs), zinc-finger nucleases (ZFNs), tran-
scription activator-like effector nucleases (TALENs), and clustered regularly inter-
spaced short palindromic repeat (CRISPR)/CRISPR-associated protein (CRISPR/
Cas), this has opened a novel path to achieve the improvement of disease resistance
in various crops (Zhang et al. 2017a; Mishra et al. 2018; Zafar et al. 2020). Recently,
several researchers have reviewed the various GE tool applications and their limita-
tions in target gene specificity and accuracy (Abdallah et al. 2015; Mishra et al.
2018; Zafar et al. 2020). As compared with SSM, MNs, and ZFNs, the most widely
used GE tools such as TALENs and the CRISPR/Cas system have a versatile, fast,
and relatively efficient GE method. Over the past several years, these two methods
have transformed the field of genome engineering, and they can easily edit and also
recognize specific genomic regions (Gaj et al. 2016). These methods have a signifi-
cant impact on the genomic revolution that has accelerated the discovery of novel
sequence variations and breakthroughs in the scientific knowledge to demonstrate
the power of these GE tools in establishing resistance to pathogens in various
diseases. The rapid progress in the CRISPR-Cas9 system makes it a highly accurate
and efficient method that can edit in multiple genes at multiple locations using a
single molecular construct (Cong et al. 2013).
7.1 Site-Specific Mutagenesis: The Path So Far
Site-specific mutagenesis is achieved by deploying a class of enzymes called

“nucleases” fused with DNA-binding motifs to target specific sequences in the
genome. The activity of nuclease results in double-strand breaks at the target site,
which are then repaired by the host DNA repair mechanisms via nonhomologous
end joining (NHEJ) or homologous recombination (Feng et al. 2013). During this
process, small insertions or deletions occur in the genome, thus disrupting the gene
sequence (Mishra et al. 2018). SSM is an evolving area of research with newer tools
often emerging with improved precision and efficiency.
7.1.1 Meganucleases
Meganucleases (MNs) are endonucleases (enzymes that cut within a strand) that
occur naturally and possess sequence-specific DNA-binding and nuclease activities.
The application of MNs for site-targeted mutagenesis began in the 1980s. Owing to
the recognition of long DNA sequences (18–40 bp), MNs were a good choice. On
the other hand, the number of naturally occurring MNs was limited, thus diminish-
ing their wider application. Moreover, custom modification of MNs is a viable but
expensive option (Abdallah et al. 2015).
7.1.2 Zinc-Finger Nucleases and TALENs
Zinc-finger nucleases (ZFNs) kick-started the wider application of site-specific

mutagenesis in 1996 (Kim et al. 1996). The zinc-finger motif is one of the most
copious DNA-binding motifs present in eukaryotes (Klug and Schwabe 1995). Each
ZF motif recognizes a specific 3-bp sequence in the major groove of DNA. Thus,
tandemly placing multiple ZF motifs of different base specificity and fusing them to
a nuclease can result in the generation of a molecular scissor that can precisely cut
the target site. Modular assembly-based methods enabled the construction of ZFNs
that can virtually target any DNA sequence (Gaj et al. 2013). However, limitations
of using ZFNs exist. The modular assembly is a complex and expensive process that
requires many optimizations. Off-target cleavage is another challenge that many
SSM techniques face (Ramirez et al. 2008; Gupta and Musunuru 2014).
Transcription activator-like effectors (TALEs) are proteins that naturally occur in
the genus Xanthomonas, which predominantly consists of phytopathogenic bacteria
(Boch et al. 2009; Moscou and Bogdanove 2009). TALEs are employed by
Xanthomonas oryzae pv. Oryzae (Xoo) to target and activate the expression of spe-
cific host genes to increase the susceptibility of the host. The specific binding to
DNA is achieved by a 33–35-amino-acid-long tandem repeat domain, each of which
targets a specific base. The base specificity is conferred by the amino acids that are
located in the 12th and 13th positions of the series. These positions are called repeat
variable di-residues (RVDs) (Boch et al. 2009; Moscou and Bogdanove 2009; Gaj
et al. 2013; Abdallah et al. 2015). Exploiting this brought in a revolution in the field
of genome editing called TALENs. TALENs are TALE nucleases wherein the DNA-
binding motif of a TALE is fused with a catalytic domain of a nuclease, thus allow-
ing the domain to target and cleave a specific sequence in the genome. By modifying
the RVDs, one could define the target site and thus assemble a custom TALEN to
target any region of interest in the genome (Christian et al. 2010; Boch 2011). The
design and delivery of TALENs, however, pose a setback for the technique owing to
their large size (Abdallah et al. 2015).
7.1.3 CRISPR-Based Genome Editing
Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-

associated (Cas), collectively called CRISPR-Cas, is a microbial adaptive immune
strategy that works based on an RNA-guided nuclease complex to cleave foreign
genetic elements. A CRISPR-Cas locus is a cluster of Cas genes, noncoding RNA,
and an array of repetitive elements. The repeated elements are interspaced with
protospacers (short variable repeats that are derived from foreign DNA targets).
Together, the noncoding RNA and protospacers constitute the CRISPR RNA
(crRNA). Each protospacer is associated with a protospacer adjacent motif (PAM)
that differs between the types of CRISPR systems. Depending on the organization
and composition of the nuclease genes, the CRISPR-Cas system is classified into
Class I and Class II. Each class has three types of CRISPR-Cas system each. The
Class I CRISPR system is less used owing to its limited knowledge and associated
complexities. The Class II system, on the other hand, is a well-characterized and
highly used genome-editing system. Class II is further subclassified into three types
(types II, V, and VI) based on the specificities for nucleotide substrates, PAM, and
the Cas genes that affect the substrate cleavage (Koonin and Makarova 2019; Moon
et al. 2019). A brief overview is discussed below.
CRISPR-Cas9 from Streptomyces pyogenes is the founding system for CRISPR-
based genome editing, which is economical, easier, and more efficient. Cas9 is an
RNA-guided nuclease that causes double-strand breaks in the genomic region that
is complementary to the crRNA provided that the 3′ of the DNA sequence is
5′-NGG-3′ (G-rich PAM). In addition, the CRISPR-Cas9 system needs a trans-
acting crRNA (tracrRNA) to be functional (Deltcheva et al. 2011; Jinek et al. 2012).
Cas9 proteins of different bacterial origins have different PAM specificities, spacer
lengths, and sizes. Improvements in the techniques made it possible to multiplex
genome editing with the use of polycistronic tRNA-gRNA (PTG), wherein the
tRNA processing system is used to construct a tandem array of tRNA and gRNA
(attached to the spacer), which would be transcribed as a full primary transcript that
is later processed and cleaved to release individual single-guide RNAs (sgRNAs),
each of which targets a unique region in the genome (Zafar et al. 2020).
Cpf1, also known as Cas12a, belongs to the type V CRISPR-Cas system. Unlike
Cas9, Cas12a does not need tracrRNA for the complex to be functional and it rec-
ognizes a 5′ T-rich PAM sequence (5′-TTTN-3′ or 5′-TTN-3′) (Zetsche et al. 2015).
Also, Cpf1 exhibits RNase activity that can cleave pre-crRNAs to mature crRNA,
thus enabling the possibility of including multiple crRNAs in a single cassette. Cpf1
allows the use of longer gRNAs of up to 100 nt (Zetsche et al. 2015; Mishra et al.
2018). This system is gaining usage because of its higher specificity and enhanced
efficiency. Advances are made in terms of increasing the range of targets by engi-
neering the complex to target other PAMs.
Base editing can be used to modify single bases in the genome, thus opening an
avenue to increase the allelic diversity of the genes and also to create specific muta-
tions to alter a gene function. The use of the CRISPR-Cas system achieves this in
conjunction with base-modifying enzymes such as cytidine deaminase (to induce
C:G to A:T mutations) or adenine deaminase (to induce A:T to G:C mutations).
Base-editing techniques eliminate the need for double-strand breaks and thus the
activation of DNA repair pathways (Lu and Zhu 2017; Hao et al. 2019).
Gene knock-in thus far required double-strand breaks and activation of homology-
directed repair (HDR), which uses a donor template (carrying the gene copy to be
knocked-in) to incorporate the new copy in the genome. This technique is extremely
limited because of the less frequent and cell cycle stage-dependent nature of
HDR. Also, the effective delivery of the donor template has posed a serious chal-
lenge. To overcome this, an elegant method was devised, called prime editing. Prime
editing depends on a two-component system that includes (1) Cas9 nickase fused
with a reverse transcriptase and (2) a prime editing guide RNA (pegRNA) that car-
ries the desired edit(s) to be incorporated into the genome. Once delivered, the com-
plex is guided to the target site by pegRNA and a nick is created in the genome. The
nicked DNA serves as a primer that the reverse transcriptase uses to reverse tran-
scribe the pegRNA, thus incorporating the edit into the genome (Anzalone et al.
2019; Lin et al. 2020). All the above-discussed techniques were successfully applied
in rice and other plant species to edit various genes. The following few paragraphs
will provide a glimpse of the application of genome editing in rice, focusing mainly
on disease resistance.
7.2 pplication of Genome Editing in Biotic Stress

A
Tolerance in Rice
Conventional breeding has been successfully employed to date to develop disease-

resistant rice varieties by introgressing resistance genes from wild rice varieties or
landraces into elite cultivars. Although successful, it is a time-consuming
procedure, and also the wild germplasm does not contain genes/loci for all the eco-
nomically important traits that are of concern for breeders. With the advent of
genome editing, several research groups started testing the possibility of using
genome editing in rice and were by and large successful.
7.2.1 Resistance to Biotic Stress Factors
Genome editing has been successfully employed to generate rice plants resistant to
various biotic stress factors, including bacterial blight, bacterial leaf streak, blast,
and tungro virus. The application of genome-editing techniques for BB resistance
began with modifying the promoter of a BB susceptibility gene, OsSWEET14
(Os11N3), using TALENs (Li et al. 2012). SWEET genes are sugar transporters, and
the expression of certain SWEET genes is induced upon Xoo infection by the action
of TALEs. So far, the SWEET genes, including OsSWEET11, OsSWEET12,
OsSWEET13, OsSWEET14, and OsSWEET15, have been shown to be induced by
Xoo and could act as susceptibility factors (Streubel et al. 2013). TAL effectors bind
to the effector-binding elements (EBEs) in the target promoter and activate the
expression of the downstream gene, which tends to be a susceptibility factor in
many cases. Different TAL effectors induce many such susceptibility genes, and
their cognate EBEs were also deciphered. Li et al. (2012) have successfully
employed TALENs to modify the EBEs of OsSWEET14. This study established the
possibility of using genome-editing techniques to generate disease-resistant variet-
ies as well as to understand the targets of different TAL effectors. Jiang et al. (2020)
have conducted a proof-of-concept study to confirm the applicability of the CRISPR-
Cas9 system in rice by editing the promoters of OsSWEET11 and OsSWEET14
genes (Jiang et al. 2013). In a study using CRISPR-Cas9, Zhou et al. (2015) created
a null mutant of OsSWEET13 to show that PthXo2 (an Xoo TAL effector)-depen-
dent disease occurrence needs intact OsSWEET13. Xu et al. (2019) used CRISPR-
Cas9 to edit OsSWEET11 and OsSWEET14 to engineer broad-spectrum resistance
to BB in rice variety Kitaake. In addition to that, they identified new EBEs in the
promoter of OsSWEET13 and successfully used CRISPR-Cas9 to disrupt the EBE,
thus generating a rice line that was resistant to all the tested Xoo isolates (n = 133)
(Xu et al. 2019). Oliva et al. (2019) generated five mutations in the promoters of
OsSWEET11, OsSWEET13, and OsSWEET14 in three rice lines, Kitaake, IR64, and
Ciherang-Sub1. All the lines were reported to show robust and broad-spectrum
resistance in the paddy trials (Oliva et al. 2019). Zhou et al. (2018) used CRISPR-
Cas9 to create a knockout of a susceptibility gene called BsrK-1 (broad-spectrum
resistance Kitaake-1), which resulted in resistance to BB as well as blast. BsrK-1 is
a tetratricopeptide domain-containing protein that was shown to bind to the mRNAs
of multiple OsPAL (phenylalanine ammonia-lyase) genes and promote their turn-
over. In BsrK-1 knockouts, the accumulation of OsPAL mRNA was observed along
with increased resistance to diseases (Zhou et al. 2018). The feasibility of the
transgene-free method of genome editing was tested by mutating Os8N3/

OsSWEET11 (Kim et al. 2019). Cai et al. (2017) demonstrated that a TAL effector
(Tal7) from X. oryzae pv. oryzicola RS105 targets the promoter of rice Cyclin-D4-1
and induces its expression. They have successfully applied TALEN-based genome
editing to disrupt the EBE in the promoter of Cyclin-D4-1, which leads to resistance
to RS105 infection.
The applicability of CRISPR-Cas9 for generating blast-resistant rice lines has
been demonstrated by performing both single-site and multisite-targeted mutagen-
esis of OsERF922, a negative regulator of blast resistance, to produce knockouts.
All the mutants showed blast resistance while not having any adverse effect on other
agronomic traits (Wang et al. 2016). Rice tungro disease (RTD) is a disease caused
by rice tungrospherical virus (RTSV) and rice tungrobacilliform virus (RTBV) and
is transmitted by green leafhoppers. RTD results in yellowing of leaves, decreased
tiller numbers, and stunted growth (Azzam and Chancellor 2002; Lee et al. 2010).
Macovei et al. (2018) generated RTSV-resistant lines in the background of IR64
using the CRISPR-Cas9 system. In this study, the eIF4G gene was successfully
mutated independently, using three different gRNAs, and the mutant plants showed
heritable resistance to RTSV (Macovei et al. 2018).
7.2.2 Summary of Nonbiotic Stress-Related Phenotypes
The application of genome editing in rice is rising with time. Other than for biotic
stress tolerance, genome editing has been successfully applied to edit several genes
having various roles, including nutritional value, yield, and abiotic stress tolerance
(Shan et al. 2015; Li et al. 2016; Sun et al. 2016; Shen et al. 2017; Tang et al. 2017;
Abe et al. 2018; Endo et al. 2019; Romero and Gatica-Arias 2019).
7.3 Improvements in the Techniques
Currently, transgene-free methods are being tested and employed for genome edit-
ing wherein the mutant plants do not contain any of the CRISPR-Cas9 components.
This is achieved in several ways, including using Cas9-gRNA ribonucleoproteins
(RNPs). This RNP complex is directly delivered into plant cells by transfection or
particle bombardment. The RNP complex can perform the editing and will be
degraded by the cellular types of machinery. Another approach is to transiently
express CRISPR-Cas9 from DNA or RNA in plants from regenerated calli. Both
methods suffer from the possibility of component degradation, which might lead to
less-efficient editing. To eliminate this disadvantage, He et al. (2018) came up with
the suicide gene-based method of a transgene-free CRISPR-Cas9 approach in rice.
In this method, a pair of suicidal genes, encoding toxic proteins that kill plant cells,
are incorporated into the CRISPR-Cas9 cassette. Therefore, no plant with a

CRISPR-Cas9 construct will survive, thus eliminating the plants containing the
transgenes. Among other surviving plants, the true mutants can be screened and
identified using appropriate techniques. In addition to protein-coding genes, miR-
NAs are being targeted for editing owing to their involvement in various growth,
development, and stress-response pathways. The use of the CRISPR-Cas system to
edit miRNAs has been functionally validated in rice (Zhou et al. 2017; Mangrauthia
et al. 2017).
8 ioinformatics Tools for Disease Resistance

B
and Management
Bioinformatics is an interdisciplinary field that uses computational tools to

capture and interpret the function of various genes. The advent of genomics has
revolutionized every aspect of life science. The availability of a large amount of
data has necessitated better ways to analyze, interpret, and organize the results
for the scientific community (Bayat 2002; Vassilev et al. 2005). Thousands of
databases and repositories are available for various datasets such as for the
genome, gene and protein sequences, expression and coexpression of genes,
and genomic variations such as SNPs and InDels, to name a few (Garg and
Jaiswal 2016). With time, sequencing platforms have seen an astounding revo-
lution and are becoming more efficient and affordable day by day. Since the
first report on the whole-genome sequence of rice in 2005, many varieties were
further sequenced as a part of the 3000 Rice Genomes Project (Matsumoto et al.
2005; Li et al. 2014). The data obtained from the project resulted in establishing
rice variation databases and these data have provided invaluable insights into
rice evolution and domestication (Chen et al. 2019). Moreover, the readily
available data can guide breeders to wisely choose varieties and markers for
breeding various traits from one cultivar to another. Procedures to score the
expression of genes have also undergone an overwhelming transformation from
methods such as serial analysis of gene expression (SAGE) to microarrays to
RNA-sequencing (Perez-de-Castro et al. 2012). As a result, other than genome
databases, gene and protein expression databases play an important role in elu-
cidating the various mechanisms that control a given trait, such as days to flow-
ering, growth and development, abiotic stress tolerance, and disease resistance,
among others. Multiple other tools and databases are available to study and
acquire information on different aspects, including phylogenomics, protein-
protein interaction, promoter analysis, gene and QTL information, marker-trait
association, and metabolite profiles (Garg and Jaiswal 2016). This section aims
to provide an overview of the application of bioinformatics in breeding for dis-
ease resistance in rice.
8.1 The Role of Bioinformatics in Mapping Genomic Loci
8.1.1 Mapping QTLs and Genes Associated with Disease Resistance
Mapping the loci responsible for a desired trait has been successfully carried out for
years using a conventional method such as simple sequence repeat (SSR)-based
genotyping of a mapping population. With the arrival of affordable sequencing tech-
niques, QTLs and genes can now be mapped at a gene-level resolution. Methods
such as MutMap and QTLseq have made it possible not only to identify the genomic
locus responsible for a trait but also to pinpoint the causal variation within a gene
that led to the phenotype (Abe et al. 2012; Takagi et al. 2013b). Thus, SNP markers
that are highly associated with a trait can be identified and employed in breeding
programmed for efficient introgression of the trait. In a proof-of-concept study,
Takagi et al. (2013a) had identified a QTL conferring partial resistance to blast dis-
ease of rice. Following this attempt, multiple studies have successfully used this
procedure to map QTLs for various traits in rice and other species. A rice blast
resistance gene called Pii was mapped by another method called MutMap-Gap
(Takagi et al. 2013b).
Sequencing data have been successfully used to compare the genomes of differ-
ent cultivars and obtain the resistance alleles of cloned rice blast resistance genes
(Mahesh et al. 2016). Genes with highly repetitive sequences pose a challenge in
accurately characterizing them in context with short-read sequences. A recent study
by Read et al. (2020) addressed this challenge by using a long-read sequencing
approach called nanopore sequencing in combination with Illumina sequencing to
assemble the genome of American rice variety Carolina Gold Select and identify
529 complete or partial NB-LRR domain-containing protein genes that are highly
repetitive in nature. The study identified a major disease resistance locus called Xo1
that confers resistance to Xanthomonas oryzae pv. oryzae (the causal agent of bacte-
rial blight of rice) and X. oryzae pv. oryzicola (the causal agent of bacterial leaf
streak of rice). Also, a blast resistance gene called Pi63 at the Xo1 locus was identi-
fied (Read et al. 2020). Another study compared the genomes of 13 domesticated
and wild rice relatives and shed light on the complex phylogeny of the Oryza genus
and identified many haplotypes of disease-resistance genes that can be of potential
use for breeding (Stein et al. 2018). Using the genome sequence of rice variety
Tetep, an extensive set of molecular markers was designed for breeding novel resis-
tant varieties (Wang et al. 2019).
8.1.2 Genome-Wide Association Studies
Genome-wide association studies (GWAS) exploit the natural variation among dif-
ferent cultivars to identify trait-associated genes (Hu et al. 2018). This is one of the
preferred methods for the identification of gene targets for breeding. The availabil-
ity of genome sequences and phenotype data, along with powerful statistical and
bioinformatics tools, have made it possible to analyze hundreds or thousands of

genomes in one go and identify genes and haplotypes that are associated with given
traits. A GWAS on 373 indica rice sequences identified SNPs associated with 14
different agronomic characteristics (Huang et al. 2010). A GWAS with a panel of
584 rice accessions led to the identification of a gene called PiPR1 that confers
partial resistance to blast disease of rice (Liu et al. 2020). Other GWAS have identi-
fied tens of QTLs and new alleles of known blast-resistance genes (Li et al. 2019a).
8.1.3 Speeding Up Breeding
The main setback with conventional breeding methods is the time taken for devel-
oping a new variety. Also, for durable disease resistance and other complex traits, it
is essential to efficiently identify minor-effect QTLs and use the associated markers
in breeding programs. The existing methods, including QTL mapping from biparen-
tal crossing and GWAS, are not up to the mark to efficiently identify such minor-
effect QTLs (Bhat et al. 2016). To address both of these concerns, genomic selection
(GS) was proposed (Meuwissen et al. 2001). Unlike MAS, GS does not necessarily
need QTL information before selection. GS uses reference population data contain-
ing phenotype and high-density marker data to predict breeding values for all the
markers. Based on the predicted values, the breeding population data will be ana-
lyzed to select the individual that possesses the desirable phenotype (Perez-de-
Castro et al. 2012; Hu et al. 2018). In this way, it is possible to introgress even
minor-effect QTLs efficiently, as there are no biased marker effects, unlike with
MAS. Studies on other plant species have shown the higher prediction accuracy of
GS in genetic gains and a significant decrease in the time taken for breeding (Hu
et al. 2018). Although proposed two decades ago, the implementation of GS in crop
breeding has just begun, mainly because of the advent of high-throughput and
affordable genotyping methods that produce dense marker information such as
genotyping-by-sequencing and automated phenotyping (Bhat et al. 2016). Given
the importance of disease-resistance breeding in rice, the application of GS could be
of tremendous benefit.
8.1.4 Using Machine Learning and Artificial Intelligence
The field of computational biology is advancing at an unprecedented rate with the

arrival of machine learning (ML) and artificial intelligence (AI). In ML, the machine
gains experience by identifying patterns in given datasets and using that experience
to interpret the data in question. ML has applications in various aspects of plant sci-
ences, including phenotyping and increasing the accuracy of sequence analysis
pipelines, such as differentiating true SNPs from spurious SNPs (Hu et al. 2018).
ML was successfully used to phenotype and categorize foliar stresses in soybean
with high accuracy (Ghosal et al. 2018). Various parameters such as yield, develop-
mental stage, weed status, crop quality, water and soil management, and disease
occurrence were successfully predicted using ML (Liakos et al. 2018). In rice,
bakanae disease (caused by Fusarium fujikuroi) was predicted with an accuracy of
87.9% using support vector machine classifiers, a popular ML tool that is often used
to overcome classification and regression problems (Chung et al. 2016). Although
few in number, these studies have put forth the applicability of advanced computa-
tional strategies to improve agriculture.
9 Future Prospects and Conclusions
The rice crop plays an essential role in ensuring global food security and providing
nutritional security for the rapidly growing world population. Increasing grain yield
is a significant target for plant breeders apart from identifying resistance to/toler-
ance of biotic and abiotic stresses. Enhancing genetic gain is also a primary concern
to meet the food demand of the ever-increasing world population, especially with
global climate change. In recent years, the innovations in rice breeding programs
and advanced genomics technologies such as next-generation sequencing and high-
throughput genotyping have been fully exploited to understand trait interactions and
select promising rice genotypes for use in breeding programs. The genetic improve-
ments in yield component traits and increasing yield significantly under biotic and
abiotic stresses have not been achieved to a great extent due to the complex nature
of these stresses. The knowledge of integrated genomics and high-throughput phe-
nomics technologies has laid the foundation to understand these complex traits and
also associated molecular genetics and physiological mechanisms that can enable
breeders to find better rice genotypes and to move forward as knowledge-based rice
breeding is the most acceptable approach in developing climate-smart stress-tolerant
and high-yielding rice genotypes. This approach has advanced at a fast pace with
low-cost, efficiency, and high resolution of genetic mapping for QTLs and genes
and also haplotype blocks to find allelic variations for the target trait of interest. The
current advances in CRISPR/Cas9 genome-editing tools have led to significant tar-
geted changes in specific trait-associated genes and changes in single base levels
that promise to accelerate crop improvement. These genomic-assisted breeding
tools are breeder-friendly, and smart decisions in breeding programs can enhance
the efficiency of the selection of rice genotypes in a short period.
Acknowledgments The authors would like to thank and acknowledge the Bill & Melinda Gates
Foundation for providing a research grant to ZL for the Green Super Rice project under ID
OPP1130530. We would like to thank the Department of Agriculture, Philippines, for providing
funds to JA under the Next-Gen project and also thank and acknowledge IRRI Communications
for English-language editing and the anonymous internal reviewer’s valuable suggestions and con-
structive comments that helped improve this chapter.
References
Abdallah NA, Prakash CS, McHughen AG (2015) Genome editing for crop improvement: chal-
lenges and opportunities. GM Crops Food 6:183–205
Abe A, Kosugi S, Yoshida K et al (2012) Genome sequencing reveals agronomically important loci
in rice using MutMap. Nat Biotechnol 30:174–178. https://doi.org/10.1038/nbt.2095
Abe K, Araki E, Suzuki Y et al (2018) Production of high oleic/low linoleic rice by genome edit-
ing. Plant Physiol Biochem 131:58–62. https://doi.org/10.1016/j.plaphy.2018.04.033
Adorada DL, Stodart BJ, Cruz CV et al (2013) Standardizing resistance screening to Pseudomonas
fuscovaginae and evaluation of rice germplasm at seedling and adult plant growth stages.
Euphytica 192:1–16. https://doi.org/10.1007/s10681-012-0804-z
Ahn S, Kim Y, Han S et al (1996) Molecular mapping of a gene for resistance to a Korean isolate
of rice blast. Rice Genet Newsl 13:74–76
Ahn SN, Kim YK, Hong HC et al (1997) Mapping of genes conferring resistance to Korean iso-
lates of rice blast fungus using DNA markers. Korean J Breed 29:416–423
Ali J, Xu JL, Gao YM et al (2017) Harnessing the hidden genetic diversity for improving multiple
abiotic stress tolerance in rice (Oryza sativa L.). PLoS One 12:e0172515
Andargie M, Li L, Feng A et al (2018) Mapping of the quantitative trait locus (QTL) confer-
ring resistance to rice false smut disease. Curr Plant Biol 15:38–43. https://doi.org/10.1016/j.
cpb.2018.11.003
Anderson S (2002) The relationship between nutrients and other elements to plant diseases.
Spectrum Analytic Inc, Washington CH, OH, pp 26–32
Anderson PK, Cunningham AA, Patel NG et al (2004) Emerging infectious diseases of plants:
pathogen pollution, climate change and agrotechnology drivers. Trends Ecol Evol 19:535–544
Anjaneyulu A, Singh SK, Shenoi MM (1982) Evaluation of rice varieties for tungro
resistance by field screening techniques. Trop Pest Manag 28:147–155. https://doi.
org/10.1080/09670878209370692
Anzalone AV, Randolph PB, Davis JR et al (2019) Search-and-replace genome editing with-
out double-strand breaks or donor DNA. Nature 576:149–157. https://doi.org/10.1038/
s41586-019-1711-4
Ashikawa I, Hayashi N, Yamane H et al (2008) Two adjacent nucleotide-binding site-leucine-
rich repeat class genes are required to confer Pikm-specific rice blast resistance. Genetics
180:2267–2276. https://doi.org/10.1534/genetics.108.095034
Ashkani S, Rafii MY, Shabanimofrad M et al (2015) Molecular breeding strategy and challenges
towards improvement of blast disease resistance in rice crop. Front Plant Sci 6:886
Azzam O, Chancellor TCB (2002) The biology, epidemiology, and management of rice tungro
disease in Asia. Plant Dis 86:88–100
Bainsla NK, Meena HP (2016) Breeding for resistance to biotic stresses in plants. In: Yadav P,
Kumar S, Jain V (eds) Recent advances in plant stress physiology. Daya Publishing House,
New Delhi
Balachiranjeevi C, Bhaskar NS, Abhilash V et al (2015) Marker-assisted introgression of bacterial
blight and blast resistance into DRR17B, an elite, fine-grain type maintainer line of rice. Mol
Breed 35:151. https://doi.org/10.1007/s11032-015-0348-8
Balachiranjeevi CH, Bhaskar Naik S, Abhilash Kumar V et al (2018) Marker-assisted pyramiding
of two major, broad-spectrum bacterial blight-resistance genes, Xa21 and Xa33 into an elite
maintainer line of rice, DRR17B. PLoS One 13:e0201271. https://doi.org/10.1371/journal.
pone.0201271
Balachiranjeevi CH, Prahalada GD, Mahender A et al (2019) Identification of a novel locus,
BPH38 (t), conferring resistance to brown planthopper (Nilaparvata lugens Stal.) using early
backcross population in rice (Oryza sativa L.). Euphytica 215:185
Bargaz A, Lyamlouli K, Chtouki M et al (2018) Soil microbial resources for improving fertilizers
efficiency in an integrated plant nutrient management system. Front Microbiol 9:1606
Barman SR, Gowda M, Venu RC, Chattoo BB (2004) Identification of a major blast
resistance gene in the rice cultivar “Tetep”. Plant Breed 123:300–302. https://doi.
org/10.1111/j.1439-0523.2004.00982.x
Bayat A (2002) Bioinformatics. Br Med J 324:1018–1022
Begum N, Rahman MM, Bashar MA et al (2011) Effect of potassium fertilizer on development of
bacterial blight of rice. Bangladesh J Sci Ind Res 46:69–76
Berruyer R, Adreit H, Milazzo J et al (2003) Identification and fine-mapping of Pi33, the rice
resistance gene corresponding to the Magnaporthe grisea avirulence gene ACE1. Theor Appl
Genet 107:1139–1147. https://doi.org/10.1007/s00122-003-1349-2
Bhasin H, Bhatia D, Raghuvanshi S et al (2012) New PCR-based sequence-tagged site marker for
bacterial blight-resistance gene Xa38 of rice. Mol Breed 30:607–611. https://doi.org/10.1007/
s11032-011-9646-y
Bhat ZA, Ahangar MA, Sanghera GS, Mubarak T (2013) Effect of cultivar, fungicide spray and
nitrogen fertilization on management of rice blast under temperate ecosystem. Int J Sci Environ
Technol 2:410–415
Bhat JA, Ali S, Salgotra RK et al (2016) Genomic selection in the era of next-generation sequenc-
ing for complex traits in plant breeding. Front Genet 7:221
Bigirimana VP, Hua GKH, Nyamangyoku OI, Hòfte M (2015) Rice sheath rot: an emerging ubiq-
uitous destructive disease complex. Front Plant Sci 6:1066
Boch J (2011) TALEs of genome targeting. Nat Biotechnol 29:135–136
Boch J, Scholze H, Schornack S et al (2009) Breaking the code of DNA binding specificity of
TAL-type III effectors. Science 326:1509–1512. https://doi.org/10.1126/science.1178811
Bolton MD, Thomma BPHJ (2008) The complexity of nitrogen metabolism and nitrogen-regulated
gene expression in plant pathogenic fungi. Physiol Mol Plant Pathol 72:104–110
Bonman JM (1992) Durable resistance to rice blast disease-environmental influences. Euphytica
63:115–123. https://doi.org/10.1007/BF00023917
Bossa-Castro AM, Tekete C, Raghavan C et al (2018) Allelic variation for broad-spectrum resis-
tance and susceptibility to bacterial pathogens identified in a rice MAGIC population. Plant
Biotechnol J 16:1559–1568. https://doi.org/10.1111/pbi.12895
Bunawan H, Dusik L, Bunawan SN, Amin NM (2014) Rice tungro disease: from identifica-
tion to disease control. World Appl Sci J 31:1221–1226. https://doi.org/10.5829/idosi.
wasj.2014.31.06.610
Busungu C, Taura S, Sakagami JI, Ichitani K (2016) Identification and linkage analysis of a
new rice bacterial blight-resistance gene from XM14, a mutant line from IR24. Breed Sci
66:636–645. https://doi.org/10.1270/jsbbs.16062
Cai L, Cao Y, Xu Z et al (2017) A transcription activator-like effector Tal7 of Xanthomonas ory-
zae pv. oryzicola activates rice gene Os09g29100 to suppress rice immunity. Sci Rep 7:1–13.
https://doi.org/10.1038/s41598-017-04800-8
Causse MA, Fulton TM, Cho YG et al (1994) Saturated molecular map of the rice genome based
on an interspecific backcross population. Genetics 138:1251–1274
Cesari S, Thilliez G, Ribot C et al (2013) The rice resistance protein pair RGA4/RGA5 recog-
nizes the Magnaporthe oryzae effectors AVR-Pia and AVR1-CO39 by direct binding. Plant
Cell 25:1463–1481. https://doi.org/10.1105/tpc.112.107201
Channamallikarjuna V, Sonah H, Prasad M et al (2010) Identification of major quantitative trait loci
qSBR11-1 for sheath blight resistance in rice. Mol Breed 25:155–166. https://doi.org/10.1007/
s11032-009-9316-5
Chaudhari AK, Rakholiya KB, Baria TT (2019) Screening of rice cultivars against false smut
[Ustilaginoidea virens (Cooke) Takahashi] of rice. Int J Curr Microbiol App Sci 8:2786–2793.
https://doi.org/10.20546/ijcmas.2019.806.336
Cheema KK, Grewal NK, Vikal Y et al (2008) A novel bacterial blight-resistance gene from Oryza
nivara mapped to 38 kb region on chromosome 4L and transferred to Oryza sativa L. Genet
Res (Camb) 90:397–407. https://doi.org/10.1017/S0016672308009786
Chen DH, Dela Viña M, Inukai T et al (1999) Molecular mapping of the blast resistance gene,
Pi44(t), in a line derived from a durably resistant rice cultivar. Theor Appl Genet 98:1046–1053.
https://doi.org/10.1007/s001220051166
Chen XW, Li SG, Xu JC et al (2004) Identification of two blast resistance genes in a rice variety,
Digu. J Phytopathol 152:77–85. https://doi.org/10.1046/j.1439-0434.2003.00803.x
Chen C, Zheng W, Huang X et al (2006a) Major QTL conferring resistance to rice bacterial leaf
streak. Agric Sci China 5:216–220. https://doi.org/10.1016/S1671-2927(06)60041-2
Chen X, Shang J, Chen D et al (2006b) A B-lectin receptor kinase gene conferring rice blast resis-
tance. Plant J 46:794–804. https://doi.org/10.1111/j.1365-313X.2006.02739.x
Chen S, Huang Z, Zeng L et al (2008) High-resolution mapping and gene prediction of
Xanthomonas oryzae pv. oryzae resistance gene Xa7. Mol Breed 22:433–441. https://doi.
org/10.1007/s11032-008-9187-1
Chen J, Shi Y, Liu W et al (2011a) A Pid3 allele from rice cultivar Gumei2 confers resistance to
Magnaporthe oryzae. J Genet Genom 38:209–216. https://doi.org/10.1016/j.jgg.2011.03.010
Chen S, Liu X, Zeng L et al (2011b) Genetic analysis and molecular mapping of a novel reces-
sive gene xa34(t) for resistance against Xanthomonas oryzae pv. oryzae. Theor Appl Genet
122:1331–1338. https://doi.org/10.1007/s00122-011-1534-7
Chen J, Peng P, Tian J et al (2015) Pike, a rice blast resistance allele consisting of two adjacent
NBS–LRR genes, was identified as a novel allele at the Pik locus. Mol Breed 35:1–15. https://
doi.org/10.1007/s11032-015-0305-6
Chen E, Huang X, Tian Z et al (2019) The genomics of Oryza species provides insights into
rice domestication and heterosis. Annu Rev Plant Biol 70:639–665. https://doi.org/10.1146/
annurev-arplant-050718-100320
Chen S, Wang C, Yang J et al (2020) Identification of the novel bacterial blight-resistance gene
Xa46(t) by mapping and expression analysis of the rice mutant H120. Sci Rep 10:12642.
https://doi.org/10.1038/s41598-020-69639-y
Chisholm ST, Coaker G, Day B et al (2006) Host-microbe interactions: shaping the evolution of
the plant immune response. Cell 124:803–814
Christian M, Cermak T, Doyle EL et al (2010) Targeting DNA double-strand breaks with TAL
effector nucleases. Genetics 186:756–761. https://doi.org/10.1534/genetics.110.120717
Chu Z, Fu B, Yang H et al (2006) Targeting xa13, a recessive gene for bacterial blight-resistance in
rice. Theor Appl Genet 112:455–461. https://doi.org/10.1007/s00122-005-0145-6
Chung CL, Huang KJ, Chen SY et al (2016) Detecting Bakanae disease in rice seedlings by machine
vision. Comput Electron Agric 121:404–411. https://doi.org/10.1016/j.compag.2016.01.008
Collard BC, Ismail AM, Hardy B (eds) (2013) EIRLSBN: twenty years of achievements in rice
breeding. International Rice Research Institute, Los Baños. 145 p
Cong L, Ran FA, Cox D et al (2013) Multiplex genome engineering using CRISPR/Cas systems.
Science 339:819–823
Deltcheva E, Chylinski K, Sharma CM et al (2011) CRISPR RNA maturation by trans-encoded
small RNA and host factor RNase III. Nature 471:602–607. https://doi.org/10.1038/nature09886
Deng Y, Zhai K, Xie Z et al (2017) Epigenetic regulation of antagonistic receptors confers rice blast
resistance with yield balance. Science 355:962–965. https://doi.org/10.1126/science.aai8898
Devi SJSR, Singh K, Umakanth B et al (2020) Identification and characterization of a large effect
QTL from Oryza glumaepatula revealed Pi68(t) as putative candidate gene for rice blast resis-
tance. Rice 13:17. https://doi.org/10.1186/s12284-020-00378-4
Dordas C (2008) Role of nutrients in controlling plant diseases in sustainable agriculture. A review.
Agron Sustain Dev 28:33–46
Eizenga GC, Lee FN, Rutger JN (2002) Screening Oryza species plants for rice sheath blight
resistance. Plant Dis 86:808–812
Eizenga GC, Prasad B, Jackson AK, Jia MH (2013) Identification of rice sheath blight and blast
quantitative trait loci in two different O. sativa/O. nivara advanced backcross populations. Mol
Breed 31:889–907. https://doi.org/10.1007/s11032-013-9843-y
Endo M, Mikami M, Endo A et al (2019) Genome editing in plants by engineered CRISPR–Cas9

recognizing NG PAM. Nat Plants 5:14–17. https://doi.org/10.1038/s41477-018-0321-8
Fageria NK, Baligar VC, Li YC (2008) The role of nutrient efficient plants in improving crop
yields in the twenty first century. J Plant Nutr 31:1121–1157
FAOSTAT (2020) Statistics data. Food and Agriculture Organization of the United Nations, Rome.
http://www.fao.org/faostat/en/#dat
Feng Z, Zhang B, Ding W et al (2013) Efficient genome editing in plants using a CRISPR/Cas
system. Cell Res 23:1229–1232
doi.org/10.3389/fpls.2018.00306
Fjellstrom R, Conaway-Bormans CA, McClung AM et al (2004) Development of DNA mark-
ers suitable for marker-assisted selection of three Pi genes conferring resistance to mul-
tiple Pyricularia grisea pathotypes. Crop Sci 44:1790–1798. https://doi.org/10.2135/
cropsci2004.1790
Fu D, Chen L, Yu G et al (2011) QTL mapping of sheath blight resistance in a deep-water rice
cultivar. Euphytica 180:209–218. https://doi.org/10.1007/s10681-011-0366-5
Fujii K, Hayano-Saito Y, Shumiya A et al (1995) Genetical mapping based on the RFLP analysis
for the panicle blast resistance derived from a rice parental line St. No. 1. Breed Sci 45:209
Fukuoka S, Saka N, Koga H et al (2009) Loss of function of a proline-containing protein con-
fers durable disease resistance in rice. Science 325:998–1001. https://doi.org/10.1126/
science.1175550
Gaj T, Gersbach CA, Barbas CF (2013) ZFN, TALEN, and CRISPR/Cas-based methods for
genome engineering. Trends Biotechnol 31:397–405
Gaj T, Sirk SJ, Shui S, Liu J (2016) Genome-editing technologies: principles and applications.
Cold Spring Harb Perspect Biol 8:a023754
Garg P, Jaiswal P (2016) Databases and bioinformatics tools for rice research. Curr Plant Biol
7–8:39–52. https://doi.org/10.1016/j.cpb.2016.12.006
Ghosal S, Blystone D, Singh AK et al (2018) An explainable deep machine vision framework for
plant stress phenotyping. Proc Natl Acad Sci U S A 115:4613–4618. https://doi.org/10.1073/
pnas.1716999115
Goad DM, Jia Y, Gibbons A et al (2020) Identification of novel QTL conferring sheath blight
resistance in two weedy rice mapping populations. Rice 13:21. https://doi.org/10.1186/
s12284-020-00381-9
Gopalakrishnan S, Sharma RK, Anand Rajkumar K et al (2008) Integrating marker-assisted
background analysis with foreground selection for identification of superior bacte-
rial blight-resistant recombinants in Basmati rice. Plant Breed 127:131–139. https://doi.
org/10.1111/j.1439-0523.2007.01458.x
Goto I (1970) Genetic studies on the resistance of rice plant to the blast fungus. Jpn J Phytopathol
36:304–312. https://doi.org/10.3186/jjphytopath.36.304
Goto I (1988) Genetic studies on resistance of rice plant to blast fungus (VII): blast resistance
genes of Kuroka. Ann Phytopathol Soc Jpn 54:460–465
Gowda M, Roy-Barman S, Chattoo BB (2006) Molecular mapping of a novel blast resistance
gene Pi38 in rice using SSLP and AFLP markers. Plant Breed 125:596–599. https://doi.
org/10.1111/j.1439-0523.2006.01248.x
Graichen FAS, Martinelli JA, Federizzi LC et al (2010) Inheritance of resistance to oat
crown rust in recombinant inbred lines. Sci Agric 67:435–440. https://doi.org/10.1590/
s0103-90162010000400010
Gu K, Yang B, Tian D et al (2005) R-gene expression induced by a type-III effector triggers disease
resistance in rice. Nature 435:1122–1125. https://doi.org/10.1038/nature03630
Guo SB, Zhang DP, Lin XH (2010) Identification and mapping of a novel bacterial blight-resistance
gene Xa35(t) originated from Oryza minuta. Scientia Agricultura Sinica 43:2611–2618
Gupta RM, Musunuru K (2014) Expanding the genetic editing tool kit: ZFNs, TALENs, and
CRISPR-Cas9. J Clin Invest 124:4154–4161
Hajira SK, Sundaram RM, Laha GS et al (2016) A single-tube, functional marker-based multiplex
PCR assay for simultaneous detection of major bacterial blight-resistance genes Xa21, xa13
and xa5 in rice. Rice Sci 23:144. https://doi.org/10.1016/j.rsci.2015.11.004
Han Y, Li D, Yang J et al (2020) Mapping quantitative trait loci for disease resistance to false smut
of rice. Phytopathol Res 2:20. https://doi.org/10.1186/s42483-020-00059-6
Hao L, Ruiying Q, Xiaoshuang L et al (2019) CRISPR/Cas9-mediated adenine base editing in rice
genome. Rice Sci 26:125–128
Hari Y, Srinivasarao K, Viraktamath BC et al (2011) Marker-assisted improvement of a stable
restorer line, KMR-3R and its derived hybrid KRH2 for bacterial blight resistance and grain
quality. Plant Breed 130:608–616. https://doi.org/10.1111/j.1439-0523.2011.01881.x
Hari Y, Srinivasarao K, Viraktamath BC et al (2013) Marker-assisted introgression of bacte-
rial blight and blast resistance into IR 58025B, an elite maintainer line of rice. Plant Breed
132:586–594. https://doi.org/10.1111/pbr.12056
Hayasaka T, Fujii H, Ishiguro K (2008) The role of silicon in preventing appressorial penetration
by the rice blast fungus. Phytopathology 98:1038–1044
Hayashi K, Yoshida H (2009) Refunctionalization of the ancient rice blast disease resistance gene
Pit by the recruitment of a retrotransposon as a promoter. Plant J 57:413–425. https://doi.
org/10.1111/j.1365-313X.2008.03694.x
Hayashi K, Yoshida H, Ashikawa I (2006) Development of PCR-based allele-specific and InDel
marker sets for nine rice blast-resistance genes. Theor Appl Genet 113:251–260. https://doi.
org/10.1007/s00122-006-0290-6
Hayashi N, Inoue H, Kato T et al (2010) Durable panicle blast-resistance gene Pb1 encodes an
atypical CC-NBS-LRR protein and was generated by acquiring a promoter through local
genome duplication. Plant J 64:498–510. https://doi.org/10.1111/j.1365-313X.2010.04348.x
He W, Huang D, Li R et al (2012) Identification of a resistance gene bls1 to bacterial leaf streak
in wild rice Oryza rufipogon Griff. J Integr Agric 11:962–969. https://doi.org/10.1016/
S2095-3119(12)60087-2
He Y, Zhu M, Wang L et al (2018) Programmed self-elimination of the CRISPR/Cas9 con-
struct greatly accelerates the isolation of edited and transgene-free rice plants. Mol Plant
11:1210–1213
Heinrichs EA, Muniappan R (2017) IPM for tropical crops: rice. CAB Rev 12:1
Hervieux V, Yaganza ES, Arul J, Tweddell RJ (2002) Effect of organic and inorganic salts on the
development of Helminthosporium solani, the causal agent of potato silver scurf. Plant Dis
86:1014–1018
Hirochika H, Guiderdoni E, An G et al (2004) Rice mutant resources for gene discovery. Plant Mol
Biol 54:325–334. https://doi.org/10.1023/B:PLAN.0000036368.74758.66
Holland JB (2001) Epistasis and pant breeding. Plant Breed Rev 21:27–92
Hu H, Scheben A, Edwards D (2018) Advances in integrating genomics and bioinformatics in the
plant breeding pipeline. Agriculture 8:75
Hua L, Wu J, Chen C et al (2012) The isolation of Pi1, an allele at the Pik locus which con-
fers broad spectrum resistance to rice blast. Theor Appl Genet 125:1047–1055. https://doi.
org/10.1007/s00122-012-1894-7
Huang N, Angeles ER, Domingo J et al (1997) Pyramiding of bacterial blight-resistance genes in
rice: marker-assisted selection using RFLP and PCR. Theor Appl Genet 95:313–320. https://
doi.org/10.1007/s001220050565
Huang X, Wei X, Sang T et al (2010) Genome-wide asociation studies of 14 agronomic traits in
rice landraces. Nat Genet 42:961–967. https://doi.org/10.1038/ng.695
Huang S, Liu L, Wang L, Hou Y (2019) Research on advance of rice false smut Ustilaginoidea
virens (Cooke) Takah worldwide: Part I. Research status of rice false smut. J Agric Sci 11:240.
https://doi.org/10.5539/jas.v11n15p240
Hutin M, Sabot F, Ghesquière A et al (2015) A knowledge-based molecular screen uncovers a

broad-spectrum OsSWEET14 resistance allele to bacterial blight from wild rice. Plant J
84:694–703. https://doi.org/10.1111/tpj.13042
Ingvardsen CR, Schejbel B, Lübberstedt T (2008) Functional markers in resistance breeding.
Springer, Berlin, pp 61–87
Inukai T, Nelson RJ, Zeigler RS et al (1996) Genetic analysis of blast resistance in tropical rice
cultivars using near-isogenic lines. In: Khush GS (ed) Rice genetics III. International Rice
Research Institute, Los Baños, pp 447–455
Inukai T, Nagashima S, Kato M (2019) Pid3-I1 is a race-specific partial-resistance allele at the
Pid3 blast resistance locus in rice. Theor Appl Genet 132:395–404. https://doi.org/10.1007/
s00122-018-3227-y
Los Baños
Los Baños
Iwata N (1996) Registration of new gene symbols. Rice Genet 13:12–18
Iyer-Pascuzzi AS, McCouch SR (2007) Functional markers for xa5-mediated resistance in rice
(Oryza sativa, L.). Mol Breed 19:291–296. https://doi.org/10.1007/s11032-006-9055-9
Jabeen R, Rahman SU, Rais A (2011) Evaluating BLB resistance/aggressiveness in rice through
best inoculum concentration, inoculation and application methods. Pak J Bot 43:2635–2638
Jamaloddin M, Durga Rani CV, Swathi G et al (2020) Marker assisted gene pyramiding (MAGP)
for bacterial blight and blast resistance into mega rice variety “Tellahamsa”. PLoS One
15:e0234088. https://doi.org/10.1371/journal.pone.0234088
Jeung JU, Kim BR, Cho YC et al (2007) A novel gene, Pi40(t), linked to the DNA markers derived
from NBS-LRR motifs confers broad spectrum of blast resistance in rice. Theor Appl Genet
115:1163–1177. https://doi.org/10.1007/s00122-007-0642-x
Jia Y, Valent B, Lee FN (2003) Determination of host responses to Magnaporthe grisea on detached
rice leaves using a spot inoculation method. Plant Dis 87:129–133. https://doi.org/10.1094/
PDIS.2003.87.2.129
Jia Y, Correa-Victoria F, McClung A et al (2007) Rapid determination of rice cultivar responses to
the sheath blight pathogen Rhizoctonia solani using a micro-chamber screening method. Plant
Dis 91:485–489. https://doi.org/10.1094/PDIS-91-5-0485
Jia L, Yan W, Zhu C et al (2012) Allelic analysis of sheath blight resistance with association map-
ping in rice. PLoS One 7:e32703. https://doi.org/10.1371/journal.pone.0032703
Jiang W, Zhou H, Bi H et al (2013) Demonstration of CRISPR/Cas9/sgRNA-mediated targeted
gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res 41:e188–e188
Jiang J, Yang D, Ali J, Mou T (2015) Molecular marker-assisted pyramiding of broad-spectrum
disease resistance genes, Pi2 and Xa23, into GZ63-4S, an elite thermo-sensitive genic male-
sterile line in rice. Mol Breed 35:1–12. https://doi.org/10.1007/s11032-015-0282-9
Jiang N, Yan J, Liang Y et al (2020) Resistance genes and their interactions with bacterial blight/
leaf streak pathogens (Xanthomonas oryzae) in rice (Oryza sativa L.)—an updated review.
Rice 13:3. https://doi.org/10.1186/s12284-019-0358-y
Jinek M, Chylinski K, Fonfara I et al (2012) A programmable dual-RNA-guided DNA endonuclease
in adaptive bacterial immunity. Science 337:816–821. https://doi.org/10.1126/science.1225829
Jones JDG, Dangl JL (2006) The plant immune system. Nature 444:323–329
Joseph M, Gopalakrishnan S, Sharma RK et al (2004) Combining bacterial blight resistance and
Basmati quality characteristics by phenotypic and molecular marker-assisted selection in rice.
Mol Breed 13:377–387. https://doi.org/10.1023/B:MOLB.0000034093.63593.4c
Ju Y, Tian H, Zhang R et al (2017) Overexpression of OsHSP18.0-CI enhances resistance to bacte-
rial leaf streak in rice. Rice 10:12. https://doi.org/10.1186/s12284-017-0153-6
Kauffman HE, Reddy APK, Hsieh SPY, Merca SD (1973) An improved technique for evaluating
resistance of rice varieties to Xanthomonas oryzae. Plant Dis Rep 57:537–541
Kaur Y (2014) Development of screening technique for false smut of rice. Dissertation. Punjab
Agricultural University, Ludhiana
Kaur T, Singh I (2017) Standardization of screening technique for false smut of rice. Progress
Agric 17:10. https://doi.org/10.5958/0976-4615.2017.00007.2
Kaur S, Padmanabhan SY, Kaur P (1979) Effect of nitrogen on the intracellular spread of
Pyricularia oryzae. Indian Phytopathol 32:285–286
Ke Y, Deng H, Wang S (2017) Advances in understanding broad-spectrum resistance to pathogens
in rice. Plant J 90:738–748. https://doi.org/10.1111/tpj.13438
Khush GS (2005) What it will take to feed 5.0 billion rice consumers in 2030. Plant Mol Biol 59:1–6
Khush GS, Angeles ER (1999) A new gene for resistance to race 6 of bacterial blight in rice, Oryza
sativa. Rice Genet Newsl 16:92–93
Kim SM (2018) Identification of novel recessive gene xa44(t) conferring resistance to bacte-
rial blight races in rice by QTL linkage analysis using an SNP chip. Theor Appl Genet
131:2733–2743. https://doi.org/10.1007/s00122-018-3187-2
Kim SM, Reinke RF (2019) A novel resistance gene for bacterial blight in rice, Xa43(t) identified
by GWAS, confirmed by QTL mapping using a bi-parental population. PLoS One 14:e0211775.
https://doi.org/10.1371/journal.pone.0211775
Kim YG, Cha J, Chandrasegaran S (1996) Hybrid restriction enzymes: zinc finger fusions to
Fok I cleavage domain. Proc Natl Acad Sci U S A 93:1156–1160. https://doi.org/10.1073/
pnas.93.3.1156
Kim SM, Suh JP, Qin Y et al (2015) Identification and fine-mapping of a new resistance gene,
Xa40, conferring resistance to bacterial blight races in rice (Oryza sativa L.). Theor Appl Genet
128:1933–1943. https://doi.org/10.1007/s00122-015-2557-2
Kim YA, Moon H, Park CJ (2019) CRISPR/Cas9-targeted mutagenesis of Os8N3 in rice to
confer resistance to Xanthomonas oryzae pv. oryzae. Rice 12:67. https://doi.org/10.1186/
s12284-019-0325-7
Kinoshita T, Kiyosawa S (1997) Some considerations on linkage relationships between Pii and Piz
in the blast resistance of rice. Rice Genet Newsl 14:57–59
Klug A, Schwabe JWR (1995) Zinc fingers. FASEB J 9:597–604. https://doi.org/10.1096/
fasebj.9.8.7768350
Koonin EV, Makarova KS (2019) Origins and evolution of CRISPR-Cas systems. Philos Trans R
Soc B Biol Sci 374:20180087
Korinsak S, Sriprakhon S, Sirithanya P et al (2009) Identification of microsatellite markers (SSR)
linked to a new bacterial blight-resistance gene xa33(t) in rice cultivar “Ba7”. Maejo Int J Sci
Technol 3:235–247
Kou Y, Wang S (2013) Bacterial blight resistance in rice. In: Translational genomics for crop
breeding. John Wiley & Sons Ltd., Chichester, pp 11–30
Kurata N, Yamazaki Y (2006) Oryzabase:an integrated biological and genome information data-
base for rice. Plant Physiol 140:12–17. https://doi.org/10.1104/pp.105.063008
Lee KS, Rasabandith S, Angeles ER, Khush GS (2003) Inheritance of resistance to bacte-
rial blight in 21 cultivars of rice. Phytopathology 93:147–152. https://doi.org/10.1094/
PHYTO.2003.93.2.147
Lee SK, Song MY, Seo YS et al (2009) Rice Pi5-mediated resistance to Magnaporthe oryzae
requires the presence of two coiled-coil-nucleotide-binding-leucine-rich repeat genes. Genetics
181:1627–1638. https://doi.org/10.1534/genetics.108.099226
Lee JH, Muhsin M, Atienza GA et al (2010) Single nucleotide polymorphisms in a gene for
translation initiation factor (elF4G) of rice (Oryza sativa) associated with resistance to
rice tungro spherical virus. Mol Plant-Microbe Interact 23:29–38. https://doi.org/10.1094/
MPMI-23-1-0029
Lei C, Huang D, Li W et al (2005) Molecular mapping of a blast resistance gene in an indica rice
cultivar Yanxian No. 1. Rice Genet Newsl 22:76–77
Li T, Liu B, Spalding MH et al (2012) High-efficiency TALEN-based gene editing produces
disease-resistant rice. Nat Biotechnol 30:390
Li Z, Fu BY, Gao YM et al (2014) The 3,000 rice genomes project. Giga Sci 3:7. https://doi.org/1
0.1186/2047-217X-3-7
and IPA1 in rice using a CRISPR/Cas9 system. Front Plant Sci 7:377
Li C, Wang D, Peng S et al (2019a) Genome-wide association mapping of resistance against rice
blast strains in South China and identification of a new Pik allele. Rice 12:47. https://doi.
org/10.1186/s12284-019-0309-7
Li W, Chern M, Yin J et al (2019b) Recent advances in broad-spectrum resistance to the rice blast
disease. Curr Opin Plant Biol 50:114–120
Liakos KG, Busato P, Moshou D et al (2018) Machine learning in agriculture: a review.
Sensors 18:2674
Lin F, Chen S, Que Z et al (2007) The blast resistance gene Pi37 encodes a nucleotide binding site-
leucine-rich repeat protein and is a member of a resistance gene cluster on rice chromosome 1.
Genetics 177:1871–1880. https://doi.org/10.1534/genetics.107.080648
Lin Q, Zong Y, Xue C et al (2020) Prime genome editing in rice and wheat. Nat Biotechnol
38:582–585. https://doi.org/10.1038/s41587-020-0455-x
Liu XQ, Wang L, Chen S et al (2005) Genetic and physical mapping of Pi36(t), a novel rice blast
resistance gene located on rice chromosome 8. Mol Gen Genomics 274:394–401. https://doi.
org/10.1007/s00438-005-0032-5
Liu X, Yang Q, Lin F et al (2007) Identification and fine-mapping of Pi39(t), a major gene confer-
ring the broad-spectrum resistance to Magnaporthe oryzae. Mol Gen Genomics 278:403–410.
https://doi.org/10.1007/s00438-007-0258-5
Liu W, Jin S, Zhu X et al (2008) Improving blast resistance of a thermo-sensitive genic male ster-
ile rice line GD-8S by molecular marker-assisted selection. Rice Sci 15:179–185. https://doi.
org/10.1016/S1672-6308(08)60040-2
Liu Q, Yuan M, Zhou Y et al (2011) A paralog of the MtN3/saliva family recessively confers race-
specific resistance to Xanthomonas oryzae in rice. Plant Cell Environ 34:1958–1969. https://
doi.org/10.1111/j.1365-3040.2011.02391.x
Liu G, Jia Y, McClung A et al (2013) Confirming QTLs and finding additional loci responsible
for resistance to rice sheath blight disease. Plant Dis 97:113–117. https://doi.org/10.1094/
PDIS-05-12-0466-RE
Liu W, Liu J, Triplett L et al (2014) Novel insights into rice innate immunity against bacte-
rial and fungal pathogens. Annu Rev Phytopathol 52:213–241. https://doi.org/10.1146/
annurev-phyto-102313-045926
Liu MH, Kang H, Xu Y et al (2020) Genome-wide association study identifies an NLR gene that
confers partial resistance to Magnaporthe oryzae in rice. Plant Biotechnol J 18:1376–1383.
https://doi.org/10.1111/pbi.13300
Lu Y, Zhu JK (2017) Precise editing of a target base in the rice genome using a modified CRISPR/
Cas9 system. Mol Plant 10:523–525
Lu Z, Yu X, Heong K, Cui HU (2007) Effect of nitrogen fertilizer on herbivores and its stimulation
to major insect pests in rice. Rice Sci 14:56–66
Ma J, Lei C, Xu X et al (2015a) Pi64, encoding a novel CC-NBS-LRR protein, confers resistance
to leaf and neck blast in rice. Mol Plant-Microbe Interact 28:558–568. https://doi.org/10.1094/
MPMI-11-14-0367-R
Ma X, Zhang Q, Zhu Q et al (2015b) A robust CRISPR/Cas9 system for convenient, high-efficiency
multiplex genome editing in monocot and dicot plants. Mol Plant 8:1274–1284. https://doi.
org/10.1016/j.molp.2015.04.007
Mackill DJ, Coffman WR, Garrity DP (1996) Rainfed lowland rice improvement. International
Rice Research Institute, Los Baños. 242 p
Macovei A, Sevilla NR, Cantos C et al (2018) Novel alleles of rice eIF4G generated by CRISPR/
Cas9-targeted mutagenesis confer resistance to Rice tungro spherical virus. Plant Biotechnol J
16:1918–1927. https://doi.org/10.1111/pbi.12927
Madamba MRS, Sugiyama N, Bordeos A et al (2009) A recessive mutation in rice conferring non-
race-specific resistance to bacterial blight and blast. Rice 2:104–114. https://doi.org/10.1007/
s12284-009-9027-x
Mahadevaiah C, Hittalmani S, Uday G, Kumar MKP (2015) Standardization of disease screening
protocol for sheath rot disease in rice. Int J Agric Sci Res 5:129–137
Mahadevaiah C, Kumar MP, Hittalmani S (2017) Dissecting parameters associated with sheath
rot (Sarocladium oryzae [(Sawada) W. Gams &D. Hawksw.]) disease in rice (Oryza sativa L.).
Curr Sci 112:151–155. https://doi.org/10.18520/cs/v112/i01/151-155
Mahesh HB, Shirke MD, Singh S et al (2016) Indica rice genome assembly, annotation and
mining of blast disease-resistance genes. BMC Genomics 17:242. https://doi.org/10.1186/
s12864-016-2523-7
Mangrauthia SK, Maliha A, Prathi NB, Marathi B (2017) MicroRNAs: potential target for genome
editing in plants for traits improvement. Indian J Plant Physiol 22:530–548
Manosalva PM, Davidson RM, Liu B et al (2009) A germin-like protein gene family functions as
a complex quantitative trait locus conferring broad-spectrum disease resistance in rice. Plant
Physiol 149:286–296. https://doi.org/10.1104/pp.108.128348
Matsumoto T, Wu J, Kanamori H et al (2005) The map-based sequence of the rice genome. Nature
436:793–800. https://doi.org/10.1038/nature03895
Matsuyama N (1973) Effect of nitrogenous fertilizer on biochemical processes that could affect
lesion size of rice blast. Phytopathology 63:1202–1203
McCouch S, Nelson R, Tohme J, Zeigler R (1994) Mapping of blast resistance genes in rice. In:
Zeigler RS, Leong SA, Teng PS (eds) Rice blast disease. CAB International, Wallingford, UK,
pp 167–186
Meuwissen THE, Hayes BJ, Goddard ME (2001) Prediction of total genetic value using genome-
wide dense marker maps. Genetics 157:1819–1829
Miah G, Rafii M, Ismail M et al (2013) A review of microsatellite markers and their applications
in rice breeding programs to improve blast disease resistance. Int J Mol Sci 14:22499–22528
Miao LL, Wang CL, Zheng CK et al (2010) Molecular mapping of a new gene for resistance to rice
bacterial blight. Sci Agric Sin 43:2611
Milovanovic V, Smutka L (2017) Asian countries in the global rice market. Acta Univ Agric Silvic
Mendel Brun 65:679–688
Mishra R, Joshi RK, Zhao K (2018) Genome editing in rice: recent advances, challenges, and
future implications. Front Plant Sci 9:1361
Molla KA, Karmakar S, Molla J et al (2020) Understanding sheath blight resistance in rice: the road
behind and the road ahead. Plant Biotechnol J 18:895–915. https://doi.org/10.1111/pbi.13312
Moon SB, Kim DY, Ko JH, Kim YS (2019) Recent advances in the CRISPR genome editing tool
set. Exp Mol Med 51:1–11
Moscou MJ, Bogdanove AJ (2009) A simple cipher governs DNA recognition by TAL effectors.
Science 326:1501. https://doi.org/10.1126/science.1178817
Mur LAJ, Simpson C, Kumari A et al (2017) Moving nitrogen to the centre of plant defense against
pathogens. Ann Bot 119:703–709
Mushtaq M, Sakina A, Wani SH et al (2019) Harnessing genome editing techniques to engineer
disease resistance in plants. Front Plant Sci 10:550
Mvuyekure SM, Sibiya J, Derera J et al (2017) Genetic analysis of mechanisms associated with
inheritance of resistance to sheath rot of rice. Plant Breed 136:509–515. https://doi.org/10.1111/
pbr.12492
Nakamura S, Asakawa S, Ohmido N et al (1997) Construction of an 800-kb contig in the near-
centromeric region of the rice blast resistance gene Pi-ta2 using a highly representative rice
BAC library. Mol Gen Genet 254:611–620. https://doi.org/10.1007/s004380050459
Naqvi NI, Bonman JM, Mackill DJ et al (1995) Identification of RAPD markers linked to a major
blast resistance gene in rice. Mol Breed 1:341–348. https://doi.org/10.1007/BF01248411
Neelam K, Mahajan R, Gupta V et al (2020) High-resolution genetic mapping of a novel bacterial
blight- resistance gene xa-45(t) identified from Oryza glaberrima and transferred to Oryza
sativa. Theor Appl Genet 133:689–705. https://doi.org/10.1007/s00122-019-03501-2
Nelson JC, Oard JH, Groth D et al (2012) Sheath-blight resistance QTLs in japonica rice germ-
plasm. Euphytica 184:23–34. https://doi.org/10.1007/s10681-011-0475-1
Ning D, Song A, Fan F et al (2014) Effects of slag-based silicon fertilizer on rice growth and
brown-spot resistance. PLoS One 9:e102681
Nürnberger T, Kemmerling B (2009) PAMP-triggered basal immunity in plants. Adv Bot
Res 51:1–38
Ogawa T (1988) Near-isogenic lines as international differentials for resistance to bacterial blight
of rice. Rice Genet Newsl 5:106
Ogawa T (2008) Monitoring race distribution and identification of genes for resistance to bacterial
leaf blight. Rice Genet III 3:456–459
Ogawa T, Lin L, Tabien RE et al (1987) A new recessive gene for resistance to bacterial blight of
rice. Rice Genet Newsl 4:98
Okuyama Y, Kanzaki H, Abe A et al (2011) A multifaceted genomics approach allows the isolation
of the rice Pia-blast resistance gene consisting of two adjacent NBS-LRR protein genes. Plant
J 66:467–479. https://doi.org/10.1111/j.1365-313X.2011.04502.x
Oliva R, Ji C, Atienza-Grande G et al (2019) Broad-spectrum resistance to bacterial blight
in rice using genome editing. Nat Biotechnol 37:1344–1350. https://doi.org/10.1038/
s41587-019-0267-z
Oliver RP, Ipcho SVS (2004) Arabidopsis pathology breathes new life into the necrotrophs-vs.-
biotrophs classification of fungal pathogens. Mol Plant Pathol 5:347–352
Oreiro EG, Grimares EK, Atienza-Grande G et al (2019) Genome-wide associations and transcrip-
tional profiling reveal ROS regulation as one underlying mechanism of sheath blight resistance
in rice. Mol Plant-Microbe Interact 33:212–222. https://doi.org/10.1094/MPMI-05-19-0141-R
Pan Q, Tanisaka T (1997) Studies on the genetics and breeding of blast resistance in rice. VII. Gene
analysis for the blast resistance of Indian native cultivar, Aus 373. Breed Sci 47:35
Pan Q, Wang L, Ikehashi H, Tanisaka T (1996) Identification of a new blast resistance gene in
the indica rice cultivar Kasalath using Japanese differential cultivars and isozyme markers.
Phytopathology 86:1071–1075
Panda KK, Mishra MK (2019) Studies on physiological characteristics of Sarocladium oryzae
causing sheath rot of rice. Int J Curr Microbiol App Sci 8:1767–1774. https://doi.org/10.20546/
ijcmas.2019.808.209
Panguluri SK, Kumar AA (2013) Phenotyping for plant breeding: applications of phenotyping
methods for crop improvement. Springer, New York
Park DS, Sayler RJ, Hong YG et al (2008) A method for inoculation and evaluation of rice sheath
blight disease. Plant Dis 92:25–29. https://doi.org/10.1094/PDIS-92-1-0025
Peeters KJ, Haeck A, Harinck L et al (2020) Morphological, pathogenic and toxigenic variabil-
ity in the rice sheath rot pathogen Sarocladium oryzae. Toxins (Basel) 12:109. https://doi.
org/10.3390/toxins12020109
Perez-de-Castro A, Vilanova S, Canizares J et al (2012) Application of genomic tools in plant
breeding. Curr Genom 13:179–195. https://doi.org/10.2174/138920212800543084
Petpisit V, Khush GS, Kauffman HE (1977) Inheritance of resistance to bacterial blight in rice. 1.
Crop Sci 17:551–554. https://doi.org/10.2135/cropsci1977.0011183x001700040018x
Qu S, Liu G, Zhou B et al (2006) The broad-spectrum blast resistance gene Pi9 encodes a
nucleotide-binding site-leucine-rich repeat protein and is a member of a multigene family in
rice. Genetics 172:1901–1914. https://doi.org/10.1534/genetics.105.044891
Rajashekara H, Ellur RK, Khanna A et al (2014) Inheritance of blast resistance and its allelic
relationship with five major R-genes in a rice landrace “Vanasurya”. Indian Phytopathol
67:365–369
Rajpurohit D, Kumar R, Kumar M et al (2011) Pyramiding of two bacterial blight resistance and a
semidwarfing gene in Type 3 Basmati using marker-assisted selection. Euphytica 178:111–126.
https://doi.org/10.1007/s10681-010-0279-8
Ramirez CL, Foley JE, Wright DA et al (2008) Unexpected failure rates for modular assembly of
engineered zinc fingers. Nat Methods 5:374–375
Rathna Priya TS, Eliazer Nelson ARL, Ravichandran K, Antony U (2019) Nutritional and func-
tional properties of coloured rice varieties of South India: a review. J Ethn Foods 6:11
Raven JA (2003) Cycling silicon: the role of accumulation in plants. New Phytol 158:419–421
Read AC, Moscou MJ, Zimin AV et al (2020) Genome assembly and characterization of a com-
plex zfBED-NLR gene-containing disease resistance locus in Carolina Gold Select rice
with Nanopore sequencing. PLoS Genet 16:e1008571. https://doi.org/10.1371/journal.
pgen.1008571
Reddy APK, Katyal JC, Rouse DI, MacKenzie DR (1979) Relationship between nitrogen fertiliza-
tion, bacterial leaf blight severity and yield of rice. Phytopathology 69:970–973
Rekha G, Abhilash Kumar V, Viraktamath BC et al (2018) Improvement of blast resistance of
the popular high-yielding, medium slender-grain type, bacterial blight-resistant rice vari-
ety, Improved Samba Mahsuri by marker-assisted breeding. J Plant Biochem Biotechnol
27:463–472. https://doi.org/10.1007/s13562-018-0455-9
Robichaux CR (2001) The effect of calcium silicate on rice yield and sheath blight disease.
Fitopatol Bras 30:457–469
Romero FM, Gatica-Arias A (2019) CRISPR/Cas9: development and application in rice breeding.
Rice Sci 26:265–281
Sallaud C, Lorieux M, Roumen E et al (2003) Identification of five new blast resistance genes in
the highly blast-resistant rice variety IR64 using a QTL mapping strategy. Theor Appl Genet
106:794–803. https://doi.org/10.1007/s00122-002-1088-9
Samiyappan R, Amutha G, Kandan A et al (2003) Purification and partial characterization
of a phytotoxin produced by Sarocladium oryzae, the rice sheath rot pathogen (Reinigung
und partielle charakterisierung eines vom reisblattscheidenfäule-pathogen sarocladium ory-
zae erzeugten phytoto). Arch Phytopathol Plant Protect 36:247–256. https://doi.org/10.108
0/03235400310001617879
Sanchez AC, Brar DS, Huang N et al (2000) Sequence tagged site marker-assisted selection for
three bacterial blight-resistance genes in rice. Crop Sci 40:792–797. https://doi.org/10.2135/
cropsci2000.403792x
Savary S, Willocquet L, Pethybridge SJ et al (2019) The global burden of pathogens and pests on
major food crops. Nat Ecol Evol 3:430–439. https://doi.org/10.1038/s41559-018-0793-y
Sebastian LS, Ikeda R, Huang N et al (1996) Molecular mapping of resistance to rice tungro spheri-
cal virus and green leafhopper. Phytopathology 86:25–30. https://doi.org/10.1094/Phyto-86-25
Serrano M, Coluccia F, Torres M et al (2014) The cuticle and plant defense to pathogens. Front
Plant Sci 5:274. https://doi.org/10.3389/fpls.2014.00274
Shan Q, Zhang Y, Chen K et al (2015) Creation of fragrant rice by targeted knockout of the
OsBADH2 gene using TALEN technology. Plant Biotechnol J 13:791–800. https://doi.
org/10.1111/pbi.12312
Shanti ML, Kumar Varm CM, Premalatha P et al (2010) Understanding the bacterial blight
pathogen-combining pathotyping and molecular marker studies. Int J Plant Pathol 1:58–68.
https://doi.org/10.3923/ijpp.2010.58.68
Sharma S, Duveiller E, Basnet R et al (2005a) Effect of potash fertilization on Helminthosporium
leaf blight severity in wheat, and associated increases in grain yield and kernel weight. Field
Crop Res 93:142–150
Sharma TR, Madhav MS, Singh BK et al (2005b) High-resolution mapping, cloning and molecular
characterization of the Pi-kh gene of rice, which confers resistance to Magnaporthe grisea.
Mol Gen Genomics 274:569–578. https://doi.org/10.1007/s00438-005-0035-2
Sharma TR, Rai AK, Gupta SK et al (2012) Rice blast management through host-plant resistance:
retrospect and prospects. Agric Res 1:37–52
Shen C, Que Z, Xia Y et al (2017) Knock out of the annexin gene OsAnn3 via CRISPR/Cas9-
mediated genome editing decreased cold tolerance in rice. J Plant Biol 60:539–547
Shinoda H, Toriyama K, Yunoki T et al (1971) Studies on the varietal resistance of rice to blast. 6.
Linkage relationship of blast resistance genes. Jpn Chugoku Nogyo Shikengo Fukuyama Bull
Ser A 20:1
Sidhu GS, Khush GS, Mew TW (1978) Genetic analysis of bacterial blight-resistance in seventy-
four cultivars of rice, Oryza sativa L. Theor Appl Genet 53:105–111. https://doi.org/10.1007/
BF00272687
Sime HD, Mbong GA, Malla DK, Suh C (2017) Effect of different doses of NPK fertilizer on the
infection coefficient of rice (Orysa sativa L.) blast in Ndop, North West of Cameroon. Agron
Afr 29:245–255
Singh S, Sidhu JS, Huang N et al (2001) Pyramiding three bacterial blight-resistance genes (xa5,
xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theor Appl
Genet 102:1011–1015. https://doi.org/10.1007/s001220000495
Singh PK, Nag A, Arya P et al (2018) Prospects of understanding the molecular biology of disease
resistance in rice. Int J Mol Sci 19:1141
Song WY, Wang GL, Chen LL et al (1995) A receptor kinase-like protein encoded by the rice dis-
ease resistance gene, Xa21. Science 270:1804. https://doi.org/10.1126/science.270.5243.1804
Stein JC, Yu Y, Copetti D et al (2018) Genomes of 13 domesticated and wild rice relatives highlight
genetic conservation, turnover and innovation across the genus Oryza. Nat Genet 50:285–296.
https://doi.org/10.1038/s41588-018-0040-0
Streubel J, Pesce C, Hutin M et al (2013) Five phylogenetically close rice SWEET genes con-
fer TAL effector-mediated susceptibility to Xanthomonas oryzae pv. oryzae. New Phytol
200:808–819. https://doi.org/10.1111/nph.12411
Su J, Wang W, Han J et al (2015) Functional divergence of duplicated genes results in a novel blast
resistance gene Pi50 at the Pi2/9 locus. Theor Appl Genet 128:2213–2225
Suh J-P, Noh T-H, Kim K-Y et al (2009) Expression levels of three bacterial blight-resistance genes
against K3a race of Korea by molecular and phenotype analysis in japonica rice (O. sativa L.).
J Crop Sci Biotechnol 12:103–108. https://doi.org/10.1007/s12892-009-0103-y
Sun W, Zhang J, Fan Q et al (2010) Silicon-enhanced resistance to rice blast is attributed to silicon-
mediated defense resistance and its role as physical barrier. Eur J Plant Pathol 128:39–49
Sun Y, Zhang X, Wu C et al (2016) Engineering herbicide-resistant rice plants through CRISPR/
Cas9-mediated homologous recombination of acetolactate synthase. Mol Plant 9:628–631
Sun Q, Liu X, Yang J et al (2018) MicroRNA528 affects lodging resistance of maize by regulating
lignin biosynthesis under nitrogen-luxury conditions. Mol Plant 11:806–814
Sun Y, Wang M, Mur LAJ et al (2020) Unravelling the roles of nitrogen nutrition in plant disease
defenses. Int J Mol Sci 21:572
Sundaram RM, Vishnupriya MR, Biradar SK et al (2008) Marker-assisted introgression of bacte-
rial blight resistance in Samba Mahsuri, an elite indica rice variety. Euphytica 160:411–422.
https://doi.org/10.1007/s10681-007-9564-6
Sundaram RM, Vishnupriya MR, Laha GS et al (2009) Introduction of bacterial blight resistance
into Triguna, a high-yielding, mid-early duration rice variety. Biotechnol J 4:400–407. https://
doi.org/10.1002/biot.200800310
Swathi G, Durga Rani CV, Md J et al (2019) Marker-assisted introgression of the major bacterial
blight- resistance genes, Xa21 and xa13, and blast resistance gene, Pi54, into the popular rice
variety, JGL1798. Mol Breed 39:1–12. https://doi.org/10.1007/s11032-019-0950-2
Tabien RE, Li Z, Paterson AH et al (2002) Mapping QTLs for field resistance to the rice blast
pathogen and evaluating their individual and combined utility in improved varieties. Theor
Appl Genet 105:313–324. https://doi.org/10.1007/s00122-002-0940-2
Taguchi-Shiobara F, Ozaki H, Sato H et al (2013) Mapping and validation of QTLs for rice sheath
blight resistance. Breed Sci 63:301–308. https://doi.org/10.1270/jsbbs.63.301
Takagi H, Abe A, Yoshida K et al (2013a) QTL-seq: rapid mapping of quantitative trait loci in rice
by whole- genome resequencing of DNA from two bulked populations. Plant J 74:174–183
Takagi H, Uemura A, Yaegashi H et al (2013b) MutMap-Gap: whole-genome resequencing of
mutant F2 progeny bulk combined with de novo assembly of gap regions identifies the rice
blast-resistance gene Pii. New Phytol 200:276–283. https://doi.org/10.1111/nph.12369
Takahashi W, Miura Y, Sasaki T (2009) A novel inoculation method for evaluation of grey leaf spot
resistance in Italian ryegrass. J Plant Pathol 91:171–176. https://doi.org/10.4454/jpp.v91i1.638
Tan GX, Ren X, Weng QM et al (2004) Mapping of a new resistance gene to bacterial blight in rice
line introgressed from Oryza officinalis. Acta Genet Sin 31:724–729
Tang D, Wu W, Li W et al (2000) Mapping of QTLs conferring resistrance to bacterial leaf streak
in rice. Theor Appl Genet 101:286–291. https://doi.org/10.1007/s001220051481
Tang L, Mao B, Li Y et al (2017) Knockout of OsNramp5 using the CRISPR/Cas9 system pro-
duces low Cd-accumulating indica rice without compromising yield. Sci Rep 7:14438. https://
doi.org/10.1038/s41598-017-14832-9
Tanksley SD, Young ND, Paterson AH, Bonierbale MW (1989) RFLP mapping in plant breeding:
new tools for an old science. Bio/Technology 7:257–264. https://doi.org/10.1038/nbt0389-257
Tanweer FA, Rafii MY, Sijam K et al (2015) Current advance methods for the identification of blast
resistance genes in rice. C R Biol 338:321–334. https://doi.org/10.1016/j.crvi.2015.03.001
Tena G, Boudsocq M, Sheen J (2011) Protein kinase signaling networks in plant innate immunity.
Curr Opin Plant Biol 14:519–529
Teng Q, Hu X-F, Chang Y-Y et al (2016) Effects of different fertilisers on rice resistance to pests
and diseases. Soil Res 54:242–253
Thakur M, Sohal BS (2013) Role of elicitors in inducing resistance in plants against pathogen
infection: a review. Int Sch Res Not 2013:762412
Tonnessen BW, Manosalva P, Lang JM et al (2015) Rice phenylalanine ammonia-lyase gene
OsPAL4 is associated with broad spectrum disease resistance. Plant Mol Biol 87:273–286.
https://doi.org/10.1007/s11103-014-0275-9
Vassilev D, Leunissen J, Atanassov A et al (2005) Application of bioinformatics in plant breeding.
Biotechnol Biotechnol Equip 19:139. https://doi.org/10.1080/13102818.2005.10817293
Vikal Y, Chawla H, Sharma R et al (2014) Mapping of bacterial blight-resistance
gene xa8 in rice (Oryza sativa L.). Indian J Genet Plant Breed 74:589. https://doi.
org/10.5958/0975-6906.2014.00895.5
Wang GL, Mackill DJ, Bonman JM et al (1994) RFLP mapping of genes conferring complete and
partial resistance to blast in a durably resistant rice cultivar. Genetics 136:1421–1434
Wang ZX, Yano M, Yamanouchi U et al (1999) The Pib gene for rice blast resistance belongs to
the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. Plant J
19:55–64. https://doi.org/10.1046/j.1365-313X.1999.00498.x
Wang W, Zhai W, Luo M et al (2001) Chromosome landing at the bacterial blight-resistance gene
Xa4 locus using a deep coverage rice BAC library. Mol Gen Genet 265:118–125. https://doi.
org/10.1007/s004380000382
Wang C, Wen G, Lin X et al (2009) Identification and fine-mapping of the new bacterial blight-
resistance gene, Xa31(t), in rice. Eur J Plant Pathol 123:235–240. https://doi.org/10.1007/
s10658-008-9356-4
Wang F, Wang C, Liu P et al (2016) Enhanced rice blast resistance by CRISPR/Cas9-targeted
mutagenesis of the ERF transcription factor gene OsERF922. PLoS One 11:e0154027
Wang M, Wang S, Liang Z et al (2018) From genetic stock to genome editing: gene exploitation in
wheat. Trends Biotechnol 36:160–172
Wang L, Zhao L, Zhang X et al (2019) Large-scale identification and functional analysis of
NLR genes in blast resistance in the Tetep rice genome sequence. Proc Natl Acad Sci U S A
116:8479–18487. https://doi.org/10.1073/pnas.1910229116
Wen ZH, Zeng YX, Ji ZJ, Yang CD (2015) Mapping quantitative trait loci for sheath blight dis-
ease resistance in Yangdao 4 rice. Genet Mol Res 14:1636–1649. https://doi.org/10.4238/2015.
March.6.10
Wu KS, Tanksley SD (1993) Abundance, polymorphism and genetic mapping of microsatellites in
rice. Mol Gen Genet 241:225–235. https://doi.org/10.1007/BF00280220
Wu JL, Fan YY, Li DB et al (2005) Genetic control of rice blast resistance in the durably resis-
tant cultivar Gumei 2 against multiple isolates. Theor Appl Genet 111:50–56. https://doi.
org/10.1007/s00122-005-1971-2
Wu KS, Martinez C, Lentini Z et al (2008) Cloning a blast resistance gene by chromosome walk-
ing. Rice Genet III:669. https://doi.org/10.1142/97898128142789_0082
Wu X, Yu Y, Baerson SR et al (2017) Interactions between nitrogen and silicon in rice and their
effects on resistance toward the brown planthopper Nilaparvata lugens. Front Plant Sci 8:28
Xiang Y, Cao Y, Xu C et al (2006) Xa3, conferring resistance for rice bacterial blight and encoding
a receptor kinase-like protein, is the same as Xa26. Theor Appl Genet 113:1347–1355. https://
doi.org/10.1007/s00122-006-0388-x
Xu Q, Yuan X, Yu H et al (2011) Mapping quantitative trait loci for sheath blight resis-
tance in rice using double haploid population. Plant Breed 130:404–406. https://doi.
org/10.1111/j.1439-0523.2010.01806.x
Xu X, Hayashi N, Wang CT et al (2014) Rice blast resistance gene Pikahei-1(t), a member of a
resistance gene cluster on chromosome 4, encodes a nucleotide-binding site and leucine-rich
repeat protein. Mol Breed 34:691–700. https://doi.org/10.1007/s11032-014-0067-6
Xu Z, Xu X, Gong Q et al (2019) Engineering broad-spectrum bacterial blight resistance by simul-
taneously disrupting variable TALE-binding elements of multiple susceptibility genes in rice.
Mol Plant 12:1434–1446. https://doi.org/10.1016/j.molp.2019.08.006
Yadav S, Anuradha G, Kumar RR et al (2015) Identification of QTLs and possible candidate genes
conferring sheath blight resistance in rice (Oryza sativa L.). Springerplus 4:175. https://doi.
org/10.1186/s40064-015-0954-2
Yoshimura S, Yamanouchi U, Katayose Y et al (1998) Expression of Xa1, a bacterial blight-
resistance gene in rice, is induced by bacterial inoculation. Proc Natl Acad Sci U S A
95:1663–1668. https://doi.org/10.1073/pnas.95.4.1663
Yu S, Ali J, Zhang C et al (2020) Correction to: Genomic breeding of green super rice varieties and
their deployment in Asia and Africa. Theor Appl Genet 133:1337
Yuan B, Zhai C, Wang W et al (2011) The Pik-p resistance to Magnaporthe oryzae in rice is
mediated by a pair of closely linked CC-NBS-LRR genes. Theor Appl Genet 122:1017–1028.
https://doi.org/10.1007/s00122-010-1506-3
Yuan C, Yuxiang Z, Zhijuan J et al (2019) Identification of stable quantitative trait loci for sheath
blight resistance using recombinant inbred line. Rice Sci 26:331–338. https://doi.org/10.1016/j.
rsci.2019.08.007
Yugander A, Sundaram RM, Ladhalakshmi D et al (2017) Virulence profiling of Xanthomonas ory-
zae pv. oryzae isolates, causing bacterial blight of rice in India. Eur J Plant Pathol 149:171–191.
https://doi.org/10.1007/s10658-017-1176-y
Yugander A, Sundaram RM, Singh K et al (2018) Incorporation of the novel bacterial blight-
resistance gene Xa38 into the genetic background of elite rice variety Improved Samba
Mahsuri. PLoS One 13:e0198260. https://doi.org/10.1371/journal.pone.0198260
Zafar K, Sedeek KEM, Rao GS et al (2020) Genome editing technologies for rice improvement:
progress, prospects, and safety concerns. Front Genome Ed 2:5. https://doi.org/10.3389/
fgeed.2020.00005
Zenbayashi K, Ashizawa T, Tani T, Koizumi S (2002) Mapping of the QTL (quantitative trait
locus) conferring partial resistance to leaf blast in rice cultivar Chubu 32. Theor Appl Genet
104:547–552. https://doi.org/10.1007/s00122-001-0779-y
Zeng YX, Xia LZ, Wen ZH et al (2015) Mapping resistant QTLs for rice sheath blight disease
with a doubled haploid population. J Integr Agric 14:801–810. https://doi.org/10.1016/
S2095-3119(14)60909-6
Zetsche B, Gootenberg JS, Abudayyeh OO et al (2015) Cpf1 is a single RNA-guided endonuclease
of a Class 2 CRISPR-Cas system. Cell 163:759–771. https://doi.org/10.1016/j.cell.2015.09.038
Zhai C, Lin F, Dong Z et al (2011) The isolation and characterization of Pik, a rice blast-
resistance gene which emerged after rice domestication. New Phytol 189:321–334. https://doi.
org/10.1111/j.1469-8137.2010.03462.x
Zhang Q, Wanf CL, Zhao KJ et al (2001) The effectiveness of advanced rice lines with new resis-
tance gene Xa23 to rice bacterial blight. Rice Genet Newsl 18:71–72
Zhang H, Li G, Li W, Song F (2009) Transgenic strategies for improving rice disease resistance.
Afr J Biotechnol 8:1750–1757
Zhang F, Zhuo DL, Zhang F et al (2015) Xa39, a novel-dominant gene conferring broad-spectrum
resistance to Xanthomonas oryzae pv. oryzae in rice. Plant Pathol 64:568–575. https://doi.
org/10.1111/ppa.12283
Zhang H, Zhang J, Lang Z et al (2017a) Genome editing: principles and applications for functional
genomics research and crop improvement. CRC Crit Rev Plant Sci 36:291–309
Zhang W, Wu L, Ding Y et al (2017b) Nitrogen fertilizer application affects lodging resistance by
altering secondary cell wall synthesis in japonica rice (Oryza sativa). J Plant Res 130:859–871
Zhao H, Wang X, Jia Y et al (2018) The rice blast-resistance gene Ptr encodes an atypical protein
required for broad-spectrum disease resistance. Nat Commun 9:1–12. https://doi.org/10.1038/
s41467-018-04369-4
Zheng CK, Wang CL, Yu YJ et al (2009) Identification and molecular mapping of Xa32(t), a novel
resistance gene for bacterial blight (Xanthomonas oryzae pv. oryzae) in rice. Acta Agron Sin
35:1173–1180. https://doi.org/10.1016/S1875-2780(08)60089-9
Zhou JH, Wang JL, Xu JC et al (2004) Identification and mapping of a rice blast-resistance
gene Pi-g(t) in the cultivar Guangchangzhan. Plant Pathol 53:191–196. https://doi.
org/10.1111/j.0032-0862.2004.00986.x
Zhou B, Qu S, Liu G et al (2006) The eight amino-acid differences within three leucine-rich repeats
between Pi2 and Piz-t resistance proteins determine the resistance specificity to Magnaporthe
grisea. Mol Plant-Microbe Interact 19:1216–1228. https://doi.org/10.1094/MPMI-19-1216
Zhou J, Peng Z, Long J et al (2015) Gene targeting by the TAL effector PthXo2 reveals cryptic
resistance gene for bacterial blight of rice. Plant J 82:632–643
Zhou J, Deng K, Cheng Y et al (2017) CRISPR-Cas9 based genome editing reveals new insights
into microRNA function and regulation in rice. Front Plant Sci 8:1598. https://doi.org/10.3389/
fpls.2017.01598
Zhou X, Liao H, Chern M et al (2018) Loss of function of a rice TPR-domain RNA-binding protein
confers broad-spectrum disease resistance. Proc Natl Acad Sci U S A 115:3174–3179. https://
doi.org/10.1073/pnas.1705927115
Zhuang JY, Ma WB, Wu JL et al (2002) Mapping of leaf and neck blast-resistance genes with
resistance gene analog, RAPD and RFLP in rice. Euphytica 128:363–370. https://doi.org/1
0.1023/A:1021272710294
Zipfel C, Felix G (2005) Plants and animals: a different taste for microbes? Curr Opin Plant Biol
8:353–360
Zuo S, Yin Y, Pan C et al (2013) Fine-mapping of qSB-11LE, the QTL that confers partial resis-
tance to rice sheath blight. Theor Appl Genet 126:1257–1272. https://doi.org/10.1007/
s00122-013-2051-7
Zuo S, Zhang Y, Yin Y et al (2014) Fine-mapping of qSB-9 TQ, a gene conferring major quan-
titative resistance to rice sheath blight. Mol Breed 34:2191–2203. https://doi.org/10.1007/
s11032-014-0173-5
Molecular Approaches for Insect Pest
Management in Rice
Jagadish S. Bentur, R. M. Sundaram, Satendra Kumar Mangrauthia,

and Suresh Nair
Abstract This chapter focuses on the progress made in using molecular tools in
understanding resistance in rice to insect pests and breeding rice for multiple and
durable insect resistance. Currently, molecular markers are being extensively used
to tag, map, introgress, and clone plant resistance genes against gall midge, plan-
thoppers, and leafhoppers. Studies on cloned insect resistance genes are leading to
a better understanding of plant defense against insect pests under different feeding
guilds. While marker-assisted breeding is successfully tackling problems in durable
and multiple pest resistance in rice, genomics of plants and insects has identified
RNAi-based gene silencing as an alternative approach for conferring insect resis-
tance. The use of these techniques in rice is in the developmental stage, with the
main focus on brown planthopper and yellow stem borer. CRISPR-based genome
editing techniques for pest control in plants has just begun. Insect susceptibility
genes (negative regulators of resistance genes) in plants are apt targets for this
approach while gene drive in insect populations, as a tool to study rice-pest interac-
tions, is another concept being tested. Transformation of crop plants with diverse
insecticidal genes is a proven technology with potential for commercial success.
Despite advances in the development and testing of transgenic rice for insect resis-
tance, no insect-resistant rice cultivar is now being commercially cultivated. An
array of molecular tools is being used to study insect-rice interactions at transcrip-
tome, proteome, metabolome, mitogenome, and metagenome levels, especially
with reference to BPH and gall midge, and such studies are uncovering new
approaches for insect pest management and for understanding population genetics
and phylogeography of rice pests. Thus, it is evident that the new knowledge being
gained through these studies has provided us with new tools and information for
J. S. Bentur (*)
Agri Biotech Foundation, Hyderabad, Telangana, India
R. M. Sundaram
ICAR-Indian Institute of Rice Research, Hyderabad, Telangana, India
S. K. Mangrauthia
ICAR-Indian Institute of Rice Research, Hyderabad, Telangana, India
S. Nair
Plant-Insect Interaction Group, International Centre for Genetic Engineering and
Biotechnology, New Delhi, India

https://doi.org/10.1007/978-3-030-66530-2_11
380 J. S. Bentur et al.
facing future challenges. However, what is also evident is that our attempts to man-
age rice pests cannot be a one-time effort but must be a continuing one.
Keywords Insect resistance · Molecular markers · Marker-assisted breeding ·

RNAi · Genome editing · Transgenic rice · Insect-plant interaction
1 Introduction
Insect pests of rice form a formidable biotic stress component and a significant pro-
duction constraint across the globe. Although more than 200 insect species are
reported to feed on rice plants, about a dozen of them are economically important in
a specific rice ecosystem at a given time. Several of these have coevolved over thou-
sands of years along with their host and many have no alternate host. The pest
complex of rice is represented by insects from all the feeding guilds, from defolia-
tors, tissue borers, and sap-suckers to gall formers, and several of these are occupied
by a complex of species (Heinrichs 1994). Most important among these are stem
borers: yellow stem borer (YSB), Scirpophaga incertulas; striped stem borer (SSB),
Chilo suppressalis; and pink stem borer (PSB), Sesamia inferens; planthoppers:
brown planthopper (BPH), Nilaparvata lugens; white-backed planthopper (WBPH),
Sogatella furcifera; and small brown planthopper (SBPH), Laodelphax striatellus;
leafhoppers: green leafhopper (GLH), Nephottetix virescens; green rice leafhopper
(GRL/GRH), Nephotettix cincticeps; and zigzag leafhopper (ZLH), Recilia dorsa-
lis; gall midges: Asian rice gall midge (ARGM), Orseolia oryzae; and African rice
gall midge (AfRGM), Orseolia oryzivora; and leaffolders: Cnaphalocrocis medina-
lis and Marasmia spp. Several other insects such as rice hispa, grain bugs, aphids,
mealy bug, and stem fly are of minor or regional importance (Bentur 2010).
Several studies reported yield losses due to either a single pest or a complex of
pests but most of them end up with either overestimating or underestimating the
damage caused by these pests. Savary et al. (2000) critically studied yield losses
caused by different pests under varying production environments and suggested that
stem borer damage at heading stage accounted for 2.3% loss. They also noted that
yield attrition from chronic injuries by stem borer deadheart damage and defoliation
is underestimated. Although this study represented the macro-level scenario, micro-
level yield losses due to any single or combination of insect pests can be high and
deserves to be mitigated. Deutsch et al. (2018) predict future increases in yield loss
in rice because of insect pests under the scenario of global warming.
Past experience has clearly shown that any unilateral approach based on chemi-
cal control, plant resistance, biocontrol, or behavioral means with pheromones has
not provided desirable and sustainable solutions to pest problems. However, an
early lead in exploring host-plant resistance taken by the International Rice Research
Institute and emulated by various national programs paved the way for breeding for
insect resistance with exemplary success against pests such as striped stem borer,
Molecular Approaches for Insect Pest Management in Rice 381
gall midge, and planthoppers. But the first wave of success was countered by the
rapid evolution of virulent biotypes. With the recent advances in molecular biology
and biotechnology, researchers now have a new set of tools with which they can
address several problems at the molecular level and identify new strategies to over-
come old problems. In this chapter, we examine progress made through the classical
approach and how the limitations of classical approach-based insect resistance and
breeding for multiple and durable insect resistance in rice are being overcome with
molecular marker-based approaches. In addition, we attempt to present the future
scenario of genomics-based tools that may provide novel strategies of pest
management.
2 lassical Approach Through Host-Plant Resistance

C
Gene Deployment
Following the seminal publication of R.H. Painter (1951), genetic resistance in the
host plant has been extensively explored and plant resistance (R) genes have been
transferred to elite cultivars of field crops and other economically important plant
species. Classical breeding methods and phenotypic selections were followed to
achieve this until molecular markers were discovered. Currently, desired R-genes
can be transferred and pyramided through marker-assisted selection and breeding.
The status of donor sources, genetics of resistance, tagging and mapping of R-genes,
and reported gene-linked markers are provided in what follows for the major insect
pests of rice.
2.1 Gall Midge
Asian rice gall midge (ARGM) is a serious pest of rice in South and Southeast Asia.
In India, gall midge damage is estimated to cause an annual yield loss of about
USD 80 million (Bentur et al. 2003). The insect displays a unique life cycle, which
is completed in 3–4 weeks. Maggots hatched from eggs laid on the plant surface
crawl down between leaf sheaths to reach the apical meristem to feed. The insect
feeds by laceration of the apical meristem and secretion of saliva, resulting in hyper-
trophy and hyperplasia of cells, ultimately leading to the development of a nutritive
tissue and a gall chamber in the tiller. The insect also renders the tiller sterile and
arrests further differentiation. Maggots cease feeding in the third instar and pupate
in the gall. The adult fly emerges from this modified sheath gall called “silver shoot,”
which is a typical symptom of gall midge damage. ARGM is predominantly a
vegetative-stage pest and, in the event of a high percentage of tillers being converted
into galls, there will be a proportionate decrease in the number of productive tillers,
panicles, and therefore grain yield.
Rice varieties differ in their response to gall midge infestation. A small propor-
tion of varieties is immune to pest attack by effectively killing the maggot within
hours of feeding. The resistance mechanism displayed by the varieties is catego-
rized into two distinct types. A majority of the resistant rice genotypes express a
hypersensitive reaction (HR), leading to tissue necrosis at the site of maggot feed-
ing, and are referred to as HR +ve (HR+) types, whereas a few of the resistant geno-
types do not display HR but still maggot mortality is noticed, and these are termed
HR −ve (HR−) types. The role of phenols in HR+ resistance has been reported
(Amudhan et al. 1999). Because the nature of resistance is antibiosis in both HR+
and HR− types, host-plant resistance is the most effective way of managing the pest
(Bentur et al. 2003).
Field and greenhouse evaluations of more than 50,000 germplasm accessions
resulted in the identification of more than 300 primary sources of resistance (Bentur
et al. 2011). Studies on the genetics of gall midge resistance in rice have often
shown the involvement of a single dominant or recessive gene. To date, 12 genes
conferring resistance against the pest have been reported (Himabindu et al. 2010;
Leelagud et al. 2020), 10 of which are dominant (Gm1 through Gm11, except
gm3 and gm12). The presence of gall midge biotypes within India was suspected
during the early phase of breeding for resistance. So far, seven distinct biotypes
have been characterized based on their reaction pattern against five groups of dif-
ferential rice varieties (Vijayalakshmi et al. 2006). Similar to the interaction between
pathogens and their plant hosts, a gene-for-gene interaction has been reported
between rice resistance genes (i.e., R genes) and gall midge biotypes (Nair et al.
2011). Each of the biotypes displays a specific range of virulence against R-genes,
and likewise each R-gene confers resistance to specific biotypes, which also implies
that none of the R-genes conferred resistance to all biotypes and none of the bio-
types showed virulence against all of the R-genes. Hence, it is possible to extend the
range of resistance against biotypes by combining diverse resistance genes through
gene pyramiding.
Of the 12 gall midge resistance genes identified thus far, 10 (Gm1, Gm2, gm3,
Gm4, Gm5, Gm6, Gm7, Gm8, Gm11, and gm12) have been tagged and mapped with
reported linked markers (Table 1). As it is well known that single gene-conferred
resistance against gall midge can break down within a short time, the strategy of
pyramiding two or more genes with divergent mechanisms of resistance (i.e., HR+
and HR−) has been advocated for durable resistance against the insect pest
(Sundaram et al. 2013). So far, three gall midge resistance genes, gm3 (Sama et al.
2014), Gm4 (Divya et al. 2015), and Gm8 (Divya et al. 2018b), have been cloned
and characterized, and another gene, Gm2, has been reported to be allelic to gm3
(Sama et al. 2014; Sundaram 2007). The recessive resistance gene, gm3, which
displays HR+, encodes an NB-ARC (NBS-LRR) domain-containing protein, while
the dominant gene, Gm4, which also displays HR+, encodes a leucine-rich repeat
(LRR) protein, and Gm8, displaying HR−, encodes a proline-rich protein (PRP). It
is desirable to deploy two or more previously undeployed genes that differ in their
mechanism of resistance, for example, Gm4 (HR+) and Gm8 (HR−) genes would
meet the above-specified requirements. Another gene, gm3, may also be considered
Table 1 List of rice resistance genes against major insects tagged and mapped along with information on linked markers
Primer
Chromosome physical
Gene no. Primer name position (bp) F primer R primer Reference
Brown planthopper
Bph 1 12L BpE18-3 STS ? CGCTGCGAGAGTGTGACACT TTGGGTTACACGGGTTTGAC Kim and Sohn
(2005)
Bph 1 12L pBPH9F 22,858,861 AGCGCTGGTCGTTGGGGTTGTAGT ATTAAAAGTGATCGCAGCCGTTCG Cha et al.
(2008)
bph2 12L KAM4STS ? TAACTGGTGTTAGTGCGAATGC AATTCACGGCATGTGAAGCCCTAG Murai et al.
(2001)
bph2 12L RM7102 13,213,987 GGGCGTTCGGTTTACTTGGTTACTCG GGCGGCATAGGAGTGTTTAGAGTGC Sun et al.
(2006)
bph2 12L RM463 22,125,420 GAGGATTAATTAGCGTGTGACC GTCGTGACATCTACTCAAATGG Sun et al.
(2006)
BPh3 6S RM190 1,765,637 CTTTGTCTATCTCAAGACAC TTGCAGATGTTCTTCCTGATG Jairin et al.
(2007a)
BPh3 6S RM589 1,381,875 GTGGCTTAACCACATGAGAAACTACC TCACATCATTAGGTGGCAATCG Jairin et al.
(2007a)
BPh3 6S RM588 1,612,412 TCTTGCTGTGCTGTTAGTGTACG GCAGGACATAAATACTAGGCATGG Jairin et al.
(2007a)
BPh3 6S RM19291 1,216,883 CACTTGCACGTGTCCTCTGTACG GTGTTTCAGTTCACCTTGCATCG Jairin et al.
(2007b)
BPh3 6S RM8072 1,409,335 GATCACTCAGGTCATCCATTC AATCAGAGAGGCTAAAGACAATAAT Jairin et al.
(2007b)
bph4 6S RM586 1,477,792 TGCCATCTCATAAACCCACTAACC CTGAGATACGCCAACGAGATACC Jairin et al.
(2010)
bph4 6S RM589 1,381,875 GTGGCTTAACCACATGAGAAACTACC TCACATCATTAGGTGGCAATCG Jairin et al.
(2010)
(continued)
Table 1 (continued)
Primer
Chromosome physical
bph4 6S RM217 ? ATCGCAGCAATGCCTCGT GGGTGTGAACAAAGACAC Kawaguchi
et al. (2001)
bph4 6S RM225 3,417,595 TGCCCATATGGTCTGGATG GAAAGTGGATCAGGAAGGC Kawaguchi
et al. (2001)
Bph6 4L RM6997 21,272,870 CGGCAGTAAATTTGCATTGACC AGTGGCCTTGTCAGTCTACATGC Qiu et al.
(2010)
Bph6 4L RM5742 21,559,553 GATCCTCAAACGGCCTCTGC CCTTCAAAGTTTACTCACGCTCTGC Qiu et al.
(2010)
Bph9 12L RM463 22,125,420 GAGGATTAATTAGCGTGTGACC GTCGTGACATCTACTCAAATGG Su et al.
(2006)
Bph9 12L RM5341 19,114,746 CATCCGGAGGAAGTTTGAAAGAAGG CAAGGGCAACCTCTTCCACTACGC Su et al.
(2006)
Bph10a 12L RG457FL/RB ? ? Lang and Buu
STS marker (2003)
Bph10a 12L RG457FL/RL ? ? Lang and Buu
STS marker (2003)
Bph12a 4L RM16459 5,213,984 TCCAGGAGTTTGCCTTGTAGTGC TAGCGAAGTCAGGATGGCATAGG Qiu et al.
(2012)
Bph12a 4L RM1305 5,659,601 GGTACTACAAAGAAACCTGCATCG TCCTAGCTCAAATGTGCTATCTGG Qiu et al.
(2012)
Bph13a 2L RM240 31,497,147 CCTTAATGGGTAGTGTGCAC TGTAACCATTCCTTCCATCC Liu et al.
(2001)
Bph13a 2L RM250 32,774,365 GGTTCAAACCAAGCTGATCA GATGAAGGCCTTCCACGCAG Liu et al.
(2001)
BPh13a 2L AJ09b StS from ? ? Renganayaki
RAPD et al. (2002)
Bph14a 3L SM1 38,751,114 AGCGTTAAGCGCCATTATCA CGCCGAGGCATTAGAGTAGA Du et al.
(2009)
Table 1 (continued)
Primer
Chromosome physical
Bph14b 3L NBS-LRR AAATTCGTGGTTGTTCTGGT TCGGTAACGATCCATGATGA Du et al.
(2009)
Bph15a 4S MS1 reported 9,278,808 CATGGACCCACTTGTCATCC AGCATGAGAGACTGCCAAGG Yang et al.
earlier by C820 (2004)
and S11182
RFLP marker
Bph15a 4S RM261 reported 6,578,953 CTACTTCTCCCCTTGTGTCG TGTACCATCGCCAAATCTCC Yang et al.
earlier by C820 (2004)
and S11182
RFLP marker
Bph16a 12L RM6732 21,983,109 AATTTTGAACACCTCAAAGG TTTTCAGTGCATGTCTTCG Hirabayashi
et al. (2004)
Bph17 4S RM8213 4,446,064 TGTTGGGTGGGTAAAGTAGATGC CCCAGTGATACAAAGATGAGTTGG Sun et al.
(2005)
Bph17 4S RM5953 9,379,510 AAACTTTCTGTGATGGTATC ATCCTTGTCTAGAATTGACA Sun et al.
(2005)
Bph17b 4S LRK2 6,953,940 CTTTCGCAGGGTGGCAAATAGGGT CCTTCGCTGCTCACTAGGACCGTGTA Liu et al.
(2015)
Bph18a 12L RM463 22,125,420 GAGGATTAATTAGCGTGTGACC GTCGTGACATCTACTCAAATGG Jena et al.
(2006)
Bph18a 12L S15552 STS ? ? Jena et al.
marker cleaved (2006)
by alu1 enzyme
Bph18a 12L RM511 17,401,530 AACGAAAGCGAAGCTGTCTCC ATTTGTTCCCTTCCTTCGATCC Suh et al.
(2011)
(continued)
Table 1 (continued)
Primer
Chromosome physical
Bph18a 12L RM1584 27,104,354 TAGCCTGCAGCCACCCTGATCC CAATGTGACTTCCGTGCGTAGTGG Suh et al.
(2011)
bph19 3S RM6308 7,181,156 TCTCGACCTGGCTCTCCTCTAGC AGTGCACGGACATGTCACTCTCG Chen et al.
(2006)
bph19 3S RM3134 7,240,409 GCAGGCACAAAAGCAAAGAG AGGTGAAGGTGCATTGTGTG Chen et al.
(2006)
Bph20a 4S MS10 STS 8,071,921 CAATACGAGAAGCCCCTCAC CTGAAGGAACACGCGGTAGT Rahman et al.
marker (2009)
Bph20a 4S RM5953 9,379,510 AAACTTTCTGTGATGGTATC ATCCTTGTCTAGAATTGACA Rahman et al.
(2009)
bph20a 4S RM435 BYL7 535,684 AAGCTAGGGAATCAGCGGTTA BYL TGTGGCATGTCACTCACTCAC Yang et al.
closest marker (2012)
bph20a 4S RM540 BYL8 468,236 CCCACTTCCACAACCACA BYL8 ATGCTCCTAGCTTCCTATTCC Yang et al.
Bph21a 12L RM3726 23,275,187 TACACCCACCCACATACGTCAGC GTCGTACTCCCGGATCTTCTTCC Rahman et al.
(2009)
Bph21a 12L RM5479 24,412,536 CTCACCATAGCAATCTCCTGTGC ACTTCGTTCACTTGCATCATGG Rahman et al.
(2009)
bph21 10S RM222 2,620,380 CTTAAATGGGCCACATGCG CAAAGCTTCCGGCCAAAAG Yang et al.
(2012)
bph21 10S RM244 CCGACTGTTCGTCCTTATCA CTGCTCTCGGGTGAACGT Yang et al.
(2012)
bph22 4 RM8212 99,416 CCACCGCACTTGTCTATG TCCAATCTCACTCTCGACTC Hou et al.
(2011)
Table 1 (continued)
Primer
Chromosome physical
bph22 4 RM261 6,574,396 CTACTTCTCCCCTTGTGTCG TGTACCATCGCCAAATCTCC Hou et al.
(2011)
Bph22a 6 RM19429Rm584 3,417,532 TATGTGGTTGGCTTGCCTAGTGG TGCCCATATGGTCTGGATGTGC Harini et al.
(2010)
Bph22a 6 RM584 3,417,532 TATGTGGTTGGCTTGCCTAGTGG TGCCCATATGGTCTGGATGTGC Harini et al.
(2010)
Bph22a 6 RM585 3,169,373 CTAGCTAGCCATGCTCTCGTACC CTGTGACTGACTTGGTCATAGGG Harini et al.
(2010)
bph23a 8 RM2655 2,017,692 TGTCTGTGTTGTCACTGCCTTATCG TCCGCTCTGTGTGTATCTGATCTGG Hou et al.
(2011)
bph23a 8 RM3572 3,928,306 CCATTTGGTAGGTCCATCTTACCC CTCCCAAGTGAAGTGCTGTCTGG Hou et al.
(2011)
Bph25 6S S00310 214,278 CAACAAGATGGACGGCAAGG TTGGAAGAAAAGGCAGGCAC Myint et al.
(2012)
Bph25 6S RM8101 1,705,742 CACTGACATAGCTAAGGTCTCATGTCTTAT TGGTTAACTCGCTATTATAATGAGTTCG Myint et al.
(2012)
Bph26 12L RM5479 24,409,241 CTAAGCTCACCATAGCAATC ATACACTTCTCCCCTCTCTG Myint et al.
(2012)
Bph26 12L MSSR2 25,033,993 CATGTCGAAGAGGTTGCAGA GGTTTCATCCAAGTCCACGA Myint et al.
(2012)
Bph26b 12L LRR 22,884,874 TAGCATCAGTCCCTTGCTTGTTTGC ATTGATTTAATTAGCAGACAAGTTG Tamura et al.
(2014)
Bph27a 4 RM16853 19,201,791 CTCCCATCCTTCATTTCATCTCG CTTTCTGCAAGACACTGCAAACG Huang et al.
(2013)
Bph27a 4 RM16846 19,115,583 CTACAAGCAACACAGTATCACAGC GGTAACTGGTGCTTATTTAGCC Huang et al.
(2013)
(continued)
Table 1 (continued)
Primer
Chromosome physical
Bph28 11 RM26656 15,738,361 GCAAAGAACATTGTGGCAAACACC TGGACACATTGTATCGTGCTTCG Wu et al.
(2014)
BPh28 11 RM26725 17,114,046 ATGTAGGCCCAAACGAGCTCTGACC ATGCCATAGTAGCGCTTGCGTATCC Wu et al.
(2014)
bph29a 6 RM435 BYL7 535,684 AAGCTAGGGAATCAGCGGTTA BYL TGTGGCATGTCACTCACTCAC Wang et al.
bph29a 6 RM540 BYL8 468,236 CCCACTTCCACAACCACA BYL8 ATGCTCCTAGCTTCCTATTCC Wang et al.
bph29b 6 G5 B3 domain 484,709 ATGGCCACCATTGTTGCATG TCAAAGCTGCAAATCCAGCG Wang et al.
(2015)
bph30a 10 RM222 2,620,380 CTTAAATGGGCCACATGCG CAAAGCTTCCGGCCAAAAG Wang et al.
(2008)
bph30a 10 RM244 CCGACTGTTCGTCCTTATCA CTGCTCTCGGGTGAACGT Wang et al.
(2008)
BPH31 3 PA26 ? ? Prahalada
et al. (2017)
BPH31 3 RM2334 26,740,452 CATGCATCTGATCTGATTAT TGTGAAGAGTACAAGTAGGG Prahalada
et al. (2017)
Bph32 6 RM19291 1,215,884 CACTTGCACGTGTCCTCTGTACG GTGTTTCAGTTCACCTTGCATCG Ren et al.
(2016)
Bph32 6 RM8072 1,408,336 GATCACTCAGGTCATCCATTC AATCAGAGAGGCTAAAGACAATAAT Ren et al.
(2016)
Bph32b 6 SCP 1,099,689 TGAGGGAGTTGTAGTAGGAGTA CGTCGTTGATGAAGTAAAGGT Ren et al.
(2016)
Bph33 1 RM11522 28,071,767 TAACTGCAGTGCTCAACAAAGG CTAGGTACCGGATTAAGATTCACC Naik et al.
(2018)
Primer
Chromosome physical
Bph33 1 RM488 24,808,556 AACAACCAGCGTATGCGTTCTCG CCCACGGCTTTGTAGGAAGAAGC Naik et al.
(2018)
Bph34a 4 RM16994 21,331,444 TGGCAGTACACACTACAGTACATGC AGAGGGAGGAGAGAAAGGAAGG Kumar et al.
(2018)
Bph34a 4 RM17007 21,484,908 CTTCCCACGCGAAACTTCATGG TCCGGCCAAGACAATATCAACG Kumar et al.
(2018)
White-backed planthopper
Wbph7 3L R1925 ? ? Tan et al.
(2004)
Wbph7 3L G1318 ? ? Tan et al.
(2004)
Wbph8 4S R288 ? ? Tan et al.
(2004)
Wbph8 4S S11182 ? ? Tan et al.
(2004)
Wbph9t 6 RM589 1,380,866 ATCATGGTCGGTGGCTTAAC CAGGTTCCAACCAGACACTG Ramesh et al.
(2014)
Wbph9t 6 RM539 GAGCGTCCTTGTTAAAACCG AGTAGGGTATCACGCATCCG Ramesh et al.
(2014)
Wbph10t 12 SSR12-17.2 Ramesh et al.
(2014)
Wbph10t 12 RM28487 23,142,514 GAGGTGATCTTAATGCCATCTTGACG TACATGCAACCTGGGTATGAGAGTGC Ramesh et al.
(2014)
Wbph11t 4 RM3643 19,948,112 AGCATGAGCAGGTGCTAGTG CGTTGCATGTGTGATGGC Ramesh et al.
(2014)
Wbph11t 4 RM1223 25,292,767 CAGCGTCTCCAAGAAACTCC GCTACCAGGTCAGAGTTGCC Ramesh et al.
(2014)
(continued)
Primer
Chromosome physical
Wbph 12t 4 RM16913 19,646,468 GTGTACGTGTTGGCTCTCTGTACG GATGTTGCTTGTGCTGCAACC Ramesh et al.
(2014)
Wbph 12t 4 RM471 19,426,246 CGGATCCAAGAAACAGCAG TTCGGTATCCTCCACACCTC Ramesh et al.
(2014)
Ovc 6S S1520 ? ? Yamasaki
et al. (2003)
Ovc 6S L688 ? ? Yamasaki
et al. (2003)
Green rice leafhopper
Grh1 5 C309 ? ? Tamura et al.
(1999)
Grh1 5 R569 ? ? Kadowaki
et al. (2003)
Grh2 11L G144 ? ? Fukuta et al.
(1998)
Grh2 11L G4001 ? ? Kadowaki
et al. (2003)
Grh2 11L G1465 ? ? Kadowaki
et al. (2003)
Grh3 6 C288B ? ? Saka et al.
(2006)
Grh3 6 C133A ? ? Saka et al.
(2006)
Grh4 3L G1465 ? ? Fukuta et al.
(1998)
Grh4 3L C1186 ? ? Kadowaki
et al. (2003)
Primer
Chromosome physical
Grh4 3L R2982 ? ? Kadowaki
et al. (2003)
Grh5 8L RM502 26,492,117 GCGATCGATGGCTACGAC ACAACCCAACAAGAAGGACG Fujita et al.
(2006)
Grh5 8L RM6845 27,560,145 GTGACGGCAAGAGGAAGAAG GTTCGACAGGAACGCCAC Fujita et al.
(2006)
Grh6 4S Y3635R ? ?? Tamura et al.
(2004)
Grh6 4S C708 ? Tamura et al.
(2004)
Grh6 4S RM8213 4,441,638 AGCCCAGTGATACAAAGATG GCGAGGAGATACCAAGAAAG Fujita et al.
(2004)
Grh6 4S G6-9 Fujita et al.
(2004)
QGRH9 9L RM201 20,174,289 CTCGTTTATTACCTACAGTACC CTACCTCCTTTCTAGACCGATA Fujita et al.
(2010)
QGRH9 9L RM205 22,720,624 CTGGTTCTGTATGGGAGCAG CTGGCCCTTCACGTTTCAGTG Fujita et al.
(2010)
Gall midge
Gm1 9 RM23941 7,818,607 AGAATCGAACCCTAACACATGC TATCGCTTGATTCTTGGACAGC Sundaram
(2007)
Gm1 9 RM23956 7,992,661 GTCTCTCCCTCTCTCATCTTGTCG CCCTATTCATGTGCAATGGAACC Sundaram
(2007)
Gm2 4 RM17473 30,838,175 TCTCTCCAGCTCCCTAAACATTCC AGCGACACACTGTTCACCTTGC Sundaram
(2007)
Gm2 4 RM17503 31,717,625 CCAGATCATCCAGGCATAACATCACC CGGCGCTGGTAAACTCCATTCC Sundaram
(2007)
(continued)
Primer
Chromosome physical
gm3 4 RM17480 31,146,877 GAGTTCGTCCCTGACAAACAGAAACG GTGAGCGAGCGAGTGAGTGAGC Sama et al.
(2014)
gm3 4 gm3SSR4 32,075,106 AGACACGAGGGAATTATGC CTCTATATTTGCCGCATCC Sama et al.
(2014)
gm3b 4 NB-ARC 31,950,000 CTGCCAGAGATGGGCCTTCCA CGTACAAATTCCTGTACCACTC Sama et al.
(2014)
Gm4 8 RM22551 5,451,661 CTTCGATCTCCTCGTCCTCTTCC GAGCATGAGATGATGCATGACG Divya et al.
(2015)
Gm4 8 RM22562 5,782,732 GATCGGAGGAGGGAGGAAGACG GTCGCATCCACTCATATTCCAAGC Divya et al.
(2015)
Gm4b 8 LRR-del 5,583,333 GTGGATCGAGAGAAGACAAG CTTGAGGACGATATTCAAGC Divya et al.
(2015)
Gm5 12 OPB14 ? ? see Bentur
et al. (2003)
Gm6 4 OPM061400 ? ? Katiyar et al.
(2001)
Gm6 4 RG214 ? ? Katiyar et al.
(2001)
Gm6 4 RG476 ? ? Katiyar et al.
(2001)
Gm7 4 SA598 ? ? Sardesai et al.
(2002)
Gm7 4 F8 ? ? Sardesai et al.
(2002)
Gm8 8 RM22685 8,800,203 ATGGGCTTCCAGGCTCAATCTCG CCCACTCTCACGTCTCCTCTCTTCC Sama et al.
(2012)
Gm8 8 RM22709 9,226,565 CGCGTGGGCGAGACTAATCG CCTTGACTCCGAGGATTCATTGTCC Sama et al.
(2012)
Primer
Chromosome physical
Gm8b 8 PRP-Del 9,127,586 TATAAAGAGGACGGTCTAACCTTTA GCACAGGGAAGTTGTCAGTTCAAGTA Divya et al.
(2018a)
Gm11 12 RM28574 24,292,314 TAGTTTGGTGAAGTGGCATTGG ATAGTAGGGCAAGGATTCAGAAGAGG Himabindu
et al. (2010)
Gm11 12 RM28706 25,992,979 GGTTCCCGGTCATCATATTTCC ACTTTACCCACGCGCTTTGC Himabindu
et al. (2010)
gm12 2 RM3340 386,212 GAGAGAGACACCAAATGATCCATCC ACTGATTTGGCCCTTGTTCTTGG Leelagud
et al. 2020
gm12 2 S2-76222 76,222 CACACATACCCACCCACTAGTGAAGATGAA[ Leelagud
C/T] et al. 2020
TGAATGCCAATGGGAGAAGAGGAGAGCAGA
? = sequence information not available in the publication cited
F primer and R primer = forward and reverse primers, respectively
a
Gene has been introgressed from wild species
b
Cloned gene
for pyramiding since it is a HR+ type and recessively inherited and has not been
deployed so far in any variety.
Using Gm4 and Gm8, the research group at ICAR-IIRR (Abhilash Kumar et al.
2017) has developed gene-pyramided lines in the genetic background of the elite
restorer line RPHR1005R (restorer line for the popular rice hybrid DRRH3) through
marker-assisted breeding. In another such effort, the high-yielding rice variety
Akshayadhan has been improved for its resistance against gall midge by targeted
transfer of Gm4 and Gm8 genes. Sama et al. (2014) introduced the recessive gene
gm3 into the genetic background of elite rice variety Improved Samba Mahsuri with
the help of markers. In a recent report (Venkanna et al. 2018), two major resistance
genes, gm3 and Gm8, have been pyramided in the genetic background of the fine-
grain-type rice variety Kavya, which already possesses Gm1. Now that closely
linked markers/functional markers are available for all the major gall midge resis-
tance genes, selected gene combinations can be pyramided into elite genetic back-
grounds (Divya et al. 2018c) easily through marker-assisted breeding for developing
durable multiARGM biotype-resistant rice cultivars/hybrids.
2.2 Planthoppers and Leafhoppers
Although more than 100 species of planthoppers (Delphacidae) and leafhoppers

(Cicadellidae) are reported to feed on rice, three species of planthoppers (BPH,
WBPH, and SBPH) have gained high economic importance since 2000 (Bentur and
Viratkamath 2008). Likewise, of the leafhoppers, GLH, GRL, and ZLH are impor-
tant. Although both groups consist of phloem sap feeders, planthoppers cause severe
damage by feeding alone, leading to total death of plants, termed hopper burn. Both
leafhoppers and planthoppers vector disease-causing viruses and cause indirect
damage to the crop. The main virus diseases thus transmitted are rice ragged stunt,
rice grassy stunt, and wilted stunt by BPH; southern rice black-streaked dwarf by
WBPH; stripe and black-streaked dwarf by SBPH; and rice tungro by several spe-
cies of leafhoppers. In response to planthoppers and leafhoppers gaining impor-
tance, screening of rice germplasm for resistance began at the International Rice
Research Institute (IRRI), Philippines, during the 1970s. Such initiatives were also
taken up in other Asian rice-growing countries, leading to reports of a large number
of resistance sources (IRRI 1979; Heinrichs et al. 1985; Heong and Hardy 2010).
Several of these sources were selected for systematic studies on genetics of resis-
tance, resulting in the identification of more than 38 major resistance genes against
BPH, 14 against WBPH, 14 against GLH, six against GRL, and three against ZLH
(Fujita et al. 2013; Ling and Weillin 2016; Du et al. 2020). Most of these genes are
now tagged and mapped on different rice chromosomes and reliable molecular
markers linked to these traits are available (Table 1). Marker-assisted selection as a
tool for breeding for BPH resistance using a single gene or multiple genes is being
reported (Liu et al. 2016; H Wang et al. 2016a; Y Wang et al. 2017b; Jiang et al.
2018). However, a few issues remain to be resolved. Several of the reported BPH
Rgenes are not effective on the Indian subcontinent (Horgan et al. 2016); hence,
more effective genes for the region need to be characterized from the reported
sources. All the BPH Rgenes, except probably Bph3 (Liu et al. 2015), are not effec-
tive against WBPH. Since these two species are sympatric and are often under
severe interspecific competition (Srinivasan et al. 2016), selecting for resistance
against BPH alone may not be the right approach. But, efforts to tag, map, and clone
WBPH resistance genes are few. Another limitation is the ability of BPH to quickly
evolve virulent biotypes, especially if a single Rgene is deployed. Hence, gene pyra-
miding is suggested for durability. Ideally, undeployed genes with different mecha-
nisms of resistance are the choice for pyramiding. Of the 13 BPH Rgenes cloned,
eight (Bph14, Bph26, Bph18, Bph9/1/7/10/21) represent the NBS-LRR family; pro-
teins coded by these are located in the cytoplasm, while others are reported as lectin
receptor kinases (Bph3, Bph15), B3 DNA-binding domain (bph29), or SCR domain
protein (Bph32) coding (Ren et al. 2016; Y Zhao et al. 2016b; Du et al. 2020), which
are membrane bound. It is suggested to combine two genes from these two classes
(such as Bph14 + Bph15) to achieve durability (Jing et al. 2017).
2.3 Other Pests
Rice stem borers are ubiquitous insects representing Diopsidae (Diptera), Noctuidae,
and Crambidae (Lepidoptera) families. Among several species of rice stem borers,
YSB is considered the most economically important insect pest in almost all rice-
growing countries of Asia (Makkar and Bentur 2017). Larvae of YSB feed only on
rice and can cause damage at both the vegetative (deadheart) and reproductive
(whitehead) stages of the rice crop, with the latter being the main cause of yield loss
(Savary et al. 2000). Because of the lack of highly resistant sources in rice germ-
plasm explored so for, breeding for resistance or molecular mapping of resistance
genes against YSB has not been encouraging (Bentur 2007). Nonetheless, rice vari-
eties such as Vikas, Ratna, and Sasyasree have been developed and released in India
with moderate YSB resistance. Most of these varieties have either TKM6 or W1263
as the source of resistance. Because of the lack of the desired level of resistance
against YSB in the primary gene pool of rice, the secondary gene pool consisting of
wild species of Oryza is being explored at IRRI, ICAR-IIRR, and other institutes.
Chromosome segment substitution lines (CSSLs) need to be developed for different
accessions of wild rice that can be evaluated for YSB resistance. Also, ethyl meth-
anesulfonate (EMS) mutants of rice have been generated and evaluated at ICAR-
IIRR and have shown encouraging results in preliminary evaluations. More extensive
and concerted efforts in this direction have potential to identify novel sources of
resistance that can be used by breeders and entomologists for understanding the
resistance mechanisms and developing YSB-resistant rice cultivars.
3 Novel Approaches Through Genomics
3.1 RNAi Approach for Insect Resistance
Transgenic crops harboring Bt endotoxin genes or other insecticidal protein-coding

genes have shown tremendous potential for managing insect pests. Several of these
genes have been used in transforming rice as described in the next section, although
none of these have been commercially cultivated. As an alternative to this approach,
RNA interference (RNAi) can be exploited, which has been well demonstrated for
resistance induction in plants against viruses, bacteria, and nematodes. RNAi is an
RNA-driven post-transcriptional homology-based gene-silencing mechanism
through the mRNA degradation pathway present in all eukaryotic organisms. The
RNAi is triggered by double-stranded RNAs (dsRNA), which are processed by the
RNase-III-like Dicer protein to produce small interfering RNAs (siRNAs). The
guide strand of siRNA directs an RNA-induced silencing complex (RISC) to the
target mRNA (Fig. 1). The most important constituent of RISC is RNase protein
Argonaute, which helps in the degradation of target mRNAs sharing homology with
the guide strand of siRNA (Zamore et al. 2000). The double-stranded RNAs specific
to key insect genes can be stably expressed in plant tissues fed on by the insect and
that in turn can trigger the RNAi pathway to degrade the mRNAs transcribed by the
key insect genes (Price and Gatehouse 2008; Agarwal et al. 2012).
Key genes in insects are identified as targets of RNAi, that is, genes coding
developmental proteins, digestive enzymes, salivary gland proteins, nervous system
regulatory proteins, proteins involved in host-insect interaction, hormone receptors,
gut enzymes, and proteins involved in metabolism (Gatehouse 2008; Huvenne and
Smagghe 2010; Agarwal et al. 2012; Kola et al. 2015).
Initial successes in experiments (Tomoyasu and Denell 2004; Turner et al. 2006)
raised hope among researchers that RNAi could be another alternative and effective
tool to develop insect resistance in crop plants. Initially, dsRNAs were delivered to
the target insects either by injection or through artificial diet. Baum et al. (2007)
demonstrated the effectiveness of host-plant-mediated production of dsRNA in crop
protection. Transgenic maize plants producing insect-specific vacuolar H+ ATPase
dsRNAs had decreased root damage by western corn rootworm. In another similar
report, Mao et al. (2007) generated transgenic Nicotiana tabacum and Arabidopsis
thaliana targeting RNAi against the cytochrome P450 gene of Helicoverpa armig-
era, resulting in retarded larval growth of insects feeding on these modified hosts.
The versatility of the application of RNAi against different insect orders and target
genes shows the potential of RNAi for managing diverse crop pests (Terenius et al.
2011; Khajuria et al. 2015; Zhang et al. 2017). Recent reports suggest that the pro-
duction of dsRNAs in chloroplasts, rather than in cytoplasm, can improve insect
resistance significantly as long as dsRNAs can be stably produced in chloroplasts,
which are devoid of RNAi machinery (Zhang et al. 2015; Jin et al. 2015; Bally et al.
2018). The first such RNAi-based DvSnf7 dsRNA-expressing maize crop targeting
western corn rootworm is scheduled to be commercialized (Khajuria et al. 2018).
Several research groups have been working on modifying the technology for its
more efficient application.
Fig. 1 Schematic representation of host-induced gene silencing in insects through siRNA

approach. (1) Integration of insect gene-targeted siRNA cassette (transgene) into rice genome; (2)
fate of transgene in rice cells; (3) expression of transgene in rice cell generates the mRNA; (4)
formations of dsRNA through self-complementation of transgene’s sense and antisense strands in
rice cell; (5) host Dicer-mediated specific cleavage of dsRNA leads to production of siRNAs in rice
cell; (6) host-generated siRNAs processed by host Argonaute protein (the main component of
RNA-induced silencing complex or RISC); (7) host-generated siRNAs are nonfunctional in rice
cells due to absence of targeted gene; (8 and 9) host-synthesized dsRNAs/siRNAs transfer from
rice plant to insect through feeding on rice tissues; (10) fate of transferred dsRNA/siRNAs in insect
cells; (11) generation of siRNAs from dsRNA through insect Dicer-mediated cleavage; (12) the
siRNAs are processed by insect Argonaute proteins/RISC complex; (13a) formation of activated
RISC along with target-specific guide RNA; (13b and 13c) the passenger RNA is separated from
guide RNA and degraded; (14) transcription of insect DNA resulted in the expression of targeted
functional mRNA (transcript); (15) guide strand of siRNA helps in identification and binding of
activated RISC to the targeted mRNA; (16) silencing of targeted gene expression by RISC-
mediated cleavage of corresponding mRNA
Application of the RNAi tool for insect resistance in rice is in the developmental
phase. Most of the reports on RNAi in rice are centered on BPH (Zha et al. 2011;
Zhou et al. 2013; Yu et al. 2014; Wang et al. 2018) and YSB (Renuka et al. 2017).
RNAi has been used for functional genomics of glutathione S-transferase (GST)
genes, which are involved in the degradation of toxins produced by host plants and
insecticides. Injecting dsRNAs targeting the NlGSTe1 and NlGSTm2 genes into
nymphs of BPH enhanced their sensitivity to chlorpyrifos but not to beta-
cypermethrin. Through feeding assays and stable expression of NlEcR (ecdysone
receptor gene) targeting dsRNAs in rice, Yu et al. (2014) showed significant down-
regulation of target gene expression and a decrease in the number of offspring
produced by BPH adults. Likewise, Zha et al. (2011) targeted three midgut genes,
carboxypeptidase (Nlcar), hexose transporter (NlHT1), and trypsin-like serine pro-
tease (Nltry). L Zhao et al. (2016a) aimed at trehalase genes involved in chitin bio-
synthesis and degradation. Wang et al. (2018) aimed at the calmodulin gene, Waris
et al. (2018) aimed at the chemosensory protein 8 (CSP8) gene, and Zhu et al.
(2017b) studied the function of the ribosomal protein gene (NlRPL5) using an RNAi
tool. Pan et al. (2018) used RNAi to knock down 135 CP (chitin and cuticular pro-
tein) genes by injecting specific dsRNAs and showed that 32 CPs are necessary for
normal egg production and development. Li et al. (2015) suggested that dsRNAs are
stable under diverse environments and can be absorbed by roots of crop plants. This
study provides scope to use dsRNAs as biopesticides. The above-cited studies are
laying the foundation for the development of RNAi as a tool for managing rice pests
such as BPH.
Kola et al. (2016) showed by feeding YSB larvae with dsRNA of cytochrome
P450 derivative (CYP6) and amino peptidase N (APN) that expression of target
genes decreased and resulted in increased mortality of larvae after 12–15 days.
Similarly, Zeng et al. (2018) knocked down three chemosensory protein (CSP)
genes in rice leaffolder (C. medinalis) through injection of dsRNAs, which down-
regulated insect response to the specific chemicals. He et al. (2018), in contrast,
overexpressed striped stem borer-derived miR-14 microRNA in rice, which resulted
in a high resistance against the pest.
3.2 Genome Editing Approach for Insect Resistance
Genome editing tools enable us to edit the genome or specific genes of an organism
by addition/deletion or replacement of nucleotides with high precision and with few
off-target effects. Because of its simplicity and wider applicability, genome editing
is being practiced in many laboratories for functional genomics and trait improve-
ment. In agriculture, the technology has immense potential to improve yield and
abiotic and biotic stress tolerance of crops. Also, the technology does not attract
many concerns regarding biosafety regulators, specifically in the case of deletion of
nucleotides. Most of the research on genome editing has been focused on functional
genomics, trait discovery, and improvement in plants (Arora and Narula 2017; Yin
et al. 2017; Aglawe et al. 2018).
The use of genome editing techniques for pest control in plants has just been
hypothesized. Zuo et al. (2017) created a mutation in Spodoptera exigua with
CRISPR/Cas9 technology, which resulted in a mutant insect with high resistance
against chlorantraniliprole, cyantraniliprole, and flubendiamide insecticides. To
demonstrate the role of the cadherin gene in developing resistance against Bt toxin,
the gene was edited by CRISPR/Cas9 in Helicoverpa armigera. The mutant strain
of the insect showed high resistance to Cry1Ac (J Wang et al. 2016b). The
pheromone-binding protein 1 (PBP1) gene of H. armigera was mutated and the
mutant male adults showed impaired responses to sex pheromone (ZF Ye et al.
2017b). Dong et al. (2017) mutated PBP1 and PBP3 genes in striped stem borer to
demonstrate their function. Biogenesis of the lysosome-related organelles complex
1 subunit 2 (BLOS2) gene of Spodoptera litura was edited, which resulted in the
disappearance of the yellow strips and white spots on the larval integument (Zhu
et al. 2017a). Similarly, when the abdominal-A (Slabd-A) gene of S. litura was
mutated, it resulted in ectopic pigmentation and anomalous segmentation during the
larval stage (Bi et al. 2016). Recently, Xue et al. (2018) edited two eye pigmentation
genes in BPH, resulting in bright red compound eyes.
Although most of these reports showed successful application of CRISPR-based
genome editing technology for functional genomics of insect genes, its use for
incorporating and enhancing pest resistance in crops is yet to be realized. It is pos-
sible to derive genome editing-mediated resistance against insects by targeting
either the host genes or the gene drive in insect populations. There is a dearth of
information with regard to insect-susceptibility genes of host plants, specifically in
rice. The recessive resistance genes identified so far are likely to represent nonfunc-
tional susceptibility genes and hence the need for more studies to characterize such
candidate genes, which represent ideal targets for genome editing to develop new
sources of resistance. Alternatively, novel resistance alleles can be created in sus-
ceptible rice cultivars either by replacement of a few nucleotides/motifs/domains or
by editing of specific bases or transfer of a complete gene. However, precise replace-
ment of nucleotides, base editing, and insertion of a gene through CRISPR technol-
ogy are relatively complex at this stage and it may require a few more years for
researchers in not-so-sophisticated laboratories to be able to use this technology.
Gene drive is another highly potential technology that can be exploited to pro-
mote the inheritance of CRISPR-generated mutated alleles or any other DNA
sequence by sexual reproduction, which allows a rapid spread of genes among the
insect population. Even the whole CRISPR machinery, that is, Cas9 mRNA and
specific sgRNAs, can be spread into insect populations via a gene drive. Besides
controlling the insect population, it can decrease vector-borne virus diseases such as
rice tungro disease. However, its application requires a thorough public debate
among scientists, policymakers, and regulators and other stakeholders (Courtier-
Orgogozo et al. 2017). In addition, the rapid advancement in genome editing tech-
nologies will facilitate the functional analysis of insect genes, which would
indirectly help in developing more effective strategies for achieving effective and
durable biotic stress resistance in crops.
4 Transgenic Approach Through Gene Transfer
As naturally occurring resistance to lepidopteran pests of rice is yet to be identified/

discovered (e.g., stem borers and leaffolders; Schuler et al. 1998), transgenesis
offers a potent, immediate, cost-effective, and environment-friendly option for con-
trol of these pests through access and use of resistance from unrelated sources (i.e.,
nonrice sources). Fortunately, tissue culture and genetic transformation protocols
are well established in rice and many bacterial-derived insecticidal proteins have
been deployed in rice through transgenic breeding (Sundaram et al. 2013). Bt genes
derived from the soil bacterium Bacillus thuringiensis have been the most success-
ful group of related genes used commercially for genetic transformation of many
crop plants, including rice. Bt genes encode for insecticidal proteins that are filled
in crystalline inclusion bodies produced by the bacterium upon sporulation (e.g.,
Cry protein) or expressed during bacterial growth (e.g., Vip proteins). In addition,
several research groups are assessing the potential of using non-Bt insecticidal pro-
teins such as lectins (carbohydrate-binding proteins), proteinase inhibitors,
ribosome-inactivating proteins, secondary plant metabolites, small RNA viruses,
etc. (Makkar and Bentur 2017).
4.1 Development of Transgenic Rice for Insect Resistance
The crystal insecticidal proteins (Cry toxins or delta-endotoxins) encoded by Bt

genes are known to possess high toxicity to lepidopteran pests (Cohen et al. 2000),
Dipterans (Andrews et al. 1987), and Coleopterans (Krieg et al. 1983; Herrnstadt
et al. 1986) but are nontoxic to other groups of insects, other animals, and humans.
Fujimoto et al. (1993) reported the first transformation of rice with a Bt gene. Many
reports on the development and evaluation of Bt rice lines have since appeared (see
review by High et al. 2004; Chen et al. 2006). Rice lines expressing Cry1Aa,
Cry1Ab, Cry1Ac, Cry1Ab/Cry1Ac fusion gene, Cry1B, Cry1C, Cry2A, and a pyra-
mid of Cry1Ac with Cry2A, under the control of various constitutive and conditional
promoters, have been shown to confer resistance to stem borers, leaffolders, and
other foliage-feeding lepidopteran insects (Table 2). Several rice lines expressing
insecticidal genes with anti-lepidopteran activity using Cry genes (Cry1Aa, Cry1Ab,
Cry1Ac, Cry1Ab/Ac, Cry1C, Cry2A), CpTI (cowpea trypsin inhibitor), Vip (vegeta-
tive insecticidal protein), etc., have been reported. Various transgenic Bt (Cry1Ab,
Cry1Ac) rice varieties (IR64, Karnal Local, etc.) resistant to YSB have been pro-
duced in India (Khanna and Raina 2002; Ramesh et al. 2004a). Pradhan et al. (2016)
deployed a vegetative insecticidal protein (vip) in the genetic background of Swarna
and demonstrated that the transgenic rice is resistant to multiple lepidopteran pests
such as yellow stem borer, leaffolder, and rice horny caterpillar. Field evaluation
and validation of transgenic rice possessing Cry1A (Shu et al. 2000; Tu et al. 2000)
and synthetic Cry1Ab (Shu et al. 2002) have been reported from China. Field trials
of Bt rice have also been conducted in Pakistan (Bashir et al. 2005; Mahmood-ur-
Rahman et al. 2007), Spain (Breitler et al. 2004), Iran (James 2005), and India
(Bunsha 2006). Iran was the first country to release Bt rice for commercial cultiva-
tion in 2004 (Makkar and Bentur 2017). China permitted the commercial produc-
tion of Bt rice lines Huahui No. 1 (CMS restorer line) and Bt Shanyou 63 (a hybrid
of Huahui No. 1 and Zhenshan 97A, a CMS line), both lines expressing Cry1Ab/Ac
fusion gene (Chen et al. 2011), but cultivation was discontinued afterward. Currently,
no Bt rice is grown in any country across the world, including China, although
Table 2 List of transgenes used in rice transformation to provide insect resistance

Reported
Transgene(s) Recipient rice variety/ Promoter resistant
S. No. deployed genotype deployed against Reference(s)
Lepidopteran pests
1 cry1Ab IR58 (indica rice) CaMV35S Yellow stem Wunn et al.
borer, striped (1996)
stem borer,
leaffolder
2 PINII (potato Japonica rice – Pink stem Duan et al.
proteinase borer (1996)
inhibitor)
3 cry1Ab Japonica, Taipei 309 Rice actin-1 Yellow stem Wu et al.
promoter borer (1997a)
4 cry1A, cowpea Japonica, Taipei 309, – Yellow stem Wu et al.
proteinase and Taipei 85-93. borer (1997b)
inhibitor gene Indica, Minghui 63,
and Qingliu Rai
5 cry1AC IR64 (indica rice) Maize Yellow stem Nayak et al.
ubiquitin 1 borer (1997)
promoter
6 cry1Aa, cry 1Ac, Indica, japonica – Yellow stem Lee et al.
cry2A, cry1C borer (1997)
7 cry1Ab Aromatic rice, Tarom – Yellow stem Ghareyazie
molaii borer et al. (1997)
8 cry2A Basmati 370 and M7 CaMV35S Yellow stem Maqbool et al.
(indica rice) promoter borer, (1998)
leaffolder
9 cry1Ab Indica and japonica – Yellow stem Datta et al.
rice borer (1998)
10 cry1Ab, cry1Ac, Japonica rice Maize Yellow stem Cheng et al.
hph, gus genes ubiquitin borer, striped (1998)
promoter, the stem borer
CaMV 35S
promoter,
and the
Brassica
Bp10 gene
promoter
11 cry1Ab Maintainer line 35S Yellow stem Alam et al.
IR68899B constitutive borer (1999)
promoter
12 cry1Ab Vaidehi (indica rice) – Yellow stem Alam et al.
borer (1998)
13 cry1Ab PR16 and PR18 Maize Yellow stem Ye et al.
ubiquitin borer (2000)
promoter
(continued)
Table 2 (continued)
Reported
14 cry1Ab, cry1Ac Minghui 63 (indica Rice actin-1 Yellow stem Tu et al.
CMS restorer line) promoter borer and (2000)
and its derived hybrid leaffolder
rice Shanyou 63
15 cry1Ab KMD1 (japonica elite – Yellow stem Shu et al.
line) borer (2000)
16 cry1A, cry1Ab, Indica rice – Yellow stem Intikhab et al.
cry1Ac, cry1c borer (2000)
and cry2A
17 cry1Ab, Xa21 Pusa Basmati 1 – Yellow stem Gosal et al.
(indica rice) borer, (2000)
Bacterial
blight disease
18 CRY1AB KMD1 and KMD2 – Yellow stem Ye et al.
borer, striped (2001)
stem borer
19 cry1Ac, cry2A, M7 and Basmati 370 Maize Yellow stem Maqbool et al.
snowdrop lectin (indica rice varieties) ubiquitin-1 borer, (2001)
gna promoter, leaffolder,
CaMV 35S and BPH
promoter
20 cry1Ab IR64 (indica rice) – Yellow stem Maiti et al.
borer (2001)
21 Spider Xiushuill and – Leaffolder Huang et al.
insecticidal gene Chunjiang 11 and striped (2001)
stem borer
22 cry1Ac gene Minghui 81 Maize Striped stem Zeng et al.
ubiquitin-1 borer (2002)
promoter
23 cry1Ac gene Pusa Basmati-1, Maize Yellow stem Khanna and
IR64, and Karnal ubiquitin-1 borer Raina (2002)
Local (indica rice) promoter
24 Bt fusion gene IR72 (indica rice) – Yellow stem Datta et al.
(for insect borer, (2002)
resistance), bacterial
Xa21 gene (for blight
BLB), chitinase disease,
gene (sheath sheath blight
blight) disease
25 Chimeric Bt IR68899B and 35S and Yellow stem Balachandran
gene, cry1Ab; IR68897B PEPC borer, et al. (2002)
cry1Ab/cry1Ac (maintainer lines), promoters; leaffolder
fusion gene MH63 and BR827- actin 1
35R (restorer lines) promoter
(continued)
Table 2 (continued)
Reported
26 cry1Ab, Rajalele (javanica – Yellow stem Slamet et al.
snowdrop lectin progenies) borer, (2003)
gna planthoppers
27 cry1Ac IR64, Pusa Maize Yellow stem Raina et al.
Basmati-1, and ubiquitin borer (2003)
Karnal Local (indica promoter
rice)
28 cry1Ac, cry2A Basmati (indica rice) PEPC Yellow stem Husnain et al.
promoter and borer (2003)
PB 10
(pollen-
specific)
promoter
29 cry1Ac, Xa21 Pusa Basmati-1 – Yellow stem Gosal et al.
bacterial
blight
30 CRY1AB, IR58025A, Maize Yellow stem Ramesh et al.
CRY1AC genes; IR58025B, and ubiquitin borer (2004b)
bar gene for Vajram (indica rice) promoter,
herbicide CaMV 35S
resistance promoter
(for BAR
gene)
31 cry1B, cry1Aa Ariete and Senia ubi 1 Striped stem Breitler et al.
promoter or borer (2004)
mpi
promoter
32 cry1Ab, cry1Ac, Indica rice – Yellow stem Alcantara et al.
cry1C, cry2A, borer, Striped (2004)
cry9C stem borer
33 mpi gene (maize Senia and Ariete Maize Striped stem Vila et al.
proteinase ubiquitin 1 borer (2005)
inhibitor) promoter
34 cry2A Minghui 63 (indica Maize Yellow stem Chen et al.
restorer line) ubiquitin borer (2005)
promoter
35 cry1Ac, cry2A Basmati line B-370 – Yellow stem Bashir et al.
leaffolder
36 cry1Ac, cry2A Basmati 370 (indica Ubiquitin Yellow stem Riaz et al.
rice) promoter and borer (2006)
CaMV 35S
promoter
(continued)
Table 2 (continued)
Reported
37 cry1Ab-1B Elite Maize Yellow stem Ho et al.
(translationally Vietnamese cultivars ubiquitin borer (2006)
fused gene) and promoter and
cry1A/cry1Ac rice actin-1
(hybrid Bt gene) promoter
38 PINII (potato Pusa basmati-1 and Pin2 Yellow stem Bhutani et al.
proteinase Tarori Basmati wound- borer (2006)
inhibitor) (indica rice) and inducible
TNG67 (japonica promoter
rice)
39 cry2Ab gene Minghui 63 (indica – Yellow stem Tang and Lin
restorer borer, (2007)
line)/T(1Ab)-10 leaffolder
40 cry1Ab Korean varieties, P-I, Maize Yellow stem Kim et al.
P-II, P-III ubiquitin borer (2008)
promoter
41 cry1Ab gene Khazar, Neda, and – Striped stem Kiani et al.
Nemat borer (2008)
42 Ten transgenic Minghui 63 (elite – Yellow stem Chen et al.
lines (two indica restorer line) borer, striped (2008)
cry1Ac lines, stem borer
three cry2A
lines, five cry9C
lines)
43 cry1C Zhonghua 11 (Oryza rbcS Yellow stem Ye et al.
sativa L. subsp. promoter borer, striped (2009)
japonica)/RJ5 line. stem borer,
leaffolder
44 cry1Ia5 Oryza sativa – Yellow stem Moghaieb
borer (2010)
45 cry1b and Oryza sativa PEPC Yellow stem Kumar et al.
cry1Aa fusion promoter borer (2010)
gene
46 cry1Ab and G6H1, G6H2, G6H3, – Striped stem Chen et al.
Vip3H fusion G6H4, G6H5, G6H6 borer, pink (2010)
gene stem borer
47 cry1Ab, cry1Ac Bt-SY63 – Striped stem Zhang et al.
fusion gene borer (2011)
48 cry1Ac, CpTI Bt-KF6 – Striped stem Zhang et al.
genes borer (2011)
49 cry1Ab Bt-DL – Striped stem Zhang et al.
borer (2011)
(continued)
Table 2 (continued)
Reported
50 cry1Ab, cry1Ac, Minghui 63 (elite Maize Yellow stem Yang et al.
cry1C, cry2A indica restorer line) ubiquitin borer, striped (2011)
promoter stem borer,
leaffolder
51 Cry1Ac, Rice pGreen Striped stem Yang et al.
cry1I-like gene borer, (2014)
leaffolder
52 cry1Ab gene Mfb-MH86 Ubiquitin Striped stem Wang et al.
promoter borer and (2014)
other
lepidopteran
pests
53 mpi-pci fusion Ariete mpi Striped stem Quilis et al.
gene promoter borer (2014)
54 Ds-Bt Zhejing-22, – Striped stem Gao et al.
Kongyu-131 borer (2014)
55 cry1Ac, cry1lg, Xiushui 134 Maize Striped stem Zhao (2015)
G10 (EPSPS ubiquitin borer,
gene) promoter leaffolder,
(pUBi)/ and
modified glyphosate
cauliflower
35S
promoter
Sucking pests
56 GNA (Galanthus ? Phloem- BPH Rao et al.
nivalis specific (1998)
agglutinin) rice-sucrose-
synthase
57 GNA ASD16/M12 Rice sucrose BPH and Foissac et al.
synthase/ GLH (2000)
maize
ubiquitin
58 GNA ? ? SBPH Wu et al.
(2002)
59 GNA Chaitanya and Phloem- BPH, GLH, Nagadhara
Phalguna, indica specific and WBPH et al. (2003,
cultivars rice-sucrose- 2004)
synthase
60 GNA BPH, GLH, Ramesh et al.
and WBPH (2004a, b)
61 GNA Zhuxian B, an indica BPH Li et al. (2005)
rice
(continued)
Table 2 (continued)
Reported
62 ASAL (Allium IR64 CaMV35S BPH and Saha et al.
sativum GLH (2006)
agglutinin)
63 ASAL Chaitanya and CaMV35S BPH, GLH, Yarasi et al.
BPT5204, indica and WBPH (2008)
cultivars
64 ASAL IR64 CaMV35S BPH and Sengupta et al.
GLH (2010)
65 DB1/G95A- Tachisugata Phloem- BPH Yoshimura
mALS specific et al. (2012)
(Dioscoria rice-sucrose-
batata tuber synthase
lectin)
66 ASAL ? Phloem- BPH Chandrasekhar
specific et al. (2014)
rice-sucrose-
synthase
67 Loop In vitro assay – BPH Shao et al.
replacements (2016)
with gut-binding
peptides in
Cry1Ab domain
II
68 Cry64Ba and report Effective Liu et al.
Cry64Ca against (2018)
sap-sucking
insects
several such transgenic rice lines have been deregulated by the respective regulatory
authorities of these countries due to various policy-related issues.
Genetic engineering for the control of planthopper and leafhopper pests of rice
has begun with the use of plant-derived lectin genes. The snowdrop lectin gene,
Galanthus nivalis agglutinin (GNA), has been transferred to several rice varieties
and has been shown to provide partial to complete resistance to planthoppers and
leafhoppers. Partial resistance to leafhoppers and planthoppers was demonstrated
by rice transformation with a lectin gene from garlic (Allium sativum leaf agglutinin
gene, ASAL; Saha et al. 2006). Bala et al. (2013) reported that ASAL interacts with
NADH quinone oxidoreductase (NQO), a key player in the electron transport chain,
and results in toxicity and increased mortality of BPH in transgenic rice lines. This
study also demonstrated that, among all the transgenes available for control of suck-
ing pests, ASAL holds significant promise, particularly against BPH. Yoshimura
et al. (2012) developed transgenic rice possessing lectin1 gene from Dioscorea
batatas under the control of a phloem-specific promoter (i.e., promoter of sucrose
synthase-1 gene) that showed a 30% decrease in the survival rate of BPH. Even
though, in general, it is known that Cry proteins are ineffective against sucking
pests, through loop replacements with gut-binding peptides in Cry1AB domain II,
enhanced toxicity against BPH has been demonstrated (Shao et al. 2016). Liu et al.
(2018) have shown the effectivity of Cry64Ba and Cry64Ca, two ETX/MTX2-type
Bt proteins, against hemipteran pests. Boddupally et al. (2018) recently demon-
strated that the expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic
rice plants imparted resistance against multiple insect pests: BPH, stem borer, and
leaffolder. The list of transgenes deployed for the control of sucking pests such as
BPH is summarized in Table 2.
5 Insect-Plant Interactions at the Genomic Level
5.1 Planthopper Genomes
The genome of BPH and its endosymbionts have been sequenced (Xue et al. 2014).
It is a large genome (1141 Mb) with 27,571 protein-coding genes, of which 16,330
are specific to this species. In comparison, the WBPH genome is relatively smaller
(720 Mb) with 21,254 protein-coding genes (L Wang et al. 2017a), while the SBPH
genome size is 541 Mb with 17,736 protein-coding genes (Zhu et al. 2017c).
Mitochondrial (mt) genomes of these three planthopper species have also been
sequenced (Zhang et al. 2013, 2014). These studies are now providing insights into
the genetic plasticity of this group, possible causes of rapid evolution of virulent
biotypes, and resistance against a wide range of synthetic insecticides. In addition,
the role of endosymbionts such as yeast-like symbiont (YLS) and Wolbachia spp. in
enhancing insect fitness is being studied. Additional genetic markers are being
developed for studying population genetics, individual differences, and the phylo-
geography of planthoppers. Several key genes of the insects have been identified,
which can be targeted for RNAi-based genetic tools of pest management.
Transcriptomics of the salivary gland has revealed more than 350 secretory proteins,
of which several, such as NlSEF1 (W Ye et al. 2017a), act as effectors modulating
plant defense response. Likewise, muscin-like protein of the salivary gland secre-
tion of BPH (Huang et al. 2017; Shangguan et al. 2018) and WBPH (Miao et al.
2018) is likely to be an effector. Such genes can be suitable targets for their control
using an RNAi-based approach described above. A high number of cytochrome
P450 genes and their functional diversification are attributed to drive the evolution
of insecticide resistance and virulence against host-plant resistance (Peng et al.
2017; Zimmer et al. 2018). In spite of efforts to map virulence loci onto the BPH
genome (Jing et al. 2014; Kobayashi et al. 2014), no aviR gene has yet been cloned
and characterized. Although mitochondrial markers based on mt genes COI and
ND4 have been screened for population differentiation, the results have not been
encouraging over large populations across countries. Further, Zhang et al. (2013)
suggest that markers based on the control region of the mt genome might provide
more reliable markers for studying population genetics and the phylogeography of
planthoppers.
5.2 Rice-Planthopper Interactions
Using both candidate gene cloning and a characterization-based approach and func-
tional genomics-based omics approaches, attempts are being made to understand
planthopper and rice interactions. Based on initial information on the nature of R
genes as being members of the NBS-LRR class or receptor kinase class, the rice
resistance mechanism against BPH is, rather hurriedly, aligned to rice resistance
against pathogens under two-tier immunity involving pattern-triggered immunity
(PTI) and effector-triggered immunity (ETI) and the involvement of both JA- and
SA-mediated pathways (Jing et al. 2017). Even the cloned genes are assigned to PTI
(Bph3, Bph15) or ETI (Bph14, Bph1/10/18) tiers. However, what is not accounted
for is the lack of documented evidence of hypersensitive reaction (HR) and systemic
acquired resistance (SAR), which are hallmarks of plant response to biotrophic
pathogens. Further, resistance in rice against planthoppers is not at the immune level
but with moderate antibiosis coupled with antifeeding and antixenosis components.
It is generally understood that SA- and JA-mediated plant defenses act reciprocally
antagonistic to each other with adaptive significance (Thaler et al. 2012). Such
antagonism has not been convincingly illustrated in the case of planthopper resis-
tance in rice. Thus, greater understanding of planthopper-rice interactions is needed.
5.3 Rice-Gall Midge Interactions
Although genome sequence data for ARGM are yet to be published (Nair et al.
unpublished), the mitogenome has been sequenced (Atray et al. 2015) and the
microbiome analyzed in different stages of the life cycle of the insect (Ojha et al.
2017). Based on identification and functional analysis of candidate genes, global
gene expression profiles and differential gene expressions detected through SSH
cDNA libraries, microarray studies, and the pyrosequencing approach in both the
plants and the insect rice-gall midge interactions have been fairly well studied. In
essence, with results from these studies indicating strategies used by both the pest
and the host to defeat each other, defense ploys can be termed as a battle for survival
(Bentur et al. 2016; Sinha et al. 2017).
During the infestation process and subsequent feeding on the host, the larvae
inject substance(s) into the host. As in the case of pathogenic bacteria and fungi,
these products could be determinants (effectors) of the avirulence/virulence phe-
nomenon. Extending this idea further, the genes that encode these molecules could
be determinants of gall midge biotypes. Further, the genes that encode such mole-
cules could be those that encode secreted salivary gland proteins (SSGPs). Therefore,
characterizing genes that encode SSGPs could provide a handle to study this inter-
action and also gain valuable insight into the process of infestation of rice by this
pest. The expression patterns of some of these SSGPs in larvae interacting with a
susceptible host (SH; compatible interaction) or resistant host (RH; incompatible
interaction) indicated that some of the SSGPs such as gamma subunit of
oligosaccharyl transferase (OoOST) and nucleoside diphosphate kinase (OoNDPK)

overexpress when interacting with SH compared with those in maggots when feed-
ing on RH (Sinha et al. 2011a, 2012a). Furthermore, NDPK protein has been dem-
onstrated to influence the host physiology. In contrast, two genes, OoprotI and
OoprotII, homologous to serine proteases, and OoDAD1 (defender against death)
overexpress in midgut of the maggots feeding on RH when compared with those
feeding on SH (Sinha et al. 2011b, 2015). Although the former interactions repre-
sent effector-induced susceptibility, the latter set forms neutralizers attempting to
overcome plant-secreted defensive toxins. Earlier studies also brought out similari-
ties in rice defense expression against gall midge with those seen against plant
pathogens (Rawat et al. 2010, 2013), complete with HR and SAR. Subsequent anal-
ysis of SSH-generated cDNA libraries and microarray data brought out differences
in the defense pathways underlying HR+-type and HR−-type resistance (Rawat
et al. 2012b), among the two HR-type resistances conferred by Gm1 and Gm8 genes
(Divya et al. 2016, 2018b), and also the diversity in susceptibility pathways in rice
genotypes with ineffective R-genes against virulent biotypes (Rawat et al. 2012a).
Generally, in the three gall midge-susceptible rice varieties studied, the insect-
challenged plants tend to step up metabolism and transport of nutrients to their
feeding site and have suppressed defense responses. However, one of the rice variet-
ies mounted an elevated defense response during early hours of infestation, only to
be overpowered later, eventually resulting in host-plant susceptibility.
Pyrosequencing-based transcriptome analysis of ARGM revealed a differential
response of the midge depending on whether it is in a compatible or incompatible
interaction with its host (Sinha et al. 2012b). A recent study with sequencing of 16S
rRNA bacterial gene (V3-V4 region) revealed differences in the microflora of the
gall midge-rice maggots feeding on susceptible or resistant rice hosts. Results
revealed that Wolbachia was the predominant bacterium in pupae and adults while
Pseudomonas was predominant in maggots. Further, it was observed that members
of proteobacteria were predominant across all the samples. There was high species
diversity in maggots isolated from susceptible rice and a high representation of
unclassified bacteria in maggots isolated from resistant rice. A first step in this
direction is a report that highlights variation in the microbiome of the rice gall
midge, based on the host phenotype from which it was isolated, and results suggest
that these variations could have an important role in the host’s susceptibility/resis-
tance (Ojha et al. 2017).
The availability of the complete sequence of the gall midge mt genome and sub-
sequent sequence analysis revealed the presence of two tandem repeat elements in
the noncoding regions of the mt genome. Further, sequencing of the iterated regions
demonstrated that the iterations of the repeat elements could not only differentiate
different gall midge biotypes present in India but also were able to genetically sepa-
rate the ARGM from its counterpart, the African rice gall midge (Atray et al. 2015).
Thus, this study identified a reliable tool to monitor changes in the insect popula-
tions so as to have an “early warning system” in place. Janique et al. (2017) reported
that two noncoding repeat motifs observed in the mitogenome of ARGM in India
were absent in Thai populations and these were replaced by an 89-bp noncoding
sequence.
6 Conclusions and Perspectives
In terms of an evolutionary perspective, survival of neither the host nor the herbi-
vore has ever been under threat. Understandably, however, over the past couple of
millennia when half of the human population started depending on this one cereal
as its staple food, conflict of interest erupted between these insects and humans. All
feasible efforts were made to protect the crop from possible damage by insects dur-
ing the early phase of domestication and cultivation of the rice crop. With the advent
of modern scientific methods of crop husbandry, crop improvement, and synthetic
chemicals, insect pests became targets of a frontal attack by humans. With quick
development of resistance against a range of synthetic insecticides, insect pests
proved their evolutionary superiority, compelling humans to concede defeat and
conclude that pest management was the best solution for sustainable productivity
rather than pest eradication or control. Rice insect pest management has traversed
the same course as that in other crops such as cotton.
Insect pest management is complex and fraught with many variables. From the
foregoing account, it is quite clear that we are just beginning to understand and
make inroads into the complex interactions between the pest and its host, rice. It is
also evident that, although productivity loss due to these insects alone runs into
several million US dollars, insects are rapidly overcoming any management strategy
that we are able to deploy, whether it is resistance genes or the development of new
pesticides. What this review hopes to highlight primarily is that as a central concept
we need to know how the rice plant interacts with its several insect enemies from an
evolutionary point of view. Against YSB, no high resistance is expressed, probably
because it is a “k” strategist and monophagous insect that does not kill the host.
Against gall midge with an intermediate population strategy displaying buck and
boost cycles, the host plant has a diverse array of immune-level R-genes that are
constantly evolving along with the virulence in the pest populations. In stark con-
trast, the rice plant has stockpiled multiple major and minor R-genes against plan-
thoppers, which are typical “r” strategists. Second, the molecular tools now available
have provided novel products for deployment to alleviate pest-induced yield losses.
Notable among these are gene-pyramided elite cultivars, derived from marker-
assisted selection, to manage multiple pests and their strains/biotypes (Divya et al.
2018c). Also present is the array of transgenic rice lines with potent genes against
all the guilds of insect pests. It is unfortunate that these products are not yet avail-
able for commercial use. Molecular approaches have also broadened our knowledge
and identified unexplored facets for possible use in pest management. Finally, this
flush in information has reiterated the evolutionary advantage of insect genome,
mitogenome, and metagenome in facing any future challenges. A recent report on
quick field selection for dsRNA resistance in western corn rootworm (Khajuria
et al. 2018) exemplifies this. As summarized, representatives of each insect guild
have evolved their own strategy to overcome plant resistance. Considering that, in
the coming years, we are likely to be under pressure to grow more in less area, it is
therefore imperative that we cut the losses in productivity due to insect pests.
We have made rapid strides in the past couple of decades toward this goal with
emerging new tools and strategies. What is also clear is that the solution to the insect
problem is unlikely to come from one area of study but from an amalgamation of
information obtained from several different studies that can provide durable, effec-
tive, and targeted resistance to insect pests of rice. The caveat is that this is unlikely
to be a one-time effort but must be a continuing one.
References
Abhilash Kumar V, Balachiranjeevi C, Naik BS et al (2017) Marker-assisted pyramiding of bacte-

rial blight and gall midge resistance genes into RPHR-1005, the restorer line of the popular rice
hybrid DRRH-3. Mol Breed 37:86. https://doi.org/10.1007/s11032-017-0687-8
Agarwal S, Mohan M, Mangrauthia SK (2012) RNAi: machinery and role in pest and disease
management. In: Venkateshwarlu B, Shankar AK, Shankar C, Maheshwari M (eds) Crop stress
and its management: perspectives and strategies. Springer, New York, pp 447–469
Aglawe SB, Barbadikar KM, Mangrauthia SK, Madhav MS (2018) New breeding technique
“genome editing” for crop improvement: applications, potentials and challenges. 3 Biotech
8(8):336
Alam MF, Datta K, Abrigo E et al (1998) Production of transgenic deep water indica rice plants
expressing a synthetic Bacillus thuringiensis cry1Ab gene with enhanced resistance to yellow
stem borer. Plant Sci 135(1):25–30
Alam MF, Abrigo E, Datta K et al (1999) Transgenic insect resistance maintainer line (IR68899B)
for improvement of hybrid rice. Plant Cell Rep 18:572–575
Alcantara EP, Aguda RM, Curtiss A et al (2004) Bacillus thuringiensis delta endotoxin bind-
ing to brush border membrane vesicles of rice stem borers. Arch Insect Biochem Physiol
55(4):169–177. https://doi.org/10.1002/arch.10128
Amudhan S, Prasad Rao U, Bentur JS (1999) Total phenol profile in some rice varieties in relation
to infestation by Asian rice gall midge Orseolia oryzae (Wood-Mason). Curr Sci 76:1577–1580
Andrews RW, Faust R, Wabiko MH et al (1987) The biotechnology of Bacillus thuringiensis. Crit
Rev Biotechnol 6:163–232. https://doi.org/10.3109/07388558709113596
Arora L, Narula A (2017) Gene editing and crop improvement using CRISPR-Cas9 system. Front
Atray I, Bentur JS, Nair S (2015) The Asian rice gall midge (Orseolia oryzae) mitogenome has
evolved novel gene boundaries and tandem repeats that distinguish its biotypes. PLoS One
10(7):e0134625. https://doi.org/10.1371/journal.pone.0134625
Bala A, Roy A, Behura N, Hess D, Das S (2013) Insight to the mode of action of Allium sati-
vum leaf agglutinin (ASAL) expressing in T3 rice lines on brown planthopper. Am J Plant Sci
4:400–407
Balachandran S, Chandel G, Alam M et al (2002) Improving hybrid rice through anther culture
and transgenic approaches. In: 4th International Symposium on Hybrid Rice. Hanoi, Vietnam.
IRRI, Los Baños, pp 105–118
Bally J, Fishilevich E, Bowling AJ, Pence HE, Narva KE, Waterhouse PM (2018) Improved insect-
proofing: expressing double-stranded RNA in chloroplasts. Pest Manag Sci 74:1751–1758
Bashir K, Husnain T, Fatima T, Riaz N, Makhdoom R, Riazuddin S (2005) Novel indica basmati
line (B-370) expressing two unrelated genes of Bacillus thuringiensis is highly resistant to two
lepidopteran insects in the field. Crop Prot 24:870–879
Baum JA, Bogaert T, Clinton W et al (2007) Control of coleopteran insect pests through RNA
interference. Nat Biotechnol 25(11):1322–1326
Bentur JS (2007) Host-plant resistance to insects as a core of rice IPM. In: Aggarwal PK, Ladha
JK, Singh RK, Devkumar C, Hardy B (eds) Science, technology, and trade for peace and pros-
perity. Proceedings of the 26th International Rice Research Conference, New Delhi, India,
9–12 October 2006. International Rice Research Institute, Indian Council of Agricultural
Research, and National Academy of Agricultural Sciences, Los Baños, New Delhi, pp 419–435
Bentur JS (2010) Insect pests of rice in India and their management. In: Reddy DV, Rao NP, Rao
KV (eds) Pests and pathogens: management strategies. BS Publications, Hyderabad, pp 1–42
Bentur JS, Viratkamath BC (2008) Rice planthoppers strike back. Curr Sci 95:441–442
Bentur JS, Pasalu IC, Sarma NP, Prasad Rao U, Mishra B (2003) Gall midge resistance in rice.
DRR technical bulletin #1. Directorate of Rice Research, Hyderabad. 20 p
Bentur JS, Padmakumari AP, Jhansilakshmi V et al (2011) Insect resistance in rice. DRR technical
bulletin #51. Directorate of Rice Research, Hyderabad. 86 p
Bentur JS, Rawat N, Divya D, Sinha DK, Agarrwal R, Atray I, Nair S (2016) Rice-gall midge inter-
actions: battle for survival. J Insect Physiol 84:40–49. dx.doi.org. https://doi.org/10.1016/j.
jinsphys.2015.09.008
Bhutani S, Kumar R, Chauhan R et al (2006) Development of transgenic indica rice plants con-
taining potato proteinase inhibitor 2 gene with improved defense against yellow stem borer.
Physiol Mol Biol Plants 12(1):43–52
Bi HL, Xu J, Tan AJ, Huang YP (2016) CRISPR/Cas9-mediated targeted gene mutagenesis in
Spodoptera litura. Insect Sci 23:469–477
Boddupally D, Tamirisa S, Gundra SR, Vudem DR, Rao KV (2018) Expression of hybrid fusion
protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect
pests. Sci Rep 8:8458. https://doi.org/10.1038/s41598-018-26881-9
Breitler JC, Vassal JM, Catala MDM et al (2004) Bt rice harbouring cry genes controlled by a consti-
tutive or wound-inducible promoter: protection and transgene expression under Mediterranean
field conditions. Plant Biotechnol J 2:417–430
Bunsha D (2006) Crops on trial. Frontline 23(23) http://www.hinduonnet.com/fline/fl2323/sto-
ries/20061201003603000.htm. Accessed 15 Jan 2008
Cha YS, Ji H, Yun DW et al (2008) Fine mapping of the rice Bph1 gene, which confers resis-
tance to the brown planthopper (Nilaparvata lugens Stal), and development of STS mark-
ers for marker-assisted selection. Mol Cell 26:146–151
Chandrasekhar K, Reddy MG, Singh J, Vani K, Vijayalakshmi M, Kaul T, Reddy MK (2014)
Development of transgenic rice harbouring mutated rice 5-Enolpyruvylshikimate 3-Phosphate
Synthase (Os-mEPSPS) and Allium sativum leaf agglutinin (ASAL) genes conferring toler-
ance to herbicides and sap-sucking insects. Plant Mol Biol Report 32(6):1146. https://doi.
org/10.1007/s11105-014-0715-3
Chen H, Tang W, Xu C et al (2005) Transgenic indica rice plants harboring a synthetic cry2A gene
of Bacillus thuringiensis exhibit enhanced resistance against lepidopteran rice pests. Theor
Appl Genet 111:1330–1337
Chen M, Zhao JZ, Ye GY, Fu Q, Shelton AM (2006) Impact of insect-resistant transgenic rice on
target insect pests and non-target arthropods in China. Insect Sci 13:409–420
Chen H, Zhang G, Zhang Q, Lin Y (2008) Effect of transgenic Bacillus thuringiensis rice lines on
mortality and feeding behavior of rice stem borers (Lepidoptera: Crambidae). J Econ Entomol
101:182–189. https://doi.org/10.1093/jee/101.1.182
Chen Y, Tian J, Shen Z et al (2010) Transgenic rice plants expressing a fused protein of Cry1Ab/
Vip3H have resistance to rice stem borers under laboratory and field conditions. J Econ Entomol
103(4):1444–1453. https://doi.org/10.1603/EC10014
Chen M, Shelton A, Ye G (2011) Insect-resistant genetically modified rice in China: from research
to commercialization. Annu Rev Entomol 56:81–101
Cheng X, Sardana R, Kaplan H et al (1998) Agrobacterium-transformed rice plants expressing
synthetic cry1A(b) and cry1A(c) genes are highly toxic to striped stem borer and yellow stem
borer. Proc Natl Acad Sci U S A 95(6):2767–2772. https://doi.org/10.1073/pnas.95.6.2767
Cohen MB, Romena AM, Gould F (2000) Dispersal by larvae of the stem borers Scirpophaga
incertulas (Lepidoptera: Pyralidae) and Chilo suppressalis (Lepidoptera: Crambidae) in plots of
transplanted rice. Environ Entomol 29:958–971. https://doi.org/10.1603/0046-225x-29.5.958
Courtier-Orgogozo V, Morizot B, Boëte C (2017) Agricultural pest control with CRISPR-based
gene drive: time for public debate. Should we use gene drive for pest control? EMBO Rep
18:878–880
Datta K, Vasquez A, Tu J et al (1998) Constitutive and tissue specific differential expression of
cry1Ab gene in transgenic rice plants conferring resistance of rice insect pest. Theor Appl
Genet 97:20–30
Datta K, Baisakh N, Thet K et al (2002) Pyramiding transgenes for multiple resistance in rice
against bacterial blight, yellow stem borer and sheath blight. Theor Appl Genet 106:1–8
Deutsch CA, Tewksbury JJ, Tigchelaar M et al (2018) Increase in crop losses to insect pests in a
warming climate. Science 361:916–919
Divya D, Himabindu K, Nair S, Bentur JS (2015) Cloning of a gene encoding LRR protein and
its validation as candidate gall midge resistance gene, Gm4, in rice. Euphytica 203:185–195
Divya D, Tunginba Singh Y, Nair S, Bentur JS (2016) Analysis of SSH library of rice variety
Aganni reveals candidate gall midge resistance genes. Funct Integr Genom 16:153–169
Divya D, Nair S, Bentur JS (2018a) Expression profiles of key genes involved in rice gall midge
interactions reveal diversity in resistance pathways. Curr Sci 115:74–82
Divya D, Sahu N, Nair S, Bentur JS (2018b) Map-based cloning and validation of a gall midge
resistance gene, Gm8, encoding a proline-rich protein in the rice variety Aganni. Mol Biol Rep
45:2075. https://doi.org/10.1007/s11033-018-4364-8
Divya D, Ratna Madhavi K, Dass MA et al (2018c) Expression profile of defense genes in rice
lines pyramided with resistance genes against bacterial blight, fungal blast and insect gall
midge. Rice 11:40
Dong XT, Liao H, Zhu GH et al (2017) CRISPR/Cas9 mediated PBP1 and PBP3 mutagenesis
induced significant reduction in electrophysiological response to sex pheromones in male
Chilo suppressalis. Insect Sci 26:388. https://doi.org/10.1111/1744-7917.12544
Du B, Zhang W, Liu B et al (2009) Identification and characterization of Bph14, a gene conferring
resistance to brown planthopper in rice. Proc Natl Acad Sci U S A 106:22163–22168
Du B, Chen R, He J (2020) Current understanding of the genomic, genetic, and molecular control
of insect resistance in rice. Mol Breed 40:24. https://doi.org/10.1007/s11032-020-1103-3
Duan X, Li X, Xue Q et al (1996) Transgenic rice plants harboring an introduced potato protein-
ase inhibitor II gene are insect resistant. Nat Biotechnol 14:494–498. https://doi.org/10.1038/
nbt0496-494
Foissac X, Nguyen TL, Christou P, Gatehouse AMR, Gatehouse JA (2000) Resistance to green
leafhopper (Nephotettix virescens) and brown planthopper (Nilaparvata lugens) in trans-
genic rice expressing snowdrop lectin (Galanthus nivalis agglutinin; GNA). J Insect Physiol
46:573–583
Fujimoto H, Itoh K, Yamamoto M, Kyozuka J, Shimamoto K (1993) Insect-resistant rice gener-
ated by introduction of a modified endotoxin gene of Bacillus thuringiensis. Biotechnology
11:1151–1155
Fujita D, Doi K, Yoshimura A, Yasui H (2004) Introgression of a resistance gene for green rice
leafhopper from Oryza nivara into cultivated rice, Oryza sativa L. Rice Genet Newsl 21:64–66
Fujita D, Doi K, Yoshimura A, Yasui H (2006) Molecular mapping of a novel gene, Grh5, confer-
ring resistance to green rice leafhopper (Nephotettix cincticeps Uhler) in rice, Oryza sativa
L. Theor Appl Genet 113:567–573
Fujita D, Doi K, Yoshimura A, Yasui H (2010) A major QTL for resistance to green rice leafhopper
(Nephotettix cincticeps Uhler) derived from African rice (Oryza glaberrima Steud.). Breed Sci
60:336–341
Fujita D, Kohli A, Horgan FG (2013) Rice resistance to planthoppers and leafhoppers. Crit Rev
Fukuta T, Tamura K, Hirae M, Oya S (1998) Genetic analysis of resistance to green rice leafhopper
(Nephotettix cincticeps (Uhler)) in rice parental line, Norin-PL6, using RFLP markers. Breed
Sci 48:243–249
Gao X, Zhou J, Li J et al (2014) Efficient generation of marker-free transgenic rice plants using
an improved transposon-mediated transgene reintegration strategy. Plant Physiol 167:11–24.
https://doi.org/10.1104/pp.114.246173
Gatehouse JA (2008) Biotechnological prospects for engineering insect-resistant plants. Plant
Physiol 146:881–887
Ghareyazie B, Alinia F, Menguito CA et al (1997) Enhanced resistance to two stem borers in an
aromatic rice containing a synthetic CRY1A(B) gene. Mol Breed 3:401–404
Gosal SS, Gill R, Sindhu AS et al (2000) Transgenic basmati rice carrying genes for stem borer
and bacterial leaf blight resistance. In: Proceedings International Rice Research Conference.
Gosal SS, Gill R, Sindhu AS et al (2003) Introducing the cry1Ac gene into basmati rice and trans-
mitting transgenes to R3 progeny. In: Proceedings International Rice Research Conference.
Harini AS, Lakshmi SS, Kumar SS, Sivaramakrishnan S, Kadirvel P (2010) Validation and fine-
mapping of genetic locus associated with resistance to brown planthopper [Nilaparvata lugens
(Stål.)] in rice (Oryza sativa L.). Asian J Biol Sci 5:32–37
He K, Xiao H, Sun Y, Ding S, Situ G, Li F (2018) Transgenic microRNA-14 rice shows high resis-
tance to rice stem borer. Plant Biotechnol J 17:461. https://doi.org/10.1111/pbi.12990
Heinrichs EA (1994) Biology and management of rice insects. Wiley Eastern Limited and New
Age International Limited, New Delhi. 779 p
Heinrichs EA, Medrano FG, Rapusas HR (1985) Genetic evaluation for insect resistance in rice.
International Rice Research Institute, Los Baños. 352 p
Heong KL, Hardy B (eds) (2010) Planthoppers: new threats to the sustainability of intensive rice
production systems in Asia. International Rice Research Institute, Los Baños. 460 p
Herrnstadt C, Soares GG, Wilcox ER et al (1986) A new strain of Bacillus thuringiensis with activ-
ity against coleopteran insects. Nat Biotechnol 4:305–308
High SM, Cohen MB, Shu QY, Altosaar I (2004) Achieving successful deployment of Bt rice.
Trends Plant Sci 9:286–292
Himabindu K, Suneetha K, Sama VSAK, Bentur JS (2010) A new rice gall midge resistance gene
in the breeding line CR57-MR1523, mapping with flanking markers and development of NILs.
Hirabayashi H, Ideta O, Sato H et al (2004) Identification of a resistance gene to brown planthop-
per derived from Oryza minuta in rice. Breed Res 6(Suppl 1):285
Ho NH, Baisakh N, Oliva N et al (2006) Translational fusion hybrid Bt genes confer resistance
against yellow stem borer in transgenic elite Vietnamese rice cultivars. Crop Sci 46:781–789
Horgan FG, Ramal AF, Bentur JS et al (2016) Virulence of brown planthopper (Nilaparvata
lugens) populations from South and South East Asia against resistant rice varieties. Crop Prot
78:222–231
Hou LY, Ping YU, Qun XU et al (2011) Genetic analysis and preliminary mapping of two recessive
resistance genes to brown planthopper, Nilaparvata lugens Stål in rice. Rice Sci 18:238–242
Huang J, Wei Z, An H et al (2001) Agrobacterium tumefaciens-mediated transformation of rice
with the spider insecticidal gene conferring resistance to leaffolder and striped stem borer. Cell
Res 11:149–155. https://doi.org/10.1038/sj.cr.7290080
Huang D, Qiu Y, Zhang Y et al (2013) Fine-mapping and characterization of BPH27, a brown
planthopper resistance gene from wild rice (Oryza rufipogon Griff.). Theor Appl Genet
126:219–229
Huang HJ, Liu CW, Xu HJ, Bao YY, Zhang CX (2017) Mucin-like protein, a saliva component
involved in brown planthopper virulence and host adaptation. J Insect Physiol 98:223–230
Husnain T, Bokhari SM, Riaz N et al (2003) Pesticidal genes of Bacillus thuringiensis in trans-
genic rice technology to breed insect resistance. Pak J Biochem Mol Biol 36(3):133–142
Huvenne H, Smagghe G (2010) Mechanisms of dsRNA uptake in insects and potential of RNAi
for pest control: a review. J Insect Physiol 56:227–235
Intikhab S, Karim S, Riazuddin S (2000) Natural variation among rice yellow stem borer and rice
leaffolder populations to C delta endotoxins. Pak J Biol Sci 3(8):1285–1289
IRRI (International Rice Research Institute) (1979) Brown planthopper: threat to rice production
in Asia. IRRI, Los Baños. 369 p
Jairin J, Phengrat K, Teangdeerith S, Vanavichit A, Toojinda T (2007a) Mapping of a broad-
spectrum brown planthopper resistance gene, Bph3, on rice chromosome 6. Mol Breed
19:35–44
Jairin J, Teangdeerith SN, Leelagud P, Phengrat K, Vanavichit A, Toojinda T (2007b) Physical
mapping of Bph3, a brown planthopper resistance locus in rice. Maejo Int J Sci Technol
1:166–177
Jairin J, Teangdeerith S, Leelagud P et al (2010) Detection of a brown planthopper resistance gene
bph4 at the same chromosomal position of Bph3 using two different genetic backgrounds of
rice. Breed Sci 60:71–75
James C (2005) Global status of commercialized biotech/GM crops: 2005. ISAAA brief No. 34.
International Service for the Acquisition of Agri-Biotech Applications, Ithaca, NY
Janique S, Sriratanasak W, Ketsuwan K, Jairin J, Jeratthitikul E (2017) Phylogeography of the
Asian rice gall midge Orseolia oryzae (Wood Mason) (Diptera: Cecidomyiidae) in Thailand.
Genetica 145:37–49
Jena KK, Jeung JU, Lee JH, Choi HC, Brar DS (2006) High-resolution mapping of a new brown
planthopper (BPH) resistance gene, Bph18(t), and marker-assisted selection for BPH resistance
in rice (Oryza sativa L.). Theor Appl Genet 112:288–297
Jiang H, Hu J, Li Z et al (2018) Evaluation and breeding application of six brown planthopper
resistance genes in rice maintainer line Jin 23B. Rice 11:22
Jin S, Singh ND, Li L, Zhang X, Daniell H (2015) Engineered chloroplast dsRNA silences cyto-
chrome p450 monooxygenase, V-ATPase and chitin synthase genes in the insect gut and dis-
rupts Helicoverpa armigera larval development and pupation. Plant Biotechnol J 13:435–446
Jing S, Zhang L, Ma Y et al (2014) Genome-wide mapping of virulence in brown planthopper
identifies loci that break down host-plant resistance. PLoS One 9:e98911
Jing S, Zhao Y, Du B, Chen R, Zhu L, He G (2017) Genomics of interaction between the brown
planthopper and rice. Curr Opin Insect Sci 19:82–87
Kadowaki M, Yoshimura A, Yasui H (2003) RFLP mapping of antibiosis to rice green leafhopper.
In: Khush GS, Brar DS, Hardy B (eds) Advances in rice genetics. International Rice Research
Institute, Los Baños, pp 270–272
Katiyar SK, Tan Y, Huang B et al (2001) Molecular mapping of gene Gm-6(t) which confers resis-
tance against four biotypes of Asian rice gall midge in China. Theor Appl Genet 103:953–961
Kawaguchi M, Murata K, Ishii T, Takumi S, Mori N, Nakamura C (2001) Assignment of a brown
planthopper (Nilaparvata lugens Stål) resistance gene bph4 to the rice chromosome 6. Breed
Sci 51(1):13–18
Khajuria C, Vélez AM, Rangasamy M et al (2015) Parental RNA interference of genes involved in
embryonic development of the western corn rootworm, Diabrotica virgifera virgifera LeConte.
Insect Biochem Mol Biol 63:54–62
Khajuria C, Ivashuta S, Wiggins E et al (2018) Development and characterization of the first
dsRNA-resistant insect population from western corn rootworm, Diabrotica virgifera virgifera
LeConte. PLoS One 13(5):e0197059. https://doi.org/10.1371/journal.pone.0197059. http://
www.epa.gov/pesticide-registration/registration-rnai-control-corn-rootworm
Khanna HK, Raina SK (2002) Elite indica transgenic rice plants expressing modified Cry1Ac endo-
toxin of Bacillus thuringiensis show enhanced resistance to yellow stem borer (Scirpophaga
incertulas). Transgenic Res 11:411–423
Kiani G, Nematzadeh G, Ghareyazie B et al (2008) Evaluation of Bt (Bacillus thuringiensis)
rice varieties against stem borer (Chilo suppressalis). Pak J Biol Sci 11:648–651. https://doi.
org/10.3923/pjbs.2008.648.651
Kim SM, Sohn JK (2005) Identification of a rice gene (Bph1) conferring resistance to brown plan-
thopper (Nilaparvata lugens Stal) using STS markers. Mol Cell 20:30–34
Kim S, Kim C, Kim WLT et al (2008) Inheritance and field performance of transgenic Korean Bt
rice lines resistant to rice yellow stem borer. Euphytica 164:829–839
Kobayashi T, Yamamoto K, Suetsugu Y et al (2014) Genetic mapping of the rice resistance break-
ing gene of the brown planthopper Nilaparvata lugens. Proc R Soc B 281:20140726
Kola VSR, Renuka P, Madhav MS, Mangrauthia SK (2015) Key enzymes and proteins of
crop insects as candidate for RNAi-based gene silencing. Front Physiol 6:119. https://doi.
org/10.3389/fphys.2015.00119
Kola VSR, Renuka P, Padmakumari AP et al (2016) Silencing of CYP6 and APN genes affects
the growth and development of rice Yellow Stem Borer, Scirpophaga incertulas. Front Physiol
Krieg A, Huger AM, Langenbruch GA et al (1983) Bacillus thuringiensis var. tenebrionis: a new
pathotype effective against larvae of coleopteran. J Appl Entomol 96:500–508
Kumar S, Arul L, Talwar D (2010) Generation of marker-free Bt transgenic indica rice and evalu-
ation of its yellow stem borer resistance. J Appl Genet 51:243–257. https://doi.org/10.1007/
bf03208854
Kumar K, Sarao PS, Bhatia D et al (2018) High-resolution genetic mapping of a novel brown
planthopper resistance locus, Bph34 in Oryza sativa L. X Oryza nivara (Sharma & Shastry)
derived interspecific F2 population. Theor Apppl Genet 131:1163. https://doi.org/10.1007/
s00122-018-3069-7
Lang TN, Buu CB (2003) Genetic and physical maps of gene Bph10 controlling brown planthop-
per resistance in rice (Oryza sativa L.). Omonrice 11:35–41
Lee M, Aguda R, Cohen M et al (1997) Determination of binding of Bacillus thuringiensis (delta)-
endotoxin receptors to rice stem borer midguts. Appl Environ Microbiol 63:1453–1459
Leelagud P, Kongsila S, Vejchasarn P et al (2020) Genetic diversity of Asian rice gall midge based
on mtCOI gene sequences and identification of a novel resistance locus gm12 in rice cultivar
MN62M. Mol Biol Rep 47:4273. https://doi.org/10.1007/s11033-020-05546-9
Li G, Xu X, Xing H, Zhu H, Fan Q (2005) Insects resistance to Nilaparvata lugens and
Cnephalocrosis medinalis in transgenic indica rice and the inheritance of gna+ sbti transgenes.
Pest Manag Sci 61:390–396
Li H, Guan R, Guo H, Miao X (2015) New insights into an RNAi approach for plant defence
against piercing-sucking and stem-borer insect pests. Plant Cell Environ 38:2277–2285.
https://doi.org/10.1111/pce.12546
Ling Y, Weillin Z (2016) Genetic and biochemical mechanisms of rice resistance to planthopper.
Plant Cell Rep 35:1559–1572
Liu G, Yan H, Fu Q et al (2001) Mapping of a new gene for brown planthopper resistance in culti-
vated rice introgressed from Oryza eichingeri. Chin Sci Bull 46:1459–1462
Liu Y, Wu H, Chen H et al (2015) A gene cluster encoding lectin receptor kinases confers broad-
spectrum and durable insect resistance in rice. Nat Biotechnol 33:301–305
Liu Y, Chen L, Liu Y et al (2016) Marker-assisted pyramiding of two brown planthopper resistance
genes, Bph3 and Bph27 (t), into elite rice cultivars. Rice 9:27
Liu Y, Wang Y, Shu C et al (2018) Cry64Ba and Cry64Ca, two ETX/MTX2 Bacillus thuringien-
sis insecticidal proteins against hemipteran pests. Appl Environ Microbiol 84:e01996–e01917.
https://doi.org/10.1128/AEM.01996-17
Mahmood-ur-Rahman RH, Shahid AA, Bashir K, Husnain T, Riazuddin S (2007) Insect resistance
and risk assessment studies of advanced generations of basmati rice expressing two genes
of Bacillus thuringiensis. Electron J Biotechnol 10(2):15. http://www.ejbiotechnology.info/
content/vol10/issue2/full/3/
Maiti MK, Nayak P, Basu A et al (2001) Performance of Bt IR64 rice plants resistant against yel-
low stem borer in their advanced generations. Food security and environment protection in the
new millennium. In: Proceedings Asian Agriculture Congress. IRRI, Los Baños, p 314
Makkar GS, Bentur JS (2017) Breeding for stem borer and gall midge resistance in rice. In:
Arora R, Sandhu S (eds) Breeding insect resistant crops for sustainable agriculture. Springer,
Singapore, pp 323–352
Mao YB, Cai WJ, Wang JW et al (2007) Silencing a cotton bollworm P450 monooxygenase gene
by plant-mediated RNAi impairs larval tolerance of gossypol. Nat Biotechnol 25:1307–1313
Maqbool SB, Husnain T, Riazuddin S et al (1998) Effective control of yellow stem borer and rice
leaf folder in transgenic rice indica varieties Basmati 370 and M7 using the novel endotoxin
cryIIA Bacillus thuringiensis gene. Mol Breed 6:1–7
Maqbool SB, Riazuddin S, Loc NT et al (2001) Expression of multiple insecticidal genes confers
broad resistance against a range of different rice pests. Mol Breed 7:85–93
Miao YT, Deng Y, Jia HK, Liu YD, Hou ML (2018) Proteomic analysis of watery saliva secreted
by white-backed planthopper, Sogatella furcifera. PLoS One 13:e0193831. https://doi.
Moghaieb R (2010) Transgenic rice plants expressing cry1Ia5 gene are resistant to stem borer
(Chilo agamemnon). GM Crops 1:288–293. https://doi.org/10.4161/gmcr.1.5.14276
Murai H, Hashimoto Z, Sharma PN, Shimizu T, Murata K, Takumi S, Mori N, Kawasaki S,
Nakamura C (2001) Construction of a high-resolution linkage map of a rice brown planthopper
(Nilaparvata lugens Stål) resistance gene bph2. Theor Appl Genet 103(4):526–532
Myint KKM, Fujita D, Matsumura M, Sonoda T, Yoshimura A, Yasui H (2012) Mapping and pyra-
miding of two major genes for resistance to the brown planthopper (Nilaparvata lugens [Stål])
in the rice cultivar ADR52. Theor Appl Genet 124:495–504
Nagadhara D, Ramesh S, Pasalu IC, Rao YK, Krishnaiah NV, Sarma NP et al (2003) Transgenic
indica rice-resistant to sap sucking insects. Plant Biotechnol J 1:231–240
Nagadhara D, Ramesh S, Pasalu IC, Rao YK, Sarma NP, Reddy VD, Rao KV (2004) Transgenic
rice plants expressing the snowdrop lectin gene (gna) exhibit high-level resistance to the white-
backed planthopper (Sogatella furcifera). Theor Appl Genet 109:1399–1405
Naik BS, Divya D, Sahu N et al (2018) A new gene Bph33(t) conferring resistance to brown
planthopper (BPH), Nilaparvata lugens (Stal) in rice line RP2068-18-3-5. Euphytica 214:53
Nair S, Bentur JS, Sama VSAK (2011) Mapping gall midge resistance genes: towards durable
resistance through gene pyramiding. In: Muralidharan K, Siddiq EA (eds) Genomics and crop
improvement: relevance and reservations. Institute of Biotechnology, ANGR Agricultural
University, Hyderabad, pp 256–264
Nayak P, Basu D, Das S et al (1997) Transgenic elite indica rice plants expressing CryIAc-
endotoxin of Bacillus thuringiensis are resistant against yellow stem borer (Scirpophaga incer-
tulas). Proc Natl Acad Sci U S A 94:2111–2116
Ojha A, Sinha DK, Padmakumari AP, Bentur JS, Nair S (2017) Bacterial community structure in
the Asian rice gall midge reveals a varied microbiome rich in Proteobacteria. Sci Rep 7:9424.
https://doi.org/10.1038/s41598-017-09791-0
Painter RH (1951) Insect resistance in crop plants. University of Kansas Press, Lawrence, KS
Pan PL, Ye YX, Lou YH et al (2018) A comprehensive omics analysis and functional survey of
cuticular proteins in the brown planthopper. Proc Natl Acad Sci U S A 115:5175. https://doi.
org/10.1073/pnas.1716951115
Peng L, Zhao Y, Wang H et al (2017) Functional study of cytochrome P450 enzymes from the
brown planthopper (Nilaparvata lugens Stål) to analyze its adaptation to BPH-resistant rice.
Front Physiol 8:972
Pradhan S, Chakraborty A, Sikdar N et al (2016) Marker-free transgenic rice expressing the veg-
etative insecticidal protein (Vip) of Bacillus thuringiensis shows broad insecticidal properties.
Planta 244:789–804
Prahalada GD, Shivakumar N, Lohithaswa HC et al (2017) Identification and fine mapping of a
new gene, BPH31 conferring resistance to brown planthopper biotype 4 of India to improve
rice, Oryza sativa L. Rice 10:41
Price DR, Gatehouse JA (2008) RNAi-mediated crop protection against insects. Trends Biotechnol
26:393–400
Qiu Y, Guo J, Jing S, Zhu L, He G (2010) High-resolution mapping of the brown planthopper
resistance gene Bph6 in rice and characterizing its resistance in the 9311 and Nipponbare near
isogenic backgrounds. Theor Appl Genet 121:1601–1611
Qiu Y, Guo J, Jing S, Zhu L, He G (2012) Development and characterization of japonica rice
lines carrying the brown planthopper-resistance genes BPH12 and BPH6. Theor Appl Genet
124:485–494
Quilis J, López-García B, Meynard D et al (2014) Inducible expression of a fusion gene encod-
ing two proteinase inhibitors leads to insect and pathogen resistance in transgenic rice. Plant
Biotechnol J 12:367–377
Rahman ML, Jiang W, Chu SH, Qiao Y, Ham TH, Woo MO, Lee J, Khanam MS, Chin JH, Jeung
JU, Brar DS (2009) High-resolution mapping of two rice brown planthopper resistance genes,
Bph20 (t) and Bph21 (t), originating from Oryza minuta. Theor Appl Genet 119(7):1237–1246
Raina SK, Khanna HK, Talwar D et al (2003) Insect bioassays of transgenic indica rice carry-
ing a synthetic Bt toxin gene, cry1Ac. In: Advances in rice genetics, Proceedings of the 4th
International Rice Research Conference, pp 567–569
Ramesh S, Nagadhara D, Pasalu IC et al (2004a) Development of stem borer- resistant transgenic
parental lines involved in the production of hybrid rice. J Biotechnol 111:131–141
Ramesh S, Nagadhara D, Reddy VD, Rao KV (2004b) Production of transgenic indica rice-resistant
to yellow stem borer and sap-sucking insects, using super-binary vectors of Agrobacterium
tumefaciens. Plant Sci 166:1077–1085
Ramesh K, Padmavathi G, Dean R, Pandey MK, Lakshmi VJ, Bentur JS (2014) White-backed
planthopper Sogatella furcifera (Horvath) (Homoptera: Delphacidae) resistance in rice variety
Sinna Sivappu. Euphytica 200:139–148
Rao KV, Rathore KS, Hodges TK et al (1998) Expression of snowdrop lectin (GNA) in transgenic
rice plants confers resistance to rice brown planthopper. Plant J 15:469–477
Rawat N, Sinha DK, Rajendrakumar P et al (2010) Role of pathogenesis-related genes in rice-gall
midge interactions. Curr Sci 99(10):1361–1368
Rawat N, Neeraja CN, Nair S, Bentur JS (2012a) Differential gene expression in gall midge sus-
ceptible rice genotypes revealed by suppressive subtraction hybridization (SSH) cDNA librar-
ies and microarray analysis. Rice 5:8
Rawat N, Neeraja CN, Sundaram RM, Nair S, Bentur JS (2012b) A novel mechanism of gall midge
resistance in the rice variety Kavya revealed by microarray analysis. Funct Integr Genom
12:249–264
Rawat N, Himabindu K, Neeraja CN, Nair S, Bentur JS (2013) Suppressive subtraction hybrid-
ization reveals that rice gall midge attack elicits plant-pathogen like responses in rice. Plant
Physiol Biochem 63:122–130
Ren J, Gao F, Wu X et al (2016) Bph32, a novel gene encoding an unknown SCR domain-
containing protein, confers resistance against the brown planthopper in rice. Sci Rep 6:37645
Renganayaki K, Fritz AK, Sadasivam S et al (2002) Mapping and progress toward map-based
cloning of brown planthopper biotype-4 resistance gene introgressed from Oryza officinalis
into cultivated rice, O. sativa. Crop Sci 42:2112–2117
Renuka P, Maganti SM, Padmakumari AP et al (2017) RNA-Seq of rice yellow stem borer,
Scirpophaga incertulas reveals molecular insights during four larval developmental stages. G3
(Bethesda) 7:3031. https://doi.org/10.1534/g3.117.043737
Riaz N, Husnain T, Fatima T et al (2006) Development of indica Basmati rice harboring two
insecticidal genes for sustainable resistance against lepidopteran insects. South Afr J Bot
72:217–223
Saha P, Majumder P, Dutta I, Ray T, Roy SC, Das S (2006) Transgenic rice expressing Allium
sativum leaf lectin with enhanced resistance against sap-sucking insect pests. Planta
223:1329–1343. https://doi.org/10.1007/s00425-005-0182-z
Saka N, Tsuji T, Toyama T, Yano M, Izawa T, Sasaki T (2006) Development of cleaved ampli-
fied polymorphic sequence (CAPS) markers linked to a green rice leafhopper resistance gene,
Grh3(t). Plant Breed 125:140–143
Sama VSAK, Himabindu K, Naik BS, Sundaram RM, Viraktamath BC, Bentur JS (2012) Mapping
and MAS breeding of an allelic gene to the Gm8 for resistance to Asian rice gall midge.
Sama VSAK, Rawat N, Sundaram RM et al (2014) A putative candidate for the recessive gall
midge resistance gene gm3 in rice identified and validated. Theor Appl Genet 127:113–124
Sardesai N, Kumar A, Rajyashri KR, Nair S, Mohan M (2002) Identification and mapping of an
AFLP marker linked to Gm7, a gall midge resistance gene and its conversion to a SCAR marker
for its utility in marker aided selection in rice. Theor Appl Genet 105:691–698
Savary S, Willocquet L, Elazegui FA, Castilla NP, Teng PS (2000) Rice pest constraints in tropical
Asia: quantification of yield losses due to rice pests in a range of production situations. Plant
Dis 84:357–369
Schuler TH, Poppy GM, Kerry BR et al (1998) Insect-resistant transgenic plants. Trends Biotechnol
16:168–175
Sengupta S, Chakraborti D, Mondal HA, Das S (2010) Selectable antibiotic resistance marker
gene-free transgenic rice harbouring the garlic leaf lectin gene exhibits resistance to sap-
sucking planthoppers. Plant Cell Rep 29:261–271
Shangguan X, Zhang J, Liu B et al (2018) A mucin-like protein of planthopper is required for feed-
ing and induces immunity response in plants. Plant Physiol 176:552–565
Shao E, Lin L, Chen C et al (2016) Loop replacements with gut-binding peptides in Cry1Ab
domain II enhanced toxicity against the brown planthopper, Nilaparvata lugens (Stål). Sci
Rep 6:20106
Shu Q, Ye G, Cui H et al (2000) Transgenic rice plants with a synthetic Cry1Ab gene from Bacillus
thuringiensis were highly resistant to eight lepidopteran rice pest species. Mol Breed 6:433–439
Shu QY, Cui HR, Ye GY et al (2002) Agronomic and morphological characterization of
Agrobacterium-transformed Bt rice plants. Euphytica 127:345–352. https://doi.org/10.102
3/a:1020358617257
Sinha DK, Bentur JS, Nair S (2011a) Compatible interaction with its rice host leads to enhanced
expression of gamma subunit of oligosaccharyl transferase (OoOST) in the Asian rice gall
midge (Orseolia oryzae). Insect Mol Biol 20(5):567–575
Sinha DK, Lakshmi M, Anuradha G et al (2011b) Serine proteases-like genes in the rice gall midge
show differential expression in compatible and incompatible interactions with rice. Int J Mol
Sci 12:2842–2852
Sinha DK, Atray I, Bentur JS, Nair S (2012a) Expression of nucleoside diphosphate kinase
(OoNDPK) is enhanced in rice gall midge feeding on susceptible rice hosts and its overexpres-
sion leads to salt tolerance in E. coli. Insect Mol Biol 21(6):593–603
Sinha DK, Nagaraju J, Tomar A, Bentur JS, Nair S (2012b) Pyrosequencing-based transcrip-
tome analysis of the Asian rice gall midge reveals differential response during compatible and
incompatible interaction. Int J Mol Sci 13:13079–13103
Sinha D, Atray I, Bentur JS, Nair S (2015) Feeding on resistant rice leads to enhanced expression
of defender against apoptotic cell death (OoDAD1) in the Asian rice gall midge. BMC Plant
Biol 15:235
Sinha DK, Atray I, Agarrwal R, Bentur JS, Nair S (2017) Genomics of the Asian rice gall midge
and its interactions with rice. Curr Opin Insect Sci 19:76–81
Slamet LIH, Novalina S, Damayanti D et al (2003) Inheritance of cry1Ab and snowdrop lectin gna
genes in transgenic javanica rice progenies and bioassay for resistance to brown planthopper
and yellow stem borer. International Rice Research Institute (IRRI), Los Baños, pp 565–566
Srinivasan TS, Almazan MLP, Bernal CC, Ramal AF, Subbarayalu MK, Horgan FG (2016)
Interactions between nymphs of Nilaparvata lugens and Sogatella furcifera (Hemiptera:
Delphacidae) on resistant and susceptible rice varieties. Appl Entomol Zool 51:81–90
Su C-C, Zhai H-Q, Wang C-MG, Sun LH, Wan J-M (2006) SSR mapping of brown planthop-
per resistance gene Bph9 in Kaharamana, an indica rice (Oryza sativa L.). Acta Genet Sin
33:262–268
Suh JP, Yang SJ, Jeung JU et al (2011) Development of elite breeding lines conferring Bph18 gene-
derived resistance to brown planthopper (BPH) by marker-assisted selection and genome-wide
background analysis in japonica rice (Oryza sativa L.). Field Crop Res 120:215–222
Sun L, Su C, Wang C, Zhai H, Wan J (2005) Mapping of a major resistance gene to the brown
planthopper in the rice cultivar Rathu Heenati. Breed Sci 55:391–396
Sun L-H, Wang C-M, Su C-C, Liu Y-Q, Zhai H-Q, Wan J-M (2006) Mapping and marker-assisted
selection of a brown planthopper resistance gene bph2 in rice (Oryza sativa L.). Acta Genet
Sin 33:717–723
Sundaram RM (2007) Fine-mapping of rice-gall midge resistance genes Gm1 and Gm2 and valida-
tion of the linked markers. Dissertation. University of Hyderabad, Hyderabad
Sundaram RM, Balachandran SM, Madhav MS, Viraktamath BC (2013) Biotechnological options
for rice improvement. In: Shetty PK, Hegde MR, Mahadevappa M (eds) Innovation in rice
production. National Institute of Advanced Studies, Bangalore, pp 167–202
Tamura K, Fukuta Y, Hirae M, Oya S, Ashikawa I, Yagi T (1999) Mapping of the Grh1 locus for
green rice leafhopper resistance in rice using RFLP markers. Breed Sci 49:11–14
Tamura K, Fukuta Y, Hirae M, Oya S, Ashikawa I, Yagi T (2004) RFLP mapping of a new resis-
tance gene for green rice leafhopper in Kanto PL10. Rice Genet Newsl 21:62–64
Tamura Y, Hattori M, Yoshioka H et al (2014) Map-based cloning and characterization of a brown
planthopper resistance gene BPH26 from Oryza sativa L. ssp. indica cultivar ADR52. Sci
Rep 4:5872
Tan GX, Wang QM, Ren X, Huang Z, Zhu LL, He GC (2004) Two white-backed planthopper resis-
tance genes in rice share the same loci with those for brown planthopper resistance. Heredity
92:212–217
Tang W, Lin YJ (2007) Field experiment of transgenic cry1Ab insect resistant rice. Hereditas
29:1008–1012
Terenius O, Papanicolaou A, Garbutt JS et al (2011) RNA interference in Lepidoptera: an over-
view of successful and unsuccessful studies and implications for experimental design. J Insect
Physiol 57:231–245
Thaler JS, Humphrey PT, Whiteman NK (2012) Evolution of jasmonate and salicylate signal
crosstalk. Trends Plant Sci 17:260–270
Tomoyasu Y, Denell RE (2004) Larval RNAi in Tribolium (Coleoptera) for analyzing adult devel-
opment. Dev Genes Evol 214:575–578. https://doi.org/10.1007/s00427-004-0434-0
Tu J, Zhang G, Datta K et al (2000) Field performance of transgenic elite commercial hybrid rice
expressing Bacillus thuringiensis delta-endotoxin. Nat Biotechnol 18:1101–1104
Turner CT, Davy MW, MacDiarmid RM, Plummer KM, Birch NP, Newcomb RD (2006) RNA
interference in the light brown apple moth, Epiphyas postvittana (Walker) induced by double-
stranded RNA feeding. Insect Mol Biol 15:383–391
Venkanna V, Hari Y, Rukminidevi K et al (2018) Marker-assisted selection for pyramiding of gall
midge resistance genes in Kavya, a popular rice variety. Int J Curr Microbiol App Sci 7:745–753
Vijayalakshmi P, Amudhan S, Himabindu K, Cheralu C, Bentur JS (2006) A new biotype of
the Asian rice gall midge Orseolia oryzae (Diptera: Cecidomyiidae) characterized from the
Warangal population in Andhra Pradesh. India Int J Trop Insect Sci 26:207–211
Vila L, Quilis J, Meynard D et al (2005) Expression of the maize proteinase inhibitor (mpi) gene
in rice plants enhances resistance against the striped stem borer (Chilo suppressalis): effects on
larval growth and insect gut proteinases. Plant Biotechnol J 3:187–202
Wang Y, Wang X, Yuan H et al (2008) Responses of two contrasting genotypes of rice to brown
planthopper. Mol Plant-Microbe Interact 21:122–132
Wang Y, Zhang L, Li Y et al (2014) Expression of Cry1Ab protein in a marker-free transgenic
Bt rice line and its efficacy in controlling a target pest, Chilo suppressalis (Lepidoptera:
Crambidae). Environ Entomol 43:528–536
Wang Y, Cao L, Zhang Y et al (2015) Map-based cloning and characterization of BPH29, a B3
domain-containing recessive gene conferring brown planthopper resistance in rice. J Exp Bot
66:6035–6045
Wang H, Ye S, Mou T (2016a) Molecular breeding of rice restorer lines and hybrids for brown
planthopper (BPH) resistance using the Bph14 and Bph15 genes. Rice 9:53
Wang J, Zhang H, Wang H et al (2016b) Functional validation of cadherin as a receptor of Bt toxin
Cry1Ac in Helicoverpa armigera utilizing the CRISPR/Cas9 system. Insect Biochem Mol Biol
76:11–17. https://doi.org/10.1016/j.ibmb.2016.06.008
Wang L, Tang N, Gao X et al (2017a) Genome sequence of a rice pest, the white-backed planthop-
per (Sogatella furcifera). Giga Sci 6:1–9
Wang Y, Jiang W, Liu H et al (2017b) Marker-assisted pyramiding of Bph6 and Bph9 into elite
restorer line 93–11 and development of functional marker for Bph9. Rice 10:51
Wang W, Wan P, Lai F, Zhu T, Fu Q (2018) Double-stranded RNA targeting calmodulin reveals
a potential target for pest management of Nilaparvata lugens. Pest Manag Sci 74:1711–1719.
https://doi.org/10.1002/ps.4865
Waris MI, Younas A, ul Qamar MT et al (2018) Silencing of chemosensory protein gene NlugCSP8
by RNAi induces declining behavioral responses of Nilaparvata lugens. Front Physiol 9:379.
https://doi.org/10.3389/fphys.2018.00379
Wu C, Fan Y, Zhang C et al (1997a) Transgenic fertile japonica rice plants expressing a modified
cry1Ab gene resistant to yellow stem borer. Plant Cell Rep 17:129–132
Wu C, Zhao R, Fan Y et al (1997b) Transgenic rice plants resistant to yellow stem borer. Rice
Biotechnol 9:7
Wu J, Maehara T, Shimokawa T et al (2002) A comprehensive rice-transcript map containing 6591
expressed sequence tag sites. Plant Cell Online 14:525–535
Wu H, Liu Y, He J et al (2014) Fine-mapping of brown planthopper (Nilaparvata lugens Stål)
resistance gene Bph28 (t) in rice (Oryza sativa L.). Mol Breed 33:909–918
Wunn J, Kloti A, Burkhardt P et al (1996) Transgenic indica rice breeding line IR58 expressing a
synthetic crylA(b) gene from Bacillus thuringiensis provides effective insect pest control. Nat
Xue J, Zhou X, Zhang CX et al (2014) Genomes of the rice pest brown planthopper and its
endosymbionts reveal complex complementary contributions for host adaptation. Genome
Biol 15:521
Xue WH, Xu N, Yuan XB et al (2018) CRISPR/Cas9-mediated knockout of two eye pigmen-
tation genes in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae). Insect
Biochem Mol Biol 93:19–26
Yamasaki M, Yoshimura A, Yasui H (2003) Genetic basis of ovicidal response to white-backed
planthopper (Sogatella furcifera Horvath) in rice (Oryza sativa L.). Mol Breed 12:133–143
Yang H, You A, Yang Z et al (2004) High-resolution genetic mapping at the Bph15 locus for brown
planthopper resistance in rice (Oryza sativa L.). Theor Appl Genet 110:182–191
Yang Z, Chen H, Tang W et al (2011) Development and characterization of transgenic rice express-
ing two Bacillus thuringiensis genes. Pest Manag Sci 67:414–422
Yang L, Li RB, Li YR et al (2012) Genetic mapping of bph20 (t) and bph21(t) loci conferring
brown planthopper resistance to Nilaparvata lugens Stål in rice (Oryza sativa L.). Euphytica
183:161–171
Yang Y, Mei F, Zhang W et al (2014) Creation of Bt rice expressing a fusion protein of cry1Ac and
Cry1I-like using a green tissue-specific promoter. J Econ Entomol 107:1674–1679
Yarasi B, Sadumpati V, Pasalu IC, Reddy DV, Rao KV (2008) Transgenic rice expressing Allium
sativum leaf agglutinin (ASAL) exhibits high-level resistance against major sap-sucking pests.
BMC Plant Biol 8:102. https://doi.org/10.1186/1471-2229-8-102
Ye G, Shu Q, Cui H et al (2000) A leaf-section bioassay for evaluating rice stem borer resistance
in transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis Berliner. Bull
Entomol Res 90:179–182. https://doi.org/10.1017/s0007485300000298
Ye G, Shu Q, Yao H et al (2001) Field evaluation of resistance of transgenic rice containing a syn-
thetic cry1Ab gene from Bacillus thuringiensis Berliner to two stem borers. J Econ Entomol
94:271–276
Ye R, Huang H, Yang Z et al (2009) Development of insect-resistant transgenic rice with Cry1C-

free endosperm. Pest Manag Sci 65:1015–1020
Ye W, Yu H, Jian Y et al (2017a) A salivary EF-hand calcium-binding protein of the brown
planthopper Nilaparvata lugens functions as an effector for defense responses in rice. Sci
Rep 7:40498
Ye ZF, Liu XL, Han Q et al (2017b) Functional characterization of PBP1 gene in Helicoverpa
armigera (Lepidoptera: Noctuidae) by using the CRISPR/Cas9 system. Sci Rep 7:8470. https://
doi.org/10.1038/s41598-017-08769-2
Yin K, Gao C, Qiu JL (2017) Progress and prospects in plant genome editing. Nat Plants 3:17107
Yoshimura S, Komatsu M, Kaku K et al (2012) Production of transgenic rice plants express-
ing Dioscorea batatas tuber lectin1 to confer resistance against brown planthopper. Plant
Yu R, Xu X, Liang Y et al (2014) The insect ecdysone receptor is a good potential target for RNAi-
based pest control. Int J Biol Sci 10:1171–1180. https://doi.org/10.7150/ijbs.9598
Zamore PD, Tuschl T, Shorp PA, Bartel DP (2000) RNAi: double-stranded RNA directs the ATP-
dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25–33
Zeng Q, Wu Q, Zhou K et al (2002) Obtaining stem borer-resistant homozygous transgenic lines
of Minghui 81 harboring novel cry1Ac gene via particle bombardment. Yi Chuan Xue Bao
29:519–524
Zeng F, Liu H, Zhang A et al (2018) Three chemosensory proteins from the rice leaffolder
Cnaphalocrocis medinalis involved in host volatile and sex pheromone reception. Insect Mol
Biol 27:710. https://doi.org/10.1111/imb.12503
Zha W, Peng X, Chen R, Du B, Zhu L, He G (2011) Knockdown of midgut genes by dsRNA-
transgenic plant-mediated RNA interference in the Hemipteran insect Nilaparvata lugens.
PLoS One 6:e20504
Zhang Y, Li Y, Zhang Y et al (2011) Seasonal expression of Bt proteins in transgenic rice lines
and the resistance against Asiatic rice borer Chilo suppressalis (Walker). Environ Entomol
40:1323–1330
Zhang KJ, Zhu WC, Rong X et al (2013) The complete mitochondrial genomes of two rice
planthoppers, Nilaparvata lugens and Laodelphax striatellus: conserved genome rearrange-
ment in Delphacidae and discovery of new characteristics of atp8 and tRNA genes. BMC
Genomics 14:417
Zhang KJ, Zhu WC, Rong X et al (2014) The complete mitochondrial genome sequence of
Sogatella furcifera (Horváth) and a comparative mitogenomic analysis of three predominant
rice planthoppers. Gene 533:100–109
Zhang J, Khan SA, Hasse C, Ruf S, Heckel DG, Bock R (2015) Full crop protection from an insect
pest by expression of long double-stranded RNAs in plastids. Science 347:991–994
Zhang L, Qiu LY, Yang HL et al (2017) Study on the effect of wing bud chitin metabolism and its
developmental network genes in the brown planthopper, Nilaparvata lugens, by knockdown of
TRE gene. Front Physiol 8:750
Zhao Q (2015) Generation of insect-resistant and glyphosate-tolerant rice by introduction of
a T-DNA containing two Bt insecticidal genes and an EPSPS gene. J Zhejiang Univ Sci B
16(10):824–831
Zhao L, Yang M, Shen Q et al (2016a) Functional characterization of three trehalase genes regulat-
ing the chitin metabolism pathway in rice brown planthopper using RNA interference. Sci Rep
6:27841. https://doi.org/10.1038/srep27841
Zhao Y, Huanga J, Wanga Z et al (2016b) Allelic diversity in an NLR gene BPH9 enables rice to
combat planthopper variation. Proc Natl Acad Sci U S A 113:45
Zhou WW, Liang QM, Xu Y et al (2013) Genomic insights into the Glutathione S-transferase
gene family of two rice planthoppers, Nilaparvata lugens (Stål) and Sogatella furcifera
(Horváth) (Hemiptera: Delphacidae). PLoS One 8(2):e56604. https://doi.org/10.1371/journal.
pone.0056604
Zhu GH, Peng YC, Zheng MY et al (2017a) CRISPR/Cas9-mediated BLOS2 knockout resulting in
disappearance of yellow strips and white spots on the larval integument in Spodoptera litura.
J Insect Physiol 103:29–35
Zhu J, Hao P, Lu C, Ma Y, Feng Y, Yu X (2017b) Expression and RNA interference of ribosomal
protein L5 gene in Nilaparvata lugens (Hemiptera: Delphacidae). J Insect Sci 17:73. https://
doi.org/10.1093/jisesa/iex047
Zhu J, Jiang F, Wang X et al (2017c) Genome sequence of the small brown planthopper, Laodelphax
striatellus. Giga Sci 6:1–12
Zimmer CT, Garrood WT, Singh SK et al (2018) Neofunctionalization of duplicated P450 genes
drives the evolution of insecticide resistance in the brown planthopper. Curr Biol 28:268–274
Zuo Y, Wang H, Xu Y et al (2017) CRISPR/Cas9-mediated G4946E substitution in the ryanodine
receptor of Spodoptera exigua confers high levels of resistance to diamide insecticides. Insect
Biochem Mol Biol 89:79–85
Doubled Haploids in Rice Improvement:
Approaches, Applications, and Future
Prospects
Sanghamitra Samantaray, Jauhar Ali, Katrina L. C. Nicolas,

Jawahar Lal Katara, Ram Lakhan Verma, C. Parameswaran, B. N. Devanna,
Awadhesh Kumar, Byomkesh Dash, and Sudhansu Sekhar Bhuyan
Abstract Exploitation of biotechnological tools in conventional breeding strate-

gies is the need of the hour for overcoming limitations in rice production and pro-
ductivity. In addition, improvement in quantity and quality along with resistance to
climatic and disease stress in rice require immediate attention. Anther culture has
proven its efficiency by instantaneously fixing homozygosity through diploidization
of regenerated haploid plants. Therefore, androgenesis provides an efficient plat-
form for developing inbred lines in a short period of time. Although anther culture
shows its efficiency in speeding up breeding in several crop species, including rice,
associated limitations still prevent the exploitation of its optimum potential.
Although anther culture is well exploited in japonica rice breeding, its application
in indica rice is limited because of inherent recalcitrant genetic backgrounds. The
success of anther culture is determined by several factors that limit the efficiency of
androgenesis. Identified constraints are early anther necrosis, poor-callus response,
and proliferation, and low green-plant regeneration, along with the most frustrating
albinism associated with indica rice, which has been considerably clarified. This
chapter details the method of androgenesis and scope for improving the applicability
of anther culture producing doubled haploids of rice in order to use it as a
complementary tool for precision breeding.
Keywords Androgenesis · Doubled haploid · Callus · Regeneration ·

Anther culture
S. Samantaray (*) · J. L. Katara · R. L. Verma · C. Parameswaran · B. N. Devanna

A. Kumar · B. Dash · S. S. Bhuyan
ICAR-National Rice Research Institute, Cuttack, Odisha, India
J. Ali · K. L. C. Nicolas
IRRI, Metro Manila, Philippines

https://doi.org/10.1007/978-3-030-66530-2_12
426 S. Samantaray et al.
1 Introduction
Doubled-haploid breeding through anther culture has emerged as an exciting and

powerful tool, and a convenient alternative to conventional techniques for crop
improvement (Purwoko et al. 2010). Doubled haploids have several advantages,
such as shortening the breeding cycle by immediate fixation of homozygosity,
offering high-selection efficiency, widening genetic variability through the
production of gametoclonal variants, and expressing desirable recessive genes
suitable for breeding (Devaux and Pickering 2005). Despite all the advantages DH
technology offers in several crops, it has not been put to use in rice to sufficient
extent in order to take maximum advantage, even though more than half of the
world’s population depends on rice for consumption as staple food. Further, the
development of high-yielding rice cultivars is urgently needed to meet the demand
of the increasing population and the challenges of a changing climate since cultivar
development is a lengthy and time-consuming process. However, anther culture has
been exploited to develop several varieties and improved breeding lines, mostly in
japonica cultivars (Grewal et al. 2011). Contrastingly, this technique has poor
implications in indica rice cultivars owing to poor-androgenic response. In addition,
early anther necrosis, poor-callus proliferation, and albino-plant regeneration are
some of the major problems encountered in the case of indica rice at the time of
androgenesis, which needs vast improvement. Hence, attempts are being made to
overcome low-anther culturability by evaluating several key factors involved in
affecting the success of anther culture (Trejo-Tapia et al. 2002; Jacquard et al. 2006).
DH technology integrated with phenomics and genomics could accelerate cultivar
development and economize plant-breeding operations.
Several approaches in the production of DHs were developed, for which in vitro
culture was found to be the most efficient and simplest technique. It is being used to
produce haploids/doubled haploids in several crops. The two commonly used
in vitro methods for DH production are gynogenesis and androgenesis. However,
androgenesis shows its effectiveness and applicability in producing haploids and
DHs in numerous cereals (Forster et al. 2007). To alleviate the problems associated
with indica rice DH breeding, manipulation of the limiting factors related to
androgenesis is required to achieve a successful protocol for effective exploitation.
This chapter deals with insights into the practical aspects of anther culture tech-
nique for it to be fully exploited for improving rice breeding.
2 tatus of Doubled-Haploid Research in the Success

S
of Indica Rice Anther Culture
The past and current status of research highlights the usefulness of DH technology
in rice improvement. The discovery of haploids in plants led to the use of DH
technology in plant breeding. Although there are different methods to generate
Doubled Haploids in Rice Improvement: Approaches, Applications, and Future Prospects 427
haploids, they are usually accompanied by chromosome doubling. In general,

in vitro methods were found to be the most pertinent in developing haploids and
DHs, for which androgenesis shows its effectiveness and applicability in numerous
cereals, including rice. These systems allow completely homozygous lines to be
developed from heterozygous parents in a single generation.
The first naturally occurring haploids were reported by Blakeslee et al. (1922) in
jimson weed (Datura stramonium L.) and thereafter natural haploids were
documented in several other species. However, the relevance of DHs came into
prominence only when Guha and Maheshwari (1964, 1966) reported a breakthrough
in the production of haploids from anther culture of Datura innoxia (Mill.). Further,
their research revolutionized the use of DH technology in plant breeding worldwide.
Subsequently, this haploid discovery by anther culture provided several opportunities
for applying this technique in crop improvement programs. In rice, the first report
on producing haploids through anther culture came from Niizeki and Oono (1968).
Subsequently, the doubled-haploidy approach coupled with conventional breeding
led to the development of several rice varieties for pest and disease resistance, high
yield, and good-quality grains in many countries. Furthermore, anther culture could
facilitate other biotechnological approaches such as gene transformation technology
and the identification of QTLs.
Despite all the advantages DH technology offers, it has not been put to use in
indica rice to a great extent for maximizing its advantage. This is mostly because of
the lack in expertise and the variable response of different genotypes under in vitro
culture. Although the androgenic response to japonica-subspecies has led to the
release of many varieties, the potential of anther culture for indica rice breeding is
not fully exploited, in spite of the release of a salt-tolerant indica variety through
anther culture (Senadhira et al. 2002). Early anther necrosis, poor-callus proliferation,
and albino-plant regeneration are some of the problems encountered in indica rice
at the time of androgenesis, which are researchable concerns. Several determining
factors associated with poor-androgenic response were also addressed to obtain
success in rice anther culture. Although one-step androgenesis (somatic
embryogenesis) is cost-effective vis-à-vis two-step organogenesis, the latter was
widely adopted because of its responsiveness in rice.
Physiology of the donor plant is an important contributory factor for the success
of rice anther culture. Anthers of panicles collected from field-grown plants have
been decided better in their anther culture response than anthers collected from pot
plants placed in the greenhouse or near the field (Veeraraghavan 2007). Second, the
microspore stage is considered as an important factor for androgenic response. An
easily observable morphological trait of the plant that shows good correlation with
the pollen development stage is used as a guide to identify the required stage of the
microspore (Nurhasanah et al. 2016). Usually, the distance between the collar of the
flag leaf and the ligule of the penultimate leaf of the tiller serves as a reliable guide
to anther maturity. The most suitable stage of microspore development has been
described as the late uninucleate to early binucleate stage. However, the appropriate
microspore stage for effective androgenic response was reported as early as mid-
uninucleate stage (Fig. 1a).
Fig. 1 Androgenesis in rice hybrids (CRHR32 and BS6444G). (a) Early to mid-uninucleate stages
of microspore; (b) callus induction; (c) green spot indicating shoot bud emergence; (d) shoot
elongation; (e) albino shoot regeneration; (f) root to microshoots
A wide range of chemical and physical factors influences androgenesis in vitro.

The most widely used pretreatment for androgenesis is low-temperature shock with
appropriate duration. Mishra et al. (2013) assessed the influence of cold pretreatment
at 10 °C for 7–9 days on the anther culture response of Rajalaxmi (CRHR 5) and
Ajay (CRHR 7), which showed a positive influence on callus induction frequency
irrespective of the media and plant growth regulators (PGRs) employed; prolonged
treatment over the optimum duration proved to be inhibitory for androgenesis.
However, cold treatment (10 °C) for 8 days was found to be effective for callus
induction and green-plant regeneration in a popular indica rice hybrid, BS6444G
(Naik et al. 2017). In addition, 2 days of preincubation period at 10 °C was quite

interesting for the success of androgenesis in a long-duration indica rice hybrid
(Rout et al. 2016).
The most commonly used basal media for anther culture are N6, MS, B5, and
Potato-2 medium. Subsequently, several media (MSN, SK1, He2, and RZ) were
developed from N6 media by modifying the nitrogen rates and sources, carbon
content and sources, and changes in vitamins and their concentrations, which were
found to be encouraging for anther response in rice. N6 media were found to induce
maximum callusing in Taraori Basmati (Grewal et al. 2006). Min et al. (2016) found
out the best media for androgenesis in the generation of DHs from F1s of two
intervarietal crosses in terms of callusing (N6) and shoot regeneration (½MS) after
a trial with 16 different media. However, two basal media, such as N6 and MS, were
found to be effective for callusing and green-shoot regeneration, respectively, in
indica rice hybrids (Rout et al. 2016; Naik et al. 2017).
Considering the importance of plant growth regulators in tissue culture, the
effects of different PGRs were investigated for androgenesis. Even though 2,4-D
has proven to be a potent auxin for callus induction from cultured anthers, medium
with lower 2,4-D rates was found to be more effective for the regeneration ability of
calli induced in indica rice than higher 2,4-D rates (Fig. 1b). The calli developed
green spots in 7–10 days after transfer to media supplemented with NAA (0.5 mg/L),
BAP (1.0 mg/L), and Kn (1.0 mg/L), which adequately supported green-plant
regeneration from subcultured calli (Fig. 1c, d). The type and concentration of
auxins seem to determine the pathway of microspore development with 2,4-D
inducing callus formation and IAA and NAA promoting direct embryogenesis (Ball
et al. 1993). The 2,4-D was found effective for callus response while the combinations
of NAA, Kn, and BAP showed shoot regeneration in the generation of DHs from F1s
of two intervarietal crosses and hybrid rice (Min et al. 2016; Rout et al. 2016; Naik
et al. 2017).
The nitrogen composition supplied in the form of nitrate and/or ammonium
ions in culture media plays a significant role in androgenesis. The ratio of nitrate
(NO3−): ammonium (NH4+) has been observed to be an important determinant
for the success of anther culture as well as for the in vitro induction of embryo-
genic calli in indica rice (Grimes and Hodges 1990). Ivanova and Van Staden
(2009) investigated the elimination of total nitrogen in media, resulting in lim-
ited ability of proliferation and shoot growth, but higher ability was observed in
media containing NO3− as the only sole nitrogen source, whereas replacing the
NH4+ with NO3− decreased the rate of hyperhydricity. Herath et al. (2007) proved
that the frequency of callus induction was improved by modifying three differ-
ent media (N6, B5, and Miller) with one-half the rate of NH4+ and double the
rate of KNO3 nitrogen.
A carbohydrate source is essential for androgenesis because of the osmotic and
nutritional effects. Naik et al. (2017) aptly demonstrated the superiority of maltose
over sucrose as the carbon source in rice anther culture for callusing. Replacing
sucrose (146 mM) with maltose (146 mM) in the callus induction medium had a
significant positive effect on anther response in both indica and japonica types, with
a greater effect on indica rice. With respect to the effect of light quality on anther
culture, the embryogenic induction of microspores is inhibited by high-intensity
white light, whereas darkness or low-intensity white light is found encouraging
(Bjørnstad et al. 1989). The incubation of anthers continuously in the dark has, on
occasion, been found to be essential.
Most in vitro morphogenic responses are genotype-dependent. In general, indica
rice cultivars exhibit poor-androgenic response vis-à-vis japonica ones. Even
among the indica cultivars, a considerable variation in microspore callusing and
green-shoot regeneration has been observed (Rout et al. 2016; Naik et al. 2017). The
highest callus-responsive cultivars often show the best regeneration frequency and
the best responsive genotypes to callusing exhibit low-regeneration ability.
Therefore, selection of a single step, either callus improvement or shoot regeneration
alone, may not help in establishing an effective androgenic method. It is rather
important to identify genotypes carrying the two traits for overall improvement in
anther culture efficiency.
The occurrence of a large proportion of albinos among the regenerated plants
following anther culture is the most frustrating feature of androgenesis and this
remains a formidable obstacle for application to rice breeding. The frequency of
albinos can vary from 5% to 100% (Talebi et al. 2007). Indica rice cultivars are
more prone to this problem than japonica cultivars. Several factors, including
pretreatment conditions and culture medium, affect the frequency of albinos,
which could be considerably decreased by shortening the culture period
(Asaduzzaman et al. 2003). The presence of large-scale deletions in some plas-
tid genomes of the albino haploid plants derived from anther culture of japon-
ica × indica hybrids and absence of such deletions in green regenerants
(Yamagishi 2002) appeared to suggest a role for the plastid genome in determin-
ing the albino phenotype. The albinos (60–100%) in the regeneration culture
proved to be detrimental for optimizing an androgenic response (Fig. 1e).
Therefore, ICAR-NRRI, India, attempted to develop a protocol for the suppres-
sion of albinism, which led to standardization of a 100% albino-free shoot
regeneration method in indica rice (patent filed 1355/KOL/2015 titled “Method
for albino-free shoot regeneration in rice through anther culture”).
The well-developed shoots were transferred to MS media supplemented with
2.0 mg/L NAA, 0.5 mg/L Kn, and 5% sucrose for rooting. Root induction starts
7 days after transfer, followed by profuse rooting after 4 weeks of culture
(Fig. 1f).
3 Diploidization of Haploid Genomes
Haploids can be diploidized (duplication of chromosomes) to produce homozygous

plants. There are two approaches for haploidy diploidization.
3.1 Artificial Genome Doubling
Artificial genome doubling is the most popular method applied for doubling
genomes in large-scale DH production. Colchicine, an antimicrotubule drug, has
been widely used and is the most effective genome-doubling agent. Colchicine
duplicates the genome by binding to tubulins and inhibits microtubule polymerization
(Kleiber et al. 2012; Prasanna et al. 2012; Weber 2014). However, colchicine is
highly toxic, which is not only potentially carcinogenic but also hazardous to the
environment (Melchinger et al. 2016). The effects of other agents with lower toxicity
on chromosome doubling, such as amiprophos-methyl (APM), oryzalin, pronamide,
and trifluralin (all of which are herbicides), have been reported (Wan et al. 1991;
Häntzschel and Weber 2010; Murovec and Bohanec 2012).
3.2 Spontaneous Genome Doubling
Spontaneous genome doubling is cost-effective and has been reported in several

cereals, including rice. The frequency of spontaneous genome doubling is reported
to be 50–60% in rice (Seguí-Simarro and Nuez 2008). However, interestingly, a
recent report on rice hybrid BS6444G showed 90–99% spontaneous doubling (Naik
et al. 2017). The doubling rate fluctuates extremely among genotypes (Chalyk 1994;
Kleiber et al. 2012). Endomitosis is one of the phenomena of doubling the number
of chromosomes without division of the nucleus. The haploid cells in general are
unstable in culture, with a tendency to undergo endomitosis. This property of
haploid cells is exploited for diploidization to produce homozygous plants. The
procedure involves growing a small segment of haploid plant stem in a suitable
medium supplemented with growth regulators (auxin and cytokinin). This induces
callus formation followed by differentiation. During callus growth, chromosomal
doubling occurs by endomitosis. This results in the production of diploid
homozygous cells and ultimately true homozygous plants.
4 Characterization of Regenerants: Ploidy Analysis
After a successful haploid induction and the regeneration procedure, evaluation of

regenerants is needed to distinguish doubled haploids from redundant heterozygous
diploids grown in the net house (Fig. 2a). During the production of homozygous
lines, various undesired heterozygous plantlets can be obtained. In anther culture,
these plants can be regenerated from the somatic tissue of inoculated plant organs
such as anther wall cells, tapetum, and filaments. Reliable and fast selection of
regenerants is therefore necessary before further employment of putative haploids
and doubled haploids.
Fig. 2 Ploidy status in green regenerants. (a) A0 plants grown in net house; (b) morphological
discrimination of ploidy status; (c) SSR marker (RM480) differentiating somatic tissue-derived
heterozygotes from DHs. M = 100-bp DNA ladder; C = CRMS31A; R = CRL22R; H = CRHR32;
1–3 to 5–20 = DHs; 4 = heterozygote (arrow)
Variations in nuclear DNA content of cultured plant tissues resulted in

changes in ploidy level, which in turn changes the phenotypic characters of the
regenerants, termed as triploid, tetraploid, polyploid, and aneuploid. This kind
of variability occurred especially in chromosome number variations of regener-
ated plants, that is, ploidy changes: deletion, duplication, and rearrangements
(d’Amato 1989). The chromosome aberrations influenced agronomic traits and
the ploidy level of rice plants (Zhang and Chu 1984). Since the isolated anthers
sometimes become contaminated from the anther wall tissues, the developed
calli may be of mixed type such as haploid, diploid, triploid, and tetraploid
(Dunwell 2010).
Different ploidy status can be evaluated through several approaches.
4.1 Morphological
Fertile diploids can be well-distinguished from other ploids such as haploids, trip-
loids, and polyploids through morphological evaluation (Fig. 2b). The diploids or
putative DHs show normal morphological appearance with 70–80% grain fertility,
whereas the polyploids are tall, large, and possess broad thick leaves with less than
1% spikelet fertility. Short stature with no spikelet fertility confirms haploids.
Sometimes, mixploids are observed in the regenerants, which can be discriminated
by observing grain type after grain maturity (Fig. 2b).
4.2 Cytological
Of the several methods tested earlier, the classical cytological approach was thought
to be ideal to determine ploidy status. Ploidy status in plants can be determined by
counting the chromosomes of root tip cells arrested in metaphase stage (Mishra
et al. 2015). However, this approach is tedious and time-consuming and also requires
expertise. This is also considered an unambiguous method. Most importantly,
tissues containing dividing cells may not always be readily available for analysis.
4.3 Pollen Fertility Analysis
Stomatal density and size, the size of pollen grains, cell size, and plant size are
mainly considered to analyze the ploidy level in DHs, out of which a cytology-
based approach through pollen size determination was used as an alternative,
convenient, rapid, and reliable method to assess the ploidy level in several plant
species (Zonneveld and Van Iren 2001). This method also has its own demerits like
cytology.
4.4 Flow Cytometry
Since the nuclear DNA content and the ploidy level have close association, flow
cytometry is the most reliable method and it has wide application in plant-ploidy
analysis (Ochatt 2008; Cousin et al. 2009; X Wang et al. 2016). It is frequently used
to analyze the ploidy level of individuals obtained from experiments of haplo-
diploidization or chromosome doubling (Grewal et al. 2009; Ochatt et al. 2009).
This method was used to discriminate the ploidy status of the regenerants developed
from rice hybrids (Mishra et al. 2015).
4.5 High-Throughput Cell Analysis
Most recently, a quick and precise ploidy determination method was developed
using high-throughput cell analysis (Sahoo et al. 2019). This is useful to analyze
nuclear DNA content-based ploidy validation of a large number of samples.
None of these approaches could differentiate DHs from heterozygotes (somatic
tissue-derived diploids), for which molecular markers might be the best option for
the identification of true DHs (Rout et al. 2016; Naik et al. 2017).
4.6 Molecular Markers
Genomic molecular markers are highly heritable, available in high numbers,

and often exhibit enough polymorphism to discriminate closely related geno-
types. Simple sequence repeats (SSRs) are abundant and well-distributed
throughout the rice genome. They are the most commonly used markers for
understanding the source of origin (originated from the microspore mother
cells or embryogenesis from diploid somatic tissue), parental contribution
(allelic frequencies), and homozygosity in plant derivatives. SSRs have been
successfully used to identify homozygous spontaneous-doubled haploids in
rice hybrids (Fig. 2c).
5 Application of DHs in Rice Improvement
To meet the challenge of food security for the increasing population amid dimin-
ishing resources such as cultivable land and irrigation water along with climate
change associated with unpredictable and unseasonal weather patterns, the
development of high-yielding rice varieties is required to feed the ever-growing
population. Hybrid rice is considered as a best option to break through the yield
barrier, showing significant yield advantages over conventional cultivars.
Although hybrid rice can outyield conventional cultivars by 30–40% in produc-
tion fields, it does not gain in popularity among Indian farmers because of its
complicated seed production system, purchase of nonreplaceable seed every
season (as it segregates in consequent seasons), higher seed cost, less-preferred
quality, and vulnerability to abiotic and biotic stresses. Therefore, we need to
find an alternative way to exploit hybrid potential in fixing heterosis along with
the associated problems for which DH technology was found to be efficient in
the rapid fixation of favorable alleles for yield and related traits. The DH breed-
ing technique shortens the time required for breeding a new variety from the
usual ~8 to ~5 years, thus saving time, labor, and financial resources. Conversely,
the DH technique could be more appropriate for developing new varieties from
photosensitive rice genotypes. Most of these advances were achieved in japon-
ica cultivars, which were amenable to anther culture, rather than in indica rice.
Significantly, several varieties and improved parental lines have been developed
through androgenic approaches, but restricted to only japonica rice cultivars.
However, the use of anther culture as a routine technique for breeding is
extremely limited in indica rice due to the poor induction of androgenic calli
and subsequent plant regeneration. An efficient androgenic protocol could gen-
erate a considerable number of DHs for various applications.
Fig. 3 Promising doubled haploids derived from rice hybrids (CRHR32 and BS6444G). (a) DHs
of BS6444G showing yield equal to that of the parent; (b) grain quality of DH lines of
hybrid BS6444G
5.1 Performance of DHs Derived from Hybrid Rice
The DH technique was used to overcome the constraints associated with indica rice
hybrids: (1) expensive seed, depriving Indian marginal farmers from using the seed
year after year; and (2) unpredictable environmental conditions and synchronized
flowering. Standardization of DH technology in rice hybrids (PHB71 and KRH2)
generated DHs from which two were released as varieties, Satyakrishna in 2008 and
Phalguni in 2010. Subsequently, androgenic protocols in two more indica rice
hybrids, CRHR32 (an elite long-duration indica rice hybrid developed at NRRI,
Cuttack) and BS6444G (a popular rice hybrid, Bayer Seed Pvt. Ltd., Hyderabad),
generated a considerable number of DHs (Rout et al. 2016; Naik et al. 2017). Some
of the DHs showed grain yield on par with that of the parent rice hybrids (Fig. 3a);
the grain quality of the DHs was also higher than that of the rice hybrids (Fig. 3b).
5.2 Mapping of Genes and QTLs for Biotic and Abiotic Stress
A quantitative trait locus (QTL) is the genomic region that contributes toward dis-
crete traits, governed by multiple genes. In plant species, QTLs are the major deter-
minants of important agronomic traits and mapping these genomic regions onto the
specific chromosomal locations is vital for their application for crop improvement.
Among the different mapping populations used for mapping QTLs in plants, dou-
bled-haploid populations have their own significance. Since the effects of QTLs are
small and are greatly influenced by environmental factors, this necessitates accurate
phenotyping with replicated trials under different environmental conditions.
Therefore, DH populations are among the few mapping populations with true breed-
ing nature that can facilitate effective mapping of QTLs in plants. In addition,
DH-mapping populations are developed in a short time, in one generation, as com-
pared with other nonsegregating, true-breeding populations such as near-isogenic
lines (NILs) and recombinant inbred lines (RILs). Therefore, DH populations are an
effective and efficient source for mapping of genes and QTLs (Forster and Thomas
2003; Forster et al. 2007). Subsequently, DH breeding through androgenesis has

emerged as a potent tool and a suitable alternative to other techniques for crop
improvement (Purwoko et al. 2010; Germana 2011).
A doubled-haploid population was used to map rice blast resistance genes and
QTLs in a more efficient way (Z Wang et al. 2001). A DH population from a cross
between blast-resistant variety Zhai Ye Qing 8 and susceptible variety Jin Xi17 was
used in combination with cDNA-amplified fragment length polymorphism and
bulked segregant analysis to identify rice blast resistance genes (Zheng et al. 2004).
Subsequently, Fatah et al. (2014) used DH lines developed from IR64 and Azucena
to map QTL regions having major blast resistance genes. A QTL responsible for
rice blast disease resistance was also mapped using a combination of DH mapping
population consisting of 88 lines (DH lines), derived by crossing Joiku No. 462 (a
blast-resistant line) and Jokei06214 (a blast-susceptible line). Besides leaf blast,
three main QTLs for neck blast resistance were identified and mapped onto rice
chromosomes 10 (qNBL-10), 9 (qNBL-9), and 5 (qNBL-5) using a DH population
from a cross between IR64 and Azucena, and the DH lines displayed complete neck
blast resistance under field conditions (Hittalmani et al. 2000).
Similarly, QTLs linked to resistance to another major rice disease, sheath blight,
were identified in a DH population. Kunihiro et al. (2002) employed indica rice line
Zhai Ye Qing 8 (ZYQ8) and japonica rice line Jing Xi 17 (JX17), along with their
DH population, to identify four sheath blight resistance (ShBR) QTLs, qSBR-2,
qSBR-3, qSBR-7, and qSBR-11, and mapped them on chromosomes 2, 3, 7, and 11,
respectively. A DH population derived from japonica rice line Maybelle and indica
rice line Baiyeqiu was also used to map a ShBR QTL using marker-assisted selection
(MAS) (Xu et al. 2011). Zeng et al. (2015) developed a DH population by crossing
japonica rice line CJ06 and indica line TN1, which underwent field evaluation
under three different environmental conditions. They identified a total of eight
QTLs each for lesion height (LH) and disease rating (DR) under three environments.
Besides for rice diseases, DH lines are used for mapping QTLs for insect resis-
tance. Using DH lines developed by crossing IR64 and Azucena, six QTLs linked
with brown planthopper (BPH) resistance in rice were mapped (Soundararajan et al.
2004). Using the same DH population, Geethanjali et al. (2009) identified QTLs
responsible for white-backed planthopper (WBPH) resistance. Later, a DH popula-
tion obtained from a cross between Cheonhcheong and Nagdong was used to iden-
tify and map QTLs for WBPH resistance. Further, the F1 rice line derived from a
cross between JSNDH13 (BPH-resistant) and CNDH32 (WBPH-resistant) was
used to develop a DH line having resistance to both insect pests (Yi et al. 2015).
Efforts are also made to map QTLs contributing to viral disease resistance in
rice. Among two DH populations derived from crosses between IR64 and Azucena,
and IRAT177 and Apura, the DH population derived from the former cross could
map a QTL responsible for rice yellow mottle virus resistance to chromosome 12 of
the rice genome (Ghesquière et al. 1997).
Further, anther culture was used to develop a mapping population from Savitri (a
high-yielding indica rice variety) × Pokkali (a salt-tolerant indica rice genotype) for
the identification of salt tolerance QTLs/genes. A systematic study with 117 DHs
LOC_Os01g09550
RM283
LOC_Os01g09560
(4.88 Mb) RM247 LOC_Os12g06560
(3.18 Mb) LOC_Os12g06570
RM324 LOC_Os02g19490
(11.38 Mb)
Ch # 1 Ch # 2 Ch # 12
Fig. 4 Identified four candidate genes for salinity tolerance at germination stage using a doubled-
haploid mapping population (Savitri × Pokkali)
derived from F1s of Savitri and Pokkali (developed at ICAR-NRRI, Cuttack) was
able to identify four candidate genes, LOC_Os01g09550 (no apical meristem
protein), LOC_Os01g09560 (mitochondrial processing peptidase subunit alpha),
LOC_Os12g06560 (putative protein), and LOC_Os12g06570 (cyclic nucleotide-
gated ion channel), for salinity tolerance at germination stage (Fig. 4).
5.3 Development of Improved Lines and Rice Cultivars
Anther culture technology is able to fix all segregating loci (100%) in one genera-
tion (Purwoko et al. 2010) rather than eight to ten inbreeding generations with the
conventional approach. Furthermore, it is able to maintain maximum genetic
variance and heritability (Prigge et al. 2012), thus providing an opportunity to select
transgressive segregants/superior genotypes at a very early stage. Anther culture
provides high reproducibility for early-selection results, which is efficient in trait
improvement strategies with simplified steps (Dicu and Cristea 2016). Hence, it is
found to be an economically viable option for accelerating breeding with more
selection accuracy and breeding value (Rober et al. 2005).
Given the scenario of dynamic demographics and diversified quality preferences,
breeding varieties combined for higher yield, more enhanced quality traits, and
wider acceptability are major concerns. Grain quality in rice hybrids is found to be
a major limitation in hybridization of rice area in India (Babu et al. 2013). Using
genetically diverse parental lines with similar quality parameters are found to be a
workable strategy to address quality concerns in hybrids. The DH approach in turn
is a probable means of helping to overcome quality problems in hybrids as it is quite
efficient in developing transgressive segregants with superior quality that might be
useful as parents for hybrid rice research and for cultivar release. Several varieties
and improved parental lines have been developed and exploited for cultivar
development, mostly with a japonica genetic background (Grewal et al. 2011). This
technology is observed to be useful in creating immortalized genetic units from
genetic resources to make them amenable to crop improvement. The libraries of DH
lines help in making genetic resources accessible to crop improvement by linking
molecular inventories of gene banks with meaningful phenotypes. Thus, a decrease
in the breeding cycle per se in varietal development has substantial economic impact
on rice breeding by saving developmental costs and maximizing genetic gain in a
short span of time in a more precise way.
Doubled haploids have been released for commercialization in several crops,
including rice. In addition, DHs are used as parents in developing rice hybrids
(Mishra and Rao 2016). In rice, more than 100 rice breeding lines or varieties have
been developed and released in China, India, Japan, South Korea, Hungary, and the
United States (Siddique 2015).
Rice varieties such as Huayu I, Huayu II, Xin Xiu, Late Keng 959, Tunghua 1,
Tunghua 2, Tunghua 3, Zhonghua 8, Zhonghua 9, Huahanzao, Huajian 7902,
Tanghuo 2, Shanhua 7706, and Huahanzao 77001 are high-yielding varieties with
superior grain quality and resistance to blast and bacterial blight diseases (Zhang
1989; Hu and Zeng 1984; Chen et al. 1986). Nanhua 5, Noll, Hua 03, and Guan 18
have early maturity, good quality, and disease resistance (Zhu and Pan 1990). Huayu
15 is resistant to lodging and diseases and has good quality (Shouyi and Shouyin
1991). Milyang 90 has good-grain quality and is resistant to brown planthopper and
stripe virus disease (Chung 1987). Hwacheongbyeo, Joryeongbyeo, and Hwajinbyeo
are resistant to BPH, rice stripe tenui-virus, blast, and bacterial blight (Lee et al.
1988). Bicoll (IR51500AC11-1) has salt tolerance (Senadhira et al. 2002) in China,
South Korea, and the Philippines. Salinity-tolerant DH line AC-1 was developed at
IRRI, Philippines, and is commercialized for salinity-prone areas of Bangladesh
(Thomson et al. 2010). Table 1 lists the commercialized DH rice varieties.
In India, the National Rice Research Institute (NRRI), Cuttack, began DH work
during 1997 to overcome the constraints associated with indica rice hybrids, that is,
expensive seed, which led to preventing marginal farmers from using the seed over
the years, and unpredictable environmental conditions. NRRI released two DH vari-
eties, Satyakrishna (CR Dhan 10) in 2008 and Phalguni (CR Dhan 801) in 2010. In
addition, rice variety Parag 401 (Patil et al. 1997) was also bred through DH
breeding.
5.4 Biofortification of Rice for Essential Traits
Being a premier food crop, rice serves as the major source of energy, protein,
thiamine, riboflavin, niacin, and micronutrients (Fe, Zn, Ca) in the diet (Juliano
1997). However, owing to deficiency for essential micronutrients (“hidden hun-
ger”), it is unable to address the nutritional food security of the country. Among
Table 1 Rice doubled haploids commercialized in different countries

Country Name of DH Important features
India Satyakrishna (CR Dhan 10) High yield, higher
Phalguni (CR Dhan 801) quality
China Huayu I, Huayu II, Xin Xiu, Late Keng 959, Tunghua 1, High yield, superior
Tunghua 2, Tunghua 3, Zhonghua 8, Zhonghua 9, grain quality, resistance
Huahanzao, Huajian 7902, Tanghuo 2, Shanhua 7706, to blast and bacterial
Huahanzao 77001, Tanfeng 1, Huayu III, Ta Be 78, blight diseases
Guan 18
South Nanhua 5, Noll, Hua 03, Guan 18 Early maturity, good
Korea quality, and disease
resistance
Philippines AC-1 Salinity tolerance
Japan Joiku N. 394, Hirohikari, Hirohonami AC No. 1, High yield, quality type,
Kibinohana cold resistance
Argentina Patei and Moccoi High yield
Hungary Dama High yield
the micronutrient malnutrition conditions, Fe and Zn deficiencies are of major

concern not only because of their serious health consequences but also of the
number of people affected worldwide. Hence, enriching rice grain with iron and
zinc is likely to have tremendous health benefits for the rice-eating population.
In addition, the presence of a substantial amount of phytate (0.06–2.22%) in
rice, which inhibits the absorption of Fe and Zn, needs to be lowered (Liang
et al. 2007). Hence, biofortification of rice varieties with enhanced content of
protein, iron, and zinc and lower phytate would be an ideal goal. Biofortification
is a promising food-based approach for helping to overcome micronutrient mal-
nutrition. Significant efforts have been made over the past decade to biofortify
the major cereals targeted to different parts of the world and a lot of progress has
already been achieved in this endeavor. There are two distinct ways in which the
nutritional value of cereals can be enhanced. The first is by using the genetic
variation available through breeding or genetic engineering. Another promising
approach is the doubled-haploid method, in which fixed genetic materials can be
developed faster relative to other mapping populations and can be evaluated
across years and locations readily. This method has less-genetic background
noise than in traditional breeding methods, which makes it an important genetic
resource for mapping QTLs/genes for various traits related to biofortification.
Several reports have shown the utility of DH populations in identifying QTLs
for the concentration of micronutrients in rice grain. Recently, two DH popula-
tions developed by IRRI were evaluated to map the QTLs related to agronomic
traits and grain micronutrients (Swamy et al. 2018). Considerable genetic varia-
tion has been observed for all traits in these DH populations. These kinds of DH
lines can be used as donors in breeding programs or can be directly tested in
multilocation trials to further evaluate their performance.
5.5 Exchange of Cytoplasmic and Nuclear Genomes
In Arabidopsis, both maternal and paternal haploids containing wild-type chromo-

somes and maternal cytoplasm can be generated using CENH3-mediated haploid
inducers as the male or female parent. Ravi et al. (2010) developed a CENH3-1
GFP-tailswap haploid inducer with Ler cytoplasm: Ler-cytoplasmic haploid inducer
(HI). When pollinating Ler-cytoplasmic HI with pollen from a wild type with Col-0
cytoplasm or Col-0 WT, haploids with Col-0 WT chromosomes and Ler cytoplasm
are generated. This method can be used to develop any combination of cytoplasmic
and nuclear genomes by transferring the male nuclear genome into a heterologous
cytoplasm rapidly and conveniently. This facilitates the production of new cytoplas-
mic male sterile (CMS) lines for F1 hybrid seed production. If the haploid inducer
line has a CMS background, pollinating this HI line with different inbred lines gen-
erates paternal haploids, which carry CMS. One or a few paternal haploids need to
be pollinated with pollen from the maternal inbred to produce a new diploid CMS
line. Using paternal haploids for cytoplasmic conversions have three distinct advan-
tages: (1) only two generations are needed, (2) the new CMS line has 100% of the
genomes of either of the inbred lines, and (3) chromosome doubling is not required
(Weber 2014). This method has been employed in maize using the ig1 system for
quite a while (Evans 2007). Most recently, knocking out the MATL ortholog in rice
resulted in haploid induction at a rate of 2–6%, suggesting the functional conserva-
tion of MATL, and this represents an advance for rice breeding (Yao et al. 2018).
5.6 Reverse Breeding
Hybrid seed is traditionally produced from a cross between two inbred lines. Dirks
et al. (2009) proposed a novel plant breeding technology, reverse breeding, which
can directly generate parental inbred lines from any hybrid. Three steps are required
for reverse breeding: (1) inhibition of meiotic crossover in F1 plants to produce
gametes containing combinations of nonrecombinant parental chromosomes, (2)
generation of DH lines via in vitro unfertilized ovule or anther culture, and (3)
regeneration of the original hybrid through crossing DH lines with complementary
sets of parental chromosomes.
5.7 Gene Stacking from Biparental Crosses
Introgression of one or a limited number of genes into elite inbreds by marker-

assisted backcrossing is routine in plant breeding (Lübberstedt and Frei 2012). At
the end of backcross programs, a heterozygous plant is selfed to produce a fixed
line. For single-gene introgression, the expected probability of individuals with the
desired homozygous genotype is 1/4. The frequency of expected genotypes

decreases exponentially following the formula ¼(n), where n is the number of
independently segregating genes (Lübberstedt and Frei 2012; Ravi et al. 2010; Shen
et al. 2015). In contrast, haploid target genotypes are generated with a frequency of
½(n). For example, for five loci, the frequency of the desired homozygous genotype
is 1/1024 in selfed diploid progenies and 1/32 in haploid progenies. The application
of doubled haploids thus significantly decreases the population size required to find
desirable genotypes.
5.8 Accelerating Plant Breeding by MAS and GS
The availability of cheap and abundant molecular markers allows breeders to apply
marker-assisted selection (MAS) and genomic selection (GS) in crop improvement.
MAS depends on the identification of markers significantly associated with a trait.
MAS allows breeders to discard a large number of plants with undesired gene
combinations, pyramid beneficial genes in subsequent generations, minimize field
testing, and decrease the number of generations (Collard and Mackill 2008; Dwivedi
et al. 2015). The combination of MAS and DHs offers new opportunities for
increasing genetic gain and shortens the time required for cultivar breeding. MAS
and DHs have been successfully used to accelerate resistance breeding in cereal
crops (Wessels and Botes 2014), which demonstrates the integration of MAS and
DH technology to increase the speed of cultivar development vis-à-vis conventional
breeding processes.
5.9 Transgenic Research
In general, the DH technique offers a rapid homozygous state attainment of heter-

ologous loci. This principle can be used in transgenic research for developing
homozygous plants within one generation. The selfing of transgenic plants after
regeneration is usually the methodology followed to obtain homozygous plants for
the transgenic loci. However, this requires two generations of selfing from positive-
transformed plants for phenotypic validation. In contrast, anther culture of positive-
transformed plants in T1 will result in homozygous conditions with one generation
of selfing. Figure 5 gives a schematic representation of the segregation of the
transgenic loci. Anther culture was successfully used for developing homozygous
transgenic rice with the chitinase gene for enhanced sheath blight resistance
(Baisakh et al. 2001). Further employment of anther culture could generate DHs
from transgenics-containing genes involved in β-carotene metabolism (Datta
et al. 2014).
Transgenic loci segregation Transgenic loci segregation

through selfing through doubled haploid
Transformation positive Transformation positive
callus in selection medium callus in selection medium
Regeneration (A/-) Regeneration (A/-)

T1 Anther culture +
Selfing Anther
culture spraying with
herbicide
A/-
AA : -/- AA
Selfing 1 : 1
AA : A/- : -/- Phenotypic validation

1 : 2 : 1 T2
Phenotypic validation
Fig. 5 Segregation of transgenic loci in selfed plants and anther culture plants
6 Knowledge Gaps
The recalcitrant nature of indica rice requires optimization of the anther culture
method, which is essential to achieve the potential yield of androgenesis technology
in indica rice lines. In spite of attempts made by Rout et al. (2016) and Naik et al.
(2017) with these concerns, additional novel attempts for media manipulation have
to be made to increase callusing potential or somatic embryogenesis. In addition,
the identification of genomic regions that contribute to promising yield in rice from
heterotic F1 hybrids has to be addressed by analyzing the genetic structure of DHs.
Recent studies with Arabidopsis and maize (D Wang et al. 2015) suggest that
heterosis could be fixed by carefully combining genomic regions from the parents
that contribute to higher performance.
7 The Way Forward
Given the importance of DHs in the quick fixation of segregating loci and varietal
development, we need to develop novel media composition to increase the callusing
potential of anthers from indica rice. Simultaneously, we need to focus on direct
somatic embryogenesis from microspores as this method is considered cost-effective
among all the pathways in tissue culture. Moreover, the mechanism of spontaneous
chromosome doubling in androgenesis requires immediate attention. Conceptual
understanding of the superior yield of DHs is still not clear. Thus, the scientific basis
of superior yield of DHs needs to be comprehensively studied through the genera-
tion of a large number of DHs (~200 DHs from each hybrid).
Acknowledgments The authors acknowledge the director general of ICAR for continuous
guidance and support for the research on doubled haploids at NRRI, Cuttack. We also greatly
acknowledge the director of NRRI for his kind support and approval for bringing out a chapter on
doubled haploids.
References
Asaduzzaman M, Bari MA, Rahman MH, Khatun N, Islam MA, Rahman M (2003) In vitro plant
regeneration through anther culture of five rice varieties. J Biol Sci 3(2):167–171
Babu VR, Shreya K, Dangi KS, Usharani G, Nagesh P (2013) Evaluation of popular rice (Oryza
sativa L.) hybrids for quantitative, qualitative and nutritional aspects. Int J Sci Res Publ 3(1):1
Baisakh N, Datta K, Oliva N, Ona I, Rao GJN, Mew TW, Datta SK (2001) Rapid development of
homozygous transgenic rice using anther culture-harboring rice chitinase gene for enhanced
sheath blight resistance. Plant Biotechnol 18(2):101–108
Ball ST, Zhou H, Konzak CF (1993) Influence of 2,4-D, IAA, and duration of callus induction in
anther cultures of spring wheat. Plant Sci 90(2):195–200
Bjørnstad A, Opsahl-Ferstad HG, Aasmo M (1989) Effects of donor plant environment and light
during incubation of anther cultures of some spring wheat (Triticum aestivum L.) cultivars.
Plant Cell Tissue Organ Cult 17:27–37
Blakeslee AF, Belling J, Farnham ME, Bergner AD (1922) A haploid mutant in the jimson weed,
“Daturastramonium”. Science 55(1433):646–647
Chalyk ST (1994) Properties of maternal haploid maize plants and potential application to maize
breeding. Euphytica 79:13–18
Chen JJ, Hus YJ, Tsay HS (1986) Effect of iron on rice anther culture. J Agric Res China
35(3):244–252
Chung GS (1987) Application of anther culture technique for rice (Oryza sativa L.) improve-
ment. In: Korea-China Plant Tissue Culture Symposium. Academia Sinica Publishers, Beijing,
pp 36–56
in the twenty-first century. Philos Trans R Soc Lond Biol 363:557–572
Cousin A, Heel K, Cowling WA, Nelson MN (2009) An efficient high-throughput flow cytometric
method for estimating DNA ploidy level in plants. Cytom Part A 75(12):1015–1019
d’Amato F (1989) Polyploidy in cell differentiation. Caryologia 42:183–211
Datta K, Sahoo G, Krishnan S, Ganguly M, Datta SK (2014) Genetic stability developed for
β-carotene synthesis in BR29 rice line using dihaploid homozygosity. PLoS One 9(6):e100212
Devaux P, Pickering R (2005) Haploids in the improvement of Poaceae. In: Palmer CE, Keller WA,
Kasha KJ (eds) Haploids in crop improvement II. Biotechnology in agriculture and forestry, vol
56. Springer, Berlin; New York, NY, pp 215–242
Dicu G, Cristea S (2016) The efficiency use of doubled-haploid technology in maize breeding:
obtaining DH parent lines and hybrids. Sci Pap Ser A Agron 59:273–278
Dirks R, Van Dun K, De Snoo CB, Van Den Berg M, Lelivelt CL, Voermans W, Woudenberg L,
De Wit JP, Reinink K, Schut JW, Van Der Zeeuw E (2009) Reverse breeding: a novel breeding
approach based on engineered meiosis. Plant Biotechnol J 7(9):837–845
Dunwell JM (2010) Haploids in flowering plants: origins and exploitation. Plant Biotechnol J
8:377–424
Dwivedi SL, Britt AB, Tripathi L, Sharma S, Upadhyaya HD, Ortiz R (2015) Haploids: constraints
and opportunities in plant breeding. Biotechnol Adv 33:812–829
Evans MM (2007) The indeterminate gametophyte 1 gene of maize encodes a LOB domain protein
required for embryo sac and leaf development. Plant Cell 19(1):46–62
Fatah T, Rafii MY, Rahim HA, Meon S, Azhar M, Latif MA (2014) Cloning and analysis of QTL
linked to blast disease resistance in Malaysian rice variety PongsuSeribu 2. Int J Agric Biol
16:395–400
Forster BP, Thomas WTB (2003) Doubled haploids in genetic mapping and genomics. In: Doubled
haploid production in crop plants. Springer, Dordrecht, pp 367–390
Forster BP, Heberle-Bors E, Kasha KJ, Touraev A (2007) The resurgence of haploids in higher
plants. Trends Plant Sci 12(8):368–375
Geethanjali S, Kadirvel P, Gunathilagaraj K, Maheswaran M (2009) Detection of quantitative trait
loci (QTL) associated with resistance to white-backed planthopper (Sogatella furcifera) in rice
(Oryza sativa). Plant Breed 128:130–136
Germana MA (2011) Anther culture for haploid and doubled haploid production. Plant Cell Tissue
Organ Cult 104(3):283–300
Ghesquière A, Albar L, Lorieux M, Ahmadi N, Fargette D, Huang N, McCouch SR, Nottéghem JL
(1997) A major quantitative trait locus for rice yellow mottle virus resistance maps to a cluster
of blast resistance genes on chromosome 12. Phytopathology 87(12):1243–1249
Grewal D, Gill R, Gosal SS (2006) Role of cysteine in enhancing androgenesis and regeneration
of indica rice (Oryza sativa L.). Plant Growth Regul 49(1):43–47
Grewal RK, Lulsdorf M, Croser J, Ochatt S, Vandenberg A, Warkenti TD (2009) Doubled hap-
loid production in chickpea (Cicer arietinum L.): role of stress treatments. Plant Cell Rep
28:1289–1299
Grewal D, Manito C, Bartolome V (2011) Doubled haploids generated through anther culture
from crosses of elite indica and japonica cultivars and/or lines of rice: large-scale production,
agronomic performance, and molecular characterization. Crop Sci 51(6):2544–2553. https://
doi.org/10.2135/cropsci2011.04.0236
Grimes HD, Hodges TK (1990) The inorganic NO3–: NH4+ ratio influences plant regeneration and
auxin sensitivity in primary callus derived from immature embryos of indica rice (Oryza sativa
L.). J Plant Physiol 136:362–367
Guha S, Maheshwari SC (1964) In vitro production of embryos from anthers of Datura. Nature
204(4957):497
Guha S, Maheshwari SC (1966) Cell division and differentiation of embryos in the pollen grains
of Datura in vitro. Nature 212:97–98
Häntzschel KR, Weber G (2010) Blockage of mitosis in maize root tips using colchicine-
alternatives. Protoplasma 241(1–4):99–104
Herath HMI, Bandara DC, Samarajeewa PK (2007) Effect of culture media for anther culture of
indica rice varieties and hybrids of Indica and Japonica. Trop Agric Res Ext 10:17–22. https://
doi.org/10.4038/tare.v10i0.1866
Hittalmani S, Parco A, Mew TV, Zeigler RS, Huang N (2000) Fine-mapping and DNA marker-
assisted pyramiding of the three major genes for blast resistance in rice. Theor Appl Genet
100(7):1121–1128
Hu H, Zeng JZ (1984) Development of new varieties via anther culture. In: Ammirato PV, Evans
DA, Sharp WR et al (eds) Handbook of plant cell culture, vol 3. Macmillan, New York, NY,
pp 65–90
Ivanova M, Van Staden J (2009) Nitrogen source, concentration, and NH4+:NO3– ratio influence
shoot regeneration and hyperhydricity in tissue-cultured Aloe polyphylla. Plant Cell Tissue
Organ Cult 99(2):167–174
Jacquard C, Asakaviciute R, Hamalian AM, Sangwan RS, Devaux P, Clement C (2006) Barley
anther culture: effects of annual cycle and spike position on microspore embryogenesis and
albinism. Plant Cell Rep 25:375–381
Juliano BO (1997) Rice products in Asia. FAO-RAP publication No. 38. FAO, Rome
Kleiber D, Prigge V, Melchinger AE, Burkard F, San Vicente F, Palomino G, Gordillo GA (2012)
Haploid fertility in temperate and tropical maize germplasm. Crop Sci 52:623–630
Kunihiro Y, Qian Q, Sato H, Teng S, Zeng DL, Fujimoto K, Zhu LH (2002) QTL analysis of sheath
blight resistance in rice (Oryza sativa L.). Chin J Genet 29:50–55
Lee SY, Lee YT, Lee MS (1988) Studies on the anther culture of Oryza sativa L. 3. Growing envi-
ronment of donor plant in anther culture, effects of photoperiod and light intensity. Res Rep
Rural Dev Adm Biotechnol 30:7–12
Liang J, Han B-Z, Han L, Robert Nout MJ, Hamer RJ (2007) Iron, zinc and phytic acid content of
selected rice varieties from China. J Sci Food Agric 87:504–510
Lübberstedt T, Frei UK (2012) Application of doubled haploids for target gene fixation in back-
cross programmes of maize. Plant Breed 131(3):449–452
Melchinger AE, Molenaar WS, Mirdita V, Schipprack W (2016) Colchicine alternatives for chro-
mosome doubling in maize haploids for doubled-haploid production. Crop Sci 56:559–569
Min ZY, Li H, Zou T, Tong L, Cheng J, Sun XW (2016) Studies of in vitro culture and plant regen-
eration of unfertilized ovary of pumpkin. Chin Bull Bot 51(1):74–80
Mishra R, Rao GJN (2016) In-vitro androgenesis in rice: advantages, constraints and future pros-
pects. Rice Sci 23:57–68
Mishra R, Rao GJN, Rao RN (2013) Effect of cold pretreatment and phytohormones on anther
culture efficiency of two indica rice (Oryza sativa L.) hybrids, Ajay and Rajalaxmi. J Exp Biol
Agric Sci 1(2):69–76
Mishra R, Rao GJN, Rao RN, Kaushal P (2015) Development and characterization of elite-dou-
bled haploid lines from two indica rice hybrids. Rice Sci 22(6):290–299
Murovec J, Bohanec B (2012) Haploids and doubled haploids in plant breeding. In: Abdurakhmonov
I (ed) Plant breeding. InTech, Rijeka, pp 87–106
Naik N, Rout P, Umakanta N, Verma RL, Katara JL, Sahoo KK et al (2017) Development of
doubled haploids from an elite indica rice hybrid (BS6444G) using anther culture. Plant Cell
Tissue Organ Cult 128(3):679–689
Niizeki H, Oono K (1968) Induction of haploid rice plant from anther culture. Proc Jpn Acad
44(6):554–557
Nurhasanah, Pratama AN, Sunaryo W (2016) Anther culture of local upland rice varieties from
East Kalimantan: effect of panicle cold pre-treatment and putrescine-enriched medium.
Biodiversitas 17(1):148–153
Ochatt SJ (2008) Flow cytometry in plant breeding. Cytom Part A 73(7):581–598
Ochatt S, Pech C, Grewal R, Conreux C, Lulsdorf M, Jacas L (2009) Abiotic stress enhances
androgenesis from isolated microspores of some legume species (Fabaceae). J Plant Physiol
166:1314–1328
Patil VD, Nerkar YS, Misal MB, Harkal SR (1997) Parag 401, a semidwarf rice variety developed
through anther culture. Int Rice Res Notes 22(2):19
Prasanna BM, Chaikam V, Mahuku G (2012) Doubled haploid technology in maize breeding:
theory and practice. International Maize and Wheat Improvement Center (CIMMYT), Mexico
Prigge V, Xu XW, Li L, Babu R, Chen SJ, Atlin GN, Melchinger AE (2012) New insights into the
genetics of in vivo induction of maternal haploids, the backbone of doubled haploid technology
in maize. Genetics 111:781–793
Purwoko BS, Dewi IS, Khumaida K (2010) Rice anther culture to obtain doubled-haploids with
multiple tolerances. Asia Pac J Mol Biol Biotechnol 18(1):55–57
Ravi M, Kwong PN, Menorca RM, Valencia JT, Ramahi JS, Stewart JL, Tran RK et al (2010)
The rapidly evolving centromere-specific histone has stringent functional requirements in
Arabidopsis thaliana. Genetics 186:461–471
Rober FK, Gordillo GA, Geiger HH (2005) In vivo haploid induction in maize: performance of new
inducers and significance of doubled haploid lines in hybrid breeding. Maydica 50:275–283
Rout P, Naik N, Ngangkham U, Verma RL, Katara JL, Singh ON, Samantaray S (2016) Doubled
haploids generated through anther culture from an elite long-duration rice hybrid, CRHR32:
method optimization and molecular characterization. Plant Biotechnol 33(3):177–186
Sahoo SA, Jha Z, Verulkar SB, Srivastava AK, Suprasanna P (2019) High-throughput cell analysis
based protocol for ploidy determination in anther-derived rice callus. Plant Cell Tissue Organ
Cult 137(1):187–192
Seguí-Simarro JM, Nuez F (2008) How microspores transform into haploid embryos: changes
associated with embryogenesis induction and microspore-derived embryogenesis. Physiol
Plant 134:1–12
Senadhira D, Zapata-Arias FJ, Gregorio GB, Alejar MS, De La Cruz HC, Padolina TF, Galvez AM
(2002) Development of the first salt-tolerant rice cultivar through indica/indica anther culture.
Field Crop Res 76:103–110
Shen Y, Pan G, Lubberstedt T (2015) Haploid strategies for functional validation of plant genes.
Trends Biotechnol 33:611–620
Shouyi L, Shouyin H (1991) Huayu 15, a high-yielding rice variety bred by anther culture. In:
Bajaj YPS (ed) Biotechnology in agriculture and forestry, Volume 14: rice. Springer, Berlin;
New York, NY, pp 230–247
Siddique R (2015) Impact of different media and genotypes in improving anther culture response
in rice (Oryza sativa) in Bangladesh. Eur Sci J 11(6)
Soundararajan RP, Kadirvel P, Gunathilagaraj K, Maheswaran M (2004) Mapping of quantitative
trait loci associated with resistance to brown plant hopper in rice by means of a doubled haploid
population. Crop Sci 44:2214–2220
Swamy BM, Descalsota GIL, Nha CT, Amparado A, Inabangan-Asilo MA, Manito C et al (2018)
Identification of genomic regions associated with agronomic and biofortification traits in DH
populations of rice. PLoS One 13(8):e0201756
Talebi R, Rahemi MR, Arefi H, Nourozi M, Bagheri N (2007) In vitro plant regeneration
through anther culture of some Iranian local rice (Oryza sativa L.) cultivars. Pak J Biol Sci
10(12):2056–2060
Thomson MJ, de Ocampo M, Egdane J, Rahman MA, Sajise AG, Adorada DL, Tumimbang-Raiz
E, Blumwald E, Seraj ZI, Singh K, Gregorio GB, Ismail AM (2010) Characterizing the Saltol
quantitative trait locus for salinity tolerance in rice. Rice 3(2):148–160
Trejo-Tapia G, Amaya UM, Morales GS, Sanchez ADJ, Bonfil BM, Rodriguez-Monroy M, Jimenez-
Aparicio A (2002) The effects of cold-pretreatment, auxins and carbon source on anther culture
of rice. Plant Cell Tissue Organ Cult 71:41–46. https://doi.org/10.1023/A:1016558025840
Veeraraghavan R (2007) A study on the comparison of anther culture response in different variet-
ies of rice (Oryza sativa L.) subspecies indica. University of Colombo, Colombo. PMCid:
PMC1891355
Wan Y, Duncan DR, Rayburn AL, Petolino JF, Widholm JM (1991) The use of antimicrotubule
herbicides for the production of doubled haploid plants from anther-derived maize callus.
Wang Z, Taramino G, Yang D, Liu G, Tingey SV, Miao GH, Wang GL (2001) Rice ESTs with
disease-resistance gene- or defense-response gene-like sequences mapped to regions contain-
ing major resistance genes or QTLs. Mol Gen Genomics 265(2):302–310
Wang D, Yu C, Zuo T, Zhang J, Weber DF, Peterson T (2015) Alternative transposition generates
new chimeric genes and segmental duplications at the maize p1 locus. Genetics 201:925–935
Wang X, Cheng ZM, Zhi S, Xu F (2016) Breeding triploid plants: a review. Czech J Genet Plant
Breed 52(2):41–54
Weber DF (2014) Today’s use of haploids in corn plant breeding. Adv Agron 123:123–144
Wessels E, Botes WC (2014) Accelerating resistance breeding in wheat by integrating marker-
assisted selection and doubled haploid technology. S Afr J Plant Soil 31:35–43
Xu Q, Yuan XP, Yu HY, Wang YP, Tang SX, Wei XH (2011) Mapping quantitative trait loci for
sheath blight resistance in rice using double haploid population. Plant Breed 130(3):404–406
Yamagishi M (2002) Heterogeneous plastid genomes in anther culture-derived albino rice plants.
Euphytica 123(1):67–74
Yao L, Zhang Y, Liu C, Liu Y, Wang Y, Liang D, Liu J, Sahoo G, Kelliher T (2018) OsMATL muta-
tion induces haploid seed formation in indica rice. Nat Plants 4:530–533
Yi S, Wu G, Lin Y, Hu N, Liu Z (2015) Characterization of a new type of glyphosate-tolerant

5-enolpyruvyl shikimate-3-phosphate synthase from Isoptericolava riabilis. J Mol Catal B
Enzym 111:1–8. https://doi.org/10.1016/j.molcatb.2014.11.009
Zeng YX, Xia LZ, Wen ZH, Ji ZJ, Zeng DL, Qian Q, Yang CD (2015) Mapping-resistant QTLs
for rice sheath blight disease with a doubled haploid population. J Integr Agric 14(5):801–810
Zhang ZH (1989) The practicability of anther culture breeding in rice. In: Advances in plant bio-
technology. CIMMYT, IRRI, Mexico, Los Baños, pp 36–37
Zhang LN, Chu QR (1984) Characteristic and chromosomal variation of somaclones and its prog-
eny in rice (Oryza sativa L.). Sci Agric Sin (China) (4):14
Zheng X, Chen X, Zhang X, Lin Z, Shang J, Xu J, Zhai W, Zhu L (2004) Isolation and identifica-
tion of a gene in response to rice blast disease in rice. Plant Mol Biol 54(1):99–109
Zhu DY, Pan XG (1990) Rice (Oryza sativa L.): guan 18: an improved variety through anther
culture. In: Bajaj YPS (ed) Biotechnology in agriculture and forestry 12: rice. Springer, Berlin,
pp 204–211
Zonneveld BJM, Van Iren F (2001) Genome size and pollen viability as taxonomic criteria, appli-
cation to the genus Hosta. Plant Biol 3:176–185
Zinc-Biofortified Rice: A Sustainable Food-
Based Product for Fighting Zinc
Malnutrition
Mark Ian C. Calayugan, B. P. Mallikarjuna Swamy, Chau Thanh Nha,

Alvin D. Palanog, Partha S. Biswas, Gwen Iris Descalsota-Empleo,
Yin Myat Myat Min, and Mary Ann Inabangan-Asilo
Abstract The lack of dietary diversity among poor communities has led to nutri-
tional consequences, particularly zinc deficiency. An adequate intake of mineral-
and vitamin-rich food is necessary for achieving and maintaining good health. Zinc
is one of the micronutrients considered essential to improve human health and
decrease the risk of malnutrition. Biofortification of rice through breeding is a cost-
effective and sustainable strategy to solve micronutrient malnutrition. The
Biofortification Priority Index prepared by HarvestPlus clearly identified several
countries in Asia with an immediate need for Zn biofortification. The International
Rice Research Institute (IRRI) and its national partners in target countries are mak-
ing efforts to develop Zn-biofortified rice varieties. The first set of high-Zn rice
varieties has been released for commercial cultivation in Bangladesh, India, the
Philippines, and Indonesia. Efforts have begun to mainstream grain Zn to ensure
that the Zn trait becomes an integral part of future varieties. Huge scope exists to
M. I. C. Calayugan
International Rice Research Institute, Metro Manila, Philippines
University of the Philippines, Los Baňos, Laguna, Philippines
B. P. M. Swamy (*) · M. A. Inabangan-Asilo
C. T. Nha
Cuu Long Delta Rice Research Institute, Cần Thơ, Vietnam
A. D. Palanog
Philippine Rice Research Institute, Negros Occidental, Philippines
P. S. Biswas
Bangladesh Rice Research Institute, Gazipur, Bangladesh
G. I. Descalsota-Empleo
University of Southern Mindanao, North Cotabato, Philippines
Y. M. M. Min
Department of Agricultural Research, Yezin, Myanmar

https://doi.org/10.1007/978-3-030-66530-2_13
450 M. I. C. Calayugan et al.
apply advanced genomics technologies such as genomic selection and genome edit-
ing to speed up high-Zn varietal development. An efficient rice value chain for
Zn-biofortified varieties, quality control, and promotion are essential for successful
adoption and consumption. The development of next-generation high-Zn rice vari-
eties with higher grain-Zn content, stacking of multiple nutrients, along with good
grain quality and acceptable agronomic traits has to be fast-tracked. Healthier rice
has a large demand from all stakeholders, so we need to keep up the pace of devel-
oping nutritious rice to meet the demand and to achieve nutritional security.
Keywords Rice · Malnutrition · Biofortification · Zinc · QTL · Gene · Bayesian

analysis
1 Introduction
The human body needs micronutrients for proper growth and development and to
maintain good health (Maret 2017; Palanog et al. 2019). However, deficiencies in
these elements and associated health risks are commonly reported in all age groups,
especially in preschool children, women, and elderly people in the developing world
(Caulfield et al. 2006). An estimated one-third of the global population suffers from
micronutrient malnutrition, mainly because of the large dependence on cereal sta-
ples for daily nutritional needs without access to a diversified diet and supplementa-
tion (Ritchie et al. 2018). The urgent need to address micronutrient malnutrition has
been widely recognized globally; hence, decreasing childhood mortality and mater-
nal death by eradicating malnutrition is an important Sustainable Development
Goal (Hanieh et al. 2020).
Among the micronutrients, zinc (Zn) is most essential for vital organs, enzymatic
activity, tissue growth and development, cognitive function, immunity, etc. There is
therefore a need for a regular daily supply of Zn in the required quantity to have
healthy and productive populations (Prasad et al. 2014; Chasapis et al. 2020).
However, an estimated two billion people suffer from Zn deficiency-related health
consequences and most of them are resource-poor urban and rural dwellers (Rampa
et al. 2020). The disability-adjusted life years (DALYs) due to Zn malnutrition
strongly impact annual GDP growth, and hamper economic development in the
developing world (Gödecke et al. 2018). Multiple interventions such as fortification
of foods, micronutrient supplementation, and food diversification have been
employed to mitigate Zn malnutrition; however, recurring costs and poor accessibil-
ity and awareness among the rural masses have resulted in limited success (Bouis
2017). Increasing the mineral density in the edible part of the major staple crops,
which is also popularly called “biofortification,” has been proven to be effective in
alleviating malnutrition without much additional cost. This complementary food-
based approach is the safest and cheapest way to deliver nutrients on a larger scale
to the target populations (Bouis and Saltzman 2017).
Zinc-Biofortified Rice: A Sustainable Food-Based Product for Fighting Zinc Malnutrition 451
Rice is among the target staple food crops for Zn biofortification in different
countries of South Asia, Southeast Asia, and Africa (Siwela et al. 2020). The
Biofortification Priority Index prepared by HarvestPlus clearly identified several
countries in Asia with an immediate need for Zn biofortification (HarvestPlus 2020).
The International Rice Research Institute (IRRI) and its national partners in target
countries are making efforts to develop Zn-biofortified rice varieties. The first set of
high-Zn rice varieties has been released for commercial cultivation in Bangladesh,
India, the Philippines, and Indonesia (Inabangan-Asilo et al. 2019). Efforts are in
place to mainstream the breeding of high-Zn rice by applying advanced breeding
techniques and genomic tools to make sure Zn will be an essential component of all
future varietal releases from the main breeding pipelines of IRRI (CGIAR 2018).
Over the past decade, great progress has been made in our understanding of Zn
homeostasis in rice from a biofortification perspective and in the development of
high-Zn rice. In this chapter, we would like to provide some insights into the recent
advances in developing Zn-biofortified rice for the target countries.
2 Zn Is Critical for Human Health
Zinc plays an important role in the catalytic function of most of the enzymes needed
for the structural stability and functioning of more than 3000 proteins, helps to
maintain membrane stability, and protects tissues and cells from oxidative damage
(Cakmak 2000; Broadley et al. 2007; Andreini et al. 2009; Maret and Li 2009).
Zinc deficiency is one of the major causes of child mortality worldwide (Black et al.
2008), which has been estimated to affect more than 178 countries (WHO 2003).
Zn-deficient children are highly prone to diarrhea, respiratory ailments, poor cognitive
function, and stunting (Brooks et al. 2004; Sazawal et al. 2007; Tielsch et al. 2007;
Young et al. 2014). Zn deficiency during the first 1000 days for children after birth
causes irreversible damage leading to less chance of survival, poor immune system and
cognitive ability, and stunting (UNICEF 2013). Hence, a regular daily supply of Zn is
highly essential, but this is rarely achieved by most resource-poor people. Thus, ade-
quate Zn nutrition is essential for good health, especially for children and pregnant
women for growth and development (IZiNCG 2009). The daily Zn requirement of
individuals varies from 9 to 11 ppm depending on age, gender, and health conditions,
but preschool children and pregnant and lactating women need more Zn (IOM 2001;
Welch and Graham 2004; Iqbal et al. 2020; Alqabbani and AlBadr 2020).
3 Rice Biofortification with High Grain Zn
Rice is the single most important source of energy and nutrition for more than half
of the world’s population (Gross and Zhao 2014). It is a major staple crop in more
than 40 countries and supplies at least 20% of the daily caloric intake of more than
3.5 billion people (FAO 2014). Asia, with 60% of the global population, consumes
more than 90% of the total rice produced annually (Milovanovic and Smutka 2017).
Annual per capita rice consumption exceeds 100 kg in some Asian countries (FAO
2016). However, milled rice is less nutritious; thus, most of the poor people who
largely depend on rice without access to a mineral-rich diverse diet suffer from hid-
den hunger, including Zn deficiency.
Food-based solutions were found to be safe and effective in controlling and pre-
venting micronutrient deficiencies, especially when multiple deficiencies occur
(Torheim et al. 2010; Szymlek-Gay et al. 2009). Several studies reported that the
consumption of a diverse diet and crops enriched with mineral elements provides
more nutrition (Brown et al. 2002; WHO 1998). Recently, biofortification of staple
crops has become a popular method for tackling malnutrition. It is the process of
increasing the density of readily bioavailable mineral elements by breeding or bio-
technological approaches (Garg et al. 2018) for staple food crops such as rice, which
has been obtaining increased attention by breeders and policymakers in recent
times. Biofortification has the lowest per capita costs vis-à-vis other interventions,
and it is especially easily accessible and affordable for rural populations (Ma et al.
2008). Therefore, increasing grain-Zn content would create a significant impact on
human health. One estimate suggested that an additional 8 μg/g of Zn in raw milled
rice over the baseline Zn (16 μg/g) in cultivated varieties could help to reach the
amount equivalent to 30% of the Estimated Average Requirement per day
(HarvestPlus 2012).
4 Trait Development for High Grain Zn
4.1 High-Zn Donor Identification
Rice is endowed with abundant genetic diversity and thereby provides needed
genetic variability for rice breeding programs (Rana and Bhat 2004). More than
230,000 rice accessions are maintained in global gene banks, which include landra-
ces, cultivars, varieties, and aromatic and wild rice (Li et al. 2014). Among the dif-
ferent species or subgroups, wild rice, landraces, and aus accessions were found to
be a rich source of micronutrients; they have several-fold higher nutrients than cul-
tivated rice (Cheng et al. 2005; Banerjee et al. 2010; Descalsota-Empleo et al.
2019a, b). Aus accessions are genetically closer to popularly grown indica rice vari-
eties, so they can be readily used by breeding programs to improve the Zn content
of modern rice varieties. Some aus accessions such as Kaliboro, Jamir, UCP122,
DZ193, and Khao ToT Long 227 have higher content of grain Zn (Norton et al.
2014; Descalsota et al. 2018). We are efficiently using aus germplasm in our breed-
ing programs at IRRI and have also widely shared these donor lines with our part-
ners for use in their breeding programs. The accessions of the 3K Genome Project,
Multi-parent Advanced Generation Inter-Cross (MAGIC)-derived lines and wild
rice introgression lines, were also characterized to identify valuable donors for grain
Zn and used in genetic dissection studies (Bandillo et al. 2013; Swamy et al. 2018a;
Descalsota et al. 2018; Zaw et al. 2019). Moreover, large scope exists for revisiting
gene banks to screen for high grain Zn and other beneficial elements using advanced
high-throughput phenotyping technologies. Similarly, a systematic effort to collect
and characterize heirloom rice for nutritional value in partner countries will help in
breeding for improved nutrition.
4.2 Association Between Yield and Zn
The development of high-yielding Zn-biofortified rice with a combination of desir-

able agronomic traits and tolerance of pests and diseases is a must for their success-
ful adoption and consumption. Both yield and grain Zn are genetically complex
traits and are hugely influenced by external environmental factors (Zaw et al. 2019;
Descalsota-Empleo et al. 2019a). In most cases, a negative association was reported
between grain-Zn content and yield, and in a few specific germplasm accessions
and populations a nonsignificant negative relationship or no relationship was
reported (Gregorio 2002; Norton et al. 2010; Morete et al. 2011; Anandan et al.
2011; Nha 2019). Under different soil Zn conditions and in a set of different aro-
matic accessions and landraces, a positive relationship between grain Zn and yield
was reported (Wissuwa et al. 2008; Gangashetty et al. 2013; Sathisha 2013).
Therefore, for the identification of stable high-Zn donor lines with higher or more
acceptable yield, the use of appropriate breeding methods and selection strategies is
needed to successfully combine yield and grain Zn.
4.3 Molecular Dissection of Grain Zn
4.3.1 QTLs and Meta-QTLs Associated with Grain Zn
Zn uptake, transport, and accumulation in the grain are governed by a complex net-
work of quantitative trait loci (QTLs) and genes. A comprehensive review of QTLs
identified for grain Zn was carried out and detailed discussion presented by Swamy
et al. (2016). Several QTLs with moderate to high phenotypic variance were reported
for grain Zn on all 12 chromosomes of rice. At IRRI, our group has also carried out
several QTL mapping studies using biparental and multiparental populations and
germplasm collections (Table 1). Swamy et al. (2018a) reported eight QTLs for
grain-Zn content. All of these QTLs were distributed across the rice genome, having
the lowest frequency (one QTL) on chromosomes 1, 9, and 11 and the highest fre-
quency (seven QTLs) on chromosome 12. Chromosome 7 had the second highest
number (six) of QTLs. However, the QTLs on chromosomes 7 and 12 were consis-
tent over different backgrounds and environments. The QTLs detected on
Table 1 QTLs identified for grain-Zn content in rice

Additive
PVE effect (mg/
QTL LOD/p value (%) kg) Reference
qZn1.1, qZn2.1, qZn3.1, qZn3.2, qZn5.1, 2.5–12.4 3.0– 0.21–6.60 Swamy et al.
qZn6.1, qZn8.1, qZn8.2, qZn9.1, qZn10.1, 36.0 (2018a)
qZn12.1
qZn2.1, qZn2.2, qZn3.1, qZn6.1, qZn6.2, 4.3–10.3 7.5– 0.9–2.1 Swamy et al.
qZn8.1, qZn11.1, qZn12.1, qZn12.2 22.8 (2018b)
qZn1.1, qZn2.1, qZn4.1, qZn6.1, qZn6.2, 0.001–0.0001 9.2– – Descalsota et al.
qZn7.1, qZn12.1 13.75 (2018)
qZn1.1, qZn6.1, qZn12.1, qZn12.2, qZn12.3 0.0000905– 11.9– – Descalsota-
0.00029 17.9 Empleo et al.
(2019a)
qZn2.1, qZn3.1, qZn5.1, qZn5.2, qZn7.1, 2.77–8.99 8.6– 0.81–2.06 Descalsota-
qZn8.1, Zn9.1, qZn11.1 27.7 Empleo et al.
(2019b)
qZn1.1, qZn6.1, qZn6.2 2.6–3.9 2.9– 0.06–3.2 Dixit et al.
34.2 (2019)
qZn1, qZn5, qZn7 – 17.57– – Zaw et al. (2019)
20.0
qZn1.1, qZn5.1, qZn9.1, qZn12.1 3.14–5.2 8.96– 0.77–0.96 Calayugan et al.
15.26 (2020)
Zn1.1, qZn1.2, qZn1.3, Zn2.1, qZn4.1, 3.28–15.36 12.60– 2.62–4.73 Jeong et al.
qZn5.1, Zn6.1, qZn7.1, qZn9.1, Zn10.1, 46.80 (2020)
qZn11.1, qZn11.2, Zn11.3, qZn12.1
qZn3.1, qZn3.1, qZn4.2 4.11–9.16 9.89– 0.0001–0.1 Lee et al. (2020)
24.56
PVE phenotypic variance explained
chromosome 7 contributed 5.3–35.0% of the phenotypic variance for grain-Zn con-

tent in different backgrounds, while the QTLs on chromosome 12 contributed
9–36% (Swamy et al. 2016, 2018a). In another study, Swamy et al. (2018b) detected
nine QTLs responsible for Zn on chromosomes 2, 3, 6, 8, 11, and 12 through two
doubled-haploid (DH) populations derived from crosses of PSBRc82 × Joryeongbyeo
and PSBRc82 × IR69428. Recently, association mapping experiments using diver-
sity panels for grain Zn led to the identification of seven QTLs on chromosomes 1,
2, 4, 6, 7, and 12 by Descalsota et al. (2018) and three QTLs on chromosomes 1, 5,
and 7 by Zaw et al. (2019). All of these findings show that numerous QTLs for Zn
highlight the genetic complexity of this trait.
Meta-QTL analysis provides consolidated, precise, and smaller confidence inter-
vals for multiple QTLs reported for a trait (Goffinet and Gerber 2000; Arcade et al.
2004; Swamy et al. 2011). Jin et al. (2015) identified 22 meta-QTLs on ten different
chromosomes for grain-Zn content (rMQTLs). Similarly, Raza et al. (2019) carried
out meta-QTL analysis of grain-Zn QTLs reported from 24 mapping populations
and three diverse germplasm sets and identified 46 MQTLs. Seven meta-QTLs
(rMQTL2.1, rMQTL4.4, rMQTL6.4, rMQTL8.2, rMQTL8.3, rMQTL8.4, and rMQTL12.4)
were found to be common between two studies (Jin et al. 2015; Raza et al. 2019). In
another study, 208 QTLs for grain Zn from 26 studies were projected on the consen-
sus map and eventually 45 meta-QTLs were identified (Soe 2020). Overall, the
confidence intervals of all the MQTLs were narrower vis-à-vis the mean values of
the original QTLs. Several consistent QTLs and associated markers were identified,
which are useful for efficient marker-assisted selection (MAS) programs. In addi-
tion, precise meta-QTL regions provide an opportunity to shortlist candidate genes
for further functional validation.
4.3.2 Network of Metal Homeostasis Genes
Mapping of major-effect QTLs/genes for grain Zn and understanding their

molecular basis can fast-track the development of Zn-biofortified rice through
MAS. The genomic regions of important QTLs associated with grain Zn identi-
fied in numerous studies contained multiple hypotheticals and functionally anno-
tated genes that function as metal chelators and ion transporters. A list of
important genes associated with Zn homeostasis in rice is summarized in Swamy
et al. (2016). Rice roots produce chemicals that free up mineral elements from
the soil complex and promote their root uptake from the soil (Widodo et al. 2010;
Nozoye et al. 2011). Several genes/gene families are involved in biosynthesis of
phytosiderophores, mineral uptake, transport, and loading such as OsDMAS,
OsSAMS, OsNAS, OsTOM1, and OsNAAT (Inoue et al. 2003, 2008; Bashir et al.
2006; Johnson et al. 2011). Zinc finger transcription factors such as OsZIP1,
OsZIP3, OsZIP4, OsZIP5, and OsZIP9 are major Zn transporters within the rice
plant (Ramesh et al. 2003; Ishimaru et al. 2005; Lee et al. 2010a, b). In separate
studies conducted using connected populations, ZIP family genes such as OsZIP5
and OsZIP9 were identified along with another 140 candidate genes (Nha 2019).
In a study using DH populations, OsZIP6 was identified as a primary candidate
gene associated with grain Zn (Calayugan et al. 2020). Similarly, OsVIT and
OsYSL family genes are involved in Zn transport across the tonoplast and phloem,
respectively (Sasaki et al. 2011; Kakei et al. 2012; Zhang et al. 2012; Lan
et al. 2013).
The well-characterized Zn metal homeostasis genes can be manipulated
through genetic engineering to improve grain-Zn content in rice (Trijatmiko
et al. 2016). The advanced genome editing techniques using zinc-finger nucle-
ases (ZFNs), transcription activator-like effector nucleases (TALENs), and clus-
tered regularly interspaced short palindromic repeats (CRISPR)/Cas systems can
be used to induce modifications at specific genomic loci (Kim et al. 1996;
Christian et al. 2010; Jinek et al. 2012; Chen and Gao 2013; Gao 2015). The Zn
homeostasis genes can be major target sites for genome editing to improve grain-
Zn content in rice.
4.3.3 Bayesian Network Analysis of Grain Yield and Zn
A Bayesian genomic prediction network (BN) provides valuable information on

interactions between multiple traits and SNP markers and helps to establish rela-
tionships among them. It clearly depicts the strength and direction of associations
among traits and SNP markers. In a way, it helps to validate the QTLs, genes, or trait
associations identified by genome-wide association analysis (Zaw et al. 2019). In a
MAGIC Plus population, a BN was used among Zn- and yield-related traits. The
results clearly showed a complex relationship among traits (Fig. 1). Among the
agronomic traits studied for their relationship with grain Fe and Zn, only panicle
length had a direct effect on Fe and Zn content in rice (Descalsota et al. 2018). Zaw
et al. (2019) conducted BN analysis in a global MAGIC population using 8110 SNP
markers and 16 traits, including grain Zn. At a BN strength of more than 0.5, strong
direct associations were reported among traits such as yield → zinc, zinc → filled
grains, iron → zinc, and iron → grain length. Zn was associated with eight markers
for each of the traits. In general, Fe and Zn content have strong positive correlations,
thus providing huge opportunities to improve both minerals together. It is interest-
ing that in both BN studies there was no direct effect of yield on Zn, indicating that
combining high yield potential and high grain-Zn content is possible in order to
develop successful Zn-biofortified rice varieties. We emphasize that there is a need
to thoroughly dissect the influence of panicle length on grain Zn. It is commonly
observed that increased yield dilutes Zn content, which results in negative correla-
tions between these traits. There is therefore a need to make adjustments for grain-
Zn mapping studies (McDonald et al. 2008).
Fig. 1 Bayesian network analysis of grain Zn and agronomic traits. Note: Zn zinc, Fe iron, HT
plant height, DF days to flowering, NT number of tillers, PT productive tillers, GL grain length,
GW grain width, TGW thousand-grain weight, YLD grain yield
4.4 Multi-Trait Genomic Selection for Zn Biofortification
QTL mapping and GWAS methods are routinely used for molecular dissection of
complex traits; however, they have limited power in detecting minor-effect loci
(Bernardo 2008; Collard and Mackill 2008; Ben-Ari and Lavi 2012). In contrast,
genomic selection (GS) considers genome-wide effects, including both major and
minor loci, and thereby assesses the genomic estimated breeding values (GEBVs)
of breeding lines (Meuwissen et al. 2001). With the recent advances in statistics,
deep machine learning models are helpful in accurately estimating GEBVs and their
cross-validation in training or reference sets (Montesinos-López et al. 2019). Since
GS captures total genetic variance, it addresses the existing limitations of GWAS
and QTL mapping to improve traits (de los Campos et al. 2009). In addition, it
speeds up selection cycles, which enhances annual genetic gain and saves cost sig-
nificantly (Shamshad and Sharma 2018). Therefore, great opportunity exists for
employing GS-related strategies that capture both major- and minor-effect alleles to
increase the genetic gain for grain yield and grain-Zn content in rice.
Selection for higher yield and other desirable agronomic traits along with high
grain-Zn content is an integral part of Zn biofortification; however, both yield and
Zn are genetically complex and difficult to manipulate or simultaneously improve
(Garcia-Oliveira et al. 2018; Zaw et al. 2019). The rate of genetic gain for grain
yield becomes stagnant at ~1% yearly. This is not sufficient to meet future demand
for rice, not to mention the strong impacts of complex genetic architecture and
genotype–environment interactions (Peng et al. 2000, 2004; Wassmann et al. 2009).
The combined genetic gain for yield and Zn will be relatively inferior when com-
pared with that for individual traits. Therefore, implementing multi-trait-based pop-
ulation improvement through genomic selection is an efficient approach.
In rice, Spindel et al. (2015) reported prediction accuracies of single-trait genomic
selection (ST-GS) models for grain yield at 0.31, while Arbelaez et al. (2019) have
shown predictive accuracies for grain yield at 0.36. Meanwhile, multi-trait genomic
selection (MT-GS) models have illustrated higher predictive abilities than ST-GS
models and the results are obvious, especially when low-heritability traits are paired
with a genetically correlated secondary trait with higher heritability (Jia and Jannink
2012; Hayashi and Iwata 2013; Guo et al. 2014; Schulthess et al. 2016). Many find-
ings have used MT-GS approaches in crop breeding, but not yet in rice. Schulthess
et al. (2016) have confirmed the predictive ability of MT-GS in outperforming ST-GS
pipelines for grain yield and protein content in rye. Lado et al. (2018) have verified
combining two, three, and four traits in bread wheat in exploiting the benefits of
MT-GS under different cross-validation scenarios. The use of correlated traits in
MT-GS models gives the best prediction accuracies in a two-trait scenario. GS in
maize showed higher prediction accuracy in DH populations than a GWAS panel
using the same set of GBS and rAmpSeq markers, and GS outperformed MAS in
predicting the performance of Zn content in maize (Guo et al. 2020). Although most
of the available GS methods increased predictive ability, Zn breeders should target
multiple independent phenotypes from multi-environments. Thus, multi-trait and
multi-environment (MTME) models have been established to employ the informa-

tion on multiple traits evaluated in multiple environments, which improves predictive
ability compared to conventional, pedigree, and independent GS analysis
(Montesinos-Lopez et al. 2016).
5 Development of High-Zn Rice
5.1 Phenotyping of Grain Zn
To enhance selection accuracy and to significantly improve a breeding program,

reliable phenotyping is crucial. Accurate phenotyping for any trait involves a stan-
dard protocol with a set of specific standards. Usually in large biofortification breed-
ing programs like the one at IRRI, we handle a huge number of breeding lines every
season, so there is a need for quick turnover of materials with accurate phenotyping
for grain Zn. Efficient high-throughput dehulling, milling, and Zn measurement
protocols and equipment are needed for successful Zn biofortification of rice (Fig. 2)
(Swamy et al. 2016; Guild et al. 2017). Several low-throughput qualitative, semi-
quantitative, and quantitative methods are available for the estimation of grain-Zn
content in rice and other cereals. Inductively coupled plasma optical emission spec-
trometry (ICP-OES) is used to assess nutrient density in grains (Zarcinas et al.
1987); this method is more accurate but low-throughput and input-intensive and it
requires trained staff. X-ray fluorescence (XRF) is a rapid non-chemical-based
Fig. 2 Phenotyping for grain-Zn milled rice

method to measure grain-Zn content in milled rice, which has decreased cost per
unit and simultaneously increased selection intensity although it still requires grain
processing under a contamination-free environment of exogenous Zn sources.
5.2 Setting a Zn Target for Rice Biofortification
The development of nutritional targets for crops for biofortification breeding was
established by a group of experts taking into account the food habits of the target
populations, nutrient losses during food processing, and nutrient bioavailability
(Hotz and McClafferty 2007). The breeding target was designed to meet the specific
nutrient requirement of the target populations considering the baseline micronutri-
ents existing in popular rice varieties and extra micronutrient content to be added to
the crop of interest. Zn-biofortified rice is expected to provide >40% of the Estimated
Average Requirement, which is enough to help overcome Zn-deficiency-induced
health risks (Bouis and Saltzman 2017). There is a plan to release high-Zn rice vari-
eties in three phases: the first set of varieties will have an additional Zn content of
6–8 ppm, the second wave of varieties will have 8–12 ppm, while the third wave of
high-Zn rice varieties will have 12 ppm of additional grain Zn (Fig. 3).
5.3 Germplasm Enhancement and Pre-breeding for Grain Zn
Exploitable genetic variability for any trait, its systematic characterization, and effi-
cient use are essential for a successful breeding program. Most elite modern rice
varieties and their closest elite genetic pool have low grain-Zn content (Gregorio
2002). Oryza nivara, O. rufipogon, O. longistaminata, and O. barthii accessions,
landraces, colored rice, and aus and aromatic accessions were found to have rich
grain-Zn content (Swamy et al. 2016, 2018a, b; Ishikawa et al. 2017). But these
accessions may not be agronomically desirable because of their poor phenotype and
lower yield. Therefore, a systematic pre-breeding for grain Zn is essential to develop
high-Zn rice varieties.
The advanced backcross method for genetic dissection of wild rice, and for
developing high-Zn introgression lines, is an attractive approach for efficient use
of wild rice accessions (Balakrishnan et al. 2020). Several wild rice-derived intro-
gression lines with high grain Zn and yield have already been developed by several
groups (Ishikawa et al. 2017; Swamy et al. 2018a). Multi-parent-derived popula-
tions to select transgressive variants with a combination of desirable traits have
yielded many desirable transgressive variants for grain Zn (Gande et al. 2013;
Ishikawa et al. 2017; Descalsota-Empleo et al. 2019a, b). Marker-assisted QTL
deployment, QTL pyramiding, and marker-assisted recurrent selection are helpful
in germplasm enhancement for grain Zn with other traits (Hill et al. 2008; Boyle
et al. 2017).
Fig. 3 Zn target set for breeding Zn-biofortified rice varieties
Several studies have characterized germplasm and advanced breeding lines

for grain-Zn content (Gregorio et al. 2000; Brar et al. 2011). Garcia-Oliveira
et al. (2009) identified 85 introgression lines with the highest quantities of Zn
with a mean value of 27.1 ppm. Martínez et al. (2010) phenotyped grain-Zn
content in 11,400 rice samples in both brown rice and milled rice and reported
corresponding Zn values of 20–25 ppm and 16–17 ppm, respectively. Gande
et al. (2013) identified eight transgressive lines for high Zn content
(31.2–35.5 ppm). Some of these introgression lines, transgressive segregants,
and breeding lines can be used as donor lines for Zn biofortification and even
some can be directly tested and released as high-Zn rice varieties for commer-
cial cultivation.
5.4 Mainstreaming of Zn Biofortification
Zinc-biofortified rice varieties have been successfully released for cultivation by

farmers in some of the target countries. However, developing, releasing, and dis-
seminating a few varieties may not create sustainable and wide-scale impact on
human health. At IRRI, mainstream breeding programs are shifting from a siloed
trait-based breeding approach to a modernized product development pipeline that
effectively integrates the improvement of all traits necessary for market accep-
tance into a single variety replacement strategy. This new strategy involves using
population improvement as a mechanism to drive genetic gain for complex traits,
while simultaneously increasing the frequency of trait-favorable alleles. Essential
to this strategy is the data-driven identification of a core set of elite lines that
represent the pool of possible parental lines that can be used in the breeding pro-
cess (Cobb et al. 2019). Through successive cycles of recurrent selection, main-
stream breeding efforts are now able to drive genetic gain and improve the average
value of all traits from a product profile in the entire elite gene pool simultane-
ously (Collard et al. 2017). By integrating selection for high grain-Zn content
directly into the mainstream breeding effort, the mean value of grain Zn among
the elite breeding lines will eventually be at or above the recommended allowance
of 28 ppm in milled grains. Once this occurs, all the most recently developed new
varieties released from the mainstream breeding program will have acceptable
concentrations of Zn in addition to other traits more valued in the marketplace.
With minimal effort, maintenance breeding for Zn can be conducted in elite
breeding programs once acceptable grain-Zn content is achieved in order to ensure
constant delivery of sufficient Zn to the diets of nutrition-vulnerable rice-consum-
ing populations. Incumbent upon this strategy is the need for sufficient variation
to drive genetic gain for complex traits. A three-phased approach is suggested:
elite germplasm characterization, elite germplasm enhancement and selection,
and mainstream breeding.
6 High-Zn Rice Testing and Release
6.1 Genotype × Environment Effects on Grain Zn
Grain-Zn content is a complex trait found to be significantly influenced by

external soil and climatic factors (Chandel et al. 2010; Anuradha et al. 2012;
Swamy et al. 2016; Naik et al. 2020). Meteorological factors such as tempera-
ture, relative humidity, and rainfall; soil factors such as organic matter, pH, and
nutrient status; and agronomic practices such as fertilizer application, tilling,
cultivation system, and irrigation (White and Broadley 2009; Joshi et al. 2010;
Chandel et al. 2010) need to be taken into account. Grain-Zn content in a study
conducted by Wissuwa et al. (2008) was found to be greatly influenced by the
native Zn in soils, genotype, and Zn fertilizer application. In a separate study by
Wang et al. (2014), water management with alternate wetting and drying (AWD)
together with ZnSO4 fertilization showed a positive response for higher yield
coupled with higher grain-Zn content in rice. Pandian et al. (2011) conducted
field experiments across three locations involving 17 genotypes of rice. The
results showed that grain-Zn content varied significantly among the genotypes
and locations.
Thus, G × E testing is needed to evaluate promising germplasm and the stability
of mineral accumulation across generations and at multiple test sites (Gregorio
2002; Wissuwa et al. 2008; Impa et al. 2013; Naik et al. 2020). Hence, the stability
of Zn-biofortified genotypes for grain-Zn content in addition to grain yield is essen-
tial for commercial release as varieties.
6.2 n-Biofortified Rice Varieties Released

Z
in Different Countries
Breeding efforts to biofortify rice with high grain Zn have resulted in the successful
release of several high-Zn rice varieties in several countries of Asia. Five high-Zn rice
varieties (BRRI dhan62, BRRI dhan64, BRRI dhan72, BRRI dhan74, and BRRI
dhan84) have been released for cultivation in Bangladesh. In India, two high-Zn rice
varieties (DRR Dhan45 and Chhattisgarh Zinc Rice-1) are available for farmers and
consumers. Similarly, NSIC Rc 460 and Inapari Nutri Zn have been released for farm-
ers’ cultivation in the Philippines and Indonesia, respectively. All these high-Zn rice
varieties have higher grain-Zn content along with desirable agronomic traits and toler-
ance of biotic and abiotic stresses (Swamy et al. 2016; Tsakirpaloglou et al. 2019).
Several promising high-Zn lines have been successfully tested in Myanmar and
Cambodia and in some African countries. We are also making efforts to develop the
next wave of Zn-biofortified rice varieties with higher grain-Zn content.
6.3 High-Zn Rice Traceability and Product Control
Grain-Zn content in rice is an invisible nutritional trait and no morphological indicators

differentiate Zn-biofortified rice from market rice. Maintaining the product integrity of
high-Zn rice throughout the value chain is an important component of successful Zn
biofortification programs. Close monitoring, supervision, and quality control are nec-
essary with proper certification, labeling, branding, and tracing of the product (www.
fao.org/tempref/codex/Meetings/CCNFSDU/ccnfsdu36/nf36_11e.pdf). The develop-
ment of Zn product-specific molecular marker-based fingerprints and rapid qualitative
biochemical marker kits will also help in tracing Zn-rich rice. Blockchain technology
is being used in the large-scale dissemination of nutritious crops to ensure quality con-
trol and to deliver the right products to consumers (Tripoli and Schmidhuber 2018).
7 Next-Generation Multi-Nutrient Rice Varieties
Breeding for rice varieties with multiple beneficial minerals and vitamins is essen-
tial to develop them holistically for one biofortified rice product. Efforts to develop
rice varieties with high Zn, high Fe, selenium, vitamin A, proteins, amino acids,
etc., should be given a priority. It will also be interesting to combine high nutrient
content with traits beneficial to health, such as low glycemic index, antioxidants,
and resistance starch. Also, there is a need to diminish the amount of harmful ele-
ments such as arsenic and cadmium. The increase in demand for rice varieties with
improved grain quality and nutrition means that a suite of rice varieties with differ-
ent combinations of traits targeted to different regions should be developed.
8 Conclusions
Biofortification of rice with improved Zn content is an efficient means to tackle Zn

malnutrition in predominantly rice-consuming developing countries. Some success
has been achieved in understanding the molecular basis of Zn accumulation and the
effects of G × E, and finally in developing and releasing Zn-biofortified rice variet-
ies for the target countries. In all, ten high-Zn rice varieties have been released in
four Asian countries. Efforts have begun to mainstream grain Zn to ensure that the
Zn trait becomes an integral part of future varieties. Huge scope exists to apply
advanced genomics technologies such as genomic selection and genome editing to
speed up high-Zn varietal development. An efficient rice value chain for
Zn-biofortified varieties, quality control, and promotion are essential for successful
adoption and consumption. The development of next-generation high-Zn rice vari-
eties with higher grain-Zn content, stacking of multiple nutrients, along with good
grain quality and acceptable agronomic traits has to be fast-tracked. Healthier rice
has a large demand from all stakeholders, so we need to keep up the pace of devel-
oping nutritious rice to meet the demand and to achieve nutritional security.
References
Alqabbani H, AlBadr N (2020) Zinc status (intake and level) of healthy elderly individuals
in Riyadh and its relationship to physical health and cognitive impairment. Clin Nutr Exp
29:10–17. https://doi.org/10.1016/j.yclnex.2019.12.001
Anandan A, Rajiv G, Eswaran R, Prakash M (2011) Genotypic variation and relationships between
quality traits and trace elements in traditional and improved rice (Oryza sativa L.) genotypes.
J Food Sci 76(4):122–130
Andreini C, Bertini I, Rosato A (2009) Metalloproteomes: a bioinformatic approach. Acc Chem
Res 42:1471–1479
Anuradha K, Agarwal S, Batchu AK, Babu AP, Swamy BPM, Longva T, Sarla N (2012) Evaluating
rice germplasm for iron and zinc concentration in brown rice and seed dimensions. J Geophys
Res 4:19–25
Arbelaez JD, Dwiyanti MS, Tandayu E et al (2019) 1k-RiCA (1K-Rice Custom Amplicon) a novel
genotyping amplicon-based SNP assay for genetics and breeding applications in rice. Rice
12:55. https://doi.org/10.1186/s12284-019-0311-0
Arcade A, Labourdette A, Falque M, Mangin B, Chardon F, Charcosset A, Joets J (2004)
BioMercator: integrating genetic maps and QTL towards discovery of candidate genes.
Bioinformatics 20(14):2324–2326
Balakrishnan D, Surapaneni M, Yadavalli VR, Addanki KR, Mesapogu S, Beerelli K, Neelamraju
S (2020) Detecting CSSLs and yield QTLs with additive, epistatic and QTL × environment
interaction effects from Oryza sativa × O. nivara IRGC81832 cross. Sci Rep 10(1):1–18.
https://doi.org/10.1038/s41598-020-64300-0
Bandillo N, Raghava C, Muyco PA, Sevilla MAL, Lobina IT, Dilla-Ermita CJ, Tung CW, McCouch
S, Thomson M, Mauleon R, Singh RK, Gregorio G, Redoña E, Leung H (2013) Multi-parent
advanced generation inter-cross (MAGIC) populations in rice: progress and potential for genet-
ics research and breeding. Rice 6:11
Banerjee S, Sharma DJ, Verulkar SB, Chandel G (2010) Use of in silico and semi quantita-
tive RT-PCR approaches to develop nutrient rich rice (Oryza sativa L). Indian J Biotechnol
9:203–212
Bashir K, Inoue H, Nagasaka S, Takahashi M, Nakanishi H, Mori S, Nishizawa NK (2006) Cloning

and characterization of deoxymugineic acid synthase genes from graminaceous plants. J Biol
Chem 281:32395–32402
Ben-Ari G, Lavi U (2012) Marker assisted selection in plant breeding. In: Plant biotechnology and
agriculture. Academic Press, Cambridge, pp 163–184
Bernardo R (2008) Molecular markers and selection for complex traits in plants: learning from the
last 20 years. Crop Sci 48:1649
Black RE, Allen LH, Bhutta ZA, Caulfield LE, de Onis M, Ezzati M, Mathers C, Rivera J (2008)
Maternal and child undernutrition: global and regional exposures and health consequences.
Lancet 371:243–260
Bouis H (2017) An overview of the landscape and approach for biofortification in Africa. Afr
J Food Agric Nutr Dev 17(2):11848–11864. https://doi.org/10.18697/ajfand.78.harvestplus01
Bouis H, Saltzman A (2017) Improving nutrition through biofortification: a review of evidence
from HarvestPlus, 2003 through 2016. Glob Food Secur 12:49–58. https://doi.org/10.1016/j.
gfs.2017.01.009
Boyle EA, Li YI, Pritchard JK (2017) An expanded view of complex traits: from polygenic to
omnigenic. Cell 169:1177–1186. https://doi.org/10.1016/j.cell.2017.05.038
Brar B, Jain S, Singh R, Jain RK (2011) Genetic diversity for iron and zinc contents in a collection
of 220 rice (Oryza sativa L.) genotypes. Indian J Genet Plant Breed 71(1):67–73
Broadley MR, White PJ, Hammond JP, Zelko I, Lux A (2007) Zinc in plants. New Phytol
173:677–702
Brooks WA, Yunus M, Santosham M et al (2004) Zinc for severe pneumonia in very young chil-
dren: double-blind placebo-controlled trial. Lancet 363:1683–1688
Brown KH, Peerson JM, Kimmons JE, Hotz C (2002) Options for achieving adequate intake
from home-prepared complementary foods in low income countries. In: Black RE, Fliescher
Michaelson K (eds) Public health issues in infant and child nutrition. Nestle nutrition workshop
series. Pediatric program, vol 48. Lippincott Williams and Wilkins; Nestec Ltd, Philadelphia,
PA; Vevey, pp 239–256
Cakmak I (2000) Role of zinc in protecting plant cells from reactive oxygen species. New Phytol
146:185–205
Calayugan MIC, Formantes AK, Amparado A, Descalsota-Empleo GI, Nha CT, Inabangan-Asilo
MA et al (2020) Genetic analysis of agronomic traits and grain iron and zinc concentrations
in a doubled haploid population of rice (Oryza sativa L.). Sci Rep 10(1):2283. https://doi.
org/10.1038/s41598-020-59184-z
Caulfield LE, Richard SA, Rivera JA et al (2006) Stunting, wasting, and micronutrient deficiency
disorders. In: Jamison DT, Breman JG, Measham AR et al (eds) Disease control priorities in
developing countries, 2nd edn. The International Bank for Reconstruction and Development/
The World Bank, Washington, DC. Chapter 28. https://www.ncbi.nlm.nih.gov/books/
NBK11761/. Co-published by Oxford University Press, New York
CGIAR (2018) 3-year system business plan companion document. CGIAR five-year biofortifica-
tion strategy 2019-2023. CGIAR, Montpellier
Chandel G, Banerjee S, See S, Meena R, Sharma DJ, Verulkar SB (2010) Effects of different
nitrogen fertilizer levels and native soil properties on rice grain Fe, Zn and protein contents.
Rice Sci 17:213–227
Chasapis C, Ntoupa P, Spiliopoulou C, Stefanidou M (2020) Recent aspects of the effects of zinc
on human health. Arch Toxicol 94(5):1443–1460. https://doi.org/10.1007/s00204-020-02702-9
Chen K, Gao C (2013) Targeted genome modification technologies and their applications in crop
improvements. Plant Cell Rep 33:575–583
Cheng ZQ, Huang XQ, Zhang YZ, Qian J (2005) Diversity in the content of some nutritional
components in husked seeds of three wild rice species and rice varieties in Yunnan Province of
China. J Integr Plant Biol l47:1260–1270
Christian M, Cermak T, Doyle EL, Schmidt C, Zhang F, Hummel A et al (2010) Targeting DNA
double-strand breaks with TAL effector nucleases. Genetics 186:757–761
Cobb JN, Juma RU, Biswas PS, Arbalaez JD, Rutkoski J, Atlin G, Hagen T, Quinn M, Ng EH (2019)
Enhancing the rate of genetic gain in public-sector plant breeding programs: lessons from the
breeder’s equation. Theor Appl Genet 132:627. https://doi.org/10.1007/s00122-019-03317-0
in the twenty-first century. Philos Trans R Soc Lond Ser B Biol Sci 363:557–572
Collard BCY, Beredo JC, Lenaerts B, Mendoza R, Santelice R, Lopena V, Verdeprado H,
Raghavan C, Gregorio GB, Vial L, Demomt M, Biswas PS, Iftkhauddaula KM, Rahman MA,
Cobb JN, Islam MA (2017) Revisiting rice breeding methods: evaluating the use of rapid gen-
eration advance (RGA) for routine rice breeding. Plant Prod Sci 20:1. https://doi.org/10.108
0/1343943X.2017.1391705
Descalsota GIL, Swamy BPM, Zaw H, Inabangan-Asilo MA, Amparado A, Mauleon R et al (2018)
Genome-wide association mapping in a rice MAGIC Plus population detects QTLs and genes
useful for biofortification. Front Plant Sci 9:1–20. https://doi.org/10.3389/fpls.2018.01347
Descalsota-Empleo GI, Noraziyah AAS, Navea IP, Chung C, Dwiyanti MS, Labios RJD, Ikmal
AM, Juanillas VM, Inabangan-Asilo MA, Amparado A, Reinke R, Vera Cruz CM, Chin JH,
Swamy BPM (2019a) Genetic dissection of grain nutritional traits and leaf blight resistance in
rice. Genes 10:30. https://doi.org/10.3390/genes10010030
Descalsota-Empleo GI, Amparado A, Inabangan-Asilo MA, Tesoro F, Stangoulis J, Reinke R,
Swamy BPM (2019b) Genetic mapping of QTL for agronomic traits and grain mineral ele-
ments in rice. Crop J 7(4):560–572. https://doi.org/10.1016/j.cj.2019.03.002
Dixit S, Singh UM, Abbai R, Ram T, Singh VK, Paul A, Virk PS, Kumar A (2019) Identification
of genomic region(s) responsible for high iron and zinc content in rice. Sci Rep 9:8136. https://
doi.org/10.1038/s41598-019-43888-y
FAO (Food and Agriculture Organization of the United Nations) (2014) Country nutrition paper
Bangladesh. In: International Conference on Nutrition, 19–21 November 2014. FAO, Rome
FAO (Food and Agriculture Organization of the United Nations) (2016) Statistical database. FAO,
Rome. http://faostat3.fao.org/home/E
Gande NK, Rakhi S, Kundur PJ, Amabti R, Bekele BD, Shashidhar HE (2013) Evaluation of
recombinant inbred lines of rice (Oryza sativa L.) for grain zinc content, yield related traits
and identification of transgressant lines grown under aerobic conditions. Asian J Exp Biol Sci
4(4):567–574
Gangashetty PI, Salimath PM, Hanamaratt NG (2013) Genetic variability studies in geneti-
cally diverse non-basmati local aromatic genotypes of rice (Oryza sativa L.). Rice Genom
Genet 4:4–8
Gao C (2015) Genome editing in crops: from bench to field. Natl Sci Rev 2:13–15
Garcia-Oliveira AL, Tan L, Fu Y, Sun C (2009) Genetic identification of quantitative trait loci for
contents of mineral nutrients in rice grain. J Integr Plant Biol 51:84–92
Garcia-Oliveira AL, Chander S, Ortiz R, Menkir A, Gedil M (2018) Genetic basis and breeding
perspectives of grain iron and zinc enrichment in cereals. Front Plant Sci 9:1–13. https://doi.
org/10.3389/fpls.2018.00937
Garg M, Sharma N, Sharma S, Kapoor P, Kumar A, Chunduri V, Arora P (2018) Biofortified crops
generated by breeding, agronomy, and transgenic approaches are improving lives of millions of
people around the world. Front Nutr 5:12. https://doi.org/10.3389/fnut.2018.00012
Gödecke T, Stein AJ, Qaim M (2018) The global burden of chronic and hidden hunger: trends and
determinants. Glob Food Secur 17:21–29. https://doi.org/10.1016/j.gfs.2018.03.004
Goffinet B, Gerber S (2000) Quantitative trait loci: a meta-analysis. Genetics 155(1):463–473
Gregorio GB (2002) Progress in breeding for trace minerals in staple crops. J Nutr 132:500–502
Gregorio GB, Senadhira D, Htut T, Graham RD (2000) Breeding for trace mineral density in rice.
Food Nutr Bull 21:382–386
Gross BL, Zhao Z (2014) Archaeological and genetic insights into the origins of domesticated rice.
Proc Natl Acad Sci U S A 111(17):6190
Guild GE, Paltridge NG, Andersson MS, Stangoulis JCR (2017) An energy-dispersive X-ray fluo-
rescence method for analysing Fe and Zn in common bean, maize and cowpea biofortification
programs. Plant Soil 419(1–2):457–466. https://doi.org/10.1007/s11104-017-3352-4
Guo G, Zhao F, Wang Y, Zhang Y, Du L, Su G (2014) Comparison of single-trait and multiple-trait

genomic prediction models. BMC Genet 15:30–36
Guo R, Dhliwayo T, Mageto EK, Palacios-Rojas N, Lee M, Yu D, Ruan Y, Zhang A, San Vicente
F, Olsen M, Crossa J, Prasanna BM, Zhang L, Zhang X (2020) Genomic prediction of ker-
nel zinc concentration in multiple maize populations using genotyping-by-sequencing and
repeat amplification sequencing markers. Front Plant Sci 11:1–15. https://doi.org/10.3389/
fpls.2020.00534
Hanieh S, High H, Boulton J (2020) Nutrition justice: uncovering invisible pathways to malnutri-
tion. Front Endocrinol 11:150. https://doi.org/10.3389/fendo.2020.00150
HarvestPlus (2012) International Rice Research Institute. http://www.harvestplus.org/content/
zinc-rice-india
HarvestPlus (2020). https://www.harvestplus.org/knowledge-market/BPI. Accessed 20 Jun 2020
Hayashi T, Iwata H (2013) A Bayesian method and its variational approximation for prediction of
genomic breeding values in multiple traits. BMC Bioinformatics 14:34
Hill WG, Michael E, Goddard ME, Visscher PM (2008) Data and theory point to mainly additive
genetic variance for complex traits. PLoS Genet 4:e1000008. https://doi.org/10.1371/journal.
pgen.1000008
Hotz C, McClafferty B (2007) From harvest to health: challenges for developing biofortified staple
foods and determining their impact on micronutrient status. Food Nutr Bull 28(2):271–279
Impa SM, Morete MJ, Ismail AM, Schulin R, Johnson-Beebout SE (2013) Zn uptake translocation
and grain Zn loading in rice (Oryza sativa L) genotypes selected for Zn-deficiency tolerance
and high grain Zn. J Exp Bot 64:2739–2751
Inabangan-Asilo MA, Mallikarjuna Swamy BP, Amparado AF, Descalsota-Empleo GIL, Arocena
EC, Reinke R (2019) Stability and G × E analysis of zinc-biofortified rice genotypes evaluated
in diverse environments. Euphytica 215(3):1–17. https://doi.org/10.1007/s10681-019-2384-7
Inoue H, Higuchi K, Takahashi M, Nakanishi H, Mori S, Nishizawa NK (2003) Three rice nico-
tianamine synthase genes, OsNAS1, OsNAS2, and OsNAS3 are expressed in cells involved in
long-distance transport of iron and differentially regulated by iron. Plant J 36:366–381
Inoue H, Takahashi M, Kobayashi T, Suzuki M, Nakanishi H, Mori S, Nishizawa NK (2008)
Identification and localisation of the rice nicotianamine aminotransferase gene OsNAAT1
expression suggests the site of phytosiderophore synthesis in rice. Plant Mol Biol 66:193–203
IOM (Institute of Medicine) (2001) Dietary reference intakes for vitamin A, vitamin K, arsenic,
boron, chromium, copper, iodine, iron, manganese, molybdenum, nickel, silicon, vanadium,
and zinc. National Academy Press, Washington, DC
Iqbal S, Ali I, Rust P, Kundi M, Ekmekcioglu C (2020) Selenium, zinc, and manganese status in
pregnant women and its relation to maternal and child complications. Nutrients 12(3):725.
https://doi.org/10.3390/nu12030725
Ishikawa R, Iwata M, Taniko K, Monden G, Miyazaki N, Orn C et al (2017) Detection of quantita-
tive trait loci controlling grain zinc concentration using Australian wild rice, Oryza meridiona-
lis, a potential genetic resource for biofortification of rice. PLoS One 12(10):e0187224. https://
Ishimaru Y, Suzuki M, Kobayashi T, Takahashi M, Nakanishi H, Mori S, Nishizawa NK (2005)
OsZIP4, a novel zinc-regulated zinc transporter in rice. J Exp Bot 56:3207–3214
IZiNCG (International Zinc Nutrition Consultative Group) (2009) Systematic reviews of zinc
intervention strategies. Food Nutr Bull 25:S12–S40
Jeong O-Y, Lee J-H, Jeong E-G et al (2020) Analysis of QTL responsible for grain iron and zinc
content in doubled haploid lines of rice (Oryza sativa) derived from an intra-japonica cross.
Plant Breed 139:344–355. https://doi.org/10.1111/pbr.12787
Jia Y, Jannink JL (2012) Multiple-trait genomic selection methods increase genetic value predic-
tion accuracy. Genetics 192:1513–1522
Jin T, Chen J, Zhu L, Zhao Y, Guo J, Huang Y (2015) Comparative mapping combined with
homology-based cloning of the rice genome reveals candidate genes for grain zinc and iron
concentration in maize. BMC Genet 16(1):17
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable
dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821
Johnson AAT, Kyriacou B, Callahan DL, Carruthers L, Stangoulis J (2011) Constitutive overex-
pression of the OsNAS gene family reveals single-gene strategies for effective iron- and zinc-
biofortification of rice endosperm. PLoS One 6:e24476
Joshi AK, Crossa J, Arun B, Chand R, Trethowan R, Vargas M, Monasterio IO (2010) Genotype
× environment interaction for zinc and iron concentration of wheat grain in eastern Gangetic
plains of India. Field Crops Res 116:268. https://doi.org/10.1016/j.fcr.2010.01.004
Kakei Y, Ishimaru Y, Kobayashi T, Yamakawa T, Nakanshi H, Nishizawa NK (2012) OsYSL16
plays a role in the allocation of iron. Plant Mol Biol 79:583–594
Kim YG, Cha J, Chandrasegaran S (1996) Hybrid restriction enzymes: zinc finger fusions to Fok I
cleavage domain. Proc Natl Acad Sci U S A 93:1156–1160
Lado B, Vázquez D, Quincke M, Silva P, Aguilar I, Gutiérrez L (2018) Resource allocation opti-
mization with multi-trait genomic prediction for bread wheat (Triticum aestivum L.) baking
quality. Theor Appl Genet 131:2719. https://doi.org/10.1007/s00122-018-3186-3
Lan HX, Wang ZF, Wang QH, Wang MM, Bao YM, Huang J, Zhang HS (2013) Characterization
of a vacuolar zinc transporter OZT1 in rice (Oryza sativa L.). Mol Biol Rep 40(2):1201–1210
Lee S, Jeong HJ, Kim SA, Lee J, Guerinot ML, An G (2010a) OsZIP5 is a plasma membrane zinc
transporter in rice. Plant Mol Biol 73(4–5):507–517
Lee S, Kim SA, Lee J, Guerinot ML, An G (2010b) Zinc deficiency-inducible OsZIP8 encodes a
plasma membrane-localized zinc transporter in rice. Mol Cell 29(6):551–558
Lee S-M, Kang J-W, Lee J-Y, Seo J, Shin D, Cho J-H, Jo S, Song Y-C, Park D-S, Ko J-M, Koh H-J,
Lee J-H (2020) QTL analysis for Fe and Zn concentrations in rice grains using a doubled hap-
loid population derived from a cross between rice (Oryza sativa) cultivar 93-11 and milyang
352. Plant Breed Biotech 8(1):69–76
Li J, Wang J, Zeigler RS (2014) The 3,000 rice genomes project: new opportunities and challenges
for future rice research. Giga Sci 3:8
de los Campos G, Naya H, Gianola D, Crossa J, Legarra A, Manfredi E, Weigel K, Cotes JM
(2009) Predicting quantitative traits with regression models for dense molecular markers and
pedigree. Genetics 182(1):375–385
Ma G, Jin Y, Li Y, Zhai F, Kok FJ, Jacobsen E, Yang X (2008) Iron and zinc deficiencies in China:
what is a feasible and cost-effective strategy? Public Health Nutr 11:632–638
Maret W (2017) Zinc in cellular regulation: the nature and significance of “zinc signals”. Int J Mol
Sci 18:2285
Maret W, Li Y (2009) Coordination dynamics of zinc in proteins. Chem Rev 109:4682–4707
Martínez CP, Borrero J, Taboada R, Viana JL, Neves P, Narvaez L, Puldon V, Adames A, Vargas
A (2010) Rice cultivars with enhanced iron and zinc content to improve human nutrition. In:
28th International Rice Research Conference, Hanoi, Vietnam, 8–12 November 2010. OP10:
Quality Grain, Health, and Nutrition
McDonald GK, Genc Y, Graham RD (2008) A simple method to evaluate genetic variation in grain
zinc concentration by correcting for differences in grain yield. Plant Soil 306:49. https://doi.
org/10.1007/s11104-008-9555-y
Meuwissen THE, Hayes BJ, Goddard ME (2001) Prediction of total genetic value using genome-
wide dense marker maps. Genetics 157:1819–1829
Milovanovic V, Smutka L (2017) Asian countries in the global rice market. Acta Univ Agric
Silvicult Mendel Brunensis 65(2):679–688. https://doi.org/10.11118/actaun201765020679
Montesinos-Lopez OA, Montesinos-Lopez A, Crossa J, Toledo FH, Perez-Hernandez O,
Eskridge KM et al (2016) A genomic Bayesian multi-trait and multi-environment model. G3
6(9):2725–2744. https://doi.org/10.1534/g3.116.032359
Montesinos-López A, Montesinos-López OA, Gianola D, Crossa J, Hernández-Suárez CM (2019)
Multivariate Bayesian analysis of on-farm trials with multiple-trait and multiple-environment
data. Agron J 3(1):1–12. https://doi.org/10.2134/agronj2018.06.0362
Morete MJ, Impa MS, Rubianes F, Beebout SEJ (2011) Characterization of zinc uptake and trans-
port in rice under reduced conditions in agar nutrient solution. In: 14th Philippine Society
of Soil Science and Technology, Scientific Conference, 25–27 May 2011. Visayas State
University, Baybay
Naik SM, Raman AK, Nagamallika M, Venkateshwarlu C, Singh SP, Kumar S, Singh SK, Ahmed
HU, Das SP, Prasad K, Izhar T, Mandal NP, Singh NK, Yadav S, Reinke R, Swamy BPM, Virk
P, Kumar A (2020) Genotype × environment interactions for grain iron and zinc content in rice.
J Sci Food Agric 100:4150. https://doi.org/10.1002/jsfa.10454
Nha CT (2019) Dissection of QTL and genes for agronomic and biofortification traits in six con-
nected populations of rice. Dissertation. University of the Philippines, Los Baños. 224 p
Norton GJ, Deacon CM, Xiong L, Huang S, Meharg AA, Price AH (2010) Genetic mapping of
the rice ionome in leaves and grain: identification of QTLs for 17 elements including arsenic,
cadmium, iron and selenium. Plant Soil 329:139–153
Norton GJ, Douglas A, Lahner B, Yakubova E, Guerinot ML et al (2014) Genome wide association
mapping of grain arsenic, copper, molybdenum and zinc in rice (Oryza sativa L.) grown at four
international field sites. PLoS One 9(2):e89685. https://doi.org/10.1371/journal.pone.0089685
Nozoye T, Nagasaka S, Kobayashi T, Takahashi M, Sato Y, Sato Y, Uozumi N, Nakanishi H,
Nishizawa NK (2011) Phytosiderophore efflux transporters are crucial for iron acquisition in
graminaceous plants. J Biol Chem 286:5446–5454
Palanog AD, Calayugan MIC, Descalsota-Empleo GI et al (2019) Zinc and iron nutrition status in
the Philippines population and local soils. Front Nutr 6:81
Pandian SS, Robin S, Vinod KK, Rajeswari S, Manonmani S, Subramanian KS, Saraswathi R,
Kirubhakaran APM (2011) Influence of intrinsic soil factors on genotype-by-environment
interactions governing micronutrient content of milled rice grains. AJCS 5(13):1737–1744
Peng S, Laza RC, Visperas RM, Sanico AL, Cassman KG, Khush GS (2000) Grain yield of rice
cultivars and lines developed in the Philippines since 1966. Crop Sci 40:307–314
Peng S, Huang J, Sheehy JE, Laza RC, Visperas RM, Zhong XH et al (2004) Rice yields decline with
higher night temperature from global warming. Proc Natl Acad Sci U S A 101(27):9971–9975
Prasad R, Shivay YS, Kumar D (2014) Agronomic biofortification of cereal grains with iron and
zinc. Adv Agron 125:55–91. https://doi.org/10.1016/B978-0-12-800137-0.00002-9
Ramesh SA, Shin R, Eide DJ, Schachtman P (2003) Differential metal selectivity and gene expres-
sion of two zinc transporters from rice. Plant Physiol 133:126–134
Rampa F, Lammers E, Linnemann A, Schoustra S, de Winter D (2020) African indigenous foods:
opportunities for improved food and nutrition security. Food & Business Knowledge Platform.
https://knowledge4food.net/african-indigenous-foods/
Rana MK, Bhat KV (2004) A comparison of AFLP and RAPD markers for genetic diversity and
cultivar identification in cotton. J Plant Biochem Biotechnol 13:19–24
Raza Q, Riaz A, Sabar M, Atif RM, Bashir K (2019) Meta-analysis of grain iron and zinc associ-
ated QTLs identified hotspot chromosomal regions and positional candidate genes for breeding
biofortified rice. Plant Sci 288:110214. https://doi.org/10.1016/j.plantsci.2019.110214
Ritchie H, Reay D, Higgins P (2018) Quantifying, projecting, and addressing India’s hidden hun-
ger. Front Sustain Food Syst 2:11. https://doi.org/10.3389/fsufs.2018.00011
Sasaki A, Yamaji N, Xia J, Ma JF (2011) OsYSL6 is involved in the detoxification of excess man-
ganese in rice. Plant Physiol 157:1832–1840
Sathisha TN (2013) Genetic variation among traditional landraces of rice with specific reference to
nutrition al quality. Karnataka J Agric Sci 26:474
Sazawal S, Black RE, Ramsan M, Chwaya HM, Dutta A, Dhingra U, Stoltzfus RJ, Othman MK,
Kabole FM (2007) Effect of zinc supplementation on mortality in children aged 1-48 months:
a community-based randomised placebo-controlled trial. Lancet 369(9565):927–934
Schulthess AW, Yu W, Miedaner T, Wilde P, Reif JC, Zhao Y (2016) Multiple-trait and selection
indices genomic predictions for grain yield and protein content in rye for feeding purposes.
Shamshad M, Sharma A (2018) The usage of genomic selection strategy in plant breeding. In: Next
generation plant breeding. InTech, Rijeka. https://doi.org/10.5772/intechopen.76247
Siwela M, Pillay K, Govender L, Lottering S (2020) Biofortified crops for combating hidden
hunger in South Africa: availability, acceptability, micronutrient retention and bioavailability.
Foods 9(6):815. https://doi.org/10.3390/foods9060815
Soe YP (2020) Meta-analysis of quantitative trait loci associated with grain zinc content in rice.
Dissertation. University of the Philippines, Los Baños. 180 pp
Spindel J, Begum H, Akdemir D, Virk P, Collard B, Redoña E et al (2015) Genomic selection and
association mapping in rice (Oryza sativa): effect of trait genetic architecture, training popula-
tion composition, marker number and statistical model on accuracy of rice genomic selection in
elite, tropical rice breeding lines. PLoS Genet 11(2):e1004982. https://doi.org/10.1371/journal.
pgen.1004982
Swamy BM, Vikram P, Dixit S, Ahmed HU, Kumar A (2011) Meta-analysis of grain yield QTL
identified during agricultural drought in grasses showed consensus. BMC Genomics 12:319.
https://doi.org/10.1186/1471-2164-12-319
Swamy BPM, Rahman MA, Inabangan-Asilo MA, Amprado A, Manito C, Chada-Mohanty P,
Reinike R, Slamet-Loedin IH (2016) Advances in breeding for high grain Zinc in rice. Rice
9:49. https://doi.org/10.1186/s12284-016-0122-5
Swamy BPM, Kaladhar K, Anuradha K, Batchu AK, Longvah T, Sarla N (2018a) QTL analysis
for grain iron and zinc concentrations in two O. nivara derived backcross populations. Rice Sci
25(4):197–207. https://doi.org/10.1016/j.rsci.2018.06.003
Swamy BPM, Descalsota GIL, Nha CT, Amparado A, Inabangan-Asilo MA, Manito C, Tesoro F,
Reinke R (2018b) Identification of genomic regions associated with agronomic and biofortifi-
cation traits in DH populations of rice. PLoS One 13(8):1–20. https://doi.org/10.1371/journal.
pone.0201756
Szymlek-Gay EA, Ferguson EL, Heath AL, Gray AR, Gibson RS (2009) Food-based strategies
improve iron status in toddlers: a randomized controlled trial. Am J Clin Nutr 90:1541–1551
Tielsch JM, Khatry SK, Stoltzfus RJ et al (2007) Effect of daily zinc supplementation on child
mortality in southern Nepal: a community-based, cluster randomized, placebo-controlled trail.
Lancet 370:1230–1239
Torheim LE, Ferguson EL, Penrose K, Arimond M (2010) Women in resource-poor settings are at
risk of inadequate intakes of multiple micronutrients. J Nutr 140:2051S–2058S
Trijatmiko KR, Dueñas C, Tsakirpaloglou N, Torrizo L, Arines FM, Adeva C, Balindong J, Oliva
N, Sapasap MV, Borrero J, Rey J, Francisco P, Nelson A, Nakanishi H, Lombi E, Tako E,
Glahn RP, Stangoulis J, Chadha-Mohanty P, Johnson AAT, Tohme J, Barry G, Slamet-Loedin
IH (2016) Biofortified indica rice attains iron and zinc nutrition dietary targets in the field. Sci
Rep 6:19792. https://doi.org/10.1038/srep19792
Tripoli M, Schmidhuber J (2018) Emerging opportunities for the application of blockchain in the
agri-food industry. FAO, ICTSD, Rome, Geneva. Licence: CC BY-NC-SA 3.0 IGO
Tsakirpaloglou N, Mallikarjuna Swamy BP, Acuin C, Slamet-Loedin IH (2019) Biofortified Zn
and Fe rice: potential contribution for dietary mineral and human health. In: Jaiwal P, Chhillar
A, Chaudhary D, Jaiwal R (eds) Nutritional quality improvement in plants. Concepts and strat-
egies in plant sciences. Springer, Cham
UNICEF (2013) Improving child nutrition: the achievable imperative for global progress. United
Nations Children’s Fund, United Nations Organization, New York, NY
Wang Y, Wei Y, Dong L, Lu L, Feng Y, Zhang J et al (2014) Improved yield and Zn accumulation
for rice grain by Zn fertilization and optimized water management. J Zhejiang Univ Sci B
15(4):365–374. https://doi.org/10.1631/jzus.b1300263
Wassmann R, Jagadish SVK, Sumfleth K, Pathak H, Howell G, Ismail A et al (2009) Regional
vulnerability of climate change impacts on Asian rice production and scope for adaptation.
Adv Agron 102:91–133
Welch RM, Graham RD (2004) Breeding for micronutrients in staple food crops from a human
nutrition perspective. J Exp Bot 55:353–364
White PJ, Broadley MR (2009) Biofortification of crops with seven mineral elements often lacking
in human diets – iron, zinc, copper, calcium, magnesium, selenium and iodine. Review. New
Phytol 182:49–84. https://doi.org/10.1111/j.1469-8137.2008.02738.x
WHO (World Health Organization) (1998) Complementary feeding of young children in develop-
ing countries: a review of current scientific knowledge. WHO, Geneva
WHO (World Health Organization) (2003) Joint WHO/FAO Expert Consultation on diet, nutrition
and the prevention of chronic diseases. WHO, Geneva
Widodo B, Broadley MR, Rose T, Frei M, Pariasca-Tanaka J, Yoshihashi T, Thomson M, Hammond
JP, Aprile A, Close TJ, Ismail AM, Wissuwa MM (2010) Response to zinc deficiency of two
rice lines with contrasting tolerance is determined by root growth maintenance and organic acid
exudation rates, and not by zinc-transporter activity. New Phytol 186:400–414
Wissuwa M, Ismail AM, Graham RD (2008) Rice grain zinc concentrations as affected by
genotype, native soil-zinc availability, and zinc fertilization. Plant Soil 306:37. https://doi.
org/10.1007/s11104-007-9368-4
Young G, Mortimer E, Gopalsamy G, Alpers D, Binder H, Manary M et al (2014) Zinc deficiency
in children with environmental enteropathy—development of new strategies: report from an
expert workshop. Am J Clin Nutr 100(4):1198–1207. https://doi.org/10.3945/ajcn.113.075036
Zarcinas BA, Cartwright B, Spouncer LR (1987) Nitric acid digestion and multi element analysis
of plant material by inductively coupled plasma spectrometry. Commun Soil Sci Plant Anal
18:131–146
Zaw H, Raghavan C, Pocsedio A, Swamy BPM, Jubay ML, Singh RK et al (2019) Exploring
genetic architecture of grain yield and quality traits in a 16-way indica by japonica rice MAGIC
global population. Sci Rep 9(1):1–11. https://doi.org/10.1038/s41598-019-55357-7
Zhang Y, Xu Y, Yi H, Gong J (2012) Vacuolar membrane transporters OsVIT1 and OsVIT2 modu-
late iron translocation between flag leaves and seeds in rice. Plant J 72:400–410
Biofortification of Rice Grains
for Increased Iron Content
Jerlie Mhay Matres, Erwin Arcillas, Maria Florida Cueto-Reaño,

Ruby Sallan-Gonzales, Kurniawan R. Trijatmiko, and Inez Slamet-Loedin
Abstract Dietary iron (Fe) deficiency affects 14% of the world population with
significant health impacts. Biofortification is the process of increasing the density of
vitamins and minerals in a crop, through conventional breeding, biotechnology
approaches, or agronomic practices. This process has recently been shown to suc-
cessfully alleviate micronutrient deficiency for populations with limited access to
diverse diets in several countries (https://www.harvestplus.org/). The Fe breeding
target in the HarvestPlus program was set based on average rice consumption to
fulfil 30% of the Estimated Average Requirement of Fe in women and children. In
this review, we present the reported transgenic approaches to increase grain Fe.
Insertion of a single or multiple genes encoding iron storage protein, metal trans-
porter, or enzyme involved in the biosynthesis of metal chelator in the rice genome
was shown to be a viable approach to significantly increase grain-Fe density. The
most successful approach to reach the Fe breeding target was by overexpression of
multiple genes. Despite this success, a significant effort of 8–10 years needs to be
dedicated from the proof of concept to varietal release. This includes large-scale
plant transformation, event selection, collection of data for premarket safety assur-
ance, securing biosafety permits for consumption and propagation, and collection of
data for variety registration.
Keywords Rice · Grain · Iron · Biofortification · Genetic engineering
J. M. Matres · E. Arcillas · M. F. Cueto-Reaño · R. Sallan-Gonzales · I. Slamet-Loedin

International Rice Research Institute, Los Baños, Laguna, Philippines
K. R. Trijatmiko (*)
Strategic Innovation Platform, International Rice Research Institute,

https://doi.org/10.1007/978-3-030-66530-2_14
472 J. M. Matres et al.
1 Introduction
Nutritional deficiency is an important global health concern that affects approxi-

mately 1.86 billion people worldwide, and 61% of it is caused by dietary iron (Fe)
deficiency (James et al. 2018). Iron deficiency anemia results in decreased work
productivity, increased maternal mortality, increased child mortality, slowed child
development, and increased susceptibility to infectious diseases (Stoltzfus 2001).
Iron deficiency anemia is estimated to be responsible for 800,000 deaths/year
(WHO 2002).
Although providing access to more diverse diets is the ideal solution to alleviate
micronutrient deficiency, this may not be achieved in the near future in developing
and less developed countries. Iron supplementation and industrial fortification have
been shown to alleviate micronutrient deficiencies but require continuous signifi-
cant budget allocation at the government or household level. Despite the potential to
diminish iron deficiency in the population, this may not help people living in remote
rural areas because of the lack of infrastructure, purchasing power, or access to
markets and healthcare systems (Mayer et al. 2008). Biofortification, a process of
increasing the concentration of micronutrient in the edible part of a crop through
conventional plant breeding, transgenic methods, and agronomic practices, offers a
feasible and cost-effective approach, complementing other efforts to reach rural
populations (Bouis and Saltzman 2017).
2 Target Concentration for Fe in Polished Rice
The Estimated Average Requirement (EAR) of iron for non-pregnant, non-lactating

women is 1460 mg/day, and for children 4–6 years old is 500 mg/day (WHO/FAO
2004). Current studies show that 90% of the iron remains in the grain after process-
ing, while the nutritionist assumption is that 10% of the iron is bioavailable. With
400 g/day per capita rice consumption for an adult woman and 120 g/day for chil-
dren 4–6 years old, the HarvestPlus program set 13 μg/g as the final target concen-
tration for Fe in polished rice to achieve 30% of the EAR (Bouis et al. 2011).
3 Iron Biofortification via Conventional Plant Breeding
Initial screening of the germplasm collection at the International Rice Research

Institute (IRRI) showed that the range in Fe concentration in brown rice among
1138 genotypes tested was 6.3–24.4 μg/g (Gregorio et al. 1999). However, the vari-
ation in Fe concentration in milled rice becomes narrow due to the high proportion
of Fe lost during milling. A study on the iron concentration of brown and milled rice
of six varieties collected from ten commercial rice mills in one province in Vietnam
Biofortification of Rice Grains for Increased Iron Content 473
showed that the percentage of Fe loss due to milling ranged from 65% to 82% (Hoa
and Lan 2004). Furthermore, the maximal iron concentration in milled rice was
8 μg/g over 11,337 genotypes from the International Center for Tropical Agriculture
(CIAT) core collection (Martínez et al. 2010). At IRRI, the highest Fe concentration
of 7.4 μg/g in polished rice was achieved by classical breeding (Virk et al.
2006, 2007).
To reach the Fe target of 13 μg/g in polished rice, transgenic approaches are
potential options because of the low concentration of Fe found in the rice gene pool.
Efforts have been made to study the physiology as well as the genetic basis and
biochemical mechanisms involved in Fe uptake and translocation in crops and
model plants. These studies have facilitated the detection of the limiting factors that
could be manipulated to increase Fe concentration in rice grain.
4 Iron Uptake and Translocation
Iron is an important micronutrient required in various processes such as photosyn-

thesis and respiration. Based on the strategy they use to uptake iron from the rhizo-
sphere, higher plants can be categorized into three different groups (Connorton
et al. 2017): (1) Strategy I plants (all dicotyledonous plants and non-graminaceous
monocots) that rely on the reduction of ferric Fe(III) to ferrous Fe(II), (2) Strategy
II plants (graminaceous monocots) that rely on the chelation strategy involving phy-
tosiderophore secretion, and (3) a combination of both. Arabidopsis has been used
as a model plant to study Strategy I plants. Some major genes responsible for iron
uptake using this strategy have been identified: iron-regulated transporter 1 (IRT1)
(Eide et al. 1996), ferric-chelate oxidase 2 (FRO2) (Robinson et al. 1999), and
HC-ATPase (HA) genes (Kobayashi and Nishizawa 2012).
Rice has been used as a model plant to study Strategy II plants. Plants in this
group that include the most important cereals in the world secrete phytosiderophore
(PS) in the rhizospere. PS is a high-Fe-affinity organic molecule from the mugineic
acid family (Bashir et al. 2017; Borrill et al. 2014; Kobayashi et al. 2005; Suzuki
et al. 2006). Figure 1 presents the basic scheme for the genes involved in iron
homeostasis in rice.
Mugineic acid is synthesized through a conserved pathway that starts from
S-adenosyl-l-methionine. It is then followed by sequential reactions catalyzed by
nicotianamine synthase (NAS), nicotianamine aminotransferase (NAAT), and
deoxymugineic acid synthase (DMAS) enzymes, producing 20-deoxymugineic
acid (DMA), a precursor of different types of mugineic acids (Bashir et al. 2006;
Higuchi et al. 1999; Kobayashi and Nishizawa 2012; Takahashi et al. 1999). In rice
roots, secretion of DMA is influenced by the expression of the TOM1 geneencoding
efflux transporter of DMA (Nozoye et al. 2011). YELLOW STRIPE 1 (YS1) and
YELLOW STRIPE 1-like (YSL1) transporters are known for their role in facilitat-
ing the uptake of Fe–MA complexes into root cells (Curie et al. 2001; Inoue et al.
2009). After reduction by ascorbate, the Fe(III)–DMA complex is likely converted
Fig. 1. Iron uptake, translocation, and storage in rice. TOM1 transporter of mugineic acid
family phytosiderophores 1, YS1 yellow stripe 1, YSL15 yellow stripe 1-like, IRT1 iron-regulated
transporter, NRAMP1 natural resistance-associated macrophage protein 1, FRO ferric reductase
oxidase, FRDL1 ferric reductase defective-like1, ENA efflux transporter of nicotianamine, VIT
vacuolar iron transporter, FER ferritin, MA mugineic acid, DMA 2′-deoxymugineic acid, NA nico-
tianamine, SAM S-adenosyl-l-methionine, NAS nicotianamine synthase, NAAT nicotianamine
aminotransferase, DMAS deoxymugineic acid synthase
to Fe(II)–NA, and then excreted to the xylem. The Fe may create complexes primar-
ily with citrate and some with DMA for further transport (Yoneyama et al. 2015).
Aside from using Strategy II, rice may be able to uptake Fe(II) directly, as indi-
cated by the presence of a ferrous transporter (OsIRT1) in the genome. Other metal
transporters involved in Strategy I and Strategy II were also identified such as natu-
ral resistance-associated macrophage protein (NRAMP) and ZIP (zinc-regulated
transporter, IRT-like protein) family (Cailliatte et al. 2010; Guerinot 2000; Lanquar
et al. 2005).
Fe translocation in higher plants is a complex process involving xylem loading/
unloading, phloem loading/unloading, and reabsorption (Kim and Guerinot 2007).
Different chelators such as citrate, nicotianamine (NA), and MAs play an essential
role in symplast metal homeostasis (Garcia-Oliveira et al. 2018). FERRIC
REDUCTASE DEFECTIVE-LIKE 1 (OsFRDL1) in rice (Fig. 1) is known to
encode a citrate transporter involved in the transport of Fe-citrate complex (Inoue
et al. 2004; Yokosho et al. 2009).
The rice YSL family encoding influx transporter consists of 18 members (Curie
et al. 2009). The OsYSL2 transporter is a carrier of Fe(II)–NA and is involved in
iron transport to sink tissues (Koike et al. 2004). OsYSL15 transports Fe(III)–DMA
and is involved in Fe uptake in the root and long-distance Fe transport. The Fe trans-
porter OsYSL18 may play a specific role in fertilization, as indicated by specific
expression in the pollen and pollen tubes. OsYSL18 may also be involved in Fe
transport in the phloem (Kobayashi and Nishizawa 2012). As indicated by their
vascular tissue expression in rice, OsIRT1 and OsTOM1 may be involved in Fe
translocation within the plant as well (Ishimaru et al. 2006; Nozoye et al. 2011).
5 Iron Biofortification via Genetic Engineering
Several efforts have been conducted to increase Fe concentration in rice grains.

These studies can be categorized into different approaches: (1) overexpression of
geneencoding iron storage protein, (2) overexpression of geneencoding enzyme
involved in the biosynthesis of metal chelator, (3) overexpression of geneencoding
metal transporter, and (4) a combination of two or three approaches (Tables 1 and 2).
Fe concentration of 38.1 μg/g in brown rice was achieved by endosperm-specific
expression of a soybean Fe storage protein, SoyFerH1 (Goto et al. 1999). Similar
approaches using the SoyferH1 gene driven by different promoters (OsGluB1,
OsGluB4, OsGlb1, ZmUbi-1) in different backgrounds (Swarna, IR68144, BR29,
IR64, M12) were reported (Slamet-Loedin et al. 2015). Stable Fe concentrations of
9.2 or 7.6 μg/g over several generations were obtained (Khalekuzzaman et al. 2006;
Oliva et al. 2014). Overexpression of the OsFer2 gene was also studied and Fe con-
centration of 15.9 μg/g, vis-à-vis 7 μg/g in control variety Pusa-Sugandh II, was
observed (Paul et al. 2012).
Another approach in improving grain-Fe concentration in rice is by increasing
the expression of genes encoding enzymes involved in the biosynthesis of metal
Table 1 Summary of transgenic approaches to develop iron-rich milled rice
476
Iron ([c] in μg/g) Growth

Mechanism involved TG WT condition Cultivar References
Rice gene overexpression
OsNAS1 Iron uptake and Up to ~40 ~20 Greenhouse Japonica cv. EYI 105 Díaz-Benito et al.
translocation (2018)
OsNAS2 Iron uptake and ~10 ~4 Greenhouse Japonica cv. Dongjin Lee et al. (2012)
translocation
OsNAS3 Iron uptake and ~12 ~4 Greenhouse Japonica cv. EYI 105 Lee et al. (2009b)
translocation
OsNAS1, OsNAS2, OsNAS3 Iron uptake and Up to ~19 ~4.5 Greenhouse Japonica cv. Johnson et al. (2011)
translocation Nipponbare
OsYSL2 Iron uptake and ~7.5 ~1.8 Greenhouse Japonica cv. Ishimaru et al.
translocation Tsukinohikari (2010)
Osfer2 Storage Up to ~7 Greenhouse Indica cv. Pusa- Paul et al. (2012)
~15.9 Sugandh II
Rice gene silencing/knockdown mutant
OsVIT2 Inter-cellular/intra-cellular ~8 ~5 Japonica cv. Dongjin Bashir et al. (2013)
transport and storage
OsYSL9 Inter-cellular/intra-cellular Up to 1 Japonica cv. Senoura et al. (2017)
transport and storage ~2.5 Tsukinohikari
OsDMAS1 Inter-cellular/intra-cellular ~5 ~5 Japonica cv. Dongjin Bashir et al. (2017)
Rice gene knockout mutant
OsVMT Inter-cellular/intra-cellular 9 4 Greenhouse Japonica cv. Che et al. (2019)
transport and storage Nipponbare
Overexpression of genes from different species
HvNAS1 Iron uptake and ~8.5 ~4 Greenhouse Japonica cv. Masuda et al. (2009)
translocation Tsukinohikari
J. M. Matres et al.
HvYS1 Iron uptake and Up to ~9 ~4 Japonica cv. EYI 105 Banakar et al.
translocation (2017a)
AtIRT1 Iron uptake and Up to ~2.28 Greenhouse Japonica cv. Taipei Boonyaves et al.
translocation ~4.86 309 (2016)
SoyferH1 Storage Up to ~37 ~10 Screenhouse Indica cv. IR68144 Vasconcelos et al.
(2003)
SoyferH1 Storage Up to ~3.8 Greenhouse Indica cv. BR29 Khalekuzzaman
~9.2 et al. (2006)
SoyferH1 Storage Up to ~16 ~6.75 Greenhouse Indica cv. Swarna Paul et al. (2014)
SoyferH1 Storage Up to ~3.3 Greenhouse Indica cv. IR64 Oliva et al. (2014)
~7.6
Multigene overexpression of genes from different species
SoyferH2 + HvNAS1 + OsYSL2 Combined mechanisms Up to ~4 ~1 Paddy field Japonica cv. Masuda et al. (2012)
Tsukinohikari
HvNAS1, HvNAS1 + HvNAAT, IDS3 Combined mechanisms Up to ~5.8 Paddy field Japonica cv. Suzuki et al. (2008)
Biofortification of Rice Grains for Increased Iron Content
~7.3 Tsukinohikari
SoyferH2 + HvNAS1 + OsYSL2 Combined mechanisms ~6.3 ~3.2 Greenhouse Tropical Japonica cv. Aung et al. (2013)
(~5.02) (~1.46) Paw San Yin
AtNAS1 + Pvfer + Afphytase Combined mechanisms Up to ~7 ~1 Hydroponic Japonica cv. Taipei Wirth et al. (2009)
309
AtIRT1, Pvfer, AtNAS1 Combined mechanisms Up to ~2.7 Greenhouse Japonica cv. Boonyaves et al.
~10.46 Nipponbare (2017)
SoyferH1 + OsNAS2 Combined mechanisms ~15 ~2.5 Paddy field Indica cv. IR64 Trijatmiko et al.
(2016)
AtNAS1 + AtFRD3 + Pvfer, Combined mechanisms Up to ~2.05 Greenhouse Japonica cv. Wu et al. (2018)
AtFRD3 + Pvfer ~11.08 Nipponbare
(continued)
477
Table 1 (continued)
478

AtNAS1 + Pvfer + AtNRAMP3, Combined mechanisms Up to ~2.72 Greenhouse Indica cv. IR64 Wu et al. (2019)
Pvfer + AtNRAMP3 ~13.65
AtNAS1 + Pvfer + ZmPSY + PaCRT1 Combined mechanisms Up to ~1.82 Greenhouse Japonica cv. Singh et al. (2017)
~6.02 Nipponbare
OsNAS1, HvHAATb, OsNAS1 + HvHAATb Combined mechanisms Up to ~18 ~4 Hydroponic Japonica cv. EYI 105 Banakar et al.
(2017b)
OsNAS1, HvNAATb, OsNAS1 + HvNAATb Combined mechanisms Up to ~55 ~20 Greenhouse Japonica cv. EYI 105 Díaz-Benito et al.
(2018)
SoyferH2 + HvNAS1 + HvNAAT- Combined mechanisms Fourfold Greenhouse Japonica cv. Masuda et al. (2013)
A,-B + IDS3 Tsukinohikari
J. M. Matres et al.
Table 2 Summary of transgenic approaches to develop iron-rich brown rice
Rice gene overexpression
OslRT1 Iron uptake and translocation ~12 ~10 Paddy field Japonica cv. Dongjin Lee and An (2009)
TOM1 Iron uptake and translocation ~18 ~15 Hydroponic Japonica cv. Nozoye et al. (2011)
Tsukinohikari
OsNAS1 Iron uptake and translocation Up to ~19 ~12 Paddy field Japonica cv. Xiushui 110 Zheng et al. (2010)
OsYSL13 Iron uptake and translocation ~15 ~11 Greenhouse Japonica cv. Zhang et al. (2018)
Zhonghua 11
OsYSL15 Iron uptake and translocation ~14 ~12 Paddy field Japonica cv. Dongjin Lee et al. (2009a)
OsbHLH Iron uptake and translocation ~35 ~18 Hydroponic Japonica cv. Nipponbare Kobayashi et al. (2019)
OsIRO2 Iron deficiency response Up to ~6 Greenhouse Japonica cv. Ogo et al. (2011)
~15.5 Tsukinohikari
TOM2 Iron deficiency response Hydroponic Japonica cv. Nipponbare Nozoye et al. (2015)
Rice gene silencing/knockdown mutant
OsVIT1 Inter-cellular/intra-cellular ~26 ~20 Paddy field Japonica cv. Zhang et al. (2012)
Biofortification of Rice Grains for Increased Iron Content
transport and storage Zhonghua 11

OsVIT2 Inter-cellular/intra-cellular ~28 ~20 Paddy field Japonica cv. Dongjin Zhang et al. (2012)
Overexpression of genes of different species
SoyferH1 Storage Up to ~38 ~14.3 Greenhouse Japonica cv. Kitaake Goto et al. (1999)
SoyferH1 Storage ~18 ~18 Greenhouse Indica cv. M12 Drakakaki et al. (2000)
SoyferH1 Storage Up to ~25 ~17 Greenhouse Japonica cv. Kitaake Qu et al. (2005)
Multigene overexpression of genes of different species
Pvfer + rgMT + phyA Combined mechanisms ~22 ~10 Greenhouse Japonica cv. Taipei 309 Lucca et al. (2002)
479
chelator. OsNAS1 overexpression resulted in Fe concentration of 19 μg/g in brown

rice; however, the concentration decreased to only 5 μg/g after polishing (Zheng
et al. 2010). Co-overexpression of OsNAS1 and HvNAAT genes in japonica rice
resulted in Fe concentration of 18 μg/g in the polished grain (Banakar et al. 2017b).
Fe concentration of 55 μg/g in the succeeding generation was observed; however,
this unusually high Fe concentration suggests either low milling degree or Fe con-
tamination (Díaz-Benito et al. 2018). Overexpression and activation tagging of
OsNAS2, on the other hand, resulted in 19 μg/g and 10 μg/g Fe concentration in
polished rice, respectively (Johnson et al. 2011; Lee et al. 2012). Meanwhile, activa-
tion tagging of OsNAS3 achieved 12 μg/g Fe in polished grain vis-à-vis 4 μg/g Fe in
the wild type (Lee et al. 2009b).
Several studies reported increased Fe uptake and translocation by overexpression
of genes encoding metal transporter, including OsYSL2 (Ishimaru et al. 2010),
OsYSL15 (Lee et al. 2009a), and OsYSL9 (Senoura et al. 2017). OsYSL2 and
OsYSL15 are responsible for the uptake of Fe(II)–NA and Fe(III)–DMA, respec-
tively, whereas OsYSL9 is involved in the transport of both complexes. Although
only a minimal Fe increase was detected in T1 brown rice of OsYSL9 and OsYSL15
OE lines, overexpression of OsYSL2 resulted in a fourfold increase in Fe concentra-
tion in T1 polished rice.
Recently, two studies reported significant Fe concentration increases in rice
grains by overexpressing multiple genes. Wu et al. (2019) overexpressed the
AtNAS1, Pvfer, and AtNRAMP3 genes, resulting in 13.65 μg/g Fe in polished grains
under greenhouse conditions. Trijatmiko et al. (2016), on the other hand, reported
an Fe concentration of 15 μg/g in polished grains under field conditions by overex-
pressing nicotianamine synthase (OsNAS2) and soybean ferritin (SoyferH-1) genes.
This high-Fe rice event did not show a yield penalty in field trials in the Philippines
and Colombia. The grain quality of the transgenic event was similar to that of the
IR64 genotype background used for transformation. These two studies show the
potential for further advanced development of a biofortified rice product with ele-
vated Fe concentration.
6 Future Directions
There is little prospect of achieving the target Fe concentration to reach 30% of the
EAR via conventional plant breeding because of limited genetic variation in the Fe
concentration in polished grains within the global rice germplasm collection. On the
contrary, recent studies show that the target concentration can be achieved via
genetic engineering. Under the current regulations in different countries, it usually
takes 8-10 years from proof of concept to market release of genetically modified
(GM) crops (Mumm 2013). The best performing events need to be selected from
large-scale transformation. These events, aside from showing stable and acceptable
trait expression, should have a simple integration of transgenes and have no
disruption of endogenous genes with important phenotypic manifestation.

Significant efforts need to be dedicated to collecting data for premarket safety assur-
ance of the potential product, such as detailed molecular characterization of the
event, safety of newly expressed proteins, novel protein expression and dietary
exposure analysis, comparative nutritional analysis, and some environmental safety
data collected from multi-location and multi-season field trials. After a biosafety per-
mit for propagation of the event has been secured, developers need to follow similar
procedures as in conventional breeding of a product for variety registration.
High Fe content is a consumer trait. To facilitate adoption by farmers, this micro-
nutrient trait needs to be combined with agronomic traits. The most prospective
agronomic trait for farmer adoption is higher yield. For this purpose, the possibility
to incorporate the high-Fe trait into hybrid rice needs to be explored. The high-yield
trait obtained through heterosis can be combined with nutritional traits. In addition,
we observed that overexpression of some genes for Fe enhancement might cause
unintended effects such as a yield decrease when the plants were in a homozygous
condition. However, this is not detrimental when only one allele is present in hemi-
zygous condition, and in some cases the micronutrient concentration can be retained
in the hemizygous condition. In such a situation, hybrid rice can be a solution to
achieve higher micronutrient concentration using a wider gene pool.
Recent developments in the regulation of genome-edited crops in different coun-
tries have attracted many scientists to work on genome editing. In the United States,
certain categories of modified plants would be exempted from the regulations if the
product can also be created through conventional breeding (APHIS 2020). In
Argentina, a resolution on New Breeding Techniques (NBT) was passed in 2015,
which rules that, if a transgene is not used or a transgene is used but is removed in
the final product, it will not be classified as a GM product (Friedrichs et al. 2019).
Precise genome editing technology that produces a double-stranded break in the
genome, followed by the repair of this break that leads to a mutation or deletion,
may result in a product that meets the non-GM regulatory classification.
Increased Fe concentration in polished grains was observed on the T-DNA inser-
tion mutant of OsVIT2 (Bashir et al. 2013). The insertion of the T-DNA in the pro-
moter region in this mutant led to the knockdown of the OsVIT2 gene (Bashir et al.
2013). Genome editing can be used to mutate the regulatory elements of genes
involved in Fe homeostasis. This type of editing could result in altered expression
of the genes and consequently enhanced Fe concentration in rice grains.
Although genome editing has great potential to ease the burden of regulatory
requirements, genetic engineering will still be the primary tool to achieve the target
Fe concentration. Overexpression of other genes involved in Fe homeostasis needs
to be explored. Special attention needs to be given to the possible yield decrease in
transgenic plants. Fine-tuning the expression of the genes by choosing a moderate
constitutive promoter or tissue- and/or stage-specific promoter may need to be
tested to avoid any yield penalty.
References
APHIS (2020) Movement of certain genetically engineered organisms. 85 FR 29790. Federal reg-
ister document: 2020-10638. APHIS, Riverdale, MD
Aung MS, Masuda H, Kobayashi T, Nakanishi H, Yamakawa T, Nishizawa NK (2013) Iron bio-
fortification of Myanmar rice. Front Plant Sci 4:158. https://doi.org/10.3389/fpls.2013.00158
Banakar R, Alvarez Fernández Á, Abadía J, Capell T, Christou P (2017a) The expression of heter-
ologous Fe (III) phytosiderophore transporter HvYS1 in rice increases Fe uptake, translocation
and seed loading and excludes heavy metals by selective Fe transport. Plant Biotechnol J
15(4):423–432. https://doi.org/10.1111/pbi.12637
Banakar R, Alvarez Fernandez A, Díaz-Benito P, Abadia J, Capell T, Christou P (2017b)
Phytosiderophores determine thresholds for iron and zinc accumulation in biofortified rice
endosperm while inhibiting the accumulation of cadmium. J Exp Bot 68(17):4983–4995.
https://doi.org/10.1093/jxb/erx304
Bashir K, Inoue H, Nagasaka S, Takahashi M, Nakanishi H, Mori S, Nishizawa NK (2006) Cloning
and characterization of deoxymugineic acid synthase genes from graminaceous plants. J Biol
Chem 281:32395. https://doi.org/10.1074/jbc.M604133200
Bashir K, Takahashi R, Akhtar S, Ishimaru Y, Nakanishi H, Nishizawa NK (2013) The knockdown
of OsVIT2 and MIT affects iron localization in rice seed. Rice 6:31. https://doi.org/10.118
6/1939-8433-6-31
Bashir K, Nozoye T, Nagasaka S, Rasheed S, Miyauchi N, Seki M et al (2017) Paralogs and
mutants show that one DMA synthase functions in iron homeostasis in rice. J Exp Bot 68:1785.
https://doi.org/10.1093/jxb/erx065
Boonyaves K, Gruissem W, Bhullar NK (2016) NOD promoter-controlled AtIRT1 expression
functions synergistically with NAS and FERRITIN genes to increase iron in rice grains. Plant
Mol Biol 90(3):207–215. https://doi.org/10.1007/s11103-015-0404-0
Boonyaves K, Wu TY, Gruissem W, Bhullar NK (2017) Enhanced grain iron levels in iron-
regulated metal transporter, nicotianamine synthase, and ferritin gene cassette. Front Plant Sci
8:130. https://doi.org/10.3389/fpls.2017.00130
Borrill P, Connorton JM, Balk J, Miller AJ, Sanders D, Uauy C (2014) Biofortification of wheat
grain with iron and zinc: integrating novel genomic resources and knowledge from model
crops. Front Plant Sci 5:53. https://doi.org/10.3389/fpls.2014.00053
Bouis HE, Saltzman A (2017) Improving nutrition through biofortification: a review of evidence
from HarvestPlus, 2003 through 2016. Glob Food Secur 12:49–58. https://doi.org/10.1016/J.
GFS.2017.01.009
Bouis HE, Hotz C, McClafferty B, Meenakshi JV, Pfeiffer WH (2011) Biofortification: a new tool
to reduce micronutrient malnutrition. Food Nutr Bull 32(1 Suppl 1):S31–S40. https://doi.org/1
0.1177/15648265110321S105
Cailliatte R, Schikora A, Briat JF, Mari S, Curie C (2010) High-affinity manganese uptake by the
metal transporter nramp1 is essential for Arabidopsis growth in low manganese conditions.
Plant Cell 22:904. https://doi.org/10.1105/tpc.109.073023
Che J, Yokosho K, Yamaji N, Ma JF (2019) A vacuolar phytosiderophore transporter alters iron
and zinc accumulation in polished rice grains. Plant Physiol 181(1):276–288. https://doi.
org/10.1104/pp.19.00598
Connorton JM, Balk J, Rodríguez-Celma J (2017) Iron homeostasis in plants: a brief overview.
Metallomics 9(7):813–823. https://doi.org/10.1039/C7MT00136C
Curie C, Panaviene Z, Loulergue C, Dellaporta SL, Briat JF, Walker EL (2001) Maize yellow
stripe1 encodes a membrane protein directly involved in Fe(III) uptake. Nature 409:346.
https://doi.org/10.1038/35053080
Curie C, Cassin G, Couch D, Divol F, Higuchi K, Le Jean M et al (2009) Metal movement within
the plant: contribution of nicotianamine and yellow stripe 1-like transporters. Ann Bot 103:1.
https://doi.org/10.1093/aob/mcn207
Díaz-Benito P, Banakar R, Rodríguez-Menéndez S, Capell T, Pereiro R, Christou P, Abadia J,

Fernández B, Álvarez-Fernández A (2018) Iron and zinc in the embryo and endosperm of rice
(Oryza sativa L.) seeds in contrasting 2′-deoxymugineic acid/nicotianamine scenarios. Front
Drakakaki G, Christou P, Stöger E (2000) Constitutive expression of soybean ferritin cDNA in
transgenic wheat and rice results in increased iron levels in vegetative tissues but not in seeds.
Transgenic Res 9:445. https://doi.org/10.1023/A:1026534009483
Eide D, Broderius M, Fett J, Guerinot ML (1996) A novel iron-regulated metal transporter from
plants identified by functional expression in yeast. Proc Natl Acad Sci U S A 93:5624. https://
doi.org/10.1073/pnas.93.11.5624
Friedrichs S, Takasu Y, Kearns P, Dagallier B, Oshima R, Schofield J, Moreddu C (2019)
Meeting report of the OECD conference on “Genome Editing: Applications in Agriculture—
Implications for Health, Environment and Regulation”. Transgenic Res 28(3–4):419–463.
https://doi.org/10.1007/s11248-019-00154-1
Garcia-Oliveira AL, Chander S, Ortiz R, Menkir A, Gedil M (2018) Genetic basis and breeding
perspectives of grain iron and zinc enrichment in cereals. Front Plant Sci 9:937. https://doi.
org/10.3389/fpls.2018.00937
Goto F, Yoshihara T, Shigemoto N, Toki S, Takaiwa F (1999) Iron fortification of rice seed by the
soybean ferritin gene. Nat Biotechnol 17(3):282–286. https://doi.org/10.1038/7029
Gregorio G, Senadhira D, Htut T (1999) Improving iron and zinc value of rice for human nutrition.
Agric Dév 23:77–81
Guerinot ML (2000) The ZIP family of metal transporters. Biochim Biophys Acta Biomembr
1465:190. https://doi.org/10.1016/S0005-2736(00)00138-3
HarvestPlus (n.d.). https://www.harvestplus.org/. Accessed 14 Jul 2020
Higuchi K, Suzuki K, Nakanishi H, Yamaguchi H, Nishizawa NK, Mori S (1999) Cloning of nico-
tianamine synthase genes, novel genes involved in the biosynthesis of phytosiderophores. Plant
Physiol 119(2):471–479. https://doi.org/10.1104/pp.119.2.471
Hoa TTC, Lan NTP (2004) Effect of milling technology on iron content in rice grains of some
leading varieties in the Mekong delta. Omonrice 12:38–44
Inoue H, Mizuno D, Nakanishi H, Mori S, Takahashi M, Nishizawa NK (2004) A rice FRD3-like
(OsFRDL1) gene is expressed in the cells involved in long-distance transport. Soil Sci Plant
Nutr 50:1133. https://doi.org/10.1080/00380768.2004.10408586
Inoue H, Kobayashi T, Nozoye T, Takahashi M, Kakei Y, Suzuki K et al (2009) Rice OsYSL15
is an iron-regulated iron (III)-deoxymugineic acid transporter expressed in the roots and is
essential for iron uptake in early growth of the seedlings. J Biol Chem 284:3470. https://doi.
org/10.1074/jbc.M806042200
Ishimaru Y, Suzuki M, Tsukamoto T, Suzuki K, Nakazono M, Kobayashi T et al (2006) Rice plants
take up iron as an Fe 3+ -phytosiderophore and as Fe 2+. Plant J 45(3):335–346. https://doi.
org/10.1111/j.1365-313X.2005.02624.x
Ishimaru Y, Masuda H, Bashir K, Inoue H, Tsukamoto T, Takahashi M et al (2010) Rice metal-
nicotianamine transporter, OsYSL2, is required for the long-distance transport of iron and
manganese. Plant J 62(3):379–390. https://doi.org/10.1111/j.1365-313X.2010.04158.x
James SL, Abate D, Abate KH, Abay SM, Abbafati C, Abbasi N et al (2018) Global, regional, and
national incidence, prevalence, and years lived with disability for 354 diseases and injuries
for 195 countries and territories, 1990-2017: a systematic analysis for the Global Burden of
Disease Study 2017. Lancet 392:1789. https://doi.org/10.1016/S0140-6736(18)32279-7
Johnson AAT, Kyriacou B, Callahan DL, Carruthers L, Stangoulis J, Lombi E, Tester M (2011)
Constitutive overexpression of the OsNAS gene family reveals single-gene strategies for effec-
tive iron- and zinc-biofortification of rice endosperm. PLoS One 6(9):e24476. https://doi.
Khalekuzzaman M, Datta K, Oliva N, Alam MF, Joarder OI, Datta SK (2006) Stable integration,
expression and inheritance of the ferritin gene in transgenic elite indica rice cultivar BR29 with
enhanced iron level in the endosperm. Indian J Biotechnol 5:26
Kim SA, Guerinot ML (2007) Mining iron: iron uptake and transport in plants. FEBS Lett
581:2273. https://doi.org/10.1016/j.febslet.2007.04.043
Kobayashi T, Nishizawa NK (2012) Iron uptake, translocation, and regulation in higher plants.
Annu Rev Plant Biol 63:131. https://doi.org/10.1146/annurev-arplant-042811-105522
Kobayashi T, Suzuki M, Inoue H, Itai RN, Takahashi M, Nakanishi H et al (2005) Expression
of iron-acquisition-related genes in iron-deficient rice is co-ordinately induced by partially
conserved iron-deficiency-responsive elements. J Exp Bot 56:1305. https://doi.org/10.1093/
jxb/eri131
Kobayashi T, Ozu A, Kobayashi S, An G, Jeon JS, Nishizawa NK (2019) OsbHLH058 and
OsbHLH059 transcription factors positively regulate iron deficiency responses in rice. Plant
Mol Biol 101:471. https://doi.org/10.1007/s11103-019-00917-8
Koike S, Inoue H, Mizuno D, Takahashi M, Nakanishi H, Mori S, Nishizawa NK (2004) OsYSL2
is a rice metal-nicotianamine transporter that is regulated by iron and expressed in the phloem.
Plant J 39(3):415–424. https://doi.org/10.1111/j.1365-313X.2004.02146.x
Lanquar V, Lelièvre F, Bolte S, Hamès C, Alcon C, Neumann D et al (2005) Mobilization of vacu-
olar iron by AtNRAMP3 and AtNRAMP4 is essential for seed germination on low iron. EMBO
J 24:4041. https://doi.org/10.1038/sj.emboj.7600864
Lee S, An G (2009) Over-expression of OsIRT1 leads to increased iron and zinc accumulations in
rice. Plant Cell Environ 32:408. https://doi.org/10.1111/j.1365-3040.2009.01935.x
Lee S, Chiecko JC, Kim SA, Walker EL, Lee Y, Guerinot ML, An G (2009a) Disruption of OsYSL15
leads to iron inefficiency in rice plants. Plant Physiol 150:786. https://doi.org/10.1104/
pp.109.135418
Lee S, Jeon US, Lee SJ, Kim Y-K, Persson DP, Husted S et al (2009b) Iron fortification of rice
seeds through activation of the nicotianamine synthase gene. Proc Natl Acad Sci U S A
106(51):22014–22019. https://doi.org/10.1073/PNAS.0910950106
Lee S, Kim YS, Jeon US, Kim YK, Schjoerring JK, An G (2012) Activation of rice nicotianamine
synthase 2 (OsNAS2) enhances iron availability for biofortification. Mol Cell 33(3):269–275.
https://doi.org/10.1007/s10059-012-2231-3
Lucca P, Hurrell R, Potrykus I (2002) Fighting iron deficiency anemia with iron-rich rice. J Am
Coll Nutr 21:184S–190S. https://doi.org/10.1080/07315724.2002.10719264
Martínez C, Borrero J, Taboada R, Viana J, Neves P, Narvaez L et al (2010) Rice cultivars
with enhanced iron and zinc content to improve human nutrition. In: Presented at the 28th
International Rice Research Conference, 8–12 November 2010. Hanoi, Vietnam
Masuda H, Usuda K, Kobayashi T, Ishimaru Y, Kakei Y, Takahashi M et al (2009) Overexpression
of the barley nicotianamine synthase gene HvNAS1 increases iron and zinc concentrations in
rice grains. Rice 2(4):155–166. https://doi.org/10.1007/s12284-009-9031-1
Masuda H, Ishimaru Y, Aung MS, Kobayashi T, Kakei Y, Takahashi M et al (2012) Iron bioforti-
fication in rice by the introduction of multiple genes involved in iron nutrition. Sci Rep 2:543.
https://doi.org/10.1038/srep00543
Masuda H, Kobayashi T, Ishimaru Y, Takahashi M, Aung MS, Nakanishi H et al (2013) Iron-
biofortification in rice by the introduction of three barley genes participated in mugineic
acid biosynthesis with soybean ferritin gene. Front Plant Sci 4:132. https://doi.org/10.3389/
fpls.2013.00132
Mayer JE, Pfeiffer WH, Beyer P (2008) Biofortified crops to alleviate micronutrient malnutrition.
Curr Opin Plant Biol 11:166. https://doi.org/10.1016/j.pbi.2008.01.007
Mumm RH (2013) A look at product development with genetically modified crops: examples from
maize. J Agric Food Chem 61:8254. https://doi.org/10.1021/jf400685y
Nozoye T, Nagasaka S, Kobayashi T, Takahashi M, Sato Y, Sato Y et al (2011) Phytosiderophore
efflux transporters are crucial for iron acquisition in graminaceous plants. J Biol Chem
286:5446. https://doi.org/10.1074/jbc.M110.180026
Nozoye T, Nagasaka S, Kobayashi T, Sato Y, Uozumi N, Nakanishi H, Nishizawa NK (2015) The
phytosiderophore efflux transporter TOM2 is involved in metal transport in rice. J Biol Chem
290(46):27688–27699. https://doi.org/10.1074/jbc.M114.635193
Ogo Y, Itai RN, Kobayashi T, Aung MS, Nakanishi H, Nishizawa NK (2011) OsIRO2 is respon-
sible for iron utilization in rice and improves growth and yield in calcareous soil. Plant Mol
Biol 75:593-605. https://doi.org/10.1007/s11103-011-9752-6
Oliva N, Chadha-Mohanty P, Poletti S, Abrigo E, Atienza G, Torrizo L et al (2014) Large-scale
production and evaluation of marker-free indica rice IR64 expressing phytoferritin genes. Mol
Breed 33:23. https://doi.org/10.1007/s11032-013-9931-z
Paul S, Ali N, Gayen D, Datta SK, Datta K (2012) Molecular breeding of Osfer 2 gene to increase
iron nutrition in rice grain. GM Crops Food 3(4):310–316. https://doi.org/10.4161/gmcr.22104
Paul S, Ali N, Datta SK, Datta K (2014) Development of an iron-enriched high-yielding indica rice
cultivar by introgression of a high-iron trait from transgenic iron-biofortified rice. Plant Foods
Hum Nutr 69:203. https://doi.org/10.1007/s11130-014-0431-z
Qu LQ, Yoshihara T, Ooyama A, Goto F, Takaiwa F (2005) Iron accumulation does not paral-
lel the high expression level of ferritin in transgenic rice seeds. Planta 222:225. https://doi.
org/10.1007/s00425-005-1530-8
Robinson NJ, Procter CM, Connolly EL, Guerinot ML (1999) A ferric-chelate reductase for iron
uptake from soils. Nature 397:694. https://doi.org/10.1038/17800
Senoura T, Sakashita E, Kobayashi T, Takahashi M, Aung MS, Masuda H et al (2017) The iron-
chelate transporter OsYSL9 plays a role in iron distribution in developing rice grains. Plant
Mol Biol 95(4–5):375–387. https://doi.org/10.1007/s11103-017-0656-y
Singh SP, Gruissem W, Bhullar NK (2017) Single genetic locus improvement of iron,
zinc and β-carotene content in rice grains. Sci Rep 7(1):6883. https://doi.org/10.1038/
s41598-017-07198-5
Slamet-Loedin IH, Johnson-Beebout SE, Impa S, Tsakirpaloglou N (2015) Enriching rice
with Zn and Fe while minimizing Cd risk. Front Plant Sci 6:1–9. https://doi.org/10.3389/
fpls.2015.00121
Stoltzfus RJ (2001) Iron-deficiency anemia: reexamining the nature and magnitude of the public
health problem. J Nutr 131:697S–700S
Suzuki M, Takahashi M, Tsukamoto T, Watanabe S, Matsuhashi S, Yazaki J et al (2006)
Biosynthesis and secretion of mugineic acid family phytosiderophores in zinc-deficient barley.
Plant J 48:85. https://doi.org/10.1111/j.1365-313X.2006.02853.x
Suzuki M, Morikawa KC, Nakanishi H, Takahashi M, Saigusa M, Mori S, Nishizawa
NK (2008) Transgenic rice lines that include barley genes have increased tolerance to
low iron availability in a calcareous paddy soil. Soil Sci Plant Nutr 54:77. https://doi.
org/10.1111/j.1747-0765.2007.00205.x
Takahashi M, Yamaguchi H, Nakanishi H, Shioiri T, Nishizawa NK, Mori S (1999) Cloning two
genes for nicotianamine aminotransferase, a critical enzyme in iron acquisition (strategy II) in
graminaceous plants. Plant Physiol 121:947. https://doi.org/10.1104/pp.121.3.947
Trijatmiko KR, Dueñas C, Tsakirpaloglou N, Torrizo L, Arines FM, Adeva C et al (2016)
Biofortified indica rice attains iron and zinc nutrition dietary targets in the field. Sci Rep
6:19792. https://doi.org/10.1038/srep19792
Vasconcelos M, Datta K, Oliva N, Khalekuzzaman M, Torrizo L, Krishnan S et al (2003) Enhanced
iron and zinc accumulation in transgenic rice with the ferritin gene. Plant Sci 164:371. https://
doi.org/10.1016/S0168-9452(02)00421-1
Virk P, Barry G, Das A, Lee J, Tan J (2006) Research status of micronutrient rice development
in Asia. In: Proceedings of the International Symposium on Rice Biofortification: Improving
Human Health Through Biofortified Rice, 15 September 2006, Suwon, Korea, pp 123–148
Virk P, Barry G, Bouis H (2007) Genetic enhancement for the nutritional quality of rice. In:
Genetic enhancement for the nutritional quality of rice. Proceedings of the 26th International
Rice Research Conference, 9–12 October 2006. Macmillan India Ltd, New Delhi, pp 279–285
WHO (2002) The world health report 2002, vol 16. World Health Organization, Geneva
WHO/FAO (2004) Vitamin and mineral requirements in human nutrition, 2nd edn. WHO, Geneva.
https://doi.org/10.1128/AAC.03728-14
Wirth J, Poletti S, Aeschlimann B, Yakandawala N, Drosse B, Osorio S et al (2009) Rice endo-

sperm iron biofortification by targeted and synergistic action of nicotianamine synthase and
ferritin. Plant Biotechnol J 7:631. https://doi.org/10.1111/j.1467-7652.2009.00430.x
Wu TY, Gruissem W, Bhullar NK (2018) Facilitated citrate-dependent iron translocation increases
rice endosperm iron and zinc concentrations. Plant Sci 270:13. https://doi.org/10.1016/j.
plantsci.2018.02.002
Wu TY, Gruissem W, Bhullar NK (2019) Targeting intracellular transport combined with efficient
uptake and storage significantly increases grain iron and zinc levels in rice. Plant Biotechnol J
17(1):9–20. https://doi.org/10.1111/pbi.12943
Yokosho K, Yamaji N, Ueno D, Mitani N, Jian FM (2009) OsFRDL1 is a citrate transporter required
for efficient translocation of iron in rice. Plant Physiol 149:297. https://doi.org/10.1104/
pp.108.128132
Yoneyama T, Ishikawa S, Fujimaki S, Yoneyama T, Ishikawa S, Fujimaki S (2015) Route and regu-
lation of zinc, cadmium, and iron transport in rice plants (Oryza sativa L.) during vegetative
growth and grain filling: metal transporters, metal speciation, grain Cd reduction and Zn and
Fe biofortification. Int J Mol Sci 16(8):19111–19129. https://doi.org/10.3390/ijms160819111
Zhang Y, Xu YH, Yi HY, Gong JM (2012) Vacuolar membrane transporters OsVIT1 and OsVIT2
modulate iron translocation between flag leaves and seeds in rice. Plant J 72:400. https://doi.
org/10.1111/j.1365-313X.2012.05088.x
Zhang C, Shinwari KI, Luo L, Zheng L (2018) OsYSL13 is involved in iron distribution in rice. Int
J Mol Sci 19:3537. https://doi.org/10.3390/ijms19113537
Zheng L, Cheng Z, Ai C, Jiang X, Bei X, Zheng Y et al (2010) Nicotianamine, a novel enhancer
of rice iron bioavailability to humans. PLoS One 5(4):e10190. https://doi.org/10.1371/journal.
pone.0010190
Correction to: Crop Establishment
in Direct-Seeded Rice: Traits,
Physiology, and Genetics
Correction to:
Chapter 6 in: J. Ali, S. H. Wani (eds.), Rice Improvement,
https://doi.org/10.1007/978-3-030-66530-2_6
“Owing to an error on the part of the editor and corresponding chapter author, the
author sequence in the chapter opening page of chapter Crop Establishment in
Direct-Seeded Rice: Traits, Physiology, and Genetics was presented wrongly. The
author sequence has now been updated to be Fergie Ann Quilloy, Benedick Labaco,
Carlos Casal Jr., Shalabh Dixit in the chapter opening page, table of contents, and
wherever applicable throughout the book.”
The updated version of this chapter can be found at

https://doi.org/10.1007/978-3-030-66530-2_6
© The Author(s) 2021 C1

https://doi.org/10.1007/978-3-030-66530-2_15
Index
A ethylene, 181
ABA-responsive element (ABRE), 82 expression analysis, 181
Abiotic stresses, 9, 12, 17–19, 253 genetic factors, 182, 183, 185
Abscisic acid (ABA), 75, 181, 229, 253, 289 genotypes, 179, 180
Acaryochloris, 43 hypoxia, 181
Acetolactate synthase gene (OsALS), 21 hypoxic conditions, 178
Adenosine triphosphate (ATP), 178 matrix polysaccharides, 182
ADP glucose pyrophosphorylase mechanism of action, 180
(ADPGPPase), 11 nonenzymatic proteins, 182
Advanced yield trial (AYT), 130 O2 concentration, 179
Aeluropus littoralis, 228 water stress, 179
Aerobic rice development, 154 rice genotypes, 178
Agronomic nutrient management (ANM) seed longevity
system, 352 crop yield, 186
Agronomic traits, 456 genetic factors, 187, 188
Alcohol dehydrogenase (ADH), 181 life cycle, 186
Alcoholic fermentation (AF) pathway, 178 nongenetic factors, 186
Aldehyde dehydrogenase (ALDH), 181 physiology and molecular mechanisms,
Allium sativum, 406 186, 187
Alternate wetting and drying (AWD), 153, rice varieties, 186
303, 461 seedling vigor
Amiprophos-methyl (APM), 431 crop establishment, 188
Anaerobic germination (AG) genetic factors, 190, 193
breeding rice, 193–195 physiology and molecular mechanisms,
crop establishment, 178 188, 190
physiology and molecular mechanisms soil/water, 188
AF, 178 weed competition, 188
amylases, 180 seeds, 178
anaerobic response index, 178 weed control mechanism, 178
anoxia, 178–181 Androgenesis, 426–430, 436, 442
ATPs, 178 Anther culture, 426, 427, 429–431, 434, 436,
carbohydrate, 180 437, 441, 442
carbon, 181 Antioxidant enzymes, 186
cellulose microfibrils, 182 Antioxidant polyphenols, 187
efficient water imbibition, 180 Antioxidant production, 186
energy, 181 Apparent amylose content (AAC), 133

https://doi.org/10.1007/978-3-030-66530-2
488 Index
Arabidopsis phytochrome, 8 Atmospheric CO2 concentrations, 35

Arabidopsis, 37, 44, 47, 48, 187, 245, 473 Atmospheric methane, 173
Arsenic contamination, 287, 302, 303, 305 ATP-binding cassette (ABC) transporter, 300
Arsenic-induced toxicity symptoms
germination, 289, 291
reproductive growth, 291, 292 B
vegetative growth, 291 Bacillus thuringiensis, 15, 16, 400
Arsenic speciation, 288, 305 Backcross-selective introgression lines
Arsenic stress responses (EB-SILs), 63, 81
arsenate uptake, 297 Bacterial blight (BB), 321, 322
arsenite uptake, 295, 296 Bacterial leaf streak (BLS), 325, 350
biological function, 299 Bangladesh Rice Research Institute
biological system, 284 (BRRI), 302
biotic and abiotic stresses, 282 Bayesian network analysis, 456
cereal crop, 282 Biochemical factors, 187
climate change, 283 Biochemical mechanisms, 473
detoxification, 299 Biofortification, 438, 439, 450
enzymatic reduction, 299 agronomic traits, 481
factors, 295 conventional plant breeding, 472, 473
food demand, 283 endogenous genes, 481
global food security, 283 Fe concentration, 472, 480, 481
grain and straw, 283 genetic engineering, 475, 480
groundwater, 283 genetically modified (GM) crops, 480
growth stages, 290 genome editing, 481
health-related concerns, 283 genome editing technology, 481
heavy metal contamination, 283, 285 genome-edited crops, 481
human agricultural advancement, 282 homozygous condition, 481
mitigation strategies, 303, 304 iron deficiency, 472
oxidative stress response, 300, 301 iron uptake, 473, 475
paddy soil micronutrient deficiency, 472
climate change, 286 molecular characterization, 481
fungicides, 286 multi-location and multi-season field
groundwater, 286 trials, 481
pesticides, 286 nutritional deficiency, 472
plant nutrients, 288 nutritional traits, 481
rice ecosystem, 287, 288 transgenic plants, 481
subsurface mobilization, 286 translocation, 473, 475
surface water, 286 Biofortification Priority Index, 451
QTL, 292–294 Bioinformatics
rainfed ecosystem, 282 AI, 362
rice production and consumers, 282 datasets, 360
rice-growing environments, 288 genome databases, 360
root epidermis and exodermis, 299 GWAS, 361
root plaque formation, 301, 302 mapping QTLs and genes, 361
state of knowledge gaps, 302, 303 ML, 362
translocation, 296–298 scientific community, 360
uptake and storage, 298 speeding up breeding, 362
worldwide distribution, 287 whole-genome sequence, 360
Arthrobacter globiformis, 18 Biological system, 284
Artificial genome doubling, 431 Biophysical stresses, 12
Artificial intelligence (AI), 362 Biosynthesis, 41
Ascorbate peroxidase (APEX), 229 Biotic processes, 204
Asian rice gall midge (ARGM), 381 Biotic stress, 12, 13, 78, 79
Index 489
Bipolaris oryzae, 353 Cold-stress response, 257

Blast disease, 322 Cold-tolerant genotypes, 262
Breeding approaches Comparative transcriptome analysis, 256
genetic transformation, 264, 265 Conventional breeding-selection
genome editing, 265, 266 approaches, 15
LTS tolerance, 261–263 Conventional plant breeding, 472, 473
plant breeders, 261 Critical sterility temperature point
SIB, 263, 264 (CSTP), 111
strategies, 261 controlled-temperature screening
Breeding rice, 193–195 conditions, 113
Breeding strategies, 346, 347 field screening, 113, 114
Broad-spectrum resistance genes, 351, 352 seed production, 113
Brown planthopper (BPH), 16, 436 sequential seeding, 113, 114
temperatures, 112
tracking technique, 112
C Crop plants, 5
Calcineurin B-like protein kinase Crop protection, 396
(CIPK15), 181 Crop simulation models, 173–174
Callus, 427–431 Crystalline, 400
Calmodulin-binding transcription activators Culture technology, 437
(CAMTAs), 253 Cumulative drought stress response index
Calvin–Benson-Cycle enzymes, 40, 41 (CDSRI), 151
Candidate gene cloning, 408 Cyanobacterium, 33
Carbohydrates, 8 Cyclic electron transport, 42
Carbon concentrating mechanism (CCM), 39 Cytokinin biosynthesis, 257
Carboxysome, 40 Cytoplasmic male sterile (CMS), 3, 100, 440
Catalase (CAT), 229
Cellular metabolic activities, 186
Cell-wall components, 353 D
CFTP, see Critical sterility temperature Damage-associated molecular patterns
point (CSTP) (DAMPs), 348
Characterization-based approach, 408 Datura innoxia, 427
Chemosensory protein (CSP) genes, 398 Defense-related genes (DR), 348
Chloroplast, 49, 50 Deoxymugineic acid synthase (DMAS)
Chloroplast electron transport capacity, 42 enzymes, 473
Chromosome, 253 Designed QTL pyramiding (DQP), 65, 81, 85
Chromosome segment substitution lines Differentially accumulated proteins
(CSSLs), 395 (DAPs), 121
Climate change, 173–176, 204, 205 Differentially expressed genes (DEGs), 257
Climatic environments, 205 Dimethylarsinic acid (DMA), 288
Clustered regularly interspaced short Dioscorea batatas, 406
palindromic repeats (CRISPR), 21, Direct-seeded rice (DSR), 74, 303
356, 357 climate change, 173–176
Clustered regularly interspaced short crop establishment, 173, 196
palindromic repeats/CRISPR- ecosystems, 172
associated protein (CRISPR/ environment, 173
Cas), 265 rainfed areas, 172
CO2 concentration, 32 rice production, 195
CO2 diffusion, 49, 50 topographical location, 172
CO2 transport, 32, 38 water and labor requirements, 195–196
Cold stress (CS), 75 water scarcity, 173–176
COLD1 gene, 254 water supply, 172
Cold-responsive (COR) genes, 230, 245 worldwide rice supply, 171
490 Index
Disease resistance microspore development, 427, 429

breeding microspore stage, 427
bacterial blight, 337, 344 microspores, 430, 442
blast resistance, 344 nitrogen composition, 429
broad-spectrum resistance, 337 phenomics, 426
conventional breeding methods, 326 physiology, 427
disease-resistant cultivars, 326 plant growth regulators, 429
DNA sequencing, 344 ploidy analysis
gene-linked molecular markers, 337 chromosome, 432
MABB, 344 cytological approach, 433
marker-assisted selection, 337 flow cytometry, 433
MAS, 344 high-throughput cell analysis, 433
molecular markers, 337 homozygous lines, 431
multiple disease, 346, 347 molecular markers, 434
pathotypes, 337 morphological evaluation, 432
pyramiding, 345, 346 nuclear DNA content, 432
varieties, 346 pollen fertility analysis, 433
genetics, 325, 326 (see also Molecular technology, 426
mechanisms) Double-stranded RNAs (dsRNA), 396
Doubled-haploid (DH) approach, 125, 454 Drought, 149–152, 156, 157
advantages, 427
albinos, 430
androgenesis, 426, 427, 430 E
application Early seed germination (ESG), 74
biofortification, 438, 439 Early seedling vigor (ESV), 74
cytoplasmic and nuclear genomes, 440 Eating and cooking quality (ECQ), 133
development, 437, 438 Economic water scarcity, 174
food security, 434 Effector-binding elements (EBEs), 358
gene stacking, 440 Effector-triggered immunity (ETI), 348, 408
GS, 441 Efficient screening technologies, 352
hybrid rice, 434, 435 Electron transport, 41–45, 47, 48
MAS, 441 Endogenous switching regression (ESR)
photosensitive rice genotypes, 434 model, 86
QTLs, 435–437 Endomitosis, 431
reverse breeding, 440 Environment-sensitive genic male sterility
transgenic research, 441 (EGMS), 4
basal media, 429 Enzymes, 451
biotechnological approaches, 427 Erwinia uredovora, 20
breeding cycle, 426 Escherichia coli, 161
carbohydrate source, 429 Estimated Average Requirement (EAR), 472
chemical and physical factors, 428 Ethyl methane sulfonate (EMS), 320, 395
chromosome doubling, 427
conventional breeding, 427
crop improvement, 426, 427 F
culture efficiency, 430 Ferric-chelate oxidase 2 (FRO2), 473
factors, 427 Fertility-sterility alteration, 115
genomic regions, 442 Flow cytometry, 433
genomics, 426 Food-based solutions, 452
gynogenesis, 426 Food security, 60
high-yielding rice cultivars, 426 Free-air CO2 enrichment (FACE)
in vitro morphogenic responses, 430 conditions, 41
indica rice, 426, 442 Functional genetic units (FGUs), 84
japonica cultivars, 426 Fungicides, 286, 353
Index 491
G achievements, 86
Galanthus nivalis agglutinin (GNA), 406 advanced genotyping technology, 80
Gall midge (GM), 16 alkalinity, 61
Gelatinization temperature (GT), 133 biotic and abiotic stress, 62
Gel-based protein, 259 breeding and population
Gene editing, 21 development, 63, 65
Gene expression analysis, 264 breeding strategy, 80
Gene transfer, 399, 400, 407 candidate genes, 68
General combining ability (GCA), 130 complex abiotic stress tolerances, 62
Genes, 292, 293, 297, 300, 303, 304 conventional and marker-assisted breeding
Genetic basis, 473 approaches, 62
Genetic breeding, 261 conventional breeding approaches, 62
Genetic engineering, 406, 475, 480 crop growth stages, 61
Genetic modification (GM) technology, 320 crop yield, 61
Genetic resources, 208, 209 development, 62
Genetic transformation, 264, 265 distribution, 81
Genetics, 325, 326 drought, 61
Genome editing, 265, 266 ecosystems, 62
Genome editing approach, 398, 399 food demand, 60
Genome editing tools (GETs), 265 food security, 60
biotic stress factors, 358, 359 genetics
CRISPR, 356, 357 biotic and abiotic stresses, 67
disease resistance, 354 biotic stress, 78, 79
genome engineering, 354 drought tolerance, 67, 69, 70
introgress disease resistance, 354 grain quality, 76–78
MNs, 355 LTS, 75, 76
nonbiotic stress-related phenotypes, 359 NUE, 73
ZFNs, 355, 356 QTLs and breeding materials, 67
Genome-wide association studies (GWAS), salinity tolerance, 70, 71
183, 232, 255, 256, 361, 456 submergence tolerance, 71, 72
Genomic estimated breeding value (GEBV), weed-competitive (WC) ability
159, 457 traits, 74, 75
Genomic resources, 256 genotyping technologies, 79
Genomic selection (GS), 160, 441, 457 grain quality, 62, 63
Genomic tools, 17 green traits, 62, 63
Genomics growth of population, 60
genome editing approach, 398, 399 list of donors, 66–67
RNAi approach, 396, 398 marker-assisted selection, 80
Genotyping by sequencing (GBS), 79 marker-trait association studies, 81
Germplasm enhancement, 459, 460 molecular genetics, 63
Gibberellic acid (GA), 181, 257, 289 multiple stress tolerance, 79, 80, 82
Global climate variability (GCV), 60, 222 multi-stress-tolerant varieties, 62
Global warming, 204, 205 nutritional and health benefits, 61
Glutathione, 299 physiological mechanisms, 63
Glutathione S-transferase (GST) genes, 397 physiological processes, 61
Glycine decarboxylase (GDC), 37 pyramiding QTLs, 80
Glyoxalase, 36 QTLs, 68
Grain, 472, 473, 475, 480, 481 rainfed environments, 80
Grain quality, 76–78, 437 rice cultivars, 61
Green Revolution (GR), 2, 3, 73, 173 rice varieties, 64
Green super rice (GSR), 9, 10, 264, 345 soil salinity, 61
ABA signaling pathways, 82 stresses, 61
abiotic stresses, 80 stress-tolerance genes, 82
492 Index
Green super rice (GSR) (cont.) Hybrid Rice Development Consortium

stress-tolerant rice varieties, 61 (HRDC), 100, 133
sustainable development programs, 60 Hybrid rice technology, 3, 4, 100
transcription factors, 82 Hydrogen peroxide (H2O2), 300
Green traits, 62 Hyperplasia, 381
See also Green super rice (GSR) Hypersensitive reaction (HR), 348, 382, 408
Greenhouse gases (GHG), 173, 204 Hypertrophy, 381
H I
Haploidy diploidization Indian Council of Agricultural Research-
artificial genome doubling, 431 National Rice Research Institute
spontaneous genome doubling, 431 (ICAR-NRRI), 149
HC-ATPase (HA) genes, 473 Indole-2-acetic acid (IAA) homeostasis,
Heat shock proteins (HSPs), 121 253, 257
Heat tolerance Inducer of CBF expression (ICE), 230
agricultural production, 204 Inductively coupled plasma optical emission
breeding, 213, 214 spectrometry (ICP-OES), 458
climate change, 204, 205 Industrial and urban sectors, 174
cultivars, 215 Infectious diseases, 353
cultural practices, 214 Infrastructure, 174, 175
damage, 205, 206 Insect pest management
evaluation, 204 biotechnology, 381
genetic efforts, 215 biotic stress, 380
genetic resources, 208, 209 chronic injuries, 380
genetics, 211, 212 dsRNA resistance, 410
genotypic and morphological feeding guilds, 380
characters, 215 genomic level
global warming, 204, 205 planthopper genomes, 407
marker-assisted gene, 215 rice-gall midge interactions,
marker-assisted recurrent selection, 215 408, 409
physiology, 209–211 rice-planthopper interactions, 408
plant hormones, 214 global warming, 380
reproductive stages, 204 host-plant resistance, 380
rice, 206–208 immune-level R-genes, 410
rice germplasm, 214 molecular approaches, 410
rice production, 205, 206 molecular biology, 381
Helicoverpa armigera, 398 molecular marker-based approaches, 381
Herbicides, 286 pesticides, 410
High temperature, 204–210, 212, 214 production environments, 380
High-throughput cell analysis, 433 resistance genes, 385–388, 390, 392
Host-plant resistance, 15 rice crop, 410
Host-plant resistance gene deployment rice ecosystem, 380
classical breeding methods, 381 siRNA approach, 397
crambidae, 395 stem borers, 380
diopsidae, 395 transgenes, 401–406
gall midge, 381, 382, 394 transgenic approach, 399, 400, 407
leafhoppers, 394, 395 Insect pests, 15, 16
noctuidae, 395 Insect-plant interaction, 407–409
phenotypic selections, 381 Inter-connected breeding (IB) population, 76
planthoppers, 394, 395 Intergovernmental Panel on Climate Change
resistance genes, 395 (IPCC), 60
Host-plant resistance mechanism, 78 International Center for Tropical Agriculture
Human health, 285 (CIAT), 473
Index 493
International Rice Research Institute (IRRI), 2, molecular and physiological levels, 230
100, 178, 206, 394, 451, 472 molecular marker technology, 227
Interval mapping (IM), 185 molecular mechanisms, 266
Introgression lines (ILs), 71, 264 natural cold-screening hotspots, 224
Iron deficiency, 472 next-generation sequencing technology
IRRI Genetic Resources Center, 182 tools, 223
Isopentyltransferase gene (IPT), 161 omics-related technologies, 266
OsNAC5 gene, 229
phenotypic evaluation, 225
L phenotypic techniques, 225
Leafhoppers, 394, 395 photosynthetic activity, 227
Lesion length (LL), 322 photosynthetic process, 228
Linear electron transport, 42 physiological and biochemical
Lipid peroxidation, 300 methods, 229
Liquid chromatography coupled with tandem physiological and metabolic activities, 230
mass spectrometry (LC-MS/ plant growth period, 225
MS), 258 plant growth stages, 223
Low-temperature stress (LTS), 75 polymorphic SNPs, 267
abiotic stresses, 222 protocols, 227
air temperature, 224 PSII, 228
antioxidative enzymes, 229 QTLs, 237
aquaporins, 229 reproductive stage, 224
biochemical parameters, 229 rice production, 222
bioinformatics, 267 rice varieties, 228
booting/flowering stage, 243, 244 screening methods, 224
breeding varieties, 229 seedling stage, 237, 241, 242
calcium signals, 230 tolerance genes and stages, 246–252
cellular metabolism, 230 water control, 223
chromosome, 236 LOX3 gene, 21
cold stress, 229 Lysine-rich protein (LRP), 15
cold-water screening, 224
colocalization, 238–241
crop growth stages, 223 M
diverse ecosystems, 222 Machine learning (ML), 362
food security, 222 Magnaporthe oryzae, 13, 322
genetic and genomic resources, 223 Major resistance (MR) genes, 348
genomics, 266 Malnutrition, 450, 463
germination, 223, 224, 232, 235, 236 MAMP-triggered immunity (MTI), 348
growth stages, 224, 226–227, Marker-assisted backcross (MABC), 120, 126
233–235, 266 Marker-assisted backcross breeding
GS-related traits, 232 (MABB), 344
high-elevation areas, 224 Marker-assisted backcrossing (MAB),
high-throughput molecular 158, 254
approaches, 225 Marker-assisted breeding (MAB), 18, 156, 394
high-throughput screening techniques, Marker-assisted pyramiding, 158, 159
225, 227 Marker-assisted recurrent selection
intracellular levels, 230 (MARS), 159
linolenic acid, 229 Marker-assisted selection (MAS), 125, 158,
low-temperature stress (LTS) 178, 320, 441
systems biology, 267 Matrix-assisted laser desorption/ionization
mechanisms, 230 (MALDI-TOF MS), 258
metabolome-wide association studies, 266 Meganucleases (MNs), 265, 355
metabolomics, 266 Metabolite quantitative trait locus
metabolomics quantitative trait locus, 266 (mQTL), 261
494 Index
Metabolome-wide association studies MABC, 158

(MWAS), 261 marker-assisted pyramiding, 158, 159
Metabolomics, 260, 261 MARS, 159
Metal chelator, 475–480 MAS, 158
Microarray studies, 408 proteins, 156
Microbe-/pathogen-associated molecular QTL mapping, 156, 157
patterns (MAMPs/PAMPs), 348 Molecular genetic mechanisms, 302
Micronutrient, 452, 472, 473 Molecular level, 17
Mitogen-activated protein (MAP) kinase Molecular marker studies, 117
activity, 348 Molecular markers, 337, 381, 394, 434
Molecular approaches Molecular mechanisms, 120, 121
agricultural crop plants, 321 bacterial blight, 349, 350
bacterial blight, 316, 327–331 BLS, 350
BB, 321, 322 broad-spectrum resistance genes,
biotic disease resistance, 326, 352–354 351, 352
biotic stresses, 316 calcium-binding proteins, 245
blast disease, 322 cold-sensing calcium channel, 245
blast resistance genes, 332–337 cold-stress conditions, 245
BLS, 325 defense mechanisms, 347
climatic conditions, 316 elicitors, 349
conventional breeding methods, 316 gene expression patterns, 245
crop protection, 316 genes and transcription factors, 245
diseases, 316–319 GWAS, 255, 256
DNA markers, 320 innate immune system, 348
false smut, 324 metabolomics, 260, 261
food demand, 363 molecular patterns, 348
food security crop, 316 molecules, 348
frequency of variations, 321 pathogens, 347
gamma-rays (γ-rays), 320 pathogen-specific factor, 348
genetic improvements, 363 phosphorylation, 245
genome engineering technologies, 321 physiological and metabolic
genome-editing technologies, 321 compounds, 245
genome-editing tools, 321 plant resistance, 349
genomic-assisted breeding tools, 363 proteomics, 258, 259
genomics, 321 rice blast, 350
GM technology, 320 sheath blight, 351
management practices, 316 signaling pathways, 253–255
methods, 316 transcription factors, 245
mutation breeding, 320 transcriptomics, 256–258
nutrient fertilizers, 352–354 Monomethylarsonic acid (MMA), 288
plant pathogens, 316 Mugineic acid, 473
QTL, 320, 332–337 Multienvironment trials (METs), 130
resistance, 320 Multi-parent Advanced Generation
R-genes, 320 Inter-Cross (MAGIC)-derived
rice cultivation, 316 lines, 452
rice grain yield, 316 Multiple stress tolerance
sheath blight (ShB) disease, 316, 322, 323 breeding products, 84–86
sheath blight-resistance genes, 338–343 rice hybrids, 87
ShR, 323, 324 stress-regulated mechanisms, 82–84
techniques, 359, 360 Multi-pronged approaches, 5
tungro disease, 324, 325 Multi-trait and multi-environment (MTME)
Molecular breeding models, 457–458
antioxidants, 156 Multi-trait genomic selection, 457, 458
GS, 160 Myeloblastosis (MYB), 257
Index 495
N Photorespiration, 11, 35, 37

NADH dehydrogenase-like (NDH) Photosynthesis, 11, 12, 473
complex, 47 air temperature, 31
NADH quinone oxidoreductase (NQO), 406 Calvin–Benson-Cycle enzymes, 40, 41
Natural resistance-associated macrophage CO2 concentrations, 38–40
protein (NRAMP), 475 crop productivity, 31
Near-isogenic line (NIL), 8, 212, 435 crop yield, 32
New breeding techniques (NBT), 481 electron transport, 41–44
New plant type (NPT), 7, 8 environmental conditions, 32
Nicotiana tabacum, 37 greenhouse gases, 32
Nicotianamine aminotransferase natural environments
(NAAT), 473 Calvin-Cycle enzymes, 48, 49
Nicotianamine synthase (NAS), 473 CO2 diffusion, 49, 50
Nicotinamide adenine dinucleotide electron transport, 45, 47, 48
(NAD), 181 genetic engineering approaches, 45
Nitrogen, 352 light intensity, 44
Nitrous oxide, 173 non-steady-state, 44
Nucleotide-binding-leucine-rich repeat photosynthetic induction, 44
(NB-LRR), 348 photorespiration, 35–37
Nucleotides, 398 Rubisco kinetics, 33, 35
Nutrient deficiency, 19 steady-state and non-steady-state, 46
Nutrient fertilizers, 352–354 thermotolerance, 37, 38
Nutrient-use efficiency (NUE), 73 Photosynthetic carbon metabolism (PCM), 12
Nutritional deficiency, 472 Photosynthetic efficiency, 33
Nutritive quality, 19, 20 Photosystem-II (PSII), 228
Physiological and metabolic pathways, 353
Physiological characterization, see
O Temperature-sensitive genetic male
Observation yield trial (OYT), 130 sterile (TGMS)
Oligosaccharyl transferase (OoOST), 409 Phytochelatins (PCs), 299
Optimum temperature, 205 Phytotoxicity, 302
Oryza australiensis, 38 Plant growth facility (PGF), 125
Oryza meridionalis, 208 Plant growth regulators (PGRs), 428
Oryza rufipogon, 156 Plant resistance, 349
Oryzalin, 431 Planthopper genomes, 407
Oxidized macromolecules, 186 Planthoppers, 394, 395
Pollen grains, 210
Polycistronic tRNA-gRNA (PTG), 356
P Posttranslational changes, 259
Pattern recognition receptors (PRRs), 348 Prime editing guide RNA (pegRNA), 357
Pattern-triggered immunity (PTI), 348, 408 Pronamide, 431
Peroxidases, 181 Prorich protein (PRP), 253
Pesticides, 286 Protein content (PC), 19
Phenotypic screening, 326, 346 Proteins, 258
Phenotypic traits, 183 Proteomic analysis, 212
Phenotypic variation (PV), 156 Proteomics, 258, 259
Phloem protein2 promoter (pPP2), 9 Protospacer adjacent motif (PAM), 356
Phosphoenolpyruvate carboxylase Pseudomonas, 409
(PEPC), 40 Pseudomonas fuscovaginae, 324
Phosphoglycerate (PGA), 33 Pyramiding lines (PDLs), 65
Phosphoglycolate (PGO), 33 Pyrosequencing approach, 408
Photoperiod-sensitive genic male sterile Pyrosequencing-based transcriptome
(PGMS), 101 analysis, 409
Photoperiod-sensitive male sterility (PGMS), 4 Pyruvate decarboxylase (PDC), 181
496 Index
Q Rice establishment methods

Quantitative trait loci (QTL), 156, 157, 183, direct-seeded rice (DSR), 177
211, 292–294, 320, puddled transplanted rice, 176
435–437, 453–455 Rice leaffolder (RLF), 16
Rice tungro bacilliform virus (RTBV), 14, 324
Rice tungro disease (RTD), 359
R Rice tungro spherical virus (RTSV), 14, 324
Rapid generation advancement (RGA), 125 Rice tungro virus (RTV), 13, 14
Rapid viscosity analysis (RVA), 133–134 RNA interference (RNAi), 14, 396, 398
Reactive oxygen species (ROS), 17, 70, 186, RNA-induced silencing complex (RISC), 396
300, 348 Root architecture, 9
Receptor-like kinase (RLK), 160 Root-related traits, 9
Recombinant inbred lines (RILs),
183, 435
Regeneration, 426–431, 434, 441 S
Regional high-temperature damage, 205 Salt overly sensitive (SOS) pathway, 18
Relative humidity (RH), 207 Sarocladium oryzae, 323
Repeat variable di-residues (RVDs), 356 Saturated soil culture (SSC), 149, 154
Resistance mechanism, 382 Secreted salivary gland proteins (SSGPs), 408
Respiration, 473 Seed production
Restriction fragment length polymorphism self–seed multiplication, 134, 135
(RFLP) markers, 183 two-line hybrid rice technology, 134
Reverse breeding, 440 Seedling survival percentage (SSP), 227
Rhizoctonia solani, 15, 322 Selective introgression breeding (SIB),
Ribonucleoproteins (RNPs), 359 263, 264
Rice (Oryza sativa L.) Selective introgression lines (SILs), 84–85
food-deficit Asia, 1 Self-fertility, 135
gene editing, 21 Serial analysis of gene expression
gene pool, 5 (SAGE), 360
GSR, 9, 10 Sexual barriers, 5
huge demand projection, 1 Sheath blight (ShB), 14, 322, 323
hybrid rice technology, 3, 4 Sheath blight resistance (ShBR), 436
ideotype breeding, 7, 8 Sheath rot (ShR), 323, 324
molecular and physiological breeding Silene vulgaris, 187
strategies, 2 Simple sequence repeat (SSR), 361, 434
physiological breeding approaches Single marker analysis (SMA), 185
abiotic stresses, 17–19 Single nucleotide polymorphisms (SNPs), 183
biophysical stresses, 12 Single-guided RNA (sgRNA), 265
biotic stresses, 13 siRNA approach, 397
diseases, 13–15 Site-specific nucleases (SSNs), 321
dwarfing genes, 10 Small heat shock proteins (sHSP), 212
insect pests, 15, 16 Small interfering RNAs (siRNAs), 396
photosynthesis, 11, 12 Soil-and irrigation-based strategies
starch biosynthesis, 11 aerobic rice development, 154
plant architecture, 7, 8 AWD, 153
root architecture, 9 depletions, 154, 155
self-sufficiency, 1 environmental changes, 153
shoot and panicle architecture, 8, 9 intensification, 155
strategies, 5 outflows, 154, 155
systematic breeding, 2 saturated soil culture, 154
wild-weedy gene pools, 5, 7 sprinkler irrigation, 155
Rice breeding programs, 452 Soil mulching, 155
Rice Diversity Panel 1 (RDP1), 255 Soil plant analysis development (SPAD), 227
Index 497
Solar radiation, 204 Thermotolerance gene (TT1), 212

Specific locus amplified fragment sequencing Thioredoxin-mediated redox regulation, 49
(SLAF-seq) technology, 255 Tiller angle (TA), 14
Spodoptera exigua, 398 Tissue culture and genetic transformation
Spodoptera litura, 399 protocols, 399
Spontaneous genome doubling, 431 Total drought response index (TDRI), 151
Standard evaluation system (SES) scale, 322 Transcription activation-like effectors
Streptomyces pyogenes, 356 (TALEs), 349
Stress-regulated mechanisms, 82–84 Transcription activator-like effector nucleases
Stress-responsive genes, 161 (TALENs), 21, 265, 321, 455
Superoxide dismutase (SOD), 229, 300 Transcription factors (TFs), 82
Susceptible host (SH), 408 Transcriptional/hormonal regulation, 9
Sustainable development goal, 162, 450 Transcriptional regulation pathways, 253
Systemic acquired resistance (SAR), 408 Transcriptomics, 120, 256–258
Transformation-regeneration protocols, 18
Transgenic approach, 21, 399, 400, 407
T Transgenic maize plants, 396
Temperature stress, 205 Transgenic plants, 32, 36
Temperature-sensitive genetic male Transgenic strategies, 160, 161
sterile (TGMS) Transgenics, 18
advantages, 111, 112 Trifluralin, 431
breeding pollen parents, 126 Tunable genotyping-by-sequencing (tGBS), 65
breeding trials, 130 Two-dimensional gel electrophoresis
China, 100 (2-DE), 258
combining ability nurseries, 130 Two-line hybrid rice technology, 101, 111
disadvantages, 111, 112
disease resistance, 133
food demand, 100 U
genetically modified (GM) domain, 137 Uniform Blast Nursery (UBN), 322
genetics Ustilaginoidea virens, 324
identification, 117, 120
molecular mechanisms, 120, 121
genome editing tools, 137 V
grain quality, 133, 134 Vigna aconitifolia, 18
hybrid rice technology, 100 Vitamin deficiency–related health
indica/japonica hybrids, 126 disorders, 20
insect pest, 133
international scientific communities, 100
male-sterile lines, 138 W
multiplex gene editing, 137 Water demand
mutation breeding, 122 abiotic stresses, 161
pedigree breeding, 122 aerobic rice varieties, 148
physiological characterization climate changes, 161
fertility-sterility alteration, 115 environmental conditions, 148
pollen parental lines, 116, 117 food security, 148
sterility-fertility alteration, 115 human population, 148
public and private sectors, 101 plant-based strategies
pyramiding, 123 cultivars/varieties, 150, 151
rapid fixation, 125, 126 decreased stand density, 152
rice production, 100 planting date, 152
transfer, 123 plants, 149
two-line hybrid rice technology, 101, 111, rainfed ecosystem, 148
136, 137 rice cultivation, 148
two-line rice hybrids, 127 rice varieties, 161
498 Index
Water demand (cont.) Z

stress-tolerant cultivars, 148 Zinc-biofortified rice
transgenic strategies, 160, 161 Bayesian network analysis, 456
water availability, 148 biofortification, 450
water-deficient conditions, 148, 150 breeding techniques, 451
water-limiting conditions, 149, 150 deficiencies, 450
water management, 148 deficiency-related health
Water scarcity, 173–176 consequences, 450
Water-use efficiency, 40 donor identification, 452, 453
Weed Tolerant Rice-1 (WTR-1), 65 food-based approach, 450
White-backed planthopper (WBPH) food habits, 459
resistance, 436 genomic tools, 451
Whole-genome sequencing (WGS), 80 genotype × environment effects, 461
Whole-genome sequence, 255 germplasm enhancement, 459, 460
Wide compatibility gene (WCG), 4 high grain Zn, 451, 452
Wide genetic variation, 207 human health, 451
Wide-compatibility (WC) gene, 126 mainstreaming, 460, 461
Wild abortive (WA), 3, 112 micronutrients, 450
Wolbachia, 407, 409 multiple interventions, 450
multi-trait genomic selection, 457, 458
network of metal homeostasis genes, 455
X next-generation multi-nutrient, 462
Xanthomonas, 355 phenotyping, 458
Xanthomonas oryzae, 353 pre-breeding, 459, 460
Xanthomonas oryzae pv. oryzae (Xoo), 13 product control, 462
X-ray fluorescence (XRF), 458 QTLs, 453–455
rice traceability, 462
varieties, 462
Y yield, 453
Yeast-like symbiont (YLS), 407 Zinc-finger nucleases (ZFNs), 265, 321, 355,
Yellow stem borer (Scirpophaga incertulas), 15 356, 455

Rice Improvement: Jauhar Ali Shabir Hussain Wani Editors

Uploaded by

Copyright:

Available Formats

Rice Improvement: Jauhar Ali Shabir Hussain Wani Editors

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Rice Improvement: Jauhar Ali Shabir Hussain Wani Editors

Uploaded by

Copyright:

Available Formats

Jauhar Ali

Shabir Hussain Wani Editors

This book is an open access publication.

vars. Understanding drought physiology and developing drought-tolerant varieties

Gurdev S. Khush FRS

Former Head, Plant Breeding Genetics and Biotechnology, IRRI

Metro Manila, Philippines Jauhar Ali

Correction to: Crop Establishment in Direct-Seeded Rice:

E. A. Siddiq and Lakshminarayana R. Vemireddy

Keywords Rice · Green revolution · Hybrid rice · Multi-pronged approaches ·

© The Author(s) 2021 1

Fig. 1 Rice yield trends and demand projections toward 2050

2 First Breakthrough: The Green Revolution

3 Second Breakthrough: Hybrid Rice Technology

4 Next Breakthrough: Strategies

4.1 Enrichment of the Rice Gene Pool

4.2  iscovery and Stacking of Yield Genes Hidden in Wild/

Strategies Cutting-edge tools

4.3 Designing of Plant Architecture or Ideotype Breeding

On the strength of findings from simulation modeling, IRRI physiologists believed

Table 1 List of wild species/landraces used for trait enhancement in rice

4.4 Designing of Shoot and Panicle Architecture

4.5 Modification of Root Architecture

Genetic improvement of the root system is important for developing tailor-made

4.6 Green Super Rice for Sustainable Performance

As a massive breeding effort placing emphasis on developing ecologically and eco-

backcross populations involving selected popular high-yielding varieties (40–50)

4.7 Physiological Breeding Approaches

Exploring Alternative Sources of Dwarfing Genes Given the experience with

Engineering of Starch Biosynthesis The first yield breakthrough achieved in

4.8 Defending Against Biophysical Stresses

in rice. Pyramiding diverse resistance genes against any disease is considered a

host resistance-based strategies, a transgenic approach through inhibition of chitin

conditions. Despite such success stories elsewhere, including in China, Spain,

4.9 Selective Modification of Traits by Gene Editing

Aside from the marker-assisted introgression of genes of interest discussed in the

For predominantly rice-consuming Asia to emerge and remain a food-/nutrition-­

Table 2 Targeted editing of important genes employing genome editing techniques

Gopalakrishna K, Vemireddy LR, Srividhya A, Nagireddy R, Jena SS, Gandikota M, Patil S,

Rashid M, Guangyuan H, Guangxiao Y, Hussain J, Xu Y (2012) AP2/ERF transcription factor in

Xu R, Qin R, Li H, Li D, Li L, Wei P et al (2017) Generation of targeted mutant rice using a

Abstract Crop productivity would have to increase by 60–110% compared with

Keywords Calvin–Benson cycle · CO2 assimilation · CO2 transport · Electron

© The Author(s) 2021 31

between CO2 assimilation R2 = 0.67

final stage, and grain yield 30

transport. Finally, it describes the importance of considering ways to improve pho-

2 Improving Rubisco Performance

2.1 Rubisco Kinetics

Rubisco (ribulose-1,5-bisphosphate carboxylase/oxygenase) is an enzyme involved

Electron transport Chloroplast

site-­directed mutagenesis of Rubisco has as yet been largely unsuccessful (Furbank

2.2 Photorespiration Bypass

Chloroplastic glycerate bypass

Calvin-Benson ADP ATP

3 Improving Thermotolerance of Rubisco Activase

activase from a wild relative (Oryza australiensis) were overexpressed in domesti-

4 Increasing CO2 Concentration Around Rubisco

Photosynthesis in C3 plants is limited by the large drawdown in CO2 concentrations

Metro Manila, Philippines Jauhar Ali

2 First Breakthrough: The Green Revolution

3 Second Breakthrough: Hybrid Rice Technology

4 Next Breakthrough: Strategies

4.1 Enrichment of the Rice Gene Pool

4.2 iscovery and Stacking of Yield Genes Hidden in Wild/

4.3 Designing of Plant Architecture or Ideotype Breeding

4.4 Designing of Shoot and Panicle Architecture

4.5 Modification of Root Architecture

4.6 Green Super Rice for Sustainable Performance

4.7 Physiological Breeding Approaches

4.8 Defending Against Biophysical Stresses

4.9 Selective Modification of Traits by Gene Editing

For predominantly rice-consuming Asia to emerge and remain a food-/nutrition-

2 Improving Rubisco Performance

2.1 Rubisco Kinetics

site-directed mutagenesis of Rubisco has as yet been largely unsuccessful (Furbank

2.2 Photorespiration Bypass

3 Improving Thermotolerance of Rubisco Activase

4 Increasing CO2 Concentration Around Rubisco

5 Enhancing Activity of Calvin–Benson-Cycle Enzymes

6 nhancing Electron Transport Rate

7 I mproving Photosynthetic Performance Under Fluctuating

7.1 Electron Transport

7.2 Activation of Calvin-Cycle Enzymes, Especially Rubisco

(Miginiac-Maslow et al. 2000); and starch metabolism (Thormählen et al. 2013).

7.3 CO2 Diffusion into the Chloroplast

2 Green Super Rice

2.1 GSR Breeding and Population Development

3 Genetics of Green Traits

3.1 Drought Tolerance

3.2 Salinity Tolerance

3.3 Submergence Tolerance

3.4 Nutrient-Use Efficiency

3.5 Weed-Competitive Ability Traits

3.6 ow-Temperature Stress Tolerance at Different Crop

3.7 Grain Quality

3.8 Biotic Stress Tolerance

4 olecular Genetics and Breeding Strategies to Combine

whole-genome sequencing (WGS) have led to the identification of major-effect

4.1 issecting the Stress-Regulated Mechanisms for Multiple

4.2 reeding Products Combining Tolerance

4.3 evelopment of Rice Hybrids

2 he Emergence of Two-Line Hybrid Rice Technology