nutrients

Article
Mechanistic Study of Coffee Effects on Gut Microbiota and
Motility in Rats
Shrilakshmi Hegde 1,†,‡ , Daniel W. Shi 2,‡ , John C. Johnson 1,3 , Ramasatyaveni Geesala 1 , Ke Zhang 1 ,
You-Min Lin 1,4 and Xuan-Zheng Shi 1, *

1 Department of Internal Medicine, University of Texas Medical Branch, Galveston, TX 77555, USA
2 College of Science, Texas A&M University, College Station, TX 77843, USA
3 John Sealy School of Medicine Class 2025, University of Texas Medical Branch, Galveston, TX 77555, USA
4 Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555, USA
* Correspondence: [email protected]
† Current address: Liverpool School of Tropical Medicine, Pembroke Place, Liverpool L3 5QA, UK.
‡ These authors contributed equally to this work.

Abstract: Consumption of coffee has benefits in postoperative ileus. We tested the hypothesis that
the benefits may be related to the effects of coffee on gut microbiota and motility and studied the
mechanisms of action in rats. The in vitro and in vivo effects of regular and decaffeinated (decaf)
coffee on gut microbiota of the ileum and colon were determined by bacterial culture and quantitative
RT-PCR. Ileal and colonic smooth muscle contractility was determined in a muscle bath. In the in vivo
studies, coffee solution (1 g/kg) was administered by oral gavage daily for 3 days. Compared to
regular LB agar, the growth of microbiota in the colon and ileal contents was significantly suppressed
in LB agar containing coffee or decaf (1.5% or 3%). Treatment with coffee or decaf in vivo for
3 days suppressed gut microbiota but did not significantly affect gut motility or smooth muscle
Citation: Hegde, S.; Shi, D.W.; contractility. However, coffee or decaf dose-dependently caused ileal and colonic muscle contractions
Johnson, J.C.; Geesala, R.; Zhang, K.; in vitro. A mechanistic study found that compound(s) other than caffeine contracted gut smooth
Lin, Y.-M.; Shi, X.-Z. Mechanistic muscle in a muscarinic receptor-dependent manner. In conclusion, coffee stimulates gut smooth
Study of Coffee Effects on Gut muscle contractions via a muscarinic receptor-dependent mechanism and inhibits microbiota in a
Microbiota and Motility in Rats. caffeine-independent manner.
Nutrients 2022, 14, 4877. https://
doi.org/10.3390/nu14224877 Keywords: coffee; small intestine; colon; microbiota; motility; smooth muscle
Academic Editors: Jason Tallis, Neil
D. Clarke and Lucas Guimaraes
Ferreira
1. Introduction
Received: 1 November 2022
Accepted: 16 November 2022
Coffee is one of the most popular beverages in the world. Current evidence suggests
Published: 18 November 2022
that it has health benefits in conditions such as cardiovascular diseases (i.e., stroke) [1],
Parkinson’s disease [2], metabolic disorders (i.e., Type 2 diabetes) [3], and liver diseases
Publisher’s Note: MDPI stays neutral
(i.e., non-alcoholic fatty liver disease) [4]. However, the effects of coffee on the gastroin-
with regard to jurisdictional claims in
testinal tract (GI) have not been well investigated. Nevertheless, population-based studies
published maps and institutional affil-
found that consumption of coffee is inversely associated with the prevalence of consti-
iations.
pation [5,6]. While postoperative ileus is a common condition after abdominal surgeries,
recent clinical trials found that postoperative coffee consumption, regardless of caffeine con-
tent, reduces the time to first defecation, and reduces the incidence of post-operative ileus
Copyright: © 2022 by the authors.
and the length of stay in hospital [7–10]. Some studies suggest that coffee may also exert a
Licensee MDPI, Basel, Switzerland. protective effect concerning colon cancer [11]. These clinical observations and population-
This article is an open access article based studies have demonstrated potential benefits of coffee on digestive health. However,
distributed under the terms and what accounts for the benefits of coffee in the GI tract is poorly understood.
conditions of the Creative Commons The GI tract represents one of the largest interfaces (250–400 m2 ) between the host
Attribution (CC BY) license (https:// and environment and is the home of 1014 microorganisms, collectively microbiota [12].
creativecommons.org/licenses/by/ Gut microbiota are proposed to play a critical role in host health. On one hand, many
4.0/). commensal bacteria such as Firmicutes and Lactobacillus are considered as probiotics as

Nutrients 2022, 14, 4877. https://doi.org/10.3390/nu14224877 https://www.mdpi.com/journal/nutrients

Nutrients 2022, 14, 4877 2 of 18

their presence in the gut are beneficial to the host [13,14]. On the other hand, some of
the microbiota such as Gamma proteobacteria and Enterobacteriaceae may impose a threat
on gut integrity or even play a pathogenic role in gut inflammation and infections [15,16].
When the host consumes coffee, the gut microbiota is among the first to be exposed to it.
Unfortunately, the effect of coffee on the gut microbiota has not been well characterized.
Jaquet et al. reported [17] that coffee promoted the growth of certain select bacteria species.
However, Nakayama et al. [18] found that coffee may exert antibiotic effects, especially
towards E. coli. There are also reports that fecal bacteria were not affected by coffee con-
sumption [19]. Overall, there is a lack of data concerning the effect of coffee on microbiota
as a whole and different groups of potential pathogenic and beneficial bacteria in the gut.
As gut microbiota in different parts of the GI tract may have very different functions, the
in vivo effect of coffee on the small intestine and colon has not been studied comparatively.
It is therefore important to study the effect of coffee on the gut microbiota and determine
the in vitro as well as in vivo effects of coffee on total microbiota and different groups of
microbes in the small intestine and colon.
Gut motility is crucial to digestive health and homeostasis in the GI tract. Although
the autonomic nervous system (mainly the parasympathetic nervous system) is involved
in the extrinsic control of gut motility, it is the intrinsic enteric nervous system (ENS) that
directly controls gut smooth muscle cells to fulfill the motility function in the gut [20,21].
Earlier manometry studies found that colonic motility was significantly increased in the
first 30 min after consuming coffee [22,23]. These in vivo studies focused on the effect
of coffee on colon motility. However, the mechanism of action of coffee on gut motility,
and whether coffee also has pro-motility properties in the small intestine are not known.
These questions are important, as recent clinical observations found that drinking coffee is
beneficial for post-operative ileus [7,10], which is a condition largely affecting the small
intestine. A better understanding of the mechanism of action of coffee on gut motility may
help develop coffee or its components as therapeutics [24,25] for motility disorders such as
ileus and constipation.
We hypothesized that the benefits of coffee in conditions such as constipation, postop-
erative ileus, and even colorectal cancer may be related to its effects on the gut microbiota
and gut motility, two important contributors to maintaining gut homeostasis. We thus
undertook a laboratory investigation into the in vitro and in vivo effects of coffee on the
gut microbiota and smooth muscle contractility in rats. We also aimed to understand the
mechanisms of the effects. Part of the results were presented earlier in an abstract form [26].

2. Materials and Methods

2.1. Preparation of Coffee Solution
The coffee solution was prepared by dissolving 100% Arabica coffee powder (Starbucks
Corporation, Seattle, WA, USA) in hot water, as described previously [18]. Briefly, boiling
water was added to regular or decaffeinated coffee powder (14 mL water for 1 g of coffee
powder). The coffee extract solution was mixed well and incubated at room temperature
for 15 min. After incubation, the coffee extract solution was centrifuged at 3000 g for 10 min.
The supernatant was taken and filtered through a 0.45-µm filter. The filtered coffee solution
was used freshly or kept at 4 ◦ C for no more than 3 days. Decaffeinated coffee solution
was also prepared in the same way but using 100% Arabica decaffeinated coffee powder
(Starbucks Corporation, Seattle, WA, USA).

2.2. Preparations of Intraluminal Fecal Contents and In Vitro Bacteria Growth Assay
Intraluminal fecal pellets were obtained aseptically from naïve Sprague-Dawley rats
(male and female) of 230~280 g. In brief, rats were euthanized with CO2 , and a laparotomy
was operated. The distal ileum (5 cm from the ileal-colon junction) and distal colon (3 cm
from the anus) were isolated and opened. Fecal contents were obtained under aseptic
operation and transferred to pre-weighed sterile tubes [27]. The sample tubes were kept on
ice throughout the procedure. The fecal contents were weighed and mixed well with sterile
Nutrients 2022, 14, 4877 3 of 18

1 mL PBS solution (Sigma-Aldrich, St. Louis, MO) and homogenized using a microtube
homogenizer (Bel-Art, Wayne, NJ, USA). After homogenization, samples were incubated
on ice for 30 min and spun down at 1200 rpm for 3 min. The supernatant collected was
used for in vitro bacterial growth inhibition assays.
In the bacterial growth inhibition assay [18], serial dilutions of the supernatant from
intraluminal fecal contents isolated from the ileum and colon were plated on regular LB
agar and LB agar containing 1.5% or 3.0% (mg/100 mL) coffee. The agar was kept at 37 ◦ C
for 24 h. After the incubation, the bacterial colonies on the regular LB agar and coffee-
contained LB agar were counted by two independent investigators, and colony forming
units (CFUs)/gram sample were calculated.

2.3. Oral Gavage Treatment of Rats with Coffee Solution and Fecal and Tissue Preparations
Sprague-Dawley rats (male and female) of 230~280 g (Harlan Sprague Dawley, Indi-
anapolis, IN, USA) were used for the study. The rats were housed in a single cage per rat in
a controlled environment (22 ◦ C, 12-h light-dark cycle) and always allowed food and water
ad libitum unless stated otherwise. The Institutional Animal Care and Use Committee at
the University of Texas Medical Branch approved all procedures performed on the animals.
All of the experimental methods were performed in accordance with the Guide for the Care
and Use of Laboratory Animals of the National Institutes of Health, USA.
Rats were randomly assigned into 3 groups, i.e., the vehicle control (Ctr), regular
coffee (Coff), and decaffeinated coffee (Decaf) groups. Rats were administered (by oral
gavage) [26,28] with distilled water (2 mL), regular coffee (1 g/kg in 2 mL of water), and
decaffeinated coffee solution (1 g/kg in 2 mL of water), respectively, daily for 3 consecutive
days. At the end of the experimental period, the rats were euthanized. The ileum and colon
were opened. The fecal contents of the ileum and colon were collected for microbiology
and qPCR studies [27,29,30]. The ileal and colon tissues were taken for measurements of
gut smooth muscle contractility [21].

2.4. Total (Anaerobic and Aerobic) Bacterial Culture from the Colon and Ileum Contents
The total bacterial abundance was quantified by culturing both anaerobic and aerobic
bacteria as described previously [26,27,31]. Gifu anaerobic media (GAM) (HIMEDIA, West
Chester, PA, USA) and tryptic soy agar (TSA) plates (Difco, BD, Franklin Lakes, NJ, USA)
were prepared as described by the manufacturer and stored at 4 ◦ C until use. Fecal samples
were collected from the ilium and colon aseptically and were weighed and homogenized
immediately in GAM broth by vortexing and using a micro tube homoginizer (Bel-Art,
Wayne, NJ, USA). After homogenization, the contents were incubated on ice for 30 min and
centrifuged at 1200 rpm for 3 min. Serial dilutions of the supernatant collected were plated
on GAM agar plates for enumeration of anaerobic bacteria. Serial dilutions were also plated
on TSA plates to quantify aerobic and facultative bacteria. GAM plates were incubated in
anaerobic jars containing anaerogen bags (Sigma, St. Louis, MO, USA), whereas TSA plates
were incubated in 5% CO2 at 37 ◦ C for 24 h. The next day, CFU/gram samples taken were
calculated by counting visible bacterial colonies.

2.5. Genomic DNA Extraction and Quantitative RT-PCR Study of Gut Microbiota Abundance
Total genomic DNA was isolated from pre-weighed colon and ilium contents using a
QIAGEN stool mini kit according to the manufacturer’s instruction for bacterial DNA isola-
tion. Total bacterial abundance in colon and ilium contents was calculated by absolute quan-
tification of 16S rRNA copies using RT-PCR as described previously [26,27,29,30]. Briefly,
16S rRNA regions were amplified by taking 0.4 µL feces DNA as template, 25 pmol/µL
specific primers [UniF: GTGCTGCATGGTCGTCGTCA; UniR: ACGTCGTCCACACCTTC-
CTC [32] and 1X power SYBR green master mix (Applied Biosystems, Foster City, CA,
USA) in 20 µL final reaction volume. All of the PCRs were done in duplicates in a StepOne
plus Real-time PCR system (Applied Biosystems, Foster City, CA, USA) [27,29,30]. The
PCR conditions were as below: 95 ◦ C for 10 min, followed by 40 cycles at 95 ◦ C for 30 s,
Nutrients 2022, 14, 4877 4 of 18

60 ◦ C for 30 s and 72 ◦ C for 45 s. A melting curve analysis was carried out at the end.
The standard curve for 16S rRNA quantification was generated by the serial dilution of
pJet plasmid (Invitrogen, Waltham, MA, USA) containing 16S rRNA target sequence from
E. coli (DH10B) [27]. The total bacterial 16S rRNA gene copy numbers/mg of sample was
calculated using the following equation: total copy numbers/mg = [mean copy numbers
from standard curve X volume of DNA taken (µL)]/[total volume of extracted DNA (µL) X
mg of sample used for DNA isolation).
For relative quantification of different classes of bacteria in the ilium and colon contents,
below class specific primers were used. Enterobacteriaceae: Eco1457F–CATTGACGTTACCCG
CAGAAGAAGC, Eco1652R–CTCTACGAGACTCAAGCTTGC (Tm = 61 ◦ C) [33]; Gamma
proteobacteria: Gamma395f–CCATGCCGCGTGTGTGAA, Gamma871r-ACTCCCCAGGCG
GTCTACTTA (Tm = 56 ◦ C) [34]; Lactobacillus: F_alllact_IS–TGGATGCCTTGGCACTAGGA,
R_alllact_IS–AAATCTCCGGATCAAAGCTTACTTAT (Tm = 58 ◦ C) [35]; Firmicutes: S-
P-Firm-0352–CAGCAGTAGGGAATCTTC, S-P-Firm-0525–ACCTACGTATTACCGCGG
(Tm = 57 ◦ C) [36]. 16S rRNA copies were quantified using UniF and UniR primers as above
and used as a reference gene for relative quantification. The reaction consisted of 0.4 µL
feces DNA as template, 25 pmol/µL specific primers and 1X power SYBR green master mix
(Applied Biosystems, Foster City, CA, USA) in 20 µL reaction. The PCR conditions were
95 ◦ C for 10 min, followed by 40 cycles of 95 ◦ C for 30 s, annealing for 30 s at respective
Tm and 72 ◦ C for 45 s. A melting curve analysis was carried out at the end. All of the
PCR reactions were done in duplicates in a StepOne plus Real-time PCR system (Applied
Biosystems, Foster City, CA, USA) using a temperature gradient block that enabled the
use of different annealing temperatures for every primer set. Results are expressed as
fold-change in the abundance of different classes of bacteria compared to the total bacterial
abundance (16S rRNA copies) and were calculated using the ∆∆CT method.

2.6. In Vivo Gut Motility Study

Colonic propulsive motility was measured as described previously [37,38]. Rats treated
with saline, regular coffee and decaffeinated coffee for three days were lightly anaesthetized
by isoflurane. A 6 mm-diameter glass bead was inserted into the distal colon about 3 cm
from the anus of each rat. After bead insertion, the rats were replaced individually without
food and water in their home cages. The time required for expulsion of the glass bead, the
mean expulsion time, was determined for each rat.

2.7. Intestinal and Colonic Muscle Contractility Study

Tissue samples of 2 cm-long distal ileum (5 cm from the ileal-colon junction) and
colon (2 cm from the anus) were collected and placed immediately in carbogenated Krebs
buffer (in mmol/L: 118 NaCl, 4.7 KCl, 2.5 CaCl2 , 1 NaH2 PO4 , 1.2 MgCl2 , 11 D-glucose, and
25 NaHCO3 ) [39–41]. The ileal and colonic specimens were opened along the mesenteric
border and pinned flat in a Petri dish with Sylgard base in a carbogenated Krebs buffer. Full
thickness ileal or colonic tissue strips (3 × 10 mm) were mounted along the longitudinal
muscle orientation in individual muscle baths (Radnoti Glass, Monrovia, CA, USA) filled
with 10 mL of carbogenated Krebs solution at 37 ◦ C. The contractile activity was recorded
as previously described [40,41], with isometric force transducers and amplifiers (Grass
Instruments, West Warwick, RI, USA) connected to a Biopac data-acquisition system (Biopac
Systems, Goleta, CA, USA). The muscle strips were equilibrated in the muscle bath under
1 g tension for 60 min at 37 ◦ C before they were tested for contractility. Muscle contractility
was tested in response to acetylcholine (ACh) (10−7 to 10−3 M), with each concentration
being recorded for at least 2 min. The contractile response was quantified as the increase
in area under contractions (AUC) during 2 min after the addition of each concentration of
ACh over the baseline AUC for 2 min before the addition of the first concentration of ACh
(10−7 M).
To determine the direct effects of coffee and decaf on gut motor activity, ileal and
colonic muscle strips (3 × 10 mm with the long axis along with the longitudinal muscle
 Nutrients 2022, 14, 4877 5 of 18

orientation) were isolated from naïve rats. The muscle contractile response to coffee or
decaf (0.1~10 mg/mL) was determined with each concentration being recorded for at least
2 min. The contractile response was quantified as the increase in area under contractions
(AUC) for 2 min after the addition of each concentration of coffee or decaf over the baseline
AUC for 2 min before the addition of the first concentration (0.1 mg/mL). To study the
mechanistic sites of action of coffee and decaf, the contractile response to coffee or decaf at
5 mg/mL was recorded in the absence and presence of the nicotinic receptor antagonist
hexamethonium (Hex, 10−4 M), muscarinic receptor antagonist atropine (Atr, 10−6 M), and
neurotoxin tetrodotoxin (TTX, 10−6 M) [42,43].

2.8. Statistical Analysis

Data points are expressed as means ± SEM, unless otherwise specified. A statis-
tical analysis was performed by analysis of variance with non-repeated measures (by
Student-Newman-Keuls test) for comparisons of multiple groups and Student’s t-test for
comparisons of two groups. A p value of ≤0.05 was considered statistically significant.

3. Results
3.1. In Vitro effects of Regular and Decaffeinated Coffee on Gut Microbiota
We first determined the in vitro effect of coffee on gut microbiota in a bacterial growth
inhibition assay [18,26]. Intraluminal fecal contents were collected from the distal ileum in
Figure 1A and colon in Figure 1B of naïve rats. The fecal contents were diluted and cultured
on regular and coffee-containing LB agar plates. Compared to regular LB agar, the growth
of bacteria from the intraluminal colon content was significantly (p = 0.009) suppressed in
x FOR PEER REVIEW LB agar with 1.5% coffee (9.31 × 109 CFU/gram vs. 9.65 × 109 CFU/gram). With6 3% of coffee,
18
5
the growth of the microbiome was further suppressed to 5.02 × 10 CFU/gram, p = 0.000).
A similar inhibitory effect was found for the ileal contents (Figure 1).

Figure 1. Inhibitory Figure

effect 1.
ofInhibitory
coffee oneffect
gut of
microbiota
coffee on gutgrowth in vitro.
microbiota growthSerial dilutions
in vitro. of intraluminal
Serial dilutions of intraluminal
fecal contents isolated
fecal contents isolated from the ileum (5~10 cm from the ileum-colon junction, (A)colon
from the ileum (5~10 cm from the ileum-colon junction, (A) and (5 cm
and colon (5 cm
from the end of colon,
from(B)
theofend
naï
ofve rats (B)
colon, were plated
of naïve ratson regular
were plated LB agar and
on regular LB agar
LB agar and LBcontaining 1.5%1.5%
agar containing
coffee, 3.0% coffee, and 3.0%
coffee, 3.0%decaffeinated
coffee, and 3.0%coffee (decaf).
decaffeinated Bacterial
coffee (decaf).colonies
Bacterial were counted
colonies 24 h later.
were counted 24 h later.
N = 4 or 5 independent experiments, # p < 0.05 vs. control (Ctr.);
N = 4 or 5 independent experiments, # p < 0.05 vs. control (Ctr.); * p < 0.001 vs. Ctr. * p < 0.001 vs. Ctr.

To determine if the bacterial growth inhibition effect is caffeine-dependent or not, we

cultured the colonic and ileal fecal contents in the agar containing 3% decaffeinated coffee.
Interestingly, decaffeinated coffee had a similar inhibitory effect on the gut microbiota as
regular coffee (Figure 1).
 coffee, 3.0% coffee, and 3.0% decaffeinated coffee (decaf). Bacterial colonies were counted 24
N = 4 or 5 independent experiments, # p < 0.05 vs. control (Ctr.); * p < 0.001 vs. Ctr.

To determine if the bacterial growth inhibition effect is caffeine-dependent or

Nutrients 2022, 14, 4877 cultured the colonic and ileal fecal contents in the agar containing 3% decaffeinated 6 of 18

Interestingly, decaffeinated coffee had a similar inhibitory effect on the gut microb
regular coffee (Figure 1).
To determine if the bacterial growth inhibition effect is caffeine-dependent or not, we
cultured the colonic and ileal fecal contents in the agar containing 3% decaffeinated coffee.
3.2. In Vivo Effectsdecaffeinated
Interestingly, of Regular and
coffeeDecaffeinated Coffee on
had a similar inhibitory GutonMicrobiota
effect the gut microbiota as
regular coffee (Figure 1).
To determine if regular daily consumption of coffee has any effect on the gut
3.2. determined
biota, we In Vivo Effects of the
Regular
in and Decaffeinated
vivo effect ofCoffee on Gut
coffee Microbiota
gavage on the total bacteria pop
To determine if regular daily consumption of coffee has any effect on the gut micro-
by culture and with qPCR techniques. We found that oral gavage treatment with
biota, we determined the in vivo effect of coffee gavage on the total bacteria population
significantly suppressed
by culture and with qPCR thetechniques.
gut microbiome.
We found thatAfter 3-daystreatment
oral gavage of treatment
with coffeewith cof
viable bacteria (counted
significantly suppressed inthe
anaerobic and aerobic
gut microbiome. culture
After 3-days conditions
of treatment separately)
with coffee, the w
viable bacteria (counted in anaerobic and aerobic culture conditions separately) were de-
creased from 1.50 × 1010 10to 9.16 × 10 9 (CFU/gram of contents, p = 0.03) in the colo
creased from 1.50 × 10 to 9.16 × 109 (CFU/gram of contents, p = 0.03) in the colon, and
from 6.21
from×6.21
109×to103.47 × 10
9 to 3.47 × 10(CFU/gram
9 9
(CFU/gram of ofcontents,
contents, p = 0.01)
p = 0.01) in the(Figure
in the ileum ileum 2). (Figure 2

Figure 2. In vivo effect of coffee on gut microbiota in the ileum and colon determined by bacterial
culture (anaerobic in GAM+ aerobic in TSA). Regular coffee solution (250 mg in 2 mL water) was
administered by oral gavage daily for 3 days. Sham rats were treated similarly, but with 2 mL of
saline. Rats were euthanized 3 days later (24 h after the 3rd coffee treatment). The intraluminal
contents from the ileum (A) and colon (B) were collected. The ileal and colonic contents were cultured
in anaerobic (GAM) and aerobic (TSA) conditions. The total bacteria abundance (CPU/gram of
luminal contents) was counted. N = 4 or 5 rats. * p < 0.05 vs. sham.

Consistent with the culture results, a qPCR study of gut microbiota in the ileum
(Figure 3) and colon (Figure 4) found that coffee treatment significantly decreased the total
bacteria abundance in the colon (p = 0.034. N = 7) and had the trend of suppressing bacteria
counts in the ileum (p = 0.07. N = 7). The consumption of decaffeinated coffee had a similar
inhibitory effect on the gut microbiota in vivo (Figures 3 and 4).
 Consistent with the culture results, a qPCR study of gut microbiota in the ileum
ure 3) and colon (Figure 4) found that coffee treatment significantly decreased th
bacteria abundance in the colon (p = 0.034. N = 7) and had the trend of suppressing b
Nutrients 2022,counts
14, 4877 in the ileum (p = 0.07. N = 7). The consumption of decaffeinated coffee
7 of 18had a s
inhibitory effect on the gut microbiota in vivo (Figures 3 and 4).

Figure 3. Quantitative RT-PCRRT-PCR

Figure 3. Quantitative detection of ofthe
detection thein vivo
in vivo effect
effect of coffee
of coffee onmicrobiota
on the total the totaland microbi
different groups of microbes in the ileum. Coffee (Coff) or decaffeinated coffee (Dec) (250 mg in
different groups of microbes in the ileum. Coffee (Coff) or decaffeinated coffee (Dec) (250 m
2 mL water) was administered by oral gavage daily for 3 days. Sham rats were treated similarly,
mL water) wasbutadministered by oral
with 2 mL of saline. gavage
Rats were daily3 days
euthanized for 3later.
days.TheSham rats contents
intraluminal were treated
from the simila
with 2 mL of saline.
ileum wereRats were
collected. Theeuthanized
total microbiota3(A)
days later. Theofintraluminal
and compositions contents
different groups (B) from th
of microbes
were collected.(Enterobacteria,
The total microbiota (A) and
Gammaproteobacteria, compositions
Lactobacillus, of different
and Firmicutes) relative togroups (B) of microb
overall microbiota
(universal) were determined by real time PCR assays. N = 6 or 5 rats in each group. Sham (Sh). Coff,
terobacteria, Gammaproteobacteria, Lactobacillus, and Firmicutes) relative to overall mic
regular coffee; Dec, decaffeinated coffee.
(universal) were determined by real time PCR assays. N = 6 or 5 rats in each group. Sham (Sh
regular coffee; Dec, decaffeinated coffee.
Nutrients 2022, 14, 4877 8 of 18

We further determined the effect of regular and decaffeinated coffee on different

groups of gut microbes relative to the whole microbiota (Figures 3 and 4). It appears that
coffee mainly inhibits Enterobacteriaceae and Gammaproteobacteria, as it had a trend to further
decrease the relative abundance of these groups in the ileum, but not of Firmicutes and
Lactobacillus in both the small intestine and colon (p > 0.05. Figures 3 and 4). Treatment
with decaffeinated coffee had the similar effect as regular coffee on the different groups of
bacteria in the colon and ileum.

3.3. Effects of Consumption of Regular and Decaffeinated Coffee on Gut Motility and Smooth
Muscle Contractility of the Small Intestine and Colon
To determine if coffee consumption has any long-term effect on gastrointestinal motil-
ity, we first measured the mean transit time of the colon to expel a pellet after rats were
treated with coffee or decaf for 3 days (~24 h after the final gavage treatment). We found
that the transit time was not statistically significant among the saline, coffee, and decaf
groups (Figure 5A). We then compared the ileal and colonic smooth muscle contractility of
rats treated with saline, coffee, and decaf. The ileal and colonic muscle strips were prepared
along the longitudinal direction, and their contractile response was recorded in response
to muscarinic cholinergic activation with acetylcholine (ACh, 10−7 ~10−3 M). Compared
to vehicle controls, coffee treatment in vivo for 3 days did not affect muscle contractile
response to ACh in the colon and ileum (Figure 5B,C), except that the response to one
concentration (10−3 M) of ACh was statistically increased in the coffee treatment group
compared to the vehicle group (Figure 5B, left panel).
As with regular coffee, daily treatment with decaffeinated coffee did not show signifi-
cant effects on the colonic and ileal smooth muscle contractile responses (Figure 5B,C).

3.4. Direct Effect of Coffee on Gut Smooth Muscle Contractility

As coffee consumption did not show a significant genomic effect on gut smooth muscle
contractility, we then detected the direct effect of coffee on ileal and colonic smooth muscle
strips in a muscle bath study. Remarkably, coffee treatment in vitro induced a robust
contractile response of the ileal and colonic smooth muscle in a dose-dependent manner
(0.1 to 10 mg/mL) (Figures 6 and 7). As an example, coffee at 1 mg/mL significantly
increased the integral contractions of ileal and colon smooth muscle by 243 (±26)% and
478 (±45)% (p < 0.01 vs. control), respectively. Furthermore, decaffeinated coffee increased
smooth muscle contractility to a similar extent as regular coffee. This demonstrates that
the robust effect of coffee on intestinal and colonic smooth muscle contractions is in a
caffein-independent manner. The contractile response to 1~5 mg/mL coffee or decaf is
similar as to 10−6 M acetylcholine (Figures 6A and 7A, bottom tracings), the prototype
excitatory neurotransmitter in the neuromuscular transmission in the gut.

3.5. Neuromuscular Mechanisms of Coffee Effect on Gut Smooth Muscle Contractions

We then investigated the neuromuscular mechanisms of action of coffee on smooth
muscle contractions. Neural control of gut smooth muscle contractions is mainly through
the excitatory motor neurons of intrinsic myenteric plexus of the enteric nervous system by
releasing the neurotransmitter acetylcholine acting on cholinergic muscarinic receptors in
smooth muscle cells [20,42]. The extrinsic nervous system (i.e., parasympathetic nervous
system) indirectly controls smooth muscle contractions by innervating the myenteric gan-
glia through acetylcholine acting on nicotinic receptors in the enteric motor neurons. In our
study, when cholinergic nicotinic receptor was blocked with hexamethonium (10−4 M), the
contractile effect of coffee remained intact in the ileal and colon strips (Figures 8A and 9A).
However, when the cholinergic muscarinic receptor antagonist atropine (10−6 M) was
present in the bath solution, the stimulating effect of coffee on muscle contractions was al-
most completely blocked (Figures 8B and 9B). Hexamethonium and atropine had the same
effect on decaffeinated coffee-induced contractions in the ileum and colon (Figures 8 and 9).
These results demonstrate that non-caffein component(s) in coffee solution acts on the in-
 Nutrients 2022, 14, 4877 9 of 18

trinsic myenteric plexus or directly on smooth muscle cells to stimulate gut smooth muscle
contractions in a muscarinic receptor-dependent mechanism. Interestingly, when neural
activity is blocked with tetrodotoxin (TTX, 10−6 M), the coffee- or decaf-evoked contractile
response in the ileal muscle remains intact (Figure 8C). However, TTX partially but signifi-
cantly attenuated coffee- or decaf-evoked contractile response in the colonic muscle strips
(Figure 9C). These data indicate that coffee or decaf contracts the ileal smooth muscle by
Nutrients 2022, 14, x FOR PEER REVIEW
acting directly on the cholinergic muscarinic receptor in the muscle cells. However, coffee 8 of 18
or decaf acts on both myenteric neurons and the smooth muscle to contract the colonic
smooth muscle in a muscarinic receptor-dependent mechanism.

Figure4.4.Quantitative
Figure Quantitative RT-PCR
RT-PCR detection
detection of in
of the the in effect
vivo vivo effect of on
of coffee coffee on the
the total total microbiota
microbiota and and
differentgroups
different groupsofofmicrobes
microbesin in
thethe colon.
colon. Coffee
Coffee (Coff)(Coff) or decaffeinated
or decaffeinated coffeecoffee (Dec)
(Dec) (250 mg(250
in mg in 2
2mLmLwater)
water)was
was administered
administered by byoral
oralgavage
gavagedailydailyforfor 3 days.
3 days. Sham
Sham ratsrats
werewere treated
treated similarly, bu
similarly,
withwith
but 2 mL of saline.
2 mL Rats
of saline. were
Rats wereeuthanized
euthanized33 days
days later. The intraluminal
later. The intraluminalcontents
contents from
from thethe colon
colon were collected. The total microbiota (A) and compositions of different groups of microbes (Entero
were collected. The total microbiota (A) and compositions of different groups of microbes
bacteria, Gammaproteobacteria,
(Enterobacteria, Gammaproteobacteria, Lactobacillus,
Lactobacillus, and
andFirmicutes) relativetotooverall
Firmicutes) relative overall microbiota (uni
microbiota
versal) (B) were determined by real time PCR assays. N = 6 or 5 rats in each
(universal) (B) were determined by real time PCR assays. N = 6 or 5 rats in each group. Sham group. Sham (Sh). Coff
(Sh).
regular
Coff, coffee;
regular Dec,Dec,
coffee; decaffeinated
decaffeinatedcoffee.
coffee.**pp<<0.05
0.05 vs.
vs. sham
sham of ofthe
thegroup.
group.

We further determined the effect of regular and decaffeinated coffee on differen

groups of gut microbes relative to the whole microbiota (Figures 3 and 4). It appears tha
coffee mainly inhibits Enterobacteriaceae and Gammaproteobacteria, as it had a trend to fur
ther decrease the relative abundance of these groups in the ileum, but not of firmicutes and
lactobacillus in both the small intestine and colon (p > 0.05. Figures 3 and 4). Treatment with
 tile response to ACh in the colon and ileum (Figure 5B,C), except that the response to one
concentration (10−3 M) of ACh was statistically increased in the coffee treatment group
compared to the vehicle group (Figure 5B, left panel).
Nutrients 2022, 14, 4877As with regular coffee, daily treatment with decaffeinated coffee did not show
10 of 18 sig-
nificant effects on the colonic and ileal smooth muscle contractile responses (Figure 5B,C)

Figure 5. EffectFigure
of coffee onof gut
5. Effect coffeepropulsive motility
on gut propulsive motilityand smooth
and smooth muscle
muscle contractility
contractility inand
in the ileum the ileum
colon.coffee
and colon. Regular Regular(Coff,
coffee (Coff,
blue)blue)
andand decaffeinated coffee
decaffeinated (Dec,
coffee pink) pink)
(Dec, (250 mg(250
in 2 mL
mgwater)
in 2 was
mL water
administered by oral gavage daily for 3 days. Sham rats were treated similarly, but with 2 mL of
was administered by oral gavage daily for 3 days. Sham rats were treated similarly, but with 2 mL
saline. Rats were euthanized 3 days later. Colon motility was measured by counting the time needed
of saline. Rats to
were euthanized 3 days later. Colon motility was measured by counting the time
expel the inserted pellet from the anus (A). The ileal (B) and colonic (C) muscle strips were isolated
needed to expel thetheinserted
from pellet
rats, and their from the
longitudinal anus
muscle (A). Thewas
contractility ileal (B) and
recorded colonic
in muscle bath. (C) muscle strips
The smooth
were isolated from the rats, and their longitudinal muscle contractility was recorded
muscle contractile response to acetylcholine (ACh) was determined. N = 6 or 5 rats in each group. in muscle bath
The smooth muscle contractile
* p < 0.05 response
vs. sham. Sham toregular
(Sh). Coff, acetylcholine
coffee; Dec,(ACh) was coffee.
decaffeinated determined. N = 6 or 5 rats in
each group. * p < 0.05 vs. sham. Sham (Sh). Coff, regular coffee; Dec, decaffeinated coffee.
 and 478 (±45)% (p < 0.01 vs. control), respectively. Furthermore, decaffeinated coffee in
strates that the robust effect of coffee on intestinal and colonic smooth muscle contraction
creased smooth muscle contractility to a similar extent as regular coffee. This demon
is in a caffein-independent manner. The contractile response to 1 ~ 5 mg/mL coffee or deca
strates that the robust effect of coffee on intestinal and colonic smooth muscle contractions
is similar as to 10−6 M acetylcholine (Figures 6A and 7A, bottom tracings), the prototyp
is in a caffein-independent manner. The contractile response to 1 ~ 5 mg/mL coffee or deca
excitatory neurotransmitter in the neuromuscular transmission in the gut.
Nutrients 2022, 14, 4877 is similar as to 10−6 M acetylcholine (Figures 6A and 7A, bottom tracings), the 11 ofprototype
18
excitatory neurotransmitter in the neuromuscular transmission in the gut.

Figure 6. In vitro effect of coffee on ileal muscle contractions. Ileal muscle strips were isolated from
naïve rats,6.and
Figure theireffect
In vitro longitudinal
of coffee muscle
on ileal contractility was recorded
muscle contractions. in muscle
Ileal muscle bath isolated
strips were (A). The in vitr
Figure
effects 6. In
fromofnaïve
vitro
regular effect
rats, coffee
of(Coff)
and their
coffee on ileal
and muscle contractions.
decaffeinated
longitudinal coffee was
muscle contractility
Ilealatmuscle
(Decaf)
recorded differentstrips were isolated from
in muscleconcentrations
bath (A). The (0.1~1
naïve
in rats,
mg/mL) onand
vitro their
muscle
effects longitudinal
contractility
of regular inmuscle
theand
coffee (Coff) contractility
first 2 min afterwas
decaffeinated eachrecorded
coffee dose was
(Decaf) atinmeasured
muscleconcentrations
different bath
(B).(A).
N = The in vitro
4 independ
effects of regular
ent (0.1~10
experiments
mg/mL) coffee
in (Coff)
4 rats.
on muscle and decaffeinated
contractility in the first 2coffee (Decaf)
min after at different
each dose concentrations
was measured (B). N = 4 (0.1~10
mg/mL) on muscle contractility
independent experiments in 4 rats. in the first 2 min after each dose was measured (B). N = 4 independ
ent experiments in 4 rats.

Figure 7. In vitro effect of coffee on colonic muscle contractions. Colonic muscle strips were isolated
Figure
from7.naïve
In vitro
rats,effect of coffee
and their on colonic
longitudinal muscle
muscle contractions.
contractility Colonic
was recorded muscle
in muscle strips
bath (A).were
The isolate
from naï ve rats, and their longitudinal muscle contractility was recorded in muscle bath (A). The i
in vitro effects of regular coffee (Coff) and decaffeinated coffee (Decaf) at different concentrations
Figure 7. In vitro effect of coffee on colonic muscle contractions. Colonic muscle strips
(0.1~10 mg/mL) on muscle contractility in the first 2 min after each dose were measured (B). N = 4
were isolated
fromindependent
naïve rats,experiments
and their longitudinal
in 4 rats. muscle contractility was recorded in muscle bath (A). The in
R PEER REVIEW 12 of 18
Nutrients 2022, 14, 4877 12 of 18

Figure 8. Site of actionFigure 8. Siteon

of coffee of action
smoothof coffee on smooth
muscle muscle contractions
contractions in the ileum.
in the ileum. IlealIleal musclestrips
muscle strips were
were
isolated from naïve rats, and their longitudinal muscle contractile activities were recorded in a muscle
isolated from naïve rats, and their longitudinal muscle contractile activities were recorded in a mus-
bath. The contractile response to regular coffee (Coff) and decaffeinated coffee (Decaf) at 5 mg/mL
cle bath. The contractile response to regular coffee (Coff) and decaffeinated coffee (Decaf) at 5
each was recorded in the absence and presence of nicotinic receptor antagonist hexamethonium (Hex,
mg/mL each was recorded 10 M)in
− 4 (A),the absence
muscarinic and presence
receptor of nicotinic
antagonist atropine (Atr, 10receptor
−6 M) (B), andantagonist
neurotoxinhexametho-
tetrodotoxin
nium (Hex, 10 M) (A),
−4
(TTX,muscarinic receptor
10−6 M) (C). Tracings are antagonist
representative atropine (Atr, 10
of 4~5 independent
−6 M) (B),The
experiments. and neurotoxin
response in the
tetrodotoxin (TTX, 10firstM)
−6 2 min(C).
afterTracings are
the addition representative
of coff of 4~5activity
or decaf over baseline independent
is summarized experiments. The
in the bar graphs.
response in the first 2Nmin= 4 or 5. * pthe
after < 0.05.
addition of coff or decaf over baseline activity is summarized in
the bar graphs. N = 4 or 5. * p < 0.05.
FOR PEER REVIEW 13 of 18
Nutrients 2022, 14, 4877 13 of 18

Figure 9. Determination
Figureof9.site(s) of action
Determination of of coffee
site(s) on smooth
of action of coffee muscle
on smooth contractions in the colon.
muscle contractions in the colon.
Colonic muscle stripsColonic
were muscle strips
isolated fromwere isolated
naï ve rats,from naïve
and rats,longitudinal
their and their longitudinal
musclemuscle contractile
contractile activities
activ-
were
ities were recorded in therecorded
muscleinbath.
the muscle bath. The contractile
The contractile responseresponse to regular
to regular coffee
coffee (Coff) and
(Coff) and decaffeinated
decaf-
coffee
feinated coffee (Decaf) at 5(Decaf)
mg/mLat was5 mg/mL was recorded
recorded in the absence
in the absence and presence
and presence of theofnicotinic
the nicotinic receptor
recep-
antagonist hexamethonium (Hex) (A), the muscarinic receptor antagonist atropine (Atr) (B), and the
tor antagonist hexamethonium (Hex) (A), the muscarinic receptor antagonist atropine (Atr) (B), and
neurotoxin tetrodotoxin (TTX) (C). Tracings are representative of 4~5 independent experiments. The
the neurotoxin tetrodotoxin (TTX) (C). Tracings are representative of 4~5 independent experiments.
response in the first 2 min after the addition of coff or decaf over baseline activity is summarized in
The response in the first 2 min after the addition of coff or decaf over baseline activity is summarized
the bar graphs. N = 4 or 5. * p < 0.05.
in the bar graphs. N = 4 or 5. * p < 0.05.
4. Discussion
4. Discussion In previous attempts to understand the impact of coffee on the microbiota, Jaquet et al. [17]
found that coffee might promote the growth of probiotic bacteria, while others [19] reported
In previous attempts tohad
that coffee understand
no effect onthe impact
fecal of coffee
bacteria. on the
Our study microbiota,
aimed to determineJaquet et the
not only
al. [17] found that coffee
in vivomight promote
effects of coffee onthe
the growth of probiotic
gut microbiota bacteria,
in the small while
intestine others
and colon, but[19]
also the
reported that coffee had no effect on fecal bacteria. Our study aimed to determine not only in
growth of microbiota in vitro. We first cultured the whole population of gut microbiota
thecoffee
the in vivo effects of intraluminal
on the(fecal) contents of the
gut microbiota inileum and colon
the small on regular
intestine and LB agar but
colon, and agar
alsowith
coffee. Remarkably, we found that bacterial growth was suppressed by 100~1000-fold on
the growth of microbiota in vitro. We first cultured the whole population of gut microbi-
coffee-agar, compared to regular LB agar. This antibacterial effect is not caffein dependent,
ota in the intraluminal (fecal) contents
as decaffeinated of the
coffee had ileuminhibitory
a similar and colon ononregular
effect LB agar and
the gut microbiota. agar
To determine
with coffee. Remarkably, we found that bacterial growth was suppressed by 100~1000-
fold on coffee-agar, compared to regular LB agar. This antibacterial effect is not caffein
dependent, as decaffeinated coffee had a similar inhibitory effect on the gut microbiota.
To determine if coffee consumption has an anti-bacterial effect, we chose to deliver coffee
Nutrients 2022, 14, 4877 14 of 18

if coffee consumption has an anti-bacterial effect, we chose to deliver coffee brew to rats
by oral gavage at 1 g/kg of body weight. This dose of coffee for a rat of ~250 g is similar
to the amount of coffee consumed by a person with a body weight of 75 kg consuming
4 cups of coffee per day. Interestingly, we found that coffee treatment for three days sub-
stantially decreased total microbiota abundance in the ileum and colon, measured by either
bacterial culture or quantitative RT-PCR. Again, this in vivo anti-bacterial effect appears to
also be independent of caffein, as treatment with decaffeinated coffee achieved a similar
inhibitory effect as regular coffee. To determine whether coffee has a similar inhibitory
effect on harmful and beneficial gut bacteria, we chose to quantitate the abundance of four
different groups of gut microbes, i.e., Enterobacteriaceae, Gammaproteobacteria, Firmicutes
and Lactobacillus, in control and coffee treated rats. Interestingly, we found that regular
coffee and decaffeinated coffee had a trend to further suppress the relative abundance
of Enterobacteriaceae in the colon and ileum. However, neither regular coffee nor decaf-
feinated coffee had any inhibitory effect on Firmicutes or Lactobacillus in the small intestine
and colon. Enterobacteria include some widely recognized pathogenic bacteria in the gut,
i.e., E. coli, Salmonella and Shigella. A previous study by Nakayama and Oishi noted that
coffee significantly inhibited E. coli, which belongs to enterobacteria [18]. On the other
hand, Firmicutes and Lactobacillus are well known probiotics for their beneficial effects in
the gut [14,27,44]. Taken together, our in vitro and in vivo results suggest that coffee has
anti-bacterial properties in the gut. This anti-bacterial effect appears largely beneficial, as
coffee is more inhibitory to potentially harmful bacteria such as enterobacteria, rather than
to beneficial ones such as Firmicutes or Lactobacillus.
It remains to be determined which components in coffee exerted the anti-bacterial
action. However, our study found that decaffeinated coffee had a similar effect as regular
coffee in inhibiting gut microbiota in vitro and in vivo. Thus, caffeine may not be the
component exerting the anti-bacterial action. Among hundreds of bioactive components
in coffee, several may have contributed to the anti-bacterial property. Chlorogenic acid
(CGA), an important biologically active dietary polyphenol, is a major component of
regular and decaffeinated coffee [45]. CGA is reported to not only have antioxidant and
anti-inflammatory properties, but also antibacterial effects [46,47]. CGA has an inhibitory
effect on both Gram-positive and Gram-negative bacteria by disrupting the cell membrane
and interfering with the cell cycle and the metabolism of bacterial cells [46,48]. There
are reports that coffee silverskin byproducts generated during the coffee roasting process
may also have anti-microbial potential [49]. In addition, in vitro studies found that coffee
melanoidins are also anti-bacterial, especially against E. coli, via a membrane damage
mechanism [50].
Studies in healthy human subjects found that drinking coffee increased colon motility [22,23].
Surveys also showed that coffee drinking is associated with a decreased risk of constipa-
tion [5]. Furthermore, recent clinical trials found that drinking coffee during the post-
operation period reduces the time to have first bowel movement and the incidence of
post-operative ileus [7,9,10]. These studies suggest that coffee may have pro-motility prop-
erties. In the second part of the study, we aimed to determine if the pro-motility effect of
coffee is via its genomic effect or immediate pharmacological action on the neuromuscular
control of gut smooth muscle contraction. The administration of coffee for three days at
a dose similar to that consumed daily by a human being did not significantly change gut
smooth muscle contractility in the colon or ileum. This suggests that coffee may not have a
significant genomic effect on the neuro-musculature of the GI tract (i.e., the up-regulation
of genes encoding key biomolecules in neuromuscular transmission or contractile proteins
involved in smooth muscle contractions).
We then decided to investigate the pharmacological effects of coffee on gut smooth
muscle contractility and its mechanism of action by testing the immediate action of coffee
on the ileal and colon tissue strips. Our data showed that regular or decaffeinated cof-
fee increased ileal and colonic smooth muscle contractility in a dose-dependent manner
(0.1~10 mg/mL). The contractile response induced by 1 mg/mL coffee is similar to that in-
Nutrients 2022, 14, 4877 15 of 18

duced by 1 µM of acetylcholine, a key neurotransmitter released from the myenteric motor

neurons in the enteric nervous system to excite the gut smooth muscle for contractions. Our
study thus indicates that the pro-motility effect of coffee is mainly through its immediate
pharmacological effect on the neuro-musculature of the gut.
We further determined the site of action of coffee on gut smooth muscle contractions.
The neuro-muscular control of gut smooth muscle contractions involves pre-ganglia neural
innervation via nicotinic receptors acting on the motor neurons in the myenteric ganglia.
The excitatory motor neurons are primarily cholinergic, acting on cholinergic muscarinic
receptors in gut smooth muscle cells leading to contractions [20,42]. In our study, pretreat-
ment with the nicotinic receptor antagonist hexamethonium did not have any inhibitory
effect on coffee-evoked contractile response, suggesting that coffee does not act on the
site of pre-ganglia neural transmission. However, the cholinergic muscarinic receptor
antagonist atropine almost completely blocked coffee-evoked contractions in the ileal and
colonic muscle strips. This suggests that coffee exerts its contractile effect by acting on the
post-ganglia neural pathway or directly on muscarinic receptors in gut smooth muscle
cells. Moreover, when neural activity is blocked with TTX, the coffee-evoked contractile
response in the ileal muscle remained intact. However, TTX significantly attenuated coffee-
evoked the contractile response in the colonic muscle strips. These data indicate that coffee
contracts ileal smooth muscle by acting directly on cholinergic muscarinic receptors in the
muscle cells. However, it contracts colonic smooth muscle by acting on both myenteric
neurons and smooth muscle in a muscarinic receptor-dependent mechanism.
Interestingly, decaffeinated coffee acted exactly as coffee in its contractile action,
suggesting that caffeine is not a key molecule in the coffee solution in exerting a contractile
effect. In fact, caffeine was found to have an inhibitory effect on gut smooth muscle
contractions at low doses [51]. At higher doses, caffeine may cause a transient contraction
followed by the prolonged relaxation of the gut smooth muscle [52]. Our findings are
supported by clinical observations that, like regular coffee, decaffeinated coffee caused
increased colonic motor activity in normal subjects [22,23], and had a beneficial effect on
post-operational ileus [8,10].
Currently, we do not know exactly which component(s) in the coffee solution is
(are) responsible for the contractile response. Among the many bioactive components
in coffee solution, melanoidins of the maillard reaction products, polyphenols, i.e., CGA
and caffeic acid (CA), or choline may be among the key potential candidate molecules
involved in the actions on gut smooth muscle contractions. Melanoidins such as Arg-Glu
were found to lead to gastric muscle contractions [53]. CGA and CA were found to have
protective effects on the enteric nervous system [24,54]. However, CA seems to lead to
smooth muscle relaxation [55]. Choline, as a nutrient, is found in coffee, although in small
amounts. The action of choline to cause gut smooth muscle contractions is well known [56].
Whether any of these potential candidate molecules is involved in the coffee effect on ileal
and colonic smooth muscle contractions will be determined in our future study. Such
studies are expected to better understand the health benefit of coffee and even to identify
pharmacological targets for therapeutics for gut motility disorders.
There are some limitations in our study. The results in the present article are based on
our study with the specific regular and decaffeinated coffee at the doses and concentrations
described in Materials and Methods. Although we tried another brand of roasted regular
and decaffeinated coffee and found that their effects on microbiota and motility are similar
to the results reported here, we are not certain if other types of coffee at different doses
will achieve the same effects. In our in vivo study, we only studied the coffee effects for
three days. We hope for the opportunity to study the effects of coffee on the gut over longer
times in the future.
Taken together, our in vitro and in vivo studies show that coffee inhibits the gut
microbiota in a caffeine-independent manner. The anti-bacterial effect of coffee is more
effective for Enterobacteria than for beneficial bacteria such as Firmicutes and Lactobacillus.
We found that coffee has a profound pro-motility effect on the ileum and colon, also in a
Nutrients 2022, 14, 4877 16 of 18

caffein-independent manner. However, coffee exerts a pro-motility effect not through a

genomic effect, as the administration of coffee for days did not change motility or muscle
contractility. Rather, coffee has a robust pharmacologic effect to directly induce gut smooth
muscle contractions in the ileum and colon. Mechanistic studies demonstrate that coffee
acts on smooth muscle cells (in the small intestine) and post-ganglia neural sites (in the
colon), rather than the pre-ganglia neural site, to evoke smooth muscle contractions in a
muscarinic receptor-dependent mechanism.

Author Contributions: S.H.–Acquisition, analysis and interpretation of data, statistical analysis, edit-
ing of manuscript; D.W.S.–Acquisition, analysis and interpretation of data, statistical analysis, editing
of manuscript; J.C.J.-Acquisition, analysis and interpretation of data; R.G.-Acquisition, analysis and
interpretation of data; K.Z.-Acquisition of data; Y.-M.L.–Acquisition of data; X.-Z.S.—Study concept
and design, analysis and interpretation of data, drafting of manuscript, and obtaining funding. All
approved final version of manuscript. All authors have read and agreed to the published version of
the manuscript.
Funding: This study was supported in part by National Institute of Health (R01 DK102811 and R01
DK124611 to XZS) and U.S. Department of Defense (W81XWH2010681 to XZS).
Institutional Review Board Statement: The animal study protocol was approved by the Institutional
Animal Care and Use Committee (IACUC) of the University of Texas Medical Branch (protocol code:
0907051D; date of approval: 28 June 2021).
Informed Consent Statement: Not applicable.
Data Availability Statement: The raw data supporting the conclusion of this article are made
available by the authors, without undue reservation.
Conflicts of Interest: The authors declare that they have no conflict of interest.

References
1. Lopez-Garcia, E.; Rodriguez-Artalejo, F.; Rexrode, K.M.; Logroscino, G.; Hu, F.B.; van Dam, R.M. Coffee consumption and risk of
stroke in women. Circulation 2009, 119, 1116–1123. [CrossRef] [PubMed]
2. Ross, G.W.; Abbott, R.D.; Petrovitch, H.; Morens, D.M.; Grandinetti, A.; Tung, K.-H.; Tanner, C.M.; Masaki, K.H.; Blanchette,
P.L.; Curb, J.D.; et al. Association of coffee and caffeine intake with the risk of Parkinson disease. JAMA 2000, 283, 2674–2679.
[CrossRef]
3. Kolb, H.; Martin, S.; Kempf, K. Coffee and Lower Risk of Type 2 Diabetes: Arguments for a Causal Relationship. Nutrients 2021,
13, 1144. [CrossRef]
4. Wadhawan, M.; Anand, A.C. Coffee and Liver Disease. J. Clin. Exp. Hepatol. 2016, 6, 40–46. [CrossRef] [PubMed]
5. Murakami, K.; Okubo, H.; Sasaki, S. Dietary intake in relation to self-reported constipation among Japanese women aged 18–20
years. Eur. J. Clin. Nutr. 2006, 60, 650–657. [CrossRef] [PubMed]
6. Müller-Lissner, S.A.; Kaatz, V.; Brandt, W.; Keller, J.; Layer, P. The perceived effect of various foods and beverages on stool
consistency. Eur. J. Gastroenterol. Hepatol. 2005, 17, 109–112. [CrossRef]
7. Müller, S.A.; Rahbari, N.N.; Schneider, F.; Warschkow, R.; Simon, T.; von Frankenberg, M.; Bork, U.; Weitz, J.; Schmied, B.M.;
Büchler, M.W. Randomized clinical trial on the effect of coffee on postoperative ileus following elective colectomy. Br. J. Surg.
2012, 99, 1530–1538. [CrossRef]
8. Müller, S.A.; Rahbari, N.N.; Schmied, B.M.; Büchler, M.W. Can postoperative coffee perk up recovery time after colon surgery?
Expert Rev. Gastroenterol. Hepatol. 2013, 7, 91–93. [CrossRef]
9. Güngördük, K.; Özdemir, İ.A.; Güngördük, Ö.; Gülseren, V.; Gokçü, M.; Sancı, M. Effects of coffee consumption on gut recovery
after surgery of gynecological cancer patients: A randomized controlled trial. Am. J. Obstet. Gynecol. 2017, 216, 145.e1–145.e7.
[CrossRef]
10. Watanabe, J.; Miki, A.; Koizumi, M.; Kotani, K.; Sata, N. Effect of Postoperative Coffee Consumption on Postoperative Ileus after
Abdominal Surgery: An Updated Systematic Review and Meta-Analysis. Nutrients 2021, 13, 4394. [CrossRef]
11. Sartini, M.; Bragazzi, N.L.; Spagnolo, A.M.; Schinca, E.; Ottria, G.; Dupont, C.; Cristina, M.L. Coffee Consumption and Risk of
Colorectal Cancer: A Systematic Review and Meta-Analysis of Prospective Studies. Nutrients 2019, 11, 694. [CrossRef]
12. Thursby, E.; Juge, N. Introduction to the human gut microbiota. Biochem. J. 2017, 474, 1823–1836. [CrossRef] [PubMed]
13. Stojanov, S.; Berlec, A.; Štrukelj, B. The Influence of Probiotics on the Firmicutes/Bacteroidetes Ratio in the Treatment of Obesity
and Inflammatory Bowel disease. Microorganisms 2020, 8, 1715. [CrossRef] [PubMed]
14. Di Cerbo, A.; Palmieri, B.; Aponte, M.; Morales-Medina, J.C.; Iannitti, T. Mechanisms and therapeutic effectiveness of lactobacilli.
J. Clin. Pathol. 2016, 69, 187–203. [CrossRef] [PubMed]
Nutrients 2022, 14, 4877 17 of 18

15. Rizzatti, G.; Lopetuso, L.R.; Gibiino, G.; Binda, C.; Gasbarrini, A. Proteobacteria: A Common Factor in Human Diseases. BioMed
Res. Int. 2017, 2017, 9351507. [CrossRef] [PubMed]
16. Davin-Regli, A.; Pagès, J.M. Enterobacter aerogenes and Enterobacter cloacae; versatile bacterial pathogens confronting antibiotic
treatment. Front. Microbiol. 2015, 6, 392. [CrossRef] [PubMed]
17. Jaquet, M.; Rochat, I.; Moulin, J.; Cavin, C.; Bibiloni, R. Impact of coffee consumption on the gut microbiota: A human volunteer
study. Int. J. Food Microbiol. 2009, 130, 117–121. [CrossRef]
18. Nakayama, T.; Oishi, K. Influence of coffee (Coffea arabica) and galacto-oligosaccharide consumption on intestinal microbiota and
the host responses. FEMS Microbiol. Lett. 2013, 343, 161–168. [CrossRef] [PubMed]
19. Gniechwitz, D.; Reichardt, N.; Blaut, M.; Steinhart, H.; Bunzel, M. Dietary fiber from coffee beverage: Degradation by human
fecal microbiota. J. Agric. Food Chem. 2007, 55, 6989–6996. [CrossRef] [PubMed]
20. Sarna, S.K.; Shi, X.Z. Function and Regulation of Colonic Contractions in Health and Disease. In Physiology of the Gastrointestinal
Tract, 4th ed.; Johnson, L.R., Barrett, K.E., Grisham, F.K., Merchant, J.L., Said, H.M., Ward, J.D., Eds.; Elsevier: San Diego, CA,
USA, 2006; Chapter 39; pp. 965–993.
21. Lin, Y.M.; Sarna, S.K.; Shi, X.Z. Prophylactic and therapeutic benefits of COX-2 inhibitor on motility dysfunction in bowel
obstruction: Roles of PGE2 and EP receptors. Am. J. Physiol. Gastrointest. Liver Physiol. 2012, 302, G267–G275. [CrossRef]
22. Brown, S.R.; Cann, P.A.; Read, N.W. Effect of coffee on distal colon function. Gut 1990, 31, 450–453. [CrossRef] [PubMed]
23. Rao, S.S.; Welcher, K.; Zimmerman, B.; Stumbo, P. Is coffee a colonic stimulant? Eur. J. Gastroenterol. Hepatol. 1998, 10, 113–118.
[CrossRef] [PubMed]
24. Iriondo-DeHond, A.; Uranga, J.A.; Del Castillo, M.D.; Abalo, R. Effects of Coffee and Its Components on the Gastrointestinal
Tract and the Brain-Gut Axis. Nutrients 2020, 13, 88. [CrossRef] [PubMed]
25. Nehlig, A. Effects of Coffee on the Gastro-Intestinal Tract: A Narrative Review and Literature Update. Nutrients 2022, 14, 399.
[CrossRef]
26. Hegde, S.; Shi, D.; Lin, Y.M.; Shi, X.Z. In vivo and in vitro effects of coffee on gut microbiota and smooth muscle contractility in
rats (Abstract). Gastroenterology 2019, 156, S-587. [CrossRef]
27. Hegde, S.; Lin, Y.M.; Golovko, G.; Khanipov, K.; Cong, Y.; Savidge, T.; Fofanov, Y.; Shi, X.Z. Microbiota dysbiosis and its
pathophysiological significance in bowel obstruction. Sci. Rep. 2018, 8, 13044. [CrossRef]
28. Hegde, S.; Lin, Y.M.; Fu, Y.; Savidge, T.; Shi, X.Z. Precision Lactobacillus reuteri therapy attenuates luminal distension-associated
visceral hypersensitivity by inducing peripheral opioid receptors in the colon. Pain 2020, 161, 2737–2749. [CrossRef]
29. Lin, Y.M.; Li, F.; Shi, X.Z. Mechanical stress is a pro-inflammatory stimulus in the gut: In vitro, in vivo and ex vivo evidence. PLoS
ONE 2014, 9, e106242. [CrossRef]
30. Lin, Y.M.; Fu, Y.; Winston, J.; Radhakrishnan, R.; Sarna, S.K.; Huang, L.M.; Shi, X.Z. Pathogenesis of abdominal pain in bowel
obstruction: Role of mechanical stress-induced upregulation of nerve growth factor in gut smooth muscle cells. Pain 2017, 158,
583–592. [CrossRef]
31. Rettedal, E.A.; Gumpert, H.; Sommer, M.O. Cultivation-based multiplex phenotyping of human gut microbiota allows targeted
recovery of previously uncultured bacteria. Nat. Commun. 2014, 5, 4714. [CrossRef]
32. Walker, A.W.; Martin, J.C.; Scott, P.; Parkhill, J.; Flint, H.J.; Scott, K.P. 16S rRNA gene-based profiling of the human infant gut
microbiota is strongly influenced by sample processing and PCR primer choice. Microbiome 2015, 3, 26. [CrossRef] [PubMed]
33. Bartosch, S.; Fite, A.; Macfarlane, G.T.; McMurdo, M. Characterization of bacterial communities in feces from healthy elderly
volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota.
Appl. Environ. Microbiol. 2004, 70, 3575–3578. [CrossRef] [PubMed]
34. Mühling, M.; Woolven-Allen, J.; Murrell, J.C.; Joint, I. Improved group-specific PCR primers for denaturing gradient gel
electrophoresis analysis of the genetic diversity of complex microbial communities. ISME J. 2008, 2, 379–392. [CrossRef] [PubMed]
35. Haarman, M.; Knol, J. Quantitative real-time PCR analysis of fecal Lactobacillus species in infants receiving a prebiotic infant
formula. Appl. Environ. Microbiol. 2006, 72, 2359–2365. [CrossRef]
36. Pfeiffer, S.; Pastar, M.; Mitter, B.; Lippert, K.; Hackl, E.; Lojan, P.; Oswald, A.; Sessitsch, A. Improved group-specific primers based
on the full SILVA 16S rRNA gene reference database. Environ. Microbiol. 2014, 16, 2389–2407. [CrossRef]
37. Broccardo, M.; Agostini, S.; Petrella, C.; Guerrini, R.; Improta, G. Central and peripheral role of the nociceptin/orphaninFQ
system on normal and disturbed colonic motor function and faecal pellet output in the rat. Neurogastroenterol. Motil. 2008, 20,
939–948. [CrossRef]
38. Raffa, R.B.; Mathiasen, J.R.; Jacoby, H.I. Colonic bead expulsion time in normal and mu-opioid receptor deficient (CXBK) mice
following central (ICV) administration of mu- and delta-opioid agonists. Life Sci. 1987, 41, 2229–2234. [CrossRef]
39. Shi, X.Z.; Choudhury, B.K.; Pasricha, P.J.; Sarna, S.K. A novel role of VIP in colonic motility function: Induction of excitation-
transcription coupling in smooth muscle cells. Gastroenterology 2007, 132, 1388–1400. [CrossRef]
40. Shi, X.Z.; Sarna, S.K. Gene therapy of Cav1.2 channel with VIP and VIP receptor agonists and antagonists: A novel approach to
designing promotility and antimotility agents. Am. J. Physiol. Gastrointest. Liver Physiol. 2008, 295, G187–G196. [CrossRef]
41. Li, F.; Lin, Y.M.; Sarna, S.K.; Shi, X.Z. Cellular mechanism of mechano-transcription in colonic smooth muscle cells. Am. J. Physiol.
Gastrointest. Liver Physiol. 2012, 303, G670–G679. [CrossRef]
42. Shi, X.Z.; Sarna, S.K. Inflammatory modulation of muscarinic receptor activation in canine ileal circular muscle cells. Gastroen-
terology 1997, 112, 864–874. [CrossRef] [PubMed]
Nutrients 2022, 14, 4877 18 of 18

43. Gonzalez, A.; Sarna, S.K. Neural regulation of in vitro giant contractions in the rat colon. Am. J. Physiol. Gastrointest. Liver Physiol.
2001, 281, G275–G282. [CrossRef]
44. Wu, G.D.; Chen, J.; Hoffmann, C.; Bittinger, K.; Chen, Y.-Y.; Keilbaugh, S.A.; Bewtra, M.; Knights, D.; Walters, W.A.;
Knight, R.; et al. Linking long-term dietary patterns with gut microbial enterotypes. Science 2011, 334, 105–108. [CrossRef]
45. Tajik, N.; Tajik, M.; Mack, I.; Enck, P. The potential effects of chlorogenic acid, the main phenolic components in coffee, on health:
A comprehensive review of the literature. Eur. J. Nutr. 2017, 56, 2215–2244. [CrossRef] [PubMed]
46. Wang, L.; Pan, X.; Jiang, L.; Chu, Y.; Gao, S.; Jiang, X.; Zhang, Y.; Chen, Y.; Luo, S.; Peng, C. The Biological Activity Mechanism of
Chlorogenic Acid and Its Applications in Food Industry: A Review. Front. Nutr. 2022, 9, 943911. [CrossRef] [PubMed]
47. Tsou, S.H.; Hu, S.W.; Yang, J.J.; Yan, M.; Lin, Y.Y. Potential Oral Health Care Agent from Coffee Against Virulence Factor of
Periodontitis. Nutrients 2019, 11, 2235. [CrossRef]
48. Su, M.; Liu, F.; Luo, Z.; Wu, H.; Zhang, X.; Wang, D.; Zhu, Y.; Sun, Z.; Xu, W.; Miao, Y. The Antibacterial Activity and Mechanism
of Chlorogenic Acid Against Foodborne Pathogen Pseudomonas aeruginosa. Foodborne Pathog. Dis. 2019, 16, 823–830. [CrossRef]
49. Rodrigues, F.; Palmeira-de-Oliveira, A.; das Neves, J.; Sarmento, B.; Amaral, M.H.; Oliveira, M.B. Coffee silverskin: A possible
valuable cosmetic ingredient. Pharm. Biol. 2015, 53, 386–394. [CrossRef]
50. Rufián-Henares, J.A.; de la Cueva, S.P. Antimicrobial activity of coffee melanoidins-a study of their metal-chelating
properties. J. Agric. Food Chem. 2009, 57, 432–438. [CrossRef]
51. Tokutomi, Y.; Tokutomi, N.; Nishi, K. The Properties of Ryanodine-Sensitive Ca2+ Release in Mouse Gastric Smooth Muscle Cells.
Br. J. Pharmacol. 2001, 133, 125–137. [CrossRef]
52. Domae, K.; Hashitani, H.; Suzuki, H. Regional Differences in the Frequency of Slow Waves in Smooth Muscle of the Guinea-Pig
Stomach. J. Smooth Muscle Res. 2008, 44, 231–248. [CrossRef] [PubMed]
53. Argirova, M.D.; Stefanova, I.D.; Krustev, A.D.; Turiiski, V.I. Testing biological activity of model Maillard reaction products:
Studies on gastric smooth muscle tissues. Amino Acids. 2010, 38, 797–803. [CrossRef] [PubMed]
54. Liu, S.; Hu, H.Z.; Gao, C.; Gao, N.; Xia, Y.; Wood, J.D. Actions of galanin on neurotransmission in the submucous plexus of guinea
pig small intestine. Eur. J. Pharmacol. 2003, 471, 49–58. [CrossRef]
55. Silva, A.D.A.; Pereira-De-Morais, L.; da Silva, R.E.R.; Dantas, D.D.M.; Milfont, C.G.B.; Gomes, M.F.; Araújo, I.M.; Kerntopf, M.R.;
de Menezes, I.R.A.; Barbosa, R. Pharmacological screening of the phenolic compound caffeic acid using rat aorta, uterus and
ileum smooth muscle. Chem. Biol. Interact. 2020, 332, 109269. [CrossRef] [PubMed]
56. Emmelin, N.; Feldberg, W. The smooth muscle contracting effects of various substances supposed to act on nervous structures in
the intestinal wall. J. Physiol. 1947, 106, 482–502. [CrossRef]