Immediate Download Information Technology in Bio and Medical Informatics 5th International Conference ITBAM 2014 Munich Germany September 2 2014 Proceedings 1st Edition Miroslav Bursa Ebooks 2024

Full download text book at textbookfull.
com
Information Technology in Bio and

Medical Informatics 5th International
Conference ITBAM 2014 Munich Germany
September 2 2014 Proceedings 1st Edition
Miroslav
DOWLOADBursa
HERE
https://textbookfull.com/product/information-
technology-in-bio-and-medical-informatics-5th-
international-conference-itbam-2014-munich-
germany-september-2-2014-proceedings-1st-edition-
miroslav-bursa/
DOWLOAD NOW
Download more textbook from textbookfull.com

More products digital (pdf, epub, mobi) instant
download maybe you interests ...
Trust Privacy and Security in Digital Business 11th

International Conference TrustBus 2014 Munich Germany
September 2 3 2014 Proceedings 1st Edition Claudia
Eckert
https://textbookfull.com/product/trust-privacy-and-security-in-
digital-business-11th-international-conference-
trustbus-2014-munich-germany-september-2-3-2014-proceedings-1st-
edition-claudia-eckert/
Informatics in Control Automation and Robotics 11th

International Conference ICINCO 2014 Vienna Austria
September 2 4 2014 Revised Selected Papers 1st Edition
Joaquim Filipe
https://textbookfull.com/product/informatics-in-control-
automation-and-robotics-11th-international-conference-
icinco-2014-vienna-austria-september-2-4-2014-revised-selected-
papers-1st-edition-joaquim-filipe/
Runtime Verification 5th International Conference RV

2014 Toronto ON Canada September 22 25 2014 Proceedings
1st Edition Borzoo Bonakdarpour
https://textbookfull.com/product/runtime-verification-5th-
international-conference-rv-2014-toronto-on-canada-
september-22-25-2014-proceedings-1st-edition-borzoo-bonakdarpour/
Serious Games Development and Applications 5th

International Conference SGDA 2014 Berlin Germany
October 9 10 2014 Proceedings 1st Edition Minhua Ma
https://textbookfull.com/product/serious-games-development-and-
applications-5th-international-conference-sgda-2014-berlin-
germany-october-9-10-2014-proceedings-1st-edition-minhua-ma/
Computational Logistics 5th International Conference
ICCL 2014 Valparaiso Chile September 24 26 2014
Proceedings 1st Edition Rosa G. González-Ramírez
https://textbookfull.com/product/computational-logistics-5th-
international-conference-iccl-2014-valparaiso-chile-
september-24-26-2014-proceedings-1st-edition-rosa-g-gonzalez-
ramirez/
Engineering Secure Software and Systems 6th

International Symposium ESSoS 2014 Munich Germany
February 26 28 2014 Proceedings 1st Edition Jan Jürjens
https://textbookfull.com/product/engineering-secure-software-and-
systems-6th-international-symposium-essos-2014-munich-germany-
february-26-28-2014-proceedings-1st-edition-jan-jurjens/
Scalable Information Systems 5th International

Conference INFOSCALE 2014 Seoul South Korea September
25 26 2014 Revised Selected Papers 1st Edition Jason J.
Jung
https://textbookfull.com/product/scalable-information-
systems-5th-international-conference-infoscale-2014-seoul-south-
korea-september-25-26-2014-revised-selected-papers-1st-edition-
jason-j-jung/
Knowledge Engineering and the Semantic Web 5th

International Conference KESW 2014 Kazan Russia
September 29 October 1 2014 Proceedings 1st Edition
Pavel Klinov
https://textbookfull.com/product/knowledge-engineering-and-the-
semantic-web-5th-international-conference-kesw-2014-kazan-russia-
september-29-october-1-2014-proceedings-1st-edition-pavel-klinov/
Supercomputing 29th International Conference ISC 2014

Leipzig Germany June 22 26 2014 Proceedings 1st Edition
Julian Martin Kunkel
https://textbookfull.com/product/supercomputing-29th-
international-conference-isc-2014-leipzig-germany-
june-22-26-2014-proceedings-1st-edition-julian-martin-kunkel/
Miroslav Bursa
Sami Khuri
M. Elena Renda (Eds.)
Information Technology
LNCS 8649
in Bio- and
Medical Informatics
5th International Conference, ITBAM 2014
Munich, Germany, September 2, 2014
Proceedings
123
Lecture Notes in Computer Science 8649
Commenced Publication in 1973
Founding and Former Series Editors:
Gerhard Goos, Juris Hartmanis, and Jan van Leeuwen
Editorial Board
David Hutchison
Lancaster University, UK
Takeo Kanade
Carnegie Mellon University, Pittsburgh, PA, USA
Josef Kittler
University of Surrey, Guildford, UK
Jon M. Kleinberg
Cornell University, Ithaca, NY, USA
Alfred Kobsa
University of California, Irvine, CA, USA
Friedemann Mattern
ETH Zurich, Switzerland
John C. Mitchell
Stanford University, CA, USA
Moni Naor
Weizmann Institute of Science, Rehovot, Israel
Oscar Nierstrasz
University of Bern, Switzerland
C. Pandu Rangan
Indian Institute of Technology, Madras, India
Bernhard Steffen
TU Dortmund University, Germany
Demetri Terzopoulos
University of California, Los Angeles, CA, USA
Doug Tygar
University of California, Berkeley, CA, USA
Gerhard Weikum
Max Planck Institute for Informatics, Saarbruecken, Germany
Miroslav Bursa Sami Khuri
M. Elena Renda (Eds.)
Information Technology
in Bio- and
Medical Informatics
5th International Conference, ITBAM 2014
Munich, Germany, September 2, 2014
Proceedings
13
Volume Editors
Miroslav Bursa
Czech Technical University in Prague
Faculty of Electrical Engineering
Department of Cybernetics
Technicka 2
166 27 Prague 6, Czech Republic
E-mail: [email protected]
Sami Khuri
San Jose State University
Department of Computer Science
One Washington Square
San Jose, CA 95192-0249, USA
M. Elena Renda
Istituto di Informatica e Telematica del CNR
Via G. Moruzzi 1
56124 Pisa, Italy
ISSN 0302-9743 e-ISSN 1611-3349

ISBN 978-3-319-10264-1 e-ISBN 978-3-319-10265-8
DOI 10.1007/978-3-319-10265-8
Springer Cham Heidelberg New York Dordrecht London
Library of Congress Control Number: 2014945811
LNCS Sublibrary: SL 3 – Information Systems and Application,

incl. Internet/Web and HCI
© Springer International Publishing Switzerland 2014
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of
the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation,
broadcasting, reproduction on microfilms or in any other physical way, and transmission or information
storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology
now known or hereafter developed. Exempted from this legal reservation are brief excerpts in connection
with reviews or scholarly analysis or material supplied specifically for the purpose of being entered and
executed on a computer system, for exclusive use by the purchaser of the work. Duplication of this publication
or parts thereof is permitted only under the provisions of the Copyright Law of the Publisher’s location,
in ist current version, and permission for use must always be obtained from Springer. Permissions for use
may be obtained through RightsLink at the Copyright Clearance Center. Violations are liable to prosecution
under the respective Copyright Law.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
While the advice and information in this book are believed to be true and accurate at the date of publication,
neither the authors nor the editors nor the publisher can accept any legal responsibility for any errors or
omissions that may be made. The publisher makes no warranty, express or implied, with respect to the
material contained herein.
Typesetting: Camera-ready by author, data conversion by Scientific Publishing Services, Chennai, India
Printed on acid-free paper
Springer is part of Springer Science+Business Media (www.springer.com)
Preface
Biomedical engineering and medical informatics represent challenging and rapidly

growing areas. Applications of information technology in these areas are of
paramount importance. Building on the success of the ITBAM 2010, ITBAM 2011,
ITBAM 2012, and ITBAM 2013, the aim of the 5th ITBAM conference was to
continue bringing together scientists, researchers, and practitioners from dif-
ferent disciplines, namely, from mathematics, computer science, bioinformatics,
biomedical engineering, medicine, biology, and different fields of life sciences, so
they can present and discuss their research results in bioinformatics and medical
informatics. We hope that ITBAM will serve as a platform for fruitful discus-
sions between all attendees, where participants can exchange their recent results,
identify future directions and challenges, initiate possible collaborative research
and develop common languages for solving problems in the realm of biomed-
ical engineering, bioinformatics, and medical informatics. The importance of
computer-aided diagnosis and therapy continues to draw attention worldwide
and has laid the foundations for modern medicine with excellent potential for
promising applications in a variety of fields, such as telemedicine, Web-based
healthcare, analysis of genetic information, and personalized medicine.
Following a thorough peer-review process, we finally selected 9 long papers for
oral presentation and 3 short papers for poster session for the 5th annual ITBAM
conference (7 were rejected). The Organizing Committee would like to thank the
reviewers for their excellent job. The articles can be found in the proceedings
and are divided in the following sections: Clustering and Bioinformatics; Medical
Image and Data Processing; Knowledge Discovery and Machine Learning in
Medicine. The papers show how broad the spectrum of topics in applications of
information technology to biomedical engineering and medical informatics is.
The editors would like to thank all the participants for their high-quality
contributions and Springer for publishing the proceedings of this conference.
Once again, our special thanks go to Gabriela Wagner for her hard work on
various aspects of this event.
June 2014 Miroslav Bursa

M. Elena Renda
Sami Khuri
Organization
General Chair
Christian Böhm University of Munich, Germany
Program Committee Co-chairs

Miroslav Bursa Czech Technical University in Prague,
Czech Republic
Sami Khuri San José State University, USA
M. Elena Renda IIT - CNR, Pisa, Italy
Program Committee
Werner Aigner FAW, Austria
Fuat Akal Functional Genomics Center Zurich,
Switzerland
Tatsuya Akutsu Kyoto University, Japan
Andreas Albrecht Queen’s University Belfast, Ireland
Peter Baumann Jacobs University Bremen, Germany
Balaram Bhattacharyya Visva-Bharati University, India
Veselka Boeva Technical University of Plovdiv, Bulgaria
Roberta Bosotti Nerviano Medical Science s.r.l., Italy
Rita Casadio University of Bologna, Italy
Sònia Casillas Universitat Autònoma de Barcelona, Spain
Kun-Mao Chao National Taiwan University, Taiwan
Vaclav Chudacek Czech Technical University in Prague,
Czech Republic
Hans-Dieter Ehrich Technical University of Braunschweig,
Germany
Christoph M. Friedrich University of Applied Sciences Dortmund,
Germany
Alejandro Giorgetti University of Verona, Italy
Jan Havlik Dep. of Circuit Theory, FEE, Czech Technical
University in Prague, Czech Republic
Volker Heun Ludwig-Maximilians-Universität München,
Germany
Larisa Ismailova NRNU MEPhI, Russia
Alastair Kerr University of Edinburgh, UK
VIII Organization
Michal Krátký Technical University of Ostrava,

Czech Republic
Vaclav Kremen Czech Technical University in Prague,
Czech Republic
Jakub Kuzilek Czech Technical University, Czech Republic
Gorka Lasso CIC bioGUNE, Spain
Lenka Lhotska Czech Technical University, Czech Republic
Roger Marshall Plymouth State University, USA
Elio Masciari ICAR-CNR, Università della Calabria, Italy
Erika Melissari University of Pisa, Italy
Henning Mersch RWTH Aachen University, Germany
Jean-Christophe Nebel Kingston University, UK
Vit Novacek National University of Ireland, Ireland
Nadia Pisanti University of Pisa, Italy
Cinzia Pizzi Università degli Studi di Padova, Italy
Clara Pizzuti (ICAR)-National Research Council (CNR),
Italy
Nicole Radde Universität Stuttgart, Germany
Stefano Rovetta University of Genova, Italy
Huseyin Seker De Montfort University, UK
Jiri Spilka Czech Technical University in Prague,
Czech Republic
Kathleen Steinhofel King’s College London, UK
Karla Stepanova Czech Technical University, Czech Republic
Roland R. Wagner University of Linz, Austria
Viacheslav Wolfengagen Institute JurInfoR-MSU, Russia
Borys Wrobel Polish Academy of Sciences, Poland
Filip Zavoral Charles University in Prague, Czech Republic
Songmao Zhang Chinese Academy of Sciences, China
Qiang Zhu The University of Michigan, USA
Table of Contents
Clustering and Bioinformatics

BINOS4DNA: Bitmap Indexes and NoSQL for Identifying Species with
DNA Signatures through Metagenomics Samples . . . . . . . . . . . . . . . . . . . . . 1
Ramin Karimi, Ladjel Bellatreche, Patrick Girard,
Ahcene Boukorca, and Andras Hajdu
Centroid Clustering of Cellular Lineage Trees . . . . . . . . . . . . . . . . . . . . . . . . 15

Valeriy Khakhutskyy, Michael Schwarzfischer, Nina Hubig,
Claudia Plant, Carsten Marr, Michael A. Rieger,
Timm Schroeder, and Fabian J. Theis
A Discussion on the Biological Relevance of Clustering Results . . . . . . . . 30

Pietro Hiram Guzzi, Elio Masciari,
Giuseppe Massimiliano Mazzeo, and Carlo Zaniolo
Medical Image and Data Processing

Segmentation and Kinetic Analysis of Breast Lesions in DCE-MR
Imaging Using ICA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45
Sebastian Goebl, Anke Meyer-Baese, Marc Lobbes, and Claudia Plant
Quantitative Fetal Growth Curves Comparison: A Collaborative

Approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
Mario A. Bochicchio, Lucia Vaira, Antonella Longo,
Antonio Malvasi, and Andrea Tinelli
Poster Session
Knowledge Reasoning Model to Support Clinical Decision Making . . . . . . 75
Qingshan Li, Jing Feng, Lu Wang, Hua Chu, and WeiJuan Fu
Method for Knowledge Acquisition and Decision-Making Process

Analysis in Clinical Decision Support System . . . . . . . . . . . . . . . . . . . . . . . . 79
Qingshan Li, Jing Feng, Lu Wang, Hua Chu, and He Yu
Towards the Integration of the Knowledge from Biomedical

Databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
Eshref Januzaj
X Table of Contents
Knowledge Discovery and Machine Learning in

Medicine
Pervasive and Intelligent Decision Support in Intensive Medicine –
The Complete Picture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Filipe Portela, Manuel Filipe Santos, José Machado,
António Abelha, Álvaro Silva, and Fernando Rua
Mining Medical Data to Obtain Fuzzy Predicates . . . . . . . . . . . . . . . . . . . . 103

Taymi Ceruto, Orenia Lapeira, Annika Tonch, Claudia Plant,
Rafael Espin, and Alejandro Rosete
On Patient’s Characteristics Extraction for Metabolic Syndrome

Diagnosis: Predictive Modelling Based on Machine Learning . . . . . . . . . . . 118
František Babič, Ljiljana Majnarić, Alexandra Lukáčová,
Ján Paralič, and Andreas Holzinger
An Evolutionary Method for Exceptional Association Rule Set

Discovery from Incomplete Database . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133
Kaoru Shimada and Takashi Hanioka
Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149

BINOS4DNA: Bitmap Indexes and NoSQL
for Identifying Species with DNA Signatures
through Metagenomics Samples
Ramin Karimi1,2 , Ladjel Bellatreche1 , Patrick Girard1 , Ahcene Boukorca1,

and Andras Hajdu2
1
LIAS/ISAE-ENSMA, Poitiers University, Futuroscope, France
{bellatreche,girard,ahcene.boukorca}@ensma.fr
2
Faculty of Informatics, Debrecen University, Hungary
{ramin.karimi,hajdu.andras}@inf.unideb.hu
Abstract. The advancement of next generation sequencing (NGS) and

shotgun sequencing technologies produced massive amounts of genomics
data. Metagenomics, a powerful technique to study genetic material of
uncultivable microorganisms received directly from their natural
environment, is dealing with high throughput sequencing read data sets.
Assembling, binning and alignment of short reads in order to identify mi-
croorganisms of a Metagenomics sample are expensive and time-
consuming, regardless of other restrictions. DNA signature is a short
nucleotide sequence fragment which is used to distinguish species across
all other species. It can be a basis for identifying microorganisms both in
environmental and clinical samples directly from the short reads, without
assembling and alignment processes. In this paper, we propose a scalable
method in which we use optimization techniques borrowed from database
technology, namely bitmap indexes. They are used to speed up searching
and matching of billions of DNA signatures in the short reads of thou-
sands of different microorganisms, using commodity High Performance
Computing, such as Hadoop MapReduce, Hive and Hbase.
Keywords: Metagenomics, Short Reads, DNA signature, Hadoop and

MapReduce, Hive, Bitmap Index, Hbase.
1 Introduction
At the age of Whole Genome Shotgun (WGS) sequencing and information tech-
nology, development of new techniques and applications in biology to study
microorganisms is highly demanded in both clinical and environmental commu-
nities. The number of existing microbial species is estimated at 105 to 106 [1, 2].

This work was performed when Ramin Karimi was visiting the LIAS/ISAE-ENSMA
Lab. This visit is funded by ERASMUS mobility program. The work was also sup-
ported in part by the projects TMOP-4.2.2.C-11/1/KONV-2012-0001, and TMOP
4.2.4. A/2-11-1-2012-0001 supported by the European Union, co-financed by the
European Social Fund, and by the OTKA grant NK101680.
M. Bursa et al. (Eds.): ITBAM 2014, LNCS 8649, pp. 1–14, 2014.

c Springer International Publishing Switzerland 2014
2 R. Karimi et al.
The majority (> 99%) of microorganisms from the environment resist cultivation
in the laboratory [3] and it was impossible to investigate them until a few years
ago. With advances of next generation sequencing (NGS) and Metagenomics
techniques in the last few years, it is possible to obtain directly the genetic
content of all organisms with their complex communities gathered from natural
environment in which they normally live.
The output of sequencing technology is short fragments of DNA sequence with
25 base pairs (bp) to 900 (bp) lengths, called short reads. They vary from one
sequencing technology to another. For instance, sequencing machines made by
Illumina, Applied Biosystems (ABI), and Helicos of Cambridge produce short
sequences of 25 to 100 (bp).
Long DNA molecules extracted from the sample, are broken into smaller pieces
by special fragmentation and cloning techniques. Then, these small pieces are
fed into the sequencer for determining the order of nucleotides in short fragments
of DNA [4]. Sequencing output for a Metagenome sample is enormous data sets
containing the short reads of hundreds to thousands of known and unknown
organisms. Having efficient implementations to facilitate the analysis process is
urgently required in both biological and computational parts of any Metage-
nomics project. Figure 1 details the steps involved in a typical sequence-based
Metagenome project [5].
Fig. 1. A typical Metagenome project flow diagram. Dashed arrows indicate steps that
can be omitted.
BINOS4DNA: Bitmap Indexes and NoSQL for Identifying Species 3
Sequence-based identification of species can be classified into two groups: As-

sembly and alignment-based approaches on one hand, alignment-free identifica-
tion approaches on the other hand [6].
Assembly is used to construct a complete genome of a species by search-
ing and matching the overlapping parts of the short reads and merging them
together. Whereas, alignment is used to reconstruct the whole genome of previ-
ously known species using a reference genome as the map to find the similarities
of the reads in different genome regions with considering the structure, function
and evolutionary relationship between the reads and the reference sequences.
Besides time and money consuming, technical challenges of alignment and
assembly programs are also considerable. Sequenced reads are short in length
and large in volume, very noisy and partial, with too many missing parts [7].
Reads contain sequencing errors caused by the sequencers. Moreover, repetitive
elements in the DNA sequence of species are another challenge of alignment and
assembly. As an example about half of the human genome is covered by repeats
[8]. These challenges cause computational complexity and create obscurity and
errors for interpreting the results in alignment and assembly based identification.
Phylogenetic analysis mostly uses multiple alignments of sequences [9, 10]
which are suitable to compare large sets of sequences all together. However,
methods of multiple sequence alignment, in addition to all the above restrictions,
are still computationally very expensive and require considerable computational
tools and applications such as server resources [11].
Thus, there is an essential need to develop efficient alignment-free methods
for phylogenetic analysis and identification of species in Metagenomics in order
to reduce the computational complexity, time and cost.
Due to the above challenges, alignment of whole shotgun genome sequenc-
ing reads is difficult and no method have been developed to compare genomes
directly from reads data, without assembly [13].
Most of the alignment-free methods use word frequencies, where words are
small fragments of sequence called k -mers or n-grams in the literature, in which
k and n are fixed length of the oligonucleotide to represent a sequence [12–14].
DNA Signature is a unique small fragment of nucleotides sequence used
to detect a target organism among all others. It can be a good solution for
real-time identification of species. There exists methods for detecting hundreds
to hundreds of thousands of signatures with different lengths of nucleotide for
every species using k -word frequencies and pattern comparison base methods
[10], [15–17].
Using DNA signatures in the isolated sample studies and Polymerase Chain
Reaction (PCR) base detection is easy to perform, because of low number of tar-
gets. But in the Metagenomics studies it is much more complicated. Taking into
account the number of signatures, short reads and organisms in the Metagenome
samples, it is obvious that we are facing massive data sets. Using ordinary hard-
ware and software tools is impossible, since it takes a long time regardless of any
failure during the process.
4 R. Karimi et al.
In this paper, we propose a method to show how parallel and distributed

computing and Bitmap Indexing technique can solve this problem. This paper
is organized as follows. Section 2 presents all ingredients related to high perfor-
mance computing and bitmap indexes to detail our proposal. Section 3 describes
our methodology. In Section 4, experiments are conducted to show the efficiency
and effectiveness of our approach. Section 5 concludes the paper by summarizing
the main results of our finding and discussing some perspective issues.
2 Background
In this section, we review the technologies and the concepts that we use in our
methodology.
Advances in parallel and distributed computing have opened new doors for
many researchers who could not access high performance computers (HPC). The
Apache Hadoop software library [18–20] is an open source framework, written in
Java. Hadoop, the application of parallel and distributed computing allows run-
ning simple programming models on large data sets across the nodes of a cluster.
The idea behind designing Hadoop is to store and run big data on commodity
hardware cluster nodes instead of expensive high performance computers which
are not available for everybody.
Hadoop handles any type of data from structured, unstructured, text files, log
files, images, audio files, communications records, etc. A Hadoop cluster has a
single Master and several Slave nodes. It can run as a single node cluster or multi
node cluster with thousands of nodes. The Hadoop core has two components:
Hadoop Distributed File System (HDFS) and MapReduce.
2.1 Hadoop Distributed File System (HDFS)

HDFS is the storage part of Hadoop. it designed to store and support the high-
throughput access of very large data sets across multi-node cluster [18–21]. HDFS
has three main components:
– NameNode: It is the Master of the filesystem. It is responsible to manage

the blocks in DataNodes and maintains the metadata and indexes of the
blocks, but not the data itself.
– DataNodes: They are the workhorses of the filesystem. NameNode breaks

down data into block-sized chunks, which are stored as independent units in
DataNod, 64 MB by default.
– Secondary NameNode: It keeps a copy of the merged namespace image,

which can be used in case of any failure for the NameNode.
2.2 MapReduce
MapReduce is a programming model for data processing. It works by breaking
the process into two phases: the map phase and the reduce phase [18, 19]. The
two main components of MapReduce are:
– JobTracker: As the Master of the system, it is responsible to manage the

map and reduce tasks.
– TaskTracker: As the slave, it receives the mapper and reducer task from
JobTracker and returns the results to the JobTracker after execution.
Hadoop is highly fault tolerant. In order to prevent any failure in the process,
HDFS creates multiple copies of data through the blocks, 3 copies by default.
NameNode can detect any failure in DataNodes or blocks and JobTracker also
can detect any failure of TaskTrackers and will replace them.
2.3 NoSQL
”NoSQL” Stands for Not Only SQL. The term ”NoSQL” was used by Carlo
Strozzi for the first time in 1998 [22]. It is a non-relational database [27]. One
of the aspects of NoSQL is its ability to handle database analytics of big data
sets in parallel and distributed platforms like Hadoop on commodity hardware.
Hive and Hbase are types of NoSQL applications on top of Apache Hadoop file
system. NoSQL databases can handle unstructured data such as text files, log
files, email, social media and multimedia. Horizontal scaling is one of the most
important features of NoSQL databases, and allows us to add more nodes to our
distributed system. Vertical scaling only allows to increase the power of existing
machine [23, 24].
2.4 Hive
Hive [19], [25] is a data warehousing infrastructure on top of Hadoop and HDFS.
HiveQL which is a SQL-like language, simplifies querying of unstructured large
datasets in distributed storage. Hive is designed to write once and read several
times. Real-time queries and row-level update are not possible. Hive is easy
to implement for everybody who is familiar with SQL queries. Facebook Data
Infrastructure Team started to create Hive in January 2007 to bring the familiar
concepts of tables, columns, partitions and a subset of SQL to the unstructured
world of Hadoop and it was open sourced in August 2008 [26]. Hive support
Bitmap Index from version 0.08.
2.5 Bitmap Index

Bitmap Index [28, 29] is an efficient way to speed up the queries and improve
performance in datawarehouse environments, which contain tables with low car-
dinality columns. As the example given in Table 1, we index the values of the
6 R. Karimi et al.
column Grade having low cardinality. In this case our index has the same num-
ber of rows and the number of columns is equal to the number of distinct values
in column Grade. In table 1, cardinality of the column Grade is 4 because we
have 4 different values in it.
Table 1. An example of a bitmap index defined on Grade column
RID Name Nationality Grade RID A B C D

1 John FRANCE B 1 0 1 0 0
2 Sara USA D 2 0 0 0 1
3 Piter RUSSIA C 3 0 0 1 0
4 David ENGLAND A 4 1 0 0 0
5 Tania GERMANY B 5 0 1 0 0
6 Daniel POLAND A 6 1 0 0 0
7 Tom CANADA C 7 0 0 1 0
8 Robert ITALY C 8 0 0 1 0
9 Jain FRANCE D 9 0 0 0 1
2.6 Hbase
Hbase [27] is a type of NoSQL database. It is an open-source, distributed,
column-oriented and scalable database built on the top of the Hadoop file sys-
tem. It is designed for random, real-time read/write access to very large tables
with billions of rows and millions of columns on commodity hardware.
3 Our Methodology
We have downloaded all complete Bacterial genomes from the National Cen-
ter for Biotechnology Information (NCBI) database [30]. The total number of
genomes was 2773 bacterial species and subspecies at the time (16.01.2014).
3.1 Insignia
Insignia is a pipeline to generate unique DNA signatures and it is also a database
and web application for obtaining DNA signatures. It contains 11274 viruses/
phages and 2653 non-viruses signatures with a length between 18 to 500 bp.
Insignia detect signatures for designing primers in Polymerase Chain Reaction
(PCR) and probes in micro-array technologies. The signatures can also be used
for real-time identification of species in microbial and viral assays [15, 16], [31].
We downloaded DNA signatures for two groups of 50 bacteria from the in-
signia database. As we are in the testing process, we just downloaded the signa-
tures with length of 18 bp. As an example, Table 2 consists of the head part of
Acholeplasma laidlawii DNA signatures.
Table 2. A part of Acholeplasma laidlawii’s DNA signatures table of unique 18-mers,

downloaded from the Insignia database
Insignia V0.7
Signatures calculated: Thu Mar 6 2014 10:58:06
Reference Organism:
Acholeplasma laidlawii PG-8A
Target Organism(s):
Signatures:
Index Start stop sequence
63965 451703 451720 ACATAAGCAGGTGCGGAA
63966 670606 670623 GATACCAATACCGCAGAT
63967 692909 692926 CCCATTCAACTTCGATCA
63968 530281 530298 ATCAACGCTAGATGAGCA
63969 268209 268226 ATGGAGGAGTCTGGATAC
63970 69763 69780 ACAGCAACAGCGTATATC
63971 357337 357354 GTGTTAGCGTTAAGTCTG
63972 1001550 1001567 TAGCCTCTTTAAGCAGGT
63973 1366201 1366218 ATGATGCAAGTGGCATGG
63974 1141698 1141715 TGCAACGGATGCATCAAG
3.2 Metasim
Metasim is a sequencing simulator application for genomics and Metagenomics
studies. It can be a great help to develop and improve Metagenomics tools, and
for planning Metagenomics projects [32, 33]. Metasim can simulate the short
reads of Roches 454 pyrosequencing, Sanger sequencing and Empirical sequenc-
ing technology. In this paper, we use Roches 454 pyrosequencing simulation.
The output of Metasim is a compressed file containing the short reads of a
bacterial chromosome or one of its Plasmids and their information.
>r16.1|SOURCES={GI=11497281,bw,1947919816}|ERRORS={8 1:C,46:
,135 1:T,160 1:A,190 1:G}|SOURCE 1=”Borrelia burgdorferi B31 plasmid cp32-8”
(44840ff90be8dcf7b704d6908ca095d559d2949e)
TTTAGGATTCGTACCCGTTTTCTTCTAATTTTTTCCTAGTGTTGTATGAATTT
CTTTTAATTTTTTTTGTTTTTCTTTCATGCAAGATTTTTTTATATTGAATTTT
TTTATTAGGGCAATTTCATTTTGTTTTAAGTATATTTATTGCCTCAATCTTAG
TATACTTTATCAATATTTAAATACAAAATAGAAAGGAGCTTCTTCCGTTTTAA
AGTTACAATTATTGAAATAATTTCTTAGTTGATATTTTTCTATTTCTTTAATC
TTTCTTTCTTCTTTTATATTATTTTTATTA
Fig. 2. An example of Metasim reads
We chose 100 bacterial genomes from NCBI data set for simulating the short
reads. The first group of 50 bacteria from Insignia database are common in 100
chosen bacterial genomes and the other group is from some other bacteria apart
from these 100.
8 R. Karimi et al.
Before any implementation, some pre-processing is needed. We need to attach

the short reads from all bacterial chromosomes and Plasmids as one file, remove
the breaks between lines of the short reads and keep everything as a single line.
From the signatures we need just the signatures of every bacteria as a single file.
We should remove all extra information, in order to have smaller data size and
shorter execution time. The pre-processing is done with bash script programming
in Linux.
3.3 The Use of the Bitmap Index

Bitmap index techniques are used to create the index table by searching the
existence of signatures in short reads. ’1’ represents the existence of the signature
in the short reads and ’0’ represents non-existence. This process is done with Java
programming. There are faster programming languages for this purpose, but as a
future work we aim to use MapReduce programming and Hadoop to implement
this part and they are more compatible with Java.
As it is shown in Table 3, the index table can be created in two ways. The
first is to keep every single signature as a column and put ’0’ and ’1’ depending
on the existence of this signature in short reads. In this case, considering the
number of signatures and reads, huge storage is needed.
Table 3. An example for our index tables; each column of these tables is kept as a
single file
RID Reads b1 b2 b3 b4 b5 RID Reads b1

s1 s2 s3 s4 s5 s6 s7
1 R1 0 0 0 1 0 1 R1 0 0 0 0 0 0 0
2 R2 1 0 0 0 0 2 R2 0 0 0 0 0 0 1
3 R3 0 0 0 1 0 3 R3 0 0 0 0 0 0 0
4 R4 0 0 0 0 0 4 R4 0 0 0 0 0 0 0
5 R5 0 0 1 0 0 5 R5 0 0 0 0 0 0 0
6 R6 0 0 0 0 1 6 R6 0 0 0 0 0 0 0
7 R7 1 0 0 0 0 7 R7 0 0 0 1 0 0 0
8 R8 0 0 0 0 0 8 R8 0 0 0 0 0 0 0
9 R9 0 0 0 0 0 9 R9 0 0 0 0 0 0 0
10 R10 1 0 0 0 0 10 R10 0 0 1 0 0 0 0
Another way is to keep every bacteria as a column. We store ’1’ if any signature
of the bacteria exists in a short read, ’0’ if not. In this case the table is much
smaller. The number of columns is equal to the number of bacteria plus two more
columns, one for row identification and the other for short reads. The number
of rows is equal to the number of short reads.
We can easily use Linux paste command to put all the files together as a
single file. As an example, in Table 4 we have 6 files. One file contains the reads
and their identification numbers and the other five contain ’0’ and ’1’ for five
bacteria.
Table 4. The newFile.txt format to create a single file
1 R1 0 0 0 1 0
2 R2 1 0 0 0 0
3 R3 0 0 0 1 0
4 R4 0 0 0 0 0
5 R5 0 0 1 0 0
6 R6 0 0 0 0 1
7 R7 1 0 0 0 0
8 R8 0 0 0 0 0
9 R9 0 0 0 0 0
10 R10 1 0 0 0 0
Then, we should create our table in Hive according to the newFile.txt struc-
ture.
hive> CREATE TABLE testTable1 ( rid INT, reads STRING, b1 INT, b2 INT
, b3 INT, b4 INT, b5 INT) ROW FORMAT DELIMITED FIELDS TERMINATED BY
’\t’ STORED AS TEXTFILE;
Next step is loading data into the Hive table:

hive> LOAD DATA LOCAL INPATH "newFile.txt" INTO TABLE testTable1;
Finally with Hive queries we can find matched bacteria and short reads.
hive> INSERT OVERWRITE LOCAL DIRECTORY ’/path to local dir for output’
select * from testTable1 where b1=1 group by rid;
Alternatively we can use a faster query:
hive> INSERT OVERWRITE LOCAL DIRECTORY ’/path to local dir for output’
select testTable1.rid from testTable1 where b1=1;
The output file contains the Rowid numbers of the short reads. As an example,
for the bacteria b1 in table 4 we have 2,7,10 which means, the signatures of
bacteria b1 are in these 3 short reads. Moreover, we have bacteria b1 in the
Metagenome sample.
In this approach, we have to repeat the query for all bacteria one by one or
write a long query and a long command to create the table. Hence, the bigger
the number of bacteria, the longer the implementation.
There is a better solution to prevent repeating the queries or writing long
commands and queries. We can add all bacterial files with ’0’ and ’1’ one after
the other and create a single column in a file with the cat command.
For big number of bacteria, we can use bash script in the incremental order
to add as much bacteria as we need at the end of each other quickly.
In this method, we need also to repeat short reads in a single column as much
as the number of bacteria. For instance, if we have 500,000 short reads and 1000
10 R. Karimi et al.
bacteria, then we should repeat short reads in one column 1000 times with the
cat command and the total number will be 500,000,000.
Next, we need to create a table with 3 columns (rid INT, reads STRING, b
INT) and run the query just once. The results will be in one column. We can
easily extract the information with Rowid numbers. It leads to a larger file size,
but a faster implementation. After getting the results, we can delete these large
tables.
We created testtable1 with 52 columns (rid INT, reads STRING, b1 INT,...,
b50 INT) and testtable2 with 3 columns (rid INT, reads STRING, b INT)
in Hive. We have short reads of 100 bacteria and two groups of 50 bacterial
signatures.
As we are in the testing process and we use Java programming without Hadoop
and MapReduce for searching signatures in the short reads to create our index
files (tables), we chose only 10% of short reads randomly.
Our future work is defining MapReduce in our Java program and using multi-
node cluster Hadoop in order to speed up this step.
We used the awk command to add Row identification (Rowid) to the file
contains short reads (132,705).
awk ’BEGIN{i=1} {if($0 !~ /^$/) {printf ("%d\t%s \n",i,$0); i++}
else { print $0} }’ reads.txt >> readsid.txt
We merged this file and all the 50 index files with the paste command into
a single file and load this file in the testtable1 in Hive. Then, we used queries
to search our table. We have done this process for both groups of 50 bacteria.
For the second table (testtable2) we attached all 50 bacteria in order as
one column in a single file and also repeat the short reads 50 times in a sin-
gle column, both with the cat command. Then, we added Rowid to the short
reads (6,635,250) and finally paste these three columns in a file and load it to
testtable2. In this case, we only need one query to get the results. It can be a
good test to see the speed and efficiency of Hive to search millions of rows with
Bitmap Index techniques.
There is a possibility of integrating Hive and Hbase. This feature allows Hive
QL statements to access HBase tables for both read (SELECT) and write (IN-
SERT). It is even possible to combine access to HBase tables with native Hive
tables via joins and unions [34]. Real-time reading and writing is possible in
Hbase. These features help us update and have faster implementation.
4 Experimental Study
All these implementations are done by Intel dual-core CPU and 4 GB of RAM,
Ubuntu 13.10, single-node-cluster Hadoop-1.2.1 and Hive-0.11.0. We can see the
elapsed time for our first implementation on testtable1 with 52 columns and
132,705 rows and the loaded file size of 44.6 MB as given in Table 5. We repeated
the query for all 50 columns. We did not consider the time for changing and
repeating the queries.
Table 5. Time taken for running the Hive query on testtable1 columns. Total time is
1065.927 Sec.
b1: 25.543 Sec. b11: 21.356 Sec. b21: 22.065 Sec. b31: 21.089 Sec. b41: 21.081 Sec.
This implementation was for the first group of 50 bacteria which are common
in 100 bacterial samples. As we expected, we could find some short reads con-
taining the signatures for every bacteria. The number of short reads is a range
between 1 for b16 to 812 for b4.
As we expected, for the second group of 50 bacteria which differs by 100
samples, we could not find any short reads containing the signatures. The average
time taken for the implementation was almost the same as the first group.
Computational times for the second implementation on testtable2 with 3
columns and 6,635,250 rows and the loaded file size of 1.6 GB are:
File Size: 1.6 GB
Loading data to testtable2
Time taken: 45.588 seconds
Time taken with SELECT* and GROUP BY query:

Total MapReduce CPU Time Spent: 54 seconds 640 msec
Time taken with SELECT file.rid query which is faster:

Total MapReduce CPU Time Spent: 43 seconds 630 msec
The result of this implementation is a column containing numbers from 1 to

6,635,250 which represent Rowid of short reads. We repeated 132,705 reads for
50 times so, numbers from 1 to 132,705 are for b1 and from 132,706 to 2∗132, 705
are for b2, and so on.
If we compare the time for executing the query on a column of testtable1
with 132,705 rows and a column of testtable2 with 6,635,250 rows, in spite of
having 50 times more rows, there is not a large difference. Namely, the average
computation time for the first case is 21.319 Sec, while 59.901 Sec for the second
one with the same query.
Another random document with
no related content on Scribd:
Many other phenomena are usually brought for vacuum, as those
of weather-glasses, æolipyles, wind-guns, &c. which would all be
very hard to be salved, unless water be penetrable by air, without
the intermixture of empty space. But now, seeing air may with no
great endeavour pass through not only water, but any other fluid
body though never so stubborn, as quicksilver, these phenomena
prove nothing. Nevertheless, it might in reason be expected, that he
that would take away vacuum, should without vacuum show us such
causes of these phenomena, as should be at least of equal, if not
greater probability. This therefore shall be done in the following
discourse, when I come to speak of these phenomena in their
proper places. But first, the most general hypotheses of natural
philosophy are to be premised.
And seeing that suppositions are put for the true causes of
apparent effects, every supposition, except such as be absurd, must
of necessity consist of some supposed possible motion; for rest can
never be the efficient cause of anything; and motion supposeth
bodies moveable; of which there are three kinds, fluid, consistent,
and mixed of both. Fluid are those, whose parts may by very weak
endeavour be separated from one another; and consistent those for
the separation of whose parts greater force is to be applied. There
are therefore degrees of consistency; which degrees, by comparison
with more or less consistent, have the names of hardness or
softness. Wherefore a fluid body is always divisible into bodies
equally fluid, as quantity into quantities; and soft bodies, of
whatsoever degree of softness, into soft bodies of the same degree.
And though many men seem to conceive no other difference of
fluidity, but such as ariseth from the different magnitudes of the
parts, in which sense dust, though of diamonds, may be called fluid;
yet I understand by fluidity, that which is made such by nature
equally in every part of the fluid body; not as dust is fluid, for so a
house which is falling in pieces may be called fluid; but in such
manner as water seems fluid, and to divide itself into parts
perpetually fluid. And this being well understood, I come to my
suppositions.
Six 5. First, therefore, I suppose that the immense
suppositions space, which we call the world, is the aggregate of
for the all bodies which are either consistent and visible, as
salving of the
phenomena the earth and the stars; or invisible, as the small
of nature. atoms which are disseminated through the whole
space between the earth and the stars; and lastly,
that most fluid ether, which so fills all the rest of the universe, as
that it leaves in it no empty place at all.
Secondly, I suppose with Copernicus, that the greater bodies of
the world, which are both consistent and permanent, have such
order amongst themselves, as that the sun hath the first place,
Mercury the second, Venus the third, the Earth with the moon going
about it the fourth, Mars the fifth, Jupiter with his attendants the
sixth, Saturn the seventh; and after these, the fixed stars have their
several distances from the sun.
Thirdly, I suppose that in the sun and the rest of the planets there
is and always has been a simple circular motion.
Fourthly, I suppose that in the body of the air there are certain
other bodies intermingled, which are not fluid; but withal that they
are so small, that they are not perceptible by sense; and that these
also have their proper simple motion, and are some of them more,
some less hard or consistent.
Fifthly, I suppose with Kepler that as the distance between the sun
and the earth is to the distance between the moon and the earth, so
the distance between the moon and the earth is to the semidiameter
of the earth.
As for the magnitude of the circles, and the times in which they
are described by the bodies which are in them, I will suppose them
to be such as shall seem most agreeable to the phenomena in
question.
Possible 6. The causes of the different seasons of the year,
causes of the and of the several variations of days and nights in
motions all the parts of the superficies of the earth, have
annual and
diurnal; and been demonstrated, first by Copernicus, and since
of the by Kepler, Galileus, and others, from the supposition
apparent of the earth's diurnal revolution about its own axis,
direction, together with its annual motion about the sun in the
station, and ecliptic according to the order of the signs; and
retrogradatio
n of the
thirdly, by the annual revolution of the same earth
planets. about its own centre, contrary to the order of the
signs. I suppose with Copernicus, that the diurnal
revolution is from the motion of the earth, by which the equinoctial
circle is described about it. And as for the other two annual motions,
they are the efficient cause of the earth's being carried about in the
ecliptic in such manner, as that its axis is always kept parallel to
itself. Which parallelism was for this reason introduced, lest by the
earth's annual revolution its poles should seem to be necessarily
carried about the sun, contrary to experience. I have, in art. 10,
chap. XXI, demonstrated, from the supposition of simple circular
motion in the sun, that the earth is so carried about the sun, as that
its axis is thereby kept always parallel to itself. Wherefore, from
these two supposed motions in the sun, the one simple circular
motion, the other circular motion about its own centre, it may be
demonstrated that the year hath both the same variations of days
and nights, as have been demonstrated by Copernicus.
For if the circle a b c d (in fig. 3) be the ecliptic, whose centre is e,
and diameter a e c; and the earth be placed in a, and the sun be
moved in the little circle f g h i, namely, according to the order f, g,
h, and i, it hath been demonstrated, that a body placed in a will be
moved in the same order through the points of the ecliptic a, b, c,
and d, and will always keep its axis parallel to itself.
But if, as I have supposed, the earth also be moved with simple
circular motion in a plane that passeth through a, cutting the plane
of the ecliptic so as that the common section of both the planes be
in a c, thus also the axis of the earth will be kept always parallel to
itself. For let the centre of the earth be moved about in the
circumference of the epicycle, whose diameter is l a k, which is a
part of the strait line l a c; therefore l a k, the diameter of the
epicycle, passing through the centre of the earth, will be in the plane
of the ecliptic. Wherefore seeing that by reason of the earth's simple
motion both in the ecliptic and in its epicycle, the strait line l a k is
kept always parallel to itself, every other strait line also taken in the
body of the earth, and consequently its axis, will in like manner be
kept always parallel to itself; so that in what part soever of the
ecliptic the centre of the epicycle be found, and in what part soever
of the epicycle the centre of the earth be found at the same time,
the axis of the earth will be parallel to the place where the same axis
would have been, if the centre of the earth had never gone out of
the ecliptic.
Now as I have demonstrated the simple annual motion of the
earth from the supposition of simple motion in the sun; so from the
supposition of simple motion in the earth may be demonstrated the
monthly simple motion of the moon. For if the names be but
changed, the demonstration will be the same, and therefore need
not be repeated.
The 7. That which makes this supposition of the sun's
supposition simple motion in the epicycle f g h i probable, is
of simple first, that the periods of all the planets are not only
motion, why
likely. described about the sun, but so described, as that
they are all contained within the zodiac, that is to
say, within the latitude of about sixteen degrees; for the cause of
this seems to depend upon some power in the sun, especially in that
part of the sun which respects the zodiac. Secondly, that in the
whole compass of the heavens there appears no other body from
which the cause of this phenomenon can in probability be derived.
Besides, I could not imagine that so many and such various motions
of the planets should have no dependance at all upon one another.
But, by supposing motive power in the sun, we suppose motion also;
for power to move without motion is no power at all. I have
therefore supposed that there is in the sun for the governing of the
primary planets, and in the earth for the governing of the moon,
such motion, as being received by the primary planets and by the
moon, makes them necessarily appear to us in such manner as we
see them. Whereas, that circular motion, which is commonly
attributed to them, about a fixed axis, which is called conversion,
being a motion of their parts only, and not of their whole bodies, is
insufficient to salve their appearances. For seeing whatsoever is so
moved, hath no endeavour at all towards those parts which are
without the circle, they have no power to propagate any endeavour
to such bodies as are placed without it. And as for them that
suppose this may be done by magnetical virtue, or by incorporeal
and immaterial species, they suppose no natural cause; nay, no
cause at all. For there is no such thing as an incorporeal movent,
and magnetical virtue is a thing altogether unknown; and
whensoever it shall be known, it will be found to be a motion of
body. It remains, therefore, that if the primary planets be carried
about by the sun, and the moon by the earth, they have the simple
circular motions of the sun and the earth for the causes of their
circulations. Otherwise, if they be not carried about by the sun and
the earth, but that every planet hath been moved, as it is now
moved, ever since it was made, there will be of their motions no
cause natural. For either these motions were concreated with their
bodies, and their cause is supernatural; or they are coeternal with
them, and so they have no cause at all. For whatsoever is eternal
was never generated.
I may add besides, to confirm the probability of this simple
motion, that as almost all learned men are now of the same opinion
with Copernicus concerning the parallelism of the axis of the earth, it
seemed to me to be more agreeable to truth, or at least more
handsome, that it should be caused by simple circular motion alone,
than by two motions, one in the ecliptic, and the other about the
earth's own axis the contrary way, neither of them simple, nor either
of them such as might be produced by any motion of the sun. I
thought best therefore to retain this hypothesis of simple motion,
and from it to derive the causes of as many of the phenomena as I
could, and to let such alone as I could not deduce from thence.
It will perhaps be objected, that although by this supposition the
reason may be given of the parallelism of the axis of the earth, and
of many other appearances, nevertheless, seeing it is done by
placing the body of the sun in the centre of that orb which the earth
describes with its annual motion, the supposition itself is false;
because this annual orb is eccentric to the sun. In the first place,
therefore, let us examine what that eccentricity is, and whence it
proceeds.
The cause of 8. Let the annual circle of the earth a b c d (in fig.
the 3) be divided into four equal parts by the strait lines
eccentricity a c and b d, cutting one another in the centre e;
of the annual
motion of the and let a be the beginning of Libra, b of Capricorn, c
earth. of Aries and d of Cancer; and let the whole orb a b c
d be understood, according to Copernicus, to have
every way so great distance from the zodiac of the fixed stars, that it
be in comparison with it but as a point. Let the earth be now
supposed to be in the beginning of Libra at a. The sun, therefore,
will appear in the beginning of Aries at c. Wherefore, if the earth be
moved from a to b, the apparent motion of the sun will be from c to
the beginning of Cancer in d; and the earth being moved forwards
from b to c, the sun also will appear to be moved forwards to the
beginning of Libra in a; wherefore c d a will be the summer arch,
and the winter arch will be a b c. Now, in the time, of the sun's
apparent motion in the summer arch, there are numbered 186¾
days; and, consequently, the earth makes in the same time the same
number of diurnal conversions in the arch a b c; and, therefore, the
earth in its motion through the arch c d a will make only 178½
diurnal conversions. Wherefore the arch a b c ought to be greater
than the arch c d a by 8¼ days, that is to say, by almost so many
degrees. Let the arch a r, as also c s, be each of them an arch of
two degrees and 1⁄16. Wherefore the arch r b s will be greater than
the semicircle a b c by 4⅛ degrees, and greater than the arch s d r
by 8¼ degrees. The equinoxes, therefore, will be in the points r and
s; and therefore also, when the earth is in r, the sun will appear in s.
Wherefore the true place of the sun will be in t, that is to say,
without the centre of the earth's annual motion by the quantity of
the sine of the arch a r, or the sine of two degrees and 16 minutes.
Now this sine, putting 100,000 for the radius, will be near 3580 parts
thereof. And so much is the eccentricity of the earth's annual
motion, provided that that motion be in a perfect circle; and s and r
are the equinoctial parts. And the strait lines s r and c a, produced
both ways till they reach the zodiac of the fixed stars, will fall still
upon the same fixed stars; because the whole orb a b c d is
supposed to have no magnitude at all in respect of the great
distance of the fixed stars.
Supposing now the sun to be in c, it remains that I show the
cause why the earth is nearer to the sun, when in its annual motion
it is found to be in d, than when it is in b. And I take the cause to be
this. When the earth is in the beginning of Capricorn at b, the sun
appears in the beginning of Cancer at d; and then is the midst of
summer. But in the midst of summer, the northern parts of the earth
are towards the sun, which is almost all dry land, containing all
Europe and much the greatest part of Asia and America. But when
the earth is in the beginning of Cancer at d, it is the midst of winter,
and that part of the earth is towards the sun, which contains those
great seas called the South Sea and the Indian Sea, which are of far
greater extent than all the dry land in that hemisphere. Wherefore
by the last article of chapter XXI, when the earth is in d, it will come
nearer to its first movent, that is, to the sun which is in t; that is to
say, the earth is nearer to the sun in the midst of winter when it is in
d, than in the midst of summer when it is in b; and, therefore,
during the winter the sun is in its Perigæum, and in its Apogæum
during the summer. And thus I have shown a possible cause of the
eccentricity of the earth; which was to be done.
I am, therefore, of Kepler's opinion in this, that he attributes the
eccentricity of the earth to the difference of the parts thereof, and
supposes one part to be affected, and another disaffected to the
sun. And I dissent from him in this, that he thinks it to be by
magnetic virtue, and that this magnetic virtue or attraction and
thrusting back of the earth is wrought by immateriate species; which
cannot be, because nothing can give motion but a body moved and
contiguous. For if those bodies be not moved which are contiguous
to a body unmoved, how this body should begin to be moved is not
imaginable; as has been demonstrated in art. 7, chap. IX, and often
inculcated in other places, to the end that philosophers might at last
abstain from the use of such unconceivable connexions of words. I
dissent also from him in this, that he says the similitude of bodies is
the cause of their mutual attraction. For if it were so, I see no
reason why one egg should not be attracted by another. If,
therefore, one part of the earth be more affected by the sun than
another part, it proceeds from this, that one part hath more water,
the other more dry land. And from hence it is, as I showed above,
that the earth comes nearer to the sun when it shines upon that part
where there is more water, than when it shines upon that where
there is more dry land.
The cause 9. This eccentricity of the earth is the cause why
why the the way of its annual motion is not a perfect circle,
moon hath but either an elliptical, or almost an elliptical line; as
always one
and the same also why the axis of the earth is not kept exactly
face turned parallel to itself in all places, but only in the
towards the equinoctial points.
earth. Now seeing I have said that the moon is carried
about by the earth, in the same manner that the earth is by the sun;
and that the earth goeth about the sun in such manner as that it
shows sometimes one hemisphere, sometimes the other to the sun;
it remains to be enquired, why the moon has always one and the
same face turned towards the earth.
Suppose, therefore, the sun to be moved with simple motion in
the little circle f g h i, (in fig. 4) whose centre is t; and let ♈ ♋ ♎
♑ be the annual circle of the earth; and a the beginning of Libra.
About the point a let the little circle l k be described; and in it let the
centre of the earth be understood to be moved with simple motion;
and both the sun and the earth to be moved according to the order
of the signs. Upon the centre a let the way of the moon m n o p be
described; and let q r be the diameter of a circle cutting the globe of
the moon into two hemispheres, whereof one is seen by us when
the moon is at the full, and the other is turned from us.
The diameter therefore of the moon q o r will be perpendicular to
the strait line t a. Wherefore the moon is carried, by reason of the
motion of the earth, from o towards p. But by reason of the motion
of the sun, if it were in p it would at the same time be carried from p
towards o; and by these two contrary movents the strait line q r will
be turned about; and, in a quadrant of the circle m n o p, it will be
turned so much as makes the fourth part of its whole conversion.
Wherefore when the moon is in p, q r will be parallel to the strait line
m o. Secondly, when the moon is in m, the strait line q r will, by
reason of the motion of the earth, be in m o. But by the working of
the sun's motion upon it in the quadrant p m, the same q r will be
turned so much as makes another quarter of its whole conversion.
When, therefore, the moon is in m, q r will be perpendicular to the
strait line o m. By the same reason, when the moon is in n, q r will
be parallel to the strait line m o; and, the moon returning to o, the
same q r will return to its first place; and the body of the moon will
in one entire period make also one entire conversion upon her own
axis. In the making of which, it is manifest, that one and the same
face of the moon is always turned towards the earth. And if any
diameter were taken in that little circle, in which the moon were
supposed to be carried about with simple motion, the same effect
would follow; for if there were no action from the sun, every
diameter of the moon would be carried about always parallel to
itself. Wherefore I have given a possible cause why one and the
same face of the moon is always turned towards the earth.
But it is to be noted, that when the moon is without the ecliptic,
we do not always see the same face precisely. For we see only that
part which is illuminated. But when the moon is without the ecliptic,
that part which is towards us is not exactly the same with that which
is illuminated.
The cause of 10. To these three simple motions, one of the
the tides of sun, another of the moon, and the third of the
the ocean. earth, in their own little circles f g h i, l k, and q r,
together with the diurnal conversion of the earth, by which
conversion all things that adhere to its superficies are necessarily
carried about with it, may be referred the three phenomena
concerning the tides of the ocean. Whereof the first is the alternate
elevation and depression of the water at the shores, twice in the
space of twenty-four hours and near upon fifty-two minutes; for so it
has constantly continued in all ages. The second, that at the new
and full moons, the elevations of the water are greater than at other
times between. And the third, that when the sun is in the
equinoctial, they are yet greater than at any other time. For the
salving of which phenomena, we have already the four above-
mentioned motions; to which I assume also this, that the part of the
earth which is called America, being higher than the water, and
extended almost the space of a whole semicircle from north to
south, gives a stop to the motion of the water.
This being granted, in the same 4th figure, where l b k c is
supposed to be in the plane of the moon's monthly motion, let the
little circle l d k e be described about the same centre a in the plane
of the equinoctial. This circle therefore will decline from the circle l b
k c in an angle of almost 28½ degrees; for the greatest declination
of the ecliptic is 23½, to which adding 5 for the greatest declination
of the moon from the ecliptic, the sum will be 28½ degrees. Seeing
now the waters, which are under the circle of the moon's course, are
by reason of the earth's simple motion in the plane of the same
circle moved together with the earth, that is to say, together with
their own bottoms, neither outgoing nor outgone; if we add the
diurnal motion, by which the other waters which are under the
equinoctial are moved in the same order, and consider withal that
the circles of the moon and of the equinoctial intersect one another;
it will be manifest, that both those waters, which are under the circle
of the moon, and under the equinoctial, will run together under the
equinoctial; and consequently, that their motion will not only be
swifter than the ground that carries them; but also that the waters
themselves will have greater elevation whensoever the earth is in
the equinoctial. Wherefore, whatsoever the cause of the tides may
be, this may be the cause of their augmentation at that time.
Again, seeing I have supposed the moon to be carried about by
the simple motion of the earth in the little circle l b k c; and
demonstrated, at the 4th article of chapter XXI, that whatsoever is
moved by a movent that hath simple motion, will be moved always
with the same velocity; it follows, that the centre of the earth will be
carried in the circumference l b k c with the same velocity with which
the moon is carried in the circumference m n o p. Wherefore the
time, in which the moon is carried about in m n o p, is to the time,
in which the earth is carried about in l b k c, as one circumference to
the other, that is, as a o to a k. But a o is observed to be to the
semidiameter of the earth as 59 to 1; and therefore the earth, if a k
be put for its semidiameter, will make fifty-nine revolutions in l b k c
in the time that the moon makes one monthly circuit in m n o p. But
the moon makes her monthly circuit in little more than twenty-nine
days. Wherefore the earth shall make its circuit in the circumference
l b k c in twelve hours and a little more, namely, about twenty-six
minutes more; that is to say, it shall make two circuits in twenty-four
hours and almost fifty-two minutes; which is observed to be the time
between the high-water of one day and the high-water of the day
following. Now the course of the waters being hindered by the
southern part of America, their motion will be interrupted there; and
consequently, they will be elevated in those places, and sink down
again by their own weight, twice in the space of twenty-four hours
and fifty-two minutes. And thus I have given a possible cause of the
diurnal reciprocation of the ocean.
Now from this swelling of the ocean in those parts of the earth,
proceed the flowings and ebbings in the Atlantic, Spanish, British,
and German seas; which though they have their set times, yet upon
several shores they happen at several hours of the day. And they
receive some augmentation from the north, by reason that the
shores of China and Tartary, hindering the general course of the
waters, make them swell there, and discharge themselves in part
through the strait of Anian into the Northern Ocean, and so into the
German Sea.
As for the spring tides which happen at the time of the new and
full moons, they are caused by that simple motion, which at the
beginning I supposed to be always in the moon. For as, when I
showed the cause of the eccentricity of the earth, I derived the
elevation of the waters from the simple motion of the sun; so the
same may here be derived from the simple motion of the moon. For
though from the generation of clouds, there appear in the sun a
more manifest power of elevating the waters than in the moon; yet
the power of increasing moisture in vegetables and living creatures
appears more manifestly in the moon than in the sun; which may
perhaps proceed from this, that the sun raiseth up greater, and the
moon lesser drops of water. Nevertheless, it is more likely, and more
agreeable to common observation, that rain is raised not only by the
sun, but also by the moon; for almost all men expect change of
weather at the time of the conjunctions of the sun and moon with
one another and with the earth, more than in the time of their
quarters.
In the last place, the cause why the spring tides are greater at the
time of the equinoxes hath been already sufficiently declared in this
article, where I have demonstrated, that the two motions of the
earth, namely, its simple motion in the little circle l b k c, and its
diurnal motion in l d k e, cause necessarily a greater elevation of
waters when the sun is about the equinoxes, than when he is in
other places. I have therefore given possible causes of the
phenomenon of the flowing and ebbing of the ocean.
Cause of the 11. As for the explication of the yearly precession
precession of of the equinoctial points, we must remember that,
the as I have already shown, the annual motion of the
equinoxes.
earth is not in the circumference of a circle, but of
an ellipsis, or a line not considerably different from that of an
ellipsis. In the first place, therefore, this elliptical line is to be
described.
Let the ecliptic ♎ ♑ ♈ ♋ (in fig. 5) be divided into four equal
parts by the two strait lines a b and ♑ ♋ , cutting one another at
right angles in the centre c. And taking the arch b d of two degrees
and sixteen minutes, let the strait line d e be drawn parallel to a b,
and cutting ♑ ♋ in f; which being done, the eccentricity of the
earth will be c f. Seeing therefore the annual motion of the earth is
in the circumference of an ellipsis, of which ♑ ♋ is the greater
axis, a b cannot be the lesser axis; for a b and ♑ ♋ are equal.
Wherefore the earth passing through a and b, will either pass above
♑ , as through g, or passing through ♑ , will fall between c and a;
it is no matter which. Let it pass therefore through g; and let g l be
taken equal to the strait line ♑ ♋; and dividing g l equally in i, g i
will be equal to ♑ f, and i l equal to f ♋ ; and consequently the
point i will cut the eccentricity c f into two equal parts; and taking i h
equal to i f, h i will be the whole eccentricity. If now a strait line,
namely, the line ♎ i ♈ , be drawn through i parallel to the strait
lines a b and e d, the way of the sun in summer, namely, the arch
♎ g ♈ , will be greater than his way in winter, by 8¼ degrees.
Wherefore the true equinoxes will be in the strait line ♎ i ♈ ; and
therefore the ellipsis of the earth's annual motion will not pass
through a, g, b, and l; but through ♎ , g, ♈ and l. Wherefore the
annual motion of the earth is in the ellipsis ♎ g ♈ l; and cannot
be, the eccentricity being salved, in any other line. And this perhaps
is the reason, why Kepler, against the opinion of all the astronomers
of former time, thought fit to bisect the eccentricity of the earth, or,
according to the ancients, of the sun, not by diminishing the quantity
of the same eccentricity, (because the true measure of that quantity
is the difference by which the summer arch exceeds the winter
arch), but by taking for the centre of the ecliptic of the great orb the
point c nearer to f, and so placing the whole great orb as much
nearer to the ecliptic of the fixed stars towards ♋ , as is the
distance between c and i. For seeing the whole great orb is but as a
point in respect of the immense distance of the fixed stars, the two
strait lines ♎ ♈ and a b, being produced both ways to the
beginnings of Aries and Libra, will fall upon the same points of the
sphere of the fixed stars. Let therefore the diameter of the earth m n
be in the plane of the earth's annual motion. If now the earth be
moved by the sun's simple motion in the circumference of the
ecliptic about the centre i, this diameter will be kept always parallel
to itself and to the strait line g l. But seeing the earth is moved in
the circumference of an ellipsis without the ecliptic, the point n,
whilst it passeth through ♎ ♑ ♈ , will go in a lesser
circumference than the point m; and consequently, as soon as ever
it begins to be moved, it will lose its parallelism with the strait line
♑ ♋ ; so that m n produced will at last cut the strait line g l
produced. And contrarily, as soon as m n is past ♈ , the earth
making its way in the internal elliptical line ♈ l ♎ , the same m n
produced towards m, will cut l g produced. And when the earth hath
almost finished its whole circumference, the same m n shall again
make a right angle with a line drawn from the centre i, a little short
of the point from which the earth began its motion. And there the
next year shall be one of the equinoctial points, namely, near the
end of ♍; the other shall be opposite to it near the end of ♓. And
thus the points in which the days and nights are made equal do
every year fall back; but with so slow a motion, that, in a whole year,
it makes but 51 first minutes. And this relapse being contrary to the
order of the signs, is commonly called the precession of the
equinoxes. Of which I have from my former suppositions deduced a
possible cause; which was to be done.
According to what I have said concerning the cause of the
eccentricity of the earth; and according to Kepler, who for the cause
thereof supposeth one part of the earth to be affected to the sun,
the other part to be disaffected; the apogæum and perigæum of the
sun should be moved every year in the same order, and with the
same velocity, with which the equinoctial points are moved; and
their distance from them should always be the quadrant of a circle;
which seems to be otherwise. For astronomers say, that the
equinoxes are now, the one about 28 degrees gone back from the
first star of Aries, the other as much from the beginning of Libra; so
that the apogæum of the sun or the aphelium of the earth ought to
be about the 28th degree of Cancer. But it is reckoned to be in the
7th degree. Seeing, therefore, we have not sufficient evidence of the
ὁτί (that so it is,) it is in vain to seek for the διότι (why it is so.)
Wherefore, as long as the motion of the apogæum is not observable
by reason of the slowness thereof, and as long as it remains doubtful
whether their distance from the equinoctial points be more or less
than a quadrant precisely; so long it may be lawful for me to think
they proceed both of them with equal velocity.
Also, I do not at all meddle with the causes of the eccentricities of
Saturn, Jupiter, Mars, and Mercury. Nevertheless, seeing the
eccentricity of the earth may, as I have shewn, be caused by the
unlike constitution of the several parts of the earth which are
alternately turned towards the sun, it is credible also, that like
effects may be produced in these other planets from their having
their superficies of unlike parts.
And this is all I shall say concerning Sidereal Philosophy. And,
though the causes I have here supposed be not the true causes of
these phenomena, yet I have demonstrated that they are sufficient
to produce them, according to what I at first propounded.
Vol. 1. Lat. & Eng.
C. XXVI.
Fig. 1-5
CHAPTER XXVII.
OF LIGHT, HEAT, AND OF COLOURS.
1. Of the immense magnitude of some bodies, and the unspeakable littleness of
others.—2. Of the cause of the light of the sun.—3. How light heateth.—4.
The generation of fire from the sun.—5. The generation of fire from collision.
—6. The cause of light in glow-worms, rotten wood, and the Bolognan stone.
—7. The cause of light in the concussion of sea water.—8. The cause of flame,
sparks, and colliquation.—9. The cause why wet hay sometimes burns of its
own accord; also the cause of lightning.—10. The cause of the force of
gunpowder; and what is to be ascribed to the coals, what to the brimstone,
and what to the nitre.—11. How heat is caused by attrition.—12. The
distinction of light into first, second, &c.—13. The causes of the colours we
see in looking through a prisma of glass, namely, of red, yellow, blue, and
violet colour.—14. Why the moon and the stars appear redder in the horizon
than in the midst of the heaven.—15. The cause of whiteness.—16. The cause
of blackness.
Of the 1. Besides the stars, of which I have spoken in

immense the last chapter, whatsoever other bodies there be
magnitude of in the world, they may be all comprehended under
some bodies,
and the the name of intersidereal bodies. And these I have
unspeakable already supposed to be either the most fluid æther,
littleness of or such bodies whose parts have some degree of
others. cohesion. Now, these differ from one another in
their several consistencies, magnitudes, motions, and figures. In
consistency, I suppose some bodies to be harder, others softer
through all the several degrees of tenacity. In magnitude, some to
be greater, others less, and many unspeakably little. For we must
remember that, by the understanding, quantity is divisible into
divisibles perpetually. And, therefore, if a man could do as much with
his hands as he can with his understanding, he would be able to
take from any given magnitude a part which should be less than any
other magnitude given. But the Omnipotent Creator of the world can
actually from a part of any thing take another part, as far as we by
our understanding can conceive the same to be divisible. Wherefore
there is no impossible smallness of bodies. And what hinders but
that we may think this likely? For we know there are some living
creatures so small that we can scarce see their whole bodies. Yet
even these have their young ones; their little veins and other
vessels, and their eyes so small as that no microscope can make
them visible. So that we cannot suppose any magnitude so little, but
that our very supposition is actually exceeded by nature. Besides,
there are now such microscopes commonly made, that the things we
see with them appear a hundred thousand times bigger than they
would do if we looked upon them with our bare eyes. Nor is there
any doubt but that by augmenting the power of these microscopes
(for it may be augmented as long as neither matter nor the hands of
workmen are wanting) every one of those hundred thousandth parts
might yet appear a hundred thousand times greater than they did
before. Neither is the smallness of some bodies to be more admired
than the vast greatness of others. For it belongs to the same Infinite
Power, as well to augment infinitely as infinitely to diminish. To make
the great orb, namely, that whose radius reacheth from the earth to
the sun, but as a point in respect of the distance between the sun
and the fixed stars; and, on the contrary, to make a body so little, as
to be in the same proportion less than any other visible body,
proceeds equally from one and the same Author of Nature. But this
of the immense distance of the fixed stars, which for a long time
was accounted an incredible thing, is now believed by almost all the
learned. Why then should not that other, of the smallness of some
bodies, become credible at some time or other? For the Majesty of
God appears no less in small things than in great; and as it
exceedeth human sense in the immense greatness of the universe,
so also it doth in the smallness of the parts thereof. Nor are the first
elements of compositions, nor the first beginnings of actions, nor the
first moments of times more credible, than that which is now
believed of the vast distance of the fixed stars.
Some things are acknowledged by mortal men to be very great,
though finite, as seeing them to be such. They acknowledge also
that some things, which they do not see, may be of infinite
magnitude. But they are not presently nor without great study
persuaded, that there is any mean between infinite and the greatest
of those things which either they see or imagine. Nevertheless,
when after meditation and contemplation many things which we
wondered at before are now grown more familiar to us, we then
believe them, and transfer our admiration from the creatures to the
Creator. But how little soever some bodies may be, yet I will not
suppose their quantity to be less than is requisite for the salving of
the phenomena. And in like manner I shall suppose their motion,
namely, their velocity and slowness, and the variety of their figures,
to be only such as the explication of their natural causes requires.
And lastly, I suppose, that the parts of the pure æther, as if it were
the first matter, have no motion at all but what they receive from
bodies which float in them, and are not themselves fluid.
Of the cause 2. Having laid these grounds, let us come to
of the light of speak of causes; and in the first place let us inquire
the sun. what may be the cause of the light of the sun.
Seeing, therefore, the body of the sun doth by its simple circular
motion thrust away the ambient ethereal substance sometimes one
way sometimes another, so that those parts, which are next the sun,
being moved by it, do propagate that motion to the next remote
parts, and these to the next, and so on continually; it must needs be
that, notwithstanding any distance, the foremost part of the eye will
at last be pressed; and by the pressure of that part, the motion will
be propagated to the innermost part of the organ of sight, namely,
to the heart; and from the reaction of the heart, there will proceed
an endeavour back by the same way, ending in the endeavour
outwards of the coat of the eye, called the retina. But this endeavour
outwards, as has been defined in chapter XXV, is the thing which is
called light, or the phantasm of a lucid body. For it is by reason of
this phantasm that an object is called lucid. Wherefore we have a
possible cause of the light of the sun; which I undertook to find.
How light 3. The generation of the light of the sun is
heateth. accompanied with the generation of heat. Now
every man knows what heat is in himself, by feeling it when he
grows hot; but what it is in other things, he knows only by
ratiocination. For it is one thing to grow hot, and another thing to
heat or make hot. And therefore though we perceive that the fire or
the sun heateth, yet we do not perceive that it is itself hot. That
other living creatures, whilst they make other things hot, are hot
themselves, we infer by reasoning from the like sense in ourselves.
But this is not a necessary inference. For though it may truly be said
of living creatures, that they heat, therefore they are themselves
hot; yet it cannot from hence be truly inferred that fire heateth,
therefore it is itself hot; no more than this, fire causeth pain,
therefore it is itself in pain. Wherefore, that is only and properly
called hot, which when we feel we are necessarily hot.
Now when we grow hot, we find that our spirits and blood, and
whatsoever is fluid within us, is called out from the internal to the
external parts of our bodies, more or less, according to the degree
of the heat; and that our skin swelleth. He, therefore, that can give
a possible cause of this evocation and swelling, and such as agrees
with the rest of the phenomena of heat, may be thought to have
given the cause of the heat of the sun.
It hath been shown, in the 5th article of chapter XXI, that the fluid
medium, which we call the air, is so moved by the simple circular
motion of the sun, as that all its parts, even the least, do perpetually
change places with one another; which change of places is that
which there I called fermentation. From this fermentation of the air, I
have, in the 8th article of the last chapter, demonstrated that the
water may be drawn up into the clouds.
And I shall now show that the fluid parts may, in like manner, by
the same fermentation, be drawn out from the internal to the
external parts of our bodies. For seeing that wheresoever the fluid
medium is contiguous to the body of any living creature, there the
parts of that medium are, by perpetual change of place, separated
from one another; the contiguous parts of the living creature must,
of necessity, endeavour to enter into the spaces of the separated
parts. For otherwise those parts, supposing there is no vacuum,
would have no place to go into. And therefore that, which is most
fluid and separable in the parts of the living creature which are
contiguous to the medium, will go first out; and into the place
thereof will succeed such other parts as can most easily transpire
through the pores of the skin. And from hence it is necessary that
the rest of the parts, which are not separated, must altogether be
moved outwards, for the keeping of all places full. But this motion
outwards of all parts together must, of necessity, press those parts
of the ambient air which are ready to leave their places; and
therefore all the parts of the body, endeavouring at once that way,
make the body swell. Wherefore a possible cause is given of heat
from the sun; which was to be done.
The 4. We have now seen how light and heat are
generation of generated; heat by the simple motion of the
fire from the medium, making the parts perpetually change
sun.
places with one another; and light by this, that by
the same simple motion action is propagated in a strait line. But
when a body hath its parts so moved, that it sensibly both heats and
shines at the same time, then it is that we say fire is generated.
Now by fire I do not understand a body distinct from matter
combustible or glowing, as wood or iron, but the matter itself, not
simply and always, but then only when it shineth and heateth. He,
therefore, that renders a cause possible and agreeable to the rest of
the phenomena, namely, whence, and from what action, both the
shining and heating proceed, may be thought to have given a
possible cause of the generation of fire.
Let, therefore, A B C (in the first figure) be a sphere, or the
portion of a sphere, whose centre is D; and let it be transparent and
homogeneous, as crystal, glass, or water, and objected to the sun.
Wherefore, the foremost part A B C will, by the simple motion of the
sun, by which it thrusts forwards the medium, be wrought upon by
the sunbeams in the strait lines E A, F B, and G C; which strait lines
may, in respect of the great distance of the sun, be taken for
parallels. And seeing the medium within the sphere is thicker than
the medium without it, those beams will be refracted towards the
perpendiculars. Let the strait lines E A and G C be produced till they
cut the sphere in H and I; and drawing the perpendiculars A D and C
D, the refracted beams E A and G C will of necessity fall, the one
between A H and A D, the other between C I and C D. Let those
refracted beams be A K and C L. And again, let the lines D K M and
D L N be drawn perpendicular to the sphere; and let A K and C L be
produced till they meet with the strait line B D produced in O.
Seeing, therefore, the medium within the sphere is thicker than that
without it, the refracted line A K will recede further from the
perpendicular K M than K O will recede from the same. Wherefore K
O will fall between the refracted line and the perpendicular. Let,
therefore, the refracted line be K P, cutting F O in P; and for the
same reason the strait line L P will be the refracted line of the strait
line C L. Wherefore, seeing the beams are nothing else but the ways
in which the motion is propagated, the motion about P will be so
much more vehement than the motion about A B C, by how much
the base of the portion A B C is greater than the base of a like
portion in the sphere, whose centre is P, and whose magnitude is
equal to that of the little circle about P, which comprehendeth all the
beams that are propagated from A B C; and this sphere being much
less than the sphere A B C, the parts of the medium, that is, of the
air about P, will change places with one another with much greater
celerity than those about A B C. If, therefore, any matter
combustible, that is to say, such as may be easily dissipated, be
placed in P, the parts of that matter, if the proportion be great
enough between A C and a like portion of the little circle about P, will
be freed from their mutual cohesion, and being separated will
acquire simple motion. But vehement simple motion generates in the
beholder a phantasm of lucid and hot, as I have before
demonstrated of the simple motion of the sun; and therefore the
combustible matter which is placed in P will be made lucid and hot,
that is to say, will be fire. Wherefore I have rendered a possible
cause of fire; which was to be done.
The 5. From the manner by which the sun generateth
generation of fire, it is easy to explain the manner by which fire
fire from may be generated by the collision of two flints. For
collision.
by that collision some of those particles of which the
stone is compacted, are violently separated and thrown off; and
being withal swiftly turned round, the eye is moved by them, as it is
in the generation of light by the sun. Wherefore they shine; and
falling upon matter which is already half dissipated, such as is tinder,
they thoroughly dissipate the parts thereof, and make them turn
round. From whence, as I have newly shown, light and heat, that is
to say fire, is generated.
The cause of 6. The shining of glow-worms, some kinds of
light in glow- rotten wood, and of a kind of stone made at
worms, Bologna, may have one common cause, namely, the
rotten wood,
and the exposing of them to the hot sun. We find by
Bolognan experience that the Bologna stone shines not,
stone. unless it be so exposed; and after it has been
exposed it shines but for a little time, namely, as
long as it retains a certain degree of heat. And the cause may be
that the parts, of which it is made, may together with heat have
simple motion imprinted in them by the sun. Which if it be so, it is
necessary that it shine in the dark, as long as there is sufficient heat
in it; but this ceasing, it will shine no longer. Also we find by
experience that in the glow-worm there is a certain thick humour,
like the crystalline humour of the eye; which if it be taken out and
held long enough in one's fingers, and then be carried into the dark,
it will shine by reason of the warmth it received from the fingers; but
as soon as it is cold it will cease shining. From whence, therefore,
can these creatures have their light, but from lying all day in the
sunshine in the hottest time of summer? In the same manner, rotten
wood, except it grow rotten in the sunshine, or be afterwards long
enough exposed to the sun, will not shine. That this doth not
happen in every worm, nor in all kinds of rotten wood, nor in all
calcined stones, the cause may be that the parts, of which the
bodies are made, are different both in motion and figure from the
parts of bodies of other kinds.
The cause of 7. Also the sea water shineth when it is either
light in the dashed with the strokes of oars, or when a ship in
concussion of its course breaks strongly through it; but more or
sea water.
less, according as the wind blows from different
points. The cause whereof may be this, that the particles of salt,
though they never shine in the salt-pits, where they are but slowly
drawn up by the sun, being here beaten up into the air in greater
quantities and with more force, are withal made to turn round, and
consequently to shine, though weakly. I have, therefore, given a
possible cause of this phenomenon.
The cause of 8. If such matter as is compounded of hard little
flame, bodies be set on fire, it must needs be, that, as they
sparks, & fly out in greater or less quantities, the flame which
colliquation.
is made by them will be greater or less. And if the
ethereal or fluid part of that matter fly out together with them, their
motion will be the swifter, as it is in wood and other things which
flame with a manifest mixture of wind. When, therefore, these hard
particles by their flying out move the eye strongly, they shine bright;
and a great quantity of them flying out together, they make a great
shining body. For flame being nothing but an aggregate of shining
particles, the greater the aggregate is, the greater and more
manifest will be the flame. I have, therefore, shown a possible cause
of flame. And from hence the cause appears evidently, why glass is
so easily and quickly melted by the small flame of a candle blown,
which will not be melted without blowing but by a very strong fire.
Now, if from the same matter there be a part broken off, namely,
such a part as consisteth of many of the small particles, of this is
made a spark. For from the breaking off it hath a violent turning
round, and from hence it shines. But though from this matter there
fly neither flame nor sparks, yet some of the smallest parts of it may
be carried out as far as to the superficies, and remain there as
ashes; the parts whereof are so extremely small, that it cannot any
longer be doubted how far nature may proceed in dividing.
Lastly, though by the application of fire to this matter there fly
little or nothing from it, yet there will be in the parts an endeavour
to simple motion; by which the whole body will either be melted, or,
which is a degree of melting, softened. For all motion has some
effect upon all matter whatsoever, as has been shown at art. 3,
chap. XV. Now if it be softened to such a degree, as that the
stubbornness of the parts be exceeded by their gravity, then we say
it is melted; otherwise, softened and made pliant and ductile.
Again, the matter having in it some particles hard, others ethereal
or watery; if, by the application of fire, these latter be called out, the
former will thereby come to a more full contact with one another;
and, consequently, will not be so easily separated; that is to say, the
whole body will be made harder. And this may be the cause why the
same fire makes some things soft, others hard.
The cause 9. It is known by experience that if hay be laid
why wet hay wet together in a heap, it will after a time begin to
sometimes smoke, and then burn as it were of itself. The cause
burns of its
own accord; whereof seems to be this, that in the air, which is
also the enclosed within the hay, there are those little
cause of bodies, which, as I have supposed, are moved freely
lightning. with simple motion. But this motion being by
degrees hindered more and more by the descending moisture, which
at the last fills and stops all the passages, the thinner parts of the air
ascend by penetrating the water; and those hard little bodies, being
so thrust together that they touch and press one another, acquire
stronger motion; till at last by the increased strength of this motion
the watery parts are first driven outwards, from whence appears
vapour; and by the continued increase of this motion, the smallest
particles of the dried hay are forced out, and recovering their natural
simple motion, they grow hot and shine, that is to say, they are set
on fire.
The same also may be the cause of lightning, which happens in
the hottest time of the year, when the water is raised up in greatest
quantity and carried highest. For after the first clouds are raised,
others after others follow them; and being congealed above, they
happen, whilst some of them ascend and others descend, to fall one
upon another in such manner, as that in some places all their parts
are joined together, in others they leave hollow spaces between
them; and into these spaces, the ethereal parts being forced out by
the compressure of the clouds, many of the harder little bodies are
so pent together, as they have not the liberty of such motion as is
natural to the air. Wherefore their endeavour grows more vehement,
till at last they force their way through the clouds, sometimes in one
place, sometimes in another; and, breaking through with great
noise, they move the air violently, and striking our eyes, generate
light, that is to say, they shine. And this shining is that we call
lightning.
The cause of 10. The most common phenomenon proceeding
the force of from fire, and yet the most admirable of all others,
gunpowder; is the force of gunpowder fired; which being
and what is
to be compounded of nitre, brimstone and coals, beaten
ascribed to small, hath from the coals its first taking fire; from
the coals, the brimstone its nourishment and flame, that is to
what to the say, light and motion, and from the nitre the
brimstone, vehemence of both. Now if a piece of nitre, before it
and what to
the nitre. is beaten, be laid upon a burning coal, first it melts,
and, like water, quencheth that part of the coal it
toucheth. Then vapour or air, flying out where the coal and nitre
join, bloweth the coal with great swiftness and vehemence on all
sides. And from hence it comes to pass, that by two contrary
motions, the one, of the particles which go out of the burning coal,
the other, of those of the ethereal and watery substance of the nitre,
is generated that vehement motion and inflammation. And, lastly,
when there is no more action from the nitre, that is to say, when the
volatile parts of the nitre are flown out, there is found about the
sides a certain white substance, which being thrown again into the
fire, will grow red-hot again, but will not be dissipated, at least
unless the fire be augmented. If now a possible cause of this be
found out, the same will also be a possible cause why a grain of
gunpowder set on fire doth expand itself with such vehement
motion, and shine. And it may be caused in this manner.
Let the particles, of which nitre consisteth, be supposed to be
some of them hard, others watery, and the rest ethereal. Also let the
hard particles be supposed to be spherically hollow, like small
bubbles, so that many of them growing together may constitute a
body, whose little caverns are filled with a substance which is either
watery, or ethereal, or both. As soon, therefore, as the hard particles
are dissipated, the watery and ethereal particles will necessarily fly
out; and as they fly, of necessity blow strongly the burning coals and
brimstone which are mingled together; whereupon there will follow a
great expansion of light, with vehement flame, and a violent
dissipation of the particles of the nitre, the brimstone and the coals.
Wherefore I have given a possible cause of the force of fired
gunpowder.
It is manifest from hence, that for the rendering of the cause why
a bullet of lead or iron, shot from a piece of ordnance, flies with so
great velocity, there is no necessity to introduce such rarefaction, as,
by the common definition of it, makes the same matter to have
sometimes more, sometimes less quantity; which is inconceivable.
For every thing is said to be greater or less, as it hath more or less
quantity. The violence with which a bullet is thrust out of a gun,
proceeds from the swiftness of the small particles of the fired
powder; at least it may proceed from that cause without the
supposition of any empty space.
How heat is 11. Besides, by the attrition or rubbing of one
caused by body against another, as of wood against wood, we
attrition. find that not only a certain degree of heat, but fire
itself is sometimes generated. For such motion is the reciprocation of
pressure, sometimes one way, sometimes the other; and by this
reciprocation whatsoever is fluid in both the pieces of wood is forced
hither and thither; and consequently, to an endeavour of getting
out; and at last by breaking out makes fire.
The 12. Now light is distinguished into, first, second,
distinction of third, and so on infinitely. And we call that first light,
light into which is in the first lucid body; as the sun, fire, &c.:
first, second,
&c. second, that which is in such bodies, as being not
transparent are illuminated by the sun; as the
moon, a wall, &c.: and third, that which is in bodies not transparent,
but illuminated by second light, &c.
The causes of 13. Colour is light, but troubled light, namely,
the colours such as is generated by perturbed motion; as shall
we see in be made manifest by the red, yellow, blue and
looking
through a purple, which are generated by the interposition of
prisma of a diaphanous prisma, whose opposite bases are
glass, triangular, between the light and that which is
namely, of enlightened.
red, yellow, [Discussion For let there be a prisma of glass,
blue, & violet of Figure or of any other transparent matter
colour. 27.2] which is of greater density than air;
and let the triangle A B C be the base of this prisma. Also let the
strait line D E be the diameter of the sun's body, having oblique
position to the strait line A B; and let the sunbeams pass in the lines
D A and E B C. And lastly, let the strait lines D A and E C be
produced indefinitely to F and G. Seeing therefore the strait line D A,
by reason of the density of the glass, is refracted towards the
perpendicular; let the line refracted at the point A be the strait line A
H. And again, seeing the medium below A C is thinner than that
above it, the other refraction, which will be made there, will diverge
from the perpendicular. Let therefore this second refracted line be A
I. Also let the same be done at the point C, by making the first
refracted line to be C K, and the second C L. Seeing therefore the
cause of the refraction in the point A of the strait line of A B is the
excess of the resistance of the medium in A B above the resistance
of the air, there must of necessity be reaction from the point A
towards the point B; and consequently the medium at A within the
triangle A B C will have its motion troubled, that is to say, the strait
motion in A F and A H will be mixed with the transverse motion
between the same A F and A H, represented by the short transverse
lines in the triangle A F H. Again, seeing at the point A of the strait
line A C there is a second refraction from A H in A I, the motion of
the medium will again be perturbed by reason of the transverse
reaction from A towards C, represented likewise by the short
transverse lines in the triangle A H I. And in the same manner there
is a double perturbation represented by the transverse lines in the
triangles C G K and C K L. But as for the light between A I and C G,
it will not be perturbed; because, if there were in all the points of
the strait lines A B and A C the same action which is in the points A
and C, then the plane of the triangle C G K would be everywhere
coincident with the plane of the triangle A F H; by which means all
would appear alike between A and C. Besides, it is to be observed,
that all the reaction at A tends towards the illuminated parts which
are between A and C, and consequently perturbeth the first light.
And on the contrary, that all the reaction at C tends towards the
parts without the triangle or without the prisma A B C, where there
is none but second light; and that the triangle A F H shows that
perturbation of light which is made in the glass itself; as the triangle
A H I shows that perturbation of light which is made below the
glass. In like manner, that C G K shows the perturbation of light
within the glass; and C K L that which is below the glass. From
whence there are four divers motions, or four different illuminations
or colours, whose differences appear most manifestly to the sense in
a prisma, whose base is an equilateral triangle, when the sunbeams
that pass through it are received upon a white paper. For the triangle
A F H appears red to the sense; the triangle A H I yellow; the
triangle C G K green, and approaching to blue; and lastly, the
triangle C K L appears purple. It is therefore evident that when weak
but first light passeth through a more resisting diaphanous body, as
glass, the beams, which fall upon it transversely, make redness; and
when the same first light is stronger, as it is in the thinner medium
below the strait line A C, the transverse beams make yellowness.
Also when second light is strong, as it is in the triangle C G K, which
is nearest to the first light, the transverse beams make greenness;
and when the same second light is weaker, as in the triangle C K L,
they make a purple colour.
Why the 14. From hence may be deduced a cause, why
moon and the the moon and stars appear bigger and redder near
stars appear the horizon than in the mid-heaven. For between
redder in the
horizon than the eye and the apparent horizon there is more
in the midst impure air, such as is mingled with watery and
of the earthy little bodies, than is between the same eye
heaven. and the more elevated part of heaven. But vision is
made by beams which constitute a cone, whose base, if we look
upon the moon, is the moon's face, and whose vertex is in the eye;
and therefore, many beams from the moon must needs fall upon
little bodies that are without the visual cone, and be by them
reflected to the eye. But these reflected beams tend all in lines
which are transverse to the visual cone, and make at the eye an
angle which is greater than the angle of the cone. Wherefore, the

Immediate Download Information Technology in Bio and Medical Informatics 5th International Conference ITBAM 2014 Munich Germany September 2 2014 Proceedings 1st Edition Miroslav Bursa Ebooks 2024

Uploaded by

Copyright:

Available Formats

Immediate Download Information Technology in Bio and Medical Informatics 5th International Conference ITBAM 2014 Munich Germany September 2 2014 Proceedings 1st Edition Miroslav Bursa Ebooks 2024

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Immediate Download Information Technology in Bio and Medical Informatics 5th International Conference ITBAM 2014 Munich Germany September 2 2014 Proceedings 1st Edition Miroslav Bursa Ebooks 2024

Uploaded by

Copyright:

Available Formats

Full download text book at textbookfull.

Information Technology in Bio and

Download more textbook from textbookfull.com

Trust Privacy and Security in Digital Business 11th

Informatics in Control Automation and Robotics 11th

Runtime Verification 5th International Conference RV

Serious Games Development and Applications 5th

Engineering Secure Software and Systems 6th

Scalable Information Systems 5th International

Knowledge Engineering and the Semantic Web 5th

Supercomputing 29th International Conference ISC 2014

ISSN 0302-9743 e-ISSN 1611-3349

Library of Congress Control Number: 2014945811

LNCS Sublibrary: SL 3 – Information Systems and Application,

Biomedical engineering and medical informatics represent challenging and rapidly

June 2014 Miroslav Bursa

Program Committee Co-chairs

Michal Krátký Technical University of Ostrava,

Clustering and Bioinformatics

Centroid Clustering of Cellular Lineage Trees . . . . . . . . . . . . . . . . . . . . . . . . 15

A Discussion on the Biological Relevance of Clustering Results . . . . . . . . 30

Medical Image and Data Processing

Quantitative Fetal Growth Curves Comparison: A Collaborative

Method for Knowledge Acquisition and Decision-Making Process

Towards the Integration of the Knowledge from Biomedical

Knowledge Discovery and Machine Learning in

Mining Medical Data to Obtain Fuzzy Predicates . . . . . . . . . . . . . . . . . . . . 103

On Patient’s Characteristics Extraction for Metabolic Syndrome

An Evolutionary Method for Exceptional Association Rule Set

Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149

Ramin Karimi1,2 , Ladjel Bellatreche1 , Patrick Girard1 , Ahcene Boukorca1,

Abstract. The advancement of next generation sequencing (NGS) and

Keywords: Metagenomics, Short Reads, DNA signature, Hadoop and

Sequence-based identiﬁcation of species can be classiﬁed into two groups: As-

In this paper, we propose a method to show how parallel and distributed

2.1 Hadoop Distributed File System (HDFS)

– NameNode: It is the Master of the ﬁlesystem. It is responsible to manage

– DataNodes: They are the workhorses of the ﬁlesystem. NameNode breaks

– Secondary NameNode: It keeps a copy of the merged namespace image,

– JobTracker: As the Master of the system, it is responsible to manage the

2.5 Bitmap Index

Table 1. An example of a bitmap index deﬁned on Grade column

RID Name Nationality Grade RID A B C D

Table 2. A part of Acholeplasma laidlawii’s DNA signatures table of unique 18-mers,

Fig. 2. An example of Metasim reads

Before any implementation, some pre-processing is needed. We need to attach

3.3 The Use of the Bitmap Index

RID Reads b1 b2 b3 b4 b5 RID Reads b1

Table 4. The newFile.txt format to create a single ﬁle

Next step is loading data into the Hive table:

Alternatively we can use a faster query:

Time taken with SELECT* and GROUP BY query:

Time taken with SELECT file.rid query which is faster:

The result of this implementation is a column containing numbers from 1 to

Of the 1. Besides the stars, of which I have spoken in

You might also like