Chromatin Remodelling

Download as pdf or txt
Download as pdf or txt
You are on page 1of 234

CHROMATIN

REMODELLING
Edited by Danuta Radzioch
Chromatin Remodelling
http://dx.doi.org/10.5772/50815
Edited by Danuta Radzioch
Contributors
Shiaw-Yih Lin, Lili Gong, Edward Wang, Luigi Bagella, Irene Marchesi, Elena R. Garcia-Trevijano, Luis Torres, Rosa
Zaragoza, Juan R. Via, Nadezhda Vorobyeva, Danuta Radzioch, Gernot Lngst, Laura Manelyte, Mario Garcia-
Dominguez, Laurence Wilson, Aude Fahrer, Daniela Zahorakova
Published by InTech
Janeza Trdine 9, 51000 Rijeka, Croatia
Copyright 2013 InTech
All chapters are Open Access distributed under the Creative Commons Attribution 3.0 license, which allows users to
download, copy and build upon published articles even for commercial purposes, as long as the author and publisher
are properly credited, which ensures maximum dissemination and a wider impact of our publications. However, users
who aim to disseminate and distribute copies of this book as a whole must not seek monetary compensation for such
service (excluded InTech representatives and agreed collaborations). After this work has been published by InTech,
authors have the right to republish it, in whole or part, in any publication of which they are the author, and to make
other personal use of the work. Any republication, referencing or personal use of the work must explicitly identify the
original source.
Notice
Statements and opinions expressed in the chapters are these of the individual contributors and not necessarily those
of the editors or publisher. No responsibility is accepted for the accuracy of information contained in the published
chapters. The publisher assumes no responsibility for any damage or injury to persons or property arising out of the
use of any materials, instructions, methods or ideas contained in the book.
Publishing Process Manager Viktorija Zgela
Technical Editor InTech DTP team
Cover InTech Design team
First published April, 2013
Printed in Croatia
A free online edition of this book is available at www.intechopen.com
Additional hard copies can be obtained from [email protected]
Chromatin Remodelling, Edited by Danuta Radzioch
p. cm.
ISBN 978-953-51-1087-3
free online editions of InTech
Books and Journals can be found at
www.intechopen.com
Contents
Preface VII
Section 1 Molecular Basis for Chromatin Structure and Regulation 1
Chapter 1 Chromatin Remodelers and Their Way of Action 3
Laura Manelyte and Gernot Lngst
Chapter 2 SUMO Tasks in Chromatin Remodeling 29
Garcia-Dominguez Mario
Section 2 Chromatin Remodeling in Regulating Gene Expression 57
Chapter 3 SWI/SNF Chromatin Remodeling Complex Involved in RNA
Polymerase II Elongation Process in Drosophila
melanogaster 59
Nadezhda E. Vorobyeva, Marina U. Mazina and Semen A. Doronin
Chapter 4 Condensins, Chromatin Remodeling and Gene
Transcription 77
Laurence O. W. Wilson and Aude M. Fahrer
Chapter 5 The Role of Id2 in the Regulation of Chromatin Structure and
Gene Expression 91
Elena R. Garca-Trevijano, Luis Torres, Rosa Zaragoz and Juan R.
Via
Section 3 Chromatin Remodeling in DNA Damage, Development and
Human Disease 117
Chapter 6 Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its
Significance in Tumor Progression and Cell Differentiation 119
Irene Marchesi and Luigi Bagella
Chapter 7 Chromatin Remodeling in DNA Damage Response and
Human Aging 153
Lili Gong, Edward Wang and Shiaw-Yih Lin
Chapter 8 Chromatin Remodelling During Host-Bacterial Pathogen
Interaction 173
Yong Zhong Xu, Cynthia Kanagaratham and Danuta Radzioch
Chapter 9 Rett Syndrome 199
Daniela Zahorakova
Contents VI
Preface
In the eukaryotic cells, DNA, histone proteins and associated macromolecules are tightly
packaged into chromatin. The basic unit of chromatin is the nucleosome a DNA fragment
wrapped around an octamer core of histone proteins. During the past two decades the field
of chromatin research has advanced at an incredible pace due to the development of novel
techniques. It has become increasingly clear that, rather than simply representing packaged
DNA, chromatin organization undergoes dynamic changes and plays a key role in conlroI
ling genome activities throughout life, from the onset of embryonic development to cell, lis
sue and organ differentiation. The term chromatin remodelling is widely used to describe
changes in chromatin structure which is controlled by histone-modifying enzymes, chroma
tin remodelling complexes, non-histone DNA-binding proteins and noncoding RNAs. Many
human diseases such as cancer, various genetic syndromes, autism and infectious disease
have been linked to the disruption of these control processes by genetic, environmental or
microbial factors. Therefore, to unravel the mechanisms by which they operate is one of the
most exciting and rapid developing fields of modern biology and will contribute to new
ways in treatment of these diseases.
The chapters in this book will focus on recent advances in our understanding of the mecha
nisms that govern the dynamic structural of chromatin, thereby providing important in
sights into gene regulation, DNA repair, and human diseases.
The book begins with the section Molecular basis for chromatin structure and regulation
dealing with the molecular mechanisms underlying chromatin dynamics. In the first chapter
Chromatin Remodelers and Their Way of Action written by Laura Manelyte and Gernot
Langsl, lhe aulhors give an overviev of four ma|or famiIies of chromalin remodeIers incIud
ing SWI/SNF, ISWI, CHD and INO80 family. The domain compositions, components and
basic functions of these remodelers have been described and the following three aspects re
Ialed lo lhe funclions of chromalin remodeIers have been highIighled: 1) Mechanisms of nu
cleosome positioning in vitro and in vivo; 2) Targeting of remodelling machines to genomic
loci and their specific interaction with the modified substrate and histone variants; 3) Regu
lation of remodeler activity. This chapter provides an excellent knowledge in understanding
the mechanisms of chromatin remodelling by ATP-dependent chromatin remodelers.
Sumoylation is a post-translational modification of proteins by attachment of the small oIy
peptide SUMO (small ubiquitin-like modifier), which plays an important role in various ceI
lular processes, such as nuclear-cytosolic transport, transcriptional regulation, apoptosis,
protein stability, signal transduction, cell cycle progression and differentiation. In the second
chapter SUMO Tasks in Chromatin Remodeling written by Mario Garcia-Dominguez, the
prominent function of SUMO in transcriptional regulation, in the context of chromatin slruc
ture and dynamic, has been discussed. The author describes in detail the different ways by
which SUMO is involved in chromatin remodeling: 1) histone modification; 2) modulation of
transcription factors activity, and 3) architecture of protein complexes associated to the chro
matin, especially those associated to the heterochromatin. This chapter provides a versatile
view on molecular mechanisms of chromatin remodeling regulated by sumoylation.
Chapters 3 to 5 are classified into section 2 Chromatin remodeling in regulating gene ex
pression. It is clear that SW/SNF chromatin remodeling complex plays an important role in
the process of RNA polymerase II-mediated transcription. SWI/SNF complex not only as
sists transcription events by remodeling nucleosomes but also participates in early event in
lranscrilion lhrough inleraclion vilh lranscrilion faclors and lhe recruilmenl of RNA oI
ymerase II. Recent studies have suggested that this complex has an activity beyond lran
scription initiation as it can regulate the transcription elongation rate with a consequence on
alternative splicing. In particular, this complex has been shown to be associated with pre-
mRNP. dSWI/SNF complex contains two subcomplexes PBAP and BAP. Which of them is
involved in transcription elongation? This question is answered in chapter 3 SWI/SNF
Chromatin Remodeling Complex Involved in RNA Polymerase II Elongation Process in
Drosophila Melanogaster written by authors Nadezhda E. Vorobyeva, Marina U. Mazina
and Semen A. Doronin. Chapter 3 is presenting results of an original research. In this article,
the authors generated two specific antibodies against OSA and BAP 170, respectively. The
OSA is the specific subunit of BAP and the BAP 170 is the specific subunit of PBAP. Using
chromalin immunoreciilalion assay, lhe aulhors found lhal bolh AI and IAI subcom
plexes bind to the promoter but not to the coding region of ftz-f1 gene before transcription
induction. Interestingly, in response to transcription induction, only PBAP but not BAP is
found to be accumulated at the coding region of this gene. Similar results are observed
when performing the same experiments using another gene (hsp70 gene). Based on these
results, the authors suggest that PABP subcomplex is involved in the transcription eIonga
tion mediated by RNA polymerase II.
In chapter 4 titled Condensins, Chromatin Remodeling and Gene Transcription, authors
Laurence O.W. Wilson and Aude M. Fahrer discuss the role of condensins in the regulation
of gene transcription. Condensins belong to an ancient family of protein complexes capable
of manipulating chromatin structure. In eukaryotes, condensin I and condensin II are vital
for the proper formation and resolution of sister chromosomes. In recent years, evidence has
gradually demonstrated that condensins are much more than architects of chromatin slruc
lure, lhey are aIso imorlanl reguIalors of gene lranscrilion. Hovever, lhe vilaI roIe of con
densins makes the study of these complexes difficult. In this chapter, the authors introduce
several different methods to investigate the roles of condensins in chromatin structure
change and gene reguIalion. A seciaI focus is Iaced on lvo arlicuIar examIes of conden
sin in regulating gene transcription: dosage compensation in C. elegans and thymocyte de
velopment in mice.
Id2 (inhibitor of DNA binding 2, dominant-negative helix-loop-helix protein) belongs to a
family of helix-loop-helix proteins which plays a central role in the regulation of cell growth
and differenlialion and cancer. In chaler 5 The RoIe of Id2 in lhe ReguIalion of Chroma
tin Structure and Gene Expression written by Elena R. Garcia-Trevijano, Luis Torres, Rosa
Zaragoz and Juan R. Via, the authors give a broad introduction to the topic. This cha
ter begins with description of the structure and functions of Id2 protein followed by the
molecular mechanisms underlying the role of Id2 as a proliferative factor in normal cell
Preface VIII
cycle progression, in cancer and in G0-G1 transition in response to mitogenic stimuli are
discussed. Id2 is involved in regulation of gene expression as a switch to open or close
chromatin structure through modulation of chromatin protein complex at target genes. Ii
nally, the molecular regulation of Id2 activity and expression by phosphorylation and GSH
depletion are also discussed.
In section 3 Chromatin remodeling in DNA damage, development and human disease,
four chapters are presented, dealing with the molecular mechanisms underlying the in
volvement of chromatin remodeling in controlling key physiological or pathological events
such as differentiation, development, DNA damage response, tumorigenesis and microbial
infection.
Polycomb group (PcG) proteins are highly conserved regulatory factors that were initially
discovered in Drosophila. They constitute a global silencing system and play key roles in
embryonic development and stem cell maintenance. Deregulation of PcG members conlrib
ute to defects in stem cell fates and to tumorigenesis. In mammals, PcG proteins form two
main complexes: polycomb-repressive complex 1 and 2 (PRC1, PRC2). They act by modify
ing chromatin structure and by regulating deposition and recognition of posttranslational
histone modifications.
Chapter 6 Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in
Tumor Progression and Cell Differentiation by Irene Marchesi and Luigi Bagella give an
overview of molecular biology and function of PCR2 with special emphasis on EZH2, the
catalytic subunit of PRC2. The content covers PCR2-mediated silencing mechanism, PCR2
aclivily reguIalion, incIuding exression reguIalion, osllranscrilionaI modificalion and re
cruitment to target genes, as well as the mechanisms underlying the role of EZH2 in neuro
genesis, skeletal myogenesis and tumorigenesis.
Cells are inescapably and constantly exposed to a variety of environmental and endogenous
agents which can cause DNA damage such as single-strand breaks, double-strand breaks,
mismatches and base modifications. To maintain genome stability, cells have developed a
global signaling network, known as DNA damage response (DDR) to sense and repair DNA
damages. Chromatin remodeling is critical during this process, as chromatin constitutes a
natural barrier to associated enzymes and regulatory factors to reach DNA. Aging is a com
plex process that has long been thought to be a consequence of unprogrammed deleterious
events and accumulation of random gene mutation. However, in recent years, DNA damage
has been shown to play a central role in premature aging and DNA damage theory of aging
has been developed although there are still several unresolved controversies that require
further clarification.
In chapter 7 Chromatin Remodeling in DNA Damage Response and Human Aging by Lili
Gong, Edward Wang and Shiaw-Yih Lin, the authors summarize the current knowledge on
DNA damage reair mechanisms, lhe roIe of chromalin remodeIing in DDR, DDR in helero
chromatin and the interplay between DNA damage, chromatin remodeling and human ag
ing. Intracellular pathogens, through a long-standing coexistence with host cells, have
evolved mechanisms that provide pathogens with the amazing capacity to adapt and sur
vive in variable and often hostile environments encountered in their hosts. The concept of
chromatin modification as a mechanism by which pathogens affect host immune responses
to facilitate infection has emerged in recent years.
Preface IX
In chapter 8 Chromatin Remodeling During Host-Bacterial Pathogen Interaction written
by Yong Zhong Xu, Cynthia Kanagaratham and Danuta Radzioch, the chromatin modifica
tions in host cells induced by bacterial pathogens and their effects on host gene expression
and infection are introduced. MAPK, IIN- and transcription factor NI-i signaling alh
ways are common targets for bacteria-induced posttranscriptional modifications. These sig
nal pathways selectively affect histone modifications at host target genes therefore affecting
the expression of target genes. In this chapter, the potential role of HDAC inhibitors to be
used as therapeutic immunomodulators in treatment of infections is also discussed. Defects
in epigenetic mechanisms can give rise to several neurological and behavioral phenotypes.
Rett syndrome is a pervasive neurodevelopmental disorder that is primarily caused by mu
tations in MECP2 gene encoding methyl-CpG-binding protein 2 (MeCP2 protein). The func
tions of this protein are related to DNA methylation process, a key epigenetic mechanism
which plays a critical role in gene silencing during chromatin remodeling. Rett syndrome is
the first human disorder that shows a link between epigenetic modifications/ chromatin re
modeling and neuronal dysfunction.
In chapter 9 Rett Syndrome, the author Daniela Zahorakova gives a detailed description
of the clinical features, diagnosis, as well as the molecular mechanism of Rett syndrome that
arises as a consequence of MECP2 gene mutations and disordered chromatin remodeling
I would like to thank Ms. Mirna Cvijic of InTech publisher for helping me on this project, to
all the authors of the chapters for their time and effort to contribute to this book. I hope
readers will enjoy reading this collection of reviews and research papers, leaving with a
sense of anticipation for what lies ahead in the field of chromatin remodeling.
Dr. Danuta Radzioch
Professor, McGill University
Department of Medicine and Department of Human Genetics
Montreal, Canada
Preface X
Section 1
Molecular Basis for Chromatin Structure and
Regulation
Chapter 1
Chromatin Remodelers and Their Way of Action
Laura Manelyte and Gernot Lngst
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/55683
1. Introduction
Chromatin is the packaged form of the eukaryotic genome in the cell nucleus, presenting the
substrate for all DNA dependent processes. The basic packaging unit of chromatin is the
nucleosome core, a nucleoprotein structure consisting of 8 histone proteins and 147 bp of DNA.
Two of each H2A and H2B, H3 and H4, form an octameric, disc like particle on which 1.65
turns of DNA is wrapped [1]. Nucleosomal cores are separated by a linker DNA, with a varying
length of 7 bp to 100 bp, with distinct lengths in different organisms and tissues. Even within
one cell type the linker length can vary about 40 bp between the actively transcribed and
repressed genes [2].
Binding of the DNA to the histone octamer and the bending of the molecule on the protein
surface present a strong barrier to sequence specific recognition of the nucleosomal DNA
molecule. Thats why the packaging of DNA into nucleosomes and higher order structures is
generally inhibitory to all kind of DNA dependent processes. To overcome DNA sequence
accessibility problems, cells have developed mechanisms to open higher order structures of
chromatin and to disrupt nucleosomes allowing the binding of sequence specific regulators.
In general, two major mechanisms exist which regulate chromatin accessibility: First, histones
can be posttranslationally modified and recruit specific effector proteins to chromatin [3].
Second, specific chromatin remodeling enzymes displace the histone octamers from DNA or
translocate them on DNA, thereby exposing or protecting underlying DNA sequences to
regulatory factors that control the DNA dependent processes [4].
The presence of 53 different chromatin remodeling enzymes in the human cell suggests
specialized functions of these enzymes and the associated complexes. Chromatin remodelers
are DNA translocases that apply an ATP-dependent torsional strain to DNA, providing the
force to reposition nucleosomes; i.e. moving the histone octamer to a different site on the DNA
[4,5]. Diverse remodeling enzymes and complexes have distinct nucleosome positioning
2013 Manelyte and Lngst; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
activities. In other words, the remodelers interpret the DNA sequence/structure information
in different ways, establishing target site-specific nucleosome positioning patterns. The exact
nucleosome positions at a given site depends on both, the type of the ATPase motor protein
and the composition of the multiprotein complex where it is integrated [6]. The specialized
functions of remodeling enzymes may result from their different nucleosome positioning
behavior and the distinct targeting to genomic sites.
There is plenty of data available on the remodeling mechanism in vitro, however not much is
known about the targeting and regulation of the remodelers in vivo. It remains unclear whether
these complexes form a dynamic chromatin environment or a rather static chromatin structure
with defined nucleosome positions in the cell nucleus. Many chromatin remodelers are
believed to bind DNA and nucleosomes in a sequence independent manner in vitro, however
there is mounting evidence for specific chromatin signals that are recognized by chromatin
remodelers. This is best demonstrated by the recognition of histone variants, modified histone
tails, the preferential binding to nucleosome free regions of DNA and binding to specific DNA
and RNA structures and sequences. In addition, interacting proteins and/or accessory domains
of the remodeling complexes may serve as an additional layer of signal recognition and
recruitment of remodelers to the right place at the right time.
2. Remodeler families
The catalytic subunit of the remodeling enzymes consists of a conserved ATPase domain and
unique flanking domains, used for a simplified separation into four distinct families (Fig. 1). The
ATPase domain consists of two tandem RecA-like folds (DExx and HELICc), containing seven
conserved heIicase-reIaled sequence molifs lhal cIassify lhe enzymes as arl of lhe Suerfami
ly 2 grouping of helicase-like proteins [7,8]. Chromatin remodelers are lacking the ability to
separate nucleic acid strands, so they are not bona fide helicases. However, they are DNA
translocases that use the energy of ATP to create a necessary force to reposition nucleosomes.
In a qualitative and quantitative study, the Snf2 family members were further subdivided into
24 distinct subfamilies based on similarities within the Snf2-specific motifs. Increased genomic
complexity is paralleled by an increasing number of subfamilies and members of a given
subfamily: the S.cerevisiae genome encoding some 6000 genes has 17 Snf2 family members
belonging to 13 subfamilies, and the human genome encoding some 21000 genes has 53 Snf2
family genes from 20 subfamilies [8].
2.1. SWI/SNF family
The SWI/SNF complex was first described in Saccharomyces cerevisiae. In 1984 genetic screens
reveaIed lhal lhe mulalions in sucrose non-fermenling (SNI) genes caused defecls in exres
sion of the SUC2 gene, which is required for growth on sucrose and raffinose as a carbon
sources [9]. Similarly, mutations in SWI genes were identified as defective for expression of
the HO gene, which is required for mating type switching (the name Swi is derived from
switching defective). Mutations in both SNF and SWI genes cause pleiotropic phenotypes,
Chromatin Remodelling 4
suggesting a global role for Swi/Snf in gene expression. However, recent whole-genome
expression studies have shown that Swi/Snf controls transcription of a small percentage of all
S. cerevisiae genes [10]. The SWI/SNF family members are defined by the presence of an N-
terminally located HSA (helicase-SANT) domain, which is known to recruit actin and actin-
related proteins, and a C-terminally located bromo domain, suggested to bind to the
acetylated-lysines of histones. This family of remodeling enzymes was shown to slide and to
evicl nucIeosomes from DNA, bul Iacking chromalin assembIy aclivilies. RemodeIers beIong
ing to this family are large, multi-subunit complexes containing 8 or more proteins. Most
eukaryotes utilize two related SWI/SNF family remodelers, built around the two related
catalytic subunits Swi2/Snf2 or Sth1 in yeast, and BRM or BRG1 in humans (Table 1). Although
SWI/SNF is not essential for yeast growth, a genome-wide analysis demonstrated that ~3 to
6% of yeast genes are regulated by SWI/SNF, with functions that contribute to both gene
activation and repression [10,11]. On the other hand, RSC complex containing the Sth1 ATPase
is essential for growth and about 10-fold more abundant than the SWI/SNF complex. RSC
function is required for normal cell cycle progression [12]. Human BAF and PBAF complexes
share eight identical subunits and are distinguished by the presence of only several unique
subunits: BAF180, BAF200 and BRD7 for PBAF and BAF250a for BAF [13]. Variant subunits
are thought to contribute to targeting, assembly and regulation of lineage-specific functions
of those complexes. For example only PBAF, but not BAF, is capable of facilitating ligand-
dependent transcriptional activation by nuclear receptors in vitro and to mediate expression
of an interferon-responsive genes [14,15]. Both appear to be associated with lung cancer, as
90% of non-small cell lung carcinomas stained positively for BRG1 and BRM [16]. BRG1
Figure 1. Classical organizaLion o renodeler anilies deined by Lheir caLalyLic donain. All renodeling enzynes con
sist of a shared ATPase domain and unique flanking domains.
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
5
possesses tumor suppressor functions, whereas BRM loss is a contributing factor and potential
marker of tumorigenesis in lung, prostate and gastric cancers [17].
Complex Catalytic subunit Auxillary subunits Organism
SWI/SNF Swi2/Snf2
Swi1/Adr6, Swi3, Swp73, Snf5, Arp7,
Arp9, Swp82, Snf11, Taf14, Snf6,
Rtt102
Yeast
RSC Sth1
Sth1, Rsc8/Swh3, Rsc6, SfhI, Arp7,
Arp9, Rsc1,2 or 4, Rsc7, Rsc30, Rsc3,
Rsc5, Rtt102, Rsc14/Ldb7, Rsc10, Rsc9
BAF BRM or BRG1
BAF250, BAF155, BAF170,BAF60(A,B or
C), SN5, A57, A53(A or ), acLin,
BAF45(A,B,C or D)
Human
PBAF BRG1
BAF180, BAF200, BRD7, BAF155,
BAF45(A,B,C or D), BAF170,BAF60(A, B
or C), SN5, A57, A53(A or ),
actin
Table 1. Selected SWI/SNF family remodelers from yeast and human.
2.2. ISWI family
The ISWI (imitation switch) family ATPases harbour a C-terminal SANT domain adjacent to
a SLIDE domain (SANT-like ISWI), which together form a nucleosome recognition module
that binds to DNA and unmodified H4 tails [4]. The ISWI remodeling enzyme in Drosophila,
is known to be present in several chromatin remodeling complexes such as NURF, CHRAC
and ACF. Snf2H and Snf2L are the mammalian homologues of ISWI, which can act on their
own or in the presence of one or more auxilary subunits forming different remodeling
complexes with different properties. For example, Snf2H is known to interact with Tip5, RSF1
and WSTF proteins to form NoRC, RSF and WICH complexes. Specialized accessory proteins
contain many chromatin binding domains, including histone fold motifs (in CHRAC), plant
homeodomain (in Tip5), bromodomains (in BPTF, ACF1, Tip5) and additional DNA-binding
motifs (HMGI(Y) in NURF301; AT hooks in Tip5). Many ISWI family complexes (ACF,
CHRAC, NoRC) catalyze nucleosome spacing, promote chromatin assembly and confer
transcriptional repression. However, NURF escapes theses general rules by disturbing
nucleosome spacing and assisting ecdysone dependent transcriptional activation, showing
that functional diversity is determined by the additional subunits [4]. The steroid hormone
ecdysone directly modulates germline stem cells maintenance, activates transcription and
proliferation in a cooperation with the NURF remodeler [18]. In Drosophila, loss of ISWI causes
global transcriptional defects and results in dramatic alterations of the higher-order structure
of chromatin, especially on the male X chromosome [19]. NoRC action correlates with specific
changes in nucleosome positioning at the rDNA promoter region, causing heterochromatin
formation and gene silencing [20].
Chromatin Remodelling 6
Complex Catalytic subunit Auxillary subunits Organism
NURF
ISWI
NURF301, NURF55/p55, NURF38
Fly ACF ACF1
CHRAC ACF1, CHRAC 14, CHRAC 16
ISWI1a
ISWI1
loc3
Yeast ISWI1b loc2, loc4
ISWI2 ISWI2 Itc1
NURF Snf2L BPTF, RbAp46 or RbAP48
Human
ACF
Snf2H
ACF1
CHRAC ACF1, CHRAC17, CHRAC15
NoRC Tip5
RSF Rsf1
WICH Wstf
Table 2. Selected SWI/SNF family remodelers.
2.3. CHD family
The CHD (Chromodomain-Helicase-DNA binding) family is defined by the presence of two
chromodomains, arranged as a tandem, N-terminal of the ATPase domain. Additional
structural motifs are used to further divide the CHD family into the subfamilies CHD1, Mi-2
and CHD7 [8,21].
Members of lhe CHD1 subfamiIy conlain a C-lerminaI DNA-binding domain lhal referen
tially binds to AT-rich DNA in vitro (members are Chd1 and Chd2 roleins in higher eukar
yotes) [22,23]. Recently, the crystal structure of the DNA binding domain of Chd1, revealed a
SANT-SLIDE like fold. This domain was shown to be required for the remodeling activity of
Chd1 in vitro and in vivo [24].
The Mi-2 subfamily members contain a pair of PHD domains (plant homeodomain) in their
N-terminal part (human Chd3 and Chd4, also known as Mi-2o and Mi-2 in Drosophila,
respectively), implicated in nucleosome binding [25].
The CHD7 subfamily members have additional C-terminal domains, like the SANT or BRK
domains (Chd5 to Chd9 proteins).
The biological properties of CHD family members are highly heterogenous. Some exist as
monomers in vivo; others are subunits of multiprotein complexes, many of which have not yet
been fully characterized [26]. The best studied is the NURD (nucleosome remodeling and
deacetalase) complex, containing Chd3/Chd4, histone deacetylases (HDAC1/2) and methyl
CG-binding domain (MD) roleins. Il vas shovn lo be invoIved in lranscrilionaI reres
sion of a specific set of genes during C.elegans, D.melanogaster and mammalian development
[26]. Chd1 together with Isw1 are also termed nucleosome-spacing enzymes that are required
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
7
to maintain nucleosomal organization in yeast [27]. To date, Chd3, Chd4, Chd5 and Chd7 have
been imIicaled in human disease rocesses. Chd3 and Chd4 have been idenlified as auloan
ligens in alienls vilh dermalomyosilis, a conneclive-lissue disease characlerized by infIam
mation of both muscles and skin. Chd3 is associated with Hodgkin's lymphoma and Chd5 is
associated with neuroblastoma, a malignant neoplasm of the peripheral sympathetic nervous
system frequently affecting infants and children [28]. Haploinsufficiency of Chd7 in humans
results in the CHARGE syndrome. Chd7 is essential for the develompment of multipotent
migratory neural crest cells, which contribute to the formation of many tissues affected in
CHARGE syndrome [29].
Complex Catalytic subunit Auxillary subunits Organism
Chd1 Chd1
Fly Chd2 Chd2
NuRD Mi-2 MBD2/3, MTA, RPD3, p55, p66/68
Chd1 Chd1
Human
Chd2 Chd2
NuRD Chd3/Chd4
MBD3, MTA1/2/3, HDAC1/2,
bAp46I48, p66uI, DOC1?
Chd5 Unknown
Chd7 PARP1, PBAF complex
Table 3. Selected CHD family remodelers.
2.4. INO80 family
The specific feature of the remodeling enzymes belonging to the INO80 (inositol requiring 80)
family is the split ATPase domain. This unique module retains ATPase activity, and acts as a
scaffold for the association with the RuvB-like proteins, Rvb1 and Rvb2. RuvB is a bacterial
ATP-dependent helicase that forms a double hexamer around Holliday junctions to promote
their migration during homologous recombination [30]. Unlike remodelers of other families,
the INO80 complex exhibits DNA helicase activity and binds to specialized DNA structures
in vitro. These DNA structures resemble Holliday junctions and replication forks consistent
with the function of the complex in homologous recombination and DNA replication [31,32].
Yeast INO80 was shown to control the genome-wide distribution and dynamics of the histone
variant H2A.Z. INO80 and SWR1 were shown to exhibit histone-exchange activity, being
capable to replace nucleosomal H2A.Z/H2B with free H2A/H2B dimers [33,34j. olh remod
eling complexes can slide nucleosomes in vitro on a reconstituted chromatin template and evict
histones from DNA [35-37]. In addition to the role of INO80 in recombination and DNA
replication, it is suggested to regulate the transcription level of about 20% of the yeast genes
and to participate in DNA double-strand break repair via the interaction with yH2AX and
recruit the MRX and Mec1 complexes to the DNA damage site [33].
Chromatin Remodelling 8
Complex Catalytic subunit Auxillary subunits Organism
INO80 Ino80
Rvb1, Rvb2, Arp5, Arp8, Arp4, Act1,
Taf14, les1, Ies2, les3, les4, les5, Ies6,
Nhp10
Yeast
SWR1 Swr1
Rvb1, Rvb2, Arp6, Arp4, Act1, Yaf9,
Swc4/Eaf2, Swc2, Swc3, Swc4, Swc5,
Swc6, Yaf9, Bdf1, Swc7, H2AZ, H2B
Table 4. Selected INO80 family remodelers.
3. Translocation mechanism of chromatin remodelers
Chromatin remodelers use the energy of ATP hydrolysis to assemble, reposition or evict
histones from DNA. Nucleosome repositioning by remodelers can be described as a 3-step
mechanism: 1) initiation step that requires the recognition and specific binding to the substrate,
2) several translocation steps with varying step-lengths and kinetics depending on the
particular remodeling enzyme and on the properties of the underlying DNA sequence, 3)
release step, which occurs at energetically favourable positions depending on the combination
of remodeler and DNA sequence/structure at this site [6,38]. This chapter will focus on the
mechanisms of the translocation step.
Proposed models for nucleosome remodeling suggest that only a minor fraction of the 358
direct and indirect histone-DNA interactions are disrupted at a given time of the reaction, as
the energy of ATP hydrolysis would not be sufficient to fully disrupt the nucleoprotein
structure [39,40]. One of the first mechanisms proposed, is the twist diffusion model
describing moving of the DNA over the histone octamer surface in 1 bp intervals. Thus, a single
base pair distortion is continuously propagated through the nucleosome, transiently storing
one additional basepair in the realm of the nucleoprotein structure. This model is supported
by nucleosomal crystal structures exhibiting such a single-basepair twist defect [39,41].
However, several studies could not confirm such a translocation model. Experiments using
nicked or gapped DNA substrates that uncouple DNA rotation mediated processes still
allowed SWI/SNF and ISWI dependent nucleosome remodeling, arguing against a sole twist-
diffusion mechanism [42-44].
Alternatively, it was suggested that nucleosomes are repositioned according to the loop
recapture model, proposing a detachment of a DNA segment from the histone octamer
surface at the entry site of the nucleosome. The exposed octamer surface would interact with
more distant regions of the DNA molecule, resulting in the formation of a DNA loop on the
histone octamer surface. This DNA loop would translocate over the octamer surface in an
energy-neutral process, by releasing and rebinding adjacent sequences on the protein surface.
DNA loop propagation would change the translational position of the nucleosome, according
to the size of the DNA loop [45]. This model is strengthened by biochemical and recent single
molecule studies. ACF remodeling complex was shown to cause the unwrapping of DNA,
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
9
roughly 20 and 40 bp, from the nucleosomal border [46]. ATP dependent translocation of SWI/
SNF and RSC on DNA and nucleosomal templates produces DNA loops and nucleosome
remodeling by RSC was shown to produce a remodeled intermediate containing internal DNA
loops [47].
NucIeosomaI lransIocalion and ils sle-size deend on lhe size of lhe DNA Ioo, a arame
ter that depends on the nature of the remodeling enzyme. Single molecule studies with the
remodeling complex ACF suggested an initial step size of 7 bp and subsequent steps of 3-4
b |48j, vhereas RSC vas shovn lo exhibil a sle size of 2 b |49j. Wilhin a slrong nucIeo
somal positioning sequence both recombinant Drosophila Mi-2 and native RSC from yeast
repositioned the nucleosome at 10 bp intervals, which are intrinsic to the positioning sequence.
Furthermore, RSC-catalysed nucleosome translocation was noticeably more efficient when
beyond the influence of this sequence. Interestingly, under limiting ATP conditions RSC
preferred to position the nucleosome with 20 bp intervals within the positioning sequence,
suggesting that native RSC preferentially translocates nucleosomes with 15 to 25 bp DNA
steps [38]. Lately, it was proposed that loops do not freely diffuse about the exterior of the
nucleosome but rather feed through specific restriction points by threading past fixed
constrictions [47].
4. Targeting remodelers: Signals
One of the enigmas is the cellular requirement for 53 types of remodeling enzymes in humans
that are capable to form hundreds to thousands of different remodeling complexes [6]. Such
high numbers already suggest specialized functions for individual complexes and that
remodeling enzymes mobilize nucleosomes in a specific manner. Many chromatin remodelers
bind to DNA and nucleosomes in a sequence independent manner in vitro, albeit they exhibit
complex specific features in nucleosome positioning and many of the complex subunits
recognize specific chromatin features, targeting the complexes to defined genomic regions in
vivo. The redundancy of enzymes and remodeling complexes suggest that they establish local
and context specific chromatin structures and thereby regulate the DNA dependent processes.
This chapter addresses the known and potential targeting mechanisms via DNA binding
factors, the recognition of local chromatin features via functional RNA molecules and the
impact of sequence context on the local chromatin structures (Fig. 2).
4.1. Direct chromatin targets
4.1.1. DNA and RNA sequence/structure
Mechanistical analysis of the nucleosome remodeling process revealed that binding of a
remodeling complex to a mononucleosomal substrate results in a specific and ATP-dependent
repositioning of the nucleosome on the DNA [50,51]. An in vitro study compared 7 different
remodelers on different nucleosomal templates [6]. It appeared that each enzyme placed the
nucleosomes at distinct positions and that even the same remodeling enzyme present in a
Chromatin Remodelling 10
differenl comIexes vilh various non-calaIylic subunils, changed lhe oulcome of lhe remod
eling reaction (Fig. 3). Additionally, recent genome-wide studies compared 4 different
remodeling complexes and similarly, it was observed that each remodeler exhibits a unique
set of genomic targets correlating with distinct chromatin signatures [52]. Thus, these data
suggest that the remodelers are capable to recognize the underlying DNA sequence/structure
and accordingly establish specific chromatin structures.
The remodeling complexes contain DNA-binding motifs that are present in the catalytic
or/and in accessory subunits (Fig. 1). For example, catalytic subunit Snf2H contains a SANT-
SLIDE domain and in addition the WAC and AT hook motifs in the Acf1 and Tip5 proteins [4,
53-57]. These modules allow the specific recognition of DNA sequences and determine the
outcome of a remodeling reaction, as it was shown by exchanging such domains between
remodeling enzymes [38,58-60]. Nucleosome positioning is most probably affected by the
Figure 2. Targeting signals for chromatin remodeling complexes.
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
11
different binding affinities of those motifs to the non-remodeled and remodeled substrates and
the sequence dependent flexibility and stability of the particle, impacting the final outcome of
the reaction. The role of specific DNA sequences in nucleosome positioning was shown for the
ISWI-containing complex ACF, which positions a nucleosome relative to an intrinsically
curved DNA sequence element [6].
Not only individual positions, but also internucleosomal distances depend on the DNA
binding domains of the enzymes. ACF interacts with linker DNA and is capable to sense its
length [61]. This structural element appears to play a key role in the positioning of nucleosomes
in regular arrays, as the remodeler-induced mobility of the nucleosome is biased towards the
longer flanking DNA [62]. Similarly, the Chd1 remodeler was described to sense the length of
linker DNA [63].
Moreover, unusual DNA structures like quadruplexes could represent specific targeting
signals. ATRX recognises G-rich repeat sequences, which are prevalent in telomeres [64]. These
repeat sequences likely to form G-quadruplex (G4) structures, and ATRX preferentially binds
to such a G4 structure in vitro. Such alternative DNA structures are believed to destabilize the
genome and it is enticing to think that ATRX is responsible for stabilizing G-rich regions of
the genome by remodeling G4 DNA and incorporating H3.3-containing nucleosomes [64].
Methylated CpG islands in the DNA were shown to be recognized by MBD (methyl-binding
domain) domains, so it can serve as a targeting signal for particular remodelers. For example,
MBD2 recruits the NuRD complex to methylated promoters [65]. The related TAM domain
(MBD-like) in Tip5, the noncatalytic subunit of the NoRC complex, does not recognise
Figure 3. Bandshift assay showing that the chromatin remodelers position nucleosomes in a DNA sequence-specific
nanner. The 350 bp DNA, conLaining Lhe hsp70 pronoLer sequence, was assenbled inLo Lhe nucleones via salL dialy
sis. Five different single-nucleosomes were observed in the bandshift assay (mapped as N1, N2, N3, N4 and N4) and
this was used as a substrate for seven recombinant chromatin remodelers (lane 1). Brg1, Chd1, ISWI, Snf2H, Mi-2, ACF
and NURF in the presence of ATP repositioned nucleosomes in a remodeler-specific manner (lanes 2-8) [6].
Chromatin Remodelling 12
methylated DNA, but binds to the pRNA (promoter RNA). The pRNA is folded into the
hairpin-like structure which is bound by NoRC and participates in the recruitment NoRC to
the rRNA gene promoter region [56,66-68].
4.1.2. Histone modifications
The histone code hypothesis suggests that individual covalent modifications of histones or
combinations of these modifications are recognized by specific readers which determine
downstream events [3]. Chromatin remodeling complexes contain histone code reader
domains, allowing the targeting to specifically modified chromatin domains and thereby
enabling the establishment of a remodeler dependent nucleosomal positioning landscape.
The SWI/SNF type of remodelers contain bromodomains, interacting specifically with
acetylated lysines on the histone tails [69]. Acetylation of the histone H3 N-terminal tail
faciIilaled lhe recruilmenl and nucIeosome mobiIizalion by SWI/SNI and RSC. Telra-acely
lated H3 tails, but not tetra-acetylated H4 tails, increased the affinity of RSC and SWI/SNF for
nucleosomes, which is dependent on the SWI/SNF bromodomain, but is not further enhanced
by additional bromodomains present in RSC [70]. By contrast, the SANT domain of the ISWI
type of remodelers is known to interact with unmodified histone tails. The H4 tail has been
shown to play a decisive role in ISWI remodeling, in that both, the complete removal of the
H4 tail [71,72] and its site-specific acetylation suppress the remodeling action of ISWI [73].
Human Chd1 protein interacts with H3K4me2/3 via its double chromodomains, which fold
into a functional unit. On the other hand, nucleosomal H3K4 methylation reduces the affinity
of the NuRD complex for H3 tail binding. It was shown that the second PHD finger of Chd4
preferentially interacts with unmodified H3K4 and H3K9me3 [74,75]. Full-length NURF301
the large subunit of the ISWI containing NURF complex contains a C-terminal bromodomain
and a juxtaposed PHD finger that bind H3K4me3 and H4K16Ac, respectively. However, a
NURF301 isoform lacking these C-terminal domains is also detected in cells, suggesting that
alternative splicing can change targeting signals and localisation of the complexes within the
genome. It was concluded, that the specific recognition of the posttranslational marks by NURF
is important for the regulation of primary spermatocyte differentiation in Drosophila [76].
4.1.3. Histone variants
Non-canonical histone variants differ from the canonical histones at the level of their primary
sequence, which can range from a few amino acid changes to large domains. These variants show
dislincl reguIalory mechanisms for lheir exression and deosilion, resuIling in lhe eslabIish
ment of chromatin domains with specific properties. The exchange of canonical histones for the
variant ones is an active process, requiring the activity of remodeling enzymes and the action of
RNA and DNA polymerases that actively displace the histones from DNA [77].
Analyzing the dynamic changes in the composition of histone variants in nuclear-transferred
embryos revealed that the donor cell-derived histone H3 variants H3.1, H3.2, and H3.3, as well
as H2A and H2A.Z, were rapidly eliminated from the chromatin of nuclei transplanted into
enucleated oocytes. In parallel to this removal, oocyte-stored histone H3 variants and H2A.X
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
13
were incorporated into the transplanted nuclei, while the incorporation of H2A and H2A.Z
was minimal or not detected. The incorporation of these variant histones was independent of
DNA replication suggesting an active process depending on the remodeling complexes [78].
An ATRX (o-lhaIassemia X-Iinked menlaI relardalion rolein) Daxx (dealh domain associ
ated protein) complex can effectively assemble H3.3-containing nucleosomes in murine
embryonic stem cells. It was shown that ATRX recruits Daxx to telomeres, and both complex
subunits are required for H3.3 deposition at telomeric chromatin [79]. Chd1 in Drosophila
embryos is required for the incorporation of the H3.3 variant into the male pronucleus,
enabling the paternal genome to participate in zygotic mitosis [80]. The exchange of H2A.Z
for H2A by the yeast SWR1 complex is in mechanistical terms the best described model system.
H2A.Z replacement studied in vitro occurs in a slevise and unidireclionaI fashion, exchang
ing one H2A.Z-H2B dimer at a time. Thereby heterotypic nucleosomes, containing one H2A.Z
and one H2A moIecuIe are eslabIished as inlermediales and lhe homolyic H2A.Z nucIeo
somes as end products are generated in a second exchange step. The ATPase activity of SWR1
is specifically stimulated by H2A-containing nucleosomes without active displacement of
hislone H2A. RemarkabIy, lhe addilion of free H2A.Z-H2 dimers resuIls in a furlher slimu
Ialion of ils ATIase aclivily and lhe combined eviclion of nucIeosomaI H2A-H2 and deo
sition of H2A.Z-H2B. These results suggest that the combination of H2A-containing
nucleosome and the presence of free H2A.Z-H2B dimer act as effector and substrate for SWR1
to govern the specificity and outcome of the replacement reaction [81]. Chromatin remodeling
enzymes are also involved in the modification and dynamics of the histone variant H2A.X,
which is phosphorylated upon DNA damage and repair. The WICH (WSTF-Snf2H) chromatin
remodeling complex exhibits a novel kinase domain capable to phosphorylate Y142 on H2A.X.
Both proteins, WSTF and Snf2H were also shown to bind to H2A.X in co-immunoprecipitation
experiments [82]. In addition, it was recently shown that the activity of the Lsh remodeling
enzyme is necessary for the efficient phosphorylation of H2A.X at DNA double-strand breaks
and the successful repair of DNA damage [83].
4.2. Indirect chromatin targets
4.2.1. Sequence specific DNA binding proteins
The DNA-sequence dependent recruitment of remodelers is not necessarily mediated by the
remodeling complex subunits themselves but can also occur via transient interactions with
other sequence specific DNA binding proteins. For example, the NuRD complex is recruited
to the various promoters of the target genes via interaction with several transcription factors
and co-regulators such as NAB2, Ikaros, FOG1, BCL11B and several other factors described
by Brehm and colleagues [26]. Genome wide expression, genetic and biochemical analysis
established that TramTrack69, MEP1, and the Drosophila remodeling enzyme Mi-2 cooperate
to control transcription levels of target genes [84]. It was also shown that Mi-2 binds to SUMO
and to SUMO-ylated proteins giving rise to the hypothesis that this is a common signal for the
Mi-2 recruitment. Similarly, Brg1 containing complexes are targeted via Sox10 to two key target
genes in the Schwann cells [85]. Recruitment of SWI/SNF to the target genes of ERo requires
Chromatin Remodelling 14
the nuclear receptor co-activator protein Flightless-I, which then directly binds to both, the ER
and lhe AI53 subunil of lhe SWI/SNI comIex |86j. The ISWI subfamiIy conlaining remod
eling complex NoRC is directly recruited to the rRNA gene by the transcription factor TTF-I,
inducing gene silencing and heterochromatin formation [56].
4.2.2. Poly(ADP-ribose) polymer
Several studies demonstrated the targeting of Chd4 to sites of DNA double strand breaks in a
PARP dependent manner [87]. The enzyme was shown to bind to the poly(ADP-ribose)
polymer in vitro. Also ALC1 binds to PAR via its macrodomain and is recruited to sites of DNA
damage [88].
5. Targeting remodelers: Search mechanism
The human genome is packaged into some 30 millions of nuclesosomes that have to be
organized into functional chromatin domains with specific local structures. In order to identify
target sites or to detect nucleosomes that have to be repositioned, the remodeling complexes
have to detect such sites in chromatin very quickly. Potential genome screening mechanisms
by the remodelers are discussed in this chapter.
5.1. Release/termination model
In the seventies, JJ Hopfield introduced the kinetic proofreading mechanism for reducing
errors in biological systems. He used Michaelis Menten kinetics to explain how enzymes
discriminate between different substrates [89]. A similar kinetic proofreading mechanism can
be used to describe the action of remodelers, where good substrates are characterized by a
high affinity of the remodeler for the nucleosome substrate (low value of Michaelis-Menten
constant K
M
) and a high catalytic conversion rate k
cat
, efficiently moving the nucleosome to the
end position of the translocation reaction. Thus, the k
cat
/K
M
ratio is high as expected for an
efficient catalytic process. The opposite would be true for bad nucleosomal substrates, i. e.
having a low k
cat
/K
M
ratio. According to this model, remodeler bind to good substrates and
move them as long, as they are converted to bad substrates, exhibiting a lower affinity for
the remodeler. The remodelers are released from the low affinity substrates, a mechanism
termed release model (Fig. 4). In an alternative arrest model, all nucleosomal substrates
are recognized with similar affinities, but remodeler has a slow translocation rate on a bad
substrate. In vitro binding assays showed that the Chd1 and ACF complexes were bound with
lower afiinity to the nucleosomes at positions that reflected the end points of the remodeling
reaction, suggesting that those enzymes function according to the release model (Fig. 4) [6].
5.2. The continuous sampling mechanism
Many proteins in the nucleus, including several remodelers are highly mobile as revealed by
fluorescence recovery after photobleaching (FRAP) experiments. For proteins that do not
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
15
interact with any cellular structures, FRAP kinetics are a direct reflection of their translational
motion properties. In contrast, proteins that bind to immobile structures such as chromatin,
exhibit a slower overall mobility. The mobility of ISWI family remodelers Snf2H, Snf2L and
Snf2L+13 (an ATPase inactive variant of the Snf2L) was studied in living U2OS cells. During
G1/2 phase only 1-4% of the enzymes were immobilized [90], whereas the rest could be fitted
by the free-diffusion model, suggesting only transient binding events. Additionally, chip-seq
exerimenls vilh remodeIing enzymes suorl lhe lransienl binding evenls. These exeri
ments revealed that the localization pattern of wild-type Isw2p did not correlate with known
sites of Isw2 function in vivo. In conlrasl, lhe calaIylicaIIy inaclive Isv2K215R vas refer
entially enriched at the known Isw2 target sites. This suggests, that in the absence of ATP
hydrolysis the target sites remain high affinity binding sites, whereas the ATPase active
enzyme does not bind to the remodeled nucleosomes [91]. These results indicate a continuous
sampling mechanism (Fig. 5), by which the remodeler continuously screens the genomic
nucleosomes for good substrates, converting them into the bad ones. Most of the binding
Figure 4. Model describing Lhe ainiLy o renodelers Lo nucleosones aL dierenL posiLions on Lhe DNA. A) n Lhe re
lease model, the remodeling complex has a weaker binding affinity to the end-positioned nucleosome in comparison
Lo any oLher nucleosone. n Lhe arresL nodel, Lhe renodeler binds all nucleosones wiLh sinilar ainiLy, buL Lhe Lrans
location rate constant is much slower on a nucleosome present in the final position. B) Chd1 positions nucleosomes
according to the release mechanism. Nucleosome position-dependent differences in the affinity of the remodeling
conplexes Lo Lhe nucleosonal subsLraLe were analyzed by bandshiL assays. enodeling reacLion o Chd1 on nono
nucleosomal substrates reconstituted on a 350 bp DNA fragment containing hsp70 promoter region. Chd1 positions
nulceosomes to the N3 and N2 positions. C) Binding reaction of Chd1 to the nucleosomes. The position of the DNA
Chd1 (D/C) and the nucleosomeChd1 (N/C) complexes are indicated. The position of the N3 nucleosome is shown by
a black box. Nucleosomes positioned at this site are bound by Chd1 with the lowest affinity. This position is at the
same time the preferred endpoint of the remodeling reaction [6].
Chromatin Remodelling 16
events seem to be unproductive, meaning that the remodeling reaction does not occur. From
the experimentally determined relatively high remodeling enzyme concentrations (in the
range of M) and short chromatin bound residence times around 100 ms, average sampling
times of tens of seconds to minutes were calculated for Snf2H containing remodelers to probe
99% of all genomic nucleosomes. Thus, a combination of high remodeler concentrations, short
residence times in the chromatin bound state and fast 3D diffusive translocations in the
intervening periods appears to be an efficient mechanism to keep nucleosomes in place [90,92].
Figure 5. Genome-wide search for nucleosomal targets by remodeling enzymes. A) Continuous sampling mechanism.
It is a diffusion-driven, rapid sampling of nonspecific sites with the remodeling enzymes binding only transiently to the
nucleosomes. Most binding events are non-productive, as the nucleosomes are well positioned. B) Immobilization
mechanism. Remodelers are recruited to the particular sites where they change nucleosomal positions. Targeting is
achieved upon recogniLion o speciic signals like hisLone nodiicaLions, chronaLinassociaLed proLeins, sLrucLural ea
tures of the chromatin environment or even by small molecules such as hormones.
5.3. Immobilization
In parallel with the continuous sampling mechanism, remodeling complexes are engaged by
specific recruitment or immobilization at specific target sites. The respective mechanisms are
described in chapter 4. For example, when cells were treated with dexamethasone, BRG1 and
BRM were concentrated in a single spot in the nucleus, as revealed by immunofluorescence. The
site coincided with the multimerized MMTV DNA and RNA FISH signals, showing that the
enzymes are recruited to the MMTV array in a hormone-dependent manner. In this case the
recruilmenl of lhe SWI/SNI machine resuIls in lhe mainlenance of an aclive chromalin slruc
ture that is compatible with transcription [93]. In other cases, like the nucleolar remodeling
comIex NoRC recruilmenl lo lhe rRNA genes, conlinuous largeling resuIls in gene reres
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
17
sion via changes of lhe romoler nucIeosome osilioning lhal are incomalibIe vilh lranscri
tion initiation factor binding and further leads to the heterochromatin formation [20,94].
5.4. Nuclear dynamics of chromatin remodeling enzymes
Cells express a plethora of different remodeling complexes that act simultaneously on the
cellular chromatin. The remodeler complexes diffuse freely through the nucleus, searching for
good nucleosomes. Good nucleosomal substrates for the one machine may represent
bad substrates for the other machine, suggesting that an active, free diffusing pool of
remodeling complexes continuously changes the local chromatin structure. Upon specific
signals individual machines are recruited to the specific sites to establish local chromatin
structures correlating with a persistent activation or repression of certain DNA dependent
processes. We hypothesize that the mixture of remodeling complexes in the cell, with their
complex-specific remodeling patterns would continuously changes local chromatin structures,
depending on complex that is currently recruited to such sites. Overall the action of the diverse
remodeling complexes suggests that chromatin is continuously switching local nucleosome
positions according to the levels, activity and set of remodeling complexes in a given cell [95].
6. Regulation of remodeler activity
As mentioned above, the individual accessory proteins of the remodeling complexes contain
a diverse set of histones, DNA and nucleosome recognition motifs and these proteins change
the outcome of nucleosome remodeling reactions. Accordingly, these proteins significantly
determine the targeting to genomic regions and the qualitative outcome of a remodeling
reaction. In this chapter, we want to focus on the regulation of the overall activity of remodeling
enzymes by metabolites and modifications. Subunits of chromatin remodeling complexes
often contain domains capable of recognizing specific posttranslational modifications on
histone tails. However, significantly less is known about the functions of posttranslational
modifications on remodeling complexes themselves and our understanding of its role is only
beginning to emerge.
Phosphorylation. The first example of phosphoregulation of a remodeler was the mitotic
phosphorylation of human SWI/SNF, which inhibits remodeling activity, with subsequent
dehoshoryIalion by hII2A resloring remodeIing aclivily. Il vas suggesled lhal lhe hos
phorylated form would promote global repression of chromatin remodeling during mitosis
[96]. In Drosophila, Mi-2 undergoes constitutive phosphorylation at N-terminus and CK2 was
identified as a major kinase. Dephosphorylated Mi-2 displays increased affinity for the
nucleosomal substrate, which in turn leads to an increased nucleosome-stimulated ATPase
and remodeling activity. It was even postulated that it might be a common regulatory
mechanism for CHD family remodelers [97]. Whether and how the phosphorylation alters the
biochemical activity of INO80 is not known, but upon exposure to DNA damage, it was found
that yeast INO80 complex is phosphorylated on the Les4 subunit in a Mec1/Tel1-dependent
manner [98].
Chromatin Remodelling 18
Acetylation. The acetyltransferase MOF acetylates TIP5, the largest subunit of NoRC, at
position K633, adjacent to the TIP5 RNA-binding domain, and that the NAD(+)-dependent
deacetylase SIRT1 removes the acetyl group. Acetylation regulates the interaction of NoRC
with pRNA, which in turn affects heterochromatin formation, nucleosome positioning and
rDNA silencing. Significantly, NoRC acetylation is responsive to the intracellular energy status
and fIucluales during S-hase. Aclivalion of SIRT1 on gIucose derivalion Ieads lo deacely
lation of K633, enhanced pRNA binding and an increase in heterochromatic histone marks [99].
The acetylation of yeast Rsc4 does not significantly affect RSC catalytic activity or its ability to
recognize acetylated nucleosomes, but K25 acetylation mark plays a key role in resistance to
DNA damage, in a manner that appears to be regulated by its interaction with bromodomain
1. Moreover, Rsc4 acetylation acts in parallel with the INO80-remodeling complex to promote
S-phase progression in cells subject to replication stress [100]. Drosophila ISWI is acetylated at
position K753 in vivo and in vitro by the histone acetyltransferase GCN5. The acetylated form
of ISWI represents a minor species presumably associated with the nucleosome remodeling
factor NURF and may contribute during metaphase chromosome condensation [101]. Human
Brm was shown to be acetylated at multiple locations, but two sites, clustered in the C-terminal
region, appear to play a central role in the regulation. Mutation of these sites into non-
acetylatable versions creates a Brm protein with increased activity in terms of inhibition of
colony formation and transcriptional activation [102].
PARylation. In Drosophila, ISWI is poly-ADP-ribosylated (PARylated) by the enzyme PARP.
PARylated ISWI binds weaker to the nucleosomes and DNA and displays weak nucleosome-
stimulated ATPase activity. Moreover, the amount of ISWI bound to chromatin is affected by
PARP activity, suggesting that PARP and ISWI might compete for common chromatin target
sites and antagonize on chromosome condensation [103]. A different scenario is reported in
lhe nucIeoIus of human embryonic kidney ceII Iine, vhere IARI1/ARTD1-medialed aryIa
tion of TIP5, a noncatalytic subunit of NoRC complex, promotes the silencing of rDNA
chromatin during replication. It is reported that upon of pRNA binding TIP5 undergoes
Figure 6. Different regulation possibilities of remodeler activity.
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
19
conformational change [67] which might favour the association of PARP1 and subsequently
Tip5 is parylated. It was postulated that PARP1 enzymatic activity facilitates formation of silent
rDNA chromatin and transcriptional silencing [104].
7. Conclusion
Global chromatin structure is a result of the combination of chromatin remodelers present in
the cell. The ability to form various complexes with different activities and the concentration
of the remodelers influences the nucleosomal positions genome-wide. Much data have been
accumulated from in vitro experiments addressing the mechanistical questions of chromatin
remodelers, but the recent studies have begun to reveal how these proteins find their place of
action in the cell. From our current knowledge it seems that the local chromatin structures
undergo a continuous change due to a continuous and random binding of different remodeling
complexes. A large fraction of the remodeling complexes diffuse freely through the nucleus
and act on nucleosomal substrates. In addition, the specific cellular signals are responsible for
the fast recruitment of the individual machines to the specialized DNA sites correlating with
a persistent activation or repression of particular DNA dependent processes, establishing
persistent changes in chromatin structure.
Acknowledgements
We apologize to all colleagues whose work could not be cited due to space limitations. Work
in the G.L. laboratory is funded by the DFG, EraSysBio+ and Baygene. Funding for open access
charge: Regensburg University Library.
Author details
Laura Manelyte and Gernot Lngst
University of Regensburg, Regensburg, Germany
References
[1] van HoIde KI, }ohnson C, Ho IS. IrinciIes of IhysicaI iochemislry. 1sl ed. Iren
tice Hall; 1998. p. 657.
[2] Grigoryev S. Nucleosome spacing and chromatin higher-order folding. Nucleus.
2012 Sep. 18;3(6).
Chromatin Remodelling 20
[3] Strahl BD, Allis CD. The language of covalent histone modifications. Nature. 2000
Jan. 6;403(6765):4145.
[4] Clapier CR, Cairns BR. The Biology of Chromatin Remodeling Complexes. Annu.
Rev. Biochem. 2009 Jun.;78(1):273304.
[5] Bowman GD. Mechanisms of ATP-dependent nucleosome sliding. Current Opinion
in Structural Biology. 2010 Feb.;20(1):7381.
[6] Rippe K, Schrader A, Riede P, Strohner R, Lehmann E, Lngst G. DNA sequence-
and conformation-directed positioning of nucleosomes by chromatin-remodeling
complexes. Proc. Natl. Acad. Sci. U.S.A. 2007 Oct. 2;104(40):1563515640.
[7] Iisen }A, Sveder KS, HanavaIl IC. IvoIulion of lhe SNI2 famiIy of roleins: subfa
milies with distinct sequences and functions. Nucleic Acids Res. 1995 Jul. 25;23(14):
27152723.
[8] Flaus A, Martin DMA, Barton GJ, Owen-Hughes T. Identification of multiple distinct
Snf2 subfamilies with conserved structural motifs. Nucleic Acids Res. 2006;34(10):
28872905.
[9] Neigeborn L, Carlson M. Genes affecting the regulation of SUC2 gene expression by
glucose repression in Saccharomyces cerevisiae. Genetics. 1984 Dec.;108(4):845858.
[10] Sudarsanam P, Iyer VR, Brown PO, Winston F. Whole-genome expression analysis of
snf/swi mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U.S.A. 2000 Mar.
28;97(7):33643369.
[11] HoIslege IC, }ennings IG, Wyrick }}, Lee TI, Hengarlner C}, Green MR, el aI. Dissecl
ing the regulatory circuitry of a eukaryotic genome. Cell. 1998 Nov. 25;95(5):717728.
[12] Muchardl C, Yaniv M. When lhe SWI/SNI comIex remodeIs 1/4 lhe ceII cycIe. On
cogene. 2001 May 28;20(24):30673075.
[13] Wilson BG, Roberts CWM. SWI/SNF nucleosome remodellers and cancer. Nat Rev
Cancer. 2011 Jul.;11(7):481492.
[14] Lemon B, Inouye C, King DS, Tjian R. Selectivity of chromatin-remodelling cofactors
for ligand-activated transcription. Nature. 2001 Nov.;414(6866):924928.
[15] Yan Z. PBAF chromatin-remodeling complex requires a novel specificity subunit,
AI200, lo reguIale exression of seIeclive inlerferon-resonsive genes. Genes & De
velopment. 2005 Jul. 15;19(14):16621667.
[16] Reisman DN, Sciarrotta J, Wang W, Funkhouser WK, Weissman BE. Loss of
BRG1/BRM in human lung cancer cell lines and primary lung cancers: correlation
with poor prognosis. Cancer Research. 2003 Feb. 1;63(3):560566.
[17] Weissman B, Knudsen KE. Hijacking the chromatin remodeling machinery: impact
of SWI/SNF perturbations in cancer. Cancer Research. 2009 Nov. 1;69(21):82238230.
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
21
[18] AbIes IT, Drummond-arbosa D. The sleroid hormone ecdysone funclions vilh in
lrinsic chromalin remodeIing faclors lo conlroI femaIe germIine slem ceIIs in Droso
phila. Cell Stem Cell. 2010 Nov. 5;7(5):581592.
[19] Sala A, Toto M, Pinello L, Gabriele A, Di Benedetto V, Ingrassia AMR, et al. Genome-
wide characterization of chromatin binding and nucleosome spacing activity of the
nucleosome remodelling ATPase ISWI. The EMBO Journal. 2011 May 4;30(9):1766
1777.
[20] Grumml I, Lngsl G. Iigenelic conlroI of RNA oIymerase I lranscrilion in mam
malian cells. Biochim. Biophys. Acta. 2012 Oct. 12.
[21] Sims JK, Wade PA. SnapShot: Chromatin remodeling: CHD. Cell. 2011 Feb. 18;144(4):
626626.e1.
[22] Delmas V, Stokes DG, Perry RP. A mammalian DNA-binding protein that contains a
chromodomain and an SNF2/SWI2-like helicase domain. Proc. Natl. Acad. Sci. U.S.A.
1993 Mar. 15;90(6):24142418.
[23] Stokes DG, Perry RP. DNA-binding and chromatin localization properties of CHD1.
Molecular and Cellular Biology. 1995 May;15(5):27452753.
[24] Ryan DI, Sundaramoorlhy R, Marlin D, Singh V, Oven-Hughes T. The DNA-bind
ing domain of the Chd1 chromatin-remodelling enzyme contains SANT and SLIDE
domains. The EMBO Journal. 2011 Jul. 6;30(13):25962609.
[25] Watson AA, Mahajan P, Mertens HDT, Deery MJ, Zhang W, Pham P, et al. The PHD
and chromo domains reguIale lhe ATIase aclivily of lhe human chromalin remodeI
er CHD4. Journal of Molecular Biology. 2012 Sep. 7;422(1):317.
[26] Murawska M, Brehm A. CHD chromatin remodelers and the transcription cycle.
Transcription. 2011 Oct.;2(6):244253.
[27] Gkikopoulos T, Schofield P, Singh V, Pinskaya M, Mellor J, Smolle M, et al. A role for
Snf2-reIaled nucIeosome-sacing enzymes in genome-vide nucIeosome organiza
tion. Science. 2011 Sep. 23;333(6050):17581760.
[28] Marfella CGA, Imbalzano AN. The Chd family of chromatin remodelers. Mutat. Res.
2007 May 1;618(1-2):3040.
[29] a|ai R, Chen DA, Rada-IgIesias A, Zhang }, Xiong Y, HeIms }, el aI. CHD7 cooera
tes with PBAF to control multipotent neural crest formation. Nature. 2010 Feb.
18;463(7283):958962.
[30] West SC. Processing of recombination intermediates by the RuvABC proteins. Annu.
Rev. Genet. 1997;31:213244.
[31] Shen X, Mizuguchi G, Hamiche A, Wu C. A chromalin remodeIIing comIex in
volved in transcription and DNA processing. Nature. 2000 Aug. 3;406(6795):541544.
Chromatin Remodelling 22
[32] Wu S, Shi Y, MuIIigan I, Gay I, Landry }, Liu H, el aI. A YY1-INO80 comIex regu
lates genomic stability through homologous recombination-based repair. Nature
Publishing Group. 2007 Dec.;14(12):11651172.
[33] Bao Y, Shen X. SnapShot: Chromatin remodeling: INO80 and SWR1. Cell. 2011 Jan.
7;144(1):158158.e2.
[34] Papamichos-Chronakis M, Watanabe S, Rando OJ, Peterson CL. Global regulation of
H2A.Z IocaIizalion by lhe INO80 chromalin-remodeIing enzyme is essenliaI for ge
nome integrity. Cell. 2011 Jan. 21;144(2):200213.
[35] Shen X, RanaIIo R, Choi I, Wu C. InvoIvemenl of aclin-reIaled roleins in ATI-de
pendent chromatin remodeling. Mol. Cell. 2003 Jul.;12(1):147155.
[36] Tsukuda T, Fleming AB, Nickoloff JA, Osley MA. Chromatin remodelling at a DNA
double-strand break site in Saccharomyces cerevisiae. Nature. 2005 Nov.
17;438(7066):379383.
[37] van Attikum H, Fritsch O, Gasser SM. Distinct roles for SWR1 and INO80 chromatin
remodeling complexes at chromosomal double-strand breaks. The EMBO Journal.
2007 Sep. 19;26(18):41134125.
[38] van Vugt JJFA, de Jager M, Murawska M, Brehm A, van Noort J, Logie C. Multiple
Asecls of ATI-Deendenl NucIeosome TransIocalion by RSC and Mi-2 Are Direcl
ed by the Underlying DNA Sequence. Freitag M, editor. PLoS ONE. 2009 Jul.
23;4(7):e6345.
[39] Davey CA, Sargenl DI, Luger K, Maeder AW, Richmond T}. SoIvenl medialed inler
actions in the structure of the nucleosome core particle at 1.9 a resolution. Journal of
Molecular Biology. 2002 Jun. 21;319(5):10971113.
[40] Lngst G, Becker PB. Nucleosome remodeling: one mechanism, many phenomena?
Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 2004 Mar.;
1677(1-3):5863.
[41] Luger K, Mder AW, Richmond RK, Sargent DF, Richmond TJ. Crystal structure of
the nucleosome core particle at 2.8 A resolution. Nature. 1997 Sep. 18;389(6648):251
260.
[42] Aoyagi S, Wade PA, Hayes JJ. Nucleosome sliding induced by the xMi-2 complex
does not occur exclusively via a simple twist-diffusion mechanism. J. Biol. Chem.
2003 Aug. 15;278(33):3056230568.
[43] Aoyagi S, Hayes JJ. hSWI/SNF-catalyzed nucleosome sliding does not occur solely
via a twist-diffusion mechanism. Molecular and Cellular Biology. 2002 Nov.;22(21):
74847490.
[44] Langst G, Becker PB. ISWI induces nucleosome sliding on nicked DNA. Mol. Cell.
2001 Nov.;8(5):10851092.
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
23
[45] Schiessel H, Widom J, Bruinsma RF, Gelbart WM. Polymer reptation and nucleosome
repositioning. Phys. Rev. Lett. 2001 May 7;86(19):44144417.
[46] Strohner R, Wachsmuth M, Dachauer K, Mazurkiewicz J, Hochstatter J, Rippe K, et
aI. A Ioo recalure mechanism for ACI-deendenl nucIeosome remodeIing. Na
ture Publishing Group. 2005 Jul. 17;12(8):683690.
[47] Liu N, Peterson CL, Hayes JJ. SWI/SNF- and RSC-catalyzed nucleosome mobilization
requires inlernaI DNA Ioo lransIocalion vilhin nucIeosomes. MoIecuIar and CeIIu
lar Biology. 2011 Oct.;31(20):41654175.
[48] Iosser TR, Yang }G, Slone MD, NarIikar G}, Zhuang X. Dynamics of nucIeosome re
modelling by individual ACF complexes. Nature. Nature Publishing Group; 2009
Dec. 14;462(7276):10221027.
[49] Sirinakis G, CIaier CR, Gao Y, Visvanalhan R, Cairns R, Zhang Y. The RSC chro
matin remodelling ATPase translocates DNA with high force and small step size.
The EMBO Journal. 2011 Jun. 15;30(12):23642372.
[50] Langst G, Bonte EJ, Corona DF, Becker PB. Nucleosome movement by CHRAC and
ISWI without disruption or trans-displacement of the histone octamer. Cell. 1999 Jun.
25;97(7):843852.
[51] Hamiche A, Sandaltzopoulos R, Gdula DA, Wu C. ATP-dependent histone octamer
sliding mediated by the chromatin remodeling complex NURF. Cell. 1999 Jun.
25;97(7):833842.
[52] Moshkin YM, ChaIkIey GI, Kan TW, Reddy A, Ozgur Z, van I|cken WI}, el aI. Re
modeIers organize ceIIuIar chromalin by counleracling inlrinsic hislone-DNA se
quence preferences in a class-specific manner. Molecular and Cellular Biology. 2012
Feb.;32(3):675688.
[53] Grne T, Brzeski J, Eberharter A, Clapier CR, Corona DFV, Becker PB, et al. Crystal
Slruclure and IunclionaI AnaIysis of a NucIeosome Recognilion ModuIe of lhe Re
modeling Factor ISWI. Mol. Cell. 2003 Aug.;12(2):449460.
[54] Fyodorov DV, Kadonaga JT. Binding of Acf1 to DNA involves a WAC motif and is
important for ACF-mediated chromatin assembly. Molecular and Cellular Biology.
2002 Sep.;22(18):63446353.
[55] Iool RA, DeIIaire G, HIsmann , GrimaIdi MA, Corona DI, ecker I, el aI. Hu
CHRAC, a human ISWI chromatin remodelling complex contains hACF1 and two
novel histone-fold proteins. The EMBO Journal. 2000 Jul. 3;19(13):33773387.
[56] Strohner R, Nemeth A, Jansa P, Hofmann-Rohrer U, Santoro R, Langst G, et al.
NoRC--a noveI member of mammaIian ISWI-conlaining chromalin remodeIing ma
chines. The EMBO Journal. 2001 Sep. 3;20(17):48924900.
Chromatin Remodelling 24
[57] Jordan-Sciutto KL, Dragich JM, Rhodes JL, Bowser R. Fetal Alz-50 clone 1, a novel
zinc finger rolein, binds a secific DNA sequence and acls as a lranscrilionaI regu
lator. J. Biol. Chem. 1999 Dec. 3;274(49):3526235268.
[58] SlockdaIe C, IIaus A, Ierreira H, Oven-Hughes T. AnaIysis of nucIeosome reosi
tioning by yeast ISWI and Chd1 chromatin remodeling complexes. J. Biol. Chem.
2006 Jun. 16;281(24):1627916288.
[59] Sims HI, Lane JM, Ulyanova NP, Schnitzler GR. Human SWI/SNF drives sequence-
direcled reosilioning of nucIeosomes on C-myc romoler DNA minicircIes. io
chemistry. 2007 Oct. 9;46(40):1137711388.
[60] Partensky PD, Narlikar GJ. Chromatin Remodelers Act Globally, Sequence Positions
Nucleosomes Locally. Journal of Molecular Biology. Elsevier Ltd; 2009 Aug. 7;391(1):
1225.
[61] Racki LR, Yang }G, Naber N, Iarlensky ID, Acevedo A, IurceII T}, el aI. The chroma
tin remodeller ACF acts as a dimeric motor to space nucleosomes. Nature. Nature
Publishing Group; 2009 Dec. 14;462(7276):10161021.
[62] Yang }G, Madrid TS, SevasloouIos I, NarIikar G}. The chromalin-remodeIing en
zyme ACI is an ATI-deendenl DNA Ienglh sensor lhal reguIales nucIeosome sac
ing. Nature Publishing Group. 2006 Nov. 12;13(12):10781083.
[63] McKnight JN, Jenkins KR, Nodelman IM, Escobar T, Bowman GD. Extranucleosomal
DNA binding directs nucleosome sliding by Chd1. Molecular and Cellular Biology.
2011 Dec.;31(23):47464759.
[64] Law MJ, Lower KM, Voon HPJ, Hughes JR, Garrick D, Viprakasit V, et al. ATR-X
syndrome protein targets tandem repeats and influences allele-specific expression in
a size-dependent manner. Cell. 2010 Oct. 29;143(3):367378.
[65] Zhang Y, Ng HH, Erdjument-Bromage H, Tempst P, Bird A, Reinberg D. Analysis of
the NuRD subunits reveals a histone deacetylase core complex and a connection with
DNA methylation. Genes & Development. 1999 Aug. 1;13(15):19241935.
[66] Mayer C, Schmitz K-M, Li J, Grummt I, Santoro R. Intergenic Transcripts Regulate
the Epigenetic State of rRNA Genes. Mol. Cell. 2006 May;22(3):351361.
[67] Mayer C, Neubert M, Grummt I. The structure of NoRC-associated RNA is crucial
for largeling lhe chromalin remodeIIing comIex NoRC lo lhe nucIeoIus. IMO re
ports. 2008 Jul. 4;9(8):774780.
[68] Schmitz KM, Mayer C, Postepska A, Grummt I. Interaction of noncoding RNA with
the rDNA promoter mediates recruitment of DNMT3b and silencing of rRNA genes.
Genes & Development. 2010 Oct. 15;24(20):22642269.
[69] Kassabov SR, Zhang B, Persinger J, Bartholomew B. SWI/SNF unwraps, slides, and
rewraps the nucleosome. Mol. Cell. 2003 Feb.;11(2):391403.
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
25
[70] Challer|ee N, Sinha D, Lemma-Dechassa M, Tan S, Shogren-Knaak MA, arlhoIo
mew B. Histone H3 tail acetylation modulates ATP-dependent remodeling through
multiple mechanisms. Nucleic Acids Res. 2011 Oct.;39(19):83788391.
[71] Dang W, Kagalwala MN, Bartholomew B. Regulation of ISW2 by Concerted Action
of Histone H4 Tail and Extranucleosomal DNA. Molecular and Cellular Biology.
2006 Oct. 2;26(20):73887396.
[72] Clapier CR, Langst G, Corona DF, Becker PB, Nightingale KP. Critical role for the
histone H4 N terminus in nucleosome remodeling by ISWI. Molecular and Cellular
Biology. 2001 Feb.;21(3):875883.
[73] Corona DFV, Clapier CR, Becker PB, Tamkun JW. Modulation of ISWI function by
site-specific histone acetylation. EMBO reports. 2002 Mar.;3(3):242247.
[74] Musselman CA, Mansfield RE, Garske AL, Davrazou F, Kwan AH, Oliver SS, et al.
inding of lhe CHD4 IHD2 finger lo hislone H3 is moduIaled by covaIenl modifica
tions. Biochem. J. 2009 Oct. 15;423(2):179187.
[75] Mansfield RE, Musselman CA, Kwan AH, Oliver SS, Garske AL, Davrazou F, et al.
Plant homeodomain (PHD) fingers of CHD4 are histone H3-binding modules with
reference for unmodified H3K4 and melhyIaled H3K9. }ournaI of ioIogicaI Chem
istry. 2011 Apr. 1;286(13):1177911791.
[76] Kwon SY, Xiao H, Wu C, Badenhorst P. Alternative splicing of NURF301 generates
dislincl NURI chromalin remodeIing comIexes vilh aIlered modified hislone bind
ing specificities. PLoS Genet. 2009 Jul.;5(7):e1000574.
[77] TaIberl I, Henikoff S. Hislone varianls--ancienl vra arlisls of lhe eigenome. Na
ture Reviews Molecular Cell Biology. 2010 Apr.;11(4):264275.
[78] Nashun B, Akiyama T, Suzuki MG, Aoki F. Dramatic replacement of histone variants
during genome remodeling in nuclear-transferred embryos. Epigenetics. 2011 Dec.;
6(12):14891497.
[79] Shechter D, Chitta RK, Xiao A, Shabanowitz J, Hunt DF, Allis CD. A distinct H2A.X
isoform is enriched in Xenopus laevis eggs and early embryos and is phosphorylated
in the absence of a checkpoint. Proc. Natl. Acad. Sci. U.S.A. 2009 Jan. 20;106(3):749
754.
[80] Konev AY, Tribus M, Park SY, Podhraski V, Lim CY, Emelyanov AV, et al. CHD1
motor protein is required for deposition of histone variant H3.3 into chromatin in
vivo. Science. 2007 Aug. 24;317(5841):10871090.
[81] Luk I, Ran|an A, IilzgeraId IC, Mizuguchi G, Huang Y, Wei D, el aI. Slevise his
lone reIacemenl by SWR1 requires duaI aclivalion vilh hislone H2A.Z and canoni
cal nucleosome. Cell. 2010 Nov. 24;143(5):725736.
Chromatin Remodelling 26
[82] Xiao A, Li H, Shechter D, Ahn SH, Fabrizio LA, Erdjument-Bromage H, et al. WSTF
reguIales lhe H2A.X DNA damage resonse via a noveI lyrosine kinase aclivily. Na
ture. 2009 Jan. 1;457(7225):5762.
[83] Burrage J, Termanis A, Geissner A, Myant K, Gordon K, Stancheva I. SNF2 family
ATIase LSH romoles hoshoryIalion of H2AX and efficienl reair of DNA dou
ble-strand breaks in mammalian cells. Journal of Cell Science. 2012 Sep. 3.
[84] Reddy BA, Bajpe PK, Bassett A, Moshkin YM, Kozhevnikova E, Bezstarosti K, et al.
Drosophila Transcription Factor Tramtrack69 Binds MEP1 To Recruit the Chromatin
Remodeler NuRD. Molecular and Cellular Biology. 2010 Oct. 11;30(21):52345244.
[85] Weider M, Kserl M, ischof M, VogI MR, Hornig }, Loy K, el aI. Chromalin-re
modeling factor Brg1 is required for Schwann cell differentiation and myelination.
Dev. Cell. 2012 Jul. 17;23(1):193201.
[86] }eong KW, Lee Y-H, SlaIIcu MR. Recruilmenl of lhe SWI/SNI chromalin remodeI
ing complex to steroid hormone-regulated promoters by nuclear receptor coactivator
flightless-I. Journal of Biological Chemistry. 2009 Oct. 23;284(43):2929829309.
[87] Polo SE, Kaidi A, Baskcomb L, Galanty Y, Jackson SP. Regulation of DNA-damage
responses and cell-cycle progression by the chromatin remodelling factor CHD4. The
EMBO Journal. Nature Publishing Group; 2010 Aug. 6;29(18):31303139.
[88] Ahel D, Horejs Z, Wiechens N, Polo SE, Garcia-Wilson E, Ahel I, et al. Poly(ADP-
ribose)-dependent regulation of DNA repair by the chromatin remodeling enzyme
ALC1. Science. 2009 Sep. 4;325(5945):12401243.
[89] HofieId }}. Kinelic roofreading: a nev mechanism for reducing errors in biosyn
thetic processes requiring high specificity. Proc. Natl. Acad. Sci. U.S.A. 1974 Oct.;
71(10):41354139.
[90] IrdeI I, Schuberl T, Marlh C, Lngsl G, Rie K. Human ISWI chromalin-remodeI
ing comIexes samIe nucIeosomes via lransienl binding reaclions and become im
mobilized at active sites. Proc. Natl. Acad. Sci. U.S.A. 2010 Nov. 16;107(46):19873
19878.
[91] GeIbarl MI, achman N, DeIrov }, oeke }D, Tsukiyama T. Genome-vide idenlifica
tion of Isw2 chromatin-remodeling targets by localization of a catalytically inactive
mutant. Genes & Development. 2005 Apr. 15;19(8):942954.
[92] Erdel F, Krug J, Lngst G, Rippe K. Targeting chromatin remodelers: signals and
search mechanisms. Biochim. Biophys. Acta. 2011 Sep.;1809(9):497508.
[93] Johnson TA, Elbi C, Parekh BS, Hager GL, John S. Chromatin remodeling complexes
interact dynamically with a glucocorticoid receptor-regulated promoter. Mol. Biol.
Cell. 2008 Aug.;19(8):33083322.
Chromatin Remodelers and Their Way of Action
http://dx.doi.org/10.5772/55683
27
[94] Li J, Lngst G, Grummt I. NoRC-dependent nucleosome positioning silences rRNA
genes. The EMBO Journal. 2006 Dec. 13;25(24):57355741.
[95] IrdeI I, Rie K. inding kinelics of human ISWI chromalin-remodeIers lo DNA re
pair sites elucidate their target location mechanism. Nucleus. 2011 Feb.;2(2):105112.
[96] Sif S, Stukenberg PT, Kirschner MW, Kingston RE. Mitotic inactivation of a human
SWI/SNF chromatin remodeling complex. Genes & Development. 1998 Sep.
15;12(18):28422851.
[97] Bouazoune K, Brehm A. dMi-2 chromatin binding and remodeling activities are
regulated by dCK2 phosphorylation. J. Biol. Chem. 2005 Dec. 23;280(51):4191241920.
[98] Morrison AJ, Kim J-A, Person MD, Highland J, Xiao J, Wehr TS, et al. Mec1/Tel1
hoshoryIalion of lhe INO80 chromalin remodeIing comIex infIuences DNA dam
age checkpoint responses. Cell. 2007 Aug. 10;130(3):499511.
[99] Zhou Y, Schmitz K-M, Mayer C, Yuan X, Akhtar A, Grummt I. Reversible acetylation
of lhe chromalin remodeIIing comIex NoRC is required for non-coding RNA-de
pendent silencing. Nat Cell Biol. 2009 Jul. 5;11(8):10101016.
[100] CharIes GM, Chen C, Shih SC, CoIIins SR, eIlrao I, Zhang X, el aI. Sile-secific ace
tylation mark on an essential chromatin-remodeling complex promotes resistance to
replication stress. Proc. Natl. Acad. Sci. U.S.A. 2011 Jun. 28;108(26):1062010625.
[101] Ierreira R, Iberharler A, onaIdi T, Chioda M, Imhof A, ecker I. Sile-secific ace
tylation of ISWI by GCN5. BMC Mol Biol. 2007;8:73.
[102] Bourachot B, Yaniv M, Muchardt C. Growth inhibition by the mammalian SWI-SNF
subunit Brm is regulated by acetylation. The EMBO Journal. 2003 Dec. 15;22(24):
65056515.
[103] SaIa A, La Rocca G, urgio G, Kolova I, Di Gesu D, CoIIesano M, el aI. The nucIeo
some-remodeling ATPase ISWI is regulated by poly-ADP-ribosylation. Plos Biol.
2008 Oct. 14;6(10):e252.
[104] Guetg C, Scheifele F, Rosenthal F, Hottiger MO, Santoro R. Inheritance of silent
rDNA chromatin is mediated by PARP1 via noncoding RNA. Mol. Cell. 2012 Mar.
30;45(6):790800.
Chromatin Remodelling 28
Chapter 2
SUMO Tasks in Chromatin Remodeling
Garcia-Dominguez Mario
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/55395
1. Introduction
Post-translational modifications implicate attachment of diverse molecules to proteins after
translation. These modifications are essential for many biological processes as they are
involved in their regulation. From relatively simple molecules to small polypetides are
common covalent modifiers of proteins. Sumoylation consists in the post-translational
modification of proteins by attachment of the small polypeptide SUMO (small ubiquitin-like
modifier). This post-translational modification was identified two decades ago and has been
very actively investigated to date. Sumoylation has consequences on protein structure and
regulation. This modification controls many processes in the eukaryotic cell and is essential
for viability of all the organisms studied so far.
From the discovery of ubiquitin in 1975, a number of ubiquitin-like proteins (UBLs) have been
identified in eukaryotes and it has been shown that many of them are able to covalently attach
to other proteins (reviewed in [1]). Several aspects are common to most UBLs: they are small
polypeptides (less than 200 amino acids) capable of attaching to other macromolecules in a
covalent way, present common structural features and use similar modification pathways.
These characteristics strongly support duplication and diversification during evolution as the
origin of the different pathways. Ubiquitin and UBLs are characterized by the presence of the
-grasp fold, which also appears in ubiquitin-like domains of several other proteins of the
ubiquitin system and in numerous non-related proteins (reviewed in [2]). The -grasp fold
seems to have emerged in prokaryotes as a translation-related RNA-binding module, which
diversified structurally and biochemically before to dramatically expand in eukaryotes [2].
Besides ubiquitin and SUMO, examples of UBLs are NEDD8, FUBI, FAT10, ISG15, UFM1,
Atg8, Atg12 and Urm1 (reviewed in [1]).
The first report of a protein being modified by SUMO occurred in the nineties and concerned
the mammalian nuclear pore-associated GTPase activating protein RanGAP1 [3, 4j. Subse
2013 Mario; licensee InTech. This is an open access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
quently, more than a hundred proteins have been identified as SUMO substrates. Although
similarities with ubiquitin are notable [5], SUMO plays many regulatory functions in the cell
that significantly differ from the major role displayed by ubiquitin: labeling proteins to target
them for proteasomal degradation [6]. A variety of consequences derived from protein
sumoylation (new interaction surfaces, modulation of protein affinity and binding capacities
to other molecules, modulation of protein activity, blocking of protein domains, steric
hindrance, crosstalk or interference with other post-translational modifications) account for
the many roles attributed to SUMO (reviewed in [7]). A major role of SUMO is associated with
RanGAP1 and thereby with the nuclear pore complex. Thus, involvement of SUMO in nucleo-
cytoplasmic transport of proteins has been well established [8]. SUMO has been also implicated
in chromosome dynamics in mitosis and meiosis (condensation, cohesion, separation) and
genome integrity, as many proteins involved in DNA replication, repair and recombination
are modulated by SUMO modification (reviewed in [7]). Other roles attributed to SUMO are
related to enzyme regulation, protein stability and cellular structure (reviewed in [9, 10]).
However, the most prominent function of SUMO concerns transcriptional regulation, and
specially transcription repression (reviewed in [11, 12]). The role of SUMO in transcription, in
the context of chromatin structure and dynamics, is analyzed in this chapter.
2. The modification pathway
2.1. Enzymes involved
Modification by SUMO involves the ATP-dependent activation of mature SUMO (C terminus
of SUMO needs to be excised by proteolysis) by the E1 enzyme, transfer to the E2 enzyme
UBC9 and conjugation to the target protein, often mediated by a SUMO ligase or E3 (Figure
1 and Table 1) (reviewed in [9]). Maturation of the SUMO precursor, as well as removal of
SUMO from targets is displayed by SUMO specific proteases.
Figure 1. The sumoylation pathway. Cleavage of the SUMO C terminus enables ATP-mediated activation and binding
to the E1 enzyme to be transferred to the E2 conjugating enzyme UBC9, which mediates target modification with the
concourse of an E3 SUMO ligase. Recycling of SUMO is performed by the same proteases involved in maturation.
SUMO E1 activity is performed by the SAE1/UBA2 heterodimer in human, in contrast to the
ubiquitination pathway where the E1 activity is displayed by a monomeric enzyme. However,
the SAE1 subunit is homologous to the N-terminal part of ubiquitin E1, while the UBA2 subunit
Chromatin Remodelling 30
is homologous to its C terminus [13]. Both monomers work together and are not found
separately [14]. E1 activation of mature SUMO involves ATP hydrolysis and formation of a
thiolester bond between E1 and the C terminus of SUMO before being transferred to the E2.
While several E2 have been described for ubiquitination, UBC9 is the only E2 known for
sumoylation [15, 16]. Thus, UBC9 is the conjugating enzyme directly involved in attachment
of SUMO to the different substrates. This second step of the sumoylation reaction involves the
formation of a thiolester bond between SUMO and UBC9 upon transfer from the E1. The region
surrounding the active site cysteine (C93 in mammals) in UBC9 is able to directly interact with
sumoylation consensus sequence (see below) in target proteins [17-19].
Enzyme Protein Activity References
E1 (activating) AOS1/UBA2 ATP-mediated activation of SUMO [13]
E2 (conjugating) UBC9 SUMO conjugation to target [15, 16]
E3 (ligase) PIAS1-4 Facilitates transfer to target [20, 21]
RanBP2 [22]
Polycomb-2 (Pc2) [23]
TOPORS [24]
Class IIa HDACs [25]
KAP-1 [26]
RHES [27]
Krox20 [28]
protease SENP1-3, 5-7 Maturation/recycling [29-31]
DeSI-1 [32]
Table 1. Enzymes involved in SUMO conjugation.
SUMO ligases are involved in facilitating the SUMO attachment to substrates (reviewed in
[33]). To date, few ligases have been described for sumoylation, in contrast to ubiquitination,
where lots of them are known to play an essential role and mediate substrate specificity. In
fact, SUMO ligases were undervalued at the beginning, since certain substrates are sumoylated
in vitro, provided that E1 and E2 are present at the adequate concentrations. Since UBC9 is
able to directly interact with sumoylation consensus sequence in substrates, it is able to render
sumoylation in the absence of a ligase. However, a number of proteins, which augmented the
efficiency of SUMO conjugation, were identified. The list of SUMO ligases progressively
increases and essential roles for these have been described in vivo (see [34]). Although
mechanisms of action of SUMO ligases have not been completely elucidated, it is obvious that
many ligases facilitate transfer of SUMO by bringing together SUMO-loaded UBC9 and the
largel rolein. Thus, simiIar lo lhe RING domain-conlaining I3 Iigases invoIved in ubiquili
nation, SUMO ligases do not establish a covalent bond with SUMO. In this context, a SUMO
ligase should normally i) interact with the substrate, ii) interact with UBC9, iii) facilitate SUMO
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
31
transfer to the substrate. Ligases of the PIAS family (PIAS1 to 4) have been extensively studied
[35]. They present a type of RING finger domain, the SP-RING (Siz/PIAS RING), for UBC9
interaction, although Ubc9 binding to a PHD domain in plant PIAS proteins has been also
described [36]. Other SUMO ligases described so far are RanBP2 [22], the Polycomb-2 (Pc2)
protein [23], class IIa histone deacetylases (HDACs) [25], topoisomerase I-binding RING finger
protein (TOPORS) [24], the PHD containing protein KAP-1 [26], Ras homologue enriched in
striatum (RHES) [27] and the transcription factor Krox20 [28]. In contrast to most ubiquitin
Iigases, SUMO Iigases may disIay significanl romiscuily, as many of lhem enhance sumoy
lation of a variety of substrates.
SUMO proteases are involved in maturation of the SUMO precursor by exposing two glycine
residues at the C terminus for binding to E1 [37]. In addition, they are also involved in SUMO
recycling by excising the SUMO moiety from substrates. Yeast Ulp1p was the first SUMO
protease identified [29]. Sequence analysis revealed that it corresponded to a protease of the
C48 cysteine group, not related to deubiquitylating enzymes but similar to adenovirus
proteases. Mammalian SUMO proteases are represented by the SENP (sentrin-specific
protease) family. It comprises six members, SENP1 to 3, and SENP5 to 7 [38]. A seventh
member, initially identified as SENP4, resulted to actually correspond to SENP3. Besides
SENP1 to 7, an additional family member has been reported, SENP8. However, this protease
does not act on SUMO, but on another UBL, NEDD8 [39, 40]. Very recently, a new type of
SUMO protease has been described, the desumoylating isopeptidase 1 (DeSI-1) [32]. The
different SUMO proteases show diverse cellular localization and different specificities for the
various SUMO molecules and substrates (reviewed in [38]).
2.2. SUMO molecules
Four different SUMO molecules have been described in mammals: SUMO1 to 4. SUMO1 has
been implicated in regulation of many processes, while SUMO2 and SUMO3 are highly related
with the response to stress. Consequently, a significant pool of free SUMO2 and SUMO3 is
detected in the cell, which is rapidly mobilized after exposure to a variety of stress conditions.
In contrast, most of SUMO1 appears conjugated to proteins [41]. SUMO2 and SUMO3 are
usually referred as SUMO2/3, as they share 97% identity and antibodies hardly differentiate
the two forms. By contrast, SUMO1 only shares about 50% identity with SUMO2/3. Despite
the low similarity showed between ubiquitin and SUMO (about 18% identity with SUMO1),
structurally they are quite similar, excepting the N-terminal region of SUMO not present in
ubiquitin [42]. A remarkable difference between SUMO1 and SUMO2/3 is the ability of this
last to form poly-SUMO chains in vitro as well as in vivo, due to the presence of a sumoylation
consensus sequence in the molecule [43]. SUMO4 is the last SUMO molecule identified. It
shows a restricted expression pattern [44] and several data bring into question its capacity to
be conjugated to proteins [45]. However, a polymorphism found in human SUMO4 correlates
with type 1 diabetes [46]. The different SUMO molecules share a common modification
pathway and the existence of functional redundancy has been suggested. However, specific
modification by the different SUMO paralogs has been implicated in the regulation of a variety
Chromatin Remodelling 32
of processes. Thus, the modification pathway is able to differentially conjugate the various
SUMO molecules depending on the substrate or the regulatory process [47].
2.3. Sumoylation consensus motifs and SUMO interacting motifs
Covalent attachment of SUMO occurs through the .-amino group of a lysine residue in target
proteins. In many cases the Lys (K) residue is the core of the consensus sequence +KxE, being
+ a large hydrophobic residue and x any amino acid. Extended consensus (phosphorylation-
dependent SUMO motif (PDSM) and negatively charged residues-dependent SUMO motif
(NDSM)) and variations have been described as well (Table 2) (reviewed in [34]). However,
sumoylation also occurs at non-consensus sequences. As mentioned above, the consensus
sequence is directly contacted by UBC9. Thus, it is possible that when sumoylation occurs at
non-consensus sequences, certain amino acid residues, otherwise dispersed in the primary
structure of the target protein, bring together in the three-dimensional structure to mimic a
consensus-like environment. It is worth noting that conversely, sumoylation consensus
sequences in a rolein are nol aIvays subslrale for SUMO allachmenl, indicaling lhal addi
tional structural features regulate and enable modification by SUMO. Besides covalent
attachement of SUMO, many proteins can associate with SUMO in a different way involving
a non-covalent interaction (reviewed in [48]). This occurs through SUMO interacting motifs
(SIMs) in proteins. SIMs are usually characterized by the presence of a short hydrophobic
region surrounded by negatively charged residues (Table 2) [49]. The non-covalent interaction
of proteins with SUMO has been revealed essential in the regulation of several processes. In a
variety of cases function of the system relies in the combinatorial occurrence of sumoylation
sites and SIMs in a given protein or in different subunits of a complex, which determines its
macromolecular architecture (Figure 2 and see below). This situation is exemplified by the
promyelocytic leukaemia protein (PML), in which combination of sumoylation sites and SIMs
dictates the formation of PML nuclear bodies and the recruitment of additional proteins [48].
2.4. Regulation of sumoylation
Despite that certain SUMO targets appear constitutively sumoylated, it is obvious that
sumoylation, as a signaling pathway needs to be regulated. A striking feature of SUMO
modification consists in the so-called SUMO enigma [9]. It has been observed that many
SUMO targets are difficult to detect at the sumoylated state, but mutation of the acceptor lysine
has severe consequences in the process involved. In other words, at the steady state, only a
low proportion of the whole pool of a given target appears sumoylated, although sumoylation
results essential for function of the target. Thus, sumoylation has been suggested to be a highly
dynamic and transient modification that permanently marks targets for specific fates even
though the SUMO moiety has been removed [9]. This can be explained by viewing sumoylation
as a lemoraI faciIilalor for lhe eslabIishmenl of rolein inleraclions, olher rolein modifica
tions, or sub-cellular localization (Figure 2).
Sumoylation can be regulated at different levels (reviewed in [34, 50]). First level of regulation
in SUMO modification relies in the nature of target proteins, as target sequence, structural
features, and other protein modifications affect attachment of SUMO. The other way to
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
33
regulate sumoylation depends on the modification pathway. Availability of the different
SUMO paralogs when sumoylation is required, or acting on the E1 and E2 enzymes, represents
a global way to regulate sumoylation. For instance, stress conditions normally leads to
SUMO2/3 conjugation, as SUMO2/3 is freely available in the cell [41]. On the other hand, it has
been shown that expression of the Gam1 protein by the CELO adenovirus leads to E1 and E2
degradation and thereby to inhibition of sumoylation [51]. Finally, a more selective way of
regulating sumoylation is given through the activity of SUMO ligases and proteases. Thus,
localization or spatiotemporal regulation of the expression of these proteins has consequences
in target sumoylation.
3. SUMO in transcription
3.1. Transcription repression
It is of significance that the sumoylation consensus sequence, before being established to be
the site for SUMO attachment, was initially identified as a negative regulatory sequence in
several transcription factors [52]. This scenario is exemplified by the transcription factor Elk-1
(Ets (E twenty-six)-like kinase 1), where a repressive domain, the R motif, was identified as an
acceptor region for SUMO attachment [53]. Targeting SUMO or the SUMO conjugation enzyme
UBC9 to promoters through a Gal4-based system efficiently represses transcription [54-56],
SUMO binding Type Sequence
Sumoylation site Consensus +KxL
LxLended consensus PDSM +KxLxxS
NDSM +KxLxx|DIL]
n
verLed consensus LxK+
hosphorylaLed Ser +KxS
SIM ZNF198 DDDDDDD VVFI
PIAS1 VLV DLT DSSSDLLLLL
SP100 V SSLDSLGSTDVD
ML LL VVV SSSLDSD
an2 SDSSDDD VLV
CoLST1 LLSLDLLLL ANGNN DLV
Table 2. SunoylaLion siLes and SMO inLeracLing noLis (SMs). + represenLs a large hydrophobic residue. SunoylaLed
Lys (K) is requenLly close Lo a hydrophobic residue and Lo negaLively charged environnenL, eiLher acidic residues
AspIGlu (DIL) or phosphorylaLion siLes (S). SMs usually consisL in a sLreLch o 4 anino acids, conLaining aL leasL 3
hydrophobic residues, close Lo an acidic region (AspIGlu) (DIL) or puLaLive phosphorylaLion siLes (SerIThr) (SIT).
Lxanples o SMs wiLh acidicIphosphorylaLion region NLerninal Lo Lhe hydrophobic core (ZN198), CLerninal (wiLh
spacer (AS1), wiLhouL spacer (S100)), aL boLh sides (ML), SMO1 speciic (an2) and SMO2I3 speciic
(CoLST1), are shown.
ChronaLin enodelling 34
indicating that sumoylation mainly associates with transcription repression. Examples from
different organisms have argued in favor of such a role. A characteristic of silenced genes is
that they correlate with low levels of histone acetylation, while active genes usually display
high histone acetylation. It has been described in yeast that temperature-sensitive mutation in
Ubc9 leads to an increase in global histone acetylation [57]. In addition, in fission yeast, it has
been shown that SUMO is required for the maintenance of heterochromatin stability [58]. Early
evidence of the involvement of the SUMO pathway in maintenance of the heterochromatin
came from Drosophila, as a PIAS mutant was identified as a suppressor of position effect
variegation, that is, as a mutant releasing heterochromatin-induced gene silencing [59]. A
mechanism that clearly account for the repressive role of SUMO is explained by the ability of
SUMO to recruit histone deacetylases [56]. For many transcription factors sumoylation has
been linked to transcription repression. Additional examples to Elk-1 are NAB proteins [28],
c-Jun [60], p53 [61], Iio |62], C/EBP [63], Sp3 [64] and MEF2 [65]. It is worth noting that in
many cases sumoylation turns activators into repressors, as it is the case of p300 and CREB
binding protein (CBP) [66, 67]. However, beyond SUMO modification of transcription factors,
SUMO associalion vilh archileclure and funclion of chromalin-associaled reressor com
plexes is recently getting increased importance. This has been reviewed in [68, 69] and is
described below.
3.2. Transcription activation
Despite the clear association of SUMO with gene repression, several reports illustrate the
involvement of sumoylation in transcription activation. Examples of transcription factors
whose activity is stimulated by SUMO are TCF4 [70], GATA4 [71], Pax6 [72], p45 [73], Smad4
Figure 2. Sumoylation and SIMs are involved in complex architecture and function. Schematic representation of some
exanples or SMOSM inLeracLions involved in recruiLing proLeins Lo a parLicular subcellular localizaLion, in Lhe archi
LecLure o ML aggregaLes and associaLion Lo Daxx, and in recruiLnenL o dierenL repressor conplexes Lo Lhe chro
matin through sumoylated Sp3 for transcription repression.
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
35
[74], Oct4 [75], p53 [76], myocardin [77], PEA3 [78], NFAT1 [79] and HSF1 and 2 [80, 81].
Intriguingly, p53 has been reported both to be activated and repressed by SUMO [76, 82]. Since
sumoylation may compete other post-translational modifications, a mechanism proposed for
SUMO-mediated activation of transcription consists in avoiding degradation, and thereby in
stabilization, of the transcription factor, as it has been proposed for Oct4 [83]. Otherwise,
SUMO modification may interfere with association of repressors with the transcription factor,
as occurs for Ikaros, whose sumoylation avoid interaction with histone deacetylase complexes
[84]. Recently, two publications have brought into consideration the general assumption that
SUMO globally associates with transcription repression. It has been reported in yeast that
SUMO is detected at all the constitutively transcribed genes tested and in inducible genes upon
activation [85]. However, Ubc9 inactivation results in increased transcription of inducible
genes, although sumoylation at promoters is reduced, suggesting a role for SUMO in the
silencing of inducible genes. In sum, authors conclude that while SUMO associates with
reression in some conlexls, olher roerlies of SUMO come inlo Iay under normaI conslil
utive transcription [85]. More recently, a study performed in HeLa cells has revealed that from
G1 to S phase of the cell cycle SUMO1 marks chromatin at the proximal promoter region on
many of the most active housekeeping genes [86]. SUMO1 depletion results in reduced
expression of these genes. However, this occurs for half of the active genes and the nature of
the sumoylated proteins at the promoters remains unknown [86]. Taken together, all these
data indicate that although SUMO may intrinsically associate with transcription repression,
many other general processes, including constitutive transcription, may also depend on
sumoylation, structurally or as a signaling pathway.
4. Histone modification and chromatin remodeling
4.1. Histone sumoylation
Regarding histone modification, sumoylation has been implicated in both, direct modification
of histones and deposition/recognition of other histone marks, such as acetylation and
methylation. Histone sumoylation has been demonstrated in both yeast and mammal cells [55,
57]. All core histones and the H2A.Z variant have been shown to be sumoylated in yeast [57,
87], while work on mammal cells has been centered on histone H4 [55]. The N-terminal tail of
canonical histones is the target for sumoylation, indicating that sumoylation may interplay
vilh olher hislone modificalions al lhis region, Iike acelyIalion, melhyIalion and hoshory
lation. Interfering with the sumoylation pathway significantly reduces the level of histone
sumoylation in yeast [57]. Histone sumoylation has been associated with transcription
repression. Indeed, mutation of sumoylation sites in histone H2B in yeast leads to increased
basal expression of several non-induced genes [57]. A more specific role in Rad51-labeling of
persistent DNA double strand breaks has been attributed to sumoylation of the histone variant
H2A.Z in yeast [87]. However, which is the real impact of histone sumoylation in transcription
in vivo and whether it is a common feature all along the genome need to be clarified.
Chromatin Remodelling 36
4.2. Involvement of SUMO in recognition of histone modifications
As explained before, sumoylation of histone tails may affect the way in which different proteins
recognize other histone modifications. Conversely, sumoylation of a chromatin-associated
factor may modulate its capacity to recognize a specific histone modification. For instance, it
has been reported that sumoylation of the bromodomain GTE3 protein, a BET (bromodomain
and extra terminal domain) family member, interferes with the capacity of this protein to
associate with acetylated histone tails [36]. A surprising link between the sumoylation pathway
and recognition of histone modifications is illustrated by a recent and intriguing report
describing the capacity of the PHD domain of plant PIAS proteins to directly recognize histone
modifications such as methylated Lys4 and Arg2 on histone H3 (methyl-H3K4 and methyl-
H3R2) [88].
Polycomb group (PcG) proteins are involved in regulation of gene transcription and chromatin
structure especially during development. These transcriptional repressors regulate lineage
choice during development and differentiation by establishing long-term heritable gene
silencing of relevant genes, for instance Hox genes. Thus, they are tightly linked to stem cell
biology and cancer [89]. Two main complexes assembling PcG proteins have been described
[90]. The polycomb repressive complex 2 (PRC2) contains the histone methyl transferase
Enhancer of Zeste (EZH2) and is involved in methylation of H3K27. The PRC1 complex
contains the Polycomb protein, which is involved in recognition of the repressive mark
trimethyl-H3K27 through a chromodomain. Recruitment of PRC1 to the chromatin results in
ubiquitination of histone H2A. Hence, coordinated action of both complexes is involved in the
establishment of a compact chromatin structure, which results in gene silencing. One of the
mammalian orthologs of Drosophila Polycomb is Polycomb-2 (Pc2), which has been shown to
display SUMO ligase activity, as previously mentioned [23]. Interestingly, two SIMs have been
described in Pc2, one of them has been shown to be relevant for the several functions attributed
to Pc2 [91]. Among the SUMO substrates identified for Pc2 are the kinase HIPK2 and the
corepressor CtBP1 (see also below), sumoylation of which results in enhanced transcription
repression [92-94]. CtBP has been shown to colocalize with Pc2 in nuclear foci called PcG
bodies, which contain several PcG proteins [95]. Other Pc2 substrates for sumoylation are
ZEB2, DNMT3A and centrin-2 [96, 97]. It has been recently reported that Pc2 mediates
sumoylation and recruitment of BMI1 at sites of DNA lesions, linking Pc2 ligase activity with
the DNA damage response [98j. SeveraI oIycomb subunils have been shovn lo be sumoy
lated, for instance SUZ12, EZH2 and YY1, although Pc2 has not been involved in the process
[99, 100]. A clear role of sumoylation in PcG proteins-mediated repression came from studies
in C. elegans. The SOP-2 protein is related to Drosophila and vertebrate PRC1-associated PcG
proteins Polyhomeotic and Sex combs on midleg (Scm). It has been shown that sumoylation
of SOP-2 is required for repression of Hox genes in C. elegans |101j. Indeed, imaired sumoy
lation leads to ectopic Hox gene expression and homeotic transformations, resulting in a
phenotype similar to that provoked by sop-2 mutations. Additional evidence of SUMO
involvement in PcG-mediated repression in vertebrates has been more recently reported. It
was previously shown that Pc2 is a target of SUMO [23]. Later, Kang et al demonstrated that
sumoylated Pc2 is a target for the SUMO protease SENP2 [102]. In Senp2 knockout mice,
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
37
sumoylated Pc2 accumulates, resulting in increased occupancy at promoters of PcG target
genes, such as Gata4 and Gata6. As a result, expression of these genes is reduced during
development, which leads to embryonic heart defects among other disorders [102]. Chromatin
occupancy by PRC2 subunits and levels of trimethyl-H3K27 seem not to be affected, suggesting
that Pc2 sumoylation has a role in recognition of H3K27 methylation, which is released by
SENP2.
4.3. SUMO-mediated regulation of histone modifications
As previously mentioned, the major impact of sumoylation on histone modification is linked
to the role of SUMO in the architecture and function of several chromatin-associated complexes
involved in histone modification. Sumoylation by itself may condition the way other histone
marks are deposited. However, it has been unambiguously demonstrated that sumoylation is
essential for function of a variety of complexes implicated in histone modification, which
mostly associate with transcription repression [68, 69]. It has been previously indicated that
SUMO is required for the maintenance of constitutive heterochromatin in fission yeast [58].
However, increased evidence of SUMO involvement in the establishment of heterochromatin-
like structures in euchromatin loci (facultative heterochromatin) has emerged during the last
years. Facultative heterochromatin, besides displaying significant DNA methylation, is
characterized by low levels of histone acetylation and histone H3 methylated at Lys4 (H3K4),
and high levels of histone H3 methylated at Lys27 (H3K27) and Lys9 (H3K9, di- or tri-
methylated), and histone H4 methylated at Lys20 (H4K20, mono-, di- or tri-methylated) [103].
Some of the complexes involved in the establishment of these marks are compiled in Table 3
and described below.
4.3.1. Histone methylation
The histone methyltransferase SETDB1 is involved in tri-methylation of H3K9, a repressive
histone mark. The methyl CpG binding protein MBD1 and MCAF1 associate to SETDB1 in a
complex, linking DNA methylation to histone methylation. This complex is recruited to the
KAP-1 (KRAB associated protein-1) corepressor in a SUMO-dependent manner [26]. In its turn,
sumoylated KAP-1 recruits the SETDB1 complex to the chromatin through the zinc finger
protein KRAB. This is mediated by a SIM in SETDB1 [26]. In addition, another SIM has been
reported in MCAF1, and both MCAF1 and MBD1 are sumoylated [104, 105]. Interestingly, a
IHD domain in KAI-1 disIays an I3 Iigase aclivily, vhich romoles inlramoIecuIar sumoy
lation of the adjacent bromodomain [26]. The SETDB1 complex, as explained below, is also
recruited to the transcription factor Sp3 in a SUMO dependent manner for transcription
repression [106].
Recently, the SUMO ligase PIAS1 has been involved in maintaining an epigenetic repressive
state, as studied at the Foxp3 locus, that restricts differentiation of natural occurring thymus-
derived regulatory T cells [107]. Knocking down of PIAS1 leads to reduced DNA methylation
and loss of the repressive mark methyl-H3K9 on the Foxp3 promoter. A prominent role of
PIAS1 in recruitment and association to the DNA methyltransferases DNMT3A and DNMT3B
Chromatin Remodelling 38
is also reported. In correlation with loss of H3K9 methylation, HP1y disappears from the Foxp3
promoter in the absence of PIAS1 [107].
Complex (subunits) Activity Recruiting factor
LSD1/CoREST
(LSD1, CoREST, BHC80, HDAC1/2,
BRAF35, ZEB1, ZNF217/198)
H3K4 demethylation (LSD1)
Histone deacetylation (HDAC1/2)
CtBP1
NurD
(CHD3/4, HDAC1/2, RbAp46/48,
MTA1/2, MBD3/2)
Nucleosome remodeling (CHD3)
Histone deacetylation (HDAC1)
KAP-1
SETDB1
(SETDB1, MBD1, MCAF1)
H3K9 tri-methylation (SETDB1)
KAP-1
Sp3
L3MBTL1
(L3MBTL1, HP1)
Methyl-histone recognition (L3MBTL1) Sp3
dMEC
(dMi-2, dMEP-1)
Nucleosome remodeling (dMi-2) Sp3
PCR2
(EZH2, EED, SUZ12, RbAp46/48)
H3K27 methylation (EZH2) various
PCR1
(Pc2, PHC, RNF1/2, SCMH)
trimethyl-H3K27 recognition (Pc2)
Table 3. SUMO associated repressor complexes. Table summarizes some repressor complexes whose function
depends on sumoylation. Examples of different transcription factors involved in recruitment of these complexes are
also shown.
4.3.2. Histone demethylation
The histone demethylase LSD1 mediates gene repression by removing methyl groups from
mono- or di-methyl-H3K4, which are marks of active transcription [108]. LSD1 works in a
corepressor complex together with HDACs and CoREST1 [109, 110]. It has been shown that
the LSD1/CoREST complex mediates SUMO-dependent repression of neuronal-specific genes,
such as SCN1A and SCN3A, in non-neuronal cells [111]. Recruitment to the chromatin and
repression depends on SUMO2/3 and is mediated by a specific SIM in CoREST. SUMO
deconjugation by the SUMO protease SENP3 provokes increased levels of di-methyl-H3K4
and acetyl-H3, which leads to gene activation. Different subunits of the LSD1/CoREST complex
have been shown to be sumoylated and/or to contain SIMs (reviewed in [68]). It has been
recently shown that sumoylation of the LSD1/CoREST complex subunit BRAF35 controls
neuronal differentiation [112]. Overexpression of BRAF35, but not of a sumoylation mutant,
strongly impairs neuronal differentiation promoted by neurogenic factors in the vertebrate
neural tube. Interestingly, iBRAF, a paralogue of BRAF35 ocasionally associated to the LSD1/
CoREST complex, is not sumoylated but is able to dimerize with BRAF35, inhibiting BRAF35
sumoylation and binding to the LSD1/CoREST complex. The LSD1/CoREST complex usually
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
39
associates with the corepressor CtBP (C-terminal binding protein), which in turn is recruited
to the chromatin by a variety of transcription factors [113]. Two CtBPs have been reported in
vertebrates, CtBP1 and CtBP2. CtBP1 mediates repression by recruiting a number of repression
factors that in addition to LSD1 and HDACs, includes the H3K9 histone methyl-transferase
G9a. CtBP1-mediated repression depends on sumoylation [92]. Besides direct interaction of
CtBP1 with UBC9, CtBP1 sumoylation is also determined by the SUMO ligases PIAS1, PIAS2
and Pc2 [23, 92, 114]. One of the transcription factors recruiting CtBP1 to the chromatin is the
Krpel-like zinc finger DNA-binding repressor ZEB1, which is also a target for sumoylation
[115]. Attachment of SUMO to ZEB1 is required for this factor to display full repression activity
[94]. Another zinc finger protein that has been associated with the LSD1/CoREST complex is
ZNF198. This factor is both able to be sumoylated and to non-covalently interact with SUMO
through a SIM [116-118]. Altogether, these data indicate that SUMO is involved on several
functional aspects of the LSD1/CoREST complex: it mediates recruitment of the complex to the
chromatin, but also is involved in the architecture of the complex, as different subunits
associate to the complex in a sumoylation/SIM-dependent manner.
4.3.3. Histone deacetylation
It has been indicated that repression activity of the LSD1/CoREST complex is in part displayed
through HDACs. Indeed, HDAC1 and HDAC2 are components of the LSD1/CoREST complex
[110j. Anolher comIex invoIved in HDAC recruilmenl lo lhe chromalin is lhe NuRD (nucIe
osome remodeling and deacetylation) complex [119]. The core component of the mammalian
NuRD complex is the ATP-dependent nucleosome remodeling enzyme CHD3. In addition,
this complex includes one or two type I HDACs, histone binding proteins RbAp46 and
RbAp48, a methylated DNA-binding protein (MBD2 or MBD3), and members of the MTA and
p66 families of proteins [119]. A screening in Drosophila cell cultures identified the CHD3
homologue dMi-2, as a factor required for SUMO dependent repression by Sp3 [64]. dMi-2/
CHD3 both sumoylates and is able to interact with SUMO-modified transcription factors
through a SIM [26, 64]. Thus, CHD3 also interacts with sumoylated KAP-1 [26]. However, it
has been demonstrated that phosphorylation of Ser824 in the C terminus of KAP-1, directly
impairs interaction between the CHD3 SIM and the SUMO molecule attached to KAP-1 [120].
Therefore, KAP-1 sumoylation is not affected, but recognition of SUMO by the SIM in CHD3.
KAP-1 phosphorylation has a role in double-strand break repair, as displaces the chromatin
barrier imosed by CHD3-deendenl nucIeosome-remodeIing aclivily. AddilionaI como
nents of the NuRD complex have been shown to be sumoylated and/or to contain SIMs:
MTA1/2, HDAC1, RbAp48 and p66 [111, 121-123]. Interestingly, phenotype of certain vulval
mutants in C. elegans, which associate with genes coding for NuRD components [124], is quite
similar to that of SUMO and UBC9 mutants [125], indicating that function of the NuRD
complex is linked to sumoylation.
SUMO directly associates with HDACs in a variety of ways. As previously indicated a well-
eslabIished Iink belveen SUMO and HDACs is iIIuslraled by lhe SIM-medialed recruil
ment of HDACs to sumoylated proteins [56, 121]. It was first demonstrated for HDAC2
recruitment to sumoylated Elk-1 [56], and subsequently for HDACs 1, 3, 4, 5 and 6, and
Chromatin Remodelling 40
cIass III SIRT1 deacelyIases lo severaI faclors. SumoyIalion of lhe coaclivalor 300 medi
ates recruitment of class II HDAC6 and class III SIRT1 deacetylases [66, 126]. HDAC1
recruitment to sumoylated Groucho, p68 and reptin has also been described [121, 127, 128].
Moreover, a SUMO-hislone H4 fusion has been shovn lo reciilale HDAC1 |55j. De
spite these data, it is not clear at present whether SUMO-dependent recruitment of HDACs
invoIves direcl binding of HDAC lo SUMO or vhelher HDACs associale lhrough cofac
tors recruited in a SUMO-dependent manner, as indicated for the LSD1/CoREST and NuRD
complexes. Another example of SUMO-dependent recruitment of HDAC is depicted by the
Daxx-mediated recruitment of HDAC2 to sumoylated CBP [67]. In this context, it is worth
noting that in a variety of cases, HDAC recruitment does not account for full repression
activity mediated by SUMO, as inhibition of HDACs does not relieve SUMO-dependent
reression as execled. Ior inslance, il has been shovn in a reorler syslem lhal reres
sion mediated by a Gal4-SUMO fusion is not sensitive to HDAC inhibition [56], as also
occurs for SUMO-deendenl S3-medialed reression |64, 129j. Desile HDAC2 recruil
menl by sumoyIaled IIk-1, HDAC2 knockdovn onIy arliaIIy aIIeviales SUMO-deend
ent Elk-1-mediated repression [56]. Therefore, histone deacetylases are recruited in a SUMO-
dependent manner through repressor complexes, together with additional repressor
components, to account for full repression activity of the complex. Conversely, HDAC
displacement by target sumoylation has been less reported, but examples have been
described. Thus, sumoylation of the Prospero-related homeobox 1 (Prox1) and the de novo
DNA melhyIlransferase DNMT3A disruls associalion lo HDAC3 and HDAC1/2, resec
tively [130, 131]. On the other hand, HDACs have also been shown to be substrates for
SUMO, which regulates HDAC activity. Then, mutation of the sumoylation sites in HDAC1
has been shown to dramatically reduce its repression activity in a reporter assay [122]. It
has been reported that the protease SENP1 is able to remove SUMO from sumoylated
HDAC1, which leads to enhanced transcription activity by the androgen receptor [132].
Interestingly, the viral protein Gam1 interferes with HDAC1 sumoylation [133]. The RanBP2
ligase has been demonstrated to promote sumoylation of HDAC4 [134], and a relevant role
for SUMO chain formation on HDAC4 has been attributed to the non-covalent interaction
between SUMO and UBC9 [135]. Paradoxically, while HDAC1 sumoylation seems to be
essenliaI for ils reression aclivily |122j, SUMO allachmenl lo HDAC1 imairs associa
tion to the CoREST repressor [116]. As previously mentioned, class IIa HDACs have been
reorled as SUMO Iigases. HDAC4 and olher cIass IIa HDACs romole SUMO2/3 allach
ment to the myocyte enhancer factor 2 family members MEF2D and MEF2C, which leads
to repression of target genes [25]. Conversely, ligase activity is inhibited by HDAC4
sumoylation. HDAC4 ligase activity has been also demonstrated on liver X receptors
sumoyIalion by SUMO2/3 |136j and on HIC1 sumoyIalion by SUMO1 |137j, vhiIe en
hanced sumoylation of PML protein has been attributed to HDAC7 [138].
4.4. Multiple complexes contribute to SUMO-dependent Sp3-mediated repression
Sp3 belongs to the specificity protein (Sp) family of transcription factors, which regulate
multiple genes involved in housekeeping, development and cell cycle. Sp3 is expressed
ubiquitously and can act either as an activator or a repressor depending on the promoter
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
41
context [106, 139]. Sp3-mediated repression depends on Sp3 sumoylation, and as previously
indicated, this repression activity is not affected by HDAC inhibitors [129, 140].
A genome-wide RNAi screen in Drosophila cell cultures revealed that multiple complexes
were involved in SUMO-dependent repression by Sp3 [64]. Among the genes identified whose
knockdown impaired SUMO-dependent transcription repression were genes encoding the
ATP-dependent chromatin remodeler dMi-2, the Drosophila ortholog of the nematode protein
MEP-1 and the polycomb protein Sfmbt. Biochemical analyses indicated that dMi-2, MEP-1
and Sfmbt interacted with each other, bound to SUMO and were recruited to the chromatin in
a SUMO-dependent manner. In addition, chromatin immunoprecipitation experiments
showed that sumoylated Sp3 recruits a number of heterochromatin associated proteins,
including dMi-2, the H3K9 histone methyl transferase (HMT) SETDB1, the H4K20 histone
methyl transferase SUV4-20H, heterochromatin protein 1 (HP1) o, and y, and MBT-domain
proteins [141].
It has been previously indicated that dMi-2 is the core component of NuRD complex, a complex
with associated HDACs. However, Sp3-SUMO-mediated repression is not sensistive to
HDACs inhibitors, indicating either that dMi-2 mediates repression outside the NuRD
complex or that there is a redundancy in the mechanisms driving Sp3-SUMO-mediated
repression. In fact, several data indicate that dMi-2 is also part of another complex lacking
HDAC activity. This complex, dMec, is composed by dMi-2 and the Drosophila homolog of
the C. elegans protein MEP-1 (dMEP-1), and works as a corepressor of proneural genes [142].
Knockdown of dMEP-1 leads to derepression of Sp3 target genes, which is in contrast to
functional redundancy among the different repression mechanisms recruited to Sp3 [64]. It is
worth noting that MEP-1 was previously shown to contribute to SUMO-dependent repression
in C. elegans [143]. Thus, sumoylated LIN-1 recruits MEP-1 for repression and inhibition of
vulval cell fate. As LIN-1 is homologous to the human Elk-1, it is tempting to speculate that a
similar mechanism may account for the SUMO-mediated HDAC-independent repression by
Elk-1, despite the absence of a clear MEP-1 homolog in vertebrates.
As formerly mentioned, two HMTs were also recruited to SUMO-Sp3: SETDB1 and SUV4-20H,
while the HMT SUV39H1 was not associated [141]. These HMTs were shown to be recruited
to the Dhfr promoter in a sumoylatable Sp3-dependent manner. Knocking down of SETDB1
and SUV4-20H resulted in reduced trimethylation of H3K9 and H4K20 at the Dhfr promoter.
Finally, polycomb protein Sfmbt and the corresponding mammalian orthologs L3MBTL1 and
L3MBTL2 also associate to sumoylated Sp3 [64, 141]. These proteins contain repeats of the
malignant brain tumor (MBT) domain, which is structurally related to the chromodomain and
the Tudor domain, and like these, is able to recognize methylated histones. However, MBTs
associate with higher affinity to mono- and di- than to trimethylated histones [144]. It has been
shown that L3MBTL1 binds HP1y and compacts chromatin in a mono- and dimethylated
H4K20 and H1bK26-dependent manner [145]. Therefore, this association provides a way to
explain L3MBTL1-mediated repression. Binding of HP1o, and y lo S3 deends on sumoy
lation [141j. SumoyIaled hislone H4 recruils HI1y |55], and HP1o has also been shown to
preferentially bind sumoylated SP100 [146], suggesting that, as occurs for HDACs, SUMO
mediates HP1 recruitment. As Sfmbt, the PRC2-associated PcG protein Scm also contains MBT
Chromatin Remodelling 42
repeats. In contrast to Scm, Sfmbt together with Pleiohomeotic, integrates in the polycomb
complex PhoRC. Thus, different polycomb complexes include MBT-containing subunits,
which might be involved in recognition of mono- and dimethylated histones to facilitate
trimethylation by recruiting other subunits with histone methyltransferase activity.
In sum, Sp3 constitutes a paradigm of SUMO-dependent transcription repression through a
variety of factors and chromatin-associated complexes. Clear evidence of SUMO involvement
in S3-medialed reression came from lhe generalion of knock-in mice vilh a non-sumoyIal
able version of Sp3 [147]. As Lys residues are targets for other modifications different of
sumoylation, for instance acetylation, authors, instead of mutating core Lys551 to Arg changed
the acidic residue at the sumoylation site. Interestingly, they substituted Glu by Asp, which
abrogated sumoylation, despite for may authors it is assumed the consensus +KxI/D.
Mutation did not affected Sp3 protein levels. However, spermatocyte-specific genes Dmc1 and
Dnahc8, and neuronal genes Paqr6, Rims3 and Robo3 appeared derepressed in non-testicular
and extra-neural tissues and in mouse embryonic fibroblasts [147]. This correlated with loss
of lhe reressive helerochromalin marks lrimelhyI-H3K9 and lrimelhyI-H4K20 and affecled
recruilmenl of reressor roleins, such as HI1, SITD1, CHD3, and L3MTL1/2, lo lhe
corresonding romolers. SurrisingIy, homozygous knock-in mice born al execled mende
lian frequency, were fertile and exhibited no obvious phenotype, in contrast to mice lacking
Sp3 [148], suggesting that additional mechanisms may control protein expression from the
aberrantly induced transcripts.
5. Conclusions
Sumoylation results essential for development and growth of all the investigated eukaryotes.
In mice, embryos Iacking lhe SUMO con|ugaling enzyme Ubc9 die al lhe earIy oslimIanla
tion stage, highlighting the relevance of SUMO conjugation during development [149]. The
SUMO pathway is conserved from yeast to human and, together with ubiquitination, appears
lo be lhe mosl uliIized alhvay in osl-lransIalionaI modificalions by ULs. Desile simiIar
structural features and a common evolutionary origin of SUMO and ubiquitin, they have
significantly diverged from a functional point of view. In fact, a complete machinery has
evoIved around SUMO for secific con|ugalion/decon|ugalion of lhis moIecuIe. Comared
vilh ubiquilin, aboul 20 N-lerminaI exlra amino acids are resenl in SUMO, vhich shouId
account for the different and specific SUMO roles. From the many examples of protein
modification by SUMO, structural, regulatory, signaling, and scaffold roles are inferred for
this molecule. All these aspects convene to reveal SUMO modification as an important post-
translational modification involved in transcription repression. Therefore, SUMO prefigures
as an adaptor molecule essential for correct assembly and function of a variety of chromatin-
associated repressor complexes. This does not exclude that involvement of SUMO in various
syslems resuIls in lranscrilionaI aclivalion. A number of SUMO-deendenl hislone modifi
cations and chromatin remodeling activities have been summarized in this chapter (Table 3).
They incIude, HDACs, HMTs and hislone demelhyIase aclivilies, associaled lo lhe NuRD,
LSD1/CoRIST, SITD1, dMec, L3MTL1 and IoIycomb comIexes, vhich resuIl in chromalin
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
43
compaction and gene silencing. However, many questions remain open. For instance, whether
proteins with intrinsic repression activity like HDACs are directly recruited by SUMO or
instead, relevant repression activity in vivo results from association of HDACs to repressor
complexes recruited in a SUMO-dependent manner, needs to be clarified. In addition, although
HDACs have intrinsic repression activity, it has been shown that sumoylation of HDAC1
accounts for its full repression activity [122], raising the question whether SUMO modulates
its activity or is recruiting additional repressors. Another intriguing aspect concerns functional
redundancy among the different repressors recruited to a locus via SUMO. A number of
repressors are recruited to the chromatin through a Gal4-SUMO2 fusion [123], but it has been
shown that individually knocking down of these factors has little consequences in SUMO2
displayed repression, which may be explained by functional redundancy of the multiple
repressors associated. In a similar way, downregulation of CHD3 (mammalian dMi-2) or
L3MBTL1/2 does not impair Sp3-SUMO-mediated repression in vertebrate cells [64, 141].
However, mutation of dMi-2 or Sfmbt in Drosophila has a significant impact in Sp3-SUMO-
dependent repression [64], suggesting that promoter context and local features account for the
level of functional redundancy of SUMO-associated repressors. In addition, an important
aspect of the SUMO modification concerns the fleeting nature of the modification in many
cases, which means that SUMO-SIM interactions may have permanent consequences despite
they are not further detected, a notion that implies a kind of memory and that thereby links
SUMO to epigenetics. Interestingly, mutation of the SUMO2 SIM in CoREST is sufficient to
abrogate repression of some neuronal specific genes in non-neuronal cells [111], highlighting
the relevance of the non-covalent interaction of proteins with SUMO in regulating SUMO-
dependent repression. In this context, SIMs and sumoylation sites have been described in many
subunits within a repressor complex (reviewed in [68]), which rises the question about how
the appropriate connections are established.
Abbreviations
CBP, CREB binding protein
DeSI-1, desumoylating isopepyidase-1
EZH2, Enhancer of Zeste
HDAC, histone deacetylase
HMT, histone methyl transferase
KAP-1, KRAB associated protein-1
NDSM, negatively charged residues-dependent SUMO motif
Pc2, polycomb-2
PcG, polycomb group
PCR1/2, polycomb repressive complex 1/2
Chromatin Remodelling 44
PDSM, phosphorylation-dependent SUMO motif
PIAS, protein inhibitor of activated STAT
PML, promyelocytic leukaemia protein
SENP, sentrin-specific protease
SIM, SUMO interacting motif
Sp3, specificity protein 3
SP-RING, Siz/PIAS-RING
SUMO, small ubiquitin-like modifier
UBLs, ubiquitin-like proteins
Acknowledgements
Work in the Garcia-Dominguez laboratory is supported by the Spanish National Ministry of
Economy and Competitiveness grant BFU2012-37304/BFI. I thank JC Reyes, P Garcia-Gutierrez
and F Juarez-Vicente for critical reading of this chapter.
Author details
Garcia-Dominguez Mario
Address all correspondence to: [email protected]
Slem CeIIs Dearlmenl. AndaIusian Cenler for MoIecuIar ioIogy and Regeneralive Medi
cine (CABIMER) & High Council for Scientific Research (CSIC), Seville, Spain
References
[1] Hochstrasser M (2009) Origin and function of ubiquitin-like proteins. Nature 458:
422-429.
[2] urroughs AM, Iyer LM, Aravind L (2012) The naluraI hislory of ubiquilin and ubiq
uitin-related domains. Frontiers in Bioscience 17: 1433-1460.
[3] Mahajan R, Delphin C, Guan T, Gerace L, Melchior F (1997) A small ubiquitin-related
polypeptide involved in targeting RanGAP1 to nuclear pore complex protein
RanBP2. Cell 88: 97-107.
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
45
[4] Malunis M}, Coulavas I, IobeI G (1996) A noveI ubiquilin-Iike modificalion modu
Iales lhe arlilioning of lhe Ran-GTIase-aclivaling rolein RanGAI1 belveen lhe cy
tosol and the nuclear pore complex. The Journal of Cell Biology 135: 1457-1470.
[5] Muller S, Hoege C, Pyrowolakis G, Jentsch S (2001) SUMO, ubiquitin's mysterious
cousin. Nature Reviews 2: 202-210.
[6] Weissman AM (2001) Themes and variations on ubiquitylation. Nature Reviews 2:
169-178.
[7] Seeler JS, Dejean A (2003) Nuclear and unclear functions of SUMO. Nature Reviews 4:
690-699.
[8] Palancade B, Doye V (2008) Sumoylating and desumoylating enzymes at nuclear
pores: underpinning their unexpected duties? Trends in Cell Biology 18: 174-183.
[9] Hay RT (2005) SUMO: a history of modification. Molecular Cell 18: 1-12.
[10] Johnson ES (2004) Protein modification by SUMO. Annual Review of Biochemistry 73:
355-382.
[11] Gill G (2005) Something about SUMO inhibits transcription. Currcni Opinicn in Gcnci
ics & Development 15: 536-541.
[12] Lysl M}, Slancheva I (2007) A roIe for SUMO modificalion in lranscrilionaI reres
sion and activation. Biochemical Society Transactions 35: 1389-1392.
[13] Johnson ES, Schwienhorst I, Dohmen RJ, Blobel G (1997) The ubiquitin-like protein
Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer.
The EMBO Journal 16: 5509-5519.
[14] Azuma Y, Tan SH, Cavenagh MM, Ainszlein AM, Sailoh H, Dasso M (2001) Ixres
sion and regulation of the mammalian SUMO-1 E1 enzyme. Faseb Journal 15:
1825-1827.
[15] Desterro JM, Thomson J, Hay RT (1997) Ubch9 conjugates SUMO but not ubiquitin.
FEBS Letters 417: 297-300.
[16] Johnson ES, Blobel G (1997) Ubc9p is the conjugating enzyme for the ubiquitin-like
protein Smt3p. The Journal of Biological Chemistry 272: 26799-26802.
[17] Samson DA, Wang M, Malunis M} (2001) The smaII ubiquilin-Iike modifier-1 (SU
MO-1) consensus sequence mediales Ubc9 binding and is essenliaI for SUMO-1 mod
ification. The Journal of Biological Chemistry 276: 21664-21669.
[18] Tatham MH, Chen Y, Hay RT (2003) Role of two residues proximal to the active site
of Ubc9 in substrate recognition by the Ubc9.SUMO-1 thiolester complex. Biccncnis
try 42: 3168-3179.
Chromatin Remodelling 46
[19] Tatham MH, Kim S, Yu B, Jaffray E, Song J, Zheng J, Rodriguez MS, Hay RT, Chen Y
(2003) RoIe of an N-lerminaI sile of Ubc9 in SUMO-1, -2, and -3 binding and con|uga
tion. Biochemistry 42: 9959-9969.
[20] Kola|a N, Karvonen U, }anne OA, IaIvimo }} (2002) IIAS roleins moduIale lran
scription factors by functioning as SUMO-1 ligases. Molecular and Cellular Biology 22:
5222-5234.
[21] Sachdev S, Bruhn L, Sieber H, Pichler A, Melchior F, Grosschedl R (2001) PIASy, a
nuclear matrix-associated SUMO E3 ligase, represses LEF1 activity by sequestration
into nuclear bodies. Genes & Development 15: 3088-3103.
[22] Pichler A, Gast A, Seeler JS, Dejean A, Melchior F (2002) The nucleoporin RanBP2 has
SUMO1 E3 ligase activity. Cell 108: 109-120.
[23] Kagey MH, Melhuish TA, Wotton D (2003) The polycomb protein Pc2 is a SUMO E3.
Cell 113: 127-137.
[24] Weger S, Hammer E, Heilbronn R (2005) Topors acts as a SUMO-1 E3 ligase for p53
in vitro and in vivo. FEBS Letters 579: 5007-5012.
[25] Gregoire S, Yang X} (2005) Associalion vilh cIass IIa hislone deacelyIases uregu
lates the sumoylation of MEF2 transcription factors. Molecular and Cellular Biology 25:
2273-2287.
[26] Ivanov AV, Peng H, Yurchenko V, Yap KL, Negorev DG, Schultz DC, Psulkowski E,
Fredericks WJ, White DE, Maul GG, Sadofsky MJ, Zhou MM, Rauscher FJ, 3rd (2007)
PHD domain-mediated E3 ligase activity directs intramolecular sumoylation of an
adjacent bromodomain required for gene silencing. Molecular Cell 28: 823-837.
[27] Subramaniam S, Sixl KM, arrov R, Snyder SH (2009) Rhes, a slrialaI secific ro
tein, mediates mutant-huntingtin cytotoxicity. Science 324: 1327-1330.
[28] Garcia-Gulierrez I, }uarez-Vicenle I, GaIIardo-Chamizo I, Charnay I, Garcia-Domi
nguez M (2011) The transcription factor Krox20 is an E3 ligase that sumoylates its
Nab coregulators. EMBO Reports 12: 1018-1023.
[29] Li SJ, Hochstrasser M (1999) A new protease required for cell-cycle progression in
yeast. Nature 398: 246-251.
[30] Li SJ, Hochstrasser M (2000) The yeast ULP2 (SMT4) gene encodes a novel protease
specific for the ubiquitin-like Smt3 protein. Molecular and Cellular Biology 20:
2367-2377.
[31] Nishida T, Tanaka H, Yasuda H (2000) A noveI mammaIian Sml3-secific isoeli
dase 1 (SMT3IP1) localized in the nucleolus at interphase. |urcpcan jcurna| cj Bic
chemistry / FEBS 267: 6423-6427.
[32] Shin EJ, Shin HM, Nam E, Kim WS, Kim JH, Oh BH, Yun Y (2012) DeSUMOylating
isopeptidase: a second class of SUMO protease. EMBO Reports 13: 339-346.
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
47
[33] Melchior F, Schergaut M, Pichler A (2003) SUMO: ligases, isopeptidases and nuclear
pores. Trends in Biochemical Sciences 28: 612-618.
[34] Gareau JR, Lima CD (2010) The SUMO pathway: emerging mechanisms that shape
specificity, conjugation and recognition. Nature Reviews 11: 861-871.
[35] Rylinki MM, Kaikkonen S, Iehkonen I, }aaskeIainen T, IaIvimo }} (2009) IIAS ro
teins: pleiotropic interactors associated with SUMO. Cc||u|ar an! Mc|ccu|ar Iijc Scicn
ces 66: 3029-3041.
[36] Garcia-Dominguez M, March-Diaz R, Reyes JC (2008) The PHD domain of plant
PIAS proteins mediates sumoylation of bromodomain GTE proteins. Tnc jcurna| cj Bi
ological Chemistry 283: 21469-21477.
[37] Yeh ET (2009) SUMOylation and De-SUMOylation: wrestling with life's processes.
The Journal of Biological Chemistry 284: 8223-8227.
[38] Mukhopadhyay D, Dasso M (2007) Modification in reverse: the SUMO proteases.
Trends in Biochemical Sciences 32: 286-295.
[39] Gan-Irdene T, NagamaIIesvari K, Yin L, Wu K, Ian ZQ, WiIkinson KD (2003) Iden
tification and characterization of DEN1, a deneddylase of the ULP family. The Journal
of Biological Chemistry 278: 28892-28900.
[40] Wu K, Yamoah K, DoIios G, Gan-Irdene T, Tan I, Chen A, Lee CG, Wei N, WiIkin
son KD, Wang R, Ian ZQ (2003) DIN1 is a duaI funclion rolease caabIe of rocess
ing the C terminus of Nedd8 and deconjugating hyper-neddylated CUL1. The Journal
of Biological Chemistry 278: 28882-28891.
[41] Sailoh H, Hinchey } (2000) IunclionaI helerogeneily of smaII ubiquilin-reIaled ro
tein modifiers SUMO-1 versus SUMO-2/3. The Journal of Biological Chemistry 275:
6252-6258.
[42] Bayer P, Arndt A, Metzger S, Mahajan R, Melchior F, Jaenicke R, Becker J (1998)
Structure determination of the small ubiquitin-related modifier SUMO-1. Journal of
Molecular Biology 280: 275-286.
[43] Tatham MH, Jaffray E, Vaughan OA, Desterro JM, Botting CH, Naismith JH, Hay RT
(2001) IoIymeric chains of SUMO-2 and SUMO-3 are con|ugaled lo rolein sub
strates by SAE1/SAE2 and Ubc9. The Journal of Biological Chemistry 276: 35368-35374.
[44] ohren KM, Nadkarni V, Song }H, Gabbay KH, Overbach D (2004) A M55V oIy
morhism in a noveI SUMO gene (SUMO-4) differenliaIIy aclivales heal shock lran
scription factors and is associated with susceptibility to type I diabetes mellitus. The
Journal of Biological Chemistry 279: 27233-27238.
[45] Overbach D, McKay IM, Yeh IT, Gabbay KH, ohren KM (2005) A roIine-90 resi
due unique to SUMO-4 prevents maturation and sumoylation. Biccncnica| an! Bic
physical Research Communications 337: 517-520.
Chromatin Remodelling 48
[46] Wang CY, She JX (2008) SUMO4 and its role in type 1 diabetes pathogenesis. Oia|c
tes/Metabolism Research and Reviews 24: 93-102.
[47] Zhu }, Zhu S, Guzzo CM, IIIis NA, Sung KS, Choi CY, Malunis M} (2008) SmaII ubiq
uilin-reIaled modifier (SUMO) binding delermines subslrale recognilion and araI
og-selective SUMO modification. The Journal of Biological Chemistry 283: 29405-29415.
[48] Kerscher O (2007) SUMO |unclion-vhal's your funclion` Nev insighls lhrough SU
MO-interacting motifs. EMBO Reports 8: 550-555.
[49] Minty A, Dumont X, Kaghad M, Caput D (2000) Covalent modification of p73alpha
by SUMO-1. Two-hybrid screening with p73 identifies novel SUMO-1-interacting
proteins and a SUMO-1 interaction motif. The Journal of Biological Chemistry 275:
36316-36323.
[50] Bossis G, Melchior F (2006) SUMO: regulating the regulator. Cell Div 1: 13.
[51] oggio R, CoIombo R, Hay RT, Draella GI, Chiocca S (2004) A mechanism for inhib
iting the SUMO pathway. Molecular Cell 16: 549-561.
|52j Iniguez-LIuhi }A, Iearce D (2000) A common molif vilhin lhe negalive reguIalory re
gions of multiple factors inhibits their transcriptional synergy. Molecular and Cellular
Biology 20: 6040-6050.
[53] Yang SH, Jaffray E, Hay RT, Sharrocks AD (2003) Dynamic interplay of the SUMO
and ERK pathways in regulating Elk-1 transcriptional activity. Molecular Cell 12:
63-74.
[54] Holmstrom S, Van Antwerp ME, Iniguez-Lluhi JA (2003) Direct and distinguishable
inhibitory roles for SUMO isoforms in the control of transcriptional synergy. Prcccc!
ings of the National Academy of Sciences USA 100: 15758-15763.
[55] Shiio Y, Eisenman RN (2003) Histone sumoylation is associated with transcriptional
repression. Proceedings of the National Academy of Sciences USA 100: 13225-13230.
[56] Yang SH, Sharrocks AD (2004) SUMO romoles HDAC-medialed lranscrilionaI re
pression. Molecular Cell 13: 611-617.
[57] Nathan D, Ingvarsdottir K, Sterner DE, Bylebyl GR, Dokmanovic M, Dorsey JA,
WheIan KA, Krsmanovic M, Lane WS, MeIuh I, }ohnson IS, erger SL (2006) His
lone sumoyIalion is a negalive reguIalor in Saccharomyces cerevisiae and shovs dy
namic interplay with positive-acting histone modifications. Genes & Development 20:
966-976.
[58] Shin }A, Choi IS, Kim HS, Ho }C, Walls IZ, Iark SD, }ang YK (2005) SUMO modifi
cation is involved in the maintenance of heterochromatin stability in fission yeast.
Molecular Cell 19: 817-828.
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
49
[59] Hari KL, Cook KR, Karpen GH (2001) The Drosophila Su(var)2-10 locus regulates
chromosome slruclure and funclion and encodes a member of lhe IIAS rolein fami
ly. Genes & Development 15: 1334-1348.
[60] Muller S, Berger M, Lehembre F, Seeler JS, Haupt Y, Dejean A (2000) c-Jun and p53
activity is modulated by SUMO-1 modification. The Journal of Biological Chemistry 275:
13321-13329.
[61] Wu SY, Chiang CM (2009) Crosstalk between sumoylation and acetylation regulates
p53-dependent chromatin transcription and DNA binding. The EMBO journal.
[62] Desterro JM, Rodriguez MS, Hay RT (1998) SUMO-1 modification of IkappaBalpha
inhibits NF-kappaB activation. Molecular Cell 2: 233-239.
[63] Kim }, CanlveII CA, }ohnson II, Ifarr CM, WiIIiams SC (2002) TranscrilionaI acliv
ily of CCAAT/enhancer-binding roleins is conlroIIed by a conserved inhibilory do
main that is a target for sumoylation. The Journal of Biological Chemistry 277:
38037-38044.
[64] Stielow B, Sapetschnig A, Kruger I, Kunert N, Brehm A, Boutros M, Suske G (2008)
Identification of SUMO-dependent chromatin-associated transcriptional repression
components by a genome-wide RNAi screen. Molecular Cell 29: 742-754.
[65] Shalizi A, Gaudilliere B, Yuan Z, Stegmuller J, Shirogane T, Ge Q, Tan Y, Schulman
, Harer }W, onni A (2006) A caIcium-reguIaled MII2 sumoyIalion svilch con
trols postsynaptic differentiation. Science 311: 1012-1017.
[66] Girdvood D, umass D, Vaughan OA, Thain A, Anderson LA, Snovden AW, Gar
cia-Wilson E, Perkins ND, Hay RT (2003) P300 transcriptional repression is mediated
by SUMO modification. Molecular Cell 11: 1043-1054.
[67] Kuo HY, Chang CC, Jeng JC, Hu HM, Lin DY, Maul GG, Kwok RP, Shih HM (2005)
SUMO modificalion negaliveIy moduIales lhe lranscrilionaI aclivily of CRI-bind
ing protein via the recruitment of Daxx. Proceedings of the National Academy of Sciences
USA 102: 16973-16978.
[68] Garcia-Dominguez M, Reyes JC (2009) SUMO association with repressor complexes,
emerging routes for transcriptional control. Biochimica et Biophysica Acta 1789:
451-459.
[69] Ouyang J, Gill G (2009) SUMO engages multiple corepressors to regulate chromatin
structure and transcription. Epigenetics 4: 440-444.
[70] Yamamolo H, Ihara M, Malsuura Y, Kikuchi A (2003) SumoyIalion is invoIved in be
ta-catenin-dependent activation of Tcf-4. The EMBO Journal 22: 2047-2059.
[71] Wang }, Ieng XH, Schvarlz R} (2004) SUMO-1 modificalion aclivaled GATA4-de
pendent cardiogenic gene activity. The Journal of Biological Chemistry 279: 49091-49098.
[72] Yan Q, Gong L, Deng M, Zhang L, Sun S, Liu J, Ma H, Yuan D, Chen PC, Hu X, Liu J,
Qin }, Xiao L, Huang XQ, Zhang }, Li DW (2010) SumoyIalion aclivales lhe lranscri
Chromatin Remodelling 50
lionaI aclivily of Iax-6, an imorlanl lranscrilion faclor for eye and brain deveIo
ment. Proceedings of the National Academy of Sciences USA 107: 21034-21039.
[73] Shyu YC, Lee TL, Ting CY, Wen SC, Hsieh LJ, Li YC, Hwang JL, Lin CC, Shen CK
(2005) Sumoylation of p45/NF-E2: nuclear positioning and transcriptional activation
of the mammalian beta-like globin gene locus. Molecular and Cellular Biology 25:
10365-10378.
[74] Lin X, Liang M, Liang YY, Brunicardi FC, Feng XH (2003) SUMO-1/Ubc9 promotes
nuclear accumulation and metabolic stability of tumor suppressor Smad4. The Journal
of Biological Chemistry 278: 31043-31048.
[75] Wei F, Scholer HR, Atchison ML (2007) Sumoylation of Oct4 enhances its stability,
DNA binding, and transactivation. The Journal of Biological Chemistry 282:
21551-21560.
[76] Gostissa M, Hengstermann A, Fogal V, Sandy P, Schwarz SE, Scheffner M, Del Sal G
(1999) Activation of p53 by conjugation to the ubiquitin-like protein SUMO-1. The
EMBO Journal 18: 6462-6471.
[77] Wang }, Li A, Wang Z, Ieng X, OIson IN, Schvarlz R} (2007) Myocardin sumoyIa
tion transactivates cardiogenic genes in pluripotent 10T1/2 fibroblasts. Molecular and
Cellular Biology 27: 622-632.
[78] Guo B, Sharrocks AD (2009) Extracellular signal-regulated kinase mitogen-activated
protein kinase signaling initiates a dynamic interplay between sumoylation and
ubiquitination to regulate the activity of the transcriptional activator PEA3. Molecular
and Cellular Biology 29: 3204-3218.
[79] Terui Y, Saad N, }ia S, McKeon I, Yuan } (2004) DuaI roIe of sumoyIalion in lhe nu
clear localization and transcriptional activation of NFAT1. The Journal of Biological
Chemistry 279: 28257-28265.
[80] Goodson ML, Hong Y, Rogers R, Malunis M}, Iark-Sarge OK, Sarge KD (2001) Su
mo-1 modification regulates the DNA binding activity of heat shock transcription
factor 2, a promyelocytic leukemia nuclear body associated transcription factor. The
Journal of Biological Chemistry 276: 18513-18518.
[81] Hong Y, Rogers R, Matunis MJ, Mayhew CN, Goodson ML, Park-Sarge OK, Sarge
KD (2001) Regulation of heat shock transcription factor 1 by stress-induced SUMO-1
modification. The Journal of Biological Chemistry 276: 40263-40267.
[82] Wu SY, Chiang CM (2009) Crosstalk between sumoylation and acetylation regulates
p53-dependent chromatin transcription and DNA binding. The EMBO Journal 28:
1246-1259.
[83] Zhang Z, Liao B, Xu M, Jin Y (2007) Post-translational modification of POU domain
transcription factor Oct-4 by SUMO-1. Faseb Journal 21: 3042-3051.
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
51
[84] Gomez-deI Arco I, KoiaIIy }, GeorgoouIos K (2005) Ikaros SUMOyIalion: svilch
ing out of repression. Molecular and Cellular Biology 25: 2688-2697.
[85] Rosonina I, Duncan SM, ManIey }L (2010) SUMO funclions in conslilulive lranscri
tion and during activation of inducible genes in yeast. Genes & Development 24:
1242-1252.
[86] Liu HW, Zhang J, Heine GF, Arora M, Gulcin Ozer H, Onti-Srinivasan R, Huang K,
Parvin JD (2012) Chromatin modification by SUMO-1 stimulates the promoters of
translation machinery genes. Nucleic Acids Research.
[87] KaIocsay M, HiIIer N}, }enlsch S (2009) Chromosome-vide Rad51 sreading and SU
MO-H2A.Z-deendenl chromosome fixalion in resonse lo a ersislenl DNA dou
ble-strand break. Molecular Cell 33: 335-343.
[88] Shindo H, Suzuki R, Tsuchiya W, Taichi M, Nishiuchi Y, Yamazaki T PHD finger of
lhe SUMO Iigase Siz/IIAS famiIy in rice reveaIs secific binding for melhyIaled his
tone H3 at lysine 4 and arginine 2. FEBS Letters 586: 1783-1789.
[89] racken AI, HeIin K (2009) IoIycomb grou roleins: navigalors of Iineage alh
ways led astray in cancer. Nature Reviews Cancer 9: 773-784.
[90] Lanzuolo C, Orlando V (2012) Memories from the Polycomb Group Proteins. Annual
Review of Genetics 46: 559-587.
[91] Yang SH, Sharrocks AD The SUMO E3 ligase activity of Pc2 is coordinated through a
SUMO interaction motif. Molecular and Cellular Biology 30: 2193-2205.
[92] Lin X, Sun B, Liang M, Liang YY, Gast A, Hildebrand J, Brunicardi FC, Melchior F,
Feng XH (2003) Opposed regulation of corepressor CtBP by SUMOylation and PDZ
binding. Molecular Cell 11: 1389-1396.
[93] Roscic A, Moller A, Calzado MA, Renner F, Wimmer VC, Gresko E, Ludi KS, Schmitz
ML (2006) Phosphorylation-dependent control of Pc2 SUMO E3 ligase activity by its
substrate protein HIPK2. Molecular Cell 24: 77-89.
[94] Wang J, Scully K, Zhu X, Cai L, Zhang J, Prefontaine GG, Krones A, Ohgi KA, Zhu P,
Garcia-Bassets I, Liu F, Taylor H, Lozach J, Jayes FL, Korach KS, Glass CK, Fu XD,
RosenfeId MG (2007) Oosing LSD1 comIexes funclion in deveIomenlaI gene ac
tivation and repression programmes. Nature 446: 882-887.
[95] van der Vlag J, Otte AP (1999) Transcriptional repression mediated by the human
polycomb-group protein EED involves histone deacetylation. Nat Genet 23: 474-478.
[96] Klein UR, Nigg EA (2009) SUMO-dependent regulation of centrin-2. Journal of Cell
Science 122: 3312-3321.
[97] Wotton D, Merrill JC (2007) Pc2 and SUMOylation. Biochemical Society Transactions 35:
1401-1404.
Chromatin Remodelling 52
[98] Ismail IH, Gagne JP, Caron MC, McDonald D, Xu Z, Masson JY, Poirier GG, Hendzel
MJ CBX4-mediated SUMO modification regulates BMI1 recruitment at sites of DNA
damage. Nucleic Acids Research 40: 5497-5510.
[99] Deng Z, Wan M, Sui G (2007) PIASy-mediated sumoylation of Yin Yang 1 depends
on their interaction but not the RING finger. Molecular and Cellular Biology 27:
3780-3792.
[100] Riising EM, Boggio R, Chiocca S, Helin K, Pasini D (2008) The polycomb repressive
complex 2 is a potential target of SUMO modifications. PLoS ONE 3: e2704.
[101] Zhang H, Smolen GA, Palmer R, Christoforou A, van den Heuvel S, Haber DA (2004)
SUMO modificalion is required for in vivo Hox gene reguIalion by lhe Caenorhabdi
tis elegans Polycomb group protein SOP-2. Nature Genetics 36: 507-511.
[102] Kang X, Qi Y, Zuo Y, Wang Q, Zou Y, Schwartz RJ, Cheng J, Yeh ET (2010) SUMO-
specific protease 2 is essential for suppression of polycomb group protein-mediated
gene silencing during embryonic development. Molecular Cell 38: 191-201.
[103] Tro|er I, Reinberg D (2007) IacuIlalive helerochromalin: is lhere a dislinclive moIec
ular signature? Molecular Cell 28: 1-13.
[104] Lysl M}, Nan X, Slancheva I (2006) ReguIalion of MD1-medialed lranscrilionaI re
pression by SUMO and PIAS proteins. The EMBO Journal 25: 5317-5328.
[105] Uchimura Y, Ichimura T, Uwada J, Tachibana T, Sugahara S, Nakao M, Saitoh H
(2006) InvoIvemenl of SUMO modificalion in MD1- and MCAI1-medialed helero
chromatin formation. The Journal of Biological Chemistry 281: 23180-23190.
[106] VaIin A, GiII G (2007) ReguIalion of lhe duaI-funclion lranscrilion faclor S3 by SU
MO. Biochemical Society Transactions 35: 1393-1396.
[107] Liu , Tahk S, Yee KM, Ian G, Shuai K (2010) The Iigase IIAS1 reslricls naluraI regu
latory T cell differentiation by epigenetic repression. Science 330: 521-525.
[108] Shi Y, Lan I, Malson C, MuIIigan I, Whelsline }R, CoIe IA, Casero RA (2004) His
tone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell 119:
941-953.
[109] Lee MG, Wynder C, Cooch N, Shiekhattar R (2005) An essential role for CoREST in
nucleosomal histone 3 lysine 4 demethylation. Nature 437: 432-435.
[110] Shi YJ, Matson C, Lan F, Iwase S, Baba T, Shi Y (2005) Regulation of LSD1 histone
demethylase activity by its associated factors. Molecular Cell 19: 857-864.
[111] Ouyang }, Shi Y, VaIin A, Xuan Y, GiII G (2009) Direcl binding of CoRIST1 lo SU
MO-2/3 conlribules lo gene-secific reression by lhe LSD1/CoRIST1/HDAC com
plex. Molecular Cell 34: 145-154.
[112] Ceballos-Chavez M, Rivero S, Garcia-Gutierrez P, Rodriguez-Paredes M, Garcia-
Dominguez M, Bhattacharya S, Reyes JC (2012) Control of neuronal differentiation
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
53
by sumoylation of BRAF35, a subunit of the LSD1-CoREST histone demethylase
complex. Proceedings of the National Academy of Sciences USA 109: 8085-8090.
[113] Chinnadurai G (2007) Transcriptional regulation by C-terminal binding proteins. The
International Journal of Biochemistry and Cell Biology 39: 1593-1607.
[114] Kagey MH, Melhuish TA, Powers SE, Wotton D (2005) Multiple activities contribute
to Pc2 E3 function. The EMBO Journal 24: 108-119.
[115] Kuusvamy M, Vi|ayaIingam S, Zhao L}, Zhou Y, Subramanian T, Ryerse }, Chin
nadurai G (2008) Role of the PLDLS-binding cleft region of CtBP1 in recruitment of
core and auxiliary components of the corepressor complex. Mc|ccu|ar an! Cc||u|ar Bi
ology 28: 269-281.
[116] Gocke CB, Yu H (2008) ZNF198 stabilizes the LSD1-CoREST-HDAC1 complex on
chromatin through its MYM-type zinc fingers. PLoS ONE 3: e3255.
[117] Gocke CB, Yu H, Kang J (2005) Systematic identification and analysis of mammalian
small ubiquitin-like modifier substrates. The Journal of Biological Chemistry 280:
5004-5012.
[118] Kunapuli P, Kasyapa CS, Chin SF, Caldas C, Cowell JK (2006) ZNF198, a zinc finger
protein rearranged in myeloproliferative disease, localizes to the PML nuclear bodies
and interacts with SUMO-1 and PML. Experimental Cell Research 312: 3739-3751.
[119] Denslow SA, Wade PA (2007) The human Mi-2/NuRD complex and gene regulation.
Oncogene 26: 5433-5438.
[120] Goodarzi AA, Kurka T, }eggo IA (2011) KAI-1 hoshoryIalion reguIales CHD3 nu
cleosome remodeling during the DNA double-strand break response. Naiurc Siruc
tural & Molecular Biology 18: 831-839.
[121] Ahn }W, Lee YA, Ahn }H, Choi CY (2009) CovaIenl con|ugalion of Groucho vilh SU
MO-1 modulates its corepressor activity. Biccncnica| an! Bicpnqsica| |cscarcn Ccnnu
nications 379: 160-165.
[122] David G, Nelune MA, DeIinho RA (2002) SUMO-1 modificalion of hislone deacely
lase 1 (HDAC1) modulates its biological activities. The Journal of Biological Chemistry
277: 23658-23663.
[123] Rosendorff A, Sakakibara S, Lu S, Kieff E, Xuan Y, DiBacco A, Shi Y, Shi Y, Gill G
(2006) NXI-2 associalion vilh SUMO-2 deends on Iysines required for lranscri
tional repression. Proceedings of the National Academy of Sciences USA 103: 5308-5313.
[124] SoIari I, Ahringer } (2000) NURD-comIex genes anlagonise Ras-induced vuIvaI de
velopment in Caenorhabditis elegans. Current Biology 10: 223-226.
[125] Poulin G, Dong Y, Fraser AG, Hopper NA, Ahringer J (2005) Chromatin regulation
and sumoyIalion in lhe inhibilion of Ras-induced vuIvaI deveIomenl in Caenorhab
ditis elegans. The EMBO Journal 24: 2613-2623.
Chromatin Remodelling 54
[126] Bouras T, Fu M, Sauve AA, Wang F, Quong AA, Perkins ND, Hay RT, Gu W, Pestell
RG (2005) SIRT1 deacetylation and repression of p300 involves lysine residues
1020/1024 within the cell cycle regulatory domain 1. The Journal of Biological Chemistry
280: 10264-10276.
[127] Jacobs AM, Nicol SM, Hislop RG, Jaffray EG, Hay RT, Fuller-Pace FV (2007) SUMO
modification of the DEAD box protein p68 modulates its transcriptional activity and
promotes its interaction with HDAC1. Oncogene 26: 5866-5876.
[128] Kim JH, Choi HJ, Kim B, Kim MH, Lee JM, Kim IS, Lee MH, Choi SJ, Kim KI, Kim SI,
Chung CH, Baek SH (2006) Roles of sumoylation of a reptin chromatin-remodelling
complex in cancer metastasis. Nature Cell Biology 8: 631-639.
[129] Ross S, esl }L, Zon LI, GiII G (2002) SUMO-1 modificalion reresses S3 lranscri
tional activation and modulates its subnuclear localization. Molecular Cell 10: 831-842.
[130] Ling Y, Sankpal UT, Robertson AK, McNally JG, Karpova T, Robertson KD (2004)
Modification of de novo DNA methyltransferase 3a (Dnmt3a) by SUMO-1 modulates
ils inleraclion vilh hislone deacelyIases (HDACs) and ils caacily lo reress lran
scription. Nucleic Acids Research 32: 598-610.
[131] Shan SF, Wang LF, Zhai JW, Qin Y, Ouyang HF, Kong YY, Liu J, Wang Y, Xie YH
(2008) ModuIalion of lranscrilionaI coreressor aclivily of rosero-reIaled homeo
box protein (Prox1) by SUMO modification. FEBS Letters 582: 3723-3728.
[132] Cheng }, Wang D, Wang Z, Yeh IT (2004) SINI1 enhances androgen recelor-de
pendent transcription through desumoylation of histone deacetylase 1. Molecular and
Cellular Biology 24: 6021-6028.
[133] Colombo R, Boggio R, Seiser C, Draetta GF, Chiocca S (2002) The adenovirus protein
Gam1 interferes with sumoylation of histone deacetylase 1. EMBO Reports 3:
1062-1068.
[134] Kirsh O, Seeler JS, Pichler A, Gast A, Muller S, Miska E, Mathieu M, Harel-Bellan A,
Kouzarides T, Melchior F, Dejean A (2002) The SUMO E3 ligase RanBP2 promotes
modification of the HDAC4 deacetylase. The EMBO Journal 21: 2682-2691.
[135] Knischeer I, van Di|k W}, OIsen }V, Mann M, Sixma TK (2007) NoncovaIenl inlerac
tion between Ubc9 and SUMO promotes SUMO chain formation. The EMBO Journal
26: 2797-2807.
[136] Ghisletti S, Huang W, Ogawa S, Pascual G, Lin ME, Willson TM, Rosenfeld MG,
GIass CK (2007) IaraIIeI SUMOyIalion-deendenl alhvays mediale gene- and sig
nal-specific transrepression by LXRs and PPARgamma. Molecular Cell 25: 57-70.
[137] Stankovic-Valentin N, Deltour S, Seeler J, Pinte S, Vergoten G, Guerardel C, Dejean
A, Leprince D (2007) An acetylation/deacetylation-SUMOylation switch through a
phylogenetically conserved psiKXEP motif in the tumor suppressor HIC1 regulates
transcriptional repression activity. Molecular and Cellular Biology 27: 2661-2675.
SUMO Tasks in Chromatin Remodeling
http://dx.doi.org/10.5772/55395
55
[138] Gao C, Ho CC, Reineke E, Lam M, Cheng X, Stanya KJ, Liu Y, Chakraborty S, Shih
HM, Kao HY (2008) Hislone deacelyIase 7 romoles IML sumoyIalion and is essen
tial for PML nuclear body formation. Molecular and Cellular Biology 28: 5658-5667.
[139] Li L, He S, Sun JM, Davie JR (2004) Gene regulation by Sp1 and Sp3. Biochemistry and
Cell Biology 82: 460-471.
[140] Sapetschnig A, Rischitor G, Braun H, Doll A, Schergaut M, Melchior F, Suske G
(2002) Transcription factor Sp3 is silenced through SUMO modification by PIAS1.
The EMBO Journal 21: 5206-5215.
[141] SlieIov , Saelschnig A, Wink C, Kruger I, Suske G (2008) SUMO-modified S3 re
presses transcription by provoking local heterochromatic gene silencing. |MBO |c
ports 9: 899-906.
[142] Kunert N, Wagner E, Murawska M, Klinker H, Kremmer E, Brehm A (2009) dMec: a
novel Mi-2 chromatin remodelling complex involved in transcriptional repression.
The EMBO Journal 28: 533-544.
[143] Leighl IR, GIossi D, KornfeId K (2005) SumoyIalion of LIN-1 romoles lranscri
tional repression and inhibition of vulval cell fates. Development 132: 1047-1056.
[144] Kim }, DanieI }, Ise|o A, Lake A, Krishna M, Xia L, Zhang Y, edford MT (2006) Tu
dor, MBT and chromo domains gauge the degree of lysine methylation. |MBO |c
ports 7: 397-403.
[145] Trojer P, Li G, Sims RJ, 3rd, Vaquero A, Kalakonda N, Boccuni P, Lee D, Erdjument-
Bromage H, Tempst P, Nimer SD, Wang YH, Reinberg D (2007) L3MBTL1, a histone-
methylation-dependent chromatin lock. Cell 129: 915-928.
[146] Seeler JS, Marchio A, Losson R, Desterro JM, Hay RT, Chambon P, Dejean A (2001)
Common properties of nuclear body protein SP100 and TIF1alpha chromatin factor:
role of SUMO modification. Molecular and Cellular Biology 21: 3314-3324.
[147] Stielow B, Kruger I, Diezko R, Finkernagel F, Gillemans N, Kong-a-San J, Philipsen S,
Suske G (2010) Epigenetic silencing of spermatocyte-specific and neuronal genes by
SUMO modification of the transcription factor Sp3. PLoS Genetics 6: e1001203.
[148] Bouwman P, Gollner H, Elsasser HP, Eckhoff G, Karis A, Grosveld F, Philipsen S,
Suske G (2000) Transcription factor Sp3 is essential for post-natal survival and late
tooth development. The EMBO Journal 19: 655-661.
[149] Nacerddine K, Lehembre F, Bhaumik M, Artus J, Cohen-Tannoudji M, Babinet C,
Pandolfi PP, Dejean A (2005) The SUMO pathway is essential for nuclear integrity
and chromosome segregation in mice. Developmental Cell 9: 769-779.
Chromatin Remodelling 56
Section 2
Chromatin Remodeling in Regulating Gene
Expression
Chapter 3
SWI/SNF Chromatin Remodeling
Complex Involved in RNA Polymerase II
Elongation Process in Drosophila melanogaster
Nadezhda E. Vorobyeva, Marina U. Mazina and
Semen A. Doronin
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/55877
1. Introduction
After more than a decade of studying the chromatin remodeling, better view of the function
mechanisms of the chromatin remodeling complexes has been developed. It was found that
chromatin remodeling complexes facilitate transcription of genes by reducing the nucleosome
density on specific genomic regions, such as enhancers and promoters, and increasing their
affinity to activators and activator-binding complexes. Moreover, the importance of the
chromatin remodeling complexes for transcriptional repression has been shown recently [1,
2]. Therefore chromatin remodeling complexes appear to be involved in nearly all aspects of
transcription regulation [3].
At present, the SWI/SNF chromatin remodeling complex is considered to be a significant player
in the process of RNA Polymerase II transcription initiation. Recruitment of the complex
recedes olher lranscrilionaI evenls and is imorlanl for lhe binding of lhe generaI lran
scriptional machinery [4j. The inlerIay belveen chromalin remodeIing and generaI lran
scriptional factors is so close, that these complexes may unite into physically stable formations
termed supercomplexes [5]. An example of such cooperation has been demonstrated for the
Drosophila SWI/SNF (dSWI/SNF) and TFIID complexes with the SAYP coactivator as a linchpin
unit [6].
Recently, abundant evidence concerning SWI/SNF participation in the process of RNA
Polymerase II elongation has been reported. It has been demonstrated that the SWI/SNF
complex does not leave the promoter after general transcriptional factors recruitment but is
involved in transcription elongation and co-transcriptional events. In addition SWI/SNF direct
2013 Vorobyeva et al.; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
influence on alternative splicing has been revealed in several studies. Using the human CD44
gene as a model it has been shown that SWI/SNF decreases the elongation rate of RNA
Polymerase II and facilitates the alternative exons incorporation. Moreover, biochemical
interaction of human SWI/SNF (hSWI/SNF) complex with splicing machinery including both
protein factor Sam68 and snRNAs of sliceosome has been demonstrated [7]. Later, a protein
complex containing p54
nrb
and PSF factors of mRNA splicing and one of the hSWI/SNF ATPase
subunit hBrg1 has been biochemically purified. The influence of the hBrg1 subunit knockdown
on the alternative exons incorporation in the TERT gene transcripts has been demonstrated. It
has been shown that hBrg1 knockdown leads to growth arrest and senescence of the human
cells [8].
Further the several evidences concerning SWI/SNF complex role in mRNP processing in insects
have been published. The knockdown of core Drosophila melanogaster SWI/SNF (dSWI/SNF)
subunits has been shown to facilitate the alternative splicing of several Drosophila genes both
in culturing cells and in the larvae [9]. Recently, physical association of the SWI/SNF complex
with pre-mRNP of Chironomus tentans was demonstrated both biochemically and by immune-
electron microscopy [10]. Thus participation of SWI/SNF complex in RNA Polymerase II
elongation coupled events is not the distinctive feature of mammals but the evolutionary
conserved phenomenon.
The participation in other important steps of the RNA Polymerase II elongation process has
been described for the SWI/SNF complex in addition to its significance for the alternative pre-
mRNP splicing. The accumulation of the SWI/SNF complex in the coding region of the genes
during active transcription has been demonstrated for the yeast. Yeast genes, tested in that
study, do not have introns. So, the presence of the SWI/SNF complex inside the coding region
of yeast genes could not be explained by its interaction with splicing machinery. ySWI/SNF
complex is rather important for the RNA Polymerase II elongation process. It has been shown,
that the swi2A mutant (the ATPase subunit of the yeast SWI/SNF) possesses heightened
sensitivity to the drugs that inhibit RNA Polymerase II elongation [11].
Similar data has been obtained for the human hsp70 gene which, like the yeast genes, contains
no inlrons al aII. The SWI/SNI bul nol ISWI comIex (anolher lye of chromalin remodeI
ing complex) binding to the coding region of the mouse hsp70 during active transcription
has been shown. Like the yeast counterpart, the homologous SWI/SNF complex of the human
has demonslraled sensilivily lo lhe drug (o-amanilin) vhich suresses RNA IoIymerase II
elongation. Amanitin treatment led to a dramatic decrease in the level of SWI/SNF binding
to the coding region of the hsp70 gene during active transcription. It has been shown that
oinl mulalions of lhe HSI1 faclor, vhich disruls lranscrilion eIongalion bul nol inilia
tion of hsp70 transcription, also causes a dramatic decrease in the SWI/SNF complex binding
to the gene [12].
Participation of the SWI/SNF complex in RNA Polymerase II elongation process on the intron-
less genes like yeast genes and human hsp70 indicates, that its function during transcription
is nol Iimiled lo sIicing evenls. Moreover, imorlance of lhe SWI/SNI for lhe RNA IoIymer
ase II elongation process itself has been demonstrated.
Chromatin Remodelling 60
Furthermore, the evidence concerning SWI/SNF complex participation in RNA Polymerase II
transition from the initiation to the productive elongation state has been described in the last
two years. Drosophila melanogaster developmental ftz-f1 gene was used as a model gene to
demonstrate the role of dSWI/SNF in RNA Polymerase II pausing process. It has been
demonstrated that dSWI/SNF complex participates in the organization of the repressed gene
state via the pausing of the RNA Polymerase II. Moreover dSWI/SNF has been revealed to be
important for the transient pausing of RNA Polymerase II during active transcription. So, the
significance of the dSWI/SNF for the proper elongation and Ser2 CTD phosphorylation marker
loading has been demonstrated for the same gene during the active transcription state [13].
Furthermore, the influence of the SWI/SNF complex on the RNA Polymerase II transition to
the elongation state has been reported for the human. It has been shown that human SWI/SNF
stimulates the occasional transcriptional elongation of the HIV-1 provirus in the absence of the
Tat activator thus disrupting the early termination of the short viral transcripts [14]. There are
a number of studies that indicate association of SWI/SNF with the process of RNA Polymerase
II elongation but the exact function of the complex during the process remains to be seen.
The first and simplest model of SWI/SNF function during elongation that comes to mind is
that SWI/SNF assists RNA Polymerase II in overcoming the nucleosome barriers during
elongation. This idea complies with the general view on SWI/SNF functions but is not in a
good correlation with the results of the splicing studies. According to that studies the
SWI/SNF complex slows down RNA Polymerase II elongation rate rather than stimulates it.
This conclusion has been made by investigators on the base of the mutation and knockdown
experiments where the incorporation rate of longer exons during transcription processing
decreased upon SWI/SNF complex disruption. One more evidence could be concluded from
these splicing studies: the RNA Polymerase II complex does not require the SWI/SNF complex
for lhe roduclive eIongalion on lhe inlron-conlaining genes. The SWI/SNI comIex knock
down performed in the experiments impaired splicing of the genes transcripts but had no effect
on the total transcription level [7]. On the other hand, it has been demonstrated recently that
RNA Polymerase II complex alone could overcome the nucleosome barrier, suggesting that
there is no urgent need for the special remodeling enzymes [15]. Thus, SWI/SNF functions
during transcription elongation are not completely clear and still need to be investigated.
The Drosophila melanogaster (d) dSWI/SNF chromatin remodeling complex is comprised of the
two types of the subcomplexes PBAP and BAP (in mammals, PBAF and BAF respectively).
These subcomplexes share several common subunits and Brahma ATPase, but also contain
several specific subunits: OSA in the BAP complex and Polybromo, Bap170 and SAYP in PBAP
[16][17]. These subcomplexes control the expression of different, but partially overlapping
gene patterns and are involved in different functions of the dSWI/SNF complex. For example,
BAP but not the PBAP subcomplex is important for proper cell cycle progression [18]. However
one question still remains uninvestigated: are there differences in the molecular mechanisms
of the subcomplexes functioning, e.g., in the way they remodel histones or in the specific
actions they perform.
The main idea of lhis vork is lo cIarify lhe nexl issue: vhich of lhe lvo dSWI/SNI subcomIex
es is invoIved in lhe nev funclion of lhe dSWI/SNI comIex and accomanies RNA IoIymer
SWI/SNF Chromatin Remodeling Complex Involved in RNA Polymerase II Elongation Process
http://dx.doi.org/10.5772/55877
61
ase II during transcription elongation. For that goal we have generated and characterized
antibodies against the BAP170 and OSA subunits of the PBAP and BAP subcomplexes of the
dSWI/SNI comIex resecliveIy. Using lhem ve have invesligaled lhe changes in dislribu
tion of the subcomplexes along the ftz-f1 and hsp70 genes upon activation of transcription.
2. Results
2.1. Polyclonal antibodies against PBAP and BAP subcomplexes specific subunits
generation and purification
Plasmids, containing two different fragments of BAP170 protein tagged with a 6xHis, for
expression in prokaryotic system were generously provided by P. Verrijzer and Y. Moshkin
(Erasmus University Medical Center, Rotterdam, The Netherlands)[16]. Expressed antigens
were purified on Ni-NTA agarose. The quality of the purified antigens was examined by PAGE
with subsequent Coomassie blue staining (Figure1A). Specific antibodies against BAP170
protein were raised in rabbits by series of immunization with both of the antigens. Antibodies
were affinity purified from the obtained sera by the column with the antigens immobilized.
The quality of the generated antibody was analyzed by Western blot (Figure1B). Drosophila
melanogaster embryonic nuclear extract (from 0-12h embryo) were loaded on the Western blot
for the analysis. Thus the affinity purified antibodies are effective against Bap170.
Antibodies against OSA specific subunit of BAP subcomplex were generated by the same
scheme as BAP170 antibodies was. Sequence coding 108-330 aa of OSA were subcloned into
pET system for the antigen expression in E.coli. Purified OSA antigen was used for the
immunization (Figure1C). After series of immunization sera was affinity purified by OSA
antigen immobilized on the sepharose column. The sera and purified antibodies were analyzed
on Western blot with Drosophila embryonic nuclear extract loaded (Figure1D).
2.2. Antibodies against PBAP and BAP-specific subunits precipitate the common subunit
but do not precipitate each other
The SWI/SNF chromatin remodeling complex of Drosophila is comprised of two different
subclasses of remodeling complexes: PBAP and BAP. These subcomplexes reveal different
targeting through the Drosophila genome and possess different functions. But the main
divergence between the subcomplexes is their ability to form protein complexes, which could
be separated biochemically. The specific subunits of the subcomplexes interact with the
common subunits of dSWI/SNF (like BRM, MOR, BAP111, SNR1 etc.) but fail to precipitate
the specific subunits of another subcomplex.
To confirm the specificity of antibodies generated against specific subunits of dSWI/SNF complex
the immunoprecipitation experiment was performed (Figure2). The subcomplexes of the dSWI/
SNI comIex vere reciilaled from lhe crude Iysale of lhe S2 Schneider ceIIs by lhe general
ed antibodies against BAP170 and OSA subunits. S2 Schneider cells are the most widely used
cells for the investigation of Drosophila proteins [19]. Both generated antibodies successfully
Chromatin Remodelling 62
precipitated the corresponding proteins and completely depleted them from the cell lysate. Both
specific subunits of the PBAP and BAP subcomplexes (BAP170 and OSA correspondingly)
successfully co-precipitated the common MOR subunit of dSWI/SNF but failed to precipitate
the specific subunits of other subcomplex. Therefore the generated antibodies against BAP170
and OSA could specifically precipitate the corresponding subcomplex.
Figure 2. The immunoprecipitation of the dSWI/SNF protein complex from the S2 Schneider cells lysate by antibodies
against BAP170 and OSA subunits (in input; out output; ip immunoprecipitation) A) The immunoprecipitation of
the dSWI/SNF complex with the anti-BAP170 antibodies. The Western blot was stained with the antibodies against
SAYP, BAP170 and MOR subunits of the dSWI/SNF complex. As a negative control for the immunoprecipitation serum
of non-immunized rabbits (IgG fraction) was taken. B) The immunoprecipitation of the dSWI/SNF complex with the
anti-OSA antibodies. The Western blot was stained with the antibodies against OSA, BAP170 and MOR subunits of the
dSWI/SNF complex. As a negative control for the immunoprecipitation serum of non-immunized rabbits (IgG fraction)
was taken.
Figure 1. Polyclonal antibodies against PBAP and BAP subcomplexes specific subunits generation and purification A)
The antigens, used for the antibodies against BAP170 subunit generation, were purified and loaded on the PAGE
(Coomassie blue staining) B) The Drosophila embryonic nuclear extract was loaded on the Western blot and stained
wiLh Lhe serun o rabbiL innunized wiLh A170 anLigens (n), Lhe serun beore innunizaLion (r) and ainiLy puri
fied antibodies against BAP170 protein. The BAP170 protein recognized with the antibodies is marked with asterisk.
C) The anLigen, used or Lhe anLibodies againsL OSA subuniL generaLion, was puriied and loaded on Lhe AGL (Coo
massie blue staining) D) The Drosophila embryonic nuclear extract was loaded on the Western blot and stained with
Lhe serun o rabbiL innunized wiLh OSA anLigen (n), Lhe serun beore innunizaLion (r) and ainiLy puriied anLi
bodies against OSA protein. The OSA protein recognized with the antibodies is marked with asterisk.
SWI/SNF Chromatin Remodeling Complex Involved in RNA Polymerase II Elongation Process
http://dx.doi.org/10.5772/55877
63
2.3. Both PBAP and BAP subcomplexes of dSWI/SNF chromatin remodeling complex are
detected on the promoter of the ftz-f1 gene
The generated antibodies were tested in the chromatin immunoprecipitation experiment on
S2 Schneider cells. According to our previous studies, the promoter of the ftz-f1 ecdysone
cascade gene with a high affinity binds the PBAP subcomplex of the dSWI/SNF [13]. It was
demonstrated for the PB- and SAYP-specific subunits of PBAP subcomplex. Therefore, BAP170
is expected to bind the promoter of the ftz-f1 gene. There are no published results about the
BAP subcomplex binding to the target genes. But there are some data which represents the
PBAP and BAP subcomplexes overlapping targeting across the Drosophila genome. These data
were obtained from the experiments with the polythene chromosome staining [18]. So, we
expected both the BAP and PBAP subcomplexes binding to the ftz-f1 gene promoter.
Two types of negative controls were used in chromatin immunoprecipitation experiment: PrA
resin without any antibody bound (to demonstrate that there is no non-specific binding of ftz-
f1 promoter) and secondly, primers for the 28S rDNA region amplification for analysis the
specificity of binding to ftz-f1 promoter region but not throughout the genome. The locus of
rDNA was chosen as a negative control because in our previous studies it did not bind the
common subunits of the dSWI/SNF complex [13j. The resuIls of chromalin immunoreciila
tion are shown on Figure 3. As expected, both generated antibodies against the PBAP and BAP
subcomplexes successfully precipitated the promoter region of ftz-f1 gene (0 primer pair in
the description) while showed no affinity to the 28S rDNA locus.
Figure 3. The immunoprecipitation of the chromatin (ChIP) from the S2 Schneider cells with antibodies against
BAP170 and OSA subunits of dSWI/SNF complex. The blue bar represents the RT-PCR analysis of the ChIP experiment
with the primers to the ftz-f1 promoter region (0 point in the description). The green bar represents the analysis
wiLh Lhe priners Lo Lhe 28S rDNA locus (negaLive conLrol). The resulLs o Lhe chronaLin innunoprecipiLaLion experi
ment were calculated as a % of precipitated chromatin relative to input fraction.
Chromatin Remodelling 64
Therefore we have proved the fact of simultaneous PBAP and BAP recruitment on the
promoter region of the same gene. The ftz-f1 gene is an example of the target gene for both of
the subcomplexes.
2.4. PBAP but not BAP subcomplex of the dSWI/SNF complex is accumulated at the coding
region of the ftz-f1 gene after transcription activation
In our previous studies we have described in details the scheme which makes possible to
activate the Drosophila developmental ftz-f1 gene in S2 Schneider cells [13]. A simultaneous
recruitment of the BAP170 and OSA subunits to the promoter of this gene in a non-activated
stage (in normal S2 Schneider cells) was demonstrated above. To evaluate which one of the
dSWI/SNF subcomplexes assists RNA Polymerase II in elongation process we have studied
the re-distribution of the subunits on the ftz-f1 gene upon transcription activation.
Earlier, we have described the multistep scheme of the ftz-f1 gene activation by the addition and
subsequent withdrawal of the 20 hydroxyecdysone (below, referred to simply as ecdysone)
hormone into the S2 Schneider cells culturing medium [13]. The main steps of the induction
system are schematically presented in the Figure 4. The ecdysone is the main regulator of the
ecdysone cascade and its addition to the cell medium induces the expression of the DHR3 nuclear
receptor, the activator protein for the ftz-f1 gene. In spite of DHR3 activator recruitment on the
ftz-f1 promoter soon after DHR3 protein expression, the activation of the ftz-f1 transcription does
nol slarl unliI lhe IeveI of lhe ecdysone in lhe medium decreases cIose lo basaI IeveI. Irevious
ly, we have shown that at the high ecdysone concentration, the DHR3 receptor settles on the
promoter region of the ftz-f1 gene and slimuIales lhe formalion of lhe IIC comIex by increas
ing the level of TFIID and dSWI/SNF complexes and as a consequence RNA Polymerase II binding
to the promoter. But transcription of the ftz-f1 gene al lhis slage does nol slarl because recruil
ed RNA Polymerase II is not in fully active state. It bears the Ser5 phosphorylation marker on its
CTD domain but lacks the Ser2 phosphorylation marker which is an illustrator of a RNA
Polymerase II elongation-competent state. So, the ftz-f1 gene in our scheme of activation has
preliminary activation state with pre-recruited activator and with RNA Polymerase II poised
for the transcription elongation. This phenomenon is called RNA Polymerase II pausing. The
ecdysone withdrawal from the culturing medium causes removing of the repressive signal and
dislurbs lhe RNA IoIymerase II comIex ausing slale. Thal Ieads lo lhe roduclive lranscri
tion elongation and synthesis of the ftz-f1 gene full-length transcripts.
Two steps, required to verify the ftz-f1 activation scheme were performed: the 1 M ecdysone
addition (overnight) and subsequent triple washing with the fresh Schneider medium. The
level of the ftz-f1 gene transcription was measured in all activation stages: in the ecdysone-free
medium (), after overnight cultivation in the ecdysone-containing medium (+), and finally 4
hours after ecdysone withdrawal from the culturing medium (+;). As expected, the ftz-f1 was
not transcribed during () and (+) stages and significantly activated 4 hours after the ecdysone
removal in (+;) stage (see Figure 5).
Next, the distribution of the BAP170 and OSA subunits of the dSWI/SNF complex along the
ftz-f1 gene on differenl slages of aclivalion vas anaIyzed by lhe chromalin immunoreciila
tion technique (see Figure 6A and B). Both of the proteins were readily bound to the promoter
SWI/SNF Chromatin Remodeling Complex Involved in RNA Polymerase II Elongation Process
http://dx.doi.org/10.5772/55877
65
region of the studied gene with a high affinity in all stages of activation. The level of the
promoter binding of the BAP170 protein increased twice in (+;-) stage after the ftz-f1 lranscri
tion activation. The amount of OSA subunit bound to the ftz-f1 promoter was increased in (+)
stage during the stage of RNA Polymerase II recruitment and was not changed significantly
after the withdrawal of the transcriptional block. Thus both of the dSWI/SNF subcomplexes
bind the promoter region of the ftz-f1 gene in all stages of activation.
The patterns of the PBAP and BAP subcomplexes distribution in the coding region of the ftz-
f1 gene during active transcription differ distinctly. The significant increase in the BAP170
subunit binding at the coding region of the ftz-f1 gene during (+;-) stage of active transcription
was detected. At that stage the binding level of the BAP170 subunit in the coding region
exceeded by a factor of several times the negative control region of the 28S rDNA, while in all
other stages was close to the background. At the same time, the binding level of the OSA
subunit of the BAP subcomplex was close to the background throughout the coding region of
the ftz-f1 gene during all transcriptional stages.
Figure 4. The scheme representation of the Drosophila developmental ftz-f1 gene LranscripLion inducLion by Lhe ecdy
sone hormone in S2 Schneider cells. A) The ftz-f1 gene is not expressed in the normal S2 Schneider cells. The promoter
of the gene is not bound with the DHR3 activator and contains few RNA Polymerase II. The (-) mark on the scheme
represents low ecdysone titer in the medium of the culturing cells. B) After ecdysone addition (represented with the
(+) mark) the DHR3 activator is recruited on the ftz-f1 promoter region. The DHR3 binding to the promoter stimulates
RNA Polymerase II loading. Transcription of the ftz-f1 gene is initiated but the RNA Polymerase II complex pauses close
Lo Lhe pronoLer. The NA olynerase aL (+) sLage is noL in Lhe sLaLe conpeLenL or Lhe elongaLion and is noL phos
phorylated on Ser2 of the CTD domain. The ftz-f1 gene is not transcribed at (+) stage. C) After ecdysone withdrawal
ron Lhe culLuring nediun Lhe block on Lhe NA olynerase elongaLion is disposed. AL Lhe poinL o LransienL paus
ing (it completely coincides with the region of pausing at (+) stage) the RNA Polymerase II is phosphorylated on Ser2
of the CTD domain and continues the moving into the coding region of the gene. A few hours after ecdysone titer
decreasing the ftz-f1 gene is actively transcribed.
Chromatin Remodelling 66
Thus the accumulation of the BAP170-specific subunit of the PBAP subcomplex in the coding
region of the ftz-f1 gene during the active stage of the transcription was demonstrated. Thereby
the participation of the PBAP but not the BAP subcomplex of the dSWI/SNF chromatin
remodeling complex in the elongation process of the RNA Polymerase II was shown.
2.5. PBAP subcomplex of the dSWI/SNF complex is accumulated at the coding region of the
hsp70 gene after transcription activation
To prove the wideness of the observation and non-specificity of the finding to the model of
gene activation the recruitment of the PBAP subcomplex on the coding region of the active
gene was studied in another system (on the model of hsp70 gene).
The hsp70 gene model system is widely used in transcriptional machinery studies. The model
uses Drosophila cells treatment with heat shock conditions (37 C for 20 min) for induction while
the normal temperature for culturing is 25-28 C [20j. In lhose slress condilions lhe lranscri
tional system of the Drosophila cell is drastically changed. Almost all of the genes stop being
transcribed while several genes (called heat shock genes) exhibit very fast and high level of
lranscrilionaI aclivalion. Il shouId be laken inlo accounl lhal in such slress and non-hysio
logical conditions the transcriptional machinery could not function by the same mechanisms
as in the normal cell. But nevertheless the hsp70 gene represents the system with the highest
induction level which was ever being described for the Drosophila. Therefore these genes are
a good model for the investigation of the subtle changes on the coding region of the gene during
transcription activation.
To verify the induction scheme the S2 Schneider cells were exposed to the heat shock conditions
(37C) and the hsp70 gene transcription was measured before and after the heat shock. The
Figure 5. The ftz-f1 gene transcription induction in the S2 Schneider cells with the ecdysone hormone addition (+
state) and sequential removing (+;- state). The cells of the all states were collected for the analysis at the same time.
The ecdysone was added overnight to the cells of (+) and (+;-) states and in (+;-) state it was removed from the cells
medium 4 hours before analysis. The Y axis represents the level of transcription induction relative to non-induced
conditions.
SWI/SNF Chromatin Remodeling Complex Involved in RNA Polymerase II Elongation Process
http://dx.doi.org/10.5772/55877
67
fifty fold increase in hsp70 gene transcription was detected after the heat shock. The hsp70
lranscrilion induclion vas measured by ReaI-Time ICR using rimer 7 from lhe descri
tion list.
To prove the involvement of the PBAP subcomplex in the process of RNA Polymerase II
elongation the BAP170 subunit distribution was analyzed along the hsp70 gene before and after
Figure 6. The BAP170 (A) and OSA (B) subunits distribution along the ftz-f1 gene at different stages of transcription
activation. The analysis was performed by chromatin immunoprecipitation technique on the S2 Schneider cells which
was growing in the ecdysone-free medium (), after overnight cultivation in the ecdysone-containing medium (+), and
finally 4 hours after ecdysone withdrawal from the culturing medium (+;). The positions of primer pairs which were
used for the RT-PCR analysis of the ftz-f1 gene are shown on the scheme of the gene. The precipitation level of the
negaLive conLrol (28S rDNA region) is shown on Lhe graphs as a grey line. The resulLs o Lhe chronaLin innunoprecipi
tation experiment were calculated as a % of precipitated chromatin relative to input fraction.
Chromatin Remodelling 68
heat shock (Figure 7). The BAP170 subunit of the PBAP subcomplex binding to the promoter
region was detected both in the repressed and active state of the gene. But several times
increase in the level of the BAP170 subunit binding inside the hsp70 coding region was
observed after transcription activation.
Thus the accumulation of the PBAP subcomplex inside the coding region upon transcription
activation was demonstrated not only for the ftz-f1, but also for the hsp70 gene.
3. Conclusions
Several pieces of evidence concerning SWI/SNF participation in the elongation process of RNA
Polymerase II have emerged during the last few years [21]. These data describe SWI/SNF
complex participation both in elongation process of RNA Polymerase II and in transcription
elongation coupled events like pre-mRNP splicing [22]. There have been a few studies to date
but there can be no doubt that the SWI/SNF complex travels with the RNA Polymerase II along
the gene during active transcription. This research area is only starting to be investigated and
attracts much attention because the participation in transcription elongation represents a novel
function of the SWI/SNF complex.
The properties of the SWI/SNF complex is under extensive study because subunits of the
complex are indispensable for the living organism [23][24]. The ability to possess all types of
nucIeosome remodeIing aclivilies dislinguishes il from olher chromalin remodeIing com
plexes [24]. The recent studies concerning the significance of SWI/SNF complex for the cell
reprogramming and association of the SWI/SNF subunits mutations with cancer susceptibility
have made this complex interesting for a wide circle of investigators [25][26].
Figure 7. The BAP170 subunit distribution along the hsp70 gene aL heaL shock (red) and nonheaL shock (blue) condi
tions. The analysis was performed by chromatin immunoprecipitation technique on the S2 Schneider cells treated with
the heat shock conditions (37C) and harvested at room temperature (presented as heat shock and control line on
the graph). The positions of primer pairs which were used for the RT-PCR analysis of the hsp70 are shown on the
schene o Lhe gene. The resulLs o Lhe chronaLin innunoprecipiLaLion experinenL were calculaLed as a o precipi
tated chromatin relative to input fraction.
SWI/SNF Chromatin Remodeling Complex Involved in RNA Polymerase II Elongation Process
http://dx.doi.org/10.5772/55877
69
It has been known for a few years that the SWI/SNF complex is comprised of PBAP and BAP
types of subcomplexes (in mammals, PBAF and BAF respectively) [16]. The subcomplexes
have partially overlapping but mostly distinct targeting throughout the genome [27]. These
subcomplexes possess different functions. Thus, the BAP but not the PBAP complex is working
in the cell cycle regulating pathway [18]. For the BAF250/ARID1-specific subunit of the BAP
subcomplex an activity of the E3 ligase and ability to ubiquitinylate histone H2B has been
demonstrated [28]. The capabilities of these subcomplexes to possess different functions
obviously lie in their specific subunits.
The main idea of lhe currenl sludy vas lo invesligale vhich one of lhe subcomIexes arlic
ipates in the new functions of SWI/SNF during transcription elongation. The model describing
results of this study is presented in Figure 8 A and B.
The drosophila developmental ftz-f1 gene was chosen as a model for the investigation. The ftz-
f1 gene transcription induction was performed by developmental ecdysone hormone (so
conditions were close to natural). This system of induction has advantages both in terms of
the physiological non-stress conditions of gene activation and the simplicity of performing
chromatin immunoprecipitation experiments on the culturing cells. The accumulation of the
PBAP but not BAP subcomplex inside the coding region upon transcription activation was
observed by chromatin immunoprecipitation with antibodies against specific subunits of the
subcomplexes. Thus, for the Drosophila melanogaster it was demonstrated that the PBAP
subcomplex of dSWI/SNF is not only important for the transcriptional initiation events but
also assists the RNA Polymerase II in transcription elongation.
The discovered effect was confirmed in another inducible gene system. The hsp70 gene is
induced by subjecting the cell to the stress heat shock conditions and the transcription level
after induction is characterized by the extremely high rate. In the inducible system of the hsp70
Figure 8. The descriptive model of the PBAP and BAP subcomplexes of the dSWI/SNF chromatin remodeling complex
re-distribution along the gene before and after transcription activation. Both of the subcomplexes are bound to the
promoter region before transcription induction (A). At the active transcription state the PBAP subcomplex of
dSWI/SNF complex is detected on the coding region of the gene (B). The PBAP subcomplex of the dSWI/SNF assists
the RNA Polymerase II in the process of transcription elongation.
Chromatin Remodelling 70
gene the significant accumulation of the PBAP subcomplex inside the coding region upon
lranscrilion aclivalion vas observed. Thus IAI subcomIex arlicialion in RNA IoIy
merase II elongation is not restricted to the solitary gene, but is realized at least on two inducible
genes of Drosophila melanogaster.
The specification of the SWI/SNF subcomplex participation in the functions during the RNA
Polymerase II elongation process will make easier further investigations of these functions.
The presence of the SWI/SNF complex inside the coding region of the intron-less genes testifies
to the existence of some other functions during elongation in addition to the participation in
the splicing process. The nature of these functions is not fully understood yet. But the functional
link of the SWI/SNF complex with the process of RNA Polymerase II elongation definitely
exists. It was shown for the yeast that mutants of the SWI/SNF subunit display heightened
sensitivity to the drugs, inhibitors of transcription elongation [11]. The participation of the
PBAP subcomplex in regulation of the RNA Polymerase II elongation rate has been described
for the Drosophila using the ftz-f1 gene as a model system. It was demonstrated that knockdown
of the PBAP subcomplex subunit causes decrease in the level of the elongated RNA Polymerase
II on the coding region, but at the same time it does not reduce the level of the promoter-bound
RNA Polymerase II complex. Moreover, the PBAP subunit knockdown leads to a considerable
decrease in level of the RNA Polymerase II CTD Ser2 phosphorylation state but does not
change the Ser5 phosphorylation. The participation of the SWI/SNF complex in the process of
CTD Ser2 phosphorylation could be one of the chromatin remodeling complex functions
during elongation. This marker of active transcription is loaded close to the promoter area and
increases towards the 3 end of the gene. The new kinase which is responsible for the Ser2 CTD
phosphorylation RNA Polymerase II elongation through the coding region of the gene has
been described recently [29]. The participation of SWI/SNF in this process could explain the
observed accumulation of the complex inside the coding region of the gene upon transcription
activation.
Experimental procedures
Drosophila embryonic nuclear extract purification
The Method of the Drosophila embryonic nuclear extract purification was described earlier in [30].
Experiments with S2 Schneider cell
The protocol of the Drosophila Schneider line 2 (S2) cells cultivation and ftz-f1 gene induction
was in the details described in [13]. For the hsp70 gene transcription induction cells were
incubated at the 37C in water bath for the 20 min and briefly cooled to the RT. To extract
proteins for IP, S2 Schneider cells were lysed in 10 mM Hepes (pH 7.9) buffer containing 5 mM
MgCl2, 0.5% Nonidet P-40, 0.45 M NaCl, 1 mM DTT, and complete protease inhibitor mixture
(Roche). IP was performed as described earlier [31].
Chromatin immunoprecipitation
For one ChIP experiment 3x10
6
of S2 Schneider cells were taken. Crosslinking was made by 15
min incubation with 1,5% formaldehyde and was stopped by addition of 1/20 volume of the
SWI/SNF Chromatin Remodeling Complex Involved in RNA Polymerase II Elongation Process
http://dx.doi.org/10.5772/55877
71
2,5M glycine. Cells were triple washed with cold (4C) PBS and resuspended in SDS-containing
buffer (50 mM HEPES-KOH pH 7.9, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0,1%
deoxycholate Na, 0,1% SDS, Protease inhibitors cocktail (Roche)). Chromatin was sheared to
DNA size of ar. 700 b.. and cenlrifuged (16 rcf, 20 min). Ior lhe one chromalin immuno
precipitation were taken: 10 g of antibodies, 15 l of PrA sepharose (Sigma), ssDNA and BSA
u lo 1 mg/mI. The reciilaled chromalin vas sequenliaIIy vashed by buffers: SDS-conlain
ing buffer, SDS-containing buffer with 0,5M NaCl, LiCl-containing buffer (20mM Tris-HCl pH
8,0, 1mM EDTA, 250 mM LiCl, 0,5% NP40, 0,5% Deoxycholate Na) and TE buffer (20mM Tris-
HCl pH 8,0, 1mM EDTA). Precipitated complexes were eluted by incubation in buffer (50mM
Tris-HCl pH 8,0, 1mM EDTA, 1% SDS) at RT. Eluted chromatin was de-crosslinked for the 16
h at 65C (16 l of 5M NaCl was added) and treated with the 3 units of proteinase K for 4 h at
55C (5 l of 0,5 M EDTA was added to each sample). DNA was purified with the phenol/
chloroform extraction and precipitated with the isopropanol. The precipitate was dissolved in
TE buffer and subjected to the Real-Time PCR (RT PCR) analysis. The result of the chromatin
immunoprecipitation experiment was calculated as a rate of precipitated fraction relative to
the input chromatin fraction (presented as a percent). Each point was measured in at least five
experiments and the mean value was calculated.
RNA purification and cDNA synthesis
The RNA purifications were performed as described in [13].
Primers for qPCR
ftz-f1 gene fragments:
Region Forward primer Reverse primer
1 ACAAAAAACTGCTGAAGAAGAGACC ACTGTGGGTATGGCATTATGAAAG
0 GAGGCAGAGGCAGCGACG GCTTTGTCATCTATGTGTGTGTTGTTG
1 AGTCAATCGAGATACGTGGTTGATG GTAACGCTTTGTCATCTATGTGTGT
2 GTTCTCTTGCTGCGTTGCG GAAAGTGGGTCACGAATTTATTGC
3 ACCGCAACCTATTTTACTACC TTAGAAGACCGAAGAGTTATCC
4 ACAACAACAATAACAACGACAATGATGC CTGATTGCCGCTGCCACTCC
5 CAGCAGCAACAGCAACAGAATATC GCGAGTGTGAGGAGGTGGTG
6 CTCCTCACACTCGCAACAGAGC AGCAGCATGTAGCCACCGC
7 CTCCGTAAGAGTCAGCTTTAAC CAGGGACATCACACATACG
8 CAACGCTTCACAGAAACAAACG GTTGTACAAAGCGGCGTATGC
9 GTTCGAGCGGATAGAATGCGT GATATGCTTGCTGGTAGCCCG
10 GAGGAGGAGGTGGCAATAATGC GATCCTATTCCAGCCTCGTGG
11 TTCAATGCACATTCTGCCG GCAGCAACATGGTTCAAAGC
12 AACATCTTACCGGAAATCCATGC ATCTCCATGAGCAGCGTTTGG
Table 1. Primers for the amplification of the ftz-f1 gene fragments.
Chromatin Remodelling 72
hsp70 gene fragments:
Region Forward primer Reverse primer
-2 GCAACTAAATTCTAATACACTTCTC TGCTGCGTTTCTAAAGATTAAAG
-1 GTGACAGAGTGAGAGAGCATTAGTG ATTGTGGTAGGTCATTTGTTTGGC
0 TTGAATTGAATTGTCGCTCCGTAG ACATACTGCTCTCGTTGGTTCG
1 GCAGTTGATTTACTTGGTTG AACAAGCAAAGTGAACACG
2 ATGAGGCGTTCCGAGTCTGTG CTACTCCTGCGTGGGTGTCTAC
3 CGCTGAGAGTCGTTGAAGTAAG GTGCTGACCAAGATGAAGGAG
4 GCTGTTCTGAGGCGTCGTAGG TTGGGCGGCGAGGACTTTG
5 CCTCCAGCGGTCTCAATTCCC GACGAGGCAGTGGCATACGG
6 GGGTGTGCCCCAGATAGAAG TGTCGTTCTTGATCGTGATGTTC
7 CTTCTCGGCGGTGGTGTTG GTAAAGCAGTCCGTGGAGCAG
8 AGCTAAAATCAATTTGTTGCTAACTT AGGTCGACTAAAGCCAAATAGA
9 GCTGTTTAATAGGGATGCCAAC TATTGTCAGGGAGTGAGTTTGC
10 GTTGTTGAACTCCGTAACCATTCTG GCCCCGCTAAGTGAGTCCTG
Table 2. Primers for the amplification of the hsp70 gene fragments.
28S rDNA:
Forward primer Reverse primer
AGAGCACTGGGCAGAAATCACATTG AATTCAGAACTGGCACGGACTTGG
Table 3. Primers for the amplification of the 28S rDNA locus fragment.
Acknowledgements
We thanks S.G. Georgieva for her critical reading of the manuscript; P. Verrijzer and Y.
Moshkin (Erasmus University Medical Center, Rotterdam) for the constructs with sequences
coding BAP170 antigens and for the antibodies against MOR (described in [16]). This work
was supported by the program Molecular and Cell Biology of the Russian Academy of
Sciences, N.V. were supported by the RF Presidential Program in Support of Young Scientists,
MK-5961.2012.4 and MD-4874.2011.4. N.V. acknowledges a fellowship from Dmitry Zimin
Dynasty Foundation.
SWI/SNF Chromatin Remodeling Complex Involved in RNA Polymerase II Elongation Process
http://dx.doi.org/10.5772/55877
73
Author details
Nadezhda E. Vorobyeva
1*
, Marina U. Mazina
1
and Semen A. Doronin
2
*Address all correspondence to: [email protected]
1 Grou of Transcrilion and mRNA Transorl, Inslilule of Gene ioIogy, Russian Acade
my of Sciences, Moscow, Russia
2 Dearlmenl of ReguIalion of Gene Ixression, Inslilule of Gene ioIogy, Russian Acade
my of Sciences, Moscow, Russia
References
[1] Rendina, R, Slrangi, A, AvaIIone, , & Giordano, I. a170, a subunil of lhe Droso
hiIa IAI chromalin remodeIing comIex, negaliveIy reguIales lhe IGIR signaI
ing., Genetics, Sep. (2010). , 186(1), 167-181.
[2] Baig, J, Chanut, F, Kornberg, T. B, & Klebes, A. The chromatin-remodeling protein
Osa interacts with CyclinE in Drosophila eye imaginal discs., Genetics, Mar. (2010). ,
184(3), 731-744.
[3] Wu, }, Lessard, }, & Crablree, G. Underslanding lhe Words of Chromalin ReguIa
tion, Cell, (2009). , 136(2), 200-206.
[4] Melivier, R, Ienol, G, Hbner, M. R, Reid, G, rand, H, Kos, M, & Gannon, I. Islro
gen recelor-aIha direcls ordered, cycIicaI, and combinaloriaI recruilmenl of cofac
tors on a natural target promoter., Cell, Dec. (2003). , 115(6), 751-763.
[5] Nakamura, T, Mori, T, Tada, S, Krajewski, W, Rozovskaia, T, Wassell, R, Dubois, G,
Mazo, A, Croce, C. M, & Canaani, I. ALL-1 is a hislone melhyIlransferase lhal as
sembles a supercomplex of proteins involved in transcriptional regulation., Mc|ccu
lar Cell, Nov. (2002). , 10(5), 1119-1128.
[6] Vorobyeva, N. E, Soshnikova, N. V, Nikolenko, J. V, Kuzmina, J. L, Nabirochkina, E.
N, Georgieva, S. G, & Shidlovskii, Y. V. Transcription coactivator SAYP combines
chromatin remodeler Brahma and transcription initiation factor TFIID into a single
supercomplex., Proceedings of the National Academy of Sciences of the United States of
America, Jul. (2009). , 106(27), 11049-11054.
[7] alsche, I, Yaniv, M, & Muchardl, C. The human SWI/SNI subunil rm is a reguIa
tor of alternative splicing., Nature Structural & Molecular Biology, Jan. (2006). , 13(1),
22-29.
[8] Ito, T, Watanabe, H, Yamamichi, N, Kondo, S, Tando, T, Haraguchi, T, Mizutani, T,
Sakurai, K, Fujita, S, Izumi, T, Isobe, T, & Iba, H. Brm transactivates the telomerase
Chromatin Remodelling 74
reverse lranscrilase (TIRT) gene and moduIales lhe sIicing allerns of ils lran
scripts in concert with p54(nrb)., The Biochemical Journal, Apr. (2008). , 411(1),
201-209.
[9] Waldholm, J, Wang, Z, Brodin, D, Tyagi, A, Yu, S, Theopold, U, Farrants, A. K. , &
Visa, N. SWI/SNF regulates the alternative processing of a specific subset of pre-
mRNAs in Drosophila melanogaster., BMC Molecular Biology, Jan. (2011). , 12(46),
1-12.
[10] Tyagi, A, Ryme, }, rodin, D, & OslIund, A. K. Iarranls, and N. Visa, SWI/SNI asso
ciates with nascent pre-mRNPs and regulates alternative pre-mRNA processing.,
PLoS Genetics, May (2009). , 5(5), e1000470.
[11] Schwabish, M, & Struhl, K. The Swi/Snf complex is important for histone eviction
during transcriptional activation and RNA polymerase II elongation in vivo., Mc|cc
ular and Cellular Biology, Oct. (2007). , 27(20), 6987-6995.
[12] Corey, L. L, Weirich, C. S, Benjamin, I. J, & Kingston, R. E. Localized recruitment of a
chromalin-remodeIing aclivily by an aclivalor in vivo drives lranscrilionaI eIonga
tion, Genes and Development, (2003). , 17, 1392-1401.
[13] Vorobyeva, N. E, Nikolenko, J. V, Nabirochkina, E. N, Krasnov, A. N, Shidlovskii, Y.
V, & Georgieva, S. G. SAYP and Brahma are important for repressive and transient
Pol II pausing., Nucleic Acids Research, May (2012). , 40(15), 7319-7331.
[14] Mizulani, T, Ishizaka, A, Tomizava, M, Okazaki, T, Yamamichi, N, Kavana-lachika
wa, A, Iwamoto, A, & Iba, H. Loss of the Brm-type SWI/SNF chromatin remodeling
comIex is a slrong barrier lo lhe Tal-indeendenl lranscrilionaI eIongalion of hu
man immunodeficiency virus type 1 transcripts., Journal of Virology, Nov. (2009). ,
83(22), 11569-11580.
[15] Kulaeva, O. I, Hsieh, F. -K, & Studitsky, V. M. RNA polymerase complexes cooperate
to relieve the nucleosomal barrier and evict histones., Proceedings of the National
Academy of Sciences of the United States of America, Jun. (2010). , 107(25), 11325-11330.
[16] Mohrmann, L, Langenberg, K, Krijgsveld, J, Kal, A. J, Heck, A. J. R, & Verrijzer, C. P.
DifferenliaI Targeling of Tvo Dislincl SWI / SNI-ReIaled DrosohiIa Chromalin-Re
modeling Complexes," Molecular and Cellular Biology, (2004). , 24(8), 3077-3088.
[17] Vorobyeva, N. E, Soshnikova, N. V, Kuzmina, J. L, Kopantseva, M. R, Nikolenko, J.
V, Nabirochkina, E. N, Georgieva, S. G, & Shidlovskii, Y. V. The novel regulator of
metazoan development SAYP organizes a nuclear coactivator supercomplex., Cell
Cycle, Jul. (2009). , 8(14), 2152-2156.
[18] Moshkin, Y. M, Mohrmann, L, Van I|cken, W. I. }, & Verri|zer, C. I. IunclionaI differ
entiation of SWI/SNF remodelers in transcription and cell cycle control., Molecular
and cellular biology, Jan. (2007). , 27(2), 651-661.
SWI/SNF Chromatin Remodeling Complex Involved in RNA Polymerase II Elongation Process
http://dx.doi.org/10.5772/55877
75
[19] Schneider, I. CeII Iines derived from Iale embryonic slages of DrosohiIa meIanogasl
er, J Embryol Exp Morphol, Apr. (1972). , 27(2), 353-365.
[20] Brien, T, & Lis, J. T. RNA Polymerase II pauses at the 5 end of the transcriptionally
Induced Drosophila hsp70 Gene, Molecular and Cellular Biology, (1991). , 11(10),
5285-5290.
[21] Subtil-rodrguez, A, & Reyes, J. C. To cross or not to cross the nucleosome, that is the
elongation question, RNA Biology, May (2011). , 8(3), 389-393.
[22] Kornblihtt, A. R. Chromatin, transcript elongation and alternative splicing., Nature
Structural & Molecular Biology, Jan. (2006). , 13(1), 5-7.
[23] ShidIovskii, Y. V, Krasnov, A. N, NikoIenko, }. V, Lebedeva, L. a, Koanlseva, M, Ir
molaeva, M. a, Ilyin, Y. V, Nabirochkina, E. N, Georgiev, P. G, & Georgieva, S. G. A
novel multidomain transcription coactivator SAYP can also repress transcription in
heterochromatin., The EMBO Journal, Jan. (2005). , 24(1), 97-107.
[24] Hargreaves, D. C, & Crabtree, G. R. ATP-dependent chromatin remodeling: genetics,
genomics and mechanisms., Cell Research, Mar. (2011). , 21(3), 396-420.
[25] He, L, Liu, H, & Tang, L. SWI/SNF chromatin remodeling complex: a new cofactor in
reprogramming., Stem Cell Reviews, Mar. (2012). , 8(1), 128-136.
[26] rovnIee, I. M, Chambers, A. L, OIiver, A. W, & Dovns, }. a. Cancer and lhe bromo
domains of BAF180., Biochemical Society Transactions, Apr. (2012). , 40(2), 364-369.
[27] Mohrmann, L, & Verrijzer, C. P. Composition and functional specificity of SWI2/
SNF2 class chromatin remodeling complexes., Biochimica et Biophysica Acta, Jan.
(2005). , 1681(2-3), 59-73.
[28] Li, X. S, Trojer, P, Matsumura, T, Treisman, J. E, & Tanese, N. Mammalian SWI/SNF--
a subunit BAF250/ARID1 is an E3 ubiquitin ligase that targets histone H2B., Mc|ccu
lar and Cellular Biology, Apr. (2010). , 30(7), 1673-1688.
[29] Bartkowiak, B, Liu, P, Phatnani, H. P, Fuda, N. J, Cooper, J. J, Price, D. H, Adelman,
K, Lis, J. T, & Greenleaf, A. L. CDK12 is a transcription elongation- associated CTD
kinase, the metazoan ortholog of yeast Ctk1, Genes and Development, (2007). , 24,
2303-2316.
[30] Blank, T. A, Sandaltzopoulos, R, & Becker, P. B. Biochemical analysis of chromatin
structure and function using Drosophila embryo extracts., Methods, May (1997). ,
12(1), 28-35.
[31] Georgieva, S, Kirschner, D. B, Jagla, T, Nabirochkina, E, Hanke, S, Schenkel, H, De
Lorenzo, C, Sinha, P, Jagla, K, Mechler, B, & Tora, L. Two novel Drosophila TAF(II)s
have homoIogy vilh human TAI(II)30 and are differenliaIIy reguIaled during deveI
opment., Molecular and Cellular Biology, Mar. (2000). , 20(5), 1639-1648.
Chromatin Remodelling 76
Chapter 4
Condensins, Chromatin Remodeling and Gene
Transcription
Laurence O. W. Wilson and Aude M. Fahrer
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/55732
1. Introduction
Condensin complexes condense chromosomes during mitosis, turning the diffuse interphase
chromosomes into the familiar X-shaped compact chromosomes that segregate during cell
division. More recently a second role for condensins has emerged, in the epigenetic regulation
of interphase gene transcription. This second fascinating role is very difficult to study since
defects in condensin will usually interfere with mitosis and result in cell death. While several
excellent reviews of condensin function have recently been published (see [1-3]), in this article
we concentrate on the epigenetic functions of condensins and how they can be studied. We
also provide the first summary of condensin protein splice forms, a largely overlooked
contributor to condensin variation.
The DNA vilhin a ceII is loo Iarge lo fil inside if Iefl in ils unvound slale. In order lo accom
modate the genetic material, a cell packages this DNA as chromati:, a combination of DNA
bound to protein. The DNA is wound around protein complexes known as histones to form
nucIeosomes, vhich form a beads-on-a-slring slruclure. These nucIeosomes can be com
pacted further to produce a highly condensed structure that fits inside the nucleus of a cell.
The regulation of this structure is vital for cell growth and survival. During mitosis, chromatin
must be unwound so that it can be properly replicated and then repackaged into sister
chromosomes that must then be segregated into the dividing cells. Defects in any of these
processes can result in cell death. Additionally, the compact nature of the chromatin limits the
cells transcription machinery from properly interacting with its targets, preventing gene
transcription. In order to counter this, selected regions of chromatin must be unwound during
interphase to allow the genes present to be transcribed. The chromatin structure of the cell is
therefore under tight control. Changes in chromatin structure are thought to occur via three
2013 Wilson and Fahrer; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
broad mechanisms; 1. methylation of DNA; 2. covalent modification of histones; 3. at a higher
level by tethering distant regions of DNA.
The condensin protein complexes, originally identified in Xenopus egg extracts [4], function
through the third pathway: inducing condensation in chromatin structure through the
introduction of positive super-coils, and by tethering together distinct regions of DNA [5, 6].
This abiIily lo condense chromalin has been found lo be cenlraI lo lhe comaclion of chromo
somes during mitosis.
Vertebrates possess two condensins, known as condensin I and condensin II, each consisting
of 5 proteins. A dimer of Structural Maintenance of Chromosome (SMC) proteins 2 and 4 forms
the core of both condensin I and II. SMC proteins are large proteins (1000 1300 amino acid
long) which fold so that their amino and carboxy termini join to form an ATPase [7]. SMC2
and 4 form a dimer with a V-shape, with the ATPase domains of each protein localized to the
tips of the V. This dimer of SMC proteins then associates with either Ncaph, Ncapg and Ncapd2
to form condensin I or with Ncaph2, Ncapg2 and Ncapd3 to form condensin II (Figure 1) [8, 9].
Figure 1. Schematic representation of the condensin complexes. A heterodimer of SMC2 and SMC4 combines
with either Ncaph, Ncapg and Ncapd2 to form condensin I or with Ncaph2, Ncapg2 and Ncapd3 to form condensin II.
Chromatin Remodelling 78
Condensins vere iniliaIIy sludied in lhe conlexl of milolic chromosomes. Mulalions inlerfer
ing with the function of either condensin complex results in aberrant chromosome formation,
and a complete loss of function of either complex is lethal [9, 10]. The emerging evidence for
chromatin structures role in gene transcription however has lead to idea that condensins may
play roles beyond mitosis, acting in interphase to influence gene transcription through the
reorganization of chromatin [11-13]. Subsequently, evidence has begun to emerge which shows
that condensins are much more than architects of chromatin structure, they are also important
regulators of gene transcription.
The vital role condensins play in mitosis makes their study difficult; disruption of their
function through means such as mutations or transcriptional interference often fatally disrupts
cell division. A variety of methods of study have therefore been employed in order to gain
insight into the complexes roles in mitosis and gene regulation.
2. The study of condensin homologs
An alternative to studying a protein directly is to study functionally and structurally similar
homologs. Such homologs may provide insight into a protein of interest through shared
mechanisms, but prove easier to study. Such an approach has been used to study condenins
and provided great insight into how they might regulate gene transcription.
One of the first examples of condenins regulating gene expression was the discovery of a
condensin homolog in C. elegans known as the Dosage Compensation Complex (DCC) [14].
In most species, the sexes are determined by a difference in the presence of specific
chromosomes (such as the X and Y chromosomes in human). In C. elegans the population
is divided into males, which possess a single X chromosome, and hermaphrodites, which
possess two copies of the X chromosome. The increased number of X chromosome present
in hermaphrodites would lead to a two-fold increase in X-linked gene expression with
olenliaIIy dire consequences unIess roerIy reguIaled |15j. To counler lhis, hermahro
dite C. elegans can reduce the expression of their X-linked genes by half, resulting in normal
levels of transcription [15].
The DCC is comprised of SMC proteins DPY-27 and MIX-1 as well as DPY-26, DPY-28 and
Capg1 [16-20]. The DCC then associates with a second 5-protein complex consisting of SDC-1,
SDC-2, SDC-3, DPY-21 and DPY-30. The structure of the DCC differs from the worm condensin
I complex only in the presence of DPY-27, which is replaced by SMC-4 in condensin I, yet
despite the similarities has a different function.
Sludies have shovn lhal lhe DCC is direcled lovards lhe X chromosome by a combina
tion of histone modifications and specific DNA motifs. The histone variant H2A.Z (called
HTZ-1 in C. elegans) is found on the X chromosome of C. elegans. Disruling lhe exres
sion of this histone using RNAis was shown to disrupt DCC binding. The disruption was
not caused by a decrease in DCC protein levels, which suggests the histone assists in the
binding/recruitment of the complex to the X chromosome [21, 22]. Once recruited to the
Condensins, Chromatin Remodeling and Gene Transcription
http://dx.doi.org/10.5772/55732
79
correct chromosome, the complex binds to the DNA through the recognition of specific
sequence molifs in vhal is nov knovn lo be a lvo-sle rocess. Iirsl, lhe DCC recogniz
es and binds to recruitment elements on X (or rex) sites. Once bound, the DCC is then
distributed along the X chromosome by migrating to dependent-on-X (or dox) sites. The
result is the distribution of the DCC along the full length of the X chromosome, allowing
it to exert its effects over the entire chromosome [23].
A second, less widely known example of a condensin- related protein was identified in a mouse
study looking for epigenetic regulators. Blewitt et al. identified the gene SMC Hinge domain
containing 1 (SMCHD1) [24]. While not a full homolog of SMC, it does bear similarities and
further investigation showed that it plays a crucial role in X-inactivation in mice, similar to the
DCC in C. elegans [25]. Further study of this protein may provide insights into the function of
SMC complexes such as condensin.
3. The study of condensins through knock-outs
Removal of a gene of interest, and study of the resulting phenotype, is a common method for
studying the function of a gene. The vital role condensins play in mitosis prevents such an
approach, as knock-outs are often lethal. Knockouts in SMC2, SMC4, Ncapd2, Ncapg and
Ncaph have all proven to be lethal [26-34]. The majority of the knock-out work has been
conducted in yeast, bacteria, Drosophila, and C. elegans. A study in 2004 generated the only
reported mammalian phenotype for a condensin knockout: a mouse strain with a deletion of
the condensin II Ncapg2 protein [35]. The resulting knock-outs were embryonic lethal, with
the mice fetuses dying almost immediately after implantation due to a catastrophic disruption
in cell growth and division.
An alternative to the use of full knock-outs is the generation of conditional knock-outs. Cell
lines can be engineered to turn-off expression of target genes when exposed to specific signals
(such as the addition of doxycylcin). Expression of the gene is then lost over time and a resulting
phenotype emerges. Chicken cell lines have now been created that stop expression of select
condensin genes upon exposure to doxycycline [36]. Whereas a normal knock-out of these
genes would likely prove lethal and prevent any sort of study, the gradual emergence of the
phenotype in these conditional knock-outs can be studied. Such an approach has been used to
investigate the different contributions of condensin I and condensin II to mitotic-chromosome
formation, showing differences in phenotype between knock-outs of the two complexes. The
results suggest that condensin II is required for the formation of the chromosome scaffold and
for providing rigidity, while condensin I acts to compact the chromatin around the scaffold.
While only used so far to study the role of these complexes in mitosis, their use could be
expanded to investigate the role condensins play during interphase. Gene expression profiling
of lhese ceII Iines couId be carried oul lo Iook for evidence of lhe direcl reguIalion of lran
scription by condensins.
Chromatin Remodelling 80
4. Knock-down and overexpression studies
Altering the expression of target proteins, either through over- or under-expression can
provide an alternative to knock-out studies, producing informative phenotypes while
avoiding the lethal side-effects often associated with complete removal of a protein. Such
approaches have been used in Drosophila to great effect, providing insights into the functions
of Condensins.
The Drosophila Barren protein, a homolog of Ncaph and component of the Drosophila Conden
sin I complex, was investigated using a knock-down approach [37]. The study showed that fly
Ncaph interacts directly with the Polycomb group protein polyhomeotic. Polycomb group
proteins are a group of proteins responsible for repressing transcription in various regions across
the genome and for maintaining this silenced state through the life of the fly. This is achieved by
the binding of these proteins to specific elements within the genome and the compaction of
neighboring DNA. The physical interaction with Ncaph suggests that this compaction is achieved
through the recruitment of Condensin via the polycomb group proteins to the target region of
the genome. The authors demonstrated a specific instance of this, showing the fly requires Ncaph
to silence the abdominal-B gene by inducing its binding to an upstream silencer. Reducing the
IeveIs of Ncah lhrough knock-dovns grealIy diminished lhe siIencing of lhis gene, highIighl
ing the role of condensin I in transcriptional regulation.
A similar approach was used in a second Drosophila study [38]. The authors noted that
Drosophila larvae with mutations in retinoblastoma family protein RBF1 often showed defects
in chromsome condensation during mitosis. Further investigation showed a direct interaction
between RBF1 and the Drosophila Ncapd3 protein. The authors showed that this interaction
was required for proper loading of condensin II onto the chromosome. A reduction in the levels
of RBF1 greatly diminished the capacity of condensin II to bind to the chromatin, but could be
compensated by over-expression of Ncapd3.
Over-expression was also used to explore the role of murine Ncapg2/MTB in erythropoiesis
[39]. Ncapg2 was found to be upregulated in erythroid cell lines. Further investigation found
the protein was capable of inhibiting SCL/E12 mediated transcription. Over-expression of the
protein was also shown to be sufficient to induce terminal differentiation of erythroleukemia
cell lines. While the precise mechanism of Ncapg2-mediated differentiation is still poorly
understood, the authors proposed two non-exclusive hypotheses. During erythroid cell
development, the chromatin becomes progressively more compacted as the cell matures and
the nucleus is ultimately ejected [40]. An increased level of Ncapg2 could result in a higher
level of condensin II, in turn leading to a higher level of chromatin compaction. Alternatively,
lhe aulhors roosed lhal Ncag2 may acl indeendenlIy of lhe Condensin comIex, coo
erating with additional enzymes to induce red blood cell development.
5. Mutation studies
In 2007, our laboratory reported the first viable mammalian mutant of a condensin protein;
the Nessy mouse, with a point mutation in the Ncaph2 (kleisin) gene [41]. The mutant was
Condensins, Chromatin Remodeling and Gene Transcription
http://dx.doi.org/10.5772/55732
81
identified as part of an ENU-mutagenesis screen for immunological phenotypes, and has a
arliaI bIock in T-ceII deveIomenl. The mulalion vas maed lo a region in mouse chromo
some 15 and ultimately identified as a T to A substitution in exon 1 of the Ncaph2 gene. The
mice are viabIe and aear olhervise normaI. The henolye lherefore is nol due lo imair
ment of cell division. Indeed, evidence was obtained that at one stage of T-cell development
(the CD4
+
CD8
+
double positive stage) Nessy thymocytes undergo more cell divisions than their
wild-type counterparts. No defects were identified in the B-cell lineage. These studies provide
the first evidence for a cell-type specific role of a condensin complex component. A subsequent
study pinpointed functional deficiencies in mature Nessy T-cells [42]. More recently a study
by Rawlings et al. presented evidence suggesting that the point mutation in the Nessy mouse
prevents Condensin II from condensing the chromatin at a key stage during thymocyte
development, resulting in aberrant gene transcription [43].
Another ENU mutagenesis screen, this time conducted on zebrafish, identified a mutation in
condensin I subunit Ncapg which caused a reduction in the number of retinal cells [44]. In
addition, the animals displayed a high incidence of polyploidy suggesting defects in cell
division.
6. Study of alternative splice forms
Until recently, it has been assumed that the genes encoding the components of the condensin
complexes each produce only a single protein. Recently however, it has emerged that this may
not be the case. In the same study that described the mutant mouse model, our laboratory also
showed that mouse Ncaph2 can undergo alternative splicing to produce multiple distinct
protein isoforms [41]. We have since studied this in more detail, showing that the mouse
Ncaph2 gene is capable of encoding at least 6 unique protein isoforms [45]. The first exon of
the gene can be translated into one of three forms. In addition, we detailed the inclusion of an
additional alanine residue between exons 15 and 16 resulting from NAGNAG variation. Our
data show that the amino-termini variants are ubiquitous throughout the mouse, expressed at
similar levels in all tissues tested.
The remaining components of the condensin complexes have never been studied to see if they
undergo alternative splicing despite annotated instances existing in the NCBI and ENSEMBL
database. We recently completed a large scale study into alternative splicing that identified
additional instances of splice variation in Ncaph2 and Ncapd2. A comprehensive summary of
the splice variants of all condensin subunits is presented in Table 1. None of the splice variants
have been characterized yet, so it remains to be seen if they are functionally unique. Their
existence however, raises the possibility that these distinct isoforms may regulate the different
functions of condensins. Inclusion of one splice form over another may switch the complex
from an architect of chromosomes to a regulator of gene function, providing an elegant method
to regulate function.
Chromatin Remodelling 82
Mouse
Protein Splice Type Description of splicing Reference
SMC2 Partial
transcription
Transcription of only the first 11 exons, resulting in a truncated
protein
ENSEMBL
SMC4 Partial
transcription
Transcription of only the first 8 exons, resulting in a truncated protein ENSEMBL
Alternate splice
site
Alternate in frame splice site at the start of exon 3, resulting in the
deletion of 25 amino-acids from the beginning of the exon
ENSEMBL
Ncapd2 Cryptic exon Inclusion of a cryptic exon between exons 20 and 21 and initiating
translation at an alternate start codon produces a truncated protein
with a unique amino-terminus
Wilson et al
(submitted)
Ncapd3 Exon skipping Skipping of exons 25 28, resulting in the deletion of 283 amino-
acids
ENSEMBL
Ncaph2 Alternate splicing
of exon 1
The protein can splice the first coding exon in one of three ways,
producing proteins with distinct amino-termini
Theodoratos et al,
2012
Cryptic exon Inclusion of a cryptic exon between exons 5 and 6, as well as initiating
translation from an alternate start site produces a protein with a
unique amino-terminus
Wilson et al
(submitted)
NAG-NAG
variation
Potential choice of a second splice site can introduce an extra residue
between exons 15 and 16
Theodoratos et al,
2012
Human
Protein Splice Type Description of splicing Reference
SMC2 Cryptic exon Inclusion of a cryptic exon after exon 23 introduces an alternate stop
codon
ENSEMBL
SMC4 Alternate splice
site
Alternate in frame splice site at the start of exon 3, resulting in the
deletion of 25 amino-acids
ENSEMBL
Exon skipping Skipping of exon 19, resulting in the deletion of 58 amino-acids ENSEMBL
Ncaph Exon skipping Skipping of exon 2, resulting in the deletion of 136 amino-acids ENSEMBL
Alternate splice
site
Alternate in frame splice site at the start of exon 2, resulting in the
deletion of 11 amino-acids
ENSEMBL
Ncapd2 Alternate splice
site of exon 1
Alternate splice site at the end of exon 1 and initiating translation at
an alternate start codon
Wilson et al
(submitted)
Exon skipping Skipping of exon 4, resulting in the deletion of 45 amino-acids ENSEMBL
Ncapd3 Alternate exon Can be transcribed with one of two first exons ENSEMBL
Cryptic exon Inclusion of a cryptic exon after exon 12, creating an alternate stop-
codon
ENSEMBL
Ncaph2 Alternate splice
site of exon 9
Alternate splice site of exon 9 creating an alternate stop-codon,
resulting in a truncated protein with an alternate carboxy-terminus
NCBI
NAG-NAG
variation
Potential choice of a second splice site can introduce an extra residue
between exons 15 and 16
Theodoratos et al,
2012
Table 1. Splice variations of the condensin components
Condensins, Chromatin Remodeling and Gene Transcription
http://dx.doi.org/10.5772/55732
83
7. Separation of function
The separation of the condensin complexes functions in mitosis and gene regulation remains
an inherently difficult process. The Nessy mouse represents the first true separation of function
in a vertebrate model, the point mutation disrupting the cell-specific role of condensin II while
leaving its mitotic role unperturbed. A previous study in bacteria reported a similar separation.
Mutations in the kleisin protein ScpA in Bacillius subtillis were found to disrupt the DNA repair
pathways as well as resulting in the deregulation of specific genes while leaving the mitotic
function intact [46].
Such results show that the functions of condensin can be separated, but is still unknown how
this occurs. The alternative splice forms may play a role in the regulation of condensin function.
Inclusion of alternate isoforms may influence weather the complex acts as a compacter of
chromosomes or as a regulator of gene transcription. In our original 2007 paper, we showed
that the Nessy mulalion couId be rescued by reinlroduclion of onIy one sIice varianl (desig
nated as the Long-form). The rescue was of the peripheral phenotype (CD44
hi
T-cells in the
spleen). Technical limitations meant that rescue of the thymus phenotype could not be
confirmed. Rescue with different splice forms, may have provided additional insight.
Condensins have also been shown to interact with additional proteins capable of regulating
their function. Once such protein is protein phosphatase 2A (PP2A), which is capable of
dephosphorylating the Ncapg subunit of condensin I, inhibiting its function [47]. This activity
has been shown to be important for gene-bookmarking. During cell division, individual cells
must remember their lineage. Promoters of select genes remain un-compacted during the
process of division, allowing for rapid expression of the genes after mitosis [48, 49]. PP2A was
found to be important for leaving these genes un-compacted. PP2A interacts with the TATA-
binding protein (TBP) which binds to the promoter regions of active genes during mitosis. The
combinalion of lhe lvo roleins lhen dehoshoryIale nearby condensin, revenling con
densation of chromatin and allowing the genes to become active shortly after division [50].
Additionally, condensin II has been shown to bind to specific histone markers. Ncapg2 and
Ncapd3 were found to recognize mono-methylation of H4K20, inducing condensin II to bind
to the DNA whereas di-methylation of the histone was found to lead to dissociation of the
complex [51j. ased on lhis finding, lhe aulhors suggesled a modeI for chromosome conden
sation during mitosis; once the cell progresses into mitosis, a demethlyase converts H4K20me2
to H4K20me1, inducing condensin II to bind and compact the chromatin into chromosomes.
Upon proper separation of the chromosomes, H4K20me1 is converted back to H4K20me2
causing condensin II to separate from the chromatin, resulting in the DNA returning to an
open state. This mechanism also provides a possible explanation for how condensins could be
targeted to distinct locations along the genome during interphase. Modification of histones at
specific loci could recruit the condensin II complex, inducing compaction of the surrounding
chromatin and repression of transcription.
Most studies have assumed that the function of condensins in mitosis and gene regulation is
similar: the compaction of chromatin through the tethering of distinct regions. However, this
Chromatin Remodelling 84
has never been experimentally demonstrated. In fact, despite its similarities to the condensin
complex, the C. elegans DCC is thought to regulate gene expression through the modification
of histones [52], and/or through the recruitment of secondary proteins to the X chromosome
[53] rather than by physically restructuring chromatin. Thus, while condensins may exert their
epigenetic/ transcriptional regulation function by compacting DNA, it is also entirely possible
that they use a different mechanism. Separation of function mutants, such as the condensin II
Nessy mutant mouse, are likely to be the key to answering this fundamental question.
8. Concluding remarks
It has become clear that condensins have a role in epigenetic/transcriptional regulation in
addition to their better-studied role in chromosome compaction during mitosis. The vital role
of condensins makes the study of these complexes difficult, with presently only 3 vertebrate
models studied, one of which is embryonic lethal. However, numerous studies using a variety
of methods have managed to glean insights into the function of these complexes. Despite the
progress of the last decade, there is still much left to be discovered about the condensins and
especially how they regulate gene transcription.
Author details
Laurence O. W. Wilson and Aude M. Fahrer
Research School of Biology, College of Medicine, Biology and Environment, The Australian
National University, Canberra, Australia
References
[1] Hirano T: Condensins: universal organizers of chromosomes with diverse functions
Genes Dev (2012).
[2] Hudson, D. F, & Marshall, K. M. Earnshaw WC: Condensin: Architect of mitotic
chromosomes. Chromosome Res (2009).
[3] Wood, A. }, & Severson, A. I. Meyer }: Condensin and cohesin comIexily: lhe ex
panding repertoire of functions. Nat Rev Genet (2010).
[4] Hirano, T, & Mitchison, T. J. A heterodimeric coiled-coil protein required for mitotic
chromosome condensation in vitro. Cell (1994).
[5] Bazett-jones, D. P, & Kimura, K. Hirano T: Efficient supercoiling of DNA by a single
condensin complex as revealed by electron spectroscopic imaging. Mol Cell (2002).
Condensins, Chromatin Remodeling and Gene Transcription
http://dx.doi.org/10.5772/55732
85
[6] Kimura, K. Hirano T: ATI-deendenl osilive suercoiIing of DNA by 13S conden
sin: a biochemical implication for chromosome condensation. Cell (1997).
[7] Hirano T: The ACs of SMC roleins: lvo-armed ATIases for chromosome conden
sationcohesion, and repair. Genes Dev (2002).
[8] Hirano, T, & Kobayashi, R. Hirano M: Condensins, chromosome condensalion ro
lein comIexes conlaining XCAI-C, XCAI-I and a Xenous homoIog of lhe Droso
phila Barren protein. Cell (1997).
[9] Ono, T, Losada, A, Hirano, M, Myers, M. P, & Neuwald, A. F. Hirano T: Differential
contributions of condensin I and condensin II to mitotic chromosome architecture in
vertebrate cells. Cell (2003).
[10] Ono, T, Iang, Y, & Seclor, D. L. Hirano T: SaliaI and lemoraI reguIalion of Con
densins I and II in mitotic chromosome assembly in human cells. Mol Biol Cell (2004).
[11] Legagneux, V, & Cubizolles, F. Watrin E: Multiple roles of Condensins: a complex
story. Biol Cell (2004).
|12j Cobbe, N, & Savvidou, I. Heck MM: Diverse milolic and inlerhase funclions of con
densins in Drosophila. Genetics (2006).
[13] Hagslrom, K. A. Meyer }: Condensin and cohesin: more lhan chromosome comac
tor and glue. Nat Rev Genet (2003).
[14] Chuang, P. T, & Lieb, J. D. Meyer BJ: Sex-specific assembly of a dosage compensation
complex on the nematode X chromosome. Science (1996).
[15] Meyer, B. J. Casson LP: Caenorhabditis elegans compensates for the difference in X
chromosome dosage between the sexes by regulating transcript levels. Cell (1986).
[16] Chuang, I. T, & AIberlson, D. G. Meyer }: DIY-27:a chromosome condensalion ro
tein homolog that regulates C. elegans dosage compensation through association
with the X chromosome. Cell (1994).
[17] Hsu, D. R. Meyer }: The dy-30 gene encodes an essenliaI comonenl of lhe Caeno
rhabditis elegans dosage compensation machinery. Genetics (1994).
[18] Lieb, J. D, Capowski, E. E, & Meneely, P. Meyer BJ: DPY-26, a link between dosage
compensation and meiotic chromosome segregation in the nematode. Science (1996).
[19] Lieb, J. D, Albrecht, M. R, & Chuang, P. T. Meyer BJ: MIX-1: an essential component
of the C. elegans mitotic machinery executes X chromosome dosage compensation.
Cell (1998).
[20] Csankovszki, G, Collette, K, Spahl, K, Carey, J, Snyder, M, Petty, E, Patel, U, Tabuchi,
T, Liu, H, Mcleod, I, et al. Three distinct condensin complexes control C. elegans
chromosome dynamics. Curr Biol (2009).
Chromatin Remodelling 86
[21] Petty, E. L, Collette, K. S, Cohen, A. J, & Snyder, M. J. Csankovszki G: Restricting
dosage compensation complex binding to the X chromosomes by H2A.Z/HTZ-1.
PLoS Genet (2009). e1000699.
[22] Petty, E, & Laughlin, E. Csankovszki G: Regulation of DCC localization by HTZ-1/
H2A.Z and DPY-30 does not correlate with H3K4 methylation levels. PLoS One
(2011). e25973.
[23] McdoneI, I, }ans, }, & Ielerson, . K. Meyer }: CIuslered DNA molifs mark X chro
mosomes for repression by a dosage compensation complex. Nature (2006).
[24] Ievill, M. I, Vickaryous, N. K, HemIey, S. }, Ashe, A, ruxner, T. }, Ireis, }. I, & Ar
keII, R. WhileIav I: An N-elhyI-N-nilrosourea screen for genes invoIved in variega
tion in the mouse. Proc Natl Acad Sci U S A (2005).
[25] Ievill, M. I, GendreI, A. V, Iang, Z, Sarrov, D. , WhileIav, N, Craig, }. M, Ae
daile, A, Hilton, D. J, Dunwoodie, S. L, Brockdorff, N, et al. SmcHD1, containing a
slrucluraI-mainlenance-of-chromosomes hinge domain, has a crilicaI roIe in X inacli
vation. Nat Genet (2008).
[26] Freeman, L, & Aragon-alcaide, L. Strunnikov A: The condensin complex governs
chromosome condensation and mitotic transmission of rDNA. J Cell Biol (2000).
[27] Lavoie, . D, & Hogan, I. KoshIand D: In vivo disseclion of lhe chromosome conden
salion machinery: reversibiIily of condensalion dislinguishes conlribulions of con
densin and cohesin. J Cell Biol (2002).
[28] Lavoie, . D, Tuffo, K. M, Oh, S, & KoshIand, D. HoIm C: Milolic chromosome con
densation requires Brn1p, the yeast homologue of Barren. Mol Biol Cell (2000).
[29] Steffensen, S, Coelho, P. A, Cobbe, N, Vass, S, Costa, M, Hassan, B, Prokopenko, S. N,
Bellen, H, Heck, M. M, & Sunkel, C. E. A role for Drosophila SMC4 in the resolution
of sister chromatids in mitosis. Curr Biol (2001).
[30] rillon, R. A, & Lin, D. C. Grossman AD: Characlerizalion of a rokaryolic SMC ro
tein involved in chromosome partitioning. Genes Dev (1998).
[31] Biggins, S, Bhalla, N, Chang, A, & Smith, D. L. Murray AW: Genes involved in sister
chromalid searalion and segregalion in lhe budding yeasl Saccharomyces cerevi
siae. Genetics (2001).
[32] Strunnikov, A. V, & Hogan, E. Koshland D: SMC2, a Saccharomyces cerevisiae gene
essential for chromosome segregation and condensation, defines a subgroup within
the SMC family. Genes Dev (1995).
[33] Slrunnikov, A. V, & Larionov, V. L. KoshIand D: SMC1: an essenliaI yeasl gene en
coding a putative head-rod-tail protein is required for nuclear division and defines a
new ubiquitous protein family. J Cell Biol (1993).
Condensins, Chromatin Remodeling and Gene Transcription
http://dx.doi.org/10.5772/55732
87
[34] Saka, Y, Sutani, T, Yamashita, Y, Saitoh, S, Takeuchi, M, & Nakaseko, Y. Yanagida M:
Fission yeast cut3 and cut14, members of a ubiquitous protein family, are required
for chromosome condensation and segregation in mitosis. EMBO J (1994).
[35] Smith, E. D, Xu, Y, Tomson, B. N, Leung, C. G, Fujiwara, Y, & Orkin, S. H. Crispino
}D: More lhan bIood, a noveI gene required for mammaIian oslimIanlalion deveI
opment. Mol Cell Biol (2004).
[36] Green, L. C, Kalitsis, P, Chang, T. M, Cipetic, M, Kim, J. H, Marshall, O, Turnbull, L,
Whitchurch, C. B, Vagnarelli, P, Samejima, K, et al. Contrasting roles of condensin I
and condensin II in mitotic chromosome formation. J Cell Sci (2012).
[37] Luo, R, reiIing, A, & ianchi, M. I. OrIando V: DrosohiIa chromosome condensa
tion proteins Topoisomerase II and Barren colocalize with Polycomb and maintain
Fab-7 PRE silencing. Mol Cell (2001).
[38] Longvorlh, M. S, Herr, A, & }i, }. Y. Dyson N}: RI1 romoles chromalin condensa
tion through a conserved interaction with the Condensin II protein dCAP-D3. Genes
Dev (2008).
[39] Xu, Y, Leung, C. G, Lee, D. C, & Kennedy, . K. Crisino }D: MT, lhe murine homo
log of condensin II subunit CAP-G2, represses transcription and promotes erythroid
cell differentiation. Leukemia (2006).
[40] Rolhmann, C, & Cohen, A. M. MaIik Z: Chromalin condensalion in erylhrooiesis re
solved by multipixel spectral imaging: differentiation versus apoptosis. J Histochem
Cytochem (1997).
[41] Gosling, K. M, Makaroff, L. E, Theodoratos, A, Kim, Y. H, Whittle, B, Rui, L, Wu, H,
Hong, N. A, Kennedy, G. C, Fritz, J. A, et al. A mutation in a chromosome condensin
II subunit, kleisin beta, specifically disrupts T cell development. Proc Natl Acad Sci U
S A (2007).
[42] Gosling, K. M, Goodnow, C. C, & Verma, N. K. Fahrer AM: Defective T-cell function
leading to reduced antibody production in a kleisin-beta mutant mouse. Immunology
(2008).
[43] Rawlings, J. S, Gatzka, M, & Thomas, P. G. Ihle JN: Chromatin condensation via the
condensin II complex is required for peripheral T-cell quiescence. EMBO J (2011).
[44] Seipold, S, Priller, F. C, Goldsmith, P, Harris, W. A, & Baier, H. Abdelilah-Seyfried S:
Non-SMC condensin I comIex roleins conlroI chromosome segregalion and sur
vival of proliferating cells in the zebrafish neural retina. BMC Dev Biol (2009).
[45] Theodoratos, A, Wilson, L. O, & Gosling, K. M. Fahrer AM: Splice variants of the
condensin II gene Ncaph2 include alternative reading frame translations of exon 1.
FEBS J (2012).
Chromatin Remodelling 88
[46] Dervyn, E, Noirot-gros, M. F, Mervelet, P, Mcgovern, S, Ehrlich, S. D, & Polard, P.
Noirot P: The bacterial condensin/cohesin-like protein complex acts in DNA repair
and regulation of gene expression. Mol Microbiol (2004).
[47] Yeong, F. M, Hombauer, H, Wendt, K. S, Hirota, T, Mudrak, I, Mechtler, K, Loregger,
T, Marchler-bauer, A, Tanaka, K, & Peters, J. M. Ogris E: Identification of a subunit of
a novel Kleisin-beta/SMC complex as a potential substrate of protein phosphatase
2A. Curr Biol (2003).
[48] Larsen, A. Weinlraub H: An aIlered DNA conformalion delecled by S1 nucIease oc
curs at specific regions in active chick globin chromatin. Cell (1982).
[49] MicheIolli, I. I, & Sanford, S. Levens D: Marking of aclive genes on milolic chromo
somes. Nature (1997).
[50] Xing, H, & Vanderford, N. L. Sarge KD: The TBP-mitotic complex bookmarks genes
by preventing condensin action. Nat Cell Biol (2008). , 2A.
[51] Liu, W, Tanasa, B, Tyurina, O. V, Zhou, T. Y, Gassmann, R, Liu, W. T, Ohgi, K. A,
Benner, C, Garcia-bassets, I, Aggarwal, A. K, et al. PHF8 mediates histone H4 lysine
20 demethylation events involved in cell cycle progression. Nature (2010).
[52] Wells, M. B, Snyder, M. J, & Custer, L. M. Csankovszki G: Caenorhabditis elegans
dosage compensation regulates histone H4 chromatin state on X chromosomes. Mol
Cell Biol (2012).
[53] Jans, J, Gladden, J. M, Ralston, E. J, Pickle, C. S, Michel, A. H, Pferdehirt, R. R, Eisen,
M. , & Meyer, . }. A condensin-Iike dosage comensalion comIex acls al a dis
tance to control expression throughout the genome. Genes Dev (2009).
Condensins, Chromatin Remodeling and Gene Transcription
http://dx.doi.org/10.5772/55732
89
Chapter 5
The Role of Id2 in the Regulation of Chromatin Structure
and Gene Expression
Elena R. Garca-Trevijano, Luis Torres,
Rosa Zaragoz and Juan R. Via
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/54969
1. Introduction
1.1. The helix-loop-helix Id2 proteins
Cell function and tissue homeostasis are dependent on the precise regulation of multiple and
converging pathways that ultimately will control a variety of biological processes such as cell
proliferation, growth arrest, differentiation or apoptosis. Frequently these pathways share one
or several steps in the signal cascade resulting in either redundant or opposing responses.
Chromatin structure is an essential part of the regulatory mechanisms for gene transcription.
Moreover, chromatin has been revealed as a dynamic structure exquisitely regulated through
multiple mechanisms including histone modifications and chromatin remodeling complexes
that finally, will give rise to an open or closed structure changing the accessibility of specific
transcription factors to nucleosomal DNA. Therefore, the protein complexes involved in the
modulation of chromatin remodelers and histone acetyltransferases (HAT) or deacetylases
(HDAC) could be somehow considered as part of a previous sensitization process necessary
for a full and specific biological response.
In the recent literature there is a number of papers describing a variety of biological processes
in which cells from different tissues need to be previously sensitized or primed to achieve
a full response to either a chemical or a biological signal. This concept has been extensively
studied in the experimental model of liver regeneration after 2/3 partial hepatectomy (PHx).
Hepatocytes in normal liver are quiescent, resting at the G0 phase of the cell cycle, and exhibit
a poor response to potent in vitro mitogens. Once hepatocytes reach the early G1 phase, cells
respond to those mitogens and can progress through the cell cycle. Consequently, it is generally
accepted that hepatocytes need to be previously sensitized to overcome the G1 restriction point
2013 Garca-Trevijano et al.; licensee InTech. This is an open access article distributed under the terms of
the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
and become competent for DNA replication [1]. On the other hand, it has been long known
that apoptosis-inducing cytokines such as TNF-o are nol abIe lo lrigger aolosis in healo
cytes unless they are accompanied by chemicals such as actinomycin D or cycloheximide [2].
Accordingly, unveiling the nature of those signals participating in the cell priming events
would be crucial to understand the molecular mechanisms mediating, not only the physiology
of different biological processes, but also the pathogenesis of many diseases. We propose here
that the helix-loop-helix (HLH) protein Id2 has an important role in the process of cell
sensitization by a mechanism affecting chromatin structure of selected genes.
Id2 belongs to a family of HLH proteins identified and named over two decades ago for its
dual role as both, inhibitors of the differentiation process and inhibitors of DNA binding. Id
proteins were initially found during a screen for determination of factors from the family of
basic-helix-loop-helix (bHLH) proteins. Paradoxically, Id proteins lack the basic region
adjacent to the HLH domain [3]. This region rich in basic aminoacids, has been shown to be
essential for specific binding to DNA: It binds to a hexanucleotide E box sequence on the DNA
of target genes (CANNTG) [4].
The HLH proteins are classified into seven groups of factors according to their DNA-binding
motif. The seven classes of HLH proteins share highly conserved amphipatic helices connected
by a loop of variable sequence and length.
Class-I (or class-A) bHLH proteins are also known as the E proteins since they are encoded by
spliced variants from the EA2 gene. This group includes proteins that are ubiquitously
expressed. Class-II (or class-B) bHLH proteins, includes members such as MyoD, NeuroD, or
Hes with a tissue-restricted pattern of gene expression. Class-I and class-II proteins can form
either homo- or heterodimers. Binding of these dimers to "E box" in the promoters of tissue-
specific genes will regulate a number of developmental processes [for review see reference 5].
Id proteins belong to the class-V of HLH factors including four members going from Id1 to
Id4 [3-6]. Id proteins can dimerize with either class-I or class-II proteins but since they do not
contain the DNA-binding motif, this dimerization will inhibit class-I and class-II factor-activity
in a dominant-negative fashion [3]. Consequently, the developmental processes modulated by
Class-I and-II factors will be blocked by Id proteins [6-10]
Over the past few years among all members of Id family of proteins, Id2 has been shown to be
essential for the modulation of biological processes other than its first described function
during cell differentiation and development. Among these functions, Id2 has been found to be
involved in the regulation or coordination of cell proliferation, cell cycle control, senescence,
apoptosis or angiogenesis and metastasis [6,11-16]. Moreover, data in the literature describing
the role of Id2 in different cell types suggest that Id2 function is highly dependent on the cell
microenvironment and that its molecular mechanism of action is far more complicated than it
was thought at first. Since the expression of individual genes is induced in response to a variety
of slimuIi and frequenlIy, lhe same signaI arliciales in so many differenl bioIogicaI roc
esses, the study of all Id2 functions turns out to be extremely complex. In this review we discuss
some of lhe olenliaI mechanisms by vhich Id2 has been roosed lo moduIale ceII roIifer
Chromatin Remodelling 92
ation under both, physiological and pathological conditions. We also present the newest
findings of the signaling network leading to the modulation of Id2 activity
2. Role of Id2 in cell proliferation
In addition to other functions described for Id2, it seems that its role as a proliferative factor
is now recognized as one of the most significant. In fact, there is a growing number of evidences
derived from both, in vitro and in vivo experiments in support of this notion. Ectopic over-
expression of Id2 in different cell types enhances proliferation [17,18] and cells acquire some
features of transformation [19]. More importantly, in some human cancers such as pancreatic,
neuroblastoma or colon carcinoma among others, Id2 is over-expressed [20-22]. Partial ablation
of Id2 by antisense oligonucleotides in these tumors decreases cell proliferation. Indeed, Id2
has been proposed as a prognostic factor and a potential therapeutical target for cancer
treatment [15,20, 23].
Figure 1. Model of Id2 as a dominant-negative factor for the cell cycle control. (Upper) Proteins of the bHLH family
dimerize and bind to the promoter of cdki genes by their basic domain. Transcription of cdki is up-regulated. CDKI
binds to the cyclin/CDK complex and blocks its activity. Cell cycle will be blocked. (Lower) bHLH proteins dimerize with
Id2. Since Id2 lacks a basic domain, the dimer bHLH/Id2 cannot bind to gene promoters. CDKI transcription is down-
regulated. Cyclin/CDK complex is active and cell cycle will progress.
2.1. Molecular mechanisms
From the classical point of view, the role of Id2 as a proliferative factor was thought to be
dependent only on its ability to dimerize with bHLH proteins as a dominant-negative factor
(Figure 1). In this model, Id2 would control cell proliferation by repressing the expression of
cell cycle inhibitors such as p21
Cip1
or p57
Kip2
[24-26]. Nevertheless, later was demonstrated that
Id2 could bind to proteins different from bHLH factors such as the tumor suppressor pRB and
the pRb-related proteins p130 and p107 [20]. In this sense, it is largely known that RB (referred
to pRb or the pocket proteins) directly associates with E2F on E2F-responsive promoters to
restrain gene expression of cell cycle-related genes [ for review see reference 27]. Therefore,
these data ultimately connect Id2 and E2F-target genes.
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
93
E2Fs contribution to cell proliferation and the molecular signaling network that converges on
RB proteins has been extensively documented. Although all RB proteins bind to E2F and are
modulated by a cell-cycle dependent mechanism, their pattern of expression is different.
Whereas p130 is most prominent in arrested cells and preferentially binds to E2F4/5, p107 is
mainly expressed in proliferating cells. Finally, pRB is expressed in both proliferating and
quiescent cells. The phosphorylation of RB proteins by specific cyclin/CDK complexes will
render the subsequent waves of E2F-dependent transcription that will guarantee the sequential
transition of cells through the cell cycle (figure 2):
Figure 2. Cell cycle control of E2F-target genes. In G0 cells, E2F4/5 associates with RB proteins and RBP. RBP connects
Lo corepressors (HDAC). L2LargeL genes are repressed aL Lhis phase. pon sLinulaLion, sequenLial phosphoryla
tion of both, RB and RBP will release the co-repressors and transition G0-G1 will take place. HATs could have access to
chromatin as G1 progress. At late G1 phase cumulative phosphorylation of RB and RBP will result in the loss of RB
function, release of E2F4/5 and the accumulation of newly synthesized E2F1,-2 and -3. These events will drive cells
into the S phase.
In quiescenl or differenlialed ceIIs, ubiquilousIy exressed I2I4/5 and 130 can bind simuI
taneously to various co-repressors such as DNA methyltransferase 1 (DNMT1) or histone
deacetylases (HDAC) complexes. p130 will inhibit E2F4/5 transcriptional activity by two
mechanisms, including binding and inhibition of the E2F transactivation domain, and by
recruiting co-repressors such as those mentioned above. These events will lead to chromatin
compaction and transcriptional inhibition of genes necessary to entry into the S phase of the
cell cycle.
Upon a mitogenic stimulus, during G1 phase, phosphorylation of RB binding proteins (RBP)
by cyclinD/CDK4/6 and cyclin E/A/CDK2 will dissociate the transcriptional co-repressors from
E2F allowing the access of acetyltransferases (HATs) to gene promoters [28].
Chromatin Remodelling 94
Al lhe Iale G1 hase of lhe ceII cycIe, lhe concurrenl and cumuIalive CDK-medialed hos
phorylation of pRb and/or p107 will result in the loss of RB function.
Finally, during G1 to S phase transition, newly synthesized E2F1, -2 and -3 will substitute
E2F4/5 and, HATs will be recruited to gene promoters. These two events will drive cells into
the S phase.
In this context Id2 seems to take part in a crucial checkpoint for cell proliferation since it can
bind to each of the pocket proteins of the RB family in a cell cycle-regulated fashion [20].
ImorlanlIy, Id2 is lhe onIy member of Id famiIy of roleins lhal can bind lo hyohoshory
lated pRB, p107 or p130 [26j. Iurlhermore, Id2 has been shovn lo disrul lhe grovlh su
pressive activity of RB when the latter is unphosphorylated [17,20,26].
The observation of the pattern of Id2 expression following a mitogenic stimulus suggests
different functional roles for this protein during cell cycle progression. The first peak of Id2
expression takes place during the transition from G0-G1[13]. Id2 could have a role in the
modulation of p130-E2F4/5 complex activity and in the priming events that occur during this
reversible phase of the cell cycle. The second peak of Id2 expression takes place at late G1
phase, where Id2 could disrupt the repressor activity of p107 and/or pRb facilitating the entry
inlo lhe S hase. The Iink belveen Id2 and R has been furlher confirmed in animaI exeri
ments with double knockout mice for both RB and Id2 [20]. The early lethal phenotype shown
in Rb -/- embryos was rescued by Id2 ablation. Several mechanisms not mutually exclusive,
have been proposed to explain the physiological role of Id2 on the RB pathway (figure 3):
1. Id2 binding to tumor suppressor protein RB would interfere with its anti-proliferative
functions. Expression of Id2 is induced as a response to mitogenic stimuli in a variety of
cell types. Therefore, a stoichiometric excess of Id2 would block RB by direct binding to
this tumor suppressor [9,12, 29]. E2F is an important factor involved in RB function.
AIlhough lhe direcl binding of Id2 lo R roleins have been demonslraled, lhe reIalion
shi belveen ceIIuIar R-I2I and R-Id2 comIexes is oorIy underslood. Immunore
cipitation experiments have shown that E2F, RB and Id2 take part of the same complex in
rat liver, most probably bound to gene promoters [30]. These data suggests that Id2 and
E2F can bind simultaneously to the same molecule of RB (figure 3a). Nevertheless, it
cannot be exclude the possibility that Id2 and E2F would compete for binding to RB (figure
3b). In this model, the cellular excess of pocket proteins is the main safeguard mechanism
of negative control on cell cycle progression.
2. In addition to RB, the targets of Id2 could be the effectors of RB-mediated cell cycle arrest
(figure 3c). These effectors could be either, bHLH or non-bHLH proteins that can also
modulate the expression or activity of important proteins controlling the cell-cycle.
CDK inhibitors (CDKIs) enhance the suppressor activity of RB proteins blocking cell cycle
progression. Therefore, proteins involved in the modulation of CDKI expression or activity
could be considered as part of the RB effectors. As mentioned above, Id2 blocks the expression
of cell cycle inhibitors such as p21
Cip1
or p57
Kip2
. Over-expression of Id2 was able to reverse
p57
Kip2
- and p21
Cip1
-induced cell cycle arrest [24,25] The expression of these inhibitors is
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
95
modulated by bHLH transcription factors. Id2 heterodimerization with these factors will lead
to CDKI repression and activation of CDKs. Moreover, MyoD a class II
a. Id2 and L2I4 s|mu|taneous|y b|nd|ng to k8
k8
L2I
Id2
E2F-target
genes
b.L2I4 and Id2 compete for b|nd|ng to k8
k8
L2I
L2I
nA1
Ac-H3/4
E2F-target
genes
Id2
k8
Co-represssor
comp|ex
c.Id2 targets the effectors of k8-med|atedce|| cyc|e arrest
k8
L2I
E2F-target
genes
CycIin/cdk
CDkI
TF
Id2
Id2
Co-represssor
comp|ex
Co-represssor
comp|ex
k8
Figure 3. Models or d2 uncLion associaLed Lo proLeins.(a) d2 and L24 sinulLaneously bind Lo Lhe sane nole
cule o on gene pronoLers. d2 excess geLs resLrain Lhe repressive acLiviLy o . (b).L24 and d2 conpeLe or bind
ing to RB. When RB is in excess prevents binding of Id2 to E2F and keeps its repressive activity. An excess of Id2
prevents binding of RB to E2F and restrains its repressive activity recruiting HATs to gene promoters. (c) Id2 targets the
effectors of RB-mediated cell cycle arrest. Id2 dimerization with bHLH factors down-regulates the expression of CDKIs.
hyperphosphorylaLion by ree cyclinICDKs will lead Lo Lhe LranscripLion o L2LargeL genes. n addiLion, d2 dineri
zation with non-bHLH transcription factors will block their DNA-binding activity necessary to modulate transcription
of E2F-target genes.
bHLH protein known to induce p21
Cip1
transcription, has been shown to act by itself as a CDKI.
MyoD binds to and inhibits CDK4 [31]. Therefore, Id2 heterodimerization with MyoD would
block MyoD function as a CDKI.
In addition to bHLH proteins, Id2 (and other members of the Id family of proteins) also binds
to other classes of transcription factors. A brief example of these non-bHLH factors includes
Pax [32] or factors from the ternary complex (TCF) sub-family of ETS-domain proteins. TCF
proteins such as Elk-1, SAP-1 and SAP-2 modulate the expression of immediate-early genes
following a mitogenic stimulus by binding to serum response factor (SRF). Id2 binding to the
Chromatin Remodelling 96
ETS DNA binding domain of TCFs prevents the interaction TCF/SRF and disrupts binding of
this complex to the serum responsive element on gene promoters [33].
In all these models, Id2 activity could be restrained by RB to keep its anti-proliferative function
as shown by Lasorella [20]. The negative role of RB proteins on Id2 could be essential to keep
cell cycle arrest for two reasons: First RB would be free to bind to and to restrain the expression
of E2F-target genes, and second it would prevent Id2 binding to other targets. On the other
hand, a high concentration of Id2, as it occurs in neoplastic transformation, may relieve E2F-
driven transcription from the repressive influence of RB. In addition, Id2 would enhance cell
proliferation modulating the expression and/or activity of other targets.
2.2. Id2 in cancer: Increased cell proliferation and survival
The role of Id proteins in cancer has been of much interest in the last decade. Variations in
expression levels of Id proteins have to be integrated into the whole cellular equilibrium. An
upstream deregulation of Id activity, going from Id gene transcription to Id protein, can result
in the downstream deregulation of diverse genes. The first evidence connecting Id2 expression
and cancer came from the observation that Id2 is a transcriptional target of both N-Myc and
c-Myc [20]. Id2 transcription is induced by Myc via binding to E-boxes on Id2 promoter. It has
been suggested that Myc increases Id2 expression to bypass the inhibitory activity of RB. TGF-
, a cytokine known to induce a cytostatic program, inhibits Id2 expression in epithelial cells
and in human keratinocytes by induction of the Myc antagonistic repressors Mad2 and Mad4.
Replacement of Myc-Max complexes with Mad-Max complexes on the Id2 promoter drives
Id2 downregulation [34].
Additional evidence for the oncogenic role of Id2 came from studies in which ectopic over-
expression of Id2 in developing thymocytes caused a rapid development of lymphomas [35].
On the other hand, aberrant Id2 expression has been reported in squamous cell carcinoma,
primary human colorectal adenocarcinomas, pancreatic and prostate cancer or neuroblastoma
[11-16]. Id2 has also been related to cancer progression, showing that Id2 expression was higher
in high-grade astrocytic tumors than in low-grade tumors [36].
Data in the literature point out to the transcriptional control of Id2 as a key event in the
modulation of its function. In this sense, a highly expressed Id2 is not only involved in cell
proliferation, but it also promotes cell survival in different cell types. Over-expression of Id2
blocks the TGF--induced apoptosis [37]. The role for Id2 as a survival factor in mammary
gland development has also been demonstrated [38]. On the other hand, IGF-I known to be a
survival growth factor, induces Id2 expression in murine hematopoietic cells [39j. Iurlher
more, knockdown of Id1 and Id2 gene expression have been shown to induce apoptosis in gut
epithelial cells [37]. These observations, together with the fact that ectopic over-expression of
Id2 enhances cell proliferation, would suggest that a highly expressed Id2 could confer a
proliferative advantage to tumor cells through the modulation of both, growth and survival
pathways.
Although it is generally accepted that deregulated expression of Id2 maintains a highly
proliferative state and/or extends the half-life of cells in culture [13], Id2 over-expression is not
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
97
sufficient for cell transformation. Actually, we must be careful to distinguish between events
in cell culture and in animals, because the requirements for the modulation and role of Id2 in
culture may be mainly related to its requirements in a transformed state more than the
requirements in a normal physiological situation. Finally, even though Id2 over-expression
has been detected in the above mentioned cancer types and its oncogenic activities cannot be
denied, its deregulation is relatively rare. In contrast, Id1 over-expression has been detected
in a larger number of cancer types [23] and seems to have a more prominent role during cancer
progression.
2.3. Id2 during G0-G1 transition
Since Id2 appears to facilitate and not to support cell cycle progression, it is possible that Id2
could have a role in the process of cell priming, sensitizing cells to a proliferative stimulus.
This priming events take place during the G0 to G1 transition and, as already mentioned, are
needed to obtain a fully proliferative response to mitogenic stimuli. The pattern of Id2
expression during the priming events support this hypothesis: During G0-G1 transition there
is a transient increase of Id2 mRNA levels [13,30].
Liver regeneration after PHx is a unique model to study cell cycle events that take place in a
synchronized manner in vivo. The protein c-Myc, proposed as part of the priming events in
liver regeneration, modulates the expression of proteins important to progress into the cell
cycle. The expression of very-early genes such as c-fos, c-jun, or c-myc lakes Iaces in a coordi
nated and sequential way. The up-regulation of some genes will trigger the next wave of gene
expression. c-Myc was suggested to use Id2 as a mediator to bypass the suppressive activity
of RB [19,20]. During G0-G1 transition after PHx in rat liver there is a concomitant and short
up-regulation of both Id2 and c-myc mRNA.
In the last decades, c-Myc has been the object of intense study in an attempt to unveil the
molecular mechanism behind the control of its abundance [review in ref 40]. c-Myc levels can
be subject to several modes of regulation, going from posttranslational control to mRNA
stability and transcriptional regulation [41-44]. The c-myc gene, although it contains a dual
promoter, is predominantly transcribed from the P2 promoter [45]. It is shown to harbor a
promoter-paused RNApol II [46] In addition to other important regulatory sites upstream of
P2 promoter, an E2F binding site at position -58 from the P2 transcription start site has been
identified [45,47]. This E2F site has been demonstrated to be essential for c-myc transcription.
It negatively controls c-myc transcription by recruitment of pocket proteins such as p130 that
will function as a scaffold for HDAC complexes [48]. Overlapping with the E2F site there is an
element essential to remodel nucleosome structure and to open c-myc promoter [45].
c-Myc expression, like Id2 expression, is induced in two stages following PHx. The first
induction during G0-G1 phase, takes place at the onset of liver regeneration and the second
peak is observed during the transition into the S phase. However, both peaks of c-myc
expression are the result of different modes of regulation. While the first increase of c-myc
expression is caused by a transcriptional and posttranscriptional up-regulation of the gene,
the second peak results as a consequence of enhanced mRNA stability [49]. During G0-G1, c-
myc lranscrilionaI inilialion increases al 1h afler IHx in mice Iiver. SlrikingIy, lhis lranscri
Chromatin Remodelling 98
tional initiation has been shown to be compensated by a concomitant block of transcriptional
elongation [46,49]. Elongation blockage of c-myc transcription has been considered as a
mechanism to prevent over-expression of the mRNA [50].
The puzzling observation that both pausing and transcriptional initiation of c-myc are
enhanced in the regenerating liver lead to hypothesize that increased transcriptional initiation
of c-myc in this growth process might be driven by a component of a more general response
[49]. Several genes that share common target sequences could be simultaneously activated by
a common mechanism, but only additional and specific factors will render the final pattern of
gene exression. Indeed, lhere are hundreds of I2I-largel genes lhal, aIlhough lranscrilion
ally dependent on RB proteins, do not show the same gene expression profile. This suggestive
idea make us wonder about the identity of that "component of a more general response"
involved in transcription initiation.
Figure 4. Model or Lhe role o d2 on cnyc expression in raL liver aLer Hx. n liver under basal condiLions hepaLo
cytes rest at G0. E2F4, p130, Id2 and the HDAC complex are bound on the c-myc promoter. RNApol II is paused on
gene promoter. Since chromatin is deacetylated and closed, paused RNApol II cannot progress and c-myc transcription
is repressed. Soon early after PHx, Id2 and the HDAC complex are released. Chromatin will be acetylated and opened.
This chromatin structure will allow paused RNApol II to progress. c-myc transcription will be transiently up-regulated.
c-Myc protein will bind to Id2 promoter inducing its expression. High levels of Id2 will favor its reassemble on c-myc
promoter together with the HDAC complex. Chromatin structure will be closed and RNApol II will remain paused on c-
myc promoter. Consequently, c-myc expression is shut off.
Id2 could play such a role as part of a common mechanism for transcription of E2F-driven
genes. Id2 has been shown to bind to a repressor complex on c-myc promoter that affects
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
99
chromatin structure (figure 4) [30]. On quiescent hepatocytes Id2, mSin3A (a co-repressor that
constitutes the core of HDAC1 and HDAC2 complex), E2F4 and p130 remain bound to the c-
myc promoter repressing its expression. Additionally, immunoprecipitation experiments
revealed that Id2 is bound to mSin3A(HDAC), E2F4 and p130. Upon stimulation after PHx,
Id2 and mSin3A(HDAC) are released from the c-myc promoter concurrently with a, at least
in part c-myc transcriptional up-regulation. On the other hand, the transient c-myc up-
regulation is followed by an increase of Id2 mRNA. Since c-Myc modulates Id2 transcription
and Id2 modulates c-myc expression, a possible regulatory loop would finally control c-myc
abundance. These observations lead to propose Id2 as part of the priming events described for
liver regeneration and perhaps for some other processes [30].
This hypothesis would go further from the initial idea of Id2 as a simple effector of c-myc to
bypass the repressive activity of RB. In this sense, endogenous levels of activated Id2 were
shown to enhance but not to support the rate of proliferation in oligodendrocyte precursor
cells at the time that slows the rate of differentiation [51]. The authors suggested that Id2 takes
part of an intrinsic timing mechanism to control or limit cell proliferation in biological
rocesses highIy deendenl on a sequenliaI chain of signaIs lhal musl be lransienlIy synlhe
sized to coordinate the process.
The significance of the mechanism proposed for the role of Id2 in the regulation of c-myc
expression, might be extended to the modulation of other genes. To ask whether Id2 plays a
global role on transcriptional regulation and/or if it is restricted to E2F4 target genes, we
performed genome-wide ChIP-on-chip experiments with antibodies specific for mouse Id2
and E2F4 in quiescent mouse liver [manuscript in preparation]. Promoter arrays contained
approximately 28,000 known mouse genes centered on the region from -6 kb to +2.5 kb relative
to the transcription start site at an average resolution of 35 bp. Analysis of at least three
independent experiments for each factor identified 871 target regions for Id2, and 9307 for
E2F4. A comparison of Id2 and E2F4 target regions indicated a limited overlap of 550 target
regions for both factors. Moreover, a genome-wide factor location analysis and region
classification for E2F4 and Id2-bound regions compared to the genome revealed that although
E2F4-alone showed a 100% overlap with gene promoters, positive probes for E2F4/Id2 were
partially overlapping with the first exon of genes. This observation suggests that there is a
common structure in those genes modulated by E2F4/Id2 that differs from those bound by
E2F4 alone. Moreover, E2F4 and Id2 seem to mutually influence each others binding position
and behave like a complex on chromatin. Finally, an in silico gene expression analysis for E2F4
or Id2 positive genes showed that Id2/E2F4-bound genes were mostly repressed in liver basal
conditions versus those bound by E2F4 alone.
ChIP-on-chip data confirm that although not all E2F-target genes bind Id2, a subset of
these genes might be modulated by the same mechanism as c-myc. This would be a
promising molecular mechanism to explain the pleiotropic activities of Id2 affecting the
expression of a variety of genes. Id2 could be one of those signals shared by a plethora
of bioIogicaI resonses lo differenl slimuIi and arl of a common mechanism for lran
scription initiation of different genes.
Chromatin Remodelling 100
Most of papers in the literature are focus on the role of Id2 in proliferating, undifferentiated
or otherwise transformed cells. However, the behavior of Id2 seems to be quite different
depending on the microenvironment, its expression levels, compartmentalization and/or
phosphorylation. In other words, the role of Id2 in quiescent cells seems to be different from
the one observed in long term proliferating cells. While "activated" Id2 seems to promote cell
cycle progression after a proliferative stimulus, "inactivated" Id2 seems to limit or to control
the number of cell divisions in quiescent cells
3. Signals involved in the molecular regulation of Id2 activity and function
Id2 expression levels have been classically described as a key event for Id2 function. In general,
Id2 expression is high in proliferating cells and low or almost absent in non-proliferating cells
such as terminally differentiated cells. However, Id2 is a pleiotropic protein involved in many
olher funclions differenl from ceII roIiferalion. TGI- (a cylokine vhose funclion is highIy
dependent on the microenvironment) represses Id2 expression in epithelial cells [34] but
induces Id2 up-regulation in dendritic cells [52]. Glucocorticoids [53], starvation [54j, anlidia
belic agenls and eroxisome roIiferalor-aclivaled recelor (IIAR) gamma agonisls or
members of HDAC famiIy incIuding HDAC1-8 |9] are some of the many examples reported
to inhibit Id2 expression in specific cell types. Furthermore, this signals can be connected and
coordinaled. Ior inslance, il seems lhal HDAC is invoIved in lhe moduIalion of Id2 exression
lhrough lhe inleraclion vilh severaI signaIing alhvays such as lhe HDAC/Ying Yang1, lhe
Wnl--calenin-TCI7L2 and lhe MI alhvays lhal can be muluaIIy coordinaled in a differenl
way in different cell types.
On the other hand, Id2 expression can be up-regulated by many factors such as glucose [55]
insulin-like growth factor, estrogen, progesterone, thyroid hormone or hypoxia-inducible
faclor-1o |reviev in ref 9j. Moreover, recenlIy il has been ubIished a Iarge-scaIe RNAi screen
to characterize genes involved in the regulation of Id2 expression [56]. To further complicate
it, in addition to a growing list of up- and down-regulators of Id2 expression, the protein
undergoes a rapid turnover, having a reported half-life of 20-60 min, depending on the cell
type [57,58]. Thus, Id2 can be regulated at several levels, i.e. transcriptional regulation and
rolein slabiIily. AIlhough lhe imorlance of lhese modes of reguIalion cannol be denied, lhey
do not explain the underlying mechanisms for the regulation of Id2 activity. It is important to
highlight that there are reports describing an important role for Id2 in conditions in which its
rolein IeveIs do nol subslanliaIIy change |51j.
3.1. Id2 phosphorylation and cell compartmentalization
An imorlanl mechanism roosed lo reguIale Id2 aclivily is lhe hoshoryIalion of secific
residues. There is a hoshoryIalion sile for CDK-lye kinases cIose lo lhe amino-lerminaI
domain of Id2 roleins. This sile comrises lhe consensus sequence for CDK subslrales (S/T-
I-X-K/R) lhal is conserved among olher members of lhe Id famiIy. Id2 has been shovn lo be
hoshoryIaled in Ser5 vilhin lhis consensus sequence by cycIin A/I/CDK2. This hoshor
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
101
ylation was reported to prevent Id2 binding to some bHLH factors and to block the activity of
Id2 in serum stimulated human fibroblasts. In vitro experiments with a mutant form of Id2 in
which Ser5 was change to Ala (Id2-S5A), showed that when Id2 phosphorylation was blocked,
Id2 was able to interact with the bHLH protein MyoD. In agreement with this, cyclinA/CDK2
phosphorylation of wild type Id2 prevented its binding to MyoD. The relation between cell
proliferation and Id2 phosphorylation state was also established. Indeed, expression of Id2-
S5A caused a 50% reduclion in coIony formalion, suggesling lhal suslained unhoshoryIal
ed-Id2 is growth inhibitory [59]. Nevertheless, it seems that Id2 phosphorylation do not
necessarily blocks Id2 interaction with other proteins. A latter report suggested that CDK2
phosphorylation of Ser5-Id2 is necessary for the interaction of Id2 with factors that allow
nuclear transport such as E47 [60].
From these observations we should infer that Id2 phosphorylation at Ser5 does not block any
of its possible interactions with other proteins. Interestingly,Id2 phosphorylated in vitro and
in vivo was subject to a tryptic peptide mapping. The unique phosphopeptide found in vitro
resulted to be phosphoSer5-Id2. However, two phosphopeptides were observed in the Id2
recovered from the experiment in vivo. Whereas lhe firsl hoshoelide vas aIso hoshoS
er5-Id2, the identity of the second phosphopeptide in metabolically labeled Id2 needs to be
determined. The authors suggested that it might reflect the action of a non-CDK kinase such
as PKA or PKC on Id2 [59]. Although this possibility needs to be confirmed in vivo, these two
kinases have been reported to phosphorylate Id2 in vitro [61]. In that case, it is reasonable to
think that the different activities of Id2 or its interaction with other proteins could be dependent
on the type or number of residues phosphorylated by specific kinases.
Another important consequence of Id2 phosphorylation on Ser5 has been pointed out above.
This phosphorylation seems to be necessary for Id2 nuclear localization and proliferating
activity. Ectopic over-expression of Id2-S5A and wild type Id2 in smooth muscle cells show a
different subcellular distribution. While wild type Id2 localization was predominantly nuclear,
mutant Id2-S5A was excluded from the nucleus,. Moreover, over-expression of wild type Id2
in smooth muscle cells leads to increase Id2 phosphorylation, down-regulation of p21 and
enhanced cell proliferation. In contrast over-expression of unphosphorylated Id2-S5A could
not promote cell proliferation [60].
The subcellular distribution is one of the major points for the regulation of Id2 activity and
funclion. During differenlialion of oIigodendrocyle recursor ceIIs (OIC) inlo oIigodendro
cytes, Id2 protein levels are similar. Interestingly, the cellular distribution of Id2 dramatically
changed as OPC differentiate. Id2 was localized into the nucleus of undifferentiated OPC
whereas in fully differentiated oligodendrocytes Id2 was localized in the cytoplasm [51].
Moreover, the authors show that Id2 needs to translocate from the nucleus to the cytosol prior
to cell differentiation.
Id2 contains two export signals (NES1 and NES2) in the HLH domain and the C-terminal
domain respectively. NES1 was found to be conserved among all members of the Id family,
and NES2 was shown to be specific for Id2. Although Id2 transport between nucleus and
cytosol had been proposed to be by passive diffusion, the recent data point out also to an active
transport of Id2. Id2 export from the nucleus is mediated by NES2. However, Id2 does not
Chromatin Remodelling 102
contain a nuclear localization signal (NLS) and translocation from the cytosolic compartment
into the nucleus should be mediated by its interaction with a NLS-containing protein. In this
way, translocation can be mediated by interaction of Id2 with E proteins such as E47[60].
Phosphorylation of Id2 favors Id2/E47 interaction and nuclear translocation. Nevertheless, it
is important to highlight that interaction with E proteins can also function sequestering Id2 in
the cytosol [61]. Moreover, since Id2 can bind to non-HLH proteins, other factors up-regulated
during cell differentiation can sequester Id2 preventing its transport into the nucleus. A
cytoskeleton-associated protein enigma homolog (ENH) is a good example of a number of
proteins described to retain Id2 in the cytosol. ENH is a member of the enigma family of PDZ-
LIM domain proteins that is associated to the actin cytoskeleton by direct interaction between
its PDZ domain and the o-actinin. Id2 binds to ENH through specific interaction between the
INH-LIM domain and lhe Id2-HLH domain. INH, u-reguIaled during neuraI differenlia
tion, sequesters Id2 in the cytoplasm preventing cell-cycle progression and releasing bHLH
factors from the restrictive activity of Id2 [62]
3.2. Role of GSH on Id2 modulation
Id2 expression and interaction with other proteins has been shown to be modulated by GSH
content [63,64]. The tripeptide glutathione is one of the most important systems against
oxidative stress in the organism. Alteration of redox balance can affect cell signaling pathways
through the induction of protein posttranslational modifications or, in an indirect manner, by
the modulation of transcription factor binding activity and signal transduction pathways [65].
However, while the role of cell GSH content in the synthesis of DNA and protection against
oxidative damage has been long established, little is known about its sub-cellular distribution
and functions in specific compartments. Moreover, the nucleus of dividing cells dramatically
change throughout progression into the cell-cycle. It has been recently shown that nuclear GSH
content is high in proliferating cultured cells. On the contrary, quiescent cells show similar or
lower GSH levels in the nucleus than in the cytosol [66]. In this sense, although most of data
describe a significant increase in the hepatic GSH content at 12h after PHx [67], at earlier times,
when the priming events take place, there is a 49% reduction in GSH content [68]. Finally, an
increasing number of evidences establish a correlation between GSH content and gene
expression. Interestingly, it has been speculated that ROS generation induced by a shift in the
redox status of cells could affect gene expression by altering chromatin configuration [69,70].
3.2.1. GSH depletion and Id2 up-regulation
The nature of a rapid response triggered by a stimulus suggests pre-existing signals within the
tissue that could modulate the expression of Id2 and/or its activity. Moreover, the role of GSH
as part of a sensitization process has been already described. GSH depletion sensitizes cells to
c-myc-induced aolosis or roIiferalion in a variely of ceII lyes, such as myobIasls, meIa
noma cells or hepatocytes [65,71]. Treatment of rats with l-buthionine-(S,R)-sulfoximine (BSO),
lhe inhibilor of y-glutamil-cysteine synthetase, induces a rapid GSH depletion in liver that in
some way resembles the one observed after PHx (figure 5). Interestingly, BSO treatment also
induces two marked peaks of c-myc and Id2 expression in rat liver [69]. The first peak of c-
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
103
myc expression after GSH depletion shows a short up-regulation also described for other
stimuli, a stereotypical transcriptional pulse that lasts for 2-3h and is followed by a shutoff [72].
The second peak of c-myc mRNA was shown to be the result of a posttranscriptional mRNA
up-regulation.
0
20
40
60
80
100
120
140
160
180
0 6 12 18 24
PH
BSO
%

l
i
v
e
r
G
S
H

c
o
n
t
e
n
t
v
s
.

c
o
n
t
r
o
l
Time after stimulus(h)
Figure 5. GSH content in rat liver after PHx or in BSO-treated animals. White squares represent GSH levels in rat liver
during the time course of BSO experiment (Torres et al. refer 63) Black squares represent GSH levels in rat liver during
the time course of liver regeneration after PHx (Lee et al. ref. 68).
GSH depletion seemed to be involved in the release of the repressor complex Id2/
mSin3A(HDAC) from the c-myc promoter as it occurred after PHx (figure 4). The proteins Id2
and mSin3A are released from the c-myc promoter as soon as the GSH content decreases 20%
under basal levels. Concomitantly with the release of the repressor complex, c-myc expression
is induced. When Id2 and mSin3A turns back to the c-myc promoter, the transcription of the
gene is down-regulated. Nevertheless it could not be established a relationship between GSH
content and the return of Id2 to the c-myc promoter. However, linking these observations to
liver regeneration, it would be possible that a decrease in GSH content very early after PH
could promote the release of Id2/mSin3A(HDAC) from the c-myc promoter.
Nevertheless, this event would not be enough to induce the transient transcription initiation
of c-myc observed after GSH depletion with BSO. However, the release of Id2 and
mSin3A(HDAC) from the c-myc promoter would induce profound changes in chromatin
structure to become accessible to transcription factors. Indeed, a deeper insight into the
molecular mechanisms involved in the regulation of transcription at the first peak of c-myc
expression after GSH depletion, suggested an important role for STAT3 at this peak. GSH
depletion induces STAT3 phosphorylation, recruitment of CBP/p300 (HAT) and binding to a
region that overlaps the E2F site in the c-myc gene P2 promoter shown to be important for
nucleosomal structure [73]. These observations are in agreement with the idea of GSH and Id2
as part of a general mechanism to sensitize cells to respond to a given stimulus (figure 6): Id2
release would lead to an open chromatin structure allowing transcription factors to gain access
Chromatin Remodelling 104
to gene promoters. The specificity of the response would be achieve by the precise combination
of activated-transcription factors and their binding to a particular gene promoter, like in this
case occurs with STAT3 and c-myc promoter.
Figure 6. Model or Lhe role o GSH on Lhe nodulaLion o d2 acLiviLy. n quiescenL cells, under physiological GSH con
tent E2F4, p130, Id2 and the HDAC complex are bound on the c-myc promoter. Chromatin structure will be closed,
inaccessible to transcription factors. RNApol II is paused on the c-myc promoter and unable to transcribe the gene.
Early after an acute GSH depletion, Id2 and HDAC would be released from c-myc promoter. Chromatin will be now
open and accessible for transcription factors like STAT3 that could now specifically induce transcription initiation.
These events would enhance an open hyperacetylated chromatin structure and RNApol II progression.
3.2.2. GSH depletion and Id2 down-regulation
It has been demonstrated that drugs, infections, inflammation, or cell proliferation can alter
GSH levels and cause a shift in the GSH/GSSG redox status of cells [65]. Over-expression of c-
myc and GSH depletion has been described in a variety of both experimentally induced and
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
105
naturally occurring liver diseases including hepatocarcinoma, HCV infection, liver cirrhosis,
apoptosis and drug-induced toxicity [74]. The information about the signals mediating the
induction or repression of Id2 transcription in response to different stimuli is scarce and
sometimes contradictory. GSH depletion by BSO has been shown to induce Id2 expression by
c-Myc [63]. Conversely, TGF- which decreases the concentration of GSH in a variety of cell
types [75], has been shown to induce Id2 down-regulation through the modulation of c-Myc
[34]. Id2 is always defined as a pleiotropic protein whose behavior depends on its expression
levels, cell type, stimulus and in general on the cell microenvironment. In addition, Id2 is a
downstream target of multiple signaling pathways that can converge or interact with each
other giving rise to a specific response. Taking into account all these considerations, it is not
surprising that under pathological conditions the effect of GSH depletion on Id2 regulation
could be quite different.
Acetaminophen (APAP)-induced intoxication, the main cause of drug-induced liver failure in
the United States and Great Britain, produces a dramatic GSH depletion in the liver. The
deleterious effect of APAP excess has been attributed to its metabolization by the cytochrome
P450 system, which gives rise to the formation of N-acetyl-p-benzoquinoneimine (NAPQI).
This derivative of APAP will then react with GSH, inducing its rapid depletion within the liver
and generating oxidative stress. Moreover, when the formation of NAPQI exceeds the GSH
content, NAPQI will covalently bind to cellular proteins. Therefore, the hepatotoxicity of
APAP overdose is the consequence of the additive effect of NAPQI formation, GSH depletion,
oxidative stress and the generation of protein adducts (figure 7) [76].
Concomitantly with the GSH depletion there is a dramatic transcriptional-dependent decrease
of Id2 expression in response to APAP toxicity [64]. RNApol-II is released from Id2 coding
region and, the promoter is hypoacetylated. These data might suggest that the combination of
GSH deIelion, oxidalive slress and AIAI derivalives lhal are roduced afler AIAI inloxi
cation (depicted in figure 7) may be responsible for the observed Id2 repression.
Id2 expression is known to be dependent on c-Myc binding to its promoter [19,20], but
surprisingly GSH depletion stimulated by APAP-overdose increases c-myc transcription.
Hovever, lhe mRNA sleady slale IeveIs do nol correIale vilh lhe rolein IeveIs and consis
tently, c-Myc does not bind to Id2 promoter in response to APAP-overdose. Although APAP
induces c-myc transcription, it also triggers the proteasome pathway leading to decreased c-
Myc half life, which is in agreement with other observations showing the APAP-induced
degradation of specific proteins [77,78]. On the other hand, it has been shown that c-Myc down-
regulation is involved in the Id2 repression [34]. Accordingly, a decreased in c-Myc half life
induced by APAP overload would lead to Id2 repression.
Data from these experiments support the idea of a regulatory loop between Id2 and c-myc:
The down-regulation of Id2 would favor the release of the repressor complex mSin3A(HDAC)
from c-myc promoter and would render a peak of c-myc expression.
On the other hand, although APAP-overdose induces c-myc mRNA up-regulation, it decreases
c-Myc protein half life and therefore protein levels are diminished.
Chromatin Remodelling 106
Administration of N-acetycysteine (NAC) prior to APAP-overload prevents GSH depletion.
Moreover, it has been suggested that NAC interferes with the proteasome pathway induced
by APAP toxicity. NAC inhibits the 26S proteasome activity in cultured cells increasing the
stability of Iio and p53 [79]. Furthermore, the proteasome has been described as a redox-
sensitive system [80]. Interestingly, NAC pretreatment prevents c-Myc degradation and
accordingly, RNApol-II release from Id2 coding region is also prevented. Consistently, Id2
promoter is hyperacetylated and Id2 repression prevented. It is noteworthy to mention that
there is a parallelism between NAC protection and keeping Id2 expression at baseline levels.
Figure 7. Model for the regulation of Id2 expression in rat liver after acetaminophen overdose and protection by N-
aceLylcysLeine. AAoverdose is neLabolized by Lhe cyLochrone 450 sysLen giving rise Lo Lhe highly reacLive deriva
tive NAPQI. This derivative will be detoxified by covalent binding to GSH, which will be soon depleted inducing c-myc
expression. When NAQ exceeds GSH sLores, oxidaLive sLress and proLein adducLs ornaLion will induce cMyc degra
daLion. The absence o cMyc ron d2 pronoLer will block d2 basal expression. NAC replenishes GSH sLores Lhus pre
venting GSH depletion, protein adduct formation and the proteasome pathway activation. In the presence of NAC, c-
Myc degradation is prevented. Therefore, c-Myc binds to Id2 promoter supporting its basal expression.
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
107
CovaIenl binding of NAIQI lo milochondriaI roleins has been shovn lo induce milochon
drial dysfunction and to enhance the formation of reactive oxygen species. The effective
protection of high doses of NAC on APAP-induced liver damage has been attributed to the
recovery of hepatic and mitochondrial GSH levels. Nevertheless, NAC is not only a GSH
precursor, but it is also a reducing and antioxidant agent acting as a direct scavenger of free
radicals. Altogether this data suggest that NAC by itself and/or GSH seem to improve the
efficiency of the detoxifying system preventing, among other events, Id2 down-regulation. But
more importantly, the effect of GSH and oxidative stress in the modulation of Id2 in the context
of a wide spread pathology such as the intoxication by APAP seems to be the result of
cumulative and converging pathways. These observations highlight the importance of
eslabIishing lhe correcl Iandscae lo sludy lhe roIe of Id2, lhe moIecuIar mechanisms govern
ing its functions, and the physiological and pathological consequences of its regulation and
deregulation.
4. Conclusions and perspectives
Among the four members of Id family of proteins, Id2 is a key player in the modulation
of cell proliferation. However, many questions about its function in vivo remain unre
solved. Most of data about the role of Id2 as a proliferating factor are referred to either
tumors or cultured and/or transformed cells that might reflect conditions far away from
a physiological situation. This is especially relevant since it is well known and generally
accepted that the modulation of Id2 activity and its many functions depend on the cell
microenvironmenl. We aIready discussed lhe diamelricaIIy oosing effecls of GSH de
Ielion on Id2 in a alhoIogicaI condilion such as AIAI-induced loxicily and in an ex
perimental condition of BSO-induced GHS depletion [63,64].
In addition, the functions of Id2 are not exclusively dependent on its abundance, but also on
its posttranslational modifications, sub-cellular distribution and its interaction with a number
of different proteins [5,6,11-15 ]. Nevertheless, most studies use ectopic over-expression of Id2
as a tool to determine its functions and molecular mechanisms with independence of its
microenvironment. To understand the role of Id2 during cell proliferation, we should take into
account that the enzymatic activities, signaling networks and redox status of cells dramatically
change throughout the different phases of the cell cycle. A static image of Id2 during cell cycle
would lead to confusion. Id2 gene expression is exposed to a tight control, restrained by a
precise timing and coordinated with the expression of other proteins to interact with (i.e. ENH
is induced during cell differentiation to sequester Id2 within the cytoplasm).
Following this rational, we can deduce that Id2 functions will change as the cell progress
through the cell cycle. Actually, Id2 shows two marked peaks of gene expression during G0-
G1 and G1-S respectively that will have different effects on the regulation of the cell cycle. In
quiescent cells Id2 binds to hypophosphorylated p130, E2F4 and a co-repressor complex. Id2
expression is low at this stage. The role of Id2 at this phase is most probably to limit the number
of cell divisions enhancing repression of E2F-target genes.
Chromatin Remodelling 108
During G0-G1 transition, at the onset of the mitogenic stimuli there is a rapid change in both,
cylosoIic and nucIear comarlmenls (i.e. redox slalus, signaIing nelvorks, enzymalic aclivi
ties) that will change the preferential Id2-p130 interaction. Initial studies suggested that HDAC
complexes directly bound to RB proteins. Nevertheless, subsequent studies revealed that
recruitment of HDAC complexes to RB was mediated by RBP1 [28]. As already discussed, the
release of RB restrictive activity is the result of cumulative CDK-mediated phosphorylations.
These phosphorylations do not have an effect exclusively on RB proteins, but also on RBP1
that bridges SAP30/mSin3(HDAC) to RB proteins. CDK-mediated phosphorylation of RBP1
induces its dissociation from RB [28j. Il seems lhal during G1 hase lhe muIliIe and cumu
lative CDK-mediated phosphorylations of cell cycle-dependant proteins would set a threshold.
This ensures lhal lhe G1 hase can onIy be overcome vhen CDKs reach a crilicaI hoshory
lation threshold for efficient dissociation of HDAC and RB from E2F. Therefore it is not a matter
of "all or nothing", but the binding affinities between co-repressors, E2F and RB gradually
change. Following the same rational, it is tempted to speculate that Id2 could remain bound
to the repressor complex SAP30/mSin3/HDAC in quiescent cells and upon a stimulus, a CDK-
mediated phosphorylation of Id2 or its interacting proteins would release Id2 and the repressor
complex from p130. As already referred, Id2 is known to be phosphorylated during G1 phase
by cyclin A/CDK2 and cyclin E/CDK2 [24,59]. This phosphorylation may target Id2 for
ubiquitn-mediated proteasomal degradation and/or change its affinity for specific bHLH
proteins [81,82]. Alternatively, other posttranslational modifications of Id2 or Id2-interacting
proteins might condition Id2 release from E2F4/5 and p130 during G0-G1 transition. In the
future it will be crucial to determine those signals that modulating Id2-binding activities can
condition the transition from G0 to G1.
It is important to highlight that independently of the molecular mechanism that trigger Id2
release, this event seems to have a profound effect on chromatin structure changing its
accessibility to specific transcription factors that on their behalf could recruit HATs (as
depicted in figure 6). This mechanism seems to operate not only in a small subset of genes, but
on the contrary it can be extended to a larger group of genes (we have observed almost 400
Id2/E2F4-bound genes in our ChIP-on-chip experiments). We propose here the suggestive
hypothesis that Id2 could take part of a common mechanism for cell sensitization or priming
to fully respond to a mitogenic stimulus inducing an open chromatin structure. The resultant
expression of a particular gene will depend on the activation and DNA-binding of the precise
combination of transcription factors for the specific gene. Nevertheless, this hypothesis
remains as a challenge to cover and understand the molecular mechanisms of Id2 regulation
and more importantly to unveil Id2 role during G0-G1 transition.
Acknowledgements
This work was supported in part by grants from Ministerio de Ciencia e Innovacin (FIS
PS09-02360) to E.R.G-T and Plan Nacional I+D+I (BFU2010-18253) and Generalitat Valenciana
(PROMETEO 2010-075) to J.R.V.
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
109
Author details
Elena R. Garca-Trevijano, Luis Torres, Rosa Zaragoz and Juan R. Via
*Address all correspondence to: [email protected]
Department of Biochemistry and Molecular Biology, University of Valencia, Valencia, Spain
References
[1] Michalopoulos GK Liver regenerationJ. Cell Physiol.(2007). , 213, 286-300.
[2] Leist, M, Gantner, F, Bohlinger, I, Germann, P. G, Tiegs, G, & Wendel, A. Murine
healocyle aolosis induced in vilro and in vivo by TNI-aIha requires lranscri
tional arrest. J Immunol.(1994). , 153, 1778-1788.
[3] Benezra, R, Davis, R. L, Lockshon, D, Turner, D. L, & Weintraub, H. The protein Id: a
negative regulator of helix-loop-helix DNA binding proteins. Cell. (1990). , 61(1),
49-59.
[4] Murre, C, Mccav, I. S, Vaessin, H, Caudy, M, }an, L. Y, }an, Y. N, Cabrera, C. V, us
kin, J. N, Hauschka, S. D, Lassar, A. B, et al. Interactions between heterologous helix-
loop-helix proteins generate complexes that bind specifically to a common DNA
sequence. Cell. (1989). , 58(3), 537-44.
[5] Massari, M. E, & Murre, C. Helix-loop-helix proteins: regulators of transcription in
eucaryotic organisms. Mol Cell Biol. (2000). , 20, 429-440.
[6] Uzinova, M. B, & Benezra, R. Id proteins in development, cell cycle and cancer.
Trends Cell Biol. (2003). , 13(8), 410-8.
[7] Kim, H. J, Hong, J. M, Yoon, K. A, Kim, N, Cho, D. W, Choi, J. Y, Lee, I. K, & Kim, S.
Y. Early growth response 2 negatively modulates osteoclast differentiation through
upregulation of Id helix-loop-helix proteins. Bone. (2012). , 51(4), 643-50.
[8] Yokota, Y, Mansouri, A, Mori, S, Sugawara, S, Adachi, S, Nishikawa, S, & Gruss, P.
Development of peripheral lymphoid organs and natural killer cells depends on the
helix-loop-helix inhibitor Id2. Nature. (1999). , 397(6721), 702-6.
[9] Chen, X. S, Zhang, Y. H, Cai, Q. Y, & Yao, Z. X. ID2: A negative transcription factor
regulating oligodendroglia differentiation. J Neurosci Res. (2012). , 90(5), 925-32.
[10] Iavarone, A, King, I. R, Dai, X. M, Leone, G, SlanIey, I. R, & LasoreIIa, A. RelinobIas
toma promotes definitive erythropoiesis by repressing Id2 in fetal liver macrophages.
Nature. (2004). , 432(7020), 1040-5.
Chromatin Remodelling 110
[11] Norlon, }. D, & HeIix-Ioo, I. D. heIix roleins in ceII grovlh, differenlialion and lu
morigenesis J. Cell Sci. (2000). , 113, 3897-3905.
[12] Lasorella, A, Uo, T, & Iavarone, A. Id proteins at the cross-road of development and
cancer. Oncogene. (2001). , 20, 8326-8333.
[13] Zebedee, Z, & Hara, I. Id roleins in ceII cycIe conlroI and ceIIuIar senescence Onco
gene. (2001). , 20, 8317-8325.
[14] Yokota, Y, & Mori, S. Role of Id family proteins in growth control J. Cell. Physiol.
(2002). , 190, 21-28.
[15] Fong, S, Debs, R. J, & Desprez, P. Y. Id genes and proteins as promising targets in
cancer therapy.Trends Mol Med. (2004). , 10(8), 387-92.
[16] Coma, S, Amin, D. N, Shimizu, A, Lasorella, A, Iavarone, A, & Klagsbrun, M. Id2
promotes tumor cell migration and invasion through transcriptional repression of
semaphorin 3F. Cancer Res. (2010). , 70(9), 3823-32.
[17] Iavarone, A, Garg, P, Lasorella, A, Hsu, J, & Israel, M. A. The helix-loop-helix protein
Id-2 enhances cell proliferation and binds to the retinoblastoma protein. Genes Dev.
(1994). , 8(11), 1270-84.
[18] Norlon, }. D, & Alherlon, G. T. CouIing of ceII grovlh conlroI and aolosis func
tions of Id proteins. Mol Cell Biol. (1998). , 18(4), 2371-81.
[19] LasoreIIa, A, oIdrini, R, Dominici, C, Donfrancesco, A, Yokola, Y, Inserra, A, & Ia
varone, A. Id2 is critical for cellular proliferation and is the oncogenic effector of N-
myc in human neuroblastoma. Cancer Res. (2002). , 62(1), 301-6.
[20] Lasorella, A, Noseda, M, Beyna, M, & Iavarone, A. Id2 is a retinoblastoma protein
target and mediates signalling by Myc oncoproteins. Nature. (2000). , 407(6804),
592-8.
[21] Maruyama, H, Kleeff, J, Wildi, S, Friess, H, Bchler, M. W, Israel, M. A, & Korc, M.
Id-1 and Id-2 are overexpressed in pancreatic cancer and in dysplastic lesions in
chronic pancreatitis. Am J Pathol. (1999). , 155(3), 815-22.
[22] Gray, M. J, Dallas, N. A, Van Buren, G, Xia, L, Yang, A. D, Somcio, R. J, Gaur, P,
MangaIa, L. S, Vivas-me|ia, I. I, Ian, I, Sanguino, A. M, GaIIick, G. I, Loez-bere
slein, G, Sood, A. K, & IIIis, L. M. Theraeulic largeling of Id2 reduces grovlh of hu
man colorectal carcinoma in the murine liver. Oncogene. (2008). , 27(57), 7192-200.
[23] Hasskarl, J, & Mnger, K. Id proteins--tumor markers or oncogenes? Cancer Biol
Ther. (2002). , 1(2), 91-6.
[24] Malsumura, M. I, Lobe, D. R, & Mcnamara, C. A. Conlribulion of lhe heIix-Ioo-he
lix factor Id2 to regulation of vascular smooth muscle cell proliferation. J Biol Chem.
(2002). , 277(9), 7293-7.
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
111
[25] Rothschild, G, Zhao, X, Iavarone, A, & Lasorella, A. E Proteins and Id2 converge on
to regulate cell cycle in neural cells. Mol Cell Biol. (2006). , 57Kip2.
[26] Lasorella, A, Iavarone, A, & Israel, M. A. Id2 specifically alters regulation of the cell
cycle by tumor suppressor proteins. Mol Cell Biol. (1996). , 16(6), 2570-8.
[27] Chen, H. Z, Tsai, S. Y, & Leone, G. Emerging roles of E2Fs in cancer: an exit from cell
cycle control. Nat Rev Cancer. (2009). , 9(11), 785-97.
[28] Suryadinala, R, Sadovski, M, SleeI, R, & Sarcevic, . CycIin-deendenl kinase-medi
aled hoshoryIalion of RI1 and Rb romoles lheir dissocialion lo mediale re
lease of the SAP30 mSin3 HDAC transcriptional repressor complex.J Biol Chem.
(2011). , 286(7), 5108-18.
[29] Ian, L. X, Li, X, Magenheimer, , & CaIvel, }. I. Li X Inhibilion of hislone deacelyIas
es largels lhe lranscrilion reguIalor Id2 lo allenuale cyslic eilheIiaI ceII roIifera
tion. Kidney Int. (2012). , 81(1), 76-85.
[30] Rodriguez, }. L, SandovaI, }, Serviddio, G, Saslre, }, Moranle, M, IerreIIi, M. G, Marli
nez-chantar, M. L, Via, J, Via, J. R, Mato, J. M, Avila, M. A, Franco, L, Lpez-rodas,
G, & Torres, L. Id2 Ieaves lhe chromalin of lhe I2I4-c-myc romoler during healo
cyte priming for liver regeneration. Biochem J. (2006). , 130.
[31] Zhang, J. M, Zhao, X, Wei, Q, & Paterson, B. M. Direct inhibition of G(1) cdk kinase
aclivily by MyoD romoles myobIasl ceII cycIe vilhdravaI and lerminaI differenlia
tion. EMBO J. (1999). , 18(24), 6983-93.
[32] Roberts, E. C, Deed, R. W, Inoue, T, & Norton, J. D. Sharrocks AD Id helix-loop-helix
proteins antagonize pax transcription factor activity by inhibiting DNA binding. Mol
Cell Biol. (2001). , 21(2), 524-33.
[33] Stinson, J, Inoue, T, Yates, P, Clancy, A, Norton, J. D, & Sharrocks, A. D. Regulation
of TCF ETS-domain transcription factors by helix-loop-helix motifs. Nucleic Acids
Res. (2003). , 31(16), 4717-28.
[34] SiegeI, I. M, Shu, W, & Massague, }. Mad ureguIalion and Id2 reression accoma
ny lransforming grovlh faclor (TGI)-bela-medialed eilheIiaI ceII grovlh sures
sion. J Biol Chem. (2003). , 278(37), 35444-50.
[35] Morrow, M. A, Mayer, E. W, Perez, C. A, Adlam, M, & Siu, G. Overexpression of the
HeIix-Loo-HeIix rolein Id2 bIocks T ceII deveIomenl al muIliIe slages. MoI Im
munol. (1999). , 36(8), 491-503.
[36] Vandeputte, D. A, Troost, D, Leenstra, S, Ijlst-keizers, H, Ramkema, M, Bosch, D. A,
Baas, F, Das, N. K, & Aronica, E. Expression and distribution of id helix-loop-helix
proteins in human astrocytic tumors. Glia. (2002). , 38(4), 329-38.
Chromatin Remodelling 112
[37] Cao, Y, Liu, X, Zhang, W, Deng, X, Zhang, H, Liu, Y, Chen, L, & Thompson, E. A.
Tovnsend CM }r, Ko TC. TGI-bela reression of Id2 induces aolosis in gul eilhe
lial cells. Oncogene. (2009). , 28, 1089-1098.
[38] Kim, N. S, Kim, H. T, Kwon, M. C, Choi, S. W, Kim, Y. Y, Yoon, K. J, Koo, B. K, Kong,
M. P, Shin, J, & Cho, Y. Kong YY Survival and differentiation of mammary epithelial
cells in mammary gland development require nuclear retention of Id2 due to RANK
signaling. Mol Cell Biol. (2011). , 31(23), 4775-88.
[39] Prisco, M, Peruzzi, F, Belletti, B, & Baserga, R. Regulation of Id gene expression by
lye I insuIin-Iike grovlh faclor: roIes of Slal3 and lhe lyrosine 950 residue of lhe re
ceptor. Mo.l Cell. Biol. (2001). , 21, 5447-5458.
[40] Oster, S. K, Ho, C. S, Soucie, E. L, & Penn, L. Z. The myc oncogene: MarvelouslY
Complex. Adv Cancer Res. (2002). , 84, 81-154.
[41] Vervoorts, J, Lscher-firzlaff, J, & Lscher, B. The ins and outs of MYC regulation by
posttranslational mechanisms. J Biol Chem. (2006). , 281, 34725-3479.
[42] Langa, F, Lafon, I, Vandormael-pournin, S, Vidaud, M, Babinet, C, & Morello, D.
HeaIlhy mice vilh an aIlered c-myc gene: roIe of lhe 3' unlransIaled region revisil
ed..Oncogene. (2001). , 20, 4344-4353.
[43] Levens, L. D. Making Myc. Curr. Top. Microbiol. Immunol., (2006). , 302, 1-32.
[44] Thomas, L. R, & Tansey, W. P. Proteolytic control of the oncoprotein transcription
factor Myc. Adv. Cancer Res. (2011). , 110, 77-106.
[45] Albert, T, Wells, J, Funk, J. O, Pullner, A, Raschke, E. E, Stelzer, G, Meisterernst, M,
Farnham, P. J, & Eick, D. The chromatin structure of the dual c-myc promoter P2 is
regulated by separate elements. J Biol Chem. (2001). , 1.
[46] enlIey, D. L, & Groudine, M. A bIock lo eIongalion is IargeIy resonsibIe for de
creased transcription of c-myc in differentiated HL60 cells. Nature. (1986). , 321,
702-6.
[47] Hamel, P. A, Gill, R. M, Phillips, R. A, & Gallie, B. L. Transcriptional repression of the
E2-containing promoters EIIaE, c-myc, and RB1 by the product of the RB1 gene. Mol
Cell Biol. (1992). , 12, 3431-3438.
[48] Iavarone, A, & Massagu, J. E. F and histone deacetylase mediate transforming
growth factor beta repression of cdc25A during keratinocyte cell cycle arrest. Mol.
Cell. Biol. (1999). , 19, 916-922.
[49] MoreIIo, D, IilzgeraId, M. }, abinel, C, & Iauslo, N. c-m. y. c. c-fos, and c-|un reguIa
tion in the regenerating livers of normal and H-2K/c-myc transgenic mice. Mol Cell
Biol. (1990). , 10(6), 3185-93.
[50] Iick, D, & ornkamm, G W. TranscrilionaI arresl vilhin lhe firsl exon is a fasl con
trol mechanism in c-myc gene expression. Nucleic Acids Res.(1986). , 14, 8331-8346.
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
113
[51] Wang, S, Sdrulla, A, Johnson, J. E, Yokota, Y, & Barres, B. A. A role for the helix-loop-
helix protein Id2 in the control of oligodendrocyte development. Neuron. (2001). ,
29(3), 603-14.
[52] Hacker, C, Kirsch, R. D, Ju, X. S, Hieronymus, T, Gust, T. C, Kuhl, C, Jorgas, T, Kurz,
S. M, Rose-john, S, Yokota, Y, & Zenke, M. Transcriptional profiling identifies Id2
function in dendritic cell development.Nat Immunol. (2003). , 4(4), 380-6.
[53] ZiIberfarb, V, Siquier, K, Slrosberg, A. D, & Issad, T. Iffecl of dexamelhasone on adi
ocyle differenlialion markers and lumour necrosis faclor-aIha exression in hu
man PAZ6 cells. Diabetologia. (2001). , 44(3), 377-86.
[54] Gonzlez Mdel CCorton JC, Acero N, Muoz-Mingarro D, Quirs Y, Alvarez-Milln
JJ, Herrera E, Bocos C Peroxisome proliferator-activated receptoro agonisls differen
tially regulate inhibitor of DNA binding expression in rodents and human cells.
PPAR Res. (2012).
[55] Gronning, L. M, Tingsabadh, R, Hardy, K, DaIen, K. T, }al, I. S, Gnudi, L, & She
herd, P. R. Glucose induces increases in levels of the transcriptional repressor Id2 via
the hexosamine pathway.Am J Physiol Endocrinol Metab. (2006). E, 599-606.
[56] Wu, N, CasleI, D, DebiIy, M. A, Vigano, M. A, AIiberl, O, Manlovani, R, II|in, K, Ro
meo, P. H, & Gidrol, X. Large scale RNAi screen reveals that the inhibitor of DNA
binding 2 (ID2) protein is repressed by family member p63 and functions in human
keratinocyte differentiation. J Biol Chem. (2011). , 53.
[57] Deed, R. W, Armilage, S, rovn, M, & Norlon, }. D. ReguIalion of Id-HLH lranscri
tion factor function in third messenger signalling. Biochem Soc Trans. (1996). S.
[58] ounheng, M. A, Dimas, }. }, Dodds, S. G, & Chrisly, . A. Degradalion of Id ro
teins by the ubiquitin-proteasome pathway.FASEB J. (1999). , 13(15), 2257-64.
[59] Hara, I, HaII, M, & Ielers, G. Cdk2-deendenl hoshoryIalion of Id2 moduIales ac
tivity of E2A-related transcription factors. EMBO J. (1997). , 16(2), 332-42.
[60] Malsumura, M. I, Lobe, D. R, & Mcnamara, C. A. Conlribulion of lhe heIix-Ioo-he
lix factor Id2 to regulation of vascular smooth muscle cell proliferation. J Biol Chem.
(2002). , 277(9), 7293-7.
[61] Samanta, J, & Kessler, J. A. Interactions between ID and OLIG proteins mediate the
inhibitory effects of BMP4 on oligodendroglial differentiation Development. (2004). ,
131(17), 4131-42.
[62] Lasorella, A. Iavarone A The protein ENH is a cytoplasmic sequestration factor for
Id2 in normal and tumor cells from the nervous system Proc Natl Acad Sci U S A.
(2006). , 103(13), 4976-81.
Chromatin Remodelling 114
[63] Torres, L, Sandoval, J, Penella, E, Zaragoz, R, Garca, C, Rodrguez, J. L, Via, J. R, &
Garcia-lrevi|ano, I. R. In vivo GSH deIelion induces c-myc exression by moduIa
tion of chromatin protein complexes.Free Radic Biol Med. (2009). , 46(11), 1534-42.
[64] IeneIIa, I, SandovaI, }, Zaragoza, R, Garcia, C, Via, }. R, Torres, L, & Garcia-lrevi|a
no, I. R. MoIecuIar mechanisms of Id2 dovn-reguIalion in ral Iiver afler acelamino
phen overdose. Protection by N-acetyl-L-cysteine. Free Radic Res. (2010). , 44(9),
1044-53.
[65] Han, D, Hanawa, N, Saberi, B, & Kaplowitz, N. Mechanisms of liver injury. III. Role
of glutathione redox status in liver injury. Am. J. Physiol. Gastrointest. Liver Physiol.
(2006). G, 1-7.
[66] Diaz Vivancos PWolff T, Markovic J, Pallard FV, Foyer CH.A nuclear glutathione
cycle within the cell cycle. Biochem J. (2010). , 431(2), 169-78.
[67] Huang, Z. Z, Li, H, Cai, }, KuhIenkam, }, KaIovilz, N, & Lu, S. C. Changes in gIu
tathione homeostasis during liver regeneration in the rat. Hepatology. (1998). , 27,
147-53.
[68] Lee, S. J, & Boyer, T. D. The effect of hepatic regeneration on the expression of the
glutathione S-transferases. Biochem. J. (1993). , 293, 137-142.
[69] Hitchler, M. J, & Domann, F. E. An epigenetic perspective on the free radical theory
of development. Free Radic Biol Med. (2007). , 43, 1023-36.
[70] HilchIer, M. }, & Domann, I. I. Redox reguIalion of lhe eigenelic Iandscae in Can
cer: A role for metabolic reprogramming in remodeling the epigenome. Free Radic
Biol Med. (2012).
[71] Biroccio, A, Benassi, B, Filomeni, G, Amodei, S, Marchini, S, Chiorino, G, Rotilio, G,
Zui, G, & CirioIo, M. R. GIulalhione infIuences c-Myc-induced aolosis in M14 hu
man melanoma cells. J Biol Chem.(2002). , 277, 43763-43770.
[72] Levens, D. How the c-myc promoter works and why it sometimes does not. J Natl
Cancer Inst Monogr. (2008). , 39, 41-43.
[73] Kiuchi, N, Nakajima, K, Ichiba, M, Fukada, T, Narimatsu, M, Mizuno, K, Hibi, M, &
Hirano, T. STAT3 is required for the gp130-mediated full activation of the c-myc
gene. J Exp Med. (1999). , 189, 63-73.
[74] Chan, K. L, Guan, X. Y, & Ng, I. O. High-throughput tissue microarray analysis of c-
myc activation in chronic liver diseases and hepatocellular carcinoma. Hum Pathol.
(2004). , 35, 1324-1331.
[75] Liu, R. M. Gaston Pravia KA.Oxidative stress and glutathione in TGF-beta-mediated
fibrogenesis. Free Radic Biol Med. (2010). , 48(1), 1-15.
The Role of Id2 in the Regulation of Chromatin Structure and Gene Expression
http://dx.doi.org/10.5772/54969
115
[76] Jaeschke, H, Mcgill, M. R, & Ramachandran, A. Oxidant stress, mitochondria, and
ceII dealh mechanisms in drug-induced Iiver in|ury: Iessons Iearned from acelamino
phen hepatotoxicity. Drug Metab Rev. (2012). , 44(1), 88-106.
[77] Lee, Y-S, Wan, J, Kim, B. J, Bae, M-A, & Song, B. J. Ubiquitin-dependent degradation
of protein despite phosphorylation at its N terminus by acetaminophen. J Pharm Exp
Ther (2006). , 53.
[78] AbdeImegeed, M. A, Moon, K-H, Chen, C, GonzaIez, I. }, & Song, -}. RoIe of cylo
chrome I1 in rolein nilralion and ubiquilin-medialed degradalion during acelami
nophen toxicity. Biochem Pharmacol. (2010). , 450.
[79] Pajonk, F, Riess, K, & Sommer, A. McBride W.H. N-acetyl-L-cysteine inhibits 26S
proteasome function: implications for effects on NF-kappaB activation. Free Rad Biol
Med. (2002). , 32, 536-543.
[80] Breusing, N, & Grune, T. Regulation of proteasome-mediated protein degradation
during oxidative stress and aging. Biol Chem. (2008). , 389, 203-209.
[81] Lasorella, A, Stegmller, J, Guardavaccaro, D, Liu, G, Carro, M. S, Rothschild, G, De
La Torre-ubieta, L, Pagano, M, Bonni, A, & Iavarone, A. Degradation of Id2 by the
anaphase-promoting complex couples cell cycle exit and axonal growth. Nature.
(2006). , 442, 471-474.
[82] Williams, S. A, Maecker, H. L, French, D. M, Liu, J, Gregg, A, Silverstein, L. B, Cao, T.
C, Carano, R. A, & Dixil, V. M. USI1 deubiquilinales ID roleins lo reserve a mes
enchymal stem cell program in osteosarcoma. Cell. (2011). , 146(6), 918-30.
Chromatin Remodelling 116
Section 3
Chromatin Remodeling in DNA Damage,
Development and Human Disease
Chapter 6
Role of Enhancer of Zeste Homolog 2 Polycomb Protein
and Its Significance in Tumor Progression and Cell
Differentiation
Irene Marchesi and Luigi Bagella
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/55370
1. Introduction
Epigenetics is a branch of genetics that focuses on the heritable changes of DNA or associated
proteins, other than DNA sequence variations, which carry information content during cell
division [1,2]. These heritable changes are ascribed to chromatin, which constitutes the
ultrastructure of DNA and whose modifications affect the genetic material functionality.
Differences in chromatin structure have been associated to transcription regulation [3-5] and
chromosome stability [6,7], affecting both genes information, expression and heritability.
Noteworthy, these epigenetic modifications are involved in both transcriptional activation and
repression, indicating their widespread role as modulators of gene expression in numerous
biological processes [8,9].
Chromatin is subjected to numerous modifications roughly classified in two groups: DNA and
histone post-translational modifications (histone-PTMs).
DNA methylation is the most studied epigenetic modification of DNA and corresponds to the
covalent addition of a methyl (CH
3
) group to the nucleotide cytosine within CG dinucleotides
or CNG trinucleotides where N can be C, A, G or T. Usually, DNA methylation induces
decreased protein-DNA binding of transcription factors and leads to the repression of gene
expression [10].
DNA methylable sequences are not uniform across the human genome but restricted in CpG
rich DNA regions termed CpG islands (CGI). CGI are localized at repetitive sequences, heavy
methylated, to prevent the reactivation of endoparasitic sequences such as transposons, and
at gene promoter sequences, which are normally refractory to methylation in normal somatic
cells [8,11].
2013 Marchesi and Bagella; licensee InTech. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
DNA methylation is specifically established by DNA methyltransferases proteins (DNMTs),
which can be recruited by numerous DNA-binding molecular complexes. These enzymes were
classically classified in two categories: de novo DNMTs, as mammalian DNMT3a and DNMT3b,
in charge of lhe addilion of lhe melhyI grou on a reviousIy unmelhyIaled DNA, and mainle
nance DNMTs, whose only known member is DNMT1, responsible for methylation renewal in
lhe nevIy synlhesized DNA coy. Hovever, lhis cIassificalion does nol enlireIy exIain melhyI
ation establishment and maintenance in various molecular processes [10]. For instance, a number
of studies demonstrated that all DNMTs are important in the maintenance of methylation during
DNA replication, therefore indicating that it is not possible to distinguish classes of DNMTs based
on lheir funclionaI roIe |12-15j. Anolher imorlanl funclionaI roIe in DNA melhyIalion dynam
ics is constituted by the removal of methyl group, which is required to activate methylated genes.
However, demethylation is a process not fully understood, in fact, until recently, it was current
oinion lhal onIy a assive demelhyIalion couId occur, as a consequence of a Iack of melhyIa
tion maintenance during DNA replication. The discovery of several putative demethylases, as
thymine DNA glycosylase (TDG), methyl-binding domain 2 (MBD2), and GADD45 [16-18],
strongly suggested that an active mechanism of demethylation can occur in specific contexts, such
as germ line reprogramming [19-22].
The second grou of eigenelic changes is reresenled by hislone osl-lransIalionaI modifica
tions (PTM), which consist in the addition of chemical groups to amino acid residues of both
canonical histones (H2A, H2B, H3 and H4) and variant histones (such as H3.1, H3.3 and HTZ.1).
Differently from DNA modifications, there are at least eight distinct types of histone post-
translational modifications: acetylation, methylation, phosphorylation, ubiquitylation,
sumoylation, ADP ribosylation, deimination, and proline isomerization. Each chemical group
can be established at multiple amino acid residues of nucleosomes in multiple levels of
substrate modification by specific classes of enzymes. For example, lysine methylation can be
established at numerous aminoacidic residues of N-terminus tails of histones H3 and H4, such
as K4, K9, K20 and K27, in mono-, di- or tri-methylated forms. This variety of histone PTMs
and its timing of appearance depends on the particular cell conditions giving the cells different
functional responses [23]. Differently from DNA methylation, histone PTMs feature numerous
functional roles. For instance, histone acetylation regulates DNA replication, repair and
condensation; methylation, phosphorylation and ubiquitylation are involved in DNA repair
or condensation. Moreover, all PTMs regulate transcription processes; acetylation is generally
a marker of transcriptionally active genes, and methylation can be a marker of repressed or
active genes depending on the amino-acid residues involved. For example, methylation of
histone H3 lysine 4 (H3K4me) is considered a mark of transcriptionally active genes, while
methylation of histone H3 lysine 9 and 27 (H3K9me; H3K27) are considered a mark of
transcriptionally repressed genes [8,11,23].
Almost all cellular processes that require transcription dynamics and genetic stability can be
considered eigenelic rocesses. CeIIuIar differenlialion is a good examIe of bioIogicaI roc
ess, which is strictly connected to epigenetics. The genome sequence is static and it is the same for
each cell of an organism (with some exceptions); however, cells are able to differentiate into many
different types, with different morphology and physiological functions. During organism
Chromatin Remodelling 120
development, the zygote, derived form a single fertilized egg cell, originates totipotent cells, able
to potentially differentiate in all cell types of adult organisms. After several divisions, totipotent
cells originate pluripotent cells, which are partially differentiated and able to differentiate in
several cell types. Finally, pluripotent cells complete differentiation becoming adult somatic cells.
The differentiation processes are characterized by transcriptional activation and repression of
specific genes and, once completed, the cells maintain their characteristic gene-expression pattern,
strictly dependent on the epigenetic modifications previously established [24]. Therefore, cell
differentiation is rigorously related to the establishment of the correct epigenetic status and to the
proper epigenetic maintenance. Epigenetic abnormalities alter gene expression, counteracting
regular differentiation and cell physiology [25]. In support of this theory, cancer cells feature an
aberranl eigenelic Iandscae, indicaling lhe causaI reIalionshi belveen eigenome dynam
ics and ceIIuIar rocesses as roIiferalion, ceIIuIar idenlily mainlenance and genomic inslabiIi
ty. [26-28]. Frequently, CGIs in the proximity of tumor suppressor genes (TSG) are methylated in
various cancers, inducing TSGs transcriptional repression and promoting cancer progression
[29]. Furthermore, specific patterns of histones H3 and H4 acetylation and methylation are
associated with numerous cancer types, and it has been shown that several epigenetic patterns
enable to distinguish disease subtypes [30,31].
This chapter explores the role of the Enhancer of Zeste Homolog 2 (EZH2). EZH2, the catalytic
subunit of Polycomb repressive complex 2, catalyzes the addition of methyl groups to lysine
27 of the N-tail of histone H3 (H3K27me). The importance to specifically focus on EZH2 raises
from the evidence that it is involved in several differentiation processes and is often over-
expressed in a wide variety of cancer types [32].
2. PcG proteins and PRC-mediated silencing
Polycomb group proteins (PcG) were discovered in Drosophila melanogaster as responsible of
homeolic gene siIencing, aIso referred as Hox cIuslers. Hox roleins are a grou of lranscri
tion factors that determine cell identity along the anteroposterior axis of the body plan by the
transcriptional regulation of hundreds of genes [33-42]. After the initial discovery in fruit flies,
IcG roleins vere delecled in Ianls and in mammaIs, vhere lhey are invoIved in deveIo
ment, stem cell biology and cancer [43-48]. Polycomb-mediated gene silencing is required in
many processes like mammalian X-chromosome inactivation and imprinting [49,50j. Iurlher
more, PcG proteins are required to maintain stem cell identity [51]. Indeed, their numerous
target genes encode for transcription factors and signaling components involved in cell fate
decision, therefore in differentiation processes [32].
Principal PcG proteins are conserved from Drosophila to human indicating that PcG-mediated
gene silencing is conserved among eukaryotes [42,52,53]. In mammals, each of the fly proteins
has two or more homologs [54]. PcG proteins form two main complexes: Polycomb-repressive
complex 1 and 2 (PRC1, PRC2) [55-59].
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
121
In mammals PRC1 is formed by BMI1, RING1A/B, CBX, and PHC subunits [60]. RING1A/B
are ubiquitin E3 ligases that catalyze the monoubiquitylation of histone H2A at lysine 119
(H2AK119ub1), a histone PTM associated with transcriptional silencing [48,53].
As previously explained, PRC2 has a histone methyltransferase activity on lysine-27 of histone
H3 [56-59]. EZH2 is the catalytic subunit of the complex and is activated by other PRC2
subunits like EED, SUZ1 and RbAp46 [61,62]. Recent studies have identified an EZH2
homolog, EZH1 that originates an alternative PRC2 complex and, as EZH2, is able to methylate
H3K27. EZH1 and EZH2 can occupy similar target genes, and in some cases have been
proposed to play redundant roles. However, during development, it has been demonstrated
that the two proteins, can also have distinct and context-dependent roles [63-65].
PRC1 and PRC2 are able to induce gene silencing independently by each other [66,67] or by a
synergistic mechanism. In fact, establishment of H3K27me3 by PRC2 complex can induce the
recruilmenl of IRC1 by binding lhe chromodomain of lhe IHC subunils |39,58j. Once recruil
ed, PRC1 induces transcriptional repression of target gene by catalyzing the ubiquitilation of
lysine 119 of histone H2 or by an H2Aub-independent mechanism [68-70]. Therefore, in gene
romolers of IRC1 and IRC2 common largel genes, H3K27me3, can be reckoned as lhe haII
mark of PcG mediated repression, whereas PRC1 carries out the gene silencing (Figure 1) [48,71].
Figure 1. Epigenetic gene silencing PcG-mediated. PRC2 induces EZH2-mediated H3K27me3. H3K27me3 recruits
PRC1 that ubiquitylates H2AK119 promoting chromatin compaction and gene silencing.
Chromatin Remodelling 122
For what concerns PRC1-independent target genes, it has been shown that PRC2 is able to
catalyze in vitro lhe melhyIalion of Iysine 26 of hislone H1, vhich in lurn recruils helerochro
matin binding protein 1 (HP1) to chromatin, influencing its structure [72,73].
PRC2 is also able to cooperate with other epigenetic silencing enzymes. Recent studies
demonstrated that it acts upstream of DNMTs in order to silence target genes [74]. The
mechanism is not yet clear, but a hypothesis is that target genes are initially repressed through
histone H3K27 methylation. Afterwards, PRC2 induces a more stable transcriptional silencing
by recruiting DNMTs and establishing CGI methylation [75-77]. Moreover, PRC2 associates
with histone deacetylases, reinforcing transcriptional repression and providing functional
synergy to stable silencing of target genes (Figure 2) [32,56-59,61,78,79].
The functional link between PcG proteins, HDACs and DMTs demonstrated a synergic control
of gene silencing involved in both physiological and pathological processes.
Figure 2. Functional link between PRC2 HDACs and DNMTs. Target genes are initially deacetylated by a histone
deacetylase. PRC2 silences target genes by H3K27me3. PRC2 may also recruit DNMTs that methylate DNA promoting a
more strongly silenced chromatin state.
3. Regulation of PRC2 activity
Polycomb group proteins are epigenetic regulators of embryonic development and stem cell
maintenance [48,51,80] and their deregulation contributes to cancer [28,81]. The crucial role of
Polycomb-repressive complexes in the regulation of these biological processes strongly
supports the presence of multiple molecular mechanisms involved in PRC activity modulation,
such as regulation of expression, post-translational modification and recruitment of other
molecular complexes to target genes.
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
123
3.1. Regulation of PRC2 components expression
As already explained, PRC2 functions are strictly tissue-specific. Therefore, it should not
surprise that the expression of PRC2 subunits has been reported to be context- and tissue-
specific, despite the activity of PRC2 promoters has not yet fully understood. Recently, it has
been proposed a general rule by which PRC2 expression is maintained by molecular factors
that control cell proliferation and self-renewal, such as E2F factors and c-myc, whereas its
transcriptional repression is induced by differentiation-promoting factors, such as pRb and
p16INK4b [65,82-85].
Ior vhal concerns lhe lranscrilionaI reguIalion by lhe Rb/I2I alhvay, il has been dem
onstrated that E2F factors are required for the transcriptional activity of EZH2 and EED in
mouse embryonic fibroblasts (MEF). Ectopic expression of pRb and p16INK4b, both involved
in E2F target gene repression, induces PRC2 subunits transcriptional repression, whereas pRb
silencing increases their transcript levels [82-84].
Furthermore, it has been recently reported that c-myc, a key regulator of ES cells pluripotency
maintenance, is directly involved in transcriptional upregulation of all components of PRC2;
c-myc binds PRC2 subunits promoters and induces the acetylation of histones H3 and H4, an
epigenetic modification involved in transcriptional activation [85].
IinaIIy, il has been demonslraled lhal IZH2 is osl-lranscrilionaIIy reguIaled by a micro
RNAs-mediated translation-inhibition mechanism. MicroRNAs (miRNAs) are small non-
coding RNA ~22 nt long (ncRNA), involved in various biological processes, which exert gene
expression regulation. Several studies showed a role of miRNA in chromatin structure, they
are indeed able to regulate transcriptional levels of epigenetic enzymes as for example PcG
proteins [86,87]. Initially, it has been shown that miRNA-101 and miRNA-26a negatively
regulate EZH2 expression by binding to its 3-UTR. However, recent studies have reported an
increasing number of miRNAs, able to inhibit the translation of PRC2 subunits (reviewed in
[87]). For example, miR-214 regulates EZH2 expression during muscle differentiation [88].
Furthermore, downregulation of several miRNAs promotes EZH2 overexpression in cancer;
for instance, miR-25 and miR30d in thyroid carcinoma [89], let-7 in prostate cancer [90], miR-98
and miR-214 in esophageal squamous cell carcinoma.
3.2. Post-translational modification of EZH2
Several studies demonstrated that post-translational modifications of PRC2 subunits can
regulate their recruitment to target genes and molecular activity [91-93].
The first post-translational modification that will be analyzed is EZH2 phosphorylation, which
has been extensively studied. In order to bind to PRC2 complex and exert its molecular
function, EZH2 must be phosphorylated in several specific sites. EZH2 phosphorylation can
be classified in two groups: dependent by cell-cycle-dependent signals and dependent by
extracellular-regulated kinases [94]. In the first mechanism, EZH2 is phosphorylated by Cdk1
and Cdk2 during cell cycle progression [92,93,95]. In murine model, phosphorylation of
threonine 345 (Thr345) increases the binding of EZH2 to specific regulatory ncRNAs as
HOTAIR that induces the recruitment of PRC2 to HOX gene promoters, and Xist RepA that
Chromatin Remodelling 124
induces the inactivation of X chromosome [93]. In humans, phosphorylation of threonine 350
(Thr350) corresponds to murine Thr345. Recently, Chen and collaborators demonstrated a
crucial role for the phosphorylation of Thr350 by Cdk1 and Cdk2 in both EZH2-dependent
gene silencing and EZH2-mediated cell proliferation and migration [92].
Moreover, Cdk1 is able to phosphorylate EZH2 at Thr487. This modification is associated with
lhe disrulion of IZH2 binding vilh olher IRC2 comonenls vilh subsequenl melhyIlrans
ferase activity inhibition [95]. Surprisingly, these data are in contrast with studies of Kaneco
and coworkers, which demonstrated that EZH2 phosphorylated at Thr487 is able to bind other
subunits of PRC2 complex and to maintain its activity. In addition, another recent work
showed that inhibition of Cdk1 suppresses hoxA gene expression in contrast to the findings
of Chen and colleagues. [92,93,95]. Bearing in mind that these three findings use different models
to analyze EZH2 phosphorylation, becomes noticeable that the apparent discrepancies could
be explained with different mechanisms of tissue-specific regulation. Further studies are
needed to resolve these specific incongruities. Mechanisms of EZH2 regulation during cell
cycle are summarized in figure 3.
Figure 3. Model for regulation of EZH2 activity during cell cycle. PRC2 subunits are E2Fs target genes. E2Fs activity
is inhibited by hypo-phosphorylated pRb during G1 phase of cell cycle. Activity of Cdk/cyclin complexes triggers the
LransiLion ron G1 Lo S phase Lhrough phoshorylaLion o pb and consequenL acLivaLion o L2 LargeL genes. More
over Cdk2 and Cdk1 are able Lo phosphorylaLe LZH2 pronoLing Lhe binding o ncNA, a crucial sLep or Lhe recruiL
ment of PRC2 to its target genes.
Phosphorylation of EZH2 is also modulated by environmental signals. Extracellular signals
induce Akt activation that in turn is able to phosphorylate EZH2 at Serine 21 (Ser21), which
results in a suppression of the PRC2 activity. Differently by previous phosphorylation
mechanisms, Akt-dependent phosphorylation does not affect the binding with other PRC2
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
125
components but it reduces the affinity of EZH2 with histone H3, which results in a decrease
of the H3K27 methylation and consequent de-repression of the EZH2-silenced genes [96].
Furthermore, recent studies reported that EZH2 can be phosphorylated at threonine 372
(Thr372) by p38o kinase in muscle stem (satellite) cells in response to tumor necrosis factor
(TNF), an inflammatory cytokine highly expressed in muscle regeneration process [97]. The
phosphorylation of EZH2 at Thr372 promotes the repression of Pax7, a marker of stem cells,
by inducing the interaction between PRC2, YY1 and PRC1. This leads to the transcriptional
activation of genes involved in muscle regeneration and to transcriptional repression of genes
involved in cell proliferation. This data are in apparent conflict with the fully studied role of
EZH2 in the cell proliferation promotion, but it is possible that in response to specific signals
and in particular cell types, PRC2 can silence genes involved in cell cycle regulation, resulting
in an antiproliferative activity [97]. Other studies are needed to confirm this hypothesis.
Finally EZH2 and SUZ12 can be sumoylated in vitro and in vivo but the role of this modification
is still not yet clear [91].
3.3. PRC2 recruitment to target genes
PRC2 core subunits bind to the DNA sequences with low affinity, this, therefore, suggests the
existence of recruiting mechanisms that direct PRC2 to target genes [98].
In Drosophila melanogaster, PcGs are recruited by Polycomb response elements (PREs), DNA
sequences of several hundred base pairs [42,48,99] located both in proximal region of gene
promoters and in long-range enhancer elements. PREs contain consensus sequences for
various transcription factors [100]. For instance, Drosophilas pleiohomeotic (PHO) and
pleiohomeotic-like (PHO-like) are PcG proteins conserved in mammalian cells and involved
in the recruitment of PRC complexes.
It is important to stress that PREs are element and not short stretches of nucleotides and contain
numerous TF binding sites, therefore, although several Drosophila transcription factors are
essential for the recruitment of PRC complexes to specific promoters, a single TF is not
sufficient alone. Moreover, universal factors able to bind all PcG target genes have not been
found yet, and it is strongly suggested that the PcG protein recruitment is a cell type-specific
mechanism dependent by various combinations of TFs [52,53]. Mammalian PREs have been
just recently discovered [101]. The mammalian orthologue of Drosophila DNA-binding protein
PHO is YY1, however, studies in mouse stem cells showed a little overlap between sequences
bound by YY1 and PRC2 suggesting a cell-type specific role rather than a general one [47].
Similar to YY1, the embryonic stem (ES) cell-related transcription factors OCT4, SOX2 and
NANOG co-occupy a subset of PcG target genes in human and mouse ES cells [45,46].
Interestingly, recent studies demonstrated that the serine/threonine protein phosphatase-1
(PP1), together with its regulatory partner NPP1, is capable of complexing PRC2 at its target
genes, modulating the DNA occupancy of EZH2 and therefore its activity [102].
Current data suggest that, similarly to flies, various transcription factors may be involved in
the recruitment of mammalian PRC2, varying in different cell types and context. Recent studies
Chromatin Remodelling 126
showed that Twist-1 recruits EZH2 at ARF-INK4a locus in Mesenchymal Stem Cells (MSCs),
inducing transcriptional repression of both p14ARF and p16INK4a, and suppression of
senescence initiation [103].
Moreover, PRC2 can also be associated with another PcG protein, called PHF1. PHF1 is not a
core subunit of PRC2 but its association with the complex influences the recruitment of PRC2
to target genes and stimulates the enzymatic activity [104,105].
Furthermore, several reports have identified in mouse and human ES cells, a novel DNA-
binding component of PRC2 complex, Jarid2, which is a member of the Jumonji C (JmjC) family
that binds GC and GA-rich motifs [106-109]. Despite this, it has been demonstrated that Jarid2
promotes PRC2 recruitment to target genes, but its precise role in PRC2 activity has not yet
been defined. Knockdown of Jarid2 causes an increase of H3K27me3 levels on some PRC2-
target genes [106,107] and a decrease on others [108,109]. Different effects of Jarid2 on PRC2
activity could depend from additional factors, and it has been suggested that it acts as a
molecular rheostat that finely calibrates PRC2 functions at developmental genes [106].
Finally, long ncRNAs have been implicated in the recruitment of PRC2 [48,53,80,81,110]. For
example, in primary human fibroblasts the ncRNA HOTAIR recruits PRC2 complex to HOXD
locus for regulating gene silencing in trans [111]. Several long ncRNA have been discovered and
its tissue-specific expression allows assuming PRC2-dependent roles in organogenesis [112].
4. Role of PRC2 in differentiation and cell fate commitment
In past decades, several studies demonstrated that PcG proteins play a key role during
invertebrate differentiation but, only recently, the involvement of these proteins during
vertebrate organogenesis as regulators of developmental gene expression has been confirmed.
Various tissues are regulated by PRC2 during development (Table 1).
Embryonic stem cells (ESC) are able to differentiate into all derivatives of the three primary
germ layers and their pluripotency is preserved by the inhibition of differentiation and the
promotion of proliferation [71]. Therefore, ESC can be an extremely valuable model to study
ceII fale lransilion mechanisms invoIved in mammaIian deveIomenl. As reviousIy ex
plained, during development, epigenetic changes regulate the activation determining cell fate.
Genome vide anaIysis reveaIed lhal eigenelic changes reguIale lhe aclivalion or lhe inhibi
tion of lineage-specific transcription factors in cell fate transition, suggesting their role in the
maintenance of ESC pluripotency. For what concerns the polycomb repressive complexes, they
occuy gene romoler sequences of lhe main deveIomenlaI genes, imeding lheir lranscri
tional activation through repressive marks [44-46].
Major targets of PRC2 are tumor suppressor genes, such as Ink4b/Arf/Ink4a locus and their
inhibition promotes cell proliferation [44,132,136-141].
In ESC, numerous differentiation-related genes feature a bivalent epigenetic regulation in
preparation of lineage commitment [65]. This bivalent epigenetic regulation consists in the
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
127
presence of both H3K27me3 and H3K4me3, which respectively are a repressing and an
activating mark of transcription [142]. Upon differentiation, PRC2 complex dissociates from
these gene promoters, inducing H3K27me3 removal and gene expression [45,46].
Similarly to ESC, PRC2 is involved in organ development through tissue-dependent
mechanisms. As a generaI ruIe, IZH2 revenls differenlialion by inhibiling genes in
volved in its completion. For instance, EZH2 negatively regulates skin development by
repressing premature differentiation of skin progenitors. Specifically, it has been shown
that in this specific differentiation model, EZH2 prevents epidermal differentiation by
inhibiting the recruitment of AP1, a transcriptional activator, to Ink4/ARF locus, thus
maintaining proliferative potential of epidermal progenitors [120]. Likewise, it has been
reorled lhal siIencing of IZH2 in healic slem/rogenilor ceIIs romoles lhe differenlia
tion into hepatocytes and further enhances the maturation of hepatocytes through Ink4a-
Ink4b dependent and independent mechanisms [130].
EZH2 also contributes to pancreatic regeneration, by the suppression of Arf/Ink4a locus and
the promotion of pancreatic -cells proliferation, [132j and lo lerminaI differenlialion inhibi
tion of mammary gland alveolar cells during pregnancy, in order to prevent milk production
and secretion until parturition [135].
In opposition to PRC2-dependent mechanisms mentioned above, there are some tissues and
organs, which require PRC2 activity for differentiation completion. For instance, recent studies
showed a promoting role of EZH2 methyltransferase activity in adipogenesis. EZH2 is
required, indeed, for silencing of Wnt1, -6, -10a, and -10b genes, which are inhibitors of
adipogenesis [134]. Moreover, EZH2 contributes to the correct development by preventing the
inappropriate gene expression, typical of different cell types. The cardiac differentiation is an
examIe of lhis IRC2-deendenl reguIalory funclion, indeed, IZH2 is invoIved in lranscri
Tissue Specie Role/Stage References
Brain
human
mouse
Neuronal stem cell maintenance; oligodendrocytes
differentiation
[113-118]
Spinal Cord chicken Dorsoventral patterning [119]
Skin
human
mouse
Epidermal stem cell maintenance; hair follicle
homeostasis
[120-122]
Cardiac Muscle mouse
Endocardial cushion formation and cardiomyocyte
proliferation
[123-125]
Skeletal Muscle mouse
Skeletal muscle stem cells maintenance; somites
developing and myoblasts proliferation
[88,126-129]
Liver mouse
Hepatic stem/progenitor cells proliferation and
self-renewal
[130,131]
Pancreas mouse cell prolieraLion [132,133]
Adipose Tissue mouse Adipogenesis promotion [134]
Mammary Gland mouse Alveolar progenitors maintenance [135]
Table 1. Tissues under PRC2 regulation
Chromatin Remodelling 128
lionaI reression of genes as Six1, resonsibIe of skeIelaI muscIe genes aclivalion in cardio
myocytes. EZH2-knockout mice feature postnatal myocardial pathologies and altered cardiac
gene expression [123,125]. EZH2 promotes evenly, by indirect mechanism, liver differentiation
by the inhibition of Pdx1 gene, which is involved in pancreatic differentiation promotion [133].
The comIexily of IRC2-deendenl moIecuIar alhvays in organogenesis has been secifi
cally demonstrated by extensive studies in neurogenesis and myogenesis.
4.1. Role of EZH2 in neurogenesis
Neurons and astrocytes derive from common neural precursors (neuronal stem cells: NSC),
which sequentially pass through phases of expansion, neurogenesis and astrogenesis. The
liming of lhe svilch from neurogenic lo aslrocyle differenlialion is cruciaI for lhe delermina
tion of neuron numbers.
Analysis of EZH2 expression in neurogenesis showed that EZH2 decreases when NSCs
differentiate into neurons and is completely suppressed in astrocyte differentiation. In
contrast, EZH2 expression remains high in oligodendrocyte differentiation, from precursor
cells to the immature stage [113]. EZH2 silencing and overexpression in NSCs confirmed these
results, indeed forced expression of EZH2 increases the number of oligodendrocytes and
reduces the number of astrocytes [113]. Furthermore, forced expression of EZH2 in astrocytes
induces a partially dedifferentiation to NSCs [117], supporting a key role for EZH2 towards
oligodendrocyte commitment. For what concerns EZH2 silencing, it has been reported that
inhibition of EZH2 or EED in neural precursor cells extends neurogenic phase, inducing an
increased production of neurons and a delay in gliogenesis [114]. However, Pereira and
colleagues found that loss of EZH2 results in a shift from self-renewal towards differentiation,
accelerating the timing for both cortical neurogenesis and gliogenesis [115]. These differences
could be accounted to differential EZH2 inhibition timing before or after neurogenesis onset;
further studies are required to clarify this pathway, but all data confirm an essential role for
PRC2 in the regulation of developmental transitions timing.
4.2. Role of EZH2 in skeletal myogenesis
Proliferation and differentiation of skeletal muscle cells are controlled by a family of
myogenic transcription factors, known as bHLH proteins. MyoD is one of the most
important bHLH factors, which is crucial for complete muscle differentiation [143]. In ESC,
PRC2 binds and represses numerous MyoD target genes [46]. In skeletal myoblasts, despite
MyoD expression, PRC2 is recruited by YY1 to muscle-specific genes, inhibiting their
exression and revenling remalure differenlialion. Afler lhe commilmenl of myogene
sis, IZH2 exression decreases and H3K27me3 al MyoD-largel Ioci is removed. Conse
quently, muscle-specific genes are transcriptionally active [126]. This process is finely
regulated by miR-214, a miRNA expressed after myogenic commitment of MyoD. In
myoblasts, PRC complexes occupy and repress transcription of the intronic region
containing miR-214. During myogenesis decreased levels of EZH2 allow derepression of
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
129
the miR-214 locus. miR-214, on the other hand, targets EZH2 3UTR reducing its mRNA
translation, thus inhibiting EZH2 mRNA translation [88].
It has been shown that UTX, a specific demethylase that accomplish the muscle specific genes
activation, is specifically involved in removal of H3K27me3 and in establishment of H3K4me3,
an epigenetic marker of active genes [127].
Interestingly, EZH1 expression increases during myogenesis and its levels remain elevated in
differentiated myoblasts [144]. It has been demonstrated that PRC2-EZH1 complex has a
crucial role in the correct timing of transcriptional activation of muscle specific genes, as
myogenin, allowing proper recruitment of MyoD on its target promoters. This mechanism
involves another epigenetic modification, the phosphorylation of serine 28 of the histone H3
(H3S28ph), which is fundamental for the displacement of the PRC2-EZH2 complex [129].
This example proves the complexity of PRC2 dependent mechanism during development and
demonstrates how distinctive complexes can regulates various stages of differentiation.
Despite the numerous roles of PRC2 in differentiation and organogenesis are attributable to a
tissue-specific behavior, further studies are required to clarify each time its role in any process
of differentiation.
It is certainly clear that both PRC2 and its catalytic subunit EZH2 can be defined as key factors
in the regulation of development and in preserving cell identity.
5. EZH2 and cancer
Epigenetic abnormalities lead to altered gene expression and cellular physiology and occur in
several pathologies such as cancer [145,146]. Cancer epigenetics is a branch of cancer biology
that focuses on the epigenetic malfunctions involved in cancer initiation and progression [11].
EZH2 is differentially expressed in many tumors with abnormally elevated levels in cancer
tissues versus the corresponding normal ones. Of interest is that EZH2 expression is generally
correlated with metastatic cancer cells and poor prognosis [32].
Microarray studies in breast and prostate cancers were the first reports addressing the
implication of EZH2 in tumor progression [79,147]. Currently, a wide number of human
cancers associated with the deregulation of EZH2 have been discovered (Table 2).
The role of PcG proteins in cancer epigenetics is partially attributed to their contribution in
transcriptional repression of INK4b-ARF-INK4a locus, which encode p15INK4b, p16INK4a
and p14ARF proteins. These proteins constitute a homeostatic mechanism that protect
organism from inappropriate growth signals, which would eventually lead to uncontrolled
proliferation, promoting in contrast senescence or apoptosis [139]. Various tumors are
characterized by mutations or transcriptional repression at INF4b-ARF-INKa locus, which is
frequently a consequence of an aberrant epigenetic landscape established by factors as EZH2.
15INK4b and 16INK4a are cycIin-deendenl kinase inhibilors (CdkI) lhal funclion u
stream in the retinoblastoma protein (pRb) pathway. pRb can be found in two isoforms: hypo-
Chromatin Remodelling 130
phosphorylated pRb is the biologically active form, while hyper-phosphorylated pRb is
inactive. Hypo-phosphorylated pRb binds and inhibits E2F transcriptional factor activity.
Cdks, through phosphorylation of pRb, render E2F an active transcriptional activator on the
E2F target genes. INK4 proteins bind Cdk4 and Cdk6, blocking the assembly of catalytically
active CyclinCdk complexes.
The result of an elevated transcription of INK4 proteins is a pRb-dependent cell-cycle arrest
in G1-phase [44,132,136-141,188,189]. Differently from INK4 proteins, p14ARF activates p53
pathway by inhibiting MDM2 functions. Indeed, MDM2 modulates p53 activity by inducing
its transcriptional repression and by promoting its proteasome-mediated degradation.
p14ARF induction generally causes cell-cycle arrest in G1 and G2 phases and apoptosis
[139,190,191]. Interestingly, EZH2 activity on p16INK4a promoter is Rb family-dependent.
Indeed, EZH2 is not able to bind INK4a locus in Rb proteins-deficient cells. A model has been
proposed where pRb recruits PRC2 to the p16INK4a promoter, which in turn promotes its
transcriptional repression [192].
EZH2 has shown a functional role evenly on pRb2/p130. pRb2/p130 is a member of Rb family
that binds and recruits HDAC1 at Cyclin A promoter, inducing gene silencing. Cyclin A is a
protein with a crucial role in cell cycle advancement. EZH2 competes with HDAC1 for its
binding with pRb2/p130, disrupting both proteins occupancy on cyclin A promoter, inducing
cyclin A activation and cell cycle progression [193,194].
As well as Rb family members, EZH2 inhibits tumor suppressor genes as p21 and phosphatase
and tensin homolog (PTEN) [170,195]. For example, oncogenic stimuli in melanocytes provoke
an oncogene-induced senescence, termed melanocytic nevus, which is a benign precursor of
melanoma. EZH2 overexpressing cells escape senescence through the inhibition of p21. EZH2
depletion indeed, results in p21 activation and senescence induction in human melanoma cells
[195]. A similar functional role has been reported in B-cell acute lymphoblastic leukemia (B-
ALL) cells, where EZH2 overexpression induces p21, p53 and PTEN silencing whereas its
knockdown induces cell cycle arrest and apoptosis [170].
As already stated, EZH2 is involved in apoptosis regulation [196,197]. High levels of EZH2
induce silencing of DAB2IP, a Ras GTPase-activating protein that promotes apoptosis through
the tumor necrosis factor-mediated JNK signaling pathway [196], and Bim, a protein that
promotes E2F1-dependent apoptosis [197].
DAB2IP is downregulated by epigenetic modifications in multiple aggressive cancers such as
Iung, breasl and roslale. In meduIIobIasloma, IZH2-deendenl-DA2II reression corre
lates significantly with a poor prognosis, independent by the metastatic stage [187].
Recenl reorls, using genome-vide lechnoIogies, reorled lhal a Iarge number of differenlia
tion-related factors are PRC2-target genes [43-47]. Consequently, numerous differentiation-
related factors as Gata, Sox, Fox, Pou, Pax, components of Wnt, TGF-, Notch, FGF and retinoic
acid pathways are silenced by EZH2 [32,44-46]. It has been proposed that similarly to ESC, the
role of EZH2 in cancer is linked to its activity in self-renewal promotion and in the maintenance
of undifferentiated state of cells; EZH2 deregulation indeed, strongly contributes to the
transcriptional silencing of tumor suppressor and differentiation genes, promoting therefore
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
131
uncontrolled cell proliferation and cancer progression [32]. For instance, EZH2 is upregulated
in Rhabdomyosarcoma (RMS) cell lines and primary tumors [180]. RMS is a tumor that arises
from muscle precursor cells, characterized by a partial myogenic differentiation. RMS cells do
not form functional muscle units and feature a strong proliferative ability. Specifically, as
shown in a recent study, EZH2 binds and silences several muscle gene promoters evenly under
differentiated conditions. The silencing of EZH2 promotes the reduction of H3K27me3
establishment, the recruitment of elongating RNA Polymerase II at these loci and the activation
of muscle specific genes, with a partial recovery of skeletal muscle phenotype [182].
Finally, PRC2 complex inhibits the expression of several tumor suppressor miRNA. For
instance, downregulation of miR-31, a common event of various melanomas, is caused by
epigenetic silencing of EZH2-mediated histone methylation [177].
Moreover, in metastatic liver cancers, up-regulation of EZH2 inhibits miR-139-5p, miR-125b,
miR-101, let-7c, and miR-200b, promoting cell motility and metastasis-related pathways [163].
Cancer Histological Origin References
Breast Epithelial [84,147-151]
Prostate Epithelial [79,149,152-157]
Lung Epithelial [158-160]
Colon Epithelial [161]
Liver Epithelial [162,163]
Gastric Epithelial [164]
Lymphoma Mesenchymal [165-171]
Myeloma Mesenchymal [172-174]
Ovarian Epithelial [175]
Skin Epithelial [149,176,177]
Bladder Epithelial [178]
Endometrial Epithelial [149,179]
Sarcoma Mesenchymal [180-182]
Pancreas Epithelial [156,183,184]
Kidney Epithelial [185]
Brain Nervous Tissue [186,187]
Table 2. Human cancers associated with overexpression of EZH2
5.1. Extra-nuclear function of EZH2
The role of EZH2 as chromatin regulator has been extensively analyzed in a number of normal
and pathological models. Recent studies demonstrated a localization of EZH2 and other PRC2
Chromatin Remodelling 132
components in the cytoplasm of murine and human cells [198]. Cytoplasmic EZH2 maintains
its methyltransferase activity and interacts with Vav1, a GDP-GTP exchange factor (GEF) for
members of lhe Rho-famiIy of GTIases. IZH2-Vav1 comIex is necessary for aclin reorgani
zation and cellular proliferation in T-lymphocytes and fibroblasts, promoting cytoskeletal
dynamics and cell migration as well as proliferation [198j. An examIe of lhis secific cylo
plasmic function could be found in prostate cancer cells, characterized by increased levels of
both nuclear and cytoplasmic EZH2. Cytoplasmic EZH2 might influence cell adhesion and
migration, contributing to invasiveness and metastatic ability of tumors [199,200]. The nuclear
and cytoplasmic functions of PRC2 thereby could co-operate to promote tumorigenesis.
5.2. Tumor suppressor roles of EZH2
Up to few years ago, EZH2 and PRC2 upregulation were assumed to hypermethylate H3K27,
repressing the transcription of tumor suppressor genes. In 2010, Morin and colleagues
identified a somatic mutation (Tyr641), which affects the EZH2 catalytic domain activity in
diffuse Iarge -ceII Iymhoma bul nol in manlIe ceII or T-ceII Iymhoma. SecificaIIy, mula
tions in lymphoma were heterozygous but haploinsufficient for the enzymatic activity,
resulting in global deficit of H3K27 methylation and derepression of gene expression [168]. It
has been supposed that the loss of EZH2 in lymphoma may lead to derepression of genes,
promoting cell growth [201]. Other reports demonstrated that specific mutations in the EZH2
enzyme display limited capacity to carry out H3K27 monomethylation but have high efficiency
for driving di- and tri-methylation. In B-cell lymphomas, mutant and wild type EZH2 co-
operate increasing the trimethylated form [202].
Although the data analyzed as of now allow us to classify EZH2 as an oncogene, it must be
stated that in particular cellular environments the picture becomes less clear, like for example
in malignant myeloid diseases. Three different reports showed the inactivation of EZH2 in
myelodysplastic syndromes (MDSs) and in myeloproliferative disorder (MPD) [203-205].
Point mutations of EZH2 gene in MDSs, MPD, and primary myelofibrosis (PMF) are predictors
of poor overall survival, independently by risk factors [206,207]. Similarly, three studies
conducted in T-acute lymphoblastic leukemia (T-ALL) demonstrated that PRC2 displays a
tumor suppressor role in this pathology [171,208,209]. Particularly, Simon and colleagues
demonstrated that in mouse, loss of EZH2 in hematopoietic stem cells induces aggressive T-
ALL. Similar studies in human showed a comparable decrease of EZH2 levels in T-ALL [171].
Moreover, Ntziachristos and coworkers found that EZH2 and other PRC2 core components
are frequently mutated in T-ALL samples [209]. Of interest is that the frequency of PRC2
mutations is higher in pediatric subtype of leukemia [208].
Despite mutations of EZH2 seem specific for a few type of cancers, latest reports suggest
a fine balance of H3K27 methylation, necessary for normal cell growth. Recent studies
showed an indirect EZH2-dependent mechanism involved in pancreatic cancer inhibition.
Jon Mallen-St. and co-authors investigated the role of EZH2 in pancreatic regeneration and
in cancer progression using a mouse model characterized by KRas activation, frequently
mulaled in ancrealic lumors. In arlicuIar, lhey shov lhal KRas mulaled mice deveI
oped preneoplastic lesions but rarely progressed into invasive adenocarcinoma. The loss
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
133
of EZH2 function in this experimental model increases by 6 times the development of
pancreatic intraepithelial neoplasia, suggesting a protective role of EZH2 in pancreatic
carcinogenesis. Since EZH2 is transiently upregulated after injury and returns to basal
levels after tissue recovery, it has been proposed that, in injured tissue, surviving acinar
cells de-differentiate into metaplastic epithelial intermediates are able to proliferate and
restore pancreatic injury. Proliferation is induced by EZH2 activation through P16INK4a
inhibition. Subsequently, acinar cell mass and function is finally restored through re-
differentiation, which corresponds to restored basal levels of EZH2. EZH2 is involved
therefore in homeostatic mechanisms that controls pancreatic regeneration, decreasing the
risk of pancreatic cancer in patient with chronic pancreatic injury [156,184].
6. Conclusions
Iigenelic aIleralions in cancer ceIIs reresenl an imorlanl asecl of lumor bioIogy. Differ
ently from genetic modifications, epigenetic alterations can be reversed by specific drugs
inducing the restoration of normal cellular pathways, which in turn promote cellular
senescence or apoptosis. Therefore, epigenetic changes are excellent target candidates for
chemotherapeutic intervention in cancer.
Several HDAC and DNMT inhibitors are already available as putative anticancer drugs, and
several clinical trials are underway [210,211].
A pharmacological therapy, which specifically targets EZH2, may constitute a novel approach
to the treatment of cancer, assuming its role in inhibition of several tumor suppressor or
differentiation genes.
Recently, an S-adenosyl-L-homocysteine (AdoHcy) hydrolase inhibitor, 3-Deazaneplanocin A
(DZNep), has been demonstrated to deplete EZH2 and remove H3K27me3 at PRC2 target
genes. The inhibition of AdoHcy hydrolase fosters accumulation of AdoHcy, which in turn
stops S-adenosyl-L-methionine (SAH)-dependent methyltransferases.
DZNep promotes apoptosis in cancer cell lines as breast and colorectal cancer cells, but not in
normal cells. DZNep reduces cellular levels of PRC2 subunits, inhibits H3K27 methylation and
promotes the reactivation of PRC2 silenced genes and apoptosis [212]
Of interest is that, in several non-small cell lung cancer (NSCLC) cell lines, DZNep treatment
results in p27 accumulation, G1 cell cycle arrest and apoptosis, whereas immortalized
bronchial epithelial and fibroblast cell lines are less sensitive and show apoptosis with lesser
extent, which render it a potential candidate in anti-cancer therapy [160].
Studies in various gastric cancer cell lines and in primary human gastric cancer cells showed
that the DZNep responsiveness is attenuated in p53-depleted cells. p53 genomic status is
therefore a potential predictive marker of DZNep response in this specific cell type [213].
Despite its potential usefulness in cancer therapy, further studies need to address its target
specificity. Indeed, it has been reported that DZNep inhibits H4K20 methylation, another
Chromatin Remodelling 134
epigenetic modification, which is involved with chromosome stability [212]. The effect of
DZNep on several methyl transferases activity is a strong limiting factor for its use as anti-
cancer drug.
New PRC2 targets have been recently developed. GSK126 is a small molecule, competitor of
S-adenosyl-L-methionine. Unlike DZNep, that reduce levels of EZH2 indirectly, GSK126
specifically inhibits EZH2 methyltransferase activity with no alterations in EZH2 expression.
In lymphoma cells, GSK126 treatment decreases global H3K27me3 levels and reactivates PRC2
target genes. [169j. IinaIIy, il has been discovered a naluraI comound, 16-hydroxycIero
da-3,13-dien-15,16-olide (PL3), which is able to promote apoptosis in leukemia K562 cells by
the modulation of various histone-modifying enzymes among which EZH2 and SUZ12 [214].
Other studies are needed to design inhibitors specific for PRC2 and to develop new strategies
for epigenetic therapy in cancer.
Acknowledgements
We are grateful to Dr. Francesco Paolo Fiorentino for his helpful comments on this manuscript.
This work was supported by a grant from POR FSE 20072013 Regione Autonoma della
Sardegna, Programma Master and Back and a grant from Fondazione Banco di Sardegna
(Rif. Vs Prot. 469/2011.271).
Author details
Irene Marchesi
1
and Luigi Bagella
1,2
1 Department of Biomedical Sciences, Division of Biochemistry and National Institute of
Biostructures and Biosystems, University of Sassari, Sassari, Italy
2 Sbarro Institute for Cancer Research and Molecular Medicine, Center for Biotechnology,
College of Science and Technology, Temple University, Philadelphia, USA
References
[1] Van Speybroeck L. From epigenesis to epigenetics: the case of C. H. Waddington.
Annals New York Academy of Sciences 2002;981: 6181.
[2] Feinberg AP, Tycko B. The history of cancer epigenetics. Nature Review Cancer
2004;4(2): 14353.
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
135
[3] Grunstein M. Yeast heterochromatin: regulation of its assembly and inheritance by
histones. Cell 1998;93(3): 3258.
[4] Turner M. Hislone acelyIalion as an eigenelic delerminanl of Iong-lerm lranscri
tional competence. Cellular and Molecular Life Sciences 1998;54(1): 2131.
[5] Strahl BD, Allis CD. The language of covalent histone modifications. Nature
2000;403(6765): 415.
[6] Karpen GH, Allshire RC. The case for epigenetic effects on centromere identity and
function. Trends in Genetics 1997;13(12): 48996.
[7] Wei Y, Yu L, oven }, Gorovsky MA, AIIis CD. IhoshoryIalion of hislone H3 is re
quired for proper chromosome condensation and segregation. Cell 1999;97(1): 99
109.
[8] erger SL. The comIex Ianguage of chromalin reguIalion during lranscrilion. Na
ture 2007;447(7143): 40712.
[9] Probst AV, Dunleavy E, Almouzni G. Epigenetic inheritance during the cell cycle.
Nature Reviews Molecular and Cellular Biology 2009;10(3): 192206.
[10] Bird A. DNA methylation patterns and epigenetic memory. Genes & Development
2002;16(1): 621.
[11] Fiorentino FP, Marchesi I, Giordano A. On the role of Retinoblastoma family proteins
in the establishment and maintenance of the epigenetic landscape. Journal of Cellular
Physiology 2013;228(2): 276-84.
[12] Liang G, Chan MF, Tomigahara Y, Tsai YC, Gonzales FA, Li E, et al. Cooperativity
belveen DNA melhyIlransferases in lhe mainlenance melhyIalion of reelilive eIe
ments. Molecular and Cellular Biology 2002;22(2): 48091.
[13] Chen T, Ueda Y, Dodge }I, Wang Z, Li I. IslabIishmenl and mainlenance of genom
ic melhyIalion allerns in mouse embryonic slem ceIIs by Dnml3a and Dnml3b. Mo
lecular and Cellular Biology 2003;23(16): 5594605.
[14] Riggs AD, Xiong Z. Methylation and epigenetic fidelity. Proceedings of the National
Academy of Sciences 2004;101(1): 45.
[15] Jeong S, Liang G, Sharma S, Lin JC, Choi SH, Han H, et al. Selective Anchoring of
DNA Methyltransferases 3A and 3B to Nucleosomes Containing Methylated DNA.
Molecular and Cellular Biology 2009;29(19): 536676.
[16] Ooi SKT, Bestor TH. The Colorful History of Active DNA Demethylation. Cell
2008;133(7): 11458.
[17] Rai K, Huggins IJ, James SR, Karpf AR, Jones DA, Cairns BR. DNA demethylation in
zebrafish involves the coupling of a deaminase, a glycosylase, and gadd45. Cell
2008;135(7): 120112.
Chromatin Remodelling 136
[18] Cortellino S, Xu J, Sannai M, Moore R, Caretti E, Cigliano A, et al. Thymine DNA
Glycosylase Is Essential for Active DNA Demethylation by Linked Deamination-Base
Excision Repair. Cell 2011;146(1): 6779.
[19] Mtivier R, Gallais R, Tiffoche C, Le Pron C, Jurkowska RZ, Carmouche RP, et al.
Cyclical DNA methylation of a transcriptionally active promoter. Nature
2008;452(7183): 4550.
[20] Kangaspeska S, Stride B, Mtivier R, Polycarpou-Schwarz M, Ibberson D, Carmouche
RP, et al. Transient cyclical methylation of promoter DNA. Nature 2008;452(7183):
1125.
[21] Kim M-S, Kondo T, Takada I, Youn M-Y, Yamamolo Y, Takahashi S, el aI. DNA de
methylation in hormone-induced transcriptional derepression. Nature
2009;461(7266): 100712.
[22] Cohen NM, Dighe V, Landan G, Reynisdottir S, Palsson A, Mitalipov S, et al. DNA
melhyIalion rogramming and rerogramming in rimale embryonic slem ceIIs. Ge
nome Research 2009;19(12): 2193201.
[23] Kouzarides T. Chromatin Modifications and Their Function. Cell 2007;128(4): 693
705.
|24j Reik W. SlabiIily and fIexibiIily of eigenelic gene reguIalion in mammaIian deveIo
ment. Nature 2007;447(7143): 42532.
[25] Ieinberg AI, OhIsson R, Henikoff S. The eigenelic rogenilor origin of human can
cer. Nature Review Genetics 2006;7(1): 2133.
[26] }ones IA, ayIin S. The fundamenlaI roIe of eigenelic evenls in cancer. Nalure Re
view Genetics 2002;3(6): 41528.
[27] Ting AH, McGarvey KM, ayIin S. The cancer eigenome--comonenls and func
tional correlates. Genes & Development 2006;20(23): 321531.
[28] Sparmann A, van Lohuizen M. Polycomb silencers control cell fate, development and
cancer. Nature Review Cancer 2006;6(11): 84656.
[29] Esteller M. Cancer epigenomics: DNA methylomes and histone-modification maps.
Nature Review Genetics 2007;8(4): 28698.
[30] Fraga MF, Ballestar E, Villar-Garea A, Boix-Chornet M, Espada J, Schotta G, et al.
Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common
hallmark of human cancer. Nature Genetics 2005;37(4): 391400.
[31] SeIigson D, Horvalh S, Shi T, Yu H, Tze S, Grunslein M, el aI. GIobaI hislone modi
fication patterns predict risk of prostate cancer recurrence. Nature Cell Biology
2005;435(7046): 12626.
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
137
[32] Simon }A, Lange CA. RoIes of lhe IZH2 hislone melhyIlransferase in cancer eige
netics. Mutation Research 2008;647(1-2): 219.
[33] Lewis EB. A gene complex controlling segmentation in Drosophila. Nature
1978;276(5688): 56570.
[34] Struhl G. A gene product required for correct initiation of segmental determination
in Drosophila. Nature 1981;293(5827): 3641.
[35] Duncan IM. IoIycombIike: a gene lhal aears lo be required for lhe normaI exres
sion of the bithorax and antennapedia gene complexes of Drosophila melanogaster.
Genetics 1982;102(1): 4970.
[36] Jurgens G. A Group of Genes-Controlling the Spatial Expression of the Bithorax
Complex in Drosophila. Nature 1985;316(6024): 1535.
[37] Schwartz YB, Kahn TG, Nix DA, Li X-Y, Bourgon R, Biggin M, et al. Genome-wide
analysis of Polycomb targets in Drosophila melanogaster. Nature Genetics
2006;38(6): 7005.
[38] Negre N, Hennelin }, Sun LV, Lavrov S, eIIis M, While KI, el aI. ChromosomaI Dis
tribution of PcG Proteins during Drosophila Development. Plos Biology 2006;4(6):
e170.
[39] ToIhuis , Mui|rers I, de Wil I, Teunissen H, TaIhoul W, van SleenseI , el aI. Ge
nome-wide profiling of PRC1 and PRC2 Polycomb chromatin binding in Drosophila
melanogaster. Nature Genetics 2006;38(6): 6949.
[40] Oklaba K, Gulierrez L, Gagneur }, Girardol C, Sengula AK, IurIong IIM, el aI. Dy
namic ReguIalion by IoIycomb Grou Irolein ComIexes ConlroIs Iallern Iorma
tion and the Cell Cycle in Drosophila. Developmental Cell 2008;15(6): 87789.
[41] Kvong C, Adryan , eII I, Meadovs L, RusseII S, Manak }R, el aI. SlabiIily and Dy
namics of Polycomb Target Sites in Drosophila Development. PLoS Genetics
2008;4(9): e1000178.
[42] Schuettengruber B, Cavalli G. Recruitment of Polycomb group complexes and their
role in the dynamic regulation of cell fate choice. Development 2009;136(21): 353142.
[43] Kirmizis A, arlIey SM, Kuzmichev A, Margueron R, Reinberg D, Green R, el aI. Si
lencing of human polycomb target genes is associated with methylation of histone
H3 Lys 27. Genes & Development 2004;18(13): 1592605.
[44] Bracken AP. Genome-wide mapping of Polycomb target genes unravels their roles in
cell fate transitions. Genes & Development 2006;20(9): 112336.
[45] Boyer LA, Plath K, Zeitlinger J, Brambrink T, Medeiros LA, Lee TI, et al. Polycomb
complexes repress developmental regulators in murine embryonic stem cells. Nature
Cell Biology 2006;441(7091): 34953.
Chromatin Remodelling 138
[46] Lee TI, Jenner RG, Boyer LA, Guenther MG, Levine SS, Kumar RM, et al. Control of
Developmental Regulators by Polycomb in Human Embryonic Stem Cells. Cell
2006;125(2): 30113.
[47] Squazzo SL. Suz12 binds to silenced regions of the genome in a cell-type-specific
manner. Genome Research 2006;16(7): 890900.
[48] Simon }A, Kingslon RI. Mechanisms of IoIycomb gene siIencing: knovns and un
knowns. Nature Review Molecular Cell Biology 2009;10(10): 697-708.
[49] Plath K, Fang J, Mlynarczyk-Evans SK, Cao R, Worringer KA, Wang H, et al. Role of
histone H3 lysine 27 methylation in X inactivation. Science 2003;300(5616): 1315.
[50] Umlauf D, Goto Y, Cao R, Cerqueira F, Wagschal A, Zhang Y, et al. Imprinting along
the Kcnq1 domain on mouse chromosome 7 involves repressive histone methylation
and recruitment of Polycomb group complexes. Nature Genetics 2004;36(12): 1296
300.
[51] Iielersen AM, van Lohuizen M. Slem ceII reguIalion by oIycomb reressors: osl
poning commitment. Current Opinion in Cell Biology 2008;20(2): 2017.
[52] Morey L, Helin K. Polycomb group protein-mediated repression of transcription.
Trends in Biochemical Sciences 2010;35(6): 32332.
[53] Margueron R, Reinberg D. The Polycomb complex PRC2 and its mark in life. Nature
2011;469(7330): 3439.
[54] Levine SS, Weiss A, Erdjument-Bromage H, Shao Z, Tempst P, Kingston RE. The core
of the polycomb repressive complex is compositionally and functionally conserved
in flies and humans. Molecular and Cellular Biology 2002;22(17): 60708.
[55] Shao Z, Raible F, Mollaaghababa R, Guyon J, Wu C, Bender W, et al. Stabilization of
Chromatin Structure by PRC1, a Polycomb Complex. Cell 1999;98(1): 3746.
[56] Cao R. RoIe of Hislone H3 Lysine 27 MelhyIalion in IoIycomb-Grou SiIencing. Sci
ence 2002;298(5595): 103943.
[57] Czermin B, Melfi R, McCabe D, Seitz V, Imhof A, Pirrotta V. Drosophila enhancer of
Zesle/ISC comIexes have a hislone H3 melhyIlransferase aclivily lhal marks chro
mosomal Polycomb sites. Cell 2002;111(2): 18596.
[58] Kuzmichev A. Hislone melhyIlransferase aclivily associaled vilh a human muIliro
tein complex containing the Enhancer of Zeste protein. Genes & Development
2002;16(22): 2893905.
[59] MIIer }, Harl CM, Irancis N}, Vargas ML, Sengula A, WiId , el aI. Hislone melh
yltransferase activity of a Drosophila Polycomb group repressor complex. Cell
2002;111(2): 197208.
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
139
[60] Surface LE, Thornton SR, Boyer LA. Polycomb Group Proteins Set the Stage for Early
Lineage Commitment. Cell Stem Cell 2010;7(3): 28898.
[61] Cao R, Zhang Y. SUZ12 Is Required for Both the Histone Methyltransferase Activity
and the Silencing Function of the EED-EZH2 Complex. Molecular Cell 2004;15(1): 57
67.
[62] Pasini D, Bracken AP, Helin K. Polycomb group proteins in cell cycle progression
and cancer. Cell Cycle 2004;3(4): 396400.
[63] Margueron R, Li G, Sarma K, Blais A, Zavadil J, Woodcock CL, et al. Ezh1 and Ezh2
maintain repressive chromatin through different mechanisms. Molecular Cell
2008;32(4): 50318.
[64] Shen X, Liu Y, Hsu Y-J, Fujiwara Y, Kim J, Mao X, et al. EZH1 mediates methylation
on histone H3 lysine 27 and complements EZH2 in maintaining stem cell identity
and executing pluripotency. Molecular Cell 2008;32(4): 491502.
[65] Aldiri I, Vetter ML. PRC2 during vertebrate organogenesis: A complex in transition.
Develomental Biology 2012;367(2): 919.
[66] Leeb M, Pasini D, Novatchkova M, Jaritz M, Helin K, Wutz A. Polycomb complexes
act redundantly to repress genomic repeats and genes. Genes & Development
2010;24(3): 26576.
[67] Ku M, Koche RI, Rheinbay I, MendenhaII IM, Indoh M, MikkeIsen TS, el aI. Ge
nomewide Analysis of PRC1 and PRC2 Occupancy Identifies Two Classes of Bivalent
Domains. van Steensel B, editor. PLoS Genetics 2008;4(10): e1000242.
[68] Wang L, Brown JL, Cao R, Zhang Y, Kassis JA, Jones RS. Hierarchical Recruitment of
Polycomb Group Silencing Complexes. Molecular Cell 2004;14(5): 63746.
[69] Cao R, Tsukada Y-I, Zhang Y. Role of Bmi-1 and Ring1A in H2A Ubiquitylation and
Hox Gene Silencing. Molecular Cell 2005;20(6): 84554.
[70] Eskeland R, Leeb M, Grimes GR, Kress C, Boyle S, Sproul D, et al. Ring1B Compacts
Chromalin Slruclure and Reresses Gene Ixression Indeendenl of Hislone Ubiq
uitination. Molecular Cell 2010;38(3): 45264.
[71] Richly H, Aloia L, Di Croce L. Roles of the Polycomb group proteins in stem cells and
cancer. Cell Death and Disease 2012;2(9): e2047.
[72] Kuzmichev A, }enuvein T, Temsl I, Reinberg D. Differenl IZH2-conlaining com
plexes target methylation of histone H1 or nucleosomal histone H3. Molecular Cell
2004;14(2): 18393.
[73] Dau|al S. HI1 inds SecificaIIy lo Lys26-melhyIaled Hislone H1.4, vhereas SimuI
taneous Ser27 Phosphorylation Blocks HP1 Binding. Journal of Biological Chemistry
2005;280(45): 380905.
Chromatin Remodelling 140
[74] Vir E, Brenner C, Deplus R, Blanchon L, Fraga M, Didelot C, et al. The Polycomb
group protein EZH2 directly controls DNA methylation. Nature Cell Biology
2005;439(7078): 8714.
[75] Ohm JE, McGarvey KM, Yu X, Cheng L, Schuebel KE, Cope L, et al. A stem celllike
chromalin allern may redisose lumor suressor genes lo DNA hyermelhyIa
tion and heritable silencing. Nature Genetics 2007;39(2): 23742.
[76] SchIesinger Y, Slraussman R, Keshel I, Iarkash S, Hechl M, Zimmerman }, el aI. IoIy
comb-mediated methylation on Lys27 of histone H3 pre-marks genes for de novo
methylation in cancer. Nature Genetics 2006;39(2): 2326.
[77] Widschvendler M, IiegI H, IgIe D, MueIIer-HoIzner I, Sizzo G, Marlh C, el aI. Ii
genetic stem cell signature in cancer. Nature Genetics 2006;39(2): 1578.
[78] van der VIag }, Olle AI. TranscrilionaI reression medialed by lhe human oIy
comb-group protein EED involves histone deacetylation. Nature Genetics 1999;23(4):
4748.
[79] Varambally S, Dhanasekaran SM, Zhou M, Barrette TR, Kumar-Sinha C, Sanda MG,
el aI. The oIycomb grou rolein IZH2 is invoIved in rogression of roslale can
cer. Nature 2002;419(6907): 6249.
[80] Kerppola TK. Polycomb group complexes many combinations, many functions.
Trends in Cell Biology 200919(12): 692704.
[81] Bracken AP, Helin K. Epigenetics and genetics: Polycomb group proteins: navigators
of lineage pathways led astray in cancer. Nature Review Cancer 2009;9(11): 773-84
[82] Weinmann AS, arlIey SM, Zhang T, Zhang MQ, Iarnham I}. Use of chromalin im
munoreciilalion lo cIone noveI I2I largel romolers. MoIecuIar and CeIIuIar ioI
ogy 2001;21(20): 682032.
[83] Mller HH, Bracken APA, Vernell RR, Moroni MCM, Christians FF, Grassilli EE, et
al. E2Fs regulate the expression of genes involved in differentiation, development,
proliferation, and apoptosis. Genes & Development 2001;15(3): 26785.
[84] Bracken AP, Pasini D, Capra M, Prosperini E, Colli E, Helin K. EZH2 is downstream
of the pRB-E2F pathway, essential for proliferation and amplified in cancer. EMBO
Journal 2003;22(20): 532335.
[85] Neri I, Zio A, KreeIova A, Cherubini A, Rocchigiani M, OIiviero S. Myc Regu
Iales lhe Transcrilion of lhe IRC2 Gene To ConlroI lhe Ixression of DeveIomen
tal Genes in Embryonic Stem Cells. Molecular and Cellular Biology 2012;32(4): 840
51.
[86] GuiI S, IsleIIer M. DNA melhyIomes, hislone codes and miRNAs: Tying il aII logelh
er. The International Journal of Biochemistry & Cell Biology 2009;41(1): 8795.
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
141
[87] Benetatos L, Voulgaris E, Vartholomatos G, Hatzimichael E. Non coding RNAs and
IZH2 inleraclions in cancer: Long and shorl laIes from lhe lranscrilome. Inlerna
tional Journal of Cancer 2012; doi: 10.1002/ijc.27859.
[88] }uan AH, Kumar RM, Marx }G, Young RA, SarloreIIi V. Mir-214-Deendenl ReguIa
lion of lhe IoIycomb Irolein Izh2 in SkeIelaI MuscIe and Imbryonic Slem CeIIs. Mo
lecular Cell 2009;36(1): 6174.
[89] Esposito F, Tornincasa M, Pallante P, Federico A, Borbone E, Pierantoni GM, et al.
Down-Regulation of the miR-25 and miR-30d Contributes to the Development of
Anaplastic Thyroid Carcinoma Targeting the Polycomb Protein EZH2. Journal of
Clinical Endocrinology & Metabolism 2012;97(5): e7108.
[90] Kong D, Heath E, Chen W, Cher ML, Powell I, Heilbrun L, et al. Loss of Let-7 Up-
Regulates EZH2 in Prostate Cancer Consistent with the Acquisition of Cancer Stem
Cell Signatures That Are Attenuated by BR-DIM. PLoS ONE 2012;7(3): e33729.
[91] Riising IM, oggio R, Chiocca S, HeIin K, Iasini D. The IoIycomb Reressive Com
plex 2 Is a Potential Target of SUMO Modifications. PLoS ONE 2008;3(7): e2704.
[92] Chen S, Bohrer LR, Rai AN, Pan Y, Gan L, Zhou X, et al. Cyclin-dependent kinases
reguIale eigenelic gene siIencing lhrough hoshoryIalion of IZH2. Nalure CeII i
ology 2010;12(11): 1108-14.
[93] Kaneko S, Li G, Son J, Xu CF, Margueron R, Neubert TA, et al. Phosphorylation of
the PRC2 component Ezh2 is cell cycle-regulated and up-regulates its binding to
ncRNA. Genes & Development 2010;24(23): 261520.
[94] Caretti G, Palacios D, Sartorelli V, Puri PL. Phosphoryl-EZH-ion. Cell Stem Cell
2011;8(3): 2625.
[95] Wei Y, Chen Y-H, Li L-Y, Lang }, Yeh S-I, in Shi, el aI. CDK1-deendenl hoshor
yIalion of IZH2 suresses melhyIalion of H3K27 and romoles osleogenic differen
tiation of human mesenchymal stem cells. Nature Cell Biology 2010;13(1): 8794.
[96] Cha T-LT, Zhou BPB, Xia WW, Wu YY, Yang C-CC, Chen C-TC, et al. Akt-mediated
phosphorylation of EZH2 suppresses methylation of lysine 27 in histone H3. Science
2005;310(5746): 30610.
[97] Palacios D, Mozzetta C, Consalvi S, Caretti G, Saccone V, Proserpio V, et al. TNF/
p38α/Polycomb Signaling to Pax7 Locus in Satellite Cells Links Inflammation
to the Epigenetic Control of Muscle Regeneration. Stem Cell 2010;7(4): 45569.
[98] Margueron R, Justin N, Ohno K, Sharpe ML, Son J, Drury WJ III, et al. Role of the
polycomb protein EED in the propagation of repressive histone marks. Nature
2009;461(7265): 7627.
[99] Ringrose L, Paro R. Polycomb/Trithorax response elements and epigenetic memory
of cell identity. Development 2007;134(2): 22332.
Chromatin Remodelling 142
[100] Mller J, Kassis JA. Polycomb response elements and targeting of Polycomb group
proteins in Drosophila. Current Opinion in Genetics & Development 2006;16(5): 476
84.
[101] Sing A, Pannell D, Karaiskakis A, Sturgeon K, Djabali M, Ellis J, et al. A Vertebrate
Polycomb Response Element Governs Segmentation of the Posterior Hindbrain. Cell
2009;138(5): 88597.
[102] Van Dessel N, Beke L, Gornemann J, Minnebo N, Beullens M, Tanuma N, et al. The
hoshalase inleraclor NIII1 reguIales lhe occuancy of lhe hislone melhyIlransfer
ase EZH2 at Polycomb targets. Nucleic Acids Research 2010;38(21): 750012.
[103] Cakouros D, Isenmann S, Cooper L, Zannettino A, Anderson P, Glackin C, et al.
Twist-1 Induces Ezh2 Recruitment Regulating Histone Methylation along the
Ink4A/Arf Locus in Mesenchymal Stem Cells. Molecular and Cellular Biology
2012;32(8): 143341.
[104] Sarma K, Margueron R, Ivanov A, Pirrotta V, Reinberg D. Ezh2 Requires PHF1 To
IfficienlIy CalaIyze H3 Lysine 27 TrimelhyIalion In Vivo. MoIecuIar and CeIIuIar i
ology 2008;28(8): 271831.
[105] Cao R, Wang H, He J, Erdjument-Bromage H, Tempst P, Zhang Y. Role of hPHF1 in
H3K27 Methylation and Hox Gene Silencing. Molecular and Cellular Biology
2008;28(5): 186272.
[106] Ieng }C, VaIouev A, Svigul T, Zhang }, Zhao Y, Sidov A, el aI. }arid2/}umon|i Coor
dinales ConlroI of IRC2 Inzymalic Aclivily and Targel Gene Occuancy in IIurio
tent Cells. Cell 2009;139(7): 1290302.
[107] Shen X, Kim W, Iu|ivara Y, Simon MD, Liu Y, MysIiviec MR, el aI. }umon|i Modu
lates Polycomb Activity and Self-Renewal versus Differentiation of Stem Cells. Cell
2009;139(7): 130314.
[108] Li G, Margueron R, Ku M, Chambon P, Bernstein BE, Reinberg D. Jarid2 and PRC2,
partners in regulating gene expression. Genes & Development 2010;24(4): 36880.
[109] Iasini D, CIoos IAC, WaIfridsson }, OIsson L, ukovski }-I, }ohansen }V, el aI. }AR
ID2 regulates binding of the Polycomb repressive complex 2 to target genes in ES
cells.Nature 2010;464(7286): 30610.
[110] Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, et al. Many
human Iarge inlergenic noncoding RNAs associale vilh chromalin-modifying com
plexes and affect gene expression. Proceedings of the National Academy of Sciences
2009;106(28): 1166772.
[111] Rinn }L, Kerlesz M, Wang }K, Squazzo SL, Xu X, rugmann SA, el aI. IunclionaI de
marcation of active and silent chromatin domains in human HOX loci by noncoding
RNAs. Cell 2007;129(7): 131123.
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
143
[112] IauIi A, Rinn }L, Schier AI. Non-coding RNAs as reguIalors of embryogenesis. Na
ture Review Genetics 2011;12(2): 13649.
[113] Sher I, RssIer R, rouver N, aIasubramaniyan V, oddeke I, Coray S. Differen
tiation of neural stem cells into oligodendrocytes: involvement of the polycomb
group protein Ezh2. Stem Cells 2008;26(11): 287583.
[114] Hirabayashi Y, Suzki N, Tsuboi M, Endo TA, Toyoda T, Shinga J, et al. Polycomb
Limits the Neurogenic Competence of Neural Precursor Cells to Promote Astrogenic
Fate Transition. Neuron 2009;63(5): 60013.
[115] Pereira JD, Sansom SN, Smith J, Dobenecker M-W, Tarakhovsky A, Livesey FJ. Ezh2,
the histone methyltransferase of PRC2, regulates the balance between self-renewal
and differentiation in the cerebral cortex. Proceedings of the National Academy of
Sciences 2010;107(36): 1595762.
[116] Yu YL, Chou RH, Chen LT, Shyu WC, Hsieh SC, Wu CS, el aI. IZH2 ReguIales Neu
ronaI Differenlialion of MesenchymaI Slem CeIIs lhrough III5K1C-deendenl CaIci
um Signaling. Journal of Biological Chemistry 2011;286(11): 965767.
[117] Sher I, oddeke I, Coray S. Izh2 Ixression in Aslrocyles Induces Their Dediffer
entiation Toward Neural Stem Cells. Cellular Reprogramming 2011;13(1): 16.
[118] Sher F, Boddeke E, Olah M, Copray S. Dynamic Changes in Ezh2 Gene Occupancy
UnderIie Ils InvoIvemenl in NeuraI Slem CeII SeIf-RenevaI and Differenlialion lo
wards Oligodendrocytes. PLoS ONE 2012;7(7): e40399.
[119] Akizu N, Estaras C, Guerrero L, Marti E, Martinez-Balbas MA. H3K27me3 regulates
BMP activity in developing spinal cord. Development 2010;137(17): 291525.
[120] Izhkova I, IasoIIi HA, Iarker }S, Slokes N, Su I-H, Hannon G, el aI. Izh2 Orches
trates Gene Expression for the Stepwise Differentiation of Tissue-Specific Stem Cells.
Cell 2009;136(6): 112235.
[121] Izhkova I, Lien WH, Slokes N, IasoIIi HA, SiIva }M, Iuchs I. IZH1 and IZH2 co
govern histone H3K27 trimethylation and are essential for hair follicle homeostasis
and wound repair. Genes & Development 2011;25(5): 48598.
[122] Mulder KW, Wang X, Escriu C, Ito Y, Schwarz RF, Gillis J, et al. Diverse epigenetic
strategies interact to control epidermal differentiation. Nature Cell Biology
2012;14(7): 75363.
[123] Delgado-Olgun P, Huang Y, Li X, Christodoulou D, Seidman CE, Seidman JG, et al.
Epigenetic repression of cardiac progenitor gene expression by Ezh2 is required for
postnatal cardiac homeostasis. Nature Genetics 2012;44(3): 343-7.
[124] He M, Zhang W, Bakken T, Schutten M, Toth Z, Jung JU, et al. Cancer angiogenesis
induced by Kaposi's sarcoma-associated herpesvirus is mediated by EZH2. Cancer
Research 2012;72(14): 3582-92.
Chromatin Remodelling 144
[125] Chen L, Ma Y, Kim EY, Yu W, Schwartz RJ, Qian L, et al. Conditional Ablation of
Izh2 in Murine Hearls ReveaIs Ils IssenliaI RoIes in IndocardiaI Cushion Iorma
tion, Cardiomyocyte Proliferation and Survival. PLoS ONE 2012;7(2): e31005.
[126] Caretti G. The Polycomb Ezh2 methyltransferase regulates muscle gene expression
and skeletal muscle differentiation. Genes & Development 2004;18(21): 262738.
[127] Seenundun S, RamaIIi S, Liu Q-C, Aziz A, IaIii C, Hong S, el aI. UTX mediales de
melhyIalion of H3K27me3 al muscIe-secific genes during myogenesis. IMO }our
nal 2010;29(8): 140111.
[128] Juan AH, Derfoul A, Feng X, Ryall JG, Dell'Orso S, Pasut A, et al. Polycomb EZH2
controls self-renewal and safeguards the transcriptional identity of skeletal muscle
stem cells. Genes & Development 2011;25(8): 78994.
[129] Stojic L, Jasencakova Z, Prezioso C, Sttzer A, Bodega B, Pasini D, et al. Chromatin
regulated interchange between polycomb repressive complex 2 (PRC2)-Ezh2 and
IRC2-Izh1 comIexes conlroIs myogenin aclivalion in skeIelaI muscIe ceIIs. Iige
netics & Chromatin 2011;4(1): 16.
[130] Aoki R, Chiba T, Miyagi S, Negishi M, Konuma T, Taniguchi H, et al. The polycomb
grou gene roducl Izh2 reguIales roIiferalion and differenlialion of murine heal
ic stem/progenitor cells. Journal of Hepatology 2010;52(6): 85463.
[131] Xu C, ian C, Yang W, GaIka M, Ouyang H, Chen C, el aI. inding of differenl his
tone marks differentially regulates the activity and specificity of polycomb repressive
complex 2 (PRC2). Proceedings of the National Academy of Sciences 2010;107(45):
1926671.
[132] Chen H, Gu X, Su I-H, ollino R, Conlreras }L, Tarakhovsky A, el aI. IoIycomb ro
tein Ezh2 regulates pancreatic -cell Ink4a/Arf expression and regeneration in diabetes
mellitus. Genes & Development 2009;23(8): 97585.
[133] Xu CR, Cole PA, Meyers DJ, Kormish J, Dent S, Zaret KS. Chromatin Prepattern
and Histone Modifiers in a Fate Choice for Liver and Pancreas. Science
2011;332(6032): 9636.
[134] Wang L, }in Q, Lee }I, Su I-H, Ge K. Hislone H3K27 melhyIlransferase Izh2 re
presses Wnt genes to facilitate adipogenesis. Proceedings of the National Academy
of Sciences 2010;107(16): 731722.
[135] Shore AN, Kabolyanski I, Roarly K, Smilh MA, Zhang Y, Creighlon C}, el aI. Ireg
nancy-Induced Noncoding RNA (IINC) Associales vilh IoIycomb Reressive Com
plex 2 and Regulates Mammary Epithelial Differentiation. PLoS Genetics 2012;8(7):
e1002840.
[136] Gil J, Bernard D, Martnez D, Beach D. Polycomb CBX7 has a unifying role in cellular
lifespan. Nature Cell Biology 2003;6(1): 6772.
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
145
[137] Leung C, Lingbeek M, Shakhova O, Liu }, Tanger I, SaremasIani I, el aI. mi1 is es
senliaI for cerebeIIar deveIomenl and is overexressed in human meduIIobIaslo
mas. Nature 2004;428(6980): 33741.
[138] Bruggeman SWM. Ink4a and Arf differentially affect cell proliferation and neural
stem cell self-renewal in Bmi1-deficient mice. Genes & Development 2005;19(12):
143843.
[139] Gil J, Peters G. Regulation of the INK4bARFINK4a tumour suppressor locus: all
for one or one for all. Nature Review Molecular Cell Biology 2006;7(9): 66777.
[140] Dietrich N, Bracken AP, Trinh E, Schjerling CK, Koseki H, Rappsilber J, et al. Bypass
of senescence by the polycomb group protein CBX8 through direct binding to the
INK4A-ARF locus. EMBO Journal 2007;26(6): 163748.
[141] Dhavan S, Tschen SI, hushan A. mi-1 reguIales lhe Ink4a/Arf Iocus lo conlroI an
creatic -cell proliferation. Genes & Development 2009;23(8): 90611.
[142] Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, et al. A Bivalent
Chromatin Structure Marks Key Developmental Genes in Embryonic Stem Cells. Cell
2006;125(2): 31526.
[143] Iuri IL, SarloreIIi V. ReguIalion of muscIe reguIalory faclors by DNA-binding, inler
acling roleins, and osl-lranscrilionaI modificalions. }ournaI of CeIIuIar IhysioIo
gy 2000;185(2): 15573.
[144] Mousavi K, Zare H, Wang AH, Sartorelli V. Polycomb Protein Ezh1 Promotes RNA
Polymerase II Elongation. Molecular Cell 2012;45(2): 25562.
[145] Gaudet F. Induction of Tumors in Mice by Genomic Hypomethylation. Science
2003;300(5618): 48992.
[146] Feinberg AP. Epigenetics at the epicenter of modern medicine. JAMA: The journal of
the American Medical Association 2008;299(11): 134550.
[147] Kleer CG, Cao Q, Varambally S, Shen R, Ota I, Tomlins SA, et al. EZH2 is a marker of
aggressive breast cancer and promotes neoplastic transformation of breast epithelial
cells. Proceedings of the National Academy of Sciences 2003;100(20): 1160611.
[148] Raaphorst FMF, Meijer CJLMC, Fieret EE, Blokzijl TT, Mommers EE, Buerger HH, et
al. Poorly differentiated breast carcinoma is associated with increased expression of
the human polycomb group EZH2 gene. Neoplasia 2003;5(6): 4818.
[149] achmann IM. IZH2 Ixression Is Associaled Wilh High IroIiferalion Rale and Ag
gressive Tumor Subgrous in Culaneous MeIanoma and Cancers of lhe Indomelri
um, Prostate, and Breast. Journal of Clinical Oncology 2005;24(2): 26873.
[150] Collett K. Expression of Enhancer of Zeste Homologue 2 Is Significantly Associated
vilh Increased Tumor CeII IroIiferalion and Is a Marker of Aggressive reasl Can
cer. Clinical Cancer Research 2006;12(4): 116874.
Chromatin Remodelling 146
[151] Ding L. Identification of EZH2 as a Molecular Marker for a Precancerous State in
Morphologically Normal Breast Tissues. Cancer Research 2006;66(8): 40959.
[152] Rhodes DRD, Sanda MGM, Olle AIA, Chinnaiyan AMA, Rubin MAM. MuIliIex bi
omarker aroach for delermining risk of roslale-secific anligen-defined recur
rence of prostate cancer. Journal of the National Cancer Institute 2003;95(9): 6618.
[153] Saramki OR, Tammela TLJ, Martikainen PM, Vessella RL, Visakorpi T. The gene for
polycomb group protein enhancer of zeste homolog 2 (EZH2) is amplified in late-
stage prostate cancer. Genes Chromosomes and Cancer 2006;45(7): 63945.
[154] Berezovska OPO, Glinskii ABA, Yang ZZ, Li X-MX, Hoffman RMR, Glinsky GVG.
Essential role for activation of the Polycomb group (PcG) protein chromatin silencing
pathway in metastatic prostate cancer. Cell Cycle 2006;5(16): 1886901.
[155] van Leenders GJLH, Dukers D, Hessels D, van den Kieboom SWM, Hulsbergen CA,
Wil|es }A, el aI. IoIycomb-Grou Oncogenes IZH2, MI1, and RING1 Are Overex
pressed in Prostate Cancer With Adverse Pathologic and Clinical Features. European
Urology 2007;52(2): 45563.
[156] MaIIen-Sl CIair }, Soydaner-AzeIogIu R, Lee KI, TayIor L, Livanos A, IyIayeva-Gu
ta Y, et al. EZH2 couples pancreatic regeneration to neoplastic progression. Genes &
Development 2012;26(5): 43944.
[157] Duan Z, Zou JX, Yang P, Wang Y, Borowsky AD, Gao AC, et al. Developmental and
androgenic regulation of chromatin regulators EZH2 and ANCCA/ATAD2 in the
prostate Via MLL histone methylase complex. Prostate 2012; doi: 10.1002/pros.22587.
[158] reuer RH}, Sni|ders I}I, Smil II, Suled|a TG, SevaIl RGA, Olle AI, el aI. In
creased Expression of the EZH2 Polycomb Group Gene in BMI-1Positive Neoplastic
Cells During Bronchial Carcinogenesis. Neoplasia 2004;6(6): 73643.
[159] McCabe MT, randes }C, Verlino IM. Cancer DNA MelhyIalion: MoIecuIar Mecha
nisms and Clinical Implications. Clinical Cancer Research 2009;15(12): 392737.
[160] Kikuchi J, Takashina T, Kinoshita I, Kikuchi E, Shimizu Y, Sakakibara-Konishi J, et al.
Iigenelic lheray vilh 3-deazaneIanocin A, an inhibilor of lhe hislone melhyI
transferase EZH2, inhibits growth of non-small cell lung cancer cells. Lung Cancer
2012;78(2): 13843.
[161] Mimori K, Ogawa K, Okamoto M, Sudo T, Inoue H, Mori M. Clinical significance of
enhancer of zeste homolog 2 expression in colorectal cancer cases. European Journal
of Surgical Oncology 2005;31(4): 37680.
[162] Sudo T, Ulsunomiya T, Mimori K, Nagahara H, Ogava K, Inoue H, el aI. CIinicoa
thological significance of EZH2 mRNA expression in patients with hepatocellular
carcinoma. British Journal of Cancer 2005;92(9): 17548.
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
147
[163] Au SL-K, Wong CC-L, Lee JM-F, Fan DN-Y, Tsang FH, Ng IO-L, et al. Enhancer of
zeste homolog 2 epigenetically silences multiple tumor suppressor microRNAs to
promote liver cancer metastasis. Hepatology 2012;56(2): 622-31.
[164] Matsukawa Y, Semba S, Kato H, Ito A, Yanagihara K, Yokozaki H. Expression of the
enhancer of zesle homoIog 2 is correIaled vilh oor rognosis in human gaslric can
cer. Cancer Science 2006;97(6): 48491.
[165] van Kemenade I}, Raahorsl IM, Iokzi|I T, Iierel I, Hamer KM, Sali|n DI, el aI. Co
expression of BMI-1 and EZH2 polycomb-group proteins is associated with cycling
cells and degree of malignancy in B-cell non-Hodgkin lymphoma. Blood 2001;97(12):
3896901.
[166] Visser HPJ, Gunster MJ, Kluin Nelemans HC, Manders EMM, Raaphorst FM, Meijer
C}LM, el aI. The IoIycomb grou rolein IZH2 is ureguIaled in roIiferaling, cuI
tured human mantle cell lymphoma. British journal of haematology 2001;112(4): 950
8.
[167] Park SW, Chung NG, Eom HS, Yoo NJ, Lee SH. Mutational analysis of EZH2 codon
641 in non-Hodgkin lymphomas and leukemias. Leukemia Research 2010;35(1): e6-7.
[168] Morin RD, }ohnson NA, Severson TM, MungaII A}, An }, Goya R, el aI. Somalic mu
tations altering EZH2 (Tyr641) in follicular and diffuse large B-cell lymphomas of
germinal-center origin. Nature Genetics 2010;42(2): 1815.
[169] McCabe MT, Ott HM, Ganji G, Korenchuk S, Thompson C, Van Aller GS, et al. EZH2
inhibition as a therapeutic strategy for lymphoma with EZH2-activating mutations.
Nature 2012; doi: 10.1038/nature11606.
[170] Chen J, Li J, Han Q, Sun Z, Wang J, WANG S, et al. Enhancer of zeste homolog 2 is
overexpressed and contributes to epigenetic inactivation of p21 and phosphatase and
tensin homolog in B-cell acute lymphoblastic leukemia. Experimental Biology and
Medicine 2012;237(9): 11106.
[171] Simon C, Chagraoui J, Krosl J, Gendron P, Wilhelm B, Lemieux S, et al. A key role for
EZH2 and associated genes in mouse and human adult T-cell acute leukemia. Genes
& Development 2012;26(7): 6516.
[172] Croonquist PA, Van Ness B. The polycomb group protein enhancer of zeste homolog
2 (EZH2) is an oncogene that influences myeloma cell growth and the mutant ras
phenotype. Oncogene 2005;24(41): 626980.
[173] Tanaka S, Miyagi S, Sashida G, Chiba T, Yuan J, Mochizuki-Kashio M, et al. Ezh2
augments leukemogenecity by reinforcing differentiation blockage in acute myeloid
leukemia. Blood 2012;120(5): 1107-17.
[174] Neff T, Sinha AU, Kluk MJ, Zhu N, Khattab MH, Stein L, et al. Polycomb repressive
complex 2 is required for MLL-AF9 leukemia. Proceedings of the National Academy
of Sciences 2012;109(13): 502833.
Chromatin Remodelling 148
[175] Rizzo S, Hersey JM, Mellor P, Dai W, Santos-Silva A, Liber D, et al. Ovarian Cancer
Slem CeII-Like Side IouIalions Are Inriched IoIIoving Chemolheray and Overex
press EZH2. Molecular Cancer Therapeutics 2011;10(2): 32535.
[176] McHugh }, IuIIen DR, Ma L, KIeer CG, Su LD. Ixression of oIycomb grou ro
tein EZH2 in nevi and melanoma. Journal of Cutaneous Pathology 2007;34(8): 597
600.
[177] Asangani IA, Harms PW, Dodson L, Pandhi M, Kunju LP, Maher CA, et al. Genetic
and epigenetic loss of microRNA-31 leads to feed-forward expression of EZH2 in
melanoma. Oncotarget 2012 3(9): 1011-25.
[178] Raman JD. Increased Expression of the Polycomb Group Gene, EZH2, in Transitional
Cell Carcinoma of the Bladder. Clinical Cancer Research 2005;11(24): 85706.
[179] Zhou }, Roh }-W, andyoadhyay S, Chen Z, Munkarah A, Hussein Y, el aI. Overex
pression of enhancer of zeste homolog 2 (EZH2) and focal adhesion kinase (FAK) in
high grade endometrial carcinoma. Gynecologic Oncology 2012; http://dx.doi.org/
10.1016/j.ygyno.2012.07.128.
[180] Ciaraica R, Russo G, VergineIIi I, Raimondi L, Donfrancesco A, Rola R, el aI. De
regulated expression of miR-26a and Ezh2 in rhabdomyosarcoma. Cell Cycle
2009;8(1): 1725.
[181] Venneti S, Le P, Martinez D, Xie SX, Sullivan LM, Rorke-Adams LB, et al. Malignant
rhabdoid tumors express stem cell factors, which relate to the expression of EZH2
and Id proteins. The American Journal of Surgical Pathology 2011;35(10): 146372.
[182] Marchesi I, Fiorentino FP, Rizzolio F, Giordano A, Bagella L. The ablation of EZH2
uncovers its crucial role in rhabdomyosarcoma formation. Cell Cycle 2012;11(20):
382836.
[183] Avan A, Crea I, IaoIicchi I, IuneI N, GaIvani I, Marquez VI, el aI. MoIecuIar mech
anisms invoIved in lhe synergislic inleraclion of lhe IZH2 inhibilor 3-deazaneIano
cin A (DZNeP) with gemcitabine in pancreatic cancer cells. Molecular Cancer
Therapeutics 2012;11(8): 1735-46.
[184] Lasfargues C, Iyronnel S. IZH2 Iinks ancrealilis lo lissue regeneralion and ancre
atic cancer. Clinics and Research in Hepatology and Gastroenterology 2012;36(4):
323-4
[185] Shen Y, Guo X, Wang Y, Qiu W, Chang Y, Zhang A, el aI. Ixression and signifi
cance of histone H3K27 demethylases in renal cell carcinoma. BMC Cancer
2012;12(1):470.
[186] Suva ML, Riggi N, Janiszewska M, Radovanovic I, Provero P, Stehle JC, et al. EZH2
Is Essential for Glioblastoma Cancer Stem Cell Maintenance. Cancer Research;69(24):
92118.
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
149
[187] Smits M, van Rijn S, Hulleman E, Biesmans D, van Vuurden DG, Kool M, et al.
EZH2-Regulated DAB2IP Is a Medulloblastoma Tumor Suppressor and a Positive
Marker for Survival. Clinical Cancer Research 2012;18(15): 4048-58.
[188] Molofsky AV. Bmi-1 promotes neural stem cell self-renewal and neural development
bul nol mouse grovlh and survivaI by reressing lhe 16Ink4a and 19Arf senes
cence pathways. Genes & Development 2005;19(12): 14327.
[189] Fiorentino FP, Symonds CE, Macaluso M, Giordano A. Senescence and p130/Rbl2: a
new beginning to the end. Cell Research 2009;19(9): 104451.
[190] Sherr CJ. The INK4a/ARF network in tumour suppression. Nature Review Molecular
Cell Biology 2001;2(10): 7317.
[191] Lowe SW, Sherr CJ. Tumor suppression by Ink4aArf: progress and puzzles. Current
Opinion in Genetics & Development 2003;13(1): 7783.
[192] Kolake Y, Cao R, Vialour I, Sage }, Zhang Y, Xiong Y. R famiIy roleins are re
quired for H3K27 trimethylation and Polycomb repression complexes binding to and
silencing p16INK4a tumor suppressor gene. Genes & Development 2007;21(1): 4954.
[193] Tonini T, Bagella L, D'andrilli G, Claudio PP, Giordano A. Ezh2 reduces the ability of
HDAC1-dependent pRb2/p130 transcriptional repression of cyclin A. Oncogene
2004;23(28): 49307.
[194] Tonini T, D'andrilli G, Fucito A, Gaspa L, Bagella L. Importance of Ezh2 polycomb
protein in tumorigenesis process interfering with the pathway of growth suppressive
key elements. Journal of Cellular Physiology 2007;214(2): 295300.
[195] Ian T, }iang S, Chung N, AIikhan A, Ni C, Lee CCR, el aI. IZH2-Deendenl Sures
sion of a Cellular Senescence Phenotype in Melanoma Cells by Inhibition of p21/
CDKN1A Expression. Molecular Cancer Research 2011;9(4): 41829.
[196] Chen H. Dovn-reguIalion of Human DA2II Gene Ixression Medialed by IoIy
comb Izh2 ComIex and Hislone DeacelyIase in Iroslale Cancer. }ournaI of ioIogi
cal Chemistry 2005;280(23): 2243744.
[197] Wu ZL, Zheng SS, Li ZM, Qiao YY, Aau MY, Yu Q. IoIycomb rolein IZH2 regu
lates E2F1-dependent apoptosis through epigenetically modulating Bim expression.
Cell Death and Differentiation 2009;17(5): 80110.
[198] Su I-H, Dobenecker M-W, Dickinson I, Oser M, asavara| A, Marqueron R, el aI. IoI
ycomb Group Protein Ezh2 Controls Actin Polymerization and Cell Signaling. Cell
2005;121(3): 42536.
[199] ryanl R}, Cross NA, Ialon CL, Hamdy IC, CunIiffe VT. IZH2 romoles roIifera
tion and invasiveness of prostate cancer cells. Prostate 2007;67(5): 54756.
Chromatin Remodelling 150
[200] ryanl R}, Winder S}, Cross SS, Hamdy IC, CunIiffe VT. The oIycomb grou ro
tein EZH2 regulates actin polymerization in human prostate cancer cells. Prostate
2008;68(3): 25563.
[201] Martinez-Garcia E, Licht JD. Deregulation of H3K27 methylation in cancer. Nature
Genetics 2010;42(2): 1001.
[202] Sneeringer C}, Scoll MI, Kunlz KW, Knulson SK, IoIIock RM, Richon VM, el aI. Co
ordinaled aclivilies of viId-lye Ius mulanl IZH2 drive lumor-associaled hyerlri
methylation of lysine 27 on histone H3 (H3K27) in human B-cell lymphomas.
Proceedings of the National Academy of Sciences 2010;107(49): 209805.
[203] Ernst T, Chase AJ, Score J, Hidalgo-Curtis CE, Bryant C, Jones AV, et al. Inactivating
mutations of the histone methyltransferase gene EZH2 in myeloid disorders. Nature
Genetics 2010;42(8): 7226.
[204] Nikoloski G, Langemeijer SMC, Kuiper RP, Knops R, Massop M, Tnnissen ERLTM,
el aI. Somalic mulalions of lhe hislone melhyIlransferase gene IZH2 in myeIodys
plastic syndromes. Nature Genetics 2010;42(8): 6657.
[205] Makishima H, Jankowska AM, Tiu RV, Szpurka H, Sugimoto Y, Hu Z, et al. Novel
homo- and hemizygous mutations in EZH2 in myeloid malignancies. Leukemia
2010;24(10): 1799804.
[206] Bejar R, Stevenson K, Abdel-Wahab O, Galili N, Nilsson B, Garcia-Manero G, et al.
Clinical Effect of Point Mutations in Myelodysplastic Syndromes.The New England
Journal of Medicine 2011;364(26): 2496506.
[207] Guglielmelli P, Biamonte F, Score J, Hidalgo-Curtis C, Cervantes F, Maffioli M, et al.
EZH2 mutational status predicts poor survival in myelofibrosis. Blood 2011;118(19):
522734.
[208] Zhang J, Ding L, Holmfeldt L, Wu G, Heatley SL, Payne-Turner D, et al. The genetic
basis of early T-cell precursor acute lymphoblastic leukaemia. Nature 2012;481(7380):
15763.
[209] Ntziachristos P, Tsirigos A, Vlierberghe PV, Nedjic J, Trimarchi T, Flaherty MS, et al.
Genelic inaclivalion of lhe oIycomb reressive comIex 2 in T ceII acule Iymho
blastic leukemia. Nature Medicine 2012;18(2): 298303.
[210] Lyko I, rovn R. DNA MelhyIlransferase Inhibilors and lhe DeveIomenl of Iige
netic Cancer Therapies. Journal of the National Cancer Institute 2005;97(20): 1498
506.
[211] Iederico M, ageIIa L. Hislone DeacelyIase Inhibilors in lhe Trealmenl of Hemalo
logical Malignancies and Solid Tumors. Journal of Biomedicine and Biotechnology
2011; doi:10.1155/2011/475641
Role of Enhancer of Zeste Homolog 2 Polycomb Protein and Its Significance in Tumor Progression...
http://dx.doi.org/10.5772/55370
151
[212] Tan J, Yang X, Zhuang L, Jiang X, Chen W, Lee PL, et al. Pharmacologic disruption of
IoIycomb-reressive comIex 2-medialed gene reression seIecliveIy induces ao
tosis in cancer cells. Genes & Development 2007;21(9): 105063.
[213] Cheng LL, Ilahana Y, Lei ZD, Chia NY, Wu Y, Yu Y, el aI. TI53 Genomic Slalus Reg
uIales Sensilivily of Gaslric Cancer CeIIs lo lhe Hislone MelhyIalion Inhibilor 3-Dea
zaneplanocin A (DZNep). Clinical Cancer Research 2012;18(15): 4201-12.
[214] Lin Y-H, Lee C-C, Chang I-R, Chang W-H, Wu Y-C, Chang }-G. 16-HydroxycIero
da-3,13-dien-15,16-olide regulates the expression of histone-modifying enzymes
PRC2 complex and induces apoptosis in CML K562 cells. Life Sciences
2011;89(23-24): 886-95.
Chromatin Remodelling 152
Chapter 7
Chromatin Remodeling in
DNA Damage Response and Human Aging
Lili Gong, Edward Wang and Shiaw-Yih Lin
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/55272
1. Introduction
Chromatin consists of the DNA and all proteins involved in organizing and regulating DNA
structure. The building block of chromatin is the nucleosome, which is composed of 146 base
pairs of DNA and a core histone octamer. The core histone oactomer is composed of two
heterodimers of histone H2A and histone H2B and a tetramer of histone H3 and histone H4
[1]. The overall chromatin structure is very dynamic in response to diverse biological events.
ReguIalion of chromalin slruclure is achieved by lvo ma|or mechanisms. The firsl is osl
lransIalionaI modificalion (ITM) of hislones and olher chromalin roleins via hoshoryIa
tion, methylation, acetylation, ubiquitination and sumoylation [2, 3]. The second is through
ATP-dependent nucleosome structure alteration. Cooperation between histone PTMs and
chromatin remodelers allows chromatin remodeling to regulate diverse biological events
including transcription, chromosome segregation, DNA replication, and DNA repair. In this
chapter, we summarize how chromatin structure is regulated during DNA damage response
(DDR), focusing particularly on three PTMs: phosphorylation, Poly(ADP-ribosyl)ation
(PARylation) and sumoylation. We discuss the DDR in a highly compacted chromatic
structure, heterochromatin, as well as the interplay between chromatin remodeling, DNA
damage and human aging.
2. DNA damage response
2.1. Sources leading to DNA damage
In order to maintain DNA fidelity, cells must overcome multiple challenges that threaten
genome slabiIily. Cues cause DNA damages can be divided inlo sonlaneous and environ
2013 Gong et al.; licensee InTech. This is an open access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
ment-induced. Spontaneous DNA damages are usually caused by intracellular metabolism
stress, or formed during genetically programmed processes such as V (variable), D (diversity),
and J (joining) (V(D)J) recombination in developing vertebrate lymphocytes or meiotic
recombination in germ cells [4, 5]. The major types of damage include aberrant conformations
of DNA, chemical instability of DNA, free radicals of oxygen, endogenous mutagens and errors
in DNA replications [6]. Environmental DNA damages generally refer to exposure of cells to
various genotoxic agents. These agents contain both physical factors, such as ultraviolet (UV),
visible light and ionizing radiation; as well as chemical factors, such as alkylating agents,
benzopyrene, aflatoxins and cis-Platinum. These DNA damages can lead to single base
mutation or more deleterious chromosomal lesion.
2.2. DDR pathway
To maintain genome stability, cells have developed a global signaling network, known as the
DNA damage response (DDR), to sense different types of genotoxic stress, to modulate cell
cycle transitions and transcriptional process, and to stimulate DNA repair. Mechanistically,
proteins involved in the DDR signaling network can be grouped into three major classes: 1)
Sensors, acting at the upstream of DDR by recognizing the DNA damage and initiating DDR;
2) Transducers, proteins that pass and amplify DNA damage signals to downstream effectors.
Notably, among diverse transducers, ATM (Ataxia Telangiectasia Mutated) and ATR (ATM
and Rad3 ReIaled) are cenlraI lo lhe enlire DDR, 3) Iffeclor, roleins delermine lhe hysio
logical outcome of DNA damage response. Depending on the context of DNA damage,
effectors can regulate cell cycle, transcription or cell apoptosis. Nevertheless, we need to point
out that although DDR is often referred to as a signaling pathway, it is more accurately
described as a network of interacting pathways that coordinate the damage response.
2.3. DNA damage repair
The various types of DNA damage include aberrant base or nucleotide modifications, single
strand DNA (ssDNA) breaks, and chromosomal lesions caused by double strand breaks
(DSBs). Among these, DSBs are regarded as the most cytotoxic. If left unrepaired, DSBs will
affect genome integrity by causing mutations, chromosome deletions or translocations,
because there is no intact complimentary template to repair the damaged strand. In this
chapter, we will use DSBs as a model lesion.
DSBs can be repaired by two principle mechanisms, the non-homologous end joining (NHEJ)
and homologous recombination (HR) [7]. These two pathways differ in their functional
enzymes, the repair efficiency and also the cell cycle phases where they are active (Figure 1).
Molecular Basis of NHEJ. In the process of NHEJ, DSBs are repaired by direct ligation of the
exposed ends regardless of their DNA sequences. Enzymes involved specifically in NHEJ
capture both ends of the broken DNA molecule, bringing them together to form a DNA-protein
complex to repair the break. Therefore NHEJ is a very efficient but error-prone way to repair
damaged DNA, and it occurs in all phases of the cell cycle [8]. In NHEJ pathway, the Ku70/80
heterodimer initiates NHEJ by binding to both ends of the broken DNA molecule, which
Chromatin Remodelling 154
creates a scaffold for the assembly of other NHEJ enzymes. After association of Ku70/80, the
DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is recruited to the DSB, forming
a synaptic complex that brings the broken DNA ends together. Once the DNA ends have been
captured and tethered, non-ligatable DNA termini must be processed (single strand fill in) or
removed by nucleases and polymerases. Lastly, the processed DNA ends are joint by ligase
IV/XRCC4 complex [9]. It was demonstrated that in higher eukaryotes, and especially in
mammals, NHEJ is the preferred pathway for DNA DSB repair [10].
Molecular Basis of HR. HR is an error-free, template-dependent strategy to repair DNA DSBs.
It occurs during the S and G2 phases, when the sister chromatids are more easily available [11].
The key reactions in HR are homology search and DNA strand invasion, which are catalyzed
by the RecA homolog Rad51 [12j. IrinciaIIy, HR can be divided inlo lhree sles: 1) Iresy
napsis. During this process, DSB ends are recognized and processed to a single-stranded tail
with a 3-OH ending. This ssDNA is then bound by the eukaryotic ssDNA binding protein
RPA (replication protein A). 2) Synapsis. With aid of cofactors, such as Rad 52 and Rad 55-57
complexes [13, 14], Rad51 binds to RPA-coated ssDNA, forming Rad51-DNA filament. After
this, DNA strand invasion by the Rad51-ssDNA filament generates a D-loop intermediate. 3)
Postsynapsis. In DSBs repair, both ends of the DSB are engaged, leading to double Holliday
junction formation. Finally, following the actions of polymerases, nucleases and helicases,
DNA ligation and substrate resolution occur.
How cells choose between NHEJ or HR to repair the DSBs is unclear. As mentioned above,
HR is initiated by ssDNA resection and requires sequence homology, but NHEJ requires
neither resection at initiation nor a homologous template. Thus, resection appears to be a
pivotal step in DSB repair initiation that determines whether HR or NHEJ occurs. However,
an alternative end-joining (A-EJ) pathway, which is also initiated by ssDNA resection but does
not require a homologous partner, was recently identified. It is proposed that the presence of
ssDNA resection will determine the selection among canonical NHEJ, A-EJ or HR; the size of
the resection, which is associated with the cell cycle phase, will then direct the DSB repair to
either HR or A-EJ [15].
3. Chromatin remodeling during DNA damage
In 1998, functions of phosphorylation at the Serine139 residue of a histone variant, H2AX,
vere firsl discovered in DDR |16j. Since lhen, exlensive sludies regarding hov chroma
tin alters its structures in response of DNA damage were made. It is now recognized that
small DNA lesion can lead to global chromatin remodeling, with changes including histone
modifications, nucleosome positioning and higher-order folding of the chromatin fiber.
Furthermore, if the DDR-induced chromatin remodeling is not properly restored, then the
epigenetic changes can be heritable and contribute to terminal cell fate, such as lransforma
tion, cell senescence and cell apoptosis [17, 18]. In this part, we will discuss recent progress
made about chromatin structures regulations in the detecting and repairing process of DNA
damage. Specifically, we will focus on H2AX phosphorylation regulation, Poly (ADP-
ribosyl)ation, and sumoylation in DDR.
Chromatin Remodeling in DNA Damage Response and Human Aging
http://dx.doi.org/10.5772/55272
155
3.1. H2AX phosphorylation
One of the key events that initiates DDR is phosphorylation at the Ser139 of histone H2AX, a
chromatin-bound histone variant compromising up to 25% of the H2A [16j. This hoshory
lation process is catalyzed by the master regulator of DDR, ATM and ATR. Phosphorylation
of H2AX at Ser139 is very rapid and this phosphorylated H2AX (yH2AX) serves as a platform,
directly recruiting Mdc1 (mediator of DNA-damage checkpoint 1), and additional factors such
as 53BP1, RNF8, and the BRCA1A complex to affected sites [19].
AIlhough yH2AX is a well-recognized marker for DNA damage, its precise role in chromatin
remodeling is only just becoming clear. It was recently found that phosphorylation at a tyrosine
site, Tyr142, plays a pivotal role in regulating H2AX functions in DDR [20j. asaI hoshor
ylation of H2AX at Tyr142 was carried out by WSTF (Williams syndrome transcription factor),
a component of the WICH ATP-dependent chromatin remodeling complex [20]. At the early
stage of DDR (<1hr), inhibition of phosphorylation at Tyr142 by knocking down WICH did
not affect yH2AX foci formation, but during the later recovery stages, yH2AX foci was greatly
reduced[20]. So it seems that in the absence of Tyr142 phosphorylation, the kinetics of the
phosphorylation/dephosphorylation cycle of y-H2AX may be altered. Following this finding,
the phosphatase EYA (eye absent) responsible for dephosphorylating H2AX at Tyr142 was
identified [21]. Dephosphorylation of Tyr142 was suggested to be a prerequisite for yH2AX to
be recognized by damage repair proteins. When persistent phosphorylation at Tyr142 happens
during DNA damage, MDC1-dependent binding of DNA repair factors is inhibited, but
recruitment of pro-apoptotic factors, such as JNK1, is promoted [21]. A more recent study
demonstrated that the doubly phosphorylated H2AX interact with Microcephalin (MCPH1),
an early DNA damage response protein [22]. Although the exact functions of such interaction
is still unknown, we speculate that the precise regulation of yH2AX will be an area of great
potential for future DNA damage studies.
3.2. Poly(ADP-ribosyl)ation
In addition to H2AX-dependent recruitment, several additional pathways have also been
shown to direct the recruitment of various proteins to DNA lesion. Poly(ADP-ribosyl)ation
(PARylation) is one of the early events in DDR [2]. Poly(ADP-ribose) polymerases-1 (PARP-1),
the founding member of PARP family, sense DNA break through its zinc-finger domain.
SlrucluraI sludies aIso shoved lhal engaging inlo lhe damaged DNA causes IARI-1 confor
mation change and increases the dynamics of its catalytic domain [23]. In this way, the
occurrence of a DNA break is immediately translated into a posttranslational modification of
histones H1 and H2B leading to chromatin structure change [24]. Two waves of accumulation
of PARP-1 were observed in living cells. The initial recruitment of PARP-1 activates and locates
poly(ADP-ribose) synthesis, which in turn generates binding sites for a second wave of PARP-1
recruitment and other DDR proteins [25]. Recently, it was found that polycomb group (PcG)
members and nucleosome remodeling and deacetylase (NuRD) complex are recruited by
PARP-1 and -2 to DNA lesions [26]. Both PcG and NuRD are negative regulators of gene
transcription, and indeed, rapid loss of nascent RNA and elongating RNA polymerase were
Chromatin Remodelling 156
observed at DNA damage sites. This finding suggests that part of PARPs regulatory role in
DDR involves repression of transcription.
3.3. Sumoylation
Sumoylation, the covalent attachment of the small proteins known as SUMO (small ubiquitin
modifier) to protein substrate, is a very dynamic and reversible PTM [27]. Compared to
ubiquitination, knowledge about sumoylation in DDR is relative rudimentary. In 2009, two
papers demonstrated the importance of this ubiquitin-like protein modification in DDR [28,
29]. A series of immunofluorescence and live-cell image experiments showed that components
in the sumoylation pathway, including enzymes E1 (SAE1), E2 (Ubc9), two of the diverse E3
enzymes (PIAS1 and PIAS4) and the conjugates SUMO1, 2 and 3, are rapidly recruited to DNA
damage sites. Functionally, sumoylation of BRCA1 is necessary for its ubiquitin ligase activity.
WhiIe associalion of 53I1, RCA1 and RNI168 vilh lhe DNA damage siles requires accu
mulation of PIAS1 and PIAS4 to the damaged sites [29].
Several more studies have further revealed that sumoylation and ubiquitination signaling
pathways are integrated in the cellular response to DNA damage. For example, two groups
showed that the human RNF4, a SUMO-targeted ubiquitin E3 ligase, was recruited to DSBs
depending on its SUMO interacting motifs [30, 31] Depletion of RNF4 impairs ubiquitin adduct
formation at DSB sites, causes persistent histone H2AX phosphorylation [30] and affects the
clearance of 53BP1, RNF8, and RNF168 from DNA damage foci [31]. It is proposed that through
physical interaction with the SUMO moiety, RNF4 promotes DNA repair by mediating
ubiquitylation of sumoylated DDR components at sites of DNA damage.
The role of sumoylation in DNA repair is emphasized by modification of the RPA (replication
protein A) complex [32]. RPA was found to physically associate with a SUMO specific protease,
SENP6, to maintain its desumoylation status in normal conditions [32]. Under DNA damage,
such as those caused by campothecin or IR, the 70 kD subunit of RPA is sumoylated, which in
turn recruits Rad51 to DNA lesions, initiating DNA repair through HR. In addition to the
specific study of RPA, a recent study in yeast identified a large group of proteins participating
in DNA repair and undergoing sumoylation. They showed that defective sumoylation results
in failure to complete replication of a damaged genome and impaired DNA end processing,
highlighting the importance of sumoylation in maintaining genome stability [33].
4. DNA damage processed in heterochromatin
4.1. The heterochromatin feature
Chromatin can be divided into euchromatin and heterochromatin, on the basis of differential
comaclion al inlerhase. Iuchromalin is IooseIy comacled, more accessibIe lo lranscri
tional machinery and thus usually actively transcribed. Heterochromatin is typically densely
packed, and was previously thought to be inaccessible to the transcription components [34].
Molecularly, heterochromatin is featured with specific histone modifications, such as di- or
Chromatin Remodeling in DNA Damage Response and Human Aging
http://dx.doi.org/10.5772/55272
157
tri-methylation of histone H3 at lysine 9, and the subsequent recruitment of chromatin
association protein such as heterochromatin protein1 (Hp1) [35]. Heterochromatin can be
further divided into two groups. First is the constitutive heterochromatin, which contains a
high density of repetitive DNA elements, such as satellite sequences and transposable
elements. They remain condensed throughout the cell cycle. A second group is facultative
heterochromatin, which is dynamic chromosomal loci, condensation of which is regulated by
cellular and environmental signals [36].
4.2. The functions of heterochromatin
The major function of heterochromatin is to repress transcription and recombination of the
embedded repetitive DNA sequences. Disruption of heterochromatin increases the occurrence
of spontaneous DSBs, leads to the expansion of DNA repeat arrays, and is correlated with
chromosomal defects, such as translocations and loss of heterozygosity [37]. Mechanistically,
methylated H3 at Lysine9 (H3K9me) and the chromatin-bound Hp1 serve as a platform,
recruiting various proteins to maintain the highly compact feature of heterochromatin. For
example, the HDAC Clr3 is recruited to heterochromatic domains by the yeast Hp1 homolog
Swi6. Deacytylation by Clr3 stabilizes H3 tri-methylation, increase chromatin condensation
and precludes access of Polymerase II [38]. In addition to physically preventing the access of
transcription machinery, heterochromatin structure also promotes the post-transcriptional
silencing of repetitive sequences. This function is achieved by preferentially targeting the RNA
interference components, such as RITS (RNA-induced transcriptional gene silencing) and
RDRC (RNA-directed RNA polymerase complex) through H3K9me and Hp1 [39] [40, 41]. On
the other side, the recruited RNAi machinery can also contribute to the heterochromatic
architecture. In mammalian and drosophila cells, Hp1 shows RNA binding activity, which is
required for assembling of condensed chromatin [42, 43]. It is proposed that the RNA derived
from repetitive DNA sequence might function as a glue to promote folding or clustering of
dispersed heterochromatic loci [36, 41].
4.3. Dctcctinn nI D5Bs in hctcrnchrnmatin: Incusing nn H2A Inci
With the realization of heterochromatin structure and functions, the question is how DNA
damages in heterochromatin are detected and repaired. In the following sections, we will
discuss the recent understanding about these issues.
Abundant reports suggest that heterochromatin is refractory to yH2A foci formation upon
ionizing radiation [44-46]. However, it remains to be determined whether this phenomenon is
due to inaccessible to phosphorylation of H2AX, or heterochromatin is more resistant to DNA
damage. Particularly, following DNA damage, chromatin in the vicinity of damaged sites are
rapidly de-condensed, which makes the idea that yH2A foci is absent in highly packed
chromatin a topic of debate [46-48]. On the other side, a recent study utilizing fluorescence in
situ hybridization found that the high amount of proteins bound to heterochromatin, including
Hp1, acts as a protective layer that prevents access to the DNA. Therefore, it seems that
heterochromatin may internally act as an isolator to inhibit DNA damage [49].
Chromatin Remodelling 158
However, those thoughts were revisited by a recent study conducted in drosophila cells. In
2011, Chiolo et al. demonstrated that yH2A foci can be formed in heterochromatin upon DSBs
[50]. Through a serious of live-cell images and immunofluorescence studies, they found that
DSBs and yH2A foci were absent at later time points of IR-induced DSBs (>60 mins post IR),
which is consistent with previous studies. However, at earlier time points of IR treatment (<10
min), both yH2Ax and ATRIP foci can be observed in heterochromatin, with a level equal to
that of non-heterochromatic sites. This study suggests that a complete DDR can occur within
heterochromatin (Figure 2A).
4.4. DSBs repair in heterochromatin
The next question is how cell repairs the DSBs in heterochromatin. Two issues are raised when
considering repair of DNA lesions in heterochromatin. The first is that chromatin compaction
in heterochromatin might restrict the access of DDR proteins to damaged sites. Indeed, it was
found that DSB repair occurs with slower kinetics and is less effective in heterochromatin [51].
Furthermore, a delay in repair of heterochromatic DSBs was observed in human cells [52]. To
overcome the challenge given by tightly compacted chromatin, it was found that the cell can
employ the ATM signaling pathway to relax chromatin [51]. Goodarzi et al. found that ATM
signaIing vas secificaIIy required for DSs reair vilhin helerochromalin, by hoshoryIal
ing a transcription repressor, KAP1 (KRAB-associated protein1). KAP1 induces transcriptional
repression and chromatin condensation through recruitment of Hp1 [53] and Mi2o |54]. In the
absence of ATM, association of KAP1 to chromatin was increased, suggesting phosphorylation
by ATM decreases the affinity of KAP1 for chromatin, which in turn reduces chromatin
condensation [51].
The second issue regarding repair of DSBs in heterochromatin is whether NHEJ or HR pathway
occurs. In the presence of the closely clustered repeats, HR might produce dicentric and
acentric chromosomes, which are known to contribute to human diseases such as cancer and
infertility [55]. In this sense, it would be very risky for cells to choose HR to repair the DSBs,
since this may lead to abnormal genome rearrangements. In other words, NHEJ repair seems
less problematic because small deletions or mutations generally do not affect the function of
tandem repeats as severely as genes. However, reports form Chiolo et al. demonstrated that
DSBs occuring in heterochromatin are repaired by HR, but the underlying mechanism is
distinct from euchromatin [50] (Figure 2A). The most prominent difference is the exclusion of
Rad51, which mediates strand invasion, from the DSBs in the heterochromatic domain.
Exclusion of Rad51 is achieved by protrusion of heterochromatin, which facilitates DSBs
relocalization to the Hp1o periphery. The movement of the DSBs from inside to outside of
heterochromatin depends on checkpoint proteins, such as ATR and resection proteins.
Furthermore, relocalization of heterochromatic DSBs is blocked by the Smc5/6 SUMO ligase
complex, the yeast homolog of which is required to prevent recombinational repair within the
repetitive rDNA locus [56]. It is proposed that Smc5/6 could catalyze sumoylation of one or
more components of the recombination machinery and block further assembly of the HR
machinery [57].
Chromatin Remodeling in DNA Damage Response and Human Aging
http://dx.doi.org/10.5772/55272
159
Together, multiple mechanisms exist to guarantee proper DDR in heterochromatin to repair
the damaged DNA without compromising genome stability. With improvements in live-cell
imaging, ve secuIale lhal more delaiIs, Iike lhe rocess of DNA damage-induced helero
chromatin expansion and reunion of the repaired heterochromatic region, will be revealed.
5. Human aging and chromatin remodeling
Aging is a complex process that has been long thought to be a consequence of unprogrammed
deleterious events and accumulation of random gene mutation. However, with extensive
studies in yeast, worm and mouse, and with the research in premature human aging disease,
novel insights have been gained into the molecular mechanisms underlying aging. In this
section, we will focus on recent understanding about the contributions that chromatin defects
and DNA damage have on human aging.
5.1. Heterochromatin defects in human aging
Through studying the premature aging disorder HutchinsonGilford Progeria Syndrome
(HGPS), the molecular mechanisms leading to chromatin defects in aging are being uncovered.
HGPS is an extremely rare genetic disease caused by a point mutation in the LMNA gene,
which encodes the major structural protein Lamin A in the nuclear envelope [58]. LMNA
mutation leads to abnormal splicing defects and consequent production of a truncated form
of lamin A protein, referred to as progerin [59, 60]. Notably, in healthy individuals, the same
splice site in lamin A was used to cause age-related nuclear defects [61], suggesting conserved
mechanism might be shared by both premature and physical human aging process.
One hallmark of human aging, and also in the aging process of other species, is global change
in chromatin structure [62, 63j.IarlicuIarIy, Ioss of helerochromalin slruclure, Ioss of helero
chromatin proteins and altered patterns of histone modifications, such as decreased H3K9me3,
are found in both physiological and premature aging [61, 64-67]. Furthermore, more open
chromatin structure, as indicated by tri-methylation at histone3 lysine4, is implicated in shorter
lifespan in worm [68, 69].
5.2. Molecular mechanisms underlying heterochromatin loss and aging
The above evidence suggests that heterochromatin maintenance is critical for longevity. Now
the question is how such densely compacted chromatin structure regulates human aging.
Unfortunately, due to the complex nature of the aging process and hence experimentally
intractability, it is hard to find a direct causal-effect relationship. But recent studies do shed
light on the heterochromatic sequence transcription and human aging. Shumaker et al found
that associated with the down-regulation of H3K9me3, the satellite III repeat transcripts, which
is locating in the pericentric heterochromatin, were up-regulated. This up-regulation seems to
be sequence-specific since transcription of other group of pericentric repeat, such as o satellite,
was not altered [66]. Interestingly, Larson et al. reported that during Drosophila aging, loss of
heterochromatin leads to an increased transcription of ribosomal DNA [67]. This rDNA locus
Chromatin Remodelling 160
contains exceeded ribosomal genes and usually only 10% of them are transcribed [70]. How
abnormal transcription of heterochromatic sequences regulate aging is currently unknown.
But it is proposed that loss of heterochromatic repeat silencing may affect gene expression
patterns and hence affect the integrity of the transcriptome. It is also intriguing to link the
heterochromatin status, ribosomal RNA synthesis and aging by taking energy metabolism into
account. That is, ribosomal RNA transcription is a rate-limiting step in protein synthesis,
increased RNA transcription would promote growth and accelerate aging [71, 72]
5.3. DNA damage and human aging
Persistent DNA damage is another hallmark in human aging. Most human premature aging
syndromes are caused by various types of DNA damage, and in particular, DSBs [73, 74]. There
is no doubt that chromatin defects and DNA damage are major contributors to human aging.
The question is which one comes first? Do the DNA damage and the DDR lead to chromatin
defects and thus human aging? Or it is that loss of chromatin structure makes the cell more
susceptible to DNA damage, increases genome instability, and therefore promotes human
aging? Observations made by Pegoraro et al. support that chromatin defects occur prior to
DNA damage [75]. They identified that NURD, a protein complex involved in establishment
of heterochromatin [76], is a key modulator in aging-associated chromatin defects. Knocking
down a subunit of NURD complex lead to aberrant chromatin structure (indicated by loss of
H3K9me3 foci) about 50 h earlier than DNA damage (indicated by existence of yH2AX foci).
This observation suggests that epigenetic and chromatin structure changes are in the upstream
of DNA damage events.
How could aberrant chromatin structure cause DNA damage and thus human aging? There
might be two mechanisms. 1) The heterochromatic sequences are highly repetitive. Loss of
chromatin condensation can leads to abnormal recombination of such sequence and thus
genome rearrangement; 2) Heterochromatin confirmation can protect DNA from various
insults and repair the damaged lesion with specific mechanisms, as mentioned above.
The next question is how DNA damage leads to human aging? Numerous studies showed that
DNA damage and mutations accumulate in human aging. In aged human cells, cytogenetically
visible lesions such as translocations, insertions, dicentrics, and acentric fragments are
frequently detected [77]. Several signaling pathways linking DNA damage and aging are also
proposed, such as the ATM-p53 axis [77] and the BRCA1 dependent aging process
[78].However, in addition to being a driver in the accumulation of mutation, recent reports
imply that DNA damage-induced RNA transcription change might be a novel mechanism
leading human aging. The involvement of RNA processing components in DNA repair
strengthens the role of DNA damage in global gene expression changes. For example, a
proteomic screen for mediators of DDR showed that enrichment for RNA processing factors,
such as splicing-regulator phosphatase PPM1G [79]. Furthermore, the deregulation of gene
expression induced by DNA damage resembles increased transcription heterogeneity seen in
aged heart tissue [80]. Specifically, Francia et al. found that small RNA produced by DICER
and DROSHA, two RNases type III enzymes that process non-coding RNA [81], are required
to activate DDR and efficiently repair DNA at the damaged sites [82]. The DICER- and
Chromatin Remodeling in DNA Damage Response and Human Aging
http://dx.doi.org/10.5772/55272
161
DROSHA-dependent small RNA products have the sequence of the damaged locus, and can
restore DDR in RNase-treated cells [82]. Intriguingly, these DNA damage-induced RNA can
regulate cellular senescence in cultured human and mouse cells, and in living zebrafish larvae
[82]. Genetic ablation of DICER has been reported to cause premature senescence in both
developing and adult mice [83]. Do the DICER- and DROSHA-dependent, DNA damaged-
induced RNAs affect heterochromatin structure and thus regulating cell senescence and
human aging? Although the methylation status of H3K9 did not alter with DICER or DROSHA
knockdown [82], it is still interesting to check if other heterochromatic proteins, such as Hp1,
which has RNA binding activity, could be affected (Figure 2). Furthermore, does the site-
specific RNA production have any role in the dynamic movement of heterochromatic domain
during DNA damage, for example, the protrusion of heterochromatin? Answering these
questions will be important to gain a comprehensive understanding of the interplay between
chromatin structure and RNA transcription during DDR.
Figure 1. In NHEJ, the heterodimer Ku70/80 interacts with the end of damaged DNA and recruits DNA-PKcs. Artemis,
which processes the ends of DNA and makes them compatible for ligation, is also recruited. Finally, the DNA breaks
were joined by XRCC4/Ligase IV. In HR, a homologous stretch on a sister chromatid is utilized to accurately repair the
DSB. DNA ends are first processed in order to create single strand overhangs. RPA is then coated to these overhangs,
which recruiLs ad51 and oLher coacLors such as ad52. The ad51 coaLed DNA ilanenL Lhen invade Lhe undan
aged strands, and a joint molecule is formed by the damaged and undamaged strands. Finally, template guides DNA
synthesis and resolution of the two strands. A-EJ shares Lhe iniLial resecLion sLep wiLh H buL iL requires neiLher ex
tended resection nor extended sequence homology. DNA ends that are not bound by Ku70/80 are degraded. Single
strand DNA resection reveals 2-4 (indicated by ATCG in the figure) or more nucleotides which can anneal, creating
branched inLernediaLe sLrucLures. The resoluLion o Lhis inLernediaLe sLrucLure resulLs in deleLions aL Lhe repair junc
tions. A-EJ is independent of Ku70/80 but dependent on Ligase III to join the DNA ends.
Chromatin Remodelling 162
6. Conclusions
Since discovery of the function of yH2AX in DDR, dynamic regulation of chromatin in
response to DNA damage has received great attention during these past decades. In this
chaler, ve have discussed lhe conlribulion of lhree osllransIalionaI modificalions: hos
phorylation, PPAR and sumoylation in DDR. We also discussed the current understanding
about heterochromatin changes during DDR and how it regulates human aging. We emphasize
the function of heterochromatin in DDR because this condensed chromatin structure is
particularly involved in human aging. Emerging evidence suggests that heterochromatin is
not refractory to DNA damage, but utilize a different downstream mechanism to repair the
damaged sites and thus prevent unwanted genome recombination. DNA damage may change
the heterochromatin structure by abnormal generation of non-coding RNA at the damaged
locus, which could titrate the RNA-binding heterochromatin proteins (such as Hp1) and lead
to subsequent abnormal heterochromatin structure. The integrity of the transcriptome can also
be affected by DNA damage and regulate human aging. We speculate that the pathways
regarding DNA damage repair in heterochromatin and the interplay between heterochromatic
sequence transcription and human aging will be a hot area for future research (Figure 3).
Figure 2. A. Schematic diagram shows DNA damage response in heterochromatin. Initial DSB recognition is very rapid
in heterochromatin. Rapid phosphorylation and relocalization of H2Ax S139 and other DSB proteins (such as ATRIP)
occur in heLerochronaLic region. ad51 reconbinase recruiLnenL is inhibiLed in Hp1rich heLerochronaLin, which al
lows DS processing Lo induce heLerochronaLin expansion and DS repaired in euchronaLic siLe. n Lhis way, unwanL
ed homologous recombination is prevented in heterochromatin. B. A potential model for DNA damage response in
heterochromatin. A typical heterochromatic domain is indicated by the enrichment of Hp1 protein (step 1). Under
DNA damage, double strand breaks occur, which might result in production of site-specific small RNA with sequence
of the damaged site (step 2). Hp1 might bind to the DNA damage-induced small RNA, which leads to its relocalization
and consequent dynamic movement of the heterochromatic domain during DNA damage. Binding of Hp1 to the
small RNA might also facilitate recruiting of other DDR proteins to the damaged heterochromatic sequences, and thus
promoting damage repair. Notably, it still needs to be determined whether the damage-induced RNA is generated in
heterochromatin (step [2]). Lhis is Lhe case, Lhe role o Lhis NA in Lhe dynanic novenenL o heLerochronaLin dur
ing DNA damage also awaits investigation (step 3).
Chromatin Remodeling in DNA Damage Response and Human Aging
http://dx.doi.org/10.5772/55272
163
Figure 3. Interplay between DNA damage, chromatin remodeling and human aging. It is well recognized that DNA
damage leads to chromatin remodeling. On the other hand, abnormal chromatin structures also contribute to DNA
danage and correlaLe wiLh hunan aging. Lnerging evidence shed lighL on Lhe DNA danageinduced global Lran
scription regulation and also locus-specific production of small RNAs. It would be interesting to know through which
mechanism the DNA damage-induced RNA regulates DNA damage response, and whether it affects the chromatin,
especially, heterochromatin structures, and hence modulate human aging.
Author details
Lili Gong, Edward Wang and Shiaw-Yih Lin
Department of Systems Biology, The University of Texas M. D. Anderson Cancer Center,
Houston, Texas, USA
References
[1] Kornberg RD. Chromatin structure: a repeating unit of histones and DNA. Science.
1974 May 24;184(4139):868-71.
Chromatin Remodelling 164
[2] Polo SE, Jackson SP. Dynamics of DNA damage response proteins at DNA breaks: a
focus on protein modifications. Genes Dev. 2011 Mar 1;25(5):409-33.
[3] Lukas J, Lukas C, Bartek J. More than just a focus: The chromatin response to DNA
damage and its role in genome integrity maintenance. Nat Cell Biol. 2011 Oct;13(10):
1161-9.
[4] Gellert M. V(D)J recombination: RAG proteins, repair factors, and regulation. Annu
Rev Biochem. 2002;71:101-32.
[5] }ackson SI, arlek }. The DNA-damage resonse in human bioIogy and disease. Na
ture. 2009 Oct 22;461(7267):1071-8.
[6] Iriedberg IC. NucIeolide excision reair of DNA: The very earIy hislory. DNA Re
pair. 2011 Jul 15;10(7):668-72.
[7] Symington LS, Gautier J. Double-strand break end resection and repair pathway
choice. Annu Rev Genet. 2011;45:247-71.
[8] Lieber MR. The mechanism of doubIe-slrand DNA break reair by lhe nonhomoIo
gous DNA end-joining pathway. Annu Rev Biochem. 2010;79:181-211.
[9] Weterings E, Chen DJ. The endless tale of non-homologous end-joining. Cell Res.
2008 Jan;18(1):114-24.
[10] Jeggo PA. DNA breakage and repair. Adv Genet. 1998;38:185-218.
[11] Haber JE. Partners and pathwaysrepairing a double-strand break. Trends Genet. 2000
Jun;16(6):259-64.
[12] aumann I, Wesl SC. RoIe of lhe human RAD51 rolein in homoIogous recombina
tion and double-stranded-break repair. Trends Biochem Sci. 1998 Jul;23(7):247-51.
[13] Gasior SL, Wong AK, Kora Y, Shinohara A, Bishop DK. Rad52 associates with RPA
and functions with rad55 and rad57 to assemble meiotic recombination complexes.
Genes Dev. 1998 Jul 15;12(14):2208-21.
[14] Sugawara N, Wang X, Haber JE. In vivo roles of Rad52, Rad54, and Rad55 proteins in
Rad51-mediated recombination. Mol Cell. 2003 Jul;12(1):209-19.
[15] Rass I, Grabarz A, IIo I, Gaulier }, erlrand I, Loez S. RoIe of Mre11 in chromoso
mal nonhomologous end joining in mammalian cells. Nat Struct Mol Biol. 2009 Aug;
16(8):819-24.
[16] Rogakou EP, Pilch DR, Orr AH, Ivanova VS, Bonner WM. DNA double-stranded
breaks induce histone H2AX phosphorylation on serine 139. J Biol Chem. 1998 Mar
6;273(10):5858-68.
[17] O'Hagan HM, Mohammad HI, ayIin S. DoubIe slrand breaks can iniliale gene si
lencing and SIRT1-dependent onset of DNA methylation in an exogenous promoter
CpG island. PLoS Genet. 2008;4(8):e1000155.
Chromatin Remodeling in DNA Damage Response and Human Aging
http://dx.doi.org/10.5772/55272
165
[18] Cuozzo C, IorceIIini A, Angrisano T, Morano A, Lee , Di Iardo A, el aI. DNA dam
age, homology-directed repair, and DNA methylation. PLoS Genet. 2007 Jul;
3(7):e110.
[19] Harper JW, Elledge SJ. The DNA damage response: ten years after. Mol Cell. 2007
Dec 14;28(5):739-45.
[20] Xiao A, Li H, Shechter D, Ahn SH, Fabrizio LA, Erdjument-Bromage H, et al. WSTF
reguIales lhe H2A.X DNA damage resonse via a noveI lyrosine kinase aclivily. Na
ture. 2009 Jan 1;457(7225):57-62.
[21] Cook I}, }u G, TeIese I, Wang X, GIass CK, RosenfeId MG. Tyrosine dehoshory
lation of H2AX modulates apoptosis and survival decisions. Nature. 2009 Apr
2;458(7238):591-6.
[22] Singh N, Basnet H, Wiltshire TD, Mohammad DH, Thompson JR, Heroux A, et al.
Dual recognition of phosphoserine and phosphotyrosine in histone variant H2A.X by
DNA damage response protein MCPH1. Proc Natl Acad Sci U S A. 2012 Sep
4;109(36):14381-6.
[23] LangeIier MI, IIanck }L, Roy S, IascaI }M. SlrucluraI basis for DNA damage-de
pendent poly(ADP-ribosyl)ation by human PARP-1. Science. 2012 May 11;336(6082):
728-32.
[24] Messner S, Altmeyer M, Zhao H, Pozivil A, Roschitzki B, Gehrig P, et al. PARP1
ADP-ribosylates lysine residues of the core histone tails. Nucleic Acids Res. 2010 Oct;
38(19):6350-62.
[25] Mortusewicz O, Ame JC, Schreiber V, Leonhardt H. Feedback-regulated poly(ADP-
ribosyl)ation by PARP-1 is required for rapid response to DNA damage in living
cells. Nucleic Acids Res. 2007;35(22):7665-75.
|26j Chou DM, Adamson , Dehoure NI, Tan X, Nollke AC, Hurov KI, el aI. A chroma
lin IocaIizalion screen reveaIs oIy (ADI ribose)-reguIaled recruilmenl of lhe reres
sive polycomb and NuRD complexes to sites of DNA damage. Proc Natl Acad Sci U
S A. 2010 Oct 26;107(43):18475-80.
[27] WiIkinson KA, HenIey }M. Mechanisms, reguIalion and consequences of rolein SU
MOylation. Biochem J. 2010 Jun 1;428(2):133-45.
[28] Galanty Y, Belotserkovskaya R, Coates J, Polo S, Miller KM, Jackson SP. Mammalian
SUMO E3-ligases PIAS1 and PIAS4 promote responses to DNA double-strand
breaks. Nature. 2009 Dec 17;462(7275):935-9.
[29] Morris }R, ouleII C, KeIer M, Densham R, Weekes D, AIamshah A, el aI. The SU
MO modification pathway is involved in the BRCA1 response to genotoxic stress.
Nature. 2009 Dec 17;462(7275):886-90.
Chromatin Remodelling 166
[30] GaIanly Y, eIolserkovskaya R, Coales }, }ackson SI. RNI4, a SUMO-largeled ubiq
uitin E3 ligase, promotes DNA double-strand break repair. Genes Dev. 2012 Jun
1;26(11):1179-95.
[31] Yin Y, Seiferl A, Chua }S, Maure }I, GoIebiovski I, Hay RT. SUMO-largeled ubiqui
tin E3 ligase RNF4 is required for the response of human cells to DNA damage.
Genes Dev. 2012 Jun 1;26(11):1196-208.
[32] Dou H, Huang C, Singh M, Carpenter PB, Yeh ET. Regulation of DNA repair
through deSUMOylation and SUMOylation of replication protein A complex. Mol
Cell. 2010 Aug 13;39(3):333-45.
[33] Cremona CA, Sarangi I, Yang Y, Hang LI, Rahman S, Zhao X. Ixlensive DNA dam
age-induced sumoylation contributes to replication and repair and acts in addition to
the mec1 checkpoint. Mol Cell. 2012 Feb 10;45(3):422-32.
[34] Huisinga KL, rover-ToIand , IIgin SC. The conlradiclory definilions of helero
chromatin: transcription and silencing. Chromosoma. 2006 Apr;115(2):110-22.
[35] Cheutin T, McNairn AJ, Jenuwein T, Gilbert DM, Singh PB, Misteli T. Maintenance of
stable heterochromatin domains by dynamic HP1 binding. Science. 2003 Jan
31;299(5607):721-5.
[36] Grewal SI, Jia S. Heterochromatin revisited. Nat Rev Genet. 2007 Jan;8(1):35-46.
[37] Ieng }C, Karen GH. Helerochromalic genome slabiIily requires reguIalors of his
tone H3 K9 methylation. PLoS Genet. 2009 Mar;5(3):e1000435.
[38] Yamada T, IischIe W, Sugiyama T, AIIis CD, GrevaI SI. The nucIealion and mainle
nance of heterochromatin by a histone deacetylase in fission yeast. Mol Cell. 2005 Oct
28;20(2):173-85.
[39] Motamedi MR, Verdel A, Colmenares SU, Gerber SA, Gygi SP, Moazed D. Two
RNAi comIexes, RITS and RDRC, hysicaIIy inleracl and IocaIize lo noncoding cen
tromeric RNAs. Cell. 2004 Dec 17;119(6):789-802.
[40] Sugiyama T, Cam H, VerdeI A, Moazed D, GrevaI SI. RNA-deendenl RNA oIy
merase is an essential component of a self-enforcing loop coupling heterochromatin
assembly to siRNA production. Proc Natl Acad Sci U S A. 2005 Jan 4;102(1):152-7.
[41] Cam HP, Sugiyama T, Chen ES, Chen X, FitzGerald PC, Grewal SI. Comprehensive
analysis of heterochromatin- and RNAi-mediated epigenetic control of the fission
yeast genome. Nat Genet. 2005 Aug;37(8):809-19.
[42] Muchardt C, Guilleme M, Seeler JS, Trouche D, Dejean A, Yaniv M. Coordinated
methyl and RNA binding is required for heterochromatin localization of mammalian
HP1alpha. EMBO Rep. 2002 Oct;3(10):975-81.
Chromatin Remodeling in DNA Damage Response and Human Aging
http://dx.doi.org/10.5772/55272
167
[43] KeIIer C, Adaixo R, Slunnenberg R, WooIcock K}, HiIIer S, uhIer M. HI1(Svi6) me
diates the recognition and destruction of heterochromatic RNA transcripts. Mol Cell.
2012 Jul 27;47(2):215-27.
[44] CoveII IG, Sunler N}, Singh I, Auslin CA, Durkacz W, TiIby M}. gammaH2AX fo
ci form preferentially in euchromatin after ionising-radiation. PLoS One.
2007;2(10):e1057.
[45] Vasireddy RS, Karagiannis TC, El-Osta A. gamma-radiation-induced gammaH2AX
formation occurs preferentially in actively transcribing euchromatic loci. Cell Mol
Life Sci. 2010 Jan;67(2):291-4.
[46] Cann KL, Dellaire G. Heterochromatin and the DNA damage response: the need to
relax. Biochem Cell Biol. 2011 Feb;89(1):45-60.
[47] Kruhlak MJ, Celeste A, Dellaire G, Fernandez-Capetillo O, Muller WG, McNally JG,
et al. Changes in chromatin structure and mobility in living cells at sites of DNA
double-strand breaks. J Cell Biol. 2006 Mar 13;172(6):823-34.
[48] IaIk M, Lukasova I, GabrieIova , Ondre| V, Kozubek S. Chromalin dynamics dur
ing DSB repair. Biochim Biophys Acta. 2007 Oct;1773(10):1534-45.
[49] Falk M, Lukasova E, Kozubek S. Chromatin structure influences the sensitivity of
DNA to gamma-radiation. Biochim Biophys Acta. 2008 Dec;1783(12):2398-414.
[50] Chiolo I, Minoda A, Colmenares SU, Polyzos A, Costes SV, Karpen GH. Double-
slrand breaks in helerochromalin move oulside of a dynamic HI1a domain lo com
plete recombinational repair. Cell. 2011 Mar 4;144(5):732-44.
[51] Goodarzi AA, Noon AT, Deckbar D, Ziv Y, Shiloh Y, Lobrich M, et al. ATM signaling
facilitates repair of DNA double-strand breaks associated with heterochromatin. Mol
Cell. 2008 Jul 25;31(2):167-77.
[52] Noon AT, Shibala A, Rief N, Lobrich M, Slevarl GS, }eggo IA, el aI. 53I1-deend
ent robust localized KAP-1 phosphorylation is essential for heterochromatic DNA
double-strand break repair. Nat Cell Biol. 2010 Feb;12(2):177-84.
[53] Lechner MS, Begg GE, Speicher DW, Rauscher FJ, 3rd. Molecular determinants for
targeting heterochromatin protein 1-mediated gene silencing: direct chromoshadow
domain-KAP-1 corepressor interaction is essential. Mol Cell Biol. 2000 Sep;20(17):
6449-65.
[54] Schultz DC, Friedman JR, Rauscher FJ, 3rd. Targeting histone deacetylase complexes
via KRA-zinc finger roleins: lhe IHD and bromodomains of KAI-1 form a cooer
ative unit that recruits a novel isoform of the Mi-2alpha subunit of NuRD. Genes
Dev. 2001 Feb 15;15(4):428-43.
[55] Iearson CI, NichoI Idamura K, CIeary }D. Reeal inslabiIily: mechanisms of dy
namic mutations. Nat Rev Genet. 2005 Oct;6(10):729-42.
Chromatin Remodelling 168
[56] Torres-Rosell J, Sunjevaric I, De Piccoli G, Sacher M, Eckert-Boulet N, Reid R, et al.
The Smc5-Smc6 comIex and SUMO modificalion of Rad52 reguIales recombinalion
al repair at the ribosomal gene locus. Nat Cell Biol. 2007 Aug;9(8):923-31.
[57] Peterson CL. The ins and outs of heterochromatic DNA repair. Dev Cell. 2011 Mar
15;20(3):285-7.
[58] Kudlow BA, Kennedy BK, Monnat RJ, Jr. Werner and Hutchinson-Gilford progeria
syndromes: mechanistic basis of human progeroid diseases. Nat Rev Mol Cell Biol.
2007 May;8(5):394-404.
[59] De Sandre-Giovannoli A, Bernard R, Cau P, Navarro C, Amiel J, Boccaccio I, et al.
Lamin a truncation in Hutchinson-Gilford progeria. Science. 2003 Jun 27;300(5628):
2055.
[60] Eriksson M, Brown WT, Gordon LB, Glynn MW, Singer J, Scott L, et al. Recurrent de
novo oinl mulalions in Iamin A cause Hulchinson-GiIford rogeria syndrome. Na
ture. 2003 May 15;423(6937):293-8.
[61] Scaffidi P, Misteli T. Lamin A-dependent nuclear defects in human aging. Science.
(Research Support, N.I.H., Intramural). 2006 May 19;312(5776):1059-63.
[62] Pegoraro G, Misteli T. The central role of chromatin maintenance in aging. Aging
(Albany NY). 2009 Dec;1(12):1017-22.
[63] SvedIov }, Danuser G. ScaIe inlegralion: lhe slruclure and dynamics of macromoIec
ular assemblies, cells and tissues. Curr Opin Cell Biol. 2012 Feb;24(1):1-3.
[64] Goldman RD, Shumaker DK, Erdos MR, Eriksson M, Goldman AE, Gordon LB, et al.
Accumulation of mutant lamin A causes progressive changes in nuclear architecture
in Hutchinson-Gilford progeria syndrome. Proc Natl Acad Sci U S A. 2004 Jun
15;101(24):8963-8.
[65] Scaffidi I, MisleIi T. ReversaI of lhe ceIIuIar henolye in lhe remalure aging dis
ease Hutchinson-Gilford progeria syndrome. Nat Med. 2005 Apr;11(4):440-5.
[66] Shumaker DK, Dechat T, Kohlmaier A, Adam SA, Bozovsky MR, Erdos MR, et al.
Mulanl nucIear Iamin A Ieads lo rogressive aIleralions of eigenelic conlroI in re
mature aging. Proc Natl Acad Sci U S A. 2006 Jun 6;103(23):8703-8.
[67] Larson K, Yan SJ, Tsurumi A, Liu J, Zhou J, Gaur K, et al. Heterochromatin formation
promotes longevity and represses ribosomal RNA synthesis. PLoS Genet. 2012 Jan;
8(1):e1002473.
[68] Hamilton B, Dong Y, Shindo M, Liu W, Odell I, Ruvkun G, et al. A systematic RNAi
screen for longevity genes in C. elegans. Genes Dev. 2005 Jul 1;19(13):1544-55.
[69] Han S, Brunet A. Histone methylation makes its mark on longevity. Trends Cell Biol.
2012 Jan;22(1):42-9.
Chromatin Remodeling in DNA Damage Response and Human Aging
http://dx.doi.org/10.5772/55272
169
[70] Iickbush DG, Ye }, Zhang X, urke WD, Iickbush TH. Iigenelic reguIalion of relro
transposons within the nucleolus of Drosophila. Mol Cell Biol. 2008 Oct;28(20):
6452-61.
[71] Hansen M, Taubert S, Crawford D, Libina N, Lee SJ, Kenyon C. Lifespan extension
by conditions that inhibit translation in Caenorhabditis elegans. Aging Cell. 2007
Feb;6(1):95-110.
[72] Pan KZ, Palter JE, Rogers AN, Olsen A, Chen D, Lithgow GJ, et al. Inhibition of
mRNA translation extends lifespan in Caenorhabditis elegans. Aging Cell. 2007 Feb;
6(1):111-9.
[73] Sedelnikova OA, Horikawa I, Redon C, Nakamura A, Zimonjic DB, Popescu NC, et
aI. DeIayed kinelics of DNA doubIe-slrand break rocessing in normaI and alhoIog
ical aging. Aging Cell. 2008 Jan;7(1):89-100.
[74] Sedelnikova OA, Horikawa I, Zimonjic DB, Popescu NC, Bonner WM, Barrett JC.
Senescing human cells and ageing mice accumulate DNA lesions with unrepairable
double-strand breaks. Nat Cell Biol. 2004 Feb;6(2):168-70.
[75] Pegoraro G, Kubben N, Wickert U, Gohler H, Hoffmann K, Misteli T. Ageing-related
chromatin defects through loss of the NURD complex. Nat Cell Biol. 2009 Oct;11(10):
1261-7.
[76] Zhang Y, Ng HH, Erdjument-Bromage H, Tempst P, Bird A, Reinberg D. Analysis of
the NuRD subunits reveals a histone deacetylase core complex and a connection with
DNA methylation. Genes Dev. 1999 Aug 1;13(15):1924-35.
[77] Lombard DB, Chua KF, Mostoslavsky R, Franco S, Gostissa M, Alt FW. DNA repair,
genome stability, and aging. Cell. 2005 Feb 25;120(4):497-512.
[78] Cao L, Li W, Kim S, rodie SG, Deng CX. Senescence, aging, and maIignanl lransfor
mation mediated by p53 in mice lacking the Brca1 full-length isoform. Genes Dev.
2003 Jan 15;17(2):201-13.
[79] eIi I, Lukashchuk N, Wagner SA, Weinerl T, OIsen }V, askcomb L, el aI. Iroleo
mic investigations reveal a role for RNA processing factor THRAP3 in the DNA
damage response. Mol Cell. 2012 Apr 27;46(2):212-25.
[80] ahar R, Harlmann CH, Rodriguez KA, Denny AD, usulliI RA, DoIIe MI, el aI. In
creased cell-to-cell variation in gene expression in ageing mouse heart. Nature. 2006
Jun 22;441(7096):1011-4.
[81] Kim VN, Han J, Siomi MC. Biogenesis of small RNAs in animals. Nat Rev Mol Cell
Biol. 2009 Feb;10(2):126-39.
[82] Francia S, Michelini F, Saxena A, Tang D, de Hoon M, Anelli V, et al. Site-specific
DICER and DROSHA RNA products control the DNA-damage response. Nature.
2012 Aug 9;488(7410):231-5.
Chromatin Remodelling 170
[83] Mudhasani R, Zhu Z, Hulvagner G, Iischen CM, LyIe S, HaII LL, el aI. Loss of miR
NA biogenesis induces p19Arf-p53 signaling and senescence in primary cells. J Cell
Biol. 2008 Jun 30;181(7):1055-63.
Chromatin Remodeling in DNA Damage Response and Human Aging
http://dx.doi.org/10.5772/55272
171
Chapter 8
Chromatin Remodelling During
Host-Bacterial Pathogen Interaction
Yong Zhong Xu, Cynthia Kanagaratham and
Danuta Radzioch
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/55977
1. Introduction
Eukaryotic DNA is tightly packaged into nucleosome repeats, which form the basic unit of
cellular chromatin. The nucleosome consists of an octamer core wrapped with a segment
of 146 base pairs of double stranded DNA. Each octamer core is composed of two molecules
of each core histone proteins H2A, H2B, H3 and H4 (Figure 1). A fifth histone protein,
linker H1, binds to the nucleosomal core particle and assists in further compaction of the
chromatin into higher-order structure(Lusser and Kadonaga, 2003;Roberts and Orkin, 2004).
This compaction of genomic DNA into chromatin restricts access of a variety of DNA
reguIalory roleins lo lhe DNA slrand, vhich are invoIved in lhe rocesses of lranscri
tion, replication, DNA repair and recombination machinery. To overcome these barriers,
eukaryolic ceIIs ossess a number of muIli-rolein comIexes vhich can aIler lhe chroma
tin structure and make DNA more accessible. These complexes can be divided into two
grous, hislone-modifying enzymes and ATI-deendenl chromalin remodeIIing com
plexes. The histone-modifying enzymes post-translationally modify the N-terminal tails of
histone proteins through acetylation, phosphorylation, ubiquitination, ADP-ribosylation and
methylation. On the other hand, ATP-dependent chromatin remodelling complexes use the
energy of ATP hydrolysis to disrupt the contact between DNA and histones, move
nucleosomes along DNA, and remove or exchange nucleosomes(Kallin and Zhang,
2004;Lusser and Kadonaga, 2003;Roberts and Orkin, 2004). The importance of chromatin
structure and its functional role in genome regulation and development is becoming
increasingly evident, especially in diseases such as cancer.
2013 Xu et al.; licensee InTech. This is an open access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
Figure 1. Schematic representation of a nucleosome (A) and major histone modifications (B). Modifications on
hisLones are described in LexL. The najor nodiicaLions shown include aceLylaLion (A), neLhylaLion (M), phosphoryla
tion (P) and ubiquitination (U). Histone modifications mainly occur on the N-terminal tails of histones but also on the
CLerninal Lails and globular donains, or exanple, ubiquiLinaLion o Lhe CLerninal Lails o H2A and H2 and aceLyla
tion and methylation of the globular domain of H3 at K56 and K79, respectively.
Intracellular pathogens, through a long-standing coexistence with host cells, have evolved
mechanisms that provide pathogens with the amazing capacity to adapt and survive in the
variable and often hostile environments of their hosts (Galan and Cossart, 2005). The concept
of chromatin modification as a mechanism by which pathogens affect host immune responses
to facilitate infection has emerged in recent years. For example, listeriolysin O (LLO), secreted
by Listeria monocytogenes, induces a dramatic dephosphorylation of histone H3 at serine 10 and
deacetylation of histone H4, and these modifications are associated with changes in host gene
expression during early stages of infection (Hamon et al., 2007). Arbibe and colleagues also
indicate that Shigella flexneri effector OspF dephosphorylates ERK and p38 mitogen-activated
protein kinase (MAPK) in the nucleus; this subsequently prevents histone H3 phosphorylation
at Ser10 at the promoters of a specific subset of genes, which blocks the activation of nuclear
faclor i (NI-i)- resonsive genes Ieading lo a comromised infIammalion in lhe infecled
tissue(Arbibe et al., 2007). These results suggest a strategy developed by microbial pathogens
Chromatin Remodelling 174
to manipulate the host cellular function through histone modification and subversion of host
innate immune responses for their survival or to infect the host.
Histone acetylation/deacetylation is a key epigenetic regulator of chromatin structure and gene
expression, in combination with other posttranslational modifications. These patterns of
hislone modificalion are mainlained by hislone modifying enzymes such as hislone acelyI
transferases (HATs) and histone deacetylases (HDACs). While HATs acetylate histones,
conferring an open chromatin structure that allows transcriptional activation, HDACs have
the opposite effect resulting in transcriptional repression by closing chromatin structure.
Global HDAC-mediated transcriptional changes can have a concomitant effect on cell function
an epigenetic mechanism often exploited by viruses to promote infection (Punga and
Akusjarvi, 2000;Radkov et al., 1999;Valls et al., 2007). Recent reports also show that intracellular
bacteria manipulate host cell epigenetics to facilitate infection (Arbibe et al., 2007;Hamon et
al., 2007;Hamon and Cossart, 2008). Disruption of HDAC activity with inhibitors or by siRNA
affects gene expression profilling in different cell types (Glaser et al., 2003a;Glaser et al.,
2003b;Lee et al., 2004;Zupkovitz et al., 2006). The potential of HDAC inhibitors in treatment of
infection has being studied.
In this chapter, the chromatin modifications in host cells induced by bacterial pathogens and
their effects on host gene expression and infection will be reviewed. Furthermore, the potential
role of HDAC inhibitors, as a therapeutic immunomodulator, in treatment of infections will
also be discussed.
2. Chromatin structure in transcription regulation
The packaging of DNA into chromatin does not only simply facilitate the compaction of
eukaryotic DNA genomes into the cell nucleus but also plays a profound and ubiquitous roles
in almost all DNA-related cellular processes such as DNA replication, repair, recombination
and transcription (Clapier and Cairns, 2009;Li et al., 2007a). Chromatin structure is not a simple
slalic unil. Il ossesses dynamic roerlies lhal are orcheslraled by ATI-deendenl chroma
tin-remodeling complexes and histone-modifying enzymes. In conjunction with other co-
regulators, these chromatin remodelers modify histone-DNA interaction and regulate
transcription at specific genomic loci.
2.1. Histone modifications and transcription
Histone sequences are highly conserved. A core histone protein typically consists of an
unstructured N-terminal tail, a globular core including a central histone-fold domain, and a
conformationally mobile C-terminal tail (Garcia et al., 2007b;Mersfelder and Parthun, 2006).
Both N-terminal tails and globular domains are subject to a variety of posttranslational
modifications (Kouzarides T, Cell, 2007, 128:693-705) (Figure 1). At least fourteen different
types of posttranslational (or covalent) modifications involving more than 60 different residues
on histones have been reported to date including acetylation, methylation, phosphorylation,
ubiquitination, poly-ADP ribosylation, sumoylation, butyrylation, formylation, deimination,
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
175
citrullination, isomerisation, O-GlcNAcylation, crotonylation and hydroxylation (Martin and
Zhang, 2007;Ruthenburg et al., 2007;Sakabe et al., 2010;Tan et al., 2011). The majority of known
hislone modificalions are Iocaled vilhin lhe N-lerminaI laiIs of core hislones. These modifi
cations play an important role in the control of chromatin dynamics and its availability for
transcription (Kouzarides, 2007). It has been suggested that all these modifications are
combinatorial and interdependent and therefore may constitute a ``histone code`` (Jenuwein
and Allis, 2001;Strahl and Allis, 2000). According to this hypothesis, the histone code is read
by effector proteins (readers) which recognize and bind to modifications via specific domains
and result in distinct and consistent cellular processes, such as replication, transcription, DNA
repair and chromosome condensation (Kouzarides, 2007;Shi and Whetstine, 2007). Specific
histone modifications are essential for partitioning the genome into functional domains, such
as transcriptionally silent heterochromatin and transcriptionally active euchromatin (Martin
and Zhang, 2005).
There are two major mechanisms underlying the function of histone modifications (Kouzar
ides, 2007;Ruthenburg et al., 2007). The first is the modulation of chromatin structure either by
altering DNA-nucleosome interaction or by altering nucleosome-nucleosome interactions via
changing lhe hislone charges or by addilion of hysicaI enlilies. Ior examIe, hislone acely
lation, a modification associated with transcriptional activation, has been proposed to unfold
chromatin structure via neutralization of the basic charges of lysines (Kouzarides, 2007).
Indeed, in vitro studies using recombinant nucleosomal arrays have demonstrated that
acetylation of H4K16 restricts the formation of a 30-nanometer fiber and the generation of
higher-order structures (Shogren-Knaak et al., 2006;Shogren-Knaak and Peterson, 2006).
Secondly, histone modifications provide docking sites for the recruitment of specific binding
proteins, which recognize and interact with modified histones via specialized domains such
as bromo-, chromo- and PHD (plant homeodomain) domains, thereby influence chromatin
dynamics and function (Wysocka et al., 2005;Wysocka et al., 2006b;Zeng and Zhou, 2002). A
number of proteins have been identified that are recruited to specific modifications. For
example, methylation of H3K4, H3K9 and H3K27 can be recognized by inhibitor of growth
(ING) proteins, heterochromatin protein 1 (HP1) and polycomb proteins, respectively. It has
been shown that histone modification binding proteins can tether, directly or indirectly, an
enzyme to chromatin. The activity of this recruited enzyme can be regulated (Pena et al.,
2006;Shi et al., 2006;Wysocka et al., 2006b). BPTF, a component of the NURF chromatin
remodelling complex, binds to H3K4me3 via a PHD domain and tethers the SNF2L ATPase
to H0XC8 gene and activates the expression of the latter (Wysocka et al., 2006b). JMJD2A and
CHD1, two other H3K4me-binding proteins, possess enzymatic activities themselves and can
directly deliver enzymatic activities to chromatin when recruited (Huang et al., 2006;Pray-
Grant et al., 2005;Sims, III et al., 2005).
The link between histone modifications and transcriptional regulation has been widely
studied. It has been found that a specific modification can be associated with transcriptional
activation or repression. Among the histone modifications, methylation and acetylation of H3
and H4 play a major role in the regulation of transcriptional activity (Berger, 2007;Jenuwein
and Allis, 2001;Li et al., 2007a;Shahbazian and Grunstein, 2007). Methylation, which occurs on
Chromatin Remodelling 176
eilher a Iysine or an arginine residue, is calaIyzed by lhree differenl cIasses of melhyIlransfer
ases: SET domain-containing histone methyltransferases (HMTs), non-SET domain-containing
lysine methyltransferases as well as protein arginine methyltransferase (PRMT). Methylation
is implicated in both activation and repression of transcription depending on the methylation
site and the type of methyltransferase involved (Shilatifard, 2006;Wysocka et al., 2006a). For
example, methylation of lysine 4, 36 or 79 of H3 correlates with activation of transcription
whereas methylation of lysine 9, 27 of H3 or lysine 20 of H4 is usually linked to transcriptional
repression (Pawlak and Deckert, 2007). Type I PRMT, such as CARM1 (cofactor associated
arginine methyltransferase 1), PRMT1 and PRMT2, catalyze the formation of monomethyl-
and asymmetric dimethyl-arginine derivatives and is involved in transcriptional activation.
Type II PRMT, such as PRMT5, catalyzes the formation of monomethyl- and symmetric
dimethyl-arginine derivatives and is involved in transcriptional repression. In addition, a
lysine can be mono-, di- or trimethylated with different effect on gene transcription (Santos-
Rosa et al., 2002;Schneider et al., 2005). Both lysine and arginine methylations can be reversed
by histone demethylases, which had been discovered many years after the discovery of HMTs.
LSD1 was the first histone demethylase discovered in 2004 and was shown to demethylate
H3K4 and to repress transcription (Shi et al., 2004). However, LSD1 was also shown to
demethylate H3K9 and activate transcription when present in a complex with the androgen
receptor (Metzger et al., 2005). Following the discovery of LSD1, a number of other related
enzymes were subsequently discovered. Among them, Jumonji domaincontaining 6 protein
(JMJD6) is the only direct arginine demethylase reported to date shown to demethylate H3 at
arginine 2 and H4 at arginine 3 (Chang et al., 2007). In addition, human peptidylarginine
deiminase 4 protein (Pad4) can regulate histone arginine methylation by converting mono-
methylated arginine into citrulline via demethylimination or deimination (Cuthbert et al.,
2004;Wang et al., 2004). Histone methylation may affect the binding of other histone-modifying
enzymes to the chromatin, which then mediates other posttranscriptional modifications, such
as histone phosphorylation and DNA methylation (Mosammaparast and Shi, 2010;Pedersen
and Helin, 2010).
Acetylation, another well-characterized modification, occurs on lysine residues mainly in
the N-terminal tail of core histones. However, a lysine 56 within the globular domain of
H3 (H3K56) has been found to be acetylated in yeast. Yeast protein SPT10, a putative histone
acetyltransferase (HAT), was shown to mediate the H3K56 acetylation of histone genes at
their promoter regions. H3K56 acetylation allows the recruitment of Snf5, an essential
component of SWI/SNF chromatin remodeling complex and subsequently regulating
transcription (Xu et al., 2005). Compared with the SPT10, the Rtt109 acetyltransferase
mediates H3K56 acetylation more globally (Driscoll et al., 2007;Han et al., 2007;Schneider et
al., 2006). The acetylation level correlates with transcriptional activation (Davie, 2003;Legube
and Trouche, 2003). The level of acetylation is balanced by HATs and HDACs. Generally,
increased levels of histone acetylation by HATs enhance chromatin decondensation and
DNA accessibility for transcription factors to activate gene expression. In contrast to
acelyIalion, deacelyIalion of hislones calaIyzed by HDACs Ieads lo chromalin condensa
tion and gene silencing (Berger, 2007;Li et al., 2007a). The relationship between histone
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
177
acetylation and gene expression has been well documented (Verdone et al., 2006). HATs
can aIso acelyIale non-hislone roleins, such as lranscrilion faclors and nucIear rece
tors to facilitate gene expression (Bannister and Miska, 2000;Masumi, 2011)
Other histone modifications, such as phosphorylation, ubiquitylation and sumoylation, have
aIso been shovn lo be invoIved in lranscrilionaI reguIalion. Ior examIe, H3S10 hoshor
ylation has been demonstrated to be involved in the activation of NF-iB-regulated genes as
well as immediate early genes, such as c-fos and c-jun (Macdonald et al., 2005). Ubiquilina
tion of H2AK119 and H2BK120 are associated with transcriptional repression and activation,
respectively (Wang et al., 2006;Zhu et al., 2005).
2.2. Chromatin remodelling complex and transcription
The second major class of chromatin-modifying factors are the protein complexes that use
energy from ATP hydrolysis to alter nucleosomal structure and DNA accessibility and hence
are generally referred to as chromatin remodeling complex (Flaus and Owen-Hughes,
2004;Saha et al., 2006). Each ATP-dependent chromatin-remodeling complex characterized to
date contains a highly conserved ATPase subunit that belongs to the SNF2 ATPase superfamily
(Marfella CGA, Mutate Res, 2007). Based on the similarities of their ATPase subunits and the
presence of other conserved domains, these complexes can be classified into at least four
different families (Figure 2): the SWI/SNF (mating type switching /sucrose non-fermenting)
family; the ISWI (imitation switch) family; the NuRD/Mi-2/CHD (chromodomain helicase
DNA-binding) family and INO80 (inositol requiring 80) family (Farrants, 2008;Saha et al.,
2006). The ATPase subunits of the SWI/SNF family members, including yeast Snf2 and Sth1,
Drosophila melangaster brahma (BRM) and mammalian BRM and BRG1 (brahma-related gene
1), contain an C-terminal bromodomains which recognize and binds to acetylated histone tails
(Hassan et al., 2002;Marfella and Imbalzano, 2007). The members of ISWI family, such as yeast
homologues ISW1 and ISW2, and mammalian homologues SNF2H and SNF2L, each contains
an ATPase subunit with homology to Drosophila ISWI protein and has nucleosome-stimulated
ATPase activity. These enzymes are characterized by the presence of a SANT (SWI3-ADA2-
NCoR-TFIIIB) domain, which functions as a histone-tail-binding module (Boyer et al., 2004;de
la Serna et al., 2006). SANT domain has been found in a number of transcriptional regulatory
proteins and is therefore thought to play a role in transcriptional regulation (Aasland et al.,
1996;Boyer et al., 2002). The NuRD/Mi-2/CHD family members include a number of proteins
that are highly conserved from yeast to humans and are characterized by the presence of two
N-terminal chromodomains involved in the remodeling of chromatin structure and regulation
of transcription (Brehm et al., 2004;Eissenberg, 2001;Jones et al., 2000). The INO80 family
contains the INO80 remodeling complex (INO80.com) and the SWR1 remodeling complex
(SWR1.com), which are distinguished by the split ATPase domains and the presence of two
RuvB-like proteins, Rvb1 and Rvb2 (Bao and Shen, 2007).
ATP-dependent chromatin remodelers can reposition (slide, twist, or loop) nucleosomes along
the DNA, evict histones from DNA or facilitate exchange of histone variants, and thus creating
nucleosome-free regions for gene activation (Figure 3) (Wang et al., 2007).
Chromatin Remodelling 178
Figure 2. ATPase subunits of the four main families of ATP-dependent chromatin remodeling complexes. The
ATPase subunit of each ATP-dependent chromatin-remodeling complex belongs to the SNF2 ATPase superfamily,
whose ATase donain conprises an NLerninal DLxx and a CLerninal HLLCc subdonain, separaLed by an inserL re
gion. The SWI/SNF family contains an HSA domain for actin binding, and a bromodomain which recognizes and binds
to the acetylated histone tails. The ISWI family contains the SANT and SLIDE domains, important for histone binding.
The CHD/NURD/Mi-2 family is characterized by the presence of two N-terminal chromodomains that is involved in the
remodeling of chromatin structure and the transcriptional regulation of genes. The INO80 family, like the SWI/SNF
family, also contains an HSA domain, however the insert region between the DExx and the HELICc subdomains is three
times longer than that of other three families.
figure 3. Mechanisms o! ATP-dependent chromatin remodeIing activity to aIter the accessibiIity o! nucIeoso
mal DNA. Upon utilization of the energy from ATP hydrolysis, the nucleosomal structure is altered to make protected
region o chronaLin available Lo DNA binding proLein conplexes, such as LranscripLion acLors, which involves nobili
zation of nucleosome position(sliding), dissociation of DNA-histone contact (unwrapping), and eviction of histones
(hisLone evicLion). n sone cases AT dependenL renodeling conplexes can use Lhe energy ron AT hydrolysis Lo in
troduce histone variants into the nucleosome (exchange of histone variants), such as H2AH2B or H2A variants
(H2Avar)H2B dimers.
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
179
3. The role of chromatin remodelling in the regulation of inflammatory
gene expression
The inflammatory response is a defense mechanism developed in higher organisms to protect
themselves from infection with pathogens. It demands rapid and coordinated regulation of
expression of multiple inflammatory genes in immune cells, including macrophages. It has
increasingly become clear that alterations of chromatin architecture orchestrated by histone
modifications and ATP-dependent chromatin remodeling complexes play a key role in
controlling of inflammatory response genes (Medzhitov and Horng, 2009;Smale, 2010).
3.1. LPS-induced chromatin modification and target gene expression
LPS, a large molecule consisting of a lipid and a polysaccharide joined by a covalent bond, is
the major component of the outer membrane of gram-negative bacteria and is one of the best-
characterized agonist of host inflammatory response. LPS is recognized by Toll-like receptor
4 (TLR4) and activates the downstream signaling pathways, including the NF-iB signaling
cascades, MAPK cascades and interferon regulatory factor (IRF) signaling cascades and induce
the transcription of proinflammatory cytokine genes such as interleukin-6 (IL-6), IL-12 and
tumor necrosis factor (TNF) (Akira and Takeda, 2004;Takeda et al., 2003). The first evidence of
the involvement of chromatin remodeling in LPS-induced gene expression dates back to 1999,
when it was observed that nucleosome remodeling appears to contribute to the rapid induction
of p40 subunit of IL-12 (IL-12p40). Upon activation by LPS, a positioned nucleosome, which
spans the IL-12p40 gene promoter, is rapidly and selectively repositioned prior to initiation of
transcription process (Weinmann et al., 1999). Iurlher sludies demonslraled lhal lhe nucIeo
some remodeling by LPS requires TLR4 signaling but is independent of c-Rel, one of the NF-
iB subunits required for transcription of integrated Il-12p40 promoter (Weinmann et al.,
2001). In the year 2000, Saccani and colleagues (Saccani et al., 2002) revealed that upon LPS
stimulation, H3 phosphorylation at serine 10 (H3S10) occurs selectively on the IL-12p40
promoter as well as promoters of a subset of other NF-i-resonsive roinfIammalory genes
such as IL-6, IL-8, and CC-chemokine ligand 2 (CCL2) but not TNF-o, MIP-1o and CCL3. This
phosphorylation event was shown to be dependent on the activation of p38 MAPK signaling
pathway by LPS, and specific inhibition of p38 activation blocks H3S10 phosphorylation,
recruitment of NF-iB to the selective promoters and gene expression (Saccani et al., 2002).
Therefore, it is postulated that phosphorylation of H3S10 via the p38 MAPK signaling pathway
promotes the loosening of chromatin at certain selective promoters, thereby permitting
accessibiIily lo NI-iB and allowing transcription to occur. There are some evidence that link
H3S10 mark with transcriptional activation. Serine to alanine substitution at position 10 of H3
or deletion of Snf1, a histone H3 kinase which phosphorylates the serine 10, abrogates
transcriptional activation of LPS- inducible genes (Lo et al., 2001;Lo et al., 2000).
LPS activates TLR-dependent signaling to produce inflammatory cytokines and chemokines,
which contribute to the efficient control and clearance of invading pathogens. However,
production of these inflammatory mediators is tightly regulated because excessive production
results in amplified inflammatory response and fatal illness characteristic of severe septic
Chromatin Remodelling 180
shock. Therefore, the host has readily available mechanisms in place which allow to dampen
the response to LPS or even confer unresponsiveness to successive stimuli with LPS, a
phenomenon named LPS or endotoxin tolerance (Cavaillon and Adib-Conquy, 2006;Cavaillon
et al., 2003). The mechanisms underlying endotoxin tolerance are not completely understood,
but are characterized by impaired TLR-mediated activation of both NF-iB- and MAPK-
dependent genes (Adib-Conquy et al., 2006;Adib-Conquy et al., 2000). Endotoxin tolerance has
been shown to be associated with chromatin remodeling in the promoter regions of several
tolerizable genes (Chan et al., 2005;El et al., 2007). Chang and colleagues have demonstrated
that chromatin remodeling and NF-iB p65 recruitment at the IL-1 gene promoter are altered
in LPS-tolerant THP-1 cells, when compared to normal THP-1 cells (Chan et al., 2005). Upon
LPS treatment, increased phosphorylation of H3S10 and demethylation of H3K9 are observed
in normaI THI-1 ceIIs, vhich reresenl an oen chromalin slale, hovever, lhese modifica
tions are impaired in LPS-tolerant cells. Concomitantly, recruitment of NF- iB p65 but not NF-
iB p50 to the IL-1 gene promoter is impaired in LPS-tolerant cells despite that the activation
and nuclear accumulation of NF- iB is not changed. Similar histone modifications and NF- i
binding were also observed at the TNF-o promoter during endotoxin tolerance (El et al., 2007).
Interestingly, LPS tolerance negatively regulates expression of proinflammatory mediators
without affecting antimicrobial effectors. Using microarrays and real-time PCR, Foster and
colleagues (Foster et al., 2007) identified two classes of genes based on their responsiveness to
re-slimuIalion vilh LIS: so caIIed loIerizabIe genes, vhich incIude roinfIammalory media
tors, and non-tolerizable genes, which include antimicrobial effectors. Induction of tolerance
to LPS inhibits expression of the proinflammatory genes, while the other group of genes remain
inducible. Both classes of gene promoters show H4 acetylation and H3K4 tri-methylation,
which mark an open chromatin state, upon initial stimulation with LPS; however, this kind
of open chromatin state and recruitment of Brg1 are lost in tolerizable genes upon LPS re-
stimulation. In contrast, these epigenetic marks are maintained in the genes that remain
inducible. Aung and colleagues reported that HDACs are transiently repressed then induced
to express in murine bone marrow-derived macrophages when treated with LPS. HDACs are
recruited to different gene promoters to regulate the expression of the latter.
3.2. Manipulation of host chromatin remodelling process by bacteria to facilitate infection
Interestingly, intracellular pathogens, such as Listeria monocytogenes, Shigella flexneri, and
Helicobacter pylori, affecting the expression of host defense gene via modulation of chromatin
structure has also been reported in recent years. Listeria monocytogenes is a gram positive
bacterium that causes listeriosis. Two different mechanisms have been reported to be used by
L. monocytogenes to modify histones during the course of infection. In endothelial cells, L.
monocytogenes has been shown to selectively induce serine 10 phosphorylation and lysine 14
acelyIalion of H3 and Iysine 8 acelyIalion of H4 al lhe IL-8 bul nol lhe Inlerferon-y (IIN-y)
gene promoter through the activation of p38 and ERK MAPK pathway. A subsequent study
showed that activation of p38 MAPK signaling pathway and NF-iB by L. monocytogenes
depends on nucleotide-binding oligomerization domain-containing protein 1 (NOD1 ). NOD1
is critical for L. monocytogenes induced secretion of IL-8. Interestingly, only invasive bacteria
which can enter into the host cell cytoplasm induce IL-8 production in endothelial cells (Opitz
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
181
et al., 2006). In another study, L. monocytogenes has been found to induce a dramatic H3
dephosphorylation at serine 10 (H3S10) as well as a deacetylation of H4 during early phase of
infection (Hamon et al., 2007). In contrast to the report described as above, entry of bacteria
into the host cells is not required for these histone modifications. The LLO released by L.
monocytogenes is a member of CDC (cholesterol-dependent cytolysin) toxin family, which is
identified as a major effector sufficient for induction of H3S10 dephosphorylation and H4
deacetylation. LLO induced H3S10 dephosphorylation specifically occurs in the case of genes
vhose exression is reguIaled by LLO, a number of vhich are invoIved in immunily. Inler
estingly, other members of the large family of CDC toxins, such as PFO and PLY secreted by
Clostridium perfringens and Streptococcus pneumonia, respectively, dephosphorylate H3S10
through a mechanism analogous to that of LLO (Hamon et al., 2007), suggesting that different
bacteria may subvert immune response through a similar mechanism.
Shigella flexneri is a human intestinal pathogen, causing dysentery by invading the epithelium
of the colon and is responsible, worldwide, for more than one million deaths per year. Arbibe
and colleagues have shown that S. flexneri infection abrogates phosphorylation of H3S10 at the
promoters of a specific subset of genes, such as IL-8 and CCL-20. The underlying mechanism
is that the type III effector protein, OspF, secreted by S. flexneri enters into the nucleus and
specifically dephosphorylates ERK and p38 MAPKs and then blocks MAPK-dependent
phosphorylation of H3S10. This occurs in a gene-selective way, and renders selected gene
promoter sites inaccessible to NF-iB, thereby reducing the expression of a subset of NF-i-
responsive genes, including IL8 (Arbibe et al., 2007). This specificity might be a consequence
of OspFs ability to inactivate MAPKs, thereby preventing them from entering into nucleus.
Once activated, MAPKs translocate into nucleus and are recruited to the chromatin covering
their target genes, where they regulate the phosphorylation of transcription factors, histones
and chromatin-remodeling enzymes (Chow and Davis, 2006). It has been shown that OspF
induced down-regulation of inflammatory response is accomplished through the interaction
of OspF with host retinoblastoma (Rb) protein, which has been linked to histone modification
(Zurawski et al., 2009). OspF also has the phosphothreonine lyase activity, a unique activity
that has been found in a family of conserved effectors secreted by type III secretion system
including OspF, SpvC from nontyphoid Salmonella species, and HopAI1 from the plant
pathogen Pseudomonas syringae (Kramer et al., 2007;Li et al., 2007b;Zhang et al., 2007). These
effectors specifically inactivate their host MAPK pathway by carrying out a elimination
reaclion lo irreversibIy remove lhe hoshale moiely from lhe hosholhreonine in hos
phorylated MAPKs. Inhibition of MAPK signaling by OspF attenuates the recruitment of
polymorphonuclear leukocytes to Shigella infection sites by suppressing the activation of a
portion of NF-iB-responsive genes in mice (Arbibe et al., 2007), thereby contributing to the
survival and persistent infection of the pathogens.
Helicobacter pylori is a Gram-negative bacterium that colonizes the human gastric mucosa. The
chronic infection generates a state of inflammation which may develop toward chronic gastritis,
peptic ulcers and gastric malignancies (Peek, Jr. and Crabtree, 2006). The virulence factors of
Helicobacter pylori have been suggesled lo Iay a cruciaI roIe in lhe deveIomenl of infIamma
tion and in affecting the host immune system (Gebert et al., 2003;Lu et al., 2005). For example, in
Chromatin Remodelling 182
mouse macrophage, H. pylori peptidyl prolyl cis-, trans-isomerase (HP0175) has been shown to
induce H3S10 hoshoryIalion al lhe IL-6 romoler resuIling in increased IL-6 gene lranscri
tion and protein expression (Pathak et al., 2006). HP0175-induced IL-6 gene transcription is
dependent on the TLR4 dependent activation of ERK and p38 MAPKs, which subsequently
activate mitogen- and stress-activated protein kinase 1 (MSK1), a serine kinase responsible for
H3S10 hoshoryIalion. This modificalion aIIovs for recruilmenl of NI-i lo lhe IL-6 romol
er and activation of gene transactivation. Interestingly, H. pylori infection has also been shown
to dephosphorylate H3S10 and deacetylate H3K23 in a time- and dose- dependent manner in
gastric epithelial cells (Ding et al., 2010). Therefore, the effect of a specific histone modification
in hosl ceIIs aears lo be ceII lye secific and gene romoler secific. Iurlher sludies demon
strate that cag pathogenicity island (PAI) is responsible for the dephosphorylation of H3S10 and
this modification is independent of ERK and p38 signaling pathways as well as IFN signaling.
In addition, H3S10 dephosphorylation is associated with changes in the host gene expression,
which contributes to bacterial infection and pathogenesis (Ding et al., 2010). Treatment of gastric
epithelial cells with TSA, a general inhibitor of HDACs which non-specifically increases histone
H3 and H4 acetylation at multiple sites results in altered gene transcription pattern in both IL-8
and c-fos genes upon H. pylori infeclion. TSA reduces IL-8 bul increases c-fos gene lranscri
tion in the presence of H. pylori infection (Ding et al., 2010). H. pylori has also been shown to
regulate the cell cycle controlled protein p21(WAF), which is associated with the release of
HDAC-1from the promoter and histone H4 acetylation (Xia et al., 2008).
4. Chrnmatin rcmndc!ing and IFN--induccd transcriptinna! rcspnnsc
IIN-y is a cylokine secreled by aclivaled T ceIIs and naluraI kiIIer ceIIs. IIN-y can induce
expression of the major histocompatibility complex class II (MHC-II) on the cell surface
(oehm et al., 1997), which presents antigens to CD4
+
T cells and plays a crucial role in
normal immune response. IIN-y activates gene expression mainly via the activation of JAK
(Janus tyrosine kinase)/STATI (signal transducer and activator of transcription) signaling
pathway, leading to the translocation of active STAT1 homodimers into the nucleus. The
STAT1 homodimers lhen bind lo lhe IIN-y -aclivaled siles (GAS) resenl in lhe romol
ers of IIN-y -resonsive genes lhereby medialing lhe lranscrilion of lhese genes, incIud
ing class II transactivator (CIITA), which is necessary for both constitutive and inducible
expression of MHC-II (Schroder et al., 2004).
Chromatin remodeling, mediated by ATP-dependent chromatin remodeling complex and
or histone-modifying enzymes, has also been shown to be involved in the activation of IFN-
y -resonsive genes, such as CIITA and HLA-DR (Ni et al., 2005;Pattenden et al., 2002;Zika
et al., 2003). SWI/SNF complex often cooperates with histone-modifying enzymes to regulate
lranscrilion of genes, incIuding lhose vhich are induced by IIN-y (Chi, 2004,Wrighl and
Ting, 2006). Sludies have demonslraled lhal lhe SWI/SNI comIex and CRI-binding
rolein (CI), a lranscrilionaI co-aclivalor vilh hislone acelyIlransferase aclivily, are
recruiled lo CIITA romoler in an IIN-y-inducibIe fashion, Ieading lo lranscrilionaI
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
183
activation of CIITA (Kretsovali et al., 1998;Pattenden et al., 2002). HLA-DR is a MHCII
surface moIecuIe vhose lranscrilionaI aclivalion is lighlIy associaled vilh CIITA. Hovev
er, forced expression of CIITA in BRG1- and BRM-deficient SW13 cells cannot activate
expression of the MHC-II genes (Mudhasani and Fontes, 2002). BRG1 or BRM represent the
catalytic subunit of mammalian SWI/SNF chromatin remodeling complex, suggesting that
the SWI/SNF complex, which contains BRG1 might play additional roles in MHC-II
expression. Further studies have indicated that BRG1 is recruited by CIITA to the MHC-
II gene romolers and lhis recruilmenl is essenliaI for aclivalion of MHC-II gene exres
sion (Mudhasani and Fontes, 2002). Interestingly, CIITA itself has intrinsic HAT activity,
which can bind not onlyBRG1 but also HATs, such as CBP and/or p300 (Ting and Trowsdale,
2002). Furthermore, CIITA is associated with increased acetylation modifications of H3 and
H4 at MHC-II promoter mediated directly through its intrinsic HAT activity or by the
recruitment of HATs, such as CBP (Beresford and Boss, 2001;Kretsovali et al., 1998). IIN-y
induced transactivation of CIITA and expression of MHC-II is inhibited by HDACs/
mSin3A corepressor complex whereas enhanced by TSA, a general inhibitor of HDAC. Co-
immunoprecipitation assay revealed that CIITA interacts strongly with HDAC1 and weakly
with HDAC2 (Zika et al., 2003). AII lhese dala suggesl lhal CIITA may acl as a moduIa
tor to coordinate functions of chromatin remodeling complex, HATs and HDACs.
In the context of host-pathogen interaction, intracellular pathogens have been shown to
subverl lhe hosl immune resonse by affecling lhe macrohage resonsiveness lo IIN-y
bul lhe underIying mechanism remains uncIear. InlraceIIuIar alhogens may affecl IIN-y
response via different ways. For example, Leishamania donovani inhibiled IIN-y resonse
lhrough dovn-reguIalion of IIN-y recelor exression or inlerfering vilh lhe }AK/STAT1
signaling pathway (Nandan and Reiner, 1995;Ray et al., 2000). By contrast, mycobacteria
such as Mycobacterium avium and Mycobacterium tuberculosis impair IIN-y response through
inhibilion of IIN-y -resonsive gene exression vilhoul inlerfering vilh lhe }AK/STAT1
signaling pathway (Kincaid EZ, } Immunol, 2003, 171:2042-2049). Interestingly, only a subset
of IIN-y resonsive genes gel affecled, incIuding CIITA, HLA-DR and CD64, vhiIe olhers
remained unaffected (Pennini et al., 2006,Wang et al., 2005). Further studies showed that
infection with M. tuberculosis affecls lhe chromalin remodeIing on CIITA gene since IIN-y
-induced histone acetylation and recruitment of BRG1 were both impaired (Pennini et al.,
2006). AddilionaIIy, LqH, a mycobacleriaI ceII vaII rolein, induces binding of lhe C/II
lranscrilionaI reressor lo lhe CIITA romoler and inhibils IIN-y -induced CIITA
transcription (Pennini et al., 2007). It has been shown that C/EBP can recruit HDAC-1-
containing transcriptional repressor complex to the promoter of peroxisome proliferator-
activated receptor beta thereby inhibiting its transcription (Di-Poi et al., 2005). Therefore,
M. tuberculosis mighl induce lhe recruilmenl of C/II resuIling in lranscrilionaI reres
sion. The exact molecular mechanism by which M. tuberculosis inhibils IIN-y -induced
CIITA lranscrilion remains lo be eIucidaled. SimiIarIy lo CIITA, IIN-y -induced hislone
acetylation gets impaired at the HLA-DR promoter and HLA-DR transcription becomes
inhibited when the cells get infected with M. tuberculosis. Furthermore, inhibition of HDAC
Chromatin Remodelling 184
activities rescues histone acetylation, suggesting a role of HDACs in the transcriptional
repression induced by M. tuberculosis (Wang et al., 2005). Indeed, Mycobacterial infection
increases lhe exression of mSin3A (a co-reressor associaled HDACs), enabIing comeli
tion with CBP for binding to the HLA-DR promoter.
A recent study has demonstrated that infection with Toxoplasma gondii renders murine
macrophages globally unresponsive to IFN-y stimulation without affecting the nuclear
translocation of STAT1 triggered by IFN-y in infected macrophages. However, the binding of
STAT1 to the STAT1-responsive promoters is aberrant. A number of genes, which were
induced by IFN-y in uninfected macrophages, were not induced in the T. gondii-infected cells.
Among them, there are several genes previously shown to be repressed by T. gondii, such as
CIITA, MHC class II molecule H2-Eo, and interferon- regulatory factor 1(IRF-1) (Lang et al.,
2012). y anaIyzing lhe underIying mechanism, lhe aulhors reveaIed lhal assembIy of chro
matin remodeling complex and histone acetylation at the IFN-y -responsive promoters are
impaired upon infection with T. gondii. Trealmenl vilh HADC inhibilor reslores lhe reson
siveness of T. gondii-infected macrophages to IFN-y, leading to an increase in the expression
of IIN-y-inducibIe genes, such as CIITA and H2-A/I.
5. The potential role of HDAC inhibitors in treatment of infection
HDAC inhibitors have been developed clinically for cancer therapy due to their abilities to
induce cell-cycle arrest and apoptosis (Adcock, 2007). Studies have demonstrated that
HDAC inhibitors can exert anti-inflammatory effects via the suppression of cytokine and
nitric oxide production (Blanchard and Chipoy, 2005;Dinarello et al., 2011), suggesting their
therapeutic potential in inflammatory diseases including infectious diseases. For example,
HDAC inhibitors have been examined for the treatment of HIV infection and the current
results are exciting and encouraging (Wightman et al., 2012). Couple of other studies have
demonstrated that HDAC inhibitors, TSA and apicidin, can inhibit the growth of P|asnc!i
um falciparum, the main parasite causing malaria in humans (Colletti et al., 2001a;Colletti et
al., 2001b). Similarly, azelaic bishydroxamic acid and suberohydroxamic acid, two other
HDAC inhibitors, also show anti-malarial activity against P. falciparum (Andrews et al.,
2000). The olenliaI of HDAC inhibilors as anli-bacleriaI agenls has aIso been invesligal
ed; however, the results are contradictory.
5.1. Inhibition of infection by targeting histone modifying enzymes in the pathogen
Candida albicans is an opportunistic pathogen that is normally found in the gut microflora of
healthy individuals; however, C. albicans can cause severe and life-threatening diseases in
immuosuppressed patients such as HIV infected, organ transplant and cancer chemotherapy
patients (Tzung et al., 2001). There is a very high rate of mortality from systemic candidiasis,
ranging between 14 and 90% and averaging between 30 to 40%, depending on the disease
group studied (Blot et al., 2003). For patients with Candida infections, antifungal drug resistance
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
185
is a major clinical problem. H3K56 acetylation is mediated by HAT Rtt109 and seems to be
much more abundant in yeasts than in mammals (Garcia et al., 2007a;Xie et al., 2009), and close
homologues of Rtt109 have not yet been detected in mammals (Bazan, 2008). Therefore, it is
expected that Rtt109 might be a unique target for antifungal therapeutics. Indeed, Wurtele and
colleagues demonstrated that modulation of the acetylation of H3K56 exhibits potential as an
anti-fungal therapy (Wurtele et al., 2010). Interestingly, similar results have been found in a
study by Lopes da Rosa et al (Lopes da et al., 2010). Wurtele and colleagues showed that deleting
Rtt109, an acetyltransferase of H3K56, leads to increased sensitivity to some anti-fungal drugs.
Both teams also demonstrated that Rtt109 mutants are considerably less virulent in a mouse
model infected with C.albicans. Wurtele and colleagues further investigated how the growth
of C. albicans is affected by chemical modification of H3 in vitro and in vivo. They have observed
that the growth of C. albicans is greatly inhibited when HST3, the H3 deacetylase acting on
lysine 56, is inhibited by nicotinamide (a form of Vitamin B3 and product of the NAD+-
dependent deacetylation reaction). Furthermore, modulation of H3K56 acetylation reduces the
virulence of wild-type C. albicans in mice when nicotinamide was given in the drinking water
of mice to repress HST3 (Wurtele et al., 2010). These results, together with the study by Lopes
da Rosa and colleagues, provide basis for targeting H3 modifying enzymes to fight fungal
infections. Although important catalytic residues in Rtt109 are much different from those in
mammalian homologues, it is still a challenge to find suitable fungal-specific inhibitors of H3
modifying enzymes in the future.
5.2. Effects of HDAC inhibitors on host defense against bacterial infection
In a mouse model of septic shock induced by LPS, administration of of suberoylanilide
hydroxamic acid (SAHA) (50mg/kg intraperitoneally), improves long-term survival rates of
mice whether given before or post a lethal dose of LPS, which may be due to the down-
regulation of MyD88-dependent pathway and decreased expression of proinflammatory
mediators such as TNF-alpha, IL-1, and IL-6 (Li et al., 2010;Li et al., 2009). Further studies
demonstrated that treatment with SAHA increases anti-inflammatory IL-10 levels while
decreasing proinflammatory IL-6 and MAP kinase production in the liver of septic shock mice
(Finkelstein et al., 2010). In contrast, it has also been shown that treatment with HDAC
inhibitors lead to impaired host defense against bacterial infections. Studies have shown that
HDAC inhibitors, TSA, SAHA, and VPA, can impair innate immune responses to TLR agonists
by down-regulating the expression of genes involved in microbial sensing, such as C-type
lectins and adhesion molecules, as well as genes involved in host defense, such as cytokines
and chemokines, thereby increasing susceptibility to infection (Roger et al., 2011). Interestingly,
while LPS-induced IFN- production is enhanced by HDAC inhibitors, the expression of a
number of IFN- /STAT1-dependent genes is strongly inhibited by TSA and VPA, suggesting
that increased IFN- production cannot overcome the potent inhibitory effects of HDAC
inhibitors. Surprisingly, VPA was shown to increase the mortality of mice infected with C.
albicans or K. pneumonia, but protect mice from toxic shock and severe sepsis in mouse models
(Roger et al., 2011). When murine macrophages were treated with TSA and VPA, their ability
to kill Escherichia coli and Staphyloccocus aureus was attenuated, with impaired phagocytosis
and production of reactive oxygen and nitrogen species (Mombelli et al., 2011). Together, these
Chromatin Remodelling 186
data reveal the complex effector mechanisms of HDAC inhibitors and suggest that more
studies are required to fully understand this complex process.
6. Concluding remarks
The aclivalion and suression of innale immunily are cenlraI rinciIes of hosl-alho
gen interaction and need to be very well controlled. To establish persistent infection,
intracellular pathogens must acquire efficient mechanisms to evade the host immune
response. Interference with host posttranscriptional modifications by bacterial pathogens is
a strategy widely used by the pathogens to promote survival and replication during the
course of infeclion. MAIK, IIN-y and lranscrilion faclor NI-i signaIing alhvays are
common targets for bacteria-induced posttranscriptional modifications (Ribet and Cossart,
2010). Interestingly, in the past few years, evidence has accumulated that targeting of histone
modifications and chromatin remodeling, and subsequently subverting the host immune
resonse, is a nev and exciling fieId in lhe sludy of hosl-alhogen inleraclion. Ihoshory
lation of H3 and acetylation of H3 and/or H4 at lysine residues are frequently associated
with transactivation. Conversely, dephosphorylation and methylation of histones are more
often associated with gene suppression (erger, 2002;Kouzarides, 2007;Verdone et al., 2006).
Several strains of bacteria, including L. monocytogenes, C. perfringens, S. pneumonia and H.
pylori, induce the same dephosphorylation of H3S10, while S. flexneri bIocks hoshoryIa
lion of H3S10, aII of vhich Iead lo decreased hoshoryIalion of H3S10 and are associal
ed with altered host immune response.
The molecular mechanisms by which bacterial infection induces histone modification and
chromatin remodeling remain to be understood. For many pathogens, it is very difficult to
hypothesize about the extent or the mechanics of epigenetic change they might induce.
Currently available data largely provide snapshots of what is happening to the usual host
genes studied in an infection model. More comprehensive global studies, such as ChIP-on
chip (chromatin immunoprecipitation coupled with expression microarray technology) for
mapping global chromatin modifications, are now necessary and possible. This might
provide fundamental clues to better understand the role and mechanism of chromatin
regulation in the control of immune gene expression in inflammatory and infectious
diseases.
Author details
Yong Zhong Xu, Cynthia Kanagaratham and Danuta Radzioch
*Address all correspondence to: [email protected]
Department of Medicine, McGill University, Montreal, Canada
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
187
References
[1] Aasland, R, Stewart, A. F, & Gibson, T. (1996). The SANT domain: a putative DNA-
binding domain in lhe SWI-SNI and ADA comIexes, lhe lranscrilionaI co-reress
or N-CoR and TFIIIB. Trends Biochem. Sci. 8788, 21
[2] Adcock, I. M. (2007). HDAC inhibitors as anti-inflammatory agents. Br. J. Pharmacol.
829831, 150
[3] Adib-conquy, M, Adrie, C, Fitting, C, Gattolliat, O, Beyaert, R, & Cavaillon, J. M.
(2006). Up-regulation of MyD88s and SIGIRR, molecules inhibiting Toll-like receptor
signaling, in monocytes from septic patients. Crit Care Med. 23772385, 34
[4] Adib-conquy, M, Adrie, C, Moine, I, Asehnoune, K, Iilling, C, Iinsky, M. R, Dhai
naut, J. F, & Cavaillon, J. M. (2000). NF-kappaB expression in mononuclear cells of
patients with sepsis resembles that observed in lipopolysaccharide tolerance. Am. J.
Respir. Crit Care Med. 18771883, 162
[5] Akira, S, & Takeda, K. (2004). Toll-like receptor signalling. Nat. Rev. Immunol.
499511, 4
[6] Andrews, K. T, Walduck, A, Kelso, M. J, Fairlie, D. P, Saul, A, & Parsons, P. G. (2000).
Anli-maIariaI effecl of hislone deacelyIalion inhibilors and mammaIian lumour cylo
differentiating agents. Int. J. Parasitol. 761768, 30
[7] Arbibe, L, Kim, D. W, Batsche, E, Pedron, T, Mateescu, B, Muchardt, C, Parsot, C, &
Sansonetti, P. J. (2007). An injected bacterial effector targets chromatin access for
lranscrilion faclor NI-kaa lo aIler lranscrilion of hosl genes invoIved in im
mune responses. Nat. Immunol. 4756, 8
[8] Bannister, A. J, & Miska, E. A. (2000). Regulation of gene expression by transcription
factor acetylation. Cell Mol. Life Sci. 11841192, 57
[9] ao, Y, & Shen, X. (2007). INO80 subfamiIy of chromalin remodeIing comIexes. Mu
tat. Res. 1829, 618
[10] Bazan, J. F. (2008). An old HAT in human CBP and yeast Rtt109. Cell Cycle. 7,
1884-1886., 300.
[11] Beresford, G. W, & Boss, J. M. (2001). CIITA coordinates multiple histone acetylation
modifications at the HLA-DRA promoter. Nat. Immunol. 652657, 2
[12] Berger, S. L. (2002). Histone modifications in transcriptional regulation. Curr. Opin.
Genet. Dev. 142148, 12
[13] erger, S. L. (2007). The comIex Ianguage of chromalin reguIalion during lranscri
tion. Nature. 407412, 447
Chromatin Remodelling 188
[14] Blanchard, F, & Chipoy, C. (2005). Histone deacetylase inhibitors: new drugs for the
treatment of inflammatory diseases? Drug Discov. Today. 197204, 10
[15] Iol, S. I, Hosle, I. A, Vandevoude, K. H, & CoIardyn, I. A. (2003). Islimales of al
tributable mortality of systemic candida infection in the ICU. J. Crit Care. 130131, 18
[16] oehm, U, KIam, T, Grool, M, & Hovard, }. C. (1997). CeIIuIar resonses lo inlerfer
on-gamma. Annu. Rev. Immunol. 74995, 15
[17] Boyer, L. A, Langer, M. R, Crowley, K. A, Tan, S, Denu, J. M, & Peterson, C. L. (2002).
IssenliaI roIe for lhe SANT domain in lhe funclioning of muIliIe chromalin remod
eling enzymes. Mol. Cell. 935942, 10
[18] oyer, L. A, Lalek, R. R, & Ielerson, C. L. (2004). The SANT domain: a unique his
tone-tail-binding module? Nat. Rev. Mol. Cell Biol. 158163, 5
[19] Brehm, A, Tufteland, K. R, Aasland, R, & Becker, P. B. (2004). The many colours of
chromodomains. Bioessays. 133140, 26
[20] CavaiIIon, }. M, & Adib-conquy, M. (2006). ench-lo-bedside reviev: endoloxin loIer
ance as a model of leukocyte reprogramming in sepsis. Crit Care. 10, 233.
[21] Cavaillon, J. M, Adrie, C, Fitting, C, & Adib-conquy, M. (2003). Endotoxin tolerance:
is there a clinical relevance? J. Endotoxin. Res. 101107, 9
[22] Chan, C, Li, L, MccaII, C. I, & Yoza, . K. (2005). Indoloxin loIerance disruls chro
malin remodeIing and NI-kaa lransaclivalion al lhe IL-1bela romoler. }. Immu
nol. 461468, 175
[23] Chang, , Chen, Y, Zhao, Y, & ruick, R. K. (2007). }M}D6 is a hislone arginine deme
thylase. Science. % 19;318444447
[24] Chi, T. view of the immune system. Nat. Rev. Immunol. 965977, 4
[25] Chow, C. W, & Davis, R. J. (2006). Proteins kinases: chromatin-associated enzymes?
Cell. 887890, 127
[26] Clapier, C. R, & Cairns, B. R. (2009). The biology of chromatin remodeling complexes.
Annu. Rev. Biochem. 273304doi:annurev.biochem.77.062706.153223., 273-304., 78
[27] CoIIelli, S. L. (2001a). road seclrum anlirolozoaI agenls lhal inhibil hislone deace
tylase: structure-activity relationships of apicidin. Part 1. Bioorg. Med. Chem. Lett.
107111, 11
|28j CoIIelli, S. L. (2001b). road seclrum anlirolozoaI agenls lhal inhibil hislone deace
tylase: structure-activity relationships of apicidin. Part 2. Bioorg. Med. Chem. Lett.
113117, 11
[29] Cuthbert, G. L. (2004). Histone deimination antagonizes arginine methylation. Cell.
545553, 118
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
189
[30] Davie, J. R. (2003). Inhibition of histone deacetylase activity by butyrate. J. Nutr. 133,
2485S-2493S.
[31] De La Serna, I. L, Ohkawa, Y, & Imbalzano, A. N. (2006). Chromatin remodelling in
mammalian differentiation: lessons from ATP-dependent remodellers. Nat. Rev.
Genet. 461473, 7
[32] Di-poi, N, Desvergne, B, Michalik, L, & Wahli, W. (2005). Transcriptional repression
of peroxisome proliferator-activated receptor beta/delta in murine keratinocytes by
CCAAT/enhancer-binding proteins. J. Biol. Chem. 3870038710, 280
[33] Dinarello, C. A, Fossati, G, & Mascagni, P. (2011). Histone deacetylase inhibitors for
treating a spectrum of diseases not related to cancer. Mol. Med. 333352, 17
[34] Ding, S. Z. (2010). Helicobacter pylori-induced histone modification, associated gene
expression in gastric epithelial cells, and its implication in pathogenesis. PLoS. One.
5, e9875.
[35] DriscoII, R, Hudson, A, & }ackson, S. I. (2007). Yeasl Rll109 romoles genome slabiIi
ty by acetylating histone H3 on lysine 56. Science. 649652, 315
[36] Iissenberg, }. C. (2001). MoIecuIar bioIogy of lhe chromo domain: an ancienl chroma
tin module comes of age. Gene. 1929, 275
[37] II,Yoza, G. M, Hu, . K, Cousarl, }. Y, & MccaII, S. L. C.I. ((2007). Iigenelic siIenc
ing of tumor necrosis factor alpha during endotoxin tolerance. J. Biol. Chem.
2685726864, 282
[38] Farrants, A. K. (2008). Chromatin remodelling and actin organisation. FEBS Lett.
20412050, 582
[39] Finkelstein, R. A, Li, Y, Liu, B, Shuja, F, Fukudome, E, Velmahos, G. C, Demoya, M,
& Alam, H. B. (2010). Treatment with histone deacetylase inhibitor attenuates MAP
kinase mediated liver injury in a lethal model of septic shock. J. Surg. Res. 146154,
163
[40] IIaus, A, & Oven-hughes, T. (2004). Mechanisms for ATI-deendenl chromalin re
modelling: farewell to the tuna-can octamer? Curr. Opin. Genet. Dev. 165173, 14
[41] Iosler, S. L, Hargreaves, D. C, & Medzhilov, R. (2007). Gene-secific conlroI of in
flammation by TLR-induced chromatin modifications. Nature. 972978, 447
[42] Galan, J. E, & Cossart, P. (2005). Host-pathogen interactions: a diversity of themes, a
variety of molecular machines. Curr. Opin. Microbiol. 13, 8
[43] Garcia, B. A. (2007a). Organismal differences in post-translational modifications in
histones H3 and H4. J. Biol. Chem. 76417655, 282
Chromatin Remodelling 190
[44] Garcia, B. A, Shabanowitz, J, & Hunt, D. F. (2007b). Characterization of histones and
their post-translational modifications by mass spectrometry. Curr. Opin. Chem. Biol.
6673, 11
[45] Gebert, B, Fischer, W, Weiss, E, Hoffmann, R, & Haas, R. (2003). Helicobacter pylori
vacuolating cytotoxin inhibits T lymphocyte activation. Science. 10991102, 301
[46] Glaser, K. B, Li, J, Staver, M. J, Wei, R. Q, Albert, D. H, & Davidsen, S. K. (2003a).
RoIe of cIass I and cIass II hislone deacelyIases in carcinoma ceIIs using siRNA. io
chem. Biophys. Res. Commun. 529536, 310
[47] Glaser, K. B, Staver, M. J, Waring, J. F, Stender, J, Ulrich, R. G, & Davidsen, S. K.
(2003b). Gene exression rofiIing of muIliIe hislone deacelyIase (HDAC) inhibi
tors: defining a common gene set produced by HDAC inhibition in T24 and MDA
carcinoma cell lines. Mol. Cancer Ther. 151163, 2
[48] Hamon, M. A, alsche, I, RegnauIl, , Tham, T. N, Seveau, S, Muchardl, C, & Cos
sart, P. (2007). Histone modifications induced by a family of bacterial toxins. Proc.
Natl. Acad. Sci. U. S. A. 1346713472, 104
[49] Hamon, M. A, & Cossart, P. (2008). Histone modifications and chromatin remodeling
during bacterial infections. Cell Host. Microbe. 100109, 4
[50] Han, }, Zhou, H, Horazdovsky, , Zhang, K, Xu, R. M, & Zhang, Z. (2007). Rll109 ace
tylates histone H3 lysine 56 and functions in DNA replication. Science. 653655, 315
[51] Hassan, A. H, Prochasson, P, Neely, K. E, Galasinski, S. C, Chandy, M, Carrozza, M.
J, & Workman, J. L. (2002). Function and selectivity of bromodomains in anchoring
chromatin-modifying complexes to promoter nucleosomes. Cell. 369379, 111
[52] Huang, Y, Iang, }, edford, M. T, Zhang, Y, & Xu, R. M. (2006). Recognilion of his
tone H3 lysine-4 methylation by the double tudor domain of JMJD2A. Science.
748751, 312
[53] Jenuwein, T, & Allis, C. D. (2001a). Translating the histone code. Science. 10741080,
293
[54] Jones, D. O, Cowell, I. G, & Singh, P. B. (2000). Mammalian chromodomain proteins:
their role in genome organisation and expression. Bioessays. 124137, 22
[55] Kallin, E, & Zhang, Y. (2004). Chromatin Remodelling. In: Encyclopedia of Biological
Chemistry. , 456-463.
[56] Kouzarides, T. (2007). Chromatin modifications and their function. Cell. 693705, 128
[57] Kramer, R. W, Slagowski, N. L, Eze, N. A, Giddings, K. S, Morrison, M. F, Siggers, K.
A, Starnbach, M. N, & Lesser, C. F. (2007). Yeast functional genomic screens lead to
identification of a role for a bacterial effector in innate immunity regulation. PLoS.
Pathog. 3, e21.
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
191
[58] KrelsovaIi, A, AgaIioli, T, SiIianakis, C, Tzorlzakaki, I, Merika, M, & Iaamalhea
kis, }. (1998). InvoIvemenl of CRI binding rolein in exression of ma|or hislocom
patibility complex class II genes via interaction with the class II transactivator. Mol.
Cell Biol. 67776783, 18
[59] Lang, C, HiIdebrandl, A, rand, I, Oilz, L, Dihazi, H, & Luder, C. G. (2012). Im
aired chromalin remodeIIing al STATreguIaled romolers Ieads lo gIobaI unreson
siveness of Toxoplasma gondii-Infected macrophages to IFN-gamma. PLoS. Pathog.
8, e1002483., 1.
[60] Lee, H. S, Park, M. H, Yang, S. J, Jung, H. Y, Byun, S. S, Lee, D. S, Yoo, H. S, Yeom, Y.
I, & Seo, S. . (2004). Gene exression anaIysis in human gaslric cancer ceII Iine lreal
ed with trichostatin A and S-adenosyl-L-homocysteine using cDNA microarray. Biol.
Pharm. Bull. 14971503, 27
[61] Legube, G, & Trouche, D. (2003). ReguIaling hislone acelyIlransferases and deacely
lases. EMBO Rep. 944947, 4
[62] Li, , Carey, M, & Workman, }. L. (2007a). The roIe of chromalin during lranscri
tion. Cell. 707719, 128
[63] Li, H, Xu, H, Zhou, Y, Zhang, J, Long, C, Li, S, Chen, S, Zhou, J. M, & Shao, F.
(2007b). The phosphothreonine lyase activity of a bacterial type III effector family.
Science. 10001003, 315
[64] Li, Y. (2010). Surviving lethal septic shock without fluid resuscitation in a rodent
model. Surgery. 246254, 148
[65] Li, Y. (2009). Iroleclive effecl of suberoyIaniIide hydroxamic acid againsl LIS-in
duced septic shock in rodents. Shock. 517523, 32
[66] Lo, W. S, Duggan, L, Emre, N. C, Belotserkovskya, R, Lane, W. S, Shiekhattar, R, &
erger, S. L. (2001). Snf1--a hislone kinase lhal vorks in concerl vilh lhe hislone ace
tyltransferase Gcn5 to regulate transcription. Science. 11421146, 293
[67] Lo, W. S, Trievel, R. C, Rojas, J. R, Duggan, L, Hsu, J. Y, Allis, C. D, Marmorstein, R,
& Berger, S. L. (2000). Phosphorylation of serine 10 in histone H3 is functionally
linked in vitro and in vivo to Gcn5-mediated acetylation at lysine 14. Mol. Cell.
917926, 5
[68] Loes daR.}., oyarlchuk,V.L., Zhu,L.}., and Kaufman,I.D. ((2010). Hislone acelyI
transferase Rtt109 is required for Candida albicans pathogenesis. Proc. Natl. Acad.
Sci. U. S. A. 15941599, 107
[69] Lu, H, Yamaoka, Y, & Graham, D. Y. (2005). Helicobacter pylori virulence factors:
facts and fantasies. Curr. Opin. Gastroenterol. 653659, 21
[70] Lusser, A, & Kadonaga, }. T. (2003). Chromalin remodeIing by ATI-deendenl mo
lecular machines. Bioessays. 11921200, 25
Chromatin Remodelling 192
[71] Macdonald, N. (2005). Molecular basis for the recognition of phosphorylated and
phosphoacetylated histone h3 by 14-3-3. Mol. Cell. 199211, 20
[72] Marfella, C. G, & Imbalzano, A. N. (2007). The Chd family of chromatin remodelers.
Mutat. Res. 3040, 618
[73] Martin, C, & Zhang, Y. (2005). The diverse functions of histone lysine methylation.
Nat. Rev. Mol. Cell Biol. 838849, 6
[74] Martin, C, & Zhang, Y. (2007). Mechanisms of epigenetic inheritance. Curr. Opin.
Cell Biol. 266272, 19
[75] Masumi, A. (2011). Histone acetyltransferases as regulators of nonhistone proteins:
the role of interferon regulatory factor acetylation on gene transcription. J. Biomed.
Biotechnol. 2011:640610. doi:Epub;% 2010 Dec 29., 640610.
[76] Medzhilov, R, & Horng, T. (2009). TranscrilionaI conlroI of lhe infIammalory re
sponse. Nat. Rev. Immunol. 692703, 9
[77] MersfeIder, I. L, & Iarlhun, M. R. (2006). The laIe beyond lhe laiI: hislone core do
main modifications and the regulation of chromatin structure. Nucleic Acids Res. %
19;3426532662
[78] Metzger, E, Wissmann, M, Yin, N, Muller, J. M, Schneider, R, Peters, A. H, Gunther,
T, Buettner, R, & Schule, R. (2005). LSD1 demethylates repressive histone marks to
promote androgen-receptor-dependent transcription. Nature. 436439, 437
[79] Mombelli, M, Lugrin, J, Rubino, I, Chanson, A. L, Giddey, M, Calandra, T, & Roger,
T. (2011). Hislone deacelyIase inhibilors imair anlibacleriaI defenses of macrohag
es. J. Infect. Dis. 13671374, 204
[80] Mosammaparast, N, & Shi, Y. (2010). Reversal of histone methylation: biochemical
and molecular mechanisms of histone demethylases. Annu. Rev. Biochem.
15579doi:annurev.biochem.78.070907.103946., 155-179., 79
[81] Mudhasani, R, & Ionles, }. D. (2002). The cIass II lransaclivalor requires brahma-re
lated gene 1 to activate transcription of major histocompatibility complex class II
genes. Mol. Cell Biol. 50195026, 22
[82] Nandan, D, & Reiner, N. I. (1995). Allenualion of gamma inlerferon-induced lyro
sine hoshoryIalion in mononucIear hagocyles infecled vilh Leishmania donova
ni: selective inhibition of signaling through Janus kinases and Stat1. Infect. Immun.
44954500, 63
[83] Ni, Z, Karaskov, I, Yu, T, CaIIaghan, S. M, Iark, S, Xu, D. S, Iallenden, Z, & remn
er, S. G. R. ((2005). Apical role for BRG1 in cytokine-induced promoter assembly.
Proc. Natl. Acad. Sci. U. S. A. 1461114616, 102
[84] Opitz, B, Puschel, A, Beermann, W, Hocke, A. C, Forster, S, Schmeck, B, Chakraborty,
L. , V, Suttorp, T, & Hippenstiel, N. S. ((2006). Listeria monocytogenes activated
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
193
MAPK and induced IL-8 secretion in a nucleotide-binding oligomerization domain 1-
dependent manner in endothelial cells. J. Immunol. 176, 484-490., 38.
[85] Pathak, S. K, Basu, S, Bhattacharyya, A, Pathak, S, Banerjee, A, Basu, J, & Kundu, M.
aclivalion and milogen- and slress-aclivaled rolein kinase 1-lriggered hoshory
lation events are central to Helicobacter pylori peptidyl prolyl cis-, trans-isomerase
(HP0175)-mediated induction of IL-6 release from macrophages. J. Immunol.
79507958, 177
[86] Iallenden, S. G, KIose, R, Karaskov, I, & remner, R. (2002). Inlerferon-gamma-in
duced chromatin remodeling at the CIITA locus is BRG1 dependent. EMBO J.
19781986, 21
[87] Pawlak, S, & Deckert, J. (2007). Histone modifications under environmental stress.
BIOLOGICAL LETT. 6573, 44
[88] Iedersen, M. T, & HeIin, K. (2010). Hislone demelhyIases in deveIomenl and dis
ease. Trends Cell Biol. 662671, 20
[89] Peek, R. M. Jr. and Crabtree,J.E. ((2006). Helicobacter infection and gastric neoplasia.
J. Pathol. 233248, 208
[90] Pena, P. V, Davrazou, F, Shi, X, Walter, K. L, Verkhusha, V. V, Gozani, O, Zhao, R, &
Kutateladze, T. G. (2006). Molecular mechanism of histone H3K4me3 recognition by
plant homeodomain of ING2. Nature. 100103, 442
[91] Pennini, M. E, Liu, Y, Yang, J, Croniger, C. M, Boom, W. H, & Harding, C. V. (2007).
CCAAT/enhancer-binding rolein bela and deIla binding lo CIITA romolers is as
socialed vilh lhe inhibilion of CIITA exression in resonse lo Mycobaclerium lu
berculosis 19-kDa lipoprotein. J. Immunol. 69106918, 179
[92] Iennini, M. I, Iai, R. K, SchuIlz, D. C, oom, W. H, & Harding, C. V. (2006). Myco
bacterium tuberculosis 19-kDa lipoprotein inhibits IFN-gamma-induced chromatin
remodeling of MHC2TA by TLR2 and MAPK signaling. J. Immunol. 43234330, 176
[93] Pray-grant, M. G, Daniel, J. A, Schieltz, D, & Yates, J. R. III, and Grant,P.A. ((2005).
Chd1 chromodomain links histone H3 methylation with SAGA- and SLIK-dependent
acetylation. Nature. 434438, 433
[94] Punga, T, & Akusjarvi, G. (2000). The adenovirus-2 E1B-55K protein interacts with a
mSin3A/histone deacetylase 1 complex. FEBS Lett. 248252, 476
[95] Radkov, S. A, Touitou, R, Brehm, A, Rowe, M, West, M, Kouzarides, T, & Allday, M.
J. (1999). Epstein-Barr virus nuclear antigen 3C interacts with histone deacetylase to
repress transcription. J. Virol. 56885697, 73
[96] Ray, M, Gam, A. A, Boykins, R. A, & Kenney, R. T. (2000). Inhibition of interferon-
gamma signaling by Leishmania donovani. J. Infect. Dis. 11211128, 181
Chromatin Remodelling 194
[97] Ribet, D, & Cossart, P. (2010). Post-translational modifications in host cells during
bacterial infection. FEBS Lett. 27482758, 584
[98] Roberts, C. W, & Orkin, S. H. (2004). The SWI/SNF complex--chromatin and cancer.
Nat. Rev. Cancer. 133142, 4
[99] Roger, T. (2011). Histone deacetylase inhibitors impair innate immune responses to
Toll-like receptor agonists and to infection. Blood. 12051217, 117
[100] Ruthenburg, A. J, Li, H, Patel, D. J, & Allis, C. D. (2007). Multivalent engagement of
chromatin modifications by linked binding modules. Nat. Rev. Mol. Cell Biol.
983994, 8
[101] Saccani, S, Ianlano, S, & NaloIi, G. (2002). marking of infIammalory genes for in
creased NF-kappa B recruitment. Nat. Immunol. 3, 69-75., 38.
[102] Saha, A, Wittmeyer, J, & Cairns, B. R. (2006). Chromatin remodelling: the industrial
revolution of DNA around histones. Nat. Rev. Mol. Cell Biol. 437447, 7
[103] Sakabe, K, Wang, Z, & Hart, G. W. (2010). Beta-N-acetylglucosamine (O-GlcNAc) is
part of the histone code. Proc. Natl. Acad. Sci. U. S. A. 1991519920, 107
[104] Santos-rosa, H, Schneider, R, Bannister, A. J, Sherriff, J, Bernstein, B. E, Emre, N. C,
Schreiber, S. L, Mellor, J, & Kouzarides, T. (2002). Active genes are tri-methylated at
K4 of histone H3. Nature. 407411, 419
[105] Schneider, J, Bajwa, P, Johnson, F. C, Bhaumik, S. R, & Shilatifard, A. (2006). Rtt109 is
required for roer H3K56 acelyIalion: a chromalin mark associaled vilh lhe eIon
gating RNA polymerase II. J. Biol. Chem. 3727037274, 281
[106] Schneider, J, Wood, A, Lee, J. S, Schuster, R, Dueker, J, Maguire, C, Swanson, S. K,
Florens, L, Washburn, M. P, & Shilatifard, A. (2005). Molecular regulation of histone
H3 trimethylation by COMPASS and the regulation of gene expression. Mol. Cell.
849856, 19
[107] Schroder, K, Hertzog, P. J, Ravasi, T, & Hume, D. A. (2004). Interferon-gamma: an
overview of signals, mechanisms and functions. J. Leukoc. Biol. 163189, 75
[108] Shahbazian, M. D, & Grunslein, M. (2007). Iunclions of sile-secific hislone acelyIa
tion and deacetylation. Annu. Rev. Biochem. 75100, 76
[109] Shi, X. (2006). ING2 PHD domain links histone H3 lysine 4 methylation to active
gene repression. Nature. 9699, 442
[110] Shi, Y, Lan, F, Matson, C, Mulligan, P, Whetstine, J. R, Cole, P. A, Casero, R. A, & Shi,
Y. (2004). Histone demethylation mediated by the nuclear amine oxidase homolog
LSD1. Cell. 941953, 119
[111] Shi, Y, & Whetstine, J. R. (2007). Dynamic regulation of histone lysine methylation by
demethylases. Mol. Cell. 114, 25
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
195
[112] Shilatifard, A. (2006). Chromatin modifications by methylation and ubiquitination:
implications in the regulation of gene expression. Annu. Rev. Biochem. 24369, 75
[113] Shogren-knaak, M, Ishii, H, Sun, J. M, Pazin, M. J, Davie, J. R, & Peterson, C. L. K16
acetylation controls chromatin structure and protein interactions. Science. 844847,
311
[114] Shogren-knaak, M, & Peterson, C. L. (2006). Switching on chromatin: mechanistic
role of histone H4-K16 acetylation. Cell Cycle. 13611365, 5
[115] Sims, R. J. III, Chen,C.F., Santos-Rosa,H., Kouzarides,T., Patel,S.S., and Reinberg,D.
((2005). Human bul nol yeasl CHD1 binds direclIy and seIecliveIy lo hislone H3 me
thylated at lysine 4 via its tandem chromodomains. J. Biol. Chem. 4178941792, 280
[116] Smale, S. T. (2010). Selective transcription in response to an inflammatory stimulus.
Cell. % 19;140833844
[117] Strahl, B. D, & Allis, C. D. (2000). The language of covalent histone modifications.
Nature. 4145, 403
[118] Takeda, K, Kaisho, T, & Akira, S. (2003). Toll-like receptors. Annu. Rev. Immunol.
33576Epub;% 2001 Dec;% 19., 335-376., 21
[119] Tan, M. (2011). Identification of 67 histone marks and histone lysine crotonylation as
a new type of histone modification. Cell. 10161028, 146
[120] Ting, J. P, & Trowsdale, J. (2002). Genetic control of MHC class II expression. Cell.
109 Suppl:S2133S21-S33.
[121] Tzung, K. W. (2001). Genomic evidence for a comIele sexuaI cycIe in Candida aIbi
cans. Proc. Natl. Acad. Sci. U. S. A. 32493253, 98
[122] Valls, E, Blanco-garcia, N, Aquizu, N, Piedra, D, Estaras, C, & Martinez-balbas, l. C. ,
X. M.A. ((2007). InvoIvemenl of chromalin and hislone deacelyIalion in SV40 T anli
gen transcription regulation. Nucleic Acids Res. 19581968, 35
[123] Verdone, L, Agricola, E, Caserta, M, & Di, M. E. (2006a). Histone acetylation in gene
regulation. Brief. Funct. Genomic. Proteomic. 209221, 5
[124] Wang, G. G, Allis, C. D, & Chi, P. (2007). Chromatin remodeling and cancer, Part II:
ATP-dependent chromatin remodeling. Trends Mol. Med. 373380, 13
[125] Wang, H, Zhai, L, Xu, J, Joo, H. Y, Jackson, S, Erdjument-bromage, H, Tempst, P,
Xiong, Y, & Zhang, Y. and H4 ubiquilyIalion by lhe CUL4-DD-ROC1 ubiquilin Ii
gase facilitates cellular response to DNA damage. Mol. Cell. 383394, 22
[126] Wang, Y, Curry, H. M, Zwilling, B. S, & Lafuse, W. P. (2005). Mycobacteria inhibition
of IIN-gamma induced HLA-DR gene exression by u-reguIaling hislone deacely
lation at the promoter region in human THP-1 monocytic cells. J. Immunol. 56875694,
174
Chromatin Remodelling 196
[127] Wang, Y. (2004). Human IAD4 reguIales hislone arginine melhyIalion IeveIs via de
methylimination. Science. 279283, 306
[128] Weinmann, A. S, Mitchell, D. M, Sanjabi, S, Bradley, M. N, Hoffmann, A, Liou, H. C,
& SmaIe, S. T. (2001). NucIeosome remodeIing al lhe IL-12 romoler is a TLR-de
pendent, Rel-independent event. Nat. Immunol. 2, 51-57., 40.
[129] Weinmann, A. S, Plevy, S. E, & Smale, S. T. (1999). Rapid and selective remodeling of
a positioned nucleosome during the induction of IL-12 transcription. Immunity. 11,
665-675., 40.
[130] Wightman, F, Ellenberg, P, Churchill, M, & Lewin, S. R. (2012). HDAC inhibitors in
HIV. Immunol. Cell Biol. 4754, 90
[131] Wright, K. L, & Ting, J. P. (2006). Epigenetic regulation of MHC-II and CIITA genes.
Trends Immunol. 405412, 27
[132] WurleIe, H, Tsao, S, Leine, G, MuIIick, A, TrembIay, }, Drogaris, I, Lee, I. H, Thi
bault, P, Verreault, A, & Raymond, M. (2010). Modulation of histone H3 lysine 56
acetylation as an antifungal therapeutic strategy. Nat. Med. 774780, 16
[133] Wysocka, J, Allis, C. D, & Coonrod, S. (2006a). Histone arginine methylation and its
dynamic regulation. Front Biosci. 34455, 11
[134] Wysocka, J, Swigut, T, Milne, T. A, Dou, Y, Zhang, X, Burlingame, A. L, Roeder, R. G,
Brivanlou, A. H, & Allis, C. D. (2005). WDR5 associates with histone H3 methylated
at K4 and is essential for H3 K4 methylation and vertebrate development. Cell.
859872, 121
[135] Wysocka, }. (2006b). A IHD finger of NURI couIes hislone H3 Iysine 4 lrimelhyIa
tion with chromatin remodelling. Nature. 8690, 442
[136] Xia, G, Schneider-stock, R, Diestel, A, Habold, C, Krueger, S, Roessner, A, Naumann,
M, & LendeckeI, U. (2008). HeIicobacler yIori reguIales WAI1) by hislone H4 acely
lation. Biochem. Biophys. Res. Commun. 369, 526-531., 21.
[137] Xie, W. (2009). Histone h3 lysine 56 acetylation is linked to the core transcriptional
network in human embryonic stem cells. Mol. Cell. 417427, 33
[138] Xu, F, Zhang, K, & Grunstein, M. (2005). Acetylation in histone H3 globular domain
regulates gene expression in yeast. Cell. 375385, 121
[139] Zeng, L, & Zhou, M. M. (2002). Bromodomain: an acetyl-lysine binding domain.
FEBS Lett. % 20;513124128
[140] Zhang, J. (2007). A Pseudomonas syringae effector inactivates MAPKs to suppress
PAMP-induced immunity in plants. Cell Host. Microbe. 175185, 1
Chromatin Remodelling During Host-Bacterial Pathogen Interaction
http://dx.doi.org/10.5772/55977
197
[141] Zhu, B, Zheng, Y, Pham, A. D, Mandal, S. S, Erdjument-bromage, H, Tempst, P, &
Reinberg, D. (2005). Monoubiquitination of human histone H2B: the factors involved
and their roles in HOX gene regulation. Mol. Cell. 601611, 20
[142] Zika, I, Greer, S. I, Zhu, X. S, & Ting, }. I. (2003). Hislone deacelyIase 1/mSin3A dis
ruls gamma inlerferon-induced CIITA funclion and ma|or hislocomalibiIily com
plex class II enhanceosome formation. Mol. Cell Biol. 30913102, 23
[143] Zupkovitz, G. (2006). Negative and positive regulation of gene expression by mouse
histone deacetylase 1. Mol. Cell Biol. 79137928, 26
[144] Zurawski, D. V, Mumy, K. L, Faherty, C. S, Mccormick, B. A, & Maurelli, A. T. (2009).
Shigella flexneri type III secretion system effectors OspB and OspF target the nucleus
lo dovnreguIale lhe hosl infIammalory resonse via inleraclions vilh relinobIaslo
ma protein. Mol. Microbiol. 350368, 71
Chromatin Remodelling 198
Chapter 9
Rett Syndrome
Daniela Zahorakova
Additional information is available at the end of the chapter
http://dx.doi.org/10.5772/55020
1. Introduction
Defects in epigenetic mechanisms can give rise to several neurological and behavioral
phenotypes. Rett syndrome (MIM 312750) is a pervasive neurodevelopmental disorder that is
primarily caused by mutations in a gene encoding methyl-CpG-binding protein 2. The
functions of the protein are related to DNA methylation, a key epigenetic mechanism that plays
a critical role in gene silencing through chromatin remodeling. Rett syndrome was the first
human disorder in which a link between epigenetic modification and neuronal dysfunction
was discovered. In this chapter, the clinical features and the molecular pathology of Rett
syndrome will be discussed.
1.1. History
Rett syndrome was first recognized by the Viennese pediatrician Andreas Rett. In 1965, he
observed lvo girIs silling on lheir molhers' Ias in his vailing room. olh girIs vere ro
foundly intellectually disabled and were continually wringing their hands in the same unusual
manner. Dr. Rett recollected seeing such behavior in previous patients and searched for their
files with his secretary. They found several girls with a similar developmental history and
clinical features. He realized that these symptoms constituted something other than cerebral
palsy, which was the usual designation at the time. In 1966, Dr. Rett published the first
description of the disorder that now bears his name [1]. His paper, however, remained
unnoticed by the medical community until the 1980s, when Swedish child neurologist Bengt
Hagberg with colleagues published the same clinical findings and named the disorder Rett
syndrome [2]. Later, diagnostic criteria were proposed [3], and Rett syndrome became
recognized worldwide by pediatricians, neurologists, geneticists, and neuroscientists. Despite
great effort, the genetic cause of the disorder was not determined until more than 30 years after
the first clinical account. In 1999, mutations within the methyl-CpG-binding protein 2 gene
(MECP2) were identified in patients with Rett syndrome [4], which became a turning point in
2013 Zahorakova; licensee InTech. This is an open access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
Rett syndrome research. This discovery allowed the molecular confirmation of clinical cases
and contributed to amendments of the diagnostic criteria [5]. Most importantly, this finding
started an extensive investigation into the molecular mechanisms that underlie the pathology
of Rett syndrome.
1.2. Occurence
The estimated prevalence of Rett syndrome is 1:10,000 females by the age of 12 years old [6]
with no specific ethnic or geographical preference. Rett syndrome is one of the leading genetic
causes of profound mental retardation in females, second only to Down syndrome [7]. Male
cases are very rare, and their phenotypic manifestations are different from those observed in
girls with Rett syndrome.
2. Clinical aspects of Rett syndrome
2.1. Symptoms and stages
Rell syndrome, in ils cIassic form, begins lo manifesl in earIy chiIdhood and is characler
ized by neurodevelopmental regression that severely affects motor, cognitive, and commu
nications skills.
Prenatal and perinatal periods are usually normal. Affected girls appear to develop
normaIIy during lhe firsl 6 lo 18 monlhs of Iife and seem lo achieve aroriale deveIo
mental milestones. Nevertheless, retrospective analyses of home videos often show that,
even during this period, affected female infants display some suboptimal development.
This underdevelopment may include subtle motor and behavioral abnormalities, as well as
hypotonia and feeding problems. General mobility and eye-hand coordination may be
inadequate, and an excess of repetitive hand patting can be observed even during the first
year of life. However, the overall developmental pattern is not obviously disturbed. The
child is usually quiet and placid, and the parents often describe the child as very good
[1, 8-11]. The characteristic clinical features appear successively over several stages, forming
a distinctive disease progression pattern (Figure 1).
Stage I: Early onset stagnation (age of onset: 6-18 months). Psychomotor development
begins to slow, but the general developmental pattern is not significantly abnormal. The
deceIeralion of head grovlh (vhich evenluaIIy Ieads lo microcehaIy), grovlh relarda
lion, and veighl Ioss occur in mosl alienls. The chiId is deIayed or ceases in lhe acquisi
tion of skills. Although babbling and new words may appear, language skills usually
remain poor. A girl with Rett syndrome may become irritable and restless, and she may
begin to display some autistic features, such as emotional withdrawal and indifference to
the surrounding environment [11, 13, 14]
Stage II: Developmental regression (age of onset: 1-4 years). This stage may occur over a
period of days to weeks and is characterized by a rapid reduction or loss of acquired skills,
especially purposeful hand use, speech, and interpersonal contact [15]. In some patients, the
Chromatin Remodelling 200
decline of motor and communicative performances is more gradual. Interest in people and
objects is diminished, but eye contact may be preserved [11]. Voluntary hand use, such as
grasping and reaching out for toys, is replaced with repetitive stereotypic hand movements,
the hallmark of Rett syndrome. Patterns consisting of wringing, hand washing, mouthing,
clapping, rubbing, squeezing, and other hand automatisms occur during waking hours [1, 16,
17]. Febrile seizures are often present, and epileptic paroxysms occur in most patients [18, 19].
The severily of seizures can vary, ranging from reIaliveIy miId or easiIy conlroIIed by medi
cation to severe drug-resistant episodes [20]. Irregular breathing patterns, such as episodes of
hyperventilation, breath holding, and aerophagia, usually develop toward the end of the
regression period. Panting, spitting, and hypersalivation are also frequent symptoms [8, 21].
Stage III: Pseudostationary period (age of onset: 4-7 years, after stage II). This stage can last
for years or decades and is characterized by a relative stabilization of the disorder course.
Patients may recover some skills, which were lost during the regression stage. Patients can
become more |oyfuI and sociabIe, and lhey may use eye oinling as a lyicaI vay lo commu
nicate and to express their needs. Some patients may even learn new words and use simple
phrases in a meaningful way. Nevertheless, they continue to suffer from gross cognitive
impairments [14]. Despite improved eye contact and non-verbal communication ability, the
loss of motor functions further progresses in this stage. Stereotypic hand movements become
prominent, as do breathing irregularities. Many patients develop scoliosis, which is often
0.5 1 1.5 2
age
(years)
Stage I
Stage II
loss of acquired hand skills, speech, and social interaction
stereotypic hand movements, motor abnormalities, mental retardation
Stage III
seizures
breathing irregularities
Stage IV
decrease/loss of mobility
3 4 5 10 20 20
microcephaly, growth arrest, hypotonia
autistic features
autonomic disfunction
scoliosis
anxiety
Parkinsonism
apparently normal development
Figure 1. Onset and progression of Rett syndrome [12]
Rett Syndrome
http://dx.doi.org/10.5772/55020
201
rapidly progressive and eventually requires surgical treatment. Cold feet and lower limbs,
with or without color and atrophic changes, are also common. These conditions occur due to
poor perfusion, which is a consequence of altered autonomic control. Sleeping patterns are
often disturbed and are characterized by frequent nighttime waking and daytime sleeping.
Unexplained night laughing, sudden agitation and crying spells may also be present [11].
Stage IV: Late motor deterioration (age of onset: 5-15 years, after stage III). Non-verbal
communication and social skills continue to improve gradually. Despite persistent serious
cognitive impairment, older patients with Rett syndrome are usually, in contrast to patients
with childhood autism, sociable and pleasant with others [22]. Seizures become less frequent
and less severe, and stereotypic hand movements become less intense. However, motor
delerioralion conlinues vilh age. Mosl alienls, vho reviousIy couId vaIk, become nonam
bulatory and wheelchair-dependent. Decreased mobility leads to pronounced muscle wasting
and rigidity, and, at older ages, the patients often develop Parkinsonian features [11, 23, 24].
Females with Rett syndrome often survive into adulthood and older age, but their life
expectancy is less than that of the healthy population. The estimated annual death rate
from Rett syndrome is 1.2%. Approximately 25% of these deaths are sudden and they may
occur due to autonomic nervous system disturbances or cardiac abnormalities [25-27].
Many other features are associated with Rett syndrome, but they are not considered
diagnostic. The patients are generally small for their age [28], which may be due to poor
self-feeding abilities and problems with chewing and swallowing. They often suffer from
gastroesophageal reflux and bloating. Decreased intestinal motility often results in severe
constipation. Electroencephalogram results tend to be abnormal but without any clear
diagnostic pattern. A prolonged QT
c
interval is observed in many patients and presents a
risk for cardiac arrhythmia [26].
2.2. Rett syndrome variants
At least five atypical variants have been delineated in addition to classic Rett syndrome. These
variants do not have all of the diagnostic features, and they are either milder or more severe
than the classic form.
The most common atypical variant of Rett syndrome is forme fruste. This mild variant is
characterized by a protracted clinical course with partially preserved communication skills
and gross motor functions. Other neurological abnormalities that are typical for Rett syndrome
are more subtle and can be easily overlooked in this variant [30]. The mild forms of Rett
syndrome also include the late regression variant, which manifests in patients of preschool or
early school age [30], and the preserved speech variant (also called the Zappella variant) in
which patients have preserved language skills and normal head sizes [31].
Severe variants include the early-onset seizure variant (the Hanefeld variant) with the onset
of seizures before the age of 6 months [32] and the congenital variant, which is rare and lacks
the early period of normal psychomotor development [33]. The Hanefeld variant is often
caused by mutations in the CDKL5 gene [34], and most cases of the congenital variant are
related to mutations in the FOXG1 gene [35]. These genetic abnormalities raise the question of
Chromatin Remodelling 202
whether these variants are separate clinical entities, different from MECP2-related Rett
syndrome [11].
2.3. Diagnostic criteria
Despite a known genetic cause, Rett syndrome remains a clinical diagnosis. Its diagnosis is
based on several well-defined criteria (Table 1), which were revised several times over the past
few decades, most recently in 2010 [29].
Consider Rett syndrome diagnosis when postnatal deceleration of head growth is observed
Required for classic Rett syndrome
1. A period of regression followed by recovery or stabilization
2. All main and all exclusive criteria
3. Supportive criteria are not required, although often present in classic Rett syndrome
Required for atypical or variant Rett syndrome
1. A period of regression followed by recovery or stabilization
2. At least 2 of 4 main criteria
3. 5 out 11 supportive criteria
Main criteria
1. Partial or complete loss of acquired purposeful hand skills
2. Partial of complete loss of acquired spoken language
3. Gait abnormalities: impaired ability (dyspraxia) or absence of ability (apraxia)
4. Stereotypic hand movements such as hand wringing/squeezing, clapping/tapping, mouthing and washing/
rubbing automatisms
Exclusion criteria for classic Rett syndrome
1. Brain injury secondary to trauma (perinatally or postnatally), neurometabolic disease or severe infection that cause
neurological problems
2. Grossly abnormal psychomotor development in the first 6 months of life
Supportive criteria for atypical or variant Rett syndrome
1. Breathing disturbances when awake (hyperventilation, breath-holding, forced expulsion of air or saliva, air
swallowing)
2. Bruxism when awake (grinding or clenching of the teeth)
3. Impaired sleep pattern
4. Abnormal muscle tone
5. Peripheral vasomotor disturbances
6. Scoliosis/kyphosis
7. Growth retardation
8. Small cold hands and feet
9. Inappropriate laughing/screaming spells
10. Diminished sensitivity to pain
11. Intense eye communication and eye-pointing behavior
Table 1. Diagnostic criteria for Rett syndrome [29]
Rett Syndrome
http://dx.doi.org/10.5772/55020
203
3. The genetics of Rett syndrome
3.1. Mapping of the causative gene
The mode of inheritance of Rett syndrome was difficult to identify because more than 99%
of the cases are sporadic, and the patients rarely reproduce. Therefore, the traditional
genome-wide linkage analysis was not an applicable method for mapping the disease locus.
The lack of males manifesting the classic Rett syndrome phenotype together with the
occurrence of famiIies vilh affecled haIf-sislers suggesled an X-Iinked dominanl inheri
tance with lethality in hemizygous males [2, 36]. Focused exclusion mapping of the X
chromosome in available familial cases was used to narrow down the candidate region,
and the subsequent analysis of candidate genes in the patients finally revealed disease-
causing mutations in the MECP2 gene [4].
3.2. MECP2 gene
The MECP2 gene (MIM 300005) is located on Xq28 and undergoes X chromosome inactivation
(XCI) in females [37, 38]. The gene spans approximately 76 kb and consists of four exons, which
encode methyl-CpG-binding protein 2 (MeCP2). Alternative splicing of exon 2 and several
polyadenylation signals in a conserved and unusually long 3 untranslated region (3UTR) give
rise to eight different transcripts regulated in a tissue-specific and developmental stage-specific
manner [39-42]. For example, the shortest transcript (1.8 kb) is predominant in adult muscles,
heart, blood, and liver. The longest transcript (10.2 kb) occurs at the highest levels in the brain
[41, 42]. The unique expression patterns of each transcript suggest a specific biological
significance, such as a role in mRNA stability, nuclear export, folding, and sub-cellular
localization, thus affecting the levels of the resulting protein [39]. The longest transcript also
has one of the longest 3 UTR tails in the human genome (8.5 kb), with several blocks of highly
conserved residues between the human and mouse genomes. These findings argue in favor of
a potential regulatory role of the 3 UTR of the MECP2 gene [43].
3.3. MECP2 mutations
Mutations in the MECP2 gene are identified in 90-95% of classic Rett syndrome patients [4,
44]. Because only the coding region and the adjacent non-coding parts of the gene are routinely
analyzed, it is highly probable that mutations in more remote regulatory elements are
responsible for the rest of the cases. The frequency of MECP2 mutations in patients with
atypical Rett syndrome variants varies considerably between studies. However, the frequency
is generally lower (only 20-70% of patients have MECP2 mutations) than in the classic form
[44-46], suggesting that mutations of regulatory elements or other genes are involved more
often in atypical Rett syndrome than in the classic Rett syndrome. The identification of CDKL5
mutations in the Hanefeld variant and FOXG1 mutations in the congenital variant strongly
support the latter idea.
According to the Human Gene Mutation Database [47], more than 550 mutations have been
identified in the MECP2 gene in patients with Rett syndrome. The spectrum of mutations is
Chromatin Remodelling 204
helerogeneous, incIuding missense and nonsense mulalions, deIelions, inserlions, duIica
tions, splice-site mutations, and large deletions of several exons or the entire MECP2 gene.
More than 99% of the mutations occur de novo and moslIy originale on lhe alernaI X chro
mosome, which explains the high occurrence of Rett syndrome in the female gender [4, 48,
49]. Familial cases of Rett syndrome (mostly affected sisters or maternal half-sisters) are very
rare. MECP2 mutations in these patients are inherited from an asymptomatic or very mildly
affected mother, who carries a somatic mutation, but does not manifest the full pathogenic
phenotype due to favorable XCI pattern [50, 51]. Another explanation for transmission of a
MECP2 mutation to the next generation is a germline mosaicism for a mutation. It is suggested
when the MECP2 mutation identified in several affected children is not present in somatic cells
of their parents [51, 52].
The majority of point mutations in the MECP2 gene are C>T transitions, presumably resulting
from the spontaneous deamination of methylated cytosines [53]. The mutations are scattered
throughout the coding sequence and splice sites, with the exception of exon 2. The eight most
common mutations, which are also C>T transitions, account for approximately 70% of the Rett
syndrome cases. Approximately 10% of cases are due to deletions, which are mostly clustered
in the terminal segment of the coding region [12].
3.4. MECP2 mutations in males and other disorders
Mutations in the MECP2 gene have long been considered lethal in hemizygous males, and Rett
syndrome has been assumed to be exclusively a female disorder. More recently, MECP2
mutations were not only identified in males but also in females with phenotypes different from
Rett syndrome. MECP2-related disorders thus represent a broad spectrum of phenotypes in
both genders.
The estimated frequency of MECP2 mutations in boys with mental retardation is 1.3-1.7% [54].
Typical Rett syndrome features have been observed almost exclusively in boys with Klinefelter
syndrome (47,XXY) [55] or somatic mosaicism for a MECP2 mutation [56, 57j. Olher heno
types include severe congenital encephalopathy with death in the first years of life [58-60] and
mild to severe intellectual disability with or without various neurological and psychiatric
symptoms [54, 61]. The most common MECP2 mutations detected in males are duplications
of the whole MECP2 gene (and usually genes in its vicinity). This finding indicates that, besides
the lack, an overabundance of fully functional MeCP2 protein is also harmful to the CNS.
MECP2 duplication syndrome is usually very mild or does not manifest in females. In boys,
this syndrome is characterized by infantile hypotonia, severe mental retardation, loss of
speech, recurrent respiratory infections, seizures, and spasticity [62-64].
In females, MECP2 mutations have been detected in patients with mild mental retardation,
learning disabilities or autism [65, 66]. More severe cases include severe mental retardation
with seizures and Angelman-like syndrome [67, 68].
Rett Syndrome
http://dx.doi.org/10.5772/55020
205
3.5. MeCP2 protein
The MeCP2 protein is ubiquitously expressed, but it is particularly abundant in the brain [41,
69]. The protein levels are low during embryogenesis, but they progressively increase during
postnatal neuronal maturation and synaptogenesis [70-75]. High expression of MeCP2 in
mature neurons implies its involvement in postmitotic neuronal functions, such as the
modulation of neuronal activity and plasticity [12].
MeCP2 occurs in two isoforms that arise from alternative splicing of exon 2, and they differ
only by their N-termini (Figure 2). MeCP2 e1 (498 amino acids), generated by exons 1, 3, and
4, is the dominant MeCP2 isoform in the brain [76-78]. The MeCP2 e2 isoform (486 amino acids)
is encoded by exons 2, 3, and 4. Both isoforms were initially assumed to be functionally
equivalent, but recent observations imply that additional isoform-specific functions may exist.
This idea is strongly supported by the fact that no mutations in exon 2 have been found in Rett
syndrome patients, which contrasts with the finding of identified mutations in exon 1. Thus,
defects in MeCP2 e2 may lead to non-Rett phenotypes or fatally affect embryo viability [79, 80].
MeCP2 e1
ATG
MECP2
1 2 3 4
polyA
(1.8 kB)
polyA
(5.4 kB)
polyA
(7.5 kB)
polyA
(10.2 kB)
MeCP2 e1
MeCP2 e2
ATG
MeCP2 e2
MAAAAAAAPSGGGGGGEEERL
MVAGMLGLR
MBD: methyl-CpG-binding domain, TRD: transcriptional repression domain, C-ter: C-terminal domain, yellow boxes:
nuclear localization signals.
Figure 2. MECP2 gene structure and the isoforms MeCP2 e1 and MeCP2 e2 with different N-termini due to alternative
splicing of exon 2 and different translation start sites.
Apart from different N-terminal regions, both isoforms share the same amino acid sequence,
including at least three functional domains and two nuclear localization signals (Figure 2). The
methyl-CpG-binding domain (MBD) (amino acids 78-162) mediates binding to symmetrically
methylated CpG dinucleotides [81, 82], with a preference for CpGs with adjacent A/T-rich
motifs [83]. The MBD also binds to unmethylated four-way DNA junctions, which suggests
the role of MeCP2 in higher-order chromatin interactions [84]. The transcriptional repression
domain (TRD) (amino acids 207-310) interacts with numerous proteins, such as co-repressor
factors and histone deacetylases, HDAC1 and HDAC2. The nuclear localization signals (NLS)
Chromatin Remodelling 206
(amino acids 173-193 and 255-271) mediate transportation of the protein into the nucleus [85].
The C-terminal domain (amino acids 325-486) facilitates binding to DNA [86] and it most likely
increases protein stability [87]. This domain also contains conserved poly-proline motifs that
can bind to group II WW domain splicing factors [88].
3.6. MeCP2 function
The original model suggested that MeCP2 is a global transcriptional repressor [89], and it was
based on in vitro experiments in which MeCP2 inhibited transcription from methylated
promoters. Briefly, the protein binds to the promoters of target genes via its MBD, and the TRD
then recruits the co-repressor Sin3A and HDACs [90, 91]. These interactions lead to the
deacelyIalion of hislones, resuIling in chromalin condensalion and lhe reression of dovn
stream genes. In addition to Sin3A, other co-repressors, such as c-Ski and N-CoR, may interact
with MeCP2 [92j. The comaclion of chromalin can aIso be romoled lhrough direcl inlerac
tion with the C-terminal domain [93], which is an example of HDAC-independent MeCP2-
mediated transcriptional repression. The TRD may also directly interact with transcription
factor IIB; therefore, MeCP2 may silence transcription by interfering with the assembly of the
transcriptional preinitiation complex [94]. Additional factors interacting with the TRD include
Brahma, which is a catalytic component of the SWI/SNF-related chromatin-remodeling
complex (at least in NIH 3T3 cells) [95], DNA methyltransferase 1 [96], and ATRX, a SWI2/
SNF2 DNA helicase/ATPase [97].
Surprisingly, transcriptional profiling studies did not reveal major gene expression changes
caused by the lack of functional MeCP2 protein [98, 99]. These observations, together with
additional evidence, implied that MeCP2 regulates the transcription of tissue-specific genes in
specific brain regions during certain developmental stages instead of acting as a global
repressor [98, 100-102]. However, recent studies suggest that MeCP2 reduces genome-wide
transcriptional noise, potentially by repressing spurious transcription of repetitive elements
[103, 104]. Surprisingly, MeCP2 also interacts with the transcriptional activator CREB, and its
genomic distribution is often associated with actively transcribed genes [105, 106]. MeCP2
apparently has dual roles in transcriptional regulation as a repressor and as an activator, and
it performs different downstream responses depending on the context.
MeCP2 additionally acts as an architectural chromatin protein that is involved in chromatin
remodeling and nucleosome clustering, which is consistent with the fact that the majority of
MeCP2-binding sites are located outside of genes [105, 107]. MeCP2 can bind in vitro to
chromatin fibers and compact them into higher order structures [93, 108, 109].
For further complexity, MeCP2 may also be involved in RNA splicing. Its interaction with the
RNA-binding protein Y box-binding protein 1 (YB-1) has been observed, and MeCP2-deficient
mice showed aberrant alternative splicing patterns [110].
MeCP2 functions are undeniably much more complex than initially anticipated (Figure 3),
although the precise mechanisms of their regulation remain unknown.
Rett Syndrome
http://dx.doi.org/10.5772/55020
207
Figure 3. Representation of multiple MeCP2 roles [111].
3.7. MeCP2 target genes
A comprehensive knowledge of the target genes that are controlled by MeCP2 is essential for
understanding the pathomechanisms of Rett syndrome and subsequently developing effective
lheraeulic slralegies. MuIliIe sludies have allemled lo idenlify genes vilh aIlered exres
sion in neuronal and nonneuronal tissues from Rett syndrome patients and mouse models,
but these studies have often yielded conflicting results [102, 106, 112, 113]. Nevertheless,
several candidate target genes have been proposed (Table 2). One of the most extensively
studied target genes is the brain-derived neurotrophic factor gene (Bdnf), which has been
shown to be up and down regulated in an activity-dependent manner through MeCP2
phosphorylation in mice [113-115]. Other targets, such as the imprinted genes Dlx5 and Dlx6,
also revealed a novel mode of gene repression mediated by MeCP2 through the formation of
a silent chromatin loop (Figure 3) [116, 117].
Chromatin Remodelling 208
Gene Function Reference
UBE3A member of ubiquitin proteasome pathway, transcriptional co-activator [118]
GABRB3 neurotransmission (GABA-A receptor) [118]
PCDHB1 cell adhesion [119]
PCDH7 cell adhesion [119]
Bdnf neuronal development and survival, neuronal plasticity, learning and memory
(brain derived neurotropic factor)
[113, 114]
Dlx5 neuronal transcription factor (probably involved in control of GABAergic
differentiation)
[116]
Sgk1 hormone signaling (regulation of renal functions and blood pressure) [120]
Fkbp5 hormone signaling (regulation of glucocorticoid receptor sensitivity) [120]
Uqcrc1 member of mitochondrial respiratory chain [121]
ID1, ID2, ID3, ID4transcription factors (involved in cell differentiation and neural development) [122]
FXYD1 ion channel regulator [123]
IGFBP3 hormone signaling (regulation of cell proliferation and apoptosis) [124]
GDI1 regulation of GDP/GTP exchange [112]
APLP1 enhancer of neuronal apoptosis [112]
CLU Extracellular molecular chaperone [112]
Crh neuropeptide (regulation of neuroendocrine stress response) [125]
Table 2. Some of MeCP2 target genes.
3.8. The effect of MECP2 mutations on MeCP2 function
Mutations in the MECP2 gene are not likely to act in a dominant-negative mechanism because
only one allele is active in each female cell due to XCI. The functional consequences of missense
mutations on the function of the MeCP2 protein are sometimes especially difficult to predict.
This difficulty is because testing the proteins various functions can be problematic because
there are still many MeCP2 roles that are as yet unknown or not fully understood. Generally,
mutations in the NLS prevent the transportation of the protein to the nucleus. Mutations
located within the MBD reduce the affinity of the protein for methylated DNA [87, 126].
However, several mutant proteins with mutations in the MBD have been shown to bind to
heterochromatin [127]. Proteins with an intact MBD but with a mutated TRD retain their ability
to bind to methylated DNA, but they have impaired repressing activity [87]. Other mutations
may affect the stability or the structure (secondary or tertiary) of the protein, and they may
interfere with other functions of the protein.
Rett Syndrome
http://dx.doi.org/10.5772/55020
209
3.9. Genotype-phenotype correlation
The severity of the clinical manifestations in Rett syndrome patients is widely variable and is
relevant beyond the context of classic vs. atypical variants. Therefore, much effort has been
devoted to uncovering the relationships between various MECP2 mutations and the variability
of clinical features. Such knowledge may provide information on the likely clinical profile of
new cases with specific MECP2 mutations and may be useful in designing specific preventive
therapeutic interventions.
The general genotype-phenotype correlations were confirmed by numerous studies. As
expected, patients with early truncating mutations (specifically p.R168X, p.R270X, p.R255X),
large deletions of several exons, or the entire MECP2 gene usually have the most severe clinical
presentations. A milder phenotype is often associated with late truncating mutations that do
not affect the MBD or the TRD, such as p.R294X. Interestingly, late truncating mutations
together with the missense mutation p.R133C, which is located in the MBD, are frequently
detected in patients with a preserved speech variant of Rett syndrome [128-133].
Despite some overall trends, considerable variability in clinical severity is often observed
among patients with the same MECP2 mutation [128, 130, 134]. Such variations may be caused
by a different XCI pattern. Favorable skewing of XCI has been observed in some patients with
milder phenotypes [135-137] and in asymptomatic carrier mothers [58, 135, 138]. However,
XCI cannot be used as the single predictor because, according to several studies, it has
limitations in explaining all of the differences of Rett syndrome severity [139-141]. Other
modulation factors have been considered, such as BDNF [142, 143] and APOE [144].
3.10. Genetic counseling
A negative result from the MECP2 analysis (usually including analysis of the entire coding
region and copy number analysis of large deletions/duplications) does not rule out the
diagnosis of Rett syndrome because regulatory and non-coding regions are not routinely
analyzed. The recurrence risk in a family with a single Rett syndrome case and an otherwise
negative family history is very low (less than 0.5%) because the majority of MECP2 mutations
arise de novo. Mothers of the patients, however, should be tested for MECP2 mutations found
in their daughters to rule out the possibility of being asymptomatic carriers. In such case, the
recurrence risk is 50%. Prenatal diagnosis may be performed even in pregnancies of non-carrier
mothers due to the likelihood of germline mosaicism.
4. Management of Rett syndrome
Currently, there is no effective cure for Rett syndrome. However, hopes for developing a
largeled lheray have risen foIIoving lhe announcemenl of a sludy lhal rescued lhe alho
logical phenotype in a mouse model after postnatal reactivation of Mecp2 [145, 146]. Treatment
slralegies are currenlIy symlomalic and revenlive. These slralegies are aimed al ameIioral
ing specific symptoms, such as seizures, mood disturbances, sleeping and feeding problems,
as well as maintaining and improving motor and communication functions.
Chromatin Remodelling 210
Rehabilitation programs and physical therapy help to control and improve balance and
movement, maintain flexibility and strengthen muscles. These programs should be adapted
to the patients individual state and needs. Proper physical therapy is also important for
preventing joint contractures and other deformities, such as scoliosis. Occupational therapy
is recommended for improving purposeful hand use and to attenuate stereotypic hand
movemenls. IarlicuIar care shouId be laken lo reserve and mainlain aIlernalive commu
nication (eye contact, eye pointing, facial expressions, signs, etc.) and thereby improving
social interactions. Receiving necessary nutrients and maintaining an adequate weight may
result in improved growth. To ensure appropriate caloric and nutritional intake, a high-
fat, high-calorie diet or gastrostomy feeding may be required. Sufficient intake of fluid and
high-fiber food is necessary to prevent constipation. The patients with cardiac conduction
defects (such as prolonged QT
c
intervals) should avoid certain medications, which may
worsen the condition. These medications include several antipsychotics (thioridazine,
tricyclic antidepressants), certain antiarrhythmics (quinidine, sotalol, amiodarone), and
antibiotics (erythromycin) [147].
Early diagnosis and intervention, together with life-long management focused on each
patients specific needs, can significantly improve the health, quality of life, and longevity of
patients with Rett syndrome.
5. Conclusion
Much progress has been made in the identification of the multiple roles of the MeCP2 protein
in the brain since its discovery. Nevertheless, many mysteries still remain in understanding
the precise mechanisms of how MECP2 mutations affect protein function and subsequently
contribute to the pathogenesis of Rett syndrome. A significant phenotypic overlap between
Rett syndrome and several neurodevelopmental disorders implies that a common pathogenic
process may induce or at least contribute to these conditions. The identification of pathogenic
MECP2 mutations in a portion of patients without the classic Rett syndrome phenotype
strengthens this theory. Understanding the molecular pathology underlying Rett syndrome
will therefore shed more light on the role of epigenetic modifications in neuronal development
and function, and it may provide insight into the pathogenesis of other neurodevelopmental
disorders.
Acknowledgements
I would like to thank prof. Pavel Martasek, MD, Ph.D. for helpful discussions and critical
reading of the manuscript. The author was supported by grants NT 13120-4/2012, MZCR RVO-
VFN64165/2012, P24/LF1/3, and UNCE 204011/2012.
Rett Syndrome
http://dx.doi.org/10.5772/55020
211
Author details
Daniela Zahorakova
*
Address all correspondence to: [email protected]
Dearlmenl of Iedialrics and AdoIescenl Medicine, Iirsl IacuIly of Medicine CharIes Uni
versity and General Teaching Hospital, Prague, Czech Republic
References
[1] Rett A. [On a unusual brain atrophy syndrome in hyperammonemia in childhood].
Wiener Medizinische Wochenschrift 1966;116(37): 723-6.
[2] Hagberg , Aicardi }, Dias K, Ramos O. A rogressive syndrome of aulism, demen
lia, alaxia, and Ioss of urosefuI hand use in girIs: Rell's syndrome: reorl of 35 cas
es. Annals of Neurology 1983;14(4): 471-9.
[3] Hagberg , Goulieres I, HanefeId I, Rell A, WiIson }. Rell syndrome: crileria for in
clusion and exclusion. Brain and Development 1985;7(3): 372-3.
[4] Amir RI, Van den Veyver I, Wan M, Tran CQ, Irancke U, Zoghbi HY. Rell syn
drome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding
protein 2. Nature Genetics 1999;23(2): 185-8.
[5] Hagberg , HanefeId I, Iercy A, Sk|eIdaI O. An udale on cIinicaIIy aIicabIe diag
noslic crileria in Rell syndrome. Commenls lo Rell Syndrome CIinicaI Crileria Con
sensus Panel Satellite to European Paediatric Neurology Society Meeting, Baden
Baden, Germany, 11 September 2001. European Journal of Paediatric Neurology
2002;6(5): 293-7.
[6] Laurvick CL, de Klerk N, Bower C, Christodoulou J, Ravine D, Ellaway C, et al. Rett
syndrome in Australia: a review of the epidemiology. Journal of Pediatrics
2006;148(3): 347-52.
[7] IIIavay C, ChrislodouIou }. Rell syndrome: cIinicaI udale and reviev of recenl ge
netic advances. Journal of Paediatrics and Child Health 1999;35(5): 419-26.
[8] Kerr AM. Early clinical signs in the Rett disorder. Neuropediatrics 1995;26(2): 67-71.
[9] urford , Kerr AM, MacIeod HA. Nurse recognilion of earIy devialion in deveIo
ment in home videos of infants with Rett disorder. Journal of Intellectual Disability
Research 2003;47(Pt 8): 588-96.
Chromatin Remodelling 212
[10] Einspieler C, Kerr AM, Prechtl HF. Abnormal general movements in girls with Rett
disorder: the first four months of life. Brain and Development 2005;27 Suppl 1: S8-
S13.
[11] Smeets EE, Pelc K, Dan B. Rett Syndrome. Molecular Syndromology 2011;2(3-5):
113-27.
[12] Chahrour M, Zoghbi HY. The story of Rett syndrome: from clinic to neurobiology.
Neuron 2007;56(3): 422-37.
[13] Nomura Y, Segawa M. Natural history of Rett syndrome. Journal of Child Neurology
2005;20(9): 764-8.
[14] Shahbazian MD, Zoghbi HY. Rett syndrome and MeCP2: linking epigenetics and
neuronal function. American Journal of Human Genetics 2002;71(6): 1259-72.
[15] Nomura Y. Early behavior characteristics and sleep disturbance in Rett syndrome.
Brain and Development 2005;27 Suppl 1: S35-S42.
[16] Nomura Y, Segawa M. Motor symptoms of the Rett syndrome: abnormal muscle
tone, posture, locomotion and stereotyped movement. Brain and Development
1992;14 Suppl: S21-8.
[17] Hagberg . Rell syndrome: cIinicaI ecuIiarilies and bioIogicaI mysleries. Acla Iae
diatrica 1995;84(9): 971-6.
[18] GIaze DG, Irosl }D, }r., Zoghbi HY, Iercy AK. Rell's syndrome. CorreIalion of eIec
troencephalographic characteristics with clinical staging. Archives of Neurology
1987;44(10): 1053-6.
[19] Sleffenburg U, Hagberg G, Hagberg . IiIesy in a reresenlalive series of Rell syn
drome. Acta Paediatrica 2001;90(1): 34-9.
[20] Jian L, Nagarajan L, de Klerk N, Ravine D, Bower C, Anderson A, et al. Predictors of
seizure onset in Rett syndrome. Journal of Pediatrics 2006;149(4): 542-7.
[21] Will Ingerslrom I. Age-reIaled occurrence of signs and symloms in lhe Rell syn
drome. Brain and Development 1992;14 Suppl: S11-20.
[22] Mount RH, Hastings RP, Reilly S, Cass H, Charman T. Behavioural and emotional
features in Rett syndrome. Disability and Rehabilitation 2001;23(3-4): 129-38.
[23] Hagberg , Will-Ingerslrom I. Rell syndrome: a suggesled slaging syslem for de
scribing impairment profile with increasing age towards adolescence. American
Journal of Medical Genetics Suppl 1986;1: 47-59.
[24] Roze E, Cochen V, Sangla S, Bienvenu T, Roubergue A, Leu-Semenescu S, et al. Rett
syndrome: an overlooked diagnosis in women with stereotypic hand movements,
psychomotor retardation, Parkinsonism, and dystonia? Movement Disorders
2007;22(3): 387-9.
Rett Syndrome
http://dx.doi.org/10.5772/55020
213
[25] Kerr AM, Armstrong DD, Prescott RJ, Doyle D, Kearney DL. Rett syndrome: analysis
of deaths in the British survey. European Child & Adolescent Psychiatry 1997;6
Suppl 1: 71-4.
[26] Guideri I, Acama M, Hayek G, ZaeIIa M, Di Ierri T. Reduced hearl rale variabiIi
ty in patients affected with Rett syndrome. A possible explanation for sudden death.
Neuropediatrics 1999;30(3): 146-8.
[27] Kerr AM, }uIu IO. Recenl insighls inlo hyervenliIalion from lhe sludy of Rell syn
drome. Archives of Disease in Childhood 1999;80(4): 384-7.
[28] HoIm VA. IhysicaI grovlh and deveIomenl in alienls vilh Rell syndrome. Ameri
can Journal of Medical Genetics Suppl 1986;1: 119-26.
[29] Neul JL, Kaufmann WE, Glaze DG, Christodoulou J, Clarke AJ, Bahi-Buisson N, et al.
Rett syndrome: revised diagnostic criteria and nomenclature. Annals of Neurology
2010;68(6): 944-50.
[30] Hagberg B. Clinical manifestations and stages of Rett syndrome. Mental Retardation
and Developmental Disabilities Research Reviews 2002;8(2): 61-5.
[31] Zappella M. The Rett girls with preserved speech. Brain and Development
1992;14(2): 98-101.
[32] Hanefeld F. The clinical pattern of the Rett syndrome. Brain and Development
1985;7(3): 320-5.
[33] Hagberg A, Sk|eIdaI OH. Rell varianls: a suggesled modeI for incIusion crileria. Ie
diatric Neurology 1994;11(1): 5-11.
[34] Tao J, Van Esch H, Hagedorn-Greiwe M, Hoffmann K, Moser B, Raynaud M, et al.
Mulalions in lhe X-Iinked cycIin-deendenl kinase-Iike 5 (CDKL5/STK9) gene are as
sociated with severe neurodevelopmental retardation. American Journal of Human
Genetics 2004;75(6): 1149-54.
[35] Ariani F, Hayek G, Rondinella D, Artuso R, Mencarelli MA, Spanhol-Rosseto A, et al.
FOXG1 is responsible for the congenital variant of Rett syndrome. American Journal
of Human Genetics 2008;83(1): 89-93.
[36] Killian W. On the genetics of Rett syndrome: analysis of family and pedigree data.
American Journal of Medical Genetics Suppl 1986;1: 369-76.
[37] D'Isosilo M, Quaderi NA, CiccodicoIa A, runi I, Isosilo T, D'Urso M, el aI. IsoIa
tion, physical mapping, and northern analysis of the X-linked human gene encoding
methyl CpG-binding protein, MECP2. Mammalian Genome 1996;7(7): 533-5.
[38] Sirianni N, Naidu S, Pereira J, Pillotto RF, Hoffman EP. Rett syndrome: confirmation
of X-linked dominant inheritance, and localization of the gene to Xq28. American
Journal of Human Genetics 1998;63(5): 1552-8.
Chromatin Remodelling 214
[39] Coy }I, SedIacek Z, achner D, DeIius H, Iouslka A. A comIex allern of evoIulion
ary conservalion and aIlernalive oIyadenyIalion vilhin lhe Iong 3"-unlransIaled re
gion of the methyl-CpG-binding protein 2 gene (MeCP2) suggests a regulatory role
in gene expression. Human Molecular Genetics 1999;8(7): 1253-62.
[40] ReichvaId K, Thiesen }, Wiehe T, WeilzeI }, Iouslka WA, RosenlhaI A, el aI. Coma
ralive sequence anaIysis of lhe MICI2-Iocus in human and mouse reveaIs nev lran
scribed regions. Mammalian Genome 2000;11(3): 182-90.
[41] Shahbazian MD, Antalffy B, Armstrong DL, Zoghbi HY. Insight into Rett syndrome:
MeCP2 levels display tissue- and cell-specific differences and correlate with neuronal
maturation. Human Molecular Genetics 2002;11(2): 115-24.
[42] Pelka GJ, Watson CM, Christodoulou J, Tam PP. Distinct expression profiles of
Mecp2 transcripts with different lengths of 3'UTR in the brain and visceral organs
during mouse development. Genomics 2005;85(4): 441-52.
[43] Sanlos M, Yan }, Temudo T, OIiveira G, Vieira }I, Ien }, el aI. AnaIysis of highIy con
served regions of the 3'UTR of MECP2 gene in patients with clinical diagnosis of Rett
syndrome and other disorders associated with mental retardation. Disease Markers
2008;24(6): 319-24.
[44] Percy AK. Rett syndrome: recent research progress. Journal of Child Neurology
2008;23(5): 543-9.
[45] Psoni S, Sofocleous C, Traeger-Synodinos J, Kitsiou-Tzeli S, Kanavakis E, Fryssira-
Kanioura H. MECP2 mutations and clinical correlations in Greek children with Rett
syndrome and associated neurodevelopmental disorders. Brain and Development
2012;34(6): 487-95.
[46] Raizis AM, Saleem M, MacKay R, George PM. Spectrum of MECP2 mutations in
New Zealand Rett syndrome patients. The New Zealand Medical Journal
2009;122(1296): 21-8.
[47] Stenson PD, Ball EV, Mort M, Phillips AD, Shiel JA, Thomas NS, et al. Human Gene
Mutation Database (HGMD): 2003 update. Human Mutation 2003;21(6): 577-81.
[48] Girard M, Couvert P, Carrie A, Tardieu M, Chelly J, Beldjord C, et al. Parental origin
of de novo MICI2 mulalions in Rell syndrome. Iuroean }ournaI of Human Genel
ics 2001;9(3): 231-6.
[49] Trappe R, Laccone F, Cobilanschi J, Meins M, Huppke P, Hanefeld F, et al. MECP2
mulalions in soradic cases of Rell syndrome are aImosl excIusiveIy of alernaI ori
gin. American Journal of Human Genetics 2001;68(5): 1093-101.
[50] Knudsen GP, Neilson TC, Pedersen J, Kerr A, Schwartz M, Hulten M, et al. Increased
skewing of X chromosome inactivation in Rett syndrome patients and their mothers.
European Journal of Human Genetics 2006;14(11): 1189-94.
Rett Syndrome
http://dx.doi.org/10.5772/55020
215
[51] Wan M, Lee SS, Zhang X, Houvink-ManviIIe I, Song HR, Amir RI, el aI. Rell syn
drome and beyond: recurrent spontaneous and familial MECP2 mutations at CpG
hotspots. American Journal of Human Genetics 1999;65(6): 1520-9.
[52] Mari F, Caselli R, Russo S, Cogliati F, Ariani F, Longo I, et al. Germline mosaicism in
Rett syndrome identified by prenatal diagnosis. Clinical Genetics 2005;67(3): 258-60.
[53] Lee SS, Wan M, Francke U. Spectrum of MECP2 mutations in Rett syndrome. Brain
and Development 2001;23 Suppl 1: S138-43.
[54] Villard L. MECP2 mutations in males. Journal of Medical Genetics 2007;44(7): 417-23.
[55] Schwartzman JS, Bernardino A, Nishimura A, Gomes RR, Zatz M. Rett syndrome in
a boy with a 47,XXY karyotype confirmed by a rare mutation in the MECP2 gene.
Neuropediatrics 2001;32(3): 162-4.
[56] Armstrong J, Pineda M, Aibar E, Gean E, Monros E. Classic Rett syndrome in a boy
as a result of somatic mosaicism for a MECP2 mutation. Annals of Neurology
2001;50(5): 692.
[57] Iieras }I, Munoz-CabeIIo , orrego S, Marcos I, Sanchez }, Madruga M, el aI. Somal
ic mosaicism for Y120X mutation in the MECP2 gene causes atypical Rett syndrome
in a male. Brain and Development 2011;33(7): 608-11.
[58] Villard L, Kpebe A, Cardoso C, Chelly PJ, Tardieu PM, Fontes M. Two affected boys
in a Rett syndrome family: clinical and molecular findings. Neurology 2000;55(8):
1188-93.
[59] Geerdink N, Rotteveel JJ, Lammens M, Sistermans EA, Heikens GT, Gabreels FJ, et al.
MICI2 mulalion in a boy vilh severe neonalaI encehaIoalhy: cIinicaI, neuroa
thological and molecular findings. Neuropediatrics 2002;33(1): 33-6.
[60] Lundvall M, Samuelsson L, Kyllerman M. Male Rett phenotypes in T158M and
R294X MeCP2-mutations. Neuropediatrics 2006;37(5): 296-301.
[61] Moog U, Smeets EE, van Roozendaal KE, Schoenmakers S, Herbergs J, Schoonbrood-
Lenssen AM, el aI. NeurodeveIomenlaI disorders in maIes reIaled lo lhe gene caus
ing Rett syndrome in females (MECP2). European Journal of Paediatric Neurology
2003;7(1): 5-12.
[62] Van Isch H, aulers M, Ignalius }, }ansen M, Raynaud M, HoIIanders K, el aI. DuIi
calion of lhe MICI2 region is a frequenl cause of severe menlaI relardalion and ro
gressive neurological symptoms in males. American Journal of Human Genetics
2005;77(3): 442-53.
[63] Van Esch H. MECP2 Duplication Syndrome. Molecular Syndromology 2012;2(3-5):
128-36.
[64] Ramocki MB, Tavyev YJ, Peters SU. The MECP2 duplication syndrome. American
Journal of Medical Genetics Part A 2010;152A(5): 1079-88.
Chromatin Remodelling 216
[65] Lam CW, Yeung WL, Ko CH, Ioon IM, Tong SI, Chan KY, el aI. Seclrum of mula
lions in lhe MICI2 gene in alienls vilh infanliIe aulism and Rell syndrome. }our
nal of Medical Genetics 2000;37(12): E41.
[66] Carney RM, Wolpert CM, Ravan SA, Shahbazian M, Ashley-Koch A, Cuccaro ML, et
aI. Idenlificalion of MeCI2 mulalions in a series of femaIes vilh aulislic disorder. Ie
diatric Neurology 2003;28(3): 205-11.
[67] Walson I, Iack G, Ramsden S, arrov M, Suer M, Kerr , el aI. AngeIman syn
drome phenotype associated with mutations in MECP2, a gene encoding a methyl
CpG binding protein. Journal of Medical Genetics 2001;38(4): 224-8.
[68] Milani D, Pantaleoni C, D'Arrigo S, Selicorni A, Riva D. Another patient with MECP2
mutation without classic Rett syndrome phenotype. Pediatric Neurology 2005;32(5):
355-7.
[69] LaSaIIe }M, GoIdsline }, aImer D, Greco CM. Quanlilalive IocaIizalion of heleroge
neous methyl-CpG-binding protein 2 (MeCP2) expression phenotypes in normal and
Rett syndrome brain by laser scanning cytometry. Human Molecular Genetics
2001;10(17): 1729-40.
[70] Cohen DR, Matarazzo V, Palmer AM, Tu Y, Jeon OH, Pevsner J, et al. Expression of
MeCP2 in olfactory receptor neurons is developmentally regulated and occurs before
synaptogenesis. Molecular and Cellular Neuroscience 2003;22(4): 417-29.
[71] Jung BP, Jugloff DG, Zhang G, Logan R, Brown S, Eubanks JH. The expression of
melhyI CG binding faclor MeCI2 correIales vilh ceIIuIar differenlialion in lhe de
veloping rat brain and in cultured cells. Journal of Neurobiology 2003;55(1): 86-96.
[72] Samaco RC, Nagarajan RP, Braunschweig D, LaSalle JM. Multiple pathways regulate
MeCI2 exression in normaI brain deveIomenl and exhibil defecls in aulism-sec
trum disorders. Human Molecular Genetics 2004;13(6): 629-39.
[73] Kishi N, MackIis }D. Dissecling MICI2 funclion in lhe cenlraI nervous syslem. }our
nal of Child Neurology 2005;20(9): 753-9.
[74] Smrt RD, Eaves-Egenes J, Barkho BZ, Santistevan NJ, Zhao C, Aimone JB, et al.
Mec2 deficiency Ieads lo deIayed maluralion and aIlered gene exression in hio
campal neurons. Neurobiology of Disease 2007;27(1): 77-89.
[75] Svanberg SI, Nagara|an RI, Ieddada S, Yasui DH, LaSaIIe }M. RecirocaI co-reguIa
lion of IGR2 and MICI2 is disruled in Rell syndrome and aulism. Human MoIecu
lar Genetics 2009;18(3): 525-34.
[76] Mnatzakanian GN, Lohi H, Munteanu I, Alfred SE, Yamada T, MacLeod PJ, et al. A
previously unidentified MECP2 open reading frame defines a new protein isoform
relevant to Rett syndrome. Nature Genetics 2004;36(4): 339-41.
Rett Syndrome
http://dx.doi.org/10.5772/55020
217
[77] Dragich JM, Kim YH, Arnold AP, Schanen NC. Differential distribution of the
MeCP2 splice variants in the postnatal mouse brain. The Journal of Comparative
Neurology 2007;501(4): 526-42.
[78] Kriaucionis S, Bird A. The major form of MeCP2 has a novel N-terminus generated
by alternative splicing. Nucleic Acids Research 2004;32(5): 1818-23.
[79] Iloh M, Tahimic CG, Ide S, Olsuki A, Sasaoka T, Noguchi S, el aI. MelhyI CG-bind
ing rolein isoform MeCI2_e2 is disensabIe for Rell syndrome henolyes bul es
sential for embryo viability and placenta development. The Journal of Biological
Chemistry 2012;287(17): 13859-67.
[80] Daslidar SG, ardai IH, Ma C, Irice V, Raval V, Verma I, el aI. Isoform-secific lox
icily of Mec2 in oslmilolic neurons: suression of neuroloxicily by IoxG1. }our
nal of Neuroscience 2012;32(8): 2846-55.
[81] Levis }D, Meehan RR, HenzeI W}, Maurer-Iogy I, }eesen I, KIein I, el aI. Iurifica
tion, sequence, and cellular localization of a novel chromosomal protein that binds to
methylated DNA. Cell 1992;69(6): 905-14.
[82] Nan X, Meehan RR, Bird A. Dissection of the methyl-CpG binding domain from the
chromosomal protein MeCP2. Nucleic Acids Research 1993;21(21): 4886-92.
[83] Klose RJ, Sarraf SA, Schmiedeberg L, McDermott SM, Stancheva I, Bird AP. DNA
binding selectivity of MeCP2 due to a requirement for A/T sequences adjacent to
methyl-CpG. Molecular Cell 2005;19(5): 667-78.
[84] Galvao TC, Thomas JO. Structure-specific binding of MeCP2 to four-way junction
DNA through its methyl CpG-binding domain. Nucleic Acids Research 2005;33(20):
6603-9.
[85] Nan X, Tate P, Li E, Bird A. DNA methylation specifies chromosomal localization of
MeCP2. Molecular and Cellular Biology 1996;16(1): 414-21.
[86] ChandIer SI, Guschin D, Landsberger N, WoIffe AI. The melhyI-CG binding lran
scriptional repressor MeCP2 stably associates with nucleosomal DNA. Biochemistry
1999;38(22): 7008-18.
[87] Yusufzai TM, Wolffe AP. Functional consequences of Rett syndrome mutations on
human MeCP2. Nucleic Acids Research 2000;28(21): 4172-9.
[88] Buschdorf JP, Stratling WH. A WW domain binding region in methyl-CpG-binding
protein MeCP2: impact on Rett syndrome. Journal of Molecular Medicine 2004;82(2):
135-43.
[89] Nan X, Camoy I}, ird A. MeCI2 is a lranscrilionaI reressor vilh abundanl bind
ing sites in genomic chromatin. Cell 1997;88(4): 471-81.
Chromatin Remodelling 218
[90] }ones IL, Veenslra G}, Wade IA, Vermaak D, Kass SU, Landsberger N, el aI. Melhy
lated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nature
Genetics 1998;19(2): 187-91.
[91] Nan X, Ng HH, }ohnson CA, Laherly CD, Turner M, Iisenman RN, el aI. Transcri
lionaI reression by lhe melhyI-CG-binding rolein MeCI2 invoIves a hislone de
acetylase complex. Nature 1998;393(6683): 386-9.
[92] Kokura K, Kaul SC, Wadhwa R, Nomura T, Khan MM, Shinagawa T, et al. The Ski
rolein famiIy is required for MeCI2-medialed lranscrilionaI reression. The }our
nal of Biological Chemistry 2001;276(36): 34115-21.
[93] Nikilina T, Shi X, Ghosh RI, Horovilz-Scherer RA, Hansen }C, Woodcock CL. MuIli
ple modes of interaction between the methylated DNA binding protein MeCP2 and
chromatin. Molecular and Cellular Biology 2007;27(3): 864-77.
[94] KaIudov NK, WoIffe AI. MeCI2 driven lranscrilionaI reression in vilro: seIeclivi
ty for methylated DNA, action at a distance and contacts with the basal transcription
machinery. Nucleic Acids Research 2000;28(9): 1921-8.
[95] Harikrishnan KN, Chow MZ, Baker EK, Pal S, Bassal S, Brasacchio D, et al. Brahma
Iinks lhe SWI/SNI chromalin-remodeIing comIex vilh MeCI2-deendenl lran
scriptional silencing. Nature Genetics 2005;37(3): 254-64.
[96] Kimura H, Shiota K. Methyl-CpG-binding protein, MeCP2, is a target molecule for
maintenance DNA methyltransferase, Dnmt1. The Journal of Biological Chemistry
2003;278(7): 4806-12.
[97] Nan X, Hou J, Maclean A, Nasir J, Lafuente MJ, Shu X, et al. Interaction between
chromatin proteins MECP2 and ATRX is disrupted by mutations that cause inherited
mental retardation. Proceedings of the National Academy of Sciences of the United
States of America 2007;104(8): 2709-14.
[98] Tudor M, Akbarian S, Chen RZ, Jaenisch R. Transcriptional profiling of a mouse
modeI for Rell syndrome reveaIs sublIe lranscrilionaI changes in lhe brain. Iroceed
ings of the National Academy of Sciences of the United States of America
2002;99(24): 15536-41.
[99] Traynor }, AgarvaI I, Lazzeroni L, Irancke U. Gene exression allerns vary in cIo
nal cell cultures from Rett syndrome females with eight different MECP2 mutations.
BMC Medical Genetics 2002;3: 12.
[100] Colantuoni C, Jeon OH, Hyder K, Chenchik A, Khimani AH, Narayanan V, et al.
Gene exression rofiIing in oslmorlem Rell Syndrome brain: differenliaI gene ex
pression and patient classification. Neurobiology of Disease 2001;8(5): 847-65.
[101] Ballestar E, Ropero S, Alaminos M, Armstrong J, Setien F, Agrelo R, et al. The impact
of MECP2 mutations in the expression patterns of Rett syndrome patients. Human
Genetics 2005;116(1-2): 91-104.
Rett Syndrome
http://dx.doi.org/10.5772/55020
219
[102] Jordan C, Li HH, Kwan HC, Francke U. Cerebellar gene expression profiles of mouse
models for Rett syndrome reveal novel MeCP2 targets. BMC Medical Genetics
2007;8: 36.
[103] Muolri AR, Marchello MC, CoufaI NG, Oefner R, Yeo G, Nakashima K, el aI. L1 rel
rotransposition in neurons is modulated by MeCP2. Nature 2010;468(7322): 443-6.
[104] Skene PJ, Illingworth RS, Webb S, Kerr AR, James KD, Turner DJ, et al. Neuronal
MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin
state. Molecular Cell 2010;37(4): 457-68.
[105] Yasui DH, Ieddada S, ieda MC, VaIIero RO, Hogarl A, Nagara|an RI, el aI. Inle
graled eigenomic anaIyses of neuronaI MeCI2 reveaI a roIe for Iong-range inlerac
tion with active genes. Proceedings of the National Academy Sciences of the United
States of America 2007;104(49): 19416-21.
[106] Chahrour M, }ung SY, Shav C, Zhou X, Wong ST, Qin }, el aI. MeCI2, a key conlrib
utor to neurological disease, activates and represses transcription. Science
2008;320(5880): 1224-9.
[107] Hite KC, Adams VH, Hansen JC. Recent advances in MeCP2 structure and function.
Biochemistry and Cell Biology 2009;87(1): 219-27.
[108] Georgel PT, Horowitz-Scherer RA, Adkins N, Woodcock CL, Wade PA, Hansen JC.
Chromatin compaction by human MeCP2. Assembly of novel secondary chromatin
structures in the absence of DNA methylation. The Journal of Biological Chemistry
2003;278(34): 32181-8.
[109] Nikitina T, Ghosh RP, Horowitz-Scherer RA, Hansen JC, Grigoryev SA, Woodcock
CL. MeCP2-chromatin interactions include the formation of chromatosome-like
slruclures and are aIlered in mulalions causing Rell syndrome. The }ournaI of io
logical Chemistry 2007;282(38): 28237-45.
[110] Young }I, Hong II, CaslIe }C, Creso-arrelo }, ovman A, Rose MI, el aI. ReguIa
tion of RNA splicing by the methylation-dependent transcriptional repressor methyl-
CpG binding protein 2. Proceeding of the National Academy of Sciences of the
United States of America 2005;102(49): 17551-8.
[111] Zachariah RM, Raslegar M. Linking eigenelics lo human disease and Rell syn
drome: the emerging novel and challenging concepts in MeCP2 research. Neural
Plasticity 2012;2012: 415825.
[112] Gibson JH, Slobedman B, K NH, Williamson SL, Minchenko D, El-Osta A, et al.
Downstream targets of methyl CpG binding protein 2 and their abnormal expression
in the frontal cortex of the human Rett syndrome brain. BMC Neuroscience 2010;11:
53.
Chromatin Remodelling 220
[113] Marlinovich K, Hallori D, Wu H, Iouse S, He I, Hu Y, el aI. DNA melhyIalion-reIal
ed chromatin remodeling in activity-dependent BDNF gene regulation. Science
2003;302(5646): 890-3.
[114] Chen WG, Chang Q, Lin Y, Meissner A, West AE, Griffith EC, et al. Derepression of
BDNF transcription involves calcium-dependent phosphorylation of MeCP2. Science
2003;302(5646): 885-9.
[115] Zhou Z, Hong I}, Cohen S, Zhao WN, Ho HY, Schmidl L, el aI. rain-secific hos
phorylation of MeCP2 regulates activity-dependent Bdnf transcription, dendritic
growth, and spine maturation. Neuron 2006;52(2): 255-69.
[116] Horike S, Cai S, Miyano M, Cheng JF, Kohwi-Shigematsu T. Loss of silent-chromatin
looping and impaired imprinting of DLX5 in Rett syndrome. Nature Genetics
2005;37(1): 31-40.
[117] Miyano M, Horike S, Cai S, Oshimura M, Kohwi-Shigematsu T. DLX5 expression is
monoaIIeIic and DIx5 is u-reguIaled in lhe Mec2-nuII fronlaI corlex. }ournaI of CeI
lular and Molecular Medicine 2008;12(4): 1188-91.
[118] Samaco RC, Hogarl A, LaSaIIe }M. Iigenelic overIa in aulism-seclrum neurode
velopmental disorders: MECP2 deficiency causes reduced expression of UBE3A and
GABRB3. Human Molecular Genetics 2005;14(4): 483-92.
[119] Miyake K, Hirasava T, Soulome M, Iloh M, Golo Y, Indoh K, el aI. The rolocadher
ins, ICDH1 and ICDH7, are reguIaled by MeCI2 in neuronaI ceIIs and brain lis
sues: implication for pathogenesis of Rett syndrome. BMC Neuroscience 2011;12: 81.
[120] Nuber UA, Kriaucionis S, RoIoff TC, Guy }, SeIfridge }, Sleinhoff C, el aI. U-reguIa
tion of glucocorticoid-regulated genes in a mouse model of Rett syndrome. Human
Molecular Genetics 2005;14(15): 2247-56.
[121] Huke I, Garlner }. MoIecuIar diagnosis of Rell syndrome. }ournaI of ChiId Neu
rology 2005;20(9): 732-6.
[122] Peddada S, Yasui DH, LaSalle JM. Inhibitors of differentiation (ID1, ID2, ID3 and
ID4) genes are neuronaI largels of MeCI2 lhal are eIevaled in Rell syndrome. Hu
man Molecular Genetics 2006;15(12): 2003-14.
[123] Deng V, Matagne V, Banine F, Frerking M, Ohliger P, Budden S, et al. FXYD1 is an
MeCP2 target gene overexpressed in the brains of Rett syndrome patients and
Mecp2-null mice. Human Molecular Genetics 2007;16(6): 640-50.
[124] Iloh M, Ide S, Takashima S, Kudo S, Nomura Y, Segava M, el aI. MelhyI CG-bind
ing protein 2 (a mutation of which causes Rett syndrome) directly regulates insulin-
like growth factor binding protein 3 in mouse and human brains. Journal of
Neuropathology & Experimental Neurology 2007;66(2): 117-23.
[125] McGill BE, Bundle SF, Yaylaoglu MB, Carson JP, Thaller C, Zoghbi HY. Enhanced
anxiety and stress-induced corticosterone release are associated with increased Crh
Rett Syndrome
http://dx.doi.org/10.5772/55020
221
exression in a mouse modeI of Rell syndrome. Iroceedings of lhe NalionaI Acade
my of Sciences of the United States of America 2006;103(48): 18267-72.
|126j aIIeslar I, Yusufzai TM, WoIffe AI. Iffecls of Rell syndrome mulalions of lhe melh
yI-CG binding domain of lhe lranscrilionaI reressor MeCI2 on seIeclivily for as
sociation with methylated DNA. Biochemistry 2000;39(24): 7100-6.
[127] Kudo S, Nomura Y, Segava M, Iu|ila N, Nakao M, Hammer S, el aI. IunclionaI char
aclerisalion of MeCI2 mulalions found in maIe alienls vilh X Iinked menlaI relar
dation. Journal of Medical Genetics 2002;39(2): 132-6.
[128] ebbinglon A, Anderson A, Ravine D, Iyfe S, Iineda M, de KIerk N, el aI. Invesligal
ing genotype-phenotype relationships in Rett syndrome using an international data
set. Neurology 2008;70(11): 868-75.
[129] Neul JL, Fang P, Barrish J, Lane J, Caeg EB, Smith EO, et al. Specific mutations in
methyl-CpG-binding protein 2 confer different severity in Rett syndrome. Neurology
2008;70(16): 1313-21.
[130] Halbach NS, Smeets EE, van den Braak N, van Roozendaal KE, Blok RM, Schrander-
SlumeI CT, el aI. Genolye-henolye reIalionshis as rognoslicalors in Rell syn
drome should be handled with care in clinical practice. American Journal of Medical
Genetics Part A 2012;158A(2): 340-50.
[131] Young D, ebbinglon A, de KIerk N, over C, Nagara|an L, Leonard H. The reIalion
ship between MECP2 mutation type and health status and service use trajectories
over time in a Rett syndrome population. Research in Autism Spectrum Disorders
2011;5(1): 442-9.
[132] Bebbington A, Percy A, Christodoulou J, Ravine D, Ho G, Jacoby P, et al. Updating
lhe rofiIe of C-lerminaI MICI2 deIelions in Rell syndrome. }ournaI of MedicaI Ge
netics 2010;47(4): 242-8.
[133] Renieri A, Mari F, Mencarelli MA, Scala E, Ariani F, Longo I, et al. Diagnostic criteria
for the Zappella variant of Rett syndrome (the preserved speech variant). Brain and
Development 2009;31(3): 208-16.
[134] Scala E, Longo I, Ottimo F, Speciale C, Sampieri K, Katzaki E, et al. MECP2 deletions
and genotype-phenotype correlation in Rett syndrome. American Journal of Medical
Genetics Part A 2007;143A(23): 2775-84.
[135] Hardvick SA, Reuler K, WiIIiamson SL, Vasudevan V, DonaId }, SIaler K, el aI. De
lineation of large deletions of the MECP2 gene in Rett syndrome patients, including a
familial case with a male proband. European Journal of Human Genetics 2007;15(12):
1218-29.
[136] Amir RI, Van den Veyver I, SchuIlz R, MaIicki DM, Tran CQ, DahIe I}, el aI. InfIu
ence of mulalion lye and X chromosome inaclivalion on Rell syndrome heno
types. Annals of Neurology 2000;47(5): 670-9.
Chromatin Remodelling 222
[137] Huppke P, Maier EM, Warnke A, Brendel C, Laccone F, Gartner J. Very mild cases of
Rett syndrome with skewed X inactivation. Journal of Medical Genetics 2006;43(10):
814-6.
[138] Villard L, Levy N, Xiang F, Kpebe A, Labelle V, Chevillard C, et al. Segregation of a
totally skewed pattern of X chromosome inactivation in four familial cases of Rett
syndrome without MECP2 mutation: implications for the disease. Journal of Medical
Genetics 2001;38(7): 435-42.
[139] Takahashi S, Ohinala }, Makila Y, Suzuki N, Araki A, Sasaki A, el aI. Skeved X chro
mosome inactivation failed to explain the normal phenotype of a carrier female with
MECP2 mutation resulting in Rett syndrome. Clinical Genetics 2008;73(3): 257-61.
[140] Archer H, Evans J, Leonard H, Colvin L, Ravine D, Christodoulou J, et al. Correlation
between clinical severity in patients with Rett syndrome with a p.R168X or p.T158M
MICI2 mulalion, and lhe direclion and degree of skeving of X-chromosome inacli
vation. Journal of Medical Genetics 2007;44(2): 148-52.
[141] Xinhua , ShengIing }, Iuying S, Hong I, Meirong L, Wu XR. X chromosome inacli
vation in Rett Syndrome and its correlations with MECP2 mutations and phenotype.
Journal of Child Neurology 2008;23(1): 22-5.
[142] Zeev BB, Bebbington A, Ho G, Leonard H, de Klerk N, Gak E, et al. The common
DNI oIymorhism may be a modifier of disease severily in Rell syndrome. Neu
rology 2009;72(14): 1242-7.
[143] Nectoux J, Bahi-Buisson N, Guellec I, Coste J, De Roux N, Rosas H, et al. The
p.Val66Met polymorphism in the BDNF gene protects against early seizures in Rett
syndrome. Neurology 2008;70(22 Pt 2): 2145-51.
[144] Zahorakova D, Jachymova M, Kemlink D, Baxova A, Martasek P. APOE epsilon4: a
potential modulation factor in Rett syndrome. Journal of Child Neurology 2010;25(5):
546-50.
[145] Guy J, Gan J, Selfridge J, Cobb S, Bird A. Reversal of neurological defects in a mouse
model of Rett syndrome. Science 2007;315(5815): 1143-7.
[146] Giacometti E, Luikenhuis S, Beard C, Jaenisch R. Partial rescue of MeCP2 deficiency
by postnatal activation of MeCP2. Proceedings of the National Academy of Sciences
of the United States of America 2007;104(6): 1931-6.
[147] Ellaway CJ, Sholler G, Leonard H, Christodoulou J. Prolonged QT interval in Rett
syndrome. Archives of Disease in Childhood 1999;80(5): 470-2.
Rett Syndrome
http://dx.doi.org/10.5772/55020
223

You might also like