Mobile CRISPR/Cas-Mediated Bacteriophage Resistance

in Lactococcus lactis
Anne M. Millen
1
, Philippe Horvath
2
, Patrick Boyaval
2
, Dennis A. Romero
1
*
1DuPont Nutrition and Health, Madison, Wisconsin, United States of America, 2DuPont Nutrition and Health, Dange-Saint-Romain, France
Abstract
Lactococcus lactis is a biotechnological workhorse for food fermentations and potentially therapeutic products and is
therefore widely consumed by humans. It is predominantly used as a starter microbe for fermented dairy products, and
specialized strains have adapted from a plant environment through reductive evolution and horizontal gene transfer as
evidenced by the association of adventitious traits with mobile elements. Specifically, L. lactis has armed itself with a myriad
of plasmid-encoded bacteriophage defensive systems to protect against viral predation. This known arsenal had not
included CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins), which forms a
remarkable microbial immunity system against invading DNA. Although CRISPR/Cas systems are common in the genomes
of closely related lactic acid bacteria (LAB), none was identified within the eight published lactococcal genomes.
Furthermore, a PCR-based search of the common LAB CRISPR/Cas systems (Types I and II) in 383 industrial L. lactis strains
proved unsuccessful. Here we describe a novel, Type III, self-transmissible, plasmid-encoded, phage-interfering CRISPR/Cas
discovered in L. lactis. The native CRISPR spacers confer resistance based on sequence identity to corresponding lactococcal
phage. The interference is directed at phages problematic to the dairy industry, indicative of a responsive system. Moreover,
targeting could be modified by engineering the spacer content. The 62.8-kb plasmid was shown to be conjugally
transferrable to various strains. Its mobility should facilitate dissemination within microbial communities and provide a
readily applicable system to naturally introduce CRISPR/Cas to industrially relevant strains for enhanced phage resistance
and prevention against acquisition of undesirable genes.
Citation: Millen AM, Horvath P, Boyaval P, Romero DA (2012) Mobile CRISPR/Cas-Mediated Bacteriophage Resistance in Lactococcus lactis. PLoS ONE 7(12):
e51663. doi:10.1371/journal.pone.0051663
Editor: Paul Jaak Janssen, Belgian Nuclear Research Centre SCK/CEN, Belgium
Received August 21, 2012; Accepted November 6, 2012; Published December 11, 2012
Copyright: 2012 Millen et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The authors have no support or funding to report.
Competing Interests: All authors are employees of DuPont Nutrition & Health. This manuscript is in part, described in patent application PCT/US2011/057102,
LACTOCOCCUS CRISPR-CAS SEQUENCES (WO/2012/054726. This does not in any manner alter the authors adherence to all the PLOS ONE policies on sharing data
and materials.
* E-mail: [email protected]
Introduction
Lactococcus lactis is a lactic acid bacterium (LAB) indispensable for
the production of approximately 40 million metric tons of
fermented dairy foods annually, which represents a hundreds of
billions (USD) dollar global industry (Euromonitor Passport 2011
report). Beyond preserving a perishable food and providing a safe
source of human nutrition, fermented dairy products are a vehicle
for the consumption and dissemination of billions of lactococci into
the human and environmental microbiome.
In nature, lactococci are believed to inhabit a plant
environmental niche [1]. The chance contamination by variants
able to grow in milk has advanced into the rigorous industrial
selection and development of highly adapted strains that are
essential for todays processing demands. These specialized
strains, referred to as starter cultures, possess unique metabolic
properties responsible for the diversity of fermented dairy
products. Today, a principal criterion for starter strain selection
is the strains ability to resist virulent phage predation, a major
cause of failed dairy fermentations whichresult in significant
waste and economic loss. Effective lactococcal starter strains
have naturally developed an extensive array of defensive
mechanisms to combat phage infection [2]. Many are
plasmid-encoded, and often multiple complementary mecha-
nisms are combined on a single element and coupled with
conjugative transfer functions. These genetic features have been
exploited to protect uniquely valuable strains [2,3]. Notably
absent, however, were CRISPR/Cas systems [4].
CRISPRs (clustered regularly interspaced short palindromic
repeats) are widely disseminated in bacteria and archaea [for
recent reviews see 5, 6, 7, 8, 9]. They are composed of repeat
sequences separated by unique intervening sequences (spacers)
that are generally derived from viral and plasmid sequences. In
many cases, a group of CRISPR-associated (cas) genes are found
adjacent to the CRISPR array. The two components form a
functional pair that confers immunity based on spacer sequence
identity against foreign DNA, including bacteriophage and
plasmids. No CRISPR or cas gene was identified within the
current eight publicly available lactococcal genomes [10]. A
PCR-based search in 383 industrial L. lactis strains from the
DuPont collection did not reveal any Type I or Type II
CRISPR/Cas system, which are common to LABs [4]. Here we
describe a novel CRISPR/Cas system in L. lactis, discovered in
the course of searching for novel phage resistance mechanisms.
PLOS ONE | www.plosone.org 1 December 2012 | Volume 7 | Issue 12 | e51663
Methods
Bacteria, Bacteriophages, Plasmids, and Culturing
Conditions
Bacterial strains, phages, and plasmids are listed in Table 1. All
L. lactis were grown at 30uC in M17 broth (Becton, Dickenson and
Co., MD, USA) supplemented with 0.5% lactose (Lac) or glucose
(Glu). Escherichia coli was propagated aerobically in LB broth
(Becton, Dickenson and Co., MD, USA) at 37uC. When required,
antibiotics were added to the media as follows: streptomycin (Sm,
1000 mg/ml), spectinomycin (Sp, 300 mg/ml), and erythromycin
(Em, 5 mg/ml). Plasmid curing was performed by sequential
transfer at 37uC in M17Glu. Selection of cured isolates for loss of
lactose fermenting ability was done by plating serial dilutions on
BCP Lactose Indicator agar containing bromocresol purple and
1% lactose [11]. For Em curing, individual colonies were first
isolated on M17Glu then replica plated onto media with and
without Em. Preparation of bacteriophage lysates was performed
as described by Terzaghi and Sandine [12]. Lysates were passed
through a 0.45 mm filter and stored at 4uC. Plaque assays were
performed as described by Terzaghi and Sandine [12] on MRS
medium with the exception of phage 949 assays which were
performed on MRS +0.5% glycine.
Electroporation and Conjugation
Electroporation of pGh9::ISS1 into L. lactis was performed
according to the method of Holo and Nes [13]. Solid surface
conjugal mating was performed as described by McKay et al. [14]
except that M17 medium containing 0.5% glucose or 0.5%
glucose and lactose was substituted for milk agar plates.
Transconjugants were selected on M17 or BCP Lactose indicator
agar media supplemented with the respective carbohydrate,
antibiotics, or phage.
DNA Manipulation
Lactococcal plasmid DNA was prepared by the method of
Anderson and McKay [15]. Preparative amounts of pKLM DNA
for sequencing were purified through cesium chloride-ethidium
bromide density gradient centrifugation for at least 20 h at 15

C
and 57,000 g using a Beckman L8-60M ultracentrifuge and
NVT65 rotor. For E. coli, DNA was purified using a QIAprep Spin
Miniprep Kit (Qiagen, Hilden Germany). Primers used in this
study are listed in Table S1 and were designed from pKLM or
phage 4268 sequences. Cell pellets resuspended in sterile water
were used as template for amplification. Purified lysate (10
9
plaque
forming units/ml) was used as template for phage amplification.
PCR was performed with GoTaq DNA polymerase (Promega,
WI, USA). Reactions were set up per manufacturers instructions.
Thermal cycler conditions were as follows: initial denaturation for
5 min at 94uC followed by 30 cycles of denaturation at 94uC for
30 s, annealing at 51uC for 30 s, and extension at 72uC (time
dependent based on amplicon size, 3045 seconds per kb), then
final extension at 72uC for 5 min. PCR products were purified
using the QIAquick PCR Purification Kit (Qiagen, Hilden
Germany).
DNA Sequencing and in silico Analysis
The plasmid sequence for pKLM was obtained from the Roy J.
Carver Biotechnology Center (University of Illinois Urbana-
Champaign, IL) by utilizing FLX-Titanium 454 sequencing
[16]. A total of 10,233 reads were generated with an average
coverage of 67X. A de novo assembly was generated using NGen
(DNAstar, Madison, WI) software and was subsequently inspected
for quality using SeqMan Pro (DNAstar, Madison, WI). Gaps in
sequence were closed by PCR, and standard dye terminator
sequencing was performed by Northwoods DNA, Inc (Solway,
MN) using amplification primers. Annotation was performed using
BLASTn and BLASTx [17]. Plasmid map and sequence
comparison were created using BLAST Ring Image Generator
(BRIG) [18]. The pKLM CRISPR/Cas sequence is available
under GenBank accession number JX524189.
Natural CRISPR Adaptation
Phage challenges were performed essentially by standard plaque
assay [12] on phage sensitive CRISPR/Cas-containing strains.
Bacteriophage insensitive mutant (BIM) colonies were tested for
spacer addition by PCR. BIM CRISPR arrays were amplified
using primers CR-F2 and CR-R3B (Table S1). Spacer addition
would be indicated by an increase in amplicon size. Plasmid
stability assays were performed essentially as described by
Garneau et al. [19]. pGK12 (EmR) was first electroporated into
IL1403S and 1403S (pLN). Cultures were propagated at 37uC in
M17Glu then plated after 12 transfers on M17 Glu 6 Em.
Insertional Mutagenesis
pGh9::ISS1 was electroporated into IL1403S containing pLN.
Transformants were used as donors in a conjugation with
LM2345. Em resistant, phage p2 sensitive transconjugants were
amplified with primers designed from the cas genes and CRISPR
array (Table S1). Amplicons larger than the pKLM control were
sequenced to determine the location of ISS1 insertion.
Spacer Engineering
A synthetic, single spacer CRISPR array was constructed via
successive PCR reactions using Finnzymes Phusion High-Fidelity
DNA Polymerase (Thermo Fisher Scientific, Vantaa, Finland).
pG6 was amplified with primer set F1 and S4R and separately
with primer set IS1194 and S4F (Table S1). Amplicons were
cleaned up with the QIAquick PCR Purification Kit (Qiagen,
Hilden Germany) then mixed 1:1. PCR was performed on the
amplicon mix using primer set F1 and IS1194. Thermal cycler
conditions for each reaction were as follows: initial denaturation
for 30 s at 98uC followed by 30 cycles of denaturation at 98uC for
10 s, annealing at 51uC for 30 s, and extension at 72uC (time
dependent on amplicon size, 1030 seconds per kb), then final
extension at 72uC for 5 min. The resulting amplicon spanned the
39 end of cas1 through the truncated IS1194 fragment with a
repeat-s4-repeat CRISPR sandwiched in-between. The construct
was first cloned into pCR4Blunt-TOPO (Invitrogen, CA, USA)
and transformed into chemically competent One Shot TOP10 E.
coli (Invitrogen, CA, USA). Plasmids were isolated from E. coli
using the QIAprep Spin MiniPrep Kit (Qiagen, Hilden Germany).
To enable selection and replication in a lactococcal host, the
pCR4Blunt-TOPO containing the desired insert (pS4TOPO) was
fused to the lactococcal vector pGhost9 (pGh9). pS4TOPO and
pGh9 were each cut with SpeI (Promega, WI USA). The cut
vectors were ligated using T4 DNA ligase (Invitrogen, CA, USA).
All reactions were performed according to manufacturers
instructions. The resulting fusion plasmid was designated pRS4R,
and the integrity of the synthetic CRISPR was confirmed by DNA
sequencing. pRS4R was electroporated into lactococcal host
1403S containing pG6. To ensure recombination with the
CRISPR/Cas present on pG6, 1403S containing pG6 and
pRS4R was used as a conjugal donor for EmR mobilization to
plasmid-free recipient LM2345.
Lactococcus CRISPR/Cas
PLOS ONE | www.plosone.org 2 December 2012 | Volume 7 | Issue 12 | e51663
Results
Plasmid-encoded, Self-transmissible Phage Resistance
L. lactis DGCC7167, which showed a high level of natural phage
resistance, was selected as a potential donor of conjugative
plasmid-encoded phage resistance. To circumvent generating
spontaneous phage resistance mutants, we chose to first introduce
pGh9::ISS1 into the donor strain to facilitate co-integration with
native self-transmissible elements. Erythromycin resistance (EmR),
encoded by pGh9::ISS1, could then be used as selection for
conjugal mobilization. EmR was transferred to plasmid-free L.
lactis 1403S, and transconjugants were screened for resistance to L.
lactis phages 949, bIL67, bIL170, and P335. The latter three are
representative of the problematic phage types (types c2, 936, and
P335, respectively) in the dairy industry. Following conjugal
transfer at approximately 10
27
per exit recipient, one transconju-
gant (designated K) amongst those screened was resistant to all
phages tested and harbored multiple plasmids (Figure 1). To
determine if one of these plasmids encoded phage resistance, K
was conjugally mated to another plasmid-free recipient, L. lactis
LM2345. Transfer occurred at 4-log higher efficiency. A
representative transconjugant (designated KLM) that was resistant
to phage p2 was selected and found to contain a single plasmid of
approximately 60 kb, corresponding to one of the plasmids found
in donor K (Figure 1). This plasmid, designated pKLM, was
transferred concomitantly with phage resistance in second round
conjugal matings from donor KLM (10
24
per exit recipient). In
addition, loss of pKLM returned a strain to phage sensitivity.
These two lines of evidence provide proof that pKLM encodes the
phage resistance phenotype. Based on these results, pKLM was
purified and sequenced.
Table 1. List of bacterial strains, plasmids, and bacteriophages.
Strains, Plasmids, Phages Relevant Characteristics Description/Reference
L. lactis
DGCC7167 Lac+ DuPont collection, industrial starter
IL1403 Lac2, plasmid-free Conjugation host, Accession AE005176 [38]
1403S Lac2, SmR, plasmid-free, Spontaneous SmR derivative of IL1403
LM2302 Lac2, SmR EmR, plasmid-free Conjugation recipient host [39]
LM2345 Lac2, SpR RfR, plasmid-free Conjugation recipient host [40]
DGCC7192 Lac+ DuPont collection, industrial starter, recipient host
K Lac2, SmR EmR, at least 4 plasmids 1403S transconjugant (DGCC7167 conjugation donor)
Plasmids
pGhost9 EmR, TS ori (pGh9) Temperature sensitive vector [29]
pGhost9::ISS1 EmR, TS ori ISS1 (pGh9::ISS1) Insertion sequence ISS1 variant of pGhost9 [29]
pGK12 EmR CmR Broad host range vector [41]
pCR4Blunt-TOPO KmR ApR cloning vector Life Technologies Corp, USA
pKLM Tra+ CRISPR/Cas EmR Fusion of DGCC7167 native plasmid with pGh9::ISS1
pLN Tra+ CRISPR/Cas Lac-cured CRISPR plasmid from DGCC7167
pF8E Tra+ CRISPR/Cas EmR pLN::pGh9::ISS1 with ISS1 inserted into s9 of pLN
pG6E Tra+ CRISPR/Cas EmR pLN::pGh9::ISS1 Ds2-s9
pG6 Tra+ PhageR Resolved pLN::pGh9::ISS1 Ds2-s9 with loss of pGh9::ISS1
pTOPOS4 repeat::s4::repeat (RS4R) RS4R construct cloned into pCR4Blunt-TOPO (Invitrogen, CA, USA)
pRS4R EmR pTOPOS4 cloned into pGhost9
pG6::pRS4R EmR, cointegrate of pG6 and pRS4R Fusion of pRS4R into CRISPR of pG6
Bacteriophages
p2 Host LM2301/LM2302/LM2345 Type 936, Accession GQ979703
bIL67 Host IL1403/1403S Type c2, Accession L33769 [42]
bIL170 Host IL1403/1403S Type 936, Accession AF009630 [43]
949 Host IL1403/1403S Accession HM029250 [44]
P008 Host IL1403/1403S Type 936, Accession DQ054536 [45]
P335 Host IL1403/1403S Accession DQ838728 [46]
M5952 Host DGCC7192 DuPont collection, 4268-like (4268 Accession AF489521) [23]
(+) =positive phenotype/(2) =negative phenotype/(R) =resistant.
Lac =lactose fermentation/Sm=streptomycin/Em=erythromycin.
Cm=chloramphenicol/Sp=spectinomycin/Rf =rifampicin.
Km=kanamycin (E. coli only)/Ap =ampicillin (E. coli only).
TS ori =temperature sensitive origin of replication.
Tra =conjugative transfer.
Repeat =lactococcal CRISPR repeat sequence.
doi:10.1371/journal.pone.0051663.t001
Lactococcus CRISPR/Cas
PLOS ONE | www.plosone.org 3 December 2012 | Volume 7 | Issue 12 | e51663
Plasmid pKLM Harbors a Novel CRISPR/Cas System
The pKLM sequence revealed a 62,862-bp plasmid encoding a
novel CRISPR/Cas locus which spans a 9.6-kb segment (Figure 2).
The CRISPR array is composed of 16 identical 36-nt repeats
interspaced by 15 spacers ranging in size from 33 to 39 nt. The
repeat (59-AAATACAACCGCTCCTCGATAAAAGGGGAC-
GAGAAC-39) shows size and sequence similarity to those
belonging to CRISPR/Cas Type III-A [7]. In particular, the 39
terminal 16-nt of the lactococccal repeat matches perfectly with
Staphylococcus epidermidis RP62a [20] and near perfectly (15 of 16-nt)
to Enterococcus italicus DSM 15952 (accession number
AEPV01000074) 3 termini. In S. epidermidis, it has been shown
that the 39 repeat terminus, specifically the sequence GGGACG, is
critical for cleavage of CRISPR RNAs (crRNA) by Cas6 [21,22].
Sequence analysis of the 15 spacers using BLASTn found 7 with
partial identity to known lactococcal phages (Table 2). Four
spacers (s5, s8, s10, s13) match phage 949, and three spacers (s2,
s3, s4) match 936-type phages that include p2, bIL170, and P008.
It is noteworthy that these spacers correspond to the resistance
phenotypes against the respective phage types. Spacer s3 also
shows a match to lytic phage 4268 [23] and prophage BK5-T
[24].
Adjacent to the CRISPR array is a set of 9 colinear genes. Eight
of the 9 encode proteins which are similar to Cas and Csm
proteins of Type III-A systems [7] (Figure 3). These 8 genes
include (in sequence on the locus) cas10, csm2, csm3, csm4, csm5,
csm6, cas6, and cas1. Interestingly absent is a cas2 homologue,
which is an endoribonuclease believed to participate in spacer
acquisition with cas1 [25]. In its place and immediately ensuing
cas1, is a 333-nt open reading frame (ORF) with 55% amino acid
similarity to the RelE family toxin component of toxin-antitoxin
systems involved in plasmid stabilization [26]. Sequence analysis
identifies this ORF, which we have designated lch, as having a
conserved domain belonging to the pfam05016/TIGR02385
family of proteins that are addiction module toxins involved in
plasmid stabilization [27].
A 150-nt putative leader sequence is found between lch and the
first CRISPR repeat. Some CRISPR arrays are delineated by a
terminal degenerate repeat, which is not the case here. A 35-nt
segment without sequence similarity follows the distal repeat. This
segment abuts a vestigial IS1194 transposase, which itself contains
an insertion of a defective ISS1 element. This suggests that the
CRISPR array has been interrupted by prior recombination
events.
Other Genetic Features of pKLM
The remainder of pKLM corresponds primarily to lactococcal
plasmid pMRC01 conjugative (orf5-20 and oriT) and replication
(orf62, repB) functions [28], and it contains ten transposase genes
(five ISS1 elements, single copies of IS905, IS981, IS1216, IS1217,
and IS712A, and several IS remnants). pGh9::ISS1 transposed into
the counterpart of pMRC01 hypothetical gene orf7 accounts for
two of the ISS1 copies (Figure 2).
Overall, pKLM has a G+C content of 31.8% after subtracting
pGh9::ISS1. This compares to the G+C content of lactococcal
genomes which averages 35.5%, and to 32.2% for S. epidermidis
RP62a. The pKLM CRISPR/Cas locus by itself has a 34.7%
G+C versus 29.0% and 37.3% for the loci in S. epidermidis RP62a
and E. italicus DSM 15952, respectively.
Food-Grade CRISPR/Cas Plasmid pLN
A food-grade, non-antibiotic marked plasmid containing
CRISPR/Cas from donor DGCC7167 was isolated followinga
conjugation with plasmid-free strain LM2302 byselecting for the
mobilization of lactose fermenting ability (Lac). A representative
phage resistant, Lac-positive transconjugant was selected. The Lac
phenotype was then cured to prevent any potential incompatibility
with native Lac plasmids when conjugated into industrial starter
strains. The Lac-cured strain contained a single plasmid of about
60 kb, designated pLN. pLN was conjugative with concomitant
transfer of phage resistance. A draft sequence of pLN was
generated. About 78% of the pLN draft sequence was conserved
with pKLM (Figure 2). The presence of CRISPR/Cas identical to
the KLM CRISPR/Cas was confirmed.
Cas Proteins are Necessary for Phage Resistance
Insertional mutagenesis of pLN with ISS1 [29] was used to
investigate cas gene involvement in phage resistance. EmR was
conjugally mobilized at 7610
25
per exit recipient. At least one
example of ISS1 insertion was identified for seven of the cas genes
and lch in pLN. In each case, the respective transconjugant was
sensitive to phage p2. No insert was found in cas6 or the leader
region in the 36 phage p2-sensitive isolates examined. These
results confirm the involvement of the cas gene cluster in phage
resistance. The possibility of polar transcriptional effects was not
ruled out, which would be consistent with the observations that
insertionally inactivated cas1 and lch, which are not believed to be
involved in interference, lead to phage sensitivity.
Phage Resistance is Directed by CRISPR Spacers
Spacer sequence is directly correlated to CRISPR/Cas-medi-
ated immunity to phage [30]. Two phage p2-sensitive variants
Figure 1. Plasmid profiles. Plasmid profile of donor L. lactis
DGCC7167 + pGh9::ISS1, phage resistant transconjugants K (derived
from recipient L. lactis 1403S) and KLM (derived from recipient LM2345).
doi:10.1371/journal.pone.0051663.g001
Lactococcus CRISPR/Cas
PLOS ONE | www.plosone.org 4 December 2012 | Volume 7 | Issue 12 | e51663
were characterized in the insertional mutagenesis experiments in
which ISS1 had not inserted into the cas gene cluster. In the first
variant, pGh9::ISS1 insertion was not conclusively mapped,
however, its single plasmid (designated pG6E) was found to have
precisely deleted spacers s9 through s2 (Figure 3). In the second
plasmid (pF8E), ISS1 had inserted into the CRISPR array,
specifically into spacer s9, which displaced spacers s1 through s8
relative to the cas genes and leader. Consequently, ISS1 insertion
would disrupt transcription of the displaced spacers in the array
(Figure 3). In both cases, p2 sensitivity can be correlated to the
deletion or displacement of spacers s3 and s4, which have partial
identity to phage p2.
Spacers s3 and s4 also have partial sequence identity to phages
P008 and bIL170 (Table 2). When plasmid pG6E or pF8E was
conjugally transferred to the plasmid-free host 1403S, transconju-
gants remained sensitive to phages P008 and bIL170. In contrast,
these 1403S transconjugants were resistant to phage 949, which is
targeted by spacers s5, s8, s10, and s13. Spacers s10 and s13 are
retained in pG6E and remain in proper transcriptional context in
pF8E. Taken together, these results further support the involve-
ment of spacers and a level sequence identity that is yet to be
determined in phage interference.
As noted, spacer s3 also shows partial identity to lactococcal
phage 4268 (Table 2). DuPont collection phage M5952 had
previously been sequenced and was found to be closely related to
phage 4268 (data not shown), sharing identical sequence across the
proto-spacer and flanking regions. CRISPR/Cas interference
against M5952 was tested after conjugal transfer of pKLM or pLN
Figure 2. pKLM map and plasmid comparison. Rings from inside out: pKLM ORFs; pKLM GC content; nucleotide identity with pLN; nucleotide
identity with pMRC01.
doi:10.1371/journal.pone.0051663.g002
Lactococcus CRISPR/Cas
PLOS ONE | www.plosone.org 5 December 2012 | Volume 7 | Issue 12 | e51663
Table 2. List and nucleotide sequence of pKLM/pLN CRISPR spacers.
Spacer Length (nt) Sequence Phage Match nt Match to Phage
s15 35 TGCATGTTTATAGCCCTGCCGGATTTTAAGCTGCG
s14 38 TTTCCATTCCGTTTAACTGCTGCCAGAAAGATTTCATC
s13 38 TGGTTGTTGTCATTAGCTGTATCGTGAATGACGATATA 949 36
s12 34 AACTTGGAATGGTAATTCATATAATTTTTTCATA
s11 35 TGCTGGTTTTATTTGCTCAATTTTTGAATTGTCAA
s10 39 TTTGTTGTAAAATATTTCATGTTTTGTTTTCTCTTTTCT 949 37
s9 38 AGAGAGTATTCAGTCATGAATGAAATGATTGCAATTTG
s8 35 ACAACTGTTTTAACTCTATCCTGATATATAAACCC 949 26
s7 33 AACTTTTTAAGGATAAGACCAACAGACTCTGAC
s6 37 TTTATTTGTGGCAACAAGTTCAGCAATAATAGGGTTT
s5 37 GAACTTAGCAAGCTATTTTGTTTCTTTTCAAGAGCCA 949 32
s4 35 ATACGTTCTTTGAACCAAGCTTCAACTCCCTC_GGA* p2 32
ATACGTTCTTTGAACCAAGCTTCAACTCCCTC_GGA* P008 32
ATACGTTCTTTGAACCAAGCTTCAACTCCCTC_GGA* bIL170 28
s3 35 TTCTGTTAATTTAACTCCCATTTGTTAGTTCTCCT p2 32
TTCTGTTAATTTAACTCCCATTTGTTAGTTCTCCT P008 28
TTCTGTTAATTTAACTCCCATTTGTTAGTTCTCCT 4268 26
s2 35 TTTTTAAAATGTTGCAAATGTTTAGCTACTTCAT P008 33
s1 34 ATATGTCGGTTTGTCTTTTGGTCTAACGTATGCA
nt =nucleotides.
Underlined nucleotides indicate mismatches against respective proto-spacer target.
*A single nucleotide gap denoted by an underscore space in sequence.
doi:10.1371/journal.pone.0051663.t002
Figure 3. Expanded view of the CRISPR/Cas locus of pKLM/pLN, pF8E, pG6, and pG6::pRS4R. View of cas genes and CRISPR arrays
correlated to phage resistance phenotype. pKLM/pLN contains the full spacer array which gives resistance to all 4 listed phages. pF8E contains an
insertion within the array which disrupts spacers s1-s9 as well as resistance to phage encoded by those spacers. pG6 contains a deletion of spacers s2-
s9, and resistance to phage encoded by those spacers is lost. pG6::pRS4R contains an engineered s4 which provides resistance to all 3 phages it has
identity to.
doi:10.1371/journal.pone.0051663.g003
Lactococcus CRISPR/Cas
PLOS ONE | www.plosone.org 6 December 2012 | Volume 7 | Issue 12 | e51663
into the industrial starter strain L. lactis DGCC7192. Conjugal
transfer of EmR or phage resistance was observed, and each
plasmid conferred resistance to phage M5952. This suggests that
spacer s3 could direct the interference phenotype. In a plaque
assay, distinct plaques were observed at the lowest phage dilutions
tested, which indicates that some phages had escaped the
CRISPR/Cas immune system.
Analysis of Phage Escape Mutants
In Streptococcus thermophilus, phages that escape CRISPR/Cas
immunity are found to have a mutation within the corresponding
phage genome sequence (proto-spacer) or PAM (proto-spacer
adjacent motif), which is also important for the interference
phenotype [30,31,32]. In the course of testing
DGCC7192(pKLM), escape phages derived from M5952 were
observed at approximately 10
26
. Seventy-three escape phages
were examined by sequencing a 438-bp amplicon spanning the s3
proto-spacer. Each escape phage was found to have a single
nucleotide mutation, mapping to 5 positions within the 22-nt
identity segment of spacer s3 (Table 3). The isolation and
characterization of escape phages provide further proof of
spacer-directed interference.
CRISPR/Cas in Additional Lactococcal Strains
Lactococci from the DuPont collection were screened for the
presence of the pKLM CRISPR/Cas locus using PCR primer sets
derived from the repeat, leader, cas1, and 39 trailer sequences
(Table S1). Only 4 additional strains of over 400 examined tested
positive for all reactions. Each of these 4 strains contains the full
complement of pKLM cas/csm genes based on expanded PCR
analysis. Sequence analysis showed that the CRISPR arrays were
composed of the singular pKLM repeat. The CRISPR flanking
regions that span lch through the leader sequence on one side and
the trailer region into the truncated IS1194 element on the other,
are nearly identical. The lch gene in particular is 99% identical
among the five characterized loci. In contrast, diversity was found
in the number (from 4 to 15) and sequence content of spacers in
each array. Twenty-three of the 26 new spacers are unique, three
are shared, and one is duplicated within one array. Sequence
analysis identified five spacers as having partial matches to
lactococcal phage 949 or 936-type genomes.
Adaptation
One feature of CRISPR/Cas is its ability to integrate new
spacers in response to phage challenge [30]. Attempts to add
spacers naturally to DGCC7192(pKLM) by challenge with escape
phages derived from M5952 were repeatedly unsuccessful. A
comparison of plasmid stability of pGK12 in 1403S versus
1403S(pLN) showed no tendency for plasmid loss in the
CRISPR/Cas-containing strain, indicating no spacer against
pGK12 was acquired.
Engineering Spacer-directed Phage Resistance
In plasmid pG6E, loss of resistance to phages p2 (LM2345 host)
and bIL170/P008 (1403S host) results from a deletion that
includes spacer s4. We sought to determine if reinserting spacer s4
would restore the resistance phenotype. A plasmid containing a
synthetic s4 was constructed (pRS4R) and integrated into the pG6
CRISPR locus. This created cointegrate plasmid, pG6::pRS4R,
which, in addition to the pG6 array, contains a single spacer array
composed of s4 in proper context with the cas genes (Figure 3).
LM2345 containing pG6::pRS4R was resistant to phage p2. We
then conjugally transferred pG6::pRS4R into 1403S. Transconju-
gants were resistant to phages bIL170 and P008. These results
further correlate spacer-directed interference and demonstrate
that CRISPR/Cas resistance can be programmed against specific
phages.
Discussion
This CRISPR/Cas system is, to our knowledge, the first
described in Lactococcus lactis. Based on sequence and structural
features, it is categorized as a Type III-A system [7], which is
relatively rare in LABs [4], but found in microbes distantly related
to lactococci, notably E. italicus and S. epidermidis. Our results
characterizing the activity of this lactococcal CRISPR/Cas system
against virulent phage complements studies of plasmid transfer
inhibition and corroborates mechanistic studies of crRNA
processing in staphylococci [21,22,33]. The lactococcal CRISPR
repeat shows sequence conservation to other Type III-A
CRISPRs, particularly at the 39 end where the formation of a
repeat stem-loop is essential for efficient interference activity in S.
epidermidis [22]. The lactococcal spacers targeting phage apparently
do not require 100% identity to confer phage resistance. It is not
uncommon in CRISPR/Cas systems for targeting to be provided
by a shorter seed sequence in the spacer [34,35]. For the
seventy-three M5952-escape phages examined, mutations circum-
venting s3-directed inhibition were localized within a 22-nt
internal segment that is complementary to the start of orf35 (in
phage 4268), encoding a structural head protein [23].
As noted, the lactococcal cas gene cluster most closely resembles
Type III loci with the exception that it does not contain a
homologue to any known cas2. Instead, next to cas1 is a gene with
partial homology to the relE/parE toxin gene which we have
designated lch. It is unclear if it could be functioning as a cas2
despite lack of sequence conservation. It has been suggested that
cas2 evolved from a toxin gene, citing its homology to the VapDHi
toxin protein [7]. This would be consistent with the speculation in
archaea that association of CRISPR/Cas with toxin-antitoxin
genes would stabilize the loci within the host genome [36]. It has
also been reported that many organisms contain Type III
CRISPRs lacking cas1 and cas2, but all of these contain an
additional CRISPR/Cas system in the genome, where cas1 and
cas2 may function in trans [7]. cas1 and cas2 are required for spacer
acquisition in E. coli [37]. Many spacer sequences among the few
lactococcal CRISPRs analyzed have identity with lactococcal
Table 3. Escape phage analysis.
Sequence
Number of
Isolates
s3 TTCTGTTAATTTAACTCCCATTTGTTAGTTCTCCT
A CTGTTAATTTAACTTCCATTTG 5
B CTATTAATTTAACTCCCATTTG 49
C CTGTTAATTTAACTCCCATGTG 1
D CTTTTAATTTAACTCCCATTTG 8
E CTGTTAATTTAACACCCATTTG 3
F CTGTTAATTTAACTGCCATTTG 3
G CTGTTAATTTGACTCCCATTTG 1
H CTGTTAATTTAACGCCCATTTG 2
I CTGTTAATTTAACCCCCATTTG 1
Alignment of pKLM/pLN spacer s3 with the corresponding proto-spacer region
in 73 M5952 escape phage isolates grouped A - I. (Bold denotes single
nucleotide mutation).
doi:10.1371/journal.pone.0051663.t003
Lactococcus CRISPR/Cas
PLOS ONE | www.plosone.org 7 December 2012 | Volume 7 | Issue 12 | e51663
phages, suggesting the CRISPR is or has been adaptive in
lactococci. The CRISPR diversity among the 5 strains analyzed,
all containing the lch gene rather than a known cas2, may suggest
the system is capable of spacer acquisition with its current Cas
complement. Alternatively it may be explained as a series of spacer
deletions by homologous recombination between direct repeats
from a longer CRISPR array. It is possible that the system was
active in an ancestor Lactococcus, such as those associated with
plants in which plasmids are scarce [1], and that the acquisition
ability was lost in the plasmid-rich Lactococcus lactis when it adapted
to growth in milk. Due to the ancillary activity of CRISPR against
plasmids, a non-adapting CRISPR/Cas system could be favorable
for lactococci, allowing them to maintain plasmids encoding
beneficial traits. Induction and regulation of the L. lactis CRISPR
adaptation would increase its industrial utility as a phage resistance
mechanism in starter strains.
CRISPR activity against plasmids may also explain its rarity in
lactococci. Our previous screens for S. thermophilus-like type I and
type II CRISPR systems in the DuPont Lactococcus lactis collection
failed to detect any positives. A PCR-based screen of over 400
lactococci for the pKLM CRISPR/cas locus found its presence in
only four additional strains confirming that the occurrence of
CRISPR/Cas is strain specific [4]. This suggests that CRISPR/
Cas may be more prevalent within bacterial genera or species than
would be expected from an examination of available genomes.
The discovery of this lactococcal plasmid-encoded CRISPR/
Cas is a function of the manner in which it was isolated; dependent
on conjugative mobilization. Furthermore, the presence of
numerous IS-elements on the plasmid suggests that CRISPR/
Cas may have been acquired via transposition. It is undetermined
if it is the norm or the exception in lactococci for the CRISPR/
Cas to reside on a plasmid. It is a matter of speculation whether
this is representative of a stable acquisition or a transition between
loss or integration into the chromosome. Prior reports have
established the presence of CRISPR/Cas on plasmids, and in
some cases the plasmids also encode conjugation related proteins
[47,48]. Therefore, while CRISPR/Cas seems to be more
commonly found on the chromosome based on examination of
currently available genomic sequences, it is not unusual for a
CRISPR/Cas to be plasmid-encoded.
Our data showing that this lactococcal CRISPR/Cas is
plasmid-encoded and self-transmissible biologically confirms a
route for CRISPR/Cas acquisition and dissemination. This
corroborates bioinformatic evidence of horizontal transfer based
on similar CRISPR/Cas loci present in non-phylogenetically
related organisms and its residence on mobile elements [4,47,48].
Though a Type II CRISPR/Cas from S. thermophilus has been
transferred to E. coli and shown to be functional, it was introduced
by cloning the CRISPR/Cas into an E. coli plasmid [32]. We
believe this to be the first biologic evidence of natural CRISPR/
Cas mobility, which will enable further studies on dissemination
and functionality in diverse microbes.
With respect to the hostile phage environment of industrial
dairy processing, starter lactococci have evolved many different
defensive systems. In this regard, the mobility of these phage
resistance genes has been critical in the evolution and adaptation
of lactococci in this application. Significantly, this CRISPR/Cas
system, like many of the previously described lactococcal phage
resistance mechanisms, is found on a self-transmissible plasmid,
which we have exploited to transfer and characterize the system in
additional lactococcal strains. The existing spacers target phages
representative of common types in the industrial environment
including 936- and 4268-like phage currently categorized with
P335. Furthermore, the resistance could be engineered by direct
introduction of a synthetic spacer against a specific phage. The
initial demonstration of CRISPR/Cas phage interference in S.
thermophilus, another food fermentation microbe, enabled a new
avenue of protecting industrially important strains which has
proven robust and highly adaptable. L. lactis has also been the
focus of such natural engineering, however relying on varied
mechanisms that, while initially efficacious, eventually are
overcome by evolving phage. The discovery of a lactococcal
CRISPR/Cas provides a potentially adaptable system that could
be harnessed in response to evolving phage.
Supporting Information
Table S1 Primer sequences. All primers were designed from
pKLM sequence or phage M5952.
(DOCX)
Acknowledgments
The authors would like to thank Buffy Stahl for her help with the
sequencing and assembly of pKLM, Lindsay Traeger for her role in the
isolation of pKLM, Mickael Charron for screening the DuPont lactococcal
collection for CRISPR, Kassie Saeger for her work with DGCC7192 and
4268 like phages, Sylvain Moineau, Julie Samson, Josiane Garneau,
Manuela Villion, and Marie-E
`
ve Dupuis for corroborating and expanding
our understanding of the lactococcal CRISPR/Cas system.
Author Contributions
Conceived and designed the experiments: AMM DAR PH PB. Performed
the experiments: AMM. Analyzed the data: AMM DAR PH PB.
Contributed reagents/materials/analysis tools: AMM DAR PH. Wrote
the paper: AMM DAR.
References
1. Kelly WJ, Lawrence JH, Ward LJH, Leahy SC (2010) Chromosomal diversity in
Lactococcus lactis and the origin of dairy starter cultures. Genome Biol Evol 2:
729744.
2. Coffey A, Ross RP (2002) Bacteriophage-resistance systems in dairy starter
strains: molecular analysis to application. Antonie van Leeuwenhoek 82: 303
321.
3. Mills S, McAuliffe OE, Coffey A, Fitzgerald GF, Ross RP (2006) Plasmids of
lactococci - Genetic accessories or genetic necessities? FEMS Microbiol Rev 30:
243273.
4. Horvath P, Coute-Monvoisin A-C, Romero DA, Boyaval P, Fremaux C, et al.
(2009) Comparative analysis of CRISPR loci in lactic acid bacteria genomes.
Int J Food Microbiol 131: 6270.
5. Horvath P, Barrangou R (2010) CRISPR/Cas, the immune system of bacteria
and archaea. Science 327: 167170.
6. Karginov FV, Hannon GJ (2010) The CRISPR system: Small RNA-guided
defense in bacteria and archaea. Mol Cell 37: 719.
7. Makarova KS, Haft DH, Barrangou R, Brouns SJJ, Charpentier E, et al. (2011)
Evolution and classification of the CRISPRCas systems. Nat Rev Microbiol 9:
467477.
8. Shah SA, Garrett RA (2011) CRISPR/Cas and Cmr modules, mobility and
evolution of adaptive immune systems. Res Microbiol 162: 2739.
9. Wiedenheft B, Sternberg SH, Doudna JA (2012) RNA-guided genetic silencing
systems in bacteria and archaea. Nature 482: 331338.
10. Grissa I, Vergnaud G, Pourcel C (2007) The CRISPRdb database and tools to
display CRISPRs and to generate dictionaries of spacers and repeats. BMC
Bioinformatics 8: 172.
11. McKay LL, Baldwin KA, Zottola EA (1972) Loss of lactose metabolism in lactic
streptococci. Appl Environ Microbiol 23: 10901096.
12. Terzaghi BE, Sandine WE (1975) Improved medium for lactic streptococci and
their bacteriophages. Appl Environ Microbiol 29: 807813.
13. Holo H, Nes IF (1989) High-frequency transformation, by electroporation, of
Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media.
Appl Environ Microbiol 55: 31193123.
Lactococcus CRISPR/Cas
PLOS ONE | www.plosone.org 8 December 2012 | Volume 7 | Issue 12 | e51663
14. McKay LL, Baldwin KA, Walsh PM (1980) Conjugal transfer of genetic
information in group N streptococci. Appl Environ Microbiol 40: 8491.
15. Anderson DG McKay LL (1983) Simple and rapid method for isolating large
plasmid DNA from lactic streptococci. Appl Environ Microbiol 46: 549552.
16. Margulies M., Egholm M., Altman W.E., Attiya S., Bader J.S., et al. (2005)
Genome sequencing in microfabricated high-density picolitre reactors. Nature
437: 376380.
17. Altschul S; Gish W; Miller W; Myers E; Lipman D (1990) Basic local alignment
search tool. J Mol Biol 215: 403410.
18. Alikhan NF, Petty NK, Ben Zakour NL, Beatson SA (2011) BLAST Ring Image
Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics 12:
402.
19. Garneau JE, Dupuis M-E, Villion M, Romero DA, Barrangou R, et al. (2010)
The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid
DNA. Nature 468: 6771.
20. Gill SR, Fouts DE, Archer GL, Mongodin EF, Deboy RT, et al. (2005) Insights
on evolution of virulence and resistance from the complete genome analysis of
an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing
methicillin-resistant Staphylococcus epidermidis strain. J Bacteriol 187: 24262438.
21. Marraffini LA, Sontheimer EJ (2010) Self versus non-self discrimination during
CRISPR RNA-directed immunity. Nature 463: 568571.
22. Hatoum-Aslan A, Maniv I, Marraffini LA (2011) Mature clustered, regularly
interspaced, short palindromic repeats RNA (crRNA) length is measured by a
ruler mechanism anchored at the precursor processing site. Proc Natl Acad Sci
USA 108: 2121821222.
23. Trotter M, McAuliffe O, Callanan M, Edwards R, Fitzgerald GF, et al. (2006)
Genome analysis of the obligately lytic bacteriophage 4268 of Lactococcus lactis
provides insight into its adaptable nature. Gene 366: 189199.
24. Mahanivong C, Boyce JD, Davidson BE, Hillier AJ (2001) Sequence analysis
and molecular characterization of the Lactococcus lactis temperate bacteriophage
BK5-T. Appl Environ Microbiol 67: 35643576.
25. Beloglazova N, Brown G, Zimmerman MD, Proudfoot M, Makarova KS, et al.
(2008) A novel family of sequence-specific endoribonucleases associated with the
clustered regularly interspaced short palindromic repeats. J Biol Chem 283:
2036120371.
26. Hayes F (1998) A family of stability determinants in pathogenic bacteria.
J Bacteriol 180: 64156418.
27. Anantharaman V, Aravind L (2003) New connections in the prokaryotic toxin-
antitoxin network: relationship with the eukaryotic nonsense-mediated RNA
decay system. Genome Biol. 4: R81.
28. Dougherty BA, Hill C, Weidman JF, Richardson DR, Venter JC, et al. (1998)
Sequence and analysis of the 60 kb conjugative, bacteriocin-producing plasmid
pMRC01 from Lactococcus lactis DPC3147. Mol Microbiol 29: 10291038.
29. Maguin E, Prevost H, Ehrlich SD, Gruss A (1996) Efficient insertional
mutagenesis in lactococci and other Gram-positive bacteria. J Bacteriol 178:
931935.
30. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, et al. (2007)
CRISPR provides acquired resistance against viruses in prokaryotes. Science
315: 17091712.
31. Deveau H, Barrangou R, Garneau JE, Labonte J, Fremaux C, et al. (2008)
Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J.
Bacteriol. 190: 13901400.
32. Sapranauskas R, Gasiunas G, Fremaux C, Barrangou R, Horvath P, et al. (2011)
The Streptococcus thermophilus CRISPR/Cas system provides immunity in
Escherichia coli. Nucl Acids Res 39: 92759282.
33. Marraffini LA, Sontheimer EJ (2008) CRISPR interference limits horizontal
gene transfer in staphylococci by targeting DNA. Science 322: 18431845.
34. Semenova E, Jore MM, Datsenko KA, Semenova A, Westra ER, et al. (2011)
Interference by clustered regularly interspaced short palindromic repeat
(CRISPR) RNA is governed by a seed sequence. Proc Natl Acad Sci USA
108: 1009810103.
35. Wiedenheft B, van Duijnc E, Bultemad JB, Waghmaree SP, Zhoua K, et al.
(2011) RNA-guided complex from a bacterial immune system enhances target
recognition through seed sequence interactions. Proc Natl Acad Sci USA 108:
1009210097.
36. Garrett RA, Vestergaard G, Shah SS (2011) Archaeal CRISPR-based immune
systems: exchangeable functional modules. Trends Microbiol 19: 549556.
37. Yosef I, Goren MG, Qimron U (2012) Proteins and DNA elements essential for
the CRISPR adaptation process in Escherichia coli. Nucl Acids Res 40: 5569
5576.
38. Chopin A, Chopin MC, Moillo-Batt A, Langella P (1984) Two plasmid-
determined restriction and modification systems in Streptococcus lactis. Plasmid 11:
260263.
39. Walsh PM, McKay LL (1981) Recombinant plasmid associated with cell
aggregation and high-frequency conjugation of Streptococcus lactis ML3. J Bacteriol
146: 937944.
40. Anderson DG, McKay LL (1984) Genetic and physical characterization of
recombinant plasmids associated with cell aggregation and high-frequency
conjugal transfer in Streptococcus lactis ML3. J. Bacteriol. 158: 954962.
41. Kok J, van der Vossen JMBM, Venema G (1984) Construction of plasmid
cloning vectors for lactic streptococci which also replicate in Bacillus subtilis and
Escherichia coli. Appl Environ Microbiol 48: 726731.
42. Schouler C, Ehrlich SD, Chopin MC (1994) Sequence and organization of the
lactococcal prolate-headed bIL67 phage genome. Microbiology 140: 3061
3069.
43. Crutz-Le Coq A-M, Cesselin B, Commissaire J, Anba J (2002) Sequence analysis
of the lactococcal bacteriophage bIL170: insights into structural proteins and
HNH endonucleases in dairy phages. Microbiology 148: 9851001.
44. Samson JE, Moineau S (2010) Characterization of Lactococcus lactis phage 949
and comparison with other lactococcal phages. Appl Environ Microbiol 76:
68436852.
45. Mahony J, Deveau H, Mc Grath S, Ventura M, Canchaya C, et al. (2006)
Sequence and comparativegenomic analysis of lactococcal bacteriophages jj50,
712, and P008: evolutionary insights into the 936 phage species. FEMS
Microbiol Lett 261: 253261.
46. Labrie SJ, Josephsen J, Neve H, Vogensen FK, Moineau S (2008) Morphology,
genome sequence, and structural proteome of type phage P335 from Lactococcus
lactis. Appl Environ Microbiol 74: 46364644.
47. Haft DH, Selengut J, Mongodin EF, Nelson KE (2005) A guild of 45 CRISPR-
associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in
prokaryotic genomes. PLoS Comput Biol 1, e60.
48. Godde JS, Bickerton A (2006) The repetitive DNA elements called CRISPRs
and their associated genes: evidence of horizontal transfer among prokaryotes.
J Mol Evol 62: 718729.
Lactococcus CRISPR/Cas
PLOS ONE | www.plosone.org 9 December 2012 | Volume 7 | Issue 12 | e51663