Yeast

Yeast 2004; 21: 947–962.

Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/yea.1142
Yeast Functional Analysis Report

A versatile toolbox for PCR-based tagging of

yeast genes: new fluorescent proteins, more
markers and promoter substitution cassettes
Carsten Janke1 , Maria M. Magiera2 , Nicole Rathfelder3 , Christof Taxis3 , Simone Reber3 ,
Hiromi Maekawa4 , Alexandra Moreno-Borchart5 , Georg Doenges5 , Etienne Schwob2 , Elmar Schiebel4
and Michael Knop3,5, *
1 CRBM, CNRS FRE2593, 1919 Route de Mende, F-34293 Montpellier cedex 5, France
2 IGM, CNRS UMR5535, 1919 Route de Mende, F-34293 Montpellier cedex 5, France
3 EMBL, Heyeshofstraße 1, D-69117, Heidelburg, Germany
4 Paterson Institute for Cancer Research, Wilmslow Road, Manchester M20 4BX, UK
5 Max-Planck-Institute for Biochemistry, Department of Molecular Cell Biology, Am Klopferspitz 18A, 82152 Martinsried, Germany

*Correspondence to: Abstract

Michael Knop, EMBL, Cell
Biology and Biophysics, Tagging of genes by chromosomal integration of PCR amplified cassettes is a widely
Meyerhofstrasse 1, D-69117 used and fast method to label proteins in vivo in the yeast Saccharomyces cerevisiae.
Heidelberg, Germany. This strategy directs the amplified tags to the desired chromosomal loci due to
E-mail: flanking homologous sequences provided by the PCR-primers, thus enabling the
[email protected] selective introduction of any sequence at any place of a gene, e.g. for the generation
of C-terminal tagged genes or for the exchange of the promoter and N-terminal
tagging of a gene. To make this method most powerful we constructed a series of 76
novel cassettes, containing a broad variety of C-terminal epitope tags as well as nine
different promoter substitutions in combination with N-terminal tags. Furthermore,
new selection markers have been introduced. The tags include the so far brightest
and most yeast-optimized version of the red fluorescent protein, called RedStar2, as
well as all other commonly used fluorescent proteins and tags used for the detection
and purification of proteins and protein complexes. Using the provided cassettes for
N- and C-terminal gene tagging or for deletion of any given gene, a set of only four
primers is required, which makes this method very cost-effective and reproducible.
This new toolbox should help to speed up the analysis of gene function in yeast, on
Received: 7 November 2003
the level of single genes, as well as in systematic approaches. Copyright  2004 John
Accepted: 19 May 2004
Wiley & Sons, Ltd.

Introduction protein complex purification (Gavin et al., 2002;

Ho et al., 2002), as well as for single gene-function
The targeted introduction of heterologous DNA to analysis. The strategy requires: (a) a pair of primers
genomic locations by a simple polymerase chain that contain within their 5
region sequences of
reaction (PCR)-based strategy has been widely homology to the genomic target location; and
used for research, particularly with the fungi Sac- (b) PCR-cassettes (also termed ‘modules’) that can
charomyces cerevisiae and Schizosaccharomyces be amplified using these primers. To make the
pombe (Bahler et al., 1998; Baudin et al., 1993; technique most powerful and cost-efficient, we con-
Knop et al., 1999; Krawchuk and Wahls, 1999; structed a series of new cassettes and included in all
Longtine et al., 1998; Schneider et al., 1995; Tasto of them identical primer-binding sites, which allow
et al., 2001; Wach et al., 1994, 1997). These strate- the amplification of all C-terminal tags with only
gies have been shown to be powerful tools in one pair of primers per gene. An additional primer
systematic gene deletion, protein localization and is needed for gene deletion (Knop et al., 1999) and

Copyright  2004 John Wiley & Sons, Ltd.

948 C. Janke et al.

Figure 1. The principle of PCR-based epitope tagging. Schematic illustration of the principle of genomic manipulation
of yeast strains using PCR-based strategies. The plasmid contains a cassette, which consists of a selection marker and
additional sequences, which can be promoter sequences and/or sequences that encode for a tag (e.g. GFP). The S1-, S2-,
S3- and S4-primers allow amplification of cassettes (A) and targeting of the respective PCR product to the desired genomic
location (B), which becomes defined by the overhangs provided by the S1- S2-, S3- and S4-primers (see colour-encoded
primers in the figure: the same colours indicate homologous sequences). Depending on whether a gene deletion, a C- or a
N-terminal gene fusion should be performed, specific pairs of the S1- S2-, S3- or S4-primers are used to amplify the cassette.
Upon transformation, an integration of the cassettes into the yeast genome occurs due to homologous recombination (C).
For primer designs, see Figure 2

a fourth primer for the introduction of sequences the PCR-cassette pYM1-12 is described in Knop
at the N-terminus (Figure 1). et al. (1999). The construction of the new cassettes
In addition to the previously published 12 cas- is summarized in Table 1; the primers used are
settes for C-terminal epitope tags (Knop et al., listed in Table 2 (further details can be obtained
1999), we present here a wider range of C-terminal upon request). A comprehensive overview of all
tags as well as two new selection markers, both available C-terminal tagging cassettes, with regard
carrying dominant antibiotic-resistance genes. We to selection marker and tag, is provided in Table 3.
also describe new cassettes that allow the replace-
ment of the promoter of a given gene, with the
optional addition of an N-terminal epitope tag to Amplification of the PCR-modules
the gene. Nine promoters, five of them inducible,
were cloned into different cassette plasmids. A set of four primers allows to amplify all N-
The construction of PCR-cassettes is straight- and C-terminal tags and to generate gene deletions.
forward and can be done via standard cloning The principle of the primer design is explained
strategies (details provided upon request). There- in Figure 2. The amplification of the modules
fore, it will be easy to create new cassettes, e.g. can cause problems, because the annealing sites
to introduce new combinations of tags, makers and for S1, S2 and S3 primers (Figure 2), which
promoters (in the case of N-terminal tagging) by were chosen initially for the EUROFAN project,
simple cloning procedures. lead to self-annealing of the primers. Another
problem is the high GC content of the natNT2
Materials and methods marker. To circumvent these problems, different
PCR conditions have been used (Goldstein and
Cassette plasmid construction McCusker, 1999). We present here one particular
Standard techniques were used for DNA manipula- condition, which works well in several laboratories.
tions (Sambrook et al., 1989). The construction of One other reason for the failure of the PCR

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
 Table 1. Properties and construction of the new cassette plasmids
Used Size Template/
with of Pro- origin of tag Restriction
Name primers product moter1 Tag Marker Primers2 or promoter Target plasmid sites used Control digest
4 7,3
pFA6a–natNT2 S1/S2- 1460 — natNT2 natMX4-1/natMX4- pEG202 pFA6–natMX4 XhoI/SacI NotI 2390+1394 bp
23
ADH1-1/ADH1-2
pFA6a–hphNT1 S1/S2- 1840 — hphNT1 hphMX4-1/hphMX4- p425-Gal16 pFA6–hphMX45,7 XhoI/SacI NotI 2390+1777 bp
25

Copyright  2004 John Wiley & Sons, Ltd.

M13-hin/CYC1-Term
pYM13 S2/S3- 2330 TAP kanMX4 CBP-s/CBP-as Oligos annealed pYM8 SalI/BamHI SalI/XbaI 4568+111 bp
pYM14 S2/S3- 1820 6HA kanMX4 pYM3/6 F/pYM3/6 R pYM3 pFA6a–kanMX4 SalI/BglII c/o BamHI NotI 2390+1782 bp HindIII/XhoI
2955+1217 bp
pYM15 S2/S3- 1670 6HA HIS3MX6 pYM3/6 F/pYM3/6 R pYM3 pFA6a–HisMX6 SalI/BglII c/o BamHI NotI 2390+1626 bp
pYM16 S2/S3- 2050 6HA hphNT1 pYM3/6 F/pYM3/6 R pYM3 pKS133 SalI/BglII c/o BamHI NotI 2390+2011 bp
pYM17 S2/S3- 1670 6HA natNT2 pYM3/6 F/pYM3/6 R pYM3 pKS134 SalI/BglII c/o BamHI NotI 2390+1628 bp HindIII/XhoI
2767+1251 bp
Toolbox for PCR-based tagging of yeast genes

pYM18 S2/S3- 1990 9Myc kanMX4 pYM3/6 F/pYM3/6 R pYM6 pFA6a–kanMX4 SalI/BglII c/o BamHI EcoRI/SalI 2459+1881 bp
pYM19 S2/S3- 1830 9Myc HIS3MX6 pYM3/6 F/pYM3/6 R pYM6 pFA6a–HISMX6 SalI/BglII c/o BamHI HindIII/PvuI 3278+906 bp
pYM20 S2/S3- 2220 9Myc hphNT1 pYM3/6 F/pYM3/6 R pYM6 pKS133 SalI/BglII c/o BamHI HindIII/XhoI 2697+1872 bp
pYM21 S2/S3- 1840 9Myc natNT2 pYM3/6 F/pYM3/6 R pYM6 pKS134 SalI/BglII c/o BamHI HindIII/XhoI 2767+1419 bp
pYM22 S2/S3- 1310 3HA klTRP1 klTRP1-1/klTRP1-2 pYM3 pYM1 BssHII/EcoRI NotI 2390+1268 bp
pYM23 S2/S3- 1330 3Myc klTRP1 klTRP1-1/klTRP1-2 pYM3 pYM4 BssHII/EcoRI BamHI/XhoI 2479+1200 bp
pYM24 S2/S3- 1910 3HA hphNT1 No PCR pYM1 pKS133 SalI/BssHII NotI 2390+1875 bp BssHII/SalI
4141+124 bp
pYM25 S2/S3- 2550 yeGFP8 hphNT1 No PCR pYM12 pKS133 SalI/BssHII BamHI/XhoI 2721+2184 bp
BssHII/SalI 4141+764 bp
pYM26 S2/S3- 1950 yeGFP8 klTRP1 klTRP1-1/klTRP1-2 pYM3 pYM12 BssHII/EcoRI XhoI/XbaI 3710+588 bp
pYM27 S2/S3- 2550 EGFP kanMX4 GFP-4/GFP-6 pEGFP9 pYM1 SalI/BamHI SalI/BamHI 4187+753 bp
pYM28 S2/S3- 2400 EGFP HIS3MX6 GFP-4/GFP-6 pEGFP9 pYM2 SalI/BamHI SalI/BamHI 4831+753 bp
pYM29 S2/S3- 1950 EGFP klTRP1 GFP-4/GFP-6 pEGFP9 pYM3 SalI/BamHI SalI/BamHI 3570+753 bp
pYM30 S2/S3- 2550 ECFP kanMX4 GFP-4/GFP-6 pECFP9 pYM1 SalI/BamHI SalI/BamHI 4187+753 bp
pYM31 S2/S3- 2400 ECFP HIS3MX6 GFP-4/GFP-6 pECFP9 pYM2 SalI/BamHI SalI/BamHI 4031+753 bp
pYM32 S2/S3- 1950 ECFP klTRP1 GFP-4/GFP-6 pECFP9 pYM3 SalI/BamHI SalI/BamHI 3570+753 bp
pYM33 S2/S3- 2550 EBFP kanMX4 GFP-4/GFP-6 pEBFP9 pYM1 SalI/BamHI SalI/BamHI 4187+753 bp
pYM34 S2/S3- 1950 EBFP klTRP1 GFP-4/GFP-6 pEBFP9 pYM1 SalI/BamHI BglII/EcoRI 3500+1446 bp
pYM35 S2/S3- 2520 DsRed1 kanMX4 Red1-1/Red1-2 pDsRed1-N1 pYM4 BssHII/BamHI SalI/StuI 4391+475 bp
pYM36 S2/S3- 2000 DsRed1 klTRP1 No PCR pSM822 pSM825 BssHII/BamHI HindIII/XhoI 2455+1804 bp
pYM37 S2/S3- 2520 DsRed kanMX4 dsRED-1/dsRED-2 DsRed10 pFA6a–kanMX4 BssHII/BamHI NotI 2390+2251 bp
pYM38 S2/S3- 2520 RedStar kanMX4 dsRED-2/dsRED-7 RedStar 10 pFA6a–kanMX4 BssHII/BamHI SalI/NcoI 3521+1120 bp
BssHII/SalI 3915+1186 bp

Yeast 2004; 21: 947–962.

949
 950

Table 1. Continued
Used Size Template/
with of Pro- origin of tag Restriction
Name primers product moter1 Tag Marker Primers2 or promoter Target plasmid sites used Control digest

pYM39 S2/S3- 2600 EYFP kanMX4 GFP-4/GFP-6 pEYFP9 pYM1 SalI/BamHI SalI/BamHI 4187+753 bp
pYM40 S2/S3- 2820 EYFP hphNT1 No PCR pYM-YK pKS133 SalI/BssHII SalI/XhoI 2715+2231 bp

Copyright  2004 John Wiley & Sons, Ltd.

pYM41 S2/S3- 2400 EYFP HIS3MX6 GFP-4/GFP-6 pEYFP9 pYM2 SalI/BamHI XbaI/PvuI 2732+2058 bp
pYM42 S2/S3- 2150 RedStar ∗11 natNT2 RedStar2- RedStar 10 pKS134–1 SalI/BamHI BamHI/SalI 3778+717 bp
BamHI/RedStar2-SalI
pYM43 S2/S3- 2150 RedStar215 natNT2 Site-directed RedStar2 pKS134–1 SalI/BamHI BamHI/SalI 3778+717 bp
mutagenesis15
pYM44 S2/S3- 2310 yeGFP8 HIS3MX6 No PCR pYM5 pYM12 BstEII/EcoRI SalI/BssHII 4141+763 bp
pYM45 S2/S3- 1740 1HA kanMX4 HA-F1/HA-F2 Oligos annealed pYM1 SalI/BssHII BglII/EcoRI 2730+1446 bp
pYM46 S2/S3- 1760 1Myc–7His kanMX4 MYC-7xHis-F1/MYC- Oligos annealed pYM1 SalI/BssHII BglII/EcoRI 2488+1446+266 bp
7xHis-F2
pYM47 S2/S3- 1852 FlAsH hphNT1 FlAsH-1/FlAsH-2 Oligos annealed pYM–hphNT1 SalI/BamHI BamHI/XhoI 2751+1446 bp
pYM48 S2/S3- 2569 PA–GFP12 hphNT1 GFP-4/GFP-6 PA-GFP pYM–hphNT1 SalI/BamHI BamHI/XhoI 3468+1446 bp
pYM51 S2/S3- 2500 eqFP61113 KanMX4 eqFP611-1/-2 pBS-KS+eqFP61113 pYM12 SalI/BssHII BamHI/XhoI 4184+704
pYM–N1 S1/S4- 1990 CUP1-1 — kanMX4 CUP1-A/CUP1-B Yeast genomic DNA PFA6a–kanMX4 SacI/EcoRI NotI 2390+2031 bp
pYM–N2 S1/S4- 1830 CUP1-1 — natNT2 CUP1-A/CUP1-B Yeast genomic DNA pYM–natNT2 SacI/EcoRI NotI 2390+1874 bp HindIII/XhoI
3247+1017 bp
pYM–N3 S1/S4- 1980 CUP1-1 3HA natNT2 HA-1%CUP/HA- pYM1 pMM40 BspEI/EcoRI SalI/XbaI 2848+1564 bp
2%CUP
pYM–N4 S1/S4- 2590 CUP1-1 yeGFP8 natNT2 eGFP%CUP- pYM12 pMM40 BspEI/EcoRI SalI/XbaI 3454+1564 bp
1/eGFP%CUP-2
pYM–N5 S1/S4- 2260 CUP1-1 ProA natNT2 ProA-1n/ProA-2n pCW804 pMM40 BspEI/EcoRI SalI/XbaI 3127+1564 bp
pYM–N6 S1/S4- 2987 ADH — kanMX4 No PCR p413-ADH14 pYM–N1 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 1480 bp
pYM–N7 S1/S4- 2827 ADH — natNT2 No PCR p413-ADH14 pYM–N2 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 1480 bp
pYM–N8 S1/S4- 2977 ADH 3HA natNT2 No PCR p413-ADH14 pYM–N3 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 1628 bp
pYM–N9 S1/S4- 3587 ADH yeGFP8 natNT2 No PCR p413-ADH14 pYM–N4 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 2234 bp
pYM–N10 S1/S4- 1816 CYC1 — kanMX4 No PCR p413-CYC114 pYM–N1 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 309 bp
pYM–N11 S1/S4- 1656 CYC1 — natNT2 No PCR p413-CYC114 pYM–N2 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 309 bp
pYM–N12 S1/S4- 1806 CYC1 3HA natNT2 No PCR p413-CYC114 pYM–N3 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 457 bp
pYM–N13 S1/S4- 2416 CYC1 yeGFP8 natNT2 No PCR p413-CYC114 pYM–N4 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 1063 bp
pYM–N14 S1/S4- 2143 GPD — kanMX4 No PCR p413-GPD14 pYM–N1 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 639 bp
pYM–N15 S1/S4- 1983 GPD — natNT2 No PCR p413-GPD14 pYM–N2 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 639 bp
pYM–N16 S1/S4- 2133 GPD 3HA natNT2 No PCR p413-GPD14 pYM–N3 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 784 bp
pYM–N17 S1/S4- 2743 GPD yeGFP8 natNT2 No PCR p413-GPD14 pYM–N4 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 1390 bp
pYM–N18 S1/S4- 1932 TEF — kanMX4 No PCR p413-TEF 14 pYM–N1 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 425 bp
pYM–N19 S1/S4- 1772 TEF — natNT2 No PCR p413-TEF 14 pYM–N2 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 425 bp
pYM–N20 S1/S4- 1922 TEF 3HA natNT2 No PCR p413-TEF 14 pYM–N3 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 573 bp

Yeast 2004; 21: 947–962.

C. Janke et al.
 pYM–N21 S1/S4- 2532 TEF yeGFP8 natNT2 No PCR p413-TEF 14 pYM–N4 SacI/SmaI c/o BspIE+Klenow SacI/EcoRI 1179 bp
pYM–N22 S1/S4- 1978 GAL1 — kanMX4 No PCR p413-GAL16 pYM–N1 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 471 bp
pYM–N23 S1/S4- 1818 GAL1 — natNT2 No PCR p413-GAL16 pYM–N2 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 471 bp
pYM–N24 S1/S4- 1968 GAL1 3HA natNT2 No PCR p413-GAL16 pYM–N3 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 619 bp
pYM–N25 S1/S4- 2578 GAL1 yeGFP8 natNT2 No PCR p413-GAL16 pYM–N4 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 1225 bp
pYM–N26 S1/S4- 1951 GALL — kanMX4 No PCR p413-GALL6 pYM–N1 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 444 bp
pYM–N27 S1/S4- 1791 GALL — natNT2 No PCR p413-GALL6 pYM–N2 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 444 bp
pYM–N28 S1/S4- 1941 GALL 3HA natNT2 No PCR p413-GALL6 pYM–N3 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 592 bp
pYM–N29 S1/S4- 2551 GALL yeGFP8 natNT2 No PCR p413-GALL6 pYM–N4 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 1198 bp
pYM–N30 S1/S4- 1935 GALS — kanMX4 No PCR p413-GALS6 pYM–N1 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 428 bp
pYM–N31 S1/S4- 1775 GALS — natNT2 No PCR p413-GALS6 pYM–N2 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 428 bp
pYM–N32 S1/S4- 1925 GALS 3HA natNT2 No PCR p413-GALS6 pYM–N3 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 576 bp
pYM–N33 S1/S4- 2535 GALS yeGFP8 natNT2 No PCR p413-GALS6 pYM–N4 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 1182 bp
pYM–N34 S1/S4- 1902 MET25 — kanMX4 No PCR p413-MET256 pYM–N1 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 395 bp
pYM–N35 S1/S4- 1742 MET25 — natNT2 No PCR p413-MET256 pYM–N2 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 395 bp

Copyright  2004 John Wiley & Sons, Ltd.

pYM–N36 S1/S4- 1892 MET25 3HA natNT2 No PCR p413-MET256 pYM–N3 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 543 bp
pYM–N37 S1/S4- 2505 MET25 yeGFP8 natNT2 No PCR p413-MET256 pYM–N4 SacI/SmaI c/o BspEI+Klenow SacI/EcoRI 1149 bp

The four rightmost columns list the primers, plasmids and restriction sites used for PCR construction of the cassettes.
1 For N-terminal tags.
2 See Table 2 for primer sequences.
3 Before subcloning of the ADH1-terminator, a XhoI site was introduced into plasmid pFA6–natMX4 using the indicated primers and the Quickchange Kit (Clonetech).
4 Gyuris et al., 1993.
Toolbox for PCR-based tagging of yeast genes

5 Before subcloning of the CYC1-terminator, a XhoI site was introduced into plasmid pFA6-hphMX4 using the indicated primers and the Quickchange Kit (Clonetech).
6 Mumberg et al., 1995.
7 Goldstein and McCusker, 1999.
8 Cormack et al., 1996.
9 From Clonetech.
10 Knop et al., 2002.
11 RedStar∗ is identical to RedStar except that the T217A mutation is missing, which causes an increase in green fluorescence (Bevis and Glick, 2002).
12 Patterson and Lippincott-Schwartz, 2002.
13 Wiedenmann et al., 2002.
14 Mumberg et al., 1994.
15 RedStar2 has been constructed by introduction of the T4 mutations (Bevis and Glick, 2002) into RedStar.

Yeast 2004; 21: 947–962.

951
952 C. Janke et al.

Table 2. Primer sequences

Primer name Sequence (5
→ 3
)

ADH1-1 GACAGAGAGCTCGATTACAACAGGTGTTGTCCTC
ADH1-2 CTGGCCTCGAGGCGAATTTCTTATGATTTATGATTT
CBP-as TCGACGCTAGCAGTAGTTGGAATATCATAATCAAGTGCCCCGGAGGATGAGATTTTCTTAAAGCGGTTGGCT
GCTGAGACGGCTATGAAATTCTTTTTCCATCTTCTCTTG
CBP-s TCGACAAGAGAAGATGGAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACCGCTTTAAGAAAATCTCATCC
TCCGGGGCACTTGATTATGATATTCCAACTACTGCTAGCG
CUP1-A GCGACGGAGCTCTAGTAAGCCGATCCCATTACC
CUP1-B CGACGAATTCTCTGTCGTCCGGATTTATGTGATGATTGATTGATTGATTG
CYC1-term GACAGAGAGCTCGTTAAAGCCTTCGAGCGTCCC
dsRED-1 CGGGATCCGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAATTCTGGGTAGATCTTCTAAGAACGTC
dsRED-2 AAGTGGCGCGCTTACAAGAACAAGTGGTGTCTAC
dsRED-7 CGGGATCCGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAATTCTGAGTAGATCTTCTAAGAACGTC
eGFP%CUP1-1 GCACGACTCCGGAATGTCTAAAGGTGAAGAATTATTCAC
eGFP%CUP1-2 CATCCGAGAATTCTCTGTCGGACCAGCACCGGCACCGGCACCAGCACCGGCACCAGCACCTTTGTACAATT
CATCCATACCATG
GFP-4 CCTGGGATCCTTACTTGTACAGCTCGTCCATGC
GFP-6 GCACTGGTCGACGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAATGAGCAAGGGCGAGGAGC
HA-1%CUP GCACGACTCCGGAATGGGTTACCCATACGATGTTCCTGACTATGCG
HA-2%CUP CATCCGAGAATTCTCTGTCGGACCAGCACCGGCACCGGCACCAGCACCGGCACCAGCACCAGAGCACTGA
GCAGCGTAATCT
HA-F1 TCGACTACCCATACGACGTCCCAGACTACGCTTAG
HA-F2 CGCGCTAAGCGTAGTCTGGGACGTCGTATGGGTAG
hphMX4-1 GGCAAAGGAATAATCTCGAGTACTGACAATAAAAAG
hphMX4-2 CTTTTTATTGTCAGTACTCGAGATTATTCCTTTGCC
klTRP1-1 AGTCTAGGCGCGCAAAGTGGAACGATCATTCAC
klTRP1-2 AGGCCGAATTCGAGCTCGCCTCGAGGC
M13hin AGCGGATAACAATTTCACACAGGA
MYC-7xHis-F1 TCGACGAGCAGAAGCTGATTAGCGAGGAAGATCTGCACCACCATCACCATCACCATTAG
MYC-7xHis-F2 CGCGCTAATGGTGATGGTGATGGTGGTGCAGATCTTCCTCGCTAATCAGCTTCTGCTCG
natMX4-1 GCCCTGCCCCTAATCTCGAGTACTGACAATAAAAAG
natMX4-2 CTTTTTATTGTCAGTACTCGAGATTAGGGGCAGGGC
pYM3/6 F AGCTTCGTACGCTGCAGGTCG
pYM3/6 R GGTAAGATCTCTTGAATGATCGTTCCACTTTTTAGC
ProA-1n GCACGACTCCGGAATGGCGCAACACGATGAAGCCGTAG
ProA-2n CATCCGAGAATTCTCTGTCGGACCAGCACCGGCACCAGGAGCACCAGCGCCTGGAGCACCAGCACCATTCG
CGTCTACTTTCGGCG
Red1-1 GGATCCGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAATGGTGCGCTCCTCCAAGAACGTC
Red1-2 AGAAGTGGCGCGCAGCTACAGGAACAGGTGGTGGCGGCC
RedStar2-BamHI GCGAGGATCCTTACAAGAACAAGTGGTGTCTAC
RedStar2-SalI GGACACAGTCGACGGAGCTGGAGCTGGTGCAGGTGCTGGTGCAATGAGTGCTTCTTCTGAAGATGTCATCA
CTGAATTCATGAGATTCAAG
FlAsH-1 TCGACTGTTGTCCAGGTTGTTGTGCTAGAGCCTGAG
FlAsH-2 GATCCTCAGGCTCTAGCACAACAACCTGGACAACAG
S2-SPC42 TACACAGAACGCTTTAAGAATGCGCCATACTCCTTAACTGCTTTTTAAATCATCAATCGATGAATTCGAGCTCG
S3-SPC42 CAAGCCTGAAAATAATATGTCAGAAACATTCGCAACTCCCACTCCCAATAATCGACGTACGCTGCAGGTCGAC
S2-SPC72 AGAGAGTGACTGAGTGTTACATTAAATATATTTATATATAAACGTATGATATTTAATCGATGAATTCGAGCTCG
S3-SPC72 ACAGGAAAATGAGTCATTGAGATCGAAACTTTTCAACCTATCAATCAACAATCCCCGTACGCTGCAGGTCGAC
S1-SSP1 TCACAATAGTGCCTATTATCATGATAGAAGTAGAGTAGAAAAGCTAGCAACAATGCGTACGCTGCAGGTCGAC
S4-SSP1 GGGAAGTTGAGGTTATTTCCCCAGAAGGATCATTCTCATATGTGCCAGAGCTTCTCATCGATGAA
TTCTCTGTCG
S1-DON1 TATCTACTTGACTTTGGCTGGTATTTAAACACAAGTAAGAGAAGCATCAAACATGCGTACGCTGCAGGTCGAC
S4-DON1 TTAGAAAAGAGGTTTTAGCAGCATTATTTTCTTTTCCCTTTCTATTTTTCTTTCCCATCGATGAATTCTCTGTCG
eqFP611-1 GCAGCAGCAGCGCGCCTCGAGTCAAAGACGTCCCAGTTTG
eqFP611-2 GCGCAGCGCGGTCGACGGAGCAGGTGCTGGTGCTGGTGCTGGAGCAGGGATCCGTATGAATTCACTGATC
AAGGAA

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
Toolbox for PCR-based tagging of yeast genes 953

Table 3. Systematic table of all available pYM plasmids for C-terminal tagging and deletion
Tag kanMX4 hphNT1 natNT2 HIS3MX6 kITRP1

Deletion module (no tag) pFA6a–kanMX4 pYM–hphNT1 pYM–natNT2 pFA6a–HIS3MX6

1HA pYM45
3HA pYM1 pYM24 pYM2 pYM22
6HA pYM14 pYM16 pYM17 pYM15 pYM3
1MYC–7His pYM46
3MYC pYM4 pYM5 pYM23
9MYC pYM18 pYM20 pYM21 pYM19 pYM6
ProA pYM7
TEV–ProA pYM8
TEV–ProA–7His pYM9 pYM10
TEV–GST–6HIS pYM11
TAP pYM13
yeGFP (em507, ex488 nm) pYM12 pYM25 pYM44 pYM26
EGFP (em507, ex488 nm) pYM27 pYM28 pYM29
ECFP (em475 (501), ex433 (453) nm) pYM30 pYM31 pYM32
EBFP (em447, ex383 nm)# pYM33 pYM34
DsRed1 (em583, ex558 nm) pYM35 pYM36
DsRed (yRFP) (em583, ex558 nm) pYM37
RedStar (em583, ex558 nm) pYM38
RedStar∗ (em583, ex558 nm) pYM42
RedStar2 (em583, ex558 nm) pYM43
EYFP (em527, ex513 nm) pYM39 pYM40 pYM41
PA–GFP (photo activated GFP) pYM48
FlAsH pYM47
eqFP611 (em611, ex559 nm) pYM51

# BFP is a very weak fluorescent protein. So far, we have not yet successfully used the BFP-modules. However, we provide the cassette since

some strongly expressed proteins might be well detected when tagged with BFP.

Figure 2. Primer design. The figure illustrates the design of the primers S1- S2-, S3- and S4 that are used for the
amplification of the cassettes described in this paper. The correct primer design is fundamental for the success of the PCR
amplification and the correct targeting into the yeast genome. The following rules should help to design the primers using
specific software such as DNA Strider: S1-primer, 45–55 bases upstream of the ATG (including ATG = start codon) of
the gene, followed by 5
-CGTACGCTGCAGGTCGAC-3
; S2-primer, the reverse complement of 45–55 bases downstream
of the STOP-codon including STOP) of the gene, followed by 5
-ATCGATGAATTCGAGCTCG-3
; S3-primer, 45–55
bases before the STOP-codon (excluding STOP) of the gene, followed by 5
-CGTACGCTGCAGGTCGAC-3
; S4-primer,
the reverse complement of 45–55 bases downstream of the ATG (start-codon) of the gene (excluding ATG), followed by
5
-CATCGATGAATTCTCTGTCG-3

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
954 C. Janke et al.

is often linked to the quality of the primers other strain backgrounds (such as SK-1), a 10-fold
(see Discussion). higher amount of DNA was used. For this purpose,
The pipetting scheme for a 50 µl reaction and the the PCR product was ethanol-precipitated and dis-
PCR cycle scheme are visualized in Figure 3A/B. solved in water (1/10 of the original volume).
A successful PCR gives a very strong band at the
estimated size (Table 1, Figure 3C), when 3–5 µl
of the PCR were analysed on a standard agarose Yeast strains and growth conditions
gel. Some natNT2 cassettes might cause problems.
The use of another PCR-buffer (Figure 3C) circum- YPD and synthetic drop-out media were pre-
vents this problem. pared as described (Sherman, 1991). For antibi-
For transformation of S288c- or W303-derived otic selection markers, the following concentrations
strains, usually 5 µl of a PCR were used. For some of antibiotics were added to standard YPD-plates

Figure 3. Amplification of PCR-cassettes. (A) 50 µl of a PCR-sample are mixed on ice. For the amplification of hphNT1-
and natNT2-containing cassettes, it is recommended to use buffer 2. (B) The amplification programme is the same for all
cassettes except the modification in the melting step for natNT2-based cassettes (grey-shaded). (C) pYM14-17 (6HA-tag)
were amplified with the S2/S3 primers of CDC6. 5 µl of the PCR reaction were analysed on a 0.9% agarose-TAE gel.
The gel was stained with ethidium bromide. As reference, 10 µl 1 kbp marker, diluted according to the manufacturers’
instructions (Invitrogen, Gibco, BRL) was run (1, 6). Under standard conditions, amplification of pYM14 (2) and pYM15
(3) gave a very strong band at the expected size (Table 1). The amplification of pYM16 (4) was less efficient, but sufficient
for transformation of the PCR-product; pYM17 could not be amplified under standard conditions (5). With the special
protocol (B), pYM17 was weakly amplified in buffer 1 (7); a very strong PCR-product of the correct size (Table 1) was
amplified when special conditions (B) and buffer 2 were used (8)

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
Toolbox for PCR-based tagging of yeast genes 955

(www.duke.edu/web/microlabs/mccusker/; Gold- anti-Don1p (Rabitsch et al., 2001); GFP, affinity-

stein and McCusker, 1999): kanMX4, geneticin purified sheep anti-GFP. For ECL detection (Amer-
(G418, GibcoBRL), 200 mg/l; hphNT1, hygromy- sham), goat anti-mouse, -rabbit or -sheep secondary
cin B (Cayla, Toulouse, France; www.cayla.com), antibodies coupled to horseradish peroxidase (Jack-
300 mg/l; and natNT2, nourseothricin (ClonNAT, son Immuno Research Laboratories) were used.
Werner BioAgents, Jena-Cospeda, Germany; www.
webioage.com), 100 mg/l.
Plasmid requests
The antibiotics were added after autoclaving and
cooling of the medium to approximately 60 ◦ C. The full collection of plasmids and the sequence
In the case of ClonNAT, a sterile filtered stock- files will be made available for non-commercial
solution was prepared prior to addition to the recipients through EUROSCARF (http://www.uni-
medium, while for geneticin and hygromycin B, frankfurt.de/fb15/mikro/euroscarf/index.html).
the powder and the solution provided by the The plasmids have been prepared and tested care-
manufacturer were used directly. fully; however, we cannot guarantee that no error
has been made. In case of problems, please do not
Yeast transformation and testing contact any of the authors unless you are absolutely
sure that the problem is associated with the plasmid
Yeast transformation using frozen competent cells (use positive controls!).
was based on the LiOAc method (Schiestl and
Gietz, 1989), however with several modifications.
A detailed description of the method is given in Results
Knop et al. (1999).
For klTRP1 or HIS3MX6 selection, after trans- Two new selection markers: hphNT1 and
formation cells were resuspended in 200 µl sterile natNT2
PBS and plated directly onto plates containing syn-
thetic medium lacking the respective amino acid Recently, Goldstein and McCusker (1999) introdu-
(SC-HIS, SC-TRP; Sherman, 1991). ced three new dominant drug resistance cas-
For kanMX4, hphNT1, natNT2-selection: after settes that can be used in the yeast S. cerevisiae.
transformation, cells were resuspended in 3 ml of The cassettes were constructed in analogy to the
YPAD medium and incubated on a shaker for at pFA6–kanMX4 marker (Goldstein and McCusker,
least 5–6 h at 30 ◦ C, than sedimented and plated 1999; Wach et al., 1994), thus allowing the use
onto the selection plates. of the established S1/S2-primer annealing sites
Selection for positive transformants on plates (Wach et al., 1994; Knop et al., 1999) for ampli-
containing antibiotics often requires replica plat- fication. The hphMX4 and natMX4 (Goldstein
ing of the plate after 2 days at 30 ◦ C, because and McCusker, 1999) markers confer resistance to
of the high background of transiently transformed hygromycin B or clonNat (nourseothricin), respec-
cells, which makes it difficult to recognize the tively, and were cloned in-between the promoter
correct integrants (Knop et al., 1999; Wach et al., and terminator of the kanMX4 cassette (Wach
1997). The success of the integration was tested et al., 1994). The homologous sequences flanking
by colony PCR using a quick chromosomal DNA the different marker genes, however, lead to recom-
isolation procedure (Finley and Brent, 1995), bination between the markers, if the two markers
immunoblotting or by immunofluorescence, as are used simultaneously in the same yeast strain.
described previously (Knop et al., 1999). For To circumvent this problem, we exchanged the ter-
immunoblotting, protein extraction was done using minator of the hphMX4 cassette and replaced it
the NaOH/βME/TCA-protocol (Knop et al., 1999). with the terminator of the CYC1 gene. Similarly,
For the detection of epitope-tagged proteins, tag- we replaced the natMX4 terminator with the ADH1
specific antibodies were used: HA-tag, mouse mon- terminator. The new cassettes were termed hphNT1
oclonal 12CA5 (Roche Boehringer-Mannheim), and natNT2, respectively (NT = new terminator;
16B12 (Babco); Myc-tag, mouse monoclonal 9E10 Table 1). As demonstrated in a control experiment
(Boehringer-Ingelheim); Protein A/TAP-tag, rab- (not shown), kanMX4, natNT2 and hphNT1 com-
bit PAP (DAKO); Don1p, affinity purified rabbit pletely failed to recombine with each other.

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
956 C. Janke et al.

C-terminal tagging: fluorescent proteins Double labelling using different fluorescent

proteins
The availability of a variety of fluorescent proteins,
such as yeGFP (Cormack et al., 1997), EGFP, For double-fluorescent labelling, different fluores-
EBFP, ECFP, EYFP (http://www.clontech.com/ cent proteins can be combined: GFP together with
gfp/excitation.shtml), DsRed (Matz et al., 1999), DsRed, GFP and BFP, GFP and CFP, and YFP
hcRED (Gurskaya et al., 2001) and RedStar, a in conjunction with CFP. The combination of YFP
much brighter version of DsRed (Knop et al., and CFP is frequently used. The tagged proteins
2002), consequently led to the construction of can be distinguished with appropriate filters. How-
new cassettes. The coding regions of the six ever, both, CFP and YFP bleach faster then GFP.
fluorophores were cloned into tagging cassettes The CFP signals often appeared weakly fluores-
preceded by a spacer sequence that codes for cent when observed by eye; however, imaging
the peptide ‘SGAGAGAGAGAIL’. This spacer with a CCD-camera gave nice and strong signals
peptide can facilitate the correct folding of the (Figure 4).
fluorescent proteins when coupled to the protein of
interest (Miller and Lindow, 1997). Additionally,
we provide a cassette containing the red fluorescent C-terminal tagging: HA, MYC and TAP tag
protein eqFP611 (Wiedenmann et al., 2002).
The properties of some of the GFP derivatives HA and MYC-tags are used for the detection of the
are summarized in a review article (Tsien, 1998; tagged proteins by immunoblotting and immunoflu-
for spectral properties, see also Table 3). All of orescence microscopy. A combination of two
them have been successfully used for applications tagged proteins (HA and MYC, respectively) in
in baker’s yeast, such as in vivo double labelling one strain is widely used to detect protein–protein
and live cell imaging. The suitability of each of interaction by co-immunoprecipitation. Further-
the individual fluorescent proteins for a specific more, it became obvious that proteins with low
experiment, however, has to be tested each time. expression levels can be detected when several
The red fluorescent protein DsRed has been lim- repeats of the HA or Myc tag (6HA or 9Myc)
ited to special application in yeast (Pereira et al., were fused to the protein. On the other hand, too
2001), since the formation of the red chromophore many tags may interfere with the functionality of
(Baird et al., 2000) is not fast enough (T1/2 ∼ 24 h) the fusion protein. For native protein purification, it
to allow the detection of de novo synthesized pro- has been shown that single HA-tagged proteins can
teins in logarithmically growing cells. This has be eluted from anti-HA beads using the HA pep-
been partially solved by the construction of a tide (YPYDVPDYA), while this was not possible
much brighter variant, called RedStar (Knop et al., when multiple tags were used. Because of these
2002), or by a faster-maturing but less bright vari- considerations, we constructed a variety of PCR
ant named T4-DsRed (Bevis and Glick, 2002). modules using single, triple and hexa- or nona-tags
We constructed a combination of the T4-DsRed in combination with a variety of selection mark-
and the RedStar mutant, which leads to a bright, ers (Table 3), thus enabling the flexible construc-
fast-maturing red fluorescent protein, RedStar2. We tion of strains carrying different tags at the same
provide for several of these DsRed variants cas- time.
settes (Table 1), most of which contain yeast codon The use of Protein A as an affinity tag has shown
optimized constructs. The last drawback of DsRed- to be a powerful tool for the purification of proteins
variants, their strong tetramerization (Baird et al., from yeast lysates, especially in combination with a
2000), has only recently been solved (Campbell calmodulin-binding peptide (CBP) and a TEV site-
et al., 2002), but this monomeric DsRed variant specific protease cleavage site. This combination of
seems to be not yet bright enough for general features, called the TAP tag (Rigaut et al., 1999),
applications in yeast (unpublished observation). has been shown to be very useful for native protein
However, the red fluorescent protein eqFP611 complex purification (Gavin et al., 2002).
(Wiedenmann et al., 2002) largely circumvents this An example for the application of the TAP tag
problem. PCR module (pYM13) is shown in Figure 5.

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
Toolbox for PCR-based tagging of yeast genes 957

Figure 4. Double labelling of two C-terminal tagged proteins: CFP and YFP. SPC42 was tagged with CFP amplified from
the cassette plasmid pYM30; SPC72 was tagged with YFP amplified from pYM41, using the corresponding S2 and S3 primers
(Table 2). The cells were collected in logarithmic growth and fixed for 5 min with 4% (w/v) paraformaldehyde. The cells
were analysed by fluorescence microscopy

Other tags
Recently, other tags with specific properties became
fashionable. The FlAsH tag consists of a small pep-
tide, containing four cystein residues (DCCPGC-
CA), that is recognized by specific di-arsenic com-
pounds, which, upon binding, become fluorescent
(Adams et al., 2001). We have tested the FlAsH tag
and found that it worked also in yeast; however the
maximally obtainable level of fluorescence, when
compared with the analogous GFP fusion, was less
than 5%, thus limiting the usefulness of this tag.
Similarly, we also constructed a cassette containing
the photo-activatable GFP (PA-GFP; Patterson and
Lippincott-Schwartz, 2002). Proteins carrying this
tag emitted, when maximally activated, less than
Figure 5. Purification of Don1p using the TAP-tag. The 10% of the fluorescence compared to GFP-tagged
protein Don1p was tagged with the TAP tag using pYM13 versions. This limits the usefulness of this tag in
and DON1 specific S2- and S3-primers. The protein was yeast.
purified from the soluble fraction of meiotic cells using a
modified version of the protocol of Rigaut et al. (1999)
Promoter replacement and N-terminal tagging
The introduction of a heterologous promoter upstr-
eam of the START codon of a gene is a way

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
958 C. Janke et al.

to control and to modulate gene expression. At N-terminal tags. For one single gene, all these cas-
the same time, it allows the introduction of a settes can be amplified with four unique primers
N-terminal epitope tag to the gene. (Figures 1 and 2). The versatility of the primers is
We constructed a set of cassettes with nine differ- a strong advantage not only regarding to the cost of
ent replacement promoters. Eight of these promot- the method. Also, once all four primers have been
ers were well characterized from previous appli- successfully tested, any concerns about the quality
cations in centromeric or 2 µ plasmids (Mumberg of the primers can be omitted, which can turn out
et al., 1994, 1995). The replacement of an inter- in some cases to be quite important (see below).
nal promoter with the constitutive ADH, CYC1, The cloning strategies for most of the cassettes
GPD or TEF promoters can be used to modulate were based on common restriction sites, which
the expression of a gene in a permanent manner. facilitate the construction of further cassettes, if
For inducible expression, the GAL1 promoter and necessary (Table 1; further details available upon
two truncated (and weaker) derivatives of this pro- request).
moter, termed GALL and GALS (Mumberg et al.,
1994), as well as the MET25 promoter, are pro- PCR amplification and primers
vided. All the promoters were cloned into cas-
settes with kanMX4 and natNT2 selection mark- Since the PCR amplification of the cassettes
ers. Additionally, all natNT2 promoter-substitution has caused problems in different laboratories, we
cassettes were combined with a N-terminal 3HA describe a PCR-protocol suitable for the amplifi-
and yeGFP (Cormack et al., 1997) tag (Table 1). cation of almost all of the cassettes. This proto-
We observed different expression rates of the gene col works well (in several laboratories), and fulfils
DON1 when controlled by the eight different pro- three major criteria: reliability, fidelity and high
moters. The inducible promoters are not always yield. It requires, however, a reliable PCR machine
completely repressed in the non-induced state. In that allows time increment programming. For the
the case of the relatively strong MET25 and the amplification of natNT2-based cassettes, this proto-
GAL1 promoters, a weak expression was observed col needs to be slightly modified due to the high GC
in the repressed state of the promoter (glucose content of the coding sequence of this marker gene
complete medium; Figure 6). In contrast, the two (see Materials and methods; Figure 3). Another
weaker versions of the GAL-promoter, GALL and reason why sometimes the PCR does not work is
GALS, were completely repressed (Figure 6). the poor primer quality. We found, that for some
Furthermore, we constructed five cassettes con- suppliers, up to 20% of the primers do not work
taining the CUP1-1 promoter (Table 1). This (e.g. 40% of the PCRs performed), while for other
strong promoter can be induced with CuSO4 . We suppliers, less then 5% are non-functional (less than
used this system successfully for the regulated 10% of PCRs performed) with respect to amplifica-
induction of gene expression during various phases tion of modules. Testing the primers in combination
of the meiotic cell cycle (unpublished data). An with established primers can help to nail down the
example of the expression of Ssp1p under control faulty primer (companies normally will provide a
of CUP1-1 is given in Figure 7. free replacement primer).

New selection markers

Discussion
The use of the hphNT1 and natNT2 cassettes is
In the present paper, we describe 37 new cassettes as robust as the kanMX4 cassettes. Cells selected
for the C-terminal epitope tagging of yeast pro- on antibiotic media tend to form a lawn, due to
teins, developed by combining existing tags with the growth of transiently transformed cells, which
new marker genes and cloning new tags, namely might hinder the identification of positive clones.
a variety of different fluorescent proteins of all In such a case the cells were replica-plated after
available colours, and the TAP-tag. Furthermore, a 2 days of growth onto a fresh plate of the same
series of 37 N-terminal cassettes has been devel- medium. On the new plate, only positive clones
oped that allow, besides the replacement of the grow. Using kanMX4 and HIS3MX6 together in
promoter of the target gene, the introduction of one strain led to recombination events within the

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
Toolbox for PCR-based tagging of yeast genes 959

CYC1

GPD
A

ADH

TEF
promoter

pYM-N... 8 12 16 20

short expo. 3HA-Don1p

long expo. 3HA-Don1p

Ponceau S

1 2 3 4 5

MET25
B
GALS
GAL1

GALL

promoter

pYM-N... 24 28 32 36
induction − + − + − + − +

short expo. 3HA-Don1p

long expo. 3HA-Don1p

Ponceau S

6 7 8 9 10 11 12 13

Figure 6. Control of expression of DON1 using a range of different promoter substitutions. The promoter of the gene
DON1 was exchanged for all available promoters (except CUP1-1; cf. Figure 7) associated with the N-terminal 3HA-tag.
Cultures were grown into the exponential growth phase. Western blot detection was done with the monoclonal antibody
16B12. Equal protein load was verified by staining the blots with Ponceau S. Two different expositions are shown to
underline the differences in promoter strength. (A) Constitutive promoters: GPD (lane 4) and TEF (lane 5) induce very strong
protein expression; the ADH-promoter (lane 1) is weaker; whereas the CYC1-promotor (lane 2) is very weak, therefore it
was detected with a 5× protein load (lane 3); 12 µg (60 µg in lane 3) total protein were analysed. (B) Inducible promoters:
induction was performed by adding 1% glucose (–) or 1% galactose (+) to YEP-raffinose medium (all GAL-promoters) or
by washing and transferring the culture to SC-met medium (MET25-promoter). Induction time was 90 min. 12 µg total
protein were analysed. The inducible promoters are different in strength; the very strong MET25 and the strong GAL1 are
slightly leaky (lanes 6 and 12)

marker genes. After the transformation of the sec- anti-Myc, anti-GFP or PAP (for detection of protein
ond cassette, positive clones must be selected on A tags) antibodies or fluorescence microscopy (to
both, G418 and SC-His plates. The klTRP1 cas- visualize fusions with fluorescent proteins) or indi-
sette seems to promote a somewhat less-than- rect immunofluorescence microscopy (HA or Myc
wild-type growth rate when used to complement fusions).
the trp1 mutation; therefore, it is recommended
to wait 2 more days in case no colonies appear New fluorescent markers
2–3 days after transformation. Usually, transfor-
mants were confirmed using colony PCR in combi- We observed that yeGFP (Cormack et al., 1997)
nation with either immunoblotting using anti-HA, and EGFP (Clontech) do not show observable

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
960 C. Janke et al.

Promoter exchange and N-terminal tagging

A new feature of the presented set of cassettes
are the 37 new promoter substitution and N-
terminal tagging modules. Apart from the CUP1-
1 promoter, which was specifically cloned for
N-terminal tagging of proteins that are involved
in meiosis, all other promoters were taken from
existing yeast plasmids, therefore, their expression
levels have already been studied in detail and
the promoters can be used according to these
data (Mumberg et al., 1994, 1995). The promoter
Figure 7. Control of expression of SSP1 by the CUP1-1 substitution can be applied for the determination
promoter. The gene SSP1, expressed only during meiosis of expression level-related phenomena, or simply
(Moreno-Borchart et al., 2001), was chromosomally tagged to deplete a gene product. It was noted that, while
using pYM-N1 and S1 and S4 primers for SSP1. Expression the GAL1 and the MET25 promoters were slightly
of the gene was detected in mitotically growing cultures. leaky under repressive conditions, the less active
Ssp1p expression was followed in the CUP1-1-SSP1 strain
and in a control strain with the unaltered SSP1 gene in the GALL and GALS were tightly repressed in glucose
absence or presence of CuSO4 (100 µM, 2 h), as indicated medium (unpublished data and Figure 6). The use
in the figure. Upon cell lysis, Ssp1p was detected using a of the GALS promoter might thus be a better tool
specific antibody than the until now frequently used GAL1 promoter,
first because of the reduced leakiness, but also for
the lower expression rate in the induced state.
differences in brightness, although they do con-
tain different mutations compared to the wild- Conclusion
type GFP.
We have also provided a number of different cas- Taken together, the new range of PCR-cassettes
settes containing DsRed and mutagenized versions allows the use of more selection markers, the com-
of DsRed. Due to the properties of the DsRed pro- bination of more tags in one single strain and the
tein, its application is somewhat limited compared application of fluorescence double labelling with
to GFP. This is mainly due to its strong tetrameriza- CFP and YFP, but also with GFP and RedStar2,
tion (Baird et al., 2000), which can interfere with while dsRed and RedStar can be used as fluores-
protein function (Knop et al., 2002). Table 4 sum- cent timers (see above and Table 4). N-terminal
marizes some of the properties of the different red tags and promoter substitutions allow to interfere
fluorescent proteins that are contained in our cas- with transcriptional regulation and to condition-
settes. ally deplete gene products, while the availability

Table 4. Properties of the red fluorescent protein

Brightness
relative Codon
Name Mutations Tm1/2 (h) Aggregation to DsRed usage

DsRed 24 +++ 1 Yeast

RedStar1 G2S, R18K, V97I, S113T, F125L, M183K, P187Q, T203I Approx. 12 + 10–202 Yeast
T4-DsRed3 R2A, K5E, N6D, T21S, H41D, N42Q, V44A, A145P, T217A 0.7 − 0.34 Original
RedStar21 Combination of RedStar+ T4–DsRed mutations Approx. 0.5–15 − 2–45 Yeast

1 The yeast codon optimized sequence of DsRed, RedStar and RedStar2, contain an additional codon at position 2.
2 Knop et al., 2002.
3 Please note that T4-DsRed is not included in the list of cassettes available.
4 Bevis and Glick, 2002.
5 Value not determined precisely.

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
Toolbox for PCR-based tagging of yeast genes 961

of N-terminal tags provides the possibility to label Gurskaya NG, Fradkov AF, Terskikh A, et al. 2001. GFP-like
proteins that cannot be tagged at the C-terminus. chromoproteins as a source of far-red fluorescent proteins. FEBS
Lett 507: 16–20.
The need of only four different primers for the use Gyuris J, Golemis E, Chertkov H, Brent R. 1993. Cdi1, a human
of all cassettes described here and in Knop et al. G1 and S phase protein phosphatase that associates with Cdk2.
(1999) makes the tagging cheap, reliable and flexi- Cell 75: 791–803.
ble. However, the ease by which new strains can be Ho Y, Gruhler A, Heilbut A, et al. 2002. Systematic identification
constructed by this method should, of course, never of protein complexes in Saccharomyces cerevisiae by mass
spectrometry. Nature 415: 180–183.
prevent us from keeping one key question in mind: Knop M, Siegers K, Pereira G, et al. 1999. Epitope tagging of
how does this manipulation affect the function of yeast genes using a PCR-based strategy: more tags and improved
the gene? practical routines. Yeast 15: 963–972.
Knop M, Barr F, Riedel CG, Heckel T, Reichel C. 2002.
Improved version of the red fluorescent protein (drFP583/DsRed/
Acknowledgements RFP). BioTechniques 33: 592–603.
The work of E. Schiebel was supported by the Cancer Krawchuk MD, Wahls WP. 1999. High-efficiency gene targeting
Research Campaign UK and of M. Knop by the Max- in Schizosaccharomyces pombe using a modular, PCR-based
Planck-Institute of Biochemistry, Department of Molecular approach with long tracts of flanking homology. Yeast 15:
Cell Biology, Munich, Germany, and the EMBL, Heidel- 1419–1427.
Longtine MS, McKenzie A III, Demarini DJ, et al. 1998.
berg, Germany. C. Janke was supported by an EMBO long-
Additional modules for versatile and economical PCR-based
term fellowship (ALTF 387-2001). E. Schwob was funded gene deletion and modification in Saccharomyces cerevisiae.
by CNRS and the Association pour la Recherche sur le Yeast 14: 953–961.
Cancer (ARC), France. M. M. Magiera is supported by a Matz MV, Fradkov AF, Labas YA, et al. 1999. Fluorescent
PhD fellowship from the French Ministry of Research. proteins from nonbioluminescent Anthozoa species. Nature
Biotechnol 17: 969–973.
Miller WG, Lindow SE. 1997. An improved GFP cloning cassette
References designed for prokaryotic transcriptional fusions. Gene 191:
149–153.
Adams SR, Campbell RE, Gross RA, et al. 2001. New biarsenic Moreno-Borchart AC, Strasser K, Finkbeiner MG, et al. 2001.
ligands and tetracystein motifs for proteins in vitro and in vivo: Prospore membrane formation linked to the leading edge protein
synthesis and biological applications. J Am Chem Soc 124: (LEP) coat assembly. EMBO J 20: 6946–6957.
6063–6076. Mumberg D, Muller R, Funk M. 1994. Regulatable promoters of
Bahler J, Wu JQ, Longtine MS, et al. 1998. Heterologous modules Saccharomyces cerevisiae: comparison of transcriptional activity
for efficient and versatile PCR-based gene targeting in and their use for heterologous expression. Nucleic Acids Res 22:
Schizosaccharomyces pombe. Yeast 14: 943–951. 5767–5768.
Baird GS, Zacharias DA, Tsien RY. 2000. Biochemistry, mutage- Mumberg D, Muller R, Funk M. 1995. Yeast vectors for the
nesis, and oligomerization of DsRed, a red fluorescent protein controlled expression of heterologous proteins in different
from coral. Proc Natl Acad Sci USA 97: 11 984–11 989. genetic backgrounds. Gene 156: 119–122.
Baudin A, Ozier-Kalogeropoulos O, Denouel A, Lacroute F, Patterson GH, Lippincott-Schwartz J. 2002. A photoactivatable
Cullin C. 1993. A simple and efficient method for direct gene GFP for selective photolabeling of proteins and cells. Science
deletion in Saccharomyces cerevisiae. Nucleic Acids Res 21: 293: 1873–1877.
3329–3330. Pereira G, Tanaka TU, Nasmyth K, Schiebel E. 2001. Modes
Bevis BJ, Glick BS. 2002. Rapidly maturing variants of the of spindle pole body inheritance and segregation of the
Discosoma red fluorescent protein (DsRed). Nature Biotechnol Bfa1p–Bub2p checkpoint protein complex. EMBO J 20:
20: 83–87. 6359–6370.
Campbell RE, Tour O, Palmer AE, et al. 2002. A monomeric red Rabitsch KP, Toth A, Galova M, et al. 2001. A screen for genes
fluorescent protein. Proc Natl Acad Sci USA 99: 7877–7882. required for meiosis and spore formation based on whole-
Cormack BP, Bertram G, Egerton M, et al. 1997. Yeast-enhanced genome expression. Curr Biol 11: 1001–1009.
green fluorescent protein (yEGFP)a reporter of gene expression Rigaut G, Shevchenko A, Rutz B, et al. 1999. A generic protein
in Candida albicans. Microbiology 143: 303–311. purification method for protein complex characterization and
Finley RLJ, Brent R. 1995. Interaction trap cloning with yeast. proteome exploration. Nature Biotechnol 17: 1030–1032.
In DNA Cloning, Expression Systems: A Practical Approach, Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning: A
Hames BD, Glover DM (eds). Oxford University Press: Oxford; Laboratory Manual. Cold Spring Harbor Laboratory Press: New
169–203. York.
Gavin AC, Bosche M, Krause R, et al. 2002. Functional organi- Schiestl RH, Gietz RD. 1989. High efficiency transformation of
zation of the yeast proteome by systematic analysis of protein intact yeast cells using single stranded nucleic acids as a carrier.
complexes. Nature 415: 141–147. Curr Genet 16: 339–346.
Goldstein AL, McCusker JH. 1999. Three new dominant drug Schneider BL, Seufert W, Steiner B, Yang QH, Futcher AB. 1995.
resistance cassettes for gene disruption in Saccharomyces Use of polymerase chain reaction epitope tagging for protein
cerevisiae. Yeast 15: 1541–1553. tagging in Saccharomyces cerevisiae. Yeast 11: 1265–1274.

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.
962 C. Janke et al.

Sherman F. 1991. Getting started with yeast. Methods Enzymol for PCR-targeting in Saccharomyces cerevisiae. Yeast 13:
194: 3–21. 1065–1075.
Tasto JJ, Carnahan RH, McDonald WH, Gould KL. 2001. Vectors Wach A, Brachat A, Pohlmann R, Philippsen P. 1994. New
and gene targeting modules for tandem affinity purification in heterologous modules for classical or PCR-based gene
Schizosaccharomyces pombe. Yeast 18: 657–662. disruptions in Saccharomyces cerevisiae. Yeast 10: 1793–1808.
Tsien RY. 1998. The green fluorescent protein. Ann Rev Biochem Wiedenmann J, Schenk A, Rocker C, et al. 2002. A far-red fluo-
67: 509–544. rescent protein with fast maturation and reduced oligomerization
Wach A, Brachat A, Alberti-Segui C, Rebischung C, Philippsen P. tendency from Entacmaea quadricolor (Anthozoa; Actinaria).
1997. Heterologous HIS3 marker and GFP reporter modules Proc Natl Acad Sci USA 99: 11 646–11 651.

Copyright  2004 John Wiley & Sons, Ltd. Yeast 2004; 21: 947–962.